Science.gov

Sample records for additional regulatory mechanisms

  1. Effect of multiplicative and additive noise on genetic transcriptional regulatory mechanism

    NASA Astrophysics Data System (ADS)

    Liu, Xue-Mei; Xie, Hui-Zhang; Liu, Liang-Gang; Li, Zhi-Bing

    2009-02-01

    A multiplicative noise and an additive noise are introduced in the kinetic model of Smolen-Baxter-Byrne [P. Smolen, D.A. Baxter, J.H. Byrne, Amer. J. Physiol. Cell. Physiol. 274 (1998) 531], in which the expression of gene is controlled by protein concentration of transcriptional activator. The Fokker-Planck equation is solved and the steady-state probability distribution is obtained numerically. It is found that the multiplicative noise converts the bistability to monostability that can be regarded as a noise-induced transition. The additive noise reduces the transcription efficiency. The correlation between the multiplicative noise and the additive noise works as a genetic switch and regulates the gene transcription effectively.

  2. Advances in Autophagy Regulatory Mechanisms

    PubMed Central

    Gallagher, Laura E.; Williamson, Leon E.; Chan, Edmond Y. W.

    2016-01-01

    Autophagy plays a critical role in cell metabolism by degrading and recycling internal components when challenged with limited nutrients. This fundamental and conserved mechanism is based on a membrane trafficking pathway in which nascent autophagosomes engulf cytoplasmic cargo to form vesicles that transport their content to the lysosome for degradation. Based on this simple scheme, autophagy modulates cellular metabolism and cytoplasmic quality control to influence an unexpectedly wide range of normal mammalian physiology and pathophysiology. In this review, we summarise recent advancements in three broad areas of autophagy regulation. We discuss current models on how autophagosomes are initiated from endogenous membranes. We detail how the uncoordinated 51-like kinase (ULK) complex becomes activated downstream of mechanistic target of rapamycin complex 1 (MTORC1). Finally, we summarise the upstream signalling mechanisms that can sense amino acid availability leading to activation of MTORC1. PMID:27187479

  3. [Proposals for economic regulatory mechanisms].

    PubMed

    Bruppacher, R

    1978-12-01

    Economic mechanisms are needed to guarantee that longterm needs are not forgotten over short term benefits and desires. In traffic, variable costs (cost per mile) should be increased relative to fixed costs, traffic education should be supported and--where needed--fines for undesirable behavior should be introduced. Toxic substances should be taxed. As far as tobacco and alcohol consumption is concerned, abstinence or temperance should be rewarded. In medical care and medical education, prevention should be promoted by increased financial support.

  4. Additive functions in boolean models of gene regulatory network modules.

    PubMed

    Darabos, Christian; Di Cunto, Ferdinando; Tomassini, Marco; Moore, Jason H; Provero, Paolo; Giacobini, Mario

    2011-01-01

    Gene-on-gene regulations are key components of every living organism. Dynamical abstract models of genetic regulatory networks help explain the genome's evolvability and robustness. These properties can be attributed to the structural topology of the graph formed by genes, as vertices, and regulatory interactions, as edges. Moreover, the actual gene interaction of each gene is believed to play a key role in the stability of the structure. With advances in biology, some effort was deployed to develop update functions in boolean models that include recent knowledge. We combine real-life gene interaction networks with novel update functions in a boolean model. We use two sub-networks of biological organisms, the yeast cell-cycle and the mouse embryonic stem cell, as topological support for our system. On these structures, we substitute the original random update functions by a novel threshold-based dynamic function in which the promoting and repressing effect of each interaction is considered. We use a third real-life regulatory network, along with its inferred boolean update functions to validate the proposed update function. Results of this validation hint to increased biological plausibility of the threshold-based function. To investigate the dynamical behavior of this new model, we visualized the phase transition between order and chaos into the critical regime using Derrida plots. We complement the qualitative nature of Derrida plots with an alternative measure, the criticality distance, that also allows to discriminate between regimes in a quantitative way. Simulation on both real-life genetic regulatory networks show that there exists a set of parameters that allows the systems to operate in the critical region. This new model includes experimentally derived biological information and recent discoveries, which makes it potentially useful to guide experimental research. The update function confers additional realism to the model, while reducing the complexity

  5. Additive Functions in Boolean Models of Gene Regulatory Network Modules

    PubMed Central

    Darabos, Christian; Di Cunto, Ferdinando; Tomassini, Marco; Moore, Jason H.; Provero, Paolo; Giacobini, Mario

    2011-01-01

    Gene-on-gene regulations are key components of every living organism. Dynamical abstract models of genetic regulatory networks help explain the genome's evolvability and robustness. These properties can be attributed to the structural topology of the graph formed by genes, as vertices, and regulatory interactions, as edges. Moreover, the actual gene interaction of each gene is believed to play a key role in the stability of the structure. With advances in biology, some effort was deployed to develop update functions in Boolean models that include recent knowledge. We combine real-life gene interaction networks with novel update functions in a Boolean model. We use two sub-networks of biological organisms, the yeast cell-cycle and the mouse embryonic stem cell, as topological support for our system. On these structures, we substitute the original random update functions by a novel threshold-based dynamic function in which the promoting and repressing effect of each interaction is considered. We use a third real-life regulatory network, along with its inferred Boolean update functions to validate the proposed update function. Results of this validation hint to increased biological plausibility of the threshold-based function. To investigate the dynamical behavior of this new model, we visualized the phase transition between order and chaos into the critical regime using Derrida plots. We complement the qualitative nature of Derrida plots with an alternative measure, the criticality distance, that also allows to discriminate between regimes in a quantitative way. Simulation on both real-life genetic regulatory networks show that there exists a set of parameters that allows the systems to operate in the critical region. This new model includes experimentally derived biological information and recent discoveries, which makes it potentially useful to guide experimental research. The update function confers additional realism to the model, while reducing the complexity

  6. Regulatory mechanisms link phenotypic plasticity to evolvability

    PubMed Central

    van Gestel, Jordi; Weissing, Franz J.

    2016-01-01

    Organisms have a remarkable capacity to respond to environmental change. They can either respond directly, by means of phenotypic plasticity, or they can slowly adapt through evolution. Yet, how phenotypic plasticity links to evolutionary adaptability is largely unknown. Current studies of plasticity tend to adopt a phenomenological reaction norm (RN) approach, which neglects the mechanisms underlying plasticity. Focusing on a concrete question – the optimal timing of bacterial sporulation – we here also consider a mechanistic approach, the evolution of a gene regulatory network (GRN) underlying plasticity. Using individual-based simulations, we compare the RN and GRN approach and find a number of striking differences. Most importantly, the GRN model results in a much higher diversity of responsive strategies than the RN model. We show that each of the evolved strategies is pre-adapted to a unique set of unseen environmental conditions. The regulatory mechanisms that control plasticity therefore critically link phenotypic plasticity to the adaptive potential of biological populations. PMID:27087393

  7. Regulatory mechanisms of cardiac development and repair.

    PubMed

    Chinchilla, Ana; Franco, Diego

    2006-06-01

    The heart originates from bilateral primordia that eventually fuse in the embryonic midline leading to a linear tube. Soon after, the heart bends to the right and atrial and ventricular chambers are formed. Progressively each embryonic compartment initiates a process of septation that eventually leads to a four chambered heart with a double circuitry and synchronous contraction. During these developmental events, the growth of the heart and in particular of its myocardial component gradually increases. However, as the heart gets into its mature stage, myocardial growth ceases and concomitantly the myocardium looses its proliferative capacity. In the adult human population, the most frequent cardiac pathologies emanate from a decompensated lost of myocardial function. Therapeutical approaches aiming to add or replace new myocytes to the failing heart are thus highly desired. Embryonic stem cells have a high capacity to give rise to multiple cell types, including myocardial cells, opening new therapeutical possibilities. Unexpectedly discrete adult cell populations have also shown a greater cell plasticity than previously thought, earning therefore much attention as therapeutic targets. These observations have launched initial clinical trials with great hope of clinical benefit. However, it is essential in this respect to initially understand, and eventually control myogenic cell fate determination. Developmental biology of the heart provides a very suitable model for this end. Over the last decade there has been a considerable advance in the understanding of the molecular mechanisms that lead to the determination of the cardiomyocyte lineage and the regulatory mechanisms by which morphogenesis of the heart takes place. Growth factor signalling and transcriptional events controlling cardiac myogenesis have been progressively unravelled. In this review we aim to summarise current data concerning the cardiomyogenic cell fate determination pathways occurring during the

  8. Mechanical properties of additively manufactured octagonal honeycombs.

    PubMed

    Hedayati, R; Sadighi, M; Mohammadi-Aghdam, M; Zadpoor, A A

    2016-12-01

    Honeycomb structures have found numerous applications as structural and biomedical materials due to their favourable properties such as low weight, high stiffness, and porosity. Application of additive manufacturing and 3D printing techniques allows for manufacturing of honeycombs with arbitrary shape and wall thickness, opening the way for optimizing the mechanical and physical properties for specific applications. In this study, the mechanical properties of honeycomb structures with a new geometry, called octagonal honeycomb, were investigated using analytical, numerical, and experimental approaches. An additive manufacturing technique, namely fused deposition modelling, was used to fabricate the honeycomb from polylactic acid (PLA). The honeycombs structures were then mechanically tested under compression and the mechanical properties of the structures were determined. In addition, the Euler-Bernoulli and Timoshenko beam theories were used for deriving analytical relationships for elastic modulus, yield stress, Poisson's ratio, and buckling stress of this new design of honeycomb structures. Finite element models were also created to analyse the mechanical behaviour of the honeycombs computationally. The analytical solutions obtained using Timoshenko beam theory were close to computational results in terms of elastic modulus, Poisson's ratio and yield stress, especially for relative densities smaller than 25%. The analytical solutions based on the Timoshenko analytical solution and the computational results were in good agreement with experimental observations. Finally, the elastic properties of the proposed honeycomb structure were compared to those of other honeycomb structures such as square, triangular, hexagonal, mixed, diamond, and Kagome. The octagonal honeycomb showed yield stress and elastic modulus values very close to those of regular hexagonal honeycombs and lower than the other considered honeycombs. PMID:27612831

  9. Mechanical properties of additively manufactured octagonal honeycombs.

    PubMed

    Hedayati, R; Sadighi, M; Mohammadi-Aghdam, M; Zadpoor, A A

    2016-12-01

    Honeycomb structures have found numerous applications as structural and biomedical materials due to their favourable properties such as low weight, high stiffness, and porosity. Application of additive manufacturing and 3D printing techniques allows for manufacturing of honeycombs with arbitrary shape and wall thickness, opening the way for optimizing the mechanical and physical properties for specific applications. In this study, the mechanical properties of honeycomb structures with a new geometry, called octagonal honeycomb, were investigated using analytical, numerical, and experimental approaches. An additive manufacturing technique, namely fused deposition modelling, was used to fabricate the honeycomb from polylactic acid (PLA). The honeycombs structures were then mechanically tested under compression and the mechanical properties of the structures were determined. In addition, the Euler-Bernoulli and Timoshenko beam theories were used for deriving analytical relationships for elastic modulus, yield stress, Poisson's ratio, and buckling stress of this new design of honeycomb structures. Finite element models were also created to analyse the mechanical behaviour of the honeycombs computationally. The analytical solutions obtained using Timoshenko beam theory were close to computational results in terms of elastic modulus, Poisson's ratio and yield stress, especially for relative densities smaller than 25%. The analytical solutions based on the Timoshenko analytical solution and the computational results were in good agreement with experimental observations. Finally, the elastic properties of the proposed honeycomb structure were compared to those of other honeycomb structures such as square, triangular, hexagonal, mixed, diamond, and Kagome. The octagonal honeycomb showed yield stress and elastic modulus values very close to those of regular hexagonal honeycombs and lower than the other considered honeycombs.

  10. Effects of Four Different Regulatory Mechanisms on the Dynamics of Gene Regulatory Cascades

    NASA Astrophysics Data System (ADS)

    Hansen, Sabine; Krishna, Sandeep; Semsey, Szabolcs; Lo Svenningsen, Sine

    2015-07-01

    Gene regulatory cascades (GRCs) are common motifs in cellular molecular networks. A given logical function in these cascades, such as the repression of the activity of a transcription factor, can be implemented by a number of different regulatory mechanisms. The potential consequences for the dynamic performance of the GRC of choosing one mechanism over another have not been analysed systematically. Here, we report the construction of a synthetic GRC in Escherichia coli, which allows us for the first time to directly compare and contrast the dynamics of four different regulatory mechanisms, affecting the transcription, translation, stability, or activity of a transcriptional repressor. We developed a biologically motivated mathematical model which is sufficient to reproduce the response dynamics determined by experimental measurements. Using the model, we explored the potential response dynamics that the constructed GRC can perform. We conclude that dynamic differences between regulatory mechanisms at an individual step in a GRC are often concealed in the overall performance of the GRC, and suggest that the presence of a given regulatory mechanism in a certain network environment does not necessarily mean that it represents a single optimal evolutionary solution.

  11. Gene Regulatory Networks Elucidating Huanglongbing Disease Mechanisms

    PubMed Central

    Martinelli, Federico; Reagan, Russell L.; Uratsu, Sandra L.; Phu, My L.; Albrecht, Ute; Zhao, Weixiang; Davis, Cristina E.; Bowman, Kim D.; Dandekar, Abhaya M.

    2013-01-01

    Next-generation sequencing was exploited to gain deeper insight into the response to infection by Candidatus liberibacter asiaticus (CaLas), especially the immune disregulation and metabolic dysfunction caused by source-sink disruption. Previous fruit transcriptome data were compared with additional RNA-Seq data in three tissues: immature fruit, and young and mature leaves. Four categories of orchard trees were studied: symptomatic, asymptomatic, apparently healthy, and healthy. Principal component analysis found distinct expression patterns between immature and mature fruits and leaf samples for all four categories of trees. A predicted protein – protein interaction network identified HLB-regulated genes for sugar transporters playing key roles in the overall plant responses. Gene set and pathway enrichment analyses highlight the role of sucrose and starch metabolism in disease symptom development in all tissues. HLB-regulated genes (glucose-phosphate-transporter, invertase, starch-related genes) would likely determine the source-sink relationship disruption. In infected leaves, transcriptomic changes were observed for light reactions genes (downregulation), sucrose metabolism (upregulation), and starch biosynthesis (upregulation). In parallel, symptomatic fruits over-expressed genes involved in photosynthesis, sucrose and raffinose metabolism, and downregulated starch biosynthesis. We visualized gene networks between tissues inducing a source-sink shift. CaLas alters the hormone crosstalk, resulting in weak and ineffective tissue-specific plant immune responses necessary for bacterial clearance. Accordingly, expression of WRKYs (including WRKY70) was higher in fruits than in leaves. Systemic acquired responses were inadequately activated in young leaves, generally considered the sites where most new infections occur. PMID:24086326

  12. Mathematical models of regulatory mechanisms of sleep-wake rhythms.

    PubMed

    Nakao, M; Karashima, A; Katayama, N

    2007-05-01

    Studies of regulatory mechanisms of sleep-wake rhythms have benefited greatly from mathematical modeling. There are two major frameworks of modeling: one integrates homeostatic and circadian regulations and the other consists of multiple interacting oscillators. In this article, model constructions based on these respective frameworks and their characteristics are reviewed. The two-process model and the multioscillator model are explained in detail. An appropriate mathematical abstraction is also shown to provide a viewpoint unifying the model structures, which might seem to be distinct. Recently acquired knowledge of neural regulatory mechanisms of sleep-wake rhythm has prompted modeling at the neural network level. Such a detailed model is also reviewed, and could be used to explore a possible neural mechanism underlying a pathological state of sleep-wake rhythm. PMID:17364138

  13. Regulatory mechanisms related to biofuel tolerance in producing microbes.

    PubMed

    Fu, Y; Chen, L; Zhang, W

    2016-08-01

    Production of renewable biofuels through either native or engineered microbes has drawn significant attention in recent years, mostly due to the increasing concerns on the energy crisis and the environmental consequences of the overutilization of petroleum-based fuels. Although significant progress has been achieved thus far, further advances are still necessary in order to decrease the manufacturing cost so that the producing processes can be more competitive to petroleum fuels. Among various possible approaches, the increase in biofuel tolerance in microbes has been suggested as one aspect which is important for the success of biofuel production at industry-scale. In this article, we critically summarize recent advances in deciphering regulatory mechanisms for enhancing biofuel tolerance in various micro-organisms, focusing on functions and utilization of several well-studied regulatory mechanisms in microbes, such as two-component signal transduction systems, sigma factors, transcription factors, noncoding RNA and other regulators. PMID:27123568

  14. Secretory pattern and regulatory mechanism of growth hormone in cattle

    PubMed Central

    2016-01-01

    Abstract The ultradian rhythm of growth hormone (GH) secretion has been known in several animal species for years and has recently been observed in cattle. Although the physiological significance of the rhythm is not yet fully understood, it appears essential for normal growth. In this review, previous studies concerning the GH secretory pattern in cattle, including its ultradian rhythm, are introduced and the regulatory mechanism is discussed on the basis of recent findings. PMID:26260675

  15. Mechanism of action of regulatory proteins encoded by complex retroviruses.

    PubMed Central

    Cullen, B R

    1992-01-01

    Complex retroviruses are distinguished by their ability to control the expression of their gene products through the action of virally encoded regulatory proteins. These viral gene products modulate both the quantity and the quality of viral gene expression through regulation at both the transcriptional and posttranscriptional levels. The most intensely studied retroviral regulatory proteins, termed Tat and Rev, are encoded by the prototypic complex retrovirus human immunodeficiency virus type 1. However, considerable information also exists on regulatory proteins encoded by human T-cell leukemia virus type I, as well as several other human and animal complex retroviruses. In general, these data demonstrate that retrovirally encoded transcriptional trans-activators can exert a similar effect by several very different mechanisms. In contrast, posttranscriptional regulation of retroviral gene expression appears to occur via a single pathway that is probably dependent on the recruitment of a highly conserved cellular cofactor. These two shared regulatory pathways are proposed to be critical to the ability of complex retroviruses to establish chronic infections in the face of an ongoing host immune response. Images PMID:1406488

  16. Oblique view of east side mechanical additions and south side ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Oblique view of east side mechanical additions and south side of 1955 addition, facing northwest. - Albrook Air Force Station, Dispensary, East side of Canfield Avenue, Balboa, Former Panama Canal Zone, CZ

  17. Molecular regulatory mechanisms of osteoclastogenesis through cytoprotective enzymes

    PubMed Central

    Kanzaki, Hiroyuki; Shinohara, Fumiaki; Kanako, Itohiya; Yamaguchi, Yuuki; Fukaya, Sari; Miyamoto, Yutaka; Wada, Satoshi; Nakamura, Yoshiki

    2016-01-01

    It has been reported that reactive oxygen species (ROS), such as hydrogen peroxide and superoxide, take part in osteoclast differentiation as intra-cellular signaling molecules. The current assumed signaling cascade from RANK to ROS production is RANK, TRAF6, Rac1, and then Nox. The target molecules of ROS in RANKL signaling remain unclear; however, several reports support the theory that NF-κB signaling could be the crucial downstream signaling molecule of RANKL-mediated ROS signaling. Furthermore, ROS exert cytotoxic effects such as peroxidation of lipids and phospholipids and oxidative damage to proteins and DNA. Therefore, cells have several protective mechanisms against oxidative stressors that mainly induce cytoprotective enzymes and ROS scavenging. Three well-known mechanisms regulate cytoprotective enzymes including Nrf2-, FOXO-, and sirtuin-dependent mechanisms. Several reports have indicated a crosslink between FOXO- and sirtuin-dependent regulatory mechanisms. The agonists against the regulatory mechanisms are reported to induce these cytoprotective enzymes successfully. Some of them inhibit osteoclast differentiation and bone destruction via attenuation of intracellular ROS signaling. In this review article, we discuss the above topics and summarize the current information available on the relationship between cytoprotective enzymes and osteoclastogenesis. PMID:26795736

  18. Regulatory mechanisms of EGFR signalling during Drosophila eye development.

    PubMed

    Malartre, Marianne

    2016-05-01

    EGFR signalling is a well-conserved signalling pathway playing major roles during development and cancers. This review explores what studying the EGFR pathway during Drosophila eye development has taught us in terms of the diversity of its regulatory mechanisms. This model system has allowed the identification of numerous positive and negative regulators acting at specific time and place, thus participating to the tight control of signalling. EGFR signalling regulation is achieved by a variety of mechanisms, including the control of ligand processing, the availability of the receptor itself and the transduction of the cascade in the cytoplasm. Ultimately, the transcriptional responses contribute to the establishment of positive and negative feedback loops. The combination of these multiple mechanisms employed to regulate the EGFR pathway leads to specific cellular outcomes involved in functions as diverse as the acquisition of cell fate, proliferation, survival, adherens junction remodelling and morphogenesis. PMID:26935860

  19. Regulatory mechanisms of EGFR signalling during Drosophila eye development.

    PubMed

    Malartre, Marianne

    2016-05-01

    EGFR signalling is a well-conserved signalling pathway playing major roles during development and cancers. This review explores what studying the EGFR pathway during Drosophila eye development has taught us in terms of the diversity of its regulatory mechanisms. This model system has allowed the identification of numerous positive and negative regulators acting at specific time and place, thus participating to the tight control of signalling. EGFR signalling regulation is achieved by a variety of mechanisms, including the control of ligand processing, the availability of the receptor itself and the transduction of the cascade in the cytoplasm. Ultimately, the transcriptional responses contribute to the establishment of positive and negative feedback loops. The combination of these multiple mechanisms employed to regulate the EGFR pathway leads to specific cellular outcomes involved in functions as diverse as the acquisition of cell fate, proliferation, survival, adherens junction remodelling and morphogenesis.

  20. Ochratoxin A Producing Fungi, Biosynthetic Pathway and Regulatory Mechanisms.

    PubMed

    Wang, Yan; Wang, Liuqing; Liu, Fei; Wang, Qi; Selvaraj, Jonathan Nimal; Xing, Fuguo; Zhao, Yueju; Liu, Yang

    2016-03-01

    Ochratoxin A (OTA), mainly produced by Aspergillus and Penicillum species, is one of the most important mycotoxin contaminants in agricultural products. It is detrimental to human health because of its nephrotoxicity, hepatotoxicity, carcinogenicity, teratogenicity, and immunosuppression. OTA structurally consists of adihydrocoumarin moiety linked with l-phenylalanine via an amide bond. OTA biosynthesis has been putatively hypothesized, although several contradictions exist on some processes of the biosynthetic pathway. We discuss recent information on molecular studies of OTA biosynthesis despite insufficient genetic background in detail. Accordingly, genetic regulation has also been explored with regard to the interaction between the regulators and the environmental factors. In this review, we focus on three aspects of OTA: OTA-producing strains, OTA biosynthetic pathway and the regulation mechanisms of OTA production. This can pave the way to assist in protecting food and feed from OTA contamination by understanding OTA biosynthetic pathway and regulatory mechanisms. PMID:27007394

  1. Ochratoxin A Producing Fungi, Biosynthetic Pathway and Regulatory Mechanisms

    PubMed Central

    Wang, Yan; Wang, Liuqing; Liu, Fei; Wang, Qi; Selvaraj, Jonathan Nimal; Xing, Fuguo; Zhao, Yueju; Liu, Yang

    2016-01-01

    Ochratoxin A (OTA), mainly produced by Aspergillus and Penicillum species, is one of the most important mycotoxin contaminants in agricultural products. It is detrimental to human health because of its nephrotoxicity, hepatotoxicity, carcinogenicity, teratogenicity, and immunosuppression. OTA structurally consists of adihydrocoumarin moiety linked with l-phenylalanine via an amide bond. OTA biosynthesis has been putatively hypothesized, although several contradictions exist on some processes of the biosynthetic pathway. We discuss recent information on molecular studies of OTA biosynthesis despite insufficient genetic background in detail. Accordingly, genetic regulation has also been explored with regard to the interaction between the regulators and the environmental factors. In this review, we focus on three aspects of OTA: OTA-producing strains, OTA biosynthetic pathway and the regulation mechanisms of OTA production. This can pave the way to assist in protecting food and feed from OTA contamination by understanding OTA biosynthetic pathway and regulatory mechanisms. PMID:27007394

  2. Laminin alters Fyn regulatory mechanisms and promotes oligodendrocyte development

    PubMed Central

    Relucio, Jenne; Tzvetanova, Iva D.; Ao, Wei; Lindquist, Sabine; Colognato, Holly

    2009-01-01

    Mutations in LAMA2, the gene for the extracellular matrix protein laminin-α2, cause a severe muscular dystrophy termed MDC1A. MDC1A patients have accompanying CNS neural dysplasias and white matter abnormalities for which the underlying mechanisms remain unknown. Here we report that in laminin-deficient mice oligodendrocyte development was delayed such that oligodendrocyte progenitors accumulated inappropriately in adult brains. Conversely, laminin substrates were found to promote the transition of oligodendrocyte progenitors to newly-formed oligodendrocytes. Laminin-enhanced differentiation was Src Family Kinase –dependent and resulted in the activation of the Src Family Kinase Fyn. In laminin-deficient brains, however, increased Fyn repression was accompanied by elevated levels of the Src Family Kinase negative regulatory proteins, C-terminal Src kinase (Csk) and its transmembrane adaptor, Csk-binding protein (Cbp). These findings indicate that laminin deficiencies delay oligodendrocyte maturation by causing dysregulation of signaling pathways critical for oligodendrocyte development, and suggest that a normal role for CNS laminin is to promote the development of oligodendrocyte progenitors into myelin-forming oligodendrocytes via modulation of Fyn regulatory molecules. PMID:19776266

  3. Glucose- and nitrogen sensing and regulatory mechanisms in Saccharomyces cerevisiae.

    PubMed

    Rødkaer, Steven V; Faergeman, Nils J

    2014-08-01

    Pro- and eukaryotic cells are constantly challenged by varying concentrations of nutrients in their environment. Perceiving and adapting to such changes are therefore crucial for cellular viability. Thus, numerous specialized cellular receptors continuously sense and react to the availability of nutrients such as glucose and nitrogen. When stimulated, these receptors initiate various cellular signaling pathways, which in concert constitute a complex regulatory network. To ensure a highly specific response, these pathways and networks cross-communicate with each other and are regulated at several steps and by numerous different regulators. As numerous of these regulating proteins, biochemical mechanisms, and cellular pathways are evolutionary conserved, complex biochemical information relevant to humans can be obtained by studying simple organisms. Thus, the yeast Saccharomyces cerevisiae has been recognized as a powerful model system to study fundamental biochemical processes. In the present review, we highlight central signaling pathways and molecular circuits conferring nitrogen- and glucose sensing in S. cerevisiae.

  4. Regulatory mechanisms of microRNAs involvement in cancer.

    PubMed

    Fabbri, Muller; Ivan, Mircea; Cimmino, Amelia; Negrini, Massimo; Calin, George A

    2007-07-01

    MicroRNAs (miRNAs) are 19-24 nucleotide noncoding RNAs that regulate the translation and degradation of target mRNAs and are extensively involved in human cancers. One unexpected conclusion of the profiling and functional studies in tumourigenesis is that some miRNAs behave in cancer cells in a dual mode, resembling the 'Dr Jekyll and Mr Hyde' story, which centers on a conception of humanity as dual in nature. The authors and others have found that onco-miRNAs and suppressor-miRNAs can represent two different looks of the same gene, behaving as oncogenes or tumour suppressors depending on tissue type and specific targets. In this review, the authors analyse the regulatory mechanisms of the main miRNA genes involved in human tumourigenesis. PMID:17665990

  5. Metal Additive Manufacturing: A Review of Mechanical Properties

    NASA Astrophysics Data System (ADS)

    Lewandowski, John J.; Seifi, Mohsen

    2016-07-01

    This article reviews published data on the mechanical properties of additively manufactured metallic materials. The additive manufacturing techniques utilized to generate samples covered in this review include powder bed fusion (e.g., EBM, SLM, DMLS) and directed energy deposition (e.g., LENS, EBF3). Although only a limited number of metallic alloy systems are currently available for additive manufacturing (e.g., Ti-6Al-4V, TiAl, stainless steel, Inconel 625/718, and Al-Si-10Mg), the bulk of the published mechanical properties information has been generated on Ti-6Al-4V. However, summary tables for published mechanical properties and/or key figures are included for each of the alloys listed above, grouped by the additive technique used to generate the data. Published values for mechanical properties obtained from hardness, tension/compression, fracture toughness, fatigue crack growth, and high cycle fatigue are included for as-built, heat-treated, and/or HIP conditions, when available. The effects of test orientation/build direction on properties, when available, are also provided, along with discussion of the potential source(s) (e.g., texture, microstructure changes, defects) of anisotropy in properties. Recommendations for additional work are also provided.

  6. Mechanical Properties of Austenitic Stainless Steel Made by Additive Manufacturing.

    PubMed

    Luecke, William E; Slotwinski, John A

    2014-01-01

    Using uniaxial tensile and hardness testing, we evaluated the variability and anisotropy of the mechanical properties of an austenitic stainless steel, UNS S17400, manufactured by an additive process, selective laser melting. Like wrought materials, the mechanical properties depend on the orientation introduced by the processing. The recommended stress-relief heat treatment increases the tensile strength, reduces the yield strength, and decreases the extent of the discontinuous yielding. The mechanical properties, assessed by hardness, are very uniform across the build plate, but the stress-relief heat treatment introduced a small non-uniformity that had no correlation to position on the build plate. Analysis of the mechanical property behavior resulted in four conclusions. (1) The within-build and build-to-build tensile properties of the UNS S17400 stainless steel are less repeatable than mature engineering structural alloys, but similar to other structural alloys made by additive manufacturing. (2) The anisotropy of the mechanical properties of the UNS S17400 material of this study is larger than that of mature structural alloys, but is similar to other structural alloys made by additive manufacturing. (3) The tensile mechanical properties of the UNS S17400 material fabricated by selective laser melting are very different from those of wrought, heat-treated 17-4PH stainless steel. (4) The large discontinuous yielding strain in all tests resulted from the formation and propagation of Lüders bands.

  7. Mechanical Properties of Austenitic Stainless Steel Made by Additive Manufacturing

    PubMed Central

    Luecke, William E; Slotwinski, John A

    2014-01-01

    Using uniaxial tensile and hardness testing, we evaluated the variability and anisotropy of the mechanical properties of an austenitic stainless steel, UNS S17400, manufactured by an additive process, selective laser melting. Like wrought materials, the mechanical properties depend on the orientation introduced by the processing. The recommended stress-relief heat treatment increases the tensile strength, reduces the yield strength, and decreases the extent of the discontinuous yielding. The mechanical properties, assessed by hardness, are very uniform across the build plate, but the stress-relief heat treatment introduced a small non-uniformity that had no correlation to position on the build plate. Analysis of the mechanical property behavior resulted in four conclusions. (1) The within-build and build-to-build tensile properties of the UNS S17400 stainless steel are less repeatable than mature engineering structural alloys, but similar to other structural alloys made by additive manufacturing. (2) The anisotropy of the mechanical properties of the UNS S17400 material of this study is larger than that of mature structural alloys, but is similar to other structural alloys made by additive manufacturing. (3) The tensile mechanical properties of the UNS S17400 material fabricated by selective laser melting are very different from those of wrought, heat-treated 17-4PH stainless steel. (4) The large discontinuous yielding strain in all tests resulted from the formation and propagation of Lüders bands. PMID:26601037

  8. Mechanical Properties of Austenitic Stainless Steel Made by Additive Manufacturing.

    PubMed

    Luecke, William E; Slotwinski, John A

    2014-01-01

    Using uniaxial tensile and hardness testing, we evaluated the variability and anisotropy of the mechanical properties of an austenitic stainless steel, UNS S17400, manufactured by an additive process, selective laser melting. Like wrought materials, the mechanical properties depend on the orientation introduced by the processing. The recommended stress-relief heat treatment increases the tensile strength, reduces the yield strength, and decreases the extent of the discontinuous yielding. The mechanical properties, assessed by hardness, are very uniform across the build plate, but the stress-relief heat treatment introduced a small non-uniformity that had no correlation to position on the build plate. Analysis of the mechanical property behavior resulted in four conclusions. (1) The within-build and build-to-build tensile properties of the UNS S17400 stainless steel are less repeatable than mature engineering structural alloys, but similar to other structural alloys made by additive manufacturing. (2) The anisotropy of the mechanical properties of the UNS S17400 material of this study is larger than that of mature structural alloys, but is similar to other structural alloys made by additive manufacturing. (3) The tensile mechanical properties of the UNS S17400 material fabricated by selective laser melting are very different from those of wrought, heat-treated 17-4PH stainless steel. (4) The large discontinuous yielding strain in all tests resulted from the formation and propagation of Lüders bands. PMID:26601037

  9. Plants with genetically modified events combined by conventional breeding: an assessment of the need for additional regulatory data.

    PubMed

    Pilacinski, W; Crawford, A; Downey, R; Harvey, B; Huber, S; Hunst, P; Lahman, L K; MacIntosh, S; Pohl, M; Rickard, C; Tagliani, L; Weber, N

    2011-01-01

    Crop varieties with multiple GM events combined by conventional breeding have become important in global agriculture. The regulatory requirements in different countries for such products vary considerably, placing an additional burden on regulatory agencies in countries where the submission of additional data is required and delaying the introduction of innovative products to meet agricultural needs. The process of conventional plant breeding has predictably provided safe food and feed products both historically and in the modern era of plant breeding. Thus, previously approved GM events that have been combined by conventional plant breeding and contain GM traits that are not likely to interact in a manner affecting safety should be considered to be as safe as their conventional counterparts. Such combined GM event crop varieties should require little, if any, additional regulatory data to meet regulatory requirements.

  10. Homopolymeric tracts represent a general regulatory mechanism in prokaryotes

    PubMed Central

    2010-01-01

    Background While, traditionally, regulation of gene expression can be grouped into transcriptional, translational, and post-translational mechanisms, some mechanisms of rapid genetic variation can also contribute to regulation of gene expression, e.g., phase variation. Results We show here that prokaryotes evolved to include homopolymeric tracts (HTs) within coding genes as a system that allows for efficient gene inactivation. Analyses of 81 bacterial and 18 archaeal genomes showed that poly(A) and poly(T) HTs are overrepresented in these genomes and preferentially located at the 5' end of coding genes. Location of HTs at the 5' end is not driven by a preferential placement of aminoacids encoded by the AAA and TTT codons at the N-terminal of proteins. The inlA gene of the pathogen L. monocytogenes was used as a model to further study the role of HTs in reversible gene inactivation. In a number of L. monocytogenes strains, inlA harbors a 5' poly(A) HT, which regularly shows frameshift mutation leading to expression of a truncated 8 aa InlA protein. Translational fusions of the inlA 5' end allowed us to estimate that the frequency of variation in this HT is about 1,000 fold higher than the estimated average point mutation frequency. Conclusions As frameshift mutations in HTs can occur at high frequencies and enable efficient gene inactivation, hypermutable HTs appear to represent a universal system for regulation of gene expression in prokaryotes. Combined with other studies indicating that HTs also enable rapid diversification of both coding and regulatory genetic sequences in eukaryotes, our data suggest that hypermutable HTs represent a general and rapid evolutionary mechanism facilitating adaptation and gene regulation across diverse organisms. PMID:20144225

  11. Redox-switch regulatory mechanism of thiolase from Clostridium acetobutylicum

    PubMed Central

    Kim, Sangwoo; Jang, Yu-Sin; Ha, Sung-Chul; Ahn, Jae-Woo; Kim, Eun-Jung; Hong Lim, Jae; Cho, Changhee; Shin Ryu, Yong; Kuk Lee, Sung; Lee, Sang Yup; Kim, Kyung-Jin

    2015-01-01

    Thiolase is the first enzyme catalysing the condensation of two acetyl-coenzyme A (CoA) molecules to form acetoacetyl-CoA in a dedicated pathway towards the biosynthesis of n-butanol, an important solvent and biofuel. Here we elucidate the crystal structure of Clostridium acetobutylicum thiolase (CaTHL) in its reduced/oxidized states. CaTHL, unlike those from other aerobic bacteria such as Escherichia coli and Zoogloea ramegera, is regulated by the redox-switch modulation through reversible disulfide bond formation between two catalytic cysteine residues, Cys88 and Cys378. When CaTHL is overexpressed in wild-type C. acetobutylicum, butanol production is reduced due to the disturbance of acidogenic to solventogenic shift. The CaTHLV77Q/N153Y/A286K mutant, which is not able to form disulfide bonds, exhibits higher activity than wild-type CaTHL, and enhances butanol production upon overexpression. On the basis of these results, we suggest that CaTHL functions as a key enzyme in the regulation of the main metabolism of C. acetobutylicum through a redox-switch regulatory mechanism. PMID:26391388

  12. CaMKII in addition to MLCK contributes to phosphorylation of regulatory light chain in cardiomyocytes.

    PubMed

    Eikemo, Hilde; Moltzau, Lise Román; Hussain, Rizwan I; Nguyen, Cam H T; Qvigstad, Eirik; Levy, Finn Olav; Skomedal, Tor; Osnes, Jan-Bjørn

    2016-02-26

    The aim was to identify kinase activities involved in the phosphorylation of regulatory light chain (RLC) in situ in cardiomyocytes. In electrically stimulated rat cardiomyocytes, phosphatase inhibition by calyculin A unmasked kinase activities evoking an increase of phosphorylated RLC (P-RLC) from about 16% to about 80% after 80 min. The phosphorylation rate in cardiomyocytes was reduced by about 40% by the myosin light chain kinase (MLCK) inhibitor, ML-7. In rat ventricular muscle strips, calyculin A induced a positive inotropic effect that correlated with P-RLC levels. The inotropic effect and P-RLC elevation were abolished by ML-7 treatment. The kinase activities phosphorylating RLC in cardiomyocytes were reduced by about 60% by the non-selective kinase inhibitor staurosporine and by about 50% by the calmodulin antagonist W7. W7 eliminated the inhibitory effect of ML-7, suggesting that the cardiac MLCK is Ca(2+)/calmodulin (CaM)-dependent. The CaM-dependent kinase II (CaMKII) inhibitor KN-93 attenuated the calyculin A-induced RLC phosphorylation by about 40%, indicating a contribution from CaMKII. The residual phosphorylation in the presence of W7 indicated that also CaM-independent kinase activities might contribute. RLC phosphorylation was insensitive to protein kinase C inhibition. In conclusion, in addition to MLCK, CaMKII phosphorylates RLC in cardiomyocytes. Involvement of other kinases cannot be excluded.

  13. [Requirements for drug approval and additional benefits assessment: Regulatory aspects and experiences].

    PubMed

    Broich, K; Löbker, W; Schulte, A; Beinlich, P; Müller, T

    2016-04-01

    The early assessment of benefits of newly approved drugs with novel active substances or new applications, which came into force on 1 January 2011 still represents a challenge to all parties involved. This article highlights the definitions, regulatory requirements and interaction between drug marketing approval and early assessment of benefits in Germany. The constellation of an extensively harmonized European and even international drug authorization process with a predominantly national regulation of drug reimbursement situation inevitably causes friction, which could be markedly reduced through early joint advisory discussions during the planning phase for pivotal clinical trials. During the year 2015 the Federal Institute for Drugs and Medical Devices (BfArM) carried out 300 scientific advice procedures of which 34 were concerned with applications in the field of indications for the central nervous system (CNS). In comparison 98 advisory meetings were held by the Federal Joint Committee (G-BA) of which the BfArM provided advice in 12 instances and in 2 cases on CNS indications. Study design, endpoints and appropriate comparative therapies are the key issues in exchanges and discussions between the BfArM, the G‑BA and applicants. Under these aspects the BfArM and G‑BA promote an early and consistent involvement in early advice procedures regarding the prerequisites for drug approval and assessment of additional benefits.

  14. [Requirements for drug approval and additional benefits assessment: Regulatory aspects and experiences].

    PubMed

    Broich, K; Löbker, W; Schulte, A; Beinlich, P; Müller, T

    2016-04-01

    The early assessment of benefits of newly approved drugs with novel active substances or new applications, which came into force on 1 January 2011 still represents a challenge to all parties involved. This article highlights the definitions, regulatory requirements and interaction between drug marketing approval and early assessment of benefits in Germany. The constellation of an extensively harmonized European and even international drug authorization process with a predominantly national regulation of drug reimbursement situation inevitably causes friction, which could be markedly reduced through early joint advisory discussions during the planning phase for pivotal clinical trials. During the year 2015 the Federal Institute for Drugs and Medical Devices (BfArM) carried out 300 scientific advice procedures of which 34 were concerned with applications in the field of indications for the central nervous system (CNS). In comparison 98 advisory meetings were held by the Federal Joint Committee (G-BA) of which the BfArM provided advice in 12 instances and in 2 cases on CNS indications. Study design, endpoints and appropriate comparative therapies are the key issues in exchanges and discussions between the BfArM, the G‑BA and applicants. Under these aspects the BfArM and G‑BA promote an early and consistent involvement in early advice procedures regarding the prerequisites for drug approval and assessment of additional benefits. PMID:27003322

  15. Translational regulatory mechanisms in persistent forms of synaptic plasticity.

    PubMed

    Kelleher, Raymond J; Govindarajan, Arvind; Tonegawa, Susumu

    2004-09-30

    Memory and synaptic plasticity exhibit distinct temporal phases, with long-lasting forms distinguished by their dependence on macromolecular synthesis. Prevailing models for the molecular mechanisms underlying long-lasting synaptic plasticity have largely focused on transcriptional regulation. However, a growing body of evidence now supports a crucial role for neuronal activity-dependent mRNA translation, which may occur in dendrites for a subset of neuronal mRNAs. Recent work has begun to define the signaling mechanisms coupling synaptic activation to the protein synthesis machinery. The ERK and mTOR signaling pathways have been shown to regulate the activity of the general translational machinery, while the translation of particular classes of mRNAs is additionally controlled by gene-specific mechanisms. Rapid enhancement of the synthesis of a diverse array of neuronal proteins through such mechanisms provides the components necessary for persistent forms of LTP and LTD. These findings have important implications for the synapse specificity and associativity of protein synthesis-dependent changes in synaptic strength. PMID:15450160

  16. Using Xenopus Embryos to Study Transcriptional and Posttranscriptional Gene Regulatory Mechanisms of Intermediate Filaments.

    PubMed

    Wang, Chen; Szaro, Ben G

    2016-01-01

    Intermediate filament genes exhibit highly regulated, tissue-specific patterns of expression during development and in response to injury. Identifying the responsible cis-regulatory gene elements thus holds great promise for revealing insights into fundamental gene regulatory mechanisms controlling tissue differentiation and repair. Because much of this regulation occurs in response to signals from surrounding cells, characterizing them requires a model system in which their activity can be tested within the context of an intact organism conveniently. We describe methods for doing so by injecting plasmid DNAs into fertilized Xenopus embryos. A prokaryotic element for site-specific recombination and two dual HS4 insulator elements flanking the reporter gene promote penetrant, promoter-typic expression that persists through early swimming tadpole stages, permitting the observation of fluorescent reporter protein expression in live embryos. In addition to describing cloning strategies for generating these plasmids, we present methods for coinjecting test and reference plasmids to identify the best embryos for analysis, for analyzing reporter protein and RNA expression, and for characterizing the trafficking of expressed reporter RNAs from the nucleus to polysomes. Thus, this system can be used to study the activities of cis-regulatory elements of intermediate filament genes at multiple levels of transcriptional and posttranscriptional control within an intact vertebrate embryo, from early stages of embryogenesis through later stages of organogenesis and tissue differentiation.

  17. Recent Topics on the Regulatory Mechanism of Ecdysteroidogenesis by the Prothoracic Glands in Insects

    PubMed Central

    Tanaka, Yoshiaki

    2011-01-01

    Molting and metamorphosis are strictly regulated by steroid hormones known as ecdysteroids. It is now widely recognized that ecdysteroid biosynthesis (ecdysteroidogenesis) in the prothoracic gland (PG) is regulated by the tropic factor prothoracicotropic hormone (PTTH). However, the importance of PTTH in the induction of molting and metamorphosis remains unclear, and other mechanisms are thought to be involved in the regulation of ecdysteroidogenesis by the PG. Recently, new regulatory mechanisms, prothoracicostatic factors, and neural regulation have been explored using the silkworm, Bombyx mori, and two circulating prothoracicostatic factors, prothoracicostatic peptide (PTSP) and Bommo-myosuppressin (BMS), have been identified. Whereas PTTH and BMS are secreted from the brain, PTSP is secreted from the peripheral neurosecretory system – the epiproctodeal gland – during the molting stage. The molecular basis of neural regulation of ecdysteroidogenesis has been revealed for the first time in B. mori. The innervating neurons supply both Bommo-FMRF related peptide (BRFa) and orcokinin to maintain low levels of ecdysteroids during the feeding stage. These complex regulatory mechanisms – involving tropic and static factors, peripheral neurosecretory cells as well as the central neuroendocrine system, and neural regulation in addition to circulating factors collaborate to regulate ecdysteroidogenesis. Thus, together they create the finely tuned fluctuations in ecdysteroid titers needed in the hemolymph during insect development. PMID:22645515

  18. Mechanical and Thermal Characterization of Ultrasonic Additive Manufacturing

    NASA Astrophysics Data System (ADS)

    Foster, Daniel R.

    Additive manufacturing is an emerging production technology used to create net shaped 3-D objects from a digital model. Ultrasonic Additive Manufacturing (UAM) is a relatively new type of additive manufacturing that uses ultrasonic energy to sequentially bond layers of metal foils at temperatures much lower than the melting temperature of the material. Constructing metal structures without melting allows UAM to have distinct advantages over beam based additive manufacturing and other traditional manufacturing processes. This is because solidification defects can be avoided, structures can be composed of dissimilar material and secondary materials (both metallic and non-metallic) can be successfully embedded into the metal matrix. These advantages allow UAM to have tremendous potential to create metal matrix composite structures that cannot be built using any other manufacturing technique. Although UAM has tremendous engineering potential, the effect of interfacial bonding defects on the mechanical and thermal properties have not be characterized. Incomplete interfacial bonding at the laminar surfaces due to insufficient welding energy can result in interfacial voids. Voids create discontinuities in the structure which change the mechanical and thermal properties of the component, resulting in a structure that has different properties than the monolithic material used to create it. In-situ thermal experiments and thermal modeling demonstrates that voids at partially bonded interfaces significantly affected heat generation and thermal conductivity in. UAM parts during consolidation as well as in the final components. Using ultrasonic testing, elastic properties of UAM structures were found to be significantly reduced due to the presence of voids, with the reduction being the most severe in the transverse (foil staking) direction. Elastic constants in all three material directions decreased linearly with a reduction in the interfacial bonded area. The linear trend

  19. Polymyxin Resistance of Pseudomonas aeruginosa phoQ Mutants Is Dependent on Additional Two-Component Regulatory Systems

    PubMed Central

    Gutu, Alina D.; Sgambati, Nicole; Strasbourger, Pnina; Brannon, Mark K.; Jacobs, Michael A.; Haugen, Eric; Kaul, Rajinder K.; Johansen, Helle Krogh; Høiby, Niels

    2013-01-01

    Pseudomonas aeruginosa can develop resistance to polymyxin as a consequence of mutations in the PhoPQ regulatory system, mediated by covalent lipid A modification. Transposon mutagenesis of a polymyxin-resistant phoQ mutant defined 41 novel loci required for resistance, including two regulatory systems, ColRS and CprRS. Deletion of the colRS genes, individually or in tandem, abrogated the polymyxin resistance of a ΔphoQ mutant, as did individual or tandem deletion of cprRS. Individual deletion of colR or colS in a ΔphoQ mutant also suppressed 4-amino-l-arabinose addition to lipid A, consistent with the known role of this modification in polymyxin resistance. Surprisingly, tandem deletion of colRS or cprRS in the ΔphoQ mutant or individual deletion of cprR or cprS failed to suppress 4-amino-l-arabinose addition to lipid A, indicating that this modification alone is not sufficient for PhoPQ-mediated polymyxin resistance in P. aeruginosa. Episomal expression of colRS or cprRS in tandem or of cprR individually complemented the Pm resistance phenotype in the ΔphoQ mutant, while episomal expression of colR, colS, or cprS individually did not. Highly polymyxin-resistant phoQ mutants of P. aeruginosa isolated from polymyxin-treated cystic fibrosis patients harbored mutant alleles of colRS and cprS; when expressed in a ΔphoQ background, these mutant alleles enhanced polymyxin resistance. These results define ColRS and CprRS as two-component systems regulating polymyxin resistance in P. aeruginosa, indicate that addition of 4-amino-l-arabinose to lipid A is not the only PhoPQ-regulated biochemical mechanism required for resistance, and demonstrate that colRS and cprS mutations can contribute to high-level clinical resistance. PMID:23459479

  20. Regulatory motifs on ISWI chromatin remodelers: molecular mechanisms and kinetic proofreading

    NASA Astrophysics Data System (ADS)

    Brysbaert, Guillaume; Lensink, Marc F.; Blossey, Ralf

    2015-02-01

    Recently, kinetic proofreading scenarios have been proposed for the regulation of chromatin remodeling, first on purely theoretical grounds (Blossey and Schiessel 2008 HFSP J. 2 167-70) and deduced from experiments on the ISWI/ACF system (Narlikar 2010 Curr. Opin. Chem. Biol. 14 660). In the kinetic proofreading scenario of chromatin remodeling, the combination of the recognition of a histone tail state and ATP-hydrolysis in the remodeler motor act together to select (i.e. proofread) a nucleosomal substrate. ISWI remodelers have recently been shown to have an additional level of regulation as they contain auto-inhibitory motifs which need to be inactivated through an interaction with the nucleosome. In this paper we show that the auto-regulatory effect enhances substrate recognition in kinetic proofreading. We further report some suggestive additional insights into the molecular mechanism underlying ISWI-autoregulation.

  1. Regulatory motifs on ISWI chromatin remodelers: molecular mechanisms and kinetic proofreading.

    PubMed

    Brysbaert, Guillaume; Lensink, Marc F; Blossey, Ralf

    2015-02-18

    Recently, kinetic proofreading scenarios have been proposed for the regulation of chromatin remodeling, first on purely theoretical grounds (Blossey and Schiessel 2008 HFSP J. 2 167-70) and deduced from experiments on the ISWI/ACF system (Narlikar 2010 Curr. Opin. Chem. Biol. 14 660). In the kinetic proofreading scenario of chromatin remodeling, the combination of the recognition of a histone tail state and ATP-hydrolysis in the remodeler motor act together to select (i.e. proofread) a nucleosomal substrate. ISWI remodelers have recently been shown to have an additional level of regulation as they contain auto-inhibitory motifs which need to be inactivated through an interaction with the nucleosome. In this paper we show that the auto-regulatory effect enhances substrate recognition in kinetic proofreading. We further report some suggestive additional insights into the molecular mechanism underlying ISWI-autoregulation. PMID:25563573

  2. The Cellular and Molecular Mechanisms of Immuno-Suppression by Human Type 1 Regulatory T Cells

    PubMed Central

    Gregori, Silvia; Goudy, Kevin S.; Roncarolo, Maria Grazia

    2011-01-01

    The immuno-regulatory mechanisms of IL-10-producing type 1 regulatory T (Tr1) cells have been widely studied over the years. However, several recent discoveries have shed new light on the cellular and molecular mechanisms that human Tr1 cells use to control immune responses and induce tolerance. In this review we outline the well known and newly discovered regulatory properties of human Tr1 cells and provide an in-depth comparison of the known suppressor mechanisms of Tr1 cells with FOXP3+ Treg. We also highlight the role that Tr1 cells play in promoting and maintaining tolerance in autoimmunity, allergy, and transplantation. PMID:22566914

  3. Distinct regulatory mechanisms act to establish and maintain Pax3 expression in the developing neural tube.

    PubMed

    Moore, Steven; Ribes, Vanessa; Terriente, Javier; Wilkinson, David; Relaix, Frédéric; Briscoe, James

    2013-01-01

    Pattern formation in developing tissues is driven by the interaction of extrinsic signals with intrinsic transcriptional networks that together establish spatially and temporally restricted profiles of gene expression. How this process is orchestrated at the molecular level by genomic cis-regulatory modules is one of the central questions in developmental biology. Here we have addressed this by analysing the regulation of Pax3 expression in the context of the developing spinal cord. Pax3 is induced early during neural development in progenitors of the dorsal spinal cord and is maintained as pattern is subsequently elaborated, resulting in the segregation of the tissue into dorsal and ventral subdivisions. We used a combination of comparative genomics and transgenic assays to define and dissect several functional cis-regulatory modules associated with the Pax3 locus. We provide evidence that the coordinated activity of two modules establishes and refines Pax3 expression during neural tube development. Mutational analyses of the initiating element revealed that in addition to Wnt signaling, Nkx family homeodomain repressors restrict Pax3 transcription to the presumptive dorsal neural tube. Subsequently, a second module mediates direct positive autoregulation and feedback to maintain Pax3 expression. Together, these data indicate a mechanism by which transient external signals are converted into a sustained expression domain by the activities of distinct regulatory elements. This transcriptional logic differs from the cross-repression that is responsible for the spatiotemporal patterns of gene expression in the ventral neural tube, suggesting that a variety of circuits are deployed within the neural tube regulatory network to establish and elaborate pattern formation.

  4. Mechanical characterisation of additively manufactured material having lattice microstructure

    NASA Astrophysics Data System (ADS)

    Cuan-Urquizo, E.; Yang, S.; Bhaskar, A.

    2015-02-01

    Many natural and engineered structures possess cellular and porous architecture. This paper is focused on the mechanical characterisation of additively manufactured lattice structures. The lattice consists of a stack of polylactic acid (PLA) filaments in a woodpile arrangement fabricated using a fused deposition modelling 3D printer. Some of the most promising applications of this 3D lattice material of this type include scaffolds for tissue engineering and the core for sandwich panels. While there is a significant body of work concerning the manufacture of such lattice materials, attempts to understand their mechanical properties are very limited. This paper brings together manufacturing with the need to understand the structure-property relationship for this class of materials. In order to understand the elastic response of the PLA-based lattice structures obtained from the fused deposition modelling process, single filaments manufactured using the same process were experimentally characterised first. The single PLA filaments were manufactured under different temperatures. These filaments were then characterised by using tensile testing. The stress-strain curves are presented. The variability of the measured results is discussed. The measured properties are then taken as input to a finite element model of the lattice material. This model uses simple one-dimensional elements in conjunction with a novel method achieving computational economy which precludes the use of fine meshes. Using this novel model, the apparent elastic modulus of lattice along the filaments has been obtained and is presented in this paper.

  5. Bioinspired Cellular Structures: Additive Manufacturing and Mechanical Properties

    NASA Astrophysics Data System (ADS)

    Stampfl, J.; Pettermann, H. E.; Liska, R.

    Biological materials (e.g., wood, trabecular bone, marine skeletons) rely heavily on the use of cellular architecture, which provides several advantages. (1) The resulting structures can bear the variety of "real life" load spectra using a minimum of a given bulk material, featuring engineering lightweight design principles. (2) The inside of the structures is accessible to body fluids which deliver the required nutrients. (3) Furthermore, cellular architectures can grow organically by adding or removing individual struts or by changing the shape of the constituting elements. All these facts make the use of cellular architectures a reasonable choice for nature. Using additive manufacturing technologies (AMT), it is now possible to fabricate such structures for applications in engineering and biomedicine. In this chapter, we present methods that allow the 3D computational analysis of the mechanical properties of cellular structures with open porosity. Various different cellular architectures including disorder are studied. In order to quantify the influence of architecture, the apparent density is always kept constant. Furthermore, it is shown that how new advanced photopolymers can be used to tailor the mechanical and functional properties of the fabricated structures.

  6. Anti-Sigma Factors in E. coli: Common Regulatory Mechanisms Controlling Sigma Factors Availability

    PubMed Central

    Treviño-Quintanilla, Luis Gerardo; Freyre-González, Julio Augusto; Martínez-Flores, Irma

    2013-01-01

    In bacteria, transcriptional regulation is a key step in cellular gene expression. All bacteria contain a core RNA polymerase that is catalytically competent but requires an additional σ factor for specific promoter recognition and correct transcriptional initiation. The RNAP core is not able to selectively bind to a given σ factor. In contrast, different σ factors have different affinities for the RNAP core. As a consequence, the concentration of alternate σ factors requires strict regulation in order to properly control the delicate interplay among them, which favors the competence for the RNAP core. This control is archived by different σ/anti-σ controlling mechanisms that shape complex regulatory networks and cascades, and enable the response to sudden environmental cues, whose global understanding is a current challenge for systems biology. Although there have been a number of excellent studies on each of these σ/anti-σ post-transcriptional regulatory systems, no comprehensive comparison of these mechanisms in a single model organism has been conducted. Here, we survey all these systems in E. coli dissecting and analyzing their inner workings and highlightin their differences. Then, following an integral approach, we identify their commonalities and outline some of the principles exploited by the cell to effectively and globally reprogram the transcriptional machinery. These principles provide guidelines for developing biological synthetic circuits enabling an efficient and robust response to sudden stimuli. PMID:24396271

  7. Mechanisms of regulatory T-cell suppression – a diverse arsenal for a moving target

    PubMed Central

    Sojka, Dorothy K; Huang, Yu-Hui; Fowell, Deborah J

    2008-01-01

    Naturally-occurring regulatory T cells (Tregs) are emerging as key regulators of immune responses to self-tissues and infectious agents. Insight has been gained into the cell types and the cellular events that are regulated by Tregs. Indeed, Tregs have been implicated in the control of initial activation events, proliferation, differentiation and effector function. However, the mechanisms by which Tregs disable their cellular targets are not well understood. Here we review recent advances in the identification of distinct mechanisms of Treg action and of signals that enable cellular targets to escape regulation. Roles for inhibitory cytokines, cytotoxic molecules, modulators of cAMP and cytokine competition have all been demonstrated. The growing number of inhibitory mechanisms ascribed to Tregs suggests that Tregs take a multi-pronged approach to immune regulation. It is likely that the relative importance of each inhibitory mechanism is context dependent and modulated by the inflammatory milieu and the magnitude of the immune response. In addition, the target cell may be differentially susceptible or resistant to distinct Treg mechanisms depending on their activation or functional status at the time of the Treg encounter. Understanding when and where each suppressive tool is most effective will help to fine tune therapeutic strategies to promote or constrain specific arms of Treg suppression. PMID:18346152

  8. Potential impact of gene regulatory mechanisms on the evolution of multicellularity in the volvocine algae.

    PubMed

    Kianianmomeni, Arash

    2015-01-01

    A fundamental question in biology is how multicellular organisms can arise from their single-celled precursors. The evolution of multicellularity requires the adoption of new traits in unicellular ancestors that allows the generation of form by, for example, increasing the size and developing new cell types. But what are the genetic, cellular and biochemical bases underlying the evolution of multicellularity? Recent advances in evolutionary developmental biology suggest that the regulation of gene expression by cis-regulatory factors, gene duplication and alternative splicing contribute to phenotypic evolution. These mechanisms enable different degrees of phenotypic divergence and complexity with variation in traits from genomes with similar gene contents. In addition, signaling pathways specific to cell types are developed to guarantee the modulation of cellular and developmental processes matched to the cell types as well as the maintenance of multicellularity. PMID:26479715

  9. A systems biology approach to defining regulatory mechanisms for cartilage and tendon cell phenotypes

    PubMed Central

    Mueller, A. J.; Tew, S. R.; Vasieva, O.; Clegg, P. D.; Canty-Laird, E. G.

    2016-01-01

    Phenotypic plasticity of adult somatic cells has provided emerging avenues for the development of regenerative therapeutics. In musculoskeletal biology the mechanistic regulatory networks of genes governing the phenotypic plasticity of cartilage and tendon cells has not been considered systematically. Additionally, a lack of strategies to effectively reproduce in vitro functional models of cartilage and tendon is retarding progress in this field. De- and redifferentiation represent phenotypic transitions that may contribute to loss of function in ageing musculoskeletal tissues. Applying a systems biology network analysis approach to global gene expression profiles derived from common in vitro culture systems (monolayer and three-dimensional cultures) this study demonstrates common regulatory mechanisms governing de- and redifferentiation transitions in cartilage and tendon cells. Furthermore, evidence of convergence of gene expression profiles during monolayer expansion of cartilage and tendon cells, and the expression of key developmental markers, challenges the physiological relevance of this culture system. The study also suggests that oxidative stress and PI3K signalling pathways are key modulators of in vitro phenotypes for cells of musculoskeletal origin. PMID:27670352

  10. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  11. Innovation of a Regulatory Mechanism Modulating Semi-determinate Stem Growth through Artificial Selection in Soybean

    PubMed Central

    Ping, Jieqing; Li, Shuai; Chen, Zhixiang; Ma, Jianxin

    2016-01-01

    It has been demonstrated that Terminal Flowering 1 (TFL1) in Arabidopsis and its functional orthologs in other plants specify indeterminate stem growth through their specific expression that represses floral identity genes in shoot apical meristems (SAMs), and that the loss-of-function mutations at these functional counterparts result in the transition of SAMs from the vegetative to reproductive state that is essential for initiation of terminal flowering and thus formation of determinate stems. However, little is known regarding how semi-determinate stems, which produce terminal racemes similar to those observed in determinate plants, are specified in any flowering plants. Here we show that semi-determinacy in soybean is modulated by transcriptional repression of Dt1, the functional ortholog of TFL1, in SAMs. Such repression is fulfilled by recently enabled spatiotemporal expression of Dt2, an ancestral form of the APETALA1/FRUITFULL orthologs, which encodes a MADS-box factor directly binding to the regulatory sequence of Dt1. In addition, Dt2 triggers co-expression of the putative SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (GmSOC1) in SAMs, where GmSOC1 interacts with Dt2, and also directly binds to the Dt1 regulatory sequence. Heterologous expression of Dt2 and Dt1 in determinate (tfl1) Arabidopsis mutants enables creation of semi-determinacy, but the same forms of the two genes in the tfl1 and soc1 background produce indeterminate stems, suggesting that Dt2 and SOC1 both are essential for transcriptional repression of Dt1. Nevertheless, the expression of Dt2 is unable to repress TFL1 in Arabidopsis, further demonstrating the evolutionary novelty of the regulatory mechanism underlying stem growth in soybean. PMID:26807727

  12. The safety and regulatory status of food, drug and cosmetics colour additives exempt from certification.

    PubMed

    Hallagan, J B; Allen, D C; Borzelleca, J F

    1995-06-01

    Colour additives exempt from certification (also known as 'natural colour additives') are commonly used in the United States to colour foods, drugs and cosmetics. The US Food and Drug Administration established regulations governing the use of these colour additives, and the labelling of the products that contain them. The safety of these colour additives has been demonstrated by safety testing programs that have yielded a significant amount of toxicology data, and also by a long and well documented history of safe use in the United States and elsewhere. In this report we review the data supporting the safety of the colour additives that are exempt from certification and approved for use in the USA, and conclude that the safety of these colour additives is well supported by the available data. Relevant aspects of the regulation of these colour additives are also described. PMID:7797179

  13. Additives

    NASA Technical Reports Server (NTRS)

    Smalheer, C. V.

    1973-01-01

    The chemistry of lubricant additives is discussed to show what the additives are chemically and what functions they perform in the lubrication of various kinds of equipment. Current theories regarding the mode of action of lubricant additives are presented. The additive groups discussed include the following: (1) detergents and dispersants, (2) corrosion inhibitors, (3) antioxidants, (4) viscosity index improvers, (5) pour point depressants, and (6) antifouling agents.

  14. Modeling Transport and Flow Regulatory Mechanisms of the Kidney

    PubMed Central

    Layton, Anita T.

    2013-01-01

    The kidney plays an indispensable role in the regulation of whole-organism water balance, electrolyte balance, and acid-base balance, and in the excretion of metabolic wastes and toxins. In this paper, we review representative mathematical models that have been developed to better understand kidney physiology and pathophysiology, including the regulation of glomerular filtration, the regulation of renal blood flow by means of the tubuloglomerular feedback mechanisms and of the myogenic mechanism, the urine concentrating mechanism, and regulation of renal oxygen transport. We discuss how such modeling efforts have significantly expanded our understanding of renal function in both health and disease. PMID:23914303

  15. Functional role of regulatory T cells in B cell lymphoma and related mechanisms.

    PubMed

    Wu, Wei; Wan, Jun; Xia, Ruixiang; Huang, Zhenqi; Ni, Jing; Yang, Mingzhen

    2015-01-01

    B cell lymphoma (BCL) has a higher degree of malignancy and complicated pathogenic mechanism. Regulatory T cells (Treg cells) are known to exert certain immune suppression functions, in addition to immune mediating effects. Recent studies have revealed the role of Treg cells in pathogenesis and progression of multiple malignant tumors. This study therefore investigated the functional role and related mechanism of Treg cells in BCL. A cohort of thirty patients who were diagnosed with BCL in our hospital between January 2013 and December 2014. Another thirty healthy individuals were recruited. Peripheral blood mononuclear cells (PBMCs) were separated and analyzed for the ratio of CD4+/CD25+ Treg cells. The mRNA expression levels of Foxp3, transforming growth factor (TGF)-β1 and interleukin (IL)-10 genes were quantified by real-time PCR, while their serum levels were determined by enzyme-linked immunosorbent assay (ELISA). Meanwhile all laboratory indexes for patients were monitored during the complete remission (CR) stage. BCL patients significantly elevated ratio of CD4+/CD25+ Treg cells, which were decreased at CR stage. mRNA levels of Foxp3, TGF-β1 and IL-10, in addition to protein levels of TGF-β1 and IL-10 were potentiated in lymphoma patients but decreased in CR patients (P<0.05 in all cases). CD4+/CD25+ Treg cells exert immune suppressing functions in BCL via regulating cytokines, thereby facilitating the pathogenesis and progression of lymphoma. PMID:26464657

  16. Structural imprints in vivo decode RNA regulatory mechanisms

    NASA Astrophysics Data System (ADS)

    Spitale, Robert C.; Flynn, Ryan A.; Zhang, Qiangfeng Cliff; Crisalli, Pete; Lee, Byron; Jung, Jong-Wha; Kuchelmeister, Hannes Y.; Batista, Pedro J.; Torre, Eduardo A.; Kool, Eric T.; Chang, Howard Y.

    2015-03-01

    Visualizing the physical basis for molecular behaviour inside living cells is a great challenge for biology. RNAs are central to biological regulation, and the ability of RNA to adopt specific structures intimately controls every step of the gene expression program. However, our understanding of physiological RNA structures is limited; current in vivo RNA structure profiles include only two of the four nucleotides that make up RNA. Here we present a novel biochemical approach, in vivo click selective 2'-hydroxyl acylation and profiling experiment (icSHAPE), which enables the first global view, to our knowledge, of RNA secondary structures in living cells for all four bases. icSHAPE of the mouse embryonic stem cell transcriptome versus purified RNA folded in vitro shows that the structural dynamics of RNA in the cellular environment distinguish different classes of RNAs and regulatory elements. Structural signatures at translational start sites and ribosome pause sites are conserved from in vitro conditions, suggesting that these RNA elements are programmed by sequence. In contrast, focal structural rearrangements in vivo reveal precise interfaces of RNA with RNA-binding proteins or RNA-modification sites that are consistent with atomic-resolution structural data. Such dynamic structural footprints enable accurate prediction of RNA-protein interactions and N6-methyladenosine (m6A) modification genome wide. These results open the door for structural genomics of RNA in living cells and reveal key physiological structures controlling gene expression.

  17. Structural imprints in vivo decode RNA regulatory mechanisms

    PubMed Central

    Spitale, Robert C.; Flynn, Ryan A.; Zhang, Qiangfeng Cliff; Crisalli, Pete; Lee, Byron; Jung, Jong-Wha; Kuchelmeister, Hannes Y.; Batista, Pedro J.; Torre, Eduardo A.; Kool, Eric T.; Chang, Howard Y.

    2015-01-01

    Visualizing the physical basis for molecular behavior inside living cells is a grand challenge in biology. RNAs are central to biological regulation, and RNA’s ability to adopt specific structures intimately controls every step of the gene expression program1. However, our understanding of physiological RNA structures is limited; current in vivo RNA structure profiles view only two of four nucleotides that make up RNA2,3. Here we present a novel biochemical approach, In Vivo Click SHAPE (icSHAPE), that enables the first global view of RNA secondary structures of all four bases in living cells. icSHAPE of mouse embryonic stem cell transcriptome versus purified RNA folded in vitro shows that the structural dynamics of RNA in the cellular environment distinguishes different classes of RNAs and regulatory elements. Structural signatures at translational start sites and ribosome pause sites are conserved from in vitro, suggesting that these RNA elements are programmed by sequence. In contrast, focal structural rearrangements in vivo reveal precise interfaces of RNA with RNA binding proteins or RNA modification sites that are consistent with atomic-resolution structural data. Such dynamic structural footprints enable accurate prediction of RNA-protein interactions and N6-methyladenosine (m6A) modification genome-wide. These results open the door for structural genomics of RNA in living cells and reveal key physiological structures controlling gene expression. PMID:25799993

  18. Heart Rate Variability: New Perspectives on Physiological Mechanisms, Assessment of Self-regulatory Capacity, and Health risk.

    PubMed

    McCraty, Rollin; Shaffer, Fred

    2015-01-01

    Heart rate variability, the change in the time intervals between adjacent heartbeats, is an emergent property of interdependent regulatory systems that operates on different time scales to adapt to environmental and psychological challenges. This article briefly reviews neural regulation of the heart and offers some new perspectives on mechanisms underlying the very low frequency rhythm of heart rate variability. Interpretation of heart rate variability rhythms in the context of health risk and physiological and psychological self-regulatory capacity assessment is discussed. The cardiovascular regulatory centers in the spinal cord and medulla integrate inputs from higher brain centers with afferent cardiovascular system inputs to adjust heart rate and blood pressure via sympathetic and parasympathetic efferent pathways. We also discuss the intrinsic cardiac nervous system and the heart-brain connection pathways, through which afferent information can influence activity in the subcortical, frontocortical, and motor cortex areas. In addition, the use of real-time HRV feedback to increase self-regulatory capacity is reviewed. We conclude that the heart's rhythms are characterized by both complexity and stability over longer time scales that reflect both physiological and psychological functional status of these internal self-regulatory systems.

  19. Heart Rate Variability: New Perspectives on Physiological Mechanisms, Assessment of Self-regulatory Capacity, and Health risk

    PubMed Central

    Shaffer, Fred

    2015-01-01

    Heart rate variability, the change in the time intervals between adjacent heartbeats, is an emergent property of interdependent regulatory systems that operates on different time scales to adapt to environmental and psychological challenges. This article briefly reviews neural regulation of the heart and offers some new perspectives on mechanisms underlying the very low frequency rhythm of heart rate variability. Interpretation of heart rate variability rhythms in the context of health risk and physiological and psychological self-regulatory capacity assessment is discussed. The cardiovascular regulatory centers in the spinal cord and medulla integrate inputs from higher brain centers with afferent cardiovascular system inputs to adjust heart rate and blood pressure via sympathetic and parasympathetic efferent pathways. We also discuss the intrinsic cardiac nervous system and the heart-brain connection pathways, through which afferent information can influence activity in the subcortical, frontocortical, and motor cortex areas. In addition, the use of real-time HRV feedback to increase self-regulatory capacity is reviewed. We conclude that the heart's rhythms are characterized by both complexity and stability over longer time scales that reflect both physiological and psychological functional status of these internal self-regulatory systems. PMID:25694852

  20. Potential self-regulatory mechanisms of yoga for psychological health

    PubMed Central

    Gard, Tim; Noggle, Jessica J.; Park, Crystal L.; Vago, David R.; Wilson, Angela

    2014-01-01

    Research suggesting the beneficial effects of yoga on myriad aspects of psychological health has proliferated in recent years, yet there is currently no overarching framework by which to understand yoga’s potential beneficial effects. Here we provide a theoretical framework and systems-based network model of yoga that focuses on integration of top-down and bottom-up forms of self-regulation. We begin by contextualizing yoga in historical and contemporary settings, and then detail how specific components of yoga practice may affect cognitive, emotional, behavioral, and autonomic output under stress through an emphasis on interoception and bottom-up input, resulting in physical and psychological health. The model describes yoga practice as a comprehensive skillset of synergistic process tools that facilitate bidirectional feedback and integration between high- and low-level brain networks, and afferent and re-afferent input from interoceptive processes (somatosensory, viscerosensory, chemosensory). From a predictive coding perspective we propose a shift to perceptual inference for stress modulation and optimal self-regulation. We describe how the processes that sub-serve self-regulation become more automatized and efficient over time and practice, requiring less effort to initiate when necessary and terminate more rapidly when no longer needed. To support our proposed model, we present the available evidence for yoga affecting self-regulatory pathways, integrating existing constructs from behavior theory and cognitive neuroscience with emerging yoga and meditation research. This paper is intended to guide future basic and clinical research, specifically targeting areas of development in the treatment of stress-mediated psychological disorders. PMID:25368562

  1. Regulatory mechanisms for specification and patterning of plant vascular tissues.

    PubMed

    Caño-Delgado, Ana; Lee, Ji-Young; Demura, Taku

    2010-01-01

    Plant vascular tissues, the conduits of water, nutrients, and small molecules, play important roles in plant growth and development. Vascular tissues have allowed plants to successfully adapt to various environmental conditions since they evolved 450 Mya. The majority of plant biomass, an important source of renewable energy, comes from the xylem of the vascular tissues. Efforts have been made to identify the underlying mechanisms of cell specification and patterning of plant vascular tissues and their proliferation. The formation of the plant vascular system is a complex process that integrates signaling and gene regulation at transcriptional and posttranscriptional levels. Recently, a wealth of molecular genetic studies and the advent of cell biology and genomic tools have enabled important progress toward understanding its underlying mechanisms. Here, we provide a comprehensive review of the cell and developmental processes of plant vascular tissue and resources recently available for studying them that will enable the discovery of new ways to develop sustainable energy using plant biomass.

  2. 'Cold cuts' added to the circadian smorgasbord of regulatory mechanisms.

    PubMed

    Green, Carla B

    2016-09-01

    In mammals, rhythms in body temperature help to entrain and synchronize circadian rhythms throughout the organism, and the cold-inducible RNA-binding protein (CIRBP) is one of the mediators of these daily temperature changes. Cirbp mRNA expression is regulated by the daily subtle rhythms in body temperature, and a new study by Gotic and colleagues (pp. 2005-2017) reveals a surprising and novel mechanism that involves temperature-dependent enhancement of splicing efficiency. PMID:27664233

  3. The beginning of a seed: regulatory mechanisms of double fertilization

    PubMed Central

    Bleckmann, Andrea; Alter, Svenja; Dresselhaus, Thomas

    2014-01-01

    The launch of seed development in flowering plants (angiosperms) is initiated by the process of double fertilization: two male gametes (sperm cells) fuse with two female gametes (egg and central cell) to form the precursor cells of the two major seed components, the embryo and endosperm, respectively. The immobile sperm cells are delivered by the pollen tube toward the ovule harboring the female gametophyte by species-specific pollen tube guidance and attraction mechanisms. After pollen tube burst inside the female gametophyte, the two sperm cells fuse with the egg and central cell initiating seed development. The fertilized central cell forms the endosperm while the fertilized egg cell, the zygote, will form the actual embryo and suspensor. The latter structure connects the embryo with the sporophytic maternal tissues of the developing seed. The underlying mechanisms of double fertilization are tightly regulated to ensure delivery of functional sperm cells and the formation of both, a functional zygote and endosperm. In this review we will discuss the current state of knowledge about the processes of directed pollen tube growth and its communication with the synergid cells resulting in pollen tube burst, the interaction of the four gametes leading to cell fusion and finally discuss mechanisms how flowering plants prevent multiple sperm cell entry (polyspermy) to maximize their reproductive success. PMID:25309552

  4. Genetic control and regulatory mechanisms of succinoglycan and curdlan biosynthesis in genus Agrobacterium.

    PubMed

    Wu, Dan; Li, Ang; Ma, Fang; Yang, Jixian; Xie, Yutong

    2016-07-01

    Agrobacterium is a genus of gram-negative bacteria that can produce several typical exopolysaccharides with commercial uses in the food and pharmaceutical fields. In particular, succinoglycan and curdlan, due to their good quality in high yield, have been employed on an industrial scale comparatively early. Exopolysaccharide biosynthesis is a multiple-step process controlled by different functional genes, and various environmental factors cause changes in exopolysaccharide biosynthesis through regulatory mechanisms. In this mini-review, we focus on the genetic control and regulatory mechanisms of succinoglycan and curdlan produced by Agrobacterium. Some key functional genes and regulatory mechanisms for exopolysaccharide biosynthesis are described, possessing a high potential for application in metabolic engineering to modify exopolysaccharide production and physicochemical properties. This review may contribute to the understanding of exopolysaccharide biosynthesis and exopolysaccharide modification by metabolic engineering methods in Agrobacterium. PMID:27255488

  5. Structure of the TRPA1 ion channel suggests regulatory mechanisms

    PubMed Central

    Paulsen, Candice E.; Armache, Jean-Paul; Gao, Yuan; Cheng, Yifan; Julius, David

    2015-01-01

    The TRPA1 ion channel (a.k.a the ‘wasabi receptor’) is a detector of noxious chemical agents encountered in our environment or produced endogenously during tissue injury or drug metabolism. These include a broad class of electrophiles that activate the channel through covalent protein modification. TRPA1 antagonists hold potential for treating neurogenic inflammatory conditions provoked or exacerbated by irritant exposure. Despite compelling reasons to understand TRPA1 function, structural mechanisms underlying channel regulation remain obscure. Here, we use single-particle electron cryo-microscopy to determine the structure of full-length human TRPA1 to ~4Å resolution in the presence of pharmacophores, including a potent antagonist. A number of unexpected features are revealed, including an extensive coiled-coil assembly domain stabilized by polyphosphate co-factors and a highly integrated nexus that converges on an unpredicted TRP-like allosteric domain. These findings provide novel insights into mechanisms of TRPA1 regulation, and establish a blueprint for structure-based design of analgesic and anti-inflammatory agents. PMID:25855297

  6. Sociocognitive self-regulatory mechanisms governing judgments of the acceptability and likelihood of sport cheating.

    PubMed

    d'Arripe-Longueville, Fabienne; Corrion, Karine; Scoffier, Stéphanie; Roussel, Peggy; Chalabaev, Aïna

    2010-10-01

    This study extends previous psychosocial literature (Bandura et al., 2001, 2003) by examining a structural model of the self-regulatory mechanisms governing the acceptability and likelihood of cheating in a sport context. Male and female adolescents (N = 804), aged 15-20 years, took part in this study. Negative affective self-regulatory efficacy influenced the acceptability and likelihood of cheating through the mediating role of moral disengagement, in females and males. Affective efficacy positively influenced prosocial behavior through moral disengagement or through resistive self-regulatory efficacy and social efficacy, in both groups. The direct effects of affective efficacy on beliefs about cheating were only evident in females. These results extend the findings of Bandura et al. (2001, 2003) to the sport context and suggest that affective and resistive self-regulatory efficacy operate in concert in governing adolescents' moral disengagement and transgressive behaviors in sport.

  7. A Cell-Regulatory Mechanism Involving Feedback between Contraction and Tissue Formation Guides Wound Healing Progression

    PubMed Central

    Valero, Clara; Javierre, Etelvina; García-Aznar, José Manuel; Gómez-Benito, María José

    2014-01-01

    Wound healing is a process driven by cells. The ability of cells to sense mechanical stimuli from the extracellular matrix that surrounds them is used to regulate the forces that cells exert on the tissue. Stresses exerted by cells play a central role in wound contraction and have been broadly modelled. Traditionally, these stresses are assumed to be dependent on variables such as the extracellular matrix and cell or collagen densities. However, we postulate that cells are able to regulate the healing process through a mechanosensing mechanism regulated by the contraction that they exert. We propose that cells adjust the contraction level to determine the tissue functions regulating all main activities, such as proliferation, differentiation and matrix production. Hence, a closed-regulatory feedback loop is proposed between contraction and tissue formation. The model consists of a system of partial differential equations that simulates the evolution of fibroblasts, myofibroblasts, collagen and a generic growth factor, as well as the deformation of the extracellular matrix. This model is able to predict the wound healing outcome without requiring the addition of phenomenological laws to describe the time-dependent contraction evolution. We have reproduced two in vivo experiments to evaluate the predictive capacity of the model, and we conclude that there is feedback between the level of cell contraction and the tissue regenerated in the wound. PMID:24681636

  8. Gap junction-mediated electrical transmission: regulatory mechanisms and plasticity

    PubMed Central

    Pereda, Alberto E.; Curti, Sebastian; Hoge, Gregory; Cachope, Roger; Flores, Carmen E.; Rash, John E.

    2012-01-01

    The term synapse applies to cellular specializations that articulate the processing of information within neural circuits by providing a mechanism for the transfer of information between two different neurons. There are two main modalities of synaptic transmission: chemical and electrical. While most efforts have been dedicated to the understanding of the properties and modifiability of chemical transmission, less is still known regarding the plastic properties of electrical synapses, whose structural correlate is the gap junction. A wealth of data indicates that, rather than passive intercellular channels, electrical synapses are more dynamic and modifiable than was generally perceived. This article will discuss the factors determining the strength of electrical transmission and review current evidence demonstrating its dynamic properties. Like their chemical counterparts, electrical synapses can also be plastic and modifiable. PMID:22659675

  9. Cis-regulatory mechanisms governing stem and progenitor cell transitions

    PubMed Central

    Johnson, Kirby D.; Kong, Guangyao; Gao, Xin; Chang, Yuan-I; Hewitt, Kyle J.; Sanalkumar, Rajendran; Prathibha, Rajalekshmi; Ranheim, Erik A.; Dewey, Colin N.; Zhang, Jing; Bresnick, Emery H.

