Science.gov

Sample records for additional regulatory mechanisms

  1. Effect of multiplicative and additive noise on genetic transcriptional regulatory mechanism

    NASA Astrophysics Data System (ADS)

    Liu, Xue-Mei; Xie, Hui-Zhang; Liu, Liang-Gang; Li, Zhi-Bing

    2009-02-01

    A multiplicative noise and an additive noise are introduced in the kinetic model of Smolen-Baxter-Byrne [P. Smolen, D.A. Baxter, J.H. Byrne, Amer. J. Physiol. Cell. Physiol. 274 (1998) 531], in which the expression of gene is controlled by protein concentration of transcriptional activator. The Fokker-Planck equation is solved and the steady-state probability distribution is obtained numerically. It is found that the multiplicative noise converts the bistability to monostability that can be regarded as a noise-induced transition. The additive noise reduces the transcription efficiency. The correlation between the multiplicative noise and the additive noise works as a genetic switch and regulates the gene transcription effectively.

  2. Comparative studies of gene regulatory mechanisms.

    PubMed

    Pai, Athma A; Gilad, Yoav

    2014-12-01

    It has become increasingly clear that changes in gene regulation have played an important role in adaptive evolution both between and within species. Over the past five years, comparative studies have moved beyond simple characterizations of differences in gene expression levels within and between species to studying variation in regulatory mechanisms. We still know relatively little about the precise chain of events that lead to most regulatory adaptations, but we have taken significant steps towards understanding the relative importance of changes in different mechanisms of gene regulatory evolution. In this review, we first discuss insights from comparative studies in model organisms, where the available experimental toolkit is extensive. We then focus on a few recent comparative studies in primates, where the limited feasibility of experimental manipulation dictates the approaches that can be used to study gene regulatory evolution. PMID:25215415

  3. Advances in Autophagy Regulatory Mechanisms

    PubMed Central

    Gallagher, Laura E.; Williamson, Leon E.; Chan, Edmond Y. W.

    2016-01-01

    Autophagy plays a critical role in cell metabolism by degrading and recycling internal components when challenged with limited nutrients. This fundamental and conserved mechanism is based on a membrane trafficking pathway in which nascent autophagosomes engulf cytoplasmic cargo to form vesicles that transport their content to the lysosome for degradation. Based on this simple scheme, autophagy modulates cellular metabolism and cytoplasmic quality control to influence an unexpectedly wide range of normal mammalian physiology and pathophysiology. In this review, we summarise recent advancements in three broad areas of autophagy regulation. We discuss current models on how autophagosomes are initiated from endogenous membranes. We detail how the uncoordinated 51-like kinase (ULK) complex becomes activated downstream of mechanistic target of rapamycin complex 1 (MTORC1). Finally, we summarise the upstream signalling mechanisms that can sense amino acid availability leading to activation of MTORC1. PMID:27187479

  4. Advances in Autophagy Regulatory Mechanisms.

    PubMed

    Gallagher, Laura E; Williamson, Leon E; Chan, Edmond Y W

    2016-01-01

    Autophagy plays a critical role in cell metabolism by degrading and recycling internal components when challenged with limited nutrients. This fundamental and conserved mechanism is based on a membrane trafficking pathway in which nascent autophagosomes engulf cytoplasmic cargo to form vesicles that transport their content to the lysosome for degradation. Based on this simple scheme, autophagy modulates cellular metabolism and cytoplasmic quality control to influence an unexpectedly wide range of normal mammalian physiology and pathophysiology. In this review, we summarise recent advancements in three broad areas of autophagy regulation. We discuss current models on how autophagosomes are initiated from endogenous membranes. We detail how the uncoordinated 51-like kinase (ULK) complex becomes activated downstream of mechanistic target of rapamycin complex 1 (MTORC1). Finally, we summarise the upstream signalling mechanisms that can sense amino acid availability leading to activation of MTORC1. PMID:27187479

  5. Chromatin insulators: regulatory mechanisms and epigenetic inheritance

    PubMed Central

    Bushey, Ashley M.; Dorman, Elizabeth R.; Corces, Victor G.

    2008-01-01

    Enhancer-blocking insulators are DNA elements that disrupt the communication between a regulatory sequence, such as an enhancer or a silencer, and a promoter. Insulators participate in both transcriptional regulation and global nuclear organization, two features of chromatin that are thought to be maintained from one generation to the next through epigenetic mechanisms. Furthermore, there are many regulatory mechanisms in place that enhance or hinder insulator activity. These modes of regulation could be used to establish cell-type specific insulator activity that is epigenetically inherited along a cell and/or organismal lineage. This review will discuss the evidence for epigenetic inheritance and regulation of insulator function. PMID:18851828

  6. Gene regulatory mechanisms underpinning prostate cancer susceptibility.

    PubMed

    Whitington, Thomas; Gao, Ping; Song, Wei; Ross-Adams, Helen; Lamb, Alastair D; Yang, Yuehong; Svezia, Ilaria; Klevebring, Daniel; Mills, Ian G; Karlsson, Robert; Halim, Silvia; Dunning, Mark J; Egevad, Lars; Warren, Anne Y; Neal, David E; Grönberg, Henrik; Lindberg, Johan; Wei, Gong-Hong; Wiklund, Fredrik

    2016-04-01

    Molecular characterization of genome-wide association study (GWAS) loci can uncover key genes and biological mechanisms underpinning complex traits and diseases. Here we present deep, high-throughput characterization of gene regulatory mechanisms underlying prostate cancer risk loci. Our methodology integrates data from 295 prostate cancer chromatin immunoprecipitation and sequencing experiments with genotype and gene expression data from 602 prostate tumor samples. The analysis identifies new gene regulatory mechanisms affected by risk locus SNPs, including widespread disruption of ternary androgen receptor (AR)-FOXA1 and AR-HOXB13 complexes and competitive binding mechanisms. We identify 57 expression quantitative trait loci at 35 risk loci, which we validate through analysis of allele-specific expression. We further validate predicted regulatory SNPs and target genes in prostate cancer cell line models. Finally, our integrated analysis can be accessed through an interactive visualization tool. This analysis elucidates how genome sequence variation affects disease predisposition via gene regulatory mechanisms and identifies relevant genes for downstream biomarker and drug development. PMID:26950096

  7. POEM: Identifying Joint Additive Effects on Regulatory Circuits

    PubMed Central

    Botzman, Maya; Nachshon, Aharon; Brodt, Avital; Gat-Viks, Irit

    2016-01-01

    Motivation: Expression Quantitative Trait Locus (eQTL) mapping tackles the problem of identifying variation in DNA sequence that have an effect on the transcriptional regulatory network. Major computational efforts are aimed at characterizing the joint effects of several eQTLs acting in concert to govern the expression of the same genes. Yet, progress toward a comprehensive prediction of such joint effects is limited. For example, existing eQTL methods commonly discover interacting loci affecting the expression levels of a module of co-regulated genes. Such “modularization” approaches, however, are focused on epistatic relations and thus have limited utility for the case of additive (non-epistatic) effects. Results: Here we present POEM (Pairwise effect On Expression Modules), a methodology for identifying pairwise eQTL effects on gene modules. POEM is specifically designed to achieve high performance in the case of additive joint effects. We applied POEM to transcription profiles measured in bone marrow-derived dendritic cells across a population of genotyped mice. Our study reveals widespread additive, trans-acting pairwise effects on gene modules, characterizes their organizational principles, and highlights high-order interconnections between modules within the immune signaling network. These analyses elucidate the central role of additive pairwise effect in regulatory circuits, and provide computational tools for future investigations into the interplay between eQTLs. Availability: The software described in this article is available at csgi.tau.ac.il/POEM/. PMID:27148351

  8. Regulatory mechanisms link phenotypic plasticity to evolvability.

    PubMed

    van Gestel, Jordi; Weissing, Franz J

    2016-01-01

    Organisms have a remarkable capacity to respond to environmental change. They can either respond directly, by means of phenotypic plasticity, or they can slowly adapt through evolution. Yet, how phenotypic plasticity links to evolutionary adaptability is largely unknown. Current studies of plasticity tend to adopt a phenomenological reaction norm (RN) approach, which neglects the mechanisms underlying plasticity. Focusing on a concrete question - the optimal timing of bacterial sporulation - we here also consider a mechanistic approach, the evolution of a gene regulatory network (GRN) underlying plasticity. Using individual-based simulations, we compare the RN and GRN approach and find a number of striking differences. Most importantly, the GRN model results in a much higher diversity of responsive strategies than the RN model. We show that each of the evolved strategies is pre-adapted to a unique set of unseen environmental conditions. The regulatory mechanisms that control plasticity therefore critically link phenotypic plasticity to the adaptive potential of biological populations. PMID:27087393

  9. Regulatory mechanisms link phenotypic plasticity to evolvability

    PubMed Central

    van Gestel, Jordi; Weissing, Franz J.

    2016-01-01

    Organisms have a remarkable capacity to respond to environmental change. They can either respond directly, by means of phenotypic plasticity, or they can slowly adapt through evolution. Yet, how phenotypic plasticity links to evolutionary adaptability is largely unknown. Current studies of plasticity tend to adopt a phenomenological reaction norm (RN) approach, which neglects the mechanisms underlying plasticity. Focusing on a concrete question – the optimal timing of bacterial sporulation – we here also consider a mechanistic approach, the evolution of a gene regulatory network (GRN) underlying plasticity. Using individual-based simulations, we compare the RN and GRN approach and find a number of striking differences. Most importantly, the GRN model results in a much higher diversity of responsive strategies than the RN model. We show that each of the evolved strategies is pre-adapted to a unique set of unseen environmental conditions. The regulatory mechanisms that control plasticity therefore critically link phenotypic plasticity to the adaptive potential of biological populations. PMID:27087393

  10. Mechanical properties of additively manufactured octagonal honeycombs.

    PubMed

    Hedayati, R; Sadighi, M; Mohammadi-Aghdam, M; Zadpoor, A A

    2016-12-01

    Honeycomb structures have found numerous applications as structural and biomedical materials due to their favourable properties such as low weight, high stiffness, and porosity. Application of additive manufacturing and 3D printing techniques allows for manufacturing of honeycombs with arbitrary shape and wall thickness, opening the way for optimizing the mechanical and physical properties for specific applications. In this study, the mechanical properties of honeycomb structures with a new geometry, called octagonal honeycomb, were investigated using analytical, numerical, and experimental approaches. An additive manufacturing technique, namely fused deposition modelling, was used to fabricate the honeycomb from polylactic acid (PLA). The honeycombs structures were then mechanically tested under compression and the mechanical properties of the structures were determined. In addition, the Euler-Bernoulli and Timoshenko beam theories were used for deriving analytical relationships for elastic modulus, yield stress, Poisson's ratio, and buckling stress of this new design of honeycomb structures. Finite element models were also created to analyse the mechanical behaviour of the honeycombs computationally. The analytical solutions obtained using Timoshenko beam theory were close to computational results in terms of elastic modulus, Poisson's ratio and yield stress, especially for relative densities smaller than 25%. The analytical solutions based on the Timoshenko analytical solution and the computational results were in good agreement with experimental observations. Finally, the elastic properties of the proposed honeycomb structure were compared to those of other honeycomb structures such as square, triangular, hexagonal, mixed, diamond, and Kagome. The octagonal honeycomb showed yield stress and elastic modulus values very close to those of regular hexagonal honeycombs and lower than the other considered honeycombs. PMID:27612831

  11. Immune Regulatory Mechanisms in Allergic Conjunctivitis

    PubMed Central

    Niederkorn, Jerry Y.

    2008-01-01

    Purpose of review This review highlights recent findings regarding the immune regulation of allergic conjunctivitis (AC). Mouse models have facilitated prospective studies that have not been possible in patients. The availability of gene knockout mice and the wealth of monoclonal antibodies have permitted exquisite dissection of the pathophysiology and immune regulation of AC. Recent findings New insights have emerged in three areas: a) role of costimulatory molecules in the induction of Th2 immune responses; b) crucial role of interferon-γ (IFN-γ) in the expression of AC; and c) the function of T regulatory cells in shaping conjunctival inflammation once the immune response has been initiated. Summary Allergic conjunctivitis involves early phase and late phase reactions. The early phase reaction (EPR) is IgE antibody-dependent, while the late phase reaction (LPR) is IgE-independent and is mediated by inflammatory cells, especially eosinophils. Recent studies in mouse models of AC have provided important insights into the immune regulation of both the EPR and LPR of AC. Mounting evidence suggests that IFN-γ is crucial for optimum expression of AC. Costimulatory molecules influence the induction of Th2 immune responses and the EPR while regulatory T cells shape the expression of the LPR of AC. PMID:18769204

  12. Effects of Four Different Regulatory Mechanisms on the Dynamics of Gene Regulatory Cascades

    PubMed Central

    Hansen, Sabine; Krishna, Sandeep; Semsey, Szabolcs; Lo Svenningsen, Sine

    2015-01-01

    Gene regulatory cascades (GRCs) are common motifs in cellular molecular networks. A given logical function in these cascades, such as the repression of the activity of a transcription factor, can be implemented by a number of different regulatory mechanisms. The potential consequences for the dynamic performance of the GRC of choosing one mechanism over another have not been analysed systematically. Here, we report the construction of a synthetic GRC in Escherichia coli, which allows us for the first time to directly compare and contrast the dynamics of four different regulatory mechanisms, affecting the transcription, translation, stability, or activity of a transcriptional repressor. We developed a biologically motivated mathematical model which is sufficient to reproduce the response dynamics determined by experimental measurements. Using the model, we explored the potential response dynamics that the constructed GRC can perform. We conclude that dynamic differences between regulatory mechanisms at an individual step in a GRC are often concealed in the overall performance of the GRC, and suggest that the presence of a given regulatory mechanism in a certain network environment does not necessarily mean that it represents a single optimal evolutionary solution. PMID:26184971

  13. Effects of Four Different Regulatory Mechanisms on the Dynamics of Gene Regulatory Cascades

    NASA Astrophysics Data System (ADS)

    Hansen, Sabine; Krishna, Sandeep; Semsey, Szabolcs; Lo Svenningsen, Sine

    2015-07-01

    Gene regulatory cascades (GRCs) are common motifs in cellular molecular networks. A given logical function in these cascades, such as the repression of the activity of a transcription factor, can be implemented by a number of different regulatory mechanisms. The potential consequences for the dynamic performance of the GRC of choosing one mechanism over another have not been analysed systematically. Here, we report the construction of a synthetic GRC in Escherichia coli, which allows us for the first time to directly compare and contrast the dynamics of four different regulatory mechanisms, affecting the transcription, translation, stability, or activity of a transcriptional repressor. We developed a biologically motivated mathematical model which is sufficient to reproduce the response dynamics determined by experimental measurements. Using the model, we explored the potential response dynamics that the constructed GRC can perform. We conclude that dynamic differences between regulatory mechanisms at an individual step in a GRC are often concealed in the overall performance of the GRC, and suggest that the presence of a given regulatory mechanism in a certain network environment does not necessarily mean that it represents a single optimal evolutionary solution.

  14. Nitrogen fixation: key genetic regulatory mechanisms.

    PubMed

    Martinez-Argudo, I; Little, R; Shearer, N; Johnson, P; Dixon, R

    2005-02-01

    The necessity to respond to the level of fixed nitrogen and external oxygen concentrations and to provide sufficient energy for nitrogen fixation imposes common regulatory principles amongst diazotrophs. The NifL-NifA system in Azotobacter vinelandii integrates the signals of redox, fixed-nitrogen and carbon status to regulate nif transcription. Multidomain signalling interactions between NifL and NifA are modulated by redox changes, ligand binding and interaction with the signal-transduction protein GlnK. Under adverse redox conditions (excess oxygen) or when fixed nitrogen is in excess, NifL forms a complex with NifA in which transcriptional activation is prevented. Oxidized NifL forms a binary complex with NifA to inhibit NifA activity. When fixed nitrogen is in excess, the non-covalently modified form of GlnK interacts with NifL to promote the formation of a GlnK-NifL-NifA ternary complex. When the cell re-encounters favourable conditions for nitrogen fixation, it is necessary to deactivate the signals to ensure that the NifL-NifA complex is dissociated so that NifA is free to activate transcription. This is achieved through interactions with 2-oxoglutarate, a key metabolic signal of the carbon status, which binds to the N-terminal GAF (cGMP-specific and stimulated phosphodiesterases, Anabaena adenylate cyclases and Escherichia coli FhlA) domain of NifA. PMID:15667291

  15. Molecular regulatory mechanism of tooth root development

    PubMed Central

    Huang, Xiao-Feng; Chai, Yang

    2012-01-01

    The root is crucial for the physiological function of the tooth, and a healthy root allows an artificial crown to function as required clinically. Tooth crown development has been studied intensively during the last few decades, but root development remains not well understood. Here we review the root development processes, including cell fate determination, induction of odontoblast and cementoblast differentiation, interaction of root epithelium and mesenchyme, and other molecular mechanisms. This review summarizes our current understanding of the signaling cascades and mechanisms involved in root development. It also sets the stage for de novo tooth regeneration. PMID:23222990

  16. Gene regulatory networks elucidating Huanglongbing disease mechanisms

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Next-generation sequencing was exploited to gain deeper insight into the response to infection by Candidatus liberibacter asiaticus (CaLas), especially the immune disregulation and metabolic dysfunction caused by source-sink disruption. Previous fruit transcriptome data were compared with additional...

  17. Mechanisms of regulatory volume increase in collecting duct cells.

    PubMed

    Fu, W J; Kuwahara, M; Cragoe, E J; Marumo, F

    1993-01-01

    To examine the mechanisms of cell volume regulation in response to hyperosmolality, segments of the inner stripe of rabbit outer medullary collecting duct (OMCDi) were perfused in vitro. The cross-sectional area of the tubule was monitored as an index of the relative cell volume. When luminal and basolateral osmolalities were increased from 290 to 390 mOsm simultaneously, the tubule cell shrank instantaneously and reswelled gradually, showing the so-called regulatory volume increase (RVI). Basolateral Na+ removal and addition of basolateral ethyl isopropyl amiloride (EIPA) decreased the RVI response by 76 and 66%, respectively. By contrast, apical Na+ removal had no effect on this response. RVI response was also inhibited by basolateral, but not luminal, Cl- removal (-63%), by total HCO3- removal (-74%), and by adding basolateral 4,4'-diisothiocyanostilbene-2,2'-disulfonic acid (DIDS) (-62%). Intracellular pH did not change significantly during RVI. Vasopressin increased RVI response by 56%. However, this increase was abolished in the absence of basolateral Na+ and Cl-, and in the presence of basolateral EIPA and DIDS. These results suggest that major mechanisms responsible for RVI are Na(+)-H+ and Cl(-)-HCO3- exchange systems in the basolateral membrane, and that these systems are stimulated by vasopressin in rabbit OMCDi. PMID:8007444

  18. [Regulatory mechanism of circulating inorganic phosphate].

    PubMed

    Michigami, Toshimi

    2016-02-01

    Circulating level of phosphate is altered by age and diet, and is also controlled by several hormones such as parathyroid hormone(PTH), 1,25-dihydroxyvitamin D[1,25(OH)2D]and fibroblast growth factor 23(FGF23). The main function of PTH and 1,25(OH)2D is maintaining calcium homeostasis, while FGF23 plays a central role in phosphate metabolism. PTH suppresses phosphate reabsorption in the proximal tubules to increase the renal phosphate wasting, while 1,25(OH)2D facilitates the intestinal phosphate absorption. FGF23 increases the renal phosphate wasting and reduces the production of 1,25(OH)2D. Of note, these hormones mutually regulate one another. The production of FGF23 is also regulated by various local factors. The mechanism for sensing the phosphate availability still remains unknown, and further investigation is required. PMID:26813498

  19. T-cell regulatory mechanisms in specific immunotherapy.

    PubMed

    Jutel, Marek; Akdis, Cezmi A

    2008-01-01

    Allergen-specific immunotherapy (SIT) is the only treatment which leads to a lifelong tolerance against previously disease-causing allergens due to restoration of normal immunity against allergens. The description of T-regulatory (Treg) cells being involved in prevention of sensitization to allergens has led to great interest whether they represent a major target for allergen-SIT and whether it would be possible to manipulate Treg cells to increase its efficacy. Activationinduced cell death, anergy and/or immune response modulation by Treg cells are essential mechanisms of peripheral T-cell tolerance. There is growing evidence that anergy, tolerance and active suppression are not entirely distinct, but rather represent linked mechanisms possibly involving the same cells and multiple suppressor mechanisms. Skewing of allergen-specific effector T cells to Treg cells appears as a crucial event in the control of healthy immune response to allergens and successful allergen-SIT. The Treg cell response is characterized by abolished allergen- induced specific T-cell proliferation and suppressed Thelper (Th)1- and Th2-type cytokine secretion. In addition, mediators of allergic inflammation that trigger cAMP-associated G-protein-coupled receptors, such as histamine receptor-2, may contribute to peripheral tolerance mechanisms. The increased levels of interleukin-10 and transforming growth factor-Beta that are produced by Treg cells potently suppress IgE production, while simultaneously increasing production of non-inflammatory isotypes IgG4 and IgA, respectively. In addition, Treg cells directly or indirectly suppress effector cells of allergic inflammation such as mast cells, basophils and eosinophils. In conclusion, peripheral tolerance to allergens is controlled by multiple active suppression mechanisms. It is associated with regulation of antibody isotypes and effector cells to the direction of a healthy immune response. By the application of the recent knowledge in Treg

  20. Gene Regulatory Networks Elucidating Huanglongbing Disease Mechanisms

    PubMed Central

    Martinelli, Federico; Reagan, Russell L.; Uratsu, Sandra L.; Phu, My L.; Albrecht, Ute; Zhao, Weixiang; Davis, Cristina E.; Bowman, Kim D.; Dandekar, Abhaya M.

    2013-01-01

    Next-generation sequencing was exploited to gain deeper insight into the response to infection by Candidatus liberibacter asiaticus (CaLas), especially the immune disregulation and metabolic dysfunction caused by source-sink disruption. Previous fruit transcriptome data were compared with additional RNA-Seq data in three tissues: immature fruit, and young and mature leaves. Four categories of orchard trees were studied: symptomatic, asymptomatic, apparently healthy, and healthy. Principal component analysis found distinct expression patterns between immature and mature fruits and leaf samples for all four categories of trees. A predicted protein – protein interaction network identified HLB-regulated genes for sugar transporters playing key roles in the overall plant responses. Gene set and pathway enrichment analyses highlight the role of sucrose and starch metabolism in disease symptom development in all tissues. HLB-regulated genes (glucose-phosphate-transporter, invertase, starch-related genes) would likely determine the source-sink relationship disruption. In infected leaves, transcriptomic changes were observed for light reactions genes (downregulation), sucrose metabolism (upregulation), and starch biosynthesis (upregulation). In parallel, symptomatic fruits over-expressed genes involved in photosynthesis, sucrose and raffinose metabolism, and downregulated starch biosynthesis. We visualized gene networks between tissues inducing a source-sink shift. CaLas alters the hormone crosstalk, resulting in weak and ineffective tissue-specific plant immune responses necessary for bacterial clearance. Accordingly, expression of WRKYs (including WRKY70) was higher in fruits than in leaves. Systemic acquired responses were inadequately activated in young leaves, generally considered the sites where most new infections occur. PMID:24086326

  1. Subversion of cell cycle regulatory mechanisms by HIV

    PubMed Central

    Rice, Andrew P.; Kimata, Jason T.

    2015-01-01

    To establish a productive infection, HIV-1 must counteract cellular innate immune mechanisms and redirect cellular process towards viral replication. Recent studies have discovered that HIV-1 and other primate immunodeficiency viruses subvert cell cycle regulatory mechanisms to achieve these ends. The viral Vpr and Vpx proteins target cell cycle controls to counter innate immunity. The cell cycle-related protein Cyclin L2 is also utilized to counter innate immunity. The viral Tat protein utilizes Cyclin T1 to activated proviral transcription, and regulation of Cyclin T1 levels in CD4+ T cells has important consequences for viral replication and latency. This review will summarize this emerging evidence that primate immunodeficiency viruses subvert cell cycle regulatory mechanisms to enhance replication. PMID:26067601

  2. Regulatory mechanisms related to biofuel tolerance in producing microbes.

    PubMed

    Fu, Y; Chen, L; Zhang, W

    2016-08-01

    Production of renewable biofuels through either native or engineered microbes has drawn significant attention in recent years, mostly due to the increasing concerns on the energy crisis and the environmental consequences of the overutilization of petroleum-based fuels. Although significant progress has been achieved thus far, further advances are still necessary in order to decrease the manufacturing cost so that the producing processes can be more competitive to petroleum fuels. Among various possible approaches, the increase in biofuel tolerance in microbes has been suggested as one aspect which is important for the success of biofuel production at industry-scale. In this article, we critically summarize recent advances in deciphering regulatory mechanisms for enhancing biofuel tolerance in various micro-organisms, focusing on functions and utilization of several well-studied regulatory mechanisms in microbes, such as two-component signal transduction systems, sigma factors, transcription factors, noncoding RNA and other regulators. PMID:27123568

  3. Secretory pattern and regulatory mechanism of growth hormone in cattle.

    PubMed

    Kasuya, Etsuko

    2016-02-01

    The ultradian rhythm of growth hormone (GH) secretion has been known in several animal species for years and has recently been observed in cattle. Although the physiological significance of the rhythm is not yet fully understood, it appears essential for normal growth. In this review, previous studies concerning the GH secretory pattern in cattle, including its ultradian rhythm, are introduced and the regulatory mechanism is discussed on the basis of recent findings. PMID:26260675

  4. Molecular regulatory mechanisms of osteoclastogenesis through cytoprotective enzymes

    PubMed Central

    Kanzaki, Hiroyuki; Shinohara, Fumiaki; Kanako, Itohiya; Yamaguchi, Yuuki; Fukaya, Sari; Miyamoto, Yutaka; Wada, Satoshi; Nakamura, Yoshiki

    2016-01-01

    It has been reported that reactive oxygen species (ROS), such as hydrogen peroxide and superoxide, take part in osteoclast differentiation as intra-cellular signaling molecules. The current assumed signaling cascade from RANK to ROS production is RANK, TRAF6, Rac1, and then Nox. The target molecules of ROS in RANKL signaling remain unclear; however, several reports support the theory that NF-κB signaling could be the crucial downstream signaling molecule of RANKL-mediated ROS signaling. Furthermore, ROS exert cytotoxic effects such as peroxidation of lipids and phospholipids and oxidative damage to proteins and DNA. Therefore, cells have several protective mechanisms against oxidative stressors that mainly induce cytoprotective enzymes and ROS scavenging. Three well-known mechanisms regulate cytoprotective enzymes including Nrf2-, FOXO-, and sirtuin-dependent mechanisms. Several reports have indicated a crosslink between FOXO- and sirtuin-dependent regulatory mechanisms. The agonists against the regulatory mechanisms are reported to induce these cytoprotective enzymes successfully. Some of them inhibit osteoclast differentiation and bone destruction via attenuation of intracellular ROS signaling. In this review article, we discuss the above topics and summarize the current information available on the relationship between cytoprotective enzymes and osteoclastogenesis. PMID:26795736

  5. Molecular regulatory mechanisms of osteoclastogenesis through cytoprotective enzymes.

    PubMed

    Kanzaki, Hiroyuki; Shinohara, Fumiaki; Kanako, Itohiya; Yamaguchi, Yuuki; Fukaya, Sari; Miyamoto, Yutaka; Wada, Satoshi; Nakamura, Yoshiki

    2016-08-01

    It has been reported that reactive oxygen species (ROS), such as hydrogen peroxide and superoxide, take part in osteoclast differentiation as intra-cellular signaling molecules. The current assumed signaling cascade from RANK to ROS production is RANK, TRAF6, Rac1, and then Nox. The target molecules of ROS in RANKL signaling remain unclear; however, several reports support the theory that NF-κB signaling could be the crucial downstream signaling molecule of RANKL-mediated ROS signaling. Furthermore, ROS exert cytotoxic effects such as peroxidation of lipids and phospholipids and oxidative damage to proteins and DNA. Therefore, cells have several protective mechanisms against oxidative stressors that mainly induce cytoprotective enzymes and ROS scavenging. Three well-known mechanisms regulate cytoprotective enzymes including Nrf2-, FOXO-, and sirtuin-dependent mechanisms. Several reports have indicated a crosslink between FOXO- and sirtuin-dependent regulatory mechanisms. The agonists against the regulatory mechanisms are reported to induce these cytoprotective enzymes successfully. Some of them inhibit osteoclast differentiation and bone destruction via attenuation of intracellular ROS signaling. In this review article, we discuss the above topics and summarize the current information available on the relationship between cytoprotective enzymes and osteoclastogenesis. PMID:26795736

  6. Regulatory mechanisms of EGFR signalling during Drosophila eye development.

    PubMed

    Malartre, Marianne

    2016-05-01

    EGFR signalling is a well-conserved signalling pathway playing major roles during development and cancers. This review explores what studying the EGFR pathway during Drosophila eye development has taught us in terms of the diversity of its regulatory mechanisms. This model system has allowed the identification of numerous positive and negative regulators acting at specific time and place, thus participating to the tight control of signalling. EGFR signalling regulation is achieved by a variety of mechanisms, including the control of ligand processing, the availability of the receptor itself and the transduction of the cascade in the cytoplasm. Ultimately, the transcriptional responses contribute to the establishment of positive and negative feedback loops. The combination of these multiple mechanisms employed to regulate the EGFR pathway leads to specific cellular outcomes involved in functions as diverse as the acquisition of cell fate, proliferation, survival, adherens junction remodelling and morphogenesis. PMID:26935860

  7. Molecular and Cellular Regulatory Mechanisms of Tongue Myogenesis

    PubMed Central

    Parada, C.; Han, D.; Chai, Y.

    2012-01-01

    The tongue exerts crucial functions in our daily life. However, we know very little about the regulatory mechanisms of mammalian tongue development. In this review, we summarize recent findings of the molecular and cellular mechanisms that control tissue-tissue interactions during tongue morphogenesis. Specifically, cranial neural crest cells (CNCC) lead the initiation of tongue bud formation and contribute to the interstitial connective tissue, which ultimately compartmentalizes tongue muscles and serves as their attachments. Occipital somite-derived cells migrate into the tongue primordium and give rise to muscle cells in the tongue. The intimate relationship between CNCC- and mesoderm-derived cells, as well as growth and transcription factors that have been shown to be crucial for tongue myogenesis, clearly indicate that tissue-tissue interactions play an important role in regulating tongue morphogenesis. PMID:22219210

  8. Ochratoxin A Producing Fungi, Biosynthetic Pathway and Regulatory Mechanisms.

    PubMed

    Wang, Yan; Wang, Liuqing; Liu, Fei; Wang, Qi; Selvaraj, Jonathan Nimal; Xing, Fuguo; Zhao, Yueju; Liu, Yang

    2016-03-01

    Ochratoxin A (OTA), mainly produced by Aspergillus and Penicillum species, is one of the most important mycotoxin contaminants in agricultural products. It is detrimental to human health because of its nephrotoxicity, hepatotoxicity, carcinogenicity, teratogenicity, and immunosuppression. OTA structurally consists of adihydrocoumarin moiety linked with l-phenylalanine via an amide bond. OTA biosynthesis has been putatively hypothesized, although several contradictions exist on some processes of the biosynthetic pathway. We discuss recent information on molecular studies of OTA biosynthesis despite insufficient genetic background in detail. Accordingly, genetic regulation has also been explored with regard to the interaction between the regulators and the environmental factors. In this review, we focus on three aspects of OTA: OTA-producing strains, OTA biosynthetic pathway and the regulation mechanisms of OTA production. This can pave the way to assist in protecting food and feed from OTA contamination by understanding OTA biosynthetic pathway and regulatory mechanisms. PMID:27007394

  9. Ochratoxin A Producing Fungi, Biosynthetic Pathway and Regulatory Mechanisms

    PubMed Central

    Wang, Yan; Wang, Liuqing; Liu, Fei; Wang, Qi; Selvaraj, Jonathan Nimal; Xing, Fuguo; Zhao, Yueju; Liu, Yang

    2016-01-01

    Ochratoxin A (OTA), mainly produced by Aspergillus and Penicillum species, is one of the most important mycotoxin contaminants in agricultural products. It is detrimental to human health because of its nephrotoxicity, hepatotoxicity, carcinogenicity, teratogenicity, and immunosuppression. OTA structurally consists of adihydrocoumarin moiety linked with l-phenylalanine via an amide bond. OTA biosynthesis has been putatively hypothesized, although several contradictions exist on some processes of the biosynthetic pathway. We discuss recent information on molecular studies of OTA biosynthesis despite insufficient genetic background in detail. Accordingly, genetic regulation has also been explored with regard to the interaction between the regulators and the environmental factors. In this review, we focus on three aspects of OTA: OTA-producing strains, OTA biosynthetic pathway and the regulation mechanisms of OTA production. This can pave the way to assist in protecting food and feed from OTA contamination by understanding OTA biosynthetic pathway and regulatory mechanisms. PMID:27007394

  10. The Molecular Mechanisms of Regulatory T Cell Immunosuppression

    PubMed Central

    Pandiyan, Pushpa; Zheng, Lixin; Lenardo, Michael J.

    2011-01-01

    CD4+CD25+Foxp3+ T lymphocytes, known as regulatory T cells or Tregs, have been proposed to be a lineage of professional immune suppressive cells that exclusively counteract the effects of the immunoprotective “helper” and “cytotoxic” lineages of T lymphocytes. Here we discuss new concepts on the mechanisms and functions of Tregs. There are several key points we emphasize: 1. Tregs exert suppressive effects both directly on effector T cells and indirectly through antigen-presenting cells; 2. Regulation can occur through a novel mechanism of cytokine consumption to regulate as opposed to the usual mechanism of cytokine/chemokine production; 3. In cases where CD4+ effector T cells are directly inhibited by Tregs, it is chiefly through a mechanism of lymphokine withdrawal apoptosis leading to polyclonal deletion; and 4. Contrary to the current view, we discuss new evidence that Tregs, similar to other T-cells lineages, can promote protective immune responses in certain infectious contexts (Chen et al., 2011; Pandiyan et al., 2011). Although these points are at variance to varying degrees with the standard model of Treg behavior, we will recount developing findings that support these new concepts. PMID:22566849

  11. Mechanical Properties of Iron Alumininides Intermetallic Alloy with Molybdenum Addition

    SciTech Connect

    Zuhailawati, H.; Fauzi, M. N. A.

    2010-03-11

    In this work, FeAl-based alloys with and without molybdenum addition were fabricated by sintering of mechanically alloyed powders in order to investigate the effect of molybdenum on iron aluminide mechanical properties. Bulk samples were prepared by mechanical alloying for 4 hours, pressing at 360 MPa and sintering at 1000 deg. C for 2 hours. The specimens were tested in compression at room temperature using Instron machine. The phase identification and microstructure of the consolidated material was examined by x-ray diffraction and scanning electron microscope correspondingly. Results show that 2.5 wt%Mo addition significantly increased the ultimate stress and ultimate strain in compressive mode due to solid solution hardening. However, the addition of Mo more than 2.5 wt% was accompanied by a reduction in both properties caused by the presence of Mo-rich precipitate particles.

  12. Metal Additive Manufacturing: A Review of Mechanical Properties

    NASA Astrophysics Data System (ADS)

    Lewandowski, John J.; Seifi, Mohsen

    2016-07-01

    This article reviews published data on the mechanical properties of additively manufactured metallic materials. The additive manufacturing techniques utilized to generate samples covered in this review include powder bed fusion (e.g., EBM, SLM, DMLS) and directed energy deposition (e.g., LENS, EBF3). Although only a limited number of metallic alloy systems are currently available for additive manufacturing (e.g., Ti-6Al-4V, TiAl, stainless steel, Inconel 625/718, and Al-Si-10Mg), the bulk of the published mechanical properties information has been generated on Ti-6Al-4V. However, summary tables for published mechanical properties and/or key figures are included for each of the alloys listed above, grouped by the additive technique used to generate the data. Published values for mechanical properties obtained from hardness, tension/compression, fracture toughness, fatigue crack growth, and high cycle fatigue are included for as-built, heat-treated, and/or HIP conditions, when available. The effects of test orientation/build direction on properties, when available, are also provided, along with discussion of the potential source(s) (e.g., texture, microstructure changes, defects) of anisotropy in properties. Recommendations for additional work are also provided.

  13. The prion hypothesis: from biological anomaly to basic regulatory mechanism

    PubMed Central

    Tuite, Mick F; Serio, Tricia R

    2010-01-01

    Preface Prions are unusual proteinaceous infectious agents that are typically associated with a class of fatal degenerative diseases of the mammalian brain. However, the discovery of fungal prions, which are not associated with disease, suggests that we must now consider the impact of these factors on basic cellular physiology in a different light. Fungal prions are epigenetic determinants that can alter a range of cellular processes, including metabolism and gene expression pathways, and these changes can lead to a range of prion-associated phenotypes. The mechanistic similarities between prion propagation in mammals and fungi suggest that prions are not a biological anomaly but instead are a new appreciated and perhaps ubiquitous regulatory mechanism. PMID:21081963

  14. Mechanical Properties of Austenitic Stainless Steel Made by Additive Manufacturing.

    PubMed

    Luecke, William E; Slotwinski, John A

    2014-01-01

    Using uniaxial tensile and hardness testing, we evaluated the variability and anisotropy of the mechanical properties of an austenitic stainless steel, UNS S17400, manufactured by an additive process, selective laser melting. Like wrought materials, the mechanical properties depend on the orientation introduced by the processing. The recommended stress-relief heat treatment increases the tensile strength, reduces the yield strength, and decreases the extent of the discontinuous yielding. The mechanical properties, assessed by hardness, are very uniform across the build plate, but the stress-relief heat treatment introduced a small non-uniformity that had no correlation to position on the build plate. Analysis of the mechanical property behavior resulted in four conclusions. (1) The within-build and build-to-build tensile properties of the UNS S17400 stainless steel are less repeatable than mature engineering structural alloys, but similar to other structural alloys made by additive manufacturing. (2) The anisotropy of the mechanical properties of the UNS S17400 material of this study is larger than that of mature structural alloys, but is similar to other structural alloys made by additive manufacturing. (3) The tensile mechanical properties of the UNS S17400 material fabricated by selective laser melting are very different from those of wrought, heat-treated 17-4PH stainless steel. (4) The large discontinuous yielding strain in all tests resulted from the formation and propagation of Lüders bands. PMID:26601037

  15. Mechanical Properties of Austenitic Stainless Steel Made by Additive Manufacturing

    PubMed Central

    Luecke, William E; Slotwinski, John A

    2014-01-01

    Using uniaxial tensile and hardness testing, we evaluated the variability and anisotropy of the mechanical properties of an austenitic stainless steel, UNS S17400, manufactured by an additive process, selective laser melting. Like wrought materials, the mechanical properties depend on the orientation introduced by the processing. The recommended stress-relief heat treatment increases the tensile strength, reduces the yield strength, and decreases the extent of the discontinuous yielding. The mechanical properties, assessed by hardness, are very uniform across the build plate, but the stress-relief heat treatment introduced a small non-uniformity that had no correlation to position on the build plate. Analysis of the mechanical property behavior resulted in four conclusions. (1) The within-build and build-to-build tensile properties of the UNS S17400 stainless steel are less repeatable than mature engineering structural alloys, but similar to other structural alloys made by additive manufacturing. (2) The anisotropy of the mechanical properties of the UNS S17400 material of this study is larger than that of mature structural alloys, but is similar to other structural alloys made by additive manufacturing. (3) The tensile mechanical properties of the UNS S17400 material fabricated by selective laser melting are very different from those of wrought, heat-treated 17-4PH stainless steel. (4) The large discontinuous yielding strain in all tests resulted from the formation and propagation of Lüders bands. PMID:26601037

  16. Emerging regulatory mechanisms in ubiquitin-dependent cell cycle control

    PubMed Central

    Mocciaro, Annamaria; Rape, Michael

    2012-01-01

    The covalent modification of proteins with ubiquitin is required for accurate cell division in all eukaryotes. Ubiquitylation depends on an enzymatic cascade, in which E3 enzymes recruit specific substrates for modification. Among ~600 human E3s, the SCF (Skp1–cullin1–F-box) and the APC/C (anaphase-promoting complex/cyclosome) are known for driving the degradation of cell cycle regulators to accomplish irreversible cell cycle transitions. The cell cycle machinery reciprocally regulates the SCF and APC/C through various mechanisms, including the modification of these E3s or the binding of specific inhibitors. Recent studies have provided new insight into the intricate relationship between ubiquitylation and the cell division apparatus as they revealed roles for atypical ubiquitin chains, new mechanisms of substrate and E3 regulation, as well as extensive crosstalk between ubiquitylation enzymes. Here, we review these emerging regulatory mechanisms of ubiquitin-dependent cell cycle control and discuss how their manipulation might provide therapeutic benefits in the future. PMID:22357967

  17. Redox-switch regulatory mechanism of thiolase from Clostridium acetobutylicum

    PubMed Central

    Kim, Sangwoo; Jang, Yu-Sin; Ha, Sung-Chul; Ahn, Jae-Woo; Kim, Eun-Jung; Hong Lim, Jae; Cho, Changhee; Shin Ryu, Yong; Kuk Lee, Sung; Lee, Sang Yup; Kim, Kyung-Jin

    2015-01-01

    Thiolase is the first enzyme catalysing the condensation of two acetyl-coenzyme A (CoA) molecules to form acetoacetyl-CoA in a dedicated pathway towards the biosynthesis of n-butanol, an important solvent and biofuel. Here we elucidate the crystal structure of Clostridium acetobutylicum thiolase (CaTHL) in its reduced/oxidized states. CaTHL, unlike those from other aerobic bacteria such as Escherichia coli and Zoogloea ramegera, is regulated by the redox-switch modulation through reversible disulfide bond formation between two catalytic cysteine residues, Cys88 and Cys378. When CaTHL is overexpressed in wild-type C. acetobutylicum, butanol production is reduced due to the disturbance of acidogenic to solventogenic shift. The CaTHLV77Q/N153Y/A286K mutant, which is not able to form disulfide bonds, exhibits higher activity than wild-type CaTHL, and enhances butanol production upon overexpression. On the basis of these results, we suggest that CaTHL functions as a key enzyme in the regulation of the main metabolism of C. acetobutylicum through a redox-switch regulatory mechanism. PMID:26391388

  18. Metabolic and transcriptional regulatory mechanisms underlying the anoxic adaptation of rice coleoptile.

    PubMed

    Lakshmanan, Meiyappan; Mohanty, Bijayalaxmi; Lim, Sun-Hyung; Ha, Sun-Hwa; Lee, Dong-Yup

    2014-01-01

    The ability of rice to germinate under anoxia by extending the coleoptile is a highly unusual characteristic and a key feature underpinning the ability of rice seeds to establish in such a stressful environment. The process has been a focal point for research for many years. However, the molecular mechanisms underlying the anoxic growth of the coleoptile still remain largely unknown. To unravel the key regulatory mechanisms of rice germination under anoxic stress, we combined in silico modelling with gene expression data analysis. Our initial modelling analysis via random flux sampling revealed numerous changes in rice primary metabolism in the absence of oxygen. In particular, several reactions associated with sucrose metabolism and fermentation showed a significant increase in flux levels, whereas reaction fluxes across oxidative phosphorylation, the tricarboxylic acid cycle and the pentose phosphate pathway were down-regulated. The subsequent comparative analysis of the differences in calculated fluxes with previously published gene expression data under air and anoxia identified at least 37 reactions from rice central metabolism that are transcriptionally regulated. Additionally, cis-regulatory content analyses of these transcriptionally controlled enzymes indicate a regulatory role for transcription factors such as MYB, bZIP, ERF and ZnF in transcriptional control of genes that are up-regulated during rice germination and coleoptile elongation under anoxia. PMID:24894389

  19. [Requirements for drug approval and additional benefits assessment: Regulatory aspects and experiences].

    PubMed

    Broich, K; Löbker, W; Schulte, A; Beinlich, P; Müller, T

    2016-04-01

    The early assessment of benefits of newly approved drugs with novel active substances or new applications, which came into force on 1 January 2011 still represents a challenge to all parties involved. This article highlights the definitions, regulatory requirements and interaction between drug marketing approval and early assessment of benefits in Germany. The constellation of an extensively harmonized European and even international drug authorization process with a predominantly national regulation of drug reimbursement situation inevitably causes friction, which could be markedly reduced through early joint advisory discussions during the planning phase for pivotal clinical trials. During the year 2015 the Federal Institute for Drugs and Medical Devices (BfArM) carried out 300 scientific advice procedures of which 34 were concerned with applications in the field of indications for the central nervous system (CNS). In comparison 98 advisory meetings were held by the Federal Joint Committee (G-BA) of which the BfArM provided advice in 12 instances and in 2 cases on CNS indications. Study design, endpoints and appropriate comparative therapies are the key issues in exchanges and discussions between the BfArM, the G‑BA and applicants. Under these aspects the BfArM and G‑BA promote an early and consistent involvement in early advice procedures regarding the prerequisites for drug approval and assessment of additional benefits. PMID:27003322

  20. CaMKII in addition to MLCK contributes to phosphorylation of regulatory light chain in cardiomyocytes.

    PubMed

    Eikemo, Hilde; Moltzau, Lise Román; Hussain, Rizwan I; Nguyen, Cam H T; Qvigstad, Eirik; Levy, Finn Olav; Skomedal, Tor; Osnes, Jan-Bjørn

    2016-02-26

    The aim was to identify kinase activities involved in the phosphorylation of regulatory light chain (RLC) in situ in cardiomyocytes. In electrically stimulated rat cardiomyocytes, phosphatase inhibition by calyculin A unmasked kinase activities evoking an increase of phosphorylated RLC (P-RLC) from about 16% to about 80% after 80 min. The phosphorylation rate in cardiomyocytes was reduced by about 40% by the myosin light chain kinase (MLCK) inhibitor, ML-7. In rat ventricular muscle strips, calyculin A induced a positive inotropic effect that correlated with P-RLC levels. The inotropic effect and P-RLC elevation were abolished by ML-7 treatment. The kinase activities phosphorylating RLC in cardiomyocytes were reduced by about 60% by the non-selective kinase inhibitor staurosporine and by about 50% by the calmodulin antagonist W7. W7 eliminated the inhibitory effect of ML-7, suggesting that the cardiac MLCK is Ca(2+)/calmodulin (CaM)-dependent. The CaM-dependent kinase II (CaMKII) inhibitor KN-93 attenuated the calyculin A-induced RLC phosphorylation by about 40%, indicating a contribution from CaMKII. The residual phosphorylation in the presence of W7 indicated that also CaM-independent kinase activities might contribute. RLC phosphorylation was insensitive to protein kinase C inhibition. In conclusion, in addition to MLCK, CaMKII phosphorylates RLC in cardiomyocytes. Involvement of other kinases cannot be excluded. PMID:26809094

  1. Translational regulatory mechanisms in persistent forms of synaptic plasticity.

    PubMed

    Kelleher, Raymond J; Govindarajan, Arvind; Tonegawa, Susumu

    2004-09-30

    Memory and synaptic plasticity exhibit distinct temporal phases, with long-lasting forms distinguished by their dependence on macromolecular synthesis. Prevailing models for the molecular mechanisms underlying long-lasting synaptic plasticity have largely focused on transcriptional regulation. However, a growing body of evidence now supports a crucial role for neuronal activity-dependent mRNA translation, which may occur in dendrites for a subset of neuronal mRNAs. Recent work has begun to define the signaling mechanisms coupling synaptic activation to the protein synthesis machinery. The ERK and mTOR signaling pathways have been shown to regulate the activity of the general translational machinery, while the translation of particular classes of mRNAs is additionally controlled by gene-specific mechanisms. Rapid enhancement of the synthesis of a diverse array of neuronal proteins through such mechanisms provides the components necessary for persistent forms of LTP and LTD. These findings have important implications for the synapse specificity and associativity of protein synthesis-dependent changes in synaptic strength. PMID:15450160

  2. Polymyxin Resistance of Pseudomonas aeruginosa phoQ Mutants Is Dependent on Additional Two-Component Regulatory Systems

    PubMed Central

    Gutu, Alina D.; Sgambati, Nicole; Strasbourger, Pnina; Brannon, Mark K.; Jacobs, Michael A.; Haugen, Eric; Kaul, Rajinder K.; Johansen, Helle Krogh; Høiby, Niels

    2013-01-01

    Pseudomonas aeruginosa can develop resistance to polymyxin as a consequence of mutations in the PhoPQ regulatory system, mediated by covalent lipid A modification. Transposon mutagenesis of a polymyxin-resistant phoQ mutant defined 41 novel loci required for resistance, including two regulatory systems, ColRS and CprRS. Deletion of the colRS genes, individually or in tandem, abrogated the polymyxin resistance of a ΔphoQ mutant, as did individual or tandem deletion of cprRS. Individual deletion of colR or colS in a ΔphoQ mutant also suppressed 4-amino-l-arabinose addition to lipid A, consistent with the known role of this modification in polymyxin resistance. Surprisingly, tandem deletion of colRS or cprRS in the ΔphoQ mutant or individual deletion of cprR or cprS failed to suppress 4-amino-l-arabinose addition to lipid A, indicating that this modification alone is not sufficient for PhoPQ-mediated polymyxin resistance in P. aeruginosa. Episomal expression of colRS or cprRS in tandem or of cprR individually complemented the Pm resistance phenotype in the ΔphoQ mutant, while episomal expression of colR, colS, or cprS individually did not. Highly polymyxin-resistant phoQ mutants of P. aeruginosa isolated from polymyxin-treated cystic fibrosis patients harbored mutant alleles of colRS and cprS; when expressed in a ΔphoQ background, these mutant alleles enhanced polymyxin resistance. These results define ColRS and CprRS as two-component systems regulating polymyxin resistance in P. aeruginosa, indicate that addition of 4-amino-l-arabinose to lipid A is not the only PhoPQ-regulated biochemical mechanism required for resistance, and demonstrate that colRS and cprS mutations can contribute to high-level clinical resistance. PMID:23459479

  3. Ser/Thr phosphorylation as a regulatory mechanism in bacteria

    PubMed Central

    Dworkin, Jonathan

    2015-01-01

    This review will discuss some recent work describing the role of Ser/Thr phosphorylation as a post-translational mechanism of regulation in bacteria. I will discuss the interaction between bacterial eukaryotic-like Ser/Thr kinases (eSTKs) and two-component systems as well as hints as to physiological function of eSTKs and their cognate eukaryotic-like phosphatases (eSTPs). In particular, I will highlight the role of eSTKs and eSTPs in the regulation of peptidoglycan metabolism and protein synthesis. In addition, I will discuss how data from phosphoproteomic surveys suggests that Ser/Thr phosphorylation plays a much more significant physiological role than would be predicted simply based on in vivo and in vitro analyses of individual kinases. PMID:25625314

  4. Bioinspired Cellular Structures: Additive Manufacturing and Mechanical Properties

    NASA Astrophysics Data System (ADS)

    Stampfl, J.; Pettermann, H. E.; Liska, R.

    Biological materials (e.g., wood, trabecular bone, marine skeletons) rely heavily on the use of cellular architecture, which provides several advantages. (1) The resulting structures can bear the variety of "real life" load spectra using a minimum of a given bulk material, featuring engineering lightweight design principles. (2) The inside of the structures is accessible to body fluids which deliver the required nutrients. (3) Furthermore, cellular architectures can grow organically by adding or removing individual struts or by changing the shape of the constituting elements. All these facts make the use of cellular architectures a reasonable choice for nature. Using additive manufacturing technologies (AMT), it is now possible to fabricate such structures for applications in engineering and biomedicine. In this chapter, we present methods that allow the 3D computational analysis of the mechanical properties of cellular structures with open porosity. Various different cellular architectures including disorder are studied. In order to quantify the influence of architecture, the apparent density is always kept constant. Furthermore, it is shown that how new advanced photopolymers can be used to tailor the mechanical and functional properties of the fabricated structures.

  5. Regulatory motifs on ISWI chromatin remodelers: molecular mechanisms and kinetic proofreading

    NASA Astrophysics Data System (ADS)

    Brysbaert, Guillaume; Lensink, Marc F.; Blossey, Ralf

    2015-02-01

    Recently, kinetic proofreading scenarios have been proposed for the regulation of chromatin remodeling, first on purely theoretical grounds (Blossey and Schiessel 2008 HFSP J. 2 167-70) and deduced from experiments on the ISWI/ACF system (Narlikar 2010 Curr. Opin. Chem. Biol. 14 660). In the kinetic proofreading scenario of chromatin remodeling, the combination of the recognition of a histone tail state and ATP-hydrolysis in the remodeler motor act together to select (i.e. proofread) a nucleosomal substrate. ISWI remodelers have recently been shown to have an additional level of regulation as they contain auto-inhibitory motifs which need to be inactivated through an interaction with the nucleosome. In this paper we show that the auto-regulatory effect enhances substrate recognition in kinetic proofreading. We further report some suggestive additional insights into the molecular mechanism underlying ISWI-autoregulation.

  6. The Cellular and Molecular Mechanisms of Immuno-Suppression by Human Type 1 Regulatory T Cells

    PubMed Central

    Gregori, Silvia; Goudy, Kevin S.; Roncarolo, Maria Grazia

    2011-01-01

    The immuno-regulatory mechanisms of IL-10-producing type 1 regulatory T (Tr1) cells have been widely studied over the years. However, several recent discoveries have shed new light on the cellular and molecular mechanisms that human Tr1 cells use to control immune responses and induce tolerance. In this review we outline the well known and newly discovered regulatory properties of human Tr1 cells and provide an in-depth comparison of the known suppressor mechanisms of Tr1 cells with FOXP3+ Treg. We also highlight the role that Tr1 cells play in promoting and maintaining tolerance in autoimmunity, allergy, and transplantation. PMID:22566914

  7. The human sperm acrosome reaction: physiology and regulatory mechanisms. An update.

    PubMed

    Brucker, C; Lipford, G B

    1995-01-01

    The acrosome reaction is a crucial step during gamete interaction in all species, including man. It allows spermatozoa to penetrate the zona pellucida and fuse with the oocyte membrane. Spermatozoa unable to undergo the acrosome reaction will not fertilize intact oocytes. This article concentrates on the characteristics and regulatory mechanisms of the acrosome reaction in human spermatozoa. During recent years, various entities found in the vicinity of the ovulated oocyte have been identified as stimulators of the acrosome reaction, of which zona protein is considered the prime physiological inducer in vivo. The steroid hormone progesterone has been shown to evoke critical responses in sperm cells leading to the acrosome reaction. Calcium has also been shown to play a central role during the acrosome reaction. Calcium flux is induced specifically by progesterone in capacitated and uncapacitated sperm cells, whereas only capacitated spermatozoa are able to subsequently complete the acrosome reaction. Progesterone as well as zona protein has been shown to evoke crucial responses within human spermatozoa, shedding light on the cascade of intracellular signalling events leading to the completion of the acrosome reaction. Furthermore, chemical agents which bring about the reaction in vitro, such as the ionophores ionomycin or A23187, have been used to shed light on its regulatory mechanisms. A number of molecules have been postulated to regulate the acrosome reaction in mammals, for example a galactosyl-transferase and a sperm protein tyrosine kinase. In addition, a novel protein, termed SAA-1, that was first detected on human spermatozoa is discussed with respect to its potential role as a regulatory protein closely involved in the initiation of the acrosome reaction. PMID:9080206

  8. Potential impact of gene regulatory mechanisms on the evolution of multicellularity in the volvocine algae.

    PubMed

    Kianianmomeni, Arash

    2015-01-01

    A fundamental question in biology is how multicellular organisms can arise from their single-celled precursors. The evolution of multicellularity requires the adoption of new traits in unicellular ancestors that allows the generation of form by, for example, increasing the size and developing new cell types. But what are the genetic, cellular and biochemical bases underlying the evolution of multicellularity? Recent advances in evolutionary developmental biology suggest that the regulation of gene expression by cis-regulatory factors, gene duplication and alternative splicing contribute to phenotypic evolution. These mechanisms enable different degrees of phenotypic divergence and complexity with variation in traits from genomes with similar gene contents. In addition, signaling pathways specific to cell types are developed to guarantee the modulation of cellular and developmental processes matched to the cell types as well as the maintenance of multicellularity. PMID:26479715

  9. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  10. Additives

    NASA Technical Reports Server (NTRS)

    Smalheer, C. V.

    1973-01-01

    The chemistry of lubricant additives is discussed to show what the additives are chemically and what functions they perform in the lubrication of various kinds of equipment. Current theories regarding the mode of action of lubricant additives are presented. The additive groups discussed include the following: (1) detergents and dispersants, (2) corrosion inhibitors, (3) antioxidants, (4) viscosity index improvers, (5) pour point depressants, and (6) antifouling agents.

  11. Innovation of a Regulatory Mechanism Modulating Semi-determinate Stem Growth through Artificial Selection in Soybean.

    PubMed

    Liu, Yunfeng; Zhang, Dajian; Ping, Jieqing; Li, Shuai; Chen, Zhixiang; Ma, Jianxin

    2016-01-01

    It has been demonstrated that Terminal Flowering 1 (TFL1) in Arabidopsis and its functional orthologs in other plants specify indeterminate stem growth through their specific expression that represses floral identity genes in shoot apical meristems (SAMs), and that the loss-of-function mutations at these functional counterparts result in the transition of SAMs from the vegetative to reproductive state that is essential for initiation of terminal flowering and thus formation of determinate stems. However, little is known regarding how semi-determinate stems, which produce terminal racemes similar to those observed in determinate plants, are specified in any flowering plants. Here we show that semi-determinacy in soybean is modulated by transcriptional repression of Dt1, the functional ortholog of TFL1, in SAMs. Such repression is fulfilled by recently enabled spatiotemporal expression of Dt2, an ancestral form of the APETALA1/FRUITFULL orthologs, which encodes a MADS-box factor directly binding to the regulatory sequence of Dt1. In addition, Dt2 triggers co-expression of the putative SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (GmSOC1) in SAMs, where GmSOC1 interacts with Dt2, and also directly binds to the Dt1 regulatory sequence. Heterologous expression of Dt2 and Dt1 in determinate (tfl1) Arabidopsis mutants enables creation of semi-determinacy, but the same forms of the two genes in the tfl1 and soc1 background produce indeterminate stems, suggesting that Dt2 and SOC1 both are essential for transcriptional repression of Dt1. Nevertheless, the expression of Dt2 is unable to repress TFL1 in Arabidopsis, further demonstrating the evolutionary novelty of the regulatory mechanism underlying stem growth in soybean. PMID:26807727

  12. Innovation of a Regulatory Mechanism Modulating Semi-determinate Stem Growth through Artificial Selection in Soybean

    PubMed Central

    Ping, Jieqing; Li, Shuai; Chen, Zhixiang; Ma, Jianxin

    2016-01-01

    It has been demonstrated that Terminal Flowering 1 (TFL1) in Arabidopsis and its functional orthologs in other plants specify indeterminate stem growth through their specific expression that represses floral identity genes in shoot apical meristems (SAMs), and that the loss-of-function mutations at these functional counterparts result in the transition of SAMs from the vegetative to reproductive state that is essential for initiation of terminal flowering and thus formation of determinate stems. However, little is known regarding how semi-determinate stems, which produce terminal racemes similar to those observed in determinate plants, are specified in any flowering plants. Here we show that semi-determinacy in soybean is modulated by transcriptional repression of Dt1, the functional ortholog of TFL1, in SAMs. Such repression is fulfilled by recently enabled spatiotemporal expression of Dt2, an ancestral form of the APETALA1/FRUITFULL orthologs, which encodes a MADS-box factor directly binding to the regulatory sequence of Dt1. In addition, Dt2 triggers co-expression of the putative SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (GmSOC1) in SAMs, where GmSOC1 interacts with Dt2, and also directly binds to the Dt1 regulatory sequence. Heterologous expression of Dt2 and Dt1 in determinate (tfl1) Arabidopsis mutants enables creation of semi-determinacy, but the same forms of the two genes in the tfl1 and soc1 background produce indeterminate stems, suggesting that Dt2 and SOC1 both are essential for transcriptional repression of Dt1. Nevertheless, the expression of Dt2 is unable to repress TFL1 in Arabidopsis, further demonstrating the evolutionary novelty of the regulatory mechanism underlying stem growth in soybean. PMID:26807727

  13. Modeling Transport and Flow Regulatory Mechanisms of the Kidney

    PubMed Central

    Layton, Anita T.

    2013-01-01

    The kidney plays an indispensable role in the regulation of whole-organism water balance, electrolyte balance, and acid-base balance, and in the excretion of metabolic wastes and toxins. In this paper, we review representative mathematical models that have been developed to better understand kidney physiology and pathophysiology, including the regulation of glomerular filtration, the regulation of renal blood flow by means of the tubuloglomerular feedback mechanisms and of the myogenic mechanism, the urine concentrating mechanism, and regulation of renal oxygen transport. We discuss how such modeling efforts have significantly expanded our understanding of renal function in both health and disease. PMID:23914303

  14. Functional role of regulatory T cells in B cell lymphoma and related mechanisms.

    PubMed

    Wu, Wei; Wan, Jun; Xia, Ruixiang; Huang, Zhenqi; Ni, Jing; Yang, Mingzhen

    2015-01-01

    B cell lymphoma (BCL) has a higher degree of malignancy and complicated pathogenic mechanism. Regulatory T cells (Treg cells) are known to exert certain immune suppression functions, in addition to immune mediating effects. Recent studies have revealed the role of Treg cells in pathogenesis and progression of multiple malignant tumors. This study therefore investigated the functional role and related mechanism of Treg cells in BCL. A cohort of thirty patients who were diagnosed with BCL in our hospital between January 2013 and December 2014. Another thirty healthy individuals were recruited. Peripheral blood mononuclear cells (PBMCs) were separated and analyzed for the ratio of CD4+/CD25+ Treg cells. The mRNA expression levels of Foxp3, transforming growth factor (TGF)-β1 and interleukin (IL)-10 genes were quantified by real-time PCR, while their serum levels were determined by enzyme-linked immunosorbent assay (ELISA). Meanwhile all laboratory indexes for patients were monitored during the complete remission (CR) stage. BCL patients significantly elevated ratio of CD4+/CD25+ Treg cells, which were decreased at CR stage. mRNA levels of Foxp3, TGF-β1 and IL-10, in addition to protein levels of TGF-β1 and IL-10 were potentiated in lymphoma patients but decreased in CR patients (P<0.05 in all cases). CD4+/CD25+ Treg cells exert immune suppressing functions in BCL via regulating cytokines, thereby facilitating the pathogenesis and progression of lymphoma. PMID:26464657

  15. Structural imprints in vivo decode RNA regulatory mechanisms

    PubMed Central

    Spitale, Robert C.; Flynn, Ryan A.; Zhang, Qiangfeng Cliff; Crisalli, Pete; Lee, Byron; Jung, Jong-Wha; Kuchelmeister, Hannes Y.; Batista, Pedro J.; Torre, Eduardo A.; Kool, Eric T.; Chang, Howard Y.

    2015-01-01

    Visualizing the physical basis for molecular behavior inside living cells is a grand challenge in biology. RNAs are central to biological regulation, and RNA’s ability to adopt specific structures intimately controls every step of the gene expression program1. However, our understanding of physiological RNA structures is limited; current in vivo RNA structure profiles view only two of four nucleotides that make up RNA2,3. Here we present a novel biochemical approach, In Vivo Click SHAPE (icSHAPE), that enables the first global view of RNA secondary structures of all four bases in living cells. icSHAPE of mouse embryonic stem cell transcriptome versus purified RNA folded in vitro shows that the structural dynamics of RNA in the cellular environment distinguishes different classes of RNAs and regulatory elements. Structural signatures at translational start sites and ribosome pause sites are conserved from in vitro, suggesting that these RNA elements are programmed by sequence. In contrast, focal structural rearrangements in vivo reveal precise interfaces of RNA with RNA binding proteins or RNA modification sites that are consistent with atomic-resolution structural data. Such dynamic structural footprints enable accurate prediction of RNA-protein interactions and N6-methyladenosine (m6A) modification genome-wide. These results open the door for structural genomics of RNA in living cells and reveal key physiological structures controlling gene expression. PMID:25799993

  16. Structural imprints in vivo decode RNA regulatory mechanisms

    NASA Astrophysics Data System (ADS)

    Spitale, Robert C.; Flynn, Ryan A.; Zhang, Qiangfeng Cliff; Crisalli, Pete; Lee, Byron; Jung, Jong-Wha; Kuchelmeister, Hannes Y.; Batista, Pedro J.; Torre, Eduardo A.; Kool, Eric T.; Chang, Howard Y.

    2015-03-01

    Visualizing the physical basis for molecular behaviour inside living cells is a great challenge for biology. RNAs are central to biological regulation, and the ability of RNA to adopt specific structures intimately controls every step of the gene expression program. However, our understanding of physiological RNA structures is limited; current in vivo RNA structure profiles include only two of the four nucleotides that make up RNA. Here we present a novel biochemical approach, in vivo click selective 2'-hydroxyl acylation and profiling experiment (icSHAPE), which enables the first global view, to our knowledge, of RNA secondary structures in living cells for all four bases. icSHAPE of the mouse embryonic stem cell transcriptome versus purified RNA folded in vitro shows that the structural dynamics of RNA in the cellular environment distinguish different classes of RNAs and regulatory elements. Structural signatures at translational start sites and ribosome pause sites are conserved from in vitro conditions, suggesting that these RNA elements are programmed by sequence. In contrast, focal structural rearrangements in vivo reveal precise interfaces of RNA with RNA-binding proteins or RNA-modification sites that are consistent with atomic-resolution structural data. Such dynamic structural footprints enable accurate prediction of RNA-protein interactions and N6-methyladenosine (m6A) modification genome wide. These results open the door for structural genomics of RNA in living cells and reveal key physiological structures controlling gene expression.