    2015-01-01

    Cis-element encyclopedias provide information on phenotypic diversity and disease mechanisms. Although cis-element polymorphisms and mutations are instructive, deciphering function remains challenging. Mutation of an intronic GATA motif (+9.5) in GATA2, encoding a master regulator of hematopoiesis, underlies an immunodeficiency associated with myelodysplastic syndrome (MDS) and acute myeloid leukemia (AML). Whereas an inversion relocalizes another GATA2 cis-element (−77) to the proto-oncogene EVI1, inducing EVI1 expression and AML, whether this reflects ectopic or physiological activity is unknown. We describe a mouse strain that decouples −77 function from proto-oncogene deregulation. The −77−/− mice exhibited a novel phenotypic constellation including late embryonic lethality and anemia. The −77 established a vital sector of the myeloid progenitor transcriptome, conferring multipotentiality. Unlike the +9.5−/− embryos, hematopoietic stem cell genesis was unaffected in −77−/− embryos. These results illustrate a paradigm in which cis-elements in a locus differentially control stem and progenitor cell transitions, and therefore the individual cis-element alterations cause unique and overlapping disease phenotypes. PMID:26601269

  10. Transcriptional and Epigenetic Regulatory Mechanisms Affecting HTLV-1 Provirus

    PubMed Central

    Miyazato, Paola; Matsuo, Misaki; Katsuya, Hiroo; Satou, Yorifumi

    2016-01-01

    Human T-cell leukemia virus type 1 (HTLV-1) is a retrovirus associated with human diseases, such as adult T-cell leukemia (ATL) and HTLV-1-associated myelopathy/Tropic spastic paraparesis (HAM/TSP). As a retrovirus, its life cycle includes a step where HTLV-1 is integrated into the host genomic DNA and forms proviral DNA. In the chronic phase of the infection, HTLV‑1 is known to proliferate as a provirus via the mitotic division of the infected host cells. There are generally tens of thousands of infected clones within an infected individual. They exist not only in peripheral blood, but also in various lymphoid organs. Viral proteins encoded in HTLV-1 genome play a role in the proliferation and survival of the infected cells. As is the case with other chronic viral infections, HTLV-1 gene expression induces the activation of the host immunity against the virus. Thus, the transcription from HTLV-1 provirus needs to be controlled in order to evade the host immune surveillance. There should be a dynamic and complex regulation in vivo, where an equilibrium between viral antigen expression and host immune surveillance is achieved. The mechanisms regulating viral gene expression from the provirus are a key to understanding the persistent/latent infection with HTLV-1 and its pathogenesis. In this article, we would like to review our current understanding on this topic. PMID:27322309

  11. Novel RNA regulatory mechanisms revealed in the epitranscriptome.

    PubMed

    Saletore, Yogesh; Chen-Kiang, Selina; Mason, Christopher E

    2013-03-01

    Methyl-6-adenosine (m (6)A) has been hypothesized to exist since the 1970s, (1) but little has been known about the specific RNAs, or sites within them, that are affected by this RNA modification. Here, we report that recent work has shown RNA modifications like m (6)A, collectively called the "epitranscriptome," are a pervasive feature of mammalian cells and likely play a role in development and disease. An enrichment of m (6)A near the last CDS of thousands of genes has implicated m (6)A in transcript processing, translational regulation and potentially a mechanism for regulating miRNA maturation. Also, because the sites of m (6)A show strong evolutionary conservation and have been replicated in nearly identical sites between mouse and human, strong evolutionary pressures are likely being maintained for this mark. (2)(,) (3) Finally, we note that m (6)A is one of over 100 modifications of RNA that have been reported, (4) and with the combination of high-throughput, next-generation sequencing (NGS) techniques, immunoprecipitation with appropriate antibodies and splicing-aware peak-finding, the dynamics of the epitranscriptome can now be mapped and characterized to discern their specific cellular roles. PMID:23434792

  12. Transcriptional and Epigenetic Regulatory Mechanisms Affecting HTLV-1 Provirus.

    PubMed

    Miyazato, Paola; Matsuo, Misaki; Katsuya, Hiroo; Satou, Yorifumi

    2016-01-01

    Human T-cell leukemia virus type 1 (HTLV-1) is a retrovirus associated with human diseases, such as adult T-cell leukemia (ATL) and HTLV-1-associated myelopathy/Tropic spastic paraparesis (HAM/TSP). As a retrovirus, its life cycle includes a step where HTLV-1 is integrated into the host genomic DNA and forms proviral DNA. In the chronic phase of the infection, HTLV‑1 is known to proliferate as a provirus via the mitotic division of the infected host cells. There are generally tens of thousands of infected clones within an infected individual. They exist not only in peripheral blood, but also in various lymphoid organs. Viral proteins encoded in HTLV-1 genome play a role in the proliferation and survival of the infected cells. As is the case with other chronic viral infections, HTLV-1 gene expression induces the activation of the host immunity against the virus. Thus, the transcription from HTLV-1 provirus needs to be controlled in order to evade the host immune surveillance. There should be a dynamic and complex regulation in vivo, where an equilibrium between viral antigen expression and host immune surveillance is achieved. The mechanisms regulating viral gene expression from the provirus are a key to understanding the persistent/latent infection with HTLV-1 and its pathogenesis. In this article, we would like to review our current understanding on this topic. PMID:27322309

  13. MYCN-driven regulatory mechanisms controlling LIN28B in neuroblastoma

    PubMed Central

    Beckers, Anneleen; Van Peer, Gert; Carter, Daniel R.; Gartlgruber, Moritz; Herrmann, Carl; Agarwal, Saurabh; Helsmoortel, Hetty H.; Althoff, Kristina; Molenaar, Jan J.; Cheung, Belamy B.; Schulte, Johannes H.; Benoit, Yves; Shohet, Jason M.; Westermann, Frank; Marshall, Glenn M.; Vandesompele, Jo; De Preter, Katleen; Speleman, Frank

    2016-01-01

    LIN28B has been identified as an oncogene in various tumor entities, including neuroblastoma, a childhood cancer that originates from neural crest-derived cells, and is characterized by amplification of the MYCN oncogene. Recently, elevated LIN28B expression levels were shown to contribute to neuroblastoma tumorigenesis via let-7 dependent de-repression of MYCN. However, additional insight in the regulation of LIN28B in neuroblastoma is lacking. Therefore, we have performed a comprehensive analysis of the regulation of LIN28B in neuroblastoma, with a specific focus on the contribution of miRNAs. We show that MYCN regulates LIN28B expression in neuroblastoma tumors via two distinct parallel mechanisms. First, through an unbiased LIN28B-3′UTR reporter screen, we found that miR-26a-5p and miR-26b-5p regulate LIN28B expression. Next, we demonstrated that MYCN indirectly affects the expression of miR-26a-5p, and hence regulates LIN28B, therefor establishing a MYCN-miR-26a-5p-LIN28B regulatory axis. Second, we provide evidence that MYCN regulates LIN28B expression via interaction with the LIN28B promotor, establishing a direct MYCN-LIN28B regulatory axis. We believe that these findings mark LIN28B as an important effector of the MYCN oncogenic phenotype and underlines the importance of MYCN-regulated miRNAs in establishing the MYCN-driven oncogenic process. PMID:26123663

  14. Structural insights into the regulatory mechanism of the Pseudomonas aeruginosa YfiBNR system.

    PubMed

    Xu, Min; Yang, Xuan; Yang, Xiu-An; Zhou, Lei; Liu, Tie-Zheng; Fan, Zusen; Jiang, Tao

    2016-06-01

    YfiBNR is a recently identified bis-(3'-5')-cyclic dimeric GMP (c-di-GMP) signaling system in opportunistic pathogens. It is a key regulator of biofilm formation, which is correlated with prolonged persistence of infection and antibiotic drug resistance. In response to cell stress, YfiB in the outer membrane can sequester the periplasmic protein YfiR, releasing its inhibition of YfiN on the inner membrane and thus provoking the diguanylate cyclase activity of YfiN to induce c-di-GMP production. However, the detailed regulatory mechanism remains elusive. Here, we report the crystal structures of YfiB alone and of an active mutant YfiB(L43P) complexed with YfiR with 2:2 stoichiometry. Structural analyses revealed that in contrast to the compact conformation of the dimeric YfiB alone, YfiB(L43P) adopts a stretched conformation allowing activated YfiB to penetrate the peptidoglycan (PG) layer and access YfiR. YfiB(L43P) shows a more compact PG-binding pocket and much higher PG binding affinity than wild-type YfiB, suggesting a tight correlation between PG binding and YfiB activation. In addition, our crystallographic analyses revealed that YfiR binds Vitamin B6 (VB6) or L-Trp at a YfiB-binding site and that both VB6 and L-Trp are able to reduce YfiB(L43P)-induced biofilm formation. Based on the structural and biochemical data, we propose an updated regulatory model of the YfiBNR system. PMID:27113583

  15. [Labor pain--physiologal basis and regulatory mechanisms].

    PubMed

    Kojić, Zvezdana; Arsenijević, Ljubica; Sćepanović, Ljiljana; Popović, Nada

    2007-01-01

    Clinically, labor (visceral) pain is extremely prevalent in general population, yet its mechanisms have been poorly understood. With development of new electrophysiological techniques and molecular biology technologies, our understanding of physiological bases of labor pain has been markedly improved; in that way possibilities for therapeutic modulation of labor pain are expanded. The aim of this study was to describe the new insight into this topic. In this paper, the theory was exposed that the reason for labor pain had been found in sensitization at the levels of the uterus, dorsal root neurones and phychologic factors. Peripheral sensitization occurs due to cervical inflammatory reaction, associated with cervical ripening and remodeling. Chemical inflammatory mediators (notably prostaglandins, cytokines, granulocytes, enzymes such as metalloproteinases, integrines) activate nociceptive nerve fibers. Nociceptive threshold is reduced (resulting in primary hyperalgesia) and because of that there occurs the total number of action potentials generated and propagated by nociceptive peripheral nerves (visceral hypersensitivity). Central sensitization arises due to phosphorylation of N-methyl-D-aspartate (NMDA) receptors of dorsal root neurones. Numerous receptors, ion channels and signaling molecules, which, together with opioid peptides participate in spinal pain control, represent, at the level of central sensitization, possible therapeutic goals for labor pain modulation. Some of them are: DREAM which constitututively suppresses transcription of mRNA for opioid peptides, oncostatin M, COX-2 inhibitors, cFOS protein, tachykinins, gamma-butyric acid agonist, L-type Ca++ channels. Fear, as one of the most frequent phychologic factors, does (not) provide good control in transmision of pain sensitization by descendent nerve fibers. Some of the candidates for objective pain marker are also described. This article outlines the factors that, based on the contemporary

  16. Sparse Additive Ordinary Differential Equations for Dynamic Gene Regulatory Network Modeling

    PubMed Central

    Wu, Hulin; Lu, Tao; Xue, Hongqi; Liang, Hua

    2014-01-01

    Summary The gene regulation network (GRN) is a high-dimensional complex system, which can be represented by various mathematical or statistical models. The ordinary differential equation (ODE) model is one of the popular dynamic GRN models. High-dimensional linear ODE models have been proposed to identify GRNs, but with a limitation of the linear regulation effect assumption. In this article, we propose a sparse additive ODE (SA-ODE) model, coupled with ODE estimation methods and adaptive group LASSO techniques, to model dynamic GRNs that could flexibly deal with nonlinear regulation effects. The asymptotic properties of the proposed method are established and simulation studies are performed to validate the proposed approach. An application example for identifying the nonlinear dynamic GRN of T-cell activation is used to illustrate the usefulness of the proposed method. PMID:25061254

  17. Sparse Additive Ordinary Differential Equations for Dynamic Gene Regulatory Network Modeling.

    PubMed

    Wu, Hulin; Lu, Tao; Xue, Hongqi; Liang, Hua

    2014-04-01

    The gene regulation network (GRN) is a high-dimensional complex system, which can be represented by various mathematical or statistical models. The ordinary differential equation (ODE) model is one of the popular dynamic GRN models. High-dimensional linear ODE models have been proposed to identify GRNs, but with a limitation of the linear regulation effect assumption. In this article, we propose a sparse additive ODE (SA-ODE) model, coupled with ODE estimation methods and adaptive group LASSO techniques, to model dynamic GRNs that could flexibly deal with nonlinear regulation effects. The asymptotic properties of the proposed method are established and simulation studies are performed to validate the proposed approach. An application example for identifying the nonlinear dynamic GRN of T-cell activation is used to illustrate the usefulness of the proposed method. PMID:25061254

  18. Insights into the inhibitory mechanisms of the regulatory protein IIA(Glc) on melibiose permease activity.

    PubMed

    Hariharan, Parameswaran; Guan, Lan

    2014-11-21

    The phosphotransfer protein IIA(Glc) of the bacterial phosphoenolpyruvate:carbohydrate phosphotransferase system plays a key role in the regulation of carbohydrate metabolism. Melibiose permease (MelB) is one among several permeases subject to IIA(Glc) regulation. The regulatory mechanisms are poorly understood; in addition, thermodynamic features of IIA(Glc) binding to other proteins are also unknown. Applying isothermal titration calorimetry and amine-specific cross-linking, we show that IIA(Glc) directly binds to MelB of Salmonella typhimurium (MelB(St)) and Escherichia coli MelB (MelB(Ec)) at a stoichiometry of unity in the absence or presence of melibiose. The dissociation constant values are 3-10 μM for MelB(St) and 25 μM for MelB(Ec). All of the binding is solely driven by favorable enthalpy forces. IIA(Glc) binding to MelB(St) in the absence or presence of melibiose yields a large negative heat capacity change; in addition, the conformational entropy is constrained upon the binding. We further found that the IIA(Glc)-bound MelB(St) exhibits a decreased binding affinity for melibiose or nitrophenyl-α-galactoside. It is believed that sugar binding to the permease is involved in an induced fit mechanism, and the transport process requires conformational cycling between different states. Thus, the thermodynamic data are consistent with the interpretation that IIA(Glc) inhibits the induced fit process and restricts the conformational dynamics of MelB(St). PMID:25296751

  19. Hospital closures and survivals: an analysis of operating characteristics and regulatory mechanisms in three states.

    PubMed Central

    Kennedy, L; Dumas, M B

    1983-01-01

    This article examines factors related to hospital closures, using a longitudinal sample of surviving and closed hospitals. The hospitals are drawn from three states with different regulatory programs. Size of hospital and occupancy rate are shown to be related to likelihood of closure, while ownership, length of stay, and expenditures are not. These findings are observed both in the aggregate and within the individual states between 1960 and 1980. The three states--Arizona, Pennsylvania, and Maryland--represent different population trends and regulatory mechanisms and goals. The findings indicate that some programs appear to guarantee survival, whereas others are more neutral. PMID:6668180

  20. Multiple regulatory mechanisms in the chloroplast of green algae: relation to hydrogen production.

    PubMed

    Antal, Taras K; Krendeleva, Tatyana E; Tyystjärvi, Esa

    2015-09-01

    A complex regulatory network in the chloroplast of green algae provides an efficient tool for maintenance of energy and redox balance in the cell under aerobic and anaerobic conditions. In this review, we discuss the structural and functional organizations of electron transport pathways in the chloroplast, and regulation of photosynthesis in the green microalga Chlamydomonas reinhardtii. The focus is on the regulatory mechanisms induced in response to nutrient deficiency stress and anoxia and especially on the role of a hydrogenase-mediated reaction in adaptation to highly reducing conditions and ATP deficiency in the cell. PMID:25986411

  1. Control and regulatory mechanisms associated with thermogenesis in flying insects and birds.

    PubMed

    Loli, Denise; Bicudo, José Eduardo P W

    2005-01-01

    Most insects and birds are able to fly. The chitin made exoskeleton of insects poses them several constraints, and this is one the reasons they are in general small sized animals. On the other hand, because birds possess an endoskeleton made of bones they may grow much larger when compared to insects. The two taxa are quite different with regards to their general "design" platform, in particular with respect to their respiratory and circulatory systems. However, because they fly, they may share in common several traits, namely those associated with the control and regulatory mechanisms governing thermogenesis. High core temperatures are essential for animal flight irrespective of the taxa they belong to. Birds and insects have thus evolved mechanisms which allowed them to control and regulate high rates of heat fluxes. This article discusses possible convergent thermogenic control and regulatory mechanisms associated with flight in insects and birds. PMID:16283551

  2. Control and regulatory mechanisms associated with thermogenesis in flying insects and birds.

    PubMed

    Loli, Denise; Bicudo, José Eduardo P W

    2005-01-01

    Most insects and birds are able to fly. The chitin made exoskeleton of insects poses them several constraints, and this is one the reasons they are in general small sized animals. On the other hand, because birds possess an endoskeleton made of bones they may grow much larger when compared to insects. The two taxa are quite different with regards to their general "design" platform, in particular with respect to their respiratory and circulatory systems. However, because they fly, they may share in common several traits, namely those associated with the control and regulatory mechanisms governing thermogenesis. High core temperatures are essential for animal flight irrespective of the taxa they belong to. Birds and insects have thus evolved mechanisms which allowed them to control and regulate high rates of heat fluxes. This article discusses possible convergent thermogenic control and regulatory mechanisms associated with flight in insects and birds.

  3. Regulatory mechanisms of immune tolerance in type 1 diabetes and their failures.

    PubMed

    Kuhn, Chantal; Besançon, Alix; Lemoine, Sébastien; You, Sylvaine; Marquet, Cindy; Candon, Sophie; Chatenoud, Lucienne

    2016-07-01

    In this brief review we propose to discuss salient data showing the importance of immune regulatory mechanisms, and in particular of Treg, for the control of pathogenic anti-β-cell response in autoimmune diabetes. Disease progression that culminates with the massive destruction of insulin-secreting β-cells and advent of hyperglycemia and glycosuria tightly correlates with a functional deficit in immune regulation. Better dissection of the cellular and molecular mechanisms through which the immune system normally sustains tolerance to "self", and which become defective when autoimmune aggression is overt, is the only direct and robust way to learn how to harness these effectively, so as to restore immune tolerance in patients with insulin-dependent type 1 diabetes. No doubt that regulatory T cells are a privileged mechanism underlying this self-tolerance in the periphery. The discovery of the key role of the transcription factor FoxP3, represented the cornerstone leading to the great advances in the field we are witnessing today. Type 1 diabetes is certainly one of the prototypic T cell-mediated autoimmune diseases where immune regulatory mechanisms relying on specialized subsets of T cells have been the most thoroughly analyzed from the fundamental point of view and also largely exploited in a translational therapeutic perspective. PMID:27216249

  4. Identification of genes involved in regulatory mechanism of pigments in broiler chickens.

    PubMed

    Tarique, T M; Yang, S; Mohsina, Z; Qiu, J; Yan, Z; Chen, G; Chen, A

    2014-01-01

    Chicken is an important model organism that unites the evolutionary gap between mammals and other vertebrates and provide major source of protein from meat and eggs for all over the world population. However, specific genes underlying the regulatory mechanism of broiler pigmentation have not yet been determined. In order to better understand the genes involved in the mechanism of pigmentation in the muscle tissues of broilers, the Affymetrix microarray hybridization experiment platform was used to identify gene expression profiles at 7 weeks of age. Broilers fed canthaxanthin, natural lutein, and orangeII pigments (100 mg/kg) were used to explore gene expression profiles). Our data showed that the 7th week of age was a very important phase with regard to gene expression profiles. We identified a number of differentially expressed genes; in canthaxanthin, natural lutein, and orangeII, there were 54 (32 upregulated and 22 downregulated), 23 (15 upregulated and 8 downregulated), and 7 (5 upregulated and 2 downregulated) known genes, respectively. Our data indicate that the numbers of differentially expressed genes were more upregulated than downregulated, and several genes showed conserved signaling to previously known functions. Thus, functional characterization of differentially expressed genes revealed several categories that are involved in important biological processes, including pigmentation, growth, molecular mechanisms, fat metabolism, cell proliferation, immune response, lipid metabolism, and protein synthesis and degradation. The results of the present study demonstrate that the genes associated with canthaxanthin, natural lutein, and orangeII are key regulatory genes that control the regulatory mechanisms of pigmentation.

  5. Regulatory mechanisms of immune tolerance in type 1 diabetes and their failures.

    PubMed

    Kuhn, Chantal; Besançon, Alix; Lemoine, Sébastien; You, Sylvaine; Marquet, Cindy; Candon, Sophie; Chatenoud, Lucienne

    2016-07-01

    In this brief review we propose to discuss salient data showing the importance of immune regulatory mechanisms, and in particular of Treg, for the control of pathogenic anti-β-cell response in autoimmune diabetes. Disease progression that culminates with the massive destruction of insulin-secreting β-cells and advent of hyperglycemia and glycosuria tightly correlates with a functional deficit in immune regulation. Better dissection of the cellular and molecular mechanisms through which the immune system normally sustains tolerance to "self", and which become defective when autoimmune aggression is overt, is the only direct and robust way to learn how to harness these effectively, so as to restore immune tolerance in patients with insulin-dependent type 1 diabetes. No doubt that regulatory T cells are a privileged mechanism underlying this self-tolerance in the periphery. The discovery of the key role of the transcription factor FoxP3, represented the cornerstone leading to the great advances in the field we are witnessing today. Type 1 diabetes is certainly one of the prototypic T cell-mediated autoimmune diseases where immune regulatory mechanisms relying on specialized subsets of T cells have been the most thoroughly analyzed from the fundamental point of view and also largely exploited in a translational therapeutic perspective.

  6. Structural Instability Tuning as a Regulatory Mechanism in Protein-Protein Interactions

    PubMed Central

    Chen, Li; Balabanidou, Vassilia; Remeta, David P.; Minetti, Conceição A.S.A.; Portaliou, Athina G.; Economou, Anastassios; Kalodimos, Charalampos G.

    2011-01-01

    SUMMARY Protein-protein interactions mediate a vast number of cellular processes. Here we present a regulatory mechanism in protein-protein interactions mediated by finely-tuned structural instability coupled with molecular mimicry. We show that a set of type III secretion (TTS) autoinhibited homodimeric chaperones adopt a molten-globule-like state that transiently exposes the substrate binding site as a means to become rapidly poised for binding to their cognate protein substrates. Packing defects at the homodimeric interface stimulate binding whereas correction of these defects results in less labile chaperones that give rise to non-functional biological systems. The protein substrates use structural mimicry to offset the “weak spots” in the chaperones and to counteract their autoinhibitory conformation. This regulatory mechanism of protein activity is evolutionary conserved among several TSS systems and presents a lucid example of functional advantage conferred upon a biological system by finely-tuned structural instability. PMID:22152477

  7. Diversity of regulatory mechanisms of photosynthetic carbon metabolism in plants and algae.

    PubMed

    Tamoi, Masahiro; Shigeoka, Shigeru

    2015-01-01

    To clarify the regulatory mechanisms of the Calvin cycle in algae, we analyzed the molecular properties of the enzymes involved in this cycle. We demonstrated that these enzymes were not regulated by redox modulation through the ferredoxin/thioredoxin system under light/dark conditions and were not sensitive to treatments with hydrogen peroxide in vitro, unlike the chloroplastic thiol-modulated enzymes of plants. On the other hand, we found that cyanobacteria possessed a unique enzyme involved in the Calvin cycle. The CP12 protein played an important role in regulating carbon metabolism in the Calvin cycle in cyanobacteria and eukaryotic algae. This review described the regulatory mechanisms of the Calvin cycle in algae and also the effects of alterations to photosynthetic carbon metabolism on plant productivity, carbon partitioning, and the carbon/nitrogen balance using transgenic plants expressing algal genes.

  8. CHOOSING A CHEMICAL MECHANISM FOR REGULATORY AND RESEARCH AIR QUALITY MODELING APPLICATIONS

    EPA Science Inventory

    There are numerous, different chemical mechanisms currently available for use in air quality models, and new mechanisms and versions of mechanisms are continually being developed. The development of Morphecule-type mechanisms will add a near-infinite number of additional mecha...

  9. A qrr noncoding RNA deploys four different regulatory mechanisms to optimize quorum-sensing dynamics.

    PubMed

    Feng, Lihui; Rutherford, Steven T; Papenfort, Kai; Bagert, John D; van Kessel, Julia C; Tirrell, David A; Wingreen, Ned S; Bassler, Bonnie L

    2015-01-15

    Quorum sensing is a cell-cell communication process that bacteria use to transition between individual and social lifestyles. In vibrios, homologous small RNAs called the Qrr sRNAs function at the center of quorum-sensing pathways. The Qrr sRNAs regulate multiple mRNA targets including those encoding the quorum-sensing regulatory components luxR, luxO, luxM, and aphA. We show that a representative Qrr, Qrr3, uses four distinct mechanisms to control its particular targets: the Qrr3 sRNA represses luxR through catalytic degradation, represses luxM through coupled degradation, represses luxO through sequestration, and activates aphA by revealing the ribosome binding site while the sRNA itself is degraded. Qrr3 forms different base-pairing interactions with each mRNA target, and the particular pairing strategy determines which regulatory mechanism occurs. Combined mathematical modeling and experiments show that the specific Qrr regulatory mechanism employed governs the potency, dynamics, and competition of target mRNA regulation, which in turn, defines the overall quorum-sensing response.

  10. Acute inflammation in peritoneal dialysis: experimental studies in rats. Characterization of regulatory mechanisms.

    PubMed

    Bazargani, Farhan

    2005-01-01

    The predominant problems associated with peritoneal dialysis (PD) are ultrafiltration failure and peritonitis. PD maintains a state of intraperitoneal inflammation that affects the structure and function of the peritoneal membrane, potentially impairing ultrafiltration efficiency. Paradoxically, some PD fluids also have anti-inflammatory properties that may compromise the immune defense against peritonitis. This anti-inflammatory feature is mostly due to the glucose degradation products (GDPs), formed during heat-sterilization and storage of PD fluids. The main purpose of the present thesis was to study regulatory mechanisms behind the acute intraperitoneal inflammatory response in PD in the presence and absence of experimental peritonitis. Rats were exposed to a single dose of heat- or filter sterilized PD fluids either as an i.p. injection or as an infusion through an indwelling catheter, with or without supplementations, or pretreatment of the animals. The dwell fluid was analyzed zero, two and four hours later concerning activation of the complement and coagulation cascades, neutrophil recruitment and respiratory burst, ultrafiltration volumes, cytokine-induced neutrophil chemoattractant (CINC-1), rat mast cell protease 2 (RMCP-2), glucose, urea and histamine concentrations and ex vivo/in vitro intraperitoneal chemotactic activity. Exposure to filter sterilized PD fluid alone induced intraperitoneal complement activation and coagulation, neutrophil recruitment and increased the levels of CINC-1 during the dwell. Intraperitoneal concentrations of the mast cell markers histamine and RMCP-2 changed little during the dwells and did not indicate mast cell activation. Low molecular weight heparin (LMWH) and C5 blockade improved ultrafiltration. Pretreatment with cobra venom factor, known decomplementing agent, blocked the CINC-1 release and the neutrophil recruitment and improved ultrafiltration. In combination with experimental peritonitis, heat sterilized PD fluid

  11. Regulatory mechanisms underlying sepsis progression in patients with tumor necrosis factor-α genetic variations

    PubMed Central

    LIU, YANGZHOU; HAN, NING; LI, QINCHUAN; LI, ZENGCHUN

    2016-01-01

    The present study aimed to investigate the regulatory mechanisms underlying sepsis progression in patients with tumor necrosis factor (TNF)-α genetic variations. The GSE5760 expression profile data, which was downloaded from the Gene Expression Omnibus database, contained 30 wild-type (WT) and 28 mutation (MUT) samples. Differentially expressed genes (DEGs) between the two types of samples were identified using the Student's t-test, and the corresponding microRNAs (miRNAs) were screened using WebGestalt software. An integrated miRNA-DEG network was constructed using the Cytoscape software, based on the interactions between the DEGs, as identified using the Search Tool for the Retrieval of Interacting Genes/Proteins database, and the correlation between miRNAs and their target genes. Furthermore, Gene Ontology and pathway enrichment analyses were conducted for the DEGs using the Database for Annotation, Visualization and Integrated Discovery and the KEGG Orthology Based Annotation System, respectively. A total of 390 DEGS between the WT and MUT samples, along with 11 -associated miRNAs, were identified. The integrated miRNA-DEG network consisted of 38 DEGs and 11 miRNAs. Within this network, COPS2 was found to be associated with transcriptional functions, while FUS was found to be involved in mRNA metabolic processes. Other DEGs, including FBXW7 and CUL3, were enriched in the ubiquitin-mediated proteolysis pathway. In addition, miR-15 was predicted to target COPS2 and CUL3. The results of the present study suggested that COPS2, FUS, FBXW7 and CUL3 may be associated with sepsis in patients with TNF-α genetic variations. In the progression of sepsis, FBXW7 and CUL3 may participate in the ubiquitin-mediated proteolysis pathway, whereas COPS2 may regulate the phosphorylation and ubiquitination of the FUS protein. Furthermore, COPS2 and CUL3 may be novel targets of miR-15. PMID:27347057

  12. Nitrous Oxide Metabolism in Nitrate-Reducing Bacteria: Physiology and Regulatory Mechanisms.

    PubMed

    Torres, M J; Simon, J; Rowley, G; Bedmar, E J; Richardson, D J; Gates, A J; Delgado, M J

    2016-01-01

    Nitrous oxide (N2O) is an important greenhouse gas (GHG) with substantial global warming potential and also contributes to ozone depletion through photochemical nitric oxide (NO) production in the stratosphere. The negative effects of N2O on climate and stratospheric ozone make N2O mitigation an international challenge. More than 60% of global N2O emissions are emitted from agricultural soils mainly due to the application of synthetic nitrogen-containing fertilizers. Thus, mitigation strategies must be developed which increase (or at least do not negatively impact) on agricultural efficiency whilst decrease the levels of N2O released. This aim is particularly important in the context of the ever expanding population and subsequent increased burden on the food chain. More than two-thirds of N2O emissions from soils can be attributed to bacterial and fungal denitrification and nitrification processes. In ammonia-oxidizing bacteria, N2O is formed through the oxidation of hydroxylamine to nitrite. In denitrifiers, nitrate is reduced to N2 via nitrite, NO and N2O production. In addition to denitrification, respiratory nitrate ammonification (also termed dissimilatory nitrate reduction to ammonium) is another important nitrate-reducing mechanism in soil, responsible for the loss of nitrate and production of N2O from reduction of NO that is formed as a by-product of the reduction process. This review will synthesize our current understanding of the environmental, regulatory and biochemical control of N2O emissions by nitrate-reducing bacteria and point to new solutions for agricultural GHG mitigation. PMID:27134026

  13. Regulatory T Cells in Autoimmune Diabetes: Mechanisms of Action and Translational Potential.

    PubMed

    Ovcinnikovs, Vitalijs; Walker, Lucy S K

    2015-01-01

    Since the discovery of specialized T cells with regulatory function, harnessing the power of these cells to ameliorate autoimmunity has been a major goal. Here we collate the evidence that regulatory T cells (Treg) can inhibit Type 1 diabetes in animal models and humans. We discuss the anatomical sites and molecular mechanisms of Treg suppressive function in the Type 1 diabetes setting, citing evidence that Treg can function in both the pancreatic lymph nodes and within the pancreatic lesion. Involvement of the CTLA-4 pathway, as well as TGF-β and IL-2 deprivation will be considered. Finally, we summarize current efforts to manipulate Treg therapeutically in individuals with Type 1 diabetes. The translation of this research area from bench to bedside is still in its infancy, but the remarkable therapeutic potential of successfully manipulating Treg populations is clear to see. PMID:26615100

  14. Latent Tuberculosis: Models, Computational Efforts and the Pathogen’s Regulatory Mechanisms during Dormancy

    PubMed Central

    Magombedze, Gesham; Dowdy, David; Mulder, Nicola

    2013-01-01

    Latent tuberculosis is a clinical syndrome that occurs after an individual has been exposed to the Mycobacterium tuberculosis (Mtb) Bacillus, the infection has been established and an immune response has been generated to control the pathogen and force it into a quiescent state. Mtb can exit this quiescent state where it is unresponsive to treatment and elusive to the immune response, and enter a rapid replicating state, hence causing infection reactivation. It remains a gray area to understand how the pathogen causes a persistent infection and it is unclear whether the organism will be in a slow replicating state or a dormant non-replicating state. The ability of the pathogen to adapt to changing host immune response mechanisms, in which it is exposed to hypoxia, low pH, nitric oxide (NO), nutrient starvation, and several other anti-microbial effectors, is associated with a high metabolic plasticity that enables it to metabolize under these different conditions. Adaptive gene regulatory mechanisms are thought to coordinate how the pathogen changes their metabolic pathways through mechanisms that sense changes in oxygen tension and other stress factors, hence stimulating the pathogen to make necessary adjustments to ensure survival. Here, we review studies that give insights into latency/dormancy regulatory mechanisms that enable infection persistence and pathogen adaptation to different stress conditions. We highlight what mathematical and computational models can do and what they should do to enhance our current understanding of TB latency. PMID:25023946

  15. Functional Genomic Insights into Regulatory Mechanisms of High-Altitude Adaptation.

    PubMed

    Storz, Jay F; Cheviron, Zachary A

    2016-01-01

    Recent studies of indigenous human populations at high altitude have provided proof-of-principle that genome scans of DNA polymorphism can be used to identify candidate loci for hypoxia adaptation. When integrated with experimental analyses of physiological phenotypes, genome-wide surveys of DNA polymorphism and tissue-specific transcriptional profiles can provide insights into actual mechanisms of adaptation. It has been suggested that adaptive phenotypic evolution is largely mediated by cis-regulatory changes in genes that are located at integrative control points in regulatory networks. This hypothesis can be tested by conducting transcriptomic analyses of hypoxic signaling pathways in conjunction with experimental measures of vascular oxygen supply and metabolic pathway flux. Such studies may reveal whether the architecture of gene regulatory networks can be used to predict which loci (and which types of loci) are likely to be "hot spots" for adaptive physiological evolution. Functional genomic studies of deer mice (Peromyscus maniculatus) demonstrate how the integrated analysis of variation in tissue-specific transcriptomes, whole-animal physiological performance, and various subordinate traits can yield insights into the mechanistic underpinnings of high-altitude adaptation. PMID:27343092

  16. Integrative functional genomics identifies regulatory mechanisms at coronary artery disease loci

    PubMed Central

    Miller, Clint L.; Pjanic, Milos; Wang, Ting; Nguyen, Trieu; Cohain, Ariella; Lee, Jonathan D.; Perisic, Ljubica; Hedin, Ulf; Kundu, Ramendra K.; Majmudar, Deshna; Kim, Juyong B.; Wang, Oliver; Betsholtz, Christer; Ruusalepp, Arno; Franzén, Oscar; Assimes, Themistocles L.; Montgomery, Stephen B.; Schadt, Eric E.; Björkegren, Johan L.M.; Quertermous, Thomas

    2016-01-01

    Coronary artery disease (CAD) is the leading cause of mortality and morbidity, driven by both genetic and environmental risk factors. Meta-analyses of genome-wide association studies have identified >150 loci associated with CAD and myocardial infarction susceptibility in humans. A majority of these variants reside in non-coding regions and are co-inherited with hundreds of candidate regulatory variants, presenting a challenge to elucidate their functions. Herein, we use integrative genomic, epigenomic and transcriptomic profiling of perturbed human coronary artery smooth muscle cells and tissues to begin to identify causal regulatory variation and mechanisms responsible for CAD associations. Using these genome-wide maps, we prioritize 64 candidate variants and perform allele-specific binding and expression analyses at seven top candidate loci: 9p21.3, SMAD3, PDGFD, IL6R, BMP1, CCDC97/TGFB1 and LMOD1. We validate our findings in expression quantitative trait loci cohorts, which together reveal new links between CAD associations and regulatory function in the appropriate disease context. PMID:27386823

  17. Integrative functional genomics identifies regulatory mechanisms at coronary artery disease loci.

    PubMed

    Miller, Clint L; Pjanic, Milos; Wang, Ting; Nguyen, Trieu; Cohain, Ariella; Lee, Jonathan D; Perisic, Ljubica; Hedin, Ulf; Kundu, Ramendra K; Majmudar, Deshna; Kim, Juyong B; Wang, Oliver; Betsholtz, Christer; Ruusalepp, Arno; Franzén, Oscar; Assimes, Themistocles L; Montgomery, Stephen B; Schadt, Eric E; Björkegren, Johan L M; Quertermous, Thomas

    2016-01-01

    Coronary artery disease (CAD) is the leading cause of mortality and morbidity, driven by both genetic and environmental risk factors. Meta-analyses of genome-wide association studies have identified >150 loci associated with CAD and myocardial infarction susceptibility in humans. A majority of these variants reside in non-coding regions and are co-inherited with hundreds of candidate regulatory variants, presenting a challenge to elucidate their functions. Herein, we use integrative genomic, epigenomic and transcriptomic profiling of perturbed human coronary artery smooth muscle cells and tissues to begin to identify causal regulatory variation and mechanisms responsible for CAD associations. Using these genome-wide maps, we prioritize 64 candidate variants and perform allele-specific binding and expression analyses at seven top candidate loci: 9p21.3, SMAD3, PDGFD, IL6R, BMP1, CCDC97/TGFB1 and LMOD1. We validate our findings in expression quantitative trait loci cohorts, which together reveal new links between CAD associations and regulatory function in the appropriate disease context. PMID:27386823

  18. Regulatory role of collagen V in establishing mechanical properties of tendons and ligaments is tissue dependent.

    PubMed

    Connizzo, Brianne K; Freedman, Benjamin R; Fried, Joanna H; Sun, Mei; Birk, David E; Soslowsky, Louis J

    2015-06-01

    Patients with classic (type I) Ehlers-Danlos syndrome (EDS), characterized by heterozygous mutations in the Col5a1 and Col5a2 genes, exhibit connective tissue hyperelasticity and recurrent joint dislocations, indicating a potential regulatory role for collagen V in joint stabilizing soft tissues. This study asked whether the contribution of collagen V to the establishment of mechanical properties is tissue dependent. We mechanically tested four different tissues from wild type and targeted collagen V-null mice: the flexor digitorum longus (FDL) tendon, Achilles tendon (ACH), the anterior cruciate ligament (ACL), and the supraspinatus tendon (SST). Area was significantly reduced in the Col5a1(ΔTen/ΔTen) group in the FDL, ACH, and SST. Maximum load and stiffness were reduced in the Col5a1(ΔTen/ΔTen) group for all tissues. However, insertion site and midsubstance modulus were reduced only for the ACL and SST. This study provides evidence that the regulatory role of collagen V in extracellular matrix assembly is tissue dependent and that joint instability in classic EDS may be caused in part by insufficient mechanical properties of the tendons and ligaments surrounding each joint. PMID:25876927

  19. Biosafety, biosecurity and internationally mandated regulatory regimes: compliance mechanisms for education and global health security

    PubMed Central

    Sture, Judi; Whitby, Simon; Perkins, Dana

    2015-01-01

    This paper highlights the biosafety and biosecurity training obligations that three international regulatory regimes place upon states parties. The duty to report upon the existence of such provisions as evidence of compliance is discussed in relation to each regime. We argue that such mechanisms can be regarded as building blocks for the development and delivery of complementary biosafety and biosecurity teaching and training materials. We show that such building blocks represent foundations upon which life and associated scientists – through greater awareness of biosecurity concerns – can better fulfil their responsibilities to guard their work from misuse in the future. PMID:24494580

  20. Regulatory Mechanisms of the Molecular Pathways in Fibrosis Induced by MicroRNAs

    PubMed Central

    Yang, Cui; Zheng, Si-Dao; Wu, Hong-Jin; Chen, Shao-Jun

    2016-01-01

    Objective: MicroRNAs (miRNAs or miRs) play critical roles in the fibrotic process in different organs. We summarized the latest research progress on the roles and mechanisms of miRNAs in the regulation of the molecular signaling pathways involved in fibrosis. Data Sources: Papers published in English from January 2010 to August 2015 were selected from the PubMed and Web of Science databases using the search terms “microRNA”, “miR”, “transforming growth factor β”, “tgf β”, “mitogen-activated protein kinase”, “mapk”, “integrin”, “p38”, “c-Jun NH2-terminal kinase”, “jnk”, “extracellular signal-regulated kinase”, “erk”, and “fibrosis”. Study Selection: Articles were obtained and reviewed to analyze the regulatory effects of miRNAs on molecular signaling pathways involved in the fibrosis. Results: Recent evidence has shown that miRNAs are involved in regulating fibrosis by targeting different substrates in the molecular processes that drive fibrosis, such as immune cell sensitization, effector cell activation, and extracellular matrix remodeling. Moreover, several important molecular signaling pathways involve in fibrosis, such as the transforming growth factor-beta (TGF-β) pathway, mitogen-activated protein kinase (MAPK) pathways, and the integrin pathway are regulated by miRNAs. Third, regulation of the fibrotic pathways induced by miRNAs is found in many other tissues in addition to the heart, lung, liver, and kidney. Interestingly, the actions of many drugs on the human body are also induced by miRNAs. It is encouraging that the fibrotic process can be blocked or reversed by targeting specific miRNAs and their signaling pathways, thereby protecting the structures and functions of different organs. Conclusions: miRNAs not only regulate molecular signaling pathways in fibrosis but also serve as potential targets of novel therapeutic interventions for fibrosing diseases. PMID:27647197

  1. Identification and characterization of the novel Col10a1 regulatory mechanism during chondrocyte hypertrophic differentiation

    PubMed Central

    Gu, J; Lu, Y; Li, F; Qiao, L; Wang, Q; Li, N; Borgia, J A; Deng, Y; Lei, G; Zheng, Q

    2014-01-01

    hypertrophic MCT cells. Electrophoretic mobility shift assay and chromatin immunoprecipitation assays confirmed the interaction between Cox-2 and Col10a1 cis-enhancer, supporting its role as a candidate Col10a1 regulator. Together, our data support a Cox-2-containing, Runx2-centered Col10a1 regulatory mechanism, during chondrocyte hypertrophic differentiation. PMID:25321476

  2. Transancestral fine-mapping of four type 2 diabetes susceptibility loci highlights potential causal regulatory mechanisms

    PubMed Central

    Horikoshi, Momoko; Pasquali, Lorenzo; Wiltshire, Steven; Huyghe, Jeroen R.; Mahajan, Anubha; Asimit, Jennifer L.; Ferreira, Teresa; Locke, Adam E.; Robertson, Neil R.; Wang, Xu; Sim, Xueling; Fujita, Hayato; Hara, Kazuo; Young, Robin; Zhang, Weihua; Choi, Sungkyoung; Chen, Han; Kaur, Ismeet; Takeuchi, Fumihiko; Fontanillas, Pierre; Thuillier, Dorothée; Yengo, Loic; Below, Jennifer E.; Tam, Claudia H.T.; Wu, Ying; Abecasis, Gonçalo; Altshuler, David; Bell, Graeme I.; Blangero, John; Burtt, Noél P.; Duggirala, Ravindranath; Florez, Jose C.; Hanis, Craig L.; Seielstad, Mark; Atzmon, Gil; Chan, Juliana C.N.; Ma, Ronald C.W.; Froguel, Philippe; Wilson, James G.; Bharadwaj, Dwaipayan; Dupuis, Josee; Meigs, James B.; Cho, Yoon Shin; Park, Taesung; Kooner, Jaspal S.; Chambers, John C.; Saleheen, Danish; Kadowaki, Takashi; Tai, E. Shyong; Mohlke, Karen L.; Cox, Nancy J.; Ferrer, Jorge; Zeggini, Eleftheria; Kato, Norihiro; Teo, Yik Ying; Boehnke, Michael; McCarthy, Mark I.; Morris, Andrew P.

    2016-01-01

    To gain insight into potential regulatory mechanisms through which the effects of variants at four established type 2 diabetes (T2D) susceptibility loci (CDKAL1, CDKN2A-B, IGF2BP2 and KCNQ1) are mediated, we undertook transancestral fine-mapping in 22 086 cases and 42 539 controls of East Asian, European, South Asian, African American and Mexican American descent. Through high-density imputation and conditional analyses, we identified seven distinct association signals at these four loci, each with allelic effects on T2D susceptibility that were homogenous across ancestry groups. By leveraging differences in the structure of linkage disequilibrium between diverse populations, and increased sample size, we localised the variants most likely to drive each distinct association signal. We demonstrated that integration of these genetic fine-mapping data with genomic annotation can highlight potential causal regulatory elements in T2D-relevant tissues. These analyses provide insight into the mechanisms through which T2D association signals are mediated, and suggest future routes to understanding the biology of specific disease susceptibility loci. PMID:26911676

  3. Deletional and regulatory mechanisms coalesce to drive transplantation tolerance through mixed chimerism.

    PubMed

    Hock, Karin; Mahr, Benedikt; Schwarz, Christoph; Wekerle, Thomas

    2015-09-01

    Establishing donor-specific immunological tolerance could improve long-term outcome by obviating the need for immunosuppressive drug therapy, which is currently required to control alloreactivity after organ transplantation. Mixed chimerism is defined as the engraftment of donor hematopoietic stem cells in the recipient, leading to viable coexistence of both donor and recipient leukocytes. In numerous experimental models, cotransplantation of donor bone marrow (BM) into preconditioned (e.g., through irradiation or cytotoxic drugs) recipients leads to transplantation tolerance through (mixed) chimerism. Mixed chimerism offers immunological advantages for clinical translation; pilot trials have established proof of concept by deliberately inducing tolerance in humans. Widespread clinical application is prevented, however, by the harsh preconditioning currently necessary for permitting BM engraftment. Recently, the immunological mechanisms inducing and maintaining tolerance in experimental mixed chimerism have been defined, revealing a more prominent role for regulation than historically assumed. The evidence from murine models suggests that both deletional and regulatory mechanisms are critical in promoting complete tolerance, encompassing also the minor histocompatibility antigens. Here, we review the current understanding of tolerance through mixed chimerism and provide an outlook on how to realize widespread clinical translation based on mechanistic insights gained from chimerism protocols, including cell therapy with polyclonal regulatory T cells.

  4. Structure-based elucidation of the regulatory mechanism for aminopeptidase activity.

    PubMed

    Ta, Hai Minh; Bae, Sangsu; Han, Seungsu; Song, Jihyuck; Ahn, Tae Kyu; Hohng, Sungchul; Lee, Sangho; Kim, Kyeong Kyu

    2013-09-01

    The specificity of proteases for the residues in and length of substrates is key to understanding their regulatory mechanism, but little is known about length selectivity. Crystal structure analyses of the bacterial aminopeptidase PepS, combined with functional and single-molecule FRET assays, have elucidated a molecular basis for length selectivity. PepS exists in open and closed conformations. Substrates can access the binding hole in the open conformation, but catalytic competency is only achieved in the closed conformation by formation of the S1 binding pocket and proximal movement of Glu343, a general base, to the cleavage site. Hence, peptides longer than the depth of the binding hole block the transition from the open to the closed conformation, and thus length selection is a prerequisite for catalytic activation. A triple-sieve interlock mechanism is proposed featuring the coupling of length selectivity with residue specificity and active-site positioning.

  5. Transcription factor abundance controlled by an auto-regulatory mechanism involving a transcription start site switch

    PubMed Central

    Ngondo, Richard Patryk; Carbon, Philippe

    2014-01-01

    A transcriptional feedback loop is the simplest and most direct means for a transcription factor to provide an increased stability of gene expression. In this work performed in human cells, we reveal a new negative auto-regulatory mechanism involving an alternative transcription start site (TSS) usage. Using the activating transcription factor ZNF143 as a model, we show that the ZNF143 low-affinity binding sites, located downstream of its canonical TSS, play the role of protein sensors to induce the up- or down-regulation of ZNF143 gene expression. We uncovered that the TSS switch that mediates this regulation implies the differential expression of two transcripts with an opposite protein production ability due to their different 5′ untranslated regions. Moreover, our analysis of the ENCODE data suggests that this mechanism could be used by other transcription factors to rapidly respond to their own aberrant expression level. PMID:24234445

  6. An atlas of gene regulatory networks reveals multiple three-gene mechanisms for interpreting morphogen gradients

    PubMed Central

    Cotterell, James; Sharpe, James

    2010-01-01

    The interpretation of morphogen gradients is a pivotal concept in developmental biology, and several mechanisms have been proposed to explain how gene regulatory networks (GRNs) achieve concentration-dependent responses. However, the number of different mechanisms that may exist for cells to interpret morphogens, and the importance of design features such as feedback or local cell–cell communication, is unclear. A complete understanding of such systems will require going beyond a case-by-case analysis of real morphogen interpretation mechanisms and mapping out a complete GRN ‘design space.' Here, we generate a first atlas of design space for GRNs capable of patterning a homogeneous field of cells into discrete gene expression domains by interpreting a fixed morphogen gradient. We uncover multiple very distinct mechanisms distributed discretely across the atlas, thereby expanding the repertoire of morphogen interpretation network motifs. Analyzing this diverse collection of mechanisms also allows us to predict that local cell–cell communication will rarely be responsible for the basic dose-dependent response of morphogen interpretation networks. PMID:21045819

  7. Putting theory to the test: which regulatory mechanisms can drive realistic growth of a root?

    PubMed

    De Vos, Dirk; Vissenberg, Kris; Broeckhove, Jan; Beemster, Gerrit T S

    2014-10-01

    In recent years there has been a strong development of computational approaches to mechanistically understand organ growth regulation in plants. In this study, simulation methods were used to explore which regulatory mechanisms can lead to realistic output at the cell and whole organ scale and which other possibilities must be discarded as they result in cellular patterns and kinematic characteristics that are not consistent with experimental observations for the Arabidopsis thaliana primary root. To aid in this analysis, a 'Uniform Longitudinal Strain Rule' (ULSR) was formulated as a necessary condition for stable, unidirectional, symplastic growth. Our simulations indicate that symplastic structures are robust to differences in longitudinal strain rates along the growth axis only if these differences are small and short-lived. Whereas simple cell-autonomous regulatory rules based on counters and timers can produce stable growth, it was found that steady developmental zones and smooth transitions in cell lengths are not feasible. By introducing spatial cues into growth regulation, those inadequacies could be avoided and experimental data could be faithfully reproduced. Nevertheless, a root growth model based on previous polar auxin-transport mechanisms violates the proposed ULSR due to the presence of lateral gradients. Models with layer-specific regulation or layer-driven growth offer potential solutions. Alternatively, a model representing the known cross-talk between auxin, as the cell proliferation promoting factor, and cytokinin, as the cell differentiation promoting factor, predicts the effect of hormone-perturbations on meristem size. By down-regulating PIN-mediated transport through the transcription factor SHY2, cytokinin effectively flattens the lateral auxin gradient, at the basal boundary of the division zone, (thereby imposing the ULSR) to signal the exit of proliferation and start of elongation. This model exploration underlines the value of

  8. Visual- and Vestibular-Autonomic Influence on Short-Term Cardiovascular Regulatory Mechanisms

    NASA Technical Reports Server (NTRS)

    Mullen, Thomas J.; Ramsdell, Craig D.

    1999-01-01

    This synergy project was a one-year effort conducted cooperatively by members of the NSBRI Cardiovascular Alterations and Neurovestibular Adaptation Teams in collaboration with NASA Johnson Space Center (JSC) colleagues. The objective of this study was to evaluate visual autonomic interactions on short-term cardiovascular regulatory mechanisms. Based on established visual-vestibular and vestibular-autonomic shared neural pathways, we hypothesized that visually induced changes in orientation will trigger autonomic cardiovascular reflexes. A second objective was to compare baroreflex changes during postural changes as measured with the new Cardiovascular System Identification (CSI) technique with those measured using a neck barocuff. While the neck barocuff stimulates only the carotid baroreceptors, CSI provides a measure of overall baroreflex responsiveness. This study involved a repeated measures design with 16 healthy human subjects (8 M, 8 F) to examine cardiovascular regulatory responses during actual and virtual head-upright tilts. Baroreflex sensitivity was first evaluated with subjects in supine and upright positions during actual tilt-table testing using both neck barocuff and CSI methods. The responses to actual tilts during this first session were then compared to responses during visually induced tilt and/or rotation obtained during a second session.

  9. Reversible oxidation of vicinal-thiols motif in sarcoplasmic reticulum calcium regulatory proteins is involved in muscle fatigue mechanism.

    PubMed

    Vázquez, Pável; Tirado-Cortés, Aldo; Álvarez, Rocío; Ronjat, Michel; Amaya, Araceli; Ortega, Alicia

    2016-10-01

    The mechanism underlying fatigue in skeletal muscle (SM) related to the redox-potential hypothesis, ranges from a direct effect of oxygen reactive species, to a number of other free radical intermediates targeting specific amino acids in the Ca(2+)-regulatory proteins of the sarcoplasmic reticulum (SR). In the present study, we investigate the selective oxidation/reduction of the protein motif Cys-(Xn=2-6)-Cys, known as a vicinal thiol group (VTG), present in the SR Ca(2+)-ATPase (SERCA) and in the Ca(2+)-channel ryanodine receptor (RyR) which are modified during muscle fatigue in SM. Selective oxidation of VTG with phenyl arsine oxide (PAO) increases fatigue in rat isolated SM and fatigue is prevented when muscle is previously incubated with a VTG selective reducing agent, 2,3-dimercaptopropanol (British anti-Lewisite (BAL)). In isolated SR membranes, PAO [<0.1mM] modifies SERCA conformation and inhibits ATPase activity but does not affect Ca(2+)-release. However, PAO at [>0.1mM] inhibits SERCA and RyR activities in a reversible manner by selectively reducing them. Interestingly, as observed by differential scanning calorimetry, the conformation of SERCA from fatigued muscle changed in a similar manner as when SERCA VTG where oxidized. The addition of BAL to fatigued muscle restored the structural conformation and activity of SERCA with full recovery of muscle force production after fatigue. We conclude that VTG reversible oxidation of SR Ca(2+) regulatory proteins are involved in muscle contraction/relaxation and are a molecular mechanism to be considered for muscle fatigue.

  10. High commitment of embryonic keratinocytes to terminal differentiation through a Notch1-caspase 3 regulatory mechanism.

    PubMed

    Okuyama, Ryuhei; Nguyen, Bach-Cuc; Talora, Claudio; Ogawa, Eisaku; Tommasi di Vignano, Alice; Lioumi, Maria; Chiorino, Giovanna; Tagami, Hachiro; Woo, Minna; Dotto, G Paolo

    2004-04-01

    Embryonic cells are expected to possess high growth/differentiation potential, required for organ morphogenesis and expansion during development. However, little is known about the intrinsic properties of embryonic epithelial cells due to difficulties in their isolation and cultivation. We report here that pure keratinocyte populations from E15.5 mouse embryos commit irreversibly to differentiation much earlier than newborn cells. Notch signaling, which promotes keratinocyte differentiation, is upregulated in embryonic keratinocyte and epidermis, and elevated caspase 3 expression, which we identify as a transcriptional Notch1 target, accounts in part for the high commitment of embryonic keratinocytes to terminal differentiation. In vivo, lack of caspase 3 results in increased proliferation and decreased differentiation of interfollicular embryonic keratinocytes, together with decreased activation of PKC-delta, a caspase 3 substrate which functions as a positive regulator of keratinocyte differentiation. Thus, a Notch1-caspase 3 regulatory mechanism underlies the intrinsically high commitment of embryonic keratinocytes to terminal differentiation.

  11. Mechanistic Basis for Plant Responses to Drought Stress : Regulatory Mechanism of Abscisic Acid Signaling

    NASA Astrophysics Data System (ADS)

    Miyakawa, Takuya; Tanokura, Masaru

    The phytohormone abscisic acid (ABA) plays a key role in the rapid adaptation of plants to environmental stresses such as drought and high salinity. Accumulated ABA in plant cells promotes stomatal closure in guard cells and transcription of stress-tolerant genes. Our understanding of ABA responses dramatically improved by the discovery of both PYR/PYL/RCAR as a soluble ABA receptor and inhibitory complex of a protein phospatase PP2C and a protein kinase SnRK2. Moreover, several structural analyses of PYR/PYL/RCAR revealed the mechanistic basis for the regulatory mechanism of ABA signaling, which provides a rational framework for the design of alternative agonists in future.

  12. Evolution of chorion structural genes and regulatory mechanisms in two wild silkmoths: a preliminary analysis.

    PubMed

    Moschonas, N K; Thireos, G; Kafatos, F C

    1988-01-01

    We report a preliminary analysis of structural and regulatory evolution of the A and B chorion gene families in two wild silkmoths, Antheraea pernyi and Antheraea polyphemus. Homospecific and heterospecific dot hybridizations were performed between previously characterized A. polyphemus complementary DNA clones and total or stage-specific follicular mRNAs from the two species. The hybridization patterns indicated substantial interspecies changes in the abundance of corresponding mRNA sequences (heteroposic evolution) without substantial changes in their developmental specificities (heterochronic evolution). In addition, the proteins encoded in the two species by corresponding mRNAs were determined by hybrid-selected translation followed by electrophoretic analysis. The results suggested that the proteins evolve in size, presumably through internal deletions and duplications.

  13. The Emerging Role of Protein Phosphorylation as a Critical Regulatory Mechanism Controlling Cellulose Biosynthesis.

    PubMed

    Jones, Danielle M; Murray, Christian M; Ketelaar, KassaDee J; Thomas, Joseph J; Villalobos, Jose A; Wallace, Ian S

    2016-01-01

    Plant cell walls are extracellular matrices that surround plant cells and critically influence basic cellular processes, such as cell division and expansion. Cellulose is a major constituent of plant cell walls, and this paracrystalline polysaccharide is synthesized at the plasma membrane by a large protein complex known as the cellulose synthase complex (CSC). Recent efforts have identified numerous protein components of the CSC, but relatively little is known about regulation of cellulose biosynthesis. Numerous phosphoproteomic surveys have identified phosphorylation events in CSC associated proteins, suggesting that protein phosphorylation may represent an important regulatory control of CSC activity. In this review, we discuss the composition and dynamics of the CSC in vivo, the catalog of CSC phosphorylation sites that have been identified, the function of experimentally examined phosphorylation events, and potential kinases responsible for these phosphorylation events. Additionally, we discuss future directions in cellulose synthase kinase identification and functional analyses of CSC phosphorylation sites. PMID:27252710

  14. The Emerging Role of Protein Phosphorylation as a Critical Regulatory Mechanism Controlling Cellulose Biosynthesis

    PubMed Central

    Jones, Danielle M.; Murray, Christian M.; Ketelaar, KassaDee J.; Thomas, Joseph J.; Villalobos, Jose A.; Wallace, Ian S.

    2016-01-01

    Plant cell walls are extracellular matrices that surround plant cells and critically influence basic cellular processes, such as cell division and expansion. Cellulose is a major constituent of plant cell walls, and this paracrystalline polysaccharide is synthesized at the plasma membrane by a large protein complex known as the cellulose synthase complex (CSC). Recent efforts have identified numerous protein components of the CSC, but relatively little is known about regulation of cellulose biosynthesis. Numerous phosphoproteomic surveys have identified phosphorylation events in CSC associated proteins, suggesting that protein phosphorylation may represent an important regulatory control of CSC activity. In this review, we discuss the composition and dynamics of the CSC in vivo, the catalog of CSC phosphorylation sites that have been identified, the function of experimentally examined phosphorylation events, and potential kinases responsible for these phosphorylation events. Additionally, we discuss future directions in cellulose synthase kinase identification and functional analyses of CSC phosphorylation sites. PMID:27252710

  15. The regulatory mechanisms of myogenin expression in doxorubicin-treated rat cardiomyocytes

    PubMed Central

    Yen, Li-Chen; Huang, Chi-Jung; Lin, Wei-Shiang; Chan, James Yi-Hsin

    2015-01-01

    Doxorubicin, an anthracycline antibiotic, has been used as an anti-neoplastic drug for almost 60 years. However, the mechanism(s) by which anthracyclines cause irreversible myocardial injury remains unclear. In order to delineate possible molecular signals involved in the myocardial toxicity, we assessed candidate genes using mRNA expression profiling in the doxorubicin-treated rat cardiomyocyte H9c2 cell line. In the study, it was confirmed that myogenin, an important transcriptional factor for muscle terminal differentiation, was significantly reduced by doxorubicin in a dose-dependent manner using both RT-PCR and western blot analyses. Also, it was identified that the doxorubicin-reduced myogenin gene level could not be rescued by most cardio-protectants. Furthermore, it was demonstrated how the signaling of the decreased myogenin expression by doxorubicin was altered at the transcriptional, post-transcriptional and translational levels. Based on these findings, a working model was proposed for relieving doxorubicin-associated myocardial toxicity by down-regulating miR-328 expression and increasing voltage-gated calcium channel β1 expression, which is a repressor of myogenin gene regulation. In summary, this study provides several lines of evidence indicating that myogenin is the target for doxorubicin-induced cardio-toxicity and a novel therapeutic strategy for doxorubicin clinical applications based on the regulatory mechanisms of myogenin expression. PMID:26452256

  16. Heritability of symbiont density reveals distinct regulatory mechanisms in a tripartite symbiosis.

    PubMed

    Parkinson, Jasmine F; Gobin, Bruno; Hughes, William O H

    2016-04-01

    Beneficial eukaryotic-bacterial partnerships are integral to animal and plant evolution. Understanding the density regulation mechanisms behind bacterial symbiosis is essential to elucidating the functional balance between hosts and symbionts. Citrus mealybugs, Planococcus citri (Risso), present an excellent model system for investigating the mechanisms of symbiont density regulation. They contain two obligate nutritional symbionts, Moranella endobia, which resides inside Tremblaya princeps, which has been maternally transmitted for 100-200 million years. We investigate whether host genotype may influence symbiont density by crossing mealybugs from two inbred laboratory-reared populations that differ substantially in their symbiont density to create hybrids. The density of the M. endobia symbiont in the hybrid hosts matched that of the maternal parent population, in keeping with density being determined either by the symbiont or the maternal genotype. However, the density of the T. princeps symbiont was influenced by the paternal host genotype. The greater dependency of T. princeps on its host may be due to its highly reduced genome. The decoupling of T. princeps and M. endobia densities, in spite of their intimate association, suggests that distinct regulatory mechanisms can be at work in symbiotic partnerships, even when they are obligate and mutualistic. PMID:27099709

  17. Distinct regulatory mechanisms of eukaryotic transcriptional activation by SAGA and TFIID.

    PubMed

    Bhaumik, Sukesh R

    2011-02-01

    A growing number of human diseases are linked to abnormal gene expression which is largely controlled at the level of transcriptional initiation. The gene-specific activator promotes the initiation of transcription through its interaction with one or more components of the transcriptional initiation machinery, hence leading to stimulated transcriptional initiation or activation. However, all activator proteins do not target the same component(s) of the transcriptional initiation machinery. Rather, they can have different target specificities, and thus, can lead to distinct mechanisms of transcriptional activation. Two such distinct mechanisms of transcriptional activation in yeast are mediated by the SAGA (Spt-Ada-Gcn5-Acetyltransferase) and TFIID (Transcription factor IID) complexes, and are termed as "SAGA-dependent" and "TFIID-dependent" transcriptional activation, respectively. SAGA is the target of the activator in case of SAGA-dependent transcriptional activation, while the targeting of TFIID by the activator leads to TFIID-dependent transcriptional activation. Both the SAGA and TFIID complexes are highly conserved from yeast to human, and play crucial roles in gene activation among eukaryotes. The regulatory mechanisms of eukaryotic transcriptional activation by SAGA and TFIID are discussed here. This article is part of a Special Issue entitled The 26S Proteasome: When degradation is just not enough!

  18. Regulatory mechanisms that modulate signalling by G-protein-coupled receptors.

    PubMed Central

    Böhm, S K; Grady, E F; Bunnett, N W

    1997-01-01

    The large and functionally diverse group of G-protein-coupled receptors includes receptors for many different signalling molecules, including peptide and non-peptide hormones and neuro-transmitters, chemokines, prostanoids and proteinases. Their principal function is to transmit information about the extracellular environment to the interior of the cell by interacting with the heterotrimeric G-proteins, and they thereby participate in many aspects of regulation. Cellular responses to agonists of these receptors are usually rapidly attenuated. Mechanisms of signal attenuation include removal of agonists from the extracellular fluid, receptor desensitization, endocytosis and down-regulation. Agonists are removed by dilution, uptake by transporters and enzymic degradation. Receptor desensitization is mediated by receptor phosphorylation by G-protein receptor kinases and second-messenger kinases, interaction of phosphorylated receptors with arrestins and receptor uncoupling from G-proteins. Agonist-induced receptor endocytosis also contributes to desensitization by depleting the cell surface of high-affinity receptors, and recycling of internalized receptors contributes to resensitization of cellular responses. Receptor down-regulation is a form of desensitization that occurs during continuous, long-term exposure of cells to receptor agonists. Down-regulation, which may occur during the development of drug tolerance, is characterized by depletion of the cellular receptor content, and is probably mediated by alterations in the rates of receptor degradation and synthesis. These regulatory mechanisms are important, as they govern the ability of cells to respond to agonists. A greater understanding of the mechanisms that modulate signalling may lead to the development of new therapies and may help to explain the mechanism of drug tolerance. PMID:9078236

  19. Core level regulatory network of osteoblast as molecular mechanism for osteoporosis and treatment

    PubMed Central

    Zhu, Xiaomei; Li, Jun; Liang, Yuhong; Liu, Tao; Zhu, Yanxia; Zhang, Bingbing; Tan, Shuang; Guo, Huajie; Guan, Shuguang; Ao, Ping; Zhou, Guangqian

    2016-01-01

    To develop and evaluate the long-term prophylactic treatment for chronic diseases such as osteoporosis requires a clear view of mechanism at the molecular and systems level. While molecular signaling pathway studies for osteoporosis are extensive, a unifying mechanism is missing. In this work, we provide experimental and systems-biology evidences that a tightly connected top-level regulatory network may exist, which governs the normal and osteoporotic phenotypes of osteoblast. Specifically, we constructed a hub-like interaction network from well-documented cross-talks among estrogens, glucocorticoids, retinoic acids, peroxisome proliferator-activated receptor, vitamin D receptor and calcium-signaling pathways. The network was verified with transmission electron microscopy and gene expression profiling for bone tissues of ovariectomized (OVX) rats before and after strontium gluconate (GluSr) treatment. Based on both the network structure and the experimental data, the dynamical modeling predicts calcium and glucocorticoids signaling pathways as targets for GluSr treatment. Modeling results further reveal that in the context of missing estrogen signaling, the GluSr treated state may be an outcome that is closest to the healthy state. PMID:26783964

  20. A LINE-1-encoded reverse transcriptase-dependent regulatory mechanism is active in embryogenesis and tumorigenesis.

    PubMed

    Spadafora, Corrado

    2015-04-01

    LINE-1 (long interspersed nuclear elements) retrotransposons constitute a large family of retrotransposable elements, accounting for 17% of the human genome. They encode proteins required for their own mobilization, including a reverse transcriptase (RT) enzyme highly expressed in mouse embryos and mouse and human cancer cells and repressed in somatic differentiated healthy cells. We have found that reverse transcription takes place in early murine embryos, yielding an increase in LINE-1 copy number during preimplantation development, which also occurs in tumor progression. RT inhibition irreversibly arrests embryo development, reduces cancer cell proliferation, promotes differentiation, antagonizes tumor growth, and causes a global reprogramming of transcription profiles. These results strongly suggest that a previously unrecognized RT-dependent regulatory mechanism operates during preimplantation development, is repressed during differentiation to normal tissues, and, when erroneously reactivated in adult life, promotes cell transformation and cancer progression by "resurrecting" embryonic transcriptional pathways. The RT-dependent mechanism emerges as a major source of genetic and epigenetic changes with physiological, pathological, and evolutionary implications.

  1. Core level regulatory network of osteoblast as molecular mechanism for osteoporosis and treatment.

    PubMed

    Yuan, Ruoshi; Ma, Shengfei; Zhu, Xiaomei; Li, Jun; Liang, Yuhong; Liu, Tao; Zhu, Yanxia; Zhang, Bingbing; Tan, Shuang; Guo, Huajie; Guan, Shuguang; Ao, Ping; Zhou, Guangqian

    2016-01-26

    To develop and evaluate the long-term prophylactic treatment for chronic diseases such as osteoporosis requires a clear view of mechanism at the molecular and systems level. While molecular signaling pathway studies for osteoporosis are extensive, a unifying mechanism is missing. In this work, we provide experimental and systems-biology evidences that a tightly connected top-level regulatory network may exist, which governs the normal and osteoporotic phenotypes of osteoblast. Specifically, we constructed a hub-like interaction network from well-documented cross-talks among estrogens, glucocorticoids, retinoic acids, peroxisome proliferator-activated receptor, vitamin D receptor and calcium-signaling pathways. The network was verified with transmission electron microscopy and gene expression profiling for bone tissues of ovariectomized (OVX) rats before and after strontium gluconate (GluSr) treatment. Based on both the network structure and the experimental data, the dynamical modeling predicts calcium and glucocorticoids signaling pathways as targets for GluSr treatment. Modeling results further reveal that in the context of missing estrogen signaling, the GluSr treated state may be an outcome that is closest to the healthy state. PMID:26783964

  2. Up-regulation of miR-98 and unraveling regulatory mechanisms in gestational diabetes mellitus

    PubMed Central

    Cao, Jing-Li; Zhang, Lu; Li, Jian; Tian, Shi; Lv, Xiao-Dan; Wang, Xue-Qin; Su, Xing; Li, Ying; Hu, Yi; Ma, Xu; Xia, Hong-Fei

    2016-01-01

    MiR-98 expression was up-regulated in kidney in response to early diabetic nephropathy in mouse and down-regulated in muscle in type 2 diabetes in human. However, the expression prolife and functional role of miR-98 in human gestational diabetes mellitus (GDM) remained unclear. Here, we investigated its expression and function in placental tissues from GDM patients and the possible molecular mechanisms. The results showed that miR-98 was up-regulated in placentas from GDM patients compared with normal placentas. MiR-98 over-expression increased global DNA methylational level and miR-98 knockdown reduced global DNA methylational level. Further investigation revealed that miR-98 could inhibit Mecp2 expression by binding the 3′-untranslated region (UTR) of methyl CpG binding protein 2 (Mecp2), and then led to the expression dysregulation of canonical transient receptor potential 3 (Trpc3), a glucose uptake related gene. More importantly, in vivo analysis found that the expression level of Mecp2 and Trpc3 in placental tissues from GDM patients, relative to the increase of miR-98, was diminished, especially for GDM patients over the age of 35 years. Collectively, up-regulation of miR-98 in the placental tissues of human GDM is linked to the global DNA methylation via targeting Mecp2, which may imply a novel regulatory mechanism in GDM. PMID:27573367

  3. Improving Student Understanding of Addition of Angular Momentum in Quantum Mechanics

    ERIC Educational Resources Information Center

    Zhu, Guangtian; Singh, Chandralekha

    2013-01-01

    We describe the difficulties advanced undergraduate and graduate students have with concepts related to addition of angular momentum in quantum mechanics. We also describe the development and implementation of a research-based learning tool, Quantum Interactive Learning Tutorial (QuILT), to reduce these difficulties. The preliminary evaluation…

  4. Improvement of mechanical properties by additive assisted laser sintering of PEEK

    SciTech Connect

    Kroh, M. Bonten, C.; Eyerer, P.

    2014-05-15

    The additive assisted laser sintering was recently developed at IKT: A carbon black (CB) additive is used to adjust the polymer's laser absorption behavior with the aim to improve the interconnection of sintered powder layers. In this paper a parameter study, Polyetheretherketone (PEEK) samples were prepared with different contents of carbon black and were laser sintered with varying thermal treatment. The samples were mechanically tested and investigated by optical light and transmission electron microscopy. An influence on the morphology at the border areas of particles and intersections of laser sintered layers was found. Depending on the viscosity of the raw material and CB content, different shapes of lamellae were observed. These (trans-) crystalline or polymorph structures, respectively, influence the thermal and mechanical behavior of the virgin PEEK. Moreover, the thermal treatment during the sintering process caused an improvement of mechanical properties like tensile strength and elongation at break.

  5. Improvement of mechanical properties by additive assisted laser sintering of PEEK

    NASA Astrophysics Data System (ADS)

    Kroh, M.; Bonten, C.; Eyerer, P.

    2014-05-01

    The additive assisted laser sintering was recently developed at IKT: A carbon black (CB) additive is used to adjust the polymer's laser absorption behavior with the aim to improve the interconnection of sintered powder layers. In this paper a parameter study, Polyetheretherketone (PEEK) samples were prepared with different contents of carbon black and were laser sintered with varying thermal treatment. The samples were mechanically tested and investigated by optical light and transmission electron microscopy. An influence on the morphology at the border areas of particles and intersections of laser sintered layers was found. Depending on the viscosity of the raw material and CB content, different shapes of lamellae were observed. These (trans-) crystalline or polymorph structures, respectively, influence the thermal and mechanical behavior of the virgin PEEK. Moreover, the thermal treatment during the sintering process caused an improvement of mechanical properties like tensile strength and elongation at break.

  6. Control of hepatic nitrogen metabolism and glutathione release by cell volume regulatory mechanisms.

    PubMed

    Hüssinger, D; Lang, F; Bauers, K; Gerok, W

    1990-11-13

    1. Urea synthesis was studied in isolated perfused rat liver during cell volume regulatory ion fluxes following exposure of the liver to anisotonic perfusion media. Lowering of the osmolarity in influent perfusate from 305 mOsm/l to 225 mOsm/l (by decreasing influent [NaCl] by 40 mmol/l) led to an inhibition of urea synthesis from NH4Cl (0.5 mmol/l) by about 60% and a decrease of hepatic oxygen uptake by 0.43 +/- 0.03 mumol g-1 min-1 [from 3.09 +/- 0.13 mumol g-1 min-1 to 2.66 +/- 0.12 mumol g-1 min-1 (n = 9)]. The effects on urea synthesis and oxygen uptake were observed throughout hypotonic exposure (225 mOsm/l). They persisted although volume regulatory K+ efflux from the liver was complete within 8 min and were fully reversible upon reexposure to normotonic perfusion media (305 mOsm/l). A 42% inhibition of urea synthesis from NH4Cl (0.5 mmol/l) during hypotonicity was also observed when the perfusion medium was supplemented with glucose (5 mmol/l). Urea synthesis was inhibited by only 10-20% in livers from fed rats, and was even stimulated in those from starved rats when an amino acid mixture (twice the physiological concentration) plus NH4Cl (0.2 mmol/l) was infused. 2. The inhibition of urea synthesis from NH4Cl (0.5 mmol/l) during hypotonicity was accompanied by a threefold increase of citrulline tissue levels, a 50-70% decrease of the tissue contents of glutamate, aspartate, citrate and malate, whereas 2-oxoglutarate, ATP and ornithine tissue levels, and the [3H]inulin extracellular space remained almost unaltered. Further, hypotonic exposure stimulated hepatic glutathione (GSH) release with a time course roughly paralleling volume regulatory K+ efflux. NH4Cl stimulated lactate release from the liver during hypotonic but not during normotonic perfusion. In the absence of NH4Cl, hypotonicity did not significantly affect the lactate/pyruvate ratio in effluent perfusate. With NH4Cl (0.5 mmol/l) present, the lactate/pyruvate ratio increased from 4.3 to 8.2 in

  7. Effect of V or Zr addition on the mechanical properties of the mechanically alloyed Al-8wt%Ti alloys

    SciTech Connect

    Moon, I.H.; Lee, J.H.; Lee, K.M. . Dept. of Materials Engineering); Kim, Y.D. . Div. of Metals)

    1995-01-01

    Mechanical alloying (MA) of Al-Ti alloy, being a solid state process, offers the unique advantage of producing homogeneous and fine dispersions of thermally stable Al[sub 3]Ti phase, where the formation of the fine Al[sub 3]Ti phase by the other method is restricted from the thermodynamic viewpoint. The MA Al-Ti alloys show substantially higher strength than the conventional Al alloys at the elevated temperature due to the presence of Al[sub 3]Ti as well as Al[sub 4]C[sub 3] and Al[sub 2]O[sub 3], of which the last two phases were introduced during MA process. The addition of V or Zr to Al-Ti alloy was known to decrease the lattice mismatch between the intermetallic compound and the aluminum matrix, and such decrease in lattice mismatching can influence positively the high temperature mechanical strength of the MA Al-Ti by increasing the resistance to dispersoid coarsening at the elevated temperature. In the present study, therefore, the mechanical behavior of the MA Al-Ti-V and Al-Ti-Zr alloys were investigated in order to evaluate the effect of V or Zr addition on the mechanical properties of the MA Al-8Ti alloy at high temperature.

  8. Simulations of cellulose translocation in the bacterial cellulose synthase suggest a regulatory mechanism for the dimeric structure of cellulose

    DOE PAGES

    Knott, Brandon C.; Crowley, Michael F.; Himmel, Michael E.; Zimmer, Jochen; Beckham, Gregg T.

    2016-01-29

    The processive cycle of the bacterial cellulose synthase (Bcs) includes the addition of a single glucose moiety to the end of a growing cellulose chain followed by the translocation of the nascent chain across the plasma membrane. The mechanism of this translocation and its precise location within the processive cycle are not well understood. In particular, the molecular details of how a polymer (cellulose) whose basic structural unit is a dimer (cellobiose) can be constructed by adding one monomer (glucose) at a time are yet to be elucidated. Here, we have utilized molecular dynamics simulations and free energy calculations tomore » the shed light on these questions. We find that translocation forward by one glucose unit is quite favorable energetically, giving a free energy stabilization of greater than 10 kcal mol-1. In addition, there is only a small barrier to translocation, implying that translocation is not rate limiting within the Bcs processive cycle (given experimental rates for cellulose synthesis in vitro). Perhaps most significantly, our results also indicate that steric constraints at the transmembrane tunnel entrance regulate the dimeric structure of cellulose. Namely, when a glucose molecule is added to the cellulose chain in the same orientation as the acceptor glucose, the terminal glucose freely rotates upon forward motion, thus suggesting a regulatory mechanism for the dimeric structure of cellulose. We characterize both the conserved and non-conserved enzyme-polysaccharide interactions that drive translocation, and find that 20 of the 25 residues that strongly interact with the translocating cellulose chain in the simulations are well conserved, mostly with polar or aromatic side chains. Our results also allow for a dynamical analysis of the role of the so-called 'finger helix' in cellulose translocation that has been observed structurally. Taken together, these findings aid in the elucidation of the translocation steps of the Bcs processive

  9. Simulations of cellulose translocation in the bacterial cellulose synthase suggest a regulatory mechanism for the dimeric structure of cellulose

    PubMed Central

    Knott, Brandon C.; Crowley, Michael F.; Himmel, Michael E.; Zimmer, Jochen; Beckham, Gregg T.

    2016-01-01

    The processive cycle of the bacterial cellulose synthase (Bcs) includes the addition of a single glucose moiety to the end of a growing cellulose chain followed by the translocation of the nascent chain across the plasma membrane. The mechanism of this translocation and its precise location within the processive cycle are not well understood. In particular, the molecular details of how a polymer (cellulose) whose basic structural unit is a dimer (cellobiose) can be constructed by adding one monomer (glucose) at a time are yet to be elucidated. Here, we have utilized molecular dynamics simulations and free energy calculations to the shed light on these questions. We find that translocation forward by one glucose unit is quite favorable energetically, giving a free energy stabilization of greater than 10 kcal/mol. In addition, there is only a small barrier to translocation, implying that translocation is not rate limiting within the Bcs processive cycle (given experimental rates for cellulose synthesis in vitro). Perhaps most significantly, our results also indicate that steric constraints at the transmembrane tunnel entrance regulate the dimeric structure of cellulose. Namely, when a glucose molecule is added to the cellulose chain in the same orientation as the acceptor glucose, the terminal glucose freely rotates upon forward motion, thus suggesting a regulatory mechanism for the dimeric structure of cellulose. We characterize both the conserved and non-conserved enzyme-polysaccharide interactions that drive translocation, and find that 20 of the 25 residues that strongly interact with the translocating cellulose chain in the simulations are well conserved, mostly with polar or aromatic side chains. Our results also allow for a dynamical analysis of the role of the so-called `finger helix' in cellulose translocation that has been observed structurally. Taken together, these findings aid in the elucidation of the translocation steps of the Bcs processive cycle and

  10. Role of extracellular vesicles in de novo mineralization: an additional novel mechanism of cardiovascular calcification.

    PubMed

    New, Sophie E P; Aikawa, Elena

    2013-08-01

    Extracellular vesicles are membrane micro/nanovesicles secreted by many cell types into the circulation and the extracellular milieu in physiological and pathological conditions. Evidence suggests that extracellular vesicles, known as matrix vesicles, play a role in the mineralization of skeletal tissue, but emerging ultrastructural and in vitro studies have demonstrated their contribution to cardiovascular calcification as well. Cells involved in the progression of cardiovascular calcification release active vesicles capable of nucleating hydroxyapatite on their membranes. This review discusses the role of extracellular vesicles in cardiovascular calcification and elaborates on this additional mechanism of calcification as an alternative pathway to the currently accepted mechanism of biomineralization via osteogenic differentiation.

  11. Effect of Organic Additive on Surface Roughness of Polycrystalline Silicon Film after Chemical Mechanical Polishing

    NASA Astrophysics Data System (ADS)

    Hwang, Hee-Sub; Park, Jin-Hyung; Yi, Sok-Ho; Paik, Ungyu; Park, Jea-Gun

    2010-01-01

    The effect of an organic additive on the surface roughness of a polycrystalline silicon (poly-Si) film was investigated by chemical mechanical polishing (CMP). The surface roughness of the polished poly-Si film was markedly reduced by adding 0.001 wt % hydroxyl ethyl cellulose (HEC) and then decreased slightly with further addition of HEC. We concluded that the reduction of surface roughness was attributed to the formation of a hydroplane layer on the poly-Si surface. Evidence of the hydroplane layer was verified by contact angle and X-ray photoelectron spectroscopy (XPS) measurements.