  17. Heart Rate Variability: New Perspectives on Physiological Mechanisms, Assessment of Self-regulatory Capacity, and Health risk

    PubMed Central

    Shaffer, Fred

    2015-01-01

    Heart rate variability, the change in the time intervals between adjacent heartbeats, is an emergent property of interdependent regulatory systems that operates on different time scales to adapt to environmental and psychological challenges. This article briefly reviews neural regulation of the heart and offers some new perspectives on mechanisms underlying the very low frequency rhythm of heart rate variability. Interpretation of heart rate variability rhythms in the context of health risk and physiological and psychological self-regulatory capacity assessment is discussed. The cardiovascular regulatory centers in the spinal cord and medulla integrate inputs from higher brain centers with afferent cardiovascular system inputs to adjust heart rate and blood pressure via sympathetic and parasympathetic efferent pathways. We also discuss the intrinsic cardiac nervous system and the heart-brain connection pathways, through which afferent information can influence activity in the subcortical, frontocortical, and motor cortex areas. In addition, the use of real-time HRV feedback to increase self-regulatory capacity is reviewed. We conclude that the heart's rhythms are characterized by both complexity and stability over longer time scales that reflect both physiological and psychological functional status of these internal self-regulatory systems. PMID:25694852

  18. Transcription factor-microRNA synergistic regulatory network revealing the mechanism of polycystic ovary syndrome

    PubMed Central

    LIU, HAI-YING; HUANG, YU-LING; LIU, JIAN-QIAO; HUANG, QING

    2016-01-01

    Polycystic ovary syndrome (PCOS) is the most common type of endocrine disorder, affecting 5–11% of women of reproductive age worldwide. Transcription factors (TFs) and microRNAs are considered to have crucial roles in the developmental process of several diseases and have synergistic regulatory actions. However, the effects of TFs and microRNAs, and the patterns of their cooperation in the synergistic regulatory network of PCOS, remain to be elucidated. The present study aimed to determine the possible mechanism of PCOS, based on a TF-microRNA synergistic regulatory network. Initially, the differentially expressed genes (DEGs) in PCOS were identified using microarray data of the GSE34526 dataset. Subsequently, the TFs and microRNAs which regulated the DEGs of PCOS were identified, and a PCOS-associated TF-microRNA synergistic regulatory network was constructed. This network included 195 DEGs, 136 TFs and 283 microRNAs, and the DEGs were regulated by TFs and microRNAs. Based on topological and functional enrichment analyses, SP1, mir-355-5p and JUN were identified as potentially crucial regulators in the development of PCOS and in characterizing the regulatory mechanism. In conclusion, the TF-microRNA synergistic regulatory network constructed in the present study provides novel insight on the molecular mechanism of PCOS in the form of synergistic regulated model. PMID:27035648

  19. Transcription factor‑microRNA synergistic regulatory network revealing the mechanism of polycystic ovary syndrome.

    PubMed

    Liu, Hai-Ying; Huang, Yu-Ling; Liu, Jian-Qiao; Huang, Qing

    2016-05-01

    Polycystic ovary syndrome (PCOS) is the most common type of endocrine disorder, affecting 5‑11% of women of reproductive age worldwide. Transcription factors (TFs) and microRNAs are considered to have crucial roles in the developmental process of several diseases and have synergistic regulatory actions. However, the effects of TFs and microRNAs, and the patterns of their cooperation in the synergistic regulatory network of PCOS, remain to be elucidated. The present study aimed to determine the possible mechanism of PCOS, based on a TF‑microRNA synergistic regulatory network. Initially, the differentially expressed genes (DEGs) in PCOS were identified using microarray data of the GSE34526 dataset. Subsequently, the TFs and microRNAs which regulated the DEGs of PCOS were identified, and a PCOS‑associated TF‑microRNA synergistic regulatory network was constructed. This network included 195 DEGs, 136 TFs and 283 microRNAs, and the DEGs were regulated by TFs and microRNAs. Based on topological and functional enrichment analyses, SP1, mir‑355‑5p and JUN were identified as potentially crucial regulators in the development of PCOS and in characterizing the regulatory mechanism. In conclusion, the TF‑microRNA synergistic regulatory network constructed in the present study provides novel insight on the molecular mechanism of PCOS in the form of synergistic regulated model. PMID:27035648

  20. Potential self-regulatory mechanisms of yoga for psychological health

    PubMed Central

    Gard, Tim; Noggle, Jessica J.; Park, Crystal L.; Vago, David R.; Wilson, Angela

    2014-01-01

    Research suggesting the beneficial effects of yoga on myriad aspects of psychological health has proliferated in recent years, yet there is currently no overarching framework by which to understand yoga’s potential beneficial effects. Here we provide a theoretical framework and systems-based network model of yoga that focuses on integration of top-down and bottom-up forms of self-regulation. We begin by contextualizing yoga in historical and contemporary settings, and then detail how specific components of yoga practice may affect cognitive, emotional, behavioral, and autonomic output under stress through an emphasis on interoception and bottom-up input, resulting in physical and psychological health. The model describes yoga practice as a comprehensive skillset of synergistic process tools that facilitate bidirectional feedback and integration between high- and low-level brain networks, and afferent and re-afferent input from interoceptive processes (somatosensory, viscerosensory, chemosensory). From a predictive coding perspective we propose a shift to perceptual inference for stress modulation and optimal self-regulation. We describe how the processes that sub-serve self-regulation become more automatized and efficient over time and practice, requiring less effort to initiate when necessary and terminate more rapidly when no longer needed. To support our proposed model, we present the available evidence for yoga affecting self-regulatory pathways, integrating existing constructs from behavior theory and cognitive neuroscience with emerging yoga and meditation research. This paper is intended to guide future basic and clinical research, specifically targeting areas of development in the treatment of stress-mediated psychological disorders. PMID:25368562

  1. The beginning of a seed: regulatory mechanisms of double fertilization

    PubMed Central

    Bleckmann, Andrea; Alter, Svenja; Dresselhaus, Thomas

    2014-01-01

    The launch of seed development in flowering plants (angiosperms) is initiated by the process of double fertilization: two male gametes (sperm cells) fuse with two female gametes (egg and central cell) to form the precursor cells of the two major seed components, the embryo and endosperm, respectively. The immobile sperm cells are delivered by the pollen tube toward the ovule harboring the female gametophyte by species-specific pollen tube guidance and attraction mechanisms. After pollen tube burst inside the female gametophyte, the two sperm cells fuse with the egg and central cell initiating seed development. The fertilized central cell forms the endosperm while the fertilized egg cell, the zygote, will form the actual embryo and suspensor. The latter structure connects the embryo with the sporophytic maternal tissues of the developing seed. The underlying mechanisms of double fertilization are tightly regulated to ensure delivery of functional sperm cells and the formation of both, a functional zygote and endosperm. In this review we will discuss the current state of knowledge about the processes of directed pollen tube growth and its communication with the synergid cells resulting in pollen tube burst, the interaction of the four gametes leading to cell fusion and finally discuss mechanisms how flowering plants prevent multiple sperm cell entry (polyspermy) to maximize their reproductive success. PMID:25309552

  2. Genetic control and regulatory mechanisms of succinoglycan and curdlan biosynthesis in genus Agrobacterium.

    PubMed

    Wu, Dan; Li, Ang; Ma, Fang; Yang, Jixian; Xie, Yutong

    2016-07-01

    Agrobacterium is a genus of gram-negative bacteria that can produce several typical exopolysaccharides with commercial uses in the food and pharmaceutical fields. In particular, succinoglycan and curdlan, due to their good quality in high yield, have been employed on an industrial scale comparatively early. Exopolysaccharide biosynthesis is a multiple-step process controlled by different functional genes, and various environmental factors cause changes in exopolysaccharide biosynthesis through regulatory mechanisms. In this mini-review, we focus on the genetic control and regulatory mechanisms of succinoglycan and curdlan produced by Agrobacterium. Some key functional genes and regulatory mechanisms for exopolysaccharide biosynthesis are described, possessing a high potential for application in metabolic engineering to modify exopolysaccharide production and physicochemical properties. This review may contribute to the understanding of exopolysaccharide biosynthesis and exopolysaccharide modification by metabolic engineering methods in Agrobacterium. PMID:27255488

  3. Structure of the TRPA1 ion channel suggests regulatory mechanisms

    PubMed Central

    Paulsen, Candice E.; Armache, Jean-Paul; Gao, Yuan; Cheng, Yifan; Julius, David

    2015-01-01

    The TRPA1 ion channel (a.k.a the ‘wasabi receptor’) is a detector of noxious chemical agents encountered in our environment or produced endogenously during tissue injury or drug metabolism. These include a broad class of electrophiles that activate the channel through covalent protein modification. TRPA1 antagonists hold potential for treating neurogenic inflammatory conditions provoked or exacerbated by irritant exposure. Despite compelling reasons to understand TRPA1 function, structural mechanisms underlying channel regulation remain obscure. Here, we use single-particle electron cryo-microscopy to determine the structure of full-length human TRPA1 to ~4Å resolution in the presence of pharmacophores, including a potent antagonist. A number of unexpected features are revealed, including an extensive coiled-coil assembly domain stabilized by polyphosphate co-factors and a highly integrated nexus that converges on an unpredicted TRP-like allosteric domain. These findings provide novel insights into mechanisms of TRPA1 regulation, and establish a blueprint for structure-based design of analgesic and anti-inflammatory agents. PMID:25855297

  4. Controlling the fire--tissue-specific mechanisms of effector regulatory T-cell homing.

    PubMed

    Chow, Zachary; Banerjee, Ashish; Hickey, Michael J

    2015-04-01

    Regulatory T cells have essential roles in regulating immune responses and limiting inappropriate inflammation. Evidence now indicates that to achieve this function, regulatory T cells must be able to migrate to the most appropriate locations within both lymphoid and non-lymphoid organs. This function is achieved via the spatiotemporally controlled expression of adhesion molecules and chemokine receptors, varying according to the developmental stage of the regulatory T cell and the location and environment where they undergo activation. In this Review, we summarise information on the roles of adhesion molecules and chemokine receptors in mediating regulatory T-cell migration and function throughout the body under homeostatic and inflammatory conditions. In addition, we review recent studies that have used in vivo imaging to examine the actions of regulatory T cells in vivo, in lymph nodes, in the microvasculature and in the interstitium of peripheral organs. These studies reveal that the capacity of regulatory T cells to undergo selective migration serves a critical role in their ability to suppress immune responses. As such, the cellular and molecular requirements of regulatory T-cell migration need to be completely understood to enable the most effective use of these cells in clinical settings. PMID:25582339

  5. A Cell-Regulatory Mechanism Involving Feedback between Contraction and Tissue Formation Guides Wound Healing Progression

    PubMed Central

    Valero, Clara; Javierre, Etelvina; García-Aznar, José Manuel; Gómez-Benito, María José

    2014-01-01

    Wound healing is a process driven by cells. The ability of cells to sense mechanical stimuli from the extracellular matrix that surrounds them is used to regulate the forces that cells exert on the tissue. Stresses exerted by cells play a central role in wound contraction and have been broadly modelled. Traditionally, these stresses are assumed to be dependent on variables such as the extracellular matrix and cell or collagen densities. However, we postulate that cells are able to regulate the healing process through a mechanosensing mechanism regulated by the contraction that they exert. We propose that cells adjust the contraction level to determine the tissue functions regulating all main activities, such as proliferation, differentiation and matrix production. Hence, a closed-regulatory feedback loop is proposed between contraction and tissue formation. The model consists of a system of partial differential equations that simulates the evolution of fibroblasts, myofibroblasts, collagen and a generic growth factor, as well as the deformation of the extracellular matrix. This model is able to predict the wound healing outcome without requiring the addition of phenomenological laws to describe the time-dependent contraction evolution. We have reproduced two in vivo experiments to evaluate the predictive capacity of the model, and we conclude that there is feedback between the level of cell contraction and the tissue regenerated in the wound. PMID:24681636

  6. Gap junction-mediated electrical transmission: regulatory mechanisms and plasticity

    PubMed Central

    Pereda, Alberto E.; Curti, Sebastian; Hoge, Gregory; Cachope, Roger; Flores, Carmen E.; Rash, John E.

    2012-01-01

    The term synapse applies to cellular specializations that articulate the processing of information within neural circuits by providing a mechanism for the transfer of information between two different neurons. There are two main modalities of synaptic transmission: chemical and electrical. While most efforts have been dedicated to the understanding of the properties and modifiability of chemical transmission, less is still known regarding the plastic properties of electrical synapses, whose structural correlate is the gap junction. A wealth of data indicates that, rather than passive intercellular channels, electrical synapses are more dynamic and modifiable than was generally perceived. This article will discuss the factors determining the strength of electrical transmission and review current evidence demonstrating its dynamic properties. Like their chemical counterparts, electrical synapses can also be plastic and modifiable. PMID:22659675

  7. Transcriptional and Epigenetic Regulatory Mechanisms Affecting HTLV-1 Provirus

    PubMed Central

    Miyazato, Paola; Matsuo, Misaki; Katsuya, Hiroo; Satou, Yorifumi

    2016-01-01

    Human T-cell leukemia virus type 1 (HTLV-1) is a retrovirus associated with human diseases, such as adult T-cell leukemia (ATL) and HTLV-1-associated myelopathy/Tropic spastic paraparesis (HAM/TSP). As a retrovirus, its life cycle includes a step where HTLV-1 is integrated into the host genomic DNA and forms proviral DNA. In the chronic phase of the infection, HTLV‑1 is known to proliferate as a provirus via the mitotic division of the infected host cells. There are generally tens of thousands of infected clones within an infected individual. They exist not only in peripheral blood, but also in various lymphoid organs. Viral proteins encoded in HTLV-1 genome play a role in the proliferation and survival of the infected cells. As is the case with other chronic viral infections, HTLV-1 gene expression induces the activation of the host immunity against the virus. Thus, the transcription from HTLV-1 provirus needs to be controlled in order to evade the host immune surveillance. There should be a dynamic and complex regulation in vivo, where an equilibrium between viral antigen expression and host immune surveillance is achieved. The mechanisms regulating viral gene expression from the provirus are a key to understanding the persistent/latent infection with HTLV-1 and its pathogenesis. In this article, we would like to review our current understanding on this topic. PMID:27322309

  8. Novel RNA regulatory mechanisms revealed in the epitranscriptome.

    PubMed

    Saletore, Yogesh; Chen-Kiang, Selina; Mason, Christopher E

    2013-03-01

    Methyl-6-adenosine (m (6)A) has been hypothesized to exist since the 1970s, (1) but little has been known about the specific RNAs, or sites within them, that are affected by this RNA modification. Here, we report that recent work has shown RNA modifications like m (6)A, collectively called the "epitranscriptome," are a pervasive feature of mammalian cells and likely play a role in development and disease. An enrichment of m (6)A near the last CDS of thousands of genes has implicated m (6)A in transcript processing, translational regulation and potentially a mechanism for regulating miRNA maturation. Also, because the sites of m (6)A show strong evolutionary conservation and have been replicated in nearly identical sites between mouse and human, strong evolutionary pressures are likely being maintained for this mark. (2)(,) (3) Finally, we note that m (6)A is one of over 100 modifications of RNA that have been reported, (4) and with the combination of high-throughput, next-generation sequencing (NGS) techniques, immunoprecipitation with appropriate antibodies and splicing-aware peak-finding, the dynamics of the epitranscriptome can now be mapped and characterized to discern their specific cellular roles. PMID:23434792

  9. Transcriptional and Epigenetic Regulatory Mechanisms Affecting HTLV-1 Provirus.

    PubMed

    Miyazato, Paola; Matsuo, Misaki; Katsuya, Hiroo; Satou, Yorifumi

    2016-01-01

    Human T-cell leukemia virus type 1 (HTLV-1) is a retrovirus associated with human diseases, such as adult T-cell leukemia (ATL) and HTLV-1-associated myelopathy/Tropic spastic paraparesis (HAM/TSP). As a retrovirus, its life cycle includes a step where HTLV-1 is integrated into the host genomic DNA and forms proviral DNA. In the chronic phase of the infection, HTLV‑1 is known to proliferate as a provirus via the mitotic division of the infected host cells. There are generally tens of thousands of infected clones within an infected individual. They exist not only in peripheral blood, but also in various lymphoid organs. Viral proteins encoded in HTLV-1 genome play a role in the proliferation and survival of the infected cells. As is the case with other chronic viral infections, HTLV-1 gene expression induces the activation of the host immunity against the virus. Thus, the transcription from HTLV-1 provirus needs to be controlled in order to evade the host immune surveillance. There should be a dynamic and complex regulation in vivo, where an equilibrium between viral antigen expression and host immune surveillance is achieved. The mechanisms regulating viral gene expression from the provirus are a key to understanding the persistent/latent infection with HTLV-1 and its pathogenesis. In this article, we would like to review our current understanding on this topic. PMID:27322309

  10. Cis-regulatory mechanisms governing stem and progenitor cell transitions

    PubMed Central

    Johnson, Kirby D.; Kong, Guangyao; Gao, Xin; Chang, Yuan-I; Hewitt, Kyle J.; Sanalkumar, Rajendran; Prathibha, Rajalekshmi; Ranheim, Erik A.; Dewey, Colin N.; Zhang, Jing; Bresnick, Emery H.

    2015-01-01

    Cis-element encyclopedias provide information on phenotypic diversity and disease mechanisms. Although cis-element polymorphisms and mutations are instructive, deciphering function remains challenging. Mutation of an intronic GATA motif (+9.5) in GATA2, encoding a master regulator of hematopoiesis, underlies an immunodeficiency associated with myelodysplastic syndrome (MDS) and acute myeloid leukemia (AML). Whereas an inversion relocalizes another GATA2 cis-element (−77) to the proto-oncogene EVI1, inducing EVI1 expression and AML, whether this reflects ectopic or physiological activity is unknown. We describe a mouse strain that decouples −77 function from proto-oncogene deregulation. The −77−/− mice exhibited a novel phenotypic constellation including late embryonic lethality and anemia. The −77 established a vital sector of the myeloid progenitor transcriptome, conferring multipotentiality. Unlike the +9.5−/− embryos, hematopoietic stem cell genesis was unaffected in −77−/− embryos. These results illustrate a paradigm in which cis-elements in a locus differentially control stem and progenitor cell transitions, and therefore the individual cis-element alterations cause unique and overlapping disease phenotypes. PMID:26601269

  11. MYCN-driven regulatory mechanisms controlling LIN28B in neuroblastoma

    PubMed Central

    Beckers, Anneleen; Van Peer, Gert; Carter, Daniel R.; Gartlgruber, Moritz; Herrmann, Carl; Agarwal, Saurabh; Helsmoortel, Hetty H.; Althoff, Kristina; Molenaar, Jan J.; Cheung, Belamy B.; Schulte, Johannes H.; Benoit, Yves; Shohet, Jason M.; Westermann, Frank; Marshall, Glenn M.; Vandesompele, Jo; De Preter, Katleen; Speleman, Frank

    2016-01-01

    LIN28B has been identified as an oncogene in various tumor entities, including neuroblastoma, a childhood cancer that originates from neural crest-derived cells, and is characterized by amplification of the MYCN oncogene. Recently, elevated LIN28B expression levels were shown to contribute to neuroblastoma tumorigenesis via let-7 dependent de-repression of MYCN. However, additional insight in the regulation of LIN28B in neuroblastoma is lacking. Therefore, we have performed a comprehensive analysis of the regulation of LIN28B in neuroblastoma, with a specific focus on the contribution of miRNAs. We show that MYCN regulates LIN28B expression in neuroblastoma tumors via two distinct parallel mechanisms. First, through an unbiased LIN28B-3′UTR reporter screen, we found that miR-26a-5p and miR-26b-5p regulate LIN28B expression. Next, we demonstrated that MYCN indirectly affects the expression of miR-26a-5p, and hence regulates LIN28B, therefor establishing a MYCN-miR-26a-5p-LIN28B regulatory axis. Second, we provide evidence that MYCN regulates LIN28B expression via interaction with the LIN28B promotor, establishing a direct MYCN-LIN28B regulatory axis. We believe that these findings mark LIN28B as an important effector of the MYCN oncogenic phenotype and underlines the importance of MYCN-regulated miRNAs in establishing the MYCN-driven oncogenic process. PMID:26123663

  12. Structural insights into the regulatory mechanism of the Pseudomonas aeruginosa YfiBNR system.

    PubMed

    Xu, Min; Yang, Xuan; Yang, Xiu-An; Zhou, Lei; Liu, Tie-Zheng; Fan, Zusen; Jiang, Tao

    2016-06-01

    YfiBNR is a recently identified bis-(3'-5')-cyclic dimeric GMP (c-di-GMP) signaling system in opportunistic pathogens. It is a key regulator of biofilm formation, which is correlated with prolonged persistence of infection and antibiotic drug resistance. In response to cell stress, YfiB in the outer membrane can sequester the periplasmic protein YfiR, releasing its inhibition of YfiN on the inner membrane and thus provoking the diguanylate cyclase activity of YfiN to induce c-di-GMP production. However, the detailed regulatory mechanism remains elusive. Here, we report the crystal structures of YfiB alone and of an active mutant YfiB(L43P) complexed with YfiR with 2:2 stoichiometry. Structural analyses revealed that in contrast to the compact conformation of the dimeric YfiB alone, YfiB(L43P) adopts a stretched conformation allowing activated YfiB to penetrate the peptidoglycan (PG) layer and access YfiR. YfiB(L43P) shows a more compact PG-binding pocket and much higher PG binding affinity than wild-type YfiB, suggesting a tight correlation between PG binding and YfiB activation. In addition, our crystallographic analyses revealed that YfiR binds Vitamin B6 (VB6) or L-Trp at a YfiB-binding site and that both VB6 and L-Trp are able to reduce YfiB(L43P)-induced biofilm formation. Based on the structural and biochemical data, we propose an updated regulatory model of the YfiBNR system. PMID:27113583

  13. Sparse Additive Ordinary Differential Equations for Dynamic Gene Regulatory Network Modeling.

    PubMed

    Wu, Hulin; Lu, Tao; Xue, Hongqi; Liang, Hua

    2014-04-01

    The gene regulation network (GRN) is a high-dimensional complex system, which can be represented by various mathematical or statistical models. The ordinary differential equation (ODE) model is one of the popular dynamic GRN models. High-dimensional linear ODE models have been proposed to identify GRNs, but with a limitation of the linear regulation effect assumption. In this article, we propose a sparse additive ODE (SA-ODE) model, coupled with ODE estimation methods and adaptive group LASSO techniques, to model dynamic GRNs that could flexibly deal with nonlinear regulation effects. The asymptotic properties of the proposed method are established and simulation studies are performed to validate the proposed approach. An application example for identifying the nonlinear dynamic GRN of T-cell activation is used to illustrate the usefulness of the proposed method. PMID:25061254

  14. Mechanisms underlying the additive and redundant Qrr phenotypes in Vibrio harveyi and Vibrio cholerae.

    PubMed

    Hunter, Geoffrey A M; Keener, James P

    2014-01-01

    Vibrio harveyi and Vibrio cholerae regulate their virulence factors according to the local cell-population density in a regulatory system called quorum sensing. Their quorum sensing systems contain a small RNA (sRNA) circuit to regulate expression of a master transcriptional regulator via multiple quorum regulated RNA (Qrr) and a protein chaperon Hfq. Experiments and genetic analysis show that their respective quorum sensing networks are topologically equivalent and have homologous components, yet they respond differently to the same experimental conditions. In particular, V. harveyi Qrr are additive because all of its Qrr are required to maintain wild-type-like repression of its master transcriptional regulator. Conversely, V. cholerae Qrr are redundant because any of its Qrr is sufficient to repress its master transcriptional regulator. Given the striking similarities between their quorum sensing systems, experimentalists have been unable to identify conclusively the mechanisms behind these phenotypic differences. Nevertheless, the current hypothesis in the literature is that dosage compensation is the mechanism underlying redundancy. In this work, we identify the mechanisms underlying Qrr redundancy using a detailed mathematical model of the V. harveyi and V. cholerae sRNA circuits. We show that there are exactly two different cases underlying Qrr redundancy and that dosage compensation is unnecessary and insufficient to explain Qrr redundancy. Although V. harveyi Qrr are additive when the perturbations in Qrr are large, we predict that V. harveyi and V. cholerae Qrr are redundant when the perturbations in Qrr are small. We argue that the additive and redundant Qrr phenotypes can emerge from parametric differences in the sRNA circuit. In particular, we find that the affinity of Qrr and its expression relative to the master transcriptional regulator determine the level of redundancy in V. harveyi and V. cholerae. Furthermore, the additive and redundant Qrr

  15. Mechanisms of allergen-specific immunotherapy: T-regulatory cells and more.

    PubMed

    Verhagen, Johan; Blaser, Kurt; Akdis, Cezmi A; Akdis, Mübeccel

    2006-05-01

    Activation-induced cell death, anergy, or immune response modulation by regulatory T cells (Treg cells) are essential mechanisms of peripheral T-cell tolerance. Genetic predisposition and environmental instructions tune thresholds for the activation of T cells, other inflammatory cells, and resident tissue cells in allergic diseases. Skewing allergen-specific effector T cells to a Treg-cell phenotype seems to be crucial in maintaining a healthy immune response to allergens and successful allergen-specific immunotherapy. The Treg-cell response is characterized by an abolished allergen-specific T-cell proliferation and the suppressed secretion of T-helper 1- and T-helper 2-type cytokines. Suppressed proliferative and cytokine responses against allergens are induced by multiple suppressor factors, including cytokines such as interleukin-10 (IL-10) and transforming growth factor beta (TGF-beta), and cell surface molecules such as cytotoxic T-lymphocyte antigen-4, programmed death-1, and histamine receptor 2. The increased levels of IL-10 and TGF-beta produced by Treg cells potently suppress IgE production while simultaneously increasing the production of noninflammatory isotypes IgG4 and IgA, respectively. In addition, Treg cells directly or indirectly suppress the activity of effector cells of allergic inflammation, such as mast cells, basophils, and eosinophils. In conclusion, peripheral tolerance to allergens is controlled by multiple active suppression mechanisms on T cells, regulation of antibody isotypes, and suppression of effector cells. The application of current knowledge of Treg cells and related mechanisms of peripheral tolerance may soon lead to more rational and safer approaches to the prevention and cure of allergic disease. PMID:16701141

  16. Multiple regulatory mechanisms in the chloroplast of green algae: relation to hydrogen production.

    PubMed

    Antal, Taras K; Krendeleva, Tatyana E; Tyystjärvi, Esa

    2015-09-01

    A complex regulatory network in the chloroplast of green algae provides an efficient tool for maintenance of energy and redox balance in the cell under aerobic and anaerobic conditions. In this review, we discuss the structural and functional organizations of electron transport pathways in the chloroplast, and regulation of photosynthesis in the green microalga Chlamydomonas reinhardtii. The focus is on the regulatory mechanisms induced in response to nutrient deficiency stress and anoxia and especially on the role of a hydrogenase-mediated reaction in adaptation to highly reducing conditions and ATP deficiency in the cell. PMID:25986411

  17. Control and regulatory mechanisms associated with thermogenesis in flying insects and birds.

    PubMed

    Loli, Denise; Bicudo, José Eduardo P W

    2005-01-01

    Most insects and birds are able to fly. The chitin made exoskeleton of insects poses them several constraints, and this is one the reasons they are in general small sized animals. On the other hand, because birds possess an endoskeleton made of bones they may grow much larger when compared to insects. The two taxa are quite different with regards to their general "design" platform, in particular with respect to their respiratory and circulatory systems. However, because they fly, they may share in common several traits, namely those associated with the control and regulatory mechanisms governing thermogenesis. High core temperatures are essential for animal flight irrespective of the taxa they belong to. Birds and insects have thus evolved mechanisms which allowed them to control and regulate high rates of heat fluxes. This article discusses possible convergent thermogenic control and regulatory mechanisms associated with flight in insects and birds. PMID:16283551

  18. A mechanism for expansion of regulatory T cell repertoire and its role in self tolerance

    PubMed Central

    Shugay, Mikhail; Putintseva, Ekaterina V; Osmanbeyoglu, Hatice U; Dikiy, Stanislav; Hoyos, Beatrice E; Moltedo, Bruno; Hemmers, Saskia; Treuting, Piper; Leslie, Christina S; Chudakov, Dmitriy M; Rudensky, Alexander Y

    2015-01-01

    SUMMARY T cell receptor (TCR) signaling plays a key role in T cell fate determination. Precursor cells expressing TCRs within a certain low affinity range for self peptide-MHC complexes undergo positive selection and differentiate into naïve T cells expressing a highly diverse self-MHC restricted TCR repertoire. In contrast, precursors displaying TCRs with a high affinity for “self” are either eliminated through TCR agonist induced apoptosis (negative selection)1 or restrained by regulatory CD4+ T (Treg) cells, whose differentiation and function are controlled by the X-chromosome encoded transcription factor Foxp3 (review2). Foxp3 is expressed in a fraction of self-reactive T cells that escape negative selection in response to agonist driven TCR signals combined with interleukin-2 (IL-2) receptor signaling. In addition to Treg cells, TCR agonist-driven selection results in the generation of several other specialized T cell lineages like NKT and MAIT cells3. Although the latter exhibit a restricted TCR repertoire, Treg cells display a highly diverse collection of TCRs4-6, Here we explored whether a specialized mechanism enables agonist driven selection of Treg cells with a diverse TCR repertoire and its significance for self-tolerance. We found that intronic Foxp3 enhancer CNS3 acts as an epigenetic switch that confers a poised state to the Foxp3 promoter in precursor cells to make Treg cell lineage commitment responsive to a broad range of TCR stimuli, particularly to suboptimal ones. CNS3-dependent expansion of the TCR repertoire enables Treg cells to effectively control self-reactive T cells, especially when thymic negative selection was genetically impaired. Our findings highlight the complementary roles of these two main mechanisms of self-tolerance. PMID:26605529

  19. Regulatory mechanisms of immune tolerance in type 1 diabetes and their failures.

    PubMed

    Kuhn, Chantal; Besançon, Alix; Lemoine, Sébastien; You, Sylvaine; Marquet, Cindy; Candon, Sophie; Chatenoud, Lucienne

    2016-07-01

    In this brief review we propose to discuss salient data showing the importance of immune regulatory mechanisms, and in particular of Treg, for the control of pathogenic anti-β-cell response in autoimmune diabetes. Disease progression that culminates with the massive destruction of insulin-secreting β-cells and advent of hyperglycemia and glycosuria tightly correlates with a functional deficit in immune regulation. Better dissection of the cellular and molecular mechanisms through which the immune system normally sustains tolerance to "self", and which become defective when autoimmune aggression is overt, is the only direct and robust way to learn how to harness these effectively, so as to restore immune tolerance in patients with insulin-dependent type 1 diabetes. No doubt that regulatory T cells are a privileged mechanism underlying this self-tolerance in the periphery. The discovery of the key role of the transcription factor FoxP3, represented the cornerstone leading to the great advances in the field we are witnessing today. Type 1 diabetes is certainly one of the prototypic T cell-mediated autoimmune diseases where immune regulatory mechanisms relying on specialized subsets of T cells have been the most thoroughly analyzed from the fundamental point of view and also largely exploited in a translational therapeutic perspective. PMID:27216249

  20. CHOOSING A CHEMICAL MECHANISM FOR REGULATORY AND RESEARCH AIR QUALITY MODELING APPLICATIONS

    EPA Science Inventory

    There are numerous, different chemical mechanisms currently available for use in air quality models, and new mechanisms and versions of mechanisms are continually being developed. The development of Morphecule-type mechanisms will add a near-infinite number of additional mecha...

  1. Modeling the Regulatory Mechanisms by Which NLRX1 Modulates Innate Immune Responses to Helicobacter pylori Infection

    PubMed Central

    Philipson, Casandra W.; Bassaganya-Riera, Josep; Viladomiu, Monica; Kronsteiner, Barbara; Abedi, Vida; Hoops, Stefan; Michalak, Pawel; Kang, Lin; Girardin, Stephen E.; Hontecillas, Raquel

    2015-01-01

    Helicobacter pylori colonizes half of the world’s population as the dominant member of the gastric microbiota resulting in a lifelong chronic infection. Host responses toward the bacterium can result in asymptomatic, pathogenic or even favorable health outcomes; however, mechanisms underlying the dual role of H. pylori as a commensal versus pathogenic organism are not well characterized. Recent evidence suggests mononuclear phagocytes are largely involved in shaping dominant immunity during infection mediating the balance between host tolerance and succumbing to overt disease. We combined computational modeling, bioinformatics and experimental validation in order to investigate interactions between macrophages and intracellular H. pylori. Global transcriptomic analysis on bone marrow-derived macrophages (BMDM) in a gentamycin protection assay at six time points unveiled the presence of three sequential host response waves: an early transient regulatory gene module followed by sustained and late effector responses. Kinetic behaviors of pattern recognition receptors (PRRs) are linked to differential expression of spatiotemporal response waves and function to induce effector immunity through extracellular and intracellular detection of H. pylori. We report that bacterial interaction with the host intracellular environment caused significant suppression of regulatory NLRC3 and NLRX1 in a pattern inverse to early regulatory responses. To further delineate complex immune responses and pathway crosstalk between effector and regulatory PRRs, we built a computational model calibrated using time-series RNAseq data. Our validated computational hypotheses are that: 1) NLRX1 expression regulates bacterial burden in macrophages; and 2) early host response cytokines down-regulate NLRX1 expression through a negative feedback circuit. This paper applies modeling approaches to characterize the regulatory role of NLRX1 in mechanisms of host tolerance employed by macrophages to

  2. Type 1 regulatory T cells: a new mechanism of peripheral immune tolerance.

    PubMed

    Zeng, Hanyu; Zhang, Rong; Jin, Boquan; Chen, Lihua

    2015-09-01

    The lack of immune response to an antigen, a process known as immune tolerance, is essential for the preservation of immune homeostasis. To date, two mechanisms that drive immune tolerance have been described extensively: central tolerance and peripheral tolerance. Under the new nomenclature, thymus-derived regulatory T (tT(reg)) cells are the major mediators of central immune tolerance, whereas peripherally derived regulatory T (pT(reg)) cells function to regulate peripheral immune tolerance. A third type of T(reg) cells, termed iT(reg), represents only the in vitro-induced T(reg) cells(1). Depending on whether the cells stably express Foxp3, pT(reg), and iT(reg) cells may be divided into two subsets: the classical CD4(+)Foxp3(+) T(reg) cells and the CD4(+)Foxp3(-) type 1 regulatory T (Tr1) cells(2). This review focuses on the discovery, associated biomarkers, regulatory functions, methods of induction, association with disease, and clinical trials of Tr1 cells. PMID:26051475

  3. Regulatory mechanisms underlying sepsis progression in patients with tumor necrosis factor-α genetic variations

    PubMed Central

    LIU, YANGZHOU; HAN, NING; LI, QINCHUAN; LI, ZENGCHUN

    2016-01-01

    The present study aimed to investigate the regulatory mechanisms underlying sepsis progression in patients with tumor necrosis factor (TNF)-α genetic variations. The GSE5760 expression profile data, which was downloaded from the Gene Expression Omnibus database, contained 30 wild-type (WT) and 28 mutation (MUT) samples. Differentially expressed genes (DEGs) between the two types of samples were identified using the Student's t-test, and the corresponding microRNAs (miRNAs) were screened using WebGestalt software. An integrated miRNA-DEG network was constructed using the Cytoscape software, based on the interactions between the DEGs, as identified using the Search Tool for the Retrieval of Interacting Genes/Proteins database, and the correlation between miRNAs and their target genes. Furthermore, Gene Ontology and pathway enrichment analyses were conducted for the DEGs using the Database for Annotation, Visualization and Integrated Discovery and the KEGG Orthology Based Annotation System, respectively. A total of 390 DEGS between the WT and MUT samples, along with 11 -associated miRNAs, were identified. The integrated miRNA-DEG network consisted of 38 DEGs and 11 miRNAs. Within this network, COPS2 was found to be associated with transcriptional functions, while FUS was found to be involved in mRNA metabolic processes. Other DEGs, including FBXW7 and CUL3, were enriched in the ubiquitin-mediated proteolysis pathway. In addition, miR-15 was predicted to target COPS2 and CUL3. The results of the present study suggested that COPS2, FUS, FBXW7 and CUL3 may be associated with sepsis in patients with TNF-α genetic variations. In the progression of sepsis, FBXW7 and CUL3 may participate in the ubiquitin-mediated proteolysis pathway, whereas COPS2 may regulate the phosphorylation and ubiquitination of the FUS protein. Furthermore, COPS2 and CUL3 may be novel targets of miR-15. PMID:27347057

  4. Nitrous Oxide Metabolism in Nitrate-Reducing Bacteria: Physiology and Regulatory Mechanisms.

    PubMed

    Torres, M J; Simon, J; Rowley, G; Bedmar, E J; Richardson, D J; Gates, A J; Delgado, M J

    2016-01-01

    Nitrous oxide (N2O) is an important greenhouse gas (GHG) with substantial global warming potential and also contributes to ozone depletion through photochemical nitric oxide (NO) production in the stratosphere. The negative effects of N2O on climate and stratospheric ozone make N2O mitigation an international challenge. More than 60% of global N2O emissions are emitted from agricultural soils mainly due to the application of synthetic nitrogen-containing fertilizers. Thus, mitigation strategies must be developed which increase (or at least do not negatively impact) on agricultural efficiency whilst decrease the levels of N2O released. This aim is particularly important in the context of the ever expanding population and subsequent increased burden on the food chain. More than two-thirds of N2O emissions from soils can be attributed to bacterial and fungal denitrification and nitrification processes. In ammonia-oxidizing bacteria, N2O is formed through the oxidation of hydroxylamine to nitrite. In denitrifiers, nitrate is reduced to N2 via nitrite, NO and N2O production. In addition to denitrification, respiratory nitrate ammonification (also termed dissimilatory nitrate reduction to ammonium) is another important nitrate-reducing mechanism in soil, responsible for the loss of nitrate and production of N2O from reduction of NO that is formed as a by-product of the reduction process. This review will synthesize our current understanding of the environmental, regulatory and biochemical control of N2O emissions by nitrate-reducing bacteria and point to new solutions for agricultural GHG mitigation. PMID:27134026

  5. Analysis of regulatory mechanism after ErbB4 gene mutation based on local modeling methodology.

    PubMed

    Chen, C L; Zhao, J W

    2016-01-01

    ErbB4 is an oncogene belonging to the epidermal growth factor receptor family and contributes to the occurrence and development of multiple cancers, such as gastric, breast, and colorectal cancers. Therefore, studies of the regulation of ErbB4 in cancerigenic pathway will advance molecular targeted therapy. Advanced bioinformatic analysis softwares, such as ExPASy, Predictprotei, QUARK, and I-TASSER, were used to analyze the regulatory mechanism after ErbB4 gene mutation in terms of amino acid sequence, primary, secondary, and tertiary structure of the protein and upstream-downstream receptor/ligands. Mutation of the 19th and 113th amino acids at the carboxyl terminus of ErbB4 protein did not affect its biological nature, but its secondary structure changed and protein binding sites were near 2 mutational sites; moreover, after mutation introduction, additional binding sites were observed. Tertiary structure modeling indicated that local structure of ErbB4 was changed from an α helical conformation into a β chain folding structure; the α helical conformation is the functional site of protein, while active sites are typically near junctions between helical regions, thus the helical structures are easily destroyed and change into folding structures or other structures after stretching. Mutable sites of ErbB4 is exact binding sites where dimer formed with other epidermal growth factor family proteins; mutation enabled the ErbB4 receptor to bind to neuregulin 1 ligand without dimer formation, disrupting the signal transduction pathway and affecting ErbB4 function. PMID:27323039

  6. A SerpinB1 regulatory mechanism is essential for restricting NETosis

    PubMed Central

    Farley, Kalamo; Stolley, J Michael; Zhao, Picheng; Cooley, Jessica; Remold-O’Donnell, Eileen

    2014-01-01

    NETosis (NET generation), a programmed death pathway initiated in mature neutrophils by pathogens and inflammatory mediators, can be a protective process that sequesters microbes and prevents spread of infection, but can also be a pathological process that causes inflammation and serious tissue injury. Little is known about the regulatory mechanism. Previously we demonstrated that serpinb1-deficient mice are highly susceptible to pulmonary bacterial and viral infections due to inflammation and tissue injury associated with increased neutrophilic death. Here we used in vitro and in vivo approaches to investigate whether SerpinB1 regulates NETosis. We found that serpinb1-deficient bone marrow and lung neutrophils are hyper-susceptible to NETosis induced by multiple mediators in both NADPH-dependent and independent manner, indicating a deeply rooted regulatory role in NETosis. This role is further supported by increased nuclear expansion (representing chromatin decondensation) of PMA-treated serpinb-1-deficient neutrophils compared to wild-type, by migration of SerpinB1 from the cytoplasm to the nucleus of human neutrophils coincident with, or before, early conversion of lobulated (segmented) nuclei to delobulated (spherical) morphology, and by finding that exogenous rSerpinB1 abrogates NET production. NETosis of serpinb1-deficient neutrophils is also increased in vivo during Pseudomonas aeruginosa lung infection. The findings identify a previously unrecognized regulatory mechanism involving SerpinB1 that restricts the production of NETs. PMID:23002442

  7. Novel Regulatory Mechanisms of Pathogenicity and Virulence to Combat MDR in Candida albicans

    PubMed Central

    Hameed, Saif; Fatima, Zeeshan

    2013-01-01

    Continuous deployment of antifungals in treating infections caused by dimorphic opportunistic pathogen Candida albicans has led to the emergence of drug resistance resulting in cross-resistance to many unrelated drugs, a phenomenon termed multidrug resistance (MDR). Despite the current understanding of major factors which contribute to MDR mechanisms, there are many lines of evidence suggesting that it is a complex interplay of multiple factors which may be contributed by still unknown mechanisms. Coincidentally with the increased usage of antifungal drugs, the number of reports for antifungal drug resistance has also increased which further highlights the need for understanding novel molecular mechanisms which can be explored to combat MDR, namely, ROS, iron, hypoxia, lipids, morphogenesis, and transcriptional and signaling networks. Considering the worrying evolution of MDR and significance of C. albicans being the most prevalent human fungal pathogen, this review summarizes these new regulatory mechanisms which could be exploited to prevent MDR development in C. albicans as established from recent studies. PMID:24163696

  8. Multiple posttranscriptional regulatory mechanisms partner to control ethanolamine utilization in Enterococcus faecalis

    PubMed Central

    Fox, Kristina A.; Ramesh, Arati; Stearns, Jennifer E.; Bourgogne, Agathe; Reyes-Jara, Angelica; Winkler, Wade C.; Garsin, Danielle A.

    2009-01-01

    Ethanolamine, a product of the breakdown of phosphatidylethanolamine from cell membranes, is abundant in the human intestinal tract and in processed foods. Effective utilization of ethanolamine as a carbon and nitrogen source may provide a survival advantage to bacteria that inhabit the gastrointestinal tract and may influence the virulence of pathogens. In this work, we describe a unique series of posttranscriptional regulatory strategies that influence expression of ethanolamine utilization genes (eut) in Enterococcus, Clostridium, and Listeria species. One of these mechanisms requires an unusual 2-component regulatory system. Regulation involves specific sensing of ethanolamine by a sensor histidine kinase (EutW), resulting in autophosphorylation and subsequent phosphoryl transfer to a response regulator (EutV) containing a RNA-binding domain. Our data suggests that EutV is likely to affect downstream gene expression by interacting with conserved transcription termination signals located within the eut locus. Breakdown of ethanolamine requires adenosylcobalamin (AdoCbl) as a cofactor, and, intriguingly, we also identify an intercistronic AdoCbl riboswitch that has a predicted structure different from previously established AdoCbl riboswitches. We demonstrate that association of AdoCbl to this riboswitch prevents formation of an intrinsic transcription terminator element located within the intercistronic region. Together, these results suggest an intricate and carefully coordinated interplay of multiple regulatory strategies for control of ethanolamine utilization genes. Gene expression appears to be directed by overlapping posttranscriptional regulatory mechanisms, each responding to a particular metabolic signal, conceptually akin to regulation by multiple DNA-binding transcription factors. PMID:19246383

  9. Regulatory mechanism of human vascular smooth muscle cell phenotypic transformation induced by NELIN.

    PubMed

    Pei, Changan; Qin, Shiyong; Wang, Minghai; Zhang, Shuguang

    2015-11-01

    Vascular disorders, including hypertension, atherosclerosis and restenosis, arise from dysregulation of vascular smooth muscle cell (VSMC) differentiation, which can be controlled by regulatory factors. The present study investigated the regulatory mechanism of the phenotypic transformation of human VSMCs by NELIN in order to evaluate its potential as a preventive and therapeutic of vascular disorders. An in vitro model of NELIN‑overexpressing VSMCs was prepared by transfection with a lentiviral (LV) vector (NELIN‑VSMCs) and NELIN was slienced using an a lentiviral vector with small interfering (si)RNA in another group (LV‑NELIN‑siRNA‑VSMCs). The effects of NELIN overexpression or knockdown on the phenotypic transformation of human VSMCs were observed, and its regulatory mechanism was studied. Compared with the control group, cells in the NELIN‑VSMCs group presented a contractile phenotype with a significant increase of NELIN mRNA, NELIN protein, smooth muscle (SM)α‑actin and total Ras homolog gene family member A (RhoA) protein expression. The intra‑nuclear translocation of SMα‑actin‑serum response factor (SMα‑actin‑SRF) occurred in these cells simultaneously. Following exposure to Rho kinsase inhibitor Y‑27632, SRF and SMα‑actin expression decreased. However, cells in the LV‑NELIN‑siRNA‑VSMCs group presented a synthetic phenotype, and the expression of NELIN mRNA, NELIN protein, SMα‑actin protein and total RhoA protein was decreased. The occurrence of SRF extra‑nuclear translocation was observed. In conclusion, the present study suggested that NELIN was able to activate regulatory factors of SMα‑actin, RhoA and SRF successively in human VSMCs cultured in vitro. Furthermore, NELIN‑induced phenotypic transformation of human VSMCs was regulated via the RhoA/SRF signaling pathway. The results of the present study provide a foundation for the use of NELIN in preventive and therapeutic treatment of vascular remodeling

  10. Identification of genes involved in regulatory mechanism of pigments in broiler chickens.

    PubMed

    Tarique, T M; Yang, S; Mohsina, Z; Qiu, J; Yan, Z; Chen, G; Chen, A

    2014-01-01

    Chicken is an important model organism that unites the evolutionary gap between mammals and other vertebrates and provide major source of protein from meat and eggs for all over the world population. However, specific genes underlying the regulatory mechanism of broiler pigmentation have not yet been determined. In order to better understand the genes involved in the mechanism of pigmentation in the muscle tissues of broilers, the Affymetrix microarray hybridization experiment platform was used to identify gene expression profiles at 7 weeks of age. Broilers fed canthaxanthin, natural lutein, and orangeII pigments (100 mg/kg) were used to explore gene expression profiles). Our data showed that the 7th week of age was a very important phase with regard to gene expression profiles. We identified a number of differentially expressed genes; in canthaxanthin, natural lutein, and orangeII, there were 54 (32 upregulated and 22 downregulated), 23 (15 upregulated and 8 downregulated), and 7 (5 upregulated and 2 downregulated) known genes, respectively. Our data indicate that the numbers of differentially expressed genes were more upregulated than downregulated, and several genes showed conserved signaling to previously known functions. Thus, functional characterization of differentially expressed genes revealed several categories that are involved in important biological processes, including pigmentation, growth, molecular mechanisms, fat metabolism, cell proliferation, immune response, lipid metabolism, and protein synthesis and degradation. The results of the present study demonstrate that the genes associated with canthaxanthin, natural lutein, and orangeII are key regulatory genes that control the regulatory mechanisms of pigmentation. PMID:25222226

  11. USP1 deubiquitinase: cellular functions, regulatory mechanisms and emerging potential as target in cancer therapy

    PubMed Central

    2013-01-01

    Reversible protein ubiquitination is emerging as a key process for maintaining cell homeostasis, and the enzymes that participate in this process, in particular E3 ubiquitin ligases and deubiquitinases (DUBs), are increasingly being regarded as candidates for drug discovery. Human DUBs are a group of approximately 100 proteins, whose cellular functions and regulatory mechanisms remain, with some exceptions, poorly characterized. One of the best-characterized human DUBs is ubiquitin-specific protease 1 (USP1), which plays an important role in the cellular response to DNA damage. USP1 levels, localization and activity are modulated through several mechanisms, including protein-protein interactions, autocleavage/degradation and phosphorylation, ensuring that USP1 function is carried out in a properly regulated spatio-temporal manner. Importantly, USP1 expression is deregulated in certain types of human cancer, suggesting that USP1 could represent a valid target in cancer therapy. This view has gained recent support with the finding that USP1 inhibition may contribute to revert cisplatin resistance in an in vitro model of non-small cell lung cancer (NSCLC). Here, we describe the current knowledge on the cellular functions and regulatory mechanisms of USP1. We also summarize USP1 alterations found in cancer, combining data from the literature and public databases with our own data. Finally, we discuss the emerging potential of USP1 as a target, integrating published data with our novel findings on the effects of the USP1 inhibitor pimozide in combination with cisplatin in NSCLC cells. PMID:23937906

  12. Regulatory role of collagen V in establishing mechanical properties of tendons and ligaments is tissue dependent.

    PubMed

    Connizzo, Brianne K; Freedman, Benjamin R; Fried, Joanna H; Sun, Mei; Birk, David E; Soslowsky, Louis J

    2015-06-01

    Patients with classic (type I) Ehlers-Danlos syndrome (EDS), characterized by heterozygous mutations in the Col5a1 and Col5a2 genes, exhibit connective tissue hyperelasticity and recurrent joint dislocations, indicating a potential regulatory role for collagen V in joint stabilizing soft tissues. This study asked whether the contribution of collagen V to the establishment of mechanical properties is tissue dependent. We mechanically tested four different tissues from wild type and targeted collagen V-null mice: the flexor digitorum longus (FDL) tendon, Achilles tendon (ACH), the anterior cruciate ligament (ACL), and the supraspinatus tendon (SST). Area was significantly reduced in the Col5a1(ΔTen/ΔTen) group in the FDL, ACH, and SST. Maximum load and stiffness were reduced in the Col5a1(ΔTen/ΔTen) group for all tissues. However, insertion site and midsubstance modulus were reduced only for the ACL and SST. This study provides evidence that the regulatory role of collagen V in extracellular matrix assembly is tissue dependent and that joint instability in classic EDS may be caused in part by insufficient mechanical properties of the tendons and ligaments surrounding each joint. PMID:25876927

  13. Integrative functional genomics identifies regulatory mechanisms at coronary artery disease loci.

    PubMed

    Miller, Clint L; Pjanic, Milos; Wang, Ting; Nguyen, Trieu; Cohain, Ariella; Lee, Jonathan D; Perisic, Ljubica; Hedin, Ulf; Kundu, Ramendra K; Majmudar, Deshna; Kim, Juyong B; Wang, Oliver; Betsholtz, Christer; Ruusalepp, Arno; Franzén, Oscar; Assimes, Themistocles L; Montgomery, Stephen B; Schadt, Eric E; Björkegren, Johan L M; Quertermous, Thomas

    2016-01-01

    Coronary artery disease (CAD) is the leading cause of mortality and morbidity, driven by both genetic and environmental risk factors. Meta-analyses of genome-wide association studies have identified >150 loci associated with CAD and myocardial infarction susceptibility in humans. A majority of these variants reside in non-coding regions and are co-inherited with hundreds of candidate regulatory variants, presenting a challenge to elucidate their functions. Herein, we use integrative genomic, epigenomic and transcriptomic profiling of perturbed human coronary artery smooth muscle cells and tissues to begin to identify causal regulatory variation and mechanisms responsible for CAD associations. Using these genome-wide maps, we prioritize 64 candidate variants and perform allele-specific binding and expression analyses at seven top candidate loci: 9p21.3, SMAD3, PDGFD, IL6R, BMP1, CCDC97/TGFB1 and LMOD1. We validate our findings in expression quantitative trait loci cohorts, which together reveal new links between CAD associations and regulatory function in the appropriate disease context. PMID:27386823

  14. Integrative functional genomics identifies regulatory mechanisms at coronary artery disease loci

    PubMed Central

    Miller, Clint L.; Pjanic, Milos; Wang, Ting; Nguyen, Trieu; Cohain, Ariella; Lee, Jonathan D.; Perisic, Ljubica; Hedin, Ulf; Kundu, Ramendra K.; Majmudar, Deshna; Kim, Juyong B.; Wang, Oliver; Betsholtz, Christer; Ruusalepp, Arno; Franzén, Oscar; Assimes, Themistocles L.; Montgomery, Stephen B.; Schadt, Eric E.; Björkegren, Johan L.M.; Quertermous, Thomas

    2016-01-01

    Coronary artery disease (CAD) is the leading cause of mortality and morbidity, driven by both genetic and environmental risk factors. Meta-analyses of genome-wide association studies have identified >150 loci associated with CAD and myocardial infarction susceptibility in humans. A majority of these variants reside in non-coding regions and are co-inherited with hundreds of candidate regulatory variants, presenting a challenge to elucidate their functions. Herein, we use integrative genomic, epigenomic and transcriptomic profiling of perturbed human coronary artery smooth muscle cells and tissues to begin to identify causal regulatory variation and mechanisms responsible for CAD associations. Using these genome-wide maps, we prioritize 64 candidate variants and perform allele-specific binding and expression analyses at seven top candidate loci: 9p21.3, SMAD3, PDGFD, IL6R, BMP1, CCDC97/TGFB1 and LMOD1. We validate our findings in expression quantitative trait loci cohorts, which together reveal new links between CAD associations and regulatory function in the appropriate disease context. PMID:27386823

  15. Biosafety, biosecurity and internationally mandated regulatory regimes: compliance mechanisms for education and global health security

    PubMed Central

    Sture, Judi; Whitby, Simon; Perkins, Dana

    2015-01-01

    This paper highlights the biosafety and biosecurity training obligations that three international regulatory regimes place upon states parties. The duty to report upon the existence of such provisions as evidence of compliance is discussed in relation to each regime. We argue that such mechanisms can be regarded as building blocks for the development and delivery of complementary biosafety and biosecurity teaching and training materials. We show that such building blocks represent foundations upon which life and associated scientists – through greater awareness of biosecurity concerns – can better fulfil their responsibilities to guard their work from misuse in the future. PMID:24494580

  16. Identification and characterization of the novel Col10a1 regulatory mechanism during chondrocyte hypertrophic differentiation.

    PubMed

    Gu, J; Lu, Y; Li, F; Qiao, L; Wang, Q; Li, N; Borgia, J A; Deng, Y; Lei, G; Zheng, Q

    2014-01-01

    hypertrophic MCT cells. Electrophoretic mobility shift assay and chromatin immunoprecipitation assays confirmed the interaction between Cox-2 and Col10a1 cis-enhancer, supporting its role as a candidate Col10a1 regulator. Together, our data support a Cox-2-containing, Runx2-centered Col10a1 regulatory mechanism, during chondrocyte hypertrophic differentiation. PMID:25321476

  17. Deletional and regulatory mechanisms coalesce to drive transplantation tolerance through mixed chimerism.

    PubMed

    Hock, Karin; Mahr, Benedikt; Schwarz, Christoph; Wekerle, Thomas

    2015-09-01

    Establishing donor-specific immunological tolerance could improve long-term outcome by obviating the need for immunosuppressive drug therapy, which is currently required to control alloreactivity after organ transplantation. Mixed chimerism is defined as the engraftment of donor hematopoietic stem cells in the recipient, leading to viable coexistence of both donor and recipient leukocytes. In numerous experimental models, cotransplantation of donor bone marrow (BM) into preconditioned (e.g., through irradiation or cytotoxic drugs) recipients leads to transplantation tolerance through (mixed) chimerism. Mixed chimerism offers immunological advantages for clinical translation; pilot trials have established proof of concept by deliberately inducing tolerance in humans. Widespread clinical application is prevented, however, by the harsh preconditioning currently necessary for permitting BM engraftment. Recently, the immunological mechanisms inducing and maintaining tolerance in experimental mixed chimerism have been defined, revealing a more prominent role for regulation than historically assumed. The evidence from murine models suggests that both deletional and regulatory mechanisms are critical in promoting complete tolerance, encompassing also the minor histocompatibility antigens. Here, we review the current understanding of tolerance through mixed chimerism and provide an outlook on how to realize widespread clinical translation based on mechanistic insights gained from chimerism protocols, including cell therapy with polyclonal regulatory T cells. PMID:26200095

  18. Mechanism of natural killer (NK) cell regulatory role in experimental autoimmune encephalomyelitis.

    PubMed

    Xu, Wen; Fazekas, Gyorgy; Hara, Hideo; Tabira, Takeshi

    2005-06-01

    The mechanism of natural killer (NK) cell regulatory role in experimental autoimmune encephalomyelitis (EAE) was studied in SJL/J mice. In vivo experiments showed that NK cell depletion by anti-NK1.1 monoclonal antibody treatment enhanced EAE in mice. To investigate the mechanism, we cultured proteolipid protein (PLP)136-150 peptide-specific, encephalitogenic T cell lines, which were used as the NK cell target. Our results show that NK cells exert a direct cytotoxic effect on autoantigen-specific, encephalitogenic T cells. Furthermore, cytotoxicity to PLP-specific, encephalitogenic T line cells was enhanced by using enriched NK cells as effector cells. However, the cytotoxic effect of NK cells to ovalbumin-specific T line cells and ConA-stimulated T cells could also be detected with a lesser efficiency. Our studies indicate that NK cells play a regulatory role in EAE through killing of syngeneic T cells which include myelin antigen-specific, encephalitogenic T cells, and thus ameliorate EAE. PMID:15885305

  19. Gene expression in maturing neurons: regulatory mechanisms and related neurodevelopmental disorders.

    PubMed

    Ding, Baojin

    2015-04-25

    During the central nervous system (CNS) development, the interactions between intrinsic genes and extrinsic environment ensure that each neuronal developmental stage (eg. neuronal proliferation, differentiation, migration, axon extension, dendritogenesis and formation of functional synapses) occurs in the proper timing and sequence. The successful coordination requires that numerous groups of genes are exquisitely regulated in a spatiotemporal manner by various regulatory mechanisms, including sequence-specific DNA-binding proteins, histone modifications, DNA methylation, chromatin remodeling, and microRNAs (miRNAs). By targeting chromatin structure, transcription and translation processes, these mechanisms form a regulatory network to accomplish the fine regulation of gene expression in response to environmental stimuli at different developmental stages. Dysregulation of the gene expression during neuronal development has been shown to be implicated in a number of neurodevelopmental disorders, such as autism spectrum disorders (ASD), Rett syndrome (RTT), Fragile-X syndrome (FXS) and other genetic diseases. The further understanding of the regulation of gene expression during neuronal development may provide new approaches for the diagnosis and treatment of these disorders. PMID:25896042

  20. Elucidating the biosynthetic and regulatory mechanisms of flavonoid-derived bioactive components in Epimedium sagittatum

    PubMed Central

    Huang, Wenjun; Zeng, Shaohua; Xiao, Gong; Wei, Guoyan; Liao, Sihong; Chen, Jianjun; Sun, Wei; Lv, Haiyan; Wang, Ying

    2015-01-01

    Herba epimedii (Epimedium), a traditional Chinese medicine, has been widely used as a kidney tonic and antirheumatic medicine for thousands of years. In Epimedium, flavonoids have been demonstrated to be the main bioactive components (BCs). However, the molecular biosynthetic and regulatory mechanisms of flavonoid-derived BCs remain obscure. In this study, we isolated 12 structural genes and two putative transcription factors (TFs) in the flavonoid pathway. Phytochemical analysis showed that the total content of four representative BCs (epimedin A, B, C, and icariin) decreased slightly or dramatically in two lines of Epimedium sagittatum during leaf development. Transcriptional analysis revealed that two R2R3-MYB TFs (EsMYBA1 and EsMYBF1), together with a bHLH TF (EsGL3) and WD40 protein (EsTTG1), were supposed to coordinately regulate the anthocyanin and flavonol-derived BCs biosynthesis in leaves. Overexpression of EsFLS (flavonol synthase) in tobacco resulted in increased flavonols content and decreased anthocyanins content in flowers. Moreover, EsMYB12 negatively correlated with the accumulation of the four BCs, and might act as a transcriptional repressor in the flavonoid pathway. Therefore, the anthocyanin pathway may coordinate with the flavonol-derived BCs pathway in Epimedium leaves. A better understanding of the flavonoid biosynthetic and regulatory mechanisms in E. sagittatum will facilitate functional characterization, metabolic engineering, and molecular breeding studies of Epimedium species. PMID:26388888

  1. Overexpression of Heat Shock Protein 72 Attenuates NF-κB Activation Using a Combination of Regulatory Mechanisms in Microglia

    PubMed Central

    Khammash, Mustafa; Giffard, Rona G.

    2014-01-01

    Overexpression of the inducible heat shock protein 70, Hsp72, has broadly cytoprotective effects and improves outcome following stroke. A full understanding of how Hsp72 protects cells against injury is elusive, though several distinct mechanisms are implicated. One mechanism is its anti-inflammatory effects. We study the effects of Hsp72 overexpression on activation of the transcription factor NF-κB in microglia combining experimentation and mathematical modeling, using TNFα to stimulate a microglial cell line stably overexpressing Hsp72. We find that Hsp72 overexpression reduces the amount of NF-κB DNA binding activity, activity of the upstream kinase IKK, and amount of IκBα inhibitor phosphorylated following TNFα application. Simulations evaluating several proposed mechanisms suggest that inhibition of IKK activation is an essential component of its regulatory activities. Unexpectedly we find that Hsp72 overexpression reduces the initial amount of the RelA/p65 NF-κB subunit in cells, contributing to the attenuated response. Neither mechanism in isolation, however, is sufficient to attenuate the response, providing evidence that Hsp72 relies upon multiple mechanisms to attenuate NF-κB activation. An additional observation from our study is that the induced expression of IκBα is altered significantly in Hsp72 expressing cells. While the mechanism responsible for this observation is not known, it points to yet another means by which Hsp72 may alter the NF-κB response. This study illustrates the multi-faceted nature of Hsp72 regulation of NF-κB activation in microglia and offers further clues to a novel mechanism by which Hsp72 may protect cells against injury. PMID:24516376

  2. Phenotype Specific Analyses Reveal Distinct Regulatory Mechanism for Chronically Activated p53

    PubMed Central

    Cairns, Jonathan M.; Menon, Suraj; Pérez-Mancera, Pedro A.; Tomimatsu, Kosuke; Bermejo-Rodriguez, Camino; Ito, Yoko; Chandra, Tamir; Narita, Masako; Lyons, Scott K.; Lynch, Andy G.; Kimura, Hiroshi; Ohbayashi, Tetsuya; Tavaré, Simon; Narita, Masashi

    2015-01-01

    The downstream functions of the DNA binding tumor suppressor p53 vary depending on the cellular context, and persistent p53 activation has recently been implicated in tumor suppression and senescence. However, genome-wide information about p53-target gene regulation has been derived mostly from acute genotoxic conditions. Using ChIP-seq and expression data, we have found distinct p53 binding profiles between acutely activated (through DNA damage) and chronically activated (in senescent or pro-apoptotic conditions) p53. Compared to the classical ‘acute’ p53 binding profile, ‘chronic’ p53 peaks were closely associated with CpG-islands. Furthermore, the chronic CpG-island binding of p53 conferred distinct expression patterns between senescent and pro-apoptotic conditions. Using the p53 targets seen in the chronic conditions together with external high-throughput datasets, we have built p53 networks that revealed extensive self-regulatory ‘p53 hubs’ where p53 and many p53 targets can physically interact with each other. Integrating these results with public clinical datasets identified the cancer-associated lipogenic enzyme, SCD, which we found to be directly repressed by p53 through the CpG-island promoter, providing a mechanistic link between p53 and the ‘lipogenic phenotype’, a hallmark of cancer. Our data reveal distinct phenotype associations of chronic p53 targets that underlie specific gene regulatory mechanisms. PMID:25790137

  3. Global analysis of p53-regulated transcription identifies its direct targets and unexpected regulatory mechanisms

    PubMed Central

    Allen, Mary Ann; Andrysik, Zdenek; Dengler, Veronica L; Mellert, Hestia S; Guarnieri, Anna; Freeman, Justin A; Sullivan, Kelly D; Galbraith, Matthew D; Luo, Xin; Kraus, W Lee; Dowell, Robin D; Espinosa, Joaquin M

    2014-01-01

    The p53 transcription factor is a potent suppressor of tumor growth. We report here an analysis of its direct transcriptional program using Global Run-On sequencing (GRO-seq). Shortly after MDM2 inhibition by Nutlin-3, low levels of p53 rapidly activate ∼200 genes, most of them not previously established as direct targets. This immediate response involves all canonical p53 effector pathways, including apoptosis. Comparative global analysis of RNA synthesis vs steady state levels revealed that microarray profiling fails to identify low abundance transcripts directly activated by p53. Interestingly, p53 represses a subset of its activation targets before MDM2 inhibition. GRO-seq uncovered a plethora of gene-specific regulatory features affecting key survival and apoptotic genes within the p53 network. p53 regulates hundreds of enhancer-derived RNAs. Strikingly, direct p53 targets harbor pre-activated enhancers highly transcribed in p53 null cells. Altogether, these results enable the study of many uncharacterized p53 target genes and unexpected regulatory mechanisms. DOI: http://dx.doi.org/10.7554/eLife.02200.001 PMID:24867637

  4. Visual- and Vestibular-Autonomic Influence on Short-Term Cardiovascular Regulatory Mechanisms

    NASA Technical Reports Server (NTRS)

    Mullen, Thomas J.; Ramsdell, Craig D.

    1999-01-01

    This synergy project was a one-year effort conducted cooperatively by members of the NSBRI Cardiovascular Alterations and Neurovestibular Adaptation Teams in collaboration with NASA Johnson Space Center (JSC) colleagues. The objective of this study was to evaluate visual autonomic interactions on short-term cardiovascular regulatory mechanisms. Based on established visual-vestibular and vestibular-autonomic shared neural pathways, we hypothesized that visually induced changes in orientation will trigger autonomic cardiovascular reflexes. A second objective was to compare baroreflex changes during postural changes as measured with the new Cardiovascular System Identification (CSI) technique with those measured using a neck barocuff. While the neck barocuff stimulates only the carotid baroreceptors, CSI provides a measure of overall baroreflex responsiveness. This study involved a repeated measures design with 16 healthy human subjects (8 M, 8 F) to examine cardiovascular regulatory responses during actual and virtual head-upright tilts. Baroreflex sensitivity was first evaluated with subjects in supine and upright positions during actual tilt-table testing using both neck barocuff and CSI methods. The responses to actual tilts during this first session were then compared to responses during visually induced tilt and/or rotation obtained during a second session.