  12. Cardiovascular Risk in Systemic Autoimmune Diseases: Epigenetic Mechanisms of Immune Regulatory Functions

    PubMed Central

    López-Pedrera, Chary; Pérez-Sánchez, Carlos; Ramos-Casals, Manuel; Santos-Gonzalez, Monica; Rodriguez-Ariza, Antonio; José Cuadrado, Ma

    2012-01-01

    Autoimmune diseases (AIDs) have been associated with accelerated atherosclerosis (AT) leading to increased cardio- and cerebrovascular disease risk. Traditional risk factors, as well as systemic inflammation mediators, including cytokines, chemokines, proteases, autoantibodies, adhesion receptors, and others, have been implicated in the development of these vascular pathologies. Yet, the characteristics of vasculopathies may significantly differ depending on the underlying disease. In recent years, many new genes and signalling pathways involved in autoimmunity with often overlapping patterns between different disease entities have been further detected. Epigenetics, the control of gene packaging and expression independent of alterations in the DNA sequence, is providing new directions linking genetics and environmental factors. Epigenetic regulatory mechanisms comprise DNA methylation, histone modifications, and microRNA activity, all of which act upon gene and protein expression levels. Recent findings have contributed to our understanding of how epigenetic modifications could influence AID development, not only showing differences between AID patients and healthy controls, but also showing how one disease differs from another and even how the expression of key proteins involved in the development of each disease is regulated. PMID:21941583

  13. Molecular interactions of the Saccharomyces cerevisiae Atg1 complex provide insights into assembly and regulatory mechanisms

    PubMed Central

    Chew, Leon H; Lu, Shan; Liu, Xu; Li, Franco Kk; Yu, Angela Yh; Klionsky, Daniel J; Dong, Meng-Qiu; Yip, Calvin K

    2015-01-01

    The Atg1 complex, which contains 5 major subunits: Atg1, Atg13, Atg17, Atg29, and Atg31, regulates the induction of autophagy and autophagosome formation. To gain a better understanding of the overall architecture and assembly mechanism of this essential autophagy regulatory complex, we have reconstituted a core assembly of the Saccharomyces cerevisiae Atg1 complex composed of full-length Atg17, Atg29, and Atg31, along with the C-terminal domains of Atg1 (Atg1[CTD]) and Atg13 (Atg13[CTD]). Using chemical-crosslinking coupled with mass spectrometry (CXMS) analysis we systematically mapped the intersubunit interaction interfaces within this complex. Our data revealed that the intrinsically unstructured C-terminal domain of Atg29 interacts directly with Atg17, whereas Atg17 interacts with Atg13 in 2 distinct intrinsically unstructured regions, including a previously unknown motif that encompasses several putative phosphorylation sites. The Atg1[CTD] crosslinks exclusively to the Atg13[CTD] and does not appear to make direct contact with the Atg17-Atg31-Atg29 scaffold. Finally, single-particle electron microscopy analysis revealed that both the Atg13[CTD] and Atg1[CTD] localize to the tip regions of Atg17-Atg31-Atg29 and do not alter the distinct curvature of this scaffolding subcomplex. This work provides a comprehensive understanding of the subunit interactions in the fully assembled Atg1 core complex, and uncovers the potential role of intrinsically disordered regions in regulating complex integrity. PMID:25998554

  14. Regulatory mechanism of protein metabolic pathway during the differentiation process of chicken male germ cell.

    PubMed

    Li, Dong; Zuo, Qisheng; Lian, Chao; Zhang, Lei; Shi, Qingqing; Zhang, Zhentao; Wang, Yingjie; Ahmed, Mahmoud F; Tang, Beibei; Xiao, Tianrong; Zhang, Yani; Li, Bichun

    2015-08-01

    We explored the regulatory mechanism of protein metabolism during the differentiation process of chicken male germ cells and provide a basis for improving the induction system of embryonic stem cell differentiation to male germ cells in vitro. We sequenced the transcriptome of embryonic stem cells, primordial germ cells, and spermatogonial stem cells with RNA sequencing (RNA-Seq), bioinformatics analysis methods, and detection of the key genes by quantitative reverse transcription PCR (qRT-PCR). Finally, we found 16 amino acid metabolic pathways enriched in the biological metabolism during the differentiation process of embryonic stem cells to primordial germ cells and 15 amino acid metabolic pathways enriched in the differentiation stage of primordial germ cells to spermatogonial stem cells. We found three pathways, arginine-proline metabolic pathway, tyrosine metabolic pathway, and tryptophan metabolic pathway, significantly enriched in the whole differentiation process of embryonic stem cells to spermatogonial stem cells. Moreover, for these three pathways, we screened key genes such as NOS2, ADC, FAH, and IDO. qRT-PCR results showed that the expression trend of these genes were the same to RNA-Seq. Our findings showed that the three pathways and these key genes play an important role in the differentiation process of embryonic stem cells to male germ cells. These results provide basic information for improving the induction system of embryonic stem cell differentiation to male germ cells in vitro.

  15. Effective Mechanical Properties of Lattice Material Fabricated by Material Extrusion Additive Manufacturing

    SciTech Connect

    Park, Sang-In; Choi, Seung-kyum; Rosen, David W; Duty, Chad E

    2014-01-01

    In this paper, a two-step homogenization method is proposed and implemented for evaluating effective mechanical properties of lattice structured material fabricated by the material extrusion additive manufacturing process. In order to consider the characteristics of the additive manufacturing process in estimation procedures, the levels of scale for homogenization are divided into three stages the levels of layer deposition, structural element, and lattice structure. The method consists of two transformations among stages. In the first step, the transformation between layer deposition and structural element levels is proposed to find the geometrical and material effective properties of structural elements in the lattice structure. In the second step, the method to estimate effective mechanical properties of lattice material is presented, which uses a unit cell and is based on the discretized homogenization method for periodic structure. The method is implemented for cubic lattice structure and compared to experimental results for validation purposes.

  16. Dynamic responsiveness of the vascular bed as a regulatory mechanism in vasomotor control.

    PubMed

    Zamir, Mair; Norton, Katelyn; Fleischhauer, Arlene; Frances, Maria F; Goswami, Ruma; Usselman, Charlotte W; Nolan, Robert P; Shoemaker, J Kevin

    2009-07-01

    The dynamics of blood supply to a vascular bed depend on lumped mechanical properties of that bed, namely the compliance (C), resistance (R), viscoelasticity (K), and inertance (L). While the study of regulatory mechanisms has so far placed the emphasis largely on R, it is not known how the remaining properties contribute collectively to the play of dynamics in vasomotor control. To examine this question and to establish some benchmark values of these properties, simultaneous measurements of pressure and flow waveforms in the vascular bed of the forearm were obtained from three groups: young healthy individuals, older hypertensives with controlled blood pressure, and older hypertensives with uncontrolled blood pressure. The values of R and C were found to vary within a wide range in each of the three groups to the extent that neither R nor C could be used independently as an indicator of health or age of the subjects tested. However, higher level dynamic properties of the bed, such as the time constants and damping index, which depend on combinations of C,K, and L, and which may reflect measures of the dynamic responsiveness or "sluggishness" of the system, were found to be maintained over a wide range of pulse pressures. These findings support a hypothesis that the pulsatile dynamics of blood supply to a vascular bed are adapted to the individual baseline values of R and C in different subjects with the effect of optimizing the level of dynamic responsiveness to changes in pressure or flow, and that this dynamic property of the vascular bed may be a protected and/or regulated property.

  17. An insight into the various regulatory mechanisms modulating human DNA methyltransferase 1 stability and function

    PubMed Central

    Kar, Swayamsiddha; Deb, Moonmoon; Sengupta, Dipta; Shilpi, Arunima; Parbin, Sabnam; Torrisani, Jérôme; Pradhan, Sriharsa; Patra, Samir Kumar

    2012-01-01

    DNA methylation is one of the principal epigenetic signals that participate in cell specific gene expression in vertebrates. DNA methylation plays a quintessential role in the control of gene expression, cellular differentiation and development. It also plays a central role in the preservation of chromatin structure and chromosomal integrity, parental imprinting, X-chromosome inactivation, aging and carcinogenesis. The foremost contributor in the mammalian methylation scheme is DNMT1, a maintenance methyltransferase that faithfully copies the pre-existing methyl marks onto hemimethylated daughter strands during DNA replication to maintain the established methylation patterns across successive cell divisions. The ever-changing cellular physiology and the significant part that DNA methylation plays in genome regulation necessitate rigid management of this enzyme. In mammalian cells, a host of intrinsic and extrinsic mechanisms regulate the expression, activity and stability of DNMT1. Transcriptional regulation, post-transcriptional auto-inhibitory controls and post-translational modifications of the enzyme are responsible for the efficient inheritance of DNA methylation patterns. Also, a large number of intra- and intercellular signaling cascades and numerous interactions with other modulator molecules that affect the catalytic activity of the enzyme at multiple levels function as major checkpoints of the DNMT1 control system. An in-depth understanding of the DNMT1 enzyme, its targeting and function is crucial for comprehending how DNA methylation is coordinated with other critical developmental and physiological processes. This review aims to provide a comprehensive account of the various regulatory mechanisms and interactions of DNMT1 so as to elucidate its function at the molecular level and understand the dynamics of DNA methylation at the cellular level. PMID:22894906

  18. Toward a mechanism for biliprotein lyases: revisiting nucleophilic addition to phycocyanobilin.

    PubMed

    Tu, Jun-Ming; Zhou, Ming; Haessner, Rainer; Plöscher, Matthias; Eichacker, Lutz; Scheer, Hugo; Zhao, Kai-Hong

    2009-04-22

    Biliprotein lyases attach linear-tetrapyrrolic bilins covalently to apoproteins, which is a prerequisite for the assembly of phycobiliproteins into phycobilisomes, the light-harvesting complexes of cyanobacteria. On the basis of the addition of thiol and imidazole to phycocyanobilin, we propose a generalized lyase reaction mechanism. The adducts contain isomerized phycocyanobilin that can be transferred by the lyase to apoproteins by either back-isomerization, generating phycocyanobilin-containing proteins, or direct transfer, generating phycoviolobilin-containing proteins.

  19. The effect of callosotomy on testicular steroidogenesis in hemiorchidectomized rats: a pituitary-independent regulatory mechanism.

    PubMed

    Banczerowski, P; Csaba, Z; Csernus, V; Gerendai, I

    2000-09-15

    In recent years, increasing number of data indicate that cerebral structures exert a direct, pituitary-independent, neural regulatory action on the endocrine glands. In addition, both experimental and clinical observations indicate functional asymmetry of the control system. Therefore, the objective of the present study was to study the effect of callosotomy on testicular steroidogenesis and serum gonadotrop concentrations in rats subjected to left- or right-sided orchidectomy. In animals underwent callosotomy plus left-sided orchidectomy the basal testosterone secretion in vitro of the remaining (right) testis was significantly higher than that of intact controls, and of rats subjected to sham surgery plus left orchidectomy. In contrast, either sham operation or callosotomy plus right-sided orchidectomy did not interfere with testicular steroidogenesis. Sham surgery or callosotomy plus left orchidectomy induced a significant rise in serum follicle-stimulating hormone concentration while right orchidectomy combined either with sham surgery or callosotomy did not alter this parameter. There was no statistically significant difference between experimental groups in serum testosterone and luteinizing hormone concentrations. The results indicate the involvement of the corpus callosum in a pituitary-independent neural control of testicular steroidogenesis. The data further suggest a different response in steroidogenesis of the left and the right testis following hemicastration and callosotomy. PMID:11044600

  20. Transcriptome analysis reveals novel regulatory mechanisms in a genome-reduced bacterium

    PubMed Central

    Mazin, Pavel V.; Fisunov, Gleb Y.; Gorbachev, Alexey Y.; Kapitskaya, Kristina Y.; Altukhov, Ilya A.; Semashko, Tatiana A.; Alexeev, Dmitry G.; Govorun, Vadim M.

    2014-01-01

    The avian bacterial pathogen Mycoplasma gallisepticum is a good model for systems studies due to small genome and simplicity of regulatory pathways. In this study, we used RNA-Seq and MS-based proteomics to accurately map coding sequences, transcription start sites (TSSs) and transcript 3′-ends (T3Es). We used obtained data to investigate roles of TSSs and T3Es in stress-induced transcriptional responses. We identified 1061 TSSs at a false discovery rate of 10% and showed that almost all transcription in M. gallisepticum is initiated from classic TATAAT promoters surrounded by A/T-rich sequences. Our analysis revealed the pronounced operon structure complexity: on average, each coding operon has one internal TSS and T3Es in addition to the primary ones. Our transcriptomic approach based on the intervals between the two nearest transcript ends allowed us to identify two classes of T3Es: strong, unregulated, hairpin-containing T3Es and weak, heat shock-regulated, hairpinless T3Es. Comparing gene expression levels under different conditions revealed widespread and divergent transcription regulation in M. gallisepticum. Modeling suggested that the core promoter structure plays an important role in gene expression regulation. We have shown that the heat stress activation of cryptic promoters combined with the hairpinless T3Es suppression leads to widespread, seemingly non-functional transcription. PMID:25361977

  1. Effects of radiation on T regulatory cells in normal states and cancer: mechanisms and clinical implications.

    PubMed

    Liu, Shu; Sun, Xiangdong; Luo, Jinhua; Zhu, Hongcheng; Yang, Xi; Guo, Qing; Song, Yaqi; Sun, Xinchen

    2015-01-01

    Radiation remains an important component of cancer treatment. In addition to inducing tumor cell death through direct cytotoxic effects, radiation can also promote the regression of tumor via augment of immune response. Regulatory T cells (Tregs) are a unique subpopulation of CD4 positive cells, which are characterized by expression of the forkhead box P3 (Foxp3) transcription factor and high levels of CD25. Mounting evidence has shown that Tregs are implicated in the development and progression of various types of cancer, which makes Tregs an important target in cancer therapeutics. Generally, lymphocytes are regarded as radiosensitive. However, Tregs have been demonstrated to be relatively resistant to radiotherapy, which is partly mediated by downregulation of pro-apoptotic proteins and upregulation of anti-apoptotic proteins. Moreover, radiotherapy can increase the production of Tregs and the recruitment of Tregs to local tumor microenvironment. Tregs can attenuate radiation-induced tumor death, which cause the resistance of tumor to radiotherapy. Recent experimental studies and clinical trails have demonstrated that the combination of radiation with medications that target Tregs is promising in the treatment of several types of neoplasms. In this review, we discussed the effect of radiation on Tregs in physiological states and cancer. Further, we presented an overview of therapies that target Tregs to enhance the efficacy of radiation in cancer therapeutics. PMID:26807310

  2. Luteal regression vs. prepartum luteolysis: regulatory mechanisms governing canine corpus luteum function.

    PubMed

    Kowalewski, Mariusz P

    2014-04-01

    Canine reproductive physiology exhibits several unusual features. Among the most interesting of these are the lack of an acute luteolytic mechanism, coinciding with the apparent luteal independency of a uterine luteolysin in absence of pregnancy, contrasting with the acute prepartum luteolysis observed in pregnant animals. These features indicate the existence of mechanisms different from those in other species for regulating the extended luteal regression observed in non-pregnant dogs, and the actively regulated termination of luteal function observed prepartum as a prerequisite for parturition. Nevertheless, the supply of progesterone (P4) depends on corpora lutea (CL) as its primary source in both conditions, resulting in P4 levels that are similar in pregnant and non-pregnant bitches during almost the entire luteal life span prior to the prepartum luteolysis. Consequently, the duration of the prolonged luteal phase in non-pregnant bitches frequently exceeds that of pregnant ones, which is a peculiarity when compared with other domestic animal species. Both LH and prolactin (PRL) are endocrine luteotrophic factors in the dog, the latter being the predominant one. In spite of increased availability of these hormones, luteal regression/luteolysis still takes place. Recently, possible mechanisms regulating the expression and function of PRL receptor have been implicated in the local, i.e., intraluteal regulation of PRL bioavailability and thus its steroidogenic potential. Similar mechanisms may relate to the luteal LH receptor. Most recently, evidence has been provided for an autocrine/paracrine role of prostaglandin E2 (PGE2) as a luteotrophic factor in the canine CL acting at the level of steroidogenic acute regulatory (STAR)-protein mediated supply of steroidogenic substrate, without having a significant impact on the enzymatic activity of the respective steroidogenic enzymes, 3β-hydroxysteroid-dehydrogenase (3βHSD, HSD3B2) and cytochrome P450 side

  3. Increased Mechanical Properties Through the Addition of Zr to GRCop-84

    NASA Technical Reports Server (NTRS)

    Ellis, David L.; Lerch, Bradley A.

    2011-01-01

    GRCop-84 (Cu-8 at.% Cr-4 at.% Nb) has shown exceptional mechanical properties above 932 F (773 K). However, its properties below 932 F (773 K) are inferior to precipitation strengthened alloys such as Cu-Cr, Cu-Zr and Cu-Cr-Zr when they are in the fully aged, hard-drawn condition. It has been noted that the addition of small amounts of Zr, typically 0.1 wt.% to 0.5 wt.%, can greatly enhance the mechanical properties of copper-based alloys. Limited testing was conducted upon GRCop-84 with an addition of 0.4 wt.% Zr to determine its tensile, creep and low cycle fatigue (LCF) properties. Very large increases in strength (up to 68%) and ductility (up to 123%) were observed at both room temperature and 932 F (773 K). Creep properties at 932 F (773 K) demonstrated more than an order of magnitude decrease in the creep rate relative to unmodified GRCop-84 with a corresponding order of magnitude increase in creep life. Limited LCF testing showed that the modified alloy had a comparable LCF life at room temperature, but it was capable of sustaining a much higher load. While more testing and composition optimization are required, the addition of Zr to GRCop-84 has shown clear benefits to mechanical properties.

  4. Transcriptome Profiling Reveals the Regulatory Mechanism Underlying Pollination Dependent and Parthenocarpic Fruit Set Mainly Mediated by Auxin and Gibberellin

    PubMed Central

    Tang, Ning; Deng, Wei; Hu, Guojian; Hu, Nan; Li, Zhengguo

    2015-01-01

    Background Fruit set is a key process for crop production in tomato which occurs after successful pollination and fertilization naturally. However, parthenocarpic fruit development can be uncoupled from fertilization triggered by exogenous auxin or gibberellins (GAs). Global transcriptome knowledge during fruit initiation would help to characterize the molecular mechanisms by which these two hormones regulate pollination-dependent and -independent fruit set. Principal Findings In this work, digital gene expression tag profiling (DGE) technology was applied to compare the transcriptomes from pollinated and 2, 4-D/GA3-treated ovaries. Activation of carbohydrate metabolism, cell division and expansion as well as the down-regulation of MADS-box is a comprehensive regulatory pathway during pollination-dependent and parthenocarpic fruit set. The signaling cascades of auxin and GA are significantly modulated. The feedback regulations of Aux/IAAs and DELLA genes which functioned to fine-tune auxin and GA response respectively play fundamental roles in triggering fruit initiation. In addition, auxin regulates GA synthesis via up-regulation of GA20ox1 and down-regulation of KNOX. Accordingly, the effect of auxin on fruit set is mediated by GA via ARF2 and IAA9 down-regulation, suggesting that both pollination-dependent and parthenocarpic fruit set depend on the crosstalk between auxin and GA. Significance This study characterizes the transcriptomic features of ovary development and more importantly unravels the integral roles of auxin and GA on pollination-dependent and parthenocarpic fruit set. PMID:25909657

  5. Inhibition of protein kinase C catalytic activity by additional regions within the human protein kinase Calpha-regulatory domain lying outside of the pseudosubstrate sequence.

    PubMed Central

    Kirwan, Angie F; Bibby, Ashley C; Mvilongo, Thierry; Riedel, Heimo; Burke, Thomas; Millis, Sherri Z; Parissenti, Amadeo M

    2003-01-01

    The N-terminal pseudosubstrate site within the protein kinase Calpha (PKCalpha)-regulatory domain has long been regarded as the major determinant for autoinhibition of catalytic domain activity. Previously, we observed that the PKC-inhibitory capacity of the human PKCalpha-regulatory domain was only reduced partially on removal of the pseudosubstrate sequence [Parissenti, Kirwan, Kim, Colantonio and Schimmer (1998) J. Biol. Chem. 273, 8940-8945]. This finding suggested that one or more additional region(s) contributes to the inhibition of catalytic domain activity. To assess this hypothesis, we first examined the PKC-inhibitory capacity of a smaller fragment of the PKCalpha-regulatory domain consisting of the C1a, C1b and V2 regions [GST-Ralpha(39-177): this protein contained the full regulatory domain of human PKCalpha fused to glutathione S-transferase (GST), but lacked amino acids 1-38 (including the pseudosubstrate sequence) and amino acids 178-270 (including the C2 region)]. GST-Ralpha(39-177) significantly inhibited PKC in a phorbol-independent manner and could not bind the peptide substrate used in our assays. These results suggested that a region within C1/V2 directly inhibits catalytic domain activity. Providing further in vivo support for this hypothesis, we found that expression of N-terminally truncated pseudosubstrate-less bovine PKCalpha holoenzymes in yeast was capable of inhibiting cell growth in a phorbol-dependent manner. This suggested that additional autoinhibitory force(s) remained within the truncated holoenzymes that could be relieved by phorbol ester. Using tandem PCR-mediated mutagenesis, we observed that mutation of amino acids 33-86 within GST-Ralpha(39-177) dramatically reduced its PKC-inhibitory capacity when protamine was used as substrate. Mutagenesis of a broad range of sequences within C2 (amino acids 159-242) also significantly reduced PKC-inhibitory capacity. Taken together, these observations support strongly the existence of

  6. Mechanisms and modeling of the effects of additives on the nitrogen oxides emission

    NASA Technical Reports Server (NTRS)

    Kundu, Krishna P.; Nguyen, H. Lee; Kang, M. Paul

    1991-01-01

    A theoretical study on the emission of the oxides of nitrogen in the combustion of hydrocarbons is presented. The current understanding of the mechanisms and the rate parameters for gas phase reactions were used to calculate the NO(x) emission. The possible effects of different chemical species on thermal NO(x), on a long time scale were discussed. The mixing of these additives at various stages of combustion were considered and NO(x) concentrations were calculated; effects of temperatures were also considered. The chemicals such as hydrocarbons, H2, CH3OH, NH3, and other nitrogen species were chosen as additives in this discussion. Results of these calculations can be used to evaluate the effects of these additives on the NO(x) emission in the industrial combustion system.

  7. Influence of oxide-based sintering additives on densification and mechanical behavior of tricalcium phosphate (TCP).

    PubMed

    Bhatt, Himesh A; Kalita, Samar J

    2007-05-01

    In this research, we studied and analyzed the effects of four different oxide-based sintering additives on densification, mechanical behavior, biodegradation and biocompatibility of tricalcium phosphate (TCP) bioceramics. Selective sintering additives were introduced into pure TCP ceramics, in small quantities, through homogeneous mixing, using a mortar and pestle. The consequent powders of different compositions were pressed into cylindrical compacts, uniaxially and sintered at elevated temperatures, 1150 degrees C and 1250 degrees C, separately in a muffle furnace. X-ray powder diffraction technique was used to analyze the phase-purity of TCP after sintering. Hardness of these sintered specimens was evaluated using a Vickers hardness tester. Sintered cylindrical samples were tested under uniaxial compressive loading, as a function of composition to determine their failure strength. Biodegradation studies conducted using simulated body fluid under dynamic environment, revealed that these additives could control the rate of resorption and hardness degradation of TCP ceramics. PMID:17211718

  8. Mutational analysis of structural elements in a class-I cyclic di-GMP riboswitch to elucidate its regulatory mechanism.

    PubMed

    Inuzuka, Saki; Nishimura, Kei-Ichiro; Kakizawa, Hitoshi; Fujita, Yuki; Furuta, Hiroyuki; Matsumura, Shigeyoshi; Ikawa, Yoshiya

    2016-09-01

    The Vc2 riboswitch possesses an aptamer domain belonging to the class-I c-di-GMP riboswitch family. This domain has been analysed and the molecular mechanism by which it recognizes the c-di-GMP ligand has been elucidated. On the other hand, the regulatory mechanism of the full-length Vc2 riboswitch to control its downstream open reading frame (ORF) remains largely unknown. In this study, we performed in vivo reporter assays and in vitro biochemical analyses of the full-length riboswitch and its aptamer domain. We evaluated the results of in vivo and in vitro analyses to elucidate the regulatory mechanism of the Vc2 riboswitch. The present results suggest that recognition of c-di-GMP ligand by the Vc2 riboswitch aptamer domain downregulates expression of its downstream ORF primarily at the translational level.

  9. Mechanical properties of potato starch modified by moisture content and addition of lubricant

    NASA Astrophysics Data System (ADS)

    Stasiak, Mateusz; Molenda, Marek; Horabik, Józef; Mueller, Peter; Opaliński, Ireneusz

    2014-10-01

    Laboratory testing was conducted to deliver a set of characteristics of structure and mechanical properties of pure starch and starch with an addition of a lubricant - magnesium stearate. Considerable influence of moisture content of potato starch was found in the case of density, parameters of internal friction, coefficients of wall friction and flowability. Elasticity was found to be strongly influenced by water content of the material. Addition of magnesium stearate affected density and parameters of flowability, internal friction and elasticity. Bulk density increased from 604 to 774 kg m-3 with decrease in moisture content of potato starch from 17 to for 6%. Addition of magnesium stearate resulted in approximately 10% decrease in bulk density. Angle of internal friction obtained for 10 kPa of consolidation stress decreased from 33 to 24º with increase in moisture content, and to approximately 22º with addition of the lubricant. With an increase of moisture content from 6 to 18% and with addition of the lubricant, the modulus of elasticity during loading decreased from approximately 1.0 to 0.1 MPa. Modulus of elasticity during unloading was found in the range from 19 to 42 MPa and increased with increase of moisture content and amount of lubricant.

  10. Mechanisms of immune suppression by interleukin-10 and transforming growth factor-β: the role of T regulatory cells

    PubMed Central

    Taylor, Alison; Verhagen, Johan; Blaser, Kurt; Akdis, Mübeccel; Akdis, Cezmi A

    2006-01-01

    Specific immune suppression and induction of tolerance are essential processes in the regulation and circumvention of immune defence. The balance between allergen-specific type 1 regulatory (Tr1) cells and T helper (Th) 2 cells appears to be decisive in the development of allergy. Tr1 cells consistently represent the dominant subset specific for common environmental allergens in healthy individuals. In contrast, there is a high frequency of allergen-specific interleukin-4 (IL-4)-secreting T cells in allergic individuals. Allergen-specific immunotherapy can induce specific Tr1 cells that abolish allergen-induced proliferation of Th1 and Th2 cells, as well as their cytokine production. Tr1 cells utilize multiple suppressor mechanisms, such as IL-10 and transforming growth factor-β (TGF-β) as secreted cytokines and various surface molecules, such as cytotoxic T-lymphocyte antigen 4 and programmed death-1. IL-10 only inhibits T cells stimulated by low numbers of triggered T-cell receptors, which depend on CD28 costimulation. IL-10 inhibits CD28 tyrosine phosphorylation, preventing the binding of phosphatidylinositol 3-kinase p85 and consequently inhibiting the CD28 signalling pathway. In addition, IL-10 and TGF-β secreted by Tr1 cells skew the antibody production from immunoglobulin E (IgE) towards the non-inflammatory isotypes IgG4 and IgA, respectively. Induction of antigen-specific Tr1 cells can thus re-direct an inappropriate immune response against allergens or auto-antigens using a broad range of suppressor mechanisms. PMID:16556256

  11. microRNA regulatory mechanism by which PLLA aligned nanofibers influence PC12 cell differentiation

    NASA Astrophysics Data System (ADS)

    Yu, Yadong; Lü, Xiaoying; Ding, Fei

    2015-08-01

    Objective. Aligned nanofibers (AFs) are regarded as promising biomaterials in nerve tissue engineering. However, a full understanding of the biocompatibility of AFs at the molecular level is still challenging. Therefore, the present study focused on identifying the microRNA (miRNA)-mediated regulatory mechanism by which poly-L-lactic acid (PLLA) AFs influence PC12 cell differentiation. Approach. Firstly, the effects of PLLA random nanofibers (RFs)/AFs and PLLA films (control) on the biological responses of PC12 cells that are associated with neuronal differentiation were examined. Then, SOLiD sequencing and cDNA microarray were employed to profile the expressions of miRNAs and mRNAs. The target genes of the misregulated miRNAs were predicted and compared with the mRNA profile data. Functions of the matched target genes (the intersection between the predicted target genes and the experimentally-determined, misregulated genes) were analyzed. Main results. The results revealed that neurites spread in various directions in control and RF groups. In the AF group, most neurites extended in parallel with each other. The glucose consumption and lactic acid production in the RF and AF groups were higher than those in the control group. Compared with the control group, 42 and 94 miRNAs were significantly dysregulated in the RF and AF groups, respectively. By comparing the predicted target genes with the mRNA profile data, five and 87 matched target genes were found in the RF and AF groups, respectively. Three of the matched target genes in the AF group were found to be associated with neuronal differentiation, whereas none had this association in the RF group. The PLLA AFs induced the dysregulation of miRNAs that regulate many biological functions, including axonal guidance, lipid metabolism and long-term potentiation. In particular, two miRNA-matched target gene-biological function modules associated with neuronal differentiation were identified as follows: (1) miR-23b, mi

  12. Deciphering Transcriptional Regulatory Mechanisms Associated with Hemicellulose Degradation in Neurospora crassa

    PubMed Central

    Sun, Jianping; Tian, Chaoguang; Diamond, Spencer

    2012-01-01

    Hemicellulose, the second most abundant plant biomass fraction after cellulose, is widely viewed as a potential substrate for the production of liquid fuels and other value-added materials. Degradation of hemicellulose by filamentous fungi requires production of many different enzymes, which are induced by biopolymers or its derivatives and regulated mainly at the transcriptional level through transcription factors (TFs). Neurospora crassa, a model filamentous fungus, expresses and secretes enzymes required for plant cell wall deconstruction. To better understand genes specifically associated with degradation of hemicellulose, we applied secretome and transcriptome analysis to N. crassa grown on beechwood xylan. We identified 34 secreted proteins and 353 genes with elevated transcription on xylan. The xylanolytic phenotype of strains with deletions in genes identified from the secretome and transcriptome analysis of the wild type was assessed, revealing functions for known and unknown proteins associated with hemicellulose degradation. By evaluating phenotypes of strains containing deletions of predicted TF genes in N. crassa, we identified a TF (XLR-1; xylan degradation regulator 1) essential for hemicellulose degradation that is an ortholog to XlnR/XYR1 in Aspergillus and Trichoderma species, respectively, a major transcriptional regulator of genes encoding both cellulases and hemicellulases. Deletion of xlr-1 in N. crassa abolished growth on xylan and xylose, but growth on cellulose and cellulolytic activity were only slightly affected. To determine the regulatory mechanisms for hemicellulose degradation, we explored the transcriptional regulon of XLR-1 under xylose, xylanolytic, and cellulolytic conditions. XLR-1 regulated only some predicted hemicellulase genes in N. crassa and was required for a full induction of several cellulase genes. Hemicellulase gene expression was induced by a combination of release from carbon catabolite repression (CCR) and induction

  13. RNA-Binding Proteins in Trichomonas vaginalis: Atypical Multifunctional Proteins Involved in a Posttranscriptional Iron Regulatory Mechanism

    PubMed Central

    Figueroa-Angulo, Elisa E.; Calla-Choque, Jaeson S.; Mancilla-Olea, Maria Inocente; Arroyo, Rossana

    2015-01-01

    Iron homeostasis is highly regulated in vertebrates through a regulatory system mediated by RNA-protein interactions between the iron regulatory proteins (IRPs) that interact with an iron responsive element (IRE) located in certain mRNAs, dubbed the IRE-IRP regulatory system. Trichomonas vaginalis, the causal agent of trichomoniasis, presents high iron dependency to regulate its growth, metabolism, and virulence properties. Although T. vaginalis lacks IRPs or proteins with aconitase activity, possesses gene expression mechanisms of iron regulation at the transcriptional and posttranscriptional levels. However, only one gene with iron regulation at the transcriptional level has been described. Recently, our research group described an iron posttranscriptional regulatory mechanism in the T. vaginalis tvcp4 and tvcp12 cysteine proteinase mRNAs. The tvcp4 and tvcp12 mRNAs have a stem-loop structure in the 5'-coding region or in the 3'-UTR, respectively that interacts with T. vaginalis multifunctional proteins HSP70, α-Actinin, and Actin under iron starvation condition, causing translation inhibition or mRNA stabilization similar to the previously characterized IRE-IRP system in eukaryotes. Herein, we summarize recent progress and shed some light on atypical RNA-binding proteins that may participate in the iron posttranscriptional regulation in T. vaginalis. PMID:26703754

  14. Gelation Behaviors and Mechanism of Silk Fibroin According to the Addition of Nitrate Salts

    PubMed Central

    Im, Dong Su; Kim, Min Hee; Yoon, Young Il; Park, Won Ho

    2016-01-01

    Silk fibroin (SF) is a typical fibrous protein that is secreted by silkworms and spiders. It has been used in a variety of areas, and especially for tissue-engineering scaffolds, due to its sound processability, mechanical properties, biodegradability, and biocompatibility. With respect to gelation, the SF gelation time is long in aqueous solutions, so a novel approach is needed to shorten this time. The solubility of regenerated SF is sound in formic acid (FA), which is a carboxylic acid of the simplest structure. In this study, SF was dissolved in formic acid, and the addition of salts then induced a rapid gelation that accompanied a solution-color change. Based on the gelation behaviors of the SF solution according to different SF and salt concentrations, the gelation mechanism was investigated. PMID:27735861

  15. Comprehensive analysis of microRNA-Seq and target mRNAs of rice sheath blight pathogen provides new insights into pathogenic regulatory mechanisms

    PubMed Central

    Lin, Runmao; He, Liye; He, Jiayu; Qin, Peigang; Wang, Yanran; Deng, Qiming; Yang, Xiaoting; Li, Shuangcheng; Wang, Shiquan; Wang, Wenming; Liu, Huainian; Li, Ping; Zheng, Aiping

    2016-01-01

    MicroRNAs (miRNAs) are ∼22 nucleotide non-coding RNAs that regulate gene expression by targeting mRNAs for degradation or inhibiting protein translation. To investigate whether miRNAs regulate the pathogenesis in necrotrophic fungus Rhizoctonia solani AG1 IA, which causes significant yield loss in main economically important crops, and to determine the regulatory mechanism occurring during pathogenesis, we constructed hyphal small RNA libraries from six different infection periods of the rice leaf. Through sequencing and analysis, 177 miRNA-like small RNAs (milRNAs) were identified, including 15 candidate pathogenic novel milRNAs predicted by functional annotations of their target mRNAs and expression patterns of milRNAs and mRNAs during infection. Reverse transcription-quantitative polymerase chain reaction results for randomly selected milRNAs demonstrated that our novel comprehensive predictions had a high level of accuracy. In our predicted pathogenic protein-protein interaction network of R. solani, we added the related regulatory milRNAs of these core coding genes into the network, and could understand the relationships among these regulatory factors more clearly at the systems level. Furthermore, the putative pathogenic Rhi-milR-16, which negatively regulates target gene expression, was experimentally validated to have regulatory functions by a dual-luciferase reporter assay. Additionally, 23 candidate rice miRNAs that may involve in plant immunity against R. solani were discovered. This first study on novel pathogenic milRNAs of R. solani AG1 IA and the recognition of target genes involved in pathogenicity, as well as rice miRNAs, participated in defence against R. solani could provide new insights into revealing the pathogenic mechanisms of the severe rice sheath blight disease. PMID:27374612

  16. Liraglutide, leptin, and their combined effects on feeding: additive intake reduction through common intracellular signaling mechanisms

    PubMed Central

    Kanoski, Scott E.; Ong, Zhi Yi; Fortin, Samantha M.; Schlessinger, Elizabeth S.; Grill, Harvey J.

    2014-01-01

    Aims Glucagon like peptide-1 receptor (GLP-1R) agonists and leptin each exert anorexigenic effects. In combination, the intake inhibitory and weight loss effects are greater than either treatment alone, however the mechanisms unclear. Materials and methods Effects of liraglutide (a long-acting GLP-1 analogue) and leptin co-treatment, delivered in low or moderate doses subcutaneously (SC) or to the 3rd ventricle respectively, on cumulative intake, meal patterns, and hypothalamic expression of intracellular signaling proteins [phosphorylated signal transducer and activator of transcription-3 (pSTAT3) and protein tyrosine phosphatase-1B (PTP1B)] were examined in lean rats. Results A low-dose combination of liraglutide (25μg/kg) and leptin (0.75μg) additively reduced cumulative food intake and body weight, a result mediated predominantly through a significant reduction in meal frequency that was not present with either drug alone. Liraglutide treatment alone also reduced meal size; an effect not enhanced with leptin co-administration. Moderate doses of liraglutide (75μg/kg) and leptin (4μg) examined separately each reduced meal frequency, cumulative food intake, and body weight; only liraglutide reduced meal size. In combination these doses did not further enhance the anorexigenic effects of either treatment alone. Ex vivo immunoblot showed elevated pSTAT3 in hypothalamic tissue following liraglutide-leptin co-treatment, an effect greater than leptin treatment alone. In addition, SC liraglutide reduced expression of PTP1B (a negative regulator of leptin receptor signaling), revealing a potential mechanism for the enhanced pSTAT3 response following liraglutide-leptin co-administration. Conclusions Collectively, these results provide novel behavioral and molecular mechanisms underlying the additive reduction in food intake and body weight following liraglutide-leptin combination treatment. PMID:25475828

  17. Failure mechanisms of additively manufactured porous biomaterials: Effects of porosity and type of unit cell.

    PubMed

    Kadkhodapour, J; Montazerian, H; Darabi, A Ch; Anaraki, A P; Ahmadi, S M; Zadpoor, A A; Schmauder, S

    2015-10-01

    Since the advent of additive manufacturing techniques, regular porous biomaterials have emerged as promising candidates for tissue engineering scaffolds owing to their controllable pore architecture and feasibility in producing scaffolds from a variety of biomaterials. The architecture of scaffolds could be designed to achieve similar mechanical properties as in the host bone tissue, thereby avoiding issues such as stress shielding in bone replacement procedure. In this paper, the deformation and failure mechanisms of porous titanium (Ti6Al4V) biomaterials manufactured by selective laser melting from two different types of repeating unit cells, namely cubic and diamond lattice structures, with four different porosities are studied. The mechanical behavior of the above-mentioned porous biomaterials was studied using finite element models. The computational results were compared with the experimental findings from a previous study of ours. The Johnson-Cook plasticity and damage model was implemented in the finite element models to simulate the failure of the additively manufactured scaffolds under compression. The computationally predicted stress-strain curves were compared with the experimental ones. The computational models incorporating the Johnson-Cook damage model could predict the plateau stress and maximum stress at the first peak with less than 18% error. Moreover, the computationally predicted deformation modes were in good agreement with the results of scaling law analysis. A layer-by-layer failure mechanism was found for the stretch-dominated structures, i.e. structures made from the cubic unit cell, while the failure of the bending-dominated structures, i.e. structures made from the diamond unit cells, was accompanied by the shearing bands of 45°.

  18. Failure mechanisms of additively manufactured porous biomaterials: Effects of porosity and type of unit cell.

    PubMed

    Kadkhodapour, J; Montazerian, H; Darabi, A Ch; Anaraki, A P; Ahmadi, S M; Zadpoor, A A; Schmauder, S

    2015-10-01

    Since the advent of additive manufacturing techniques, regular porous biomaterials have emerged as promising candidates for tissue engineering scaffolds owing to their controllable pore architecture and feasibility in producing scaffolds from a variety of biomaterials. The architecture of scaffolds could be designed to achieve similar mechanical properties as in the host bone tissue, thereby avoiding issues such as stress shielding in bone replacement procedure. In this paper, the deformation and failure mechanisms of porous titanium (Ti6Al4V) biomaterials manufactured by selective laser melting from two different types of repeating unit cells, namely cubic and diamond lattice structures, with four different porosities are studied. The mechanical behavior of the above-mentioned porous biomaterials was studied using finite element models. The computational results were compared with the experimental findings from a previous study of ours. The Johnson-Cook plasticity and damage model was implemented in the finite element models to simulate the failure of the additively manufactured scaffolds under compression. The computationally predicted stress-strain curves were compared with the experimental ones. The computational models incorporating the Johnson-Cook damage model could predict the plateau stress and maximum stress at the first peak with less than 18% error. Moreover, the computationally predicted deformation modes were in good agreement with the results of scaling law analysis. A layer-by-layer failure mechanism was found for the stretch-dominated structures, i.e. structures made from the cubic unit cell, while the failure of the bending-dominated structures, i.e. structures made from the diamond unit cells, was accompanied by the shearing bands of 45°. PMID:26143351

  19. Investigation of mechanical properties of masterbatches and composites with small additions of CNTs

    NASA Astrophysics Data System (ADS)

    Burmistrov, I. N.; Yudintseva, T. I.; Ilinykh, I. A.; Khaydarov, B. B.; Mazov, I. N.; Anshin, S. M.; Kuznetsov, D. V.

    2016-01-01

    The present paper investigated physical and mechanical properties of the nanotube masterbatches and the polymer composites with low contents of carbon nanotubes (CNTs), which were obtained by diluting masterbatches. Ethylene-octene copolymer was used as the binder for the masterbatches, which provides the elasticity of the material at a content 20 wt% of CNT. Masterbatches were obtained with a 2-roller mixer, and their additive to polypropylene was carried out on a single screw injection molding machine. Strength properties of ethylene-octene copolymer increased when additing CNTs in an amount of 5-20 wt%. When the concentration of CNT in masterbatches is reduced to 0.01-0.1 wt% its strength characteristics increased up to 4-18%. The most effective strengthening of polypropylene was observed with the content of CNTs 0.1 wt%.

  20. Regulatory Mechanisms That Prevent Re-initiation of DNA Replication Can Be Locally Modulated at Origins by Nearby Sequence Elements

    PubMed Central

    Richardson, Christopher D.; Li, Joachim J.

    2014-01-01

    Eukaryotic cells must inhibit re-initiation of DNA replication at each of the thousands of origins in their genome because re-initiation can generate genomic alterations with extraordinary frequency. To minimize the probability of re-initiation from so many origins, cells use a battery of regulatory mechanisms that reduce the activity of replication initiation proteins. Given the global nature of these mechanisms, it has been presumed that all origins are inhibited identically. However, origins re-initiate with diverse efficiencies when these mechanisms are disabled, and this diversity cannot be explained by differences in the efficiency or timing of origin initiation during normal S phase replication. This observation raises the possibility of an additional layer of replication control that can differentially regulate re-initiation at distinct origins. We have identified novel genetic elements that are necessary for preferential re-initiation of two origins and sufficient to confer preferential re-initiation on heterologous origins when the control of re-initiation is partially deregulated. The elements do not enhance the S phase timing or efficiency of adjacent origins and thus are specifically acting as re-initiation promoters (RIPs). We have mapped the two RIPs to ∼60 bp AT rich sequences that act in a distance- and sequence-dependent manner. During the induction of re-replication, Mcm2-7 reassociates both with origins that preferentially re-initiate and origins that do not, suggesting that the RIP elements can overcome a block to re-initiation imposed after Mcm2-7 associates with origins. Our findings identify a local level of control in the block to re-initiation. This local control creates a complex genomic landscape of re-replication potential that is revealed when global mechanisms preventing re-replication are compromised. Hence, if re-replication does contribute to genomic alterations, as has been speculated for cancer cells, some regions of the genome

  1. Effect of Y Addition on the Mechanical Properties and Microstructure of Zn-Al Alloys

    NASA Astrophysics Data System (ADS)

    Li, Mingyang; Lu, Shujing; Long, Fang; Sheng, Meng; Geng, Haoran; Liu, Wendi

    2015-05-01

    This article will discuss the influence of the rare earth Y on the microstructure and mechanical properties of Zn-Al alloys (ZA27, ZA35, and ZA40), and it will provide reference to rare-earth microalloying through the cast ingot metallurgy process. The results also suggest that the microstructure can be refined and mechanical properties can be improved obviously when adding the right amount of Y, and its tensile strength and brinell hardness increased by 9.1% and 11.7% compared with the unmodified ZA27 alloys, respectively. Compared with non-Y addition, the alloys will form dispersed YZn12 phase, which can strongly pin dislocations and subgrain boundary, inhibiting further recrystallization. On this basis, the impacts of Y on the microstructure and mechanical properties of ZA27, ZA35, and ZA40 have been explored. After adding Y, the microstructures of as-cast Zn-Al alloys are refined at different degree. However, with the increase of Al content, the microstructure shows a certain coarsening and the segregation and shrinkage porosity occur. The most effective refining appears in ZA27-0.4%Y.

  2. Modeling and additive manufacturing of bio-inspired composites with tunable fracture mechanical properties.

    PubMed

    Dimas, Leon S; Buehler, Markus J

    2014-07-01

    Flaws, imperfections and cracks are ubiquitous in material systems and are commonly the catalysts of catastrophic material failure. As stresses and strains tend to concentrate around cracks and imperfections, structures tend to fail far before large regions of material have ever been subjected to significant loading. Therefore, a major challenge in material design is to engineer systems that perform on par with pristine structures despite the presence of imperfections. In this work we integrate knowledge of biological systems with computational modeling and state of the art additive manufacturing to synthesize advanced composites with tunable fracture mechanical properties. Supported by extensive mesoscale computer simulations, we demonstrate the design and manufacturing of composites that exhibit deformation mechanisms characteristic of pristine systems, featuring flaw-tolerant properties. We analyze the results by directly comparing strain fields for the synthesized composites, obtained through digital image correlation (DIC), and the computationally tested composites. Moreover, we plot Ashby diagrams for the range of simulated and experimental composites. Our findings show good agreement between simulation and experiment, confirming that the proposed mechanisms have a significant potential for vastly improving the fracture response of composite materials. We elucidate the role of stiffness ratio variations of composite constituents as an important feature in determining the composite properties. Moreover, our work validates the predictive ability of our models, presenting them as useful tools for guiding further material design. This work enables the tailored design and manufacturing of composites assembled from inferior building blocks, that obtain optimal combinations of stiffness and toughness. PMID:24700202

  3. Design of a mechanical system in gait rehabilitation with progressive addition of weight

    NASA Astrophysics Data System (ADS)

    Braidot, Ariel A. A.; Aleman, Guillermo L.

    2011-12-01

    In this paper we designed and developed a mechanical device for gait rehabilitation based on the application of "partial body weight reduction therapy". An evaluation of the characteristics of devices based on this therapy currently available on the market was carried out obtaining information of the different mechanisms used in it. The device was designed to adapt to different height and weight of patients and to be used with additional equipment in gait rehabilitation, for example, treadmills, elliptical trainers and vertical scalers. It was envisaged to be used by patients with asymmetry in the lower extremities capabilities. We developed a stable structure in steel ASTM A36 which does not depend on the building conditions of the installation site. RamAdvanse software was used to calculate structural stability. A winch with automatic brake mechanism was used to raise/lower the patient, who was tied to a comfortable harness which provided safety to the patient and therapist. It was possible to quantify precisely, using counterweights, the weight borne by the patient during therapy. We obtained a small-sized and ergonomic low-cost prototype, with similar features to those currently considered cutting-edge devices.

  4. The effects of tantalum addition on the microtexture and mechanical behaviour of tungsten for ITER applications

    NASA Astrophysics Data System (ADS)

    Tejado, E.; Carvalho, P. A.; Munoz, A.; Dias, M.; Correia, J. B.; Mardolcar, U. V.; Pastor, J. Y.

    2015-12-01

    Tungsten (W) and its alloys are very promising materials for producing plasma-facing components (PFCs) in the fusion power reactors of the near future, even as a structural part in them. However, whereas the properties of pure tungsten are suitable for a PFC, its structural applications are still limited due to its low toughness, ductile to brittle transition temperature and recrystallization behaviour. Therefore, many efforts have been made to improve its performance by alloying tungsten with other elements. Hence, in this investigation, the thermo-mechanical performance of two new tungsten-tantalum materials has been evaluated. Materials with W-5wt.%Ta and W-15wt.%Ta were processed by mechanical alloying (MA) and later consolidation by hot isostatic pressing (HIP), with distinct settings for each composition. Thus, it was possible to determine the relationship between the microstructure and the addition of Ta with the macroscopic mechanical properties. These were measured by means of hardness, flexural strength and fracture toughness, in the temperature range of 300-1473 K. The microstructure and the fracture surfaces features of the tested materials were analysed by Field Emission Scanning Electron Microscopy (FESEM).

  5. Modeling and additive manufacturing of bio-inspired composites with tunable fracture mechanical properties.

    PubMed

    Dimas, Leon S; Buehler, Markus J

    2014-07-01

    Flaws, imperfections and cracks are ubiquitous in material systems and are commonly the catalysts of catastrophic material failure. As stresses and strains tend to concentrate around cracks and imperfections, structures tend to fail far before large regions of material have ever been subjected to significant loading. Therefore, a major challenge in material design is to engineer systems that perform on par with pristine structures despite the presence of imperfections. In this work we integrate knowledge of biological systems with computational modeling and state of the art additive manufacturing to synthesize advanced composites with tunable fracture mechanical properties. Supported by extensive mesoscale computer simulations, we demonstrate the design and manufacturing of composites that exhibit deformation mechanisms characteristic of pristine systems, featuring flaw-tolerant properties. We analyze the results by directly comparing strain fields for the synthesized composites, obtained through digital image correlation (DIC), and the computationally tested composites. Moreover, we plot Ashby diagrams for the range of simulated and experimental composites. Our findings show good agreement between simulation and experiment, confirming that the proposed mechanisms have a significant potential for vastly improving the fracture response of composite materials. We elucidate the role of stiffness ratio variations of composite constituents as an important feature in determining the composite properties. Moreover, our work validates the predictive ability of our models, presenting them as useful tools for guiding further material design. This work enables the tailored design and manufacturing of composites assembled from inferior building blocks, that obtain optimal combinations of stiffness and toughness.

  6. Counterintuitive mechanisms of the addition of hydrogen and simple olefins to heavy group 13 alkene analogues.

    PubMed

    Caputo, Christine A; Koivistoinen, Juha; Moilanen, Jani; Boynton, Jessica N; Tuononen, Heikki M; Power, Philip P

    2013-02-01

    The mechanism of the reaction of olefins and hydrogen with dimetallenes ArMMAr (Ar = aromatic group; M = Al or Ga) was studied by density functional theory calculations and experimental methods. The digallenes, for which the most experimental data are available, are extensively dissociated to gallanediyl monomers, :GaAr, in hydrocarbon solution, but the calculations and experimental data showed also that they react with simple olefins, such as ethylene, as intact ArGaGaAr dimers via stepwise [2 + 2 + 2] cycloadditions due to their considerably lower activation barriers vis-à-vis the gallanediyl monomers, :GaAr. This pathway was preferred over the [2 + 2] cycloaddition of olefin to monomeric :GaAr to form a gallacyclopropane ring with subsequent dimerization to yield the 1,2-digallacyclobutane intermediate and, subsequently, the 1,4-digallacyclohexane product. The calculations showed also that the addition of H(2) to digallene proceeds by a different mechanism involving the initial addition of one equivalent of H(2) to form a 1,2-dihydride intermediate. This reacts with a second equivalent of H(2) to give two ArGaH(2) fragments which recombine to give the observed product with terminal and bridging H-atoms, Ar(H)Ga(μ-H)(2)Ga(H)Ar. The computations agree with the experimental observation that the :GaAr(iPr(8)) (Ar(iPr(8)) = C(6)H-2,6-(C(6)H(3)-2,4,6-(i)Pr(3))(2)-3,5-(i)Pr(2)), which does not associate even in the solid state, does not react with ethylene or hydrogen. Calculations on the reaction of propene with ArAlAlAr show that, in contrast to the digallenes, addition involves an open-shell transition state consistent with the higher singlet diradical character of dialuminenes.

  7. [Peripheral blood circulation in the skin and the regulatory mechanisms in the course of primary transmural myocardial infarction].

    PubMed

    Khalepo, O V; Molotkov, O V; Eshkina, S L

    2009-01-01

    Laser Doppler flowmetry was used to study the indicators characterizing the peripheral blood circulation in the skin, regulatory mechanisms, and the compensatory capacities of the microcirculatory bed in 32 patients aged 45-60 years in the course of primary transmural myocardial infarction during exercise tests. Significant disturbances of the mechanism responsible for regulating the peripheral blood circulation system and chiefly its active components were detected in the presence of adequate blood filling of microvessels. There was a drastic decrease in the reserves of skin microvascular endothelial activity during ionophoresis of sodium nitroprusside and acetylcholine, the maximum degree of disturbances being observed on day 10 of myocardial infarction development.

  8. ADDITIONAL STRESS AND FRACTURE MECHANICS ANALYSES OF PRESSURIZED WATER REACTOR PRESSURE VESSEL NOZZLES

    SciTech Connect

    Walter, Matthew; Yin, Shengjun; Stevens, Gary; Sommerville, Daniel; Palm, Nathan; Heinecke, Carol

    2012-01-01

    In past years, the authors have undertaken various studies of nozzles in both boiling water reactors (BWRs) and pressurized water reactors (PWRs) located in the reactor pressure vessel (RPV) adjacent to the core beltline region. Those studies described stress and fracture mechanics analyses performed to assess various RPV nozzle geometries, which were selected based on their proximity to the core beltline region, i.e., those nozzle configurations that are located close enough to the core region such that they may receive sufficient fluence prior to end-of-life (EOL) to require evaluation of embrittlement as part of the RPV analyses associated with pressure-temperature (P-T) limits. In this paper, additional stress and fracture analyses are summarized that were performed for additional PWR nozzles with the following objectives: To expand the population of PWR nozzle configurations evaluated, which was limited in the previous work to just two nozzles (one inlet and one outlet nozzle). To model and understand differences in stress results obtained for an internal pressure load case using a two-dimensional (2-D) axi-symmetric finite element model (FEM) vs. a three-dimensional (3-D) FEM for these PWR nozzles. In particular, the ovalization (stress concentration) effect of two intersecting cylinders, which is typical of RPV nozzle configurations, was investigated. To investigate the applicability of previously recommended linear elastic fracture mechanics (LEFM) hand solutions for calculating the Mode I stress intensity factor for a postulated nozzle corner crack for pressure loading for these PWR nozzles. These analyses were performed to further expand earlier work completed to support potential revision and refinement of Title 10 to the U.S. Code of Federal Regulations (CFR), Part 50, Appendix G, Fracture Toughness Requirements, and are intended to supplement similar evaluation of nozzles presented at the 2008, 2009, and 2011 Pressure Vessels and Piping (PVP

  9. Regulatory T cells and dendritic cells in transplantation tolerance: molecular markers and mechanisms.

    PubMed

    Cobbold, Stephen P; Nolan, Kathleen F; Graca, Luis; Castejon, Raquel; Le Moine, Alain; Frewin, Mark; Humm, Susan; Adams, Elizabeth; Thompson, Sara; Zelenika, Diana; Paterson, Alison; Yates, Stephen; Fairchild, Paul J; Waldmann, Herman

    2003-12-01

    Transplantation tolerance can be induced in adult rodents using monoclonal antibodies against coreceptor or costimulation molecules on the surface of T cells. There are currently two well-characterized populations of T cells, demonstrating regulatory capacity: the "natural" CD4+CD25+ T cells and the interleukin (IL)-10-producing Tr1 cells. Although both types of regulatory T cells can induce transplantation tolerance under appropriate conditions, it is not clear whether either one plays any role in drug-induced dominant tolerance, primarily due to a lack of clear-cut molecular or functional markers. Similarly, although dendritic cells (DCs) can be pharmacologically manipulated to promote tolerance, the phenotype of such populations remains poorly defined. We have used serial analysis of gene expression (SAGE) with 29 different T-cell and antigen-presenting cell libraries to identify gene-expression signatures associated with immune regulation. We found that independently derived, regulatory Tr1-like clones were highly concordant in their patterns of gene expression but were quite distinct from CD4+CD25+ regulatory T cells from the spleen. DCs that were treated with the tolerance-enhancing agents IL-10 or vitamin D3 expressed a gene signature reflecting a functional specification in common with the most immature DCs derived from embryonic stem cells. PMID:14617201

  10. Effect of yttrium addition on the microstructure and mechanical properties of ODS RAF steels

    NASA Astrophysics Data System (ADS)

    Auger, M. A.; de Castro, V.; Leguey, T.; Tarcísio-Costa, J.; Monge, M. A.; Muñoz, A.; Pareja, R.

    2014-12-01

    An oxide dispersion strengthened (ODS) alloy with nominal composition Fe-14Cr-2W-0.3Ti-0.24Y (wt.%) was produced by mechanical alloying using elemental powders, and subsequent hot isostatic pressing. The microstructure of the material and characteristics of the oxide particle dispersion were investigated by electron microscopy. The effect of heat treatments on the microhardness and tensile properties at room temperature was also studied. The results show that a fine dispersion of Y-O-rich nanoparticles is achieved, together with larger (Cr, Ti)-rich precipitates. The absence of Ti is apparent in the majority of these nanoparticles, in contrast with reported results for ODS Ti-modified steels processed with Y2O3 addition.

  11. Additive effect of alcohol and nicotine on lipid peroxidation and antioxidant defence mechanism in rats.

    PubMed

    Ashakumary, L; Vijayammal, P L

    1996-01-01

    Cigarette smoking has been established as a major risk factor for atherosclerosis and also for lung cancer. Nicotine is one of the major toxic components of cigarette smoke that is believed to be partly responsible for the deleterious effect of cigarette smoke. Alcohol intake is another major risk factor for the development of cardiovascular disease. Lipid peroxidation is a process associated with the pathogenesis of atherosclerosis. The concentration of lipid peroxides is found to be increased in alcohol-treated rats. On nicotine administration along with alcohol, an additive effect was observed in lipid peroxidation and the antioxidant defence mechanism. The activity of scavenging enzymes superoxide dismutase, catalase and glutathione reductase was found to be decreased, while the activity of glutathione peroxidase and the concentration of glutathione were increased. PMID:8854216

  12. Mechanically tunable aspheric lenses via additive manufacture of hanging elastomeric droplets for microscopic applications

    NASA Astrophysics Data System (ADS)

    Fuh, Yiin-Kuen; Chen, Pin-Wen; Lai, Zheng-Hong

    2016-07-01

    Mechanically deformable lenses with dynamically tunable focal lengths have been developed in this work. The fabricated five types of aspheric polydimethylsiloxane (PDMS) lenses presented here have an initial focal length of 7.0, 7.8, 9.0, 10.0 and 10.2 mm. Incorporating two modes of operation in biconvex and concave-convex configurations, the focal lengths can be tuned dynamically as 5.2-10.2, 5.5-9.9, 6.6-11.9, 6.1-13.5 and 6.6-13.5 mm respectively. Additive manufacturing was utilized to fabricate these five types of aspheric lenses (APLs) via sequential layering of PDMS materials. Complex structures with three-dimensional features and shorter focal lengths can be successfully produced by repeatedly depositing, inverting and curing controlled PDMS volume onto previously cured PDMS droplets. From our experiments, we empirically found a direct dependence of the focal length of the lenses with the amount (volume) of deposited PDMS droplets. This new mouldless, low-cost, and flexible lens fabrication method is able to transform an ordinary commercial smartphone camera into a low-cost portable microscope. A few microscopic features can be readily visualized, such as wrinkles of ladybird pupa and printed circuit board. The fabrication technique by successively applying hanging droplet and facile mechanical focal-length-tuning set-up can be easily adopted in the development of high-performance optical lenses.

  13. Effect of addition of semi refined carrageenan on mechanical characteristics of gum arabic edible film

    NASA Astrophysics Data System (ADS)

    Setyorini, D.; Nurcahyani, P. R.

    2016-04-01

    Currently the seaweed is processed flour and Semi Refined Carraagenan (SRC). However, total production is small, but both of these products have a high value and are used in a wide variety of products such as cosmetics, processed foods, medicines, and edible film. The aim of this study were (1) to determine the effect of SRC on mechanical characteristics of edible film, (2) to determine the best edible film which added by SRC with different concentration. The edible film added by SRC flour which divided into three concentrations of SRC. There are 1.5%; 3%; and 4.5% of SRC, then added 3% glycerol and 0.6% arabic gum. The mechanical properties of the film measured by a universal testing machine Orientec Co. Ltd., while the water vapor permeability measured by the gravimetric method dessicant modified. The experimental design used was completely randomized design with a further test of Duncan. The result show SRC concentration differences affect the elongation breaking point and tensile strength. But not significant effect on the thickness, yield strength and the modulus of elasticity. The best edible film is edible film with the addition of SRC 4.5%.

  14. Mechanical characterization of an additively manufactured Inconel 718 theta-shaped specimen

    SciTech Connect

    Cakmak, Ercan; Watkins, Thomas R.; Bunn, Jeffrey R.; Cornwell, Paris A.; Wang, Yanli; Dehoff, Ryan R.; Babu, Sudarsanam Suresh; Sochalski-Kolbus, Lindsay M.

    2015-11-20

    Two sets of “theta”-shaped specimens were additively manufactured with Inconel 718 powders using an electron beam melting technique with two distinct scan strategies. Light optical microscopy, mechanical testing coupled with a digital image correlation (DIC) technique, finite element modeling, and neutron diffraction with in situ loading characterizations were conducted. The cross-members of the specimens were the focus. Light optical micrographs revealed that different microstructures were formed with different scan strategies. Ex situ mechanical testing revealed each build to be stable under load until ductility was observed on the cross-members before failure. The elastic moduli were determined by forming a correlation between the elastic tensile stresses determined from FEM, and the elastic strains obtained from DIC. The lattice strains were mapped with neutron diffraction during in situ elastic loading; and a good correlation between the average axial lattice strains on the cross-member and those determined from the DIC analysis was found. Lastly, the spatially resolved stresses in the elastic deformation regime are derived from the lattice strains and increased with applied load, showing a consistent distribution along the cross-member.

  15. Mechanical characterization of an additively manufactured Inconel 718 theta-shaped specimen

    DOE PAGES

    Cakmak, Ercan; Watkins, Thomas R.; Bunn, Jeffrey R.; Cornwell, Paris A.; Wang, Yanli; Dehoff, Ryan R.; Babu, Sudarsanam Suresh; Sochalski-Kolbus, Lindsay M.

    2015-11-20

    Two sets of “theta”-shaped specimens were additively manufactured with Inconel 718 powders using an electron beam melting technique with two distinct scan strategies. Light optical microscopy, mechanical testing coupled with a digital image correlation (DIC) technique, finite element modeling, and neutron diffraction with in situ loading characterizations were conducted. The cross-members of the specimens were the focus. Light optical micrographs revealed that different microstructures were formed with different scan strategies. Ex situ mechanical testing revealed each build to be stable under load until ductility was observed on the cross-members before failure. The elastic moduli were determined by forming a correlationmore » between the elastic tensile stresses determined from FEM, and the elastic strains obtained from DIC. The lattice strains were mapped with neutron diffraction during in situ elastic loading; and a good correlation between the average axial lattice strains on the cross-member and those determined from the DIC analysis was found. Lastly, the spatially resolved stresses in the elastic deformation regime are derived from the lattice strains and increased with applied load, showing a consistent distribution along the cross-member.« less

  16. Effects of nitrogen addition on microstructure and mechanical behavior of biomedical Co-Cr-Mo alloys.

    PubMed

    Yamanaka, Kenta; Mori, Manami; Chiba, Akihiko

    2014-01-01

    In the present study, the microstructures and tensile deformation behaviors of biomedical Co-29Cr-6Mo (wt%) alloys containing different concentrations of nitrogen (0-0.24wt%) were systematically investigated. As the nitrogen concentration increased, the volume fraction of athermal ε martensite decreased, because nanoprecipitates hindered the formation of stacking faults (SFs) by acting as obstacles to Shockley partial dislocation formation, and athermal ε martensite usually forms through the regular overlapping of SFs. The formation of the athermal ε martensite was completely suppressed when the nitrogen concentration exceeded 0.10wt%, resulting in a simultaneous improvement in the strength and ductility of the alloys. It was found that the glide of the Shockley partial dislocations and the strain-induced γ (fcc)→ε (hcp) martensitic transformation (SIMT) operated as the primary deformation mechanisms. However, adding nitrogen reduced the work hardening by suppressing the formation of the SFs and preventing the SIMT from taking place. This resulted in an intrinsic decrease in the tensile ductility of the alloys. It is also shown that all the alloys exhibited premature fractures owing to the SIMT. The formation of annealing twins in the γ grains is found to be enhanced by nitrogen addition and to promote the SIMT, resulting in a reduction in the elongation-to-failure due to nitrogen addition. These results should aid in the design of alloys that contain nitrogen.

  17. Mechanisms on electrical breakdown strength increment of polyethylene by aromatic carbonyl compounds addition: a theoretical study.

    PubMed

    Zhang, Hui; Shang, Yan; Wang, Xuan; Zhao, Hong; Han, Baozhong; Li, Zesheng

    2013-12-01

    A theoretical investigation is accomplished on the mechanisms of electrical breakdown strength increment of polyethylene at the atomic and molecular levels. It is found that the addition of aromatic carbonyl compounds as voltage stabilizers is one of the important factors for increasing electrical breakdown strength of polyethylene, as the additives can trap hot electrons, obtain energy of hot electrons, and transform the aliphatic cation to relatively stable aromatic cation to prevent the degradation of the polyethylene matrix. The HOMO-LUMO energy gaps (E(g)), the ionization potentials (IPs), and electron affinities (EAs) at the ground states of a series of aromatic carbonyl compounds are obtained at the B3LYP/6-311+G(d,p) level. The theoretical results are in good agreement with the available experimental findings, show that 2,4-dioctyloxybenzophenone (Bzo) and 4,4'-didodecyloxybenzil (Bd) molecules can effectively increase the electrical breakdown strength when they are doped into polyethylene because of their much smaller E g values than all the other studied aromatic carbonyl molecules and excellent compatibility with polymers matrix.

  18. Beyond Mutations: Additional Mechanisms and Implications of SWI/SNF Complex Inactivation

    PubMed Central

    Marquez, Stefanie B.; Thompson, Kenneth W.; Lu, Li; Reisman, David

    2015-01-01

    SWI/SNF is a major regulator of gene expression. Its role is to facilitate the shifting and exposure of DNA segments within the promoter and other key domains to transcription factors and other essential cellular proteins. This complex interacts with a wide range of proteins and does not function within a single, specific pathway; thus, it is involved in a multitude of cellular processes, including DNA repair, differentiation, development, cell adhesion, and growth control. Given SWI/SNF’s prominent role in these processes, many of which are important for blocking cancer development, it is not surprising that the SWI/SNF complex is targeted during cancer initiation and progression both by mutations and by non-mutational mechanisms. Currently, the understanding of the types of alterations, their frequency, and their impact on the SWI/SNF subunits is an area of intense research that has been bolstered by a recent cadre of NextGen sequencing studies. These studies have revealed mutations in SWI/SNF subunits, indicating that this complex is thus important for cancer development. The purpose of this review is to put into perspective the role of mutations versus other mechanisms in the silencing of SWI/SNF subunits, in particular, BRG1 and BRM. In addition, this review explores the recent development of synthetic lethality and how it applies to this complex, as well as how BRM polymorphisms are becoming recognized as potential clinical biomarkers for cancer risk. Significance: Recent reviews have detailed the occurrence of mutations in nearly all SWI/SNF subunits, which indicates that this complex is an important target for cancer. However, when the frequency of mutations in a given tumor type is compared to the frequency of subunit loss, it becomes clear that other non-mutational mechanisms must play a role in the inactivation of SWI/SNF subunits. Such data indicate that epigenetic mechanisms that are known to regulate BRM may also be involved in the loss of

  19. Biofilm formation by Bacillus subtilis: new insights into regulatory strategies and assembly mechanisms

    PubMed Central

    Cairns, Lynne S; Hobley, Laura; Stanley-Wall, Nicola R

    2014-01-01

    Biofilm formation is a social behaviour that generates favourable conditions for sustained survival in the natural environment. For the Gram-positive bacterium Bacillus subtilis the process involves the differentiation of cell fate within an isogenic population and the production of communal goods that form the biofilm matrix. Here we review recent progress in understanding the regulatory pathways that control biofilm formation and highlight developments in understanding the composition, function and structure of the biofilm matrix. PMID:24988880

  20. De Novo Evolution of Complex, Global and Hierarchical Gene Regulatory Mechanisms

    PubMed Central

    Jenkins, Dafyd J.

    2010-01-01

    Gene regulatory networks exhibit complex, hierarchical features such as global regulation and network motifs. There is much debate about whether the evolutionary origins of such features are the results of adaptation, or the by-products of non-adaptive processes of DNA replication. The lack of availability of gene regulatory networks of ancestor species on evolutionary timescales makes this a particularly difficult problem to resolve. Digital organisms, however, can be used to provide a complete evolutionary record of lineages. We use a biologically realistic evolutionary model that includes gene expression, regulation, metabolism and biosynthesis, to investigate the evolution of complex function in gene regulatory networks. We discover that: (i) network architecture and complexity evolve in response to environmental complexity, (ii) global gene regulation is selected for in complex environments, (iii) complex, inter-connected, hierarchical structures evolve in stages, with energy regulation preceding stress responses, and stress responses preceding growth rate adaptations and (iv) robustness of evolved models to mutations depends on hierarchical level: energy regulation and stress responses tend not to be robust to mutations, whereas growth rate adaptations are more robust and non-lethal when mutated. These results highlight the adaptive and incremental evolution of complex biological networks, and the value and potential of studying realistic in silico evolutionary systems as a way of understanding living systems. Electronic supplementary material The online version of this article (doi:10.1007/s00239-010-9369-4) contains supplementary material, which is available to authorized users. PMID:20680619

  1. The Mechanisms of Water Exchange: The Regulatory Roles of Multiple Interactions in Social Wasps

    PubMed Central

    Agrawal, Devanshu; Karsai, Istvan

    2016-01-01

    Evolutionary benefits of task fidelity and improving information acquisition via multiple transfers of materials between individuals in a task partitioned system have been shown before, but in this paper we provide a mechanistic explanation of these phenomena. Using a simple mathematical model describing the individual interactions of the wasps, we explain the functioning of the common stomach, an information center, which governs construction behavior and task change. Our central hypothesis is a symmetry between foragers who deposit water and foragers who withdraw water into and out of the common stomach. We combine this with a trade-off between acceptance and resistance to water transfer. We ultimately derive a mathematical function that relates the number of interactions that foragers complete with common stomach wasps during a foraging cycle. We use field data and additional model assumptions to calculate values of our model parameters, and we use these to explain why the fullness of the common stomach stabilizes just below 50 percent, why the average number of successful interactions between foragers and the wasps forming the common stomach is between 5 and 7, and why there is a variation in this number of interactions over time. Our explanation is that our proposed water exchange mechanism places natural bounds on the number of successful interactions possible, water exchange is set to optimize mediation of water through the common stomach, and the chance that foragers abort their task prematurely is very low. PMID:26751076

  2. The Mechanisms of Water Exchange: The Regulatory Roles of Multiple Interactions in Social Wasps.

    PubMed

    Agrawal, Devanshu; Karsai, Istvan

    2016-01-01

    Evolutionary benefits of task fidelity and improving information acquisition via multiple transfers of materials between individuals in a task partitioned system have been shown before, but in this paper we provide a mechanistic explanation of these phenomena. Using a simple mathematical model describing the individual interactions of the wasps, we explain the functioning of the common stomach, an information center, which governs construction behavior and task change. Our central hypothesis is a symmetry between foragers who deposit water and foragers who withdraw water into and out of the common stomach. We combine this with a trade-off between acceptance and resistance to water transfer. We ultimately derive a mathematical function that relates the number of interactions that foragers complete with common stomach wasps during a foraging cycle. We use field data and additional model assumptions to calculate values of our model parameters, and we use these to explain why the fullness of the common stomach stabilizes just below 50 percent, why the average number of successful interactions between foragers and the wasps forming the common stomach is between 5 and 7, and why there is a variation in this number of interactions over time. Our explanation is that our proposed water exchange mechanism places natural bounds on the number of successful interactions possible, water exchange is set to optimize mediation of water through the common stomach, and the chance that foragers abort their task prematurely is very low.

  3. The Mechanisms of Water Exchange: The Regulatory Roles of Multiple Interactions in Social Wasps.

    PubMed

    Agrawal, Devanshu; Karsai, Istvan

    2016-01-01

    Evolutionary benefits of task fidelity and improving information acquisition via multiple transfers of materials between individuals in a task partitioned system have been shown before, but in this paper we provide a mechanistic explanation of these phenomena. Using a simple mathematical model describing the individual interactions of the wasps, we explain the functioning of the common stomach, an information center, which governs construction behavior and task change. Our central hypothesis is a symmetry between foragers who deposit water and foragers who withdraw water into and out of the common stomach. We combine this with a trade-off between acceptance and resistance to water transfer. We ultimately derive a mathematical function that relates the number of interactions that foragers complete with common stomach wasps during a foraging cycle. We use field data and additional model assumptions to calculate values of our model parameters, and we use these to explain why the fullness of the common stomach stabilizes just below 50 percent, why the average number of successful interactions between foragers and the wasps forming the common stomach is between 5 and 7, and why there is a variation in this number of interactions over time. Our explanation is that our proposed water exchange mechanism places natural bounds on the number of successful interactions possible, water exchange is set to optimize mediation of water through the common stomach, and the chance that foragers abort their task prematurely is very low. PMID:26751076

  4. Role of Sodium Bicarbonate Cotransporters in Intracellular pH Regulation and Their Regulatory Mechanisms in Human Submandibular Glands.

    PubMed

    Namkoong, Eun; Shin, Yong-Hwan; Bae, Jun-Seok; Choi, Seulki; Kim, Minkyoung; Kim, Nahyun; Hwang, Sung-Min; Park, Kyungpyo

    2015-01-01

    Sodium bicarbonate cotransporters (NBCs) are involved in the pH regulation of salivary glands. However, the roles and regulatory mechanisms among different NBC isotypes have not been rigorously evaluated. We investigated the roles of two different types of NBCs, electroneutral (NBCn1) and electrogenic NBC (NBCe1), with respect to pH regulation and regulatory mechanisms using human submandibular glands (hSMGs) and HSG cells. Intracellular pH (pHi) was measured and the pHi recovery rate from cell acidification induced by an NH4Cl pulse was recorded. Subcellular localization and protein phosphorylation were determined using immunohistochemistry and co-immunoprecipitation techniques. We determined that NBCn1 is expressed on the basolateral side of acinar cells and the apical side of duct cells, while NBCe1 is exclusively expressed on the apical membrane of duct cells. The pHi recovery rate in hSMG acinar cells, which only express NBCn1, was not affected by pre-incubation with 5 μM PP2, an Src tyrosine kinase inhibitor. However, in HSG cells, which express both NBCe1 and NBCn1, the pHi recovery rate was inhibited by PP2. The apparent difference in regulatory mechanisms for NBCn1 and NBCe1 was evaluated by artificial overexpression of NBCn1 or NBCe1 in HSG cells, which revealed that the pHi recovery rate was only inhibited by PP2 in cells overexpressing NBCe1. Furthermore, only NBCe1 was significantly phosphorylated and translocated by NH4Cl, which was inhibited by PP2. Our results suggest that both NBCn1 and NBCe1 play a role in pHi regulation in hSMG acinar cells, and also that Src kinase does not regulate the activity of NBCn1.

  5. Activation of Vago by interferon regulatory factor (IRF) suggests an interferon system-like antiviral mechanism in shrimp.

    PubMed

    Li, Chaozheng; Li, Haoyang; Chen, Yixiao; Chen, Yonggui; Wang, Sheng; Weng, Shao-Ping; Xu, Xiaopeng; He, Jianguo

    2015-01-01

    There is a debate on whether invertebrates possess an antiviral immunity similar to the interferon (IFN) system of vertebrates. The Vago gene from arthropods encodes a viral-activated secreted peptide that restricts virus infection through activating the JAK-STAT pathway and is considered to be a cytokine functionally similar to IFN. In this study, the first crustacean IFN regulatory factor (IRF)-like gene was identified in Pacific white shrimp, Litopenaeus vannamei. The L. vannamei IRF showed similar protein nature to mammalian IRFs and could be activated during virus infection. As a transcriptional regulatory factor, L. vannamei IRF could activate the IFN-stimulated response element (ISRE)-containing promoter to regulate the expression of mammalian type I IFNs and initiate an antiviral state in mammalian cells. More importantly, IRF could bind the 5'-untranslated region of L. vannamei Vago4 gene and activate its transcription, suggesting that shrimp Vago may be induced in a similar manner to that of IFNs and supporting the opinion that Vago might function as an IFN-like molecule in invertebrates. These suggested that shrimp might possess an IRF-Vago-JAK/STAT regulatory axis, which is similar to the IRF-IFN-JAK/STAT axis of vertebrates, indicating that invertebrates might possess an IFN system-like antiviral mechanism.

  6. Activation of Vago by interferon regulatory factor (IRF) suggests an interferon system-like antiviral mechanism in shrimp

    PubMed Central

    Li, Chaozheng; Li, Haoyang; Chen, Yixiao; Chen, Yonggui; Wang, Sheng; Weng, Shao-Ping; Xu, Xiaopeng; He, Jianguo

    2015-01-01

    There is a debate on whether invertebrates possess an antiviral immunity similar to the interferon (IFN) system of vertebrates. The Vago gene from arthropods encodes a viral-activated secreted peptide that restricts virus infection through activating the JAK-STAT pathway and is considered to be a cytokine functionally similar to IFN. In this study, the first crustacean IFN regulatory factor (IRF)-like gene was identified in Pacific white shrimp, Litopenaeus vannamei. The L. vannamei IRF showed similar protein nature to mammalian IRFs and could be activated during virus infection. As a transcriptional regulatory factor, L. vannamei IRF could activate the IFN-stimulated response element (ISRE)-containing promoter to regulate the expression of mammalian type I IFNs and initiate an antiviral state in mammalian cells. More importantly, IRF could bind the 5′-untranslated region of L. vannamei Vago4 gene and activate its transcription, suggesting that shrimp Vago may be induced in a similar manner to that of IFNs and supporting the opinion that Vago might function as an IFN-like molecule in invertebrates. These suggested that shrimp might possess an IRF-Vago-JAK/STAT regulatory axis, which is similar to the IRF-IFN-JAK/STAT axis of vertebrates, indicating that invertebrates might possess an IFN system-like antiviral mechanism. PMID:26459861

  7. Identification of a regulatory loop for the synthesis of neurosteroids: a steroidogenic acute regulatory protein-dependent mechanism involving hypothalamic-pituitary-gonadal axis receptors.

    PubMed

    Meethal, Sivan Vadakkadath; Liu, Tianbing; Chan, Hsien W; Ginsburg, Erika; Wilson, Andrea C; Gray, Danielle N; Bowen, Richard L; Vonderhaar, Barbara K; Atwood, Craig S

    2009-08-01

    Brain sex steroids are derived from both peripheral (primarily gonadal) and local (neurosteroids) sources and are crucial for neurogenesis, neural differentiation and neural function. The mechanism(s) regulating the production of neurosteroids is not understood. To determine whether hypothalamic-pituitary-gonadal axis components previously detected in the extra-hypothalamic brain comprise a feedback loop to regulate neuro-sex steroid (NSS) production, we assessed dynamic changes in expression patterns of steroidogenic acute regulatory (StAR) protein, a key regulator of steroidogenesis, and key hypothalamic-pituitary-gonadal endocrine receptors, by modulating peripheral sex hormone levels in female mice. Ovariectomy (OVX; high serum gonadotropins, low serum sex steroids) had a differential effect on StAR protein levels in the extrahypothalamic brain; increasing the 30- and 32-kDa variants but decreasing the 37-kDa variant and is indicative of cholesterol transport into mitochondria for steroidogenesis. Treatment of OVX animals with E(2), P(4), or E(2) + P(4) for 3 days, which decreases OVX-induced increases in GnRH/gonadotropin production, reversed this pattern. Suppression of gonadotropin levels in OVX mice using the GnRH agonist leuprolide acetate inhibited the processing of the 37-kDa StAR protein into the 30-kDa StAR protein, confirming that the differential processing of brain StAR protein is regulated by gonadotropins. OVX dramatically suppressed extra-hypothalamic brain gonadotropin-releasing hormone 1 receptor expression, and was further suppressed in E(2)- or P(4)-treated OVX mice. Together, these data indicate the existence of endocrine and autocrine/paracrine feedback loops that regulate NSS synthesis. Further delineation of these feedback loops that regulate NSS production will aid in developing therapies to maintain brain sex steroid levels and cognition.

  8. Additional funding mechanisms for Public Hospitals in Greece: the case of Chania Mental Health Hospital

    PubMed Central

    2010-01-01

    Objectives To investigate whether the long term lease of public hospital owned land could be an additional financing mechanism for Greek public (mental) health hospitals. Methods We performed a financial analysis of the official 2008 data of a case - study hospital (Mental Health Hospital of Chania). We used a capital budgeting approach to investigate whether value is created for the public hospital by engaging its assets in a project for the development of a private renal dialysis Unit. Results The development of the private unit in hospital owned land is a good investment decision, as it generates high project Net Present Value and Internal Rate of Return. When the project commences generating operating cash flows, nearly €400.000 will be paid annually to the Mental Health Hospital of Chania as rent, thereby gradually decreasing the annual deficit of the hospital. Conclusions Revenue generated from the long term lease of public hospital land is crucial to gradually eliminate hospital deficit. The Ministry of Health should encourage similar forms of Public Private Partnerships in order to ensure the sustainability of public (mental) hospitals. PMID:21067580

  9. Mechanical properties of SiB6 addition of carbon sintered body

    NASA Astrophysics Data System (ADS)

    Tanaka, Samon; Fukushima, Noriyuki; Matsushita, Jun-ichi; Akatsu, T.; Niihara, K.; Yasuda, E.

    2001-04-01

    Boride material is said as the useful material, which has high melting point and high strength. B4C in carbide is very hard at the next of the diamond and cubic-BN in the Mohs hardness and B4C has excellent chemical stability and high strength. B4C is being used as the polishing material from the hardness. However, it is difficult to make sintered body from high melting point (2623 K). Several silicon boride phases such as SiB4, SiB6, SiB6-x, SiB6+x, and Si11B31, were previously reported. Silicon hexaboride (SiB6) has proved to be a potentially useful material because of its high degree of hardness, moderate melting point (2123 K), and low specific gravity. We studied the preparation of SiB6-B4C-SiC sintered body in this report. We knew experientially that SiB6 reacts with carbon at the high temperature, and forms B4C or SiC. Carbon addition SiB6 sintered body produced by hot pressing and reaction sintering that sintering condition was 1973 K for 3.6 ks in vacuum under a pressure of 25 MPa. The relative density of sintered bodies (SiB6-0,5,10,15 wt%C) was approximately 100%. Characterization of mechanical properties was used indentation, Vickers hardness and thermal

  10. Effect of green propolis addition to physical-mechanical properties of glass ionomer cements

    PubMed Central

    TROCA, Valéria Barros Pereira Barbosa; FERNANDES, Karen Barros Parron; TERRILE, Amélia Elena; MARCUCCI, Maria Cristina; de ANDRADE, Flaviana Bombarda; WANG, Linda

    2011-01-01

    Objective This study investigated the mechanical properties of glass ionomer cements (GICs) combined with propolis as a natural antimicrobial substance Material and Methods Typified green propolis, as an ethanolic extract (EEP) or in the lyophilized form (powder), was incorporated to specimens of Ketac Fil Plus, ChemFlex and Ketac Molar Easymix GICs. For each test, 8 specimens of each material were prepared. For water sorption and solubility tests, specimens were subjected to dehydration, hydration and re-dehydration cycles until a constant mass was obtained for each step. Measurements were recorded using a digital balance of 10-4 g precision. For the diametral tensile strength test, specimens were tested in a universal test machine at 0.5 mm/min crosshead speed after 24 h storage in deionized water. Data were evaluated by one-way ANOVA and Tukey’s tests (p<0.05). Results The addition of propolis to GIC clearly increased water sorption compared to pure material. Solubility was material-dependent and was not clearly evident. For the diametral tensile strength test, association with propolis altered negatively only Chemflex. Conclusion It may be concluded that incorporation of propolis to GICs alters some properties in a material-dependent condition. PMID:21552709

  11. Effect of Ag and Pb Addition on Microstructural and Mechanical Properties of SAC 105 Solders

    NASA Astrophysics Data System (ADS)

    Molnar, Aliz; Janovszky, Dora; Kardos, Ibolya; Molnar, Istvan; Gacsi, Zoltan

    2015-10-01

    Melting and crystallization processes of lead-free and lead-contaminated alloys in near-equilibrium state were investigated. In addition, the effect of silver content up to 4 wt.% on the microstructure of Sn-Ag-Cu alloys was studied. The volume fraction of β-Sn decreased by half owing to 4 wt.% Ag content. Furthermore, contamination by lead strongly influences the properties of the solidified microstructure. The Pb grains appear as a result of two processes when the Pb content is equal to 0.5 wt.% or higher: Pb phase solidifies in the quaternary eutectic at 176°C, and Pb grains precipitate from the primary β-Sn solid solution grain during a solid state reaction. The freezing range enlarges to 51°C due to 2 wt.% Pb content owing to quaternary eutectic. Above 1 wt.% Pb content, the mechanical properties also improve due to grains of quaternary eutectic Pb and precipitated Pb grains with a size <1 μm.

  12. Genome-Wide Analysis of Wilms’ Tumor 1-Controlled Gene Expression in Podocytes Reveals Key Regulatory Mechanisms

    PubMed Central

    Kann, Martin; Ettou, Sandrine; Jung, Youngsook L.; Lenz, Maximilian O.; Taglienti, Mary E.; Park, Peter J.; Schermer, Bernhard

    2015-01-01

    The transcription factor Wilms’ tumor suppressor 1 (WT1) is key to podocyte development and viability; however, WT1 transcriptional networks in podocytes remain elusive. We provide a comprehensive analysis of the genome-wide WT1 transcriptional network in podocytes in vivo using chromatin immunoprecipitation followed by sequencing (ChIPseq) and RNA sequencing techniques. Our data show a specific role for WT1 in regulating the podocyte-specific transcriptome through binding to both promoters and enhancers of target genes. Furthermore, we inferred a podocyte transcription factor network consisting of WT1, LMX1B, TCF21, Fox-class and TEAD family transcription factors, and MAFB that uses tissue-specific enhancers to control podocyte gene expression. In addition to previously described WT1-dependent target genes, ChIPseq identified novel WT1-dependent signaling systems. These targets included components of the Hippo signaling system, underscoring the power of genome-wide transcriptional-network analyses. Together, our data elucidate a comprehensive gene regulatory network in podocytes suggesting that WT1 gene regulatory function and podocyte cell-type specification can best be understood in the context of transcription factor-regulatory element network interplay. PMID:25636411

  13. Mosaic gene network modelling identified new regulatory mechanisms in HCV infection.

    PubMed

    Popik, Olga V; Petrovskiy, Evgeny D; Mishchenko, Elena L; Lavrik, Inna N; Ivanisenko, Vladimir A

    2016-06-15

    Modelling of gene networks is widely used in systems biology to study the functioning of complex biological systems. Most of the existing mathematical modelling techniques are useful for analysis of well-studied biological processes, for which information on rates of reactions is available. However, complex biological processes such as those determining the phenotypic traits of organisms or pathological disease processes, including pathogen-host interactions, involve complicated cross-talk between interacting networks. Furthermore, the intrinsic details of the interactions between these networks are often missing. In this study, we developed an approach, which we call mosaic network modelling, that allows the combination of independent mathematical models of gene regulatory networks and, thereby, description of complex biological systems. The advantage of this approach is that it allows us to generate the integrated model despite the fact that information on molecular interactions between parts of the model (so-called mosaic fragments) might be missing. To generate a mosaic mathematical model, we used control theory and mathematical models, written in the form of a system of ordinary differential equations (ODEs). In the present study, we investigated the efficiency of this method in modelling the dynamics of more than 10,000 simulated mosaic regulatory networks consisting of two pieces. Analysis revealed that this approach was highly efficient, as the mean deviation of the dynamics of mosaic network elements from the behaviour of the initial parts of the model was less than 10%. It turned out that for construction of the control functional, data on perturbation of one or two vertices of the mosaic piece are sufficient. Further, we used the developed method to construct a mosaic gene regulatory network including hepatitis C virus (HCV) as the first piece and the tumour necrosis factor (TNF)-induced apoptosis and NF-κB induction pathways as the second piece. Thus

  14. Mosaic gene network modelling identified new regulatory mechanisms in HCV infection.

    PubMed

    Popik, Olga V; Petrovskiy, Evgeny D; Mishchenko, Elena L; Lavrik, Inna N; Ivanisenko, Vladimir A

    2016-06-15

    Modelling of gene networks is widely used in systems biology to study the functioning of complex biological systems. Most of the existing mathematical modelling techniques are useful for analysis of well-studied biological processes, for which information on rates of reactions is available. However, complex biological processes such as those determining the phenotypic traits of organisms or pathological disease processes, including pathogen-host interactions, involve complicated cross-talk between interacting networks. Furthermore, the intrinsic details of the interactions between these networks are often missing. In this study, we developed an approach, which we call mosaic network modelling, that allows the combination of independent mathematical models of gene regulatory networks and, thereby, description of complex biological systems. The advantage of this approach is that it allows us to generate the integrated model despite the fact that information on molecular interactions between parts of the model (so-called mosaic fragments) might be missing. To generate a mosaic mathematical model, we used control theory and mathematical models, written in the form of a system of ordinary differential equations (ODEs). In the present study, we investigated the efficiency of this method in modelling the dynamics of more than 10,000 simulated mosaic regulatory networks consisting of two pieces. Analysis revealed that this approach was highly efficient, as the mean deviation of the dynamics of mosaic network elements from the behaviour of the initial parts of the model was less than 10%. It turned out that for construction of the control functional, data on perturbation of one or two vertices of the mosaic piece are sufficient. Further, we used the developed method to construct a mosaic gene regulatory network including hepatitis C virus (HCV) as the first piece and the tumour necrosis factor (TNF)-induced apoptosis and NF-κB induction pathways as the second piece. Thus

  15. Mechanism of concentration addition toxicity: they are different for nonpolar narcotic chemicals, polar narcotic chemicals and reactive chemicals.

    PubMed

    Lin, Zhifen; Du, Jianwei; Yin, Kedong; Wang, Liansheng; Yu, Hongxia

    2004-03-01

    According to the toxicity mechanism of the individual chemicals, the concentration addition toxicity mechanism is revealed for nonpolar-narcotic-chemical mixtures, polar-narcotic-chemical mixtures and reactive-chemical mixtures, respectively. For nonpolar-narcotic-chemical mixtures, the partitioning of individual chemicals from water to biophase was determined, and the result shows that their concentration additive effect results from no competitive partitioning among individual chemicals. For polar-narcotic-chemical mixtures, their toxicity are contributed by two factors (the total baseline toxicity and the hydrogen bond donor activity of individual chemicals), and it is the concentration additive effect for either of these two factors that leads to their concentration addition toxicity. In addition, the interactions between the reactive chemicals and the biological macromolecules are discussed thoroughly. The results suggest that the net effect of these interactions is zero, and it is this zero net effect that leads to the concentration addition toxicity mechanism for reactive-chemical mixtures.

  16. Nicotiana tabacum protoplasts secretome can evidence relations among regulatory elements of exocytosis mechanisms.

    PubMed

    Ul-Rehman, Reiaz; Rinalducci, Sara; Zolla, Lello; Dalessandro, Giuseppe; Di Sansebastiano, Gian Pietro

    2011-08-01

    An alternative study involving proteome analysis of the 24 hour Nicotiana tabacum protoplast culture medium was performed with the aim to confirm relations among regulatory elements of exocytotic processes. Protoplasts present many convenient features to study cellular processes during transient over-expression or suppression of specific gene's products. We performed a proteomic analysis of the culture medium fraction of protoplasts transiently expressing transgenes for 24 hours to characterize the effect of various regulatory proteins dominant negative mutants. A total number of 49 spots were found reproducible in the medium. 24 of these spots were identified with nano RP-HPLC-ESI-MS/MS. Only three and six spots were respectively identified as canonical and non-canonical secreted cell wall proteins. The low number of spots present in the culture medium fraction allowed us the ambitious experiment to analyze the influence of various SNAREs (SYP121, SYP122, SNAP33) and Rab (Rab11) dominant negative mutants. Missing a reasonable number of identified proteins the analyses gave rise to a similarity matrix statistically analyzed considering variation within the presence of 24 spots reproducible in presence of transient over-expression of SNAREs (SYP121 and SYP122) and Rab11 native cDNAs. The similarity confirmed the closer relation between the function of SYP122 and Rab11 as evidenced by the secRGUS based analysis. This analysis included the effect of SNAP33 DN mutant and showed that this Qb-c-SNARE influence both SYP121 and SYP122 SNARE complexes.

  17. Additive manufacturing of Inconel 718 using electron beam melting: Processing, post-processing, & mechanical properties

    NASA Astrophysics Data System (ADS)

    Sames, William James, V.

    Additive Manufacturing (AM) process parameters were studied for production of the high temperature alloy Inconel 718 using Electron Beam Melting (EBM) to better understand the relationship between processing, microstructure, and mechanical properties. Processing parameters were analyzed for impact on process time, process temperature, and the amount of applied energy. The applied electron beam energy was shown to be integral to the formation of swelling defects. Standard features in the microstructure were identified, including previously unidentified solidification features such as shrinkage porosity and non-equilibrium phases. The as-solidified structure does not persist in the bulk of EBM parts due to a high process hold temperature (˜1000°C), which causes in situ homogenization. The most significant variability in as-fabricated microstructure is the formation of intragranular delta-phase needles, which can form in samples produced with lower process temperatures (< 960°C). A novel approach was developed and demonstrated for controlling the temperature of cool down, thus providing a technique for in situ heat treatment of material. This technique was used to produce material with hardness of 478+/-7 HV with no post-processing, which exceeds the hardness of peak-aged Inconel 718. Traditional post-processing methods of hot isostatic pressing (HIP) and solution treatment and aging (STA) were found to result in variability in grain growth and phase solution. Recrystallization and grain structure are identified as possible mechanisms to promote grain growth. These results led to the conclusion that the first step in thermal post-processing of EBM Inconel 718 should be an optimized solution treatment to reset phase variation in the as-fabricated microstructure without incurring significant grain growth. Such an optimized solution treatment was developed (1120°C, 2hr) for application prior to aging or HIP. The majority of as-fabricated tensile properties met ASTM

  18. High-precision, in vitro validation of the sequestration mechanism for generating ultrasensitive dose-response curves in regulatory networks.

    PubMed

    Ricci, Francesco; Vallée-Bélisle, Alexis; Plaxco, Kevin W

    2011-10-01

    Our ability to recreate complex biochemical mechanisms in designed, artificial systems provides a stringent test of our understanding of these mechanisms and opens the door to their exploitation in artificial biotechnologies. Motivated by this philosophy, here we have recapitulated in vitro the "target sequestration" mechanism used by nature to improve the sensitivity (the steepness of the input/output curve) of many regulatory cascades. Specifically, we have employed molecular beacons, a commonly employed optical DNA sensor, to recreate the sequestration mechanism and performed an exhaustive, quantitative study of its key determinants (e.g., the relative concentrations and affinities of probe and depletant). We show that, using sequestration, we can narrow the pseudo-linear range of a traditional molecular beacon from 81-fold (i.e., the transition from 10% to 90% target occupancy spans an 81-fold change in target concentration) to just 1.5-fold. This narrowing of the dynamic range improves the sensitivity of molecular beacons to that equivalent of an oligomeric, allosteric receptor with a Hill coefficient greater than 9. Following this we have adapted the sequestration mechanism to steepen the binding-site occupancy curve of a common transcription factor by an order of magnitude over the sensitivity observed in the absence of sequestration. Given the success with which the sequestration mechanism has been employed by nature, we believe that this strategy could dramatically improve the performance of synthetic biological systems and artificial biosensors.

  19. Potential Novel Mechanism for Axenfeld-Rieger Syndrome: Deletion of a Distant Region Containing Regulatory Elements of PITX2

    PubMed Central

    Volkmann, Bethany A.; Zinkevich, Natalya S.; Mustonen, Aki; Schilter, Kala F.; Bosenko, Dmitry V.; Reis, Linda M.; Broeckel, Ulrich; Link, Brian A.

    2011-01-01

    Purpose. Mutations in PITX2 are associated with Axenfeld-Rieger syndrome (ARS), which involves ocular, dental, and umbilical abnormalities. Identification of cis-regulatory elements of PITX2 is important to better understand the mechanisms of disease. Methods. Conserved noncoding elements surrounding PITX2/pitx2 were identified and examined through transgenic analysis in zebrafish; expression pattern was studied by in situ hybridization. Patient samples were screened for deletion/duplication of the PITX2 upstream region using arrays and probes. Results. Zebrafish pitx2 demonstrates conserved expression during ocular and craniofacial development. Thirteen conserved noncoding sequences positioned within a gene desert as far as 1.1 Mb upstream of the human PITX2 gene were identified; 11 have enhancer activities consistent with pitx2 expression. Ten elements mediated expression in the developing brain, four regions were active during eye formation, and two sequences were associated with craniofacial expression. One region, CE4, located approximately 111 kb upstream of PITX2, directed a complex pattern including expression in the developing eye and craniofacial region, the classic sites affected in ARS. Screening of ARS patients identified an approximately 7600-kb deletion that began 106 to 108 kb upstream of the PITX2 gene, leaving PITX2 intact while removing regulatory elements CE4 to CE13. Conclusions. These data suggest the presence of a complex distant regulatory matrix within the gene desert located upstream of PITX2 with an essential role in its activity and provides a possible mechanism for the previous reports of ARS in patients with balanced translocations involving the 4q25 region upstream of PITX2 and the current patient with an upstream deletion. PMID:20881290

  20. Transcriptional regulatory network triggered by oxidative signals configures the early response mechanisms of japonica rice to chilling stress

    PubMed Central

    2010-01-01

    Background The transcriptional regulatory network involved in low temperature response leading to acclimation has been established in Arabidopsis. In japonica rice, which can only withstand transient exposure to milder cold stress (10°C), an oxidative-mediated network has been proposed to play a key role in configuring early responses and short-term defenses. The components, hierarchical organization and physiological consequences of this network were further dissected by a systems-level approach. Results Regulatory clusters responding directly to oxidative signals were prominent during the initial 6 to 12 hours at 10°C. Early events mirrored a typical oxidative response based on striking similarities of the transcriptome to disease, elicitor and wounding induced processes. Targets of oxidative-mediated mechanisms are likely regulated by several classes of bZIP factors acting on as1/ocs/TGA-like element enriched clusters, ERF factors acting on GCC-box/JAre-like element enriched clusters and R2R3-MYB factors acting on MYB2-like element enriched clusters. Temporal induction of several H2O2-induced bZIP, ERF and MYB genes coincided with the transient H2O2 spikes within the initial 6 to 12 hours. Oxidative-independent responses involve DREB/CBF, RAP2 and RAV1 factors acting on DRE/CRT/rav1-like enriched clusters and bZIP factors acting on ABRE-like enriched clusters. Oxidative-mediated clusters were activated earlier than ABA-mediated clusters. Conclusion Genome-wide, physiological and whole-plant level analyses established a holistic view of chilling stress response mechanism of japonica rice. Early response regulatory network triggered by oxidative signals is critical for prolonged survival under sub-optimal temperature. Integration of stress and developmental responses leads to modulated growth and vigor maintenance contributing to a delay of plastic injuries. PMID:20100339

  1. Possible additional antidepressant-like mechanism of sodium butyrate: targeting the hippocampus.

    PubMed

    Han, Arum; Sung, Yu-Bin; Chung, Soo-Young; Kwon, Min-Soo

    2014-06-01

    Chromatin remodeling mediated by histone acetylation might be involved in the pathophysiology and the treatment of depression. Recently, it has been reported that the histone deacetylase (HDAC) inhibitors, such as sodium butyrate (SB), could be a potential therapeutic agent for depression treatment. In the present study, we aimed to clarify the antidepressant mechanism of SB in the hippocampus. The mice were exposed to chronic restraint stress (CRS) for 14 consecutive days (2 h/day) to induce depression-like behaviors. To assess depression-like behaviors, sucrose preference test, light dark test (LD), tail suspension test (TST), and forced swim test (FST) were performed after CRS. We observed that CRS decreased HDAC2 and 5 mRNA and protein levels in the hippocampus. In addition, SB co-treatment decreased the depression-like behaviors that are induced by CRS. SB prevented and normalized the phosphorylation of cAMP response element binding protein (pCREB), acetylation of histone H3 (AceH3), HDAC2, and brain-derived neurotrophic factor (BDNF) expression level that were decreased by CRS in the hippocampus. These results suggest that the decreased HDAC2 and 5 expressions in the hippocampus of CRS may be a type of spontaneous coping response against CRS. However, it seems to be unsuccessful to prevent depression induction since reduction of pCREB, AceH3 and BDNF were accompanied by CRS in the hippocampus. Moreover, the reduced AceH3 level may be associated with the decreased pCREB, which appears to lead to the decreased BDNF.

  2. Mechanics of additively manufactured porous biomaterials based on the rhombicuboctahedron unit cell.

    PubMed

    Hedayati, R; Sadighi, M; Mohammadi-Aghdam, M; Zadpoor, A A

    2016-01-01

    Thanks to recent developments in additive manufacturing techniques, it is now possible to fabricate porous biomaterials with arbitrarily complex micro-architectures. Micro-architectures of such biomaterials determine their physical and biological properties, meaning that one could potentially improve the performance of such biomaterials through rational design of micro-architecture. The relationship between the micro-architecture of porous biomaterials and their physical and biological properties has therefore received increasing attention recently. In this paper, we studied the mechanical properties of porous biomaterials made from a relatively unexplored unit cell, namely rhombicuboctahedron. We derived analytical relationships that relate the micro-architecture of such porous biomaterials, i.e. the dimensions of the rhombicuboctahedron unit cell, to their elastic modulus, Poisson's ratio, and yield stress. Finite element models were also developed to validate the analytical solutions. Analytical and numerical results were compared with experimental data from one of our recent studies. It was found that analytical solutions and numerical results show a very good agreement particularly for smaller values of apparent density. The elastic moduli predicted by analytical and numerical models were in very good agreement with experimental observations too. While in excellent agreement with each other, analytical and numerical models somewhat over-predicted the yield stress of the porous structures as compared to experimental data. As the ratio of the vertical struts to the inclined struts, α, approaches zero and infinity, the rhombicuboctahedron unit cell respectively approaches the octahedron (or truncated cube) and cube unit cells. For those limits, the analytical solutions presented here were found to approach the analytic solutions obtained for the octahedron, truncated cube, and cube unit cells, meaning that the presented solutions are generalizations of the

  3. A meta-analysis of caloric restriction gene expression profiles to infer common signatures and regulatory mechanisms.

    PubMed

    Plank, Michael; Wuttke, Daniel; van Dam, Sipko; Clarke, Susan A; de Magalhães, João Pedro

    2012-04-01

    Caloric restriction, a reduction in calorie intake without malnutrition, retards age-related degeneration and extends lifespan in several organisms. CR induces multiple changes, yet its underlying mechanisms remain poorly understood. In this work, we first performed a meta-analysis of microarray CR studies in mammals and identified genes and processes robustly altered due to CR. Our results reveal a complex array of CR-induced changes and we re-identified several genes and processes previously associated with CR, such as growth hormone signalling, lipid metabolism and immune response. Moreover, our results highlight novel associations with CR, such as retinol metabolism and copper ion detoxification, as well as hint of a strong effect of CR on circadian rhythms that in turn may contribute to metabolic changes. Analyses of our signatures by integrating co-expression data, information on genetic mutants, and transcription factor binding site analysis revealed candidate regulators of transcriptional modules in CR. Our results hint at a transcriptional module involved in sterol metabolism regulated by Srebf1. A putative regulatory role of Ppara was also identified. Overall, our conserved molecular signatures of CR provide a comprehensive picture of CR-induced changes and help understand its regulatory mechanisms.

  4. Antigen-specific expansion of human regulatory T cells as a major tolerance mechanism against mucosal fungi.

    PubMed

    Bacher, P; Kniemeyer, O; Schönbrunn, A; Sawitzki, B; Assenmacher, M; Rietschel, E; Steinbach, A; Cornely, O A; Brakhage, A A; Thiel, A; Scheffold, A

    2014-07-01

    Foxp3(+) regulatory T cells (Treg) have a central role for keeping the balance between pro- and anti-inflammatory immune responses against chronically encountered antigens at mucosal sites. However, their antigen specificity especially in humans is largely unknown. Here we used a sensitive enrichment technology for antigen-reactive T cells to directly compare the conventional vs. regulatory CD4(+) T-cell response directed against two ubiquitous mucosal fungi, Aspergillus fumigatus and Candida albicans. In healthy humans, fungus-specific CD4(+)CD25(+)CD127(-)Foxp3(+) Treg are strongly expanded in peripheral blood and possess phenotypic, epigenetic and functional features of thymus-derived Treg. Intriguingly, for A. fumigatus, the strong Treg response contrasts with minimal conventional T-cell memory, indicating selective Treg expansion as an effective mechanism to prevent inappropriate immune activation in healthy individuals. By contrast, in subjects with A. fumigatus allergies, specific Th2 cells were strongly expanded despite the presence of specific Treg. Taken together, we demonstrate a largely expanded Treg population specific for mucosal fungi as part of the physiological human T-cell repertoire and identify a unique capacity of A. fumigatus to selectively generate Treg responses as a potentially important mechanism for the prevention of allergic reactions.

  5. Regulatory mechanisms of ethylene biosynthesis in response to various stimuli during maturation and ripening in fig fruit (Ficus carica L.).

    PubMed

    Owino, W O; Manabe, Y; Mathooko, F M; Kubo, Y; Inaba, A

    2006-01-01

    In order to obtain a greater uniformity of maturation, the growth of the fig fruit (Ficus carica L.) can be stimulated by the application of either olive oil, ethrel/ethephon or auxin. The three treatments induce ethylene production in figs. In this study, we investigated the regulatory mechanisms responsible for oil, auxin and ethylene induced ethylene production in figs. The ethylene production in response to olive oil, auxin, and propylene treatments and during ripening were all induced by 1-methylcyclopropene (1-MCP) and inhibited by propylene indicating a negative feedback regulation mechanism. Three 1-aminocyclopropane-1-carboxylic acid (ACC) synthase genes (Fc-ACS1, Fc-ACS2 and Fc-ACS3) and one ACC oxidase gene (Fc-ACO1) were isolated and their expression patterns in response to either oil, propylene or auxin treatment in figs determined. The expression patterns of Fc-ACS1 and Fc-ACO1 were clearly inhibited by 1-MCP and induced by propylene in oil treated and ripe fruits indicating positive regulation by ethylene, whereas Fc-ACS2 gene expression was induced by 1-MCP and inhibited by propylene indicating negative regulation by ethylene. The Fc-ACS3 mRNA showed high level accumulation in the auxin treated fruit. The inhibition of Fc-ACS3 gene by 1-MCP in oil treated and in ripe fruits suggests that auxin and ethylene modulate the expression of this gene by multi-responsive signal transduction pathway mechanisms. We further report that the olive oil-induced ethylene in figs involves the ACC-dependent pathway and that multiple ethylene regulatory pathways are involved during maturation and ripening in figs and each specific pathway depends on the inducer/stimulus. PMID:16889975

  6. Pyruvate dehydrogenase kinase regulatory mechanisms and inhibition in treating diabetes, heart ischemia, and cancer.

    PubMed

    Roche, T E; Hiromasa, Y

    2007-04-01

    The fraction of pyruvate dehydrogenase complex (PDC) in the active form is reduced by the activities of dedicated PD kinase isozymes (PDK1, PDK2, PDK3 and PDK4). Via binding to the inner lipoyl domain (L2) of the dihydrolipoyl acetyltransferase (E2 60mer), PDK rapidly access their E2-bound PD substrate. The E2-enhanced activity of the widely distributed PDK2 is limited by dissociation of ADP from its C-terminal catalytic domain, and this is further slowed by pyruvate binding to the N-terminal regulatory (R) domain. Via the reverse of the PDC reaction, NADH and acetyl-CoA reductively acetylate lipoyl group of L2, which binds to the R domain and stimulates PDK2 activity by speeding up ADP dissociation. Activation of PDC by synthetic PDK inhibitors binding at the pyruvate or lipoyl binding sites decreased damage during heart ischemia and lowered blood glucose in insulin-resistant animals. PDC activation also triggers apoptosis in cancer cells that selectively convert glucose to lactate. PMID:17310282

  7. Immunomodulation of mesenchymal stromal cells on regulatory T cells and its possible mechanism.

    PubMed

    Yan, Zhidong; Zhuansun, Yongxun; Chen, Rui; Li, Jianguo; Ran, Pixin

    2014-05-15

    Mesenchymal stromal cells (MSCs) and regulatory T cells (Tregs) have both garnered abundant interests from immunologists worldwide, as both MSCs and Tregs can be considered immunosuppressive in their own right. But a little attention has been paid to the impacts of MSCs on Tregs. To clarify the effects of MSCs on Tregs, we performed the coculture systems within MSCs and Tregs. We confirmed that MSC-exposed Tregs are capable of more immunosuppressive than Tregs without coculturing with MSCs. And this augmenting suppressive capacity was accompanied with an upregulation of programmed cell death 1 receptor (PD-1) on Tregs. Importantly, we found that cell viability of Tregs was excluded from the influences of MSCs. Finally, we showed that PD-1/B7-H1 interactions and IL-10 might be responsible for the enhanced suppressive capability of MSC-exposed Tregs. Further analysis revealed that PD-1/B7-H1 interactions were not responsible for the productions of IL-10 and TGF-β1 in the MSC-Treg coculture systems; in contrast, IL-10 rather than TGF-β1 played a role in the upregualtion of PD-1. Furthermore, this is the first explorative study to evaluate the immunomodulation of MSCs on the suppressive capacity of Tregs in MSC-Treg in vitro coculture setting.

  8. Discovery of Novel Splice Variants and Regulatory Mechanisms for Microsomal Triglyceride Transfer Protein in Human Tissues

    PubMed Central

    Suzuki, Takashi; Swift, Larry L.

    2016-01-01

    Microsomal triglyceride transfer protein (MTP) is a unique lipid transfer protein essential for the assembly of triglyceride-rich lipoproteins by the liver and intestine. Previous studies in mice identified a splice variant of MTP with an alternate first exon. Splice variants of human MTP have not been reported. Using PCR approaches we have identified two splice variants in human tissues, which we have named MTP-B and MTP-C. MTP-B has a unique first exon (Ex1B) located 10.5 kb upstream of the first exon (Ex1A) for canonical MTP (MTP-A); MTP-C contains both first exons for MTP-A and MTP-B. MTP-B was found in a number of tissues, whereas MTP-C was prominent in brain and testis. MTP-B does not encode a protein; MTP-C encodes the same protein encoded by MTP-A, although MTP-C translation is strongly inhibited by regulatory elements within its 5′-UTR. Using luciferase assays, we demonstrate that the promoter region upstream of exon 1B is quite adequate to drive expression of MTP. We conclude that alternate splicing plays a key role in regulating cellular MTP levels by introducing distinct promoter regions and unique 5′-UTRs, which contain elements that alter translation efficiency, enabling the cell to optimize MTP activity. PMID:27256115

  9. Structure of the Yeast Polarity Protein Sro7 Reveals a SNARE Regulatory Mechanism

    SciTech Connect

    Hattendorf, D.A.; Andreeva, A.; Gangar, A.; Brennwald, P.J.; Weis, W.I.; /Stanford U., Med. School /North Carolina U.

    2007-07-09

    Polarized exocytosis requires coordination between the actin cytoskeleton and the exocytic machinery responsible for fusion of secretory vesicles at specific sites on the plasma membrane. Fusion requires formation of a complex between a vesicle-bound R-SNARE and plasma membrane Qa, Qb and Qc SNARE proteins. Proteins in the lethal giant larvae protein family, including lethal giant larvae and tomosyn in metazoans and Sro7 in yeast, interact with Q-SNAREs and are emerging as key regulators of polarized exocytosis. The crystal structure of Sro7 reveals two seven-bladed WD40 {beta}-propellers followed by a 60-residue-long 'tail', which is bound to the surface of the amino-terminal propeller. Deletion of the Sro7 tail enables binding to the Qbc SNARE region of Sec9 and this interaction inhibits SNARE complex assembly. The N-terminal domain of Sec9 provides a second, high-affinity Sro7 interaction that is unaffected by the tail. The results suggest that Sro7 acts as an allosteric regulator of exocytosis through interactions with factors that control the tail. Sequence alignments indicate that lethal giant larvae and tomosyn have a two-{beta}-propeller fold similar to that of Sro7, but only tomosyn appears to retain the regulatory tail.

  10. Discovery of Novel Splice Variants and Regulatory Mechanisms for Microsomal Triglyceride Transfer Protein in Human Tissues.

    PubMed

    Suzuki, Takashi; Swift, Larry L

    2016-01-01

    Microsomal triglyceride transfer protein (MTP) is a unique lipid transfer protein essential for the assembly of triglyceride-rich lipoproteins by the liver and intestine. Previous studies in mice identified a splice variant of MTP with an alternate first exon. Splice variants of human MTP have not been reported. Using PCR approaches we have identified two splice variants in human tissues, which we have named MTP-B and MTP-C. MTP-B has a unique first exon (Ex1B) located 10.5 kb upstream of the first exon (Ex1A) for canonical MTP (MTP-A); MTP-C contains both first exons for MTP-A and MTP-B. MTP-B was found in a number of tissues, whereas MTP-C was prominent in brain and testis. MTP-B does not encode a protein; MTP-C encodes the same protein encoded by MTP-A, although MTP-C translation is strongly inhibited by regulatory elements within its 5'-UTR. Using luciferase assays, we demonstrate that the promoter region upstream of exon 1B is quite adequate to drive expression of MTP. We conclude that alternate splicing plays a key role in regulating cellular MTP levels by introducing distinct promoter regions and unique 5'-UTRs, which contain elements that alter translation efficiency, enabling the cell to optimize MTP activity. PMID:27256115

  11. Regulatory Light Chain Mutations Associated with Cardiomyopathy Affect Myosin Mechanics and Kinetics

    PubMed Central

    Greenberg, Michael J.; Watt, James D.; Jones, Michelle; Kazmierczak, Katarzyna; Szczesna-Cordary, Danuta; Moore, Jeffrey R.

    2009-01-01

    The myosin regulatory light chain (RLC) wraps around the alpha helical neck region of myosin. This neck region has been proposed to act as a lever arm, amplifying small conformational changes in the myosin head to generate motion. The RLC serves an important structural role, supporting the myosin neck region and a modulatory role, tuning the kinetics of the actin myosin interaction. Given the importance of the RLC, it is not surprising that mutations of the RLC can lead to familial hypertrophic cardiomyopathy (FHC), the leading cause of sudden cardiac death in people under 30. Population studies identified two FHC mutations located near the cationic binding site of the RLC, R58Q and N47K. Although these mutations are close in sequence, they differ in clinical presentation and prognosis with R58Q showing a more severe phenotype. We examined the molecular based changes in myosin that are responsible for the disease phenotype by purifying myosin from transgenic mouse hearts expressing mutant myosins and examining actin filament sliding using the in vitro motility assay. We found that both R58Q and N47K showed reductions in force compared to the wild type that could result in compensatory hypertrophy. Furthermore, we observed a higher ATPase rate and an increased activation at submaximal calcium levels for the R58Q myosin that could lead to decreased efficiency and incomplete cardiac relaxation, potentially explaining the more severe phenotype for the R58Q mutation. PMID:18929571

  12. On multiple regulatory mechanisms in the tryptophan operon system in Escherichia coli: in silico study of perturbation dynamics.

    PubMed

    Nguyen, Lan K; Kulasiri, Don

    2008-01-01

    Living organisms often exist in uncertain environments where changes are the norm. Cellular systems therefore require resilient regulatory mechanisms for timely and stable adaptation. Among various regulation motifs, multiple feedback control emerges as a common theme. The tryptophan operon system in Escherichia coli regulates the production ofintracellular tryptophan using an apparatus of three feedback mechanisms: repression, attenuation and enzyme inhibition; each provides essentially the same function but operates in distinctly different ways. Here we aim to understand the roles of each loop by studying transient dynamics of the system to perturbations of different types; to reveal the underlying relationships between individual control mechanisms and macroscopic behaviour. We develop an S-systems approximation of an existing model for the system and characterise transient dynamics by introducing two measurable quantities: maximum disturbance (MD) and recovery time (RT). Our simulation results showed that combined regulation using all three feedback mechanisms significantly increases system stability, broadening the range of kinetic parameters for stable behaviour. Enzyme inhibition was shown to directly control the disturbance level in system variables after perturbations. Attenuation, on the other hand, was found to speed up system recovery whereas repression lengthens recovery time. The method developed in this paper and the defined transient dynamics measurements can be applied to other cellular systems. PMID:19374133

  13. Analysis of microRNA and Gene Expression Profiles in Multiple Sclerosis: Integrating Interaction Data to Uncover Regulatory Mechanisms

    PubMed Central

    Freiesleben, Sherry; Hecker, Michael; Zettl, Uwe Klaus; Fuellen, Georg; Taher, Leila

    2016-01-01

    MicroRNAs (miRNAs) have been reported to contribute to the pathophysiology of multiple sclerosis (MS), an inflammatory disorder of the central nervous system. Here, we propose a new consensus-based strategy to analyse and integrate miRNA and gene expression data in MS as well as other publically available data to gain a deeper understanding of the role of miRNAs in MS and to overcome the challenges posed by studies with limited patient sample sizes. We processed and analysed microarray datasets, and compared the expression of genes and miRNAs in the blood of MS patients and controls. We then used our consensus and integration approach to construct two molecular networks dysregulated in MS: a miRNA- and a gene-based network. We identified 18 differentially expressed (DE) miRNAs and 128 DE genes that may contribute to the regulatory alterations behind MS. The miRNAs were linked to immunological and neurological pathways, and we exposed let-7b-5p and miR-345-5p as promising blood-derived disease biomarkers in MS. The results suggest that DE miRNAs are more informative than DE genes in uncovering pathways potentially involved in MS. Our findings provide novel insights into the regulatory mechanisms and networks underlying MS. PMID:27694855

  14. Catalytic control in the EGF Receptor and its connection to general kinase regulatory mechanisms

    PubMed Central

    Jura, Natalia; Zhang, Xuewu; Endres, Nicholas F.; Seeliger, Markus A.; Schindler, Thomas; Kuriyan, John

    2011-01-01

    Summary In contrast to the active conformations of protein kinases, which are essentially the same for all kinases, inactive kinase conformations are structurally diverse. Some inactive conformations are, however, observed repeatedly in different kinases, perhaps reflecting an important role in catalysis. In this review, we analyze one of these recurring conformations, first identified in CDK and Src kinases, which turned out to be central to understanding of how kinase domain of the EGF receptor is activated. This mechanism, which involves the stabilization of the active conformation of an α helix, has features in common with mechanisms operative in several other kinases. PMID:21474065

  15. Regulatory mechanisms differ in UMP kinases from gram-negative and gram-positive bacteria.

    PubMed

    Evrin, Cécile; Straut, Monica; Slavova-Azmanova, Neli; Bucurenci, Nadia; Onu, Adrian; Assairi, Liliane; Ionescu, Mihaela; Palibroda, Nicolae; Bârzu, Octavian; Gilles, Anne-Marie

    2007-03-01

    In this work, we examined the regulation by GTP and UTP of the UMP kinases from eight bacterial species. The enzyme from Gram-positive organisms exhibited cooperative kinetics with ATP as substrate. GTP decreased this cooperativity and increased the affinity for ATP. UTP had the opposite effect, as it decreased the enzyme affinity for ATP. The nucleotide analogs 5-bromo-UTP and 5-iodo-UTP were 5-10 times stronger inhibitors than the parent compound. On the other hand, UMP kinases from the Gram-negative organisms did not show cooperativity in substrate binding and catalysis. Activation by GTP resulted mainly from the reversal of inhibition caused by excess UMP, and inhibition by UTP was accompanied by a strong increase in the apparent K(m) for UMP. Altogether, these results indicate that, depending on the bacteria considered, GTP and UTP interact with different enzyme recognition sites. In Gram-positive bacteria, GTP and UTP bind to a single site or largely overlapping sites, shifting the T R equilibrium to either the R or T form, a scenario corresponding to almost all regulatory proteins, commonly called K systems. In Gram-negative organisms, the GTP-binding site corresponds to the unique allosteric site of the Gram-positive bacteria. In contrast, UTP interacts cooperatively with a site that overlaps the catalytic center, i.e. the UMP-binding site and part of the ATP-binding site. These characteristics make UTP an original regulator of UMP kinases from Gram-negative organisms, beyond the common scheme of allosteric control.

  16. TGF-β-Induced Regulatory T Cells Directly Suppress B Cell Responses through a Noncytotoxic Mechanism.

    PubMed

    Xu, Anping; Liu, Ya; Chen, Weiqian; Wang, Julie; Xue, Youqiu; Huang, Feng; Rong, Liming; Lin, Jin; Liu, Dahai; Yan, Mei; Li, Quan-Zhen; Li, Bin; Song, Jianxun; Olsen, Nancy; Zheng, Song Guo

    2016-05-01

    Foxp3(+) regulatory T cells (Treg) playing a crucial role in the maintenance of immune tolerance and prevention of autoimmune diseases consist of thymus-derived naturally occurring CD4(+)Foxp3(+) Treg cells (nTreg) and those that can be induced ex vivo with TGF-β (iTreg). Although both Treg subsets share similar phenotypes and functional characteristics, they also have potential biologic differences on their biology. The role of iTreg in regulating B cells remains unclear so far. The suppression assays of Treg subsets on activation, proliferation, and Abs production of B cells were measured using a Treg and B cell coculture system in vitro. Transwell and Ab blockade experiments were performed to assess the roles of cell contact and soluble cytokines. Treg were adoptively transferred to lupus mice to assess in vivo effects on B cells. Like nTreg, iTreg subset also directly suppressed activation and proliferation of B cells. nTreg subset suppressed B cell responses through cytotoxic manner related to expression of granzyme A, granzyme B, and perforin, whereas the role of iTreg subset on B cells did not involve in cytotoxic action but depending on TGF-β signaling. Furthermore, iTreg subset can significantly suppress Ab produced by lupus B cells in vitro. Comparison experiments using autoantibodies microarrays demonstrated that adoptive transfer of iTreg had a superior effect than nTreg subset on suppressing lupus B cell responses in vivo. Our data implicate a role and advantage of iTreg subset in treating B cell-mediated autoimmune diseases, boosting the translational potential of these findings. PMID:27001954

  17. [Regulatory role of mechanical stress response in cellular function: development of new drugs and tissue engineering].

    PubMed

    Momose, Kazutaka; Matsuda, Takehisa; Oike, Masahiro; Obara, Kazuo; Laher, Ismail; Sugiura, Seiryo; Ohata, Hisayuki; Nakayama, Koichi

    2003-02-01

    The investigation of mechanotransduction in the cardiovascular system is essentially important for elucidating the cellular and molecular mechanisms involved in not only the maintenance of hemodynamic homeostasis but also etiology of cardiovascular diseases including arteriosclerosis. The present review summarizes the latest research performed by six academic groups, and presented at the 75th Annual Meeting of the Japanese Pharmacological Society. Technology of cellular biomechanics is also required for research and clinical application of a vascular hybrid tissue responding to pulsatile stress. 1) Vascular tissue engineering: Design of pulsatile stress-responsive scaffold and in vivo vascular wall reconstruction (T. Matsuda); 2) Cellular mechanisms of mechanosensitive calcium transients in vascular endothelium (M. Oike et al.); 3) Cross-talk of stimulation with fluid flow and lysophosphatidic acid in vascular endothelial cells (K. Momose et al.); 4) Mechanotransduction of vascular smooth muscles: Rate-dependent stretch-induced protein phosphorylations and contractile activation (K. Obara et al.); 5) Lipid mediators in vascular myogenic tone (I. Laher et al.); and 6) Caldiomyocyte regulates its mechanical output in response to mechanical load (S. Sugiura et al.).

  18. Reactive oxygen species regulatory mechanisms associated with rapid response of MC3T3-E1 cells for vibration stress.

    PubMed

    Zhang, Ling; Gan, Xueqi; Zhu, Zhuoli; Yang, Yang; He, Yuting; Yu, Haiyang

    2016-02-12

    Although many previous studies have shown that refractory period-dependent memory effect of vibration stress is anabolic for skeletal homeostasis, little is known about the rapid response of osteoblasts simply derived from vibration itself. In view of the potential role of reactive oxygen species (ROS) in mediating differentiated activity of osteoblasts, whether and how ROS regulates the rapid effect of vibration deserve to be demonstrated. Our findings indicated that MC3T3-E1 cells underwent decreased gene expression of Runx2, Col-I and ALP and impaired ALP activity accompanied by increased mitochondrial fission immediately after vibration loading. Moreover, we also revealed the involvement of ERK-Drp1 signal transduction in ROS regulatory mechanisms responsible for the rapid effect of vibration stress.

  19. Reactive oxygen species regulatory mechanisms associated with rapid response of MC3T3-E1 cells for vibration stress.

    PubMed

    Zhang, Ling; Gan, Xueqi; Zhu, Zhuoli; Yang, Yang; He, Yuting; Yu, Haiyang

    2016-02-12

    Although many previous studies have shown that refractory period-dependent memory effect of vibration stress is anabolic for skeletal homeostasis, little is known about the rapid response of osteoblasts simply derived from vibration itself. In view of the potential role of reactive oxygen species (ROS) in mediating differentiated activity of osteoblasts, whether and how ROS regulates the rapid effect of vibration deserve to be demonstrated. Our findings indicated that MC3T3-E1 cells underwent decreased gene expression of Runx2, Col-I and ALP and impaired ALP activity accompanied by increased mitochondrial fission immediately after vibration loading. Moreover, we also revealed the involvement of ERK-Drp1 signal transduction in ROS regulatory mechanisms responsible for the rapid effect of vibration stress. PMID:26802466

  20. Single-Nucleotide Mutations in FMR1 Reveal Novel Functions and Regulatory Mechanisms of the Fragile X Syndrome Protein FMRP

    PubMed Central

    Suhl, Joshua A.; Warren, Stephen T.

    2015-01-01

    Fragile X syndrome is a monogenic disorder and a common cause of intellectual disability. Despite nearly 25 years of research on FMR1, the gene underlying the syndrome, very few pathological mutations other than the typical CGG-repeat expansion have been reported. This is in contrast to other X-linked, monogenic, intellectual disability disorders, such as Rett syndrome, where many point mutations have been validated as causative of the disorder. As technology has improved and significantly driven down the cost of sequencing, allowing for whole genes to be sequenced with relative ease, in-depth sequencing studies on FMR1 have recently been performed. These studies have led to the identification of novel variants in FMR1, where some of which have been functionally evaluated and are likely pathogenic. In this review, we discuss recently identified FMR1 variants, the ways these novel variants cause dysfunction, and how they reveal new regulatory mechanisms and functionalities of the gene. PMID:26819560

  1. Mechanical properties of PLA/PCL blends crosslinked by electron beam and TAIC additive

    NASA Astrophysics Data System (ADS)

    Malinowski, Rafał

    2016-10-01

    Investigation of the effect of electron radiation on selected mechanical properties of polylactide/polycaprolactone blends containing triallyl isocyanurate was the objective of the present paper. It was found that triallyl isocyanurate is an effective agent that hinders phase separation and links macromolecules of both the same and the different polymers. As a consequence of this, strength and modulus of elasticity of studied blends rise, while elongation at break as well as impact strength decrease. Moreover, some mechanical properties of crosslinked polylactide/polycaprolactone blends may also result from the partial degradation of polylactide phase after irradiation.

  2. Investigation of molecular mechanisms and regulatory pathways of pro-angiogenic nanorods

    NASA Astrophysics Data System (ADS)

    Nethi, Susheel Kumar; Veeriah, Vimal; Barui, Ayan Kumar; Rajendran, Saranya; Mattapally, Saidulu; Misra, Sanjay; Chatterjee, Suvro; Patra, Chitta Ranjan

    2015-05-01

    Angiogenesis, a process involving the growth of new blood vessels from the pre-existing vasculature, plays a crucial role in various pathophysiological conditions. We have previously demonstrated that europium hydroxide [EuIII(OH)3] nanorods (EHNs) exhibit pro-angiogenic properties through the generation of reactive oxygen species (ROS) and mitogen activated protein kinase (MAPK) activation. Considering the enormous implication of angiogenesis in cardiovascular diseases (CVDs) and cancer, it is essential to understand in-depth molecular mechanisms and signaling pathways in order to develop the most efficient and effective alternative treatment strategy for CVDs. However, the exact underlying mechanism and cascade signaling pathways behind the pro-angiogenic properties exhibited by EHNs still remain unclear. Herein, we report for the first time that the hydrogen peroxide (H2O2), a redox signaling molecule, generated by these EHNs activates the endothelial nitric oxide synthase (eNOS) that promotes the nitric oxide (NO) production in a PI3K (phosphoinositide 3-kinase)/Akt dependent manner, eventually triggering angiogenesis. We intensely believe that the investigation and understanding of the in-depth molecular mechanism and signaling pathways of EHNs induced angiogenesis will help us in developing an effective alternative treatment strategy for cardiovascular related and ischemic diseases where angiogenesis plays an important role.Angiogenesis, a process involving the growth of new blood vessels from the pre-existing vasculature, plays a crucial role in various pathophysiological conditions. We have previously demonstrated that europium hydroxide [EuIII(OH)3] nanorods (EHNs) exhibit pro-angiogenic properties through the generation of reactive oxygen species (ROS) and mitogen activated protein kinase (MAPK) activation. Considering the enormous implication of angiogenesis in cardiovascular diseases (CVDs) and cancer, it is essential to understand in-depth molecular

  3. [Research Progress of NOS3 Participation in Regulatory Mechanisms of Cardiovascular Diseases].

    PubMed

    Sun, Ting; Chi, Qingjia; Wang, Guixue

    2016-02-01

    Cardiovascular disease has been a major threat to human's health and lives for many years. It is of great importance to explore the mechanisms and develop strategies to prevent the pathogenesis. Generally, cardiovascular disease is associated with endothelial dysfunction, which is closely related to the nitric oxide (NO)-mediated vasodilatation. The release of NO is regulated by NOS3 gene in mammals' vascular system. A great deal of evidences have shown that the polymorphism and epigenetic of NOS3 gene play vital roles in the pathological process of cardiovascular disease. To gain insights into the role of NOS3 in the cardiovascular diseases, we reviewed the molecular mechanisms underlying the development of cardiovascular diseases in this paper, including the uncoupling of NOS3 protein, epigenetic and polymorphism of NOS3 gene. The review can also offer possible strategies to prevent and treat cardiovascular diseases. PMID:27382763

  4. Transport mechanism and regulatory properties of the human amino acid transporter ASCT2 (SLC1A5).

    PubMed

    Scalise, Mariafrancesca; Pochini, Lorena; Panni, Simona; Pingitore, Piero; Hedfalk, Kristina; Indiveri, Cesare

    2014-11-01

    The kinetic mechanism of the transport catalyzed by the human glutamine/neutral amino acid transporter hASCT2 over-expressed in P. pastoris was determined in proteoliposomes by pseudo-bi-substrate kinetic analysis of the Na(+)-glutamineex/glutaminein transport reaction. A random simultaneous mechanism resulted from the experimental analysis. Purified functional hASCT2 was chemically cross-linked to a stable dimeric form. The oligomeric structure correlated well with the kinetic mechanism of transport. Half-saturation constants (Km) of the transporter for the other substrates Ala, Ser, Asn and Thr were measured both on the external and internal side. External Km were much lower than the internal ones confirming the asymmetry of the transporter. The electric nature of the transport reaction was determined imposing a negative inside membrane potential generated by K(+) gradients in the presence of valinomycin. The transport reaction resulted to be electrogenic and the electrogenicity originated from external Na(+). Internal Na(+) exerted a stimulatory effect on the transport activity which could be explained by a regulatory, not a counter-transport, effect. Native and deglycosylated hASCT2 extracted from HeLa showed the same transport features demonstrating that the glycosyl moiety has no role in transport function. Both in vitro and in vivo interactions of hASCT2 with the scaffold protein PDZK1 were revealed.

  5. Regulatory mechanisms of RNA function: emerging roles of DNA repair enzymes.

    PubMed

    Jobert, Laure; Nilsen, Hilde

    2014-07-01

    The acquisition of an appropriate set of chemical modifications is required in order to establish correct structure of RNA molecules, and essential for their function. Modification of RNA bases affects RNA maturation, RNA processing, RNA quality control, and protein translation. Some RNA modifications are directly involved in the regulation of these processes. RNA epigenetics is emerging as a mechanism to achieve dynamic regulation of RNA function. Other modifications may prevent or be a signal for degradation. All types of RNA species are subject to processing or degradation, and numerous cellular mechanisms are involved. Unexpectedly, several studies during the last decade have established a connection between DNA and RNA surveillance mechanisms in eukaryotes. Several proteins that respond to DNA damage, either to process or to signal the presence of damaged DNA, have been shown to participate in RNA quality control, turnover or processing. Some enzymes that repair DNA damage may also process modified RNA substrates. In this review, we give an overview of the DNA repair proteins that function in RNA metabolism. We also discuss the roles of two base excision repair enzymes, SMUG1 and APE1, in RNA quality control.

  6. Antiwear performance and mechanism of an oil-miscible ionic liquid as a lubricant additive.

    PubMed

    Qu, Jun; Bansal, Dinesh G; Yu, Bo; Howe, Jane Y; Luo, Huimin; Dai, Sheng; Li, Huaqing; Blau, Peter J; Bunting, Bruce G; Mordukhovich, Gregory; Smolenski, Donald J

    2012-02-01

    An ionic liquid (IL) trihexyltetradecylphosphonium bis(2-ethylhexyl) phosphate has been investigated as a potential antiwear lubricant additive. Unlike most other ILs that have very low solubility in nonpolar fluids, this IL is fully miscible with various hydrocarbon oils. In addition, it is thermally stable up to 347 °C, showed no corrosive attack to cast iron in an ambient environment, and has excellent wettability on solid surfaces (e.g., contact angle on cast iron <8°). Most importantly, this phosphonium-based IL has demonstrated effective antiscuffing and antiwear characteristics when blended with lubricating oils. For example, a 5 wt % addition into a synthetic base oil eliminated the scuffing failure experienced in neat oil and, as a result, reduced the friction coefficient by 60% and the wear rate by 3 orders of magnitude. A synergistic effect on wear protection was observed with the current antiwear additive when added into a fully formulated engine oil. Nanostructure examination and composition analysis revealed a tribo-boundary film and subsurface plastic deformation zone for the metallic surface lubricated by the IL-containing lubricants. This protective boundary film is believed to be responsible for the IL's antiscuffing and antiwear functionality. PMID:22248297

  7. Dissolution and mechanical behaviors of recrystallized carbamazepine from alcohol solution in the presence of additives

    NASA Astrophysics Data System (ADS)

    Nokhodchi, A.; Bolourtchian, N.; Dinarvand, R.

    2005-02-01

    Carbamazepine (CBZ) crystals were grown from pure ethanol solutions containing various additives (PEG 4000, PVP K30 or Tween 80). Physical characteristics of the crystals were studied for the morphology of crystals using scanning electron microscope, for the identification of polymorphism by X-ray powder diffraction (XRPD) and FT-IR, and for thermodynamic properties using differential scanning calorimetery (DSC). The dissolution behaviour of various carbamazepine crystals was also studied by dissolution apparatus II at pH 7.4 containing 1% sodium lauryl sulphate (SLS). The scanning electron micrograph (SEM) studies showed that the presence of the additives in the solutions growth medium affected the morphology and size of carbamazepine crystals. SEMs of untreated and treated carbamazepine crystals obtained from alcohol containing PEG 4000, PVP K30 or Tween 80 showed that the crystal shape of untreated carbamazepine is flaky or thin plate-like, whereas the crystals obtained from alcohol containing no additive, PEG 4000, PVP K30 or Tween 80 are polyhedral prismatic, block-shaped, polyhedral or hexagonal, respectively. XRPD, FT-IR and DSC results showed that the untreated CBZ was form III and recrystallization of CBZ in the absence or presence of the additives did not cause any polymorphic changes. The results showed that the higher dissolution rate and compact strength were observed for the crystals obtained in the presence of PVP K30. The presence of the additives in crystallization medium alters crystal morphology of carbamazepine, but only the samples crystallized in the presence of PVP K30 showed an improvement in dissolution rate and tensile strength.

  8. Effect of sulfonation and diethanolamine addition on the mechanical and physicochemical properties of SEPS copolymer

    NASA Astrophysics Data System (ADS)

    Patiño, D.; Correa, E.; Acevedo-Morantes, M.

    2016-02-01

    Modification techniques have been developed to achieve changes in the processing of polymers, and modification of their mechanical, thermal and morphological properties, as well as their hydrophobicity and conductivity. Sulfonation improves ion conductivity, antistatic behaviour, hydrophilicity and solubility of the polymers. These characteristics are related to the presence of sulfonic groups in the polymer matrix. This research project focuses on the evaluation of mechanical, physical and chemical properties of membranes that are based on a sulfonated Styrene-Ethylene-Propylene-Styrene (SEPS) copolymer. The membranes were functionalized with diethanolamine at 5, 15 and 30% w/w, to separate carbon dioxide. FTIR and XRD analyses were used to characterize the membranes. The sulfonated-loaded membrane with 15% of diethanolamine showed the best results in each characterization.

  9. Process for improving mechanical properties of epoxy resins by addition of cobalt ions

    NASA Technical Reports Server (NTRS)

    Stoakley, D. M.; St.clair, A. K. (Inventor)

    1984-01-01

    A resin product useful as an adhesive, composite or casting resin is described as well as the process used in its preparation to improve its flexural strength mechanical property characteristics. Improved flexural strength is attained with little or no change in density, thermal stability or moisture resistance by chemically incorporating 1.2% to 10.6% by weight Co(3) ions in an epoxidized resin system.

  10. [Research progress in biofilm formation and regulatory mechanism of Campylobacter jejuni].

    PubMed

    Wu, Qingping; Zhong, Xian; Zhang, Jumei

    2016-02-01

    Biofilm of Campylobacter jejuni was formed by cross-linking its extracellular secretion, polysaccharides, various extracellular proteins, nucleic acids etc to enhance its survival in hostile environments, especially for detergents, antibiotics and disinfectants. This paper elaborated C. jejuni biofilm formation and regulation mechanisms in the surface properties of the media, temperatures, gas environment, the regulation of gene etc, also analysed and discussed a variety of biofilm removal practical applications. We hope it can provide a reference for studies on biofilm control of C. jejuni. PMID:27373066

  11. Influence of polymer addition on the mechanical properties of a premixed calcium phosphate cement

    PubMed Central

    Engstrand, Johanna; Persson, Cecilia; Engqvist, Håkan

    2013-01-01

    Premixed calcium phosphate cements can reduce handling complications that are associated with the mixing of cements in the operating room. However, to extend the clinical indication of ceramic cements their mechanical properties need to be further improved. The incorporation of a polymeric material with intrinsically high tensile properties could possibly assist in increasing the mechanical properties of calcium phosphate cement. In this study polymer microparticles made from poly(lactid-co-glycolide) plasticised with poly(ethylene glycol) 400 (PLGA/PEG microparticles) were added in amounts of up to 5 wt% to a premixed acidic calcium phosphate cement. The PLGA/PEG microparticles added undergo a shape transformation at 37 °C, which could give a better integration between polymer microparticles and ceramic cement compared with polymer microparticles lacking this property. The results showed that the incorporation of 1.25 wt% PLGA/PEG microparticles increased the compressive strength by approximately 20% up to 15.1 MPa while the diametral tensile strength was kept constant. The incorporation of PLGA/PEG microparticles increased the brushite to monetite ratio after setting compared with pure ceramic cements. In conclusion, small amounts of PLGA/PEG microparticles can be incorporated into premixed acidic calcium phosphate cement and increase their mechanical properties, which could lead to increased future applications. PMID:24270588

  12. A global regulatory mechanism for activating an exon network required for neurogenesis.

    PubMed

    Raj, Bushra; Irimia, Manuel; Braunschweig, Ulrich; Sterne-Weiler, Timothy; O'Hanlon, Dave; Lin, Zhen-Yuan; Chen, Ginny I; Easton, Laura E; Ule, Jernej; Gingras, Anne-Claude; Eyras, Eduardo; Blencowe, Benjamin J

    2014-10-01

    The vertebrate and neural-specific Ser/Arg (SR)-related protein nSR100/SRRM4 regulates an extensive program of alternative splicing with critical roles in nervous system development. However, the mechanism by which nSR100 controls its target exons is poorly understood. We demonstrate that nSR100-dependent neural exons are associated with a unique configuration of intronic cis-elements that promote rapid switch-like regulation during neurogenesis. A key feature of this configuration is the insertion of specialized intronic enhancers between polypyrimidine tracts and acceptor sites that bind nSR100 to potently activate exon inclusion in neural cells while weakening 3' splice site recognition and contributing to exon skipping in nonneural cells. nSR100 further operates by forming multiple interactions with early spliceosome components bound proximal to 3' splice sites. These multifaceted interactions achieve dominance over neural exon silencing mediated by the splicing regulator PTBP1. The results thus illuminate a widespread mechanism by which a critical neural exon network is activated during neurogenesis. PMID:25219497

  13. Effects of chemical mechanical planarization slurry additives on the agglomeration of alumina nanoparticles II: aggregation rate analysis.

    PubMed

    Brahma, Neil; Talbot, Jan B

    2014-04-01

    The aggregation rate and mechanism of 150 nm alumina particles in 1mM KNO3 with various additives used in chemical mechanical planarization of copper were investigated. The pH of each suspension was ∼8 such that the aggregation rate was slow enough to be measured and analyzed over ∼120 min. In general, an initial exponential growth was observed for most suspensions indicating reaction-limited aggregation. After aggregate sizes increase to >500 nm, the rate followed a power law suggesting diffusion-limited aggregation. Stability ratios and fractal dimension numbers were also calculated to further elucidate the aggregation mechanism. PMID:24491325

  14. The Influence of Early Life Nutrition on Epigenetic Regulatory Mechanisms of the Immune System

    PubMed Central

    Paparo, Lorella; di Costanzo, Margherita; di Scala, Carmen; Cosenza, Linda; Leone, Ludovica; Nocerino, Rita; Berni Canani, Roberto

    2014-01-01

    The immune system is exquisitely sensitive to environmental changes. Diet constitutes one of the major environmental factors that exerts a profound effect on immune system development and function. Epigenetics is the study of mitotically heritable, yet potentially reversible, molecular modifications to DNA and chromatin without alteration to the underlying DNA sequence. Nutriepigenomics is an emerging discipline examining the role of dietary influences on gene expression. There is increasing evidence that the epigenetic mechanisms that regulate gene expression during immune differentiation are directly affected by dietary factors or indirectly through modifications in gut microbiota induced by different dietary habits. Short-chain fatty acids, in particular butyrate, produced by selected bacteria stains within gut microbiota, are crucial players in this network. PMID:25353665

  15. The T box mechanism: tRNA as a regulatory molecule

    PubMed Central

    Green, Nicholas J.; Grundy, Frank J.; Henkin, Tina M.

    2009-01-01

    The T box mechanism is widely used in Gram-positive bacteria to regulate expression of aminoacyl-tRNA synthetase genes and genes involved in amino acid biosynthesis and uptake. Binding of a specific uncharged tRNA to a riboswitch element in the nascent transcript causes a structural change in the transcript that promotes expression of the downstream coding sequence. In most cases, this occurs by stabilization of an antiterminator element that competes with formation of a terminator helix. Specific tRNA recognition by the nascent transcript results in increased expression of genes important for tRNA aminoacylation in response to decreased pools of charged tRNA. PMID:19932103

  16. [The defense and regulatory mechanisms during development of legume-Rhizobium symbiosis].

    PubMed

    Glian'ko, A K; Akimova, G P; Sokolova, M G; Makarova, L E; Vasil'eva, G G

    2007-01-01

    The roles of indolylacetic acid, the peroxidase system, catalase, active oxygen species, and phenolic compounds in the physiological and biochemical mechanisms involved in the autoregulation of nodulation in the developing legume-Rhizobium symbiosis were studied. It was inferred that the concentration of indolylacetic acid in the roots of inoculated plants, controlled by the enzymes of the peroxidase complex, is the signal permitting or limiting nodulation at the initial stages of symbiotic interaction. Presumably, the change in the level of active oxygen species is determined by an antioxidant activity of phenolic compounds. During the development of symbiosis, phytohormones, antioxidant enzymes, and active oxygen species may be involved in the regulation of infection via both a direct antibacterial action and regulation of functional activity of the host plant defense systems. PMID:17619575

  17. New effector functions and regulatory mechanisms of BCL6 in normal and malignant lymphocytes

    PubMed Central

    Bunting, Karen L.; Melnick, Ari M.

    2014-01-01

    The BCL6 oncogenic repressor is a master regulator of humoral immunity and B-cell lymphoma survival. Whereas much research has focused on its regulation and function in germinal center B-cells, its role in other mature lymphoid cell compartments is less clear. A novel role for BCL6 in follicular T helper cell development was recently uncovered. The latest discoveries reveal that BCL6 is also an important regulator of other specialized helper T-cell subsets within germinal centers, pre-germinal center events, and peripheral T-cells effector functions. Here, we review newly discovered roles for BCL6 in lymphocyte subsets residing within and outside of germinal centers, and discuss their implications with respect to the molecular mechanisms of BCL6 regulation and potential links to B and T-cell lymphomas. PMID:23725655

  18. Early decrease in dietary protein:energy ratio by fat addition and ontogenetic changes in muscle growth mechanisms of rainbow trout: short- and long-term effects.

    PubMed

    Alami-Durante, Hélène; Cluzeaud, Marianne; Duval, Carine; Maunas, Patrick; Girod-David, Virginia; Médale, Françoise

    2014-09-14

    As the understanding of the nutritional regulation of muscle growth mechanisms in fish is fragmentary, the present study aimed to (1) characterise ontogenetic changes in muscle growth-related genes in parallel to changes in muscle cellularity; (2) determine whether an early decrease in dietary protein:energy ratio by fat addition affects the muscle growth mechanisms of rainbow trout (Oncorhynchus mykiss) alevins; and (3) determine whether this early feeding of a high-fat (HF) diet to alevins had a long-term effect on muscle growth processes in juveniles fed a commercial diet. Developmental regulation of hyperplasia and hypertrophy was evidenced at the molecular (expression of myogenic regulatory factors, proliferating cell nuclear antigen and myosin heavy chains (MHC)) and cellular (number and diameter of white muscle fibres) levels. An early decrease in dietary protein:energy ratio by fat addition stimulated the body growth of alevins but led to a fatty phenotype, with accumulation of lipids in the anterior part, and less caudal muscle when compared at similar body weights, due to a decrease in both the white muscle hyperplasia and maximum hypertrophy of white muscle fibres. These HF diet-induced cellular changes were preceded by a very rapid down-regulation of the expression of fast-MHC. The present study also demonstrated that early dietary composition had a long-term effect on the subsequent muscle growth processes of juveniles fed a commercial diet for 3 months. When compared at similar body weights, initially HF diet-fed juveniles indeed had a lower mean diameter of white muscle fibres, a smaller number of large white muscle fibres, and lower expression levels of MyoD1 and myogenin. These findings demonstrated the strong effect of early feed composition on the muscle growth mechanisms of trout alevins and juveniles.

  19. Mechanism of hydrofluoric acid formation in ethylene carbonate electrolytes with fluorine salt additives

    NASA Astrophysics Data System (ADS)

    Tebbe, Jonathon L.; Fuerst, Thomas F.; Musgrave, Charles B.

    2015-11-01

    We utilized density functional theory to examine HF generation in lithium-ion battery electrolytes from reactions between H2O and the decomposition products of three electrolyte additives: LiPF6, LiPOF4, and LiAsF6. Decomposition of these additives produces PF5, AsF5, and POF3 along with LiF precipitates. We found PF5 and AsF5 react with H2O in two sequential steps to form two HF molecules and POF3 and AsOF3, respectively. PF5 (or AsF5) complexes with H2O and undergoes ligand exchange to form HF and PF4OH (AsF4OH) with an activation barrier of 114.2 (30.5) kJ mol-1 and reaction enthalpy of 14.6 (-11.3) kJ mol-1. The ethylene carbonate (EC) electrolyte forms a Lewis acid-base complex with the PF4OH (AsF4OH) product, reducing the barrier to HF formation. Reactions of POF3 were examined and are not characterized by complexation of POF3 with H2O or EC, while PF5 and AsF5 complex favorably with H2O and EC. HF formation from POF3 occurs with a reaction enthalpy of -3.8 kJ mol-1 and a 157.7 kJ mol-1 barrier, 43.5 kJ mol-1 higher than forming HF from PF5. HF generation in electrolytes employing LiPOF4 should be significantly lower than those using LiPF6 or LiAsF6 and LiPOF4 should be further investigated as an alternative electrolyte additive.

  20. Late Chondritic Additions and Planet and Planetesimal Growth: Evaluation of Physical and Chemical Mechanisms

    NASA Technical Reports Server (NTRS)

    Righter, Kevin

    2013-01-01

    Studies of terrestrial peridotite and martian and achondritic meteorites have led to the conclusion that addition of chondritic material to growing planets or planetesimals, after core formation, occurred on Earth, Mars, asteroid 4 Vesta, and the parent body of the angritic meteorites [1-4]. One study even proposed that this was a common process in the final stages of growth [5]. These conclusions are based almost entirely on the highly siderophile elements (HSE; Re, Au, Pt, Pd, Rh, Ru, Ir, Os). The HSE are a group of eight elements that have been used to argue for late accretion of chondritic material to the Earth after core formation was complete (e.g., [6]). This idea was originally proposed because the D(metal/silicate) values for the HSE are so high, yet their concentration in the mantle is too high to be consistent with such high Ds. The HSE also are present in chondritic relative abundances and hence require similar Ds if this is the result of core-mantle equilibration. Since the work of [6] there has been a realization that core formation at high PT conditions can explain the abundances of many siderophile elements in the mantle (e.g., [7]), but such detailed high PT partitioning data are lacking for many of the HSE to evaluate whether such ideas are viable for all four bodies. Consideration of other chemical parameters reveals larger problems that are difficult to overcome, but must be addressed in any scenario which calls on the addition of chondritic material to a reduced mantle. Yet these problems are rarely discussed or emphasized, making the late chondritic (or late veneer) addition hypothesis suspect.

  1. Gene Regulatory Mechanisms Underlying the Spatial and Temporal Regulation of Target-Dependent Gene Expression in Drosophila Neurons.

    PubMed

    Berndt, Anthony J E; Tang, Jonathan C Y; Ridyard, Marc S; Lian, Tianshun; Keatings, Kathleen; Allan, Douglas W

    2015-12-01

    Neuronal differentiation often requires target-derived signals from the cells they innervate. These signals typically activate neural subtype-specific genes, but the gene regulatory mechanisms remain largely unknown. Highly restricted expression of the FMRFa neuropeptide in Drosophila Tv4 neurons requires target-derived BMP signaling and a transcription factor code that includes Apterous. Using integrase transgenesis of enhancer reporters, we functionally dissected the Tv4-enhancer of FMRFa within its native cellular context. We identified two essential but discrete cis-elements, a BMP-response element (BMP-RE) that binds BMP-activated pMad, and a homeodomain-response element (HD-RE) that binds Apterous. These cis-elements have low activity and must be combined for Tv4-enhancer activity. Such combinatorial activity is often a mechanism for restricting expression to the intersection of cis-element spatiotemporal activities. However, concatemers of the HD-RE and BMP-RE cis-elements were found to independently generate the same spatiotemporal expression as the Tv4-enhancer. Thus, the Tv4-enhancer atypically combines two low-activity cis-elements that confer the same output from distinct inputs. The activation of target-dependent genes is assumed to 'wait' for target contact. We tested this directly, and unexpectedly found that premature BMP activity could not induce early FMRFa expression; also, we show that the BMP-insensitive HD-RE cis-element is activated at the time of target contact. This led us to uncover a role for the nuclear receptor, seven up (svp), as a repressor of FMRFa induction prior to target contact. Svp is normally downregulated immediately prior to target contact, and we found that maintaining Svp expression prevents cis-element activation, whereas reducing svp gene dosage prematurely activates cis-element activity. We conclude that the target-dependent FMRFa gene is repressed prior to target contact, and that target-derived BMP signaling directly

  2. Gene Regulatory Mechanisms Underlying the Spatial and Temporal Regulation of Target-Dependent Gene Expression in Drosophila Neurons

    PubMed Central

    Ridyard, Marc S.; Lian, Tianshun; Keatings, Kathleen; Allan, Douglas W.

    2015-01-01

    Neuronal differentiation often requires target-derived signals from the cells they innervate. These signals typically activate neural subtype-specific genes, but the gene regulatory mechanisms remain largely unknown. Highly restricted expression of the FMRFa neuropeptide in Drosophila Tv4 neurons requires target-derived BMP signaling and a transcription factor code that includes Apterous. Using integrase transgenesis of enhancer reporters, we functionally dissected the Tv4-enhancer of FMRFa within its native cellular context. We identified two essential but discrete cis-elements, a BMP-response element (BMP-RE) that binds BMP-activated pMad, and a homeodomain-response element (HD-RE) that binds Apterous. These cis-elements have low activity and must be combined for Tv4-enhancer activity. Such combinatorial activity is often a mechanism for restricting expression to the intersection of cis-element spatiotemporal activities. However, concatemers of the HD-RE and BMP-RE cis-elements were found to independently generate the same spatiotemporal expression as the Tv4-enhancer. Thus, the Tv4-enhancer atypically combines two low-activity cis-elements that confer the same output from distinct inputs. The activation of target-dependent genes is assumed to 'wait' for target contact. We tested this directly, and unexpectedly found that premature BMP activity could not induce early FMRFa expression; also, we show that the BMP-insensitive HD-RE cis-element is activated at the time of target contact. This led us to uncover a role for the nuclear receptor, seven up (svp), as a repressor of FMRFa induction prior to target contact. Svp is normally downregulated immediately prior to target contact, and we found that maintaining Svp expression prevents cis-element activation, whereas reducing svp gene dosage prematurely activates cis-element activity. We conclude that the target-dependent FMRFa gene is repressed prior to target contact, and that target-derived BMP signaling directly

  3. Investigation of gamma ray shielding efficiency and mechanical performances of concrete shields containing bismuth oxide as an environmentally friendly additive

    NASA Astrophysics Data System (ADS)

    Yao, Ya; Zhang, Xiaowen; Li, Mi; Yang, Rong; Jiang, Tianjiao; Lv, Junwen

    2016-10-01

    Concrete has a proven ability to attenuate gamma rays and neutrons without compromising structural property; therefore, it is widely used as the primary shielding material in many nuclear facilities. Recently, there is a tendency toward using various additives to enhance the shielding properties of these concrete mixtures. However, most of these additives being used either pose hygiene hazards or require special handling processes. It would be ideal if environmentally friendly additives were available for use. The bismuth oxide (Bi2O3) additive shows promise in various shielding applications due to its proven radiation attenuation ability and environmentally friendly nature. To the best of our knowledge, however, Bi2O3 has never been used in concrete mixtures. Therefore, for this research, we fabricated the Bi2O3-based concrete mixtures by adding Bi2O3 powder in the ordinary concrete mixture. Concrete mixtures with lead oxide (PbO) additives were used for comparison. Radiation shielding parameters like the linear attenuation coefficients (LAC) of all these concrete mixtures showing the effects of the Bi2O3 additions are presented. The mechanical performances of concrete mixtures incorporated with Bi2O3 additive were also investigated. It suggested that the concrete mixture containing 25% Bi2O3 powder (B5 in this study) provided the best shielding capacity and mechanical performance among other mixes. It has a significant potential for application as a structural concrete where radiological protection capability is required.

  4. Miniaturization of cellulose fibers and effect of addition on the mechanical and barrier properties of hydroxypropyl methylcellulose

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cellulose fibers were miniaturized by microfluidics technology and incorporated in hydroxypropyl methylcellulose (HPMC) films to study the effect of the addition of such fibers on the mechanical and barrier properties of HPMC films suitable for food packaging applications. The particle size of the f...

  5. Ocean warming and acidification modulate energy budget and gill ion regulatory mechanisms in Atlantic cod (Gadus morhua).

    PubMed

    Kreiss, C M; Michael, K; Lucassen, M; Jutfelt, F; Motyka, R; Dupont, S; Pörtner, H-O

    2015-10-01

    Ocean warming and acidification are threatening marine ecosystems. In marine animals, acidification is thought to enhance ion regulatory costs and thereby baseline energy demand, while elevated temperature also increases baseline metabolic rate. Here we investigated standard metabolic rates (SMR) and plasma parameters of Atlantic cod (Gadus morhua) after 3-4 weeks of exposure to ambient and future PCO2 levels (550, 1200 and 2200 µatm) and at two temperatures (10, 18 °C). In vivo branchial ion regulatory costs were studied in isolated, perfused gill preparations. Animals reared at 18 °C responded to increasing CO2 by elevating SMR, in contrast to specimens at 10 °C. Isolated gills at 10 °C and elevated PCO2 (≥1200 µatm) displayed increased soft tissue mass, in parallel to increased gill oxygen demand, indicating an increased fraction of gill in whole animal energy budget. Altered gill size was not found at 18 °C, where a shift in the use of ion regulation mechanisms occurred towards enhanced Na(+)/H(+)-exchange and HCO3 (-) transport at high PCO2 (2200 µatm), paralleled by higher Na(+)/K(+)-ATPase activities. This shift did not affect total gill energy consumption leaving whole animal energy budget unaffected. Higher Na(+)/K(+)-ATPase activities in the warmth might have compensated for enhanced branchial permeability and led to reduced plasma Na(+) and/or Cl(-) concentrations and slightly lowered osmolalities seen at 18 °C and 550 or 2200 µatm PCO2 in vivo. Overall, the gill as a key ion regulation organ seems to be highly effective in supporting the resilience of cod to effects of ocean warming and acidification. PMID:26219611

  6. Glucocorticoid receptor-mediated cell cycle arrest is achieved through distinct cell-specific transcriptional regulatory mechanisms.

    PubMed Central

    Rogatsky, I; Trowbridge, J M; Garabedian, M J

    1997-01-01

    Glucocorticoids inhibit proliferation of many cell types, but the events leading from the activated glucocorticoid receptor (GR) to growth arrest are not understood. Ectopic expression and activation of GR in human osteosarcoma cell lines U2OS and SAOS2, which lack endogenous receptors, result in a G1 cell cycle arrest. GR activation in U2OS cells represses expression of the cyclin-dependent kinases (CDKs) CDK4 and CDK6 as well as their regulatory partner, cyclin D3, leading to hypophosphorylation of the retinoblastoma protein (Rb). We also demonstrate a ligand-dependent reduction in the expression of E2F-1 and c-Myc, transcription factors involved in the G1-to-S-phase transition. Mitogen-activated protein kinase, CDK2, cyclin E, and the CDK inhibitors (CDIs) p27 and p21 are unaffected by receptor activation in U2OS cells. The receptor's N-terminal transcriptional activation domain is not required for growth arrest in U2OS cells. In Rb-deficient SAOS2 cells, however, the expression of p27 and p21 is induced upon receptor activation. Remarkably, in SAOS2 cells that express a GR deletion derivative lacking the N-terminal transcriptional activation domain, induction of CDI expression is abolished and the cells fail to undergo ligand-dependent cell cycle arrest. Similarly, murine S49 lymphoma cells, which, like SAOS2 cells, lack Rb, require the N-terminal activation domain for growth arrest and induce CDI expression upon GR activation. These cell-type-specific differences in receptor domains and cellular targets linking GR activation to cell cycle machinery suggest two distinct regulatory mechanisms of GR-mediated cell cycle arrest: one involving transcriptional repression of G1 cyclins and CDKs and the other involving enhanced transcription of CDIs by the activated receptor. PMID:9154817

  7. Ocean warming and acidification modulate energy budget and gill ion regulatory mechanisms in Atlantic cod (Gadus morhua).

    PubMed

    Kreiss, C M; Michael, K; Lucassen, M; Jutfelt, F; Motyka, R; Dupont, S; Pörtner, H-O

    2015-10-01

    Ocean warming and acidification are threatening marine ecosystems. In marine animals, acidification is thought to enhance ion regulatory costs and thereby baseline energy demand, while elevated temperature also increases baseline metabolic rate. Here we investigated standard metabolic rates (SMR) and plasma parameters of Atlantic cod (Gadus morhua) after 3-4 weeks of exposure to ambient and future PCO2 levels (550, 1200 and 2200 µatm) and at two temperatures (10, 18 °C). In vivo branchial ion regulatory costs were studied in isolated, perfused gill preparations. Animals reared at 18 °C responded to increasing CO2 by elevating SMR, in contrast to specimens at 10 °C. Isolated gills at 10 °C and elevated PCO2 (≥1200 µatm) displayed increased soft tissue mass, in parallel to increased gill oxygen demand, indicating an increased fraction of gill in whole animal energy budget. Altered gill size was not found at 18 °C, where a shift in the use of ion regulation mechanisms occurred towards enhanced Na(+)/H(+)-exchange and HCO3 (-) transport at high PCO2 (2200 µatm), paralleled by higher Na(+)/K(+)-ATPase activities. This shift did not affect total gill energy consumption leaving whole animal energy budget unaffected. Higher Na(+)/K(+)-ATPase activities in the warmth might have compensated for enhanced branchial permeability and led to reduced plasma Na(+) and/or Cl(-) concentrations and slightly lowered osmolalities seen at 18 °C and 550 or 2200 µatm PCO2 in vivo. Overall, the gill as a key ion regulation organ seems to be highly effective in supporting the resilience of cod to effects of ocean warming and acidification.

  8. Targeted mutagenesis of intergenic regions in the Neisseria gonorrhoeae gonococcal genetic island reveals multiple regulatory mechanisms controlling type IV secretion

    PubMed Central

    Ramsey, Meghan E.; Bender, Tobias; Klimowicz, Amy K.; Hackett, Kathleen T.; Yamamoto, Ami; Jolicoeur, Adrienne; Callaghan, Melanie M.; Wassarman, Karen M.; van der Does, Chris; Dillard, Joseph P.

    2015-01-01

    Summary Gonococci secrete chromosomal DNA into the extracellular environment using a type IV secretion system (T4SS). The secreted DNA acts in natural transformation and initiates biofilm development. Although the DNA and its effects are detectable, structural components of the T4SS are present at very low levels, suggestive of uncharacterized regulatory control. We sought to better characterize the expression and regulation of T4SS genes and found that the four operons containing T4SS genes are transcribed at very different levels. Increasing transcription of two of the operons through targeted promoter mutagenesis did not increase DNA secretion. The stability and steady-state levels of two T4SS structural proteins were affected by a homolog of tail-specific protease. An RNA switch was also identified that regulates translation of a third T4SS operon. The switch mechanism relies on two putative stem-loop structures contained within the 5’ untranslated region of the transcript, one of which occludes the ribosome binding site and start codon. Mutational analysis of these stem-loops supports a model in which induction of an alternative structure relieves repression. Taken together, these results identify multiple layers of regulation, including transcriptional, translational, and post-translational mechanisms controlling T4SS gene expression and DNA secretion. PMID:26076069

  9. Targeted mutagenesis of intergenic regions in the Neisseria gonorrhoeae gonococcal genetic island reveals multiple regulatory mechanisms controlling type IV secretion.

    PubMed

    Ramsey, Meghan E; Bender, Tobias; Klimowicz, Amy K; Hackett, Kathleen T; Yamamoto, Ami; Jolicoeur, Adrienne; Callaghan, Melanie M; Wassarman, Karen M; van der Does, Chris; Dillard, Joseph P

    2015-09-01

    Gonococci secrete chromosomal DNA into the extracellular environment using a type IV secretion system (T4SS). The secreted DNA acts in natural transformation and initiates biofilm development. Although the DNA and its effects are detectable, structural components of the T4SS are present at very low levels, suggestive of uncharacterized regulatory control. We sought to better characterize the expression and regulation of T4SS genes and found that the four operons containing T4SS genes are transcribed at very different levels. Increasing transcription of two of the operons through targeted promoter mutagenesis did not increase DNA secretion. The stability and steady-state levels of two T4SS structural proteins were affected by a homolog of tail-specific protease. An RNA switch was also identified that regulates translation of a third T4SS operon. The switch mechanism relies on two putative stem-loop structures contained within the 5' untranslated region of the transcript, one of which occludes the ribosome binding site and start codon. Mutational analysis of these stem loops supports a model in which induction of an alternative structure relieves repression. Taken together, these results identify multiple layers of regulation, including transcriptional, translational and post-translational mechanisms controlling T4SS gene expression and DNA secretion.

  10. Targeted mutagenesis of intergenic regions in the Neisseria gonorrhoeae gonococcal genetic island reveals multiple regulatory mechanisms controlling type IV secretion.