  5. The Potential Regulatory Mechanisms of miR-196a in Huntington’s Disease through Bioinformatic Analyses

    PubMed Central

    Tsai, Shaw-Jeng; Lai, Yen-Yu; Chang, Yu-Fan; Cheng, Pei-Hsun; Chen, Chuan-Mu; Yang, Shang-Hsun

    2015-01-01

    High throughput screening is a powerful tool to identify the potential candidate molecules involved during disease progression. However, analysis of complicated data is one of the most challenging steps on the way to obtaining useful results from this approach. Previously, we showed that a specific miRNA, miR-196a, could ameliorate the pathological phenotypes of Huntington’s disease (HD) in different models, and performed high throughput screening by using the striatum of transgenic mice. In this study, we further tried to identify the potential regulatory mechanisms using different bioinformatic tools, including Database for Annotation, Visualization and Integrated Discovery (DAVID), Molecular Signatures Database (MSigDB), TargetScan and MetaCore. The results showed that miR-196a dominantly altered “ABC transporters”, “RIG-I-like receptor signaling pathway”, immune system”, “adaptive immune system”,“tissue remodeling and wound repair” and “cytoskeleton remodeling”. In addition, miR-196a also changed the expression of several well-defined pathways of HD, such as apoptosis and cell adhesion. Since these analyses showed the regulatory pathways are highly related to the modification of the cytoskeleton, we further confirmed that miR-196a could enhance the neurite outgrowth in neuroblastoma cells, suggesting miR-196a might provide beneficial functions through the alteration of cytoskeleton structures. Since impairment of the cytoskeleton has been reported in several neuronal diseases, this study will provide not only the potential working mechanisms of miR-196a but also insights for therapeutic strategies for use with different neuronal diseases. PMID:26376480

  6. Transcriptional Control of Photosynthesis Genes: The Evolutionarily Conserved Regulatory Mechanism in Plastid Genome Function

    PubMed Central

    Puthiyaveetil, Sujith; Ibrahim, Iskander M.; Jeličić, Branka; Tomašić, Ana; Fulgosi, Hrvoje; Allen, John F.

    2010-01-01

    Chloroplast sensor kinase (CSK) is a bacterial-type sensor histidine kinase found in chloroplasts—photosynthetic plastids—in eukaryotic plants and algae. Using a yeast two-hybrid screen, we demonstrate recognition and interactions between: CSK, plastid transcription kinase (PTK), and a bacterial-type RNA polymerase sigma factor-1 (SIG-1). CSK interacts with itself, with SIG-1, and with PTK. PTK also interacts directly with SIG-1. PTK has previously been shown to catalyze phosphorylation of plastid-encoded RNA polymerase (PEP), suppressing plastid transcription nonspecifically. Phospho-PTK is inactive as a PEP kinase. Here, we propose that phospho-CSK acts as a PTK kinase, releasing PTK repression of chloroplast transcription, while CSK also acts as a SIG-1 kinase, blocking transcription specifically at the gene promoter of chloroplast photosystem I. Oxidation of the photosynthetic electron carrier plastoquinone triggers phosphorylation of CSK, inducing chloroplast photosystem II while suppressing photosystem I. CSK places photosystem gene transcription under the control of photosynthetic electron transport. This redox signaling pathway has its origin in cyanobacteria, photosynthetic prokaryotes from which chloroplasts evolved. The persistence of this mechanism in cytoplasmic organelles of photosynthetic eukaryotes is in precise agreement with the CoRR hypothesis for the function of organellar genomes: the plastid genome and its primary gene products are Co-located for Redox Regulation. Genes are retained in plastids primarily in order for their expression to be subject to this rapid and robust redox regulatory transcriptional control mechanism, whereas plastid genes also encode genetic system components, such as some ribosomal proteins and RNAs, that exist in order to support this primary, redox regulatory control of photosynthesis genes. Plastid genome function permits adaptation of the photosynthetic apparatus to changing environmental conditions of light

  7. The regulatory mechanisms of myogenin expression in doxorubicin-treated rat cardiomyocytes

    PubMed Central

    Yen, Li-Chen; Huang, Chi-Jung; Lin, Wei-Shiang; Chan, James Yi-Hsin

    2015-01-01

    Doxorubicin, an anthracycline antibiotic, has been used as an anti-neoplastic drug for almost 60 years. However, the mechanism(s) by which anthracyclines cause irreversible myocardial injury remains unclear. In order to delineate possible molecular signals involved in the myocardial toxicity, we assessed candidate genes using mRNA expression profiling in the doxorubicin-treated rat cardiomyocyte H9c2 cell line. In the study, it was confirmed that myogenin, an important transcriptional factor for muscle terminal differentiation, was significantly reduced by doxorubicin in a dose-dependent manner using both RT-PCR and western blot analyses. Also, it was identified that the doxorubicin-reduced myogenin gene level could not be rescued by most cardio-protectants. Furthermore, it was demonstrated how the signaling of the decreased myogenin expression by doxorubicin was altered at the transcriptional, post-transcriptional and translational levels. Based on these findings, a working model was proposed for relieving doxorubicin-associated myocardial toxicity by down-regulating miR-328 expression and increasing voltage-gated calcium channel β1 expression, which is a repressor of myogenin gene regulation. In summary, this study provides several lines of evidence indicating that myogenin is the target for doxorubicin-induced cardio-toxicity and a novel therapeutic strategy for doxorubicin clinical applications based on the regulatory mechanisms of myogenin expression. PMID:26452256

  8. Heritability of symbiont density reveals distinct regulatory mechanisms in a tripartite symbiosis.

    PubMed

    Parkinson, Jasmine F; Gobin, Bruno; Hughes, William O H

    2016-04-01

    Beneficial eukaryotic-bacterial partnerships are integral to animal and plant evolution. Understanding the density regulation mechanisms behind bacterial symbiosis is essential to elucidating the functional balance between hosts and symbionts. Citrus mealybugs, Planococcus citri (Risso), present an excellent model system for investigating the mechanisms of symbiont density regulation. They contain two obligate nutritional symbionts, Moranella endobia, which resides inside Tremblaya princeps, which has been maternally transmitted for 100-200 million years. We investigate whether host genotype may influence symbiont density by crossing mealybugs from two inbred laboratory-reared populations that differ substantially in their symbiont density to create hybrids. The density of the M. endobia symbiont in the hybrid hosts matched that of the maternal parent population, in keeping with density being determined either by the symbiont or the maternal genotype. However, the density of the T. princeps symbiont was influenced by the paternal host genotype. The greater dependency of T. princeps on its host may be due to its highly reduced genome. The decoupling of T. princeps and M. endobia densities, in spite of their intimate association, suggests that distinct regulatory mechanisms can be at work in symbiotic partnerships, even when they are obligate and mutualistic. PMID:27099709

  9. The Emerging Role of Protein Phosphorylation as a Critical Regulatory Mechanism Controlling Cellulose Biosynthesis

    PubMed Central

    Jones, Danielle M.; Murray, Christian M.; Ketelaar, KassaDee J.; Thomas, Joseph J.; Villalobos, Jose A.; Wallace, Ian S.

    2016-01-01

    Plant cell walls are extracellular matrices that surround plant cells and critically influence basic cellular processes, such as cell division and expansion. Cellulose is a major constituent of plant cell walls, and this paracrystalline polysaccharide is synthesized at the plasma membrane by a large protein complex known as the cellulose synthase complex (CSC). Recent efforts have identified numerous protein components of the CSC, but relatively little is known about regulation of cellulose biosynthesis. Numerous phosphoproteomic surveys have identified phosphorylation events in CSC associated proteins, suggesting that protein phosphorylation may represent an important regulatory control of CSC activity. In this review, we discuss the composition and dynamics of the CSC in vivo, the catalog of CSC phosphorylation sites that have been identified, the function of experimentally examined phosphorylation events, and potential kinases responsible for these phosphorylation events. Additionally, we discuss future directions in cellulose synthase kinase identification and functional analyses of CSC phosphorylation sites. PMID:27252710

  10. The Emerging Role of Protein Phosphorylation as a Critical Regulatory Mechanism Controlling Cellulose Biosynthesis.

    PubMed

    Jones, Danielle M; Murray, Christian M; Ketelaar, KassaDee J; Thomas, Joseph J; Villalobos, Jose A; Wallace, Ian S

    2016-01-01

    Plant cell walls are extracellular matrices that surround plant cells and critically influence basic cellular processes, such as cell division and expansion. Cellulose is a major constituent of plant cell walls, and this paracrystalline polysaccharide is synthesized at the plasma membrane by a large protein complex known as the cellulose synthase complex (CSC). Recent efforts have identified numerous protein components of the CSC, but relatively little is known about regulation of cellulose biosynthesis. Numerous phosphoproteomic surveys have identified phosphorylation events in CSC associated proteins, suggesting that protein phosphorylation may represent an important regulatory control of CSC activity. In this review, we discuss the composition and dynamics of the CSC in vivo, the catalog of CSC phosphorylation sites that have been identified, the function of experimentally examined phosphorylation events, and potential kinases responsible for these phosphorylation events. Additionally, we discuss future directions in cellulose synthase kinase identification and functional analyses of CSC phosphorylation sites. PMID:27252710

  11. Improving Student Understanding of Addition of Angular Momentum in Quantum Mechanics

    ERIC Educational Resources Information Center

    Zhu, Guangtian; Singh, Chandralekha

    2013-01-01

    We describe the difficulties advanced undergraduate and graduate students have with concepts related to addition of angular momentum in quantum mechanics. We also describe the development and implementation of a research-based learning tool, Quantum Interactive Learning Tutorial (QuILT), to reduce these difficulties. The preliminary evaluation…

  12. Improvement of mechanical properties by additive assisted laser sintering of PEEK

    SciTech Connect

    Kroh, M. Bonten, C.; Eyerer, P.

    2014-05-15

    The additive assisted laser sintering was recently developed at IKT: A carbon black (CB) additive is used to adjust the polymer's laser absorption behavior with the aim to improve the interconnection of sintered powder layers. In this paper a parameter study, Polyetheretherketone (PEEK) samples were prepared with different contents of carbon black and were laser sintered with varying thermal treatment. The samples were mechanically tested and investigated by optical light and transmission electron microscopy. An influence on the morphology at the border areas of particles and intersections of laser sintered layers was found. Depending on the viscosity of the raw material and CB content, different shapes of lamellae were observed. These (trans-) crystalline or polymorph structures, respectively, influence the thermal and mechanical behavior of the virgin PEEK. Moreover, the thermal treatment during the sintering process caused an improvement of mechanical properties like tensile strength and elongation at break.

  13. Development of neurodevelopmental disorders: a regulatory mechanism involving bromodomain-containing proteins

    PubMed Central

    2013-01-01

    Neurodevelopmental disorders are classified as diseases that cause abnormal functions of the brain or central nervous system. Children with neurodevelopmental disorders show impaired language and speech abilities, learning and memory damage, and poor motor skills. However, we still know very little about the molecular etiology of these disorders. Recent evidence implicates the bromodomain-containing proteins (BCPs) in the initiation and development of neurodevelopmental disorders. BCPs have a particular domain, the bromodomain (Brd), which was originally identified as specifically binding acetyl-lysine residues at the N-terminus of histone proteins in vitro and in vivo. Other domains of BCPs are responsible for binding partner proteins to form regulatory complexes. Once these complexes are assembled, BCPs alter chromosomal states and regulate gene expression. Some BCP complexes bind nucleosomes, are involved in basal transcription regulation, and influence the transcription of many genes. However, most BCPs are involved in targeting. For example, some BCPs function as a recruitment platform or scaffold through their Brds-binding targeting sites. Others are recruited to form a complex to bind the targeting sites of their partners. The regulation mediated by these proteins is especially critical during normal and abnormal development. Mutant BCPs or dysfunctional BCP-containing complexes are implicated in the initiation and development of neurodevelopmental disorders. However, the pathogenic molecular mechanisms are not fully understood. In this review, we focus on the roles of regulatory BCPs associated with neurodevelopmental disorders, including mental retardation, Fragile X syndrome (FRX), Williams syndrome (WS), Rett syndrome and Rubinstein-Taybi syndrome (RTS). A better understanding of the molecular pathogenesis, based upon the roles of BCPs, will lead to screening of targets for the treatment of neurodevelopmental disorders. PMID:23425632

  14. Development of neurodevelopmental disorders: a regulatory mechanism involving bromodomain-containing proteins.

    PubMed

    Li, Junlin; Zhao, Guifang; Gao, Xiaocai

    2013-01-01

    Neurodevelopmental disorders are classified as diseases that cause abnormal functions of the brain or central nervous system. Children with neurodevelopmental disorders show impaired language and speech abilities, learning and memory damage, and poor motor skills. However, we still know very little about the molecular etiology of these disorders. Recent evidence implicates the bromodomain-containing proteins (BCPs) in the initiation and development of neurodevelopmental disorders. BCPs have a particular domain, the bromodomain (Brd), which was originally identified as specifically binding acetyl-lysine residues at the N-terminus of histone proteins in vitro and in vivo. Other domains of BCPs are responsible for binding partner proteins to form regulatory complexes. Once these complexes are assembled, BCPs alter chromosomal states and regulate gene expression. Some BCP complexes bind nucleosomes, are involved in basal transcription regulation, and influence the transcription of many genes. However, most BCPs are involved in targeting. For example, some BCPs function as a recruitment platform or scaffold through their Brds-binding targeting sites. Others are recruited to form a complex to bind the targeting sites of their partners. The regulation mediated by these proteins is especially critical during normal and abnormal development. Mutant BCPs or dysfunctional BCP-containing complexes are implicated in the initiation and development of neurodevelopmental disorders. However, the pathogenic molecular mechanisms are not fully understood. In this review, we focus on the roles of regulatory BCPs associated with neurodevelopmental disorders, including mental retardation, Fragile X syndrome (FRX), Williams syndrome (WS), Rett syndrome and Rubinstein-Taybi syndrome (RTS). A better understanding of the molecular pathogenesis, based upon the roles of BCPs, will lead to screening of targets for the treatment of neurodevelopmental disorders. PMID:23425632

  15. Core level regulatory network of osteoblast as molecular mechanism for osteoporosis and treatment.

    PubMed

    Yuan, Ruoshi; Ma, Shengfei; Zhu, Xiaomei; Li, Jun; Liang, Yuhong; Liu, Tao; Zhu, Yanxia; Zhang, Bingbing; Tan, Shuang; Guo, Huajie; Guan, Shuguang; Ao, Ping; Zhou, Guangqian

    2016-01-26

    To develop and evaluate the long-term prophylactic treatment for chronic diseases such as osteoporosis requires a clear view of mechanism at the molecular and systems level. While molecular signaling pathway studies for osteoporosis are extensive, a unifying mechanism is missing. In this work, we provide experimental and systems-biology evidences that a tightly connected top-level regulatory network may exist, which governs the normal and osteoporotic phenotypes of osteoblast. Specifically, we constructed a hub-like interaction network from well-documented cross-talks among estrogens, glucocorticoids, retinoic acids, peroxisome proliferator-activated receptor, vitamin D receptor and calcium-signaling pathways. The network was verified with transmission electron microscopy and gene expression profiling for bone tissues of ovariectomized (OVX) rats before and after strontium gluconate (GluSr) treatment. Based on both the network structure and the experimental data, the dynamical modeling predicts calcium and glucocorticoids signaling pathways as targets for GluSr treatment. Modeling results further reveal that in the context of missing estrogen signaling, the GluSr treated state may be an outcome that is closest to the healthy state. PMID:26783964

  16. Atomistic Insights into Regulatory Mechanisms of the HER2 Tyrosine Kinase Domain: A Molecular Dynamics Study

    PubMed Central

    Telesco, Shannon E.; Radhakrishnan, Ravi

    2009-01-01

    HER2 (ErbB2/Neu) is a receptor tyrosine kinase belonging to the epidermal growth factor receptor (EGFR)/ErbB family and is overexpressed in 20–30% of human breast cancers. Although several crystal structures of ErbB kinases have been solved, the precise mechanism of HER2 activation remains unknown, and it has been suggested that HER2 is unique in its requirement for phosphorylation of Y877, a key tyrosine residue located in the activation loop. To elucidate mechanistic details of kinase domain regulation, we performed molecular dynamics simulations of a homology-modeled HER2 kinase structure in active and inactive conformations. Principal component analysis of the atomistic fluctuations reveals a tight coupling between the activation loop and catalytic loop that may contribute to alignment of residues required for catalysis in the active kinase. The free energy perturbation method is also employed to predict a role for phosphorylated Y877 in stabilizing the kinase conformations. Finally, simulation results are presented for a HER2/EGFR heterodimer and reveal that the dimeric interface induces a rearrangement of the αC helix toward the active conformation. Elucidation of the molecular regulatory mechanisms in HER2 will help establish structure-function relationships in the wild-type kinase, as well as predict mutations with a propensity for constitutive activation in HER2-mediated cancers. PMID:19289058

  17. Up-regulation of miR-98 and unraveling regulatory mechanisms in gestational diabetes mellitus.

    PubMed

    Cao, Jing-Li; Zhang, Lu; Li, Jian; Tian, Shi; Lv, Xiao-Dan; Wang, Xue-Qin; Su, Xing; Li, Ying; Hu, Yi; Ma, Xu; Xia, Hong-Fei

    2016-01-01

    MiR-98 expression was up-regulated in kidney in response to early diabetic nephropathy in mouse and down-regulated in muscle in type 2 diabetes in human. However, the expression prolife and functional role of miR-98 in human gestational diabetes mellitus (GDM) remained unclear. Here, we investigated its expression and function in placental tissues from GDM patients and the possible molecular mechanisms. The results showed that miR-98 was up-regulated in placentas from GDM patients compared with normal placentas. MiR-98 over-expression increased global DNA methylational level and miR-98 knockdown reduced global DNA methylational level. Further investigation revealed that miR-98 could inhibit Mecp2 expression by binding the 3'-untranslated region (UTR) of methyl CpG binding protein 2 (Mecp2), and then led to the expression dysregulation of canonical transient receptor potential 3 (Trpc3), a glucose uptake related gene. More importantly, in vivo analysis found that the expression level of Mecp2 and Trpc3 in placental tissues from GDM patients, relative to the increase of miR-98, was diminished, especially for GDM patients over the age of 35 years. Collectively, up-regulation of miR-98 in the placental tissues of human GDM is linked to the global DNA methylation via targeting Mecp2, which may imply a novel regulatory mechanism in GDM. PMID:27573367

  18. Up-regulation of miR-98 and unraveling regulatory mechanisms in gestational diabetes mellitus

    PubMed Central

    Cao, Jing-Li; Zhang, Lu; Li, Jian; Tian, Shi; Lv, Xiao-Dan; Wang, Xue-Qin; Su, Xing; Li, Ying; Hu, Yi; Ma, Xu; Xia, Hong-Fei

    2016-01-01

    MiR-98 expression was up-regulated in kidney in response to early diabetic nephropathy in mouse and down-regulated in muscle in type 2 diabetes in human. However, the expression prolife and functional role of miR-98 in human gestational diabetes mellitus (GDM) remained unclear. Here, we investigated its expression and function in placental tissues from GDM patients and the possible molecular mechanisms. The results showed that miR-98 was up-regulated in placentas from GDM patients compared with normal placentas. MiR-98 over-expression increased global DNA methylational level and miR-98 knockdown reduced global DNA methylational level. Further investigation revealed that miR-98 could inhibit Mecp2 expression by binding the 3′-untranslated region (UTR) of methyl CpG binding protein 2 (Mecp2), and then led to the expression dysregulation of canonical transient receptor potential 3 (Trpc3), a glucose uptake related gene. More importantly, in vivo analysis found that the expression level of Mecp2 and Trpc3 in placental tissues from GDM patients, relative to the increase of miR-98, was diminished, especially for GDM patients over the age of 35 years. Collectively, up-regulation of miR-98 in the placental tissues of human GDM is linked to the global DNA methylation via targeting Mecp2, which may imply a novel regulatory mechanism in GDM. PMID:27573367

  19. Effect of V or Zr addition on the mechanical properties of the mechanically alloyed Al-8wt%Ti alloys

    SciTech Connect

    Moon, I.H.; Lee, J.H.; Lee, K.M. . Dept. of Materials Engineering); Kim, Y.D. . Div. of Metals)

    1995-01-01

    Mechanical alloying (MA) of Al-Ti alloy, being a solid state process, offers the unique advantage of producing homogeneous and fine dispersions of thermally stable Al[sub 3]Ti phase, where the formation of the fine Al[sub 3]Ti phase by the other method is restricted from the thermodynamic viewpoint. The MA Al-Ti alloys show substantially higher strength than the conventional Al alloys at the elevated temperature due to the presence of Al[sub 3]Ti as well as Al[sub 4]C[sub 3] and Al[sub 2]O[sub 3], of which the last two phases were introduced during MA process. The addition of V or Zr to Al-Ti alloy was known to decrease the lattice mismatch between the intermetallic compound and the aluminum matrix, and such decrease in lattice mismatching can influence positively the high temperature mechanical strength of the MA Al-Ti by increasing the resistance to dispersoid coarsening at the elevated temperature. In the present study, therefore, the mechanical behavior of the MA Al-Ti-V and Al-Ti-Zr alloys were investigated in order to evaluate the effect of V or Zr addition on the mechanical properties of the MA Al-8Ti alloy at high temperature.

  20. Regulatory mechanisms, expression levels and proliferation effects of the FUS-DDIT3 fusion oncogene in liposarcoma.

    PubMed

    Åman, Pierre; Dolatabadi, Soheila; Svec, David; Jonasson, Emma; Safavi, Setareh; Andersson, Daniel; Grundevik, Pernilla; Thomsen, Christer; Ståhlberg, Anders

    2016-04-01

    Fusion oncogenes are among the most common types of oncogene in human cancers. The gene rearrangements result in new combinations of regulatory elements and functional protein domains. Here we studied a subgroup of sarcomas and leukaemias characterized by the FET (FUS, EWSR1, TAF15) family of fusion oncogenes, including FUS-DDIT3 in myxoid liposarcoma (MLS). We investigated the regulatory mechanisms, expression levels and effects of FUS-DDIT3 in detail. FUS-DDIT3 showed a lower expression than normal FUS at both the mRNA and protein levels, and single-cell analysis revealed a lack of correlation between FUS-DDIT3 and FUS expression. FUS-DDIT3 transcription was regulated by the FUS promotor, while its mRNA stability depended on the DDIT3 sequence. FUS-DDIT3 protein stability was regulated by protein interactions through the FUS part, rather than the leucine zipper containing DDIT3 part. In addition, in vitro as well as in vivo FUS-DDIT3 protein expression data displayed highly variable expression levels between individual MLS cells. Combined mRNA and protein analyses at the single-cell level showed that FUS-DDIT3 protein expression was inversely correlated to the expression of cell proliferation-associated genes. We concluded that FUS-DDIT3 is uniquely regulated at the transcriptional as well as the post-translational level and that its expression level is important for MLS tumour development. The FET fusion oncogenes are potentially powerful drug targets and detailed knowledge about their regulation and functions may help in the development of novel treatments. PMID:26865464

  1. Influence of cementitious additions on rheological and mechanical properties of reactive powder concretes

    NASA Astrophysics Data System (ADS)

    Zenati, A.; Arroudj, K.; Lanez, M.; Oudjit, M. N.

    2009-11-01

    Following needs of concrete market and the economic and ecological needs, several researchers, all over the world, studied the beneficial effect which the incorporation of the mineral additions in Portland cement industry can bring. It was shown that the incorporation of local mineral additions can decrease the consumption of crushing energy of cements, and reduce the CO2 emission. Siliceous additions, moreover their physical role of filling, play a chemical role pozzolanic. They contribute to improving concrete performances and thus their durability. The abundance of dunes sand and blast furnace slag in Algeria led us to study their effect like cementitious additions. The objective of this paper is to study the effect of the incorporation of dunes sand and slag, finely ground on rheological and mechanical properties of reactive powder concretes containing ternary binders.

  2. Mechanical characterization of filler sandcretes with rice husk ash additions. Study applied to Senegal

    SciTech Connect

    Cisse, I.K.; Laquerbe, M.

    2000-01-01

    To capitalize on the local materials of Senegal (agricultural and industrial wastes, residual fines from crushing process, sands from dunes, etc.), rise husk ash and residues of industrial and agricultural wastes have been used as additions in sandcretes. The mechanical resistance of sandcrete blocks obtained when unground ash (and notably the ground ash) is added reveals that there is an increase in performance over the classic mortar blocks. In addition, the use of unground rice husk ash enables production of a lightweight sandcrete with insulating properties, at a reduced cost. The ash pozzolanic reactivity explains the high strengths obtained.

  3. Effective Mechanical Properties of Lattice Material Fabricated by Material Extrusion Additive Manufacturing

    SciTech Connect

    Park, Sang-In; Choi, Seung-kyum; Rosen, David W; Duty, Chad E

    2014-01-01

    In this paper, a two-step homogenization method is proposed and implemented for evaluating effective mechanical properties of lattice structured material fabricated by the material extrusion additive manufacturing process. In order to consider the characteristics of the additive manufacturing process in estimation procedures, the levels of scale for homogenization are divided into three stages the levels of layer deposition, structural element, and lattice structure. The method consists of two transformations among stages. In the first step, the transformation between layer deposition and structural element levels is proposed to find the geometrical and material effective properties of structural elements in the lattice structure. In the second step, the method to estimate effective mechanical properties of lattice material is presented, which uses a unit cell and is based on the discretized homogenization method for periodic structure. The method is implemented for cubic lattice structure and compared to experimental results for validation purposes.

  4. Mechanical Effects of Hafnium and Boron Addition to Aluminum Alloy Films for Submicrometer LSI Interconnects

    NASA Astrophysics Data System (ADS)

    Onoda, Hiroshi; Takahashi, Eishi; Kawai, Yasuaki; Madokoro, Shoji; Fukuyo, Hideaki; Sawada, Susumu

    1993-11-01

    This is the first report on the mechanical properties of hafnium- and boron-added Al-Si-Cu alloy film for LSI interconnects. Two to three hundred ppm of hafnium and boron addition into Al-Si-Cu alloy film does not influence the Al alloy properties for metal lines as LSI interconnects, such as its low resistivity, low ohmic contact resistance with Si, and fine-line patterning feasibility. The mechanical properties of the Al alloy film, however, change greatly. Vertical hillock and lateral hillock formation is considerably suppressed during heat treatments used in LSI fabrication processes. Stress-induced void formation is also reduced during aging test at 125°C. These effects due to hafnium and boron addition are considered to be an impurity precipitation effect ihat was confirmed by X-ray diffraction analysis and electron probe microanalysis.

  5. Simulations of cellulose translocation in the bacterial cellulose synthase suggest a regulatory mechanism for the dimeric structure of cellulose

    DOE PAGESBeta

    Knott, Brandon C.; Crowley, Michael F.; Himmel, Michael E.; Zimmer, Jochen; Beckham, Gregg T.

    2016-01-29

    The processive cycle of the bacterial cellulose synthase (Bcs) includes the addition of a single glucose moiety to the end of a growing cellulose chain followed by the translocation of the nascent chain across the plasma membrane. The mechanism of this translocation and its precise location within the processive cycle are not well understood. In particular, the molecular details of how a polymer (cellulose) whose basic structural unit is a dimer (cellobiose) can be constructed by adding one monomer (glucose) at a time are yet to be elucidated. Here, we have utilized molecular dynamics simulations and free energy calculations tomore » the shed light on these questions. We find that translocation forward by one glucose unit is quite favorable energetically, giving a free energy stabilization of greater than 10 kcal mol-1. In addition, there is only a small barrier to translocation, implying that translocation is not rate limiting within the Bcs processive cycle (given experimental rates for cellulose synthesis in vitro). Perhaps most significantly, our results also indicate that steric constraints at the transmembrane tunnel entrance regulate the dimeric structure of cellulose. Namely, when a glucose molecule is added to the cellulose chain in the same orientation as the acceptor glucose, the terminal glucose freely rotates upon forward motion, thus suggesting a regulatory mechanism for the dimeric structure of cellulose. We characterize both the conserved and non-conserved enzyme-polysaccharide interactions that drive translocation, and find that 20 of the 25 residues that strongly interact with the translocating cellulose chain in the simulations are well conserved, mostly with polar or aromatic side chains. Our results also allow for a dynamical analysis of the role of the so-called 'finger helix' in cellulose translocation that has been observed structurally. Taken together, these findings aid in the elucidation of the translocation steps of the Bcs processive

  6. Simulations of cellulose translocation in the bacterial cellulose synthase suggest a regulatory mechanism for the dimeric structure of cellulose

    PubMed Central

    Knott, Brandon C.; Crowley, Michael F.; Himmel, Michael E.; Zimmer, Jochen; Beckham, Gregg T.

    2016-01-01

    The processive cycle of the bacterial cellulose synthase (Bcs) includes the addition of a single glucose moiety to the end of a growing cellulose chain followed by the translocation of the nascent chain across the plasma membrane. The mechanism of this translocation and its precise location within the processive cycle are not well understood. In particular, the molecular details of how a polymer (cellulose) whose basic structural unit is a dimer (cellobiose) can be constructed by adding one monomer (glucose) at a time are yet to be elucidated. Here, we have utilized molecular dynamics simulations and free energy calculations to the shed light on these questions. We find that translocation forward by one glucose unit is quite favorable energetically, giving a free energy stabilization of greater than 10 kcal/mol. In addition, there is only a small barrier to translocation, implying that translocation is not rate limiting within the Bcs processive cycle (given experimental rates for cellulose synthesis in vitro). Perhaps most significantly, our results also indicate that steric constraints at the transmembrane tunnel entrance regulate the dimeric structure of cellulose. Namely, when a glucose molecule is added to the cellulose chain in the same orientation as the acceptor glucose, the terminal glucose freely rotates upon forward motion, thus suggesting a regulatory mechanism for the dimeric structure of cellulose. We characterize both the conserved and non-conserved enzyme-polysaccharide interactions that drive translocation, and find that 20 of the 25 residues that strongly interact with the translocating cellulose chain in the simulations are well conserved, mostly with polar or aromatic side chains. Our results also allow for a dynamical analysis of the role of the so-called `finger helix' in cellulose translocation that has been observed structurally. Taken together, these findings aid in the elucidation of the translocation steps of the Bcs processive cycle and

  7. Increased Mechanical Properties Through the Addition of Zr to GRCop-84

    NASA Technical Reports Server (NTRS)

    Ellis, David L.; Lerch, Bradley A.

    2011-01-01

    GRCop-84 (Cu-8 at.% Cr-4 at.% Nb) has shown exceptional mechanical properties above 932 F (773 K). However, its properties below 932 F (773 K) are inferior to precipitation strengthened alloys such as Cu-Cr, Cu-Zr and Cu-Cr-Zr when they are in the fully aged, hard-drawn condition. It has been noted that the addition of small amounts of Zr, typically 0.1 wt.% to 0.5 wt.%, can greatly enhance the mechanical properties of copper-based alloys. Limited testing was conducted upon GRCop-84 with an addition of 0.4 wt.% Zr to determine its tensile, creep and low cycle fatigue (LCF) properties. Very large increases in strength (up to 68%) and ductility (up to 123%) were observed at both room temperature and 932 F (773 K). Creep properties at 932 F (773 K) demonstrated more than an order of magnitude decrease in the creep rate relative to unmodified GRCop-84 with a corresponding order of magnitude increase in creep life. Limited LCF testing showed that the modified alloy had a comparable LCF life at room temperature, but it was capable of sustaining a much higher load. While more testing and composition optimization are required, the addition of Zr to GRCop-84 has shown clear benefits to mechanical properties.

  8. Effects of annealing and additions on dynamic mechanical properties of SnSb quenched alloy

    NASA Astrophysics Data System (ADS)

    El-Bediwi, A. B.

    2004-08-01

    The elastic modulus, internal friction and stiffness values of quenched SnSb bearing alloy have been evaluated using the dynamic resonance technique. Annealing for 2 and 4 h at 120, 140 and 160degreesC caused variations in the elastic modulus. internal friction and stiffness values. This is due to structural changes in the SnSb matrix during isothermal annealing such as coarsening in the phases (Sn, Sb or intermetallic compounds), recrystallization and stress relief. In addition, adding a small amount (1 wt.%) of Cu or Ag improved the bearing mechanical properties of the SnSb bearing alloy. The SnSbCu1 alloy has the best bearing mechanical properties with thermo-mechanical stability for long time at high temperature.

  9. Influence of oxide-based sintering additives on densification and mechanical behavior of tricalcium phosphate (TCP).

    PubMed

    Bhatt, Himesh A; Kalita, Samar J

    2007-05-01

    In this research, we studied and analyzed the effects of four different oxide-based sintering additives on densification, mechanical behavior, biodegradation and biocompatibility of tricalcium phosphate (TCP) bioceramics. Selective sintering additives were introduced into pure TCP ceramics, in small quantities, through homogeneous mixing, using a mortar and pestle. The consequent powders of different compositions were pressed into cylindrical compacts, uniaxially and sintered at elevated temperatures, 1150 degrees C and 1250 degrees C, separately in a muffle furnace. X-ray powder diffraction technique was used to analyze the phase-purity of TCP after sintering. Hardness of these sintered specimens was evaluated using a Vickers hardness tester. Sintered cylindrical samples were tested under uniaxial compressive loading, as a function of composition to determine their failure strength. Biodegradation studies conducted using simulated body fluid under dynamic environment, revealed that these additives could control the rate of resorption and hardness degradation of TCP ceramics. PMID:17211718

  10. Mechanisms and modeling of the effects of additives on the nitrogen oxides emission

    NASA Technical Reports Server (NTRS)

    Kundu, Krishna P.; Nguyen, Hung Lee; Kang, M. Paul

    1991-01-01

    A theoretical study on the emission of the oxides of nitrogen in the combustion of hydrocarbons is presented. The current understanding of the mechanisms and the rate parameters for gas phase reactions were used to calculate the NO(x) emission. The possible effects of different chemical species on thermal NO(x), on a long time scale were discussed. The mixing of these additives at various stages of combustion were considered and NO(x) concentrations were calculated; effects of temperatures were also considered. The chemicals such as hydrocarbons, H2, CH3OH, NH3, and other nitrogen species were chosen as additives in this discussion. Results of these calculations can be used to evaluate the effects of these additives on the NO(x) emission in the industrial combustion system.

  11. Molecular interactions of the Saccharomyces cerevisiae Atg1 complex provide insights into assembly and regulatory mechanisms

    PubMed Central

    Chew, Leon H; Lu, Shan; Liu, Xu; Li, Franco Kk; Yu, Angela Yh; Klionsky, Daniel J; Dong, Meng-Qiu; Yip, Calvin K

    2015-01-01

    The Atg1 complex, which contains 5 major subunits: Atg1, Atg13, Atg17, Atg29, and Atg31, regulates the induction of autophagy and autophagosome formation. To gain a better understanding of the overall architecture and assembly mechanism of this essential autophagy regulatory complex, we have reconstituted a core assembly of the Saccharomyces cerevisiae Atg1 complex composed of full-length Atg17, Atg29, and Atg31, along with the C-terminal domains of Atg1 (Atg1[CTD]) and Atg13 (Atg13[CTD]). Using chemical-crosslinking coupled with mass spectrometry (CXMS) analysis we systematically mapped the intersubunit interaction interfaces within this complex. Our data revealed that the intrinsically unstructured C-terminal domain of Atg29 interacts directly with Atg17, whereas Atg17 interacts with Atg13 in 2 distinct intrinsically unstructured regions, including a previously unknown motif that encompasses several putative phosphorylation sites. The Atg1[CTD] crosslinks exclusively to the Atg13[CTD] and does not appear to make direct contact with the Atg17-Atg31-Atg29 scaffold. Finally, single-particle electron microscopy analysis revealed that both the Atg13[CTD] and Atg1[CTD] localize to the tip regions of Atg17-Atg31-Atg29 and do not alter the distinct curvature of this scaffolding subcomplex. This work provides a comprehensive understanding of the subunit interactions in the fully assembled Atg1 core complex, and uncovers the potential role of intrinsically disordered regions in regulating complex integrity. PMID:25998554

  12. Cardiovascular Risk in Systemic Autoimmune Diseases: Epigenetic Mechanisms of Immune Regulatory Functions

    PubMed Central

    López-Pedrera, Chary; Pérez-Sánchez, Carlos; Ramos-Casals, Manuel; Santos-Gonzalez, Monica; Rodriguez-Ariza, Antonio; José Cuadrado, Ma

    2012-01-01

    Autoimmune diseases (AIDs) have been associated with accelerated atherosclerosis (AT) leading to increased cardio- and cerebrovascular disease risk. Traditional risk factors, as well as systemic inflammation mediators, including cytokines, chemokines, proteases, autoantibodies, adhesion receptors, and others, have been implicated in the development of these vascular pathologies. Yet, the characteristics of vasculopathies may significantly differ depending on the underlying disease. In recent years, many new genes and signalling pathways involved in autoimmunity with often overlapping patterns between different disease entities have been further detected. Epigenetics, the control of gene packaging and expression independent of alterations in the DNA sequence, is providing new directions linking genetics and environmental factors. Epigenetic regulatory mechanisms comprise DNA methylation, histone modifications, and microRNA activity, all of which act upon gene and protein expression levels. Recent findings have contributed to our understanding of how epigenetic modifications could influence AID development, not only showing differences between AID patients and healthy controls, but also showing how one disease differs from another and even how the expression of key proteins involved in the development of each disease is regulated. PMID:21941583

  13. Regulatory mechanism of the flavoprotein Tah18-dependent nitric oxide synthesis and cell death in yeast.

    PubMed

    Yoshikawa, Yuki; Nasuno, Ryo; Kawahara, Nobuhiro; Nishimura, Akira; Watanabe, Daisuke; Takagi, Hiroshi

    2016-07-01

    Nitric oxide (NO) is a ubiquitous signaling molecule involved in the regulation of a large number of cellular functions. The regulatory mechanism of NO generation in unicellular eukaryotic yeast cells is poorly understood due to the lack of mammalian and bacterial NO synthase (NOS) orthologues, even though yeast produces NO under oxidative stress conditions. Recently, we reported that the flavoprotein Tah18, which was previously shown to transfer electrons to the iron-sulfur cluster protein Dre2, is involved in NOS-like activity in the yeast Saccharomyces cerevisiae. On the other hand, Tah18 was reported to promote apoptotic cell death after exposure to hydrogen peroxide (H2O2). Here, we showed that NOS-like activity requiring Tah18 induced cell death upon treatment with H2O2. Our experimental results also indicate that Tah18-dependent NO production and cell death are suppressed by enhancement of the interaction between Tah18 and its molecular partner Dre2. Our findings indicate that the Tah18-Dre2 complex regulates cell death as a molecular switch via Tah18-dependent NOS-like activity in response to environmental changes. PMID:27178802

  14. Identification of regulatory mechanisms of intestinal folate transport in condition of folate deficiency.

    PubMed

    Thakur, Shilpa; Rahat, Beenish; Hamid, Abid; Najar, Rauf Ahmad; Kaur, Jyotdeep

    2015-10-01

    Folic acid is an essential micronutrient, deficiency of which can lead to disturbance in various metabolic processes of cell. Folate transport across intestine occurs via the involvement of specialized folate transporters viz. proton coupled folate transporter (PCFT) and reduced folate carrier (RFC), which express at the membrane surfaces. The current study was designed to identify the regulatory mechanisms underlying the effects of folate deficiency (FD) on folate transport in human intestinal cell line as well as in rats and to check the reversibility of such effects. Caco-2 cells were grown for five generations in control and FD medium. Following treatment, one subgroup of cells was shifted on folate sufficient medium and grown for three more generations. Similarly, rats were fed an FD diet for 3 and 5 months, and after 3 months of FD treatment, one group of rats were shifted on normal folate-containing diet. Increase in folate transport and expression of folate transporters were observed on FD treatment. However, when cells and rats were shifted to control conditions after treatment, transport and expression of these genes restored to the control level. FD was found to have no impact on promoter methylation of PCFT and RFC; however, messenger RNA stability of transporters was found to be decreased, suggesting some adaptive response. Overall, increased expression of transporters under FD conditions can be attributed to enhanced rate of transcription of folate transporters and also to the increased binding of specificity protein 1 transcription factor to the RFC promoter only. PMID:26168702

  15. Luteal regression vs. prepartum luteolysis: regulatory mechanisms governing canine corpus luteum function.

    PubMed

    Kowalewski, Mariusz P

    2014-04-01

    Canine reproductive physiology exhibits several unusual features. Among the most interesting of these are the lack of an acute luteolytic mechanism, coinciding with the apparent luteal independency of a uterine luteolysin in absence of pregnancy, contrasting with the acute prepartum luteolysis observed in pregnant animals. These features indicate the existence of mechanisms different from those in other species for regulating the extended luteal regression observed in non-pregnant dogs, and the actively regulated termination of luteal function observed prepartum as a prerequisite for parturition. Nevertheless, the supply of progesterone (P4) depends on corpora lutea (CL) as its primary source in both conditions, resulting in P4 levels that are similar in pregnant and non-pregnant bitches during almost the entire luteal life span prior to the prepartum luteolysis. Consequently, the duration of the prolonged luteal phase in non-pregnant bitches frequently exceeds that of pregnant ones, which is a peculiarity when compared with other domestic animal species. Both LH and prolactin (PRL) are endocrine luteotrophic factors in the dog, the latter being the predominant one. In spite of increased availability of these hormones, luteal regression/luteolysis still takes place. Recently, possible mechanisms regulating the expression and function of PRL receptor have been implicated in the local, i.e., intraluteal regulation of PRL bioavailability and thus its steroidogenic potential. Similar mechanisms may relate to the luteal LH receptor. Most recently, evidence has been provided for an autocrine/paracrine role of prostaglandin E2 (PGE2) as a luteotrophic factor in the canine CL acting at the level of steroidogenic acute regulatory (STAR)-protein mediated supply of steroidogenic substrate, without having a significant impact on the enzymatic activity of the respective steroidogenic enzymes, 3β-hydroxysteroid-dehydrogenase (3βHSD, HSD3B2) and cytochrome P450 side

  16. Transcriptome analysis reveals novel regulatory mechanisms in a genome-reduced bacterium.

    PubMed

    Mazin, Pavel V; Fisunov, Gleb Y; Gorbachev, Alexey Y; Kapitskaya, Kristina Y; Altukhov, Ilya A; Semashko, Tatiana A; Alexeev, Dmitry G; Govorun, Vadim M

    2014-12-01

    The avian bacterial pathogen Mycoplasma gallisepticum is a good model for systems studies due to small genome and simplicity of regulatory pathways. In this study, we used RNA-Seq and MS-based proteomics to accurately map coding sequences, transcription start sites (TSSs) and transcript 3'-ends (T3Es). We used obtained data to investigate roles of TSSs and T3Es in stress-induced transcriptional responses. We identified 1061 TSSs at a false discovery rate of 10% and showed that almost all transcription in M. gallisepticum is initiated from classic TATAAT promoters surrounded by A/T-rich sequences. Our analysis revealed the pronounced operon structure complexity: on average, each coding operon has one internal TSS and T3Es in addition to the primary ones. Our transcriptomic approach based on the intervals between the two nearest transcript ends allowed us to identify two classes of T3Es: strong, unregulated, hairpin-containing T3Es and weak, heat shock-regulated, hairpinless T3Es. Comparing gene expression levels under different conditions revealed widespread and divergent transcription regulation in M. gallisepticum. Modeling suggested that the core promoter structure plays an important role in gene expression regulation. We have shown that the heat stress activation of cryptic promoters combined with the hairpinless T3Es suppression leads to widespread, seemingly non-functional transcription. PMID:25361977

  17. Transcriptome analysis reveals novel regulatory mechanisms in a genome-reduced bacterium

    PubMed Central

    Mazin, Pavel V.; Fisunov, Gleb Y.; Gorbachev, Alexey Y.; Kapitskaya, Kristina Y.; Altukhov, Ilya A.; Semashko, Tatiana A.; Alexeev, Dmitry G.; Govorun, Vadim M.

    2014-01-01

    The avian bacterial pathogen Mycoplasma gallisepticum is a good model for systems studies due to small genome and simplicity of regulatory pathways. In this study, we used RNA-Seq and MS-based proteomics to accurately map coding sequences, transcription start sites (TSSs) and transcript 3′-ends (T3Es). We used obtained data to investigate roles of TSSs and T3Es in stress-induced transcriptional responses. We identified 1061 TSSs at a false discovery rate of 10% and showed that almost all transcription in M. gallisepticum is initiated from classic TATAAT promoters surrounded by A/T-rich sequences. Our analysis revealed the pronounced operon structure complexity: on average, each coding operon has one internal TSS and T3Es in addition to the primary ones. Our transcriptomic approach based on the intervals between the two nearest transcript ends allowed us to identify two classes of T3Es: strong, unregulated, hairpin-containing T3Es and weak, heat shock-regulated, hairpinless T3Es. Comparing gene expression levels under different conditions revealed widespread and divergent transcription regulation in M. gallisepticum. Modeling suggested that the core promoter structure plays an important role in gene expression regulation. We have shown that the heat stress activation of cryptic promoters combined with the hairpinless T3Es suppression leads to widespread, seemingly non-functional transcription. PMID:25361977

  18. Endothelial cellular senescence is inhibited by liver X receptor activation with an additional mechanism for its atheroprotection in diabetes

    PubMed Central

    Hayashi, Toshio; Kotani, Hitoshi; Yamaguchi, Tomoe; Taguchi, Kumiko; Iida, Mayu; Ina, Koichiro; Maeda, Morihiko; Kuzuya, Masafumi; Hattori, Yuichi; Ignarro, Louis J.

    2014-01-01

    Senescence of vascular endothelial cells leads to endothelial dysfunction and contributes to the progression of atherosclerosis. Liver X receptors (LXRs) are nuclear receptors whose activation protects against atherosclerosis by transcriptional regulation of genes important in promoting cholesterol efflux and inhibiting inflammation. Here we found that LXR activation with specific ligands reduced the increase in senescence-associated (SA) β-gal activity, a senescence marker, and reversed the decrease in telomerase activity, a replicative senescence marker, in human endothelial cells under high glucose. This effect of LXR activation was associated with reduced reactive oxygen species and increased endothelial NO synthase activity. A series of experiments that used siRNAs indicated that LXRβ mediates the prevention of endothelial cellular senescence, and that sterol regulatory element binding protein-1, which was up-regulated as a direct LXRβ target gene, may act as a brake of endothelial cellular senescence. Although oral administration of the LXR ligand led to severe fatty liver in diabetic rats, concomitant therapy with metformin avoided the development of hepatic steatosis. However, the preventive effect of the LXR ligand on SA β-gal–stained cells in diabetic aortic endothelium was preserved even if metformin was coadministered. Taken together, our studies demonstrate that an additional mechanism, such as the regulation of endothelial cellular senescence, is related to the antiatherogenic properties of LXRs, and concomitant treatment with metformin may provide a clinically useful therapeutic strategy to alleviate an LXR activation-mediated adverse effects on liver triglyceride metabolism. PMID:24398515

  19. Physico-mechanical and dissolution behaviours of ibuprofen crystals crystallized in the presence of various additives

    PubMed Central

    Nokhodchi, A.; Amire, O.; Jelvehgari, M.

    2010-01-01

    Background and the purpose of the study The success of any direct-tableting procedure is strongly affected by the quality of the crystals used in the process. Ibuprofen is a poorly compactible drug with a high tendency for capping. In order to use ibuprofen in direct compression formulations, physico-mechanical properties of ibuprofen should be improved considerably. The aim of the present investigation was to employ crystallization techniques in order to improve the physico- mechanical properties of ibuprofen for direct compression. Methods The experimental methods involved the preparation of ibuprofen crystals by solvent change technique. Ibuprofen was dissolved in ethanol and crystallized out with water in the absence or presence of various hydrophilic additives (PEG 6000, 8000, Brij 98P and polyvinyl alcohol 22000, PVA 22000) with different concentrations. The physico-mechanical properties of the ibuprofen crystals were studied in terms of flow, density, tensile strength and dissolution behaviour. Morphology of ibuprofen crystals was studied by scanning electron microscopic (SEM). Solid state of the recrystallized particles was also investigated using differential scanning calorimeter (DSC) and FT-IR. Results Ibuprofen samples crystallized in the presence of PEG 6000 and 8000 and PVA showed remarkable increase in the tensile strengths of the directly compressed tablets, while some other additives, i.e. Brij 98P did not produce improved ibuprofen crystals. Ibuprofen powders made from particles obtained in the presence of PVA and Brij 98P showed similar dissolution profiles to the commercial ibuprofen particles. DSC and FT-IR results ruled out any significant interaction between ibuprofen and additives except for the samples crystallized in the presence of PEG 8000. Conclusion The crystal habit of ibuprofen can be altered successfully by the crystallization technique which was developed in this study. The crystals developed in the presence of certain additives

  20. Transcriptome Profiling Reveals the Regulatory Mechanism Underlying Pollination Dependent and Parthenocarpic Fruit Set Mainly Mediated by Auxin and Gibberellin

    PubMed Central

    Tang, Ning; Deng, Wei; Hu, Guojian; Hu, Nan; Li, Zhengguo

    2015-01-01

    Background Fruit set is a key process for crop production in tomato which occurs after successful pollination and fertilization naturally. However, parthenocarpic fruit development can be uncoupled from fertilization triggered by exogenous auxin or gibberellins (GAs). Global transcriptome knowledge during fruit initiation would help to characterize the molecular mechanisms by which these two hormones regulate pollination-dependent and -independent fruit set. Principal Findings In this work, digital gene expression tag profiling (DGE) technology was applied to compare the transcriptomes from pollinated and 2, 4-D/GA3-treated ovaries. Activation of carbohydrate metabolism, cell division and expansion as well as the down-regulation of MADS-box is a comprehensive regulatory pathway during pollination-dependent and parthenocarpic fruit set. The signaling cascades of auxin and GA are significantly modulated. The feedback regulations of Aux/IAAs and DELLA genes which functioned to fine-tune auxin and GA response respectively play fundamental roles in triggering fruit initiation. In addition, auxin regulates GA synthesis via up-regulation of GA20ox1 and down-regulation of KNOX. Accordingly, the effect of auxin on fruit set is mediated by GA via ARF2 and IAA9 down-regulation, suggesting that both pollination-dependent and parthenocarpic fruit set depend on the crosstalk between auxin and GA. Significance This study characterizes the transcriptomic features of ovary development and more importantly unravels the integral roles of auxin and GA on pollination-dependent and parthenocarpic fruit set. PMID:25909657

  1. Endocytosis and trafficking of BMP receptors: Regulatory mechanisms for fine-tuning the signaling response in different cellular contexts.

    PubMed

    Ehrlich, Marcelo

    2016-02-01

    Signaling by bone morphogenetic protein (BMP) receptors is regulated at multiple levels in order to ensure proper interpretation of BMP stimuli in different cellular settings. As with other signaling receptors, regulation of the amount of exposed and signaling-competent BMP receptors at the plasma-membrane is predicted to be a key mechanism in governing their signaling output. Currently, the endocytosis of BMP receptors is thought to resemble that of the structurally related transforming growth factor-β (TGF-β) receptors, as BMP receptors are constitutively internalized (independently of ligand binding), with moderate kinetics, and mostly via clathrin-mediated endocytosis. Also similar to TGF-β receptors, BMP receptors are able to signal from the plasma membrane, while internalization to endosomes may have a signal modulating effect. When at the plasma membrane, BMP receptors localize to different membrane domains including cholesterol rich domains and caveolae, suggesting a complex interplay between membrane distribution and internalization. An additional layer of complexity stems from the putative regulatory influence on the signaling and trafficking of BMP receptors exerted by ligand traps and/or co-receptors. Furthermore, the trafficking and signaling of BMP receptors are subject to alterations in cellular context. For example, genetic diseases involving changes in the expression of auxiliary factors of endocytic pathways hamper retrograde BMP signals in neurons, and perturb the regulation of synapse formation. This review summarizes current understanding of the trafficking of BMP receptors and discusses the role of trafficking in regulation of BMP signals. PMID:26776724

  2. Aspects of the regulatory mechanisms of PPAR functions: analysis of a bidirectional response element and regulation by sumoylation.

    PubMed

    Shimizu, Makoto; Yamashita, Daisuke; Yamaguchi, Tomohiro; Hirose, Fumiko; Osumi, Takashi

    2006-06-01

    Peroxisome proliferator-activated receptors (PPARs) constitute a subfamily of nuclear receptor superfamily. A wide variety of compounds including hypolipidemic agents, antidiabetic drugs, and long-chain fatty acids are the potential ligands of PPARs. To approach the regulatory mechanisms of PPARs, we studied on two subjects in this work. First, we identified a functional PPAR-binding site in the spacer region between the PEX11alpha and perilipin genes, which are arranged in tandem on the mouse genome. By gene reporter assays and in vivo as well as in vitro binding assays, we show that these genes are regulated tissue-selectively through this common binding site: The PEX11alpha gene is activated by PPARalpha in the liver, whereas the perilipin gene by PPARgamma in the adipose tissue. As the second subject, we found that PPARgamma2 is conjugated with small ubiquitin-related modifier (SUMO) at a specific lysine residue in the amino-terminal region. By site-directed mutagenesis combined with gene reporter assays and sumoylation analyses, we show that sumoylation represses the ligand-independent transactivating function carried by this region, and hence negatively regulates the whole transactivating competence of PPARgamma2. In addition, phosphorylation at a specific site in the amino-terminal region represses the transactivation by PPARgamma2 possibly through enhancing sumoylation. PMID:16534556

  3. Mechanical properties of potato starch modified by moisture content and addition of lubricant

    NASA Astrophysics Data System (ADS)

    Stasiak, Mateusz; Molenda, Marek; Horabik, Józef; Mueller, Peter; Opaliński, Ireneusz

    2014-10-01

    Laboratory testing was conducted to deliver a set of characteristics of structure and mechanical properties of pure starch and starch with an addition of a lubricant - magnesium stearate. Considerable influence of moisture content of potato starch was found in the case of density, parameters of internal friction, coefficients of wall friction and flowability. Elasticity was found to be strongly influenced by water content of the material. Addition of magnesium stearate affected density and parameters of flowability, internal friction and elasticity. Bulk density increased from 604 to 774 kg m-3 with decrease in moisture content of potato starch from 17 to for 6%. Addition of magnesium stearate resulted in approximately 10% decrease in bulk density. Angle of internal friction obtained for 10 kPa of consolidation stress decreased from 33 to 24º with increase in moisture content, and to approximately 22º with addition of the lubricant. With an increase of moisture content from 6 to 18% and with addition of the lubricant, the modulus of elasticity during loading decreased from approximately 1.0 to 0.1 MPa. Modulus of elasticity during unloading was found in the range from 19 to 42 MPa and increased with increase of moisture content and amount of lubricant.

  4. Inhibition of protein kinase C catalytic activity by additional regions within the human protein kinase Calpha-regulatory domain lying outside of the pseudosubstrate sequence.

    PubMed

    Kirwan, Angie F; Bibby, Ashley C; Mvilongo, Thierry; Riedel, Heimo; Burke, Thomas; Millis, Sherri Z; Parissenti, Amadeo M

    2003-07-15

    The N-terminal pseudosubstrate site within the protein kinase Calpha (PKCalpha)-regulatory domain has long been regarded as the major determinant for autoinhibition of catalytic domain activity. Previously, we observed that the PKC-inhibitory capacity of the human PKCalpha-regulatory domain was only reduced partially on removal of the pseudosubstrate sequence [Parissenti, Kirwan, Kim, Colantonio and Schimmer (1998) J. Biol. Chem. 273, 8940-8945]. This finding suggested that one or more additional region(s) contributes to the inhibition of catalytic domain activity. To assess this hypothesis, we first examined the PKC-inhibitory capacity of a smaller fragment of the PKCalpha-regulatory domain consisting of the C1a, C1b and V2 regions [GST-Ralpha(39-177): this protein contained the full regulatory domain of human PKCalpha fused to glutathione S-transferase (GST), but lacked amino acids 1-38 (including the pseudosubstrate sequence) and amino acids 178-270 (including the C2 region)]. GST-Ralpha(39-177) significantly inhibited PKC in a phorbol-independent manner and could not bind the peptide substrate used in our assays. These results suggested that a region within C1/V2 directly inhibits catalytic domain activity. Providing further in vivo support for this hypothesis, we found that expression of N-terminally truncated pseudosubstrate-less bovine PKCalpha holoenzymes in yeast was capable of inhibiting cell growth in a phorbol-dependent manner. This suggested that additional autoinhibitory force(s) remained within the truncated holoenzymes that could be relieved by phorbol ester. Using tandem PCR-mediated mutagenesis, we observed that mutation of amino acids 33-86 within GST-Ralpha(39-177) dramatically reduced its PKC-inhibitory capacity when protamine was used as substrate. Mutagenesis of a broad range of sequences within C2 (amino acids 159-242) also significantly reduced PKC-inhibitory capacity. Taken together, these observations support strongly the existence of

  5. Failure mechanisms of additively manufactured porous biomaterials: Effects of porosity and type of unit cell.

    PubMed

    Kadkhodapour, J; Montazerian, H; Darabi, A Ch; Anaraki, A P; Ahmadi, S M; Zadpoor, A A; Schmauder, S

    2015-10-01

    Since the advent of additive manufacturing techniques, regular porous biomaterials have emerged as promising candidates for tissue engineering scaffolds owing to their controllable pore architecture and feasibility in producing scaffolds from a variety of biomaterials. The architecture of scaffolds could be designed to achieve similar mechanical properties as in the host bone tissue, thereby avoiding issues such as stress shielding in bone replacement procedure. In this paper, the deformation and failure mechanisms of porous titanium (Ti6Al4V) biomaterials manufactured by selective laser melting from two different types of repeating unit cells, namely cubic and diamond lattice structures, with four different porosities are studied. The mechanical behavior of the above-mentioned porous biomaterials was studied using finite element models. The computational results were compared with the experimental findings from a previous study of ours. The Johnson-Cook plasticity and damage model was implemented in the finite element models to simulate the failure of the additively manufactured scaffolds under compression. The computationally predicted stress-strain curves were compared with the experimental ones. The computational models incorporating the Johnson-Cook damage model could predict the plateau stress and maximum stress at the first peak with less than 18% error. Moreover, the computationally predicted deformation modes were in good agreement with the results of scaling law analysis. A layer-by-layer failure mechanism was found for the stretch-dominated structures, i.e. structures made from the cubic unit cell, while the failure of the bending-dominated structures, i.e. structures made from the diamond unit cells, was accompanied by the shearing bands of 45°. PMID:26143351

  6. Fluid mechanics of additive manufacturing of metal objects by accretion of droplets - a survey

    NASA Astrophysics Data System (ADS)

    Tesař, Václav

    2016-03-01

    Paper presents a survey of principles of additive manufacturing of metal objects by accretion of molten metal droplets, focusing on fluid-mechanical problems that deserve being investigated. The main problem is slowness of manufacturing due to necessarily small size of added droplets. Increase of droplet repetition rate calls for basic research of the phenomena that take place inside and around the droplets: ballistics of their flight, internal flowfield with heat and mass transfer, oscillation of surfaces, and the ways to elimination of satellite droplets.

  7. Effects of Additive on the Mechanical Properties of Bamboo/pbs Composites

    NASA Astrophysics Data System (ADS)

    Lee, Yeon-Hee; Yoon, Han-Ki; Takagi, Hitoshi; Ohkita, Kazuya

    Compared with general composites which are produced from fossil fuel, biodegradable resins have received considerable attention as an environment-friendly material. Bamboo fiber has relatively high strength compared with other natural fibers. Therefore, the focus of this study is to produce bamboo fiber reinforced Poly butylene succinate (PBS) composites by injection molding and to study the effects of additive on mechanical properties of this bamboo/PBS composite. The injection-molding is a highly productive fabrication technique. Bamboo/PBS composites were examined by flexural test and Vickers hardness. Also we examined fracture surface and microstructure of the bamboo/PBS composites by microscope.

  8. Investigation of mechanical properties of masterbatches and composites with small additions of CNTs

    NASA Astrophysics Data System (ADS)

    Burmistrov, I. N.; Yudintseva, T. I.; Ilinykh, I. A.; Khaydarov, B. B.; Mazov, I. N.; Anshin, S. M.; Kuznetsov, D. V.

    2016-01-01

    The present paper investigated physical and mechanical properties of the nanotube masterbatches and the polymer composites with low contents of carbon nanotubes (CNTs), which were obtained by diluting masterbatches. Ethylene-octene copolymer was used as the binder for the masterbatches, which provides the elasticity of the material at a content 20 wt% of CNT. Masterbatches were obtained with a 2-roller mixer, and their additive to polypropylene was carried out on a single screw injection molding machine. Strength properties of ethylene-octene copolymer increased when additing CNTs in an amount of 5-20 wt%. When the concentration of CNT in masterbatches is reduced to 0.01-0.1 wt% its strength characteristics increased up to 4-18%. The most effective strengthening of polypropylene was observed with the content of CNTs 0.1 wt%.

  9. Effect and Regulatory Mechanism of Clock Gene Per1 on Biological Behaviors of Human Oral Squamous Carcinoma Cell.

    PubMed

    Han-Xue, L I; Kai, Yang; Xiao-Juan, F U; Qin, Zhao

    2016-04-10

    Objective To investigate the effect and regulatory mechanism of clock gene Per1 on the proliferation,apoptosis,migration,and invasion of human oral squamous carcinoma SCC15 cells. Methods RNA interference was used to knock down Per1 gene in human oral squamous cell carcinoma SCC15 cell line. Changes of cell proliferation and apoptosis were analyzed by flow cytometry. Transwell assay was carried out to assess cell migration and invasion. Real-time polymerase chain reaction was used to detect the mRNA expressions of Ki-67,murine double minute 2(MDM2),c-Myc,p53,Bax,Bcl-2,metalloproteinase (MMP)2,MMP9,and vascular endothelial growth factor (VEGF). Results shRNA-mediated knockdown of Per1 promoted the proliferation,migration and invasion capacity,and inhibited cell apoptosis capacity of SCC15 cells (all P<0.05). Additionally,Per1 knockdown also increased the mRNA expressions of Ki-67,MDM2,Bcl-2,MMP2,and MMP9 and decreased the mRNA expressions of c-Myc,p53,and Bax (all P<0.05);however,the VEGF mRNA expression did not differ significantly after Per1 knockdown (P>0.05). Conclusions Clock gene Perl can regulate important tumor-related genes downstream such as Ki-67,MDM2,c-Myc,p53,Bax,Bcl-2,MMP2,and MMP9,and the aberrant expression of Per1 can affect tumor cell proliferation,apoptosis,migration and invasion. An in-depth study of Per1 may further clarify the mechanism of tumorigenesis and tumor development and thus provides new effective molecular targets for cancer treatment. PMID:27181891

  10. A mechanism for expansion of regulatory T-cell repertoire and its role in self-tolerance.

    PubMed

    Feng, Yongqiang; van der Veeken, Joris; Shugay, Mikhail; Putintseva, Ekaterina V; Osmanbeyoglu, Hatice U; Dikiy, Stanislav; Hoyos, Beatrice E; Moltedo, Bruno; Hemmers, Saskia; Treuting, Piper; Leslie, Christina S; Chudakov, Dmitriy M; Rudensky, Alexander Y

    2015-12-01

    T-cell receptor (TCR) signalling has a key role in determining T-cell fate. Precursor cells expressing TCRs within a certain low-affinity range for complexes of self-peptide and major histocompatibility complex (MHC) undergo positive selection and differentiate into naive T cells expressing a highly diverse self-MHC-restricted TCR repertoire. In contrast, precursors displaying TCRs with a high affinity for 'self' are either eliminated through TCR-agonist-induced apoptosis (negative selection) or restrained by regulatory T (Treg) cells, whose differentiation and function are controlled by the X-chromosome-encoded transcription factor Foxp3 (reviewed in ref. 2). Foxp3 is expressed in a fraction of self-reactive T cells that escape negative selection in response to agonist-driven TCR signals combined with interleukin 2 (IL-2) receptor signalling. In addition to Treg cells, TCR-agonist-driven selection results in the generation of several other specialized T-cell lineages such as natural killer T cells and innate mucosal-associated invariant T cells. Although the latter exhibit a restricted TCR repertoire, Treg cells display a highly diverse collection of TCRs. Here we explore in mice whether a specialized mechanism enables agonist-driven selection of Treg cells with a diverse TCR repertoire, and the importance this holds for self-tolerance. We show that the intronic Foxp3 enhancer conserved noncoding sequence 3 (CNS3) acts as an epigenetic switch that confers a poised state to the Foxp3 promoter in precursor cells to make Treg cell lineage commitment responsive to a broad range of TCR stimuli, particularly to suboptimal ones. CNS3-dependent expansion of the TCR repertoire enables Treg cells to control self-reactive T cells effectively, especially when thymic negative selection is genetically impaired. Our findings highlight the complementary roles of these two main mechanisms of self-tolerance. PMID:26605529

  11. Mechanisms of immune suppression by interleukin-10 and transforming growth factor-beta: the role of T regulatory cells.

    PubMed

    Taylor, Alison; Verhagen, Johan; Blaser, Kurt; Akdis, Mübeccel; Akdis, Cezmi A

    2006-04-01

    Specific immune suppression and induction of tolerance are essential processes in the regulation and circumvention of immune defence. The balance between allergen-specific type 1 regulatory (Tr1) cells and T helper (Th) 2 cells appears to be decisive in the development of allergy. Tr1 cells consistently represent the dominant subset specific for common environmental allergens in healthy individuals. In contrast, there is a high frequency of allergen-specific interleukin-4 (IL-4)-secreting T cells in allergic individuals. Allergen-specific immunotherapy can induce specific Tr1 cells that abolish allergen-induced proliferation of Th1 and Th2 cells, as well as their cytokine production. Tr1 cells utilize multiple suppressor mechanisms, such as IL-10 and transforming growth factor-beta (TGF-beta) as secreted cytokines and various surface molecules, such as cytotoxic T-lymphocyte antigen 4 and programmed death-1. IL-10 only inhibits T cells stimulated by low numbers of triggered T-cell receptors, which depend on CD28 costimulation. IL-10 inhibits CD28 tyrosine phosphorylation, preventing the binding of phosphatidylinositol 3-kinase p85 and consequently inhibiting the CD28 signalling pathway. In addition, IL-10 and TGF-beta secreted by Tr1 cells skew the antibody production from immunoglobulin E (IgE) towards the non-inflammatory isotypes IgG4 and IgA, respectively. Induction of antigen-specific Tr1 cells can thus re-direct an inappropriate immune response against allergens or auto-antigens using a broad range of suppressor mechanisms. PMID:16556256

  12. microRNA regulatory mechanism by which PLLA aligned nanofibers influence PC12 cell differentiation

    NASA Astrophysics Data System (ADS)

    Yu, Yadong; Lü, Xiaoying; Ding, Fei

    2015-08-01

    Objective. Aligned nanofibers (AFs) are regarded as promising biomaterials in nerve tissue engineering. However, a full understanding of the biocompatibility of AFs at the molecular level is still challenging. Therefore, the present study focused on identifying the microRNA (miRNA)-mediated regulatory mechanism by which poly-L-lactic acid (PLLA) AFs influence PC12 cell differentiation. Approach. Firstly, the effects of PLLA random nanofibers (RFs)/AFs and PLLA films (control) on the biological responses of PC12 cells that are associated with neuronal differentiation were examined. Then, SOLiD sequencing and cDNA microarray were employed to profile the expressions of miRNAs and mRNAs. The target genes of the misregulated miRNAs were predicted and compared with the mRNA profile data. Functions of the matched target genes (the intersection between the predicted target genes and the experimentally-determined, misregulated genes) were analyzed. Main results. The results revealed that neurites spread in various directions in control and RF groups. In the AF group, most neurites extended in parallel with each other. The glucose consumption and lactic acid production in the RF and AF groups were higher than those in the control group. Compared with the control group, 42 and 94 miRNAs were significantly dysregulated in the RF and AF groups, respectively. By comparing the predicted target genes with the mRNA profile data, five and 87 matched target genes were found in the RF and AF groups, respectively. Three of the matched target genes in the AF group were found to be associated with neuronal differentiation, whereas none had this association in the RF group. The PLLA AFs induced the dysregulation of miRNAs that regulate many biological functions, including axonal guidance, lipid metabolism and long-term potentiation. In particular, two miRNA-matched target gene-biological function modules associated with neuronal differentiation were identified as follows: (1) miR-23b, mi

  13. Deciphering Transcriptional Regulatory Mechanisms Associated with Hemicellulose Degradation in Neurospora crassa

    PubMed Central

    Sun, Jianping; Tian, Chaoguang; Diamond, Spencer

    2012-01-01

    Hemicellulose, the second most abundant plant biomass fraction after cellulose, is widely viewed as a potential substrate for the production of liquid fuels and other value-added materials. Degradation of hemicellulose by filamentous fungi requires production of many different enzymes, which are induced by biopolymers or its derivatives and regulated mainly at the transcriptional level through transcription factors (TFs). Neurospora crassa, a model filamentous fungus, expresses and secretes enzymes required for plant cell wall deconstruction. To better understand genes specifically associated with degradation of hemicellulose, we applied secretome and transcriptome analysis to N. crassa grown on beechwood xylan. We identified 34 secreted proteins and 353 genes with elevated transcription on xylan. The xylanolytic phenotype of strains with deletions in genes identified from the secretome and transcriptome analysis of the wild type was assessed, revealing functions for known and unknown proteins associated with hemicellulose degradation. By evaluating phenotypes of strains containing deletions of predicted TF genes in N. crassa, we identified a TF (XLR-1; xylan degradation regulator 1) essential for hemicellulose degradation that is an ortholog to XlnR/XYR1 in Aspergillus and Trichoderma species, respectively, a major transcriptional regulator of genes encoding both cellulases and hemicellulases. Deletion of xlr-1 in N. crassa abolished growth on xylan and xylose, but growth on cellulose and cellulolytic activity were only slightly affected. To determine the regulatory mechanisms for hemicellulose degradation, we explored the transcriptional regulon of XLR-1 under xylose, xylanolytic, and cellulolytic conditions. XLR-1 regulated only some predicted hemicellulase genes in N. crassa and was required for a full induction of several cellulase genes. Hemicellulase gene expression was induced by a combination of release from carbon catabolite repression (CCR) and induction

  14. An examination of the regulatory mechanism of Pxdn mutation-induced eye disorders using microarray analysis

    PubMed Central

    YANG, YANG; XING, YIQIAO; LIANG, CHAOQUN; HU, LIYA; XU, FEI; MEI, QI

    2016-01-01

    The present study aimed to identify biomarkers for peroxidasin (Pxdn) mutation-induced eye disorders and study the underlying mechanisms involved in this process. The microarray dataset GSE49704 was used, which encompasses 4 mouse samples from embryos with Pxdn mutation and 4 samples from normal tissues. After data preprocessing, the differentially expressed genes (DEGs) between Pxdn mutation and normal tissues were identified using the t-test in the limma package, followed by functional enrichment analysis. The protein-protein interaction (PPI) network was constructed based on the STRING database, and the transcriptional regulatory (TR) network was established using the GeneCodis database. Subsequently, the overlapping DEGs with high degrees in two networks were identified, as well as the sub-network extracted from the TR network. In total, 121 (75 upregulated and 46 downregulated) DEGs were identified, and these DEGs play important roles in biological processes (BPs), including neuron development and differentiation. A PPI network containing 25 nodes such as actin, alpha 1, skeletal muscle (Acta1) and troponin C type 2 (fast) (Tnnc2), and a TR network including 120 nodes were built. By comparing the two networks, seven crucial genes which overlapped were identified, including cyclin-dependent kinase inhibitor 1B (Cdkn1b), Acta1 and troponin T type 3 (Tnnt3). In the sub-network, Cdkn1b was predicted as the target of miRNAs such as mmu-miR-24 and transcription factors (TFs) including forkhead box O4 (FOXO4) and activating enhancer binding protein 4 (AP4). Thus, we suggest that seven crucial genes, including Cdkn1b, Acta1 and Tnnt3, play important roles in the progression of eye disorders such as glaucoma. We suggest that Cdkn1b exert its effects via the inhibition of proliferation and is mediated by mmu-miR-24 and targeted by the TFs FOXO4 and AP4. PMID:27121343

  15. Sleep-wake states and their regulatory mechanisms throughout early human development.

    PubMed

    Peirano, Patricio; Algarín, Cecilia; Uauy, Ricardo

    2003-10-01

    The emergence of sleep states is one of the most significant aspects of development. Descriptions of both neonatal and late fetal behavior and studies on the organization of sleep have shown that fetus and newborns exhibit spontaneously discrete and cyclic patterns of active sleep (AS) and quiet sleep (QS). Human fetuses and neonates sleep most of their life, and AS is the prevailing state even during the first postnatal months. Several hypotheses to explain central nervous system development consider that AS is the expression of a basic activation program for the central nervous system that increases the functional competence of neurons, circuits, and complex patterns before the organism is called on to use them. Current results indicate the maturation of QS not only coincides with the formation of thalamocortical and intracortical patterns of innervation and periods of heightened synaptogenesis, since this sleep state is also associated with important processes in synaptic remodeling. In fact, several studies suggest that the information acquired during wakefulness is further processed during AS and QS. This article reviews the processes involved in the timing of both AS/QS and sleep/wake alternating patterns throughout early human development. A growing body of evidence indicates that the duration of unmodulated parental care and noncircadian environmental conditions may be detrimental for the establishment of these basic rhythmicities. As a consequence, alterations in parental/environmental entraining factors may well contribute to disturb sleep and feeding commonly experienced by preterm infants. Further knowledge on the early establishment of sleep-wake states regulatory mechanisms is needed to improve modalities for appropriate stimulation in the developing human being. PMID:14597916

  16. RNA-Binding Proteins in Trichomonas vaginalis: Atypical Multifunctional Proteins Involved in a Posttranscriptional Iron Regulatory Mechanism

    PubMed Central

    Figueroa-Angulo, Elisa E.; Calla-Choque, Jaeson S.; Mancilla-Olea, Maria Inocente; Arroyo, Rossana

    2015-01-01

    Iron homeostasis is highly regulated in vertebrates through a regulatory system mediated by RNA-protein interactions between the iron regulatory proteins (IRPs) that interact with an iron responsive element (IRE) located in certain mRNAs, dubbed the IRE-IRP regulatory system. Trichomonas vaginalis, the causal agent of trichomoniasis, presents high iron dependency to regulate its growth, metabolism, and virulence properties. Although T. vaginalis lacks IRPs or proteins with aconitase activity, possesses gene expression mechanisms of iron regulation at the transcriptional and posttranscriptional levels. However, only one gene with iron regulation at the transcriptional level has been described. Recently, our research group described an iron posttranscriptional regulatory mechanism in the T. vaginalis tvcp4 and tvcp12 cysteine proteinase mRNAs. The tvcp4 and tvcp12 mRNAs have a stem-loop structure in the 5'-coding region or in the 3'-UTR, respectively that interacts with T. vaginalis multifunctional proteins HSP70, α-Actinin, and Actin under iron starvation condition, causing translation inhibition or mRNA stabilization similar to the previously characterized IRE-IRP system in eukaryotes. Herein, we summarize recent progress and shed some light on atypical RNA-binding proteins that may participate in the iron posttranscriptional regulation in T. vaginalis. PMID:26703754

  17. Possible Mechanism of ``Additional'' Production of H^- in a Glow Discharge

    NASA Astrophysics Data System (ADS)

    Belostotskiy, S.; Economou, D.; Lopaev, D.; Rakhimova, T.

    2006-10-01

    Based on measurements of H^- and H densities a DC glow discharge in H2 (P=0.1-3 Torr) the rate coefficient of H^- production as a function of E/N was determined. To analyze the mechanisms of H^- production, a simple model of H2 vibrational excitation was developed. Estimations of vibrational level densities (v=3-5) obtained from VUV absorption measurements were in reasonable agreement with the calculated data. The analysis revealed that standard mechanisms of H^- production (dissociative attachment to vibrationally excited molecules H2(v) and molecules in Rydberg states H2(Ry)) were not enough to explain the experimental results. In order to describe both the shape (vs E/N) and the magnitude of the measured H^- production rate coefficient, an ``additional'' source of H^-, having a strong resonant electron attachment CS in the range of ˜5-9 eV, should be invoked. Although H2 has no resonances in the 5-9 eV range, water is known to strongly dissociatively attach in this range. Thus, even small amounts (0.1-1%) of water vapor in the apparatus can explain the origin of the ``additional'' H^- production. This result is corroborated by the work of Cadez et. al. in Proc. of XXVII ICPIG, 2005. This work was supported by the RFBR (No.05-02-17649a), Scientific School - 171113.2003.2 and NATO Collaborative Linkage Grant (No.980097).

  18. Regulatory Mechanisms That Prevent Re-initiation of DNA Replication Can Be Locally Modulated at Origins by Nearby Sequence Elements

    PubMed Central

    Richardson, Christopher D.; Li, Joachim J.

    2014-01-01

    Eukaryotic cells must inhibit re-initiation of DNA replication at each of the thousands of origins in their genome because re-initiation can generate genomic alterations with extraordinary frequency. To minimize the probability of re-initiation from so many origins, cells use a battery of regulatory mechanisms that reduce the activity of replication initiation proteins. Given the global nature of these mechanisms, it has been presumed that all origins are inhibited identically. However, origins re-initiate with diverse efficiencies when these mechanisms are disabled, and this diversity cannot be explained by differences in the efficiency or timing of origin initiation during normal S phase replication. This observation raises the possibility of an additional layer of replication control that can differentially regulate re-initiation at distinct origins. We have identified novel genetic elements that are necessary for preferential re-initiation of two origins and sufficient to confer preferential re-initiation on heterologous origins when the control of re-initiation is partially deregulated. The elements do not enhance the S phase timing or efficiency of adjacent origins and thus are specifically acting as re-initiation promoters (RIPs). We have mapped the two RIPs to ∼60 bp AT rich sequences that act in a distance- and sequence-dependent manner. During the induction of re-replication, Mcm2-7 reassociates both with origins that preferentially re-initiate and origins that do not, suggesting that the RIP elements can overcome a block to re-initiation imposed after Mcm2-7 associates with origins. Our findings identify a local level of control in the block to re-initiation. This local control creates a complex genomic landscape of re-replication potential that is revealed when global mechanisms preventing re-replication are compromised. Hence, if re-replication does contribute to genomic alterations, as has been speculated for cancer cells, some regions of the genome

  19. Direct Addition Mechanism during the Catalytic Hydrogenation of Olefins over Platinum Surfaces.

    PubMed

    Dong, Yujung; Ebrahimi, Maryam; Tillekaratne, Aashani; Zaera, Francisco

    2016-07-01

    The mechanism of the hydrogenation of olefins catalyzed by metal surfaces was probed by using isotope labeling in conjunction with a high-flux effusive molecular beam setup capable of sustaining steady-state conversion under well-controlled ultrahigh vacuum (UHV). The unique conditions afforded by this instrument, namely, a single collision regime and impinging frequencies equivalent to pressures in the mTorr range, led to the clear identification of two competing pathways: a multiple H-D isotope exchange channel explained by the well-known Horiuti-Polanyi mechanism but with an unusually high probability for β-hydride elimination from the alkyl surface intermediate (versus its reductive elimination to the alkane), and a direct addition route that produces dideuterated alkanes selectively. The latter may follow an Eley-Rideal mechanism involving an adsorbate (either the olefin or the hydrogen/deuterium atoms resulting from dissociative adsorption of H2/D2) and a gas-phase molecule (the other reactant), or, alternatively, it could reflect the limited diffusion of the hydrogen atoms on the surface under catalytic conditions because of site blocking by the islands of strongly bonded carbonaceous (alkylidyne) layers present during catalysis. Regardless, our data clearly show that the distribution of alkane isotopologues obtained from the conversion of olefins with deuterium can deviate significantly from statistical expectations. PMID:27309969

  20. Effect of Y Addition on the Mechanical Properties and Microstructure of Zn-Al Alloys

    NASA Astrophysics Data System (ADS)

    Li, Mingyang; Lu, Shujing; Long, Fang; Sheng, Meng; Geng, Haoran; Liu, Wendi

    2015-05-01

    This article will discuss the influence of the rare earth Y on the microstructure and mechanical properties of Zn-Al alloys (ZA27, ZA35, and ZA40), and it will provide reference to rare-earth microalloying through the cast ingot metallurgy process. The results also suggest that the microstructure can be refined and mechanical properties can be improved obviously when adding the right amount of Y, and its tensile strength and brinell hardness increased by 9.1% and 11.7% compared with the unmodified ZA27 alloys, respectively. Compared with non-Y addition, the alloys will form dispersed YZn12 phase, which can strongly pin dislocations and subgrain boundary, inhibiting further recrystallization. On this basis, the impacts of Y on the microstructure and mechanical properties of ZA27, ZA35, and ZA40 have been explored. After adding Y, the microstructures of as-cast Zn-Al alloys are refined at different degree. However, with the increase of Al content, the microstructure shows a certain coarsening and the segregation and shrinkage porosity occur. The most effective refining appears in ZA27-0.4%Y.

  1. Design of a mechanical system in gait rehabilitation with progressive addition of weight

    NASA Astrophysics Data System (ADS)

    Braidot, Ariel A. A.; Aleman, Guillermo L.

    2011-12-01

    In this paper we designed and developed a mechanical device for gait rehabilitation based on the application of "partial body weight reduction therapy". An evaluation of the characteristics of devices based on this therapy currently available on the market was carried out obtaining information of the different mechanisms used in it. The device was designed to adapt to different height and weight of patients and to be used with additional equipment in gait rehabilitation, for example, treadmills, elliptical trainers and vertical scalers. It was envisaged to be used by patients with asymmetry in the lower extremities capabilities. We developed a stable structure in steel ASTM A36 which does not depend on the building conditions of the installation site. RamAdvanse software was used to calculate structural stability. A winch with automatic brake mechanism was used to raise/lower the patient, who was tied to a comfortable harness which provided safety to the patient and therapist. It was possible to quantify precisely, using counterweights, the weight borne by the patient during therapy. We obtained a small-sized and ergonomic low-cost prototype, with similar features to those currently considered cutting-edge devices.

  2. Modeling and additive manufacturing of bio-inspired composites with tunable fracture mechanical properties.

    PubMed

    Dimas, Leon S; Buehler, Markus J

    2014-07-01

    Flaws, imperfections and cracks are ubiquitous in material systems and are commonly the catalysts of catastrophic material failure. As stresses and strains tend to concentrate around cracks and imperfections, structures tend to fail far before large regions of material have ever been subjected to significant loading. Therefore, a major challenge in material design is to engineer systems that perform on par with pristine structures despite the presence of imperfections. In this work we integrate knowledge of biological systems with computational modeling and state of the art additive manufacturing to synthesize advanced composites with tunable fracture mechanical properties. Supported by extensive mesoscale computer simulations, we demonstrate the design and manufacturing of composites that exhibit deformation mechanisms characteristic of pristine systems, featuring flaw-tolerant properties. We analyze the results by directly comparing strain fields for the synthesized composites, obtained through digital image correlation (DIC), and the computationally tested composites. Moreover, we plot Ashby diagrams for the range of simulated and experimental composites. Our findings show good agreement between simulation and experiment, confirming that the proposed mechanisms have a significant potential for vastly improving the fracture response of composite materials. We elucidate the role of stiffness ratio variations of composite constituents as an important feature in determining the composite properties. Moreover, our work validates the predictive ability of our models, presenting them as useful tools for guiding further material design. This work enables the tailored design and manufacturing of composites assembled from inferior building blocks, that obtain optimal combinations of stiffness and toughness. PMID:24700202

  3. Hypoxia-induced autophagy as an additional mechanism in human osteosarcoma radioresistance.

    PubMed

    Feng, Helin; Wang, Jin; Chen, Wei; Shan, Baoen; Guo, Yin; Xu, Jianfa; Wang, Ling; Guo, Peng; Zhang, Yingze

    2016-06-01

    Osteosarcoma (OS) responds poorly to radiotherapy, but the mechanism is unclear. We found OS tumor tissues expressed high level of protein HIF-1α, a common biological marker indicative of hypoxia. It is known that hypoxic cells are generally radioresistant because of reduced production of irradiation-induced DNA-damaging reactive oxygen species (ROS) in the anaerobic condition. Here we report another mechanism how hypoxia induces radioresistance. In MG-63 human osteosarcoma cells, hypoxic pretreatment increased the cellular survival in irradiation. These hypoxia-exposed cells displayed compartmental recruitment of GFP-tagged LC3 and expression of protein LC3-II, and restored the radiosensitivity upon autophagy inhibition. The following immunohistochemistry of OS tumor tissue sections revealed upregulated LC3 expression in a correlation with HIF-1α protein level, implying the possibly causative link between hypoxia and autophagy. Further studies in MG-63 cells demonstrated hypoxic pretreatment reduced cellular and mitochondrial ROS production during irradiation, while inhibition of autophagy re-elicited them. Taken together, our study suggests hypoxia can confer cells resistance to irradiation through activated autophagy to accelerate the clearance of cellular ROS products. This might exist in human osteosarcoma as an additional mechanism for radioresistance. PMID:27335774

  4. The effects of tantalum addition on the microtexture and mechanical behaviour of tungsten for ITER applications

    NASA Astrophysics Data System (ADS)

    Tejado, E.; Carvalho, P. A.; Munoz, A.; Dias, M.; Correia, J. B.; Mardolcar, U. V.; Pastor, J. Y.

    2015-12-01

    Tungsten (W) and its alloys are very promising materials for producing plasma-facing components (PFCs) in the fusion power reactors of the near future, even as a structural part in them. However, whereas the properties of pure tungsten are suitable for a PFC, its structural applications are still limited due to its low toughness, ductile to brittle transition temperature and recrystallization behaviour. Therefore, many efforts have been made to improve its performance by alloying tungsten with other elements. Hence, in this investigation, the thermo-mechanical performance of two new tungsten-tantalum materials has been evaluated. Materials with W-5wt.%Ta and W-15wt.%Ta were processed by mechanical alloying (MA) and later consolidation by hot isostatic pressing (HIP), with distinct settings for each composition. Thus, it was possible to determine the relationship between the microstructure and the addition of Ta with the macroscopic mechanical properties. These were measured by means of hardness, flexural strength and fracture toughness, in the temperature range of 300-1473 K. The microstructure and the fracture surfaces features of the tested materials were analysed by Field Emission Scanning Electron Microscopy (FESEM).

  5. [Progress of research in osteoarthritis. Gene expression and its regulatory mechanisms in the degenerative cartilage in osteoarthritis].

    PubMed

    Okazaki, Ken; Iwamoto, Yukihide

    2009-11-01

    Spatiotemporal variations of pathological changes were observed in the osteoarthritis joints. Gene expressions vary depending on the zones in the cartilage. For example, the expressions of degradative enzymes such as matrix metalloproteinases were enhanced in the superficial zone whereas the expression of matrix proteins enhanced at the deep zone. Many factors such as mechanical stress, aging, genetic background, inflammation and phenotypic changes of chondrocytes influence the pathogenesis of osteoarthritis, suggesting the involvement of many regulatory mechanisms in the gene expression. However, discoveries of regulatory factors that provide common pathways for the various phenomenon observed in the osteoarthritis cartilage suggest the interaction and co-operation of these important factors to conduct the pathology of degenerative cartilage. PMID:19880989

  6. The effect of additional etching and curing mechanism of composite resin on the dentin bond strength

    PubMed Central

    Lee, In-Su; Son, Sung-Ae; Hur, Bock; Kwon, Yong-Hoon

    2013-01-01

    PURPOSE The aim of this study was to evaluate the effects of additional acid etching and curing mechanism (light-curing or self-curing) of a composite resin on the dentin bond strength and compatibility of one-step self-etching adhesives. MATERIALS AND METHODS Sixteen human permanent molars were randomly divided into eight groups according to the adhesives used (All-Bond Universal: ABU, Clearfil S3 Bond: CS3), additional acid etching (additional acid etching performed: EO, no additional acid etching performed: EX), and composite resins (Filtek Z-250: Z250, Clearfil FII New Bond: CFNB). Group 1: ABU-EO-Z250, Group 2: ABU-EO-CFNB, Group 3: ABU-EX-Z250, Group 4: ABU-EX-CFNB, Group 5: CS3-EO-Z250, Group 6: CS3-EO-CFNB, Group 7: CS3-EX-Z250, Group 8: CS3-EX-CFNB. After bonding procedures, composite resins were built up on dentin surfaces. After 24-hour water storage, the teeth were sectioned to make 10 specimens for each group. The microtensile bond strength test was performed using a microtensile testing machine. The failure mode of the fractured specimens was examined by means of an optical microscope at ×20 magnification. The data was analyzed using a one-way ANOVA and Scheffe's post-hoc test (α=.05). RESULTS Additional etching groups showed significantly higher values than the no additional etching group when using All-Bond Universal. The light-cured composite resin groups showed significantly higher values than the self-cured composite resin groups in the Clearfil S3 Bond. CONCLUSION The additional acid etching is beneficial for the dentin bond strength when using low acidic one-step self-etch adhesives, and low acidic one-step self-etch adhesives are compatible with self-cured composite resin. The acidity of the one-step self-etch adhesives is an influencing factor in terms of the dentin bonding strength and incompatibility with a self-cured composite resin. PMID:24353889

  7. Using deep sequencing to characterize the biophysical mechanism of a transcriptional regulatory sequence

    PubMed Central

    Kinney, Justin B.; Murugan, Anand; Callan, Curtis G.; Cox, Edward C.

    2010-01-01

    Cells use protein-DNA and protein-protein interactions to regulate transcription. A biophysical understanding of this process has, however, been limited by the lack of methods for quantitatively characterizing the interactions that occur at specific promoters and enhancers in living cells. Here we show how such biophysical information can be revealed by a simple experiment in which a library of partially mutated regulatory sequences are partitioned according to their in vivo transcriptional activities and then sequenced en masse. Computational analysis of the sequence data produced by this experiment can provide precise quantitative information about how the regulatory proteins at a specific arrangement of binding sites work together to regulate transcription. This ability to reliably extract precise information about regulatory biophysics in the face of experimental noise is made possible by a recently identified relationship between likelihood and mutual information. Applying our experimental and computational techniques to the Escherichia coli lac promoter, we demonstrate the ability to identify regulatory protein binding sites de novo, determine the sequence-dependent binding energy of the proteins that bind these sites, and, importantly, measure the in vivo interaction energy between RNA polymerase and a DNA-bound transcription factor. Our approach provides a generally applicable method for characterizing the biophysical basis of transcriptional regulation by a specified regulatory sequence. The principles of our method can also be applied to a wide range of other problems in molecular biology. PMID:20439748

  8. ADDITIONAL STRESS AND FRACTURE MECHANICS ANALYSES OF PRESSURIZED WATER REACTOR PRESSURE VESSEL NOZZLES

    SciTech Connect

    Walter, Matthew; Yin, Shengjun; Stevens, Gary; Sommerville, Daniel; Palm, Nathan; Heinecke, Carol

    2012-01-01

    In past years, the authors have undertaken various studies of nozzles in both boiling water reactors (BWRs) and pressurized water reactors (PWRs) located in the reactor pressure vessel (RPV) adjacent to the core beltline region. Those studies described stress and fracture mechanics analyses performed to assess various RPV nozzle geometries, which were selected based on their proximity to the core beltline region, i.e., those nozzle configurations that are located close enough to the core region such that they may receive sufficient fluence prior to end-of-life (EOL) to require evaluation of embrittlement as part of the RPV analyses associated with pressure-temperature (P-T) limits. In this paper, additional stress and fracture analyses are summarized that were performed for additional PWR nozzles with the following objectives: To expand the population of PWR nozzle configurations evaluated, which was limited in the previous work to just two nozzles (one inlet and one outlet nozzle). To model and understand differences in stress results obtained for an internal pressure load case using a two-dimensional (2-D) axi-symmetric finite element model (FEM) vs. a three-dimensional (3-D) FEM for these PWR nozzles. In particular, the ovalization (stress concentration) effect of two intersecting cylinders, which is typical of RPV nozzle configurations, was investigated. To investigate the applicability of previously recommended linear elastic fracture mechanics (LEFM) hand solutions for calculating the Mode I stress intensity factor for a postulated nozzle corner crack for pressure loading for these PWR nozzles. These analyses were performed to further expand earlier work completed to support potential revision and refinement of Title 10 to the U.S. Code of Federal Regulations (CFR), Part 50, Appendix G, Fracture Toughness Requirements, and are intended to supplement similar evaluation of nozzles presented at the 2008, 2009, and 2011 Pressure Vessels and Piping (PVP

  9. An examination of the regulatory mechanism of Pxdn mutation-induced eye disorders using microarray analysis.

    PubMed

    Yang, Yang; Xing, Yiqiao; Liang, Chaoqun; Hu, Liya; Xu, Fei; Mei, Qi

    2016-06-01

    The present study aimed to identify biomarkers for peroxidasin (Pxdn) mutation-induced eye disorders and study the underlying mechanisms involved in this process. The microarray dataset GSE49704 was used, which encompasses 4 mouse samples from embryos with Pxdn mutation and 4 samples from normal tissues. After data preprocessing, the differentially expressed genes (DEGs) between Pxdn mutation and normal tissues were identified using the t-test in the limma package, followed by functional enrichment analysis. The protein-protein interaction (PPI) network was constructed based on the STRING database, and the transcriptional regulatory (TR) network was established using the GeneCodis database. Subsequently, the overlapping DEGs with high degrees in two networks were identified, as well as the sub-network extracted from the TR network. In total, 121 (75 upregulated and 46 downregulated) DEGs were identified, and these DEGs play important roles in biological processes (BPs), including neuron development and differentiation. A PPI network containing 25 nodes such as actin, alpha 1, skeletal muscle (Acta1) and troponin C type 2 (fast) (Tnnc2), and a TR network including 120 nodes were built. By comparing the two networks, seven crucial genes which overlapped were identified, including cyclin‑dependent kinase inhibitor 1B (Cdkn1b), Acta1 and troponin T type 3 (Tnnt3). In the sub-network, Cdkn1b was predicted as the target of miRNAs such as mmu-miR-24 and transcription factors (TFs) including forkhead box O4 (FOXO4) and activating enhancer binding protein 4 (AP4). Thus, we suggest that seven crucial genes, including Cdkn1b, Acta1 and Tnnt3, play important roles in the progression of eye disorders such as glaucoma. We suggest that Cdkn1b exert its effects via the inhibition of proliferation and is mediated by mmu-miR-24 and targeted by the TFs FOXO4 and AP4. PMID:27121343

  10. Effects of Ce Addition on the Microstructure and Mechanical Properties of Sn-58Bi Solder Joints

    NASA Astrophysics Data System (ADS)

    Chuang, Tung-Han; Wu, Hsing-Fei

    2011-01-01

    The effects of a rare-earth element on the microstructure, mechanical properties, and whisker growth of Sn-58Bi alloys and solder joints in ball grid array (BGA) packages with Ag/Cu pads have been investigated. Mechanical testing indicated that the elongation of Sn-58Bi alloys doped with Ce increased significantly, and the tensile strength decreased slightly, in compar- ison with undoped Sn-58Bi. In addition, the growth of both fiber- and hillock-shaped tin whiskers on the surface of Sn-58Bi-0.5Ce was retarded in the case of Sn-3Ag-0.5Cu-0.5Ce alloys. The growth of interfacial intermetallic compounds (IMC) in Sn-58Bi-0.5Ce solder joints was slower than that in Sn-58Bi because the activity of Ce atoms at the interface of the Cu6Sn5 IMC/solder was reduced. The reflowed Sn-58Bi and Sn-58Bi-0.5Ce BGA packages with Ag/Cu pads had a ball shear strength of 7.91 N and 7.64 N, which decreased to about 7.13 N and 6.87 N after aging at 100°C for 1000 h, respectively. The reflowed and aged solder joints fractured across the solder balls with ductile characteristics after ball shear tests.

  11. Mechanical Characterization of an Additively Manufactured Inconel 718 Theta-Shaped Specimen

    NASA Astrophysics Data System (ADS)

    Cakmak, Ercan; Watkins, Thomas R.; Bunn, Jeffrey R.; Cooper, Ryan C.; Cornwell, Paris A.; Wang, Yanli; Sochalski-Kolbus, Lindsay M.; Dehoff, Ryan R.; Babu, Sudarsanam S.

    2016-02-01

    Two sets of "theta"-shaped specimens were additively manufactured with Inconel 718 powders using an electron beam melting technique with two distinct scan strategies. Light optical microscopy, mechanical testing coupled with a digital image correlation (DIC) technique, finite element modeling, and neutron diffraction with in situ loading characterizations were conducted. The cross-members of the specimens were the focus. Light optical micrographs revealed that different microstructures were formed with different scan strategies. Ex situ mechanical testing revealed each build to be stable under load until ductility was observed on the cross-members before failure. The elastic moduli were determined by forming a correlation between the elastic tensile stresses determined from FEM, and the elastic strains obtained from DIC. The lattice strains were mapped with neutron diffraction during in situ elastic loading; and a good correlation between the average axial lattice strains on the cross-member and those determined from the DIC analysis was found. The spatially resolved stresses in the elastic deformation regime are derived from the lattice strains and increased with applied load, showing a consistent distribution along the cross-member.

  12. Effect of addition of semi refined carrageenan on mechanical characteristics of gum arabic edible film

    NASA Astrophysics Data System (ADS)

    Setyorini, D.; Nurcahyani, P. R.

    2016-04-01

    Currently the seaweed is processed flour and Semi Refined Carraagenan (SRC). However, total production is small, but both of these products have a high value and are used in a wide variety of products such as cosmetics, processed foods, medicines, and edible film. The aim of this study were (1) to determine the effect of SRC on mechanical characteristics of edible film, (2) to determine the best edible film which added by SRC with different concentration. The edible film added by SRC flour which divided into three concentrations of SRC. There are 1.5%; 3%; and 4.5% of SRC, then added 3% glycerol and 0.6% arabic gum. The mechanical properties of the film measured by a universal testing machine Orientec Co. Ltd., while the water vapor permeability measured by the gravimetric method dessicant modified. The experimental design used was completely randomized design with a further test of Duncan. The result show SRC concentration differences affect the elongation breaking point and tensile strength. But not significant effect on the thickness, yield strength and the modulus of elasticity. The best edible film is edible film with the addition of SRC 4.5%.

  13. Mechanically tunable aspheric lenses via additive manufacture of hanging elastomeric droplets for microscopic applications

    NASA Astrophysics Data System (ADS)

    Fuh, Yiin-Kuen; Chen, Pin-Wen; Lai, Zheng-Hong

    2016-07-01

    Mechanically deformable lenses with dynamically tunable focal lengths have been developed in this work. The fabricated five types of aspheric polydimethylsiloxane (PDMS) lenses presented here have an initial focal length of 7.0, 7.8, 9.0, 10.0 and 10.2 mm. Incorporating two modes of operation in biconvex and concave-convex configurations, the focal lengths can be tuned dynamically as 5.2-10.2, 5.5-9.9, 6.6-11.9, 6.1-13.5 and 6.6-13.5 mm respectively. Additive manufacturing was utilized to fabricate these five types of aspheric lenses (APLs) via sequential layering of PDMS materials. Complex structures with three-dimensional features and shorter focal lengths can be successfully produced by repeatedly depositing, inverting and curing controlled PDMS volume onto previously cured PDMS droplets. From our experiments, we empirically found a direct dependence of the focal length of the lenses with the amount (volume) of deposited PDMS droplets. This new mouldless, low-cost, and flexible lens fabrication method is able to transform an ordinary commercial smartphone camera into a low-cost portable microscope. A few microscopic features can be readily visualized, such as wrinkles of ladybird pupa and printed circuit board. The fabrication technique by successively applying hanging droplet and facile mechanical focal-length-tuning set-up can be easily adopted in the development of high-performance optical lenses.

  14. Mechanical characterization of an additively manufactured Inconel 718 theta-shaped specimen

    SciTech Connect

    Cakmak, Ercan; Watkins, Thomas R.; Bunn, Jeffrey R.; Cornwell, Paris A.; Wang, Yanli; Dehoff, Ryan R.; Babu, Sudarsanam Suresh; Sochalski-Kolbus, Lindsay M.

    2015-11-20

    Two sets of “theta”-shaped specimens were additively manufactured with Inconel 718 powders using an electron beam melting technique with two distinct scan strategies. Light optical microscopy, mechanical testing coupled with a digital image correlation (DIC) technique, finite element modeling, and neutron diffraction with in situ loading characterizations were conducted. The cross-members of the specimens were the focus. Light optical micrographs revealed that different microstructures were formed with different scan strategies. Ex situ mechanical testing revealed each build to be stable under load until ductility was observed on the cross-members before failure. The elastic moduli were determined by forming a correlation between the elastic tensile stresses determined from FEM, and the elastic strains obtained from DIC. The lattice strains were mapped with neutron diffraction during in situ elastic loading; and a good correlation between the average axial lattice strains on the cross-member and those determined from the DIC analysis was found. Lastly, the spatially resolved stresses in the elastic deformation regime are derived from the lattice strains and increased with applied load, showing a consistent distribution along the cross-member.

  15. Mechanical characterization of an additively manufactured Inconel 718 theta-shaped specimen

    DOE PAGESBeta

    Cakmak, Ercan; Watkins, Thomas R.; Bunn, Jeffrey R.; Cornwell, Paris A.; Wang, Yanli; Dehoff, Ryan R.; Babu, Sudarsanam Suresh; Sochalski-Kolbus, Lindsay M.

    2015-11-20

    Two sets of “theta”-shaped specimens were additively manufactured with Inconel 718 powders using an electron beam melting technique with two distinct scan strategies. Light optical microscopy, mechanical testing coupled with a digital image correlation (DIC) technique, finite element modeling, and neutron diffraction with in situ loading characterizations were conducted. The cross-members of the specimens were the focus. Light optical micrographs revealed that different microstructures were formed with different scan strategies. Ex situ mechanical testing revealed each build to be stable under load until ductility was observed on the cross-members before failure. The elastic moduli were determined by forming a correlationmore » between the elastic tensile stresses determined from FEM, and the elastic strains obtained from DIC. The lattice strains were mapped with neutron diffraction during in situ elastic loading; and a good correlation between the average axial lattice strains on the cross-member and those determined from the DIC analysis was found. Lastly, the spatially resolved stresses in the elastic deformation regime are derived from the lattice strains and increased with applied load, showing a consistent distribution along the cross-member.« less

  16. Accumulation Mechanisms of CD4(+)CD25(+)FOXP3(+) Regulatory T Cells in EBV-associated Gastric Carcinoma.

    PubMed

    Zhang, Na-na; Chen, Jian-ning; Xiao, Lin; Tang, Fang; Zhang, Zhi-gang; Zhang, Yi-wang; Feng, Zhi-ying; Jiang, Ye; Shao, Chun-kui

    2015-01-01

    Approximately 10% of gastric carcinomas are associated with Epstein-Barr virus (EBV) and are defined as EBV-associated gastric carcinomas (EBVaGCs). EBVaGCs are known to be accompanied by massive CD8(+) cytotoxic T cell (CTL) infiltration; however, adoptive cellular immunotherapy based on EBV-specific CD8(+) CTLs has been explored with limited success. Because regulatory T cells (Tregs) are regarded as a critical hurdle in anti-tumour immunity, we assessed the distribution of Tregs in 45 cases of EBVaGC and 45 cases of EBV-negative gastric carcinoma (EBVnGC) with matched clinicopathological parameters by immunohistochemistry. We showed that Tregs were significantly increased in EBVaGC compared to EBVnGC (15.92 ± 11.45/HPF vs. 8.45 ± 6.16/HPF, p = 0.001). In addition, we explored the accumulation mechanisms of Tregs in EBVaGC by using EBV (+) gastric carcinoma cell lines SNU719 and GT39 as ex vivo models. When peripheral blood mononuclear cells (PBMCs) were co-cultured with EBV (+) gastric carcinoma cell lines, the Treg frequency increased, and they underwent phenotypic and functional changes. The enhanced recruitment by CCL22 produced by EBVaGC cells, the decreased emigration due to CCR7 downregulation on the Treg surface, the higher proliferation rate, and the lower apoptosis rate of Tregs at tumour sites may promote the accumulation of Tregs in EBVaGC. PMID:26673957

  17. Mechanical properties of tungsten alloys with Y 2O 3 and titanium additions

    NASA Astrophysics Data System (ADS)

    Aguirre, M. V.; Martín, A.; Pastor, J. Y.; LLorca, J.; Monge, M. A.; Pareja, R.

    2011-10-01

    In this research the mechanical behaviour of pure tungsten (W) and its alloys (2 wt.% Ti-0.47 wt.% Y 2O 3 and 4 wt.% Ti-0.5 wt.% Y 2O 3) is compared. These tungsten alloys, have been obtained by powder metallurgy. The yield strength, fracture toughness and elastic modulus have been studied in the temperature interval of 25 °C to 1000 °C. The results have shown that the addition of Ti substantially improves the bending strength and toughness of W, but it also dramatically increases the DBTT. On the other hand, the addition of 0.5% Y 2O 3, is enough to improve noticeably the oxidation behaviour at the higher temperatures. The grain size, fractography and microstructure are studied in these materials. Titanium is a good grain growth inhibitor and effective precursor of liquid phase in HIP. The simultaneous presence of Y 2O 3 and Ti permits to obtain materials with low pores presence.

  18. Beyond Mutations: Additional Mechanisms and Implications of SWI/SNF Complex Inactivation

    PubMed Central

    Marquez, Stefanie B.; Thompson, Kenneth W.; Lu, Li; Reisman, David

    2015-01-01

    SWI/SNF is a major regulator of gene expression. Its role is to facilitate the shifting and exposure of DNA segments within the promoter and other key domains to transcription factors and other essential cellular proteins. This complex interacts with a wide range of proteins and does not function within a single, specific pathway; thus, it is involved in a multitude of cellular processes, including DNA repair, differentiation, development, cell adhesion, and growth control. Given SWI/SNF’s prominent role in these processes, many of which are important for blocking cancer development, it is not surprising that the SWI/SNF complex is targeted during cancer initiation and progression both by mutations and by non-mutational mechanisms. Currently, the understanding of the types of alterations, their frequency, and their impact on the SWI/SNF subunits is an area of intense research that has been bolstered by a recent cadre of NextGen sequencing studies. These studies have revealed mutations in SWI/SNF subunits, indicating that this complex is thus important for cancer development. The purpose of this review is to put into perspective the role of mutations versus other mechanisms in the silencing of SWI/SNF subunits, in particular, BRG1 and BRM. In addition, this review explores the recent development of synthetic lethality and how it applies to this complex, as well as how BRM polymorphisms are becoming recognized as potential clinical biomarkers for cancer risk. Significance: Recent reviews have detailed the occurrence of mutations in nearly all SWI/SNF subunits, which indicates that this complex is an important target for cancer. However, when the frequency of mutations in a given tumor type is compared to the frequency of subunit loss, it becomes clear that other non-mutational mechanisms must play a role in the inactivation of SWI/SNF subunits. Such data indicate that epigenetic mechanisms that are known to regulate BRM may also be involved in the loss of

  19. Microstructure and mechanical behavior of iron-40 aluminum containing carbon and boron additions

    NASA Astrophysics Data System (ADS)

    Pang, Lixin

    2000-10-01

    In this thesis, the effect of second phase particles on the microstructure and mechanical behavior of cast and extruded Fe-40 at.%Al-0.6 at.%C and Fe-40 at.%Al-0.5 at.%B-0.7 at.%C alloys was studied. A variety of heat treatments was performed to study changes in microstructure and their effect on the mechanical properties (tensile tests and Charpy impact tests at different strain rates and temperatures). In the as-extruded condition, the microstructure of Fe-40Al-0.6C consists of a B2 matrix, Fe3AlCO0.5 precipitates, and graphite; the microstructure of the Fe-40A1-0.7C-0.5B is further complicated by the presence of Fe2B precipitates, a metastable nu phase and a planar defect. The stability of these phases and defects was studied in detail. The nu precipitate was found to be metastable, and its formation is cooling-rate dependent. The planar defects lie on the {001} planes of the matrix, with a displacement vector 1/2<001>, which is parallel to the plane of the defect. In addition, there is an aluminum layer missing on the fault plane; these planar defects are thought to form as a consequence of the dissociation of <001> dislocations. The addition of C and B was shown to be beneficial to the ductility and impact toughness of the Fe-40Al alloy. This improvement is attributed to hydrogen trapping by carbides and borides in the FeAl matrix, thereby delaying environmental embrittlement kinetics. The strain rate versus ductility curves for the two alloys show different characteristics in the slow strain rate regime--whereas the ductility of the FeAlBC alloy remains at a constant level of ˜3.5%, the curve for the FeAlC alloy shows first, a decrease with strain rate and then a gradual increase in elongation.

  20. Biofilm formation by Bacillus subtilis: new insights into regulatory strategies and assembly mechanisms.

    PubMed

    Cairns, Lynne S; Hobley, Laura; Stanley-Wall, Nicola R

    2014-08-01

    Biofilm formation is a social behaviour that generates favourable conditions for sustained survival in the natural environment. For the Gram-positive bacterium Bacillus subtilis the process involves the differentiation of cell fate within an isogenic population and the production of communal goods that form the biofilm matrix. Here we review recent progress in understanding the regulatory pathways that control biofilm formation and highlight developments in understanding the composition, function and structure of the biofilm matrix. PMID:24988880

  1. Biofilm formation by Bacillus subtilis: new insights into regulatory strategies and assembly mechanisms

    PubMed Central

    Cairns, Lynne S; Hobley, Laura; Stanley-Wall, Nicola R

    2014-01-01

    Biofilm formation is a social behaviour that generates favourable conditions for sustained survival in the natural environment. For the Gram-positive bacterium Bacillus subtilis the process involves the differentiation of cell fate within an isogenic population and the production of communal goods that form the biofilm matrix. Here we review recent progress in understanding the regulatory pathways that control biofilm formation and highlight developments in understanding the composition, function and structure of the biofilm matrix. PMID:24988880

  2. De Novo Evolution of Complex, Global and Hierarchical Gene Regulatory Mechanisms

    PubMed Central

    Jenkins, Dafyd J.

    2010-01-01

    Gene regulatory networks exhibit complex, hierarchical features such as global regulation and network motifs. There is much debate about whether the evolutionary origins of such features are the results of adaptation, or the by-products of non-adaptive processes of DNA replication. The lack of availability of gene regulatory networks of ancestor species on evolutionary timescales makes this a particularly difficult problem to resolve. Digital organisms, however, can be used to provide a complete evolutionary record of lineages. We use a biologically realistic evolutionary model that includes gene expression, regulation, metabolism and biosynthesis, to investigate the evolution of complex function in gene regulatory networks. We discover that: (i) network architecture and complexity evolve in response to environmental complexity, (ii) global gene regulation is selected for in complex environments, (iii) complex, inter-connected, hierarchical structures evolve in stages, with energy regulation preceding stress responses, and stress responses preceding growth rate adaptations and (iv) robustness of evolved models to mutations depends on hierarchical level: energy regulation and stress responses tend not to be robust to mutations, whereas growth rate adaptations are more robust and non-lethal when mutated. These results highlight the adaptive and incremental evolution of complex biological networks, and the value and potential of studying realistic in silico evolutionary systems as a way of understanding living systems. Electronic supplementary material The online version of this article (doi:10.1007/s00239-010-9369-4) contains supplementary material, which is available to authorized users. PMID:20680619

  3. Ti-6Al-4V Additively Manufactured by Selective Laser Melting with Superior Mechanical Properties

    NASA Astrophysics Data System (ADS)

    Xu, W.; Sun, S.; Elambasseril, J.; Liu, Q.; Brandt, M.; Qian, M.

    2015-03-01

    The Achilles' heel of additively manufactured Ti-6Al-4V by selective laser melting (SLM) is its inferior mechanical properties compared with its wrought (forged) counterparts. Acicular α' martensite resulted from rapid cooling by SLM is primarily responsible for high strength but inadequate tensile ductility achieved in the as-fabricated state. This study presents a solution to eliminating the adverse effect of the nonequilibrium α' martensite. This is achieved by enabling in situ martensite decomposition into a novel ultrafine (200-300 nm) lamellar ( α + β) microstructure via the selection of an array of processing variables including the layer thickness, energy density, and focal offset distance. The resulting tensile elongation reached 11.4% while the yield strength was kept above 1100 MPa. These properties compare favorably with those of mill-annealed Ti-6Al-4V consisting of globular α and β. The fatigue life of SLM-fabricated Ti-6Al-4V with an ultrafine lamellar ( α + β) structure has approached that of the mill-annealed counterparts and is much superior to that of SLM-fabricated Ti-6Al-4V with α' martensite.

  4. Synthesis mechanism of nanoporous Sn3O4 nanosheets by hydrothermal process without any additives

    NASA Astrophysics Data System (ADS)

    Zhao, Jun-Hua; Tan, Rui-Qin; Yang, Ye; Xu, Wei; Li, Jia; Shen, Wen-Feng; Wu, Guo-Qiang; Zhu, You-Liang; Yang, Xu-Feng; Song, Wei-Jie

    2015-06-01

    Nanoporous anorthic-phase Sn3O4 nanosheets are successfully fabricated via a hydrothermal process without any additives. With the pH value of the precursor increasing from 2.0 to 11.8, the valence of the precursor changes from mixed valence (the ratio of Sn2+ to Sn4+ is 2.7:1) to pure bivalent, and the product transformed from Sn3O4 to SnO mesocrystals. When doping SbCl3 to the alkaline precursor, the valence of the precursor shows mixed valence with the ratio of Sn2+ to Sn4+ being 2.6:1 and Sn3O4 is synthesized after the hydrothermal process. The valence state of Sn species in the precursor is the key factor of the formation of Sn3O4. The synthesis mechanism is discussed and proposed. These experimental results expand the knowledge base that can be used to guide technological applications of intermediate tin oxide materials. Project supported by the National Natural Science Foundation of China (Grant Nos. 21377063, 51102250, 21203226, and 21205127) and the Personnel Training Foundation of Quzhou University (Grant No. BSYJ201412).

  5. Additional funding mechanisms for Public Hospitals in Greece: the case of Chania Mental Health Hospital

    PubMed Central

    2010-01-01

    Objectives To investigate whether the long term lease of public hospital owned land could be an additional financing mechanism for Greek public (mental) health hospitals. Methods We performed a financial analysis of the official 2008 data of a case - study hospital (Mental Health Hospital of Chania). We used a capital budgeting approach to investigate whether value is created for the public hospital by engaging its assets in a project for the development of a private renal dialysis Unit. Results The development of the private unit in hospital owned land is a good investment decision, as it generates high project Net Present Value and Internal Rate of Return. When the project commences generating operating cash flows, nearly €400.000 will be paid annually to the Mental Health Hospital of Chania as rent, thereby gradually decreasing the annual deficit of the hospital. Conclusions Revenue generated from the long term lease of public hospital land is crucial to gradually eliminate hospital deficit. The Ministry of Health should encourage similar forms of Public Private Partnerships in order to ensure the sustainability of public (mental) hospitals. PMID:21067580

  6. Effect of Ag and Pb Addition on Microstructural and Mechanical Properties of SAC 105 Solders

    NASA Astrophysics Data System (ADS)

    Molnar, Aliz; Janovszky, Dora; Kardos, Ibolya; Molnar, Istvan; Gacsi, Zoltan

    2015-10-01

    Melting and crystallization processes of lead-free and lead-contaminated alloys in near-equilibrium state were investigated. In addition, the effect of silver content up to 4 wt.% on the microstructure of Sn-Ag-Cu alloys was studied. The volume fraction of β-Sn decreased by half owing to 4 wt.% Ag content. Furthermore, contamination by lead strongly influences the properties of the solidified microstructure. The Pb grains appear as a result of two processes when the Pb content is equal to 0.5 wt.% or higher: Pb phase solidifies in the quaternary eutectic at 176°C, and Pb grains precipitate from the primary β-Sn solid solution grain during a solid state reaction. The freezing range enlarges to 51°C due to 2 wt.% Pb content owing to quaternary eutectic. Above 1 wt.% Pb content, the mechanical properties also improve due to grains of quaternary eutectic Pb and precipitated Pb grains with a size <1 μm.

  7. The Mechanisms of Water Exchange: The Regulatory Roles of Multiple Interactions in Social Wasps

    PubMed Central

    Agrawal, Devanshu; Karsai, Istvan

    2016-01-01

    Evolutionary benefits of task fidelity and improving information acquisition via multiple transfers of materials between individuals in a task partitioned system have been shown before, but in this paper we provide a mechanistic explanation of these phenomena. Using a simple mathematical model describing the individual interactions of the wasps, we explain the functioning of the common stomach, an information center, which governs construction behavior and task change. Our central hypothesis is a symmetry between foragers who deposit water and foragers who withdraw water into and out of the common stomach. We combine this with a trade-off between acceptance and resistance to water transfer. We ultimately derive a mathematical function that relates the number of interactions that foragers complete with common stomach wasps during a foraging cycle. We use field data and additional model assumptions to calculate values of our model parameters, and we use these to explain why the fullness of the common stomach stabilizes just below 50 percent, why the average number of successful interactions between foragers and the wasps forming the common stomach is between 5 and 7, and why there is a variation in this number of interactions over time. Our explanation is that our proposed water exchange mechanism places natural bounds on the number of successful interactions possible, water exchange is set to optimize mediation of water through the common stomach, and the chance that foragers abort their task prematurely is very low. PMID:26751076

  8. A Regulatory Mechanism for RSK2 NH2-Terminal Kinase Activity

    PubMed Central

    Cho, Yong-Yeon; Yao, Ke; Pugliese, Angelo; Malakhova, Margarita L.; Bode, Ann M.; Dong, Zigang

    2010-01-01

    Our previous findings indicated that RSK2 plays a critical role in proliferation and cell transformation induced by tumor promoters, such as epidermal growth factor or 12-O-tetradecanoylphorbol-13-acetate, and that kaempferol, a natural compound found in edible plants, selectively inhibits RSK2 activity. However, the molecular mechanism for RSK2 activation is unclear. Herein, we provide evidence showing that NH2-terminal kinase domain (NTD) activation of RSK2 is required for the activation of the extracellular signal-regulated kinase–mediated COOH-terminal kinase domain (CTD). We also found that the NTD plays a key role in substrate phosphorylation and that kaempferol binds with the NTD but not the CTD in both the active and inactive forms. Homology modeling of the RSK2 NH2-terminal domain and small-molecule docking, validated by mutagenesis experiments, clearly showed that Val82 and Lys100 are critical amino acids for kaempferol binding and RSK2 activity. Furthermore, immunohistofluorescence and Western blot results indicated that the RSK2 protein level is markedly higher in cancer cell lines as well as cancer tissues compared with nonmalignant cell lines or normal tissues. In addition, kaempferol inhibited proliferation of malignant human cancer cell lines, including A431, SK-MEL-5 and SK-MEL-28, and HCT-116. These results indicate that targeting RSK2 with natural compounds, such as kaempferol, might be a good strategy for chemopreventive or chemotherapeutic application. PMID:19435896

  9. Role of Sodium Bicarbonate Cotransporters in Intracellular pH Regulation and Their Regulatory Mechanisms in Human Submandibular Glands

    PubMed Central

    Namkoong, Eun; Shin, Yong-Hwan; Bae, Jun-Seok; Choi, Seulki; Kim, Minkyoung; Kim, Nahyun; Hwang, Sung-Min; Park, Kyungpyo

    2015-01-01

    Sodium bicarbonate cotransporters (NBCs) are involved in the pH regulation of salivary glands. However, the roles and regulatory mechanisms among different NBC isotypes have not been rigorously evaluated. We investigated the roles of two different types of NBCs, electroneutral (NBCn1) and electrogenic NBC (NBCe1), with respect to pH regulation and regulatory mechanisms using human submandibular glands (hSMGs) and HSG cells. Intracellular pH (pHi) was measured and the pHi recovery rate from cell acidification induced by an NH4Cl pulse was recorded. Subcellular localization and protein phosphorylation were determined using immunohistochemistry and co-immunoprecipitation techniques. We determined that NBCn1 is expressed on the basolateral side of acinar cells and the apical side of duct cells, while NBCe1 is exclusively expressed on the apical membrane of duct cells. The pHi recovery rate in hSMG acinar cells, which only express NBCn1, was not affected by pre-incubation with 5 μM PP2, an Src tyrosine kinase inhibitor. However, in HSG cells, which express both NBCe1 and NBCn1, the pHi recovery rate was inhibited by PP2. The apparent difference in regulatory mechanisms for NBCn1 and NBCe1 was evaluated by artificial overexpression of NBCn1 or NBCe1 in HSG cells, which revealed that the pHi recovery rate was only inhibited by PP2 in cells overexpressing NBCe1. Furthermore, only NBCe1 was significantly phosphorylated and translocated by NH4Cl, which was inhibited by PP2. Our results suggest that both NBCn1 and NBCe1 play a role in pHi regulation in hSMG acinar cells, and also that Src kinase does not regulate the activity of NBCn1. PMID:26375462

  10. Role of Sodium Bicarbonate Cotransporters in Intracellular pH Regulation and Their Regulatory Mechanisms in Human Submandibular Glands.

    PubMed

    Namkoong, Eun; Shin, Yong-Hwan; Bae, Jun-Seok; Choi, Seulki; Kim, Minkyoung; Kim, Nahyun; Hwang, Sung-Min; Park, Kyungpyo

    2015-01-01

    Sodium bicarbonate cotransporters (NBCs) are involved in the pH regulation of salivary glands. However, the roles and regulatory mechanisms among different NBC isotypes have not been rigorously evaluated. We investigated the roles of two different types of NBCs, electroneutral (NBCn1) and electrogenic NBC (NBCe1), with respect to pH regulation and regulatory mechanisms using human submandibular glands (hSMGs) and HSG cells. Intracellular pH (pHi) was measured and the pHi recovery rate from cell acidification induced by an NH4Cl pulse was recorded. Subcellular localization and protein phosphorylation were determined using immunohistochemistry and co-immunoprecipitation techniques. We determined that NBCn1 is expressed on the basolateral side of acinar cells and the apical side of duct cells, while NBCe1 is exclusively expressed on the apical membrane of duct cells. The pHi recovery rate in hSMG acinar cells, which only express NBCn1, was not affected by pre-incubation with 5 μM PP2, an Src tyrosine kinase inhibitor. However, in HSG cells, which express both NBCe1 and NBCn1, the pHi recovery rate was inhibited by PP2. The apparent difference in regulatory mechanisms for NBCn1 and NBCe1 was evaluated by artificial overexpression of NBCn1 or NBCe1 in HSG cells, which revealed that the pHi recovery rate was only inhibited by PP2 in cells overexpressing NBCe1. Furthermore, only NBCe1 was significantly phosphorylated and translocated by NH4Cl, which was inhibited by PP2. Our results suggest that both NBCn1 and NBCe1 play a role in pHi regulation in hSMG acinar cells, and also that Src kinase does not regulate the activity of NBCn1. PMID:26375462

  11. Regulatory Role of Collagen V in Establishing Mechanical Properties of Tendons and Ligaments is Tissue-Dependent

    PubMed Central

    Connizzo, Brianne K.; Freedman, Benjamin R.; Fried, Joanna H.; Sun, Mei; Birk, David E.; Soslowsky, Louis J.

    2015-01-01

    Patients with classic (type I) Ehlers-Danlos Syndrome (EDS), characterized by heterozygous mutations in the Col5a1 and Col5a2 genes, exhibit connective tissue hyperelasticity and recurrent joint dislocations, indicating a potential regulatory role for collagen V in joint stabilizing soft tissues. This study asked whether the contribution of collagen V to the establishment of mechanical properties is tissue-dependent. We mechanically tested four different tissues from wild type and targeted collagen V-null mice: the flexor digitorum longus tendon (FDL), Achilles tendon (ACH), the anterior cruciate ligament (ACL) and the supraspinatus tendon (SST). Area was significantly reduced in the Col5a1ΔTen/ΔTen group in the FDL, ACH, and SST. Maximum load and stiffness were reduced in the Col5a1ΔTen/ΔTen group for all tissues. However, insertion site and midsubstance modulus were reduced only for the ACL and SST. This study provides evidence that the regulatory role of collagen V in extracellular matrix assembly is tissue-dependent and that joint instability in classic EDS may be caused in part by insufficient mechanical properties of the tendons and ligaments surrounding each joint. PMID:25876927

  12. Mechanisms of diabetic autoimmunity: II--Is diabetes a central or peripheral disorder of effector and regulatory cells?

    PubMed

    Askenasy, Nadir

    2016-02-01

    Two competing hypotheses aiming to explain the onset of autoimmune reactions are discussed in the context of genetic and environmental predisposition to type 1 diabetes (T1D). The first hypothesis has evolved along characterization of the mechanisms of self-discrimination and attributes diabetic autoimmunity to escape of reactive T cells from central regulation in the thymus. The second considers frequent occurrence of autoimmune reactions within the immune homunculus, which are adequately suppressed by regulatory T cells originating from the thymus, and occasionally, insufficient suppression results in autoimmunity. Besides thymic dysfunction, deregulation of both effector and suppressor cells can in fact result from homeostatic aberrations at the peripheral level during initial stages of evolution of adaptive immunity. Pathogenic cells sensitized in the islets are efficiently expanded in the target tissue and pancreatic lymph nodes of lymphopenic neonates. In parallel, the same mechanisms of peripheral sensitization contribute to tolerization through education of naïve/effector T cells and expansion of regulatory T cells. Experimental evidence presented for each individual mechanism implies that T1D may result from a primary effector or suppressor immune abnormality. Disturbed self-tolerance leading to T1D may well result from peripheral deregulation of innate and adaptive immunity, with variable contribution of central thymic dysfunction. PMID:26482052

  13. Activation of Vago by interferon regulatory factor (IRF) suggests an interferon system-like antiviral mechanism in shrimp

    PubMed Central

    Li, Chaozheng; Li, Haoyang; Chen, Yixiao; Chen, Yonggui; Wang, Sheng; Weng, Shao-Ping; Xu, Xiaopeng; He, Jianguo

    2015-01-01

    There is a debate on whether invertebrates possess an antiviral immunity similar to the interferon (IFN) system of vertebrates. The Vago gene from arthropods encodes a viral-activated secreted peptide that restricts virus infection through activating the JAK-STAT pathway and is considered to be a cytokine functionally similar to IFN. In this study, the first crustacean IFN regulatory factor (IRF)-like gene was identified in Pacific white shrimp, Litopenaeus vannamei. The L. vannamei IRF showed similar protein nature to mammalian IRFs and could be activated during virus infection. As a transcriptional regulatory factor, L. vannamei IRF could activate the IFN-stimulated response element (ISRE)-containing promoter to regulate the expression of mammalian type I IFNs and initiate an antiviral state in mammalian cells. More importantly, IRF could bind the 5′-untranslated region of L. vannamei Vago4 gene and activate its transcription, suggesting that shrimp Vago may be induced in a similar manner to that of IFNs and supporting the opinion that Vago might function as an IFN-like molecule in invertebrates. These suggested that shrimp might possess an IRF-Vago-JAK/STAT regulatory axis, which is similar to the IRF-IFN-JAK/STAT axis of vertebrates, indicating that invertebrates might possess an IFN system-like antiviral mechanism. PMID:26459861

  14. Additive manufacturing of Inconel 718 using electron beam melting: Processing, post-processing, & mechanical properties

    NASA Astrophysics Data System (ADS)

    Sames, William James, V.

    Additive Manufacturing (AM) process parameters were studied for production of the high temperature alloy Inconel 718 using Electron Beam Melting (EBM) to better understand the relationship between processing, microstructure, and mechanical properties. Processing parameters were analyzed for impact on process time, process temperature, and the amount of applied energy. The applied electron beam energy was shown to be integral to the formation of swelling defects. Standard features in the microstructure were identified, including previously unidentified solidification features such as shrinkage porosity and non-equilibrium phases. The as-solidified structure does not persist in the bulk of EBM parts due to a high process hold temperature (˜1000°C), which causes in situ homogenization. The most significant variability in as-fabricated microstructure is the formation of intragranular delta-phase needles, which can form in samples produced with lower process temperatures (< 960°C). A novel approach was developed and demonstrated for controlling the temperature of cool down, thus providing a technique for in situ heat treatment of material. This technique was used to produce material with hardness of 478+/-7 HV with no post-processing, which exceeds the hardness of peak-aged Inconel 718. Traditional post-processing methods of hot isostatic pressing (HIP) and solution treatment and aging (STA) were found to result in variability in grain growth and phase solution. Recrystallization and grain structure are identified as possible mechanisms to promote grain growth. These results led to the conclusion that the first step in thermal post-processing of EBM Inconel 718 should be an optimized solution treatment to reset phase variation in the as-fabricated microstructure without incurring significant grain growth. Such an optimized solution treatment was developed (1120°C, 2hr) for application prior to aging or HIP. The majority of as-fabricated tensile properties met ASTM

  15. Genome-Wide Analysis of Wilms' Tumor 1-Controlled Gene Expression in Podocytes Reveals Key Regulatory Mechanisms.

    PubMed

    Kann, Martin; Ettou, Sandrine; Jung, Youngsook L; Lenz, Maximilian O; Taglienti, Mary E; Park, Peter J; Schermer, Bernhard; Benzing, Thomas; Kreidberg, Jordan A

    2015-09-01

    The transcription factor Wilms' tumor suppressor 1 (WT1) is key to podocyte development and viability; however, WT1 transcriptional networks in podocytes remain elusive. We provide a comprehensive analysis of the genome-wide WT1 transcriptional network in podocytes in vivo using chromatin immunoprecipitation followed by sequencing (ChIPseq) and RNA sequencing techniques. Our data show a specific role for WT1 in regulating the podocyte-specific transcriptome through binding to both promoters and enhancers of target genes. Furthermore, we inferred a podocyte transcription factor network consisting of WT1, LMX1B, TCF21, Fox-class and TEAD family transcription factors, and MAFB that uses tissue-specific enhancers to control podocyte gene expression. In addition to previously described WT1-dependent target genes, ChIPseq identified novel WT1-dependent signaling systems. These targets included components of the Hippo signaling system, underscoring the power of genome-wide transcriptional-network analyses. Together, our data elucidate a comprehensive gene regulatory network in podocytes suggesting that WT1 gene regulatory function and podocyte cell-type specification can best be understood in the context of transcription factor-regulatory element network interplay. PMID:25636411

  16. Mosaic gene network modelling identified new regulatory mechanisms in HCV infection.

    PubMed

    Popik, Olga V; Petrovskiy, Evgeny D; Mishchenko, Elena L; Lavrik, Inna N; Ivanisenko, Vladimir A

    2016-06-15

    Modelling of gene networks is widely used in systems biology to study the functioning of complex biological systems. Most of the existing mathematical modelling techniques are useful for analysis of well-studied biological processes, for which information on rates of reactions is available. However, complex biological processes such as those determining the phenotypic traits of organisms or pathological disease processes, including pathogen-host interactions, involve complicated cross-talk between interacting networks. Furthermore, the intrinsic details of the interactions between these networks are often missing. In this study, we developed an approach, which we call mosaic network modelling, that allows the combination of independent mathematical models of gene regulatory networks and, thereby, description of complex biological systems. The advantage of this approach is that it allows us to generate the integrated model despite the fact that information on molecular interactions between parts of the model (so-called mosaic fragments) might be missing. To generate a mosaic mathematical model, we used control theory and mathematical models, written in the form of a system of ordinary differential equations (ODEs). In the present study, we investigated the efficiency of this method in modelling the dynamics of more than 10,000 simulated mosaic regulatory networks consisting of two pieces. Analysis revealed that this approach was highly efficient, as the mean deviation of the dynamics of mosaic network elements from the behaviour of the initial parts of the model was less than 10%. It turned out that for construction of the control functional, data on perturbation of one or two vertices of the mosaic piece are sufficient. Further, we used the developed method to construct a mosaic gene regulatory network including hepatitis C virus (HCV) as the first piece and the tumour necrosis factor (TNF)-induced apoptosis and NF-κB induction pathways as the second piece. Thus

  17. Mechanisms and treatment of allergic disease in the big picture of regulatory T cells.

    PubMed

    Akdis, Cezmi A; Akdis, Mübeccel

    2009-04-01

    Various populations of regulatory T (Treg) cells have been shown to play a central role in the maintenance of peripheral homeostasis and the establishment of controlled immune responses. Their identification as key regulators of immunologic processes in peripheral tolerance to allergens has opened an important era in the prevention and treatment of allergic diseases. Both naturally occurring CD4+CD25+ Treg cells and inducible populations of allergen-specific, IL-10-secreting Treg type 1 (T(R)1) cells inhibit allergen-specific effector cells in experimental models. Skewing of allergen-specific effector T cells to a regulatory phenotype appears to be a key event in the development of healthy immune response to allergens and successful outcome in allergen-specific immunotherapy. Forkhead box protein 3-positive CD4+CD25+ Treg cells and T(R)1 cells contribute to the control of allergen-specific immune responses in several major ways, which can be summarized as suppression of dendritic cells that support the generation of effector T cells; suppression of effector T(H)1, T(H)2, and T(H)17 cells; suppression of allergen-specific IgE and induction of IgG4; suppression of mast cells, basophils, and eosinophils; interaction with resident tissue cells and remodeling; and suppression of effector T-cell migration to tissues. Current strategies for drug development and allergen-specific immunotherapy exploit these observations, with the potential for preventive therapies and cure for allergic diseases. PMID:19348912

  18. Potential Novel Mechanism for Axenfeld-Rieger Syndrome: Deletion of a Distant Region Containing Regulatory Elements of PITX2

    PubMed Central

    Volkmann, Bethany A.; Zinkevich, Natalya S.; Mustonen, Aki; Schilter, Kala F.; Bosenko, Dmitry V.; Reis, Linda M.; Broeckel, Ulrich; Link, Brian A.