    PubMed

    Ramsey, Meghan E; Bender, Tobias; Klimowicz, Amy K; Hackett, Kathleen T; Yamamoto, Ami; Jolicoeur, Adrienne; Callaghan, Melanie M; Wassarman, Karen M; van der Does, Chris; Dillard, Joseph P

    2015-09-01

    Gonococci secrete chromosomal DNA into the extracellular environment using a type IV secretion system (T4SS). The secreted DNA acts in natural transformation and initiates biofilm development. Although the DNA and its effects are detectable, structural components of the T4SS are present at very low levels, suggestive of uncharacterized regulatory control. We sought to better characterize the expression and regulation of T4SS genes and found that the four operons containing T4SS genes are transcribed at very different levels. Increasing transcription of two of the operons through targeted promoter mutagenesis did not increase DNA secretion. The stability and steady-state levels of two T4SS structural proteins were affected by a homolog of tail-specific protease. An RNA switch was also identified that regulates translation of a third T4SS operon. The switch mechanism relies on two putative stem-loop structures contained within the 5' untranslated region of the transcript, one of which occludes the ribosome binding site and start codon. Mutational analysis of these stem loops supports a model in which induction of an alternative structure relieves repression. Taken together, these results identify multiple layers of regulation, including transcriptional, translational and post-translational mechanisms controlling T4SS gene expression and DNA secretion. PMID:26076069

  11. Mechanical behaviour of pressed and sintered titanium alloys obtained from master alloy addition powders.

    PubMed

    Bolzoni, L; Esteban, P G; Ruiz-Navas, E M; Gordo, E

    2012-11-01

    The fabrication of the workhorse Ti-6Al-4V alloy and of the Ti-3Al-2.5V alloy was studied considering the master alloy addition variant of the blending elemental approach conventionally used for titanium powder metallurgy. The powders were characterised by means thermal analysis and X-ray diffraction and shaped by means of uniaxial pressing. The microstructural evolution with the sintering temperature (900-1400 °C) was evaluated by SEM and EDS was used to study the composition. XRD patterns as well as the density by Archimedes method were also obtained. The results indicate that master alloy addition is a suitable way to fabricate well developed titanium alloy but also to produce alloy with the desired composition, not available commercially. Density of 4.3 g/cm³ can be obtained where a temperature higher than 1200 °C is needed for the complete diffusion of the alloying elements. Flexural properties comparable to those specified for wrought Ti-6Al-4V medical devices are, generally, obtained.

  12. TRIENNIAL LACTATION SYMPOSIUM: Systems biology of regulatory mechanisms of nutrient metabolism in lactation.

    PubMed

    McNamara, J P

    2015-12-01

    A major role of the dairy cow is to convert low-quality plant materials into high-quality protein and other nutrients for humans. We must select and manage cows with the goal of having animals of the greatest efficiency matched to their environment. We have increased efficiency tremendously over the years, yet the variation in productive and reproductive efficiency among animals is still large. In part, this is because of a lack of full integration of genetic, nutritional, and reproductive biology into management decisions. However, integration across these disciplines is increasing as the biological research findings show specific control points at which genetics, nutrition, and reproduction interact. An ordered systems biology approach that focuses on why and how cells regulate energy and N use and on how and why organs interact through endocrine and neurocrine mechanisms will speed improvements in efficiency. More sophisticated dairy managers will demand better information to improve the efficiency of their animals. Using genetic improvement and animal management to improve milk productive and reproductive efficiency requires a deeper understanding of metabolic processes throughout the life cycle. Using existing metabolic models, we can design experiments specifically to integrate data from global transcriptional profiling into models that describe nutrient use in farm animals. A systems modeling approach can help focus our research to make faster and larger advances in efficiency and determine how this knowledge can be applied on the farms.

  13. TRIENNIAL LACTATION SYMPOSIUM: Systems biology of regulatory mechanisms of nutrient metabolism in lactation.

    PubMed

    McNamara, J P

    2015-12-01

    A major role of the dairy cow is to convert low-quality plant materials into high-quality protein and other nutrients for humans. We must select and manage cows with the goal of having animals of the greatest efficiency matched to their environment. We have increased efficiency tremendously over the years, yet the variation in productive and reproductive efficiency among animals is still large. In part, this is because of a lack of full integration of genetic, nutritional, and reproductive biology into management decisions. However, integration across these disciplines is increasing as the biological research findings show specific control points at which genetics, nutrition, and reproduction interact. An ordered systems biology approach that focuses on why and how cells regulate energy and N use and on how and why organs interact through endocrine and neurocrine mechanisms will speed improvements in efficiency. More sophisticated dairy managers will demand better information to improve the efficiency of their animals. Using genetic improvement and animal management to improve milk productive and reproductive efficiency requires a deeper understanding of metabolic processes throughout the life cycle. Using existing metabolic models, we can design experiments specifically to integrate data from global transcriptional profiling into models that describe nutrient use in farm animals. A systems modeling approach can help focus our research to make faster and larger advances in efficiency and determine how this knowledge can be applied on the farms. PMID:26641166

  14. Inducible nitric oxide synthase (NOS-2) in subarachnoid hemorrhage: Regulatory mechanisms and therapeutic implications

    PubMed Central

    Iqbal, Sana; Hayman, Erik G; Hong, Caron; Stokum, Jesse A; Kurland, David B; Gerzanich, Volodymyr; Simard, J Marc

    2016-01-01

    Aneurysmal subarachnoid hemorrhage (SAH) typically carries a poor prognosis. Growing evidence indicates that overabundant production of nitric oxide (NO) may be responsible for a large part of the secondary injury that follows SAH. Although SAH modulates the activity of all three isoforms of nitric oxide synthase (NOS), the inducible isoform, NOS-2, accounts for a majority of NO-mediated secondary injuries after SAH. Here, we review the indispensable physiological roles of NO that must be preserved, even while attempting to downmodulate the pathophysiologic effects of NO that are induced by SAH. We examine the effects of SAH on the function of the various NOS isoforms, with a particular focus on the pathological effects of NOS-2 and on the mechanisms responsible for its transcriptional upregulation. Finally, we review interventions to block NOS-2 upregulation or to counteract its effects, with an emphasis on the potential therapeutic strategies to improve outcomes in patients afflicted with SAH. There is still much to be learned regarding the apparently maladaptive response of NOS-2 and its harmful product NO in SAH. However, the available evidence points to crucial effects that, on balance, are adverse, making the NOS-2/NO/peroxynitrite axis an attractive therapeutic target in SAH. PMID:27774520

  15. Tuning of Redox Regulatory Mechanisms, Reactive Oxygen Species and Redox Homeostasis under Salinity Stress.

    PubMed

    Hossain, M Sazzad; Dietz, Karl-Josef

    2016-01-01

    Soil salinity is a crucial environmental constraint which limits biomass production at many sites on a global scale. Saline growth conditions cause osmotic and ionic imbalances, oxidative stress and perturb metabolism, e.g., the photosynthetic electron flow. The plant ability to tolerate salinity is determined by multiple biochemical and physiological mechanisms protecting cell functions, in particular by regulating proper water relations and maintaining ion homeostasis. Redox homeostasis is a fundamental cell property. Its regulation includes control of reactive oxygen species (ROS) generation, sensing deviation from and readjustment of the cellular redox state. All these redox related functions have been recognized as decisive factors in salinity acclimation and adaptation. This review focuses on the core response of plants to overcome the challenges of salinity stress through regulation of ROS generation and detoxification systems and to maintain redox homeostasis. Emphasis is given to the role of NADH oxidase (RBOH), alternative oxidase (AOX), the plastid terminal oxidase (PTOX) and the malate valve with the malate dehydrogenase isoforms under salt stress. Overwhelming evidence assigns an essential auxiliary function of ROS and redox homeostasis to salinity acclimation of plants. PMID:27242807

  16. Social dominance-related major urinary proteins and the regulatory mechanism in mice.

    PubMed

    Guo, Huifen; Fang, Qi; Huo, Ying; Zhang, Yaohua; Zhang, Jianxu

    2015-11-01

    Major urinary proteins (MUPs) have been proven to be non-volatile male pheromones in mice. Here, we aimed to elucidate the relationship between MUPs and dominance hierarchy, and the underlying molecular mechanisms. Dominance-submission relationship was established by chronic dyadic encountering. We found that at the urinary protein level and hepatic mRNA level, the expression of major MUPs, including Mup20, was enhanced in dominant males compared with subordinate males, indicating that MUPs might signal the social status of male mice. Meanwhile, the mRNA level of hepatic corticotropin releasing hormone receptor 2 (CRHR2) was higher in subordinate male mice than in dominant male mice. Castration also enhanced the expression of CRHR2, but suppressed that of MUPs. CRHR2 agonist treatment reduced the expression of MUPs in liver. However, male social status failed to exert significant influence on serum testosterone and corticosterone as well as the mRNA expression of their receptors. These findings reveal that some MUPs, especially Mup20, might constitute potential dominance pheromones and could be downregulated by hepatic CRHR2, which is possibly independent of androgen or corticosterone systems.

  17. Familial autoinflammation with neutrophilic dermatosis reveals a regulatory mechanism of pyrin activation.

    PubMed

    Masters, Seth L; Lagou, Vasiliki; Jéru, Isabelle; Baker, Paul J; Van Eyck, Lien; Parry, David A; Lawless, Dylan; De Nardo, Dominic; Garcia-Perez, Josselyn E; Dagley, Laura F; Holley, Caroline L; Dooley, James; Moghaddas, Fiona; Pasciuto, Emanuela; Jeandel, Pierre-Yves; Sciot, Raf; Lyras, Dena; Webb, Andrew I; Nicholson, Sandra E; De Somer, Lien; van Nieuwenhove, Erika; Ruuth-Praz, Julia; Copin, Bruno; Cochet, Emmanuelle; Medlej-Hashim, Myrna; Megarbane, Andre; Schroder, Kate; Savic, Sinisa; Goris, An; Amselem, Serge; Wouters, Carine; Liston, Adrian

    2016-03-30

    Pyrin responds to pathogen signals and loss of cellular homeostasis by forming an inflammasome complex that drives the cleavage and secretion of interleukin-1β (IL-1β). Mutations in the B30.2/SPRY domain cause pathogen-independent activation of pyrin and are responsible for the autoinflammatory disease familial Mediterranean fever (FMF). We studied a family with a dominantly inherited autoinflammatory disease, distinct from FMF, characterized by childhood-onset recurrent episodes of neutrophilic dermatosis, fever, elevated acute-phase reactants, arthralgia, and myalgia/myositis. The disease was caused by a mutation in MEFV, the gene encoding pyrin (S242R). The mutation results in the loss of a 14-3-3 binding motif at phosphorylated S242, which was not perturbed by FMF mutations in the B30.2/SPRY domain. However, loss of both S242 phosphorylation and 14-3-3 binding was observed for bacterial effectors that activate the pyrin inflammasome, such as Clostridium difficile toxin B (TcdB). The S242R mutation thus recapitulated the effect of pathogen sensing, triggering inflammasome activation and IL-1β production. Successful therapy targeting IL-1β has been initiated in one patient, resolving pyrin-associated autoinflammation with neutrophilic dermatosis. This disease provides evidence that a guard-like mechanism of pyrin regulation, originally identified for Nod-like receptors in plant innate immunity, also exists in humans.

  18. Tuning of Redox Regulatory Mechanisms, Reactive Oxygen Species and Redox Homeostasis under Salinity Stress

    PubMed Central

    Hossain, M. Sazzad; Dietz, Karl-Josef

    2016-01-01

    Soil salinity is a crucial environmental constraint which limits biomass production at many sites on a global scale. Saline growth conditions cause osmotic and ionic imbalances, oxidative stress and perturb metabolism, e.g., the photosynthetic electron flow. The plant ability to tolerate salinity is determined by multiple biochemical and physiological mechanisms protecting cell functions, in particular by regulating proper water relations and maintaining ion homeostasis. Redox homeostasis is a fundamental cell property. Its regulation includes control of reactive oxygen species (ROS) generation, sensing deviation from and readjustment of the cellular redox state. All these redox related functions have been recognized as decisive factors in salinity acclimation and adaptation. This review focuses on the core response of plants to overcome the challenges of salinity stress through regulation of ROS generation and detoxification systems and to maintain redox homeostasis. Emphasis is given to the role of NADH oxidase (RBOH), alternative oxidase (AOX), the plastid terminal oxidase (PTOX) and the malate valve with the malate dehydrogenase isoforms under salt stress. Overwhelming evidence assigns an essential auxiliary function of ROS and redox homeostasis to salinity acclimation of plants. PMID:27242807

  19. Fluorescence single-molecule imaging of actin turnover and regulatory mechanisms.

    PubMed

    Watanabe, Naoki

    2012-01-01

    Cells must rapidly remodel the actin filament network to achieve various cellular functions. Actin filament turnover is a dynamic process that plays crucial roles in cell adhesion, locomotion, cytokinesis, endocytosis, phagocytosis, tissue remodeling, etc., and is regulated by cell signaling cascades. Success in elucidating dynamic biological processes such as actin-based motility relies on the means enabling real time monitoring of the process. The invention of live-cell fluorescence single-molecule imaging has opened a window for direct viewing of various actin remodeling processes. In general, assembly and dissociation of actin and its regulators turned out to occur at the faster rates than previously estimated by biochemical and structural analyses. Cells undergo such fast continuous exchange of the components perhaps not only to drive actin remodeling but also to facilitate rapid response in many other cell mechanics and signaling cascades. This chapter describes how epifluorescence single-molecule imaging which visualizes deeper area than the TIRF microscopy is achieved in XTC cells, the currently best platform for this approach.

  20. Phosphorylation regulates myo-inositol-3-phosphate synthase: a novel regulatory mechanism of inositol biosynthesis.

    PubMed

    Deranieh, Rania M; He, Quan; Caruso, Joseph A; Greenberg, Miriam L

    2013-09-13

    myo-Inositol-3-phosphate synthase (MIPS) plays a crucial role in inositol homeostasis. Transcription of the coding gene INO1 is highly regulated. However, regulation of the enzyme is not well defined. We previously showed that MIPS is indirectly inhibited by valproate, suggesting that the enzyme is post-translationally regulated. Using (32)Pi labeling and phosphoamino acid analysis, we show that yeast MIPS is a phosphoprotein. Mass spectrometry analysis identified five phosphosites, three of which are conserved in the human MIPS. Analysis of phosphorylation-deficient and phosphomimetic site mutants indicated that the three conserved sites in yeast (Ser-184, Ser-296, and Ser-374) and humans (Ser-177, Ser-279, and Ser-357) affect MIPS activity. Both S296A and S296D yeast mutants and S177A and S177D human mutants exhibited decreased enzymatic activity, suggesting that a serine residue is critical at that location. The phosphomimetic mutations S184D (human S279D) and S374D (human S357D) but not the phosphodeficient mutations decreased activity, suggesting that phosphorylation of these two sites is inhibitory. The double mutation S184A/S374A caused an increase in MIPS activity, conferred a growth advantage, and partially rescued sensitivity to valproate. Our findings identify a novel mechanism of regulation of inositol synthesis by phosphorylation of MIPS.

  1. Seasonality of reproduction in mammals: intimate regulatory mechanisms and practical implications.

    PubMed

    Chemineau, P; Guillaume, D; Migaud, M; Thiéry, J C; Pellicer-Rubio, M T; Malpaux, B

    2008-07-01

    Farm mammals generally express seasonal variations in their production traits, thus inducing changing availability of fresh derived animal products (meat, milk and cheese) or performances (horses). This is due to a more or less marked seasonal birth distribution in sheep and goats, in horses but not cattle. Birth peak occurs at the end of winter-early spring, the most favourable period for the progeny to survive. Most species show seasonal variations in their ovulation frequency (presence or absence of ovulation), spermatogenic activity (from moderate decrease to complete absence of sperm production), gamete quality (variations in fertilization rates and embryo survival), and also sexual behaviour. The intimate mechanism involved is a complex combination of endogenous circannual rhythm driven and synchronized by light and melatonin. Profound and long-term neuroendocrine changes involving different neuromediator systems were described to play a role in these processes. In most species artificial photoperiodic treatments consisting of extra-light during natural short days (in sheep and goats and mares) or melatonin during long days (in sheep and goats) are extensively used to either adjust the breeding season to animal producer needs and/or to completely overcome seasonal variations of sperm production in artificial insemination centres. Pure light treatments (without melatonin), especially when applied in open barns, could be considered as non-invasive ones which fully respect animal welfare. Genetic selection could be one of the future ways to decrease seasonality in sheep and goats. PMID:18638103

  2. Sweat, the driving force behind normal skin: an emerging perspective on functional biology and regulatory mechanisms.

    PubMed

    Murota, Hiroyuki; Matsui, Saki; Ono, Emi; Kijima, Akiko; Kikuta, Junichi; Ishii, Masaru; Katayama, Ichiro

    2015-01-01

    The various symptoms associated with excessive or insufficient perspiration can significantly reduce a patient's quality of life. If a versatile and minimally invasive method could be established for returning sweat activity to normalcy, there is no question that it could be used in the treatment of many diseases that are believed to involve perspiration. For this reason, based on an understanding of the sweat-gland control function and sweat activity, it was necessary to conduct a comprehensive search for the factors that control sweating, such as the central and peripheral nerves that control sweat-gland function, the microenvironment surrounding the sweat glands, and lifestyle. We focused on the mechanism by which atopic dermatitis leads to hypohidrosis and confirmed that histamine inhibits acetylcholinergic sweating. Acetylcholine promotes the phosphorylation of glycogen synthesis kinase 3β (GSK3β) in the sweat-gland secretory cells and leads to sensible perspiration. By suppressing the phosphorylation of GSK3β, histamine inhibits the movement of sweat from the sweat-gland secretory cells through the sweat ducts, which could presumably be demonstrated by dynamic observations of the sweat glands using two-photon microscopy. It is expected that the discovery of new factors that control sweat-gland function can contribute to the treatment of diseases associated with dyshidrosis.

  3. Physical-mechanical properties of Bis-EMA based root canal sealer with different fillers addition

    PubMed Central

    de Souza, Marcela Oliveira; Branco Leitune, Vicente Castelo; Bohn, Priscila Veit; Werner Samuel, Susana Maria; Collares, Fabrício Mezzomo

    2015-01-01

    Aim: To evaluate influence of three different filler particles on an experimental Bisphenol A ethoxylated dimethacrylate (Bis-EMA) based root filling material. Materials and Methods: Resin-based endodontic sealers were produced using Bis-EMA, camphorquinone, ethyl 4-dimethylaminobenzoate (EDAB), N, N-dihydroxyethyl-p-toluidine (DHEPT), butylated hydroxytoluene (BHT), and benzoyl peroxide. The experimental groups were formulated adding 10, 20, 30, 40, and 50% of calcium tungstate (CaWO4), ytterbium trifluoride(YbF3), and tantalum oxide(Ta2O5). Flow, thickness, and radiopacity tests were conducted in accordance with ISO 6876. Sorption and solubility (SL) tests were conducted in accordance with ISO 4049, pH was measured with a pH meter, and degree of conversion (DC) was evaluated with Fourier transform infrared spectroscopy (FTIR). For radiopacity, two-way analysis of variance (ANOVA) and Tukey's multiple comparison test was performed. For DC analysis, one-way ANOVA and Tukey's multiple comparison test was performed. All statistical analyses were performed with a significance level of 5%. Results: All groups showed lower flow with increased filler concentration. All groups showed film thickness values lower than 50μm, as ISO recommends, except CaWO450% group (76.7μm). pH values varied from 5.95 (± 0.07) in YbF340% group to 6.90 (± 0.07) in Ta2O540% group. In the radiopacity test, YbF330%, Ta2O540%, and Ta2O550% groups showed no statistical significant difference to 3mmAl. Ta2O5 and YbF3 groups in 10, 20, and 30% concentrations presented sorption and SL values as ISOrecommendation. Addition ofTa2O5 and CaWO4 decreased DC after 14 days. YbF3 addition showed no difference in DC from control group. Conclusion: YbF3 filler addition promoted higher properties compared to CaWO4 and Ta2O5 on Bis-EMA based root canal sealer. PMID:26069410

  4. Deciphering regulatory mechanisms for secondary metabolite production in the myxobacterium Sorangium cellulosum So ce56.

    PubMed

    Rachid, Shwan; Gerth, Klaus; Kochems, Irene; Müller, Rolf

    2007-03-01

    Sorangium cellulosum strains produce approximately 50% of the biologically active secondary metabolites known from myxobacteria. These metabolites include several compounds of biotechnological importance such as the epothilones and chivosazols, which, respectively, stabilize the tubulin and actin skeletons of eukaryotic cells. S. cellulosum is characterized by its slow growth rate, and natural products are typically produced in low yield. In this study, biomagnetic bead separation of promoter-binding proteins and subsequent inactivation experiments were employed to identify the chivosazol regulator, ChiR, as a positive regulator of chivosazol biosynthesis in the genome-sequenced strain So ce56. Overexpression of chiR under the control of T7A1 promoter in a merodiploid mutant resulted in fivefold overproduction of chivosazol in a kinetic shake flask experiment, and 2.5-fold overproduction by fermentation. Using quantitative reverse transcription PCR and gel shift experiments employing heterologously expressed ChiR, we have shown that transcription of the chivosazol biosynthetic genes (chiA-chiF) is directly controlled by this protein. In addition, we have demonstrated that ChiR serves as a pleiotropic regulator in S. cellulosum, because mutant strains lack the ability to develop into regular fruiting bodies. PMID:17367395

  5. Mechanism of wiggling enhancement due to HBr gas addition during amorphous carbon etching

    NASA Astrophysics Data System (ADS)

    Kofuji, Naoyuki; Ishimura, Hiroaki; Kobayashi, Hitoshi; Une, Satoshi

    2015-06-01

    The effect of gas chemistry during etching of an amorphous carbon layer (ACL) on wiggling has been investigated, focusing especially on the changes in residual stress. Although the HBr gas addition reduces critical dimension loss, it enhances the surface stress and therefore increases wiggling. Attenuated total reflectance Fourier transform infrared spectroscopy revealed that the increase in surface stress was caused by hydrogenation of the ACL surface with hydrogen radicals. Three-dimensional (3D) nonlinear finite element method analysis confirmed that the increase in surface stress is large enough to cause the wiggling. These results also suggest that etching with hydrogen compound gases using an ACL mask has high potential to cause the wiggling.

  6. Deformation Mechanisms in NiTi-Al Composites Fabricated by Ultrasonic Additive Manufacturing

    NASA Astrophysics Data System (ADS)

    Chen, Xiang; Hehr, Adam; Dapino, Marcelo J.; Anderson, Peter M.

    2015-09-01

    Thermally active NiTi shape memory alloy (SMA) fibers can be used to tune or tailor the effective coefficient of thermal expansion (CTE) of a metallic matrix composite. In this paper, a novel NiTi-Al composite is fabricated using ultrasonic additive manufacturing (UAM). A combined experimental-simulation approach is used to develop and validate a microstructurally based finite element model of the composite. The simulations are able to closely reproduce the macroscopic strain versus temperature cyclic response, including initial transient effects in the first cycle. They also show that the composite CTE is minimized if the austenite texture in the SMA wires is <001>B2, that a fiber aspect ratio >10 maximizes fiber efficiency, and that the UAM process may reduce hysteresis in embedded SMA wires.

  7. Metal and pharmaceutical mixtures: is ion loss the mechanism underlying acute toxicity and widespread additive toxicity in zebrafish?

    PubMed

    Alsop, Derek; Wood, Chris M

    2013-09-15

    The acute toxicities and mechanisms of action of a variety of environmental contaminants were examined using zebrafish larvae (Danio rerio; 4-8 days post fertilization). Toxic interactions were observed between metals. For example, the addition of a sublethal level of nickel (15% of the LC50, one third of the LC01) to all copper treatments decreased the copper 96 h LC50 by 58%, while sublethal copper exposure (6% of the copper LC50, 13% of the LC01) decreased the cadmium 96 h LC50 by 47%. Two predictive models were assessed, the concentration addition (CA) model, which assumes similar mechanisms of action, and the independent action (IA) model, which assumes different mechanisms of action. Quantitative comparisons indicated the CA model performed better than the IA model; the latter tended to underestimate combined toxicity to a greater extent. The effects of mixtures with nickel or ammonia were typically additive, while mixtures with copper or cadmium were typically greater than additive. Larvae exposed to cadmium, copper or nickel experienced whole body ion loss. Decreases were greatest for Na(+) followed by K(+) (as high as 19% and 9%, respectively, in 24h). Additive toxicity between copper and other pharmaceutical compounds such as fluoxetine (Prozac™), β-naphthoflavone, estrogen and 17α-ethinylestradiol were also observed. Similar to metals, acutely toxic concentrations of fluoxetine, β-naphthoflavone and ammonia all decreased whole body Na(+) and K(+). Overall, whole body Na(+) loss showed the greatest correlation with mortality across a variety of toxicants. We theorize that a disruption of ion homeostasis may be a common mechanism underlying the acute additive toxicity of many contaminants in fish.

  8. Effect of Zr addition on the mechanical characteristics and wear resistance of Al grain refined by Ti after extrusion

    NASA Astrophysics Data System (ADS)

    Zaid, Adnan I. O.; Al-Qawabah, S. M. A.

    2016-08-01

    Aluminum and its alloys are normally grain refined by Ti or Ti+B to transfer their columnar structure during solidification into equiaxed one which improves their mechanical behavior and surface quality. In this paper, the effect of addition of Zr on the metallurgical, and mechanical aspects, hardness, ductility and wear resistance of commercially pure aluminum grain refined by Ti after extrusion is investigated. Zr was added at a level of 0.1% which corresponds to the peretectic limit at the Al-Zr phase diagram. The experimental work was carried out on the specimens after direct extrusion. It was found that addition of Ti resulted in decrease of Al grain size, whereas addition of Zr alone or in the presence of Ti, resulted in reduction of Al grain size. This led to increase of Al hardness. The effect of the addition of Ti or Zr alone resulted almost in the same enhancement of Al mechanical characteristics. As for the strain hardening index,n, increase was obtained when Zr was added alone or in the presence of Ti. Hence pronounced improvement of its formability. Regarding the effect of Zr addition on the wear resistance of aluminum; it was found that at small loads and speeds addition of Ti or Zr or both together resulted in deterioration of its wear resistance whereas at higher loads and speeds resulted in pronounced improvement of its wear resistance. Finally, the available Archard model and the other available models which consider only the mass loss failed to describe the wear mechanism of Al and its micro-alloys because they do not consider the mushrooming effect at the worn end.

  9. Unravelling the impact of hydrocarbon structure on the fumarate addition mechanism--a gas-phase ab initio study.

    PubMed

    Bharadwaj, Vivek S; Vyas, Shubham; Villano, Stephanie M; Maupin, C Mark; Dean, Anthony M

    2015-02-14

    The fumarate addition reaction mechanism is central to the anaerobic biodegradation pathway of various hydrocarbons, both aromatic (e.g., toluene, ethyl benzene) and aliphatic (e.g., n-hexane, dodecane). Succinate synthase enzymes, which belong to the glycyl radical enzyme family, are the main facilitators of these biochemical reactions. The overall catalytic mechanism that converts hydrocarbons to a succinate molecule involves three steps: (1) initial H-abstraction from the hydrocarbon by the radical enzyme, (2) addition of the resulting hydrocarbon radical to fumarate, and (3) hydrogen abstraction by the addition product to regenerate the radical enzyme. Since the biodegradation of hydrocarbon fuels via the fumarate addition mechanism is linked to bio-corrosion, an improved understanding of this reaction is imperative to our efforts of predicting the susceptibility of proposed alternative fuels to biodegradation. An improved understanding of the fuel biodegradation process also has the potential to benefit bioremediation. In this study, we consider model aromatic (toluene) and aliphatic (butane) compounds to evaluate the impact of hydrocarbon structure on the energetics and kinetics of the fumarate addition mechanism by means of high level ab initio gas-phase calculations. We predict that the rate of toluene degradation is ∼100 times faster than butane at 298 K, and that the first abstraction step is kinetically significant for both hydrocarbons, which is consistent with deuterium isotope effect studies on toluene degradation. The detailed computations also show that the predicted stereo-chemical preference of the succinate products for both toluene and butane are due to the differences in the radical addition rate constants for the various isomers. The computational and kinetic modeling work presented here demonstrates the importance of considering pre-reaction and product complexes in order to accurately treat gas phase systems that involve intra and inter

  10. Endocannabinoids are Involved in Male Vertebrate Reproduction: Regulatory Mechanisms at Central and Gonadal Level.

    PubMed

    Bovolin, Patrizia; Cottone, Erika; Pomatto, Valentina; Fasano, Silvia; Pierantoni, Riccardo; Cobellis, Gilda; Meccariello, Rosaria

    2014-01-01

    Endocannabinoids (eCBs) are natural lipids regulating a large array of physiological functions and behaviors in vertebrates. The eCB system is highly conserved in evolution and comprises several specific receptors (type-1 and type-2 cannabinoid receptors), their endogenous ligands (e.g., anandamide and 2-arachidonoylglycerol), and a number of biosynthetic and degradative enzymes. In the last few years, eCBs have been described as critical signals in the control of male and female reproduction at multiple levels: centrally, by targeting hypothalamic gonadotropin-releasing-hormone-secreting neurons and pituitary, and locally, with direct effects on the gonads. These functions are supported by the extensive localization of cannabinoid receptors and eCB metabolic enzymes at different levels of the hypothalamic-pituitary-gonadal axis in mammals, as well as bonyfish and amphibians. In vivo and in vitro studies indicate that eCBs centrally regulate gonadal functions by modulating the gonadotropin-releasing hormone-gonadotropin-steroid network through direct and indirect mechanisms. Several proofs of local eCB regulation have been found in the testis and male genital tracts, since eCBs control Sertoli and Leydig cells activity, germ cell progression, as well as the acquisition of sperm functions. A comparative approach usually is a key step in the study of physiological events leading to the building of a general model. Thus, in this review, we summarize the action of eCBs at different levels of the male reproductive axis, with special emphasis, where appropriate, on data from non-mammalian vertebrates.

  11. Regulatory mechanisms of the acrosome reaction revealed by multiview microscopy of single starfish sperm

    PubMed Central

    1995-01-01

    The acrosome reaction in many animals is a coupled reaction involving an exocytotic step and a dramatic change in cell shape. It has been proposed that these morphological changes are regulated by intracellular ions such as Ca2+ and H+. We report here simultaneous visualization, under a multiview microscope, of intracellular free Ca2+ concentration ([Ca2+]i), intracellular pH (pHi), and morphological changes in a single starfish sperm (Asterina pectinifera). [Ca2+]i and pHi were monitored with the fluorescent probes indo-1 and SNARF-1, respectively. The acrosome reaction was induced with ionomycin. After the introduction of ionomycin in the medium, [Ca2+]i increased gradually and reached a plateau in approximately 30 s. The fusion of the acrosomal vacuole took place abruptly before the plateau, during the rising phase. Although the speed of the [Ca2+]i increase varied among the many sperm tested, exocytosis in all cases occurred at the same [Ca2+]i of approximately 2 microM (estimated using the dissociation constant of indo-1 for Ca2+ of 1.1 microM). This result suggests that the exocytotic mechanism in starfish sperm responds to [Ca2+]i rapidly, with a reaction time of the order of one second or less. Unlike the change in [Ca2+]i, an abrupt increase in pHi was observed immediately after exocytosis, suggesting the presence of a proton mobilizing system that is triggered by exocytosis. The rapid increase in pHi coincided with the formation of the acrosomal rod and the beginning of vigorous movement of the flagellum, both of which have been proposed to be pHi dependent. The exocytotic event itself was visualized with the fluorescent membrane probe RH292. The membrane of the acrosomal vacuole, concealed from the external medium in an unreacted sperm, was seen to fuse with the plasma membrane. PMID:7490297

  12. Endocannabinoids are Involved in Male Vertebrate Reproduction: Regulatory Mechanisms at Central and Gonadal Level

    PubMed Central

    Bovolin, Patrizia; Cottone, Erika; Pomatto, Valentina; Fasano, Silvia; Pierantoni, Riccardo; Cobellis, Gilda; Meccariello, Rosaria

    2014-01-01

    Endocannabinoids (eCBs) are natural lipids regulating a large array of physiological functions and behaviors in vertebrates. The eCB system is highly conserved in evolution and comprises several specific receptors (type-1 and type-2 cannabinoid receptors), their endogenous ligands (e.g., anandamide and 2-arachidonoylglycerol), and a number of biosynthetic and degradative enzymes. In the last few years, eCBs have been described as critical signals in the control of male and female reproduction at multiple levels: centrally, by targeting hypothalamic gonadotropin-releasing-hormone-secreting neurons and pituitary, and locally, with direct effects on the gonads. These functions are supported by the extensive localization of cannabinoid receptors and eCB metabolic enzymes at different levels of the hypothalamic–pituitary–gonadal axis in mammals, as well as bonyfish and amphibians. In vivo and in vitro studies indicate that eCBs centrally regulate gonadal functions by modulating the gonadotropin-releasing hormone–gonadotropin–steroid network through direct and indirect mechanisms. Several proofs of local eCB regulation have been found in the testis and male genital tracts, since eCBs control Sertoli and Leydig cells activity, germ cell progression, as well as the acquisition of sperm functions. A comparative approach usually is a key step in the study of physiological events leading to the building of a general model. Thus, in this review, we summarize the action of eCBs at different levels of the male reproductive axis, with special emphasis, where appropriate, on data from non-mammalian vertebrates. PMID:24782832

  13. Anaerobic transcription activation in Bacillus subtilis: identification of distinct FNR-dependent and -independent regulatory mechanisms.

    PubMed Central

    Cruz Ramos, H; Boursier, L; Moszer, I; Kunst, F; Danchin, A; Glaser, P

    1995-01-01

    Bacillus subtilis is able to grow anaerobically using alternative electron acceptors, including nitrate or fumarate. We characterized an operon encoding the dissimilatory nitrate reductase subunits homologous to the Escherichia coli narGHJI operon and the narK gene encoding a protein with nitrite extrusion activity. Downstream from narK and co-transcribed with it a gene (fnr) encoding a protein homologous to E.coli FNR was found. Disruption of fnr abolished both nitrate and fumarate utilization as electron acceptors and anaerobic induction of narK. Four putative FNR binding sites were found in B.subtilis sequences. The consensus sequence, centred at position -41.5, is identical to the consensus for the DNA site for E.coli CAP. Bs-FNR contained a four cysteine residue cluster at its C-terminal end. This is in contrast to Ec-FNR, where a similar cluster is present at the N-terminal end. It is possible that oxygen modulates the activity of both activators by a similar mechanism involving iron. Unlike in E.coli, where fnr expression is weakly repressed by anaerobiosis, fnr gene expression in B.subtilis is strongly activated by anaerobiosis. We have identified in the narK-fnr intergenic region a promotor activated by anaerobiosis independently of FNR. Thus induction of genes involved in anaerobic respiration requires in B.subtilis at least two levels of regulation: activation of fnr transcription and activation of FNR to induce transcription of FNR-dependent promoters. Images PMID:8846791

  14. Cellular Interrogation: Exploiting Cell-to-Cell Variability to Discriminate Regulatory Mechanisms in Oscillatory Signalling.

    PubMed

    Estrada, Javier; Andrew, Natalie; Gibson, Daniel; Chang, Frederick; Gnad, Florian; Gunawardena, Jeremy

    2016-07-01

    The molecular complexity within a cell may be seen as an evolutionary response to the external complexity of the cell's environment. This suggests that the external environment may be harnessed to interrogate the cell's internal molecular architecture. Cells, however, are not only nonlinear and non-stationary, but also exhibit heterogeneous responses within a clonal, isogenic population. In effect, each cell undertakes its own experiment. Here, we develop a method of cellular interrogation using programmable microfluidic devices which exploits the additional information present in cell-to-cell variation, without requiring model parameters to be fitted to data. We focussed on Ca2+ signalling in response to hormone stimulation, which exhibits oscillatory spiking in many cell types and chose eight models of Ca2+ signalling networks which exhibit similar behaviour in simulation. We developed a nonlinear frequency analysis for non-stationary responses, which could classify models into groups under parameter variation, but found that this question alone was unable to distinguish critical feedback loops. We further developed a nonlinear amplitude analysis and found that the combination of both questions ruled out six of the models as inconsistent with the experimentally-observed dynamics and heterogeneity. The two models that survived the double interrogation were mathematically different but schematically identical and yielded the same unexpected predictions that we confirmed experimentally. Further analysis showed that subtle mathematical details can markedly influence non-stationary responses under parameter variation, emphasising the difficulty of finding a "correct" model. By developing questions for the pathway being studied, and designing more versatile microfluidics, cellular interrogation holds promise as a systematic strategy that can complement direct intervention by genetics or pharmacology.

  15. Cellular Interrogation: Exploiting Cell-to-Cell Variability to Discriminate Regulatory Mechanisms in Oscillatory Signalling

    PubMed Central

    Gibson, Daniel; Chang, Frederick; Gnad, Florian; Gunawardena, Jeremy

    2016-01-01

    The molecular complexity within a cell may be seen as an evolutionary response to the external complexity of the cell’s environment. This suggests that the external environment may be harnessed to interrogate the cell’s internal molecular architecture. Cells, however, are not only nonlinear and non-stationary, but also exhibit heterogeneous responses within a clonal, isogenic population. In effect, each cell undertakes its own experiment. Here, we develop a method of cellular interrogation using programmable microfluidic devices which exploits the additional information present in cell-to-cell variation, without requiring model parameters to be fitted to data. We focussed on Ca2+ signalling in response to hormone stimulation, which exhibits oscillatory spiking in many cell types and chose eight models of Ca2+ signalling networks which exhibit similar behaviour in simulation. We developed a nonlinear frequency analysis for non-stationary responses, which could classify models into groups under parameter variation, but found that this question alone was unable to distinguish critical feedback loops. We further developed a nonlinear amplitude analysis and found that the combination of both questions ruled out six of the models as inconsistent with the experimentally-observed dynamics and heterogeneity. The two models that survived the double interrogation were mathematically different but schematically identical and yielded the same unexpected predictions that we confirmed experimentally. Further analysis showed that subtle mathematical details can markedly influence non-stationary responses under parameter variation, emphasising the difficulty of finding a “correct” model. By developing questions for the pathway being studied, and designing more versatile microfluidics, cellular interrogation holds promise as a systematic strategy that can complement direct intervention by genetics or pharmacology. PMID:27367445

  16. Multiple regulatory mechanisms control the expression of the Geobacillus stearothermophilus gene for extracellular xylanase.

    PubMed

    Shulami, Smadar; Shenker, Ofer; Langut, Yael; Lavid, Noa; Gat, Orit; Zaide, Galia; Zehavi, Arie; Sonenshein, Abraham L; Shoham, Yuval

    2014-09-12

    Geobacillus stearothermophilus T-6 produces a single extracellular xylanase (Xyn10A) capable of producing short, decorated xylo-oligosaccharides from the naturally branched polysaccharide, xylan. Gel retardation assays indicated that the master negative regulator, XylR, binds specifically to xylR operators in the promoters of xylose and xylan-utilization genes. This binding is efficiently prevented in vitro by xylose, the most likely molecular inducer. Expression of the extracellular xylanase is repressed in medium containing either glucose or casamino acids, suggesting that carbon catabolite repression plays a role in regulating xynA. The global transcriptional regulator CodY was shown to bind specifically to the xynA promoter region in vitro, suggesting that CodY is a repressor of xynA. The xynA gene is located next to an uncharacterized gene, xynX, that has similarity to the NIF3 (Ngg1p interacting factor 3)-like protein family. XynX binds specifically to a 72-bp fragment in the promoter region of xynA, and the expression of xynA in a xynX null mutant appeared to be higher, indicating that XynX regulates xynA. The specific activity of the extracellular xylanase increases over 50-fold during early exponential growth, suggesting cell density regulation (quorum sensing). Addition of conditioned medium to fresh and low cell density cultures resulted in high expression of xynA, indicating that a diffusible extracellular xynA density factor is present in the medium. The xynA density factor is heat-stable, sensitive to proteases, and was partially purified using reverse phase liquid chromatography. Taken together, these results suggest that xynA is regulated by quorum-sensing at low cell densities. PMID:25070894

  17. Additive-free hot-pressed silicon carbide ceramics-A material with exceptional mechanical properties

    DOE PAGES

    Sajgalik, P.; Sedlacek, J.; Lences, Z.; Dusza, J.; Lin, H. -T.

    2015-12-30

    Densification of silicon carbide without any sintering aids by hot-pressing and rapid hot pressing was investigated. Full density (>99% t.d.) has been reached at 1850 °C, a temperature of at least 150-200 °C lower compared to the up to now known solid state sintered silicon carbide powders. Silicon carbide was freeze granulated and heat treated prior the densification. Furthermore, evolution of microstructure, mechanical properties and creep behavior were evaluated and compared to reference ceramics from as received silicon carbide powder as well as those of commercial one. Novel method results in dense ceramics with Vickers hardness and indentation fracture toughnessmore » of 29.0 GPa and 5.25 MPam1/2, respectively. Moreover, the creep rate of 3.8 x 10–9 s–1 at 1450 °C and the load of 100 MPa is comparable to the commercial α-SiC solid state sintered at 2150 °C.« less

  18. Additive-free hot-pressed silicon carbide ceramics-A material with exceptional mechanical properties

    SciTech Connect

    Sajgalik, P.; Sedlacek, J.; Lences, Z.; Dusza, J.; Lin, H. -T.

    2015-12-30

    Densification of silicon carbide without any sintering aids by hot-pressing and rapid hot pressing was investigated. Full density (>99% t.d.) has been reached at 1850 °C, a temperature of at least 150-200 °C lower compared to the up to now known solid state sintered silicon carbide powders. Silicon carbide was freeze granulated and heat treated prior the densification. Furthermore, evolution of microstructure, mechanical properties and creep behavior were evaluated and compared to reference ceramics from as received silicon carbide powder as well as those of commercial one. Novel method results in dense ceramics with Vickers hardness and indentation fracture toughness of 29.0 GPa and 5.25 MPam1/2, respectively. Moreover, the creep rate of 3.8 x 10–9 s–1 at 1450 °C and the load of 100 MPa is comparable to the commercial α-SiC solid state sintered at 2150 °C.

  19. Energy efficient reduced graphene oxide additives: Mechanism of effective lubrication and antiwear properties

    PubMed Central

    Gupta, Bhavana; Kumar, N.; Panda, Kalpataru; Dash, S.; Tyagi, A. K.

    2016-01-01

    Optimized concentration of reduced graphene oxide (rGO) in the lube is one of the important factors for effective lubrication of solid body contacts. At sufficiently lower concentration, the lubrication is ineffective and friction/wear is dominated by base oil. In contrast, at sufficiently higher concentration, the rGO sheets aggregates in the oil and weak interlayer sliding characteristic of graphene sheets is no more active for providing lubrication. However, at optimized concentration, friction coefficient and wear is remarkably reduced to 70% and 50%, respectively, as compared to neat oil. Traditionally, such lubrication is described by graphene/graphite particle deposited in contact surfaces that provides lower shear strength of boundary tribofilm. In the present investigation, graphene/graphite tribofilm was absent and existing traditional lubrication mechanism for the reduction of friction and wear is ruled out. It is demonstrated that effective lubrication is possible, if rGO is chemically linked with PEG molecules through hydrogen bonding and PEG intercalated graphene sheets provide sufficiently lower shear strength of freely suspended composite tribofilm under the contact pressure. The work revealed that physical deposition and adsorption of the graphene sheets in the metallic contacts is not necessary for the lubrication. PMID:26725334

  20. Enhancing water repellence and mechanical properties of gelatin films by tannin addition.

    PubMed

    Peña, Cristina; de la Caba, Koro; Eceiza, Arantxa; Ruseckaite, Roxana; Mondragon, Iñaki

    2010-09-01

    In order to reduce pollution caused by traditional non-biodegradable plastic films, renewable raw materials from plants and wastes of meat industries have been employed in this work. A hydrolysable chestnut-tree tannin was used for gelatin modification. Films of gelatin and gelatin-tannin were obtained by casting at room conditions. Transition temperatures of both gelatin and gelatin-tannin systems were determined by differential scanning calorimetry (DSC). Glass transition temperatures of modified gelatin occurred at higher temperatures than for neat gelatin. Enthalpy and temperature of helix-coil transition decreased when tannin content increased due to variations in the helical structure of gelatin as a consequence of tannin presence in agreement with X-ray analysis. Mechanical and thermal behaviour varied as a function of the content of tannin, showing optimum values for films modified with 10 wt% tannin. The transparency of films was maintained after modification with tannin. Solubility and swelling tests of the films revealed that the presence of tannin reduced the water affinity of gelatin.

  1. Energy efficient reduced graphene oxide additives: Mechanism of effective lubrication and antiwear properties

    NASA Astrophysics Data System (ADS)

    Gupta, Bhavana; Kumar, N.; Panda, Kalpataru; Dash, S.; Tyagi, A. K.

    2016-01-01

    Optimized concentration of reduced graphene oxide (rGO) in the lube is one of the important factors for effective lubrication of solid body contacts. At sufficiently lower concentration, the lubrication is ineffective and friction/wear is dominated by base oil. In contrast, at sufficiently higher concentration, the rGO sheets aggregates in the oil and weak interlayer sliding characteristic of graphene sheets is no more active for providing lubrication. However, at optimized concentration, friction coefficient and wear is remarkably reduced to 70% and 50%, respectively, as compared to neat oil. Traditionally, such lubrication is described by graphene/graphite particle deposited in contact surfaces that provides lower shear strength of boundary tribofilm. In the present investigation, graphene/graphite tribofilm was absent and existing traditional lubrication mechanism for the reduction of friction and wear is ruled out. It is demonstrated that effective lubrication is possible, if rGO is chemically linked with PEG molecules through hydrogen bonding and PEG intercalated graphene sheets provide sufficiently lower shear strength of freely suspended composite tribofilm under the contact pressure. The work revealed that physical deposition and adsorption of the graphene sheets in the metallic contacts is not necessary for the lubrication.

  2. Vpu Mediates Depletion of Interferon Regulatory Factor 3 during HIV Infection by a Lysosome-Dependent Mechanism

    PubMed Central

    Doehle, Brian P.; Chang, Kristina; Rustagi, Arjun; McNevin, John; McElrath, M. Juliana

    2012-01-01

    HIV has evolved sophisticated mechanisms to avoid restriction by intracellular innate immune defenses that otherwise serve to control acute viral infection and virus dissemination. Innate defenses are triggered when pattern recognition receptor (PRR) proteins of the host cell engage pathogen-associated molecule patterns (PAMPs) present in viral products. Interferon regulatory factor 3 (IRF3) plays a central role in PRR signaling of innate immunity to drive the expression of type I interferon (IFN) and interferon-stimulated genes (ISGs), including a variety of HIV restriction factors, that serve to limit viral replication directly and/or program adaptive immunity. Productive infection of T cells by HIV is dependent upon the targeted proteolysis of IRF3 that occurs through a virus-directed mechanism that results in suppression of innate immune defenses. However, the mechanisms by which HIV controls innate immune signaling and IRF3 function are not defined. Here, we examined the innate immune response induced by HIV strains identified through their differential control of PRR signaling. We identified viruses that, unlike typical circulating HIV strains, lack the ability to degrade IRF3. Our studies show that IRF3 regulation maps specifically to the HIV accessory protein Vpu. We define a molecular interaction between Vpu and IRF3 that redirects IRF3 to the endolysosome for proteolytic degradation, thus allowing HIV to avoid the innate antiviral immune response. Our studies reveal that Vpu is an important IRF3 regulator that supports acute HIV infection through innate immune suppression. These observations define the Vpu-IRF3 interface as a novel target for therapeutic strategies aimed at enhancing the immune response to HIV. PMID:22593165

  3. Vpu mediates depletion of interferon regulatory factor 3 during HIV infection by a lysosome-dependent mechanism.

    PubMed

    Doehle, Brian P; Chang, Kristina; Rustagi, Arjun; McNevin, John; McElrath, M Juliana; Gale, Michael

    2012-08-01

    HIV has evolved sophisticated mechanisms to avoid restriction by intracellular innate immune defenses that otherwise serve to control acute viral infection and virus dissemination. Innate defenses are triggered when pattern recognition receptor (PRR) proteins of the host cell engage pathogen-associated molecule patterns (PAMPs) present in viral products. Interferon regulatory factor 3 (IRF3) plays a central role in PRR signaling of innate immunity to drive the expression of type I interferon (IFN) and interferon-stimulated genes (ISGs), including a variety of HIV restriction factors, that serve to limit viral replication directly and/or program adaptive immunity. Productive infection of T cells by HIV is dependent upon the targeted proteolysis of IRF3 that occurs through a virus-directed mechanism that results in suppression of innate immune defenses. However, the mechanisms by which HIV controls innate immune signaling and IRF3 function are not defined. Here, we examined the innate immune response induced by HIV strains identified through their differential control of PRR signaling. We identified viruses that, unlike typical circulating HIV strains, lack the ability to degrade IRF3. Our studies show that IRF3 regulation maps specifically to the HIV accessory protein Vpu. We define a molecular interaction between Vpu and IRF3 that redirects IRF3 to the endolysosome for proteolytic degradation, thus allowing HIV to avoid the innate antiviral immune response. Our studies reveal that Vpu is an important IRF3 regulator that supports acute HIV infection through innate immune suppression. These observations define the Vpu-IRF3 interface as a novel target for therapeutic strategies aimed at enhancing the immune response to HIV.

  4. MicroRNA Regulatory Mechanisms on Citrus sinensis leaves to Magnesium-Deficiency.

    PubMed

    Ma, Cui-Lan; Qi, Yi-Ping; Liang, Wei-Wei; Yang, Lin-Tong; Lu, Yi-Bin; Guo, Peng; Ye, Xin; Chen, Li-Song

    2016-01-01

    Magnesium (Mg)-deficiency, which affects crop productivity and quality, widespreadly exists in many agricultural crops, including citrus. However, very limited data are available on Mg-deficiency-responsive microRNAs (miRNAs) in higher plants. Using Illumina sequencing, we isolated 75 (73 known and 2 novel) up- and 71 (64 known and 7 novel) down-regulated miRNAs from Mg-deficient Citrus sinensis leaves. In addition to the remarkable metabolic flexibility as indicated by the great alteration of miRNA expression, the adaptive responses of leaf miRNAs to Mg-deficiency might also involve the following several aspects: (a) up-regulating stress-related genes by down-regulating miR164, miR7812, miR5742, miR3946, and miR5158; (b) enhancing cell transport due to decreased expression of miR3946 and miR5158 and increased expression of miR395, miR1077, miR1160, and miR8019; (c) activating lipid metabolism-related genes by repressing miR158, miR5256, and miR3946; (d) inducing cell wall-related gene expansin 8A by repressing miR779; and (e) down-regulating the expression of genes involved in the maintenance of S, K and Cu by up-regulating miR395 and miR6426. To conclude, we isolated some new known miRNAs (i.e., miR7812, miR8019, miR6218, miR1533, miR6426, miR5256, miR5742, miR5561, miR5158, and miR5818) responsive to nutrient deficiencies and found some candidate miRNAs that might contribute to Mg-deficiency tolerance. Therefore, our results not only provide novel information about the responses of plant to Mg-deficiency, but also are useful for obtaining the key miRNAs for plant Mg-deficiency tolerance.

  5. MicroRNA Regulatory Mechanisms on Citrus sinensis leaves to Magnesium-Deficiency

    PubMed Central

    Ma, Cui-Lan; Qi, Yi-Ping; Liang, Wei-Wei; Yang, Lin-Tong; Lu, Yi-Bin; Guo, Peng; Ye, Xin; Chen, Li-Song

    2016-01-01

    Magnesium (Mg)-deficiency, which affects crop productivity and quality, widespreadly exists in many agricultural crops, including citrus. However, very limited data are available on Mg-deficiency-responsive microRNAs (miRNAs) in higher plants. Using Illumina sequencing, we isolated 75 (73 known and 2 novel) up- and 71 (64 known and 7 novel) down-regulated miRNAs from Mg-deficient Citrus sinensis leaves. In addition to the remarkable metabolic flexibility as indicated by the great alteration of miRNA expression, the adaptive responses of leaf miRNAs to Mg-deficiency might also involve the following several aspects: (a) up-regulating stress-related genes by down-regulating miR164, miR7812, miR5742, miR3946, and miR5158; (b) enhancing cell transport due to decreased expression of miR3946 and miR5158 and increased expression of miR395, miR1077, miR1160, and miR8019; (c) activating lipid metabolism-related genes by repressing miR158, miR5256, and miR3946; (d) inducing cell wall-related gene expansin 8A by repressing miR779; and (e) down-regulating the expression of genes involved in the maintenance of S, K and Cu by up-regulating miR395 and miR6426. To conclude, we isolated some new known miRNAs (i.e., miR7812, miR8019, miR6218, miR1533, miR6426, miR5256, miR5742, miR5561, miR5158, and miR5818) responsive to nutrient deficiencies and found some candidate miRNAs that might contribute to Mg-deficiency tolerance. Therefore, our results not only provide novel information about the responses of plant to Mg-deficiency, but also are useful for obtaining the key miRNAs for plant Mg-deficiency tolerance. PMID:26973661

  6. MicroRNA Regulatory Mechanisms on Citrus sinensis leaves to Magnesium-Deficiency.

    PubMed

    Ma, Cui-Lan; Qi, Yi-Ping; Liang, Wei-Wei; Yang, Lin-Tong; Lu, Yi-Bin; Guo, Peng; Ye, Xin; Chen, Li-Song

    2016-01-01

    Magnesium (Mg)-deficiency, which affects crop productivity and quality, widespreadly exists in many agricultural crops, including citrus. However, very limited data are available on Mg-deficiency-responsive microRNAs (miRNAs) in higher plants. Using Illumina sequencing, we isolated 75 (73 known and 2 novel) up- and 71 (64 known and 7 novel) down-regulated miRNAs from Mg-deficient Citrus sinensis leaves. In addition to the remarkable metabolic flexibility as indicated by the great alteration of miRNA expression, the adaptive responses of leaf miRNAs to Mg-deficiency might also involve the following several aspects: (a) up-regulating stress-related genes by down-regulating miR164, miR7812, miR5742, miR3946, and miR5158; (b) enhancing cell transport due to decreased expression of miR3946 and miR5158 and increased expression of miR395, miR1077, miR1160, and miR8019; (c) activating lipid metabolism-related genes by repressing miR158, miR5256, and miR3946; (d) inducing cell wall-related gene expansin 8A by repressing miR779; and (e) down-regulating the expression of genes involved in the maintenance of S, K and Cu by up-regulating miR395 and miR6426. To conclude, we isolated some new known miRNAs (i.e., miR7812, miR8019, miR6218, miR1533, miR6426, miR5256, miR5742, miR5561, miR5158, and miR5818) responsive to nutrient deficiencies and found some candidate miRNAs that might contribute to Mg-deficiency tolerance. Therefore, our results not only provide novel information about the responses of plant to Mg-deficiency, but also are useful for obtaining the key miRNAs for plant Mg-deficiency tolerance. PMID:26973661

  7. Leaf Litter Mixtures Alter Microbial Community Development: Mechanisms for Non-Additive Effects in Litter Decomposition

    PubMed Central

    Chapman, Samantha K.; Newman, Gregory S.; Hart, Stephen C.; Schweitzer, Jennifer A.; Koch, George W.

    2013-01-01

    To what extent microbial community composition can explain variability in ecosystem processes remains an open question in ecology. Microbial decomposer communities can change during litter decomposition due to biotic interactions and shifting substrate availability. Though relative abundance of decomposers may change due to mixing leaf litter, linking these shifts to the non-additive patterns often recorded in mixed species litter decomposition rates has been elusive, and links community composition to ecosystem function. We extracted phospholipid fatty acids (PLFAs) from single species and mixed species leaf litterbags after 10 and 27 months of decomposition in a mixed conifer forest. Total PLFA concentrations were 70% higher on litter mixtures than single litter types after 10 months, but were only 20% higher after 27 months. Similarly, fungal-to-bacterial ratios differed between mixed and single litter types after 10 months of decomposition, but equalized over time. Microbial community composition, as indicated by principal components analyses, differed due to both litter mixing and stage of litter decomposition. PLFA biomarkers a15∶0 and cy17∶0, which indicate gram-positive and gram-negative bacteria respectively, in particular drove these shifts. Total PLFA correlated significantly with single litter mass loss early in decomposition but not at later stages. We conclude that litter mixing alters microbial community development, which can contribute to synergisms in litter decomposition. These findings advance our understanding of how changing forest biodiversity can alter microbial communities and the ecosystem processes they mediate. PMID:23658639

  8. Mechanisms of nitrite addition for simultaneous sludge fermentation/nitrite removal (SFNR).

    PubMed

    Wu, Chengcheng; Peng, Yongzhen; Wang, Shuying; Li, Baikun; Zhang, Liang; Cao, Shenbin; Du, Rui

    2014-11-01

    Simultaneous sludge fermentation and nitrite removal (SFNR) was investigated as a novel sludge/wastewater treatment process with high nitrogen concentrations. The results showed that introducing nitrite improved the primary sludge (PS) fermentation system by improving the chemical oxygen demand (COD) yields and the volatile suspend solid (VSS) reduction. At a nitrite dosage of 0.2 g g SS(-1), the COD production was 1.02 g g VSS(-1) and the VSS reduction was 63.4% within 7-day fermentation, while the COD production was only 0.17 g g VSS(-1) and the VSS reduction was only 4.9% in the blank test. Nitrite contained in wastewater was removed through denitrification process in the SFNR system. The solubility of carbohydrate and protein was substantially enhanced, and their contents reached the peak once nitrite was consumed. In addition, the nutrient release and methane generation were inhibited in the SFNR system, which alleviated the environmental pollution. Unlike traditional fermentation systems, neither alkaline condition nor high free nitrite acid (FNA) concentration affected the PS fermentation in the SFNR system. Molecular weight distribution (MWD) and Live/Dead cell analysis indicated that the sludge disruption by nitrite and the consumption of soluble organic substances in sludge might play important roles in SFNR.

  9. Frequency, Suppressive Capacity, Recruitment and Induction Mechanisms of Regulatory T Cells in Sinonasal Squamous Cell Carcinoma and Nasal Inverted Papilloma

    PubMed Central

    Li, Pingdong; Zhou, Weiguo; Wang, Yang; Fan, Erzhong; Li, Ying; Wang, Hong; Liu, Zhongyan; Xiao, Lei; Wang, Chengshuo; Zhang, Luo

    2015-01-01

    Background Sinonasal squamous cell carcinoma (SSCC) and nasal inverted papilloma (NIP) represent the predominant type of malignant and benign tumors in sinonasal tract, respectively. CD4+CD25+Foxp3+ natural regulatory T (Treg) cells might play critical role(s) in the suppression of anti-tumor immune response and thus shed light on tumor progression from benign to malignant. Objective This study aimed to evaluate the frequency and suppressive capacity of Treg cells in SSCC compared to NIP and further to explore the underlying mechanisms. Patients and Methods Frequencies of Treg, Th1 and Th2 cells were evaluated by flow cytometry in tissue homogenate and peripheral blood from 31 SSCC patients, 32 NIP patients and 35 normal controls. Treg cells were tested for regulatory function by co-culture with effector T cells. CCR4 and its ligands, CCL22 and CCL17, were analyzed by flow cytometry and Luminex, respectively. The chemoattractant properties of CCR4/CCL22 and CCR4/CCL17 for Treg cells were assessed using the Boyden chamber technique, to elucidate the potential mechanisms of Treg recruitment in tumor microenvironment. Treg cells induction via TGF-β was assessed with transwells after local CD4+Foxp3+ T cells were assessed by immunohistochemistry and TGF-β concentration was measured by Luminex. Results Tumor-infiltrating Treg cells increased significantly from normal to NIP to SSCC (P ≤ 0.001 for normal vs. NIP and P = 0.004 for NIP vs. SSCC). Significantly elevated frequency and enhanced suppression capacity of circulating Treg cells in SSCC were detected compared to NIP and healthy controls, concomitant with Th1 decrease and Th2 increase. Apparently increased CCL22 attracted CCR4-expressing Treg cells to tumor microenvironment in SSCC, compared to NIP. SSCC produced significantly more TGF-β than NIP and thus possessed greater potential for Treg cell induction. Conclusion Frequency and suppressive capacity of Treg cells enhanced with progression of malignancy from

  10. Effect of One Percent Chlorhexidine Addition on the Antibacterial Activity and Mechanical Properties of Sealants: An in vitro Study

    PubMed Central

    Asokan, Sharath; John, J Baby; Priya, PR Geetha; Devi, Jagadeesan Gnana

    2015-01-01

    ABSTRACT Aim: The aim of the study was to evaluate the effect of addition of 1% chlorhexidine digluconate solution on the antibacterial activity and mechanical properties of glass ionomer and resin based sealant. Materials and methods: Conventional glass ionomer sealant (GIS) (Fuji VII, Japan) and resin sealant (Clinpro 3M ESPE, USA) were used in this study. Chlorhexidine digluconate (CHX) (20%) liquid was added to both the sealants, and the concentration of chlorhexidine in sealants was adjusted to 1%. The sealants were divided into four groups as: group A (GIS), group B (GIS + 1% CHX), group C (resin sealant), group D (resin sealant + 1% CHX). Five cylindrical specimens were prepared in each group. Their antibacterial activity against Streptococcus mutans and Lactobacillus acidophilus, and their mechanical properties (compressive strength and diametrical tensile strength) were assessed. Mann-Whitney and Wilcoxon signed rank test were used appropriately for statistical analysis (SPSS version 19). Result: Addition of one percent chlorhexidine significantly increased the antibacterial activity of both the sealants. There was a significant difference between groups A and B (p < 0.009), and groups C and D (p < 0.008). There was no significant difference in the mechanical properties of the sealants. Conclusion: Addition of one percent chlorhexidine to the glass ionomer and resin based sealants provided sufficient antibacterial activity, without significantly affecting the mechanical property of the sealants. How to cite this article: Shanmugaavel AK, Asokan S, John JB, Geetha Priya PR, Gnana Devi J. Effect of one percent Chlorhexidine Addition on the Antibacterial Activity and Mechanical Properties of Sealants: An in vitro Study. Int J Clin Pediatr Dent 2015;8(3):196-201. PMID:26628854

  11. Effects of Sn addition on the microstructure, mechanical properties and corrosion behavior of Ti–Nb–Sn alloys

    SciTech Connect

    Moraes, Paulo E.L.; Contieri, Rodrigo J.; Lopes, Eder S.N.; Robin, Alain; Caram, Rubens

    2014-10-15

    Ti and Ti alloys are widely used in restorative surgery because of their good biocompatibility, enhanced mechanical behavior and high corrosion resistance in physiological media. The corrosion resistance of Ti-based materials is due to the spontaneous formation of the TiO{sub 2} oxide film on their surface, which exhibits elevated stability in biological fluids. Ti–Nb alloys, depending on the composition and the processing routes to which the alloys are subjected, have high mechanical strength combined with low elastic modulus. The addition of Sn to Ti–Nb alloys allows the phase transformations to be controlled, particularly the precipitation of ω phase. The aim of this study is to discuss the microstructure, mechanical properties and corrosion behavior of cast Ti–Nb alloys to which Sn has been added. Samples were centrifugally cast in a copper mold, and the microstructure was characterized using optical microscopy, scanning electron microscopy and X-ray diffractometry. Mechanical behavior evaluation was performed using Berkovich nanoindentation, Vickers hardness and compression tests. The corrosion behavior was evaluated in Ringer's solution at room temperature using electrochemical techniques. The results obtained suggested that the physical, mechanical and chemical behaviors of the Ti–Nb–Sn alloys are directly dependent on the Sn content. - Graphical abstract: Effects of Sn addition to the Ti–30Nb alloy on the elastic modulus. - Highlights: • Sn addition causes reduction of the ω phase precipitation. • Minimum Vickers hardness and elastic modulus occurred for 6 wt.% Sn content. • Addition of 6 wt.% Sn resulted in maximum ductility and minimum compression strength. • All Ti–30Nb–XSn (X = 0, 2, 4, 6, 8 and 10%) alloys are passive in Ringer's solution. • Highest corrosion resistance was observed for 6 wt.% Sn content.

  12. Mechanisms underlying zoonotic success of Campylobacter jejuni: the CprRS two-component regulatory system influences essential processes, biofilm formation, and pathogenesis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Mechanisms underlying zoonotic success of Campylobacter jejuni: the CprRS two-component regulatory system influences essential processes, biofilm formation, and pathogenesis Campylobacter jejuni is a leading cause of food- and waterbourne bacterial gastroenteritis in the developed world. Although il...

  13. Mechanical and Electrical Properties of a Polyimide Film Significantly Enhanced by the Addition of Single-Wall Carbon Nanotubes

    NASA Technical Reports Server (NTRS)

    Meador, Michael A.

    2005-01-01

    Single-wall carbon nanotubes have been shown to possess a combination of outstanding mechanical, electrical, and thermal properties. The use of carbon nanotubes as an additive to improve the mechanical properties of polymers and/or enhance their thermal and electrical conductivity has been a topic of intense interest. Nanotube-modified polymeric materials could find a variety of applications in NASA missions including large-area antennas, solar arrays, and solar sails; radiation shielding materials for vehicles, habitats, and extravehicular activity suits; and multifunctional materials for vehicle structures and habitats. Use of these revolutionary materials could reduce vehicle weight significantly and improve vehicle performance and capabilities.

  14. Regulatory Dendritic Cells Restrain NK Cell IFN-γ Production through Mechanisms Involving NKp46, IL-10, and MHC Class I-Specific Inhibitory Receptors.

    PubMed

    Spallanzani, Raúl G; Torres, Nicolás I; Avila, Damián E; Ziblat, Andrea; Iraolagoitia, Ximena L Raffo; Rossi, Lucas E; Domaica, Carolina I; Fuertes, Mercedes B; Rabinovich, Gabriel A; Zwirner, Norberto W

    2015-09-01

    Cross-talk between mature dendritic cells (mDC) and NK cells through the cell surface receptors NKp30 and DNAM-1 leads to their reciprocal activation. However, the impact of regulatory dendritic cells (regDC) on NK cell function remains unknown. As regDC constrain the immune response in different physiological and pathological conditions, the aim of this work was to investigate the functional outcome of the interaction between regDC and NK cells and the associated underlying mechanisms. RegDC generated from monocyte-derived DC treated either with LPS and dexamethasone, vitamin D3, or vitamin D3 and dexamethasone instructed NK cells to secrete lower amounts of IFN-γ than NK cells exposed to mDC. Although regDC triggered upregulation of the activation markers CD69 and CD25 on NK cells, they did not induce upregulation of CD56 as mDC, and silenced IFN-γ secretion through mechanisms involving insufficient secretion of IL-18, but not IL-12 or IL-15 and/or induction of NK cell apoptosis. Blocking experiments demonstrated that regDC curb IFN-γ secretion by NK cells through a dominant suppressive mechanism involving IL-10, NK cell inhibitory receptors, and, unexpectedly, engagement of the activating receptor NKp46. Our findings unveil a previously unrecognized cross-talk through which regDC shape NK cell function toward an alternative activated phenotype unable to secrete IFN-γ, highlighting the plasticity of NK cells in response to tolerogenic stimuli. In addition, our findings contribute to identify a novel inhibitory role for NKp46 in the control of NK cell function, and have broad implications in the resolution of inflammatory responses and evasion of antitumor responses. PMID:26232426

  15. Myosin light chain kinase (MLCK) regulates cell migration in a myosin regulatory light chain phosphorylation-independent mechanism.

    PubMed

    Chen, Chen; Tao, Tao; Wen, Cheng; He, Wei-Qi; Qiao, Yan-Ning; Gao, Yun-Qian; Chen, Xin; Wang, Pei; Chen, Cai-Ping; Zhao, Wei; Chen, Hua-Qun; Ye, An-Pei; Peng, Ya-Jing; Zhu, Min-Sheng

    2014-10-10

    Myosin light chain kinase (MLCK) has long been implicated in the myosin phosphorylation and force generation required for cell migration. Here, we surprisingly found that the deletion of MLCK resulted in fast cell migration, enhanced protrusion formation, and no alteration of myosin light chain phosphorylation. The mutant cells showed reduced membrane tether force and fewer membrane F-actin filaments. This phenotype was rescued by either kinase-dead MLCK or five-DFRXXL motif, a MLCK fragment with potent F-actin-binding activity. Pull-down and co-immunoprecipitation assays showed that the absence of MLCK led to attenuated formation of transmembrane complexes, including myosin II, integrins and fibronectin. We suggest that MLCK is not required for myosin phosphorylation in a migrating cell. A critical role of MLCK in cell migration involves regulating the cell membrane tension and protrusion necessary for migration, thereby stabilizing the membrane skeleton through F-actin-binding activity. This finding sheds light on a novel regulatory mechanism of protrusion during cell migration.

  16. Auxin Response Factor SlARF2 Is an Essential Component of the Regulatory Mechanism Controlling Fruit Ripening in Tomato.

    PubMed

    Hao, Yanwei; Hu, Guojian; Breitel, Dario; Liu, Mingchun; Mila, Isabelle; Frasse, Pierre; Fu, Yongyao; Aharoni, Asaph; Bouzayen, Mondher; Zouine, Mohamed

    2015-12-01

    Ethylene is the main regulator of climacteric fruit ripening, by contrast the putative role of other phytohormones in this process remains poorly understood. The present study brings auxin signaling components into the mechanism regulating tomato fruit ripening through the functional characterization of Auxin Response Factor2 (SlARF2) which encodes a downstream component of auxin signaling. Two paralogs, SlARF2A and SlARF2B, are found in the tomato genome, both displaying a marked ripening-associated expression but distinct responsiveness to ethylene and auxin. Down-regulation of either SlARF2A or SlARF2B resulted in ripening defects while simultaneous silencing of both genes led to severe ripening inhibition suggesting a functional redundancy among the two ARFs. Tomato fruits under-expressing SlARF2 produced less climacteric ethylene and exhibited a dramatic down-regulation of the key ripening regulators RIN, CNR, NOR and TAGL1. Ethylene treatment failed to reverse the non-ripening phenotype and the expression of ethylene signaling and biosynthesis genes was strongly altered in SlARF2 down-regulated fruits. Although both SlARF proteins are transcriptional repressors the data indicate they work as positive regulators of tomato fruit ripening. Altogether, the study defines SlARF2 as a new component of the regulatory network controlling the ripening process in tomato. PMID:26716451

  17. Auxin Response Factor SlARF2 Is an Essential Component of the Regulatory Mechanism Controlling Fruit Ripening in Tomato

    PubMed Central

    Hao, Yanwei; Hu, Guojian; Breitel, Dario; Liu, Mingchun; Mila, Isabelle; Frasse, Pierre; Fu, Yongyao; Aharoni, Asaph; Bouzayen, Mondher; Zouine, Mohamed

    2015-01-01

    Ethylene is the main regulator of climacteric fruit ripening, by contrast the putative role of other phytohormones in this process remains poorly understood. The present study brings auxin signaling components into the mechanism regulating tomato fruit ripening through the functional characterization of Auxin Response Factor2 (SlARF2) which encodes a downstream component of auxin signaling. Two paralogs, SlARF2A and SlARF2B, are found in the tomato genome, both displaying a marked ripening-associated expression but distinct responsiveness to ethylene and auxin. Down-regulation of either SlARF2A or SlARF2B resulted in ripening defects while simultaneous silencing of both genes led to severe ripening inhibition suggesting a functional redundancy among the two ARFs. Tomato fruits under-expressing SlARF2 produced less climacteric ethylene and exhibited a dramatic down-regulation of the key ripening regulators RIN, CNR, NOR and TAGL1. Ethylene treatment failed to reverse the non-ripening phenotype and the expression of ethylene signaling and biosynthesis genes was strongly altered in SlARF2 down-regulated fruits. Although both SlARF proteins are transcriptional repressors the data indicate they work as positive regulators of tomato fruit ripening. Altogether, the study defines SlARF2 as a new component of the regulatory network controlling the ripening process in tomato. PMID:26716451

  18. Inhibition of protein synthesis by TOR inactivation revealed a conserved regulatory mechanism of the BiP chaperone in Chlamydomonas.

    PubMed

    Díaz-Troya, Sandra; Pérez-Pérez, María Esther; Pérez-Martín, Marta; Moes, Suzette; Jeno, Paul; Florencio, Francisco J; Crespo, José L

    2011-10-01

    The target of rapamycin (TOR) kinase integrates nutritional and stress signals to coordinately control cell growth in all eukaryotes. TOR associates with highly conserved proteins to constitute two distinct signaling complexes termed TORC1 and TORC2. Inactivation of TORC1 by rapamycin negatively regulates protein synthesis in most eukaryotes. Here, we report that down-regulation of TOR signaling by rapamycin in the model green alga Chlamydomonas reinhardtii resulted in pronounced phosphorylation of the endoplasmic reticulum chaperone BiP. Our results indicated that Chlamydomonas TOR regulates BiP phosphorylation through the control of protein synthesis, since rapamycin and cycloheximide have similar effects on BiP modification and protein synthesis inhibition. Modification of BiP by phosphorylation was suppressed under conditions that require the chaperone activity of BiP, such as heat shock stress or tunicamycin treatment, which inhibits N-linked glycosylation of nascent proteins in the endoplasmic reticulum. A phosphopeptide localized in the substrate-binding domain of BiP was identified in Chlamydomonas cells treated with rapamycin. This peptide contains a highly conserved threonine residue that might regulate BiP function, as demonstrated by yeast functional assays. Thus, our study has revealed a regulatory mechanism of BiP in Chlamydomonas by phosphorylation/dephosphorylation events and assigns a role to the TOR pathway in the control of BiP modification.

  19. Auxin Response Factor SlARF2 Is an Essential Component of the Regulatory Mechanism Controlling Fruit Ripening in Tomato.

    PubMed

    Hao, Yanwei; Hu, Guojian; Breitel, Dario; Liu, Mingchun; Mila, Isabelle; Frasse, Pierre; Fu, Yongyao; Aharoni, Asaph; Bouzayen, Mondher; Zouine, Mohamed

    2015-12-01

    Ethylene is the main regulator of climacteric fruit ripening, by contrast the putative role of other phytohormones in this process remains poorly understood. The present study brings auxin signaling components into the mechanism regulating tomato fruit ripening through the functional characterization of Auxin Response Factor2 (SlARF2) which encodes a downstream component of auxin signaling. Two paralogs, SlARF2A and SlARF2B, are found in the tomato genome, both displaying a marked ripening-associated expression but distinct responsiveness to ethylene and auxin. Down-regulation of either SlARF2A or SlARF2B resulted in ripening defects while simultaneous silencing of both genes led to severe ripening inhibition suggesting a functional redundancy among the two ARFs. Tomato fruits under-expressing SlARF2 produced less climacteric ethylene and exhibited a dramatic down-regulation of the key ripening regulators RIN, CNR, NOR and TAGL1. Ethylene treatment failed to reverse the non-ripening phenotype and the expression of ethylene signaling and biosynthesis genes was strongly altered in SlARF2 down-regulated fruits. Although both SlARF proteins are transcriptional repressors the data indicate they work as positive regulators of tomato fruit ripening. Altogether, the study defines SlARF2 as a new component of the regulatory network controlling the ripening process in tomato.

  20. Additive manufacturing and mechanical characterization of graded porosity scaffolds designed based on triply periodic minimal surface architectures.

    PubMed

    Afshar, M; Anaraki, A Pourkamali; Montazerian, H; Kadkhodapour, J

    2016-09-01

    Since the advent of additive manufacturing techniques, triply periodic minimal surfaces have emerged as a novel tool for designing porous scaffolds. Whereas scaffolds are expected to provide multifunctional performance, spatially changing pore patterns have been a promising approach to integrate mechanical characteristics of different architectures into a unique scaffold. Smooth morphological variations are also frequently seen in nature particularly in bone and cartilage structures and can be inspiring for designing of artificial tissues. In this study, we carried out experimental and numerical procedures to uncover the mechanical properties and deformation mechanisms of linearly graded porosity scaffolds for two different mathematically defined pore structures. Among TPMS-based scaffolds, P and D surfaces were subjected to gradient modeling to explore the mechanical responses for stretching and bending dominated deformations, respectively. Moreover, the results were compared to their corresponding uniform porosity structures. Mechanical properties were found to be by far greater for the stretching dominated structure (P-Surface). For bending dominated architecture (D-Surface), although there was no global fracture for uniform structures, graded structure showed a brittle fracture at 0.08 strain. A layer by layer deformation mechanism for stretching dominated structure was observed. For bending dominated scaffolds, deformation was accompanied by development of 45° shearing bands. Finite element simulations were also performed and the results showed a good agreement with the experimental observations.

  1. Additive manufacturing and mechanical characterization of graded porosity scaffolds designed based on triply periodic minimal surface architectures.

    PubMed

    Afshar, M; Anaraki, A Pourkamali; Montazerian, H; Kadkhodapour, J

    2016-09-01

    Since the advent of additive manufacturing techniques, triply periodic minimal surfaces have emerged as a novel tool for designing porous scaffolds. Whereas scaffolds are expected to provide multifunctional performance, spatially changing pore patterns have been a promising approach to integrate mechanical characteristics of different architectures into a unique scaffold. Smooth morphological variations are also frequently seen in nature particularly in bone and cartilage structures and can be inspiring for designing of artificial tissues. In this study, we carried out experimental and numerical procedures to uncover the mechanical properties and deformation mechanisms of linearly graded porosity scaffolds for two different mathematically defined pore structures. Among TPMS-based scaffolds, P and D surfaces were subjected to gradient modeling to explore the mechanical responses for stretching and bending dominated deformations, respectively. Moreover, the results were compared to their corresponding uniform porosity structures. Mechanical properties were found to be by far greater for the stretching dominated structure (P-Surface). For bending dominated architecture (D-Surface), although there was no global fracture for uniform structures, graded structure showed a brittle fracture at 0.08 strain. A layer by layer deformation mechanism for stretching dominated structure was observed. For bending dominated scaffolds, deformation was accompanied by development of 45° shearing bands. Finite element simulations were also performed and the results showed a good agreement with the experimental observations. PMID:27281165

  2. The function of the RNA-binding protein TEL1 in moss reveals ancient regulatory mechanisms of shoot development.

    PubMed

    Vivancos, Julien; Spinner, Lara; Mazubert, Christelle; Charlot, Florence; Paquet, Nicolas; Thareau, Vincent; Dron, Michel; Nogué, Fabien; Charon, Céline

    2012-03-01

    The shoot represents the basic body plan in land plants. It consists of a repeated structure composed of stems and leaves. Whereas vascular plants generate a shoot in their diploid phase, non-vascular plants such as mosses form a shoot (called the gametophore) in their haploid generation. The evolution of regulatory mechanisms or genetic networks used in the development of these two kinds of shoots is unclear. TERMINAL EAR1-like genes have been involved in diploid shoot development in vascular plants. Here, we show that disruption of PpTEL1 from the moss Physcomitrella patens, causes reduced protonema growth and gametophore initiation, as well as defects in gametophore development. Leafy shoots formed on ΔTEL1 mutants exhibit shorter stems with more leaves per shoot, suggesting an accelerated leaf initiation (shortened plastochron), a phenotype shared with the Poaceae vascular plants TE1 and PLA2/LHD2 mutants. Moreover, the positive correlation between plastochron length and leaf size observed in ΔTEL1 mutants suggests a conserved compensatory mechanism correlating leaf growth and leaf initiation rate that would minimize overall changes in plant biomass. The RNA-binding protein encoded by PpTEL1 contains two N-terminus RNA-recognition motifs, and a third C-terminus non-canonical RRM, specific to TEL proteins. Removal of the PpTEL1 C-terminus (including this third RRM) or only 16-18 amino acids within it seriously impairs PpTEL1 function, suggesting a critical role for this third RRM. These results show a conserved function of the RNA-binding PpTEL1 protein in the regulation of shoot development, from early ancestors to vascular plants, that depends on the third TEL-specific RRM.

  3. Effect of additives on mechanical and electrical properties of semi organic non linear material-γ-glycine

    NASA Astrophysics Data System (ADS)

    Ravishankar, M. N.; Chandramani, R.; Prakash, A. P. Gnana

    2012-06-01

    The semi-organic non-linear optical (NLO) crystals of γ-Glycine (G), with additives like Ammonium Oxalate (AO), Barium Nitrate (BN) and Potassium Nitrate (PN) were grown by aqueous solution method. The mechanical properties, dielectric constant, dielectric loss, AC conductivity of the grown crystals were studied. Studies confirm that the grown NLO crystals retain the merits of organic (SHG response and flexibility) and inorganic (good hardness) properties.

  4. The effect of boron addition on microstructure and mechanical properties of biomedical Ti35Nb6Ta alloy

    SciTech Connect

    Málek, Jaroslav; Hnilica, František; Veselý, Jaroslav; Smola, Bohumil; Březina, Vítězslav

    2014-10-15

    The beta-titanium alloys are promising materials for bioapplications but their processing via melting is difficult. Coarse grains have been observed in as-cast specimens. Subsequent thermo-mechanical processing seems to be necessary in order to obtain fine-grained microstructure with better mechanical properties. The grain size can be decreased significantly by addition of small boron amount. In this work Ti–35Nb–6Ta alloy with various B additions (0, 0.05, 0.1, 0.3 and 0.5 wt.%) has been studied. Even the smallest amount of B leads to significant grain refinement in Ti–35Nb–6Ta alloy (from 1300 to about 350 μm). Slight grain refinement has been observed also after hot forging and solution treatment. TiB particles emerged in specimens due to B addition. These particles contribute to changes in mechanical properties not only in hot forged and solution treated specimens (hardness increase from 140 to 180 HV10), but also in cold swaged specimens (hardness from 230 to 250 HV10, tensile strength from 800 to 920 MPa). The hardness values can be increased up to 370 HV10 during aging at 400 °C (specimen with 0.5 wt.% B). It has been observed that specimens with low boron addition 0.05 wt.% possess no cytotoxicity. On the other hand in specimens with 0.1 wt.% B or more slight adverse effect on cytotoxicity has been observed. - Highlights: • The influence of boron on microstructure and mechanical properties has been studied. • Beta-transus temperature has been determined. • Cytotoxicity depending on boron content has been evaluated. • Possibility of final heat treatment has been determined.

  5. Bifurcational Mechanism of Multistability Formation and Frequency Entrainment in a van der Pol Oscillator with an Additional Oscillatory Circuit

    NASA Astrophysics Data System (ADS)

    Astakhov, Sergey; Astakhov, Oleg; Astakhov, Vladimir; Kurths, Jürgen

    2016-06-01

    In this paper, the bifurcational mechanism of frequency entrainment in a van der Pol oscillator coupled with an additional oscillatory circuit is studied. It is shown that bistability observed in the system is based on two bifurcations: a supercritical Andronov-Hopf bifurcation and a sub-critical Neimark-Sacker bifurcation. The attracting basin boundaries are determined by stable and unstable invariant manifolds of a saddle two-dimensional torus.