    2011-01-01

    Purpose. Mutations in PITX2 are associated with Axenfeld-Rieger syndrome (ARS), which involves ocular, dental, and umbilical abnormalities. Identification of cis-regulatory elements of PITX2 is important to better understand the mechanisms of disease. Methods. Conserved noncoding elements surrounding PITX2/pitx2 were identified and examined through transgenic analysis in zebrafish; expression pattern was studied by in situ hybridization. Patient samples were screened for deletion/duplication of the PITX2 upstream region using arrays and probes. Results. Zebrafish pitx2 demonstrates conserved expression during ocular and craniofacial development. Thirteen conserved noncoding sequences positioned within a gene desert as far as 1.1 Mb upstream of the human PITX2 gene were identified; 11 have enhancer activities consistent with pitx2 expression. Ten elements mediated expression in the developing brain, four regions were active during eye formation, and two sequences were associated with craniofacial expression. One region, CE4, located approximately 111 kb upstream of PITX2, directed a complex pattern including expression in the developing eye and craniofacial region, the classic sites affected in ARS. Screening of ARS patients identified an approximately 7600-kb deletion that began 106 to 108 kb upstream of the PITX2 gene, leaving PITX2 intact while removing regulatory elements CE4 to CE13. Conclusions. These data suggest the presence of a complex distant regulatory matrix within the gene desert located upstream of PITX2 with an essential role in its activity and provides a possible mechanism for the previous reports of ARS in patients with balanced translocations involving the 4q25 region upstream of PITX2 and the current patient with an upstream deletion. PMID:20881290

  19. Characterization of the liver X receptor-dependent regulatory mechanism of goat stearoyl-coenzyme A desaturase 1 gene by linoleic acid.

    PubMed

    Yao, D W; Luo, J; He, Q Y; Li, J; Wang, H; Shi, H B; Xu, H F; Wang, M; Loor, J J

    2016-05-01

    Stearoyl-coenzyme A desaturase 1 (SCD1) is a key enzyme in the biosynthesis of palmitoleic and oleic acid. Although the transcriptional regulatory mechanism of SCD1 via polyunsaturated fatty acids (PUFA) has been extensively explored in nonruminants, the existence of such mechanism in ruminant mammary gland remains unknown. In this study, we used goat genomic DNA to clone and sequence a 1,713-bp fragment of the SCD1 5' flanking region. Deletion assays revealed a core region of the promoter located between -415 and -109 bp upstream of the transcription start site, and contained the highly conserved PUFA response region. An intact PUFA response region was required for the basal transcriptional activity of SCD1. Linoleic acid reduced endogenous expression of SCD1 and sterol regulatory element binding factor-1 (SREBF1) in goat mammary epithelial cells. Further analysis indicated that both the sterol response element (SRE) and the nuclear factor Y (NF-Y) binding site in the SCD1 promoter were responsible for the inhibition effect by linoleic acid, whereas the effect was abrogated once NF-Y was deleted. In addition, SRE and NF-Y were partly responsible for the transcriptional activation induced via the liver X receptor agonist T 4506585 (Sigma-Aldrich, St. Louis, MO). When goat mammary epithelial cells were cultured with linoleic acid, addition of T 4506585 markedly increased SCD1 transcription in controls, but had no effect on cells with a deleted SRE promoter. These results demonstrated that linoleic acid can regulate SCD1 expression at the transcriptional level through SRE and NF-Y in a liver X receptor-dependent fashion in the goat mammary gland. PMID:26947306

  20. Thermo-mechanical properties of poly ε-caprolactone/poly L-lactic acid blends: addition of nalidixic acid and polyethylene glycol additives.

    PubMed

    Douglas, P; Albadarin, Ahmad B; Al-Muhtaseb, Ala'a H; Mangwandi, Chirangano; Walker, G M

    2015-05-01

    The search for ideal biomaterials is still on-going for tissue regeneration. In this study, blends of poly ε-caprolactone (PCL) with poly l-lactic acid (PLLA), nalidixic acid (NA) and polyethylene glycol (PEG) were prepared. Mechanical and thermal properties of the blends were investigated by tensile and flexural analysis, DSC, TGA, WXRD, MFI, BET, SEM and hot stage optical microscopy. Results showed that the loading of PLLA caused a significant decrease in tensile strength and almost total eradication of the elongation at break of PCL matrix, especially after PEG and NA addition. Increased stiffness was also noted with additional NA, PEG and PLLA, resulting in an increase in the flexural modulus of the blends. Isothermal degradation indicated that bulk PCL, PLLA and the blends were thermally stable at 200°C for the duration of 2h making extrusion of the blends at this temperature viable. Morphological study showed that increasing the PLLA content and addition of the very low viscosity PEG and powder NA decreased the Melt Flow Indexer and increased the viscosity. At the higher temperature, the PLLA begins to soften and eventually melts allowing for increased flow and, coupling this with, the natural increase in MFI caused by temperature is enhanced further. The PEG and NA addition increased dramatically the pore volume which is important for cell growth and flow transport of nutrients and metabolic waste. PMID:25725403

  1. Analysis of the dual regulatory mechanisms controlling expression of the vegetative catalase gene of Bacillus subtilis.

    PubMed Central

    Bol, D K; Yasbin, R E

    1994-01-01

    The expression of a vegetative catalase gene, katA (formerly the kat-19 gene), is necessary to protect Bacillus subtilis from H2O2, presumably by removing the oxidant from the environment. Genetic analysis of katA revealed that this gene is under two distinct forms of regulation, temporal and H2O2 inducible. The results reported here demonstrate that (i) the H2O2-inducible regulation of katA gene is not a component of the SOS regulon, (ii) the regulatory genes spo0A and abrB are involved in the temporal regulation but not the H2O2-specific induction of katA gene expression, and (iii) transcription initiation for the katA gene occurs at the same site under both forms of regulation. Images PMID:7961428

  2. Moisture permeability mechanisms of some aqueous-based tablet film coatings containing soluble additives.

    PubMed

    Okhamafe, A O; Iwebor, H U

    1987-09-01

    Moisture permeation parameters--diffusion, solubility and permeation coefficients--for hydroxypropyl methylcellulose (HPMC) and partially hydrolyzed polyvinyl alcohol (PVA) films containing either of two water-soluble additives (citric acid and urea) have been evaluated from transmission and time lag data. Contrary to expectations, the moisture diffusivities of the films were markedly lowered by the presence of these additives. However, the solubility coefficients increased while the permeability coefficients were largely unchanged up to 10 wt% of the additives. A complex phenomenon involving an extensive interlacing network of mainly hydrogen bond interactions between additive and films former was believed to influence the permeation properties of the films. The estimated limits of compatibility of the additives with the film-former were in the range of 5-10 wt%. PMID:3432347

  3. Modular cis-regulatory organization of developmentally expressed genes: two genes transcribed territorially in the sea urchin embryo, and additional examples.

    PubMed Central

    Kirchhamer, C V; Yuh, C H; Davidson, E H

    1996-01-01

    The cis-regulatory systems that control developmental expression of two sea urchin genes have been subjected to detailed functional analysis. Both systems are modular in organization: specific, separable fragments of the cis-regulatory DNA each containing multiple transcription factor target sites execute particular regulatory subfunctions when associated with reporter genes and introduced into the embryo. The studies summarized here were carried out on the CyIIIa gene, expressed in the embryonic aboral ectoderm and on the Endo16 gene, expressed in the embryonic vegetal plate, archenteron, and then midgut. The regulatory systems of both genes include modules that control particular aspects of temporal and spatial expression, and in both the territorial boundaries of expression depend on a combination of negative and positive functions. In both genes different regulatory modules control early and late embryonic expression. Modular cis-regulatory organization is widespread in developmentally regulated genes, and we present a tabular summary that includes many examples from mouse and Drosophila. We regard cis-regulatory modules as units of developmental transcription control, and also of evolution, in the assembly of transcription control systems. Images Fig. 2 PMID:8790328

  4. Regulatory mechanisms of ethylene biosynthesis in response to various stimuli during maturation and ripening in fig fruit (Ficus carica L.).

    PubMed

    Owino, W O; Manabe, Y; Mathooko, F M; Kubo, Y; Inaba, A

    2006-01-01

    In order to obtain a greater uniformity of maturation, the growth of the fig fruit (Ficus carica L.) can be stimulated by the application of either olive oil, ethrel/ethephon or auxin. The three treatments induce ethylene production in figs. In this study, we investigated the regulatory mechanisms responsible for oil, auxin and ethylene induced ethylene production in figs. The ethylene production in response to olive oil, auxin, and propylene treatments and during ripening were all induced by 1-methylcyclopropene (1-MCP) and inhibited by propylene indicating a negative feedback regulation mechanism. Three 1-aminocyclopropane-1-carboxylic acid (ACC) synthase genes (Fc-ACS1, Fc-ACS2 and Fc-ACS3) and one ACC oxidase gene (Fc-ACO1) were isolated and their expression patterns in response to either oil, propylene or auxin treatment in figs determined. The expression patterns of Fc-ACS1 and Fc-ACO1 were clearly inhibited by 1-MCP and induced by propylene in oil treated and ripe fruits indicating positive regulation by ethylene, whereas Fc-ACS2 gene expression was induced by 1-MCP and inhibited by propylene indicating negative regulation by ethylene. The Fc-ACS3 mRNA showed high level accumulation in the auxin treated fruit. The inhibition of Fc-ACS3 gene by 1-MCP in oil treated and in ripe fruits suggests that auxin and ethylene modulate the expression of this gene by multi-responsive signal transduction pathway mechanisms. We further report that the olive oil-induced ethylene in figs involves the ACC-dependent pathway and that multiple ethylene regulatory pathways are involved during maturation and ripening in figs and each specific pathway depends on the inducer/stimulus. PMID:16889975

  5. Site-specific silencing of regulatory elements as a mechanism of X inactivation.

    PubMed

    Calabrese, J Mauro; Sun, Wei; Song, Lingyun; Mugford, Joshua W; Williams, Lucy; Yee, Della; Starmer, Joshua; Mieczkowski, Piotr; Crawford, Gregory E; Magnuson, Terry

    2012-11-21

    The inactive X chromosome's (Xi) physical territory is microscopically devoid of transcriptional hallmarks and enriched in silencing-associated modifications. How these microscopic signatures relate to specific Xi sequences is unknown. Therefore, we profiled Xi gene expression and chromatin states at high resolution via allele-specific sequencing in mouse trophoblast stem cells. Most notably, X-inactivated transcription start sites harbored distinct epigenetic signatures relative to surrounding Xi DNA. These sites displayed H3-lysine27-trimethylation enrichment and DNaseI hypersensitivity, similar to autosomal Polycomb targets, yet excluded Pol II and other transcriptional hallmarks, similar to nontranscribed genes. CTCF bound X-inactivated and escaping genes, irrespective of measured chromatin boundaries. Escape from X inactivation occurred within, and X inactivation was maintained exterior to, the area encompassed by Xist in cells subject to imprinted and random X inactivation. The data support a model whereby inactivation of specific regulatory elements, rather than a simple chromosome-wide separation from transcription machinery, governs gene silencing over the Xi. PMID:23178118

  6. Site-specific silencing of regulatory elements as a mechanism of X-inactivation

    PubMed Central

    Calabrese, J. Mauro; Sun, Wei; Song, Lingyun; Mugford, Joshua W.; Williams, Lucy; Yee, Della; Starmer, Joshua; Mieczkowski, Piotr; Crawford, Gregory E.; Magnuson, Terry

    2012-01-01

    The inactive X chromosome’s (Xi) physical territory is microscopically devoid of transcriptional hallmarks and enriched in silencing-associated modifications. How these microscopic signatures relate to specific Xi sequence is unknown. Therefore, we profiled Xi gene expression and chromatin states at high resolution via allele-specific sequencing in mouse trophoblast stem cells. Most notably, X-inactivated transcription start sites harbored distinct epigenetic signatures relative to surrounding Xi DNA. These sites displayed H3-lysine27-trimethylation enrichment and DNaseI hypersensitivity, similar to autosomal Polycomb targets, yet excluded Pol II and other transcriptional hallmarks, similar to non-transcribed genes. CTCF bound X-inactivated and escaping genes, irrespective of measured chromatin boundaries. Escape from X-inactivation occurred within, and X-inactivation was maintained exterior to, the area encompassed by Xist in cells subject to imprinted and random X-inactivation. The data support a model whereby inactivation of specific regulatory elements, rather than a simple chromosome-wide separation from transcription machinery, governs gene silencing over the Xi. PMID:23178118

  7. Discovery of Novel Splice Variants and Regulatory Mechanisms for Microsomal Triglyceride Transfer Protein in Human Tissues

    PubMed Central

    Suzuki, Takashi; Swift, Larry L.

    2016-01-01

    Microsomal triglyceride transfer protein (MTP) is a unique lipid transfer protein essential for the assembly of triglyceride-rich lipoproteins by the liver and intestine. Previous studies in mice identified a splice variant of MTP with an alternate first exon. Splice variants of human MTP have not been reported. Using PCR approaches we have identified two splice variants in human tissues, which we have named MTP-B and MTP-C. MTP-B has a unique first exon (Ex1B) located 10.5 kb upstream of the first exon (Ex1A) for canonical MTP (MTP-A); MTP-C contains both first exons for MTP-A and MTP-B. MTP-B was found in a number of tissues, whereas MTP-C was prominent in brain and testis. MTP-B does not encode a protein; MTP-C encodes the same protein encoded by MTP-A, although MTP-C translation is strongly inhibited by regulatory elements within its 5′-UTR. Using luciferase assays, we demonstrate that the promoter region upstream of exon 1B is quite adequate to drive expression of MTP. We conclude that alternate splicing plays a key role in regulating cellular MTP levels by introducing distinct promoter regions and unique 5′-UTRs, which contain elements that alter translation efficiency, enabling the cell to optimize MTP activity. PMID:27256115

  8. The Hematopoietic Stem and Progenitor Cell Cistrome: GATA Factor-Dependent cis-Regulatory Mechanisms.

    PubMed

    Hewitt, K J; Johnson, K D; Gao, X; Keles, S; Bresnick, E H

    2016-01-01

    Transcriptional regulators mediate the genesis and function of the hematopoietic system by binding complex ensembles of cis-regulatory elements to establish genetic networks. While thousands to millions of any given cis-element resides in a genome, how transcriptional regulators select these sites and how site attributes dictate functional output is not well understood. An instructive system to address this problem involves the GATA family of transcription factors that control vital developmental and physiological processes and are linked to multiple human pathologies. Although GATA factors bind DNA motifs harboring the sequence GATA, only a very small subset of these abundant motifs are occupied in genomes. Mechanistic studies revealed a unique configuration of a GATA factor-regulated cis-element consisting of an E-box and a downstream GATA motif separated by a short DNA spacer. GATA-1- or GATA-2-containing multiprotein complexes at these composite elements control transcription of genes critical for hematopoietic stem cell emergence in the mammalian embryo, hematopoietic progenitor cell regulation, and erythroid cell maturation. Other constituents of the complex include the basic helix-loop-loop transcription factor Scl/TAL1, its heterodimeric partner E2A, and the Lim domain proteins LMO2 and LDB1. This chapter reviews the structure/function of E-box-GATA composite cis-elements, which collectively constitute an important sector of the hematopoietic stem and progenitor cell cistrome. PMID:27137654

  9. Discovery of Novel Splice Variants and Regulatory Mechanisms for Microsomal Triglyceride Transfer Protein in Human Tissues.

    PubMed

    Suzuki, Takashi; Swift, Larry L

    2016-01-01

    Microsomal triglyceride transfer protein (MTP) is a unique lipid transfer protein essential for the assembly of triglyceride-rich lipoproteins by the liver and intestine. Previous studies in mice identified a splice variant of MTP with an alternate first exon. Splice variants of human MTP have not been reported. Using PCR approaches we have identified two splice variants in human tissues, which we have named MTP-B and MTP-C. MTP-B has a unique first exon (Ex1B) located 10.5 kb upstream of the first exon (Ex1A) for canonical MTP (MTP-A); MTP-C contains both first exons for MTP-A and MTP-B. MTP-B was found in a number of tissues, whereas MTP-C was prominent in brain and testis. MTP-B does not encode a protein; MTP-C encodes the same protein encoded by MTP-A, although MTP-C translation is strongly inhibited by regulatory elements within its 5'-UTR. Using luciferase assays, we demonstrate that the promoter region upstream of exon 1B is quite adequate to drive expression of MTP. We conclude that alternate splicing plays a key role in regulating cellular MTP levels by introducing distinct promoter regions and unique 5'-UTRs, which contain elements that alter translation efficiency, enabling the cell to optimize MTP activity. PMID:27256115

  10. On multiple regulatory mechanisms in the tryptophan operon system in Escherichia coli: in silico study of perturbation dynamics.

    PubMed

    Nguyen, Lan K; Kulasiri, Don

    2008-01-01

    Living organisms often exist in uncertain environments where changes are the norm. Cellular systems therefore require resilient regulatory mechanisms for timely and stable adaptation. Among various regulation motifs, multiple feedback control emerges as a common theme. The tryptophan operon system in Escherichia coli regulates the production ofintracellular tryptophan using an apparatus of three feedback mechanisms: repression, attenuation and enzyme inhibition; each provides essentially the same function but operates in distinctly different ways. Here we aim to understand the roles of each loop by studying transient dynamics of the system to perturbations of different types; to reveal the underlying relationships between individual control mechanisms and macroscopic behaviour. We develop an S-systems approximation of an existing model for the system and characterise transient dynamics by introducing two measurable quantities: maximum disturbance (MD) and recovery time (RT). Our simulation results showed that combined regulation using all three feedback mechanisms significantly increases system stability, broadening the range of kinetic parameters for stable behaviour. Enzyme inhibition was shown to directly control the disturbance level in system variables after perturbations. Attenuation, on the other hand, was found to speed up system recovery whereas repression lengthens recovery time. The method developed in this paper and the defined transient dynamics measurements can be applied to other cellular systems. PMID:19374133

  11. The regulatory role of cell mechanics for migration of differentiating myeloid cells.

    PubMed

    Lautenschläger, Franziska; Paschke, Stephan; Schinkinger, Stefan; Bruel, Arlette; Beil, Michael; Guck, Jochen

    2009-09-15

    Migration of cells is important for tissue maintenance, immune response, and often altered in disease. While biochemical aspects, including cell adhesion, have been studied in detail, much less is known about the role of the mechanical properties of cells. Previous measurement methods rely on contact with artificial surfaces, which can convolute the results. Here, we used a non-contact, microfluidic optical stretcher to study cell mechanics, isolated from other parameters, in the context of tissue infiltration by acute promyelocytic leukemia (APL) cells, which occurs during differentiation therapy with retinoic acid. Compliance measurements of APL cells reveal a significant softening during differentiation, with the mechanical properties of differentiated cells resembling those of normal neutrophils. To interfere with the migratory ability acquired with the softening, differentiated APL cells were exposed to paclitaxel, which stabilizes microtubules. This treatment does not alter compliance but reduces cell relaxation after cessation of mechanical stress six-fold, congruent with a significant reduction of motility. Our observations imply that the dynamical remodeling of cell shape required for tissue infiltration can be frustrated by stiffening the microtubular system. This link between the cytoskeleton, cell mechanics, and motility suggests treatment options for pathologies relying on migration of cells, notably cancer metastasis. PMID:19717452

  12. Understanding gene regulatory mechanisms by integrating ChIP-seq and RNA-seq data: statistical solutions to biological problems

    PubMed Central

    Angelini, Claudia; Costa, Valerio

    2014-01-01

    The availability of omic data produced from international consortia, as well as from worldwide laboratories, is offering the possibility both to answer long-standing questions in biomedicine/molecular biology and to formulate novel hypotheses to test. However, the impact of such data is not fully exploited due to a limited availability of multi-omic data integration tools and methods. In this paper, we discuss the interplay between gene expression and epigenetic markers/transcription factors. We show how integrating ChIP-seq and RNA-seq data can help to elucidate gene regulatory mechanisms. In particular, we discuss the two following questions: (i) Can transcription factor occupancies or histone modification data predict gene expression? (ii) Can ChIP-seq and RNA-seq data be used to infer gene regulatory networks? We propose potential directions for statistical data integration. We discuss the importance of incorporating underestimated aspects (such as alternative splicing and long-range chromatin interactions). We also highlight the lack of data benchmarks and the need to develop tools for data integration from a statistical viewpoint, designed in the spirit of reproducible research. PMID:25364758

  13. Posttranslational Modification of Maize Chloroplast Pyruvate Orthophosphate Dikinase Reveals the Precise Regulatory Mechanism of Its Enzymatic Activity.

    PubMed

    Chen, Yi-Bo; Lu, Tian-Cong; Wang, Hong-Xia; Shen, Jie; Bu, Tian-Tian; Chao, Qing; Gao, Zhi-Fang; Zhu, Xin-Guang; Wang, Yue-Feng; Wang, Bai-Chen

    2014-04-01

    In C4 plants, pyruvate orthophosphate dikinase (PPDK) activity is tightly dark/light regulated by reversible phosphorylation of an active-site threonine (Thr) residue; this process is catalyzed by PPDK regulatory protein (PDRP). Phosphorylation and dephosphorylation of PPDK lead to its inactivation and activation, respectively. Here, we show that light intensity rather than the light/dark transition regulates PPDK activity by modulating the reversible phosphorylation at Thr-527 (previously termed Thr-456) of PPDK in maize (Zea mays). The amount of PPDK (unphosphorylated) involved in C4 photosynthesis is indeed strictly controlled by light intensity, despite the high levels of PPDK protein that accumulate in mesophyll chloroplasts. In addition, we identified a transit peptide cleavage site, uncovered partial amino-terminal acetylation, and detected phosphorylation at four serine (Ser)/Thr residues, two of which were previously unknown in maize. In vitro experiments indicated that Thr-527 and Ser-528, but not Thr-309 and Ser-506, are targets of PDRP. Modeling suggests that the two hydrogen bonds between the highly conserved residues Ser-528 and glycine-525 are required for PDRP-mediated phosphorylation of the active-site Thr-527 of PPDK. Taken together, our results suggest that the regulation of maize plastid PPDK isoform (C4PPDK) activity is much more complex than previously reported. These diverse regulatory pathways may work alone or in combination to fine-tune C4PPDK activity in response to changes in lighting. PMID:24710069

  14. TGF-β-Induced Regulatory T Cells Directly Suppress B Cell Responses through a Noncytotoxic Mechanism.

    PubMed

    Xu, Anping; Liu, Ya; Chen, Weiqian; Wang, Julie; Xue, Youqiu; Huang, Feng; Rong, Liming; Lin, Jin; Liu, Dahai; Yan, Mei; Li, Quan-Zhen; Li, Bin; Song, Jianxun; Olsen, Nancy; Zheng, Song Guo

    2016-05-01

    Foxp3(+) regulatory T cells (Treg) playing a crucial role in the maintenance of immune tolerance and prevention of autoimmune diseases consist of thymus-derived naturally occurring CD4(+)Foxp3(+) Treg cells (nTreg) and those that can be induced ex vivo with TGF-β (iTreg). Although both Treg subsets share similar phenotypes and functional characteristics, they also have potential biologic differences on their biology. The role of iTreg in regulating B cells remains unclear so far. The suppression assays of Treg subsets on activation, proliferation, and Abs production of B cells were measured using a Treg and B cell coculture system in vitro. Transwell and Ab blockade experiments were performed to assess the roles of cell contact and soluble cytokines. Treg were adoptively transferred to lupus mice to assess in vivo effects on B cells. Like nTreg, iTreg subset also directly suppressed activation and proliferation of B cells. nTreg subset suppressed B cell responses through cytotoxic manner related to expression of granzyme A, granzyme B, and perforin, whereas the role of iTreg subset on B cells did not involve in cytotoxic action but depending on TGF-β signaling. Furthermore, iTreg subset can significantly suppress Ab produced by lupus B cells in vitro. Comparison experiments using autoantibodies microarrays demonstrated that adoptive transfer of iTreg had a superior effect than nTreg subset on suppressing lupus B cell responses in vivo. Our data implicate a role and advantage of iTreg subset in treating B cell-mediated autoimmune diseases, boosting the translational potential of these findings. PMID:27001954

  15. [VEGETATIVE REGULATORY MECHANISMS IN DIFFERENT GEOMAGNETIC CONDITIONS DEPENDING ON A DEGREE OF PHYSICAL CONDITIONING].

    PubMed

    Kvachadze, I; Tsibadze, A; Sanadiradze, G; Mzhavanadze, D; Chichinadze, G

    2016-04-01

    The aim of the study was to evaluate the vegetative regulatory action in healthy, untrained and trained individuals in different geomagnetic conditions. The study involved 94 healthy untrained young men aged 18-22 years - I group (control), and 60 trained volunteers aged 18-25 years - II group, who during the period of the study and for at least three years prior have been following active regular physical exercise regimen(weight lifting), but were not professional athletes. In order to evaluate the heart rate variability the following statistical indicators were studied: arithmetic mean, the arithmetic mean of the error variance, dispersion, the arithmetic mean deviation, coefficient of skewness, kurtosis, standard deviation of the mean. Geometric analysis was performed using a variation pulsometry. All the individuals were studied in natural/tranquil conditions, during naturally occuring or a simulated geomagnetic storm, which provided the use of the characteristics of vegetative balance as a marker for differential assessment of the impact of electromagnetic field (EMF). The forecast of natural geomagnetic conditions had been made at least three days before the study. Under the conditions of simulated geomagnetic storm the test subjects were placed in a solenoid with non-magnetic equipment. EMF inductance in the solenoid corresponded to the geomagnetic storm frequencies. The study had a nature of social experiment and was carried out by a single blind method: tested subjects were unaware of geomagnetic conditions during the study. This was an open, three-step, cohort, prospective study with parallel character. The results showed that under the uniform qualitative conditions (balanced, in particular) of initial state of vegetative equilibrium, the level of fitness of the human body determines the differentiated response to EMF exposure. Thus, with the possible inclusion of the EMF in the complex of therapeutic or preventive measures, it is necessary to predict

  16. Signal Transduction and Regulatory Mechanisms Involved in Control of the σS (RpoS) Subunit of RNA Polymerase

    PubMed Central

    Hengge-Aronis, Regine

    2002-01-01

    The σS (RpoS) subunit of RNA polymerase is the master regulator of the general stress response in Escherichia coli and related bacteria. While rapidly growing cells contain very little σS, exposure to many different stress conditions results in rapid and strong σS induction. Consequently, transcription of numerous σS-dependent genes is activated, many of which encode gene products with stress-protective functions. Multiple signal integration in the control of the cellular σS level is achieved by rpoS transcriptional and translational control as well as by regulated σS proteolysis, with various stress conditions differentially affecting these levels of σS control. Thus, a reduced growth rate results in increased rpoS transcription whereas high osmolarity, low temperature, acidic pH, and some late-log-phase signals stimulate the translation of already present rpoS mRNA. In addition, carbon starvation, high osmolarity, acidic pH, and high temperature result in stabilization of σS, which, under nonstress conditions, is degraded with a half-life of one to several minutes. Important cis-regulatory determinants as well as trans-acting regulatory factors involved at all levels of σS regulation have been identified. rpoS translation is controlled by several proteins (Hfq and HU) and small regulatory RNAs that probably affect the secondary structure of rpoS mRNA. For σS proteolysis, the response regulator RssB is essential. RssB is a specific direct σS recognition factor, whose affinity for σS is modulated by phosphorylation of its receiver domain. RssB delivers σS to the ClpXP protease, where σS is unfolded and completely degraded. This review summarizes our current knowledge about the molecular functions and interactions of these components and tries to establish a framework for further research on the mode of multiple signal input into this complex regulatory system. PMID:12208995

  17. Antiwear performance and mechanism of an oil-miscible ionic liquid as a lubricant additive.

    PubMed

    Qu, Jun; Bansal, Dinesh G; Yu, Bo; Howe, Jane Y; Luo, Huimin; Dai, Sheng; Li, Huaqing; Blau, Peter J; Bunting, Bruce G; Mordukhovich, Gregory; Smolenski, Donald J

    2012-02-01

    An ionic liquid (IL) trihexyltetradecylphosphonium bis(2-ethylhexyl) phosphate has been investigated as a potential antiwear lubricant additive. Unlike most other ILs that have very low solubility in nonpolar fluids, this IL is fully miscible with various hydrocarbon oils. In addition, it is thermally stable up to 347 °C, showed no corrosive attack to cast iron in an ambient environment, and has excellent wettability on solid surfaces (e.g., contact angle on cast iron <8°). Most importantly, this phosphonium-based IL has demonstrated effective antiscuffing and antiwear characteristics when blended with lubricating oils. For example, a 5 wt % addition into a synthetic base oil eliminated the scuffing failure experienced in neat oil and, as a result, reduced the friction coefficient by 60% and the wear rate by 3 orders of magnitude. A synergistic effect on wear protection was observed with the current antiwear additive when added into a fully formulated engine oil. Nanostructure examination and composition analysis revealed a tribo-boundary film and subsurface plastic deformation zone for the metallic surface lubricated by the IL-containing lubricants. This protective boundary film is believed to be responsible for the IL's antiscuffing and antiwear functionality. PMID:22248297

  18. Single-Nucleotide Mutations in FMR1 Reveal Novel Functions and Regulatory Mechanisms of the Fragile X Syndrome Protein FMRP

    PubMed Central

    Suhl, Joshua A.; Warren, Stephen T.

    2015-01-01

    Fragile X syndrome is a monogenic disorder and a common cause of intellectual disability. Despite nearly 25 years of research on FMR1, the gene underlying the syndrome, very few pathological mutations other than the typical CGG-repeat expansion have been reported. This is in contrast to other X-linked, monogenic, intellectual disability disorders, such as Rett syndrome, where many point mutations have been validated as causative of the disorder. As technology has improved and significantly driven down the cost of sequencing, allowing for whole genes to be sequenced with relative ease, in-depth sequencing studies on FMR1 have recently been performed. These studies have led to the identification of novel variants in FMR1, where some of which have been functionally evaluated and are likely pathogenic. In this review, we discuss recently identified FMR1 variants, the ways these novel variants cause dysfunction, and how they reveal new regulatory mechanisms and functionalities of the gene. PMID:26819560

  19. Dissolution and mechanical behaviors of recrystallized carbamazepine from alcohol solution in the presence of additives

    NASA Astrophysics Data System (ADS)

    Nokhodchi, A.; Bolourtchian, N.; Dinarvand, R.

    2005-02-01

    Carbamazepine (CBZ) crystals were grown from pure ethanol solutions containing various additives (PEG 4000, PVP K30 or Tween 80). Physical characteristics of the crystals were studied for the morphology of crystals using scanning electron microscope, for the identification of polymorphism by X-ray powder diffraction (XRPD) and FT-IR, and for thermodynamic properties using differential scanning calorimetery (DSC). The dissolution behaviour of various carbamazepine crystals was also studied by dissolution apparatus II at pH 7.4 containing 1% sodium lauryl sulphate (SLS). The scanning electron micrograph (SEM) studies showed that the presence of the additives in the solutions growth medium affected the morphology and size of carbamazepine crystals. SEMs of untreated and treated carbamazepine crystals obtained from alcohol containing PEG 4000, PVP K30 or Tween 80 showed that the crystal shape of untreated carbamazepine is flaky or thin plate-like, whereas the crystals obtained from alcohol containing no additive, PEG 4000, PVP K30 or Tween 80 are polyhedral prismatic, block-shaped, polyhedral or hexagonal, respectively. XRPD, FT-IR and DSC results showed that the untreated CBZ was form III and recrystallization of CBZ in the absence or presence of the additives did not cause any polymorphic changes. The results showed that the higher dissolution rate and compact strength were observed for the crystals obtained in the presence of PVP K30. The presence of the additives in crystallization medium alters crystal morphology of carbamazepine, but only the samples crystallized in the presence of PVP K30 showed an improvement in dissolution rate and tensile strength.

  20. Effect of sulfonation and diethanolamine addition on the mechanical and physicochemical properties of SEPS copolymer

    NASA Astrophysics Data System (ADS)

    Patiño, D.; Correa, E.; Acevedo-Morantes, M.

    2016-02-01

    Modification techniques have been developed to achieve changes in the processing of polymers, and modification of their mechanical, thermal and morphological properties, as well as their hydrophobicity and conductivity. Sulfonation improves ion conductivity, antistatic behaviour, hydrophilicity and solubility of the polymers. These characteristics are related to the presence of sulfonic groups in the polymer matrix. This research project focuses on the evaluation of mechanical, physical and chemical properties of membranes that are based on a sulfonated Styrene-Ethylene-Propylene-Styrene (SEPS) copolymer. The membranes were functionalized with diethanolamine at 5, 15 and 30% w/w, to separate carbon dioxide. FTIR and XRD analyses were used to characterize the membranes. The sulfonated-loaded membrane with 15% of diethanolamine showed the best results in each characterization.

  1. Investigation of molecular mechanisms and regulatory pathways of pro-angiogenic nanorods

    NASA Astrophysics Data System (ADS)

    Nethi, Susheel Kumar; Veeriah, Vimal; Barui, Ayan Kumar; Rajendran, Saranya; Mattapally, Saidulu; Misra, Sanjay; Chatterjee, Suvro; Patra, Chitta Ranjan

    2015-05-01

    Angiogenesis, a process involving the growth of new blood vessels from the pre-existing vasculature, plays a crucial role in various pathophysiological conditions. We have previously demonstrated that europium hydroxide [EuIII(OH)3] nanorods (EHNs) exhibit pro-angiogenic properties through the generation of reactive oxygen species (ROS) and mitogen activated protein kinase (MAPK) activation. Considering the enormous implication of angiogenesis in cardiovascular diseases (CVDs) and cancer, it is essential to understand in-depth molecular mechanisms and signaling pathways in order to develop the most efficient and effective alternative treatment strategy for CVDs. However, the exact underlying mechanism and cascade signaling pathways behind the pro-angiogenic properties exhibited by EHNs still remain unclear. Herein, we report for the first time that the hydrogen peroxide (H2O2), a redox signaling molecule, generated by these EHNs activates the endothelial nitric oxide synthase (eNOS) that promotes the nitric oxide (NO) production in a PI3K (phosphoinositide 3-kinase)/Akt dependent manner, eventually triggering angiogenesis. We intensely believe that the investigation and understanding of the in-depth molecular mechanism and signaling pathways of EHNs induced angiogenesis will help us in developing an effective alternative treatment strategy for cardiovascular related and ischemic diseases where angiogenesis plays an important role.Angiogenesis, a process involving the growth of new blood vessels from the pre-existing vasculature, plays a crucial role in various pathophysiological conditions. We have previously demonstrated that europium hydroxide [EuIII(OH)3] nanorods (EHNs) exhibit pro-angiogenic properties through the generation of reactive oxygen species (ROS) and mitogen activated protein kinase (MAPK) activation. Considering the enormous implication of angiogenesis in cardiovascular diseases (CVDs) and cancer, it is essential to understand in-depth molecular

  2. Process for improving mechanical properties of epoxy resins by addition of cobalt ions

    NASA Technical Reports Server (NTRS)

    Stoakley, D. M.; St.clair, A. K. (Inventor)

    1984-01-01

    A resin product useful as an adhesive, composite or casting resin is described as well as the process used in its preparation to improve its flexural strength mechanical property characteristics. Improved flexural strength is attained with little or no change in density, thermal stability or moisture resistance by chemically incorporating 1.2% to 10.6% by weight Co(3) ions in an epoxidized resin system.

  3. Viscosity of sodium-borate melts containing mechanically activated REM oxide additions

    NASA Astrophysics Data System (ADS)

    Ryabov, V. V.; Istomin, S. A.; Khokhryakov, A. A.; Ivanov, A. V.; Paivin, A. S.

    2015-08-01

    The viscosity of sodium-borate melts containing 1 wt % mechanically activated lanthanide group REM oxide is measured in the temperature range 950-1650 K using an oscillating viscometer. The dependences of the viscosity on temperature and composition are determined. The logarithmic dependences have high- and low-temperature portions with different viscous flow activation energies. It is found that the melt structure changes as a function of composition and temperature.

  4. Influence of polymer addition on the mechanical properties of a premixed calcium phosphate cement

    PubMed Central

    Engstrand, Johanna; Persson, Cecilia; Engqvist, Håkan

    2013-01-01

    Premixed calcium phosphate cements can reduce handling complications that are associated with the mixing of cements in the operating room. However, to extend the clinical indication of ceramic cements their mechanical properties need to be further improved. The incorporation of a polymeric material with intrinsically high tensile properties could possibly assist in increasing the mechanical properties of calcium phosphate cement. In this study polymer microparticles made from poly(lactid-co-glycolide) plasticised with poly(ethylene glycol) 400 (PLGA/PEG microparticles) were added in amounts of up to 5 wt% to a premixed acidic calcium phosphate cement. The PLGA/PEG microparticles added undergo a shape transformation at 37 °C, which could give a better integration between polymer microparticles and ceramic cement compared with polymer microparticles lacking this property. The results showed that the incorporation of 1.25 wt% PLGA/PEG microparticles increased the compressive strength by approximately 20% up to 15.1 MPa while the diametral tensile strength was kept constant. The incorporation of PLGA/PEG microparticles increased the brushite to monetite ratio after setting compared with pure ceramic cements. In conclusion, small amounts of PLGA/PEG microparticles can be incorporated into premixed acidic calcium phosphate cement and increase their mechanical properties, which could lead to increased future applications. PMID:24270588

  5. [Research Progress of NOS3 Participation in Regulatory Mechanisms of Cardiovascular Diseases].

    PubMed

    Sun, Ting; Chi, Qingjia; Wang, Guixue

    2016-02-01

    Cardiovascular disease has been a major threat to human's health and lives for many years. It is of great importance to explore the mechanisms and develop strategies to prevent the pathogenesis. Generally, cardiovascular disease is associated with endothelial dysfunction, which is closely related to the nitric oxide (NO)-mediated vasodilatation. The release of NO is regulated by NOS3 gene in mammals' vascular system. A great deal of evidences have shown that the polymorphism and epigenetic of NOS3 gene play vital roles in the pathological process of cardiovascular disease. To gain insights into the role of NOS3 in the cardiovascular diseases, we reviewed the molecular mechanisms underlying the development of cardiovascular diseases in this paper, including the uncoupling of NOS3 protein, epigenetic and polymorphism of NOS3 gene. The review can also offer possible strategies to prevent and treat cardiovascular diseases. PMID:27382763

  6. Regulatory mechanism of the three-component system HptRSA in glucose-6-phosphate uptake in Staphylococcus aureus.

    PubMed

    Yang, Yifan; Sun, Haipeng; Liu, Xiaoyu; Wang, Mingxing; Xue, Ting; Sun, Baolin

    2016-06-01

    Glucose-6-phosphate (G6P) is a common alternative carbon source for various bacteria, and its uptake usually relies on the hexose phosphate antiporter UhpT. In the human pathogenic bacterium Staphylococcus aureus, the ability to utilize different nutrients, particularly alternative carbon source uptake in glucose-limiting conditions, is essential for its fitness in the host environment during the infectious process. It has been reported that G6P uptake in S. aureus is regulated by the three-component system HptRSA. When G6P is provided as the only carbon source, HptRSA could sense extracellular G6P and activate uhpT expression to facilitate G6P utilization. However, the regulatory mechanism of HptRSA is still unclear. In this study, we further investigated the HptRSA system in S. aureus. First, we confirmed that HptRSA is necessary for the normal growth of this pathogen in chemically defined medium with G6P supplementation, and we discovered that HptRSA could exclusively sense extracellular G6P compared to the other organophosphates we tested. Next, using isothermal titration calorimetry, we found that HptA could bind to G6P, suggesting that it may be the G6P sensor. After that experiment, using an electrophoresis mobility shift assay, we verified that the response regulator HptR could directly bind to the uhpT promoter and identified a putative binding site from -67 to -96-bp. Subsequently, we created different point mutations in the putative binding site and revealed that the entire 30-bp sequence is essential for HptR regulation. In summary, we unveiled the regulatory mechanism of the HptRSA system in S. aureus, HptA most likely functions as the G6P sensor, and HptR could implement its regulatory function by directly binding to a conserved, approximately 30-bp sequence in the uhpT promoter. PMID:26711125

  7. Effects of chemical mechanical planarization slurry additives on the agglomeration of alumina nanoparticles II: aggregation rate analysis.

    PubMed

    Brahma, Neil; Talbot, Jan B

    2014-04-01

    The aggregation rate and mechanism of 150 nm alumina particles in 1mM KNO3 with various additives used in chemical mechanical planarization of copper were investigated. The pH of each suspension was ∼8 such that the aggregation rate was slow enough to be measured and analyzed over ∼120 min. In general, an initial exponential growth was observed for most suspensions indicating reaction-limited aggregation. After aggregate sizes increase to >500 nm, the rate followed a power law suggesting diffusion-limited aggregation. Stability ratios and fractal dimension numbers were also calculated to further elucidate the aggregation mechanism. PMID:24491325

  8. Investigation of molecular mechanisms and regulatory pathways of pro-angiogenic nanorods†

    PubMed Central

    Nethi, Susheel Kumar; Veeriah, Vimal; Barui, Ayan Kumar; Rajendran, Saranya; Mattapally, Saidulu; Misra, Sanjay

    2016-01-01

    Angiogenesis, a process involving the growth of new blood vessels from the pre-existing vasculature, plays a crucial role in various pathophysiological conditions. We have previously demonstrated that europium hydroxide [EuIII(OH)3] nanorods (EHNs) exhibit pro-angiogenic properties through the generation of reactive oxygen species (ROS) and mitogen activated protein kinase (MAPK) activation. Considering the enormous implication of angiogenesis in cardiovascular diseases (CVDs) and cancer, it is essential to understand in-depth molecular mechanisms and signaling pathways in order to develop the most efficient and effective alternative treatment strategy for CVDs. However, the exact underlying mechanism and cascade signaling pathways behind the pro-angiogenic properties exhibited by EHNs still remain unclear. Herein, we report for the first time that the hydrogen peroxide (H2O2), a redox signaling molecule, generated by these EHNs activates the endothelial nitric oxide synthase (eNOS) that promotes the nitric oxide (NO) production in a PI3K (phosphoinositide 3-kinase)/Akt dependent manner, eventually triggering angiogenesis. We intensely believe that the investigation and understanding of the in-depth molecular mechanism and signaling pathways of EHNs induced angiogenesis will help us in developing an effective alternative treatment strategy for cardiovascular related and ischemic diseases where angiogenesis plays an important role. PMID:25963768

  9. Effect of nano-additives on microstructure, mechanical properties and wear behaviour of Fe-Cr-B hardfacing alloy

    NASA Astrophysics Data System (ADS)

    Gou, Junfeng; Lu, Pengpeng; Wang, You; Liu, Saiyue; Zou, Zhiwei

    2016-01-01

    Fe-Cr-B hardfacing alloys with different nano-additives content were investigated. The effects of nano-additives on the microstructures of hardfacing alloy were studied by using optical microscope, scanning electron microscope, X-ray diffractometer. The hardness and the fracture toughness of hardfacing alloys were measured, respectively. The sliding wear tests were carried out using a ball-on-disc tribometer. The experimental results showed that primary carbide of hardfacing alloys was refined and its distribution became uniform with content of nano-additives increased. The hardfacing alloys are composed of Cr7C3, Fe7C3, α-Fe and Fe2B according to the results of X-ray diffraction. The hardness of hardfacing alloys increased linearly with the increase of nano-additives. The hardness of the hardfacing alloy with 1.5 wt.% nano-additives increased 54.8% than that of the hardfacing alloy without nano-additives and reached to 1011HV. The KIC of the hardfacing alloy with 0.65 wt.% nano-additives was 15.4 MPam1/2, which reached a maximum. The value increased 57.1% than that of the hardfacing alloy without nano-additives. The wear rates of the hardfacing layer with 0.65 wt.% and 1.0 wt.% nano-additives decreased about 88% than that of the hardfacing layer without nano-additives. The main wear mechanism was adhesion wear.

  10. Identification of Novel Pretranslational Regulatory Mechanisms for NF-κB Activation*

    PubMed Central

    Huang, Xiao; Gong, Ren; Li, Xinyuan; Virtue, Anthony; Yang, Fan; Yang, Irene H.; Tran, Anh H.; Yang, Xiao-Feng; Wang, Hong

    2013-01-01

    NF-κB-controlled transcriptional regulation plays a central role in inflammatory and immune responses. Currently, understanding about NF-κB activation mechanism emphasizes IκB-tethered complex inactivation in the cytoplasm. In the case of NF-κB activation, IκB phosphorylation leads to its degradation, followed by NF-κB relocation to the nucleus and trans-activation of NF-κB-targeted genes. Pretranslational mechanism mediated NF-κB activation remains poorly understood. In this study, we investigated NF-κB pretranslational regulation by performing a series of database mining analyses and using six large national experimental databases (National Center of Biotechnology Information UniGene expressed sequence tag profile database, Gene Expression Omnibus database, Transcription Element Search System database, AceView database, and Epigenomics database) and TargetScan software. We reported the following findings: 1) NF-κB-signaling genes are differentially expressed in human and mouse tissues; 2) heart and vessels are the inflammation-privileged tissues and less easy to be inflamed because lacking in key NF-κB-signaling molecular expression; 3) NF-κB-signaling genes are induced by cardiovascular disease risk factors oxidized phospholipids and proinflammatory cytokines in endothelial cells; 4) transcription factors CCAAT/enhancer-binding proteins and NF-κB have higher binding site frequencies in the promoters of proinflammatory cytokine-induced NF-κB genes; 5) most NF-κB-signaling genes have multiple alternative promoters and alternatively spliced isoforms; 6) NF-κB family genes can be regulated by DNA methylation; and 7) 27 of 38 NF-κB-signaling genes can be regulated by microRNAs. Our findings provide important insight into the mechanism of NF-κB activation, which may contribute to cardiovascular disease, inflammatory diseases, and immunological disorders. PMID:23515310

  11. Miniaturization of cellulose fibers and effect of addition on the mechanical and barrier properties of hydroxypropyl methylcellulose

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cellulose fibers were miniaturized by microfluidics technology and incorporated in hydroxypropyl methylcellulose (HPMC) films to study the effect of the addition of such fibers on the mechanical and barrier properties of HPMC films suitable for food packaging applications. The particle size of the f...

  12. Mechanism of hydrofluoric acid formation in ethylene carbonate electrolytes with fluorine salt additives

    NASA Astrophysics Data System (ADS)

    Tebbe, Jonathon L.; Fuerst, Thomas F.; Musgrave, Charles B.

    2015-11-01

    We utilized density functional theory to examine HF generation in lithium-ion battery electrolytes from reactions between H2O and the decomposition products of three electrolyte additives: LiPF6, LiPOF4, and LiAsF6. Decomposition of these additives produces PF5, AsF5, and POF3 along with LiF precipitates. We found PF5 and AsF5 react with H2O in two sequential steps to form two HF molecules and POF3 and AsOF3, respectively. PF5 (or AsF5) complexes with H2O and undergoes ligand exchange to form HF and PF4OH (AsF4OH) with an activation barrier of 114.2 (30.5) kJ mol-1 and reaction enthalpy of 14.6 (-11.3) kJ mol-1. The ethylene carbonate (EC) electrolyte forms a Lewis acid-base complex with the PF4OH (AsF4OH) product, reducing the barrier to HF formation. Reactions of POF3 were examined and are not characterized by complexation of POF3 with H2O or EC, while PF5 and AsF5 complex favorably with H2O and EC. HF formation from POF3 occurs with a reaction enthalpy of -3.8 kJ mol-1 and a 157.7 kJ mol-1 barrier, 43.5 kJ mol-1 higher than forming HF from PF5. HF generation in electrolytes employing LiPOF4 should be significantly lower than those using LiPF6 or LiAsF6 and LiPOF4 should be further investigated as an alternative electrolyte additive.

  13. Late Chondritic Additions and Planet and Planetesimal Growth: Evaluation of Physical and Chemical Mechanisms

    NASA Technical Reports Server (NTRS)

    Righter, Kevin

    2013-01-01

    Studies of terrestrial peridotite and martian and achondritic meteorites have led to the conclusion that addition of chondritic material to growing planets or planetesimals, after core formation, occurred on Earth, Mars, asteroid 4 Vesta, and the parent body of the angritic meteorites [1-4]. One study even proposed that this was a common process in the final stages of growth [5]. These conclusions are based almost entirely on the highly siderophile elements (HSE; Re, Au, Pt, Pd, Rh, Ru, Ir, Os). The HSE are a group of eight elements that have been used to argue for late accretion of chondritic material to the Earth after core formation was complete (e.g., [6]). This idea was originally proposed because the D(metal/silicate) values for the HSE are so high, yet their concentration in the mantle is too high to be consistent with such high Ds. The HSE also are present in chondritic relative abundances and hence require similar Ds if this is the result of core-mantle equilibration. Since the work of [6] there has been a realization that core formation at high PT conditions can explain the abundances of many siderophile elements in the mantle (e.g., [7]), but such detailed high PT partitioning data are lacking for many of the HSE to evaluate whether such ideas are viable for all four bodies. Consideration of other chemical parameters reveals larger problems that are difficult to overcome, but must be addressed in any scenario which calls on the addition of chondritic material to a reduced mantle. Yet these problems are rarely discussed or emphasized, making the late chondritic (or late veneer) addition hypothesis suspect.

  14. Early decrease in dietary protein:energy ratio by fat addition and ontogenetic changes in muscle growth mechanisms of rainbow trout: short- and long-term effects.

    PubMed

    Alami-Durante, Hélène; Cluzeaud, Marianne; Duval, Carine; Maunas, Patrick; Girod-David, Virginia; Médale, Françoise

    2014-09-14

    As the understanding of the nutritional regulation of muscle growth mechanisms in fish is fragmentary, the present study aimed to (1) characterise ontogenetic changes in muscle growth-related genes in parallel to changes in muscle cellularity; (2) determine whether an early decrease in dietary protein:energy ratio by fat addition affects the muscle growth mechanisms of rainbow trout (Oncorhynchus mykiss) alevins; and (3) determine whether this early feeding of a high-fat (HF) diet to alevins had a long-term effect on muscle growth processes in juveniles fed a commercial diet. Developmental regulation of hyperplasia and hypertrophy was evidenced at the molecular (expression of myogenic regulatory factors, proliferating cell nuclear antigen and myosin heavy chains (MHC)) and cellular (number and diameter of white muscle fibres) levels. An early decrease in dietary protein:energy ratio by fat addition stimulated the body growth of alevins but led to a fatty phenotype, with accumulation of lipids in the anterior part, and less caudal muscle when compared at similar body weights, due to a decrease in both the white muscle hyperplasia and maximum hypertrophy of white muscle fibres. These HF diet-induced cellular changes were preceded by a very rapid down-regulation of the expression of fast-MHC. The present study also demonstrated that early dietary composition had a long-term effect on the subsequent muscle growth processes of juveniles fed a commercial diet for 3 months. When compared at similar body weights, initially HF diet-fed juveniles indeed had a lower mean diameter of white muscle fibres, a smaller number of large white muscle fibres, and lower expression levels of MyoD1 and myogenin. These findings demonstrated the strong effect of early feed composition on the muscle growth mechanisms of trout alevins and juveniles. PMID:24949706

  15. Regulatory mechanisms of betacellulin in CXCL8 production from lung cancer cells

    PubMed Central

    2014-01-01

    Background Betacellulin (BTC), a member of the epidermal growth factor (EGF) family, binds and activates ErbB1 and ErbB4 homodimers. BTC was expressed in tumors and involved in tumor growth progression. CXCL8 (interleukin-8) was involved in tumor cell proliferation via the transactivation of the epidermal growth factor receptor (EGFR). Materials and methods The present study was designed to investigate the possible interrelation between BTC and CXCL8 in human lung cancer cells (A549) and demonstrated the mechanisms of intracellular signals in the regulation of both functions. Bio-behaviors of A549 were assessed using Cell-IQ Alive Image Monitoring System. Results We found that BTC significantly increased the production of CXCL8 through the activation of the EGFR-PI3K/Akt-Erk signal pathway. BTC induced the resistance of human lung cancer cells to TNF-α/CHX-induced apoptosis. Treatments with PI3K inhibitors, Erk1/2 inhibitor, or Erlotinib significantly inhibited BTC-induced CXCL8 production and cell proliferation and movement. Conclusion Our data indicated that CXCL8 production from lung cancer cells could be initiated by an autocrine mechanism or external sources of BTC through the EGFR–PI3K–Akt–Erk pathway to the formation of inflammatory microenvironment. BTC may act as a potential target to monitor and improve the development of lung cancer inflammation. PMID:24629040

  16. Stability of amorphous pharmaceutical solids: crystal growth mechanisms and effect of polymer additives.

    PubMed

    Sun, Ye; Zhu, Lei; Wu, Tian; Cai, Ting; Gunn, Erica M; Yu, Lian

    2012-09-01

    We review recent progress toward understanding and enhancing the stability of amorphous pharmaceutical solids against crystallization. As organic liquids are cooled to become glasses, fast modes of crystal growth can emerge. One such growth mode, the glass-to-crystal or GC mode, occurs in the bulk, and another exists at the free surface, both leading to crystal growth much faster than predicted by theories that assume diffusion defines the kinetic barrier of crystallization. These phenomena have received different explanations, and we propose that GC growth is a solid-state transformation enabled by local mobility in glasses and that fast surface crystal growth is facilitated by surface molecular mobility. In the second part, we review recent findings concerning the effect of polymer additives on crystallization in organic glasses. Low-concentration polymer additives can strongly inhibit crystal growth in the bulk of organic glasses, while having weaker effect on surface crystal growth. Ultra-thin polymer coatings can inhibit surface crystallization. Recent work has shown the importance of molecular weight for crystallization inhibitors of organic glasses, besides "direct intermolecular interactions" such as hydrogen bonding. Relative to polyvinylpyrrolidone, the VP dimer is far less effective in inhibiting crystal growth in amorphous nifedipine. Further work is suggested for better understanding of crystallization of amorphous organic solids and the prediction of their stability. PMID:22434258

  17. Physical-mechanical properties of Bis-EMA based root canal sealer with different fillers addition

    PubMed Central

    de Souza, Marcela Oliveira; Branco Leitune, Vicente Castelo; Bohn, Priscila Veit; Werner Samuel, Susana Maria; Collares, Fabrício Mezzomo

    2015-01-01

    Aim: To evaluate influence of three different filler particles on an experimental Bisphenol A ethoxylated dimethacrylate (Bis-EMA) based root filling material. Materials and Methods: Resin-based endodontic sealers were produced using Bis-EMA, camphorquinone, ethyl 4-dimethylaminobenzoate (EDAB), N, N-dihydroxyethyl-p-toluidine (DHEPT), butylated hydroxytoluene (BHT), and benzoyl peroxide. The experimental groups were formulated adding 10, 20, 30, 40, and 50% of calcium tungstate (CaWO4), ytterbium trifluoride(YbF3), and tantalum oxide(Ta2O5). Flow, thickness, and radiopacity tests were conducted in accordance with ISO 6876. Sorption and solubility (SL) tests were conducted in accordance with ISO 4049, pH was measured with a pH meter, and degree of conversion (DC) was evaluated with Fourier transform infrared spectroscopy (FTIR). For radiopacity, two-way analysis of variance (ANOVA) and Tukey's multiple comparison test was performed. For DC analysis, one-way ANOVA and Tukey's multiple comparison test was performed. All statistical analyses were performed with a significance level of 5%. Results: All groups showed lower flow with increased filler concentration. All groups showed film thickness values lower than 50μm, as ISO recommends, except CaWO450% group (76.7μm). pH values varied from 5.95 (± 0.07) in YbF340% group to 6.90 (± 0.07) in Ta2O540% group. In the radiopacity test, YbF330%, Ta2O540%, and Ta2O550% groups showed no statistical significant difference to 3mmAl. Ta2O5 and YbF3 groups in 10, 20, and 30% concentrations presented sorption and SL values as ISOrecommendation. Addition ofTa2O5 and CaWO4 decreased DC after 14 days. YbF3 addition showed no difference in DC from control group. Conclusion: YbF3 filler addition promoted higher properties compared to CaWO4 and Ta2O5 on Bis-EMA based root canal sealer. PMID:26069410

  18. New effector functions and regulatory mechanisms of BCL6 in normal and malignant lymphocytes

    PubMed Central

    Bunting, Karen L.; Melnick, Ari M.

    2014-01-01

    The BCL6 oncogenic repressor is a master regulator of humoral immunity and B-cell lymphoma survival. Whereas much research has focused on its regulation and function in germinal center B-cells, its role in other mature lymphoid cell compartments is less clear. A novel role for BCL6 in follicular T helper cell development was recently uncovered. The latest discoveries reveal that BCL6 is also an important regulator of other specialized helper T-cell subsets within germinal centers, pre-germinal center events, and peripheral T-cells effector functions. Here, we review newly discovered roles for BCL6 in lymphocyte subsets residing within and outside of germinal centers, and discuss their implications with respect to the molecular mechanisms of BCL6 regulation and potential links to B and T-cell lymphomas. PMID:23725655

  19. The T box mechanism: tRNA as a regulatory molecule

    PubMed Central

    Green, Nicholas J.; Grundy, Frank J.; Henkin, Tina M.

    2009-01-01

    The T box mechanism is widely used in Gram-positive bacteria to regulate expression of aminoacyl-tRNA synthetase genes and genes involved in amino acid biosynthesis and uptake. Binding of a specific uncharged tRNA to a riboswitch element in the nascent transcript causes a structural change in the transcript that promotes expression of the downstream coding sequence. In most cases, this occurs by stabilization of an antiterminator element that competes with formation of a terminator helix. Specific tRNA recognition by the nascent transcript results in increased expression of genes important for tRNA aminoacylation in response to decreased pools of charged tRNA. PMID:19932103

  20. Dss1 Interaction with Brh2 as a Regulatory Mechanism for Recombinational Repair▿

    PubMed Central

    Zhou, Qingwen; Kojic, Milorad; Cao, Zhimin; Lisby, Michael; Mazloum, Nayef A.; Holloman, William K.

    2007-01-01

    Brh2, the BRCA2 ortholog in Ustilago maydis, enables recombinational repair of DNA by controlling Rad51 and is in turn regulated by Dss1. Interplay with Rad51 is conducted via the BRC element located in the N-terminal region of the protein and through an unrelated domain, CRE, at the C terminus. Mutation in either BRC or CRE severely reduces functional activity, but repair deficiency of the brh2 mutant can be complemented by expressing BRC and CRE on different molecules. This intermolecular complementation is dependent upon the presence of Dss1. Brh2 molecules associate through the region overlapping with the Dss1-interacting domain to form at least dimer-sized complexes, which in turn, can be dissociated by Dss1 to monomer. We propose that cooperation between BRC and CRE domains and the Dss1-provoked dissociation of Brh2 complexes are requisite features of Brh2's molecular mechanism. PMID:17261595

  1. [The defense and regulatory mechanisms during development of legume-Rhizobium symbiosis].

    PubMed

    Glian'ko, A K; Akimova, G P; Sokolova, M G; Makarova, L E; Vasil'eva, G G

    2007-01-01

    The roles of indolylacetic acid, the peroxidase system, catalase, active oxygen species, and phenolic compounds in the physiological and biochemical mechanisms involved in the autoregulation of nodulation in the developing legume-Rhizobium symbiosis were studied. It was inferred that the concentration of indolylacetic acid in the roots of inoculated plants, controlled by the enzymes of the peroxidase complex, is the signal permitting or limiting nodulation at the initial stages of symbiotic interaction. Presumably, the change in the level of active oxygen species is determined by an antioxidant activity of phenolic compounds. During the development of symbiosis, phytohormones, antioxidant enzymes, and active oxygen species may be involved in the regulation of infection via both a direct antibacterial action and regulation of functional activity of the host plant defense systems. PMID:17619575

  2. The Influence of Early Life Nutrition on Epigenetic Regulatory Mechanisms of the Immune System

    PubMed Central

    Paparo, Lorella; di Costanzo, Margherita; di Scala, Carmen; Cosenza, Linda; Leone, Ludovica; Nocerino, Rita; Berni Canani, Roberto

    2014-01-01

    The immune system is exquisitely sensitive to environmental changes. Diet constitutes one of the major environmental factors that exerts a profound effect on immune system development and function. Epigenetics is the study of mitotically heritable, yet potentially reversible, molecular modifications to DNA and chromatin without alteration to the underlying DNA sequence. Nutriepigenomics is an emerging discipline examining the role of dietary influences on gene expression. There is increasing evidence that the epigenetic mechanisms that regulate gene expression during immune differentiation are directly affected by dietary factors or indirectly through modifications in gut microbiota induced by different dietary habits. Short-chain fatty acids, in particular butyrate, produced by selected bacteria stains within gut microbiota, are crucial players in this network. PMID:25353665

  3. Deformation Mechanisms in NiTi-Al Composites Fabricated by Ultrasonic Additive Manufacturing

    NASA Astrophysics Data System (ADS)

    Chen, Xiang; Hehr, Adam; Dapino, Marcelo J.; Anderson, Peter M.

    2015-09-01

    Thermally active NiTi shape memory alloy (SMA) fibers can be used to tune or tailor the effective coefficient of thermal expansion (CTE) of a metallic matrix composite. In this paper, a novel NiTi-Al composite is fabricated using ultrasonic additive manufacturing (UAM). A combined experimental-simulation approach is used to develop and validate a microstructurally based finite element model of the composite. The simulations are able to closely reproduce the macroscopic strain versus temperature cyclic response, including initial transient effects in the first cycle. They also show that the composite CTE is minimized if the austenite texture in the SMA wires is <001>B2, that a fiber aspect ratio >10 maximizes fiber efficiency, and that the UAM process may reduce hysteresis in embedded SMA wires.

  4. Mechanism of wiggling enhancement due to HBr gas addition during amorphous carbon etching

    NASA Astrophysics Data System (ADS)

    Kofuji, Naoyuki; Ishimura, Hiroaki; Kobayashi, Hitoshi; Une, Satoshi

    2015-06-01

    The effect of gas chemistry during etching of an amorphous carbon layer (ACL) on wiggling has been investigated, focusing especially on the changes in residual stress. Although the HBr gas addition reduces critical dimension loss, it enhances the surface stress and therefore increases wiggling. Attenuated total reflectance Fourier transform infrared spectroscopy revealed that the increase in surface stress was caused by hydrogenation of the ACL surface with hydrogen radicals. Three-dimensional (3D) nonlinear finite element method analysis confirmed that the increase in surface stress is large enough to cause the wiggling. These results also suggest that etching with hydrogen compound gases using an ACL mask has high potential to cause the wiggling.

  5. Lithium Enolates Derived from Pyroglutaminol: Mechanism and Stereoselectivity of an Azaaldol Addition.

    PubMed

    Houghton, Michael J; Huck, Christopher J; Wright, Stephen W; Collum, David B

    2016-08-17

    A lithium enolate derived from an acetonide-protected pyroglutaminol undergoes a highly selective azaaldol addition with (E)-N-phenyl-1-[2-(trifluoromethyl)phenyl]methanimine. The selectivity is sensitive to tetrahydrofuran (THF) concentration, temperature, and the presence of excess lithium diisopropylamide base. Rate studies show that the observable tetrasolvated dimeric enolate undergoes reversible deaggregation, with the reaction proceeding via a disolvated-monomer-based transition structure. Limited stereochemical erosion stems from the intervention of a trisolvated-monomer-based pathway, which is suppressed at low THF concentrations and elevated temperature. Endofacial selectivity observed with excess lithium diisopropylamide (LDA) is traced to an intermediate dianion formed by subsequent lithiation of the monomeric azaaldol adduct, which is characterized as both a dilithio form and a trilithio dianion-LDA mixed aggregate. PMID:27500546

  6. Focused ultrasound: relevant history and prospects for the addition of mechanical energy to the neurosurgical armamentarium.

    PubMed

    Christian, Eisha; Yu, Cheng; Apuzzo, Michael L J

    2014-01-01

    Although the concept of focused ultrasonography emerged more than 70 years ago, the need for a craniectomy obviated its development as a noninvasive technology. Since then advances in phased array transducers and magnetic resonance imaging technology have resurrected the ultrasound as a noninvasive therapeutic for a plethora of neurological conditions ranging from embolic stroke and intracranial hemorrhage to movement disorders and brain neoplasia. In the same way that stereotactic radiosurgery has fundamentally changed the scope and treatment paradigms of tumor and specifically skull base surgery, focused ultrasound has a similar potential to revolutionize the field of neurological surgery. In addition, focused ultrasound comes without the general complexity or the risks of ionizing radiation that accompany radiosurgery. As the quest for minimally invasive and noninvasive therapeutics continues to define the new neurosurgery, the focused ultrasound evolves to join the neurosurgical armamentarium. PMID:24952224

  7. Gene Regulatory Mechanisms Underlying the Spatial and Temporal Regulation of Target-Dependent Gene Expression in Drosophila Neurons

    PubMed Central

    Ridyard, Marc S.; Lian, Tianshun; Keatings, Kathleen; Allan, Douglas W.