  6. Digestive cells from Mytilus galloprovincialis show a partial regulatory volume decrease following acute hypotonic stress through mechanisms involving inorganic ions.

    PubMed

    Torre, Agata; Trischitta, Francesca; Corsaro, Carmelo; Mallamace, Domenico; Faggio, Caterina

    2013-08-01

    The response of isolated digestive cells of the digestive gland of Mytilus galloprovincialis to hypotonic shock was studied using videometric methods. The isolated cells exposed to a rapid change (from 1100 to 800 mosmol kg(-1) ) of the bathing solution osmolality swelled but thereafter underwent a regulatory volume decrease (RVD), tending to recover the original size. When the hypotonic stress was applied in the presence of quinine and glibenclamide, known inhibitors of swelling activated ion channels, the cells did not exhibit an RVD response; in addition, they showed a larger increase in size in respect to control cells. These observations suggest that the digestive cells of the digestive gland have the machinery to cope with the hyposmotic shock allowing them to exhibit a small but significant RVD preventing an excessive increase in cell size. The pharmacological treatment of digestive cells during the RVD experiments suggests that cell volume is regulated by K(+) and Cl(-) efflux followed by an obliged water efflux from the cell. The involvement of organic osmolytes such as taurine and betaine seems to be excluded by NMR measurement on digestive cells.

  7. Influence of additional coupling agent on the mechanical properties of polyester-agave cantala roxb based composites

    NASA Astrophysics Data System (ADS)

    Ubaidillah, Raharjo, Wijang W.; Wibowo, A.; Harjana, Mazlan, S. A.

    2016-03-01

    The mechanical and morphological properties of the unsaturated polyester resins (UPRs)-agave cantala roxb based composite are investigated in this paper. The cantala fiber woven in 3D angle interlock was utilized as the composite reinforcement. Surface grafting of the cantala fiber through chemical treatment was performed by introducing silane coupling agent to improving the compatibility with the polymer matrix. The fabrication of the composite specimens was conducted using vacuum bagging technique. The effect of additional coupling agent to the morphological appearance of surface fracture was observed using scanning electron microscopy. Meanwhile, the influence of additional silane to the mechanical properties was examined using tensile, bending and impact test. The photograph of surface fracture on the treated specimens showed the residual matrix left on the fibers in which the phenomenon was not found in the untreated specimens. Based on mechanical tests, the treated specimens were successfully increased their mechanical properties by 55%, 9.67%, and 92.4% for tensile strength, flexural strength, and impact strength, respectively, at 1.5% silane coupling agent.

  8. A multilayered regulatory mechanism for the autoinhibition and activation of a plant CC-NB-LRR resistance protein with an extra N-terminal domain.

    PubMed

    Chen, Xiaojiao; Zhu, Min; Jiang, Lei; Zhao, Wenyang; Li, Jia; Wu, Jianyan; Li, Chun; Bai, Baohui; Lu, Gang; Chen, Hongyu; Moffett, Peter; Tao, Xiaorong

    2016-10-01

    The tomato resistance protein Sw-5b differs from the classical coiled-coil nucleotide-binding leucine-rich repeat (CC-NB-LRR) resistance proteins by having an extra N-terminal domain (NTD). To understand how NTD, CC and NB-LRR regulate autoinhibition and activation of Sw-5b, we dissected the function(s) of each domain. When viral elicitor was absent, Sw-5b LRR suppressed the central NB-ARC to maintain autoinhibition of the NB-LRR segment. The CC and NTD domains independently and additively enhanced the autoinhibition of NB-LRR. When viral elicitor was present, the NB-LRR segment of Sw-5b was specifically activated to trigger a hypersensitive response. Surprisingly, Sw-5b CC suppressed the activation of NB-LRR, whereas the extra NTD of Sw-5b became a positive regulator and fully activated the resistance protein, probably by relieving the inhibitory effects of the CC. In infection assays of transgenic plants, the NB-LRR segment alone was insufficient to confer resistance against Tomato spotted wilt tospovirus; the layers of NTD and CC regulation on NB-LRR were required for Sw-5b to confer resistance. Based on these findings, we propose that, to counter the negative regulation of the CC on NB-LRR, Sw-5b evolved an extra NTD to coordinate with the CC, thus developing a multilayered regulatory mechanism to control autoinhibition and activation.

  9. A multilayered regulatory mechanism for the autoinhibition and activation of a plant CC-NB-LRR resistance protein with an extra N-terminal domain.

    PubMed

    Chen, Xiaojiao; Zhu, Min; Jiang, Lei; Zhao, Wenyang; Li, Jia; Wu, Jianyan; Li, Chun; Bai, Baohui; Lu, Gang; Chen, Hongyu; Moffett, Peter; Tao, Xiaorong

    2016-10-01

    The tomato resistance protein Sw-5b differs from the classical coiled-coil nucleotide-binding leucine-rich repeat (CC-NB-LRR) resistance proteins by having an extra N-terminal domain (NTD). To understand how NTD, CC and NB-LRR regulate autoinhibition and activation of Sw-5b, we dissected the function(s) of each domain. When viral elicitor was absent, Sw-5b LRR suppressed the central NB-ARC to maintain autoinhibition of the NB-LRR segment. The CC and NTD domains independently and additively enhanced the autoinhibition of NB-LRR. When viral elicitor was present, the NB-LRR segment of Sw-5b was specifically activated to trigger a hypersensitive response. Surprisingly, Sw-5b CC suppressed the activation of NB-LRR, whereas the extra NTD of Sw-5b became a positive regulator and fully activated the resistance protein, probably by relieving the inhibitory effects of the CC. In infection assays of transgenic plants, the NB-LRR segment alone was insufficient to confer resistance against Tomato spotted wilt tospovirus; the layers of NTD and CC regulation on NB-LRR were required for Sw-5b to confer resistance. Based on these findings, we propose that, to counter the negative regulation of the CC on NB-LRR, Sw-5b evolved an extra NTD to coordinate with the CC, thus developing a multilayered regulatory mechanism to control autoinhibition and activation. PMID:27558751

  10. Autophagy Regulatory Network - a systems-level bioinformatics resource for studying the mechanism and regulation of autophagy.

    PubMed

    Türei, Dénes; Földvári-Nagy, László; Fazekas, Dávid; Módos, Dezső; Kubisch, János; Kadlecsik, Tamás; Demeter, Amanda; Lenti, Katalin; Csermely, Péter; Vellai, Tibor; Korcsmáros, Tamás

    2015-01-01

    Autophagy is a complex cellular process having multiple roles, depending on tissue, physiological, or pathological conditions. Major post-translational regulators of autophagy are well known, however, they have not yet been collected comprehensively. The precise and context-dependent regulation of autophagy necessitates additional regulators, including transcriptional and post-transcriptional components that are listed in various datasets. Prompted by the lack of systems-level autophagy-related information, we manually collected the literature and integrated external resources to gain a high coverage autophagy database. We developed an online resource, Autophagy Regulatory Network (ARN; http://autophagy-regulation.org), to provide an integrated and systems-level database for autophagy research. ARN contains manually curated, imported, and predicted interactions of autophagy components (1,485 proteins with 4,013 interactions) in humans. We listed 413 transcription factors and 386 miRNAs that could regulate autophagy components or their protein regulators. We also connected the above-mentioned autophagy components and regulators with signaling pathways from the SignaLink 2 resource. The user-friendly website of ARN allows researchers without computational background to search, browse, and download the database. The database can be downloaded in SQL, CSV, BioPAX, SBML, PSI-MI, and in a Cytoscape CYS file formats. ARN has the potential to facilitate the experimental validation of novel autophagy components and regulators. In addition, ARN helps the investigation of transcription factors, miRNAs and signaling pathways implicated in the control of the autophagic pathway. The list of such known and predicted regulators could be important in pharmacological attempts against cancer and neurodegenerative diseases.

  11. Autophagy Regulatory Network - a systems-level bioinformatics resource for studying the mechanism and regulation of autophagy.

    PubMed

    Türei, Dénes; Földvári-Nagy, László; Fazekas, Dávid; Módos, Dezső; Kubisch, János; Kadlecsik, Tamás; Demeter, Amanda; Lenti, Katalin; Csermely, Péter; Vellai, Tibor; Korcsmáros, Tamás

    2015-01-01

    Autophagy is a complex cellular process having multiple roles, depending on tissue, physiological, or pathological conditions. Major post-translational regulators of autophagy are well known, however, they have not yet been collected comprehensively. The precise and context-dependent regulation of autophagy necessitates additional regulators, including transcriptional and post-transcriptional components that are listed in various datasets. Prompted by the lack of systems-level autophagy-related information, we manually collected the literature and integrated external resources to gain a high coverage autophagy database. We developed an online resource, Autophagy Regulatory Network (ARN; http://autophagy-regulation.org), to provide an integrated and systems-level database for autophagy research. ARN contains manually curated, imported, and predicted interactions of autophagy components (1,485 proteins with 4,013 interactions) in humans. We listed 413 transcription factors and 386 miRNAs that could regulate autophagy components or their protein regulators. We also connected the above-mentioned autophagy components and regulators with signaling pathways from the SignaLink 2 resource. The user-friendly website of ARN allows researchers without computational background to search, browse, and download the database. The database can be downloaded in SQL, CSV, BioPAX, SBML, PSI-MI, and in a Cytoscape CYS file formats. ARN has the potential to facilitate the experimental validation of novel autophagy components and regulators. In addition, ARN helps the investigation of transcription factors, miRNAs and signaling pathways implicated in the control of the autophagic pathway. The list of such known and predicted regulators could be important in pharmacological attempts against cancer and neurodegenerative diseases. PMID:25635527

  12. The effect of TiO2/aluminosilicate nanocomposite additives on the mechanical and thermal properties of polyacrylic coatings

    NASA Astrophysics Data System (ADS)

    Nosrati, Rahimeh; Olad, Ali

    2015-12-01

    The commercial grade polyacrylic latex was modified in order to prepare a mechanical and thermal improved coating. TiO2/Ag-exchanged-aluminosilicate nanocomposites with montmorillonite, zeolite-A and clinoptilolite aluminosilicates were prepared and used as additive in the matrix of polyacrylic latex to achieve a coating with proper mechanical and thermal properties. X-ray diffraction patterns and FESEM were used to characterize the composition, structure, and morphology of the nanocomposite additives. Polyacrylic coatings modified by TiO2/Ag-exchanged-aluminosilicate nanocomposite additives showed higher adhesion strength and hardness compared to unmodified commercial grade polyacrylic coatings. Differential Scanning Calorimetry (DSC) analysis showed lower glass transition temperature for modified polyacrylic coatings than that of unmodified polyacrylic coatings. The tensile tests were also carried out for unmodified and modified polyacrylic coatings. According to the results, the modified polyacrylic based coating with TiO2/Ag-exchanged-clinoptilolite nanocomposite additive was the best coating considering most of useful properties.

  13. Influence of strontium addition on the mechanical properties of gravity cast Mg-3Al-3Sn alloy

    SciTech Connect

    Germen, Gülşah Şevik, Hüseyin; Kurnaz, S. Can

    2013-12-16

    In this study, the effect of strontium (0.01, 0.1, 0.5, 1 wt%) addition on the microstructure and mechanical properties of the gravity cast Mg-3Al-3Sn alloy were investigated. X-ray diffractometry revealed that the main phases are α−Mg, β−Mg{sub 17}Al{sub 12} and Mg{sub 2}Sn in the Mg-3Al-3Sn alloy. With addition The tensile testing results showed that the yield and ultimate tensile strength and elongation of Mg-3Al-3Sn alloy increased by adding Sr up to 0.1 wt.% and then is gradually decreased with the addition of more alloying element.

  14. Effects of Minute Addition of Ni on Microstructure and Mechanical Properties of Sn-Zn Eutectic Alloy

    NASA Astrophysics Data System (ADS)

    Pandey, P.; Tiwary, C. S.; Chattopadhyay, K.

    2016-10-01

    The current work explores the effects of a small addition of Ni on the microstructure and mechanical properties of Sn-Zn eutectic solder alloy (Sn-14.9 at.%Zn). In two sets of experiments, Ni is either added to the eutectic alloy or Zn in the eutectic alloy is replaced by an increasing amount of Ni. The study indicates that small additions of Ni in eutectic Sn-Zn solder (˜0.017 at.%) refines the eutectic microstructure together with the appearance of the small amount of primary Zn plates. Increasing the Ni content to 0.142 at.% and beyond, then an intermetallic phase ϒ-Ni5Zn21 with dendritic morphology appears in the microstructure along with dendrites of primary Sn. The scale of eutectic microstructure shows a decreasing trend till 0.902 at.%Ni with eutectic spacing of 1.98 ± 0.32 μm for this alloy. Further addition of Ni coarsens the microstructure. The replacement of Zn with Ni in the eutectic composition follows a similar trend with a lesser refinement of the microstructure. In both the scenarios, the addition of a small amount of Ni increases the eutectic temperatures till a critical concentration is reached beyond which one can observe a decrease in the eutectic point. The trend is similar for the solid solubility of Zn in Sn while the trend is opposite for the measured eutectic composition, which decreases at the initial stages of Ni addition. Through a detailed measurement of mechanical properties, the study establishes significant improvement of the strength of Sn-Zn solder with small additions of Ni in the alloy with a maximum hardness of 26 ± 1 HV and 0.2% proof stress of 72 ± 3 MPa at room temperature for the eutectic alloy with 0.902 at.%Ni.

  15. Effects of Minute Addition of Ni on Microstructure and Mechanical Properties of Sn-Zn Eutectic Alloy

    NASA Astrophysics Data System (ADS)

    Pandey, P.; Tiwary, C. S.; Chattopadhyay, K.

    2016-06-01

    The current work explores the effects of a small addition of Ni on the microstructure and mechanical properties of Sn-Zn eutectic solder alloy (Sn-14.9 at.%Zn). In two sets of experiments, Ni is either added to the eutectic alloy or Zn in the eutectic alloy is replaced by an increasing amount of Ni. The study indicates that small additions of Ni in eutectic Sn-Zn solder (˜0.017 at.%) refines the eutectic microstructure together with the appearance of the small amount of primary Zn plates. Increasing the Ni content to 0.142 at.% and beyond, then an intermetallic phase ϒ-Ni5Zn21 with dendritic morphology appears in the microstructure along with dendrites of primary Sn. The scale of eutectic microstructure shows a decreasing trend till 0.902 at.%Ni with eutectic spacing of 1.98 ± 0.32 μm for this alloy. Further addition of Ni coarsens the microstructure. The replacement of Zn with Ni in the eutectic composition follows a similar trend with a lesser refinement of the microstructure. In both the scenarios, the addition of a small amount of Ni increases the eutectic temperatures till a critical concentration is reached beyond which one can observe a decrease in the eutectic point. The trend is similar for the solid solubility of Zn in Sn while the trend is opposite for the measured eutectic composition, which decreases at the initial stages of Ni addition. Through a detailed measurement of mechanical properties, the study establishes significant improvement of the strength of Sn-Zn solder with small additions of Ni in the alloy with a maximum hardness of 26 ± 1 HV and 0.2% proof stress of 72 ± 3 MPa at room temperature for the eutectic alloy with 0.902 at.%Ni.

  16. Role of hydrogen abstraction acetylene addition mechanisms in the formation of chlorinated naphthalenes. 2. Kinetic modeling and the detailed mechanism of ring closure.

    PubMed

    McIntosh, Grant J; Russell, Douglas K

    2014-12-26

    The dominant formation mechanisms of chlorinated phenylacetylenes, naphthalenes, and phenylvinylacetylenes in relatively low pressure and temperature (∼40 Torr and 1000 K) pyrolysis systems are explored. Mechanism elucidation is achieved through a combination of theoretical and experimental techniques, the former employing a novel simplification of kinetic modeling which utilizes rate constants in a probabilistic framework. Contemporary formation schemes of the compounds of interest generally require successive additions of acetylene to phenyl radicals. As such, infrared laser powered homogeneous pyrolyses of dichloro- or trichloroethylene were perturbed with 1,2,4- or 1,2,3-trichlorobenzene. The resulting changes in product identities were compared with the major products expected from conventional pathways, aided by the results of our previous computational work. This analysis suggests that a Bittner-Howard growth mechanism, with a novel amendment to the conventional scheme made just prior to ring closure, describes the major products well. Expected products from a number of other potentially operative channels are shown to be incongruent with experiment, further supporting the role of Bittner-Howard channels as the unique pathway to naphthalene growth. A simple quantitative analysis which performs very well is achieved by considering the reaction scheme as a probability tree, with relative rate constants being cast as branching probabilities. This analysis describes all chlorinated phenylacetylene, naphthalene, and phenylvinylacetylene congeners. The scheme is then tested in a more general system, i.e., not enforcing a hydrogen abstraction/acetylene addition mechanism, by pyrolyzing mixtures of di- and trichloroethylene without the addition of an aromatic precursor. The model indicates that these mechanisms are still likely to be operative.

  17. Immune-Regulatory Mechanisms of Classical and Experimental Multiple Sclerosis Drugs: A Special Focus on Helminth-Derived Treatments.

    PubMed

    Peón, Alberto N; Terrazas, Luis I

    2016-01-01

    Multiple sclerosis (MS) is the most prevalent autoimmune disease affecting the central nervous system (CNS). Its pathophysiology is centered on neuron myelin sheath destruction in a manner largely dependent upon CD4+/CD8+ T-cell autoreactivity against myelin antigens, inducing Th1/Th17 pathogenic responses with the resulting production of free radicals and soluble mediators that exhibit the effector mechanisms of neurodegeneration. The immune response responsible for this disease is complex and challenges modern medicine. Consequently, many experimental therapies have been proposed in addition to the classical array of immunoregulatory/ immunosuppressive drugs that are normally used to treat MS. In this review, we will describe the effects and mechanisms of action of widely used disease-modifying MS drugs as well as those of select treatments that are currently in the experimental phase. Special emphasis is placed on helminth-derived immunoregulators, as some of them have shown promising results. Additionally, we will compare the mechanisms of action of both the MS drugs and the helminth-derived treatments to discuss the potential importance of some signaling pathways in the control of MS.

  18. Effect of additive particles on mechanical, thermal, and cell functioning properties of poly(methyl methacrylate) cement

    PubMed Central

    Khandaker, Morshed; Vaughan, Melville B; Morris, Tracy L; White, Jeremiah J; Meng, Zhaotong

    2014-01-01

    The most common bone cement material used clinically today for orthopedic surgery is poly(methyl methacrylate) (PMMA). Conventional PMMA bone cement has several mechanical, thermal, and biological disadvantages. To overcome these problems, researchers have investigated combinations of PMMA bone cement and several bioactive particles (micrometers to nanometers in size), such as magnesium oxide, hydroxyapatite, chitosan, barium sulfate, and silica. A study comparing the effect of these individual additives on the mechanical, thermal, and cell functional properties of PMMA would be important to enable selection of suitable additives and design improved PMMA cement for orthopedic applications. Therefore, the goal of this study was to determine the effect of inclusion of magnesium oxide, hydroxyapatite, chitosan, barium sulfate, and silica additives in PMMA on the mechanical, thermal, and cell functional performance of PMMA. American Society for Testing and Materials standard three-point bend flexural and fracture tests were conducted to determine the flexural strength, flexural modulus, and fracture toughness of the different PMMA samples. A custom-made temperature measurement system was used to determine maximum curing temperature and the time needed for each PMMA sample to reach its maximum curing temperature. Osteoblast adhesion and proliferation experiments were performed to determine cell viability using the different PMMA cements. We found that flexural strength and fracture toughness were significantly greater for PMMA specimens that incorporated silica than for the other specimens. All additives prolonged the time taken to reach maximum curing temperature and significantly improved cell adhesion of the PMMA samples. The results of this study could be useful for improving the union of implant-PMMA or bone-PMMA interfaces by incorporating nanoparticles into PMMA cement for orthopedic and orthodontic applications. PMID:24920906

  19. Microhomology-mediated mechanisms underlie non-recurrent disease-causing microdeletions of the FOXL2 gene or its regulatory domain.

    PubMed

    Verdin, Hannah; D'haene, Barbara; Beysen, Diane; Novikova, Yana; Menten, Björn; Sante, Tom; Lapunzina, Pablo; Nevado, Julian; Carvalho, Claudia M B; Lupski, James R; De Baere, Elfride

    2013-01-01

    Genomic disorders are often caused by recurrent copy number variations (CNVs), with nonallelic homologous recombination (NAHR) as the underlying mechanism. Recently, several microhomology-mediated repair mechanisms--such as microhomology-mediated end-joining (MMEJ), fork stalling and template switching (FoSTeS), microhomology-mediated break-induced replication (MMBIR), serial replication slippage (SRS), and break-induced SRS (BISRS)--were described in the etiology of non-recurrent CNVs in human disease. In addition, their formation may be stimulated by genomic architectural features. It is, however, largely unexplored to what extent these mechanisms contribute to rare, locus-specific pathogenic CNVs. Here, fine-mapping of 42 microdeletions of the FOXL2 locus, encompassing FOXL2 (32) or its regulatory domain (10), serves as a model for rare, locus-specific CNVs implicated in genetic disease. These deletions lead to blepharophimosis syndrome (BPES), a developmental condition affecting the eyelids and the ovary. For breakpoint mapping we used targeted array-based comparative genomic hybridization (aCGH), quantitative PCR (qPCR), long-range PCR, and Sanger sequencing of the junction products. Microhomology, ranging from 1 bp to 66 bp, was found in 91.7% of 24 characterized breakpoint junctions, being significantly enriched in comparison with a random control sample. Our results show that microhomology-mediated repair mechanisms underlie at least 50% of these microdeletions. Moreover, genomic architectural features, like sequence motifs, non-B DNA conformations, and repetitive elements, were found in all breakpoint regions. In conclusion, the majority of these microdeletions result from microhomology-mediated mechanisms like MMEJ, FoSTeS, MMBIR, SRS, or BISRS. Moreover, we hypothesize that the genomic architecture might drive their formation by increasing the susceptibility for DNA breakage or promote replication fork stalling. Finally, our locus-centered study

  20. Dynamic mechanical properties of a maxillofacial silicone elastomer incorporating a ZnO additive: the effect of artificial aging.

    PubMed

    Mouzakis, Dionysios E; Papadopoulos, Triantafillos D; Polyzois, Gregory L; Griniari, Panagiota G

    2010-11-01

    The main objective of the current study was to investigate the dynamic mechanical properties of a room-temperature vulcanizing silicone incorporating different fractions of zinc oxide (ZnO) after indoor and outdoor photoaging. Forty-eight samples were produced by adding different amounts of ZnO into a commercial maxillofacial silicone (EPISIL-E). The samples were divided into 4 groups containing 0.0, 0.2, 0.5, and 1 wt% ZnO additive, respectively. Samples were exposed to sunlight (subgroup 2), ultraviolet (subgroup 3), and fluorescence (subgroup 4) aging, whereas nonaged samples comprised the control subgroup (subgroup 1). Dynamic mechanical analysis was used to determine the storage modulus (E'), loss modulus (E″), and damping capacity (tanδ). General linear statistic model was conducted to evaluate the effects of aging, testing frequency, and composition on the dynamic mechanical properties of the silicone with the ZnO additive. Post hoc analysis was performed using Tukey test. Statistical analysis revealed a significant impact of composition on tanδ (P < 0.05). Aging influenced E' and E″ (P < 0.01). The combination of aging and composition had a significant effect on all dynamic properties (P < 0.01).

  1. Dynamic mechanical properties of a maxillofacial silicone elastomer incorporating a ZnO additive: the effect of artificial aging.

    PubMed

    Mouzakis, Dionysios E; Papadopoulos, Triantafillos D; Polyzois, Gregory L; Griniari, Panagiota G

    2010-11-01

    The main objective of the current study was to investigate the dynamic mechanical properties of a room-temperature vulcanizing silicone incorporating different fractions of zinc oxide (ZnO) after indoor and outdoor photoaging. Forty-eight samples were produced by adding different amounts of ZnO into a commercial maxillofacial silicone (EPISIL-E). The samples were divided into 4 groups containing 0.0, 0.2, 0.5, and 1 wt% ZnO additive, respectively. Samples were exposed to sunlight (subgroup 2), ultraviolet (subgroup 3), and fluorescence (subgroup 4) aging, whereas nonaged samples comprised the control subgroup (subgroup 1). Dynamic mechanical analysis was used to determine the storage modulus (E'), loss modulus (E″), and damping capacity (tanδ). General linear statistic model was conducted to evaluate the effects of aging, testing frequency, and composition on the dynamic mechanical properties of the silicone with the ZnO additive. Post hoc analysis was performed using Tukey test. Statistical analysis revealed a significant impact of composition on tanδ (P < 0.05). Aging influenced E' and E″ (P < 0.01). The combination of aging and composition had a significant effect on all dynamic properties (P < 0.01). PMID:21119441

  2. Insight into the reaction mechanisms for oxidative addition of strong σ bonds to an Al(i) center.

    PubMed

    Zhang, Xiangfei; Cao, Zexing

    2016-06-21

    The oxidation addition of a series of σ H-X bonds (X = H, B, C, Si, N, P, and O) to a single Al(i) supported by a (NacNac)(-) bidentate ligand ((NacNac)(-) = [ArNC(Me)CHC(Me)NAr](-) and Ar = 2,6-(i)Pr2C6H3) has been explored through extensive DFT calculations. The presented results show that activation and addition of these σ bonds follow various reaction mechanisms, in which hydride transfer, proton transfer, and Al-X bond coupling steps are involved. The predicted free energy barriers for these oxidative additions range from 8 to 32 kcal mol(-1), and all the reactions are remarkably favorable thermodynamically. However, sterically hindered ligands, for most reactants, make the formation of the initial reactant complex difficult and may reduce the efficiency of the reaction. Calculations reveal a strong dependence of the reaction mechanism and low-energy channel on the bonding features of X-H and the local structural environments. PMID:27249667

  3. Effect of Ti additive on (Cr, Fe)7C3 carbide in arc surfacing layer and its refined mechanism

    NASA Astrophysics Data System (ADS)

    Zhou, Yefei; Yang, Yulin; Yang, Jian; Hao, Feifei; Li, Da; Ren, Xuejun; Yang, Qingxiang

    2012-06-01

    Arc surfacing layer of hypoeutectic high chromium cast iron (HCCI) expects refiner carbides in the microstructure to improve its mechanical properties. In this paper, Ti additive as a strong carbide forming element was added in the hypoeutectic HCCI arc surfacing layer. Microstructure of titaniferous hypoeutectic HCCI was studied by optical microscopy, X-ray diffraction and field emission scanning electronic microscopy with energy dispersive spectrometer. Furthermore, the M(M = Cr, Fe)7C3 carbide refinement mechanism was explained by the phase diagram calculation and lattice misfit theory. The results show that, the M7C3 carbide in arc surfacing microstructure of hypoeutectic HCCI has been refined with 2 wt.% Ti additive, and TiC carbide can be observed in/around the M7C3 carbide. With Ti addictive increasing, the micro-hardness along the depth in profile section of layer becomes more uniform, and the wear resistance has been improved. According to the phase diagram calculation, MC carbide precipitates prior to M7C3 carbide in Fe-Cr-C-Ti alloy. In addition, the lattice misfit between (1 1 0)TiC and (0C is 9.257%, which indicates that the TiC as heterogeneous nuclei of the M7C3 is medium effective. Therefore, the M7C3 carbide can be refined.

  4. Review: regulatory mechanisms of gonadotropin-inhibitory hormone (GnIH) synthesis and release in photoperiodic animals

    PubMed Central

    Tsutsui, Kazuyoshi; Ubuka, Takayoshi; Bentley, George E.; Kriegsfeld, Lance J.

    2013-01-01

    Gonadotropin-inhibitory hormone (GnIH) is a novel hypothalamic neuropeptide that was discovered in quail as an inhibitory factor for gonadotropin release. GnIH inhibits gonadotropin synthesis and release in birds through actions on gonadotropin-releasing hormone (GnRH) neurons and gonadotropes, mediated via the GnIH receptor (GnIH-R), GPR147. Subsequently, GnIH was identified in mammals and other vertebrates. As in birds, mammalian GnIH inhibits gonadotropin secretion, indicating a conserved role for this neuropeptide in the control of the hypothalamic-pituitary-gonadal (HPG) axis across species. Identification of the regulatory mechanisms governing GnIH expression and release is important in understanding the physiological role of the GnIH system. A nocturnal hormone, melatonin, appears to act directly on GnIH neurons through its receptor to induce expression and release of GnIH in quail, a photoperiodic bird. Recently, a similar, but opposite, action of melatonin on the inhibition of expression of mammalian GnIH was shown in hamsters and sheep, photoperiodic mammals. These results in photoperiodic animals demonstrate that GnIH expression is photoperiodically modulated via a melatonin-dependent process. Recent findings indicate that GnIH may be a mediator of stress-induced reproductive disruption in birds and mammals, pointing to a broad role for this neuropeptide in assessing physiological state and modifying reproductive effort accordingly. This paper summarizes the advances made in our knowledge regarding the regulation of GnIH synthesis and release in photoperiodic birds and mammals. This paper also discusses the neuroendocrine integration of environmental signals, such as photoperiods and stress, and internal signals, such as GnIH, melatonin, and glucocorticoids, to control avian and mammalian reproduction. PMID:23596387

  5. Review: regulatory mechanisms of gonadotropin-inhibitory hormone (GnIH) synthesis and release in photoperiodic animals.

    PubMed

    Tsutsui, Kazuyoshi; Ubuka, Takayoshi; Bentley, George E; Kriegsfeld, Lance J

    2013-01-01

    Gonadotropin-inhibitory hormone (GnIH) is a novel hypothalamic neuropeptide that was discovered in quail as an inhibitory factor for gonadotropin release. GnIH inhibits gonadotropin synthesis and release in birds through actions on gonadotropin-releasing hormone (GnRH) neurons and gonadotropes, mediated via the GnIH receptor (GnIH-R), GPR147. Subsequently, GnIH was identified in mammals and other vertebrates. As in birds, mammalian GnIH inhibits gonadotropin secretion, indicating a conserved role for this neuropeptide in the control of the hypothalamic-pituitary-gonadal (HPG) axis across species. Identification of the regulatory mechanisms governing GnIH expression and release is important in understanding the physiological role of the GnIH system. A nocturnal hormone, melatonin, appears to act directly on GnIH neurons through its receptor to induce expression and release of GnIH in quail, a photoperiodic bird. Recently, a similar, but opposite, action of melatonin on the inhibition of expression of mammalian GnIH was shown in hamsters and sheep, photoperiodic mammals. These results in photoperiodic animals demonstrate that GnIH expression is photoperiodically modulated via a melatonin-dependent process. Recent findings indicate that GnIH may be a mediator of stress-induced reproductive disruption in birds and mammals, pointing to a broad role for this neuropeptide in assessing physiological state and modifying reproductive effort accordingly. This paper summarizes the advances made in our knowledge regarding the regulation of GnIH synthesis and release in photoperiodic birds and mammals. This paper also discusses the neuroendocrine integration of environmental signals, such as photoperiods and stress, and internal signals, such as GnIH, melatonin, and glucocorticoids, to control avian and mammalian reproduction.

  6. Bacillus subtilis as a platform for molecular characterisation of regulatory mechanisms of Enterococcus faecalis resistance against cell wall antibiotics.

    PubMed

    Fang, Chong; Stiegeler, Emanuel; Cook, Gregory M; Mascher, Thorsten; Gebhard, Susanne

    2014-01-01

    To combat antibiotic resistance of Enterococcus faecalis, a better understanding of the molecular mechanisms, particularly of antibiotic detection, signal transduction and gene regulation is needed. Because molecular studies in this bacterium can be challenging, we aimed at exploiting the genetically highly tractable Gram-positive model organism Bacillus subtilis as a heterologous host. Two fundamentally different regulators of E. faecalis resistance against cell wall antibiotics, the bacitracin sensor BcrR and the vancomycin-sensing two-component system VanSB-VanRB, were produced in B. subtilis and their functions were monitored using target promoters fused to reporter genes (lacZ and luxABCDE). The bacitracin resistance system BcrR-BcrAB of E. faecalis was fully functional in B. subtilis, both regarding regulation of bcrAB expression and resistance mediated by the transporter BcrAB. Removal of intrinsic bacitracin resistance of B. subtilis increased the sensitivity of the system. The lacZ and luxABCDE reporters were found to both offer sensitive detection of promoter induction on solid media, which is useful for screening of large mutant libraries. The VanSB-VanRB system displayed a gradual dose-response behaviour to vancomycin, but only when produced at low levels in the cell. Taken together, our data show that B. subtilis is a well-suited host for the molecular characterization of regulatory systems controlling resistance against cell wall active compounds in E. faecalis. Importantly, B. subtilis facilitates the careful adjustment of expression levels and genetic background required for full functionality of the introduced regulators.

  7. Spectral changes of near-infrared spectroscopy signals in migraineurs with aura reveal an impaired carbon dioxide-regulatory mechanism.

    PubMed

    Liboni, William; Molinari, Filippo; Allais, Gianni; Mana, Ornella; Negri, Emanuela; Bussone, Gennaro; D'Andrea, Giovanni; Benedetto, Chiara

    2009-05-01

    Subjects suffering from migraine with aura (MwA) present an altered cerebral autoregulation during migraine attacks. It is still unclear whether MwA sufferers present a normal autoregulation during attack-free periods. In this study, we characterized cerebral autoregulation in the frequency domain by analyzing the spontaneous oscillations superimposed on the cerebral hemodynamic signals, as detected by near-infrared spectroscopy (NIRS). Ten healthy women (age: 38.4 +/- 9.5 years) and ten women suffering from MwA (age: 35.2 +/- 10.5 years) underwent NIRS recording in resting conditions and during breath-holding (BH). Being the NIRS signals during BH nonstationary, we used the Choi-Williams time-frequency distribution to perform spectral analysis. We considered 256 s of signals and quantified the variation in the power of the very-low frequencies (VLF: 20-40 mHz) and of the low frequencies (LF: 40-140 mHz) as response to BH. Results showed that BH increases the power in the LF band both in healthy and MwA subjects. Considering the signal of the deoxygenated hemoglobin, the average power increase in the LF band was equal to 20% +/- 15.4% for the healthy group and significantly lower, 4.8% +/- 8.3%, in the MwA group (Student's t test, P < 0.02). No significant difference was observed in the VLF band or in the oxygenated hemoglobin signal power variations of the LF and VLF bands. The resulting data reveal a possible impairment in the carbon dioxide-regulatory mechanism in MwA subjects.

  8. Regulatory mechanisms and the role of calcium and potassium channels controlling supercontractile crop muscles in adult Phormia regina.

    PubMed

    Solari, Paolo; Stoffolano, John G; Fitzpatrick, Joanna; Gelperin, Alan; Thomson, Alan; Talani, Giuseppe; Sanna, Enrico; Liscia, Anna

    2013-09-01

    Bioassays and electrophysiological recordings were conducted in the adult blowfly Phormia regina to provide new insights into the regulatory mechanisms governing the crop filling and emptying processes of the supercontractile crop muscles. The cibarial pump drives ingestion. Simultaneous multisite extracellular recordings show that crop lobe (P5) distension during ingestion of a 4.7 μl sugar meal does not require muscle activity by any of the other pumps of the system. Conversely, pumping of fluids toward the anterior of the crop system during crop emptying is brought about by active muscle contraction, in the form of a highly coordinated peristaltic wave starting from P5 and progressively propagating to P6, P4 and P3 pumps, with P5 contracting with a frequency about 3.4 times higher than the other pumps. The crop contraction rate is also modulated by hemolymph-borne factors such as sugars, through ligand recognition at a presumptive receptor site rather than by an osmotic effect, as assessed by both behavioural and electrophysiological experiments. In this respect, sugars of equal osmolarity produce different effects, glucose being inhibitory and mannose ineffective for crop muscles, while trehalose enhances crop activity. Finally, voltage and current clamp experiments show that the muscle action potentials (mAPs) at the P4 pump are sustained by a serotonin-sensitive calcium conductance. Serotonin enhances calcium entry into the muscle cells and this could lead, as an indirect modulatory effect, to activation of a Ca(2+)-activated K(+) conductance (IK(Ca)), which sustains the following mAP repolarization phase in such a way that further mAPs can be generated early and the frequency consequently increased. PMID:23834826

  9. Probing the chemical mechanism and critical regulatory amino acid residues of Drosophila melanogaster arylalkylamine N-acyltransferase like 2.

    PubMed

    Dempsey, Daniel R; Carpenter, Anne-Marie; Ospina, Santiago Rodriguez; Merkler, David J

    2015-11-01

    Arylalkylamine N-acyltransferase like 2 (AANATL2) catalyzes the formation of N-acylarylalkylamides from the corresponding acyl-CoA and arylalkylamine. The N-acylation of biogenic amines in Drosophila melanogaster is a critical step for the inactivation of neurotransmitters, cuticle sclerotization, and melatonin biosynthesis. In addition, D. melanogaster has been used as a model system to evaluate the biosynthesis of fatty acid amides: a family of potent cell signaling lipids. We have previously showed that AANATL2 catalyzes the formation of N-acylarylakylamides, including long-chain N-acylserotonins and N-acyldopamines. Herein, we define the kinetic mechanism for AANATL2 as an ordered sequential mechanism with acetyl-CoA binding first followed by tyramine to generate the ternary complex prior to catalysis. Bell shaped kcat,app - acetyl-CoA and (kcat/Km)app - acetyl-CoA pH-rate profiles identified two apparent pKa,app values of ∼7.4 and ∼8.9 that are critical to catalysis, suggesting the AANATL2-catalyzed formation of N-acetyltyramine occurs through an acid/base chemical mechanism. Site-directed mutagenesis of a conserved glutamate that corresponds to the catalytic base for other D. melanogaster AANATL enzymes did not produce a substantial depression in the kcat,app value nor did it abolish the pKa,app value attributed to the general base in catalysis (pKa ∼7.4). These data suggest that AANATL2 catalyzes the formation of N-acylarylalkylamides using either different catalytic residues or a different chemical mechanism relative to other D. melanogaster AANATL enzymes. In addition, we constructed other site-directed mutants of AANATL2 to help define the role of targeted amino acids in substrate binding and/or enzyme catalysis.

  10. Mechanical degradation under hydrogen of yttrium doped barium zirconate electrolyte material prepared with NiO additive

    NASA Astrophysics Data System (ADS)

    Ciria, D.; Ben Hassine, M.; Jiménez-Melendo, M.; Iakovleva, A.; Haghi-Ashtiani, P.; Aubin, V.; Dezanneau, G.

    2016-07-01

    Recently, a novel process was presented to fabricate dense yttrium-doped barium zirconate electrolytes with high proton conductivity. This process was based on the use of a NiO additive during reactive sintering. We show here that materials made from this process present a fast degradation of mechanical properties when put in hydrogen-rich conditions, while material made from conventional sintering without NiO aid remains intact in the same conditions. The fast degradation of samples made from reactive sintering, leading to sample failure under highly compressive conditions, is due to the reduction of NiO nanoparticles at grain boundaries as shown from structural and chemical analyses using Transmission Electron Microscopy. By the present study, we alert about the potential risk of cell failure due to this mechanical degradation.

  11. Porous calcium polyphosphate bone substitutes: additive manufacturing versus conventional gravity sinter processing-effect on structure and mechanical properties.

    PubMed

    Hu, Youxin; Shanjani, Yaser; Toyserkani, Ehsan; Grynpas, Marc; Wang, Rizhi; Pilliar, Robert

    2014-02-01

    Porous calcium polyphosphate (CPP) structures proposed as bone-substitute implants and made by sintering CPP powders to form bending test samples of approximately 35 vol % porosity were machined from preformed blocks made either by additive manufacturing (AM) or conventional gravity sintering (CS) methods and the structure and mechanical characteristics of samples so made were compared. AM-made samples displayed higher bending strengths (≈1.2-1.4 times greater than CS-made samples), whereas elastic constant (i.e., effective elastic modulus of the porous structures) that is determined by material elastic modulus and structural geometry of the samples was ≈1.9-2.3 times greater for AM-made samples. X-ray diffraction analysis showed that samples made by either method displayed the same crystal structure forming β-CPP after sinter annealing. The material elastic modulus, E, determined using nanoindentation tests also showed the same value for both sample types (i.e., E ≈ 64 GPa). Examination of the porous structures indicated that significantly larger sinter necks resulted in the AM-made samples which presumably resulted in the higher mechanical properties. The development of mechanical properties was attributed to the different sinter anneal procedures required to make 35 vol % porous samples by the two methods. A primary objective of the present study, in addition to reporting on bending strength and sample stiffness (elastic constant) characteristics, was to determine why the two processes resulted in the observed mechanical property differences for samples of equivalent volume percentage of porosity. An understanding of the fundamental reason(s) for the observed effect is considered important for developing improved processes for preparation of porous CPP implants as bone substitutes for use in high load-bearing skeletal sites.

  12. Enhancement of the Thermal Stability and Mechanical Hardness of Zr-Al-Co Amorphous Alloys by Ag Addition

    NASA Astrophysics Data System (ADS)

    Wang, Yongyong; Dong, Xiao; Song, Xiaohui; Wang, Jinfeng; Li, Gong; Liu, Riping

    2016-05-01

    The thermal and mechanical properties of Zr57Al15Co28- X Ag X ( X = 0 and 8) amorphous alloys were investigated using differential scanning calorimetry, in situ high-pressure angle dispersive X-ray diffraction measurements with synchrotron radiation, and nanoindentation. Results show that Ag doping improves effective activation energy, nanohardness, elastic modulus, and bulk modulus. Ag addition enhances topological and chemical short-range orderings, which can improve local packing efficiency and restrain long-range atom diffusion. This approach has implications for the design of the microstructure- and property-controllable functional materials for various applications.

  13. Effect of silver addition on mechanical properties of melt-processed Sm-Ba-Cu-O bulk superconductor

    SciTech Connect

    Sakai, Naomichi; Miyamoto, Takeshi; Seo, Seokjong; Nariki, Shinya; Murakami, Masato

    1999-11-01

    The authors have studied mechanical properties of melt-processed single-grain Sm-Ba-Cu-O (Sm123+Sm211) bulks with and without silver doping. Tensile stress is induced by thermal stress during heat treatment, and also induced by applying magnetic fields. It is found that the silver addition was effective in decreasing the thermal stress and increasing the tensile strength of the Sm-Ba-Cu-O bulk. The tensile strength of the silver doped sample was 37.4MPa, which is about one and half times larger than that of the undoped sample.

  14. Effect of Ca addition on the microstructure and mechanical properties of as-cast Mg-Sm alloys.

    PubMed

    Luo, Xiaoping; Fang, Daqing; Chai, Yuesheng; Yang, Bin

    2016-08-01

    This study investigated the effect of Ca addition on the microstructure and mechanical properties of as-cast Mg-4Sm alloys. The addition of 1.0 wt% Ca led to a significant grain refinement of Mg-4.0Sm alloys owing to the formation of rod-like Mg2Ca phases that acted as active nucleates for the Mg matrix. The as-cast Mg-4.0Sm-1.0Ca alloy showed the smallest grain size at 45 μm. Furthermore, the Mg-4.0Sm-1.0Ca alloy exhibited greater hardness, higher tensile strength, and higher yield tensile strength and elongation than the other two alloys with different Ca contents. These results were attributed to the grain refinement and precipitation strengthening of the Mg2Ca and Mg41Sm5 phases. Microsc. Res. Tech. 79:707-711, 2016. © 2016 Wiley Periodicals, Inc.

  15. Theoretical study of the oxidation mechanisms of naphthalene initiated by hydroxyl radicals: the OH-addition pathway.

    PubMed

    Shiroudi, Abolfazl; Deleuze, Michael S; Canneaux, Sébastien

    2014-07-01

    The oxidation mechanisms of naphthalene by OH radicals under inert (He) conditions have been studied using density functional theory along with various exchange-correlation functionals. Comparison has been made with benchmark CBS-QB3 theoretical results. Kinetic rate constants were correspondingly estimated by means of transition state theory and statistical Rice-Ramsperger-Kassel-Marcus (RRKM) theory. Comparison with experiment confirms that, on the OH-addition reaction pathway leading to 1-naphthol, the first bimolecular reaction step has an effective negative activation energy around -1.5 kcal mol(-1), whereas this step is characterized by an activation energy around 1 kcal mol(-1) on the OH-addition reaction pathway leading to 2-naphthol. Effective rate constants have been calculated according to a steady state analysis upon a two-step model reaction mechanism. In line with experiment, the correspondingly obtained branching ratios indicate that, at temperatures lower than 410 K, the most abundant product resulting from the oxidation of naphthalene by OH radicals must be 1-naphthol. The regioselectivity of the OH(•)-addition onto naphthalene decreases with increasing temperatures and decreasing pressures. Because of slightly positive or even negative activation energies, the RRKM calculations demonstrate that the transition state approximation breaks down at ambient pressure (1 bar) for the first bimolecular reaction steps. Overwhelmingly high pressures, larger than 10(5) bar, would be required for restoring to some extent (within ∼5% accuracy) the validity of this approximation for all the reaction channels that are involved in the OH-addition pathway. Analysis of the computed structures, bond orders, and free energy profiles demonstrate that all reaction steps involved in the oxidation of naphthalene by OH radicals satisfy Leffler-Hammond's principle. Nucleus independent chemical shift indices and natural bond orbital analysis also show that the computed

  16. A novel P106L mutation in EPSPS and an unknown mechanism(s) act additively to confer resistance to glyphosate in a South African Lolium rigidum population.

    PubMed

    Kaundun, Shiv S; Dale, Richard P; Zelaya, Ian A; Dinelli, Giovanni; Marotti, Ilaria; McIndoe, Eddie; Cairns, Andrew

    2011-04-13

    Glyphosate resistance evolution in weeds is a growing problem in world agriculture. Here, we have investigated the mechanism(s) of glyphosate resistance in a Lolium rigidum population (DAG1) from South Africa. Nucleotide sequencing revealed the existence of at least three EPSPS homologues in the L. rigidum genome and identified a novel proline 106 to leucine substitution (P106L) in 52% DAG1 individuals. This mutation conferred a 1.7-fold resistance increase to glyphosate at the whole plant level. Additionally, a 3.1-fold resistance increase, not linked to metabolism or translocation, was estimated between wild-type P106-DAG1 and P106-STDS sensitive plants. Point accepted mutation analysis suggested that other amino acid substitutions at EPSPS position 106 are likely to be found in nature besides the P106/S/A/T/L point mutations reported to date. This study highlights the importance of minor mechanisms acting additively to confer significant levels of resistance to commercial field rates of glyphosate in weed populations subjected to high selection pressure.

  17. Microstructure and Room Temperature Mechanical Properties of the Ni3Si-BASED Alloy with Titanium Addition

    NASA Astrophysics Data System (ADS)

    Wang, S. K.; Fu, C. C.; Cai, Z. W.; Jian, S. R.; Jang, J. S. C.; Zhang, H. Z.; Hsu, H. C.

    2011-06-01

    The microstructure and room temperature (RT) mechanical properties of the Ni-15Si-2Nb-1Cr-3Ti-0.2B alloy were investigated by means of X-ray diffraction, scanning electron microscopy (SEM), electron probe microanalysis (EPMA), transmission electron microscopy (TEM), and tensile test in air and vacuum. The results of tensile test revealed that the effect of Ti addition can significantly improve the elongation as well as ultimate tensile strength (UTS) (18.3% and 1320 MPa in air, 21% and 1600 MPa in vacuum) in comparison with the Ni-18Si-3Nb-1Cr-0.2B base alloy (10% and 1130 MPa in air, 14% and 1240 MPa in vacuum) at room temperature. In addition, the fracture surface of specimen after tensile test presents a typical transgranular ductile mode, with a fully dimpled fracture pattern. This indicates that the addition of Ti in the Ni-15Si-2Nb-1Cr-3Ti-0.2B alloy can effectively suppress the environmental embrittlement at room temperature. In addition, the Ni-15Si-2Nb-1Cr-3Ti-0.2B alloy exhibits insensitively to the strain rate both in air or vacuum at room temperature.

  18. Awareness of federal regulatory mechanisms relevant to community-engaged research: survey of health disparities-oriented NIH-funded investigators

    PubMed Central

    Fullerton, Stephanie M.; Anderson, Emily E.; Cowan, Ketch; Malen, Rachel C.; Brugge, Doug

    2015-01-01

    Few studies or investigators involved in community engaged research or community-based participatory research have examined awareness and adoption of federal regulatory mechanisms. We conducted a survey of investigators affiliated with the ten National Institutes of Health (NIH) Centers for Population Health and Health Disparities. A questionnaire designed to capture experience with the conduct and oversight of community engaged research, and awareness of pertinent regulatory mechanisms, including Federalwide Assurances (FWAs), Individual Investigator Agreements (IIAs), and Institutional Review Board Authorization Agreements (IAAs), was completed by 101 respondents (68% response rate). Although most were aware of FWAs, only a minority of those surveyed reported knowledge of IAAs and IIAs and even fewer had used them in their research with community partners. Implications for future training and oversight are discussed. PMID:25742662

  19. BosR (BB0647) Controls the RpoN-RpoS Regulatory Pathway and Virulence Expression in Borrelia burgdorferi by a Novel DNA-Binding Mechanism

    PubMed Central

    Ouyang, Zhiming; Deka, Ranjit K.; Norgard, Michael V.

    2011-01-01

    In Borrelia burgdorferi (Bb), the Lyme disease spirochete, the alternative σ factor σ54 (RpoN) directly activates transcription of another alternative σ factor, σS (RpoS) which, in turn, controls the expression of virulence-associated membrane lipoproteins. As is customary in σ54-dependent gene control, a putative NtrC-like enhancer-binding protein, Rrp2, is required to activate the RpoN-RpoS pathway. However, recently it was found that rpoS transcription in Bb also requires another regulator, BosR, which was previously designated as a Fur or PerR homolog. Given this unexpected requirement for a second activator to promote σ54-dependent gene transcription, and the fact that regulatory mechanisms among similar species of pathogenic bacteria can be strain-specific, we sought to confirm the regulatory role of BosR in a second virulent strain (strain 297) of Bb. Indeed, BosR displayed the same influence over lipoprotein expression and mammalian infectivity for strain Bb 297 that were previously noted for Bb strain B31. We subsequently found that recombinant BosR (rBosR) bound to the rpoS gene at three distinct sites, and that binding occurred despite the absence of consensus Fur or Per boxes. This led to the identification of a novel direct repeat sequence (TAAATTAAAT) critical for rBosR binding in vitro. Mutations in the repeat sequence markedly inhibited or abolished rBosR binding. Taken together, our studies provide new mechanistic insights into how BosR likely acts directly on rpoS as a positive transcriptional activator. Additional novelty is engendered by the facts that, although BosR is a Fur or PerR homolog and it contains zinc (like Fur and PerR), it has other unique features that clearly set it apart from these other regulators. Our findings also have broader implications regarding a previously unappreciated layer of control that can be involved in σ54–dependent gene regulation in bacteria. PMID:21347346

  20. Quantum mechanics/molecular mechanics modeling of covalent addition between EGFR-cysteine 797 and N-(4-anilinoquinazolin-6-yl) acrylamide.

    PubMed

    Capoferri, Luigi; Lodola, Alessio; Rivara, Silvia; Mor, Marco

    2015-03-23

    Irreversible epidermal growth factor receptor (EGFR) inhibitors can circumvent resistance to first-generation ATP-competitive inhibitors in the treatment of nonsmall-cell lung cancer. They covalently bind a noncatalytic cysteine (Cys797) at the surface of EGFR active site by an acrylamide warhead. Herein, we used a hybrid quantum mechanics/molecular mechanics (QM/MM) potential in combination with umbrella sampling in the path-collective variable space to investigate the mechanism of alkylation of Cys797 by the prototypical covalent inhibitor N-(4-anilinoquinazolin-6-yl) acrylamide. Calculations show that Cys797 reacts with the acrylamide group of the inhibitor through a direct addition mechanism, with Asp800 acting as a general base/general acid in distinct steps of the reaction. The obtained reaction free energy is negative (ΔA = -12 kcal/mol) consistent with the spontaneous and irreversible alkylation of Cys797 by N-(4-anilinoquinazolin-6-yl) acrylamide. Our calculations identify desolvation of Cys797 thiolate anion as a key step of the alkylation process, indicating that changes in the intrinsic reactivity of the acrylamide would have only a minor impact on the inhibitor potency.

  1. Effect of Ti addition on the microstructure and mechanical properties of a cast Fe-Ni-Mo-Mn maraging steel

    NASA Astrophysics Data System (ADS)

    Nejad, S. Hossein; Nili Ahmadabadi, M.

    2003-10-01

    To study the effect of Ti on the age hardening behavior of Fe-Ni-Mn maraging steels, a Fe-Ni-Mo-Mn steel was alloyed with Ti then mechanical properties and aging behavior of two cast steels were investigated. In this regard, two heats of nominal compositions of Fe-10Ni-6Mo-3Mn and Fe-lONi-6Mo-3Mn-0. 7Ti were induction melted in air and vacuum respectively and cast in iron mold. After homogenizing at 1473K for 21.6ks and water quenching, solution annealing was performed at 1223K for 3.6ks followed by air cooling. Age hardening behavior at 773Kin the range of 0.36-172. 8 ks was determined. Tensile properties and Charpy impact toughness were measured in the solution annealed and peak-aged conditions. Fractographic features were studied by scanning electron microscope equipped with EDX microanalyses. Tensile properties of the alloys in the peakaged condition were in the range of grade 200 standard maraging steel. It has been found that Ti addition resulted in increasing of hardness and strength in aged condition and decreasing of Charpy impact toughness in both solution annealed and aged conditions. Ti addition also changes type and morphology of inclusions and fracture mechanism from semi-ductile intergranular mode to semi-ductile transgranular one.

  2. Hydro-gel environment and solution additives modify calcite growth mechanism to an accretion process of amorphous nanospheres

    NASA Astrophysics Data System (ADS)

    Gal, A.; Kahil, K.; Habraken, W.; Gur, D.; Fratzl, P.; Addadi, L.; Weiner, S.

    2013-12-01

    Various biominerals form via the transformation of a transient amorphous precursor phase into a mature crystalline phase. The mature biominerals usually exhibit morphology reminiscent of aggregated nanoparticles. Although these observations suggest an accretion-based growth process consisting on nanoparticles, the key factors that control the accretion process are unknown. We investigated the transformation of solid amorphous calcium carbonate (ACC) into calcite. When plant cystoliths, a biogenic stable ACC phase, are transformed into calcite in vitro by immersion in water, calcite crystals grow in two distinct steps (Gal et al., Angewandte Chemie, 2013). First, rhombohedral crystals grow that show flat facets as expected from ion-by-ion growth. These crystals then grow by the aggregation and crystallization of the original ACC nanospheres leading to a surface morphology dominated by aggregated spheres. The transformation process occurs within an organic hydro-gel that originates from inside the cystoliths. We tested the importance of the gel phase to the transformation process by transforming synthetic ACC into calcite inside various gels. In all the investigated systems: in gelatin, agarose, and pectin gels, calcite crystals grew that showed the nanosphere aggregation morphology. In additional experiments we demonstrated that also other additives, such as phosphate ions and biogenic macromolecules, that slow down ACC dissolution and calcite precipitation from ions can induce the accretion process dominance (see figure attached). These experiments show that although in solution the dominant process is dissolution to ions of the ACC and crystal growth by ion-by-ion mechanism, the presence of an additive that slows the ion-mediated processes makes the ACC nanospheres stable long enough to interact with the crystal surface. As a result, the metastable ACC nanospheres undergo secondary nucleation on the crystal surface without dissolving. These experiments highlight

  3. Meta-analysis of high-latitude nitrogen-addition and warming studies implies ecological mechanisms overlooked by land models

    DOE PAGES

    Bouskill, N. J.; Riley, W. J.; Tang, J. Y.

    2014-12-11

    Accurate representation of ecosystem processes in land models is crucial for reducing predictive uncertainty in energy and greenhouse gas feedbacks with the climate. Here we describe an observational and modeling meta-analysis approach to benchmark land models, and apply the method to the land model CLM4.5 with two versions of belowground biogeochemistry. We focused our analysis on the aboveground and belowground responses to warming and nitrogen addition in high-latitude ecosystems, and identified absent or poorly parameterized mechanisms in CLM4.5. While the two model versions predicted similar soil carbon stock trajectories following both warming and nitrogen addition, other predicted variables (e.g., belowgroundmore » respiration) differed from observations in both magnitude and direction, indicating that CLM4.5 has inadequate underlying mechanisms for representing high-latitude ecosystems. On the basis of observational synthesis, we attribute the model–observation differences to missing representations of microbial dynamics, aboveground and belowground coupling, and nutrient cycling, and we use the observational meta-analysis to discuss potential approaches to improving the current models. However, we also urge caution concerning the selection of data sets and experiments for meta-analysis. For example, the concentrations of nitrogen applied in the synthesized field experiments (average = 72 kg ha-1 yr-1) are many times higher than projected soil nitrogen concentrations (from nitrogen deposition and release during mineralization), which precludes a rigorous evaluation of the model responses to likely nitrogen perturbations. Overall, we demonstrate that elucidating ecological mechanisms via meta-analysis can identify deficiencies in ecosystem models and empirical experiments.« less

  4. Review of Mechanical Properties of Ti-6Al-4V Made by Laser-Based Additive Manufacturing Using Powder Feedstock

    NASA Astrophysics Data System (ADS)

    Beese, Allison M.; Carroll, Beth E.

    2016-03-01

    Laser-based additive manufacturing (AM) of metals using powder feedstock can be accomplished via two broadly defined technologies: directed energy deposition (DED) and powder bed fusion (PBF). In these processes, metallic powder is delivered to a location and locally melted with a laser heat source. Upon deposition, the material undergoes a rapid cooling and solidification, and as subsequent layers are added to the component, the material within the component is subjected to rapid thermal cycles. In order to adopt AM for the building of structural components, a thorough understanding of the relationships among the complex thermal cycles seen in AM, the unique heterogeneous and anisotropic microstructure, and the mechanical properties must be developed. Researchers have fabricated components by both DED and PBF from the widely used titanium alloy Ti-6Al-4V and studied the resultant microstructure and mechanical properties. This review article discusses the progress to date on investigating the as-deposited and heat-treated microstructures and mechanical properties of Ti-6Al-4V structures made by powder-based laser AM using DED and PBF.

  5. Investigation into the effect of some additives on the mechanical strength, quality and thermal conductivity of clay bricks

    NASA Astrophysics Data System (ADS)

    Zaid, Adnan I. O.; Qandil, A.; Qattous, M. A. A.

    2016-08-01

    It was repeatedly reported that the clay bricks industry in Jordan is facing both weak mechanical strength and poor quality which caused marketing problems where it is expected to serve the increasing demand of housing in the country especially after the political crises in the neighboring countries Iraq and Syria. It is therefore anticipated that improvement of the mechanical strength and quality of the produced clay evaluation of the brick industry in Jordan is worth investigating. In this paper, theoretical and experimental investigation obtained from field visits to the factories producing clay bricks were carried out. Furthermore, the effect of using some additives from locally available materials namely: Battn El-Ghoul Clay, Suweileh sand and Olive extracts on the mechanical strength, thermal conductivity and surface quality of the produced bricks is investigated and discussed. The experimental results indicated that thermal conductivity, color and durability were all enhanced and the ultimate compressive strength was reduced but remained higher than the acceptable value for brickwork.

  6. Microstructure and Mechanical Properties of Microwave Sintered ZrO2 Bioceramics with TiO2 Addition

    PubMed Central

    Chou, Jyh-Horng

    2016-01-01

    The microwave sintered zirconia ceramics with 0, 1, 3, and 5 wt% TiO2 addition at a low sintering temperature of 1300°C and a short holding time of 1 hour were investigated. Effect of contents of TiO2 addition on microstructure and mechanical properties of microwave sintered zirconia bioceramics was reported. In the sintered samples, the main phase is monoclinic zirconia (m-ZrO2) phase and minor phase is tetragonal zirconia (t-ZrO2) phase. The grain sizes increased with increasing the TiO2 contents under the sintering temperature of 1300°C. Although the TiO2 phase was not detected in the XRD pattern, Ti and O elements were detected in the EDS analysis. The presence of TiO2 effectively improved grain growth of the ZrO2 ceramics. The Vickers hardness was in the range of 125 to 300 Hv and increased with the increase of TiO2 contents. Sintering temperature dependence on the Vickers hardness was also investigated from 1150°C to 1300°C, showing the increase of Vickers hardness with the increase of the sintering temperature as well as TiO2 addition. PMID:27504072

  7. Microstructure and Mechanical Properties of Microwave Sintered ZrO2 Bioceramics with TiO2 Addition.

    PubMed

    Kuo, Hsien-Nan; Chou, Jyh-Horng; Liu, Tung-Kuan

    2016-01-01

    The microwave sintered zirconia ceramics with 0, 1, 3, and 5 wt% TiO2 addition at a low sintering temperature of 1300°C and a short holding time of 1 hour were investigated. Effect of contents of TiO2 addition on microstructure and mechanical properties of microwave sintered zirconia bioceramics was reported. In the sintered samples, the main phase is monoclinic zirconia (m-ZrO2) phase and minor phase is tetragonal zirconia (t-ZrO2) phase. The grain sizes increased with increasing the TiO2 contents under the sintering temperature of 1300°C. Although the TiO2 phase was not detected in the XRD pattern, Ti and O elements were detected in the EDS analysis. The presence of TiO2 effectively improved grain growth of the ZrO2 ceramics. The Vickers hardness was in the range of 125 to 300 Hv and increased with the increase of TiO2 contents. Sintering temperature dependence on the Vickers hardness was also investigated from 1150°C to 1300°C, showing the increase of Vickers hardness with the increase of the sintering temperature as well as TiO2 addition. PMID:27504072

  8. Probing the Additional Capacity and Reaction Mechanism of the RuO2 Anode in Lithium Rechargeable Batteries.

    PubMed

    Kim, Yunok; Muhammad, Shoaib; Kim, Hyunchul; Cho, Yong-Hun; Kim, Hansu; Kim, Ji Man; Yoon, Won-Sub

    2015-07-20

    The structural changes and electrochemical behavior of RuO2 are investigated by using in situ XRD, X-ray absorption spectroscopy, and electrochemical techniques to understand the electrochemical reaction mechanism of this metal oxide anode material. Intermediate phase-assisted transformation of RuO2 to LiRuO2 takes place at the start of discharge. Upon further lithiation, LiRuO2 formed by intercalation decomposes to nanosized Ru metal and Li2 O by a conversion reaction. A reversible capacity in addition to its theoretical capacity is observed on discharging below 0.5 V during which no redox activity involving Ru is observed. TEM, X-ray photoelectron spectroscopy, and the galvanostatic intermittent titration technique are used to probe this additional capacity. The results show that the additional capacity is a result of Li storage in the grain boundary between nanosized Ru metal and Li2 O. Findings of this study provide a better understanding of the quantitative share of capacity by a unique combination of intercalation, conversion, and interfacial Li storage in a RuO2 anode.

  9. A quantum chemical study of the mechanisms of olefin addition to group 9 transition metal dioxo compounds.

    PubMed

    Ahmed, Issahaku; Tia, Richard; Adei, Evans

    2016-01-01

    triplet PES than on the singlet PES for the formation of similar analogues. There are fewer competitive reaction pathways on the triplet surface than on the singlet PES. Also, cycloadditions that seem impossible on the singlet PES seem possible on the doublet and or triplet PESs, this is the case typically for the Rh and Co complexes, illustrating the importance of multiple spin states in organometallic reactions.Graphical AbstractTable of Contents Synopsis: A study of the mechanism of ethylene addition to MO2(CH2)(CH3)(M=Co,Rh,Ir) shows the reactions of the Co complex have lower activation barriers for the preferred [3+2] and [2+2] addition pathways and fewer side reactions than those of Rh and Ir. Reactions are more feasible and selective on the triplet PES than on the singlet PES. These illustrate the importance of multiple spin states in organometallic reactions and shows catalyst activity and selectivity decreases down the group.

  10. Contrasting Evolutionary Dynamics of the Developmental Regulator PAX9, among Bats, with Evidence for a Novel Post-Transcriptional Regulatory Mechanism

    PubMed Central

    Phillips, Caleb D.; Butler, Boyd; Fondon, John W.; Mantilla-Meluk, Hugo; Baker, Robert J.

    2013-01-01

    Morphological evolution can be the result of natural selection favoring modification of developmental signaling pathways. However, little is known about the genetic basis of such phenotypic diversity. Understanding these mechanisms is difficult for numerous reasons, yet studies in model organisms often provide clues about the major developmental pathways involved. The paired-domain gene, PAX9, is known to be a key regulator of development, particularly of the face and teeth. In this study, using a comparative genetics approach, we investigate PAX9 molecular evolution among mammals, focusing on craniofacially diversified (Phyllostomidae) and conserved (Vespertilionidae) bat families, and extend our comparison to other orders of mammal. Open-reading frame analysis disclosed signatures of selection, in which a small percentage of residues vary, and lineages acquire different combinations of variation through recurrent substitution and lineage specific changes. A few instances of convergence for specific residues were observed between morphologically convergent bat lineages. Bioinformatic analysis for unknown PAX9 regulatory motifs indicated a novel post-transcriptional regulatory mechanism involving a Musashi protein. This regulation was assessed through fluorescent reporter assays and gene knockdowns. Results are compatible with the hypothesis that the number of Musashi binding-elements in PAX9 mRNA proportionally regulates protein translation rate. Although a connection between morphology and binding element frequency was not apparent, results indicate this regulation would vary among craniofacially divergent bat species, but be static among conserved species. Under this model, Musashi’s regulatory control of alternative human PAX9 isoforms would also vary. The presence of Musashi-binding elements within PAX9 of all mammals examined, chicken, zebrafish, and the fly homolog of PAX9, indicates this regulatory mechanism is ancient, originating basal to much of the

  11. Integrated proteomic and transcriptomic analysis reveals novel genes and regulatory mechanisms involved in salt stress responses in Synechocystis sp. PCC 6803.

    PubMed

    Qiao, Jianjun; Huang, Siqiang; Te, Rigen; Wang, Jiangxin; Chen, Lei; Zhang, Weiwen

    2013-09-01

    Salt stress is a common stress that limits growth and productivity of photosynthetic microbes in natural environments. Although cellular responses of a model cyanobacterium Synechocystis sp. PCC6803 to high and changing salt concentration have been studied, it remains undefined of the gene components and their regulation in the long-term salt acclimation networks. In this study, we performed an integrated study coupling a quantitative iTRAQ-LC-MS/MS proteomics and a next-generation sequencing-based RNA-seq transcriptomics on Synechocystis under salt stress for an extended period of time. Comparative quantification of protein abundances led to the identification of 68 and 108 proteins differentially regulated by salt treatment at 24 and 48 h, respectively. RNA-seq transcriptomic analysis showed that genes involved in energy metabolism and protein synthesis, and genes encoding hypothetical proteins responded to salt stress in a phase-dependent pattern. Notably, a gene encoding CO2-uptake-related protein (CupA) and three genes encoding hypothetical proteins were induced significantly at either transcript or protein level after long-term salt stress. Gene knockout and comparative growth analysis demonstrated that these four genes were involved in salt tolerance in Synechocystis. In addition, a complementary proteome and transcriptome analysis showed that concordance between protein abundances and their corresponding mRNAs varied significantly between various gene-protein pairs, indicating divergent regulation of transcriptional and post-transcriptional processes during salt stress adaptation in Synechocystis. The study provided new insights on genes and regulatory mechanism involved in salt stress response in Synechocystis.

  12. Effects of microstructure and CaO addition on the magnetic and mechanical properties of NiCuZn ferrites

    NASA Astrophysics Data System (ADS)

    Wang, Sea-Fue; Hsu, Yung-Fu; Liu, Yi-Xin; Hsieh, Chung-Kai

    2015-11-01

    In this study, the effects of grain size and the addition of CaCO3 on the magnetic and mechanical properties of Ni0.5Cu0.3Zn0.2Fe2O4 ceramics were investigated. The bending strength of the ferrites increased from 66 to 84 MPa as the grain size of the sintered ceramics decreased from 10.25 μm to 7.53 μm, while the change in hardness was insignificant. The addition of various amounts of CaCO3 densified the Ni0.5Cu0.3Zn0.2Fe2O4 ceramics at 1075 °C. In the pure Ni0.5Cu0.3Zn0.2Fe2O4 ceramic, second phase CuO was segregated at the grain boundaries. With the CaCO3 content ≥1.5 wt%, a small amount of discrete plate-like second phase Fe2CaO4 was observed, together with the disappearance of the second phase CuO. The grain size of the Ni0.5Cu0.3Zn0.2Fe2O4 ceramic dropped from 7.80 μm to 4.68 μm, and the grain size distribution widened as the CaCO3 content increased from 0 to 5 wt%. Initially rising to 807 after CaCO3 addition up to 2.0 wt%, due to a reduced grain size, the Vickers hardness began to drop as the CaCO3 content increased. The bending strength grew linearly with the CaCO3 content and reached twice the value for the Ni0.5Cu0.3Zn0.2Fe2O4 ceramic with an addition of 5.0 wt% CaCO3. The initial permeability of the Ni0.5Cu0.3Zn0.2Fe2O4 ceramic decreased substantially from 402 to 103 as the addition of CaCO3 in ferrite increased from 0 to 5 wt%, and the quality factor of the Ni0.5Cu0.3Zn0.2Fe2O4 ceramic was maximized at 95 for 1.0 wt% CaCO3 addition.

  13. Undeniable Confirmation of the syn-Addition Mechanism for Metal-Free Diboration by Using the Crystalline Sponge Method.

    PubMed

    Cuenca, Ana B; Zigon, Nicolas; Duplan, Vincent; Hoshino, Manabu; Fujita, Makoto; Fernández, Elena

    2016-03-24

    The stereochemical outcome of the recently developed metal-free 1,2-diboration of aliphatic alkenes has, until now, only been elucidated by indirect means (e.g. derivatization). This is because classical conformational analysis of the resulting 1,2-diboranes is not viable; in the (1)H NMR spectrum the relevant (1)H resonances are broadened by (11)B, and the occurrence of the products as oily compounds precludes X-ray crystallographic analysis. Herein, the crystalline sponge method is used to display the crystal structures of the diboronic esters formed from internal E and Z olefins, evidencing the stereospecific syn addition mechanism of the reaction, which is fully consistent with the prediction from DFT calculations.

  14. The Effect of the Kind of Sands and Additions on the Mechanical Behaviour of S.C.C

    NASA Astrophysics Data System (ADS)

    Zeghichi, L.; Benghazi, Z.; Baali, L.

    The sand is an inert element essential in the composition of concrete; its use ensures granular continuity between the cement and gravel for better cohesion of concrete. This paper presents the results of a study that investigated the influence of sand quality on the properties of fresh and hardened self-compacting concrete (SCC). The dune sands are very fine materials characterized by a high intergranular porosity, high surface area and low fineness modulus; on the other hand crushed (manufactured) sand has a high rate into thin and irregular shapes which are influencing the workability of concrete. The amount of dune sand varies from (0% 50%, to 100%) by weight of fine aggregates. The effect of additions is also treated (blast furnace slag and lime stone) The results show that the rheological properties favour the use of dune sands; however the mechanical properties support the use of crushed sand.

  15. Distinct regulatory mechanisms of the human ferritin gene by hypoxia and hypoxia mimetic cobalt chloride at the transcriptional and post-transcriptional levels.

    PubMed

    Huang, Bo-Wen; Miyazawa, Masaki; Tsuji, Yoshiaki

    2014-12-01

    Cobalt chloride has been used as a hypoxia mimetic because it stabilizes hypoxia inducible factor-1α (HIF1-α) and activates gene transcription through a hypoxia responsive element (HRE). However, differences between hypoxia and hypoxia mimetic cobalt chloride in gene regulation remain elusive. Expression of ferritin, the major iron storage protein, is regulated at the transcriptional and posttranscriptional levels through DNA and RNA regulatory elements. Here we demonstrate that hypoxia and cobalt chloride regulate ferritin heavy chain (ferritin H) expression by two distinct mechanisms. Both hypoxia and cobalt chloride increased HIF1-α but a putative HRE in the human ferritin H gene was not activated. Instead, cobalt chloride but not hypoxia activated ferritin H transcription through an antioxidant responsive element (ARE), to which Nrf2 was recruited. Intriguingly, cobalt chloride downregulated ferritin H protein expression while it upregulated other ARE-regulated antioxidant genes in K562 cells. Further characterization demonstrated that cobalt chloride increased interaction between iron regulatory proteins (IRP1 and IRP2) and iron responsive element (IRE) in the 5'UTR of ferritin H mRNA, resulting in translational block of the accumulated ferritin H mRNA. In contrast, hypoxia had marginal effect on ferritin H transcription but increased its translation through decreased IRP1-IRE interaction. These results suggest that hypoxia and hypoxia mimetic cobalt chloride employ distinct regulatory mechanisms through the interplay between DNA and mRNA elements at the transcriptional and post-transcriptional levels.

  16. Theoretical investigation on mechanism of asymmetric Michael addition of malononitrile to chalcones catalyzed by Cinchona alkaloid aluminium(III) complex.

    PubMed

    Su, Zhishan; Lee, Hai Whang; Kim, Chan Kyung

    2011-09-21

    The mechanism of Michael addition of malononitrile to chalcones catalyzed by Cinchona alkaloid aluminium(III) complex has been investigated by DFT and ONIOM methods. Calculations indicate that the reaction proceeds through a dual activation mechanism, in which Al(III) acts as a Lewis acid to activate the electrophile α,β-unsaturated carbonyl substrate while the tertiary amine in the Cinchona alkaloid works as a Lewis base to promote the activation of the malononitrile and deprotonation. A stepwise pathway involving C-C bond formation followed by proton transfer from the catalyst to the carbonyl substrate is adopted, and latter step is predicted to be the rate-determining-step in the reaction with an energy barrier of 12.4 kcal mol(-1). In the absence of the Al(III)-complex, a Cinchona alkaloid activates the carbonyl substrate by a hydrogen bonding of the hydroxyl group, involving a higher energy barrier of 30.4 kcal mol(-1). The steric repulsion between the phenyl group attached to the carbonyl group in the chalcone and isopropoxyl groups of the Al(III)-complex may play an important role in the control of stereoselectivity. The π-π stacking effect between the quinuclidine ring of the quinine and the phenyl group of the chalcones may also help the stabilization of the preferred molecular complex. These results are in agreement with experimental observations. PMID:21796318

  17. Unraveling the Fundamental Mechanisms of Solvent-Additive-Induced Optimization of Power Conversion Efficiencies in Organic Photovoltaic Devices.

    PubMed

    Herath, Nuradhika; Das, Sanjib; Zhu, Jiahua; Kumar, Rajeev; Chen, Jihua; Xiao, Kai; Gu, Gong; Browning, James F; Sumpter, Bobby G; Ivanov, Ilia N; Lauter, Valeria

    2016-08-10

    The realization of controllable morphologies of bulk heterojunctions (BHJ) in organic photovoltaics (OPVs) is one of the key factors enabling high-efficiency devices. We provide new insights into the fundamental mechanisms essential for the optimization of power conversion efficiencies (PCEs) with additive processing to PBDTTT-CF:PC71BM system. We have studied the underlying mechanisms by monitoring the 3D nanostructural modifications in BHJs and correlated the modifications with the optical analysis and theoretical modeling of charge transport. Our results demonstrate profound effects of diiodooctane (DIO) on morphology and charge transport in the active layers. For small amounts of DIO (<3 vol %), DIO promotes the formation of a well-mixed donor-acceptor compact film and augments charge transfer and PCE. In contrast, for large amounts of DIO (>3 vol %), DIO facilitates a loosely packed mixed morphology with large clusters of PC71BM, leading to deterioration in PCE. Theoretical modeling of charge transport reveals that DIO increases the mobility of electrons and holes (the charge carriers) by affecting the energetic disorder and electric field dependence of the mobility. Our findings show the implications of phase separation and carrier transport pathways to achieve optimal device performances. PMID:27403964

  18. Effect of addition of Ag nano powder on mechanical properties of epoxy/polyaminoamide adduct coatings filled with conducting polymer

    SciTech Connect

    Samad, Ubair Abdus; Khan, Rawaiz; Alam, Mohammad Asif; Al-Othman, Othman Y.; Al-Zahrani, Saeed M.

    2015-05-22

    In this study the effect of Ag Nano powder on mechanical properties of epoxy coatings filled with optimized ratio of conducting polymers (Polyaniline and Polyppyrole) was evaluated. Bisphenol A diglycidyl ether epoxy resin (DGEBA) along with polyaminoamide adduct (ARADUR 3282-1 BD) is used as curing agent under optimized stoichiometry values. Curing is performed at room temperature with different percentages of Nano filler. Glass and steel panels were used as coating substrate. Bird applicator was used to coat the samples in order to obtain thin film with wet film thickness (WFT) of about 70-90 µm. The samples were kept in dust free environment for about 7 days at room temperature for complete curing. The coated steel panels were used to evaluate the mechanical properties of coating such as hardness, scratch and impact tests whereas coated glass panels were used for measuring pendulum hardness of the coatings. To check the dispersion and morphology of Nano filler in epoxy matrix scanning electron microscopy (SEM) was used in addition Nano indentation was also performed to observe the effect of Nano filler on modulus of elasticity and hardness at Nano scale.

  19. Unraveling the Fundamental Mechanisms of Solvent-Additive-Induced Optimization of Power Conversion Efficiencies in Organic Photovoltaic Devices.

    PubMed

    Herath, Nuradhika; Das, Sanjib; Zhu, Jiahua; Kumar, Rajeev; Chen, Jihua; Xiao, Kai; Gu, Gong; Browning, James F; Sumpter, Bobby G; Ivanov, Ilia N; Lauter, Valeria

    2016-08-10

    The realization of controllable morphologies of bulk heterojunctions (BHJ) in organic photovoltaics (OPVs) is one of the key factors enabling high-efficiency devices. We provide new insights into the fundamental mechanisms essential for the optimization of power conversion efficiencies (PCEs) with additive processing to PBDTTT-CF:PC71BM system. We have studied the underlying mechanisms by monitoring the 3D nanostructural modifications in BHJs and correlated the modifications with the optical analysis and theoretical modeling of charge transport. Our results demonstrate profound effects of diiodooctane (DIO) on morphology and charge transport in the active layers. For small amounts of DIO (<3 vol %), DIO promotes the formation of a well-mixed donor-acceptor compact film and augments charge transfer and PCE. In contrast, for large amounts of DIO (>3 vol %), DIO facilitates a loosely packed mixed morphology with large clusters of PC71BM, leading to deterioration in PCE. Theoretical modeling of charge transport reveals that DIO increases the mobility of electrons and holes (the charge carriers) by affecting the energetic disorder and electric field dependence of the mobility. Our findings show the implications of phase separation and carrier transport pathways to achieve optimal device performances.

  20. Effect of addition of Ag nano powder on mechanical properties of epoxy/polyaminoamide adduct coatings filled with conducting polymer

    NASA Astrophysics Data System (ADS)

    Samad, Ubair Abdus; Khan, Rawaiz; Alam, Mohammad Asif; Al-Othman, Othman Y.; Al-Zahrani, Saeed M.

    2015-05-01

    In this study the effect of Ag Nano powder on mechanical properties of epoxy coatings filled with optimized ratio of conducting polymers (Polyaniline and Polyppyrole) was evaluated. Bisphenol A diglycidyl ether epoxy resin (DGEBA) along with polyaminoamide adduct (ARADUR 3282-1 BD) is used as curing agent under optimized stoichiometry values. Curing is performed at room temperature with different percentages of Nano filler. Glass and steel panels were used as coating substrate. Bird applicator was used to coat the samples in order to obtain thin film with wet film thickness (WFT) of about 70-90 µm. The samples were kept in dust free environment for about 7 days at room temperature for complete curing. The coated steel panels were used to evaluate the mechanical properties of coating such as hardness, scratch and impact tests whereas coated glass panels were used for measuring pendulum hardness of the coatings. To check the dispersion and morphology of Nano filler in epoxy matrix scanning electron microscopy (SEM) was used in addition Nano indentation was also performed to observe the effect of Nano filler on modulus of elasticity and hardness at Nano scale.

  1. Meta-analysis of high-latitude nitrogen-addition and warming studies imply ecological mechanisms overlooked by land models

    DOE PAGES

    Bouskill, N. J.; Riley, W. J.; Tang, J.

    2014-08-18

    Accurate representation of ecosystem processes in land models is crucial for reducing predictive uncertainty in energy and greenhouse gas feedbacks with the atmosphere. Here we describe an observational and modeling meta-analysis approach to benchmark land models, and apply the method to the land model CLM4.5 with two versions of belowground biogeochemistry. We focused our analysis on the above and belowground high-latitude ecosystem responses to warming and nitrogen addition, and identified mechanisms absent, or poorly parameterized in CLM4.5. While the two model versions predicted similar trajectories for soil carbon stocks following both types of perturbation, other variables (e.g., belowground respiration) differedmore » from the observations in both magnitude and direction, indicating the underlying mechanisms are inadequate for representing high-latitude ecosystems. The observational synthesis attribute these differences to missing representations of microbial dynamics, characterization of above and belowground functional processes, and nutrient competition. We use the observational meta-analyses to discuss potential approaches to improving the current models (e.g., the inclusion of dynamic vegetation or different microbial functional guilds), however, we also raise a cautionary note on the selection of data sets and experiments to be included in a meta-analysis. For example, the concentrations of nitrogen applied in the synthesized field experiments (average =72 kg ha-1 yr-1) are many times higher than projected soil nitrogen concentrations (from nitrogen deposition and release during mineralization), which preclude a rigorous evaluation of the model responses to nitrogen perturbation. Overall, we demonstrate here that elucidating ecological mechanisms via meta-analysis can identify deficiencies in both ecosystem models and empirical experiments.« less

  2. Characterization and mechanism insight of accelerated catalytic promiscuity of Sulfolobus tokodaii (ST0779) peptidase for aldol addition reaction.

    PubMed

    Li, Rong; Perez, Bianca; Jian, Hui; Jensen, Mads Mørk; Gao, Renjun; Dong, Mingdong; Glasius, Marianne; Guo, Zheng

    2015-11-01

    A novel peptidase from thermophilic archaea Sulfolobus tokodaii (ST0779) is examined for its catalytic promiscuity of aldol addition, which shows comparable activity as porcine pancreatic lipase (PPL, one of the best enzymes identified for biocatalytic aldol addition) at 30 °C but much accelerated activity at elevated temperature. The molecular catalytic efficiency kcat/Km (M(-1) s(-1)) of this thermostable enzyme at 55 °C adds up to 140 times higher than that of PPL at its optimum temperature 37 °C. The fluorescence quenching analysis depicts that the binding constants of PPL are significantly higher than those of ST0779, and their numbers of binding sites show opposite temperature dependency. Thermodynamic parameters estimated by fluorescence quenching analysis unveil distinctly different substrate-binding modes between PPL and ST0779: the governing binding interaction between PPL and substrates is hydrophobic force, while the dominating substrate-binding forces for ST0779 are van der Waals and H-bonds interactions. A reasonable mechanism for ST0779-catalyzed aldol reaction is proposed based on kinetic study, spectroscopic analysis, and molecular stereostructure simulation. This work represents a successful example to identify a new enzyme for catalytic promiscuity, which demonstrates a huge potential to discover and exploit novel biocatalyst from thermophile microorganism sources. PMID:26169629

  3. α -Actinin TvACTN3 of Trichomonas vaginalis is an RNA-binding protein that could participate in its posttranscriptional iron regulatory mechanism.

    PubMed

    Calla-Choque, Jaeson Santos; Figueroa-Angulo, Elisa Elvira; Ávila-González, Leticia; Arroyo, Rossana

    2014-01-01

    Trichomonas vaginalis is a sexually transmitted flagellated protist parasite responsible for trichomoniasis. This parasite is dependent on high levels of iron, favoring its growth and multiplication. Iron also differentially regulates some trichomonad virulence properties by unknown mechanisms. However, there is evidence to support the existence of gene regulatory mechanisms at the transcriptional and posttranscriptional levels that are mediated by iron concentration in T. vaginalis. Thus, the goal of this study was to identify an RNA-binding protein in T. vaginalis that interacts with the tvcp4 RNA stem-loop structure, which may participate in a posttranscriptional iron regulatory mechanism mediated by RNA-protein interactions. We performed RNA electrophoretic mobility shift assay (REMSA) and supershift, UV cross-linking, Northwestern blot, and western blot (WB) assays using cytoplasmic protein extracts from T. vaginalis with the tvcp4 RNA hairpin structure as a probe. We identified a 135-kDa protein isolated by the UV cross-linking assays as α-actinin 3 (TvACTN3) by MALDI-TOF-MS that was confirmed by LS-MS/MS and de novo sequencing. TvACTN3 is a cytoplasmic protein that specifically binds to hairpin RNA structures from trichomonads and humans when the parasites are grown under iron-depleted conditions. Thus, TvACTN3 could participate in the regulation of gene expression by iron in T. vaginalis through a parallel posttranscriptional mechanism similar to that of the IRE/IRP system. PMID:24719864

  4. α -Actinin TvACTN3 of Trichomonas vaginalis is an RNA-binding protein that could participate in its posttranscriptional iron regulatory mechanism.

    PubMed

    Calla-Choque, Jaeson Santos; Figueroa-Angulo, Elisa Elvira; Ávila-González, Leticia; Arroyo, Rossana

    2014-01-01

    Trichomonas vaginalis is a sexually transmitted flagellated protist parasite responsible for trichomoniasis. This parasite is dependent on high levels of iron, favoring its growth and multiplication. Iron also differentially regulates some trichomonad virulence properties by unknown mechanisms. However, there is evidence to support the existence of gene regulatory mechanisms at the transcriptional and posttranscriptional levels that are mediated by iron concentration in T. vaginalis. Thus, the goal of this study was to identify an RNA-binding protein in T. vaginalis that interacts with the tvcp4 RNA stem-loop structure, which may participate in a posttranscriptional iron regulatory mechanism mediated by RNA-protein interactions. We performed RNA electrophoretic mobility shift assay (REMSA) and supershift, UV cross-linking, Northwestern blot, and western blot (WB) assays using cytoplasmic protein extracts from T. vaginalis with the tvcp4 RNA hairpin structure as a probe. We identified a 135-kDa protein isolated by the UV cross-linking assays as α-actinin 3 (TvACTN3) by MALDI-TOF-MS that was confirmed by LS-MS/MS and de novo sequencing. TvACTN3 is a cytoplasmic protein that specifically binds to hairpin RNA structures from trichomonads and humans when the parasites are grown under iron-depleted conditions. Thus, TvACTN3 could participate in the regulation of gene expression by iron in T. vaginalis through a parallel posttranscriptional mechanism similar to that of the IRE/IRP system.

  5. α-Actinin TvACTN3 of Trichomonas vaginalis Is an RNA-Binding Protein That Could Participate in Its Posttranscriptional Iron Regulatory Mechanism

    PubMed Central

    Calla-Choque, Jaeson Santos; Figueroa-Angulo, Elisa Elvira; Ávila-González, Leticia; Arroyo, Rossana

    2014-01-01

    Trichomonas vaginalis is a sexually transmitted flagellated protist parasite responsible for trichomoniasis. This parasite is dependent on high levels of iron, favoring its growth and multiplication. Iron also differentially regulates some trichomonad virulence properties by unknown mechanisms. However, there is evidence to support the existence of gene regulatory mechanisms at the transcriptional and posttranscriptional levels that are mediated by iron concentration in T. vaginalis. Thus, the goal of this study was to identify an RNA-binding protein in T. vaginalis that interacts with the tvcp4 RNA stem-loop structure, which may participate in a posttranscriptional iron regulatory mechanism mediated by RNA-protein interactions. We performed RNA electrophoretic mobility shift assay (REMSA) and supershift, UV cross-linking, Northwestern blot, and western blot (WB) assays using cytoplasmic protein extracts from T. vaginalis with the tvcp4 RNA hairpin structure as a probe. We identified a 135-kDa protein isolated by the UV cross-linking assays as α-actinin 3 (TvACTN3) by MALDI-TOF-MS that was confirmed by LS-MS/MS and de novo sequencing. TvACTN3 is a cytoplasmic protein that specifically binds to hairpin RNA structures from trichomonads and humans when the parasites are grown under iron-depleted conditions. Thus, TvACTN3 could participate in the regulation of gene expression by iron in T. vaginalis through a parallel posttranscriptional mechanism similar to that of the IRE/IRP system. PMID:24719864

  6. Cis- and Trans-Regulatory Mechanisms of Gene Expression in the ASJ Sensory Neuron of Caenorhabditis elegans

    PubMed Central

    González-Barrios, María; Fierro-González, Juan Carlos; Krpelanova, Eva; Mora-Lorca, José Antonio; Pedrajas, José Rafael; Peñate, Xenia; Chavez, Sebastián; Swoboda, Peter; Jansen, Gert; Miranda-Vizuete, Antonio

    2015-01-01

    The identity of a given cell type is determined by the expression of a set of genes sharing common cis-regulatory motifs and being regulated by shared transcription factors. Here, we identify cis and trans regulatory elements that drive gene expression in the bilateral sensory neuron ASJ, located in the head of the nematode Caenorhabditis elegans. For this purpose, we have dissected the promoters of the only two genes so far reported to be exclusively expressed in ASJ, trx-1 and ssu-1. We hereby identify the ASJ motif, a functional cis-regulatory bipartite promoter region composed of two individual 6 bp elements separated by a 3 bp linker. The first element is a 6 bp CG-rich sequence that presumably binds the Sp family member zinc-finger transcription factor SPTF-1. Interestingly, within the C. elegans nervous system SPTF-1 is also found to be expressed only in ASJ neurons where it regulates expression of other genes in these neurons and ASJ cell fate. The second element of the bipartite motif is a 6 bp AT-rich sequence that is predicted to potentially bind a transcription factor of the homeobox family. Together, our findings identify a specific promoter signature and SPTF-1 as a transcription factor that functions as a terminal selector gene to regulate gene expression in C. elegans ASJ sensory neurons. PMID:25769980

  7. EVOLUTIONARY BIOSCIENCE AS REGULATORY SYSTEMS BIOLOGY

    PubMed Central

    Davidson, Eric H.

    2011-01-01

    At present several entirely different explanatory approaches compete to illuminate the mechanisms by which animal body plans have evolved. Their respective relevance is briefly considered here in the light of modern knowledge of genomes and the regulatory processes by which development is controlled. Just as development is a system property of the regulatory genome, so causal explanation of evolutionary change in developmental process must be considered at a system level. Here I enumerate some mechanistic consequences that follow from the conclusion that evolution of the body plan has occurred by alteration of the structure of developmental gene regulatory networks. The hierarchy and multiple additional design features of these networks act to produce Boolean regulatory state specification functions at upstream phases of development of the body plan. These are created by the logic outputs of network subcircuits, and in modern animals these outputs are impervious to continuous adaptive variation unlike genes operating more peripherally in the network. PMID:21320483

  8. Influence of Si addition on the microstructure and mechanical properties of Ti-35Nb alloy for applications in orthopedic implants.

    PubMed

    Tavares, A M G; Ramos, W S; de Blas, J C G; Lopes, E S N; Caram, R; Batista, W W; Souza, S A

    2015-11-01

    In the development of new materials for orthopedic implants, special attention has been given to Ti alloys that show biocompatible alloy elements and that are capable of reducing the elastic modulus. Accordingly, Ti-Nb-Si alloys show great potential for application. Thus, this is a study on the microstructures and properties of Ti-35Nb-xSi alloys (x=0, 0.15, 0.35 and 0.55) (wt%) which were thermally treated and cooled under the following conditions: furnace cooling (FC), air cooling (AC), and water quenching (WQ). The results showed that Si addition is effective to reduce the density of omega precipitates making beta more stable, and to produce grain refinement. Silicides, referred as (Ti,Nb)3Si, were formed for alloys containing 0.55% Si, and its formation presumably occurred during the heating at 1000°C. In all cooling conditions, the hardness values increased with the increasing of Si content, as a result from the strong Si solid solution strengthening effect, while the elastic modulus underwent a continuous reduction due to the reduction of omega precipitates in beta matrix. Lower elastic moduli were observed in water-quenched alloys, which concentration of 0.15% Si was more effective in their reduction, with value around 65 GPa. Regarding Ti-35Nb-xSi alloys (x=0, 0.15 and 0.35), the "double yield point" phenomenon, which is typical of alloys with shape memory effect, was observed. The increase in Si concentration also produced an increase from 382 MPa to 540 MPa in the alloys' mechanical strength. Ti-35Nb-0.55Si alloy, however, showed brittle mechanical behavior which was related to the presence of silicides at the grain boundary.

  9. Influence of Addition of Nb on Phase Transformation, Microstructure and Mechanical Properties of Equiatomic NiTi SMA

    NASA Astrophysics Data System (ADS)

    Jiang, Shuyong; Liang, Yulong; Zhang, Yanqiu; Zhao, Yanan; Zhao, Chengzhi

    2016-10-01

    Three novel NiTiNb shape memory alloys, which possess a nominal chemical composition of Ni50- x/2-Ti50- x/2-Nb x (at.%) where x stands for 2, 4 and 6, respectively, were designed in order to investigate the influence of the addition of Nb on phase transformation, microstructure and mechanical properties of equiatomic NiTi shape memory alloy. All the three NiTiNb shape memory alloys contain B2 austenite phase, B19' martensite phase and β-Nb precipitate phase. Martensite type II twin can be observed in the case of Ni49Ti49Nb2 alloy. In the case of Ni48Ti48Nb4 alloy, there exists a boundary between Ti2Ni precipitate phase and β-Nb precipitate phase. As for Ni47Ti47Nb6 alloy, it can be observed that there exists an orientation relationship of [01bar{1}]_{{β{{ - Nb}}}} //[01bar{1}]_{{B2}} between β-Nb precipitate phase and B2 austenite matrix. The increase in Nb content contributes to enhancing the yield stress of NiTiNb shape memory alloy, but it leads to the decrease in compression fracture stress. The addition of Nb to equiatomic NiTi shape memory alloy does not have a significant influence on the transformation hysteresis of the alloy, which is attributed to the fact that NiTiNb shape memory alloy is not subjected to plastic deformation and hence β-Nb precipitate phase is unable to relax the elastic strain in the martensite interface.

  10. Influence of Addition of Nb on Phase Transformation, Microstructure and Mechanical Properties of Equiatomic NiTi SMA

    NASA Astrophysics Data System (ADS)

    Jiang, Shuyong; Liang, Yulong; Zhang, Yanqiu; Zhao, Yanan; Zhao, Chengzhi

    2016-08-01

    Three novel NiTiNb shape memory alloys, which possess a nominal chemical composition of Ni50-x/2-Ti50-x/2-Nb x (at.%) where x stands for 2, 4 and 6, respectively, were designed in order to investigate the influence of the addition of Nb on phase transformation, microstructure and mechanical properties of equiatomic NiTi shape memory alloy. All the three NiTiNb shape memory alloys contain B2 austenite phase, B19' martensite phase and β-Nb precipitate phase. Martensite type II twin can be observed in the case of Ni49Ti49Nb2 alloy. In the case of Ni48Ti48Nb4 alloy, there exists a boundary between Ti2Ni precipitate phase and β-Nb precipitate phase. As for Ni47Ti47Nb6 alloy, it can be observed that there exists an orientation relationship of [01bar{1}]_{{β{{ - Nb}}}} //[01bar{1}]_{{B2}} between β-Nb precipitate phase and B2 austenite matrix. The increase in Nb content contributes to enhancing the yield stress of NiTiNb shape memory alloy, but it leads to the decrease in compression fracture stress. The addition of Nb to equiatomic NiTi shape memory alloy does not have a significant influence on the transformation hysteresis of the alloy, which is attributed to the fact that NiTiNb shape memory alloy is not subjected to plastic deformation and hence β-Nb precipitate phase is unable to relax the elastic strain in the martensite interface.

  11. The Regulatory T Cell Lineage Factor Foxp3 Regulates Gene Expression through Several Distinct Mechanisms Mostly Independent of Direct DNA Binding

    PubMed Central

    Andersen, Kristian G.; Hebenstreit, Daniel; Teichmann, Sarah A.; Betz, Alexander G.

    2015-01-01

    The lineage factor Foxp3 is essential for the development and maintenance of regulatory T cells, but little is known about the mechanisms involved. Here, we demonstrate that an N-terminal proline-rich interaction region is crucial for Foxp3’s function. Subdomains within this key region link Foxp3 to several independent mechanisms of transcriptional regulation. Our study suggests that Foxp3, even in the absence of its DNA-binding forkhead domain, acts as a bridge between DNA-binding interaction partners and proteins with effector function permitting it to regulate a large number of genes. We show that, in one such mechanism, Foxp3 recruits class I histone deacetylases to the promoters of target genes, counteracting activation-induced histone acetylation and thereby suppressing their expression. PMID:26107960

  12. PARP-2 and PARP-3 are selectively activated by 5' phosphorylated DNA breaks through an allosteric regulatory mechanism shared with PARP-1.

    PubMed

    Langelier, Marie-France; Riccio, Amanda A; Pascal, John M

    2014-07-01

    PARP-1, PARP-2 and PARP-3 are DNA-dependent PARPs that localize to DNA damage, synthesize poly(ADP-ribose) (PAR) covalently attached to target proteins including themselves, and thereby recruit repair factors to DNA breaks to increase repair efficiency. PARP-1, PARP-2 and PARP-3 have in common two C-terminal domains-Trp-Gly-Arg (WGR) and catalytic (CAT). In contrast, the N-terminal region (NTR) of PARP-1 is over 500 residues and includes four regulatory domains, whereas PARP-2 and PARP-3 have smaller NTRs (70 and 40 residues, respectively) of unknown structural composition and function. Here, we show that PARP-2 and PARP-3 are preferentially activated by DNA breaks harboring a 5' phosphate (5'P), suggesting selective activation in response to specific DNA repair intermediates, in particular structures that are competent for DNA ligation. In contrast to PARP-1, the NTRs of PARP-2 and PARP-3 are not strictly required for DNA binding or for DNA-dependent activation. Rather, the WGR domain is the central regulatory domain of PARP-2 and PARP-3. Finally, PARP-1, PARP-2 and PARP-3 share an allosteric regulatory mechanism of DNA-dependent catalytic activation through a local destabilization of the CAT. Collectively, our study provides new insights into the specialization of the DNA-dependent PARPs and their specific roles in DNA repair pathways.

  13. Microstructure-mechanical property relationships for Al-Cu-Li-Zr alloys with minor additions of cadmium, indium or tin

    NASA Technical Reports Server (NTRS)

    Blackburn, L. B.; Starke, E. A., Jr.

    1989-01-01

    Minor amounts of cadmium, indium or tin were added to a baseline alloy with the nominal composition of Al-2.4Cu-2.4Li-0.15Zr. These elements were added in an attempt to increase the age-hardening response of the material such that high strengths could be achieved through heat-treatment alone, without the need for intermediate mechanical working. The alloy variant containing indium achieved a higher peak hardness in comparison to the other alloy variations, including the baseline material, when aged at temperatures ranging from 160 C to 190 C. Tensile tests on specimens peak-aged at 160 indicated the yield strength of the indium-bearing alloy increased by approximately 15 percent compared to that of the peak-aged baseline alloy. In addition, the yield strength obtained in the indium-bearing alloy was comparable to that reported for similar baseline material subjected to a 6 percent stretch prior to peak-aging at 190 C. The higher strength levels obtaied for the indium-bearing alloy are attributed to increased number densities and homogeneity of both the T1 and theta-prime phases, as determined by TEM studies.

  14. The Effect of SiC Particle Addition During FSW on Microstructure and Mechanical Properties of AZ31 Magnesium Alloy

    NASA Astrophysics Data System (ADS)

    Abbasi, M.; Abdollahzadeh, A.; Bagheri, B.; Omidvar, H.

    2015-12-01

    Welding and joining of magnesium alloys exert a profound effect on magnesium application expansion, especially in ground and air transportations where large-size, complex components are required. Due to specific physical properties of magnesium, its welding requires great control. In general, the solid-state nature of friction stir welding (FSW) process has been found to produce a low concentration of defects. In the current research, specimens from AZ31 magnesium alloy were welded together using the friction stir process with previously inserted SiC powder particles in the nugget zone. In other words, during the FSW process, the pre-placed SiC particles were stirred throughout the nugget zone of the weld. The results indicated that proper values of rotation and translation speeds led to good appearance of weld zone and suitable distribution of SiC particles producing increased weld strength. The comparison of the microstructures and mechanical properties of FS-welded AZ31 with those of FS-welded one using pre-placed SiC particles showed that the addition of SiC particles decreased the grain size and increased the strength and the formability index.

  15. Failure mechanism of layered lithium-rich oxide/graphite cell and its solution by using electrolyte additive

    NASA Astrophysics Data System (ADS)

    Zhu, Yunmin; Luo, Xueyi; Xu, Mengqing; Zhang, Liping; Yu, Le; Fan, Weizhen; Li, Weishan

    2016-06-01

    We report a failure mechanism of layered lithium-rich oxide/graphite cell and a solution to this failure. Charge/discharge tests demonstrate that Li1.2Mn0.54Ni0.13Co0.13O2/graphite full cell fails when it is performed with cycling and this issue can be solved effectively by using an electrolyte additive, tris (trimethylsilyl) phosphite (TMSPi). Further cycling tests on Li/Li1.2Mn0.54Ni0.13Co0.13O2 and Li/graphite half-cells and physical characterizations on the cycled cathode indicate that this failure involves the increased HF concentration and the subsequent corrosion for aluminum current collector of cathode due to the electrolyte decomposition during cycling. TMSPi contributes to the formation of a protective interphase on cathode due to its preferential oxidation compared with the base electrolyte, which suppresses the electrolyte decomposition and the HF formation, preventing aluminum current collector from corrosion.

  16. Investigation of thermal, mechanical and magnetic behaviors of the Cu-11%Al alloy with Ag and Mn additions

    SciTech Connect

    Silva, R.A.G.; Paganotti, A.; Gama, S.; Adorno, A.T.; Carvalho, T.M.; Santos, C.M.A.

    2013-01-15

    The investigation of thermal, mechanical and magnetic behaviors of the Cu-11%Al, Cu-11%Al-3%Ag, Cu-11%Al-10%Mn and Cu-11%Al-10%Mn-3%Ag alloys was made using microhardness measurements, differential scanning calorimetry, X-ray diffractometry, scanning electron microscopy, energy dispersion X-ray spectroscopy and magnetic moment change with applied field measurement. The results indicated that the Mn addition changes the phase stability range, the microhardness values and makes undetectable the eutectoid reaction in annealed Cu-11%Al and Cu-11%Al-3%Ag alloys while the presence of Ag does not modify the phase transformation sequence neither microhardness values of the annealed Cu-11%Al and Cu-11%Al-10%Mn alloys, but it increases the magnetic moment of this latter at about 2.7 times and decreases the rates of eutectoid and peritectoid reactions of the former. - Highlights: Black-Right-Pointing-Pointer The microstructure of Cu-Al alloy is modified in the Ag presence. Black-Right-Pointing-Pointer ({alpha} + {gamma}) phase is stabilized down to room temperature when Ag is added to Cu-Al alloy. Black-Right-Pointing-Pointer Ag-rich phase modifies the magnetic characteristics of Cu-Al-Mn alloy.

  17. Enhancement mechanism of the additional absorbent on the absorption of the absorbing composite using a type-based mixing rule

    NASA Astrophysics Data System (ADS)

    Xu, Yonggang; Yuan, Liming; Zhang, Deyuan

    2016-04-01

    A silicone rubber composite filled with carbonyl iron particles and four different carbonous materials (carbon black, graphite, carbon fiber or multi-walled carbon nanotubes) was prepared using a two-roller mixture. The complex permittivity and permeability were measured using a vector network analyzer at the frequency of 2-18 GHz. Then a type-based mixing rule based on the dielectric absorbent and magnetic absorbent was proposed to reveal the enhancing mechanism on the permittivity and permeability. The enforcement effect lies in the decreased percolation threshold and the changing pending parameter as the carbonous materials were added. The reflection loss (RL) result showed the added carbonous materials enhanced the absorption in the lower frequency range, the RL decrement value being about 2 dB at 4-5 GHz with a thickness of 1 mm. All the added carbonous materials reinforced the shielding effectiveness (SE) of the composites. The maximum increment value of the SE was about 3.23 dB at 0.5 mm and 4.65 dB at 1 mm, respectively. The added carbonous materials could be effective additives for enforcing the absorption and shielding property of the absorbers.

  18. Regulatory RNAs

    PubMed Central

    Vazquez-Anderson, Jorge; Contreras, Lydia M

    2013-01-01

    RNAs have many important functional properties, including that they are independently controllable and highly tunable. As a result of these advantageous properties, their use in a myriad of sophisticated devices has been widely explored. Yet, the exploitation of RNAs for synthetic applications is highly dependent on the ability to characterize the many new molecules that continue to be discovered by large-scale sequencing and high-throughput screening techniques. In this review, we present an exhaustive survey of the most recent synthetic bacterial riboswitches and small RNAs while emphasizing their virtues in gene expression management. We also explore the use of these RNA components as building blocks in the RNA synthetic biology toolbox and discuss examples of synthetic RNA components used to rewire bacterial regulatory circuitry. We anticipate that this field will expand its catalog of smart devices by mimicking and manipulating natural RNA mechanisms and functions. PMID:24356572

  19. Positive and Negative Regulatory Mechanisms for Fine-Tuning Cellularity and Functions of Medullary Thymic Epithelial Cells

    PubMed Central

    Akiyama, Taishin; Tateishi, Ryosuke; Akiyama, Nobuko; Yoshinaga, Riko; Kobayashi, Tetsuya J.

    2015-01-01

    Self-tolerant T cells and regulatory T cells develop in the thymus. A wide variety of cell–cell interactions in the thymus is required for the differentiation, proliferation, and repertoire selection of T cells. Various secreted and cell surface molecules expressed in thymic epithelial cells (TECs) mediate these processes. Moreover, cytokines expressed by cells of hematopoietic origin regulate the cellularity of TECs. Tumor necrosis factor (TNF) family RANK ligand, lymphotoxin, and CD40 ligand, expressed in T cells and innate lymphoid cells (ILCs), promote the differentiation and proliferation of medullary TECs (mTECs) that play critical roles in the induction of immune tolerance. A recent study suggests that interleukin-22 (IL-22) produced by ILCs promotes regeneration of TECs after irradiation. Intriguingly, tumor growth factor-β and osteoprotegerin limit cellularity of mTECs, thereby attenuating regulatory T cell generation. We will review recent insights into the molecular basis for cell–cell interactions regulating differentiation and proliferation of mTECs and also discuss about a perspective on use of mathematical models for understanding this complicated system. PMID:26441966

  20. Mechanical properties and phase composition of potential biodegradable Mg-Zn-Mn-base alloys with addition of rare earth elements

    SciTech Connect

    Stulikova, Ivana; Smola, Bohumil

    2010-10-15

    Mechanical properties and creep resistance of the MgY4Zn1Mn1 alloy in the as cast as well as in the T5 condition were compared to those of the MgCe4Zn1Mn1 alloy in the same conditions. Yield tensile stress and ultimate tensile strength of the MgY4Zn1Mn1 alloy are slightly better in the temperature range 20 deg. C-400 deg. C than these of the MgCe4Zn1Mn1 alloy. Better thermal stability of ultimate tensile strength was observed in the T5 treated MgCe4Zn1Mn1 alloy than in this material in the as cast condition. An outstanding creep resistance at 225 deg. C-350 deg. C found in the MgY4Zn1Mn1 alloy is due to the existence of the 18R long period stacking structure persisting in this alloy even a long heat treatment of 500 deg. C/32 h. No similar stacking effects happen when Ce substitutes Y in approximately the same concentration. The creep resistance deteriorates considerably in the MgCe4Zn1Mn1 alloy. Rectangular particles of the equilibrium Mg{sub 12}Ce phase dominate in the microstructure of as cast as well as of high temperature heat-treated MgCe4Zn1Mn1 alloy. A population of small oval particles containing Mg and Zn develops additionally during annealing of this alloy. These particles pin effectively dislocations and can be responsible for the better thermal stability of the T5 treated material.

  1. FarR regulates the farAB-encoded efflux pump of Neisseria gonorrhoeae via an MtrR regulatory mechanism.

    PubMed

    Lee, E-H; Rouquette-Loughlin, C; Folster, J P; Shafer, W M

    2003-12-01

    The farAB operon of Neisseria gonorrhoeae encodes an efflux pump which mediates gonococcal resistance to antibacterial fatty acids. It was previously observed that expression of the farAB operon was positively regulated by MtrR, which is a repressor of the mtrCDE-encoded efflux pump system (E.-H. Lee and W. M. Shafer, Mol. Microbiol. 33:839-845, 1999). This regulation was believed to be indirect since MtrR did not bind to the farAB promoter. In this study, computer analysis of the gonococcal genome sequence database, lacZ reporter fusions, and gel mobility shift assays were used to elucidate the regulatory mechanism by which expression of the farAB operon is modulated by MtrR in gonococci. We identified a regulatory protein belonging to the MarR family of transcriptional repressors and found that it negatively controls expression of farAB by directly binding to the farAB promoter. We designated this regulator FarR to signify its role in regulating the farAB operon. We found that MtrR binds to the farR promoter, thereby repressing farR expression. Hence, MtrR regulates farAB in a positive fashion by modulating farR expression. This MtrR regulatory cascade seems to play an important role in adjusting levels of the FarAB and MtrCDE efflux pumps to prevent their excess expression in gonococci. PMID:14645274

  2. Mechanism of the positive effect of poly(ethylene glycol) addition in enzymatic hydrolysis of steam pretreated lignocelluloses.

    PubMed

    Sipos, Bálint; Szilágyi, Mátyás; Sebestyén, Zoltán; Perazzini, Raffaella; Dienes, Dóra; Jakab, Emma; Crestini, Claudia; Réczey, Kati

    2011-11-01

    The efficiency of enzymatic hydrolysis of lignocellulses can be increased by addition of surfactants and polymers, such as poly(ethylene glycol) (PEG). The effect of PEG addition on the cellulase adsorption was tested on various steam pretreated lignocellulose substrates (spruce, willow, hemp, corn stover, wheat straw, sweet sorghum bagasse). A positive effect of PEG addition was observed, as protein adsorption has decreased and free enzyme activities (FP, β-glucosidase) have increased due to the additive. However, the degree of enhancement differed among the substrates, being highest on steam pretreated spruce. Results of lignin analysis (pyrolysis-GC/MS, (31)P NMR) suggest that the effect of PEG addition is in connection with the amount of unsubstituted phenolic hydroxyl groups of lignin in the substrate. Adsorption experiments using two commercial enzyme preparations, Celluclast 1.5L (Trichoderma reesei cellulase) and Novozym 188 (Aspergillus niger β-glucosidase) suggested that enzyme origins affected on the adsorptivity of β-glucosidases.

  3. Characterization of microRNA expression in bovine adipose tissues: a potential regulatory mechanism of subcutaneous adipose tissue development

    PubMed Central

    2010-01-01

    Background MicroRNAs (miRNAs), a family of small non-coding RNA molecules, appear to regulate animal lipid metabolism and preadipocyte conversion to form lipid-assimilating adipocytes (i.e. adipogenesis). However, no miRNA to date has been reported to modulate adipogenesis and lipid deposition in beef cattle. Results The expression patterns of 89 miRNAs including four bovine specific miRNAs in subcutaneous adipose tissues from three groups of crossbred steers differing in backfat thickness were compared using qRT-PCR analysis. Eighty-six miRNAs were detectable in all samples, with 42 miRNAs differing among crossbreds (P < 0.05) and 15 miRNAs differentially expressed between tissues with high and low backfat thickness (P < 0.05). The expression levels of 18 miRNAs were correlated with backfat thickness (P < 0.05). The miRNA most differentially expressed and the most strongly associated with backfat thickness was miR-378, with a 1.99-fold increase in high backfat thickness tissues (r = 0.72). Conclusions MiRNA expression patterns differed significantly in response to host genetic components. Approximately 20% of the miRNAs in this study were identified as being correlated with backfat thickness. This result suggests that miRNAs may play a regulatory role in white adipose tissue development in beef animals. PMID:20423511

  4. Temperature controls on the basal emission rate of isoprene in a tropical tree Ficus septica: exploring molecular regulatory mechanisms.

    PubMed

    Mutanda, Ishmael; Inafuku, Masashi; Saitoh, Seikoh; Iwasaki, Hironori; Fukuta, Masakazu; Watanabe, Keiichi; Oku, Hirosuke

    2016-10-01

    Isoprene emission from plants is very sensitive to environmental temperature both at short-term and long-term scales. Our previous study demonstrated suppression of isoprene emission by cold temperatures in a high emitting tropical tree Ficus septica and revealed a strong correlation of emission to isoprene synthase (IspS) protein levels. When challenged with decreasing daily temperatures from 30 to 12 °C, F. septica completely stopped isoprene emission at 12 °C, only to recover on the second day after re-exposure to 30 °C. Here, we explored this regulation of isoprene emission in response to environmental temperature by a comprehensive analysis of transcriptome data, gene expressions and metabolite pools of the 2-C-methyl-D-erythritol 4-phosphate (MEP) pathway. MEP pathway genes and metabolites dynamics did not support substrate-level limitations as major control over observed basal emission, but transcriptome data, network inferences and putative regulatory elements on IspS promoter suggested transcriptional regulation of IspS gene through circadian rhythm and phytohormone signalling processes. Expression levels of 29 genes involved in these pathways were examined by quantitative real-time PCR. We propose that temperature controls over basal isoprene emission at a time-scale of hours to few days are regulated by phytohormone-mediated transcriptional modulation of IspS gene under synchronization by the circadian clock. PMID:27425779

  5. Inference of the Arabidopsis Lateral Root Gene Regulatory Network Suggests a Bifurcation Mechanism That Defines Primordia Flanking and Central Zones[OPEN

    PubMed Central

    Lavenus, Julien; Goh, Tatsuaki; Guyomarc’h, Soazig; Hill, Kristine; Lucas, Mikael; Voß, Ute; Kenobi, Kim; Wilson, Michael H.; Farcot, Etienne; Hagen, Gretchen; Guilfoyle, Thomas J.; Fukaki, Hidehiro; Laplaze, Laurent; Bennett, Malcolm J.

    2015-01-01

    A large number of genes involved in lateral root (LR) organogenesis have been identified over the last decade using forward and reverse genetic approaches in Arabidopsis thaliana. Nevertheless, how these genes interact to form a LR regulatory network largely remains to be elucidated. In this study, we developed a time-delay correlation algorithm (TDCor) to infer the gene regulatory network (GRN) controlling LR primordium initiation and patterning in Arabidopsis from a time-series transcriptomic data set. The predicted network topology links the very early-activated genes involved in LR initiation to later expressed cell identity markers through a multistep genetic cascade exhibiting both positive and negative feedback loops. The predictions were tested for the key transcriptional regulator AUXIN RESPONSE FACTOR7 node, and over 70% of its targets were validated experimentally. Intriguingly, the predicted GRN revealed a mutual inhibition between the ARF7 and ARF5 modules that would control an early bifurcation between two cell fates. Analyses of the expression pattern of ARF7 and ARF5 targets suggest that this patterning mechanism controls flanking and central zone specification in Arabidopsis LR primordia. PMID:25944102

  6. [Triggering and regulatory mechanisms of ciliary motion in the ctenophore Bolinopsis. III. Electric excitability and inherent contractility of ciliated cells].

    PubMed

    Labas, Iu A; Mashanskiĭ, V F

    1977-01-01

    Rhythmical electrostimulation is able to produce in a tissue strip of Bolinopsis series of beats of combs-plates. However, the beat frequency, within one series, is only poorly controlled by electrical stimuli. Isolated comb-plate cells with a cilium cut off maintain rhythmical contractions stimulated both mechanically and electrically. A lot of microtubules has been found in the apical region of these cells. It is supposed that it is these microtubules, probably together with the associated root filaments, that are responsible for cell motility. Mutual mechanical stimulation of ciliary cells in these motions is, presumably, a signal providing intratissue propagation of metachronal wave.

  7. Functional anatomy and ion regulatory mechanisms of the antennal gland in a semi-terrestrial crab, Ocypode stimpsoni

    PubMed Central

    Tsai, Jyuan-Ru; Lin, Hui-Chen

    2014-01-01

    ABSTRACT Brachyuran crabs from diverse habitats show great differences in their osmoregulatory processes, especially in terms of the structural and physiological characteristics of the osmoregulatory organs. In crustaceans, the antennal glands are known to be important in osmoregulation, and they play a functional role analogous to that of the vertebrate kidney. Nevertheless, the detailed structure and function of the antennal glands in different species have rarely been described. The aim of this study is to investigate the role of the antennal gland in ion regulation by examining the ultrastructure of the cells and the distribution of the ion regulatory proteins in each cell type in the antennal gland of a semi-terrestrial crab. The results showed that Na+, K+-ATPase activity significantly increased in the antennal gland after a 4-day acclimation in dilute seawater and returned to its original (day 0) level after 7 days. Three major types of cells were identified in the antennal gland, including coelomic cells (COEs), labyrinthine cells (LBRs) and end-labyrinthine cells (ELBRs). The proximal tubular region (PT) and distal tubular region (DT) of the antennal gland consist of LBRs and COEs, whereas the end tubular region (ET) consists of all three types of cells, with fewer COEs and more ELBRs. We found a non-uniform distribution of NKA immunoreactivity, with increasing intensity from the proximal to the distal regions of the antennal gland. We summarise our study with a proposed model for the urine reprocessing pathway and the role of each cell type or segment of the antennal gland. PMID:24795144

  8. Trypanosoma cruzi Infection Imparts a Regulatory Program in Dendritic Cells and T Cells via Galectin-1-Dependent Mechanisms.

    PubMed

    Poncini, Carolina V; Ilarregui, Juan M; Batalla, Estela I; Engels, Steef; Cerliani, Juan P; Cucher, Marcela A; van Kooyk, Yvette; González-Cappa, Stella M; Rabinovich, Gabriel A

    2015-10-01

    Galectin-1 (Gal-1), an endogenous glycan-binding protein, is widely distributed at sites of inflammation and microbial invasion. Despite considerable progress regarding the immunoregulatory activity of this lectin, the role of endogenous Gal-1 during acute parasite infections is uncertain. In this study, we show that Gal-1 functions as a negative regulator to limit host-protective immunity following intradermal infection with Trypanosoma cruzi. Concomitant with the upregulation of immune inhibitory mediators, including IL-10, TGF-β1, IDO, and programmed death ligand 2, T. cruzi infection induced an early increase of Gal-1 expression in vivo. Compared to their wild-type (WT) counterpart, Gal-1-deficient (Lgals1(-/-)) mice exhibited reduced mortality and lower parasite load in muscle tissue. Resistance of Lgals1(-/-) mice to T. cruzi infection was associated with a failure in the activation of Gal-1-driven tolerogenic circuits, otherwise orchestrated by WT dendritic cells, leading to secondary dysfunction in the induction of CD4(+)CD25(+)Foxp3(+) regulatory T cells. This effect was accompanied by an increased number of CD8(+) T cells and higher frequency of IFN-γ-producing CD4(+) T cells in muscle tissues and draining lymph nodes as well as reduced parasite burden in heart and hindlimb skeletal muscle. Moreover, dendritic cells lacking Gal-1 interrupted the Gal-1-mediated tolerogenic circuit and reinforced T cell-dependent anti-parasite immunity when adoptively transferred into WT mice. Thus, endogenous Gal-1 may influence T. cruzi infection by fueling tolerogenic circuits that hinder anti-parasite immunity.

  9. Potential of acute phase proteins as predictor of postpartum uterine infections during transition period and its regulatory mechanism in dairy cattle

    PubMed Central

    Manimaran, A.; Kumaresan, A.; Jeyakumar, S.; Mohanty, T. K.; Sejian, V.; Kumar, Narender; Sreela, L.; Prakash, M. Arul; Mooventhan, P.; Anantharaj, A.; Das, D. N.

    2016-01-01

    Among the various systemic reactions against infection or injury, the acute phase response is the cascade of reaction and mostly coordinated by cytokines-mediated acute phase proteins (APPs) production. Since APPs are sensitive innate immune molecules, they are useful for early detection of inflammation in bovines and believed to be better discriminators than routine hematological parameters. Therefore, the possibility of using APPs as a diagnostic and prognostic marker of inflammation in major bovine health disorders including postpartum uterine infection has been explored by many workers. In this review, we discussed specifically importance of postpartum uterine infection, the role of energy balance in uterine infections and potential of APPs as a predictor of postpartum uterine infections during the transition period and its regulatory mechanism in dairy cattle. PMID:27051191

  10. Crosstalk between bone marrow-derived mesenchymal stem cells and regulatory T cells through a glucocorticoid-induced leucine zipper/developmental endothelial locus-1-dependent mechanism

    PubMed Central

    Yang, Nianlan; Baban, Babak; Isales, Carlos M.; Shi, Xing-Ming

    2015-01-01

    Bone marrow is a reservoir for regulatory T (Treg) cells, but how Treg cells are regulated in that environment remains poorly understood. We show that expression of glucocorticoid (GC)-induced leucine zipper (GILZ) in bone marrow mesenchymal lineage cells or bone marrow-derived mesenchymal stem cells (BMSCs) increases the production of Treg cells via a mechanism involving the up-regulation of developmental endothelial locus-1 (Del-1), an endogenous leukocyte-endothelial adhesion inhibitor. We found that the expression of Del-1 is increased ∼4-fold in the bone tissues of GILZ transgenic (Tg) mice, and this increase is coupled with a significant increase in the production of IL-10 (2.80 vs. 0.83) and decrease in the production of IL-6 (0.80 vs. 2.33) and IL-12 (0.25 vs. 1.67). We also show that GILZ-expressing BMSCs present antigen in a way that favors Treg cells. These results indicate that GILZ plays a critical role mediating the crosstalk between BMSCs and Treg in the bone marrow microenvironment. These data, together with our previous findings that overexpression of GILZ in BMSCs antagonizes TNF-α-elicited inflammatory responses, suggest that GILZ plays important roles in bone-immune cell communication and BMSC immune suppressive functions.—Yang, N., Baban, B., Isales, C. M., Shi, X.-M. Crosstalk between bone marrow-derived mesenchymal stem cells and regulatory T cells through a glucocorticoid-induced leucine zipper/developmental endothelial locus-1-dependent mechanism. PMID:26038125

  11. Selective laser melting additive manufactured Inconel 718 superalloy parts: High-temperature oxidation property and its mechanisms

    NASA Astrophysics Data System (ADS)

    Jia, Qingbo; Gu, Dongdong

    2014-10-01

    This work presented a comprehensive study of high-temperature oxidation behaviors and mechanisms of Selective laser melting (SLM) processed Inconel 718 superalloy parts using different methods including isothermal oxidation testing, X-ray diffraction, scanning electron microscopy and energy dispersive X-ray spectroscopy. The experimental results revealed that the oxidation process of the tested parts processed at a lower volumetric laser energy density experienced the severe spallation. On reasonably increasing the applied volumetric laser energy density, the oxidation kinetics of the as-produced parts obeyed a parabolic law, exhibiting the significantly improved oxidation resistance performance. The constitutional phases within the oxidation film were identified and the corresponding formation mechanisms were elucidated in detail according to the thermodynamic principles. The cross-sectional morphologies of oxidized Inconel 718 parts indicated that the oxidation microstructure mainly consisted of an external oxidation layer and an internal oxidation zone. The oxidation process was controlled by the outward diffusion of oxide forming elements and inward penetration of oxygen, by which the interaction mechanisms between the microstructures and internal oxidation zones were clarified. On the basis of the experimental results and theoretical analyses, the physical oxidation mechanisms were accordingly established to illustrate the oxidation behaviors of SLM-processed Inconel 718 parts at elevated operative temperatures.

  12. Casein films: effects of formulation, environmental conditions, and addition of citric pectin on the structure and mechanical properties

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Thin casein films for food packaging applications reportedly possess good strength and low oxygen permeability, but low water-resistance and elasticity. Modifying and customizing the mechanical properties of the films to target specific behaviors depending on environmental conditions would enable a...

  13. Molecular dynamics simulations for the examination of mechanical properties of hydroxyapatite/ poly α-n-butyl cyanoacrylate under additive manufacturing.

    PubMed

    Wang, Yanen; Wei, Qinghua; Pan, Feilong; Yang, Mingming; Wei, Shengmin

    2014-01-01

    Molecular dynamics (MD) simulations emerged to be a helpful tool in the field of material science. In rapid prototyping artificial bone scaffolds process, the binder spraying volume and mechanism are very important for bone scaffolds mechanical properties. In this study, we applied MD simulations to investigating the binding energy of α-n-butyl cyanoacrylate (NBCA) on Hydroxyapatite (HA) crystallographic planes (001, 100 and 110), and to calculating and analyzing the mechanical properties and radial distribution function of the HA(110)/NBCA mixed system. The simulation results suggested that HA (110) has the highest binding energy with NBCA owing to the high planar atom density, and the mechanical properties of HA(110)/NBCA mixed system is stronger than pure HA system. Therefore, the multi-grade strength bone scaffold could be fabricated through spraying various volume NBCA binders during 3D printing process. By calculating the radial distribution function of HA(110)/NBCA, the essence of the interface interaction were successfully elucidated. The forming situation parameters can be referred to calculation results. There exists a strong interaction between HA crystallographic plane (110) and NBCA, it is mainly derived from the hydrogen bonds between O atoms which connect with C atoms of NBCA and H atoms in HA crystal. Furthermore, a strong adsorption effect can be demonstrated between HA and NBCA.

  14. To Gate, or Not to Gate: Regulatory Mechanisms for Intercellular Protein Transport and Virus Movement in Plants

    PubMed Central

    Ueki, Shoko; Citovsky, Vitaly

    2011-01-01

    Cell-to-cell signal transduction is vital for orchestrating the whole-body physiology of multi-cellular organisms, and many endogenous macromolecules, proteins, and nucleic acids function as such transported signals. In plants, many of these molecules are transported through plasmodesmata (Pd), the cell wall-spanning channel structures that interconnect plant cells. Furthermore, Pd also act as conduits for cell-to-cell movement of most plant viruses that have evolved to pirate these channels to spread the infection. Pd transport is presumed to be highly selective, and only a limited repertoire of molecules is transported through these channels. Recent studies have begun to unravel mechanisms that actively regulate the opening of the Pd channel to allow traffic. This macromolecular transport between cells comprises two consecutive steps: intracellular targeting to Pd and translocation through the channel to the adjacent cell. Here, we review the current knowledge of molecular species that are transported though Pd and the mechanisms that control this traffic. Generally, Pd traffic can occur by passive diffusion through the trans-Pd cytoplasm or through the membrane/lumen of the trans-Pd ER, or by active transport that includes protein–protein interactions. It is this latter mode of Pd transport that is involved in intercellular traffic of most signal molecules and is regulated by distinct and sometimes interdependent mechanisms, which represent the focus of this article. PMID:21746703

  15. Anti-Wear Performance and Mechanism of an Oil-Miscible Ionic Liquid as a Lubricant Additive

    SciTech Connect

    Qu, Jun; Bansal, Dinesh G; Yu, Bo; Howe, Jane Y; Luo, Huimin; Dai, Sheng; Li, Huaqing; Blau, Peter Julian; Bunting, Bruce G; Mordukhovich, Gregory; Smolenski, Donald

    2012-01-01

    An ionic liquid (IL) trihexyltetradecylphosphonium bis(2-ethylhexyl) phosphate has been investigated as a potential anti-wear lubricant additive. Unlike most other ILs that have very low solubility in non-polar fluids, this IL is fully miscible with various hydrocarbon oils. In addition, it is thermally stable up to 347 oC, showed no corrosive attack to cast iron in ambient environment, and has excellent wettability on solid surfaces (e.g., contact angle on cast iron <8o). Most importantly, this phosphonium-based IL has demonstrated effective anti-scuffing and anti-wear characteristics when blended with lubricating oils. For example, a 5 wt.% addition into a synthetic base oil eliminated the scuffing failure experienced by the neat oil and, as a result, reduced the friction coefficient by 60% and the wear rate by three orders of magnitude. A synergistic effect on wear protection was observed with the current anti-wear additive when added into a fully-formulated engine oil. Nanostructure examination and composition analysis revealed a tribo-boundary film and subsurface plastic deformation zone for the metallic surface lubricated by the IL-containing lubricants. This protective boundary film is believed to be responsible for the IL s anti-scuffing and anti-wear functionality.

  16. The mechanism of deceleration of nucleation and crystal growth by the small addition of transition metals to lithium disilicate glasses

    NASA Astrophysics Data System (ADS)

    Thieme, Katrin; Avramov, Isak; Rüssel, Christian

    2016-05-01

    The addition of small amounts of niobium or tantalum oxide to lithium disilicate glass provokes a drastic decrease of the steady-state nucleation rates and the crystal growth velocities. The viscosity of the residual glassy matrix is considered as a function of the crystallization degree in the course of a non-isothermal crystallization. For simplification, a homogeneous distribution of the added oxides in the glass matrix is assumed. While the viscosity initially decreases, it significantly increases again for higher crystallization degrees hindering crystal growth. However, it was shown that the additives are enriched at the crystal interface. Several possible reasons for the inhibition of nucleation and growth kinetics such as viscosity, interfacial energy crystal/glassy phase, thermodynamic driving force or impingement rate are discussed. Since the crystallization front is blocked by the additives the impingement rate is decreased with increasing additive concentration. Since small concentrations of Nb2O5 and Ta2O5 have a drastic effect on the nucleation, these components should be enriched at the interface crystal/glass. This will only take place, if it leads to a decrease in the interfacial energy. Since this effect alone should result in an increase of the nucleation rate, it must be overcompensated by kinetic effects.

  17. Effects of Additional Elements on the Evolution of Second Phases in 9-12% cr Steel and Resulting Mechanical Properties

    NASA Astrophysics Data System (ADS)

    Dong, Jiling; Yu, Hui; Yoo, Dae-Hwang; Huynh, Quocbao; Shin, Keesam; Kim, Minsoo; Kang, Sungtae

    Investigated in this study are precipitate evolution with and without addition of W, Co, and B in two kinds of 9-12% Cr steels (named as A and B) used for power plants after various aging time and temperature using OM, SEM, TEM, etc. Three kinds of precipitates (Cr-rich M23C6, Nb-rich and V-rich MX, W-rich and Mo-rich Laves phase) were observed and investigated in the two alloys. Upon aging, the area fraction of M23C6 increased whereas that of Laves phases decreased despite of increase in size. The area fraction of W-rich Laves phase was much higher than that of Mo-rich Laves phase, indicating that W addition, compared to that of Mo addition, is more powerful in the formation of Laves phase precipitation (specimen A). The martensitic microstructure of specimen B was more stable than that of specimen A due to the addition of cobalt and boron. The tensile test and impact test were measured and studied in relation to the long term aging effect.

  18. Densification of Reaction Bonded Silicon Nitride with the Addition of Fine Si Powder Effects on the Sinterability and Mechanical Properties

    SciTech Connect

    Lee, Sea-Hoon; Cho, Chun-Rae; Park, Young-Jo; Ko, Jae-Woong; Kim, Hai-Doo; Lin, Hua-Tay; Becher, Paul F

    2013-01-01

    The densification behavior and strength of sintered reaction bonded silicon nitrides (SRBSN) that contain Lu2O3-SiO2 additives were improved by the addition of fine Si powder. Dense specimens (relative density: 99.5%) were obtained by gas-pressure sintering (GPS) at 1850oC through the addition of fine Si. In contrast, the densification of conventional specimens did not complete at 1950oC. The fine Si decreased the onset temperature of shrinkage and increased the shrinkage rate because the additive helped the compaction of green bodies and induced the formation of fine Si3N4 particles after nitridation and sintering at and above 1600oC. The amount of residual SiO2 within the specimens was not strongly affected by adding fine Si powder because most of the SiO2 layer that had formed on the fine Si particles decomposed during nitridation. The maximum strength and fracture toughness of the specimens were 991 MPa and 8.0 MPa m1/2, respectively.

  19. The mechanism of deceleration of nucleation and crystal growth by the small addition of transition metals to lithium disilicate glasses

    PubMed Central

    Thieme, Katrin; Avramov, Isak; Rüssel, Christian

    2016-01-01

    The addition of small amounts of niobium or tantalum oxide to lithium disilicate glass provokes a drastic decrease of the steady-state nucleation rates and the crystal growth velocities. The viscosity of the residual glassy matrix is considered as a function of the crystallization degree in the course of a non-isothermal crystallization. For simplification, a homogeneous distribution of the added oxides in the glass matrix is assumed. While the viscosity initially decreases, it significantly increases again for higher crystallization degrees hindering crystal growth. However, it was shown that the additives are enriched at the crystal interface. Several possible reasons for the inhibition of nucleation and growth kinetics such as viscosity, interfacial energy crystal/glassy phase, thermodynamic driving force or impingement rate are discussed. Since the crystallization front is blocked by the additives the impingement rate is decreased with increasing additive concentration. Since small concentrations of Nb2O5 and Ta2O5 have a drastic effect on the nucleation, these components should be enriched at the interface crystal/glass. This will only take place, if it leads to a decrease in the interfacial energy. Since this effect alone should result in an increase of the nucleation rate, it must be overcompensated by kinetic effects. PMID:27150844

  20. The mechanism of deceleration of nucleation and crystal growth by the small addition of transition metals to lithium disilicate glasses.

    PubMed

    Thieme, Katrin; Avramov, Isak; Rüssel, Christian

    2016-01-01

    The addition of small amounts of niobium or tantalum oxide to lithium disilicate glass provokes a drastic decrease of the steady-state nucleation rates and the crystal growth velocities. The viscosity of the residual glassy matrix is considered as a function of the crystallization degree in the course of a non-isothermal crystallization. For simplification, a homogeneous distribution of the added oxides in the glass matrix is assumed. While the viscosity initially decreases, it significantly increases again for higher crystallization degrees hindering crystal growth. However, it was shown that the additives are enriched at the crystal interface. Several possible reasons for the inhibition of nucleation and growth kinetics such as viscosity, interfacial energy crystal/glassy phase, thermodynamic driving force or impingement rate are discussed. Since the crystallization front is blocked by the additives the impingement rate is decreased with increasing additive concentration. Since small concentrations of Nb2O5 and Ta2O5 have a drastic effect on the nucleation, these components should be enriched at the interface crystal/glass. This will only take place, if it leads to a decrease in the interfacial energy. Since this effect alone should result in an increase of the nucleation rate, it must be overcompensated by kinetic effects. PMID:27150844

  1. The Effects of Hydroxyapatite Addition on the Properties of the Mechanically Alloyed and Sintered Mg-RE-Zr Alloy

    NASA Astrophysics Data System (ADS)

    Kowalski, K.; Nowak, M.; Jakubowicz, J.; Jurczyk, M.

    2016-08-01

    This paper discusses the influence of the chemical composition on the microstructure, mechanical and corrosion properties of mechanically alloyed and sintered (Mg-4Y-5.5Dy-0.5Zr)-x wt.% HA composites. Mechanical alloying for 25 h of the Mg-4Y-5.5Dy-0.5Zr composition, followed by sintering under argon at 550 °C for 2 h, led to the formation of a bulk alloy with an ultrafine grained microstructure. With the increase of the hydroxyapatite content in the (Mg-4Y-5.5Dy-0.5Zr)-x wt.% HA composite, a reduction of the grain sizes of the bulk material was noticeable. In the case of the bulk (Mg-4Y-5.5Dy-0.5Zr)-10 wt.% HA composite, the grain sizes of approx. 60 nm have been recorded by atomic force microscopy. The final microstructure of the synthesized composites strongly influenced the mechanical and corrosion properties. The Mg-4Y-5.5Dy-0.5Zr alloy was characterized by higher average values of Young's modulus (36.6 GPa). In the case of the (Mg-4Y-5.5Dy-0.5Zr)-5 wt.% HA scaffolds with the porosity of 48%, the Young's modulus was equal to 7.1 GPa. The (Mg-4Y-5.5Dy-0.5Zr)-10 wt.% HA composite was more corrosion resistant (I c = 5.849 × 10-5 A cm-2, E c = -1.565 V versus SCE) than Mg-4Y-5.5Dy-0.5Zr alloy (I c = 4.838 × 10-4 A cm-2, E c = -1.555 V versus SCE). The influence of hydrofluoric acid treatment on the corrosion behavior of the (Mg-4Y-5.5Dy-0.5Zr)-5 wt.% HA composite was also investigated. The electrochemical test showed that the corrosion resistance of fluoride-treated specimens was higher, compared with the untreated samples in the Ringer's solution. In conclusion, fluoride-treated (Mg-4Y-5.5Dy-0.5Zr)-HA composites are biodegradable materials with adjustable mechanical and corrosive properties.

  2. The Effects of Hydroxyapatite Addition on the Properties of the Mechanically Alloyed and Sintered Mg-RE-Zr Alloy

    NASA Astrophysics Data System (ADS)

    Kowalski, K.; Nowak, M.; Jakubowicz, J.; Jurczyk, M.

    2016-10-01

    This paper discusses the influence of the chemical composition on the microstructure, mechanical and corrosion properties of mechanically alloyed and sintered (Mg-4Y-5.5Dy-0.5Zr)- x wt.% HA composites. Mechanical alloying for 25 h of the Mg-4Y-5.5Dy-0.5Zr composition, followed by sintering under argon at 550 °C for 2 h, led to the formation of a bulk alloy with an ultrafine grained microstructure. With the increase of the hydroxyapatite content in the (Mg-4Y-5.5Dy-0.5Zr)- x wt.% HA composite, a reduction of the grain sizes of the bulk material was noticeable. In the case of the bulk (Mg-4Y-5.5Dy-0.5Zr)-10 wt.% HA composite, the grain sizes of approx. 60 nm have been recorded by atomic force microscopy. The final microstructure of the synthesized composites strongly influenced the mechanical and corrosion properties. The Mg-4Y-5.5Dy-0.5Zr alloy was characterized by higher average values of Young's modulus (36.6 GPa). In the case of the (Mg-4Y-5.5Dy-0.5Zr)-5 wt.% HA scaffolds with the porosity of 48%, the Young's modulus was equal to 7.1 GPa. The (Mg-4Y-5.5Dy-0.5Zr)-10 wt.% HA composite was more corrosion resistant ( I c = 5.849 × 10-5 A cm-2, E c = -1.565 V versus SCE) than Mg-4Y-5.5Dy-0.5Zr alloy ( I c = 4.838 × 10-4 A cm-2, E c = -1.555 V versus SCE). The influence of hydrofluoric acid treatment on the corrosion behavior of the (Mg-4Y-5.5Dy-0.5Zr)-5 wt.% HA composite was also investigated. The electrochemical test showed that the corrosion resistance of fluoride-treated specimens was higher, compared with the untreated samples in the Ringer's solution. In conclusion, fluoride-treated (Mg-4Y-5.5Dy-0.5Zr)-HA composites are biodegradable materials with adjustable mechanical and corrosive properties.

  3. Effects of silicon additions on oxidation and mechanical behavior of the nickel-base superalloy B-1900

    NASA Technical Reports Server (NTRS)

    Miner, R. V., Jr.; Lowell, C. E.

    1975-01-01

    Test specimens with nominal additions of Si were tested in oxidation, thermal fatigue, sulfidation, tension, and stress rupture, and were also extensively studied metallographically. Alloy B-1900 modified with 0.6- or 1.2-wt% Si exhibited oxidation resistance equivalent to that of aluminide-coated B-1900 during cyclic, high-gas-velocity oxidation tests. Resistances to thermal fatigue and sulfidation were improved by the Si additions, but were not superior to aluminide-coated B-1900. Stress-rupture tests at 1000 C of specimens given the standard heat treatment to simulate an aluminide coating cycle showed Si to be detrimental. However, application of another heat treatment increased the rupture life of the alloy with 0.6-wt% Si to that of the unmodified B-1900 given the standard heat treatment.

  4. Disparate Regulatory Mechanisms Control Fat3 and P75NTR Protein Transport through a Conserved Kif5-Interaction Domain

    PubMed Central

    Birkness, Jacqueline E.; Trinidad, Jonathan C.

    2016-01-01

    Directed transport delivers proteins to specific cellular locations and is one mechanism by which cells establish and maintain polarized cellular architectures. The atypical cadherin Fat3 directs the polarized extension of dendrites in retinal amacrine cells by influencing the distribution of cytoskeletal regulators during retinal development, however the mechanisms regulating the distribution of Fat3 remain unclear. We report a novel Kinesin/Kif5 Interaction domain (Kif5-ID) in Fat3 that facilitates Kif5B binding, and determines the distribution of Fat3 cytosolic domain constructs in neurons and MDCK cells. The Kif5-ID sequence is conserved in the neurotrophin receptor P75NTR, which also binds Kif5B, and Kif5-ID mutations similarly result in P75NTR mislocalization. Despite these similarities, Kif5B-mediated protein transport is differentially regulated by these two cargos. For Fat3, the Kif5-ID is regulated by alternative splicing, and the timecourse of splicing suggests that the distribution of Fat3 may switch between early and later stages of retinal development. In contrast, P75NTR binding to Kif5B is enhanced by tyrosine phosphorylation and thus has the potential to be dynamically regulated on a more rapid time scale. PMID:27788242

  5. Transcriptomes reveal the genetic mechanisms underlying ionic regulatory adaptations to salt in the crab-eating frog

    PubMed Central

    Shao, Yong; Wang, Li-Jun; Zhong, Li; Hong, Mei-Ling; Chen, Hong-Man; Murphy, Robert W.; Wu, Dong-Dong; Zhang, Ya-Ping; Che, Jing

    2015-01-01

    The crab-eating frog, Fejervarya cancrivora, is the only frog that lives near seas. It tolerates increased environmental concentrations of sodium, chloride and potassium partly by raising ion and urea levels in its blood plasma. The molecular mechanism of the adaptation remains rarely documented. Herein, we analyze transcriptomes of the crab-eating frog and its closely related saline-intolerant species, F. limnocharis, to explore the molecular basis of adaptations to such extreme environmental conditions. Analyses reveal the potential genetic mechanism underlying the adaptation to salinity for the crab-eating frog. Genes in categories associated with ion transport appear to have evolved rapidly in F. cancrivora. Both positively selected and differentially expressed genes exhibit enrichment in the GO category regulation of renal sodium excretion. In this category, the positively selected sites of ANPEP and AVPR2 encode CD13 and V2 receptors, respectively; they fall precisely on conserved domains. More differentially expressed rapidly evolved genes occur in the kidney of F. cancrivora than in F. limnocharis. Four genes involved in the regulation of body fluid levels show signs of positive selection and increased expression. Significant up-regulation occurs in several genes of F. cancrivora associated with renin-angiotensin system and aldosterone-regulated sodium reabsorption pathways, which relate to osmotic regulation. PMID:26619819

  6. Subchromoplast Sequestration of Carotenoids Affects Regulatory Mechanisms in Tomato Lines Expressing Different Carotenoid Gene Combinations[C][W

    PubMed Central

    Nogueira, Marilise; Mora, Leticia; Enfissi, Eugenia M.A.; Bramley, Peter M.; Fraser, Paul D.

    2013-01-01

    Metabolic engineering of the carotenoid pathway in recent years has successfully enhanced the carotenoid contents of crop plants. It is now clear that only increasing biosynthesis is restrictive, as mechanisms to sequestrate these increased levels in the cell or organelle should be exploited. In this study, biosynthetic pathway genes were overexpressed in tomato (Solanum lycopersicum) lines and the effects on carotenoid formation and sequestration revealed. The bacterial Crt carotenogenic genes, independently or in combination, and their zygosity affect the production of carotenoids. Transcription of the pathway genes was perturbed, whereby the tissue specificity of transcripts was altered. Changes in the steady state levels of metabolites in unrelated sectors of metabolism were found. Of particular interest was a concurrent increase of the plastid-localized lipid monogalactodiacylglycerol with carotenoids along with membranous subcellular structures. The carotenoids, proteins, and lipids in the subchromoplast fractions of the transgenic tomato fruit with increased carotenoid content suggest that cellular structures can adapt to facilitate the sequestration of the newly formed products. Moreover, phytoene, the precursor of the pathway, was identified in the plastoglobule, whereas the biosynthetic enzymes were in the membranes. The implications of these findings with respect to novel pathway regulation mechanisms are discussed. PMID:24249831

  7. Mechanism of NHC-Catalyzed Conjugate Additions of Diboron and Borosilane Reagents to α,β-Unsaturated Carbonyl Compounds.

    PubMed

    Wu, Hao; Garcia, Jeannette M; Haeffner, Fredrik; Radomkit, Suttipol; Zhugralin, Adil R; Hoveyda, Amir H

    2015-08-26

    Broadly applicable enantioselective C-B and C-Si bond-forming processes catalyzed by an N-heterocyclic carbene (NHC) were recently introduced; these boryl and silyl conjugate addition reactions (BCA and SCA, respectively), which proceed without the need for a transition-metal complex, represent reaction pathways that are distinct from those facilitated by transition-metal-containing species (e.g., Cu, Ni, Pt, Pd, or Rh based). The Lewis-base-catalyzed (NHC) transformations are valuable to chemical synthesis, as they can generate high enantioselectivities and possess unique chemoselectivity profiles. Here, the results of investigations that elucidate the principal features of the NHC-catalyzed BCA and SCA processes are detailed. Spectroscopic evidence is provided illustrating why the presence of excess base and MeOH or H2O is required for efficient and enantioselective boryl and silyl addition reactions. It is demonstrated that the proton sources influence the efficiency and/or enantioselectivity of NHC-catalyzed enantioselective transformations in several ways. The positive, and at times adverse, impact of water (biphasic conditions) on catalytic enantioselective silyl addition reactions is analyzed. It is shown that a proton source can facilitate nonenantioselective background reactions and NHC decomposition, requiring the catalyst to surpass such complications. Stereochemical models are presented that account for the identity of the observed major enantiomers, providing a rationale for the differences in selectivity profiles of BCA and SCA processes. PMID:26263513

  8. Improvement of mechanical and biological properties of TiNi alloys by addition of Cu and Co to orthodontic archwires.

    PubMed

    Phukaoluan, Aphinan; Khantachawana, Anak; Kaewtatip, Pongpan; Dechkunakorn, Surachai; Kajornchaiyakul, Julathep

    2016-09-01

    The purpose of this study was to investigate improved performances of TiNi in order to promote tooth movement. Special attention was paid to the effect on the clinical properties of TiNi of adding Cu and Co to this alloy. Ti49.4Ni50.6, Ti49Ni46Cu5 and Ti50Ni47Co3 (at %) alloys were prepared. Specimens were cold-rolled at 30% reduction and heat-treated at 400°C for 60min. Then, the test results were compared with two types of commercial archwires. The findings showed that superelasticity properties were confirmed in the manufactured commercial alloys at mouth temperature. The difference of stress plateau in TiNi, TiNiCo and commercial wires B at 25°C changed significantly at various testing temperatures due to the combination of martensite and austenite phases. At certain temperatures the alloys exhibited zero recovery stress at 2% strain and consequently produced zero activation force for moving teeth. The corrosion test showed that the addition of Cu and Co to TiNi alloys generates an increase in corrosion potential (Ecorr) and corrosion current densities (Icorr). Finally, we observed that addition of Cu and Co improved cell viability. We conclude that addition of an appropriate amount of a third alloying element can help enhance the performances of TiNi orthodontic archwires. PMID:27520713

  9. Response of Mg Addition on the Dendritic Structures and Mechanical Properties of Hypoeutectic Al-10Si (Wt Pct) Alloys

    NASA Astrophysics Data System (ADS)

    Karaköse, Ercan; Yildiz, Mehmet; Keskin, Mustafa

    2016-08-01

    Rapidly solidified hypoeutectic Al-10Si- xMg ( x = 0, 5, 10 wt pct) alloys were produced by the melt-spinning method. The phase composition was identified by X-ray diffractometry, and the microstructures of the alloys were characterized by scanning electron microscopy. The melting characteristics were studied by differential scanning calorimetry and differential thermal analysis under an Ar atmosphere. The mechanical properties of the melt-spun and conventionally solidified alloys were tested by tensile-strength and Vickers microhardness tests. The results illustrate that the cooling rate and solidification time of 89 μm thick melt-spun ribbon were estimated to be 2.97 × 107 K s-1 and 9.31 × 10-6 s, respectively. Nanoscale Si spot particles were observed growing on the surface of the dendritic α-Al matrix and the average sizes of these spots ranged from 10 to 50 nm. The improvement in the tensile properties and microhardness was related to structural refinement and the supersaturated α-Al solid solution; the nanoscale-dispersed Si spot particles made a significant improvement to the mechanical properties of the melt-spun ribbon. Detailed electrical resistivity tests of the ribbons were carried out at temperatures of 300 K to 800 K (27 °C to 527 °C).

  10. Gene expression suggests double-segmental and single-segmental patterning mechanisms during posterior segment addition in the beetle Tribolium castaneum.

    PubMed

    Janssen, Ralf

    2014-01-01

    In the model arthropod Drosophila, all segments are patterned simultaneously in the blastoderm. In most other arthropods, however, posterior segments are added sequentially from a posterior segment addition zone. Posterior addition of single segments likely represents the ancestral mode of arthropod segmentation, although in Drosophila, segments are patterned in pairs by the pair-rule genes. It has been shown that in the new model insect, the beetle Tribolium, a segmentation clock operates that apparently patterns all segments in pairs as well. Here, I report on the expression of the segment polarity gene H15/midline in Tribolium. In the anterior embryo, segmental stripes of H15 appear in pairs, but in the posterior of the embryo stripes appear in a single-segmental periodicity. This implies that either two completely different segmentation-mechanisms may act in the germ band of Tribolium, that the segmentation clock changes its periodicity during development, or that the speed in which posterior segments are patterned changes. In any case, the data suggest the presence of another (or modified), yet undiscovered, mechanism of posterior segment addition in one of the best-understood arthropod models. The finding of a hitherto unrecognized segmentation mechanism in Tribolium may have major implications for the understanding of the origin of segmentation mechanisms, including the origin of pair rule patterning. It also calls for (re)-investigation of posterior segment addition in Tribolium and other previously studied arthropod models.

  11. The influence of α-Al2O3 addition on microstructure, mechanical and formaldehyde adsorption properties of fly ash-based geopolymer products.

    PubMed

    Huang, Yi; Han, Minfang

    2011-10-15

    Fly ash-based geopolymer with α-Al(2)O(3) addition were synthesized and used to remove formaldehyde from indoor air. The microstructure, mechanical and formaldehyde adsorption properties of the geopolymer products obtained were investigated. The results showed that α-Al(2)O(3) addition with appropriate amount (such as 5 wt%) increased the geopolymerization extent, resulting in the increase of surface area and compressive strength. In addition, the improvement of structural ordering level for geopolymer sample with 5 wt% α-Al(2)O(3) addition was found through FTIR analysis. By contrast, excessive addition (such as 10 wt%) had the opposite effect. The test of formaldehyde adsorption capacity confirmed that fly ash-based geopolymer product exhibited much better property of adsorbing indoor formaldehyde physically and chemically than fly ash itself. The surface area was an important but not unique factor influencing the adsorption capacity of geopolymers.

  12. Control of the Inflammatory Response Mechanisms Mediated by Natural and Induced Regulatory T-Cells in HCV-, HTLV-1-, and EBV-Associated Cancers

    PubMed Central

    Moralès, Olivier; Delhem, Nadira

    2014-01-01

    Virus infections are involved in chronic inflammation and, in some cases, cancer development. Although a viral infection activates the immune system's response that eradicates the pathogen mainly through inflammatory mechanisms, it is now recognized that this inflammatory condition is also favorable to the development of tumors. Indeed, it is well described that viruses, such as hepatitis C virus (HCV), Epstein Barr virus (EBV), human papillomavirus (HPV) or human T-cell lymphotropic virus type-1 (HTLV-1), are important risk factors for tumor malignancies. The inflammatory response is a fundamental immune mechanism which involves several molecular and cellular components consisting of cytokines and chemokines that are released by various proinflammatory cells. In parallel to this process, some endogenous recruited components release anti-inflammatory mediators to restore homeostasis. The development of tools and strategies using viruses to hijack the immune response is mostly linked to the presence of regulatory T-cells (Treg) that can inhibit inflammation and antiviral responses of other effector cells. In this review, we will focus on current understanding of the role of natural and induced Treg in the control and the resolution of inflammatory response in HCV-, HTLV-1-, and EBV-associated cancers. PMID:25525301

  13. The improved mechanical properties of β-CaSiO3 bioceramics with Si3N4 addition.

    PubMed

    Pan, Ying; Zuo, Kaihui; Yao, Dongxu; Yin, Jinwei; Xin, Yunchuan; Xia, Yongfeng; Liang, Hanqin; Zeng, Yuping

    2015-03-01

    The motivation of this study is to investigate the effect of Si3N4 addition on the sinterability of β-CaSiO3 ceramics. β-CaSiO3 ceramics with different content of Si3N4 were prepared at the sintering temperature ranging from 1000°C to 1150°C. The results showed that Si3N4 can be successfully used as sintering additive by being oxidized to form SiO2. The β-CaSiO3 ceramics with 3wt% Si3N4 sintered at 1100°C revealed flexural strength, hardness and fracture toughness of 157.2MPa, 4.4GPa and 2.3MPam(1/2) respectively, which was much higher than that of pure β-CaSiO3 ceramics (41.1MPa, 1.0GPa, 1.1MPam(1/2)). XRD analysis and SEM observation indicated that the main phase maintained to be β-phase after sintering. PMID:26580024

  14. Effects of h-BN addition on microstructures and mechanical properties of β-CaSiO3 bioceramics.

    PubMed

    Pan, Ying; Yao, Dongxu; Zuo, Kaihui; Xia, Yongfeng; Yin, Jinwei; Liang, Hanqin; Zeng, Yuping

    2016-09-01

    The main purpose of this study consists in investigating the effects of h-BN addition on the sinterability of β-CaSiO3 (β-CS) bioceramics. β-CS bioceramics with different contents of h-BN were prepared at the sintering temperature ranging from 800°C to 1100°C. The results showed that h-BN can be successfully used as sintering additive by being oxidized to form low melting point B2O3 related glassy phase and enhanced the flexural strength by the formation of rod-like β-CS grains. β-CS bioceramics with 1wt% h-BN sintered at 1000°C revealed flexural strength and fracture toughness of 182.2MPa and 2.4MPam(1/2) respectively, which were much higher than that of pure β-CS bioceramics (30.2MPa, 0.53MPam(1/2)) fabricated in the same processing condition. PMID:27227289

  15. Influence of Tin Additions on the Phase-Transformation Characteristics of Mechanical Alloyed Cu-Al-Ni Shape-Memory Alloy

    NASA Astrophysics Data System (ADS)

    Saud, Safaa N.; Hamzah, E.; Abubakar, T.; Bakhsheshi-Rad, H. R.; Mohammed, M. N.

    2016-07-01

    The influence of the addition of Sn to Cu-Al-Ni alloy as a fourth element with different percentages of 0.5, 1.0, and 1.5 wt pct on the microstructure, phase-transformation temperatures, mechanical properties, and corrosion behaviors was investigated. The modified and unmodified alloys were fabricated by mechanical alloying followed by microwave sintering. The sintered and homogenized alloys of Cu-Al-Ni-xSn shape-memory alloys had a refined particle structure with an average particle size of 40 to 50 µm associated with an improvement in the mechanical properties and corrosion resistance. With the addition of Sn, the porosity density tends to decrease, which can also lead to improvements in the properties of the modified alloys. The minimum porosity percentage was observed in the Cu-Al-Ni-1.0 wt pct Sn alloy, which resulted in enhancing the ductility, strain recovery, and corrosion resistance. Further increasing the Sn addition to 1.5 wt pct, the strength of the alloy increased because the highest volume fraction of precipitates was formed. Regarding the corrosion behavior, addition of Sn up to 1 wt pct increased the corrosion resistance of the base SMA from 2.97 to 19.20 kΩ cm2 because of formation of a protective film that contains hydrated tin oxyhydroxide, aluminum dihydroxychloride, and copper chloride on the alloy. However, further addition of Sn reduced the corrosion resistance.

  16. Influence of Tin Additions on the Phase-Transformation Characteristics of Mechanical Alloyed Cu-Al-Ni Shape-Memory Alloy

    NASA Astrophysics Data System (ADS)

    Saud, Safaa N.; Hamzah, E.; Abubakar, T.; Bakhsheshi-Rad, H. R.; Mohammed, M. N.

    2016-10-01

    The influence of the addition of Sn to Cu-Al-Ni alloy as a fourth element with different percentages of 0.5, 1.0, and 1.5 wt pct on the microstructure, phase-transformation temperatures, mechanical properties, and corrosion behaviors was investigated. The modified and unmodified alloys were fabricated by mechanical alloying followed by microwave sintering. The sintered and homogenized alloys of Cu-Al-Ni- xSn shape-memory alloys had a refined particle structure with an average particle size of 40 to 50 µm associated with an improvement in the mechanical properties and corrosion resistance. With the addition of Sn, the porosity density tends to decrease, which can also lead to improvements in the properties of the modified alloys. The minimum porosity percentage was observed in the Cu-Al-Ni-1.0 wt pct Sn alloy, which resulted in enhancing the ductility, strain recovery, and corrosion resistance. Further increasing the Sn addition to 1.5 wt pct, the strength of the alloy increased because the highest volume fraction of precipitates was formed. Regarding the corrosion behavior, addition of Sn up to 1 wt pct increased the corrosion resistance of the base SMA from 2.97 to 19.20 kΩ cm2 because of formation of a protective film that contains hydrated tin oxyhydroxide, aluminum dihydroxychloride, and copper chloride on the alloy. However, further addition of Sn reduced the corrosion resistance.

  17. Investigation on the effect of titanium (Ti) addition to the Mg- AZ31 alloy in the as cast and after extrusion conditions on its metallurgical and mechanical characteristics

    NASA Astrophysics Data System (ADS)

    Zaid, Adnan I. O.; Raghad; Hememat, S.

    2016-08-01

    Magnesium-aluminum alloys are versatile materials which are used in manufacturing a number of engineering and industrial parts in the automobile and aircraft industries due to their strength - to -weight -ratios. Against these preferable characteristics, magnesium is difficult to deform at room temperature; therefore it is alloyed with other elements mainly aluminum and zinc to add some required properties particularly to achieve high strength -to- weight ratio. Grain refinement is an important technology to improve the mechanical propertiesand the microstructure uniformity of the alloys. Most of the published work on grain refinement was directed toward grain refining aluminum and zinc alloys; however, the effect of the addition of rare earth material on the grain size or the mechanical behavior of Mg alloys is rare. In this paper the effect of Ti addition on the grain size, mechanical behavior, ductility, extrusion force and energy, of Mg-AZ31 alloy both in the as cast condition and after direct extrusion is investigated.

  18. Modeling the mechanical and aging properties of silicone rubber and foam - stockpile-historical & additively manufactured materials

    SciTech Connect

    Maiti, A.; Weisgraber, T. H.; Gee, R. H.

    2014-09-30

    M97* and M9763 belong to the M97xx series of cellular silicone materials that have been deployed as stress cushions in some of the LLNL systems. Their purpose of these support foams is to distribute the stress between adjacent components, maintain relative positioning of various components, and mitigate the effects of component size variation due to manufacturing and temperature changes. In service these materials are subjected to a continuous compressive strain over long periods of time. In order to ensure their effectiveness, it is important to understand how their mechanical properties change over time. The properties we are primarily concerned about are: compression set, load retention, and stress-strain response (modulus).

  19. Effect of Ti addition on the mechanical properties and the magnetocaloric effect of Ni-Mn-In metamagnetic shape memory alloys

    NASA Astrophysics Data System (ADS)

    Sánchez-Alarcos, V.; Pérez-Landazábal, J. I.; Recarte, V.; Urdiaín, A.

    2015-11-01

    The effect of small amounts of Ti on the microstructure, mechanical properties and the magnetocaloric effect of a Ni-Mn-In metamagnetic shape memory alloy has been investigated. A strong grain refinement is observed as a consequence of the Ti addition, which in turn does not affect the crystallographic structure. Linked to the grain size reduction, mechanical properties such as microhardness and yield strength considerably increase with the increasing Ti content, following a Hall-Petch relation. Likewise, the MT temperature diminishes with the decreasing grain size, in spite of the increasing e/a. On the other hand, both the Curie temperature and the saturation magnetization of the martensite decrease as a result of the Ti addition. The lowering of the MT temperature brought by the grain refinement and the decrease of the saturation magnetization of the martensite that occurs as a consequence of the Ti addition result in a considerable enhancement of the magnetocaloric effect.

  20. Deciphering the molecular mechanisms underlying the binding of the TWIST1/E12 complex to regulatory E-box sequences.

    PubMed

    Bouard, Charlotte; Terreux, Raphael; Honorat, Mylène; Manship, Brigitte; Ansieau, Stéphane; Vigneron, Arnaud M; Puisieux, Alain; Payen, Léa

    2016-06-20

    The TWIST1 bHLH transcription factor controls embryonic development and cancer processes. Although molecular and genetic analyses have provided a wealth of data on the role of bHLH transcription factors, very little is known on the molecular mechanisms underlying their binding affinity to the E-box sequence of the promoter. Here, we used an in silico model of the TWIST1/E12 (TE) heterocomplex and performed molecular dynamics (MD) simulations of its binding to specific (TE-box) and modified E-box sequences. We focused on (i) active E-box and inactive E-box sequences, on (ii) modified active E-box sequences, as well as on (iii) two box sequences with modified adjacent bases the AT- and TA-boxes. Our in silico models were supported by functional in vitro binding assays. This exploration highlighted the predominant role of protein side-chain residues, close to the heart of the complex, at anchoring the dimer to DNA sequences, and unveiled a shift towards adjacent ((-1) and (-1*)) bases and conserved bases of modified E-box sequences. In conclusion, our study provides proof of the predictive value of these MD simulations, which may contribute to the characterization of specific inhibitors by docking approaches, and their use in pharmacological therapies by blocking the tumoral TWIST1/E12 function in cancers. PMID:27151200

  1. Studies on the regulatory effect of Peony-Glycyrrhiza Decoction on prolactin hyperactivity and underlying mechanism in hyperprolactinemia rat model.

    PubMed

    Wang, Di; Wang, Wei; Zhou, Yulin; Wang, Juan; Jia, Dongxu; Wong, Hei Kiu; Zhang, Zhang-Jin

    2015-10-01

    Clinical trials have demonstrated the beneficial effects of Peony-Glycyrrhiza Decoction (PGD) in alleviating antipsychotic-induced hyperprolactinemia (hyperPRL) in schizophrenic patients. In previous experiment, PGD suppressed prolactin (PRL) level in MMQ cells, involving modulating the expression of D2 receptor (DRD2) and dopamine transporter (DAT). In the present study, hyperPRL female rat model induced by dopamine blocker metoclopramide (MCP) was applied to further confirm the anti-hyperpPRL activity of PGD and underlying mechanism. In MCP-induced hyperPRL rats, the elevated serum PRL level was significantly suppressed by either PGD (2.5-10 g/kg) or bromocriptine (BMT) (0.6 mg/kg) administration for 14 days. However, in MCP-induced rats, only PGD restored the under-expressed serum progesterone (P) to control level. Both PGD and BMT administration restore the under-expression of DRD2, DAT and TH resulted from MCP in pituitary gland and hypothalamus. Compared to untreated group, hyperPRL animals had a marked reduction on DRD2 and DAT expression in the arcuate nucleus. PGD (10 g/kg) and BMT (0.6 mg/kg) treatment significant reversed the expression of DRD2 and DAT. Collectively, the anti-hyperPRL activity of PGD associates with the modulation of dopaminergic neuronal system and the restoration of serum progesterone level. Our finding supports PGD as an effective agent against hyperPRL.