    2015-01-01

    Neuronal differentiation often requires target-derived signals from the cells they innervate. These signals typically activate neural subtype-specific genes, but the gene regulatory mechanisms remain largely unknown. Highly restricted expression of the FMRFa neuropeptide in Drosophila Tv4 neurons requires target-derived BMP signaling and a transcription factor code that includes Apterous. Using integrase transgenesis of enhancer reporters, we functionally dissected the Tv4-enhancer of FMRFa within its native cellular context. We identified two essential but discrete cis-elements, a BMP-response element (BMP-RE) that binds BMP-activated pMad, and a homeodomain-response element (HD-RE) that binds Apterous. These cis-elements have low activity and must be combined for Tv4-enhancer activity. Such combinatorial activity is often a mechanism for restricting expression to the intersection of cis-element spatiotemporal activities. However, concatemers of the HD-RE and BMP-RE cis-elements were found to independently generate the same spatiotemporal expression as the Tv4-enhancer. Thus, the Tv4-enhancer atypically combines two low-activity cis-elements that confer the same output from distinct inputs. The activation of target-dependent genes is assumed to 'wait' for target contact. We tested this directly, and unexpectedly found that premature BMP activity could not induce early FMRFa expression; also, we show that the BMP-insensitive HD-RE cis-element is activated at the time of target contact. This led us to uncover a role for the nuclear receptor, seven up (svp), as a repressor of FMRFa induction prior to target contact. Svp is normally downregulated immediately prior to target contact, and we found that maintaining Svp expression prevents cis-element activation, whereas reducing svp gene dosage prematurely activates cis-element activity. We conclude that the target-dependent FMRFa gene is repressed prior to target contact, and that target-derived BMP signaling directly

  8. Glucocorticoid receptor-mediated cell cycle arrest is achieved through distinct cell-specific transcriptional regulatory mechanisms.

    PubMed Central

    Rogatsky, I; Trowbridge, J M; Garabedian, M J

    1997-01-01

    Glucocorticoids inhibit proliferation of many cell types, but the events leading from the activated glucocorticoid receptor (GR) to growth arrest are not understood. Ectopic expression and activation of GR in human osteosarcoma cell lines U2OS and SAOS2, which lack endogenous receptors, result in a G1 cell cycle arrest. GR activation in U2OS cells represses expression of the cyclin-dependent kinases (CDKs) CDK4 and CDK6 as well as their regulatory partner, cyclin D3, leading to hypophosphorylation of the retinoblastoma protein (Rb). We also demonstrate a ligand-dependent reduction in the expression of E2F-1 and c-Myc, transcription factors involved in the G1-to-S-phase transition. Mitogen-activated protein kinase, CDK2, cyclin E, and the CDK inhibitors (CDIs) p27 and p21 are unaffected by receptor activation in U2OS cells. The receptor's N-terminal transcriptional activation domain is not required for growth arrest in U2OS cells. In Rb-deficient SAOS2 cells, however, the expression of p27 and p21 is induced upon receptor activation. Remarkably, in SAOS2 cells that express a GR deletion derivative lacking the N-terminal transcriptional activation domain, induction of CDI expression is abolished and the cells fail to undergo ligand-dependent cell cycle arrest. Similarly, murine S49 lymphoma cells, which, like SAOS2 cells, lack Rb, require the N-terminal activation domain for growth arrest and induce CDI expression upon GR activation. These cell-type-specific differences in receptor domains and cellular targets linking GR activation to cell cycle machinery suggest two distinct regulatory mechanisms of GR-mediated cell cycle arrest: one involving transcriptional repression of G1 cyclins and CDKs and the other involving enhanced transcription of CDIs by the activated receptor. PMID:9154817

  9. Ocean warming and acidification modulate energy budget and gill ion regulatory mechanisms in Atlantic cod (Gadus morhua).

    PubMed

    Kreiss, C M; Michael, K; Lucassen, M; Jutfelt, F; Motyka, R; Dupont, S; Pörtner, H-O

    2015-10-01

    Ocean warming and acidification are threatening marine ecosystems. In marine animals, acidification is thought to enhance ion regulatory costs and thereby baseline energy demand, while elevated temperature also increases baseline metabolic rate. Here we investigated standard metabolic rates (SMR) and plasma parameters of Atlantic cod (Gadus morhua) after 3-4 weeks of exposure to ambient and future PCO2 levels (550, 1200 and 2200 µatm) and at two temperatures (10, 18 °C). In vivo branchial ion regulatory costs were studied in isolated, perfused gill preparations. Animals reared at 18 °C responded to increasing CO2 by elevating SMR, in contrast to specimens at 10 °C. Isolated gills at 10 °C and elevated PCO2 (≥1200 µatm) displayed increased soft tissue mass, in parallel to increased gill oxygen demand, indicating an increased fraction of gill in whole animal energy budget. Altered gill size was not found at 18 °C, where a shift in the use of ion regulation mechanisms occurred towards enhanced Na(+)/H(+)-exchange and HCO3 (-) transport at high PCO2 (2200 µatm), paralleled by higher Na(+)/K(+)-ATPase activities. This shift did not affect total gill energy consumption leaving whole animal energy budget unaffected. Higher Na(+)/K(+)-ATPase activities in the warmth might have compensated for enhanced branchial permeability and led to reduced plasma Na(+) and/or Cl(-) concentrations and slightly lowered osmolalities seen at 18 °C and 550 or 2200 µatm PCO2 in vivo. Overall, the gill as a key ion regulation organ seems to be highly effective in supporting the resilience of cod to effects of ocean warming and acidification. PMID:26219611

  10. Targeted mutagenesis of intergenic regions in the Neisseria gonorrhoeae gonococcal genetic island reveals multiple regulatory mechanisms controlling type IV secretion.

    PubMed

    Ramsey, Meghan E; Bender, Tobias; Klimowicz, Amy K; Hackett, Kathleen T; Yamamoto, Ami; Jolicoeur, Adrienne; Callaghan, Melanie M; Wassarman, Karen M; van der Does, Chris; Dillard, Joseph P

    2015-09-01

    Gonococci secrete chromosomal DNA into the extracellular environment using a type IV secretion system (T4SS). The secreted DNA acts in natural transformation and initiates biofilm development. Although the DNA and its effects are detectable, structural components of the T4SS are present at very low levels, suggestive of uncharacterized regulatory control. We sought to better characterize the expression and regulation of T4SS genes and found that the four operons containing T4SS genes are transcribed at very different levels. Increasing transcription of two of the operons through targeted promoter mutagenesis did not increase DNA secretion. The stability and steady-state levels of two T4SS structural proteins were affected by a homolog of tail-specific protease. An RNA switch was also identified that regulates translation of a third T4SS operon. The switch mechanism relies on two putative stem-loop structures contained within the 5' untranslated region of the transcript, one of which occludes the ribosome binding site and start codon. Mutational analysis of these stem loops supports a model in which induction of an alternative structure relieves repression. Taken together, these results identify multiple layers of regulation, including transcriptional, translational and post-translational mechanisms controlling T4SS gene expression and DNA secretion. PMID:26076069

  11. Stimulation of rat hepatic low density lipoprotein receptors by glucagon. Evidence of a novel regulatory mechanism in vivo.

    PubMed Central

    Rudling, M; Angelin, B

    1993-01-01

    We studied the influence of glucagon on hepatic LDL receptors and plasma lipoproteins in rats. A dose-dependent (maximum, threefold) increase in LDL-receptor binding was evident already at a dose of 2 x 4 micrograms, and detectable 3 h after injection; concomitantly, cholesterol and apolipoprotein (apo) B and apoE within LDL and large HDL decreased in plasma. LDL receptor mRNA levels were however unaltered or reduced. Hepatic microsomal cholesterol was increased and the enzymatic activities of 3-hydroxy-3-methylglutaryl coenzyme A reductase and cholesterol 7 alpha-hydroxylase in hepatic microsomes were reduced. Insulin alone increased receptor binding and receptor mRNA levels twofold, but plasma cholesterol was unchanged and plasma apoE and apoB increased. Administration of insulin to glucagon-treated animals reduced the LDL-receptor binding to control levels and apoB appeared in LDL particles. Estrogen treatment increased LDL-receptor binding and mRNA levels five- and eightfold, respectively. Combined treatment with glucagon and estrogen reduced the stimulation of LDL-receptor mRNA levels by 80% although LDL-receptor binding was unchanged. Immunoblot analysis showed that glucagon increased the number of hepatic LDL receptors. We conclude that glucagon induces the number of hepatic LDL receptors by a mechanism not related to increased mRNA levels, suggesting the presence of a posttranscriptional regulatory mechanism present in the liver in vivo. Images PMID:8514887

  12. Additive-free hot-pressed silicon carbide ceramics-A material with exceptional mechanical properties

    SciTech Connect

    Sajgalik, P.; Sedlacek, J.; Lences, Z.; Dusza, J.; Lin, H. -T.

    2015-12-30

    Densification of silicon carbide without any sintering aids by hot-pressing and rapid hot pressing was investigated. Full density (>99% t.d.) has been reached at 1850 °C, a temperature of at least 150-200 °C lower compared to the up to now known solid state sintered silicon carbide powders. Silicon carbide was freeze granulated and heat treated prior the densification. Furthermore, evolution of microstructure, mechanical properties and creep behavior were evaluated and compared to reference ceramics from as received silicon carbide powder as well as those of commercial one. Novel method results in dense ceramics with Vickers hardness and indentation fracture toughness of 29.0 GPa and 5.25 MPam1/2, respectively. Moreover, the creep rate of 3.8 x 10–9 s–1 at 1450 °C and the load of 100 MPa is comparable to the commercial α-SiC solid state sintered at 2150 °C.

  13. Additive-free hot-pressed silicon carbide ceramics-A material with exceptional mechanical properties

    DOE PAGESBeta

    Sajgalik, P.; Sedlacek, J.; Lences, Z.; Dusza, J.; Lin, H. -T.

    2015-12-30

    Densification of silicon carbide without any sintering aids by hot-pressing and rapid hot pressing was investigated. Full density (>99% t.d.) has been reached at 1850 °C, a temperature of at least 150-200 °C lower compared to the up to now known solid state sintered silicon carbide powders. Silicon carbide was freeze granulated and heat treated prior the densification. Furthermore, evolution of microstructure, mechanical properties and creep behavior were evaluated and compared to reference ceramics from as received silicon carbide powder as well as those of commercial one. Novel method results in dense ceramics with Vickers hardness and indentation fracture toughnessmore » of 29.0 GPa and 5.25 MPam1/2, respectively. Moreover, the creep rate of 3.8 x 10–9 s–1 at 1450 °C and the load of 100 MPa is comparable to the commercial α-SiC solid state sintered at 2150 °C.« less

  14. Energy efficient reduced graphene oxide additives: Mechanism of effective lubrication and antiwear properties

    PubMed Central

    Gupta, Bhavana; Kumar, N.; Panda, Kalpataru; Dash, S.; Tyagi, A. K.

    2016-01-01

    Optimized concentration of reduced graphene oxide (rGO) in the lube is one of the important factors for effective lubrication of solid body contacts. At sufficiently lower concentration, the lubrication is ineffective and friction/wear is dominated by base oil. In contrast, at sufficiently higher concentration, the rGO sheets aggregates in the oil and weak interlayer sliding characteristic of graphene sheets is no more active for providing lubrication. However, at optimized concentration, friction coefficient and wear is remarkably reduced to 70% and 50%, respectively, as compared to neat oil. Traditionally, such lubrication is described by graphene/graphite particle deposited in contact surfaces that provides lower shear strength of boundary tribofilm. In the present investigation, graphene/graphite tribofilm was absent and existing traditional lubrication mechanism for the reduction of friction and wear is ruled out. It is demonstrated that effective lubrication is possible, if rGO is chemically linked with PEG molecules through hydrogen bonding and PEG intercalated graphene sheets provide sufficiently lower shear strength of freely suspended composite tribofilm under the contact pressure. The work revealed that physical deposition and adsorption of the graphene sheets in the metallic contacts is not necessary for the lubrication. PMID:26725334

  15. Steroids augment relengthening of contracted airway smooth muscle: potential additional mechanism of benefit in asthma.

    PubMed

    Lakser, O J; Dowell, M L; Hoyte, F L; Chen, B; Lavoie, T L; Ferreira, C; Pinto, L H; Dulin, N O; Kogut, P; Churchill, J; Mitchell, R W; Solway, J

    2008-11-01

    Breathing (especially deep breathing) antagonises development and persistence of airflow obstruction during bronchoconstrictor stimulation. Force fluctuations imposed on contracted airway smooth muscle (ASM) in vitro result in its relengthening, a phenomenon called force fluctuation-induced relengthening (FFIR). Because breathing imposes similar force fluctuations on contracted ASM within intact lungs, FFIR represents a likely mechanism by which breathing antagonises bronchoconstriction. While this bronchoprotective effect appears to be impaired in asthma, corticosteroid treatment can restore the ability of deep breaths to reverse artificially induced bronchoconstriction in asthmatic subjects. It has previously been demonstrated that FFIR is physiologically regulated through the p38 mitogen-activated protein kinase (MAPK) signalling pathway. While the beneficial effects of corticosteroids have been attributed to suppression of airway inflammation, the current authors hypothesised that alternatively they might exert their action directly on ASM by augmenting FFIR as a result of inhibiting p38 MAPK signalling. This possibility was tested in the present study by measuring relengthening in contracted canine tracheal smooth muscle (TSM) strips. The results indicate that dexamethasone treatment significantly augmented FFIR of contracted canine TSM. Canine tracheal ASM cells treated with dexamethasone demonstrated increased MAPK phosphatase-1 expression and decreased p38 MAPK activity, as reflected in reduced phosphorylation of the p38 MAPK downstream target, heat shock protein 27. These results suggest that corticosteroids may exert part of their therapeutic effect through direct action on airway smooth muscle, by decreasing p38 mitogen-activated protein kinase activity and thus increasing force fluctuation-induced relengthening. PMID:18768574

  16. Energy efficient reduced graphene oxide additives: Mechanism of effective lubrication and antiwear properties

    NASA Astrophysics Data System (ADS)

    Gupta, Bhavana; Kumar, N.; Panda, Kalpataru; Dash, S.; Tyagi, A. K.

    2016-01-01

    Optimized concentration of reduced graphene oxide (rGO) in the lube is one of the important factors for effective lubrication of solid body contacts. At sufficiently lower concentration, the lubrication is ineffective and friction/wear is dominated by base oil. In contrast, at sufficiently higher concentration, the rGO sheets aggregates in the oil and weak interlayer sliding characteristic of graphene sheets is no more active for providing lubrication. However, at optimized concentration, friction coefficient and wear is remarkably reduced to 70% and 50%, respectively, as compared to neat oil. Traditionally, such lubrication is described by graphene/graphite particle deposited in contact surfaces that provides lower shear strength of boundary tribofilm. In the present investigation, graphene/graphite tribofilm was absent and existing traditional lubrication mechanism for the reduction of friction and wear is ruled out. It is demonstrated that effective lubrication is possible, if rGO is chemically linked with PEG molecules through hydrogen bonding and PEG intercalated graphene sheets provide sufficiently lower shear strength of freely suspended composite tribofilm under the contact pressure. The work revealed that physical deposition and adsorption of the graphene sheets in the metallic contacts is not necessary for the lubrication.

  17. Leaf Litter Mixtures Alter Microbial Community Development: Mechanisms for Non-Additive Effects in Litter Decomposition

    PubMed Central

    Chapman, Samantha K.; Newman, Gregory S.; Hart, Stephen C.; Schweitzer, Jennifer A.; Koch, George W.

    2013-01-01

    To what extent microbial community composition can explain variability in ecosystem processes remains an open question in ecology. Microbial decomposer communities can change during litter decomposition due to biotic interactions and shifting substrate availability. Though relative abundance of decomposers may change due to mixing leaf litter, linking these shifts to the non-additive patterns often recorded in mixed species litter decomposition rates has been elusive, and links community composition to ecosystem function. We extracted phospholipid fatty acids (PLFAs) from single species and mixed species leaf litterbags after 10 and 27 months of decomposition in a mixed conifer forest. Total PLFA concentrations were 70% higher on litter mixtures than single litter types after 10 months, but were only 20% higher after 27 months. Similarly, fungal-to-bacterial ratios differed between mixed and single litter types after 10 months of decomposition, but equalized over time. Microbial community composition, as indicated by principal components analyses, differed due to both litter mixing and stage of litter decomposition. PLFA biomarkers a15∶0 and cy17∶0, which indicate gram-positive and gram-negative bacteria respectively, in particular drove these shifts. Total PLFA correlated significantly with single litter mass loss early in decomposition but not at later stages. We conclude that litter mixing alters microbial community development, which can contribute to synergisms in litter decomposition. These findings advance our understanding of how changing forest biodiversity can alter microbial communities and the ecosystem processes they mediate. PMID:23658639

  18. TRIENNIAL LACTATION SYMPOSIUM: Systems biology of regulatory mechanisms of nutrient metabolism in lactation.

    PubMed

    McNamara, J P

    2015-12-01

    A major role of the dairy cow is to convert low-quality plant materials into high-quality protein and other nutrients for humans. We must select and manage cows with the goal of having animals of the greatest efficiency matched to their environment. We have increased efficiency tremendously over the years, yet the variation in productive and reproductive efficiency among animals is still large. In part, this is because of a lack of full integration of genetic, nutritional, and reproductive biology into management decisions. However, integration across these disciplines is increasing as the biological research findings show specific control points at which genetics, nutrition, and reproduction interact. An ordered systems biology approach that focuses on why and how cells regulate energy and N use and on how and why organs interact through endocrine and neurocrine mechanisms will speed improvements in efficiency. More sophisticated dairy managers will demand better information to improve the efficiency of their animals. Using genetic improvement and animal management to improve milk productive and reproductive efficiency requires a deeper understanding of metabolic processes throughout the life cycle. Using existing metabolic models, we can design experiments specifically to integrate data from global transcriptional profiling into models that describe nutrient use in farm animals. A systems modeling approach can help focus our research to make faster and larger advances in efficiency and determine how this knowledge can be applied on the farms. PMID:26641166

  19. Familial autoinflammation with neutrophilic dermatosis reveals a regulatory mechanism of pyrin activation.

    PubMed

    Masters, Seth L; Lagou, Vasiliki; Jéru, Isabelle; Baker, Paul J; Van Eyck, Lien; Parry, David A; Lawless, Dylan; De Nardo, Dominic; Garcia-Perez, Josselyn E; Dagley, Laura F; Holley, Caroline L; Dooley, James; Moghaddas, Fiona; Pasciuto, Emanuela; Jeandel, Pierre-Yves; Sciot, Raf; Lyras, Dena; Webb, Andrew I; Nicholson, Sandra E; De Somer, Lien; van Nieuwenhove, Erika; Ruuth-Praz, Julia; Copin, Bruno; Cochet, Emmanuelle; Medlej-Hashim, Myrna; Megarbane, Andre; Schroder, Kate; Savic, Sinisa; Goris, An; Amselem, Serge; Wouters, Carine; Liston, Adrian

    2016-03-30

    Pyrin responds to pathogen signals and loss of cellular homeostasis by forming an inflammasome complex that drives the cleavage and secretion of interleukin-1β (IL-1β). Mutations in the B30.2/SPRY domain cause pathogen-independent activation of pyrin and are responsible for the autoinflammatory disease familial Mediterranean fever (FMF). We studied a family with a dominantly inherited autoinflammatory disease, distinct from FMF, characterized by childhood-onset recurrent episodes of neutrophilic dermatosis, fever, elevated acute-phase reactants, arthralgia, and myalgia/myositis. The disease was caused by a mutation in MEFV, the gene encoding pyrin (S242R). The mutation results in the loss of a 14-3-3 binding motif at phosphorylated S242, which was not perturbed by FMF mutations in the B30.2/SPRY domain. However, loss of both S242 phosphorylation and 14-3-3 binding was observed for bacterial effectors that activate the pyrin inflammasome, such as Clostridium difficile toxin B (TcdB). The S242R mutation thus recapitulated the effect of pathogen sensing, triggering inflammasome activation and IL-1β production. Successful therapy targeting IL-1β has been initiated in one patient, resolving pyrin-associated autoinflammation with neutrophilic dermatosis. This disease provides evidence that a guard-like mechanism of pyrin regulation, originally identified for Nod-like receptors in plant innate immunity, also exists in humans. PMID:27030597

  20. Tuning of Redox Regulatory Mechanisms, Reactive Oxygen Species and Redox Homeostasis under Salinity Stress

    PubMed Central

    Hossain, M. Sazzad; Dietz, Karl-Josef

    2016-01-01

    Soil salinity is a crucial environmental constraint which limits biomass production at many sites on a global scale. Saline growth conditions cause osmotic and ionic imbalances, oxidative stress and perturb metabolism, e.g., the photosynthetic electron flow. The plant ability to tolerate salinity is determined by multiple biochemical and physiological mechanisms protecting cell functions, in particular by regulating proper water relations and maintaining ion homeostasis. Redox homeostasis is a fundamental cell property. Its regulation includes control of reactive oxygen species (ROS) generation, sensing deviation from and readjustment of the cellular redox state. All these redox related functions have been recognized as decisive factors in salinity acclimation and adaptation. This review focuses on the core response of plants to overcome the challenges of salinity stress through regulation of ROS generation and detoxification systems and to maintain redox homeostasis. Emphasis is given to the role of NADH oxidase (RBOH), alternative oxidase (AOX), the plastid terminal oxidase (PTOX) and the malate valve with the malate dehydrogenase isoforms under salt stress. Overwhelming evidence assigns an essential auxiliary function of ROS and redox homeostasis to salinity acclimation of plants. PMID:27242807

  1. Seasonality of reproduction in mammals: intimate regulatory mechanisms and practical implications.

    PubMed

    Chemineau, P; Guillaume, D; Migaud, M; Thiéry, J C; Pellicer-Rubio, M T; Malpaux, B

    2008-07-01

    Farm mammals generally express seasonal variations in their production traits, thus inducing changing availability of fresh derived animal products (meat, milk and cheese) or performances (horses). This is due to a more or less marked seasonal birth distribution in sheep and goats, in horses but not cattle. Birth peak occurs at the end of winter-early spring, the most favourable period for the progeny to survive. Most species show seasonal variations in their ovulation frequency (presence or absence of ovulation), spermatogenic activity (from moderate decrease to complete absence of sperm production), gamete quality (variations in fertilization rates and embryo survival), and also sexual behaviour. The intimate mechanism involved is a complex combination of endogenous circannual rhythm driven and synchronized by light and melatonin. Profound and long-term neuroendocrine changes involving different neuromediator systems were described to play a role in these processes. In most species artificial photoperiodic treatments consisting of extra-light during natural short days (in sheep and goats and mares) or melatonin during long days (in sheep and goats) are extensively used to either adjust the breeding season to animal producer needs and/or to completely overcome seasonal variations of sperm production in artificial insemination centres. Pure light treatments (without melatonin), especially when applied in open barns, could be considered as non-invasive ones which fully respect animal welfare. Genetic selection could be one of the future ways to decrease seasonality in sheep and goats. PMID:18638103

  2. The regulatory mechanism underlying light-inducible production of carotenoids in nonphototrophic bacteria.

    PubMed

    Takano, Hideaki

    2016-07-01

    Light is a ubiquitous environmental factor serving as an energy source and external stimulus. Here, I review the conserved molecular mechanism of light-inducible production of carotenoids in three nonphototrophic bacteria: Streptomyces coelicolor A3(2), Thermus thermophilus HB27, and Bacillus megaterium QM B1551. A MerR family transcriptional regulator, LitR, commonly plays a central role in their light-inducible carotenoid production. Genetic and biochemical studies on LitR proteins revealed a conserved function: LitR in complex with adenosyl B12 (AdoB12) has a light-sensitive DNA-binding activity and thus suppresses the expression of the Crt biosynthesis gene cluster. The in vitro DNA-binding and transcription assays showed that the LitR-AdoB12 complex serves as a repressor allowing transcription initiation by RNA polymerase in response to illumination. The existence of novel light-inducible genes and the unique role of the megaplasmid were revealed by the transcriptomic analysis of T. thermophilus. The findings suggest that LitR is a general regulator responsible for the light-inducible carotenoid production in the phylogenetically divergent nonphototrophic bacteria, and that LitR performs diverse physiological functions in bacteria. PMID:26967471

  3. Sweat, the driving force behind normal skin: an emerging perspective on functional biology and regulatory mechanisms.

    PubMed

    Murota, Hiroyuki; Matsui, Saki; Ono, Emi; Kijima, Akiko; Kikuta, Junichi; Ishii, Masaru; Katayama, Ichiro

    2015-01-01

    The various symptoms associated with excessive or insufficient perspiration can significantly reduce a patient's quality of life. If a versatile and minimally invasive method could be established for returning sweat activity to normalcy, there is no question that it could be used in the treatment of many diseases that are believed to involve perspiration. For this reason, based on an understanding of the sweat-gland control function and sweat activity, it was necessary to conduct a comprehensive search for the factors that control sweating, such as the central and peripheral nerves that control sweat-gland function, the microenvironment surrounding the sweat glands, and lifestyle. We focused on the mechanism by which atopic dermatitis leads to hypohidrosis and confirmed that histamine inhibits acetylcholinergic sweating. Acetylcholine promotes the phosphorylation of glycogen synthesis kinase 3β (GSK3β) in the sweat-gland secretory cells and leads to sensible perspiration. By suppressing the phosphorylation of GSK3β, histamine inhibits the movement of sweat from the sweat-gland secretory cells through the sweat ducts, which could presumably be demonstrated by dynamic observations of the sweat glands using two-photon microscopy. It is expected that the discovery of new factors that control sweat-gland function can contribute to the treatment of diseases associated with dyshidrosis. PMID:25266651

  4. Fluorescence single-molecule imaging of actin turnover and regulatory mechanisms.

    PubMed

    Watanabe, Naoki

    2012-01-01

    Cells must rapidly remodel the actin filament network to achieve various cellular functions. Actin filament turnover is a dynamic process that plays crucial roles in cell adhesion, locomotion, cytokinesis, endocytosis, phagocytosis, tissue remodeling, etc., and is regulated by cell signaling cascades. Success in elucidating dynamic biological processes such as actin-based motility relies on the means enabling real time monitoring of the process. The invention of live-cell fluorescence single-molecule imaging has opened a window for direct viewing of various actin remodeling processes. In general, assembly and dissociation of actin and its regulators turned out to occur at the faster rates than previously estimated by biochemical and structural analyses. Cells undergo such fast continuous exchange of the components perhaps not only to drive actin remodeling but also to facilitate rapid response in many other cell mechanics and signaling cascades. This chapter describes how epifluorescence single-molecule imaging which visualizes deeper area than the TIRF microscopy is achieved in XTC cells, the currently best platform for this approach. PMID:22289456

  5. Tuning of Redox Regulatory Mechanisms, Reactive Oxygen Species and Redox Homeostasis under Salinity Stress.

    PubMed

    Hossain, M Sazzad; Dietz, Karl-Josef

    2016-01-01

    Soil salinity is a crucial environmental constraint which limits biomass production at many sites on a global scale. Saline growth conditions cause osmotic and ionic imbalances, oxidative stress and perturb metabolism, e.g., the photosynthetic electron flow. The plant ability to tolerate salinity is determined by multiple biochemical and physiological mechanisms protecting cell functions, in particular by regulating proper water relations and maintaining ion homeostasis. Redox homeostasis is a fundamental cell property. Its regulation includes control of reactive oxygen species (ROS) generation, sensing deviation from and readjustment of the cellular redox state. All these redox related functions have been recognized as decisive factors in salinity acclimation and adaptation. This review focuses on the core response of plants to overcome the challenges of salinity stress through regulation of ROS generation and detoxification systems and to maintain redox homeostasis. Emphasis is given to the role of NADH oxidase (RBOH), alternative oxidase (AOX), the plastid terminal oxidase (PTOX) and the malate valve with the malate dehydrogenase isoforms under salt stress. Overwhelming evidence assigns an essential auxiliary function of ROS and redox homeostasis to salinity acclimation of plants. PMID:27242807

  6. PD-L1 expression in metastatic neuroblastoma as an additional mechanism for limiting immune surveillance

    PubMed Central

    Dondero, Alessandra; Pastorino, Fabio; Della Chiesa, Mariella; Corrias, Maria Valeria; Morandi, Fabio; Pistoia, Vito; Olive, Daniel; Bellora, Francesca; Locatelli, Franco; Castellano, Aurora; Moretta, Lorenzo; Moretta, Alessandro; Bottino, Cristina; Castriconi, Roberta

    2016-01-01

    ABSTRACT The prognosis of high-risk neuroblastoma (NB) remains poor, although immunotherapies with anti-GD2 antibodies have been reported to provide some benefit. Immunotherapies can be associated with an IFNγ storm that induces in tumor cells the “adaptive immune resistance” characterized by the de-novo expression of Programmed Death Ligands (PD-Ls). Tumor cells can also constitutively express PD-Ls in response to oncogenic signaling. Here, we analyze the constitutive and the inducible surface expression of PD-Ls in NB cells. We show that virtually all HLA class Ipos NB cell lines constitutively express PD-L1, whereas PD-L2 is rarely detected. IFNγ upregulates or induces PD-L1 both in NB cell lines in vitro and in NB engrafted nude/nude mice. Importantly, after IFNγ stimulation PD-L1 can be acquired by NB cell lines, as well as by metastatic neuroblasts isolated from bone marrow aspirates of high-risk NB patients, characterized by different MYCN amplification status. Interestingly, in one patient NB cells were poorly responsive to IFNγ stimulation, pointing out that responsiveness to IFNγ might represent a further element of heterogeneity in metastatic neuroblasts. Finally, we document the presence of lymphocytes expressing the PD-1 receptor in NB-infiltrated bone marrow of patients. PD-1pos cells are mainly represented by αβ T cells, but also include small populations of γδ T cells and NK cells. Moreover, PD-1pos T cells have a higher expression of activation markers. Overall, our data show that a PD-L1-mediated immune resistance mechanism occurs in metastatic neuroblasts and provide a biological rationale for blocking the PD-1/PD-Ls axis in future combined immunotherapeutic approaches. PMID:26942080

  7. Effects of Sn addition on the microstructure, mechanical properties and corrosion behavior of Ti–Nb–Sn alloys

    SciTech Connect

    Moraes, Paulo E.L.; Contieri, Rodrigo J.; Lopes, Eder S.N.; Robin, Alain; Caram, Rubens

    2014-10-15

    Ti and Ti alloys are widely used in restorative surgery because of their good biocompatibility, enhanced mechanical behavior and high corrosion resistance in physiological media. The corrosion resistance of Ti-based materials is due to the spontaneous formation of the TiO{sub 2} oxide film on their surface, which exhibits elevated stability in biological fluids. Ti–Nb alloys, depending on the composition and the processing routes to which the alloys are subjected, have high mechanical strength combined with low elastic modulus. The addition of Sn to Ti–Nb alloys allows the phase transformations to be controlled, particularly the precipitation of ω phase. The aim of this study is to discuss the microstructure, mechanical properties and corrosion behavior of cast Ti–Nb alloys to which Sn has been added. Samples were centrifugally cast in a copper mold, and the microstructure was characterized using optical microscopy, scanning electron microscopy and X-ray diffractometry. Mechanical behavior evaluation was performed using Berkovich nanoindentation, Vickers hardness and compression tests. The corrosion behavior was evaluated in Ringer's solution at room temperature using electrochemical techniques. The results obtained suggested that the physical, mechanical and chemical behaviors of the Ti–Nb–Sn alloys are directly dependent on the Sn content. - Graphical abstract: Effects of Sn addition to the Ti–30Nb alloy on the elastic modulus. - Highlights: • Sn addition causes reduction of the ω phase precipitation. • Minimum Vickers hardness and elastic modulus occurred for 6 wt.% Sn content. • Addition of 6 wt.% Sn resulted in maximum ductility and minimum compression strength. • All Ti–30Nb–XSn (X = 0, 2, 4, 6, 8 and 10%) alloys are passive in Ringer's solution. • Highest corrosion resistance was observed for 6 wt.% Sn content.

  8. Effect of One Percent Chlorhexidine Addition on the Antibacterial Activity and Mechanical Properties of Sealants: An in vitro Study

    PubMed Central

    Asokan, Sharath; John, J Baby; Priya, PR Geetha; Devi, Jagadeesan Gnana

    2015-01-01

    ABSTRACT Aim: The aim of the study was to evaluate the effect of addition of 1% chlorhexidine digluconate solution on the antibacterial activity and mechanical properties of glass ionomer and resin based sealant. Materials and methods: Conventional glass ionomer sealant (GIS) (Fuji VII, Japan) and resin sealant (Clinpro 3M ESPE, USA) were used in this study. Chlorhexidine digluconate (CHX) (20%) liquid was added to both the sealants, and the concentration of chlorhexidine in sealants was adjusted to 1%. The sealants were divided into four groups as: group A (GIS), group B (GIS + 1% CHX), group C (resin sealant), group D (resin sealant + 1% CHX). Five cylindrical specimens were prepared in each group. Their antibacterial activity against Streptococcus mutans and Lactobacillus acidophilus, and their mechanical properties (compressive strength and diametrical tensile strength) were assessed. Mann-Whitney and Wilcoxon signed rank test were used appropriately for statistical analysis (SPSS version 19). Result: Addition of one percent chlorhexidine significantly increased the antibacterial activity of both the sealants. There was a significant difference between groups A and B (p < 0.009), and groups C and D (p < 0.008). There was no significant difference in the mechanical properties of the sealants. Conclusion: Addition of one percent chlorhexidine to the glass ionomer and resin based sealants provided sufficient antibacterial activity, without significantly affecting the mechanical property of the sealants. How to cite this article: Shanmugaavel AK, Asokan S, John JB, Geetha Priya PR, Gnana Devi J. Effect of one percent Chlorhexidine Addition on the Antibacterial Activity and Mechanical Properties of Sealants: An in vitro Study. Int J Clin Pediatr Dent 2015;8(3):196-201. PMID:26628854

  9. Regulatory mechanism of ZNF139 in multi-drug resistance of gastric cancer cells.

    PubMed

    Li, Yong; Tan, Bi-bo; Zhao, Qun; Fan, Li-qiao; Liu, Yü; Wang, Dong

    2014-06-01

    Our previous study found increased zinc finger protein 139 (ZNF139) expression in gastric cancer (GC) cells. Purpose of the study is to further clarify the role and mechanism of ZNF139 in multi-drug resistance (MDR) of GC cells. MTT assay, RT-PCR, Western blotting were employed to detect susceptibility of GC cells to chemotherapeutic agents (5-FU, L-OHP) in vitro, and expressions of ZNF139 and MDR associated genes MDR1/P-gp, MRP1, Bcl-2, Bax were also detected. siRNA specific to ZNF139 was transfected into MKN28 cells, then chemosensitivity of GC cells as well as changes of ZNF139 and MDR associated genes were detected. It's found the inhibition rate of 5-FU, L-OHP to well-differentiated GC tissues and cell line was lower than that in the poorly differentiated tissues and cell line; expressions of ZNF139 and MDR1/P-gp, MRP1 and Bcl-2 in well-differentiated GC tissues and cell line MKN28 were higher, while Bax expression was lower. After ZNF139-siRNA was transfected into MKN28, ZNF139 expression in GC cells was inhibited by 90%; inhibition rate of 5-FU, L-OHP to tumor cells increased, and expressions of MDR1/P-gp, MRP1 and Bcl-2 were down-regulated, while Bax was up-regulated. ZNF139 was involved in GC MDR by promoting expressions of MDR1/P-gp, MRP1 and Bcl-2 and inhibiting Bax simultaneously. PMID:24515389

  10. Multiple Regulatory Mechanisms Control the Expression of the Geobacillus stearothermophilus Gene for Extracellular Xylanase*

    PubMed Central

    Shulami, Smadar; Shenker, Ofer; Langut, Yael; Lavid, Noa; Gat, Orit; Zaide, Galia; Zehavi, Arie; Sonenshein, Abraham L.; Shoham, Yuval

    2014-01-01

    Geobacillus stearothermophilus T-6 produces a single extracellular xylanase (Xyn10A) capable of producing short, decorated xylo-oligosaccharides from the naturally branched polysaccharide, xylan. Gel retardation assays indicated that the master negative regulator, XylR, binds specifically to xylR operators in the promoters of xylose and xylan-utilization genes. This binding is efficiently prevented in vitro by xylose, the most likely molecular inducer. Expression of the extracellular xylanase is repressed in medium containing either glucose or casamino acids, suggesting that carbon catabolite repression plays a role in regulating xynA. The global transcriptional regulator CodY was shown to bind specifically to the xynA promoter region in vitro, suggesting that CodY is a repressor of xynA. The xynA gene is located next to an uncharacterized gene, xynX, that has similarity to the NIF3 (Ngg1p interacting factor 3)-like protein family. XynX binds specifically to a 72-bp fragment in the promoter region of xynA, and the expression of xynA in a xynX null mutant appeared to be higher, indicating that XynX regulates xynA. The specific activity of the extracellular xylanase increases over 50-fold during early exponential growth, suggesting cell density regulation (quorum sensing). Addition of conditioned medium to fresh and low cell density cultures resulted in high expression of xynA, indicating that a diffusible extracellular xynA density factor is present in the medium. The xynA density factor is heat-stable, sensitive to proteases, and was partially purified using reverse phase liquid chromatography. Taken together, these results suggest that xynA is regulated by quorum-sensing at low cell densities. PMID:25070894

  11. Cellular Interrogation: Exploiting Cell-to-Cell Variability to Discriminate Regulatory Mechanisms in Oscillatory Signalling

    PubMed Central

    Gibson, Daniel; Chang, Frederick; Gnad, Florian; Gunawardena, Jeremy

    2016-01-01

    The molecular complexity within a cell may be seen as an evolutionary response to the external complexity of the cell’s environment. This suggests that the external environment may be harnessed to interrogate the cell’s internal molecular architecture. Cells, however, are not only nonlinear and non-stationary, but also exhibit heterogeneous responses within a clonal, isogenic population. In effect, each cell undertakes its own experiment. Here, we develop a method of cellular interrogation using programmable microfluidic devices which exploits the additional information present in cell-to-cell variation, without requiring model parameters to be fitted to data. We focussed on Ca2+ signalling in response to hormone stimulation, which exhibits oscillatory spiking in many cell types and chose eight models of Ca2+ signalling networks which exhibit similar behaviour in simulation. We developed a nonlinear frequency analysis for non-stationary responses, which could classify models into groups under parameter variation, but found that this question alone was unable to distinguish critical feedback loops. We further developed a nonlinear amplitude analysis and found that the combination of both questions ruled out six of the models as inconsistent with the experimentally-observed dynamics and heterogeneity. The two models that survived the double interrogation were mathematically different but schematically identical and yielded the same unexpected predictions that we confirmed experimentally. Further analysis showed that subtle mathematical details can markedly influence non-stationary responses under parameter variation, emphasising the difficulty of finding a “correct” model. By developing questions for the pathway being studied, and designing more versatile microfluidics, cellular interrogation holds promise as a systematic strategy that can complement direct intervention by genetics or pharmacology. PMID:27367445

  12. Cellular Interrogation: Exploiting Cell-to-Cell Variability to Discriminate Regulatory Mechanisms in Oscillatory Signalling.

    PubMed

    Estrada, Javier; Andrew, Natalie; Gibson, Daniel; Chang, Frederick; Gnad, Florian; Gunawardena, Jeremy

    2016-07-01

    The molecular complexity within a cell may be seen as an evolutionary response to the external complexity of the cell's environment. This suggests that the external environment may be harnessed to interrogate the cell's internal molecular architecture. Cells, however, are not only nonlinear and non-stationary, but also exhibit heterogeneous responses within a clonal, isogenic population. In effect, each cell undertakes its own experiment. Here, we develop a method of cellular interrogation using programmable microfluidic devices which exploits the additional information present in cell-to-cell variation, without requiring model parameters to be fitted to data. We focussed on Ca2+ signalling in response to hormone stimulation, which exhibits oscillatory spiking in many cell types and chose eight models of Ca2+ signalling networks which exhibit similar behaviour in simulation. We developed a nonlinear frequency analysis for non-stationary responses, which could classify models into groups under parameter variation, but found that this question alone was unable to distinguish critical feedback loops. We further developed a nonlinear amplitude analysis and found that the combination of both questions ruled out six of the models as inconsistent with the experimentally-observed dynamics and heterogeneity. The two models that survived the double interrogation were mathematically different but schematically identical and yielded the same unexpected predictions that we confirmed experimentally. Further analysis showed that subtle mathematical details can markedly influence non-stationary responses under parameter variation, emphasising the difficulty of finding a "correct" model. By developing questions for the pathway being studied, and designing more versatile microfluidics, cellular interrogation holds promise as a systematic strategy that can complement direct intervention by genetics or pharmacology. PMID:27367445

  13. Multiple regulatory mechanisms control the expression of the Geobacillus stearothermophilus gene for extracellular xylanase.

    PubMed

    Shulami, Smadar; Shenker, Ofer; Langut, Yael; Lavid, Noa; Gat, Orit; Zaide, Galia; Zehavi, Arie; Sonenshein, Abraham L; Shoham, Yuval

    2014-09-12

    Geobacillus stearothermophilus T-6 produces a single extracellular xylanase (Xyn10A) capable of producing short, decorated xylo-oligosaccharides from the naturally branched polysaccharide, xylan. Gel retardation assays indicated that the master negative regulator, XylR, binds specifically to xylR operators in the promoters of xylose and xylan-utilization genes. This binding is efficiently prevented in vitro by xylose, the most likely molecular inducer. Expression of the extracellular xylanase is repressed in medium containing either glucose or casamino acids, suggesting that carbon catabolite repression plays a role in regulating xynA. The global transcriptional regulator CodY was shown to bind specifically to the xynA promoter region in vitro, suggesting that CodY is a repressor of xynA. The xynA gene is located next to an uncharacterized gene, xynX, that has similarity to the NIF3 (Ngg1p interacting factor 3)-like protein family. XynX binds specifically to a 72-bp fragment in the promoter region of xynA, and the expression of xynA in a xynX null mutant appeared to be higher, indicating that XynX regulates xynA. The specific activity of the extracellular xylanase increases over 50-fold during early exponential growth, suggesting cell density regulation (quorum sensing). Addition of conditioned medium to fresh and low cell density cultures resulted in high expression of xynA, indicating that a diffusible extracellular xynA density factor is present in the medium. The xynA density factor is heat-stable, sensitive to proteases, and was partially purified using reverse phase liquid chromatography. Taken together, these results suggest that xynA is regulated by quorum-sensing at low cell densities. PMID:25070894

  14. Mechanical and Electrical Properties of a Polyimide Film Significantly Enhanced by the Addition of Single-Wall Carbon Nanotubes

    NASA Technical Reports Server (NTRS)

    Meador, Michael A.

    2005-01-01

    Single-wall carbon nanotubes have been shown to possess a combination of outstanding mechanical, electrical, and thermal properties. The use of carbon nanotubes as an additive to improve the mechanical properties of polymers and/or enhance their thermal and electrical conductivity has been a topic of intense interest. Nanotube-modified polymeric materials could find a variety of applications in NASA missions including large-area antennas, solar arrays, and solar sails; radiation shielding materials for vehicles, habitats, and extravehicular activity suits; and multifunctional materials for vehicle structures and habitats. Use of these revolutionary materials could reduce vehicle weight significantly and improve vehicle performance and capabilities.

  15. Effects of Yttrium Addition on Microstructure and Mechanical Properties of AZ80-2Sn Magnesium Alloys

    NASA Astrophysics Data System (ADS)

    Xue, Hansong; Yang, Gang; Li, Di; Xing, Zhihui; Pan, Fusheng

    2015-12-01

    The effects of Y on microstructure and mechanical properties of as-cast AZ80-2Sn magnesium alloys were investigated by optical microscopy, scanning electron microscopy and X-ray diffraction. Y addition not only changes the as-cast microstructure but also influences the mechanical properties of AZ80-2Sn alloy. Unmodified AZ80-2Sn alloys under casting state show that Mg17Al12 eutectic phase is semicontinuous and reticulated shape and distributes mainly at grain boundaries. Moreover, there are numerous Mg2Sn precipitate particles dispersing in Mg17Al12 eutectic phases. Y addition to as-cast AZ80-2Sn alloys has an important influence on the precipitation phase. But there has no obvious effect on grain refinement with Y addition. The results show that the AZ80-2Sn alloys with variable Y contents all contain Al2Y phase. By adding Y, the amount of Mg17Al12 is decreased and the dimension of that is reduced. Mg17Al12 eutectic phase turns to discontinuous, and the more disperse phases occur with the increase of Y content. The tensile tests indicate that a minor addition of Y can contribute to the formation of the dispersed small polygonal Al2Y particles and the improvement in the room-temperature strength. However, excessive Y addition leads to the coarsening of Al2Y phases, and thus results in the decline of strength and ductility.

  16. MicroRNA Regulatory Mechanisms on Citrus sinensis leaves to Magnesium-Deficiency

    PubMed Central

    Ma, Cui-Lan; Qi, Yi-Ping; Liang, Wei-Wei; Yang, Lin-Tong; Lu, Yi-Bin; Guo, Peng; Ye, Xin; Chen, Li-Song

    2016-01-01

    Magnesium (Mg)-deficiency, which affects crop productivity and quality, widespreadly exists in many agricultural crops, including citrus. However, very limited data are available on Mg-deficiency-responsive microRNAs (miRNAs) in higher plants. Using Illumina sequencing, we isolated 75 (73 known and 2 novel) up- and 71 (64 known and 7 novel) down-regulated miRNAs from Mg-deficient Citrus sinensis leaves. In addition to the remarkable metabolic flexibility as indicated by the great alteration of miRNA expression, the adaptive responses of leaf miRNAs to Mg-deficiency might also involve the following several aspects: (a) up-regulating stress-related genes by down-regulating miR164, miR7812, miR5742, miR3946, and miR5158; (b) enhancing cell transport due to decreased expression of miR3946 and miR5158 and increased expression of miR395, miR1077, miR1160, and miR8019; (c) activating lipid metabolism-related genes by repressing miR158, miR5256, and miR3946; (d) inducing cell wall-related gene expansin 8A by repressing miR779; and (e) down-regulating the expression of genes involved in the maintenance of S, K and Cu by up-regulating miR395 and miR6426. To conclude, we isolated some new known miRNAs (i.e., miR7812, miR8019, miR6218, miR1533, miR6426, miR5256, miR5742, miR5561, miR5158, and miR5818) responsive to nutrient deficiencies and found some candidate miRNAs that might contribute to Mg-deficiency tolerance. Therefore, our results not only provide novel information about the responses of plant to Mg-deficiency, but also are useful for obtaining the key miRNAs for plant Mg-deficiency tolerance. PMID:26973661

  17. MicroRNA Regulatory Mechanisms on Citrus sinensis leaves to Magnesium-Deficiency.

    PubMed

    Ma, Cui-Lan; Qi, Yi-Ping; Liang, Wei-Wei; Yang, Lin-Tong; Lu, Yi-Bin; Guo, Peng; Ye, Xin; Chen, Li-Song

    2016-01-01

    Magnesium (Mg)-deficiency, which affects crop productivity and quality, widespreadly exists in many agricultural crops, including citrus. However, very limited data are available on Mg-deficiency-responsive microRNAs (miRNAs) in higher plants. Using Illumina sequencing, we isolated 75 (73 known and 2 novel) up- and 71 (64 known and 7 novel) down-regulated miRNAs from Mg-deficient Citrus sinensis leaves. In addition to the remarkable metabolic flexibility as indicated by the great alteration of miRNA expression, the adaptive responses of leaf miRNAs to Mg-deficiency might also involve the following several aspects: (a) up-regulating stress-related genes by down-regulating miR164, miR7812, miR5742, miR3946, and miR5158; (b) enhancing cell transport due to decreased expression of miR3946 and miR5158 and increased expression of miR395, miR1077, miR1160, and miR8019; (c) activating lipid metabolism-related genes by repressing miR158, miR5256, and miR3946; (d) inducing cell wall-related gene expansin 8A by repressing miR779; and (e) down-regulating the expression of genes involved in the maintenance of S, K and Cu by up-regulating miR395 and miR6426. To conclude, we isolated some new known miRNAs (i.e., miR7812, miR8019, miR6218, miR1533, miR6426, miR5256, miR5742, miR5561, miR5158, and miR5818) responsive to nutrient deficiencies and found some candidate miRNAs that might contribute to Mg-deficiency tolerance. Therefore, our results not only provide novel information about the responses of plant to Mg-deficiency, but also are useful for obtaining the key miRNAs for plant Mg-deficiency tolerance. PMID:26973661

  18. Regulatory effect and mechanism of gastrin and its antagonists on colorectal carcinoma

    PubMed Central

    He, Shuang-Wu; Shen, Kang-Qiang; He, Yu-Jun; Xie, Bin; Zhao, Yan-Ming

    1999-01-01

    AIM: To explore the effect and mechanism of gastrin and its an tagonists proglumide and somatostatin on colorectal carcinoma and their clinical significance. METHODS: A model of transplanted human colonic carcinoma was established from SW480 cell line in gymnomouse body. The volume and weight of transplanted carcinoma was observed under the effect of pentagatrin (PG), proglumide (PGL) and octapeptide somotostatin (SMS201-995, SMS). The cAMP content of carcinoma cell was determined by radioimmunoassay and the DNA, protein content and cell cycle were determined by flow-cytometry. The amount of viable cells was determined by MTT colorimetric analysis, IP3 content was determined by radioimmuno assay, Ca2+ concentration in cell by fluorometry and PKC activity by isotopic enzymolysis. The expression of gastrin, c-myc, c-fos and rasP21 in 48 case s of colorectal carcinoma tissue was detected by the immuno-cytochemistry SP method. Argyrophilia nucleolar organizer regions was determined with argyrophilia stain. RESULTS: The volume, weight, cAMP, DNA and protein content in carcinoma cell, cell amount and proliferation index of S and G2M phase in PG group were all significantly higher than those of control group. When PG was at the concentration of 25 mg/L, the amount of viable cells, IP3 content and Ca2+ concentration in cell and membrane PKC activity in PG group were significantly higher than those in control group; when PGL was at a concentration of 32 mg/L, they dropped to the lowest level in PG (25 mg/L) + PGL group, but without significant difference from the control group. The positive expression rate of gastrin, c-myc, c-fos and rasP21 in carcinoma tissue was 39.6%, 54.2%, 47.9% and 54.2% respectively and significantly higher than that in mucosa 3 cm and 6 cm adjacent to carcinoma tissue and normal colorectal mucosa. The positive expression rate of gastrin of highly-differentiated adenocarcinoma group was significantly higher than that of poorly-differentiated and

  19. Noncoding Regulatory RNAs in Hematopoiesis.

    PubMed

    Jeong, M; Goodell, M A

    2016-01-01

    Hematopoiesis is a dynamic process in which blood cells are continuously generated from hematopoietic stem cells (HSCs). The regulatory mechanisms controlling HSC fate have been studied extensively over the past several decades. Although many protein-coding genes have been shown to regulate hematopoietic differentiation, additional levels of HSC regulation are not well studied. Advances in deep sequencing have revealed many new classes of regulatory noncoding RNAs (ncRNAs), such as enhancer RNAs and antisense ncRNAs. Functional analysis of some of these ncRNAs has provided insights into the molecular mechanisms that regulate hematopoietic development and disease. In this review, we summarize recent advances in our understanding of functional regulatory ncRNAs associated with hematopoietic self-renewal and differentiation, as well as those dysregulated ncRNAs involved in hematologic malignancies. PMID:27137659

  20. Mechanisms underlying zoonotic success of Campylobacter jejuni: the CprRS two-component regulatory system influences essential processes, biofilm formation, and pathogenesis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Mechanisms underlying zoonotic success of Campylobacter jejuni: the CprRS two-component regulatory system influences essential processes, biofilm formation, and pathogenesis Campylobacter jejuni is a leading cause of food- and waterbourne bacterial gastroenteritis in the developed world. Although il...

  1. Additive manufacturing and mechanical characterization of graded porosity scaffolds designed based on triply periodic minimal surface architectures.

    PubMed

    Afshar, M; Anaraki, A Pourkamali; Montazerian, H; Kadkhodapour, J

    2016-09-01

    Since the advent of additive manufacturing techniques, triply periodic minimal surfaces have emerged as a novel tool for designing porous scaffolds. Whereas scaffolds are expected to provide multifunctional performance, spatially changing pore patterns have been a promising approach to integrate mechanical characteristics of different architectures into a unique scaffold. Smooth morphological variations are also frequently seen in nature particularly in bone and cartilage structures and can be inspiring for designing of artificial tissues. In this study, we carried out experimental and numerical procedures to uncover the mechanical properties and deformation mechanisms of linearly graded porosity scaffolds for two different mathematically defined pore structures. Among TPMS-based scaffolds, P and D surfaces were subjected to gradient modeling to explore the mechanical responses for stretching and bending dominated deformations, respectively. Moreover, the results were compared to their corresponding uniform porosity structures. Mechanical properties were found to be by far greater for the stretching dominated structure (P-Surface). For bending dominated architecture (D-Surface), although there was no global fracture for uniform structures, graded structure showed a brittle fracture at 0.08 strain. A layer by layer deformation mechanism for stretching dominated structure was observed. For bending dominated scaffolds, deformation was accompanied by development of 45° shearing bands. Finite element simulations were also performed and the results showed a good agreement with the experimental observations. PMID:27281165

  2. The effect of boron addition on microstructure and mechanical properties of biomedical Ti35Nb6Ta alloy

    SciTech Connect

    Málek, Jaroslav; Hnilica, František; Veselý, Jaroslav; Smola, Bohumil; Březina, Vítězslav

    2014-10-15

    The beta-titanium alloys are promising materials for bioapplications but their processing via melting is difficult. Coarse grains have been observed in as-cast specimens. Subsequent thermo-mechanical processing seems to be necessary in order to obtain fine-grained microstructure with better mechanical properties. The grain size can be decreased significantly by addition of small boron amount. In this work Ti–35Nb–6Ta alloy with various B additions (0, 0.05, 0.1, 0.3 and 0.5 wt.%) has been studied. Even the smallest amount of B leads to significant grain refinement in Ti–35Nb–6Ta alloy (from 1300 to about 350 μm). Slight grain refinement has been observed also after hot forging and solution treatment. TiB particles emerged in specimens due to B addition. These particles contribute to changes in mechanical properties not only in hot forged and solution treated specimens (hardness increase from 140 to 180 HV10), but also in cold swaged specimens (hardness from 230 to 250 HV10, tensile strength from 800 to 920 MPa). The hardness values can be increased up to 370 HV10 during aging at 400 °C (specimen with 0.5 wt.% B). It has been observed that specimens with low boron addition 0.05 wt.% possess no cytotoxicity. On the other hand in specimens with 0.1 wt.% B or more slight adverse effect on cytotoxicity has been observed. - Highlights: • The influence of boron on microstructure and mechanical properties has been studied. • Beta-transus temperature has been determined. • Cytotoxicity depending on boron content has been evaluated. • Possibility of final heat treatment has been determined.

  3. Bifurcational Mechanism of Multistability Formation and Frequency Entrainment in a van der Pol Oscillator with an Additional Oscillatory Circuit

    NASA Astrophysics Data System (ADS)

    Astakhov, Sergey; Astakhov, Oleg; Astakhov, Vladimir; Kurths, Jürgen

    2016-06-01

    In this paper, the bifurcational mechanism of frequency entrainment in a van der Pol oscillator coupled with an additional oscillatory circuit is studied. It is shown that bistability observed in the system is based on two bifurcations: a supercritical Andronov-Hopf bifurcation and a sub-critical Neimark-Sacker bifurcation. The attracting basin boundaries are determined by stable and unstable invariant manifolds of a saddle two-dimensional torus.

  4. Effect of additives on mechanical and electrical properties of semi organic non linear material-γ-glycine

    NASA Astrophysics Data System (ADS)

    Ravishankar, M. N.; Chandramani, R.; Prakash, A. P. Gnana

    2012-06-01

    The semi-organic non-linear optical (NLO) crystals of γ-Glycine (G), with additives like Ammonium Oxalate (AO), Barium Nitrate (BN) and Potassium Nitrate (PN) were grown by aqueous solution method. The mechanical properties, dielectric constant, dielectric loss, AC conductivity of the grown crystals were studied. Studies confirm that the grown NLO crystals retain the merits of organic (SHG response and flexibility) and inorganic (good hardness) properties.

  5. Effect of ZrO2 addition on the mechanical properties of porous TiO2 bone scaffolds.

    PubMed

    Tiainen, Hanna; Eder, Georg; Nilsen, Ola; Haugen, Håvard J

    2012-08-01

    This study aimed at the investigation of the effect of zirconium dioxide (ZrO2) addition on the mechanical properties of titanium dioxide (TiO2) bone scaffolds. The highly biocompatible TiO2 has been identified as a promising material for bone scaffolds, whereas the more bioinert ZrO2 is known for its excellent mechanical properties. Ultra-porous TiO2 scaffolds (>89% porosity) were produced using polymer sponge replication with 0-40 wt.% of the TiO2 raw material substituted with ZrO2. Microstructure, chemical composition, and pore architectural features of the prepared ceramic foams were characterised and related to their mechanical strength. Addition of 1 wt.% of ZrO2 led to 16% increase in the mean compressive strength without significant changes in the pore architectural parameters of TiO2 scaffolds. Further ZrO2 additions resulted in reduction of compressive strength in comparison to containing no ZrO2. The appearance of zirconium titanate (ZrTiO4) phase was found to hinder the densification of the ceramic material during sintering resulting in poor intergranular connections and thus significantly reducing the compressive strength of the highly porous ceramic foam scaffolds. PMID:24364936

  6. Iron acquisition from Pseudomonas aeruginosa siderophores by human phagocytes: an additional mechanism of host defense through iron sequestration?

    PubMed

    Britigan, B E; Rasmussen, G T; Olakanmi, O; Cox, C D

    2000-03-01

    Chelation of iron to iron-binding proteins is a strategy of host defense. Some pathogens counter this via the secretion of low-molecular-weight iron-chelating agents (siderophores). Human phagocytes possess a high-capacity mechanism for iron acquisition from low-molecular-weight iron chelates. Efficient acquisition and sequestration of iron bound to bacterial siderophores by host phagocytes could provide a secondary mechanism to limit microbial access to iron. In the present work we report that human neutrophils, macrophages, and myeloid cell lines can acquire iron from the two Pseudomonas aeruginosa siderophores. Analogous to iron acquisition from other low-molecular-weight chelates, iron acquisition from the siderophores is ATP independent, induced by multivalent cationic metals, and unaffected by inhibitors of endocytosis and pinocytosis. In vivo, this process could serve as an additional mechanism of host defense to limit iron availability to invading siderophore-producing microbes. PMID:10678937

  7. Iron Acquisition from Pseudomonas aeruginosa Siderophores by Human Phagocytes: an Additional Mechanism of Host Defense through Iron Sequestration?

    PubMed Central

    Britigan, Bradley E.; Rasmussen, George T.; Olakanmi, Oyebode; Cox, Charles D.

    2000-01-01

    Chelation of iron to iron-binding proteins is a strategy of host defense. Some pathogens counter this via the secretion of low-molecular-weight iron-chelating agents (siderophores). Human phagocytes possess a high-capacity mechanism for iron acquisition from low-molecular-weight iron chelates. Efficient acquisition and sequestration of iron bound to bacterial siderophores by host phagocytes could provide a secondary mechanism to limit microbial access to iron. In the present work we report that human neutrophils, macrophages, and myeloid cell lines can acquire iron from the two Pseudomonas aeruginosa siderophores. Analogous to iron acquisition from other low-molecular-weight chelates, iron acquisition from the siderophores is ATP independent, induced by multivalent cationic metals, and unaffected by inhibitors of endocytosis and pinocytosis. In vivo, this process could serve as an additional mechanism of host defense to limit iron availability to invading siderophore-producing microbes. PMID:10678937

  8. Influence of additional coupling agent on the mechanical properties of polyester-agave cantala roxb based composites

    NASA Astrophysics Data System (ADS)

    Ubaidillah, Raharjo, Wijang W.; Wibowo, A.; Harjana, Mazlan, S. A.

    2016-03-01

    The mechanical and morphological properties of the unsaturated polyester resins (UPRs)-agave cantala roxb based composite are investigated in this paper. The cantala fiber woven in 3D angle interlock was utilized as the composite reinforcement. Surface grafting of the cantala fiber through chemical treatment was performed by introducing silane coupling agent to improving the compatibility with the polymer matrix. The fabrication of the composite specimens was conducted using vacuum bagging technique. The effect of additional coupling agent to the morphological appearance of surface fracture was observed using scanning electron microscopy. Meanwhile, the influence of additional silane to the mechanical properties was examined using tensile, bending and impact test. The photograph of surface fracture on the treated specimens showed the residual matrix left on the fibers in which the phenomenon was not found in the untreated specimens. Based on mechanical tests, the treated specimens were successfully increased their mechanical properties by 55%, 9.67%, and 92.4% for tensile strength, flexural strength, and impact strength, respectively, at 1.5% silane coupling agent.

  9. The effect of TiO2/aluminosilicate nanocomposite additives on the mechanical and thermal properties of polyacrylic coatings

    NASA Astrophysics Data System (ADS)

    Nosrati, Rahimeh; Olad, Ali

    2015-12-01

    The commercial grade polyacrylic latex was modified in order to prepare a mechanical and thermal improved coating. TiO2/Ag-exchanged-aluminosilicate nanocomposites with montmorillonite, zeolite-A and clinoptilolite aluminosilicates were prepared and used as additive in the matrix of polyacrylic latex to achieve a coating with proper mechanical and thermal properties. X-ray diffraction patterns and FESEM were used to characterize the composition, structure, and morphology of the nanocomposite additives. Polyacrylic coatings modified by TiO2/Ag-exchanged-aluminosilicate nanocomposite additives showed higher adhesion strength and hardness compared to unmodified commercial grade polyacrylic coatings. Differential Scanning Calorimetry (DSC) analysis showed lower glass transition temperature for modified polyacrylic coatings than that of unmodified polyacrylic coatings. The tensile tests were also carried out for unmodified and modified polyacrylic coatings. According to the results, the modified polyacrylic based coating with TiO2/Ag-exchanged-clinoptilolite nanocomposite additive was the best coating considering most of useful properties.

  10. Influence of strontium addition on the mechanical properties of gravity cast Mg-3Al-3Sn alloy

    SciTech Connect

    Germen, Gülşah Şevik, Hüseyin; Kurnaz, S. Can

    2013-12-16

    In this study, the effect of strontium (0.01, 0.1, 0.5, 1 wt%) addition on the microstructure and mechanical properties of the gravity cast Mg-3Al-3Sn alloy were investigated. X-ray diffractometry revealed that the main phases are α−Mg, β−Mg{sub 17}Al{sub 12} and Mg{sub 2}Sn in the Mg-3Al-3Sn alloy. With addition The tensile testing results showed that the yield and ultimate tensile strength and elongation of Mg-3Al-3Sn alloy increased by adding Sr up to 0.1 wt.% and then is gradually decreased with the addition of more alloying element.

  11. Myosin Light Chain Kinase (MLCK) Regulates Cell Migration in a Myosin Regulatory Light Chain Phosphorylation-independent Mechanism*

    PubMed Central

    Chen, Chen; Tao, Tao; Wen, Cheng; He, Wei-Qi; Qiao, Yan-Ning; Gao, Yun-Qian; Chen, Xin; Wang, Pei; Chen, Cai-Ping; Zhao, Wei; Chen, Hua-Qun; Ye, An-Pei; Peng, Ya-Jing; Zhu, Min-Sheng

    2014-01-01

    Myosin light chain kinase (MLCK) has long been implicated in the myosin phosphorylation and force generation required for cell migration. Here, we surprisingly found that the deletion of MLCK resulted in fast cell migration, enhanced protrusion formation, and no alteration of myosin light chain phosphorylation. The mutant cells showed reduced membrane tether force and fewer membrane F-actin filaments. This phenotype was rescued by either kinase-dead MLCK or five-DFRXXL motif, a MLCK fragment with potent F-actin-binding activity. Pull-down and co-immunoprecipitation assays showed that the absence of MLCK led to attenuated formation of transmembrane complexes, including myosin II, integrins and fibronectin. We suggest that MLCK is not required for myosin phosphorylation in a migrating cell. A critical role of MLCK in cell migration involves regulating the cell membrane tension and protrusion necessary for migration, thereby stabilizing the membrane skeleton through F-actin-binding activity. This finding sheds light on a novel regulatory mechanism of protrusion during cell migration. PMID:25122766

  12. Auxin Response Factor SlARF2 Is an Essential Component of the Regulatory Mechanism Controlling Fruit Ripening in Tomato.