  2. Comparative transcriptome and metabolome provides new insights into the regulatory mechanisms of accelerated senescence in litchi fruit after cold storage

    PubMed Central

    Yun, Ze; Qu, Hongxia; Wang, Hui; Zhu, Feng; Zhang, Zhengke; Duan, Xuewu; Yang, Bao; Cheng, Yunjiang; Jiang, Yueming

    2016-01-01

    Litchi is a non-climacteric subtropical fruit of high commercial value. The shelf life of litchi fruit under ambient conditions (AC) is approximately 4–6 days. Post-harvest cold storage prolongs the life of litchi fruit for up to 30 days with few changes in pericarp browning and total soluble solids. However, the shelf life of litchi fruits at ambient temperatures after pre-cold storage (PCS) is only 1–2 days. To better understand the mechanisms involved in the rapid fruit senescence induced by pre-cold storage, a transcriptome of litchi pericarp was constructed to assemble the reference genes, followed by comparative transcriptomic and metabolomic analyses. Results suggested that the senescence of harvested litchi fruit was likely to be an oxidative process initiated by ABA, including oxidation of lipids, polyphenols and anthocyanins. After cold storage, PCS fruit exhibited energy deficiency, and respiratory burst was elicited through aerobic and anaerobic respiration, which was regulated specifically by an up-regulated calcium signal, G-protein-coupled receptor signalling pathway and small GTPase-mediated signal transduction. The respiratory burst was largely associated with increased production of reactive oxygen species, up-regulated peroxidase activity and initiation of the lipoxygenase pathway, which were closely related to the accelerated senescence of PCS fruit. PMID:26763309

  3. Deciphering the molecular mechanisms underlying the binding of the TWIST1/E12 complex to regulatory E-box sequences

    PubMed Central

    Bouard, Charlotte; Terreux, Raphael; Honorat, Mylène; Manship, Brigitte; Ansieau, Stéphane; Vigneron, Arnaud M.; Puisieux, Alain; Payen, Léa

    2016-01-01

    The TWIST1 bHLH transcription factor controls embryonic development and cancer processes. Although molecular and genetic analyses have provided a wealth of data on the role of bHLH transcription factors, very little is known on the molecular mechanisms underlying their binding affinity to the E-box sequence of the promoter. Here, we used an in silico model of the TWIST1/E12 (TE) heterocomplex and performed molecular dynamics (MD) simulations of its binding to specific (TE-box) and modified E-box sequences. We focused on (i) active E-box and inactive E-box sequences, on (ii) modified active E-box sequences, as well as on (iii) two box sequences with modified adjacent bases the AT- and TA-boxes. Our in silico models were supported by functional in vitro binding assays. This exploration highlighted the predominant role of protein side-chain residues, close to the heart of the complex, at anchoring the dimer to DNA sequences, and unveiled a shift towards adjacent ((-1) and (-1*)) bases and conserved bases of modified E-box sequences. In conclusion, our study provides proof of the predictive value of these MD simulations, which may contribute to the characterization of specific inhibitors by docking approaches, and their use in pharmacological therapies by blocking the tumoral TWIST1/E12 function in cancers. PMID:27151200

  4. Nek2A phosphorylates and stabilizes SuFu: A new strategy of Gli2/Hedgehog signaling regulatory mechanism.

    PubMed

    Wang, Yao; Li, Yong; Hu, Guanghui; Huang, Xuan; Rao, Hai; Xiong, Xiangyang; Luo, Zhijun; Lu, Quqin; Luo, Shiwen

    2016-09-01

    Suppressor of Fused (SuFu) plays a conservative role in the regulation of the Gli transcription factors within the Hedgehog (Hh) signaling pathway. Despite the central importance of SuFu in the Hh pathway, little is known about its regulation. Here, we performed a GAL4-based yeast two-hybrid screen using human SuFu as bait, and identified NIMA-related expressed kinase 2A (Nek2A) as a new SuFu-interacting protein, which was also confirmed by glutathione-S-transferase pull-down and co-immunoprecipitation assays. Intriguingly, Nek2A is found to stabilize SuFu at least partly depending on its kinase activity, thereby triggering phosphorylation of the SuFu protein. Moreover, the phosphorylated SuFu inhibits the nuclear localization and transcriptional activity of Gli2/Hh signaling. These findings reveal a new mechanism of mammalian SuFu regulation, and offers novel insights into Hh signaling regulation in development and human disease. PMID:27297360

  5. Comparative transcriptome and metabolome provides new insights into the regulatory mechanisms of accelerated senescence in litchi fruit after cold storage.

    PubMed

    Yun, Ze; Qu, Hongxia; Wang, Hui; Zhu, Feng; Zhang, Zhengke; Duan, Xuewu; Yang, Bao; Cheng, Yunjiang; Jiang, Yueming

    2016-01-01

    Litchi is a non-climacteric subtropical fruit of high commercial value. The shelf life of litchi fruit under ambient conditions (AC) is approximately 4-6 days. Post-harvest cold storage prolongs the life of litchi fruit for up to 30 days with few changes in pericarp browning and total soluble solids. However, the shelf life of litchi fruits at ambient temperatures after pre-cold storage (PCS) is only 1-2 days. To better understand the mechanisms involved in the rapid fruit senescence induced by pre-cold storage, a transcriptome of litchi pericarp was constructed to assemble the reference genes, followed by comparative transcriptomic and metabolomic analyses. Results suggested that the senescence of harvested litchi fruit was likely to be an oxidative process initiated by ABA, including oxidation of lipids, polyphenols and anthocyanins. After cold storage, PCS fruit exhibited energy deficiency, and respiratory burst was elicited through aerobic and anaerobic respiration, which was regulated specifically by an up-regulated calcium signal, G-protein-coupled receptor signalling pathway and small GTPase-mediated signal transduction. The respiratory burst was largely associated with increased production of reactive oxygen species, up-regulated peroxidase activity and initiation of the lipoxygenase pathway, which were closely related to the accelerated senescence of PCS fruit. PMID:26763309

  6. Structural basis of the regulatory mechanism of the plant CIPK family of protein kinases controlling ion homeostasis and abiotic stress

    PubMed Central

    Chaves-Sanjuan, Antonio; Sanchez-Barrena, Maria Jose; Gonzalez-Rubio, Juana Maria; Moreno, Maria; Ragel, Paula; Jimenez, Marta; Pardo, Jose M.; Martinez-Ripoll, Martin; Quintero, Francisco J.; Albert, Armando

    2014-01-01

    Plant cells have developed specific protective molecular machinery against environmental stresses. The family of CBL-interacting protein kinases (CIPK) and their interacting activators, the calcium sensors calcineurin B-like (CBLs), work together to decode calcium signals elicited by stress situations. The molecular basis of biological activation of CIPKs relies on the calcium-dependent interaction of a self-inhibitory NAF motif with a particular CBL, the phosphorylation of the activation loop by upstream kinases, and the subsequent phosphorylation of the CBL by the CIPK. We present the crystal structures of the NAF-truncated and pseudophosphorylated kinase domains of CIPK23 and CIPK24/SOS2. In addition, we provide biochemical data showing that although CIPK23 is intrinsically inactive and requires an external stimulation, CIPK24/SOS2 displays basal activity. This data correlates well with the observed conformation of the respective activation loops: Although the loop of CIPK23 is folded into a well-ordered structure that blocks the active site access to substrates, the loop of CIPK24/SOS2 protrudes out of the active site and allows catalysis. These structures together with biochemical and biophysical data show that CIPK kinase activity necessarily requires the coordinated releases of the activation loop from the active site and of the NAF motif from the nucleotide-binding site. Taken all together, we postulate the basis for a conserved calcium-dependent NAF-mediated regulation of CIPKs and a variable regulation by upstream kinases. PMID:25288725

  7. Study on the molecular regulatory mechanism of MicroRNA-195 in the invasion and metastasis of colorectal carcinoma

    PubMed Central

    Yang, Bin; Tan, Zhigang; Song, Yan

    2015-01-01

    Objective: This study aims to identify the target gene of hsa-miR-195 and to research the molecular mechanism of hsa-miR-195 which is through its target genes in the colorectal cancer invasion and metastasis. Methods: We used biological informatics (RNAhybrid and Target Scan analysis database) to predict the target genes of hsa-miR-195. Collected colon cancer tissues from clinical colorectal cancer patients by surgical removal of the carcinoma and control tissues, and researched the expression of Bcl-2 in tissues by immunohistochemical. Next, Real-time PCR was used to research the expression of hsa-miR-195 in Caco-2 and NCM460 cell line. hsa -miR-195 Mimics was transient transfered to Caco-2 cells, western blot was used to analysis the expression changes of Bcl-2. To analysis the possibility that hsa-miR-195 can affect the invasive ability of tumor cells by Bcl-2, we transferred hsa-miR-195 Mimics and Bcl-2 expression plasmid, and used the cell invasion experiment to discusses hsa-miR-195 effect on the ability of tumor cell invasion. Results: the immunohistochemical results showed that, the semi-quantitative parameters for the Bcl-2: control by 0.89 ± 0.51, 6 colon cancer by 31 ± 0.79. The expression of has-miR-195 in Caco-2 is 0.39 ± 1.5 while the value in control is2.01 ± 0.2, **P < 0.01. Conclusion: In colorectal cancer, has-miR-195 can promote cell apoptosis and inhibit the invasion and metastasis by inhibiting the expression of Bcl-2. PMID:26064276

  8. S-nitrosation of β-catenin and p120 catenin: a novel regulatory mechanism in endothelial hyperpermeability

    PubMed Central

    Marín, N.; Zamorano, P.; Carrasco, R.; Mujica, P.; González, FG.; Quezada, C.; Meininger, CJ.; Boric, MP.; Durán, WN.; Sánchez, FA.

    2014-01-01

    Rationale Endothelial adherens junction proteins constitute an important element in the control of microvascular permeability. Platelet-activating factor (PAF) increases permeability to macromolecules via translocation of eNOS to cytosol and stimulation of eNOS-derived NO signaling cascade. The mechanisms by which NO signaling regulates permeability at adherens junctions are still incompletely understood. Objective We explored the hypothesis that PAF stimulates hyperpermeability via S-nitrosation (SNO) of adherens junction proteins. Methods and Results We measured PAF-stimulated S-nitrosation of β-catenin and p120-catenin (p120) in three cell lines: ECV-eNOSGFP, EAhy926 (derived from human umbilical vein) and CVEC (derived from bovine heart endothelium) and in the mouse cremaster muscle in vivo. SNO correlated with diminished abundance of β-catenin and p120 at the adherens junction and with hyperpermeability. TNF-α increased NO production and caused similar increase in S-nitrosation as PAF. To ascertain the importance of eNOS subcellular location in this process, we used ECV-304 cells transfected with cytosolic eNOS (GFPeNOSG2A) and plasma membrane eNOS (GFPeNOSCAAX). PAF induced S-nitrosation of β-catenin and p120 and significantly diminished association between these proteins in cells with cytosolic eNOS but not in cells wherein eNOS is anchored to the cell membrane. Inhibitors of NO production and of S-nitrosation blocked PAF-induced S-nitrosation and hyperpermeability whereas inhibition of the cGMP pathway had no effect. Mass spectrometry analysis of purified p120 identified cysteine 579 as the main S-nitrosated residue in the region that putatively interacts with VE-cadherin. Conclusions Our results demonstrate that agonist-induced SNO contributes to junctional membrane protein changes that enhance endothelial permeability. PMID:22777005

  9. Lycopene treatment against loss of bone mass, microarchitecture and strength in relation to regulatory mechanisms in a postmenopausal osteoporosis model.

    PubMed

    Ardawi, Mohammed-Salleh M; Badawoud, Mohammed H; Hassan, Sherif M; Rouzi, Abdulrahim A; Ardawi, Jumanah M S; AlNosani, Nouf M; Qari, Mohammed H; Mousa, Shaker A

    2016-02-01

    Lycopene supplementation decreases oxidative stress and exhibits beneficial effects on bone health, but the mechanisms through which it alters bone metabolism in vivo remain unclear. The present study aims to evaluate the effects of lycopene treatment on postmenopausal osteoporosis. Six-month-old female Wistar rats (n=264) were sham-operated (SHAM) or ovariectomized (OVX). The SHAM group received oral vehicle only and the OVX rats were randomized into five groups receiving oral daily lycopene treatment (mg/kg body weight per day): 0 OVX (control), 15 OVX, 30 OVX, and 45 OVX, and one group receiving alendronate (ALN) (2μg/kg body weight per day), for 12weeks. Bone densitometry measurements, bone turnover markers, biomechanical testing, and histomorphometric analysis were conducted. Micro computed tomography was also used to evaluate changes in microarchitecture. Lycopene treatment suppressed the OVX-induced increase in bone turnover, as indicated by changes in biomarkers of bone metabolism: serum osteocalcin (s-OC), serum N-terminal propeptide of type 1 collagen (s-PINP), serum crosslinked carboxyterminal telopeptides (s-CTX-1), and urinary deoxypyridinoline (u-DPD). Significant improvement in OVX-induced loss of bone mass, bone strength, and microarchitectural deterioration was observed in lycopene-treated OVX animals. These effects were observed mainly at sites rich in trabecular bone, with less effect in cortical bone. Lycopene treatment down-regulated osteoclast differentiation concurrent with up-regulating osteoblast together with glutathione peroxidase (GPx) catalase (CAT) and superoxide dismutase (SOD) activities. These findings demonstrate that lycopene treatment in OVX rats primarily suppressed bone turnover to restore bone strength and microarchitecture.

  10. Effect of C and Ce addition on the microstructure and magnetic property of the mechanically alloyed FeSiBAlNi high entropy alloys

    NASA Astrophysics Data System (ADS)

    Xu, Jing; Axinte, Eugen; Zhao, Zhengfeng; Wang, Yan

    2016-09-01

    The effects of elemental addition, C and Ce, on the microstructure, thermal property and magnetic property of mechanically alloyed FeSiBAlNi (based-W5) high entropy alloys (HEAs) have been investigated in depth in the present work. The amorphous HEAs have been successfully fabricated by mechanical alloying. The results reveal that Ce addition obviously shortens the formation time of fully amorphous phase, therefore leading to the enhanced glass forming ability (GFA) of the based-W5. The final products of as-milled FeSiBAlNiC alloy consist of the main amorphous phase and a small amount of Si nanocrystals. In addition, C and Ce addition are both beneficial to enhance the thermal stability. The coercivity force (Hc) of the tested samples lies in the range of 50-378 Oe, suggesting the semi-hard magnetic property. The saturation magnetization (Ms) becomes decreased with increasing the milling time. C addition effectively increases Ms exhibiting the good magnetic property, however, Ce addition presents the negative effect. It should be noted that the amorphous phase tends to be formed when the radius ratio (Rr) is larger than 1, and the GFA is enhanced with increasing Rr and valence electron concentration.

  11. Dynamic Changes in ANGUSTIFOLIA3 Complex Composition Reveal a Growth Regulatory Mechanism in the Maize Leaf[OPEN

    PubMed Central

    Nelissen, Hilde; Eeckhout, Dominique; Demuynck, Kirin; Persiau, Geert; Walton, Alan; van Bel, Michiel; Vervoort, Marieke; Candaele, Jasper; De Block, Jolien; Aesaert, Stijn; Van Lijsebettens, Mieke; Goormachtig, Sofie; Vandepoele, Klaas; Van Leene, Jelle; Muszynski, Michael; Gevaert, Kris; Inzé, Dirk; De Jaeger, Geert

    2015-01-01

    Most molecular processes during plant development occur with a particular spatio-temporal specificity. Thus far, it has remained technically challenging to capture dynamic protein-protein interactions within a growing organ, where the interplay between cell division and cell expansion is instrumental. Here, we combined high-resolution sampling of the growing maize (Zea mays) leaf with tandem affinity purification followed by mass spectrometry. Our results indicate that the growth-regulating SWI/SNF chromatin remodeling complex associated with ANGUSTIFOLIA3 (AN3) was conserved within growing organs and between dicots and monocots. Moreover, we were able to demonstrate the dynamics of the AN3-interacting proteins within the growing leaf, since copurified GROWTH-REGULATING FACTORs (GRFs) varied throughout the growing leaf. Indeed, GRF1, GRF6, GRF7, GRF12, GRF15, and GRF17 were significantly enriched in the division zone of the growing leaf, while GRF4 and GRF10 levels were comparable between division zone and expansion zone in the growing leaf. These dynamics were also reflected at the mRNA and protein levels, indicating tight developmental regulation of the AN3-associated chromatin remodeling complex. In addition, the phenotypes of maize plants overexpressing miRNA396a-resistant GRF1 support a model proposing that distinct associations of the chromatin remodeling complex with specific GRFs tightly regulate the transition between cell division and cell expansion. Together, our data demonstrate that advancing from static to dynamic protein-protein interaction analysis in a growing organ adds insights in how developmental switches are regulated. PMID:26036253

  12. Mesobuthus tamulus venom induces acute respiratory distress syndrome in rats involving additional mechanisms as compared to oleic acid model.

    PubMed

    Akella, Aparna; Tiwari, Anil K; Patne, Shashikant C U; Deshpande, Shripad B

    2015-04-01

    The present study was undertaken to determine whether acute respiratory distress syndrome (ARDS) is produced after Mesobuthus tamulus (MBT) envenomation and compared it with oleic acid (OA)-induced ARDS. The trachea, jugular vein and femoral artery were cannulated in anesthetized adult rats. Lethal dose of MBT venom (5 mg/kg) or OA (75 μL) was administered intravenously and the time-dependent changes in respiratory frequency (RF), heart rate (HR) and mean arterial pressure (MAP) were recorded. Minute ventilation (MV) and the PaO2/FiO2 (P/F) ratio were also determined. At the end lungs were excised, one lung was used for histopathological examination and the other was used for determination of pulmonary water content physically. MBT venom or OA produced hypoxemia, pulmonary pathology (alveolar damage, infiltration of inflammatory cells, capillary damage and exudation) and pulmonary edema implicating for ARDS. However, the hypoxemia in MBT venom group was associated with decreased MV, apnea/bradypnea, and bradycardia whereas, in OA group it was seen with increased MV, tachypnea, and tachycardia. Lack of effect of hypoxemic drive on RF/MV or HR in MBT venom group unlike OA group, suggests the involvement of medullary centers. The present results demonstrate that MBT venom produces ARDS. However MBT venom-induced ARDS involves pulmonary as well as extrapulmonary mechanisms.

  13. High-throughput exploration of thermoelectric and mechanical properties of amorphous NbO2 with transition metal additions

    NASA Astrophysics Data System (ADS)

    Music, Denis; Geyer, Richard W.; Hans, Marcus

    2016-07-01

    To increase the thermoelectric efficiency and reduce the thermal fatigue upon cyclic heat loading, alloying of amorphous NbO2 with all 3d and 5d transition metals has systematically been investigated using density functional theory. It was found that Ta fulfills the key design criteria, namely, enhancement of the Seebeck coefficient and positive Cauchy pressure (ductility gauge). These quantum mechanical predictions were validated by assessing the thermoelectric and elastic properties on combinatorial thin films, which is a high-throughput approach. The maximum power factor is 2813 μW m-1 K-2 for the Ta/Nb ratio of 0.25, which is a hundredfold increment compared to pure NbO2 and exceeds many oxide thermoelectrics. Based on the elasticity measurements, the consistency between theory and experiment for the Cauchy pressure was attained within 2%. On the basis of the electronic structure analysis, these configurations can be perceived as metallic, which is consistent with low electrical resistivity and ductile behavior. Furthermore, a pronounced quantum confinement effect occurs, which is identified as the physical origin for the Seebeck coefficient enhancement.

  14. [Effects and mechanism of alkaline wastes application and zinc fertilizer addition on Cd bioavailability in contaminated soil].

    PubMed

    Liu, Zhao-Bing; Ji, Xiong-Hui; Tian, Fa-Xiang; Peng, Hua; Wu, Jia-Mei; Shi, Li-Hong

    2011-04-01

    The effects of paper mill sludge, red mud and zinc fertilizer addition on remediation of acid cadmium contaminated paddy soil were studied in a pot experiment, and their beneficial effects were verified in a field experiment, by using lime as comparison. The pot experiment results showed that a single application (2 g x kg(-1)) of lime, paper mill sludge or red mud increased soil pH significantly. Compared with no applying alkaline substances, the soil exchangeable Ca content was increased by 33.1%-76.0% at 7 days after applying alkaline substances and 31.0%-78.3% at 30 days after rice transplanting, respectively. The soil available Cd content was significantly decreased by 38.4%-45.0% at 7 days after the three alkaline substances applications, and was decreased by 37.4%-52.9% and 33.2%-38.7% at 30 days and 60 days after rice transplanting, respectively. The Cd content in rice root and brown rice was decreased by 24.0%-48.5% and 26.3%-44.7%, respectively. With equal applications of lime, paper mill sludge and red mud, the effects on increase of soil pH and decrease in Cd accumulation by rice was lime > red mud > paper mill sludge. Compared with a single application (2 g x kg(-1)) of paper mill sludge or red mud, Cd accumulation decreased significantly following the application of zinc fertilizer (0.2 g x kg(-1)) field experimental results were similar to the pot experiment that Cd accumulation apparently declined in the first and second crops (late rice and autumn rape) following the application of paper mill sludge, red mud and addition of zinc fertilizer. The Cd content in brown rice and rape seeds was decreased by 27.1-65.1% and 16.4%-41.6%, respectively, compared with no alkaline substances application. The Cd content in brown rice reached the National Hygienic Standard for Grains (GB 2715-2005). Therefore, combined application of paper mill sludge or red mud with zinc fertilizer was a feasible method to remediate acid cadmium contaminated paddy soil. Rice

  15. The growth mechanism and ferroelectric domains of diisopropylammonium bromide films synthesized via 12-crown-4 addition at room temperature.

    PubMed

    Gao, Kaige; Xu, Cong; Cui, Zepeng; Liu, Chuang; Gao, Linsong; Li, Chen; Wu, Di; Cai, Hong-Ling; Wu, X S

    2016-03-21

    Diisopropylammonium bromide (DIPAB) has attracted great attention as a molecular ferroelectric with large spontaneous polarization and high Curie temperature. It is hard to grow the ferroelectric phase DIPAB because of the appearance of the non-ferroelectric phase DIPAB at room temperature. Here, a ferroelectric thin film of DIPAB was successfully fabricated on a Si substrate using a spin coating method from aqueous solution via 12-crown-4 addition at room temperature. The ferroelectric DIPAB film with a thickness of hundreds of nanometers is distributed discontinuously on the substrate in narrow strips. The direction of polarization is along the narrow strip. Piezoresponse force microscopy (PFM) shows that the ferroelectric films have two kinds of domain structures: noncharged antiparallel stripe domains and charged head-to-head (H-H)/tail-to-tail (T-T) type domains. 12-crown-4 has been proved to play important roles in forming the H-H/T-T type domains. The Chynoweth method shows that the DIPAB films synthesized in this way show a better pyroelectric effect than DIPAB crystals.

  16. Integrative Modeling of eQTLs and Cis-Regulatory Elements Suggests Mechanisms Underlying Cell Type Specificity of eQTLs

    PubMed Central

    Brown, Christopher D.; Mangravite, Lara M.; Engelhardt, Barbara E.

    2013-01-01

    Genetic variants in cis-regulatory elements or trans-acting regulators frequently influence the quantity and spatiotemporal distribution of gene transcription. Recent interest in expression quantitative trait locus (eQTL) mapping has paralleled the adoption of genome-wide association studies (GWAS) for the analysis of complex traits and disease in humans. Under the hypothesis that many GWAS associations tag non-coding SNPs with small effects, and that these SNPs exert phenotypic control by modifying gene expression, it has become common to interpret GWAS associations using eQTL data. To fully exploit the mechanistic interpretability of eQTL-GWAS comparisons, an improved understanding of the genetic architecture and causal mechanisms of cell type specificity of eQTLs is required. We address this need by performing an eQTL analysis in three parts: first we identified eQTLs from eleven studies on seven cell types; then we integrated eQTL data with cis-regulatory element (CRE) data from the ENCODE project; finally we built a set of classifiers to predict the cell type specificity of eQTLs. The cell type specificity of eQTLs is associated with eQTL SNP overlap with hundreds of cell type specific CRE classes, including enhancer, promoter, and repressive chromatin marks, regions of open chromatin, and many classes of DNA binding proteins. These associations provide insight into the molecular mechanisms generating the cell type specificity of eQTLs and the mode of regulation of corresponding eQTLs. Using a random forest classifier with cell specific CRE-SNP overlap as features, we demonstrate the feasibility of predicting the cell type specificity of eQTLs. We then demonstrate that CREs from a trait-associated cell type can be used to annotate GWAS associations in the absence of eQTL data for that cell type. We anticipate that such integrative, predictive modeling of cell specificity will improve our ability to understand the mechanistic basis of human complex phenotypic

  17. 75 FR 61531 - Issuance of Regulatory Guide

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-05

    ... E. Norris, Component Integrity Branch, Division of Engineering, Office of Nuclear Regulatory... acceptable alternatives to requirements in the American Society of Mechanical Engineers (ASME) Boiler and.... Harriet Karagiannis, Acting Chief, Regulatory Guide Development Branch, Division of Engineering, Office...

  18. Effect of addition of plants-derived polyamide 11 elastomer on the mechanical and tribological properties of hemp fiber reinforced polyamide 1010 composites

    NASA Astrophysics Data System (ADS)

    Mukaida, Jun; Nishitani, Yosuke; Kitano, Takeshi

    2015-05-01

    For the purpose of developing the new engineering materials such as structural materials and tribomaterials based on all plants-derived materials, the effect of the addition of plant-derived polyamide 11 Elastomer (PA11E) on the mechanical and tribological properties of hemp fiber(HF) reinforced polyamide 1010 (HF/PA1010) composites was investigated. PA1010 and PA11E (except the polyether groups used as soft segment) were made from plant-derived castor oil. Hemp fiber was surface-treated by two types of treatment: alkali treatment by NaOH solution and surface treatment by ureido silane coupling agent. HF/PA1010/PA11E ternary composites were extruded by a twin screw extruder and injection-molded. Their mechanical properties such as tensile, bending, Izod impact and tribological properties by ring-on-plate type sliding wear testing were evaluated. The effect of the addition of PA11E on the mechanical and tribological properties of HF/PA1010 composite differed for each property. Izod impact strength and specific wear rate improved with the addition of PA11E although tensile strength, modulus, and friction coefficient decreased with PA11E. It follows from these results that it may be possible to develop the new engineering materials with sufficient balance between mechanical and tribological properties.

  19. Effects of the addition of casein phosphopeptide-amorphous calcium phosphate (CPP-ACP) on mechanical properties of luting and lining glass ionomer cement

    NASA Astrophysics Data System (ADS)

    Heravi, Farzin; Bagheri, Hossein; Rangrazi, Abdolrasoul; Mojtaba Zebarjad, Seyed

    2016-07-01

    Recently, the addition of casein phosphopeptide-amorphous calcium phosphate (CPP-ACP) into glass ionomer cements (GICs) has attracted interest due to its remineralization of teeth and its antibacterial effects. However, it should be investigated to ensure that the incorporation of CPP-ACP does not have significant adverse effects on its mechanical properties. The purpose of this study was to evaluate the effects of the addition of CPP-ACP on the mechanical properties of luting and lining GIC. The first step was to synthesize the CPP-ACP. Then the CPP-ACP at concentrations of 1%, 1.56% and 2% of CPP-ACP was added into a luting and lining GIC. GIC without CPP-ACP was used as a control group. The results revealed that the incorporation of CPP-ACP up to 1.56%(w/w) increased the flexural strength (29%), diametral tensile strength (36%) and microhardness (18%), followed by a reduction in these mechanical properties at 2%(w/w) CPP-ACP. The wear rate was significantly decreased (23%) in 1.56%(w/w) concentration of CPP-ACP and it was increased in 2%(w/w). Accordingly, the addition of 1.56%(w/w) CPP-ACP into luting and lining GIC had no adverse effect on the mechanical properties of luting and lining GIC and could be used in clinical practice.

  20. Effect of Zr, Nb and Ti addition on injection molded 316L stainless steel for bio-applications: Mechanical, electrochemical and biocompatibility properties.

    PubMed

    Gulsoy, H Ozkan; Pazarlioglu, Serdar; Gulsoy, Nagihan; Gundede, Busra; Mutlu, Ozal

    2015-11-01

    The research investigated the effect of Zr, Nb and Ti additions on mechanical, electrochemical properties and biocompatibility of injection molded 316L stainless steel. Addition of elemental powder is promoted to get high performance of sintered 316L stainless steels. The amount of additive powder plays a role in determining the sintered microstructure and all properties. In this study, 316L stainless steel powders used with the elemental Zr, Nb and Ti powders. A feedstock containing 62.5 wt% powders loading was molded at different injection molded temperature. The binders were completely removed from molded components by solvent and thermal debinding at different temperatures. The debinded samples were sintered at 1350°C for 60 min. Mechanical, electrochemical property and biocompatibility of the sintered samples were performed mechanical, electrochemical, SBF immersion tests and cell culture experiments. Results of study showed that sintered 316L and 316L with additives samples exhibited high corrosion properties and biocompatibility in a physiological environment. PMID:26275484

  1. Invasiveness as a putative additional virulence mechanism of some atypical Enteropathogenic Escherichia coli strains with different uncommon intimin types

    PubMed Central

    2009-01-01

    Background Enteropathogenic Escherichia coli (EPEC) produce attaching/effacing (A/E) lesions on eukaryotic cells mediated by the outer membrane adhesin intimin. EPEC are sub-grouped into typical (tEPEC) and atypical (aEPEC). We have recently demonstrated that aEPEC strain 1551-2 (serotype O non-typable, non-motile) invades HeLa cells by a process dependent on the expression of intimin sub-type omicron. In this study, we evaluated whether aEPEC strains expressing other intimin sub-types are also invasive using the quantitative gentamicin protection assay. We also evaluated whether aEPEC invade differentiated intestinal T84 cells. Results Five of six strains invaded HeLa and T84 cells in a range of 13.3%–20.9% and 5.8%–17.8%, respectively, of the total cell-associated bacteria. The strains studied were significantly more invasive than prototype tEPEC strain E2348/69 (1.4% and 0.5% in HeLa and T84 cells, respectively). Invasiveness was confirmed by transmission electron microscopy. We also showed that invasion of HeLa cells by aEPEC 1551-2 depended on actin filaments, but not on microtubules. In addition, disruption of tight junctions enhanced its invasion efficiency in T84 cells, suggesting preferential invasion via a non-differentiated surface. Conclusion Some aEPEC strains may invade intestinal cells in vitro with varying efficiencies and independently of the intimin sub-type. PMID:19622141

  2. The heat dissipation model and desensitizing mechanism of the HMX/additive interfaces: a theoretical investigation based on linear response theory

    NASA Astrophysics Data System (ADS)

    Long, Yao; Chen, Jun

    2013-07-01

    Octahydro-1,3,5,7-tetranitro-1,3,5,7-tetrazocine (HMX) is a high-energy explosive with high sensitivity. The heat dissipation of the HMX/additive interface is a key issue in understanding the hot spot formation and desensitizing mechanism of mixture explosive. In this work, we derive new formulae to calculate the heat dissipation rate for a set of HMX/additive interfaces, and build a physical model to describe the energy dissipation time and distance in mixture explosive. Four kinds of additives are considered: 1,3,5-triamino-2,4,6-trinitrobenzene, graphite, paraffin and fluoropolymers. At low strength loading, we prove that the heat dissipation rate is proportional to the square of frequency, and suggest a way to decrease the sensitivity of the explosive. At medium strength loading, the viscosity coefficient and friction coefficient of interface are calculated. The desensitizing abilities of additives to HMX are discussed systematically.

  3. Genome-wide analysis of the H-NS and Sfh regulatory networks in Salmonella Typhimurium identifies a plasmid-encoded transcription silencing mechanism.

    PubMed

    Dillon, Shane C; Cameron, Andrew D S; Hokamp, Karsten; Lucchini, Sacha; Hinton, Jay C D; Dorman, Charles J

    2010-06-01

    The conjugative IncHI1 plasmid pSfR27 from Shigella flexneri 2a strain 2457T encodes the Sfh protein, a paralogue of the global transcriptional repressor H-NS. Sfh allows pSfR27 to be transmitted to new bacterial hosts with minimal impact on host fitness, providing a 'stealth' function whose molecular mechanism has yet to be determined. The impact of the Sfh protein on the Salmonella enterica serovar Typhimurium transcriptome was assessed and binding sites for Sfh in the Salmonella Typhimurium genome were identified by chromatin immunoprecipitation. Sfh did not bind uniquely to any sites. Instead, it bound to a subset of the larger H-NS regulatory network. Analysis of Sfh binding in the absence of H-NS revealed a greatly expanded population of Sfh binding sites that included the majority of H-NS target genes. Furthermore, the presence of plasmid pSfR27 caused a decrease in H-NS interactions with the S. Typhimurium chromosome, suggesting that the A + T-rich DNA of this large plasmid acts to titrate H-NS, removing it from chromosomal locations. It is proposed that Sfh acts as a molecular backup for H-NS and that it provides its 'stealth' function by replacing H-NS on the chromosome, thus minimizing disturbances to the H-NS-DNA binding pattern in cells that acquire pSfR27.

  4. Dissection of the regulatory mechanism of a heat-shock responsive promoter in Haloarchaea: a new paradigm for general transcription factor directed archaeal gene regulation

    PubMed Central

    Lu, Qiuhe; Han, Jing; Zhou, Ligang; Coker, James A.; DasSarma, Priya; DasSarma, Shiladitya; Xiang, Hua

    2008-01-01

    Multiple general transcription factors (GTFs), TBP and TFB, are present in many haloarchaea, and are deemed to accomplish global gene regulation. However, details and the role of GTF-directed transcriptional regulation in stress response are still not clear. Here, we report a comprehensive investigation of the regulatory mechanism of a heat-induced gene (hsp5) from Halobacterium salinarum. We demonstrated by mutation analysis that the sequences 5′ and 3′ to the core elements (TATA box and BRE) of the hsp5 promoter (Phsp5) did not significantly affect the basal and heat-induced gene expression, as long as the transcription initiation site was not altered. Moreover, the BRE and TATA box of Phsp5 were sufficient to render a nonheat-responsive promoter heat-inducible, in both Haloferax volcanii and Halobacterium sp. NRC-1. DNA–protein interactions revealed that two heat-inducible GTFs, TFB2 from H. volcanii and TFBb from Halobacterium sp. NRC-1, could specifically bind to Phsp5 likely in a temperature-dependent manner. Taken together, the heat-responsiveness of Phsp5 was mainly ascribed to the core promoter elements that were efficiently recognized by specific heat-induced GTFs at elevated temperature, thus providing a new paradigm for GTF-directed gene regulation in the domain of Archaea. PMID:18390887

  5. Stable Suppression of Lactate Dehydrogenase Activity during Anoxia in the Foot Muscle of Littorina littorea and the Potential Role of Acetylation as a Novel Posttranslational Regulatory Mechanism.

    PubMed

    Shahriari, Ali; Dawson, Neal J; Bell, Ryan A V; Storey, Kenneth B

    2013-01-01

    The intertidal marine snail, Littorina littorea, has evolved to withstand extended bouts of oxygen deprivation brought about by changing tides or other potentially harmful environmental conditions. Survival is dependent on a strong suppression of its metabolic rate and a drastic reorganization of its cellular biochemistry in order to maintain energy balance under fixed fuel reserves. Lactate dehydrogenase (LDH) is a crucial enzyme of anaerobic metabolism as it is typically responsible for the regeneration of NAD(+), which allows for the continued functioning of glycolysis in the absence of oxygen. This study compared the kinetic and structural characteristics of the D-lactate specific LDH (E.C. 1.1.1.28) from foot muscle of aerobic control versus 24 h anoxia-exposed L. littorea. Anoxic LDH displayed a near 50% decrease in V max (pyruvate-reducing direction) as compared to control LDH. These kinetic differences suggest that there may be a stable modification and regulation of LDH during anoxia, and indeed, subsequent dot-blot analyses identified anoxic LDH as being significantly less acetylated than the corresponding control enzyme. Therefore, acetylation may be the regulatory mechanism that is responsible for the suppression of LDH activity during anoxia, which could allow for the production of alternative glycolytic end products that in turn would increase the ATP yield under fixed fuel reserves. PMID:24233354

  6. Stable Suppression of Lactate Dehydrogenase Activity during Anoxia in the Foot Muscle of Littorina littorea and the Potential Role of Acetylation as a Novel Posttranslational Regulatory Mechanism

    PubMed Central

    Shahriari, Ali; Dawson, Neal J.; Bell, Ryan A. V.; Storey, Kenneth B.

    2013-01-01

    The intertidal marine snail, Littorina littorea, has evolved to withstand extended bouts of oxygen deprivation brought about by changing tides or other potentially harmful environmental conditions. Survival is dependent on a strong suppression of its metabolic rate and a drastic reorganization of its cellular biochemistry in order to maintain energy balance under fixed fuel reserves. Lactate dehydrogenase (LDH) is a crucial enzyme of anaerobic metabolism as it is typically responsible for the regeneration of NAD+, which allows for the continued functioning of glycolysis in the absence of oxygen. This study compared the kinetic and structural characteristics of the D-lactate specific LDH (E.C. 1.1.1.28) from foot muscle of aerobic control versus 24 h anoxia-exposed L. littorea. Anoxic LDH displayed a near 50% decrease in Vmax (pyruvate-reducing direction) as compared to control LDH. These kinetic differences suggest that there may be a stable modification and regulation of LDH during anoxia, and indeed, subsequent dot-blot analyses identified anoxic LDH as being significantly less acetylated than the corresponding control enzyme. Therefore, acetylation may be the regulatory mechanism that is responsible for the suppression of LDH activity during anoxia, which could allow for the production of alternative glycolytic end products that in turn would increase the ATP yield under fixed fuel reserves. PMID:24233354

  7. Mechanisms of formation of hardening precipitates and hardening in aging of Al-Li-Cu-Mg model alloys with silver additions

    NASA Astrophysics Data System (ADS)

    Alekseev, A. A.; Zhuravleva, P. L.; Onuchina, M. R.; Klochkova, Yu. Yu.

    2015-11-01

    The mechanisms of the influence of silver additions on the phase transformations that occur in aging are revealed. The contribution of Ω'-phase particles to the deformation stress in Al alloys is estimated. The mechanisms of the effect of low (up to 0.5 wt %) silver additions and the copper content on the structure of the Ω'-phase precipitates in Al alloys are found. According to the proposed model, silver atoms remain immobile during the decomposition of a solid solution and nucleation centers of the Ω' phase form near them in low-temperature aging. Upon hardening aging, fragmented Ω'-phase particles intersect with each other, and the contribution of the intersection regions to the hardening of alloys by Ω'-phase particles is principal.

  8. Microstructure Evolution and Mechanical Properties of Long Period Stacking Ordered Mg96Gd3Ni1 Alloy with Al and Sr Additions

    NASA Astrophysics Data System (ADS)

    Wang, Dandan; Zhang, Jinshan; Zhang, Wenbo; Nie, Kaibo; Niu, Xiaofeng; You, Zhiyong; Xu, Chunxiang; Wang, Hongxia

    2015-06-01

    The effects of 0.3 at. pct Al and x at. pct Sr ( x = 0.0, 0.1, 0.2, 0.3) on the microstructure and mechanical properties of as-cast Mg96Gd3Ni1 alloy were investigated. With addition of 0.3 at. pct Al, new quaternary Mg-Gd-Ni-Al phases with peculiar rod-like and petal-like morphologies are uniformly distributed in the alloy. The angles between petals of the petal-like phase are all about 60 deg. The microstructure of the alloy is refined, leading to fine grain strengthening. The volume fraction of the long-period stacking ordered phase which is excellent reinforcement phase of Mg alloys increases significantly. Moreover, combined addition of 0.3 at. pct Al and 0.1 at. pct Sr refines the microstructure further and enhances the mechanical properties of the alloy simultaneously.

  9. Effect of SrO additions on the grain-boundary microstructure and mechanical properties of magnesia-partially-stabilized zirconia

    SciTech Connect

    Drennan, J.; Hannik, R.H.J.

    1986-07-01

    Improvements in the mechanical properties of magnesia-partially-stabilized zirconia are obtained by the addition of SrO. Evidence is presented which indicates that the added SrO effectively neutralizes the detrimental effect of SiO/sub 2/ contaminant by forming a glass phase which is effected from the bulk of the ceramic during sintering. this combined effect results in the retardation of the subeutectoid decomposition reaction while minimizing retention of glass phases at the grain boundaries.

  10. Identification of novel estrogen receptor (ER) agonists that have additional and complementary anti-cancer activities via ER-independent mechanism.

    PubMed

    Kim, Taelim; Kim, Hye-In; An, Ji-Young; Lee, Jun; Lee, Na-Rae; Heo, Jinyuk; Kim, Ji-Eun; Yu, Jihyun; Lee, Yong Sup; Inn, Kyung-Soo; Kim, Nam-Jung

    2016-04-01

    In this study, a series of bis(4-hydroxy)benzophenone oxime ether derivatives such as 12c, 12e and 12h were identified as novel estrogen receptor (ER) agonists that have additional and complementary anti-proliferative activities via ER-independent mechanism in cancer cells. These compounds are expected to overcome the therapeutic limitation of existing ER agonists such as estradiol and tamoxifen, which have been known to induce the proliferation of cancer cells. PMID:26905830

  11. Preparation and characterization of new dental porcelains, using K-feldspar and quartz raw materials. Effect of B2O3 additions on sintering and mechanical properties.

    PubMed

    Harabi, Abdelhamid; Guerfa, Fatiha; Harabi, Esma; Benhassine, Mohamed-Tayeb; Foughali, Lazhar; Zaiou, Soumia

    2016-08-01

    The aim of this work was to determine the effect of temperature and boric oxide (B2O3) addition on sintering and mechanical properties of a newly developed dental porcelain (DP) prepared from local Algerian raw materials. Based on a preliminary work, the new selected composition was 75wt.% feldspar, 20wt.% quartz and 5wt.% kaolin. It was prepared by sintering the mixture at different temperatures (1100-1250°C). The optimum sintering conditions gave a relatively higher density (2.47g/cm(3)) and excellent mechanical properties. The three point flexural strength (3PFS) and Martens micro-hardness of dental porcelains were 149MPa and 2600MPa, respectively. This obtained 3PFS value is more than four times greater than that of hydroxyapatite (HA) value (about 37MPa) sintered under the same conditions. However, the sintering temperature was lowered by about 25 and 50°C for 3 and 5wt.% B2O3 additions, respectively. But, it did not improve furthermore the samples density and their mechanical properties. It has also been found that B2O3 additions provoke a glass matrix composition variation which delays the leucite formation during sintering. PMID:27157725

  12. Numerical investigation of the mechanical properties of the additive manufactured bone scaffolds fabricated by FDM: The effect of layer penetration and post-heating.

    PubMed

    Naghieh, S; Karamooz Ravari, M R; Badrossamay, M; Foroozmehr, E; Kadkhodaei, M

    2016-06-01

    In recent years, thanks to additive manufacturing technology, researchers have gone towards the optimization of bone scaffolds for the bone reconstruction. Bone scaffolds should have appropriate biological as well as mechanical properties in order to play a decisive role in bone healing. Since the fabrication of scaffolds is time consuming and expensive, numerical methods are often utilized to simulate their mechanical properties in order to find a nearly optimum one. Finite element analysis is one of the most common numerical methods that is used in this regard. In this paper, a parametric finite element model is developed to assess the effects of layers penetration׳s effect on inter-layer adhesion, which is reflected on the mechanical properties of bone scaffolds. To be able to validate this model, some compression test specimens as well as bone scaffolds are fabricated with biocompatible and biodegradable poly lactic acid using fused deposition modeling. All these specimens are tested in compression and their elastic modulus is obtained. Using the material parameters of the compression test specimens, the finite element analysis of the bone scaffold is performed. The obtained elastic modulus is compared with experiment indicating a good agreement. Accordingly, the proposed finite element model is able to predict the mechanical behavior of fabricated bone scaffolds accurately. In addition, the effect of post-heating of bone scaffolds on their elastic modulus is investigated. The results demonstrate that the numerically predicted elastic modulus of scaffold is closer to experimental outcomes in comparison with as-built samples.

  13. Numerical investigation of the mechanical properties of the additive manufactured bone scaffolds fabricated by FDM: The effect of layer penetration and post-heating.

    PubMed

    Naghieh, S; Karamooz Ravari, M R; Badrossamay, M; Foroozmehr, E; Kadkhodaei, M

    2016-06-01

    In recent years, thanks to additive manufacturing technology, researchers have gone towards the optimization of bone scaffolds for the bone reconstruction. Bone scaffolds should have appropriate biological as well as mechanical properties in order to play a decisive role in bone healing. Since the fabrication of scaffolds is time consuming and expensive, numerical methods are often utilized to simulate their mechanical properties in order to find a nearly optimum one. Finite element analysis is one of the most common numerical methods that is used in this regard. In this paper, a parametric finite element model is developed to assess the effects of layers penetration׳s effect on inter-layer adhesion, which is reflected on the mechanical properties of bone scaffolds. To be able to validate this model, some compression test specimens as well as bone scaffolds are fabricated with biocompatible and biodegradable poly lactic acid using fused deposition modeling. All these specimens are tested in compression and their elastic modulus is obtained. Using the material parameters of the compression test specimens, the finite element analysis of the bone scaffold is performed. The obtained elastic modulus is compared with experiment indicating a good agreement. Accordingly, the proposed finite element model is able to predict the mechanical behavior of fabricated bone scaffolds accurately. In addition, the effect of post-heating of bone scaffolds on their elastic modulus is investigated. The results demonstrate that the numerically predicted elastic modulus of scaffold is closer to experimental outcomes in comparison with as-built samples. PMID:26874065

  14. Viral complement regulatory proteins.

    PubMed

    Rosengard, A M; Ahearn, J M

    1999-05-01

    The inactivation of complement provides cells and tissues critical protection from complement-mediated attack and decreases the associated recruitment of other inflammatory mediators. In an attempt to evade the host immune response, viruses have evolved two mechanisms to acquire complement regulatory proteins. They can directly seize the host cell complement regulators onto their outer envelope and/or they can produce their own proteins which are either secreted into the neighboring intercellular space or expressed as membrane-bound proteins on the infected host cell. The following review will concentrate on the viral homologues of the mammalian complement regulatory proteins, specifically those containing complement control protein (CCP) repeats. PMID:10408371

  15. Effects of Sodium Butyrate Treatment on Histone Modifications and the Expression of Genes Related to Epigenetic Regulatory Mechanisms and Immune Response in European Sea Bass (Dicentrarchus Labrax) Fed a Plant-Based Diet.

    PubMed

    Terova, Genciana; Díaz, Noelia; Rimoldi, Simona; Ceccotti, Chiara; Gliozheni, Emi; Piferrer, Francesc

    2016-01-01

    Bacteria that inhabit the epithelium of the animals' digestive tract provide the essential biochemical pathways for fermenting otherwise indigestible dietary fibers, leading to the production of short-chain fatty acids (SCFAs). Of the major SCFAs, butyrate has received particular attention due to its numerous positive effects on the health of the intestinal tract and peripheral tissues. The mechanisms of action of this four-carbon chain organic acid are different; many of these are related to its potent regulatory effect on gene expression since butyrate is a histone deacetylase inhibitor that play a predominant role in the epigenetic regulation of gene expression and cell function. In the present work, we investigated in the European sea bass (Dicentrarchus labrax) the effects of butyrate used as a feed additive on fish epigenetics as well as its regulatory role in mucosal protection and immune homeostasis through impact on gene expression. Seven target genes related to inflammatory response and reinforcement of the epithelial defense barrier [tnfα (tumor necrosis factor alpha) il1β, (interleukin 1beta), il-6, il-8, il-10, and muc2 (mucin 2)] and five target genes related to epigenetic modifications [dicer1(double-stranded RNA-specific endoribonuclease), ehmt2 (euchromatic histone-lysine-N-methyltransferase 2), pcgf2 (polycomb group ring finger 2), hdac11 (histone deacetylase-11), and jarid2a (jumonji)] were analyzed in fish intestine and liver. We also investigated the effect of dietary butyrate supplementation on histone acetylation, by performing an immunoblotting analysis on liver core histone extracts. Results of the eight-week-long feeding trial showed no significant differences in weight gain or SGR (specific growth rate) of sea bass that received 0.2% sodium butyrate supplementation in the diet in comparison to control fish that received a diet without Na-butyrate. Dietary butyrate led to a twofold increase in the acetylation level of histone H4 at

  16. Effects of Sodium Butyrate Treatment on Histone Modifications and the Expression of Genes Related to Epigenetic Regulatory Mechanisms and Immune Response in European Sea Bass (Dicentrarchus Labrax) Fed a Plant-Based Diet.

    PubMed

    Terova, Genciana; Díaz, Noelia; Rimoldi, Simona; Ceccotti, Chiara; Gliozheni, Emi; Piferrer, Francesc

    2016-01-01

    Bacteria that inhabit the epithelium of the animals' digestive tract provide the essential biochemical pathways for fermenting otherwise indigestible dietary fibers, leading to the production of short-chain fatty acids (SCFAs). Of the major SCFAs, butyrate has received particular attention due to its numerous positive effects on the health of the intestinal tract and peripheral tissues. The mechanisms of action of this four-carbon chain organic acid are different; many of these are related to its potent regulatory effect on gene expression since butyrate is a histone deacetylase inhibitor that play a predominant role in the epigenetic regulation of gene expression and cell function. In the present work, we investigated in the European sea bass (Dicentrarchus labrax) the effects of butyrate used as a feed additive on fish epigenetics as well as its regulatory role in mucosal protection and immune homeostasis through impact on gene expression. Seven target genes related to inflammatory response and reinforcement of the epithelial defense barrier [tnfα (tumor necrosis factor alpha) il1β, (interleukin 1beta), il-6, il-8, il-10, and muc2 (mucin 2)] and five target genes related to epigenetic modifications [dicer1(double-stranded RNA-specific endoribonuclease), ehmt2 (euchromatic histone-lysine-N-methyltransferase 2), pcgf2 (polycomb group ring finger 2), hdac11 (histone deacetylase-11), and jarid2a (jumonji)] were analyzed in fish intestine and liver. We also investigated the effect of dietary butyrate supplementation on histone acetylation, by performing an immunoblotting analysis on liver core histone extracts. Results of the eight-week-long feeding trial showed no significant differences in weight gain or SGR (specific growth rate) of sea bass that received 0.2% sodium butyrate supplementation in the diet in comparison to control fish that received a diet without Na-butyrate. Dietary butyrate led to a twofold increase in the acetylation level of histone H4 at

  17. Effects of Sodium Butyrate Treatment on Histone Modifications and the Expression of Genes Related to Epigenetic Regulatory Mechanisms and Immune Response in European Sea Bass (Dicentrarchus Labrax) Fed a Plant-Based Diet

    PubMed Central

    Díaz, Noelia; Rimoldi, Simona; Ceccotti, Chiara; Gliozheni, Emi; Piferrer, Francesc

    2016-01-01

    Bacteria that inhabit the epithelium of the animals’ digestive tract provide the essential biochemical pathways for fermenting otherwise indigestible dietary fibers, leading to the production of short-chain fatty acids (SCFAs). Of the major SCFAs, butyrate has received particular attention due to its numerous positive effects on the health of the intestinal tract and peripheral tissues. The mechanisms of action of this four-carbon chain organic acid are different; many of these are related to its potent regulatory effect on gene expression since butyrate is a histone deacetylase inhibitor that play a predominant role in the epigenetic regulation of gene expression and cell function. In the present work, we investigated in the European sea bass (Dicentrarchus labrax) the effects of butyrate used as a feed additive on fish epigenetics as well as its regulatory role in mucosal protection and immune homeostasis through impact on gene expression. Seven target genes related to inflammatory response and reinforcement of the epithelial defense barrier [tnfα (tumor necrosis factor alpha) il1β, (interleukin 1beta), il-6, il-8, il-10, and muc2 (mucin 2)] and five target genes related to epigenetic modifications [dicer1(double-stranded RNA-specific endoribonuclease), ehmt2 (euchromatic histone-lysine-N-methyltransferase 2), pcgf2 (polycomb group ring finger 2), hdac11 (histone deacetylase-11), and jarid2a (jumonji)] were analyzed in fish intestine and liver. We also investigated the effect of dietary butyrate supplementation on histone acetylation, by performing an immunoblotting analysis on liver core histone extracts. Results of the eight-week-long feeding trial showed no significant differences in weight gain or SGR (specific growth rate) of sea bass that received 0.2% sodium butyrate supplementation in the diet in comparison to control fish that received a diet without Na-butyrate. Dietary butyrate led to a twofold increase in the acetylation level of histone H4 at

  18. Effects of Cu, Fe and Co addition on the glass-forming ability and mechanical properties of Zr-Al-Ni bulk metallic glasses

    NASA Astrophysics Data System (ADS)

    Li, YanHui; Zhang, Wei; Dong, Chuang; Makino, Akihiro

    2012-12-01

    The thermal stability, glass-forming ability (GFA) and mechanical properties of Zr60Al15Ni25- x TM x (TM = Cu, Fe and Co, x = 0-10) bulk metallic glasses (BMGs) were systematically investigated. Additional 5-10 at.% Cu greatly enhances the thermal stability and GFA of the base alloy. Zr60Al15Ni15Cu10 BMG exhibits the largest supercooled liquid region of 104 K and critical diameter of 18 mm. However, addition of 5-10 at.% Fe or Co decrease the thermal stability and GFA. In addition, the plasticity of the BMG can be improved by adding of Cu, while the strength is decreased slightly. Zr60Al15Ni20Cu5 BMG has the largest plastic strain of 5.5% with a yield stress of 1755 MPa and Young's modulus of 83 GPa. Addition of Co brings an increase of strength but a lower of plasticity, and additional Fe reduces the strength and plasticity simultaneously.

  19. Investigating the addition of SiO₂-CaO-ZnO-Na₂O-TiO₂ bioactive glass to hydroxyapatite: Characterization, mechanical properties and bioactivity.

    PubMed

    Yatongchai, Chokchai; Placek, Lana M; Curran, Declan J; Towler, Mark R; Wren, Anthony W

    2015-11-01

    Hydroxyapatite (Ca10(PO4)6(OH)2) is widely investigated as an implantable material for hard tissue restoration due to its osteoconductive properties. However, hydroxyapatite in bulk form is limited as its mechanical properties are insufficient for load-bearing orthopedic applications. Attempts have been made to improve the mechanical properties of hydroxyapatite, by incorporating ceramic fillers, but the resultant composite materials require high sintering temperatures to facilitate densification, leading to the decomposition of hydroxyapatite into tricalcium phosphate, tetra-calcium phosphate and CaO phases. One method of improving the properties of hydroxyapatite is to incorporate bioactive glass particles as a second phase. These typically have lower softening points which could possibly facilitate sintering at lower temperatures. In this work, a bioactive glass (SiO2-CaO-ZnO-Na2O-TiO2) is incorporated (10, 20 and 30 wt%) into hydroxyapatite as a reinforcing phase. X-ray diffraction confirmed that no additional phases (other than hydroxyapatite) were formed at a sintering temperature of 560 ℃ with up to 30 wt% glass addition. The addition of the glass phase increased the % crystallinity and the relative density of the composites. The biaxial flexural strength increased to 36 MPa with glass addition, and there was no significant change in hardness as a function of maturation. The pH of the incubation media increased to pH 10 or 11 through glass addition, and ion release profiles determined that Si, Na and P were released from the composites. Calcium phosphate precipitation was encouraged in simulated body fluid with the incorporation of the bioactive glass phase, and cell culture testing in MC-3T3 osteoblasts determined that the composite materials did not significantly reduce cell viability.

  20. Investigating the addition of SiO₂-CaO-ZnO-Na₂O-TiO₂ bioactive glass to hydroxyapatite: Characterization, mechanical properties and bioactivity.

    PubMed

    Yatongchai, Chokchai; Placek, Lana M; Curran, Declan J; Towler, Mark R; Wren, Anthony W

    2015-11-01

    Hydroxyapatite (Ca10(PO4)6(OH)2) is widely investigated as an implantable material for hard tissue restoration due to its osteoconductive properties. However, hydroxyapatite in bulk form is limited as its mechanical properties are insufficient for load-bearing orthopedic applications. Attempts have been made to improve the mechanical properties of hydroxyapatite, by incorporating ceramic fillers, but the resultant composite materials require high sintering temperatures to facilitate densification, leading to the decomposition of hydroxyapatite into tricalcium phosphate, tetra-calcium phosphate and CaO phases. One method of improving the properties of hydroxyapatite is to incorporate bioactive glass particles as a second phase. These typically have lower softening points which could possibly facilitate sintering at lower temperatures. In this work, a bioactive glass (SiO2-CaO-ZnO-Na2O-TiO2) is incorporated (10, 20 and 30 wt%) into hydroxyapatite as a reinforcing phase. X-ray diffraction confirmed that no additional phases (other than hydroxyapatite) were formed at a sintering temperature of 560 ℃ with up to 30 wt% glass addition. The addition of the glass phase increased the % crystallinity and the relative density of the composites. The biaxial flexural strength increased to 36 MPa with glass addition, and there was no significant change in hardness as a function of maturation. The pH of the incubation media increased to pH 10 or 11 through glass addition, and ion release profiles determined that Si, Na and P were released from the composites. Calcium phosphate precipitation was encouraged in simulated body fluid with the incorporation of the bioactive glass phase, and cell culture testing in MC-3T3 osteoblasts determined that the composite materials did not significantly reduce cell viability. PMID:26116020

  1. Influence of type and level of water-soluble additives on drug release and surface and mechanical properties of Surelease films.

    PubMed

    Rohera, Bhagwan D; Parikh, Nilesh H

    2002-11-01

    Ethylcellulose in combination with water-soluble additives has been used in the development of microporous membrane-coated dosage forms. In the present study, application of three types of water-soluble additives, namely polyethylene glycols (PEG 400, 3350, and 8000), maltodextrins (Maltrin M150, M100, and M040 in the order of lower to higher average polymer size and molecular weight; dextrose equivalence 16.9, 11.1, and 4.8, respectively), and xylitol, as porosity modifiers in the films of a commercially available aqueous ethylcellulose dispersion (Surelease/E-7-7060 plasticized with glyceryl tricaprylate/caprate) was investigated. The effect of type and level of these additives on drug release characteristics and surface and mechanical properties of the polymeric films was studied. Each additive was incorporated at 20 and 30% levels in the polymeric dispersion based on its solids content. Ibuprofen tablets were coated using the polymeric dispersion with and without additive at 3% w/w coat level in a fluid-bed equipment. The coated tablets were evaluated for their drug release rate, coat reflectivity (gloss), Brinell hardness, and elastic modulus. Differential scanning calorimetric analysis of the films was performed to determine the physico-chemical changes in the applied film-coats. The rate of drug release, hence film porosity, was observed to be dependent on the type and level of the additive added. The molecular weight of the additive and its concentration in the polymeric dispersion had significant influence on the rate of drug release, hardness, and elasticity of the film-coats.

  2. Study on the regulatory mechanism of the lipid metabolism pathways during chicken male germ cell differentiation based on RNA-seq.

    PubMed

    Zuo, Qisheng; Li, Dong; Zhang, Lei; Elsayed, Ahmed Kamel; Lian, Chao; Shi, Qingqing; Zhang, Zhentao; Zhu, Rui; Wang, Yinjie; Jin, Kai; Zhang, Yani; Li, Bichun

    2015-01-01

    Here, we explore the regulatory mechanism of lipid metabolic signaling pathways and related genes during differentiation of male germ cells in chickens, with the hope that better understanding of these pathways may improve in vitro induction. Fluorescence-activated cell sorting was used to obtain highly purified cultures of embryonic stem cells (ESCs), primitive germ cells (PGCs), and spermatogonial stem cells (SSCs). The total RNA was then extracted from each type of cell. High-throughput analysis methods (RNA-seq) were used to sequence the transcriptome of these cells. Gene Ontology (GO) analysis and the KEGG database were used to identify lipid metabolism pathways and related genes. Retinoic acid (RA), the end-product of the retinol metabolism pathway, induced in vitro differentiation of ESC into male germ cells. Quantitative real-time PCR (qRT-PCR) was used to detect changes in the expression of the genes involved in the retinol metabolic pathways. From the results of RNA-seq and the database analyses, we concluded that there are 328 genes in 27 lipid metabolic pathways continuously involved in lipid metabolism during the differentiation of ESC into SSC in vivo, including retinol metabolism. Alcohol dehydrogenase 5 (ADH5) and aldehyde dehydrogenase 1 family member A1 (ALDH1A1) are involved in RA synthesis in the cell. ADH5 was specifically expressed in PGC in our experiments and aldehyde dehydrogenase 1 family member A1 (ALDH1A1) persistently increased throughout development. CYP26b1, a member of the cytochrome P450 superfamily, is involved in the degradation of RA. Expression of CYP26b1, in contrast, decreased throughout development. Exogenous RA in the culture medium induced differentiation of ESC to SSC-like cells. The expression patterns of ADH5, ALDH1A1, and CYP26b1 were consistent with RNA-seq results. We conclude that the retinol metabolism pathway plays an important role in the process of chicken male germ cell differentiation.

  3. Analysis of tomato plasma membrane H(+)-ATPase gene family suggests a mycorrhiza-mediated regulatory mechanism conserved in diverse plant species.

    PubMed

    Liu, Junli; Liu, Jianjian; Chen, Aiqun; Ji, Minjie; Chen, Jiadong; Yang, Xiaofeng; Gu, Mian; Qu, Hongye; Xu, Guohua

    2016-10-01

    In plants, the plasma membrane H(+)-ATPase (HA) is considered to play a crucial role in regulating plant growth and respoding to environment stresses. Multiple paralogous genes encoding different isozymes of HA have been identified and characterized in several model plants, while limited information of the HA gene family is available to date for tomato. Here, we describe the molecular and expression features of eight HA-encoding genes (SlHA1-8) from tomato. All these genes are interrupted by multiple introns with conserved positions. SlHA1, 2, and 4 were widely expressed in all tissues, while SlHA5, 6, and 7 were almost only expressed in flowers. SlHA8, the transcripts of which were barely detectable under normal or nutrient-/salt-stress growth conditions, was strongly activated in arbuscular mycorrhizal (AM) fungal-colonized roots. Extreme lack of SlHA8 expression in M161, a mutant defective to AM fungal colonization, provided genetic evidence towards the dependence of its expression on AM symbiosis. A 1521-bp SlHA8 promoter could direct the GUS reporter expression specifically in colonized cells of transgenic tobacco, soybean, and rice mycorrhizal roots. Promoter deletion assay revealed a 223-bp promoter fragment of SlHA8 containing a variant of AM-specific cis-element MYCS (vMYCS) sufficient to confer the AM-induced activity. Targeted deletion of this motif in the corresponding promoter region causes complete abolishment of GUS staining in mycorrhizal roots. Together, these results lend cogent evidence towards the evolutionary conservation of a potential regulatory mechanism mediating the activation of AM-responsive HA genes in diverse mycorrhizal plant species.

  4. Rab27a negatively regulates CFTR chloride channel function in colonic epithelia: Involvement of the effector proteins in the regulatory mechanism

    SciTech Connect

    Saxena, Sunil K. . E-mail: ssaxena@stevens.edu; Kaur, Simarna

    2006-07-21

    Cystic fibrosis, an autosomal recessive disorder, is caused by the disruption of biosynthesis or function of CFTR. CFTR regulatory mechanisms include channel transport to plasma membrane and protein-protein interactions. Rab proteins are small GTPases involved in vesicle transport, docking, and fusion. The colorectal epithelial HT-29 cells natively express CFTR and respond to cAMP with an increase in CFTR-mediated currents. DPC-inhibited currents could be completely eliminated with CFTR-specific SiRNA. Over-expression of Rab27a inhibited, while isoform specific SiRNA and Rab27a antibody stimulated CFTR-mediated currents in HT-29 cells. CFTR activity is inhibited both by Rab27a (Q78L) (constitutive active GTP-bound form of Rab27a) and Rab27a (T23N) (constitutive negative form that mimics the GDP-bound form). Rab27a mediated effects could be reversed by Rab27a-binding proteins, the synaptotagmin-like protein (SLP-5) and Munc13-4 accessory protein (a putative priming factor for exocytosis). The SLP reversal of Rab27a effect was restricted to C2A/C2B domains while the SHD motif imparted little more inhibition. The CFTR-mediated currents remain unaffected by Rab3 though SLP-5 appears to weakly bind it. The immunoprecipitation experiments suggest protein-protein interactions between Rab27a and CFTR. Rab27a appears to impair CFTR appearance at the cell surface by trapping CFTR in the intracellular compartments. Munc13-4 and SLP-5, on the other hand, limit Rab27a availability to CFTR, thus minimizing its effect on channel function. These observations decisively prove that Rab27a is involved in CFTR channel regulation through protein-protein interactions involving Munc13-4 and SLP-5 effector proteins, and thus could be a potential target for cystic fibrosis therapy.

  5. The Functional and Regulatory Mechanisms of the Thellungiella salsuginea Ascorbate Peroxidase 6 (TsAPX6) in Response to Salinity and Water Deficit Stresses

    PubMed Central

    Li, Zeqin; Zhang, Jilong; Li, Jingxiao; Li, Hongjie; Zhang, Genfa

    2016-01-01

    Soil salinization is a resource and ecological problem in the world. Thellungiella salsuginea is becoming a new model plant because it resembles its relative species, Arabidopsis thaliana, in small genome and short life cycle. It is highly tolerant to salinity and drought stresses. Ascorbate peroxidase (APX) is an enzyme that clears H2O2 in plants. The function and molecular and regulation mechanisms of APX in T. salsuginea have rarely been reported. In this study, an APX gene, TsApx6, was cloned from T. salsuginea and its responses to abiotic stresses in transgenic Arabidopsis were studied. Under high salinity treatment, the expression of TsApx6 was significantly induced. Under drought treatment, overexpression of TsApx6 increased the survival rate and reduced leaf water loss rate in Arabidopsis. Compared to the wild type plants, high salinity treatment reduced the concentrations of MDA, H2O2 and proline but elevated the activities of APX, GPX, CAT and SOD in the TsApx6-overexpressing plants. Meanwhile, germination rate, cotyledon greening, and root length were improved in the transgenic plants compared to the wild type plants under salt and water deficit conditions. Based on these findings, TsApx6 has an important function in the resistance of plants to certain abiotic stresses. The TsApx6 promoter sequence was obtained using Genome Walking technology. Bioinformatics analysis indicated that it contains some cis-acting elements related to stress response. The treatments of salt, dehydration, and ABA induced the expression of Gus gene under the regulation of the TsApx6 promoter. Mutation analysis showed that the MBS motif present in the TsApx6 promoter might be a key negative regulatory element which has an important effect on the growth and developmental process of plants. PMID:27097028

  6. Regulatory mechanism of the light-activable allosteric switch LOV-TAP for the control of DNA binding: a computer simulation study.

    PubMed

    Peter, Emanuel; Dick, Bernhard; Baeurle, Stephan A

    2013-03-01

    The spatio-temporal control of gene expression is fundamental to elucidate cell proliferation and deregulation phenomena in living systems. Novel approaches based on light-sensitive multiprotein complexes have recently been devised, showing promising perspectives for the noninvasive and reversible modulation of the DNA-transcriptional activity in vivo. This has lately been demonstrated in a striking way through the generation of the artificial protein construct light-oxygen-voltage (LOV)-tryptophan-activated protein (TAP), in which the LOV-2-Jα photoswitch of phototropin1 from Avena sativa (AsLOV2-Jα) has been ligated to the tryptophan-repressor (TrpR) protein from Escherichia coli. Although tremendous progress has been achieved on the generation of such protein constructs, a detailed understanding of their functioning as opto-genetical tools is still in its infancy. Here, we elucidate the early stages of the light-induced regulatory mechanism of LOV-TAP at the molecular level, using the noninvasive molecular dynamics simulation technique. More specifically, we find that Cys450-FMN-adduct formation in the AsLOV2-Jα-binding pocket after photoexcitation induces the cleavage of the peripheral Jα-helix from the LOV core, causing a change of its polarity and electrostatic attraction of the photoswitch onto the DNA surface. This goes along with the flexibilization through unfolding of a hairpin-like helix-loop-helix region interlinking the AsLOV2-Jα- and TrpR-domains, ultimately enabling the condensation of LOV-TAP onto the DNA surface. By contrast, in the dark state the AsLOV2-Jα photoswitch remains inactive and exerts a repulsive electrostatic force on the DNA surface. This leads to a distortion of the hairpin region, which finally relieves its tension by causing the disruption of LOV-TAP from the DNA.

  7. The Functional and Regulatory Mechanisms of the Thellungiella salsuginea Ascorbate Peroxidase 6 (TsAPX6) in Response to Salinity and Water Deficit Stresses.

    PubMed

    Li, Zeqin; Zhang, Jilong; Li, Jingxiao; Li, Hongjie; Zhang, Genfa

    2016-01-01

    Soil salinization is a resource and ecological problem in the world. Thellungiella salsuginea is becoming a new model plant because it resembles its relative species, Arabidopsis thaliana, in small genome and short life cycle. It is highly tolerant to salinity and drought stresses. Ascorbate peroxidase (APX) is an enzyme that clears H2O2 in plants. The function and molecular and regulation mechanisms of APX in T. salsuginea have rarely been reported. In this study, an APX gene, TsApx6, was cloned from T. salsuginea and its responses to abiotic stresses in transgenic Arabidopsis were studied. Under high salinity treatment, the expression of TsApx6 was significantly induced. Under drought treatment, overexpression of TsApx6 increased the survival rate and reduced leaf water loss rate in Arabidopsis. Compared to the wild type plants, high salinity treatment reduced the concentrations of MDA, H2O2 and proline but elevated the activities of APX, GPX, CAT and SOD in the TsApx6-overexpressing plants. Meanwhile, germination rate, cotyledon greening, and root length were improved in the transgenic plants compared to the wild type plants under salt and water deficit conditions. Based on these findings, TsApx6 has an important function in the resistance of plants to certain abiotic stresses. The TsApx6 promoter sequence was obtained using Genome Walking technology. Bioinformatics analysis indicated that it contains some cis-acting elements related to stress response. The treatments of salt, dehydration, and ABA induced the expression of Gus gene under the regulation of the TsApx6 promoter. Mutation analysis showed that the MBS motif present in the TsApx6 promoter might be a key negative regulatory element which has an important effect on the growth and developmental process of plants. PMID:27097028

  8. Influence of the season on vitamin D levels and regulatory T cells in patients with polymorphic light eruption† †Electronic supplementary information (ESI) available. See DOI: 10.1039/c5pp00398a Click here for additional data file. Click here for additional data file.

    PubMed Central

    Schweintzger, N. A.; Gruber-Wackernagel, A.; Shirsath, N.; Quehenberger, F.; Obermayer-Pietsch, B.

    2016-01-01

    The exact mechanisms of photohardening in polymorphic light eruption (PLE) are still unknown, but medical photohardening was shown to increase regulatory T cell (Treg) numbers in the blood of PLE patients, similar to natural hardening. Furthermore, oral vitamin D supplementation increased peripheral Tregs in healthy individuals. We herein report on a post hoc analysis of 26 screened PLE patients of a clinical trial (ClinicalTrials.gov No. NCT01595893), in which the influence of the progressing season was investigated on baseline CD4+CD25+FoxP3+CD127– Treg numbers by flow cytometry and Treg suppressive function by co-culture assays with T effector cells as a secondary endpoint, together with 25-hydroxy vitamin D (25(OH)D) serum levels at the study's screening visit, taking place in the period from January to June. The mean 25(OH)D serum level of all patients was 33.2 ng ml–1. Ten of those patients (38.5%) were identified with low 25(OH)D levels (<30 ng ml–1). Significantly higher baseline 25(OH)D serum levels (plus 34.4%; P = 0.0182) as well as higher relative Treg percentages in CD4+ population (plus 62.8%; P = 0.0157) and in total lymphocyte population (plus 59.6%; P = 0.0372) and higher absolute Treg numbers (plus 100.2%; P = 0.0042) were observed in the late spring/early summer period (April to June) compared to the winter period (January to February). No significant relationship was observed when Treg numbers and function were correlated with 25(OH)D levels. These data indicate that in PLE patients Treg numbers and their suppressive function are independent of vitamin D serum levels and suggest that UV light and/or other seasonal factors may affect these cells via the non-vitamin D related pathway(s). PMID:26911519

  9. [On improvement of the mechanism for establishing and changing indicators of quality and food safety in the regulatory and legal acts of the Eurasian Economical Union].

    PubMed

    Arnautov, O V

    2016-01-01

    In accordance with the Treaty on the Eurasian Economic Union (EAEU) to ensure the sanitary and epidemiological welfare of the population within the Union, a coordinated policy in agreed policy in the sphere of application of sanitary measures is carried out. Sanitary measures are the obligatory requirements and procedures, including requirements for the final product, processing methods, production, transportation, storage and disposal, sampling procedures, methods of research (tests), risk assessment, the state registration, requirements for packaging directly aimed at ensuring the safety of products (goods) in order to protect human welfare, and they should be applied on the basis having a scientific explanation, and only to the extent that is necessary to protect human welfare. Sanitary measures applied within the Union should be based on international and regional standards, guidelines and (or) the recommendations, except when they based on appropriate scientific studies and explanations. In this case sanitary measures which could provide a higher level of sanitary protection are introduced. At present, the mechanism of the development, justification and approval of common sanitary and epidemiological requirements (ESR) and procedures of the Eurasian Economic Commission (the Commission) is not installed. The absence of a clear mechanism for the development, approval and implementation of the ESR to the products (goods) on the basis having a scientific explanation on the one hand could lead to the creation of unjustified barriers to foreign and mutual trade, on the other--to weaken the level of safety for human life and health of products (goods) placed on markets of the Union. In order to bring the regulatory legal acts of the Customs Union in accordance with the Treaty on the Eurasian Economic Union the Commission in cooperation with the competent authorities of the Member States in the field of sanitary and epidemiological welfare developed the project of

  10. [On improvement of the mechanism for establishing and changing indicators of quality and food safety in the regulatory and legal acts of the Eurasian Economical Union].

    PubMed

    Arnautov, O V

    2016-01-01

    In accordance with the Treaty on the Eurasian Economic Union (EAEU) to ensure the sanitary and epidemiological welfare of the population within the Union, a coordinated policy in agreed policy in the sphere of application of sanitary measures is carried out. Sanitary measures are the obligatory requirements and procedures, including requirements for the final product, processing methods, production, transportation, storage and disposal, sampling procedures, methods of research (tests), risk assessment, the state registration, requirements for packaging directly aimed at ensuring the safety of products (goods) in order to protect human welfare, and they should be applied on the basis having a scientific explanation, and only to the extent that is necessary to protect human welfare. Sanitary measures applied within the Union should be based on international and regional standards, guidelines and (or) the recommendations, except when they based on appropriate scientific studies and explanations. In this case sanitary measures which could provide a higher level of sanitary protection are introduced. At present, the mechanism of the development, justification and approval of common sanitary and epidemiological requirements (ESR) and procedures of the Eurasian Economic Commission (the Commission) is not installed. The absence of a clear mechanism for the development, approval and implementation of the ESR to the products (goods) on the basis having a scientific explanation on the one hand could lead to the creation of unjustified barriers to foreign and mutual trade, on the other--to weaken the level of safety for human life and health of products (goods) placed on markets of the Union. In order to bring the regulatory legal acts of the Customs Union in accordance with the Treaty on the Eurasian Economic Union the Commission in cooperation with the competent authorities of the Member States in the field of sanitary and epidemiological welfare developed the project of

  11. Effect of the addition order and amylose content on mechanical, barrier and structural properties of films made with starch and montmorillonite.

    PubMed

    Romero-Bastida, C A; Bello-Pérez, L A; Velazquez, G; Alvarez-Ramirez, J

    2015-01-01

    This study considered the effect of amylose content (30% and 70%), montmorillonite (MMT) fraction (5 and 15%) and preparation method on mechanical and barrier properties of starch/clay nanocomposites prepared by casting. In Method 1, (30% w/w) glycerol was incorporated before starch gelatinization and MMT addition, while in Method 2 after gelatinization and MMT addition. Nanocomposites with higher amount of MMT showed the highest tensile strength and Young's modulus for both preparation methods. Method 1 favored nanocomposite properties of films with less amylose content, meanwhile Method 2 favored nanocomposites properties with higher amylose content. Water vapor permeability did not decrease significantly in starch films with different amylose content with the two different preparation methods. X-ray diffraction of the starch films indicated intercalated structures. Higher melting temperature (Tm) was found for nanocomposites with Method 2, indicating more ordered structures. Films with 70% amylose content have higher Tm than films with 30% amylose.

  12. Effect of glycine addition on the structural, thermal, optical, mechanical and electrical properties of Sr (HCOO)2·2H2O crystals

    NASA Astrophysics Data System (ADS)

    Muthupoongodi, S.; Theodore David Manickam, S.; Mahadevan, C. K.; Angel Mary Greena, J.; Balakumar, S.; Sahaya Shajan, X.

    2015-10-01

    Pure and glycine doped strontium formate dihydrate (SFD) single crystals were grown by the free evaporation method to understand the effect of glycine addition on the structural, thermal, optical, mechanical and electrical properties of SFD crystal. The grown crystals were characterized by carrying out powder X-ray diffraction, high resolution X-ray diffraction, Fourier transform infrared spectral, Raman spectral, UV-vis-NIR spectral, thermogravimetric (TG/DTA), second harmonic generation (SHG), microhardness and DC electrical conductivity measurements. Results obtained in the present study indicate improvement in crystalline perfection, optical transmittance, and SHG efficiency, and change in microhardness, and DC electrical conductivity on doping SFD with glycine. In addition, a large size (~1.9 cm length, ~1.2 cm breath and ~0.6 cm height) SFD crystal with good optical quality could be grown successfully by the seeded free evaporation method.

  13. Effects of Ti and B Addition on Microstructures and Mechanical Properties of Hot-Rolled High-Strength Nb-Containing Steels

    NASA Astrophysics Data System (ADS)

    Meng, Xianna; Li, Cong; Chen, Wanglin

    2016-08-01

    Four microalloyed samples were designed to study the effects of Ti and B additions on microstructures and mechanical properties. Experimental results show that the samples without B addition mainly contain well-developed pearlite and polygonal ferrite, whereas the B-containing samples consist of degenerated pearlite, polygonal ferrite, and Widmanstätten ferrite (WF). The B addition promotes the precipitation of the complex (Ti,Al,Nb)N and (Ti,Al,Nb)2CS phases during the hot-rolling process. Grain sizes are significantly refined by the combinations of undissolved (Ti,Al)N, (Ti,Al,Nb)N complex, (Ti,Al,Nb)2CS, and fine inclusions, which act as the nucleation sites of intragranular ferrite. The core of complex (Ti,Al,Nb)N precipitate is undissolved Ti-N-rich (Ti,Al)N phase, and the cap is Nb-N-rich (Nb,Ti)N phase. The property measurements show that the B addition enhances comprehensive properties of tensile strength and elongation, but decreases fracture toughness due to higher contents of the WF and subgrains.

  14. The Influence of Sc and Zr Additions on the Microstructure and Mechanical Behavior of Ultrafine Grained Al-Mg Alloys Processed by Powder Metallurgy

    NASA Astrophysics Data System (ADS)

    Harrell, Tammy Jeanne

    Additions of Sc and Zr to an Al-Mg matrix were investigated, paying particular attention to the influence of Al3Sc precipitates and other dispersoids, as well as grain size, on mechanical behavior. Prior studies have shown that Sc and Zr significantly increase the strength of coarse-grained Al-Mg alloys. Prompted by these findings, we hypothesized that it would be of fundamental and technological interest to study the behavior of Sc additions to an ultra-fine-grained (UFG) microstructure (e.g., 100's nm). Accordingly, we investigate the microstructural evolution and mechanical behavior of four powder metallurgy UFG Al-Mg-Sc-(Zr) compositions and compared the results to those of equivalent fine-grained (FG) compositions - Al-5Mg-0.1Sc, Al-3Mg-0.5Sc, Al-5Mg-0.4Sc and Al-5Mg-0.2Sc-0.2Zr (wt.%). Experimental materials were consolidated by hot isostatic pressing (HIP'ing) followed by extrusion or dual mode dynamic (DMD) forging. Under identical processing conditions, UFG ternary Al-5Mg-0.4Sc materials generate large Al3Sc precipitates with an average diameter of 154 nm and spaced approximately 1 - 3 μm apart, while precipitates in the FG materials have an average diameter of 24 nm and are spaced 50 - 200 nm apart. The strengthening mechanisms are quantitatively evaluated for all materials and it is determined that the greatest strengthening contributions for the UFG and FG materials are dispersion strengthening due to the presence of Mg-rich oxides/nitrides and precipitate strengthening, respectively. Preliminary results suggest that replacing 0.2 wt% Sc with Zr results in higher strength, lower ductility and a change in precipitate distribution.

  15. Low-temperature mechanisms for the formation of substituted azanaphthalenes through consecutive CN and C2H additions to styrene and N-methylenebenzenamine: a theoretical study.

    PubMed

    Landera, Alexander; Mebel, Alexander M

    2013-05-15

    Ab initio G3(MP2,CC)/B3LYP/6-311G** calculations of potential energy surfaces (PESs) for the reactions of cyano and ethynyl radicals with styrene and N-methylenebenzenamine have been performed to investigate a possible formation mechanism of the prototype nitrogen-containing polycyclic aromatic compounds: (substituted) 1- and 2-azanaphthalenes. The computed PESs and molecular parameters have been used for RRKM and RRKM-Master Equation calculations of reaction rate constants and product branching ratios under single-collision conditions and at pressures from 3 to 10(-6) mbar and temperatures of 90-200 K relevant to the organic aerosol formation regions in the stratosphere of a Saturn's moon Titan. The results show that ethynyl-substituted 1- and 2-azanaphthalenes can be produced by consecutive CN and C2H additions to styrene or by two C2H additions to N-methylenebenzenamine. All CN and C2H radical addition complexes are formed in the entrance channels without barriers, and the reactions are computed to be exothermic, with all intermediates and transition states along the favorable pathways residing lower in energy than the respective initial reactants. The reactions are completed by dissociation of chemically activated radical intermediates via H losses, so that collisional stabilization of the intermediates is not required to form the final products. These features make the proposed mechanism viable even at very low temperatures and under single-collision conditions and especially significant for astrochemical environments. In Titan's stratosphere, collisional stabilization of the initial CN + styrene reaction adducts may be significant, but substantial amounts of 2-vinylbenzonitrile and 2-ethynyl-N-methylenebenzenamine can still be produced and then react with C2H to form substituted az