    PubMed

    Hao, Yanwei; Hu, Guojian; Breitel, Dario; Liu, Mingchun; Mila, Isabelle; Frasse, Pierre; Fu, Yongyao; Aharoni, Asaph; Bouzayen, Mondher; Zouine, Mohamed

    2015-12-01

    Ethylene is the main regulator of climacteric fruit ripening, by contrast the putative role of other phytohormones in this process remains poorly understood. The present study brings auxin signaling components into the mechanism regulating tomato fruit ripening through the functional characterization of Auxin Response Factor2 (SlARF2) which encodes a downstream component of auxin signaling. Two paralogs, SlARF2A and SlARF2B, are found in the tomato genome, both displaying a marked ripening-associated expression but distinct responsiveness to ethylene and auxin. Down-regulation of either SlARF2A or SlARF2B resulted in ripening defects while simultaneous silencing of both genes led to severe ripening inhibition suggesting a functional redundancy among the two ARFs. Tomato fruits under-expressing SlARF2 produced less climacteric ethylene and exhibited a dramatic down-regulation of the key ripening regulators RIN, CNR, NOR and TAGL1. Ethylene treatment failed to reverse the non-ripening phenotype and the expression of ethylene signaling and biosynthesis genes was strongly altered in SlARF2 down-regulated fruits. Although both SlARF proteins are transcriptional repressors the data indicate they work as positive regulators of tomato fruit ripening. Altogether, the study defines SlARF2 as a new component of the regulatory network controlling the ripening process in tomato. PMID:26716451

  13. Auxin Response Factor SlARF2 Is an Essential Component of the Regulatory Mechanism Controlling Fruit Ripening in Tomato

    PubMed Central

    Hao, Yanwei; Hu, Guojian; Breitel, Dario; Liu, Mingchun; Mila, Isabelle; Frasse, Pierre; Fu, Yongyao; Aharoni, Asaph; Bouzayen, Mondher; Zouine, Mohamed

    2015-01-01

    Ethylene is the main regulator of climacteric fruit ripening, by contrast the putative role of other phytohormones in this process remains poorly understood. The present study brings auxin signaling components into the mechanism regulating tomato fruit ripening through the functional characterization of Auxin Response Factor2 (SlARF2) which encodes a downstream component of auxin signaling. Two paralogs, SlARF2A and SlARF2B, are found in the tomato genome, both displaying a marked ripening-associated expression but distinct responsiveness to ethylene and auxin. Down-regulation of either SlARF2A or SlARF2B resulted in ripening defects while simultaneous silencing of both genes led to severe ripening inhibition suggesting a functional redundancy among the two ARFs. Tomato fruits under-expressing SlARF2 produced less climacteric ethylene and exhibited a dramatic down-regulation of the key ripening regulators RIN, CNR, NOR and TAGL1. Ethylene treatment failed to reverse the non-ripening phenotype and the expression of ethylene signaling and biosynthesis genes was strongly altered in SlARF2 down-regulated fruits. Although both SlARF proteins are transcriptional repressors the data indicate they work as positive regulators of tomato fruit ripening. Altogether, the study defines SlARF2 as a new component of the regulatory network controlling the ripening process in tomato. PMID:26716451

  14. Comparative Study between Transcriptionally- and Translationally-Acting Adenine Riboswitches Reveals Key Differences in Riboswitch Regulatory Mechanisms

    PubMed Central

    Blouin, Simon; Heppell, Benoit; Bastet, Laurène; St-Pierre, Patrick; Massé, Eric; Lafontaine, Daniel A.

    2011-01-01

    Many bacterial mRNAs are regulated at the transcriptional or translational level by ligand-binding elements called riboswitches. Although they both bind adenine, the adenine riboswitches of Bacillus subtilis and Vibrio vulnificus differ by controlling transcription and translation, respectively. Here, we demonstrate that, beyond the obvious difference in transcriptional and translational modulation, both adenine riboswitches exhibit different ligand binding properties and appear to operate under different regulation regimes (kinetic versus thermodynamic). While the B. subtilis pbuE riboswitch fully depends on co-transcriptional binding of adenine to function, the V. vulnificus add riboswitch can bind to adenine after transcription is completed and still perform translation regulation. Further investigation demonstrates that the rate of transcription is critical for the B. subtilis pbuE riboswitch to perform efficiently, which is in agreement with a co-transcriptional regulation. Our results suggest that the nature of gene regulation control, that is transcription or translation, may have a high importance in riboswitch regulatory mechanisms. PMID:21283784

  15. Effects of Minute Addition of Ni on Microstructure and Mechanical Properties of Sn-Zn Eutectic Alloy

    NASA Astrophysics Data System (ADS)

    Pandey, P.; Tiwary, C. S.; Chattopadhyay, K.

    2016-06-01

    The current work explores the effects of a small addition of Ni on the microstructure and mechanical properties of Sn-Zn eutectic solder alloy (Sn-14.9 at.%Zn). In two sets of experiments, Ni is either added to the eutectic alloy or Zn in the eutectic alloy is replaced by an increasing amount of Ni. The study indicates that small additions of Ni in eutectic Sn-Zn solder (˜0.017 at.%) refines the eutectic microstructure together with the appearance of the small amount of primary Zn plates. Increasing the Ni content to 0.142 at.% and beyond, then an intermetallic phase ϒ-Ni5Zn21 with dendritic morphology appears in the microstructure along with dendrites of primary Sn. The scale of eutectic microstructure shows a decreasing trend till 0.902 at.%Ni with eutectic spacing of 1.98 ± 0.32 μm for this alloy. Further addition of Ni coarsens the microstructure. The replacement of Zn with Ni in the eutectic composition follows a similar trend with a lesser refinement of the microstructure. In both the scenarios, the addition of a small amount of Ni increases the eutectic temperatures till a critical concentration is reached beyond which one can observe a decrease in the eutectic point. The trend is similar for the solid solubility of Zn in Sn while the trend is opposite for the measured eutectic composition, which decreases at the initial stages of Ni addition. Through a detailed measurement of mechanical properties, the study establishes significant improvement of the strength of Sn-Zn solder with small additions of Ni in the alloy with a maximum hardness of 26 ± 1 HV and 0.2% proof stress of 72 ± 3 MPa at room temperature for the eutectic alloy with 0.902 at.%Ni.

  16. Apparent anti-Woodward-Hoffmann addition to a nickel bis(dithiolene) complex: the reaction mechanism involves reduced, dimetallic intermediates.

    PubMed

    Dang, Li; Shibl, Mohamed F; Yang, Xinzheng; Harrison, Daniel J; Alak, Aiman; Lough, Alan J; Fekl, Ulrich; Brothers, Edward N; Hall, Michael B

    2013-04-01

    Nickel dithiolene complexes have been proposed as electrocatalysts for alkene purification. Recent studies of the ligand-based reactions of Ni(tfd)2 (tfd = S2C2(CF3)2) and its anion [Ni(tfd)2](-) with alkenes (ethylene and 1-hexene) showed that in the absence of the anion, the reaction proceeds most rapidly to form the intraligand adduct, which decomposes by releasing a substituted dihydrodithiin. However, the presence of the anion increases the rate of formation of the stable cis-interligand adduct, and decreases the rate of dihydrodithiin formation and decomposition. In spite of both computational and experimental studies, the mechanism, especially the role of the anion, remained somewhat elusive. We are now providing a combined experimental and computational study that addresses the mechanism and explains the role of the anion. A kinetic study (global analysis) for the reaction of 1-hexene is reported, which supports the following mechanism: (1) reversible intraligand addition, (2) oxidation of the intraligand addition product prior to decomposition, and (3) interligand adduct formation catalyzed by Ni(tfd)2(-). Density functional theory (DFT) calculations were performed on the Ni(tfd)2/Ni(tfd)2(-)/ethylene system to shed light on the selectivity of adduct formation in the absence of anion and on the mechanism in which Ni(tfd)2(-) shifts the reaction from intraligand addition to interligand addition. Computational results show that in the neutral system the free energy of activation for intraligand addition is lower than that for interligand addition, in agreement with the experimental results. The computations predict that the anion enhances the rate of the cis-interligand adduct formation by forming a dimetallic complex with the neutral complex. The [(Ni(tfd)2)2](-) dimetallic complex then coordinates ethylene and isomerizes to form a Ni,S-bound ethylene complex, which then rapidly isomerizes to the stable interligand adduct but not to the intraligand adduct

  17. The function of the RNA-binding protein TEL1 in moss reveals ancient regulatory mechanisms of shoot development.

    PubMed

    Vivancos, Julien; Spinner, Lara; Mazubert, Christelle; Charlot, Florence; Paquet, Nicolas; Thareau, Vincent; Dron, Michel; Nogué, Fabien; Charon, Céline

    2012-03-01

    The shoot represents the basic body plan in land plants. It consists of a repeated structure composed of stems and leaves. Whereas vascular plants generate a shoot in their diploid phase, non-vascular plants such as mosses form a shoot (called the gametophore) in their haploid generation. The evolution of regulatory mechanisms or genetic networks used in the development of these two kinds of shoots is unclear. TERMINAL EAR1-like genes have been involved in diploid shoot development in vascular plants. Here, we show that disruption of PpTEL1 from the moss Physcomitrella patens, causes reduced protonema growth and gametophore initiation, as well as defects in gametophore development. Leafy shoots formed on ΔTEL1 mutants exhibit shorter stems with more leaves per shoot, suggesting an accelerated leaf initiation (shortened plastochron), a phenotype shared with the Poaceae vascular plants TE1 and PLA2/LHD2 mutants. Moreover, the positive correlation between plastochron length and leaf size observed in ΔTEL1 mutants suggests a conserved compensatory mechanism correlating leaf growth and leaf initiation rate that would minimize overall changes in plant biomass. The RNA-binding protein encoded by PpTEL1 contains two N-terminus RNA-recognition motifs, and a third C-terminus non-canonical RRM, specific to TEL proteins. Removal of the PpTEL1 C-terminus (including this third RRM) or only 16-18 amino acids within it seriously impairs PpTEL1 function, suggesting a critical role for this third RRM. These results show a conserved function of the RNA-binding PpTEL1 protein in the regulation of shoot development, from early ancestors to vascular plants, that depends on the third TEL-specific RRM. PMID:22170036

  18. Digestive cells from Mytilus galloprovincialis show a partial regulatory volume decrease following acute hypotonic stress through mechanisms involving inorganic ions.

    PubMed

    Torre, Agata; Trischitta, Francesca; Corsaro, Carmelo; Mallamace, Domenico; Faggio, Caterina

    2013-08-01

    The response of isolated digestive cells of the digestive gland of Mytilus galloprovincialis to hypotonic shock was studied using videometric methods. The isolated cells exposed to a rapid change (from 1100 to 800 mosmol kg(-1) ) of the bathing solution osmolality swelled but thereafter underwent a regulatory volume decrease (RVD), tending to recover the original size. When the hypotonic stress was applied in the presence of quinine and glibenclamide, known inhibitors of swelling activated ion channels, the cells did not exhibit an RVD response; in addition, they showed a larger increase in size in respect to control cells. These observations suggest that the digestive cells of the digestive gland have the machinery to cope with the hyposmotic shock allowing them to exhibit a small but significant RVD preventing an excessive increase in cell size. The pharmacological treatment of digestive cells during the RVD experiments suggests that cell volume is regulated by K(+) and Cl(-) efflux followed by an obliged water efflux from the cell. The involvement of organic osmolytes such as taurine and betaine seems to be excluded by NMR measurement on digestive cells. PMID:23112133

  19. Mechanisms of andrographolide-induced platelet apoptosis in human platelets: regulatory roles of the extrinsic apoptotic pathway.

    PubMed

    Lien, Li-Ming; Su, Cheng-Chen; Hsu, Wen-Hsien; Lu, Wan-Jung; Chung, Chi-Li; Yen, Ting-Lin; Chiu, Hou-Chang; Sheu, Joen-Rong; Lin, Kuan-Hung

    2013-11-01

    Andrographolide, a novel nuclear factor-κB (NF-κB) inhibitor, is isolated from the leaves of Andrographis paniculata. Platelet activation is relevant to a variety of coronary heart diseases. Our recent studies revealed that andrographolide possesses potent antiplatelet activity by inhibition of the p38 MAPK/(●) HO-NF-κB-ERK2 cascade. Although platelets are anucleated cells, apoptotic machinery apparatus recently has been found to regulate platelet activation and limit platelet lifespan. Therefore, we further investigated the regulatory effects of andrographolide on platelet apoptotic events. In this study, apoptotic signaling events for caspase-3, -8, and Bid were time (10-60 min)- and dose (25-100 μΜ)-dependently activated by andrographolide in human platelets. Andrographolide could also disrupt mitrochondrial membrane potential. In addition, caspase-8 inhibitor (z-IETD-fmk, 50 μΜ) was found to reverse andrographolide-induced caspase-8 activation, whereas the antagonistic anti-Fas receptor (ZB4, 500 ng/mL) and anti-tumor necrosis factor-R1 (H398, 10 µg/mL) monoclonal antibodies did not. In conclusion, this study for the first time demonstrated that andrographolide might limit platelet lifespan by initiating the caspase-8-dependent extrinsic apoptotic pathway, in spite of no direct evidence that death receptors are involved in this process proved. Overall, the various medicinal properties of andrographolide suggest its potential value in treating patients with thromboembolic disorders. PMID:23292890

  20. Effect of additive particles on mechanical, thermal, and cell functioning properties of poly(methyl methacrylate) cement

    PubMed Central

    Khandaker, Morshed; Vaughan, Melville B; Morris, Tracy L; White, Jeremiah J; Meng, Zhaotong

    2014-01-01

    The most common bone cement material used clinically today for orthopedic surgery is poly(methyl methacrylate) (PMMA). Conventional PMMA bone cement has several mechanical, thermal, and biological disadvantages. To overcome these problems, researchers have investigated combinations of PMMA bone cement and several bioactive particles (micrometers to nanometers in size), such as magnesium oxide, hydroxyapatite, chitosan, barium sulfate, and silica. A study comparing the effect of these individual additives on the mechanical, thermal, and cell functional properties of PMMA would be important to enable selection of suitable additives and design improved PMMA cement for orthopedic applications. Therefore, the goal of this study was to determine the effect of inclusion of magnesium oxide, hydroxyapatite, chitosan, barium sulfate, and silica additives in PMMA on the mechanical, thermal, and cell functional performance of PMMA. American Society for Testing and Materials standard three-point bend flexural and fracture tests were conducted to determine the flexural strength, flexural modulus, and fracture toughness of the different PMMA samples. A custom-made temperature measurement system was used to determine maximum curing temperature and the time needed for each PMMA sample to reach its maximum curing temperature. Osteoblast adhesion and proliferation experiments were performed to determine cell viability using the different PMMA cements. We found that flexural strength and fracture toughness were significantly greater for PMMA specimens that incorporated silica than for the other specimens. All additives prolonged the time taken to reach maximum curing temperature and significantly improved cell adhesion of the PMMA samples. The results of this study could be useful for improving the union of implant-PMMA or bone-PMMA interfaces by incorporating nanoparticles into PMMA cement for orthopedic and orthodontic applications. PMID:24920906

  1. Effect of additive particles on mechanical, thermal, and cell functioning properties of poly(methyl methacrylate) cement.

    PubMed

    Khandaker, Morshed; Vaughan, Melville B; Morris, Tracy L; White, Jeremiah J; Meng, Zhaotong

    2014-01-01

    The most common bone cement material used clinically today for orthopedic surgery is poly(methyl methacrylate) (PMMA). Conventional PMMA bone cement has several mechanical, thermal, and biological disadvantages. To overcome these problems, researchers have investigated combinations of PMMA bone cement and several bioactive particles (micrometers to nanometers in size), such as magnesium oxide, hydroxyapatite, chitosan, barium sulfate, and silica. A study comparing the effect of these individual additives on the mechanical, thermal, and cell functional properties of PMMA would be important to enable selection of suitable additives and design improved PMMA cement for orthopedic applications. Therefore, the goal of this study was to determine the effect of inclusion of magnesium oxide, hydroxyapatite, chitosan, barium sulfate, and silica additives in PMMA on the mechanical, thermal, and cell functional performance of PMMA. American Society for Testing and Materials standard three-point bend flexural and fracture tests were conducted to determine the flexural strength, flexural modulus, and fracture toughness of the different PMMA samples. A custom-made temperature measurement system was used to determine maximum curing temperature and the time needed for each PMMA sample to reach its maximum curing temperature. Osteoblast adhesion and proliferation experiments were performed to determine cell viability using the different PMMA cements. We found that flexural strength and fracture toughness were significantly greater for PMMA specimens that incorporated silica than for the other specimens. All additives prolonged the time taken to reach maximum curing temperature and significantly improved cell adhesion of the PMMA samples. The results of this study could be useful for improving the union of implant-PMMA or bone-PMMA interfaces by incorporating nanoparticles into PMMA cement for orthopedic and orthodontic applications. PMID:24920906

  2. A multilayered regulatory mechanism for the autoinhibition and activation of a plant CC-NB-LRR resistance protein with an extra N-terminal domain.

    PubMed

    Chen, Xiaojiao; Zhu, Min; Jiang, Lei; Zhao, Wenyang; Li, Jia; Wu, Jianyan; Li, Chun; Bai, Baohui; Lu, Gang; Chen, Hongyu; Moffett, Peter; Tao, Xiaorong

    2016-10-01

    The tomato resistance protein Sw-5b differs from the classical coiled-coil nucleotide-binding leucine-rich repeat (CC-NB-LRR) resistance proteins by having an extra N-terminal domain (NTD). To understand how NTD, CC and NB-LRR regulate autoinhibition and activation of Sw-5b, we dissected the function(s) of each domain. When viral elicitor was absent, Sw-5b LRR suppressed the central NB-ARC to maintain autoinhibition of the NB-LRR segment. The CC and NTD domains independently and additively enhanced the autoinhibition of NB-LRR. When viral elicitor was present, the NB-LRR segment of Sw-5b was specifically activated to trigger a hypersensitive response. Surprisingly, Sw-5b CC suppressed the activation of NB-LRR, whereas the extra NTD of Sw-5b became a positive regulator and fully activated the resistance protein, probably by relieving the inhibitory effects of the CC. In infection assays of transgenic plants, the NB-LRR segment alone was insufficient to confer resistance against Tomato spotted wilt tospovirus; the layers of NTD and CC regulation on NB-LRR were required for Sw-5b to confer resistance. Based on these findings, we propose that, to counter the negative regulation of the CC on NB-LRR, Sw-5b evolved an extra NTD to coordinate with the CC, thus developing a multilayered regulatory mechanism to control autoinhibition and activation. PMID:27558751

  3. Autophagy Regulatory Network — A systems-level bioinformatics resource for studying the mechanism and regulation of autophagy

    PubMed Central

    Türei, Dénes; Földvári-Nagy, László; Fazekas, Dávid; Módos, Dezső; Kubisch, János; Kadlecsik, Tamás; Demeter, Amanda; Lenti, Katalin; Csermely, Péter; Vellai, Tibor; Korcsmáros, Tamás

    2015-01-01

    Autophagy is a complex cellular process having multiple roles, depending on tissue, physiological, or pathological conditions. Major post-translational regulators of autophagy are well known, however, they have not yet been collected comprehensively. The precise and context-dependent regulation of autophagy necessitates additional regulators, including transcriptional and post-transcriptional components that are listed in various datasets. Prompted by the lack of systems-level autophagy-related information, we manually collected the literature and integrated external resources to gain a high coverage autophagy database. We developed an online resource, Autophagy Regulatory Network (ARN; http://autophagy-regulation.org), to provide an integrated and systems-level database for autophagy research. ARN contains manually curated, imported, and predicted interactions of autophagy components (1,485 proteins with 4,013 interactions) in humans. We listed 413 transcription factors and 386 miRNAs that could regulate autophagy components or their protein regulators. We also connected the above-mentioned autophagy components and regulators with signaling pathways from the SignaLink 2 resource. The user-friendly website of ARN allows researchers without computational background to search, browse, and download the database. The database can be downloaded in SQL, CSV, BioPAX, SBML, PSI-MI, and in a Cytoscape CYS file formats. ARN has the potential to facilitate the experimental validation of novel autophagy components and regulators. In addition, ARN helps the investigation of transcription factors, miRNAs and signaling pathways implicated in the control of the autophagic pathway. The list of such known and predicted regulators could be important in pharmacological attempts against cancer and neurodegenerative diseases. PMID:25635527

  4. Design rules for rational control of polymer glass formation behavior and mechanical properties with small molecular additives

    NASA Astrophysics Data System (ADS)

    Mangalara, Jayachandra Hari; Simmons, David

    Small molecule additives have long been employed to tune polymers' glass formation, mechanical and transport properties. For example, plasticizers are commonly employed to suppress polymer Tg and soften the glassy state, while antiplasticizers, which stiffen the glassy state of a polymer while suppressing its Tg, are employed to enhance protein and tissue preservation in sugar glasses. Recent literature indicates that additives can have a wide range of possible effects, but all of these have not been clearly understood and well appreciated. Here we employ molecular dynamics simulations to establish design rules for the selection of small molecule additives with size, molecular stiffness, and interaction energy chosen to achieve targeted effects on polymer properties. We furthermore find that a given additive's effect on a polymer's Tg can be predicted from its Debye-Waller factor via a function previously found to describe nanoconfinement effects on the glass transition. These results emphasize the potential for a new generation of targeted molecular additives to contribute to more targeted rational design of polymers. We acknowledge the Keck Foundation and the Ohio Supercomputing Center for financial and computational support of this effort, respectively.

  5. Effect of Ti additive on (Cr, Fe)7C3 carbide in arc surfacing layer and its refined mechanism

    NASA Astrophysics Data System (ADS)

    Zhou, Yefei; Yang, Yulin; Yang, Jian; Hao, Feifei; Li, Da; Ren, Xuejun; Yang, Qingxiang

    2012-06-01

    Arc surfacing layer of hypoeutectic high chromium cast iron (HCCI) expects refiner carbides in the microstructure to improve its mechanical properties. In this paper, Ti additive as a strong carbide forming element was added in the hypoeutectic HCCI arc surfacing layer. Microstructure of titaniferous hypoeutectic HCCI was studied by optical microscopy, X-ray diffraction and field emission scanning electronic microscopy with energy dispersive spectrometer. Furthermore, the M(M = Cr, Fe)7C3 carbide refinement mechanism was explained by the phase diagram calculation and lattice misfit theory. The results show that, the M7C3 carbide in arc surfacing microstructure of hypoeutectic HCCI has been refined with 2 wt.% Ti additive, and TiC carbide can be observed in/around the M7C3 carbide. With Ti addictive increasing, the micro-hardness along the depth in profile section of layer becomes more uniform, and the wear resistance has been improved. According to the phase diagram calculation, MC carbide precipitates prior to M7C3 carbide in Fe-Cr-C-Ti alloy. In addition, the lattice misfit between (1 1 0)TiC and (0C is 9.257%, which indicates that the TiC as heterogeneous nuclei of the M7C3 is medium effective. Therefore, the M7C3 carbide can be refined.

  6. Insight into the reaction mechanisms for oxidative addition of strong σ bonds to an Al(i) center.

    PubMed

    Zhang, Xiangfei; Cao, Zexing

    2016-06-21

    The oxidation addition of a series of σ H-X bonds (X = H, B, C, Si, N, P, and O) to a single Al(i) supported by a (NacNac)(-) bidentate ligand ((NacNac)(-) = [ArNC(Me)CHC(Me)NAr](-) and Ar = 2,6-(i)Pr2C6H3) has been explored through extensive DFT calculations. The presented results show that activation and addition of these σ bonds follow various reaction mechanisms, in which hydride transfer, proton transfer, and Al-X bond coupling steps are involved. The predicted free energy barriers for these oxidative additions range from 8 to 32 kcal mol(-1), and all the reactions are remarkably favorable thermodynamically. However, sterically hindered ligands, for most reactants, make the formation of the initial reactant complex difficult and may reduce the efficiency of the reaction. Calculations reveal a strong dependence of the reaction mechanism and low-energy channel on the bonding features of X-H and the local structural environments. PMID:27249667

  7. Immune-Regulatory Mechanisms of Classical and Experimental Multiple Sclerosis Drugs: A Special Focus on Helminth-Derived Treatments.

    PubMed

    Peón, Alberto N; Terrazas, Luis I

    2016-01-01

    Multiple sclerosis (MS) is the most prevalent autoimmune disease affecting the central nervous system (CNS). Its pathophysiology is centered on neuron myelin sheath destruction in a manner largely dependent upon CD4+/CD8+ T-cell autoreactivity against myelin antigens, inducing Th1/Th17 pathogenic responses with the resulting production of free radicals and soluble mediators that exhibit the effector mechanisms of neurodegeneration. The immune response responsible for this disease is complex and challenges modern medicine. Consequently, many experimental therapies have been proposed in addition to the classical array of immunoregulatory/ immunosuppressive drugs that are normally used to treat MS. In this review, we will describe the effects and mechanisms of action of widely used disease-modifying MS drugs as well as those of select treatments that are currently in the experimental phase. Special emphasis is placed on helminth-derived immunoregulators, as some of them have shown promising results. Additionally, we will compare the mechanisms of action of both the MS drugs and the helminth-derived treatments to discuss the potential importance of some signaling pathways in the control of MS. PMID:26947777

  8. Microhomology-mediated mechanisms underlie non-recurrent disease-causing microdeletions of the FOXL2 gene or its regulatory domain.

    PubMed

    Verdin, Hannah; D'haene, Barbara; Beysen, Diane; Novikova, Yana; Menten, Björn; Sante, Tom; Lapunzina, Pablo; Nevado, Julian; Carvalho, Claudia M B; Lupski, James R; De Baere, Elfride

    2013-01-01

    Genomic disorders are often caused by recurrent copy number variations (CNVs), with nonallelic homologous recombination (NAHR) as the underlying mechanism. Recently, several microhomology-mediated repair mechanisms--such as microhomology-mediated end-joining (MMEJ), fork stalling and template switching (FoSTeS), microhomology-mediated break-induced replication (MMBIR), serial replication slippage (SRS), and break-induced SRS (BISRS)--were described in the etiology of non-recurrent CNVs in human disease. In addition, their formation may be stimulated by genomic architectural features. It is, however, largely unexplored to what extent these mechanisms contribute to rare, locus-specific pathogenic CNVs. Here, fine-mapping of 42 microdeletions of the FOXL2 locus, encompassing FOXL2 (32) or its regulatory domain (10), serves as a model for rare, locus-specific CNVs implicated in genetic disease. These deletions lead to blepharophimosis syndrome (BPES), a developmental condition affecting the eyelids and the ovary. For breakpoint mapping we used targeted array-based comparative genomic hybridization (aCGH), quantitative PCR (qPCR), long-range PCR, and Sanger sequencing of the junction products. Microhomology, ranging from 1 bp to 66 bp, was found in 91.7% of 24 characterized breakpoint junctions, being significantly enriched in comparison with a random control sample. Our results show that microhomology-mediated repair mechanisms underlie at least 50% of these microdeletions. Moreover, genomic architectural features, like sequence motifs, non-B DNA conformations, and repetitive elements, were found in all breakpoint regions. In conclusion, the majority of these microdeletions result from microhomology-mediated mechanisms like MMEJ, FoSTeS, MMBIR, SRS, or BISRS. Moreover, we hypothesize that the genomic architecture might drive their formation by increasing the susceptibility for DNA breakage or promote replication fork stalling. Finally, our locus-centered study

  9. Mechanical degradation under hydrogen of yttrium doped barium zirconate electrolyte material prepared with NiO additive

    NASA Astrophysics Data System (ADS)

    Ciria, D.; Ben Hassine, M.; Jiménez-Melendo, M.; Iakovleva, A.; Haghi-Ashtiani, P.; Aubin, V.; Dezanneau, G.

    2016-07-01

    Recently, a novel process was presented to fabricate dense yttrium-doped barium zirconate electrolytes with high proton conductivity. This process was based on the use of a NiO additive during reactive sintering. We show here that materials made from this process present a fast degradation of mechanical properties when put in hydrogen-rich conditions, while material made from conventional sintering without NiO aid remains intact in the same conditions. The fast degradation of samples made from reactive sintering, leading to sample failure under highly compressive conditions, is due to the reduction of NiO nanoparticles at grain boundaries as shown from structural and chemical analyses using Transmission Electron Microscopy. By the present study, we alert about the potential risk of cell failure due to this mechanical degradation.

  10. Mechanical Deformation Behavior of Sn-Ag-Cu Solders with Minor Addition of 0.05 wt.% Ni

    NASA Astrophysics Data System (ADS)

    Hammad, A. E.; El-Taher, A. M.

    2014-11-01

    The aim of the present work is to develop a comparative evaluation of the microstructural and mechanical deformation behavior of Sn-Ag-Cu (SAC) solders with the minor addition of 0.05 wt.% Ni. Test results showed that, by adding 0.05Ni element into SAC solders, generated mainly small rod-shaped (Cu,Ni)6Sn5 intermetallic compounds (IMCs) inside the β-Sn phase. Moreover, increasing the Ag content and adding Ni could result in the change of the shape and size of the IMC precipitate. Hence, a significant improvement is observed in the mechanical properties of SAC solders with increasing Ag content and Ni addition. On the other hand, the tensile results of Ni-doped SAC solders showed that both the yield stress and ultimate tensile strengths decrease with increasing temperature and with decreasing strain rate. This behavior was attributed to the competing effects of work hardening and dynamic recovery processes. The Sn-2.0Ag-0.5Cu-0.05Ni solder displayed the highest mechanical properties due to the formation of hard (Cu,Ni)6Sn5 IMCs. Based on the obtained stress exponents and activation energies, it is suggested that the dominant deformation mechanism in SAC (205)-, SAC (0505)- and SAC (0505)-0.05Ni solders is pipe diffusion, and lattice self-diffusion in SAC (205)-0.05Ni solder. In view of these results, the Sn-2.0Ag-0.5Cu-0.05Ni alloy is a more reliable solder alloy with improved properties compared with other solder alloys tested in the present work.

  11. Enhancement of the Thermal Stability and Mechanical Hardness of Zr-Al-Co Amorphous Alloys by Ag Addition

    NASA Astrophysics Data System (ADS)

    Wang, Yongyong; Dong, Xiao; Song, Xiaohui; Wang, Jinfeng; Li, Gong; Liu, Riping

    2016-05-01

    The thermal and mechanical properties of Zr57Al15Co28- X Ag X ( X = 0 and 8) amorphous alloys were investigated using differential scanning calorimetry, in situ high-pressure angle dispersive X-ray diffraction measurements with synchrotron radiation, and nanoindentation. Results show that Ag doping improves effective activation energy, nanohardness, elastic modulus, and bulk modulus. Ag addition enhances topological and chemical short-range orderings, which can improve local packing efficiency and restrain long-range atom diffusion. This approach has implications for the design of the microstructure- and property-controllable functional materials for various applications.

  12. Effect of silver addition on mechanical properties of melt-processed Sm-Ba-Cu-O bulk superconductor

    SciTech Connect

    Sakai, Naomichi; Miyamoto, Takeshi; Seo, Seokjong; Nariki, Shinya; Murakami, Masato

    1999-11-01

    The authors have studied mechanical properties of melt-processed single-grain Sm-Ba-Cu-O (Sm123+Sm211) bulks with and without silver doping. Tensile stress is induced by thermal stress during heat treatment, and also induced by applying magnetic fields. It is found that the silver addition was effective in decreasing the thermal stress and increasing the tensile strength of the Sm-Ba-Cu-O bulk. The tensile strength of the silver doped sample was 37.4MPa, which is about one and half times larger than that of the undoped sample.

  13. Effect of Ca addition on the microstructure and mechanical properties of as-cast Mg-Sm alloys.

    PubMed

    Luo, Xiaoping; Fang, Daqing; Chai, Yuesheng; Yang, Bin

    2016-08-01

    This study investigated the effect of Ca addition on the microstructure and mechanical properties of as-cast Mg-4Sm alloys. The addition of 1.0 wt% Ca led to a significant grain refinement of Mg-4.0Sm alloys owing to the formation of rod-like Mg2Ca phases that acted as active nucleates for the Mg matrix. The as-cast Mg-4.0Sm-1.0Ca alloy showed the smallest grain size at 45 μm. Furthermore, the Mg-4.0Sm-1.0Ca alloy exhibited greater hardness, higher tensile strength, and higher yield tensile strength and elongation than the other two alloys with different Ca contents. These results were attributed to the grain refinement and precipitation strengthening of the Mg2Ca and Mg41Sm5 phases. Microsc. Res. Tech. 79:707-711, 2016. © 2016 Wiley Periodicals, Inc. PMID:27311709

  14. Probing the chemical mechanism and critical regulatory amino acid residues of Drosophila melanogaster arylalkylamine N-acyltransferase like 2.

    PubMed

    Dempsey, Daniel R; Carpenter, Anne-Marie; Ospina, Santiago Rodriguez; Merkler, David J

    2015-11-01

    Arylalkylamine N-acyltransferase like 2 (AANATL2) catalyzes the formation of N-acylarylalkylamides from the corresponding acyl-CoA and arylalkylamine. The N-acylation of biogenic amines in Drosophila melanogaster is a critical step for the inactivation of neurotransmitters, cuticle sclerotization, and melatonin biosynthesis. In addition, D. melanogaster has been used as a model system to evaluate the biosynthesis of fatty acid amides: a family of potent cell signaling lipids. We have previously showed that AANATL2 catalyzes the formation of N-acylarylakylamides, including long-chain N-acylserotonins and N-acyldopamines. Herein, we define the kinetic mechanism for AANATL2 as an ordered sequential mechanism with acetyl-CoA binding first followed by tyramine to generate the ternary complex prior to catalysis. Bell shaped kcat,app - acetyl-CoA and (kcat/Km)app - acetyl-CoA pH-rate profiles identified two apparent pKa,app values of ∼7.4 and ∼8.9 that are critical to catalysis, suggesting the AANATL2-catalyzed formation of N-acetyltyramine occurs through an acid/base chemical mechanism. Site-directed mutagenesis of a conserved glutamate that corresponds to the catalytic base for other D. melanogaster AANATL enzymes did not produce a substantial depression in the kcat,app value nor did it abolish the pKa,app value attributed to the general base in catalysis (pKa ∼7.4). These data suggest that AANATL2 catalyzes the formation of N-acylarylalkylamides using either different catalytic residues or a different chemical mechanism relative to other D. melanogaster AANATL enzymes. In addition, we constructed other site-directed mutants of AANATL2 to help define the role of targeted amino acids in substrate binding and/or enzyme catalysis. PMID:26476413

  15. The effect of unsaturated fatty acid and triglyceride oil addition on the mechanical and antibacterial properties of acrylic bone cements.

    PubMed

    Persson, Cecilia; Robert, Elise; Carlsson, Elin; Robo, Céline; López, Alejandro; Godoy-Gallardo, Maria; Ginebra, Maria-Pau; Engqvist, Håkan

    2015-09-01

    Acrylic bone cements have an elastic modulus several times higher than the surrounding trabecular bone. This has been hypothesized to contribute to certain clinical complications. There are indications that the addition of specific fatty acids and triglyceride oils may reduce the elastic modulus of these types of cements. Some of these additives also appear to have inherent antibiotic properties, although this has never been evaluated in bone cements. In this study, several types of fatty acids and triglyceride oils were evaluated for use in acrylic bone cements. Their mechanical properties were evaluated under uniaxial compression testing and selected cements were then further characterized in terms of microstructure, handling and antibacterial properties using scanning electron microscopy, polymerization temperature measurements, agar diffusion tests and bactericidal activity assays of cement extracts. It was found that any of the evaluated fatty acids or triglyceride oils could be used to tailor the stiffness of acrylic bone cements, although at varying concentrations, which also depended on the type of commercial base cement used. In particular, the addition of very small amounts of linoleic acid (<2.0 wt%) resulted in Young's moduli and compressive strengths in the range of human trabecular bone, while maintaining a similar setting time. Further, the addition of 12.6 wt% ricinoleic acid to Osteopal V cement was found to have a significant antibacterial effect, inhibiting growth of Staphylococcus aureus in an agar diffusion test as well as demonstrating 100% bactericidal activity against the same strain. PMID:25876889

  16. Microstructure and Room Temperature Mechanical Properties of the Ni3Si-BASED Alloy with Titanium Addition

    NASA Astrophysics Data System (ADS)

    Wang, S. K.; Fu, C. C.; Cai, Z. W.; Jian, S. R.; Jang, J. S. C.; Zhang, H. Z.; Hsu, H. C.

    2011-06-01

    The microstructure and room temperature (RT) mechanical properties of the Ni-15Si-2Nb-1Cr-3Ti-0.2B alloy were investigated by means of X-ray diffraction, scanning electron microscopy (SEM), electron probe microanalysis (EPMA), transmission electron microscopy (TEM), and tensile test in air and vacuum. The results of tensile test revealed that the effect of Ti addition can significantly improve the elongation as well as ultimate tensile strength (UTS) (18.3% and 1320 MPa in air, 21% and 1600 MPa in vacuum) in comparison with the Ni-18Si-3Nb-1Cr-0.2B base alloy (10% and 1130 MPa in air, 14% and 1240 MPa in vacuum) at room temperature. In addition, the fracture surface of specimen after tensile test presents a typical transgranular ductile mode, with a fully dimpled fracture pattern. This indicates that the addition of Ti in the Ni-15Si-2Nb-1Cr-3Ti-0.2B alloy can effectively suppress the environmental embrittlement at room temperature. In addition, the Ni-15Si-2Nb-1Cr-3Ti-0.2B alloy exhibits insensitively to the strain rate both in air or vacuum at room temperature.

  17. Regulatory mechanisms and the role of calcium and potassium channels controlling supercontractile crop muscles in adult Phormia regina.

    PubMed

    Solari, Paolo; Stoffolano, John G; Fitzpatrick, Joanna; Gelperin, Alan; Thomson, Alan; Talani, Giuseppe; Sanna, Enrico; Liscia, Anna

    2013-09-01

    Bioassays and electrophysiological recordings were conducted in the adult blowfly Phormia regina to provide new insights into the regulatory mechanisms governing the crop filling and emptying processes of the supercontractile crop muscles. The cibarial pump drives ingestion. Simultaneous multisite extracellular recordings show that crop lobe (P5) distension during ingestion of a 4.7 μl sugar meal does not require muscle activity by any of the other pumps of the system. Conversely, pumping of fluids toward the anterior of the crop system during crop emptying is brought about by active muscle contraction, in the form of a highly coordinated peristaltic wave starting from P5 and progressively propagating to P6, P4 and P3 pumps, with P5 contracting with a frequency about 3.4 times higher than the other pumps. The crop contraction rate is also modulated by hemolymph-borne factors such as sugars, through ligand recognition at a presumptive receptor site rather than by an osmotic effect, as assessed by both behavioural and electrophysiological experiments. In this respect, sugars of equal osmolarity produce different effects, glucose being inhibitory and mannose ineffective for crop muscles, while trehalose enhances crop activity. Finally, voltage and current clamp experiments show that the muscle action potentials (mAPs) at the P4 pump are sustained by a serotonin-sensitive calcium conductance. Serotonin enhances calcium entry into the muscle cells and this could lead, as an indirect modulatory effect, to activation of a Ca(2+)-activated K(+) conductance (IK(Ca)), which sustains the following mAP repolarization phase in such a way that further mAPs can be generated early and the frequency consequently increased. PMID:23834826

  18. The Inhibition Mechanism of Non-phosphorylated Ser768 in the Regulatory Domain of Cystic Fibrosis Transmembrane Conductance Regulator*

    PubMed Central

    Wang, Guangyu

    2011-01-01

    The cystic fibrosis transmembrane conductance regulator (CFTR) is a member of the ATP-binding cassette transporters but serves as a chloride channel dysfunctional in cystic fibrosis. The activity of CFTR is tightly controlled not only by ATP-driven dimerization of its nucleotide-binding domains but also by phosphorylation of a unique regulatory (R) domain by protein kinase A (PKA). The R domain has multiple excitatory phosphorylation sites, but Ser737 and Ser768 are inhibitory. The underlying mechanism is unclear. Here, sulfhydryl-specific cross-linking strategy was employed to demonstrate that Ser768 or Ser737 could interact with outwardly facing hydrophilic residues of cytoplasmic loop 3 regulating channel gating. Furthermore, mutation of these residues to alanines promoted channel opening by curcumin in an ATP-dependent manner even in the absence of PKA. However, mutation of Ser768 and His950 with different hydrogen bond donors or acceptors clearly changed ATP- and PKA-dependent channel activity no matter whether curcumin was present or not. More importantly, significant activation of a double mutant H950R/S768R needed only ATP. Finally, in vitro and in vivo single channel recordings suggest that Ser768 may form a putative hydrogen bond with His950 of cytoplasmic loop 3 to prevent channel opening by ATP in the non-phosphorylated state and by subsequent cAMP-dependent phosphorylation. These observations support an electron cryomicroscopy-based structural model on which the R domain is closed to cytoplasmic loops regulating channel gating. PMID:21059651

  19. Effect of Ti addition on the microstructure and mechanical properties of a cast Fe-Ni-Mo-Mn maraging steel

    NASA Astrophysics Data System (ADS)

    Nejad, S. Hossein; Nili Ahmadabadi, M.

    2003-10-01

    To study the effect of Ti on the age hardening behavior of Fe-Ni-Mn maraging steels, a Fe-Ni-Mo-Mn steel was alloyed with Ti then mechanical properties and aging behavior of two cast steels were investigated. In this regard, two heats of nominal compositions of Fe-10Ni-6Mo-3Mn and Fe-lONi-6Mo-3Mn-0. 7Ti were induction melted in air and vacuum respectively and cast in iron mold. After homogenizing at 1473K for 21.6ks and water quenching, solution annealing was performed at 1223K for 3.6ks followed by air cooling. Age hardening behavior at 773Kin the range of 0.36-172. 8 ks was determined. Tensile properties and Charpy impact toughness were measured in the solution annealed and peak-aged conditions. Fractographic features were studied by scanning electron microscope equipped with EDX microanalyses. Tensile properties of the alloys in the peakaged condition were in the range of grade 200 standard maraging steel. It has been found that Ti addition resulted in increasing of hardness and strength in aged condition and decreasing of Charpy impact toughness in both solution annealed and aged conditions. Ti addition also changes type and morphology of inclusions and fracture mechanism from semi-ductile intergranular mode to semi-ductile transgranular one.

  20. Hydro-gel environment and solution additives modify calcite growth mechanism to an accretion process of amorphous nanospheres

    NASA Astrophysics Data System (ADS)

    Gal, A.; Kahil, K.; Habraken, W.; Gur, D.; Fratzl, P.; Addadi, L.; Weiner, S.

    2013-12-01

    Various biominerals form via the transformation of a transient amorphous precursor phase into a mature crystalline phase. The mature biominerals usually exhibit morphology reminiscent of aggregated nanoparticles. Although these observations suggest an accretion-based growth process consisting on nanoparticles, the key factors that control the accretion process are unknown. We investigated the transformation of solid amorphous calcium carbonate (ACC) into calcite. When plant cystoliths, a biogenic stable ACC phase, are transformed into calcite in vitro by immersion in water, calcite crystals grow in two distinct steps (Gal et al., Angewandte Chemie, 2013). First, rhombohedral crystals grow that show flat facets as expected from ion-by-ion growth. These crystals then grow by the aggregation and crystallization of the original ACC nanospheres leading to a surface morphology dominated by aggregated spheres. The transformation process occurs within an organic hydro-gel that originates from inside the cystoliths. We tested the importance of the gel phase to the transformation process by transforming synthetic ACC into calcite inside various gels. In all the investigated systems: in gelatin, agarose, and pectin gels, calcite crystals grew that showed the nanosphere aggregation morphology. In additional experiments we demonstrated that also other additives, such as phosphate ions and biogenic macromolecules, that slow down ACC dissolution and calcite precipitation from ions can induce the accretion process dominance (see figure attached). These experiments show that although in solution the dominant process is dissolution to ions of the ACC and crystal growth by ion-by-ion mechanism, the presence of an additive that slows the ion-mediated processes makes the ACC nanospheres stable long enough to interact with the crystal surface. As a result, the metastable ACC nanospheres undergo secondary nucleation on the crystal surface without dissolving. These experiments highlight

  1. Meta-analysis of high-latitude nitrogen-addition and warming studies implies ecological mechanisms overlooked by land models

    DOE PAGESBeta

    Bouskill, N. J.; Riley, W. J.; Tang, J. Y.

    2014-12-11

    Accurate representation of ecosystem processes in land models is crucial for reducing predictive uncertainty in energy and greenhouse gas feedbacks with the climate. Here we describe an observational and modeling meta-analysis approach to benchmark land models, and apply the method to the land model CLM4.5 with two versions of belowground biogeochemistry. We focused our analysis on the aboveground and belowground responses to warming and nitrogen addition in high-latitude ecosystems, and identified absent or poorly parameterized mechanisms in CLM4.5. While the two model versions predicted similar soil carbon stock trajectories following both warming and nitrogen addition, other predicted variables (e.g., belowgroundmore » respiration) differed from observations in both magnitude and direction, indicating that CLM4.5 has inadequate underlying mechanisms for representing high-latitude ecosystems. On the basis of observational synthesis, we attribute the model–observation differences to missing representations of microbial dynamics, aboveground and belowground coupling, and nutrient cycling, and we use the observational meta-analysis to discuss potential approaches to improving the current models. However, we also urge caution concerning the selection of data sets and experiments for meta-analysis. For example, the concentrations of nitrogen applied in the synthesized field experiments (average = 72 kg ha-1 yr-1) are many times higher than projected soil nitrogen concentrations (from nitrogen deposition and release during mineralization), which precludes a rigorous evaluation of the model responses to likely nitrogen perturbations. Overall, we demonstrate that elucidating ecological mechanisms via meta-analysis can identify deficiencies in ecosystem models and empirical experiments.« less

  2. Review of Mechanical Properties of Ti-6Al-4V Made by Laser-Based Additive Manufacturing Using Powder Feedstock

    NASA Astrophysics Data System (ADS)

    Beese, Allison M.; Carroll, Beth E.

    2016-03-01

    Laser-based additive manufacturing (AM) of metals using powder feedstock can be accomplished via two broadly defined technologies: directed energy deposition (DED) and powder bed fusion (PBF). In these processes, metallic powder is delivered to a location and locally melted with a laser heat source. Upon deposition, the material undergoes a rapid cooling and solidification, and as subsequent layers are added to the component, the material within the component is subjected to rapid thermal cycles. In order to adopt AM for the building of structural components, a thorough understanding of the relationships among the complex thermal cycles seen in AM, the unique heterogeneous and anisotropic microstructure, and the mechanical properties must be developed. Researchers have fabricated components by both DED and PBF from the widely used titanium alloy Ti-6Al-4V and studied the resultant microstructure and mechanical properties. This review article discusses the progress to date on investigating the as-deposited and heat-treated microstructures and mechanical properties of Ti-6Al-4V structures made by powder-based laser AM using DED and PBF.

  3. Awareness of federal regulatory mechanisms relevant to community-engaged research: survey of health disparities-oriented NIH-funded investigators

    PubMed Central

    Fullerton, Stephanie M.; Anderson, Emily E.; Cowan, Ketch; Malen, Rachel C.; Brugge, Doug

    2015-01-01

    Few studies or investigators involved in community engaged research or community-based participatory research have examined awareness and adoption of federal regulatory mechanisms. We conducted a survey of investigators affiliated with the ten National Institutes of Health (NIH) Centers for Population Health and Health Disparities. A questionnaire designed to capture experience with the conduct and oversight of community engaged research, and awareness of pertinent regulatory mechanisms, including Federalwide Assurances (FWAs), Individual Investigator Agreements (IIAs), and Institutional Review Board Authorization Agreements (IAAs), was completed by 101 respondents (68% response rate). Although most were aware of FWAs, only a minority of those surveyed reported knowledge of IAAs and IIAs and even fewer had used them in their research with community partners. Implications for future training and oversight are discussed. PMID:25742662

  4. BosR (BB0647) Controls the RpoN-RpoS Regulatory Pathway and Virulence Expression in Borrelia burgdorferi by a Novel DNA-Binding Mechanism

    PubMed Central

    Ouyang, Zhiming; Deka, Ranjit K.; Norgard, Michael V.

    2011-01-01

    In Borrelia burgdorferi (Bb), the Lyme disease spirochete, the alternative σ factor σ54 (RpoN) directly activates transcription of another alternative σ factor, σS (RpoS) which, in turn, controls the expression of virulence-associated membrane lipoproteins. As is customary in σ54-dependent gene control, a putative NtrC-like enhancer-binding protein, Rrp2, is required to activate the RpoN-RpoS pathway. However, recently it was found that rpoS transcription in Bb also requires another regulator, BosR, which was previously designated as a Fur or PerR homolog. Given this unexpected requirement for a second activator to promote σ54-dependent gene transcription, and the fact that regulatory mechanisms among similar species of pathogenic bacteria can be strain-specific, we sought to confirm the regulatory role of BosR in a second virulent strain (strain 297) of Bb. Indeed, BosR displayed the same influence over lipoprotein expression and mammalian infectivity for strain Bb 297 that were previously noted for Bb strain B31. We subsequently found that recombinant BosR (rBosR) bound to the rpoS gene at three distinct sites, and that binding occurred despite the absence of consensus Fur or Per boxes. This led to the identification of a novel direct repeat sequence (TAAATTAAAT) critical for rBosR binding in vitro. Mutations in the repeat sequence markedly inhibited or abolished rBosR binding. Taken together, our studies provide new mechanistic insights into how BosR likely acts directly on rpoS as a positive transcriptional activator. Additional novelty is engendered by the facts that, although BosR is a Fur or PerR homolog and it contains zinc (like Fur and PerR), it has other unique features that clearly set it apart from these other regulators. Our findings also have broader implications regarding a previously unappreciated layer of control that can be involved in σ54–dependent gene regulation in bacteria. PMID:21347346

  5. Probing the Additional Capacity and Reaction Mechanism of the RuO2 Anode in Lithium Rechargeable Batteries.

    PubMed

    Kim, Yunok; Muhammad, Shoaib; Kim, Hyunchul; Cho, Yong-Hun; Kim, Hansu; Kim, Ji Man; Yoon, Won-Sub

    2015-07-20

    The structural changes and electrochemical behavior of RuO2 are investigated by using in situ XRD, X-ray absorption spectroscopy, and electrochemical techniques to understand the electrochemical reaction mechanism of this metal oxide anode material. Intermediate phase-assisted transformation of RuO2 to LiRuO2 takes place at the start of discharge. Upon further lithiation, LiRuO2 formed by intercalation decomposes to nanosized Ru metal and Li2 O by a conversion reaction. A reversible capacity in addition to its theoretical capacity is observed on discharging below 0.5 V during which no redox activity involving Ru is observed. TEM, X-ray photoelectron spectroscopy, and the galvanostatic intermittent titration technique are used to probe this additional capacity. The results show that the additional capacity is a result of Li storage in the grain boundary between nanosized Ru metal and Li2 O. Findings of this study provide a better understanding of the quantitative share of capacity by a unique combination of intercalation, conversion, and interfacial Li storage in a RuO2 anode. PMID:26130378

  6. Microstructure and Mechanical Properties of Microwave Sintered ZrO2 Bioceramics with TiO2 Addition

    PubMed Central

    Chou, Jyh-Horng

    2016-01-01

    The microwave sintered zirconia ceramics with 0, 1, 3, and 5 wt% TiO2 addition at a low sintering temperature of 1300°C and a short holding time of 1 hour were investigated. Effect of contents of TiO2 addition on microstructure and mechanical properties of microwave sintered zirconia bioceramics was reported. In the sintered samples, the main phase is monoclinic zirconia (m-ZrO2) phase and minor phase is tetragonal zirconia (t-ZrO2) phase. The grain sizes increased with increasing the TiO2 contents under the sintering temperature of 1300°C. Although the TiO2 phase was not detected in the XRD pattern, Ti and O elements were detected in the EDS analysis. The presence of TiO2 effectively improved grain growth of the ZrO2 ceramics. The Vickers hardness was in the range of 125 to 300 Hv and increased with the increase of TiO2 contents. Sintering temperature dependence on the Vickers hardness was also investigated from 1150°C to 1300°C, showing the increase of Vickers hardness with the increase of the sintering temperature as well as TiO2 addition. PMID:27504072

  7. Microstructure and Mechanical Properties of Microwave Sintered ZrO2 Bioceramics with TiO2 Addition.

    PubMed

    Kuo, Hsien-Nan; Chou, Jyh-Horng; Liu, Tung-Kuan

    2016-01-01

    The microwave sintered zirconia ceramics with 0, 1, 3, and 5 wt% TiO2 addition at a low sintering temperature of 1300°C and a short holding time of 1 hour were investigated. Effect of contents of TiO2 addition on microstructure and mechanical properties of microwave sintered zirconia bioceramics was reported. In the sintered samples, the main phase is monoclinic zirconia (m-ZrO2) phase and minor phase is tetragonal zirconia (t-ZrO2) phase. The grain sizes increased with increasing the TiO2 contents under the sintering temperature of 1300°C. Although the TiO2 phase was not detected in the XRD pattern, Ti and O elements were detected in the EDS analysis. The presence of TiO2 effectively improved grain growth of the ZrO2 ceramics. The Vickers hardness was in the range of 125 to 300 Hv and increased with the increase of TiO2 contents. Sintering temperature dependence on the Vickers hardness was also investigated from 1150°C to 1300°C, showing the increase of Vickers hardness with the increase of the sintering temperature as well as TiO2 addition. PMID:27504072

  8. Effects of microstructure and CaO addition on the magnetic and mechanical properties of NiCuZn ferrites

    NASA Astrophysics Data System (ADS)

    Wang, Sea-Fue; Hsu, Yung-Fu; Liu, Yi-Xin; Hsieh, Chung-Kai

    2015-11-01

    In this study, the effects of grain size and the addition of CaCO3 on the magnetic and mechanical properties of Ni0.5Cu0.3Zn0.2Fe2O4 ceramics were investigated. The bending strength of the ferrites increased from 66 to 84 MPa as the grain size of the sintered ceramics decreased from 10.25 μm to 7.53 μm, while the change in hardness was insignificant. The addition of various amounts of CaCO3 densified the Ni0.5Cu0.3Zn0.2Fe2O4 ceramics at 1075 °C. In the pure Ni0.5Cu0.3Zn0.2Fe2O4 ceramic, second phase CuO was segregated at the grain boundaries. With the CaCO3 content ≥1.5 wt%, a small amount of discrete plate-like second phase Fe2CaO4 was observed, together with the disappearance of the second phase CuO. The grain size of the Ni0.5Cu0.3Zn0.2Fe2O4 ceramic dropped from 7.80 μm to 4.68 μm, and the grain size distribution widened as the CaCO3 content increased from 0 to 5 wt%. Initially rising to 807 after CaCO3 addition up to 2.0 wt%, due to a reduced grain size, the Vickers hardness began to drop as the CaCO3 content increased. The bending strength grew linearly with the CaCO3 content and reached twice the value for the Ni0.5Cu0.3Zn0.2Fe2O4 ceramic with an addition of 5.0 wt% CaCO3. The initial permeability of the Ni0.5Cu0.3Zn0.2Fe2O4 ceramic decreased substantially from 402 to 103 as the addition of CaCO3 in ferrite increased from 0 to 5 wt%, and the quality factor of the Ni0.5Cu0.3Zn0.2Fe2O4 ceramic was maximized at 95 for 1.0 wt% CaCO3 addition.

  9. The Effect of the Kind of Sands and Additions on the Mechanical Behaviour of S.C.C

    NASA Astrophysics Data System (ADS)

    Zeghichi, L.; Benghazi, Z.; Baali, L.

    The sand is an inert element essential in the composition of concrete; its use ensures granular continuity between the cement and gravel for better cohesion of concrete. This paper presents the results of a study that investigated the influence of sand quality on the properties of fresh and hardened self-compacting concrete (SCC). The dune sands are very fine materials characterized by a high intergranular porosity, high surface area and low fineness modulus; on the other hand crushed (manufactured) sand has a high rate into thin and irregular shapes which are influencing the workability of concrete. The amount of dune sand varies from (0% 50%, to 100%) by weight of fine aggregates. The effect of additions is also treated (blast furnace slag and lime stone) The results show that the rheological properties favour the use of dune sands; however the mechanical properties support the use of crushed sand.

  10. Unraveling the Fundamental Mechanisms of Solvent-Additive-Induced Optimization of Power Conversion Efficiencies in Organic Photovoltaic Devices.

    PubMed

    Herath, Nuradhika; Das, Sanjib; Zhu, Jiahua; Kumar, Rajeev; Chen, Jihua; Xiao, Kai; Gu, Gong; Browning, James F; Sumpter, Bobby G; Ivanov, Ilia N; Lauter, Valeria

    2016-08-10

    The realization of controllable morphologies of bulk heterojunctions (BHJ) in organic photovoltaics (OPVs) is one of the key factors enabling high-efficiency devices. We provide new insights into the fundamental mechanisms essential for the optimization of power conversion efficiencies (PCEs) with additive processing to PBDTTT-CF:PC71BM system. We have studied the underlying mechanisms by monitoring the 3D nanostructural modifications in BHJs and correlated the modifications with the optical analysis and theoretical modeling of charge transport. Our results demonstrate profound effects of diiodooctane (DIO) on morphology and charge transport in the active layers. For small amounts of DIO (<3 vol %), DIO promotes the formation of a well-mixed donor-acceptor compact film and augments charge transfer and PCE. In contrast, for large amounts of DIO (>3 vol %), DIO facilitates a loosely packed mixed morphology with large clusters of PC71BM, leading to deterioration in PCE. Theoretical modeling of charge transport reveals that DIO increases the mobility of electrons and holes (the charge carriers) by affecting the energetic disorder and electric field dependence of the mobility. Our findings show the implications of phase separation and carrier transport pathways to achieve optimal device performances. PMID:27403964

  11. Theoretical investigation on mechanism of asymmetric Michael addition of malononitrile to chalcones catalyzed by Cinchona alkaloid aluminium(III) complex.

    PubMed

    Su, Zhishan; Lee, Hai Whang; Kim, Chan Kyung

    2011-09-21

    The mechanism of Michael addition of malononitrile to chalcones catalyzed by Cinchona alkaloid aluminium(III) complex has been investigated by DFT and ONIOM methods. Calculations indicate that the reaction proceeds through a dual activation mechanism, in which Al(III) acts as a Lewis acid to activate the electrophile α,β-unsaturated carbonyl substrate while the tertiary amine in the Cinchona alkaloid works as a Lewis base to promote the activation of the malononitrile and deprotonation. A stepwise pathway involving C-C bond formation followed by proton transfer from the catalyst to the carbonyl substrate is adopted, and latter step is predicted to be the rate-determining-step in the reaction with an energy barrier of 12.4 kcal mol(-1). In the absence of the Al(III)-complex, a Cinchona alkaloid activates the carbonyl substrate by a hydrogen bonding of the hydroxyl group, involving a higher energy barrier of 30.4 kcal mol(-1). The steric repulsion between the phenyl group attached to the carbonyl group in the chalcone and isopropoxyl groups of the Al(III)-complex may play an important role in the control of stereoselectivity. The π-π stacking effect between the quinuclidine ring of the quinine and the phenyl group of the chalcones may also help the stabilization of the preferred molecular complex. These results are in agreement with experimental observations. PMID:21796318

  12. Effect of addition of Ag nano powder on mechanical properties of epoxy/polyaminoamide adduct coatings filled with conducting polymer

    SciTech Connect

    Samad, Ubair Abdus; Khan, Rawaiz; Alam, Mohammad Asif; Al-Othman, Othman Y.; Al-Zahrani, Saeed M.

    2015-05-22

    In this study the effect of Ag Nano powder on mechanical properties of epoxy coatings filled with optimized ratio of conducting polymers (Polyaniline and Polyppyrole) was evaluated. Bisphenol A diglycidyl ether epoxy resin (DGEBA) along with polyaminoamide adduct (ARADUR 3282-1 BD) is used as curing agent under optimized stoichiometry values. Curing is performed at room temperature with different percentages of Nano filler. Glass and steel panels were used as coating substrate. Bird applicator was used to coat the samples in order to obtain thin film with wet film thickness (WFT) of about 70-90 µm. The samples were kept in dust free environment for about 7 days at room temperature for complete curing. The coated steel panels were used to evaluate the mechanical properties of coating such as hardness, scratch and impact tests whereas coated glass panels were used for measuring pendulum hardness of the coatings. To check the dispersion and morphology of Nano filler in epoxy matrix scanning electron microscopy (SEM) was used in addition Nano indentation was also performed to observe the effect of Nano filler on modulus of elasticity and hardness at Nano scale.

  13. Effect of addition of Ag nano powder on mechanical properties of epoxy/polyaminoamide adduct coatings filled with conducting polymer

    NASA Astrophysics Data System (ADS)

    Samad, Ubair Abdus; Khan, Rawaiz; Alam, Mohammad Asif; Al-Othman, Othman Y.; Al-Zahrani, Saeed M.

    2015-05-01

    In this study the effect of Ag Nano powder on mechanical properties of epoxy coatings filled with optimized ratio of conducting polymers (Polyaniline and Polyppyrole) was evaluated. Bisphenol A diglycidyl ether epoxy resin (DGEBA) along with polyaminoamide adduct (ARADUR 3282-1 BD) is used as curing agent under optimized stoichiometry values. Curing is performed at room temperature with different percentages of Nano filler. Glass and steel panels were used as coating substrate. Bird applicator was used to coat the samples in order to obtain thin film with wet film thickness (WFT) of about 70-90 µm. The samples were kept in dust free environment for about 7 days at room temperature for complete curing. The coated steel panels were used to evaluate the mechanical properties of coating such as hardness, scratch and impact tests whereas coated glass panels were used for measuring pendulum hardness of the coatings. To check the dispersion and morphology of Nano filler in epoxy matrix scanning electron microscopy (SEM) was used in addition Nano indentation was also performed to observe the effect of Nano filler on modulus of elasticity and hardness at Nano scale.

  14. Contrasting Evolutionary Dynamics of the Developmental Regulator PAX9, among Bats, with Evidence for a Novel Post-Transcriptional Regulatory Mechanism

    PubMed Central

    Phillips, Caleb D.; Butler, Boyd; Fondon, John W.; Mantilla-Meluk, Hugo; Baker, Robert J.

    2013-01-01

    Morphological evolution can be the result of natural selection favoring modification of developmental signaling pathways. However, little is known about the genetic basis of such phenotypic diversity. Understanding these mechanisms is difficult for numerous reasons, yet studies in model organisms often provide clues about the major developmental pathways involved. The paired-domain gene, PAX9, is known to be a key regulator of development, particularly of the face and teeth. In this study, using a comparative genetics approach, we investigate PAX9 molecular evolution among mammals, focusing on craniofacially diversified (Phyllostomidae) and conserved (Vespertilionidae) bat families, and extend our comparison to other orders of mammal. Open-reading frame analysis disclosed signatures of selection, in which a small percentage of residues vary, and lineages acquire different combinations of variation through recurrent substitution and lineage specific changes. A few instances of convergence for specific residues were observed between morphologically convergent bat lineages. Bioinformatic analysis for unknown PAX9 regulatory motifs indicated a novel post-transcriptional regulatory mechanism involving a Musashi protein. This regulation was assessed through fluorescent reporter assays and gene knockdowns. Results are compatible with the hypothesis that the number of Musashi binding-elements in PAX9 mRNA proportionally regulates protein translation rate. Although a connection between morphology and binding element frequency was not apparent, results indicate this regulation would vary among craniofacially divergent bat species, but be static among conserved species. Under this model, Musashi’s regulatory control of alternative human PAX9 isoforms would also vary. The presence of Musashi-binding elements within PAX9 of all mammals examined, chicken, zebrafish, and the fly homolog of PAX9, indicates this regulatory mechanism is ancient, originating basal to much of the

  15. Meta-analysis of high-latitude nitrogen-addition and warming studies imply ecological mechanisms overlooked by land models

    DOE PAGESBeta

    Bouskill, N. J.; Riley, W. J.; Tang, J.

    2014-08-18

    Accurate representation of ecosystem processes in land models is crucial for reducing predictive uncertainty in energy and greenhouse gas feedbacks with the atmosphere. Here we describe an observational and modeling meta-analysis approach to benchmark land models, and apply the method to the land model CLM4.5 with two versions of belowground biogeochemistry. We focused our analysis on the above and belowground high-latitude ecosystem responses to warming and nitrogen addition, and identified mechanisms absent, or poorly parameterized in CLM4.5. While the two model versions predicted similar trajectories for soil carbon stocks following both types of perturbation, other variables (e.g., belowground respiration) differedmore » from the observations in both magnitude and direction, indicating the underlying mechanisms are inadequate for representing high-latitude ecosystems. The observational synthesis attribute these differences to missing representations of microbial dynamics, characterization of above and belowground functional processes, and nutrient competition. We use the observational meta-analyses to discuss potential approaches to improving the current models (e.g., the inclusion of dynamic vegetation or different microbial functional guilds), however, we also raise a cautionary note on the selection of data sets and experiments to be included in a meta-analysis. For example, the concentrations of nitrogen applied in the synthesized field experiments (average =72 kg ha-1 yr-1) are many times higher than projected soil nitrogen concentrations (from nitrogen deposition and release during mineralization), which preclude a rigorous evaluation of the model responses to nitrogen perturbation. Overall, we demonstrate here that elucidating ecological mechanisms via meta-analysis can identify deficiencies in both ecosystem models and empirical experiments.« less

  16. The Hog1 SAPK controls the Rtg1/Rtg3 transcriptional complex activity by multiple regulatory mechanisms

    PubMed Central

    Ruiz-Roig, Clàudia; Noriega, Núria; Duch, Alba; Posas, Francesc; de Nadal, Eulàlia

    2012-01-01

    Cells modulate expression of nuclear genes in response to alterations in mitochondrial function, a response termed retrograde (RTG) regulation. In budding yeast, the RTG pathway relies on Rtg1 and Rtg3 basic helix-loop-helix leucine Zipper transcription factors. Exposure of yeast to external hyperosmolarity activates the Hog1 stress-activated protein kinase (SAPK), which is a key player in the regulation of gene expression upon stress. Several transcription factors, including Sko1, Hot1, the redundant Msn2 and Msn4, and Smp1, have been shown to be directly controlled by the Hog1 SAPK. The mechanisms by which Hog1 regulates their activity differ from one to another. In this paper, we show that Rtg1 and Rtg3 transcription factors are new targets of the Hog1 SAPK. In response to osmostress, RTG-dependent genes are induced in a Hog1-dependent manner, and Hog1 is required for Rtg1/3 complex nuclear accumulation. In addition, Hog1 activity regulates Rtg1/3 binding to chromatin and transcriptional activity. Therefore Hog1 modulates Rtg1/3 complex activity by multiple mechanisms in response to stress. Overall our data suggest that Hog1, through activation of the RTG pathway, contributes to ensure mitochondrial function as part of the Hog1-mediated osmoadaptive response. PMID:22956768

  17. Regulatory mechanisms underlying oil palm fruit mesocarp maturation, ripening, and functional specialization in lipid and carotenoid metabolism.

    PubMed

    Tranbarger, Timothy J; Dussert, Stéphane; Joët, Thierry; Argout, Xavier; Summo, Marilyne; Champion, Antony; Cros, David; Omore, Alphonse; Nouy, Bruno; Morcillo, Fabienne

    2011-06-01

    Fruit provide essential nutrients and vitamins for the human diet. Not only is the lipid-rich fleshy mesocarp tissue of the oil palm (Elaeis guineensis) fruit the main source of edible oil for the world, but it is also the richest dietary source of provitamin A. This study examines the transcriptional basis of these two outstanding metabolic characters in the oil palm mesocarp. Morphological, cellular, biochemical, and hormonal features defined key phases of mesocarp development. A 454 pyrosequencing-derived transcriptome was then assembled for the developmental phases preceding and during maturation and ripening, when high rates of lipid and carotenoid biosynthesis occur. A total of 2,629 contigs with differential representation revealed coordination of metabolic and regulatory components. Further analysis focused on the fatty acid and triacylglycerol assembly pathways and during carotenogenesis. Notably, a contig similar to the Arabidopsis (Arabidopsis thaliana) seed oil transcription factor WRINKLED1 was identified with a transcript profile coordinated with those of several fatty acid biosynthetic genes and the high rates of lipid accumulation, suggesting some common regulatory features between seeds and fruits. We also focused on transcriptional regulatory networks of the fruit, in particular those related to ethylene transcriptional and GLOBOSA/PISTILLATA-like proteins in the mesocarp and a central role for ethylene-coordinated transcriptional regulation of type VII ethylene response factors during ripening. Our results suggest that divergence has occurred in the regulatory components in this monocot fruit compared with those identified in the dicot tomato (Solanum lycopersicum) fleshy fruit model. PMID:21487046

  18. Distinct Regulatory Mechanisms of the Human Ferritin Gene by Hypoxia and Hypoxia Mimetic Cobalt Chloride at the Transcriptional and Post-transcriptional Levels

    PubMed Central

    Huang, Bo-Wen; Miyazawa, Masaki; Tsuji, Yoshiaki

    2014-01-01

    Cobalt chloride has been used as a hypoxia mimetic because it stabilizes hypoxia inducible factor-1α (HIF1-α) and activates gene transcription through a hypoxia responsive element (HRE). However, differences between hypoxia and hypoxia mimetic cobalt chloride in gene regulation remain elusive. Expression of ferritin, the major iron storage protein, is regulated at the transcriptional and posttranscriptional levels through DNA and RNA regulatory elements. Here we demonstrate that hypoxia and cobalt chloride regulate ferritin heavy chain (ferritin H) expression by two distinct mechanisms. Both hypoxia and cobalt chloride increased HIF1-α but a putative HRE in the human ferritin H gene was not activated. Instead, cobalt chloride but not hypoxia activated ferritin H transcription through an antioxidant responsive element (ARE), to which Nrf2 was recruited. Intriguingly, cobalt chloride downregulated ferritin H protein expression while upregulated other ARE-regulated antioxidant genes in K562 cells. Further characterization demonstrated that cobalt chloride increased interaction between iron regulatory proteins (IRP1 and IRP2) and iron responsive element (IRE) in the 5′UTR of ferritin H mRNA, resulting in translational block of the accumulated ferritin H mRNA. In contrast, hypoxia had marginal effect on ferritin H transcription but increased its translation through decreased IRP1-IRE interaction. These results suggest that hypoxia and hypoxia mimetic cobalt chloride employ distinct regulatory mechanisms through the interplay between DNA and mRNA elements at the transcriptional and post-transcriptional levels. PMID:25172425

  19. Effects of Ce and La Additions on the Microstructure and Mechanical Properties of Sn-9Zn Solder Joints

    NASA Astrophysics Data System (ADS)

    Lin, Hsiu-Jen; Chuang, Tung-Han

    2010-02-01

    The effects of rare-earth elements on the microstructure and mechanical properties of Sn-9Zn alloys and solder joints in ball grid array packages with Ni/Au(ENIG) surface finishes have been investigated. Metallographic observations showed that (Ce0.8Zn0.2)Sn3 and (La0.9Zn0.1)Sn3 intermetallic compounds appeared in the solder matrix of Sn-9Zn-0.5Ce and Sn-9Zn-0.5La alloys, respectively. Both fiber- and hillock-shaped tin whiskers were inhibited in the Sn-9Zn-0.5Ce solder, while tin fibers were still observed on the surface of oxidized (La0.9Zn0.1)Sn3 intermetallics in Sn-9Zn-0.5La after air exposure at room temperature. Mechanical testing indicated that the tensile strength of Sn-9Zn alloys doped with Ce and La increased significantly, and the elongation decreased, in comparison with the undoped Sn-9Zn. The bonding strengths of the as-reflowed Sn-9Zn-0.5Ce and Sn-9Zn-0.5La solder joints were also improved. However, aging treatment at 100°C and 150°C caused degradation of ball shear strength in all specimens. During the reflowing and aging processes, AuZn8 intermetallic phases appeared at the interfaces of all solder joints. In addition, Zn-rich phases were observed to migrate from the solder matrix to the solder/pad interfaces of the aged specimens.

  20. Influence of Si addition on the microstructure and mechanical properties of Ti-35Nb alloy for applications in orthopedic implants.

    PubMed

    Tavares, A M G; Ramos, W S; de Blas, J C G; Lopes, E S N; Caram, R; Batista, W W; Souza, S A

    2015-11-01

    In the development of new materials for orthopedic implants, special attention has been given to Ti alloys that show biocompatible alloy elements and that are capable of reducing the elastic modulus. Accordingly, Ti-Nb-Si alloys show great potential for application. Thus, this is a study on the microstructures and properties of Ti-35Nb-xSi alloys (x=0, 0.15, 0.35 and 0.55) (wt%) which were thermally treated and cooled under the following conditions: furnace cooling (FC), air cooling (AC), and water quenching (WQ). The results showed that Si addition is effective to reduce the density of omega precipitates making beta more stable, and to produce grain refinement. Silicides, referred as (Ti,Nb)3Si, were formed for alloys containing 0.55% Si, and its formation presumably occurred during the heating at 1000°C. In all cooling conditions, the hardness values increased with the increasing of Si content, as a result from the strong Si solid solution strengthening effect, while the elastic modulus underwent a continuous reduction due to the reduction of omega precipitates in beta matrix. Lower elastic moduli were observed in water-quenched alloys, which concentration of 0.15% Si was more effective in their reduction, with value around 65 GPa. Regarding Ti-35Nb-xSi alloys (x=0, 0.15 and 0.35), the "double yield point" phenomenon, which is typical of alloys with shape memory effect, was observed. The increase in Si concentration also produced an increase from 382 MPa to 540 MPa in the alloys' mechanical strength. Ti-35Nb-0.55Si alloy, however, showed brittle mechanical behavior which was related to the presence of silicides at the grain boundary. PMID:26218870

  1. Role of dendritic cells in the induction of regulatory T cells

    PubMed Central

    2011-01-01

    Dendritic cells (DCs) play a key role in initiating immune responses and maintaining immune tolerance. In addition to playing a role in thymic selection, DCs play an active role in tolerance under steady state conditions through several mechanisms which are dependent on IL-10, TGF-β, retinoic acid, indoleamine-2,3,-dioxygenase along with vitamin D. Several of these mechanisms are employed by DCs in induction of regulatory T cells which are comprised of Tr1 regulatory T cells, natural and inducible foxp3+ regulatory T cells, Th3 regulatory T cells and double negative regulatory T cells. It appears that certain DC subsets are highly specialized in inducing regulatory T cell differentiation and in some tissues the local microenvironment plays a role in driving DCs towards a tolerogenic response. In this review we discuss the recent advances in our understanding of the mechanisms underlying DC driven regulatory T cell induction. PMID:21711933

  2. Influence of Addition of Nb on Phase Transformation, Microstructure and Mechanical Properties of Equiatomic NiTi SMA

    NASA Astrophysics Data System (ADS)

    Jiang, Shuyong; Liang, Yulong; Zhang, Yanqiu; Zhao, Yanan; Zhao, Chengzhi

    2016-08-01

    Three novel NiTiNb shape memory alloys, which possess a nominal chemical composition of Ni50-x/2-Ti50-x/2-Nb x (at.%) where x stands for 2, 4 and 6, respectively, were designed in order to investigate the influence of the addition of Nb on phase transformation, microstructure and mechanical properties of equiatomic NiTi shape memory alloy. All the three NiTiNb shape memory alloys contain B2 austenite phase, B19' martensite phase and β-Nb precipitate phase. Martensite type II twin can be observed in the case of Ni49Ti49Nb2 alloy. In the case of Ni48Ti48Nb4 alloy, there exists a boundary between Ti2Ni precipitate phase and β-Nb precipitate phase. As for Ni47Ti47Nb6 alloy, it can be observed that there exists an orientation relationship of [01bar{1}]_{{β{{ - Nb}}}} //[01bar{1}]_{{B2}} between β-Nb precipitate phase and B2 austenite matrix. The increase in Nb content contributes to enhancing the yield stress of NiTiNb shape memory alloy, but it leads to the decrease in compression fracture stress. The addition of Nb to equiatomic NiTi shape memory alloy does not have a significant influence on the transformation hysteresis of the alloy, which is attributed to the fact that NiTiNb shape memory alloy is not subjected to plastic deformation and hence β-Nb precipitate phase is unable to relax the elastic strain in the martensite interface.

  3. Cis- and Trans-Regulatory Mechanisms of Gene Expression in the ASJ Sensory Neuron of Caenorhabditis elegans

    PubMed Central

    González-Barrios, María; Fierro-González, Juan Carlos; Krpelanova, Eva; Mora-Lorca, José Antonio; Pedrajas, José Rafael; Peñate, Xenia; Chavez, Sebastián; Swoboda, Peter; Jansen, Gert; Miranda-Vizuete, Antonio

    2015-01-01

    The identity of a given cell type is determined by the expression of a set of genes sharing common cis-regulatory motifs and being regulated by shared transcription factors. Here, we identify cis and trans regulatory elements that drive gene expression in the bilateral sensory neuron ASJ, located in the head of the nematode Caenorhabditis elegans. For this purpose, we have dissected the promoters of the only two genes so far reported to be exclusively expressed in ASJ, trx-1 and ssu-1. We hereby identify the ASJ motif, a functional cis-regulatory bipartite promoter region composed of two individual 6 bp elements separated by a 3 bp linker. The first element is a 6 bp CG-rich sequence that presumably binds the Sp family member zinc-finger transcription factor SPTF-1. Interestingly, within the C. elegans nervous system SPTF-1 is also found to be expressed only in ASJ neurons where it regulates expression of other genes in these neurons and ASJ cell fate. The second element of the bipartite motif is a 6 bp AT-rich sequence that is predicted to potentially bind a transcription factor of the homeobox family. Together, our findings identify a specific promoter signature and SPTF-1 as a transcription factor that functions as a terminal selector gene to regulate gene expression in C. elegans ASJ sensory neurons. PMID:25769980

  4. Enhancement mechanism of the additional absorbent on the absorption of the absorbing composite using a type-based mixing rule

    NASA Astrophysics Data System (ADS)

    Xu, Yonggang; Yuan, Liming; Zhang, Deyuan

    2016-04-01

    A silicone rubber composite filled with carbonyl iron particles and four different carbonous materials (carbon black, graphite, carbon fiber or multi-walled carbon nanotubes) was prepared using a two-roller mixture. The complex permittivity and permeability were measured using a vector network analyzer at the frequency of 2-18 GHz. Then a type-based mixing rule based on the dielectric absorbent and magnetic absorbent was proposed to reveal the enhancing mechanism on the permittivity and permeability. The enforcement effect lies in the decreased percolation threshold and the changing pending parameter as the carbonous materials were added. The reflection loss (RL) result showed the added carbonous materials enhanced the absorption in the lower frequency range, the RL decrement value being about 2 dB at 4-5 GHz with a thickness of 1 mm. All the added carbonous materials reinforced the shielding effectiveness (SE) of the composites. The maximum increment value of the SE was about 3.23 dB at 0.5 mm and 4.65 dB at 1 mm, respectively. The added carbonous materials could be effective additives for enforcing the absorption and shielding property of the absorbers.

  5. The Effect of SiC Particle Addition During FSW on Microstructure and Mechanical Properties of AZ31 Magnesium Alloy

    NASA Astrophysics Data System (ADS)

    Abbasi, M.; Abdollahzadeh, A.; Bagheri, B.; Omidvar, H.

    2015-12-01

    Welding and joining of magnesium alloys exert a profound effect on magnesium application expansion, especially in ground and air transportations where large-size, complex components are required. Due to specific physical properties of magnesium, its welding requires great control. In general, the solid-state nature of friction stir welding (FSW) process has been found to produce a low concentration of defects. In the current research, specimens from AZ31 magnesium alloy were welded together using the friction stir process with previously inserted SiC powder particles in the nugget zone. In other words, during the FSW process, the pre-placed SiC particles were stirred throughout the nugget zone of the weld. The results indicated that proper values of rotation and translation speeds led to good appearance of weld zone and suitable distribution of SiC particles producing increased weld strength. The comparison of the microstructures and mechanical properties of FS-welded AZ31 with those of FS-welded one using pre-placed SiC particles showed that the addition of SiC particles decreased the grain size and increased the strength and the formability index.

  6. Failure mechanism of layered lithium-rich oxide/graphite cell and its solution by using electrolyte additive

    NASA Astrophysics Data System (ADS)

    Zhu, Yunmin; Luo, Xueyi; Xu, Mengqing; Zhang, Liping; Yu, Le; Fan, Weizhen; Li, Weishan

    2016-06-01

    We report a failure mechanism of layered lithium-rich oxide/graphite cell and a solution to this failure. Charge/discharge tests demonstrate that Li1.2Mn0.54Ni0.13Co0.13O2/graphite full cell fails when it is performed with cycling and this issue can be solved effectively by using an electrolyte additive, tris (trimethylsilyl) phosphite (TMSPi). Further cycling tests on Li/Li1.2Mn0.54Ni0.13Co0.13O2 and Li/graphite half-cells and physical characterizations on the cycled cathode indicate that this failure involves the increased HF concentration and the subsequent corrosion for aluminum current collector of cathode due to the electrolyte decomposition during cycling. TMSPi contributes to the formation of a protective interphase on cathode due to its preferential oxidation compared with the base electrolyte, which suppresses the electrolyte decomposition and the HF formation, preventing aluminum current collector from corrosion.

  7. Investigation of thermal, mechanical and magnetic behaviors of the Cu-11%Al alloy with Ag and Mn additions

    SciTech Connect

    Silva, R.A.G.; Paganotti, A.; Gama, S.; Adorno, A.T.; Carvalho, T.M.; Santos, C.M.A.

    2013-01-15

    The investigation of thermal, mechanical and magnetic behaviors of the Cu-11%Al, Cu-11%Al-3%Ag, Cu-11%Al-10%Mn and Cu-11%Al-10%Mn-3%Ag alloys was made using microhardness measurements, differential scanning calorimetry, X-ray diffractometry, scanning electron microscopy, energy dispersion X-ray spectroscopy and magnetic moment change with applied field measurement. The results indicated that the Mn addition changes the phase stability range, the microhardness values and makes undetectable the eutectoid reaction in annealed Cu-11%Al and Cu-11%Al-3%Ag alloys while the presence of Ag does not modify the phase transformation sequence neither microhardness values of the annealed Cu-11%Al and Cu-11%Al-10%Mn alloys, but it increases the magnetic moment of this latter at about 2.7 times and decreases the rates of eutectoid and peritectoid reactions of the former. - Highlights: Black-Right-Pointing-Pointer The microstructure of Cu-Al alloy is modified in the Ag presence. Black-Right-Pointing-Pointer ({alpha} + {gamma}) phase is stabilized down to room temperature when Ag is added to Cu-Al alloy. Black-Right-Pointing-Pointer Ag-rich phase modifies the magnetic characteristics of Cu-Al-Mn alloy.

  8. Hemolysate-mediated platelet aggregation: an additional risk mechanism contributing to thrombosis of continuous flow ventricular assist devices.

    PubMed

    Tran, Phat L; Pietropaolo, Maria-Grazia; Valerio, Lorenzo; Brengle, William; Wong, Raymond K; Kazui, Toshinobu; Khalpey, Zain I; Redaelli, Alberto; Sheriff, Jawaad; Bluestein, Danny; Slepian, Marvin J

    2016-07-01

    Despite the clinical success and growth in the utilization of continuous flow ventricular assist devices (cfVADs) for the treatment of advanced heart failure, hemolysis and thrombosis remain major limitations. Inadequate and/or ineffective anticoagulation regimens, combined with high pump speed and non-physiological flow patterns, can result in hemolysis which often is accompanied by pump thrombosis. An unexpected increase in cfVADs thrombosis was reported by multiple major VAD implanting centers in 2014, highlighting the association of hemolysis and a rise in lactate dehydrogenase (LDH) presaging thrombotic events. It is well established that thrombotic complications arise from the abnormal shear stresses generated by cfVADs. What remains unknown is the link between cfVAD-associated hemolysis and pump thrombosis. Can hemolysis of red blood cells (RBCs) contribute to platelet aggregation, thereby, facilitating prothrombotic complications in cfVADs? Herein, we examine the effect of RBC-hemolysate and selected major constituents, i.e., lactate dehydrogenase (LDH) and plasma free hemoglobin (pHb) on platelet aggregation, utilizing electrical resistance aggregometry. Our hypothesis is that elements of RBCs, released as a result of shear-mediated hemolysis, will contribute to platelet aggregation. We show that RBC hemolysate and pHb, but not LDH, are direct contributors to platelet aggregation, posing an additional risk mechanism for cfVAD thrombosis. PMID:26590166

  9. Microstructure-mechanical property relationships for Al-Cu-Li-Zr alloys with minor additions of cadmium, indium or tin

    NASA Technical Reports Server (NTRS)

    Blackburn, L. B.; Starke, E. A., Jr.

    1989-01-01

    Minor amounts of cadmium, indium or tin were added to a baseline alloy with the nominal composition of Al-2.4Cu-2.4Li-0.15Zr. These elements were added in an attempt to increase the age-hardening response of the material such that high strengths could be achieved through heat-treatment alone, without the need for intermediate mechanical working. The alloy variant containing indium achieved a higher peak hardness in comparison to the other alloy variations, including the baseline material, when aged at temperatures ranging from 160 C to 190 C. Tensile tests on specimens peak-aged at 160 indicated the yield strength of the indium-bearing alloy increased by approximately 15 percent compared to that of the peak-aged baseline alloy. In addition, the yield strength obtained in the indium-bearing alloy was comparable to that reported for similar baseline material subjected to a 6 percent stretch prior to peak-aging at 190 C. The higher strength levels obtaied for the indium-bearing alloy are attributed to increased number densities and homogeneity of both the T1 and theta-prime phases, as determined by TEM studies.

  10. Comparative transcriptomic analysis reveals novel genes and regulatory mechanisms of Tetragenococcus halophilus in response to salt stress.

    PubMed

    Liu, Licui; Si, Lifang; Meng, Xin; Luo, Lixin

    2015-04-01

    Tetragenococcus halophilus, a moderately halophilic Gram-positive bacterium, was isolated from Chinese style soy sauce. This species is a valuable resource for investigating salt tolerance mechanisms and improving salinity resistance in microorganisms. RNA-seq was used to sequence T. halophilus samples treated with 0 M (T1), 1 M (T2), and 3.5 M NaCl (T3). Comparative transcriptomic analyses of the different treatments were performed using gene ontology and Kyoto encyclopedia of genes and genome. The comparison of T1 and T2 by RNA-seq revealed that genes involved in transcription, translation, membrane system, and division were highly up-regulated under optimum salt condition. The comparison of T2 and T3 showed that genes related to heat shock proteins or the ATP-binding cassette transport systems were significantly up-regulated under maximum-salt condition. In addition, a considerable proportion of the significantly differently expressed genes identified in this study are novel. These data provide a crucial resource that may determine specific responses to salt stress in T. halophilus. PMID:25563971

  11. The Regulatory T Cell Lineage Factor Foxp3 Regulates Gene Expression through Several Distinct Mechanisms Mostly Independent of Direct DNA Binding

    PubMed Central

    Andersen, Kristian G.; Hebenstreit, Daniel; Teichmann, Sarah A.; Betz, Alexander G.

    2015-01-01

    The lineage factor Foxp3 is essential for the development and maintenance of regulatory T cells, but little is known about the mechanisms involved. Here, we demonstrate that an N-terminal proline-rich interaction region is crucial for Foxp3’s function. Subdomains within this key region link Foxp3 to several independent mechanisms of transcriptional regulation. Our study suggests that Foxp3, even in the absence of its DNA-binding forkhead domain, acts as a bridge between DNA-binding interaction partners and proteins with effector function permitting it to regulate a large number of genes. We show that, in one such mechanism, Foxp3 recruits class I histone deacetylases to the promoters of target genes, counteracting activation-induced histone acetylation and thereby suppressing their expression. PMID:26107960

  12. EVOLUTIONARY BIOSCIENCE AS REGULATORY SYSTEMS BIOLOGY

    PubMed Central

    Davidson, Eric H.

    2011-01-01

    At present several entirely different explanatory approaches compete to illuminate the mechanisms by which animal body plans have evolved. Their respective relevance is briefly considered here in the light of modern knowledge of genomes and the regulatory processes by which development is controlled. Just as development is a system property of the regulatory genome, so causal explanation of evolutionary change in developmental process must be considered at a system level. Here I enumerate some mechanistic consequences that follow from the conclusion that evolution of the body plan has occurred by alteration of the structure of developmental gene regulatory networks. The hierarchy and multiple additional design features of these networks act to produce Boolean regulatory state specification functions at upstream phases of development of the body plan. These are created by the logic outputs of network subcircuits, and in modern animals these outputs are impervious to continuous adaptive variation unlike genes operating more peripherally in the network. PMID:21320483

  13. Mechanical properties and phase composition of potential biodegradable Mg-Zn-Mn-base alloys with addition of rare earth elements

    SciTech Connect

    Stulikova, Ivana; Smola, Bohumil

    2010-10-15

    Mechanical properties and creep resistance of the MgY4Zn1Mn1 alloy in the as cast as well as in the T5 condition were compared to those of the MgCe4Zn1Mn1 alloy in the same conditions. Yield tensile stress and ultimate tensile strength of the MgY4Zn1Mn1 alloy are slightly better in the temperature range 20 deg. C-400 deg. C than these of the MgCe4Zn1Mn1 alloy. Better thermal stability of ultimate tensile strength was observed in the T5 treated MgCe4Zn1Mn1 alloy than in this material in the as cast condition. An outstanding creep resistance at 225 deg. C-350 deg. C found in the MgY4Zn1Mn1 alloy is due to the existence of the 18R long period stacking structure persisting in this alloy even a long heat treatment of 500 deg. C/32 h. No similar stacking effects happen when Ce substitutes Y in approximately the same concentration. The creep resistance deteriorates considerably in the MgCe4Zn1Mn1 alloy. Rectangular particles of the equilibrium Mg{sub 12}Ce phase dominate in the microstructure of as cast as well as of high temperature heat-treated MgCe4Zn1Mn1 alloy. A population of small oval particles containing Mg and Zn develops additionally during annealing of this alloy. These particles pin effectively dislocations and can be responsible for the better thermal stability of the T5 treated material.

  14. Identification of a Novel Regulatory Mechanism of Nutrient Transport Controlled by TORC1-Npr1-Amu1/Par32.

    PubMed

    Boeckstaens, Mélanie; Merhi, Ahmad; Llinares, Elisa; Van Vooren, Pascale; Springael, Jean-Yves; Wintjens, René; Marini, Anna Maria

    2015-07-01

    Fine-tuning the plasma-membrane permeability to essential nutrients is fundamental to cell growth optimization. Nutritional signals including nitrogen availability are integrated by the TORC1 complex which notably regulates arrestin-mediated endocytosis of amino-acid transporters. Ammonium is a ubiquitous compound playing key physiological roles in many, if not all, organisms. In yeast, it is a preferred nitrogen source transported by three Mep proteins which are orthologues of the mammalian Rhesus factors. By combining genetic, kinetic, biochemical and cell microscopy analyses, the current study reveals a novel mechanism enabling TORC1 to regulate the inherent activity of ammonium transport proteins, independently of arrestin-mediated endocytosis, identifying the still functional orphan Amu1/Par32 as a selective regulator intermediate. We show that, under poor nitrogen supply, the TORC1 effector kinase' Npr1' promotes phosphorylation of Amu1/Par32 which appears mainly cytosolic while ammonium transport proteins are active. Upon preferred nitrogen supplementation, like glutamine or ammonium addition, TORC1 upregulation enables Npr1 inhibition and Amu1/Par32 dephosphorylation. In these conditions, as in Npr1-lacking cells, hypophosphorylated Amu1/Par32 accumulates at the cell surface and mediates the inhibition of specific ammonium transport proteins. We show that the integrity of a conserved repeated motif of Amu1/Par32 is required for the interaction with these transport proteins. This study underscores the diversity of strategies enabling TORC1-Npr1 to selectively monitor cell permeability to nutrients by discriminating between transporters to be degraded or transiently inactivated and kept stable at the plasma membrane. This study further identifies the function of Amu1/Par32 in acute control of ammonium transport in response to variations in nitrogen availability. PMID:26172854

  15. Identification of a Novel Regulatory Mechanism of Nutrient Transport Controlled by TORC1-Npr1-Amu1/Par32

    PubMed Central

    Boeckstaens, Mélanie; Merhi, Ahmad; Llinares, Elisa; Van Vooren, Pascale; Springael, Jean-Yves; Wintjens, René; Marini, Anna Maria

    2015-01-01

    Fine-tuning the plasma-membrane permeability to essential nutrients is fundamental to cell growth optimization. Nutritional signals including nitrogen availability are integrated by the TORC1 complex which notably regulates arrestin-mediated endocytosis of amino-acid transporters. Ammonium is a ubiquitous compound playing key physiological roles in many, if not all, organisms. In yeast, it is a preferred nitrogen source transported by three Mep proteins which are orthologues of the mammalian Rhesus factors. By combining genetic, kinetic, biochemical and cell microscopy analyses, the current study reveals a novel mechanism enabling TORC1 to regulate the inherent activity of ammonium transport proteins, independently of arrestin-mediated endocytosis, identifying the still functional orphan Amu1/Par32 as a selective regulator intermediate. We show that, under poor nitrogen supply, the TORC1 effector kinase' Npr1' promotes phosphorylation of Amu1/Par32 which appears mainly cytosolic while ammonium transport proteins are active. Upon preferred nitrogen supplementation, like glutamine or ammonium addition, TORC1 upregulation enables Npr1 inhibition and Amu1/Par32 dephosphorylation. In these conditions, as in Npr1-lacking cells, hypophosphorylated Amu1/Par32 accumulates at the cell surface and mediates the inhibition of specific ammonium transport proteins. We show that the integrity of a conserved repeated motif of Amu1/Par32 is required for the interaction with these transport proteins. This study underscores the diversity of strategies enabling TORC1-Npr1 to selectively monitor cell permeability to nutrients by discriminating between transporters to be degraded or transiently inactivated and kept stable at the plasma membrane. This study further identifies the function of Amu1/Par32 in acute control of ammonium transport in response to variations in nitrogen availability. PMID:26172854

  16. Superacid-promoted additions involving vinyl-substituted pyrimidines, quinoxalines, and quinazolines: mechanisms correlated to charge distributions

    PubMed Central

    Zhang, Yiliang; Sheets, Matthew R.; Raja, Erum K.; Boblak, Kenneth N.

    2011-01-01

    The superacid-promoted reactions of vinyl-substituted N-heterocycles have been studied. Diprotonated pyrimidines, quinoxalines, and quinazolines exhibit an unusual regioelectronic effect that controls the type of addition reaction observed. Depending on the ring position of the vinyl-substituent, either conjugate addition or Markovnikov addition occurs. The mode of addition has been shown to correlate well to NBO calculated charges. PMID:21548654

  17. Regulatory RNAs

    PubMed Central

    Vazquez-Anderson, Jorge; Contreras, Lydia M

    2013-01-01

    RNAs have many important functional properties, including that they are independently controllable and highly tunable. As a result of these advantageous properties, their use in a myriad of sophisticated devices has been widely explored. Yet, the exploitation of RNAs for synthetic applications is highly dependent on the ability to characterize the many new molecules that continue to be discovered by large-scale sequencing and high-throughput screening techniques. In this review, we present an exhaustive survey of the most recent synthetic bacterial riboswitches and small RNAs while emphasizing their virtues in gene expression management. We also explore the use of these RNA components as building blocks in the RNA synthetic biology toolbox and discuss examples of synthetic RNA components used to rewire bacterial regulatory circuitry. We anticipate that this field will expand its catalog of smart devices by mimicking and manipulating natural RNA mechanisms and functions. PMID:24356572

  18. Mechanisms of impaired regulation by CD4+CD25+FOXP3+ regulatory T cells in human autoimmune diseases

    PubMed Central

    Buckner, Jane Hoyt

    2011-01-01

    A lack of regulatory T (TReg) cells that express CD4, CD25 and forkhead box P3 (FOXP3) results in severe autoimmunity in both mice and humans. Since the discovery of TReg cells, there has been intense investigation aimed at determining how they protect an organism from autoimmunity and whether defects in their number or function contribute to the development of autoimmunity in model systems. The next phase of investigation — that is, to define the role that defects in TReg cells have in human autoimmunity — is now underway. This Review summarizes our progress so far towards understanding the role of CD4+CD25+FOXP3+ TReg cells in human autoimmune diseases and the impact that this knowledge might have on the diagnosis and treatment of these diseases. PMID:21107346

  19. FarR regulates the farAB-encoded efflux pump of Neisseria gonorrhoeae via an MtrR regulatory mechanism.

    PubMed

    Lee, E-H; Rouquette-Loughlin, C; Folster, J P; Shafer, W M

    2003-12-01

    The farAB operon of Neisseria gonorrhoeae encodes an efflux pump which mediates gonococcal resistance to antibacterial fatty acids. It was previously observed that expression of the farAB operon was positively regulated by MtrR, which is a repressor of the mtrCDE-encoded efflux pump system (E.-H. Lee and W. M. Shafer, Mol. Microbiol. 33:839-845, 1999). This regulation was believed to be indirect since MtrR did not bind to the farAB promoter. In this study, computer analysis of the gonococcal genome sequence database, lacZ reporter fusions, and gel mobility shift assays were used to elucidate the regulatory mechanism by which expression of the farAB operon is modulated by MtrR in gonococci. We identified a regulatory protein belonging to the MarR family of transcriptional repressors and found that it negatively controls expression of farAB by directly binding to the farAB promoter. We designated this regulator FarR to signify its role in regulating the farAB operon. We found that MtrR binds to the farR promoter, thereby repressing farR expression. Hence, MtrR regulates farAB in a positive fashion by modulating farR expression. This MtrR regulatory cascade seems to play an important role in adjusting levels of the FarAB and MtrCDE efflux pumps to prevent their excess expression in gonococci. PMID:14645274

  20. Temperature controls on the basal emission rate of isoprene in a tropical tree Ficus septica: exploring molecular regulatory mechanisms.

    PubMed

    Mutanda, Ishmael; Inafuku, Masashi; Saitoh, Seikoh; Iwasaki, Hironori; Fukuta, Masakazu; Watanabe, Keiichi; Oku, Hirosuke

    2016-10-01

    Isoprene emission from plants is very sensitive to environmental temperature both at short-term and long-term scales. Our previous study demonstrated suppression of isoprene emission by cold temperatures in a high emitting tropical tree Ficus septica and revealed a strong correlation of emission to isoprene synthase (IspS) protein levels. When challenged with decreasing daily temperatures from 30 to 12 °C, F. septica completely stopped isoprene emission at 12 °C, only to recover on the second day after re-exposure to 30 °C. Here, we explored this regulation of isoprene emission in response to environmental temperature by a comprehensive analysis of transcriptome data, gene expressions and metabolite pools of the 2-C-methyl-D-erythritol 4-phosphate (MEP) pathway. MEP pathway genes and metabolites dynamics did not support substrate-level limitations as major control over observed basal emission, but transcriptome data, network inferences and putative regulatory elements on IspS promoter suggested transcriptional regulation of IspS gene through circadian rhythm and phytohormone signalling processes. Expression levels of 29 genes involved in these pathways were examined by quantitative real-time PCR. We propose that temperature controls over basal isoprene emission at a time-scale of hours to few days are regulated by phytohormone-mediated transcriptional modulation of IspS gene under synchronization by the circadian clock. PMID:27425779

  1. Characterization of microRNA expression in bovine adipose tissues: a potential regulatory mechanism of subcutaneous adipose tissue development

    PubMed Central

    2010-01-01

    Background MicroRNAs (miRNAs), a family of small non-coding RNA molecules, appear to regulate animal lipid metabolism and preadipocyte conversion to form lipid-assimilating adipocytes (i.e. adipogenesis). However, no miRNA to date has been reported to modulate adipogenesis and lipid deposition in beef cattle. Results The expression patterns of 89 miRNAs including four bovine specific miRNAs in subcutaneous adipose tissues from three groups of crossbred steers differing in backfat thickness were compared using qRT-PCR analysis. Eighty-six miRNAs were detectable in all samples, with 42 miRNAs differing among crossbreds (P < 0.05) and 15 miRNAs differentially expressed between tissues with high and low backfat thickness (P < 0.05). The expression levels of 18 miRNAs were correlated with backfat thickness (P < 0.05). The miRNA most differentially expressed and the most strongly associated with backfat thickness was miR-378, with a 1.99-fold increase in high backfat thickness tissues (r = 0.72). Conclusions MiRNA expression patterns differed significantly in response to host genetic components. Approximately 20% of the miRNAs in this study were identified as being correlated with backfat thickness. This result suggests that miRNAs may play a regulatory role in white adipose tissue development in beef animals. PMID:20423511

  2. Simultaneous coexpression of Borrelia burgdorferi Erp proteins occurs through a specific, erp locus-directed regulatory mechanism.

    PubMed

    El-Hage, Nazira; Stevenson, Brian

    2002-08-01

    An individual Borrelia burgdorferi bacterium can encode as many as 13 different Erp (OspE/F-related) proteins from mono-and bicistronic loci that are carried on up to 10 separate plasmids. We demonstrate through multilabel immunofluorescence analyses that individual bacteria simultaneously coexpress their entire Erp protein repertoire. While it has been proposed that B. burgdorferi controls expression of Erp and other plasmid-encoded proteins through changes in DNA topology, we observed regulated Erp expression in the absence of detectable differences in DNA supercoiling. Likewise, inhibition of DNA gyrase had no detectable effect on Erp expression. Furthermore, expression of loci physically adjacent to erp loci was observed to be independently regulated. It is concluded that Erp expression is regulated by a mechanism(s) directed at erp loci and not by a global, plasmid-wide mechanism. PMID:12142424

  3. Inference of the Arabidopsis Lateral Root Gene Regulatory Network Suggests a Bifurcation Mechanism That Defines Primordia Flanking and Central Zones[OPEN

    PubMed Central

    Lavenus, Julien; Goh, Tatsuaki; Guyomarc’h, Soazig; Hill, Kristine; Lucas, Mikael; Voß, Ute; Kenobi, Kim; Wilson, Michael H.; Farcot, Etienne; Hagen, Gretchen; Guilfoyle, Thomas J.; Fukaki, Hidehiro; Laplaze, Laurent; Bennett, Malcolm J.

    2015-01-01

    A large number of genes involved in lateral root (LR) organogenesis have been identified over the last decade using forward and reverse genetic approaches in Arabidopsis thaliana. Nevertheless, how these genes interact to form a LR regulatory network largely remains to be elucidated. In this study, we developed a time-delay correlation algorithm (TDCor) to infer the gene regulatory network (GRN) controlling LR primordium initiation and patterning in Arabidopsis from a time-series transcriptomic data set. The predicted network topology links the very early-activated genes involved in LR initiation to later expressed cell identity markers through a multistep genetic cascade exhibiting both positive and negative feedback loops. The predictions were tested for the key transcriptional regulator AUXIN RESPONSE FACTOR7 node, and over 70% of its targets were validated experimentally. Intriguingly, the predicted GRN revealed a mutual inhibition between the ARF7 and ARF5 modules that would control an early bifurcation between two cell fates. Analyses of the expression pattern of ARF7 and ARF5 targets suggest that this patterning mechanism controls flanking and central zone specification in Arabidopsis LR primordia. PMID:25944102

  4. Casein films: effects of formulation, environmental conditions, and addition of citric pectin on the structure and mechanical properties

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Thin casein films for food packaging applications reportedly possess good strength and low oxygen permeability, but low water-resistance and elasticity. Modifying and customizing the mechanical properties of the films to target specific behaviors depending on environmental conditions would enable a...

  5. Selective laser melting additive manufactured Inconel 718 superalloy parts: High-temperature oxidation property and its mechanisms

    NASA Astrophysics Data System (ADS)

    Jia, Qingbo; Gu, Dongdong

    2014-10-01

    This work presented a comprehensive study of high-temperature oxidation behaviors and mechanisms of Selective laser melting (SLM) processed Inconel 718 superalloy parts using different methods including isothermal oxidation testing, X-ray diffraction, scanning electron microscopy and energy dispersive X-ray spectroscopy. The experimental results revealed that the oxidation process of the tested parts processed at a lower volumetric laser energy density experienced the severe spallation. On reasonably increasing the applied volumetric laser energy density, the oxidation kinetics of the as-produced parts obeyed a parabolic law, exhibiting the significantly improved oxidation resistance performance. The constitutional phases within the oxidation film were identified and the corresponding formation mechanisms were elucidated in detail according to the thermodynamic principles. The cross-sectional morphologies of oxidized Inconel 718 parts indicated that the oxidation microstructure mainly consisted of an external oxidation layer and an internal oxidation zone. The oxidation process was controlled by the outward diffusion of oxide forming elements and inward penetration of oxygen, by which the interaction mechanisms between the microstructures and internal oxidation zones were clarified. On the basis of the experimental results and theoretical analyses, the physical oxidation mechanisms were accordingly established to illustrate the oxidation behaviors of SLM-processed Inconel 718 parts at elevated operative temperatures.

  6. Reovirus μ2 Protein Inhibits Interferon Signaling through a Novel Mechanism Involving Nuclear Accumulation of Interferon Regulatory Factor 9▿

    PubMed Central

    Zurney, Jennifer; Kobayashi, Takeshi; Holm, Geoffrey H.; Dermody, Terence S.; Sherry, Barbara

    2009-01-01

    The secreted cytokine alpha/beta interferon (IFN-α/β) binds its receptor to activate the Jak-STAT signal transduction pathway, leading to formation of the heterotrimeric IFN-stimulated gene factor 3 (ISGF3) transcription complex for induction of IFN-stimulated genes (ISGs) and establishment of an antiviral state. Many viruses have evolved countermeasures to inhibit the IFN pathway, thereby subverting the innate antiviral response. Here, we demonstrate that the mildly myocarditic reovirus type 1 Lang (T1L), but not the nonmyocarditic reovirus type 3 Dearing, represses IFN induction of a subset of ISGs and that this repressor function segregates with the T1L M1 gene. Concordantly, the T1L M1 gene product, μ2, dramatically inhibits IFN-β-induced reporter gene expression. Surprisingly, T1L infection does not degrade components of the ISGF3 complex or interfere with STAT1 or STAT2 nuclear translocation as has been observed for other viruses. Instead, infection with T1L or reassortant or recombinant viruses containing the T1L M1 gene results in accumulation of interferon regulatory factor 9 (IRF9) in the nucleus. This effect has not been previously described for any virus and suggests that μ2 modulates IRF9 interactions with STATs for both ISGF3 function and nuclear export. The M1 gene is a determinant of virus strain-specific differences in the IFN response, which are linked to virus strain-specific differences in induction of murine myocarditis. We find that virus-induced myocarditis is associated with repression of IFN function, providing new insights into the pathophysiology of this disease. Together, these data provide the first report of an increase in IRF9 nuclear accumulation associated with viral subversion of the IFN response and couple virus strain-specific differences in IFN antagonism to the pathogenesis of viral myocarditis. PMID:19109390

  7. “Curcumin, the King of Spices”: Epigenetic Regulatory Mechanisms in the Prevention of Cancer, Neurological, and Inflammatory Diseases

    PubMed Central

    Boyanapalli, Sarandeep S. S.

    2015-01-01

    Curcumin (diferuloylmethane), a polyphenolic compound, is a component of Curcuma longa, commonly known as turmeric. It is a well-known anti-inflammatory, anti-oxidative, and anti-lipidemic agent and has recently been shown to modulate several diseases via epigenetic regulation. Many recent studies have demonstrated the role of epigenetic inactivation of pivotal genes that regulate human pathologies, such as neurocognitive disorders, inflammation, obesity, and cancers. Epigenetic changes involve changes in DNA methylation, histone modifications, or altered microRNA expression patterns which are known to be interconnected and play a key role in tumor progression and failure of conventional chemotherapy. The majority of epigenetic changes are influenced by lifestyle and diets. In this regard, dietary phytochemicals as dietary supplements have emerged as a promising source that are able to reverse these epigenetic alterations, to actively regulate gene expression and molecular targets that are known to promote tumorigenesis, and also to prevent age-related diseases through epigenetic modifications. There have been several studies which reported the role of curcumin as an epigenetic regulator in neurological disorders, inflammation, and in diabetes apart from cancers. The epigenetic regulatory roles of curcumin include (1) inhibition of DNA methyltransferases (DNMTs), which has been well defined from the recent studies on its function as a DNA hypomethylating agent; (2) regulation of histone modifications via regulation of histone acetyltransferases (HATs) and histone deacetylases (HDACs); and (3) regulation of micro RNAs (miRNA). This review summarizes the current knowledge on the effect of curcumin in the treatment and/or prevention of inflammation, neurodegenerative diseases, and cancers by regulating histone deacetylases, histone acetyltransferases, and DNA methyltransferases. PMID:26457241

  8. The mechanism of deceleration of nucleation and crystal growth by the small addition of transition metals to lithium disilicate glasses

    PubMed Central

    Thieme, Katrin; Avramov, Isak; Rüssel, Christian

    2016-01-01

    The addition of small amounts of niobium or tantalum oxide to lithium disilicate glass provokes a drastic decrease of the steady-state nucleation rates and the crystal growth velocities. The viscosity of the residual glassy matrix is considered as a function of the crystallization degree in the course of a non-isothermal crystallization. For simplification, a homogeneous distribution of the added oxides in the glass matrix is assumed. While the viscosity initially decreases, it significantly increases again for higher crystallization degrees hindering crystal growth. However, it was shown that the additives are enriched at the crystal interface. Several possible reasons for the inhibition of nucleation and growth kinetics such as viscosity, interfacial energy crystal/glassy phase, thermodynamic driving force or impingement rate are discussed. Since the crystallization front is blocked by the additives the impingement rate is decreased with increasing additive concentration. Since small concentrations of Nb2O5 and Ta2O5 have a drastic effect on the nucleation, these components should be enriched at the interface crystal/glass. This will only take place, if it leads to a decrease in the interfacial energy. Since this effect alone should result in an increase of the nucleation rate, it must be overcompensated by kinetic effects. PMID:27150844

  9. Anti-Wear Performance and Mechanism of an Oil-Miscible Ionic Liquid as a Lubricant Additive

    SciTech Connect

    Qu, Jun; Bansal, Dinesh G; Yu, Bo; Howe, Jane Y; Luo, Huimin; Dai, Sheng; Li, Huaqing; Blau, Peter Julian; Bunting, Bruce G; Mordukhovich, Gregory; Smolenski, Donald

    2012-01-01

    An ionic liquid (IL) trihexyltetradecylphosphonium bis(2-ethylhexyl) phosphate has been investigated as a potential anti-wear lubricant additive. Unlike most other ILs that have very low solubility in non-polar fluids, this IL is fully miscible with various hydrocarbon oils. In addition, it is thermally stable up to 347 oC, showed no corrosive attack to cast iron in ambient environment, and has excellent wettability on solid surfaces (e.g., contact angle on cast iron <8o). Most importantly, this phosphonium-based IL has demonstrated effective anti-scuffing and anti-wear characteristics when blended with lubricating oils. For example, a 5 wt.% addition into a synthetic base oil eliminated the scuffing failure experienced by the neat oil and, as a result, reduced the friction coefficient by 60% and the wear rate by three orders of magnitude. A synergistic effect on wear protection was observed with the current anti-wear additive when added into a fully-formulated engine oil. Nanostructure examination and composition analysis revealed a tribo-boundary film and subsurface plastic deformation zone for the metallic surface lubricated by the IL-containing lubricants. This protective boundary film is believed to be responsible for the IL s anti-scuffing and anti-wear functionality.

  10. The mechanism of deceleration of nucleation and crystal growth by the small addition of transition metals to lithium disilicate glasses.

    PubMed

    Thieme, Katrin; Avramov, Isak; Rüssel, Christian

    2016-01-01

    The addition of small amounts of niobium or tantalum oxide to lithium disilicate glass provokes a drastic decrease of the steady-state nucleation rates and the crystal growth velocities. The viscosity of the residual glassy matrix is considered as a function of the crystallization degree in the course of a non-isothermal crystallization. For simplification, a homogeneous distribution of the added oxides in the glass matrix is assumed. While the viscosity initially decreases, it significantly increases again for higher crystallization degrees hindering crystal growth. However, it was shown that the additives are enriched at the crystal interface. Several possible reasons for the inhibition of nucleation and growth kinetics such as viscosity, interfacial energy crystal/glassy phase, thermodynamic driving force or impingement rate are discussed. Since the crystallization front is blocked by the additives the impingement rate is decreased with increasing additive concentration. Since small concentrations of Nb2O5 and Ta2O5 have a drastic effect on the nucleation, these components should be enriched at the interface crystal/glass. This will only take place, if it leads to a decrease in the interfacial energy. Since this effect alone should result in an increase of the nucleation rate, it must be overcompensated by kinetic effects. PMID:27150844

  11. Densification of Reaction Bonded Silicon Nitride with the Addition of Fine Si Powder Effects on the Sinterability and Mechanical Properties

    SciTech Connect

    Lee, Sea-Hoon; Cho, Chun-Rae; Park, Young-Jo; Ko, Jae-Woong; Kim, Hai-Doo; Lin, Hua-Tay; Becher, Paul F

    2013-01-01

    The densification behavior and strength of sintered reaction bonded silicon nitrides (SRBSN) that contain Lu2O3-SiO2 additives were improved by the addition of fine Si powder. Dense specimens (relative density: 99.5%) were obtained by gas-pressure sintering (GPS) at 1850oC through the addition of fine Si. In contrast, the densification of conventional specimens did not complete at 1950oC. The fine Si decreased the onset temperature of shrinkage and increased the shrinkage rate because the additive helped the compaction of green bodies and induced the formation of fine Si3N4 particles after nitridation and sintering at and above 1600oC. The amount of residual SiO2 within the specimens was not strongly affected by adding fine Si powder because most of the SiO2 layer that had formed on the fine Si particles decomposed during nitridation. The maximum strength and fracture toughness of the specimens were 991 MPa and 8.0 MPa m1/2, respectively.

  12. FGF23-Associated Tumor-Induced Osteomalacia in a Patient With Small Cell Carcinoma: A Case Report and Regulatory Mechanism Study.

    PubMed

    Sauder, Adrienne; Wiernek, Szymon; Dai, Xumin; Pereira, Renata; Yudd, Michael; Patel, Charvi; Golden, Andrew; Ahmed, Shahida; Choe, Jin; Chang, Victor; Sender, Slawomir; Cai, Donghong

    2016-04-01

    Tumor-induced osteomalacia (TIO) is typically caused by phosphaturic mesenchymal tumor (PMT) that secretes the phosphaturic hormone, fibroblast growth factor-23 (FGF23), resulting in decreased phosphate reabsorption in kidneys, hypophosphatemia, and finally osteomalacia. Rare cases of malignant tumor manifesting with TIO other than PMT had been reported, although in most of these reports, except one, circulating FGF23 levels were not evaluated and tissue expressing of FGF23 was not confirmed. In this article, we report a case of TIO in a patient with pulmonary small cell carcinoma with liver metastasis. The patient manifested with hypophosphatemia. His circulating level of FGF23 was markedly increased. The expression of FGF23 in tumor cells was confirmed. Furthermore, the regulatory mechanism of FGF23 in this patient was also investigated. PMID:26612848

  13. Stimulation of beta(1----3)glucan synthetase of various fungi by nucleoside triphosphates: generalized regulatory mechanism for cell wall biosynthesis.

    PubMed Central

    Szaniszlo, P J; Kang, M S; Cabib, E

    1985-01-01

    Particulate fractions from the taxonomically diverse fungi Achlya ambisexualis, Hansenula anomala, Neurospora crassa, Cryptococcus laurentii, Schizophyllum commune, and Wangiella dermatitidis were found to catalyze the time-dependent incorporation of glucose from UDP-[14C]glucose into a water-insoluble material. The reaction was stimulated by bovine serum albumin. The product was characterized as beta(1----3)glucan on the basis of its resistance to alpha- and beta-amylase and susceptibility to beta(1----3)glucanase. With the exception of the preparation from A. ambisexualis, all others were stimulated by nucleoside triphosphates and their analogs. The best activators were GTP and guanosine 5'-(gamma-thio)triphosphate. It is concluded that the stimulation by nucleotides, previously found with the glucan synthetase of Saccharomyces cerevisiae, is a regulatory mechanism that was well conserved during fungal evolution, presumably because of its importance in controlling cell wall biosynthesis and cell growth. PMID:3156122

  14. Potential of acute phase proteins as predictor of postpartum uterine infections during transition period and its regulatory mechanism in dairy cattle.

    PubMed

    Manimaran, A; Kumaresan, A; Jeyakumar, S; Mohanty, T K; Sejian, V; Kumar, Narender; Sreela, L; Prakash, M Arul; Mooventhan, P; Anantharaj, A; Das, D N

    2016-01-01

    Among the various systemic reactions against infection or injury, the acute phase response is the cascade of reaction and mostly coordinated by cytokines-mediated acute phase proteins (APPs) production. Since APPs are sensitive innate immune molecules, they are useful for early detection of inflammation in bovines and believed to be better discriminators than routine hematological parameters. Therefore, the possibility of using APPs as a diagnostic and prognostic marker of inflammation in major bovine health disorders including postpartum uterine infection has been explored by many workers. In this review, we discussed specifically importance of postpartum uterine infection, the role of energy balance in uterine infections and potential of APPs as a predictor of postpartum uterine infections during the transition period and its regulatory mechanism in dairy cattle. PMID:27051191

  15. Potential of acute phase proteins as predictor of postpartum uterine infections during transition period and its regulatory mechanism in dairy cattle

    PubMed Central

    Manimaran, A.; Kumaresan, A.; Jeyakumar, S.; Mohanty, T. K.; Sejian, V.; Kumar, Narender; Sreela, L.; Prakash, M. Arul; Mooventhan, P.; Anantharaj, A.; Das, D. N.

    2016-01-01

    Among the various systemic reactions against infection or injury, the acute phase response is the cascade of reaction and mostly coordinated by cytokines-mediated acute phase proteins (APPs) production. Since APPs are sensitive innate immune molecules, they are useful for early detection of inflammation in bovines and believed to be better discriminators than routine hematological parameters. Therefore, the possibility of using APPs as a diagnostic and prognostic marker of inflammation in major bovine health disorders including postpartum uterine infection has been explored by many workers. In this review, we discussed specifically importance of postpartum uterine infection, the role of energy balance in uterine infections and potential of APPs as a predictor of postpartum uterine infections during the transition period and its regulatory mechanism in dairy cattle. PMID:27051191

  16. To gate, or not to gate: regulatory mechanisms for intercellular protein transport and virus movement in plants.

    PubMed

    Ueki, Shoko; Citovsky, Vitaly

    2011-09-01

    Cell-to-cell signal transduction is vital for orchestrating the whole-body physiology of multi-cellular organisms, and many endogenous macromolecules, proteins, and nucleic acids function as such transported signals. In plants, many of these molecules are transported through plasmodesmata (Pd), the cell wall-spanning channel structures that interconnect plant cells. Furthermore, Pd also act as conduits for cell-to-cell movement of most plant viruses that have evolved to pirate these channels to spread the infection. Pd transport is presumed to be highly selective, and only a limited repertoire of molecules is transported through these channels. Recent studies have begun to unravel mechanisms that actively regulate the opening of the Pd channel to allow traffic. This macromolecular transport between cells comprises two consecutive steps: intracellular targeting to Pd and translocation through the channel to the adjacent cell. Here, we review the current knowledge of molecular species that are transported though Pd and the mechanisms that control this traffic. Generally, Pd traffic can occur by passive diffusion through the trans-Pd cytoplasm or through the membrane/lumen of the trans-Pd ER, or by active transport that includes protein-protein interactions. It is this latter mode of Pd transport that is involved in intercellular traffic of most signal molecules and is regulated by distinct and sometimes interdependent mechanisms, which represent the focus of this article. PMID:21746703

  17. The Allosteric Regulatory Mechanism of the Escherichia coli MetNI Methionine ATP Binding Cassette (ABC) Transporter*

    PubMed Central

    Yang, Janet G.; Rees, Douglas C.

    2015-01-01

    The MetNI methionine importer of Escherichia coli, an ATP binding cassette (ABC) transporter, uses the energy of ATP binding and hydrolysis to catalyze the high affinity uptake of d- and l-methionine. Early in vivo studies showed that the uptake of external methionine is repressed by the level of the internal methionine pool, a phenomenon termed transinhibition. Our understanding of the MetNI mechanism has thus far been limited to a series of crystal structures in an inward-facing conformation. To understand the molecular mechanism of transinhibition, we studied the kinetics of ATP hydrolysis using detergent-solubilized MetNI. We find that transinhibition is due to noncompetitive inhibition by l-methionine, much like a negative feedback loop. Thermodynamic analyses revealed two allosteric methionine binding sites per transporter. This quantitative analysis of transinhibition, the first to our knowledge for a structurally defined transporter, builds upon the previously proposed structurally based model for regulation. This mechanism of regulation at the transporter activity level could be applicable to not only ABC transporters but other types of membrane transporters as well. PMID:25678706

  18. Effects of silicon additions on oxidation and mechanical behavior of the nickel-base superalloy B-1900

    NASA Technical Reports Server (NTRS)

    Miner, R. V., Jr.; Lowell, C. E.

    1975-01-01

    Test specimens with nominal additions of Si were tested in oxidation, thermal fatigue, sulfidation, tension, and stress rupture, and were also extensively studied metallographically. Alloy B-1900 modified with 0.6- or 1.2-wt% Si exhibited oxidation resistance equivalent to that of aluminide-coated B-1900 during cyclic, high-gas-velocity oxidation tests. Resistances to thermal fatigue and sulfidation were improved by the Si additions, but were not superior to aluminide-coated B-1900. Stress-rupture tests at 1000 C of specimens given the standard heat treatment to simulate an aluminide coating cycle showed Si to be detrimental. However, application of another heat treatment increased the rupture life of the alloy with 0.6-wt% Si to that of the unmodified B-1900 given the standard heat treatment.

  19. Mechanism of NHC-Catalyzed Conjugate Additions of Diboron and Borosilane Reagents to α,β-Unsaturated Carbonyl Compounds.

    PubMed

    Wu, Hao; Garcia, Jeannette M; Haeffner, Fredrik; Radomkit, Suttipol; Zhugralin, Adil R; Hoveyda, Amir H

    2015-08-26

    Broadly applicable enantioselective C-B and C-Si bond-forming processes catalyzed by an N-heterocyclic carbene (NHC) were recently introduced; these boryl and silyl conjugate addition reactions (BCA and SCA, respectively), which proceed without the need for a transition-metal complex, represent reaction pathways that are distinct from those facilitated by transition-metal-containing species (e.g., Cu, Ni, Pt, Pd, or Rh based). The Lewis-base-catalyzed (NHC) transformations are valuable to chemical synthesis, as they can generate high enantioselectivities and possess unique chemoselectivity profiles. Here, the results of investigations that elucidate the principal features of the NHC-catalyzed BCA and SCA processes are detailed. Spectroscopic evidence is provided illustrating why the presence of excess base and MeOH or H2O is required for efficient and enantioselective boryl and silyl addition reactions. It is demonstrated that the proton sources influence the efficiency and/or enantioselectivity of NHC-catalyzed enantioselective transformations in several ways. The positive, and at times adverse, impact of water (biphasic conditions) on catalytic enantioselective silyl addition reactions is analyzed. It is shown that a proton source can facilitate nonenantioselective background reactions and NHC decomposition, requiring the catalyst to surpass such complications. Stereochemical models are presented that account for the identity of the observed major enantiomers, providing a rationale for the differences in selectivity profiles of BCA and SCA processes. PMID:26263513

  20. Assessment of Physical and Mechanical Properties of Cement Panel Influenced by Treated and Untreated Coconut Fiber Addition

    NASA Astrophysics Data System (ADS)

    Abdullah, Alida; Jamaludin, Shamsul Baharin; Anwar, Mohamed Iylia; Noor, Mazlee Mohd; Hussin, Kamarudin

    This project was conducted to produce a cement panel with the addition of treated and untreated coconut fiber in cement panel. Coconut fiber was added to replace coarse aggregate (sand) in this cement panel. In this project, the ratios used to design the mixture were 1:1:0, 1:0.97:0.03, 1:0.94:0.06, 1:0.91:0.09 (cement: sand: coconut fiber). The water cement ratio was constant at 0.55. The sizes of sample tested were, 160 mm x 40 mm x 40 mm for compression test, and 100 mm x 100 mm x 40 mm for density, moisture content and water absorption tests. After curing samples for 28 days, it was found that the addition of coconut fiber, further increase in compressive strength of cement panel with untreated coconut fiber. Moisture content of cement panel with treated coconut fiber increased with increasing content of coconut fiber whereas water absorption of cement panel with untreated coconut fiber increased with increasing content of coconut fiber. The density of cement panel decreased with the addition of untreated and treated coconut fiber.

  1. Improvement of mechanical and biological properties of TiNi alloys by addition of Cu and Co to orthodontic archwires.

    PubMed

    Phukaoluan, Aphinan; Khantachawana, Anak; Kaewtatip, Pongpan; Dechkunakorn, Surachai; Kajornchaiyakul, Julathep

    2016-09-01

    The purpose of this study was to investigate improved performances of TiNi in order to promote tooth movement. Special attention was paid to the effect on the clinical properties of TiNi of adding Cu and Co to this alloy. Ti49.4Ni50.6, Ti49Ni46Cu5 and Ti50Ni47Co3 (at %) alloys were prepared. Specimens were cold-rolled at 30% reduction and heat-treated at 400°C for 60min. Then, the test results were compared with two types of commercial archwires. The findings showed that superelasticity properties were confirmed in the manufactured commercial alloys at mouth temperature. The difference of stress plateau in TiNi, TiNiCo and commercial wires B at 25°C changed significantly at various testing temperatures due to the combination of martensite and austenite phases. At certain temperatures the alloys exhibited zero recovery stress at 2% strain and consequently produced zero activation force for moving teeth. The corrosion test showed that the addition of Cu and Co to TiNi alloys generates an increase in corrosion potential (Ecorr) and corrosion current densities (Icorr). Finally, we observed that addition of Cu and Co improved cell viability. We conclude that addition of an appropriate amount of a third alloying element can help enhance the performances of TiNi orthodontic archwires. PMID:27520713

  2. Response of Mg Addition on the Dendritic Structures and Mechanical Properties of Hypoeutectic Al-10Si (Wt Pct) Alloys

    NASA Astrophysics Data System (ADS)

    Karaköse, Ercan; Yildiz, Mehmet; Keskin, Mustafa

    2016-08-01

    Rapidly solidified hypoeutectic Al-10Si- xMg ( x = 0, 5, 10 wt pct) alloys were produced by the melt-spinning method. The phase composition was identified by X-ray diffractometry, and the microstructures of the alloys were characterized by scanning electron microscopy. The melting characteristics were studied by differential scanning calorimetry and differential thermal analysis under an Ar atmosphere. The mechanical properties of the melt-spun and conventionally solidified alloys were tested by tensile-strength and Vickers microhardness tests. The results illustrate that the cooling rate and solidification time of 89 μm thick melt-spun ribbon were estimated to be 2.97 × 107 K s-1 and 9.31 × 10-6 s, respectively. Nanoscale Si spot particles were observed growing on the surface of the dendritic α-Al matrix and the average sizes of these spots ranged from 10 to 50 nm. The improvement in the tensile properties and microhardness was related to structural refinement and the supersaturated α-Al solid solution; the nanoscale-dispersed Si spot particles made a significant improvement to the mechanical properties of the melt-spun ribbon. Detailed electrical resistivity tests of the ribbons were carried out at temperatures of 300 K to 800 K (27 °C to 527 °C).

  3. Response of Mg Addition on the Dendritic Structures and Mechanical Properties of Hypoeutectic Al-10Si (Wt Pct) Alloys

    NASA Astrophysics Data System (ADS)

    Karaköse, Ercan; Yildiz, Mehmet; Keskin, Mustafa

    2016-05-01

    Rapidly solidified hypoeutectic Al-10Si-xMg (x = 0, 5, 10 wt pct) alloys were produced by the melt-spinning method. The phase composition was identified by X-ray diffractometry, and the microstructures of the alloys were characterized by scanning electron microscopy. The melting characteristics were studied by differential scanning calorimetry and differential thermal analysis under an Ar atmosphere. The mechanical properties of the melt-spun and conventionally solidified alloys were tested by tensile-strength and Vickers microhardness tests. The results illustrate that the cooling rate and solidification time of 89 μm thick melt-spun ribbon were estimated to be 2.97 × 107 K s-1 and 9.31 × 10-6 s, respectively. Nanoscale Si spot particles were observed growing on the surface of the dendritic α-Al matrix and the average sizes of these spots ranged from 10 to 50 nm. The improvement in the tensile properties and microhardness was related to structural refinement and the supersaturated α-Al solid solution; the nanoscale-dispersed Si spot particles made a significant improvement to the mechanical properties of the melt-spun ribbon. Detailed electrical resistivity tests of the ribbons were carried out at temperatures of 300 K to 800 K (27 °C to 527 °C).

  4. The mechanism of alkene addition to a nickel bis(dithiolene) complex: the role of the reduced metal complex.

    PubMed

    Dang, Li; Shibl, Mohamed F; Yang, Xinzheng; Alak, Aiman; Harrison, Daniel J; Fekl, Ulrich; Brothers, Edward N; Hall, Michael B

    2012-03-14

    The binding of an alkene by Ni(tfd)(2) [tfd = S(2)C(2)(CF(3))(2)] is one of the most intriguing ligand-based reactions. In the presence of the anionic, reduced metal complex, the primary product is an interligand adduct, while in the absence of the anion, dihydrodithiins and metal complex decomposition products are preferred. New kinetic (global analysis) and computational (DFT) data explain the crucial role of the anion in suppressing decomposition and catalyzing the formation of the interligand product through a dimetallic complex that appears to catalyze alkene addition across the Ni-S bond, leading to a lower barrier for the interligand adduct. PMID:22364208

  5. The influence of α-Al2O3 addition on microstructure, mechanical and formaldehyde adsorption properties of fly ash-based geopolymer products.

    PubMed

    Huang, Yi; Han, Minfang

    2011-10-15

    Fly ash-based geopolymer with α-Al(2)O(3) addition were synthesized and used to remove formaldehyde from indoor air. The microstructure, mechanical and formaldehyde adsorption properties of the geopolymer products obtained were investigated. The results showed that α-Al(2)O(3) addition with appropriate amount (such as 5 wt%) increased the geopolymerization extent, resulting in the increase of surface area and compressive strength. In addition, the improvement of structural ordering level for geopolymer sample with 5 wt% α-Al(2)O(3) addition was found through FTIR analysis. By contrast, excessive addition (such as 10 wt%) had the opposite effect. The test of formaldehyde adsorption capacity confirmed that fly ash-based geopolymer product exhibited much better property of adsorbing indoor formaldehyde physically and chemically than fly ash itself. The surface area was an important but not unique factor influencing the adsorption capacity of geopolymers. PMID:21802843

  6. Mechanism of Regulatory Effect of MicroRNA-206 on Connexin 43 in Distant Metastasis of Breast Cancer

    PubMed Central

    Lin, Zi-Jing; Ming, Jia; Yang, Lu; Du, Jun-Ze; Wang, Ning; Luo, Hao-Jun

    2016-01-01

    Background: MicroRNA-206 (miR-206) and connexin 43 (Cx43) are related with the distant metastasis of breast cancer. It remains unclear whether the regulatory effect of miR-206 on Cx43 is involved in metastasis of breast cancer. Methods: Using quantitative real-time polymerase chain reaction and Western blot, the expressions of miR-206 and Cx43 were determined in breast cancer tissues, hepatic and pulmonary metastasis (PM), and cell lines (MCF-10A, MCF-7, and MDA-MB-231). MCF-7/MDA-M-231 cells were transfected with lentivirus-shRNA vectors to enhance/inhibit miR-206, and then Cx43 expression was observed. Cell counting kit-8 assay and Transwell method were used to detect their changes in proliferation, migration, and invasion activity. The mutant plasmids of Cx43-3’ untranslated region (3’UTR) at position 478–484 and position 1609–1615 were constructed. Luciferase reporter assay was performed to observe the effects of miR-206 on luciferase expression of different mutant plasmids and to confirm the potential binding sites of Cx43. Results: Cx43 protein expression in hepatic and PM was significantly higher than that in the primary tumor, while no significant difference was showed in messenger RNA (mRNA) expression. MiR-206 mRNA expression in hepatic and PM was significantly lower than that in the primary tumor. Cx43 mRNA and protein levels, as well as cell proliferation, migration, and invasion capabilities, were all significantly improved in MDA-MB-231 cells after reducing miR-206 expression but decreased in MCF-7 cells after elevating miR-206 expression, which demonstrated a significantly negative correlation between miR-206 and Cx43 expression (P = 0.03). MiR-206 can drastically decrease Cx43 expression of MCF-7 cells but exerts no effects on Cx43 expression in 293 cells transfected with the Cx43 coding region but the lack of Cx43-3’UTR, suggesting that Cx43-3’UTR may be the key in Cx43 regulated by miR-206. Luciferase expression showed that the

  7. Transcriptomes reveal the genetic mechanisms underlying ionic regulatory adaptations to salt in the crab-eating frog

    PubMed Central

    Shao, Yong; Wang, Li-Jun; Zhong, Li; Hong, Mei-Ling; Chen, Hong-Man; Murphy, Robert W.; Wu, Dong-Dong; Zhang, Ya-Ping; Che, Jing

    2015-01-01

    The crab-eating frog, Fejervarya cancrivora, is the only frog that lives near seas. It tolerates increased environmental concentrations of sodium, chloride and potassium partly by raising ion and urea levels in its blood plasma. The molecular mechanism of the adaptation remains rarely documented. Herein, we analyze transcriptomes of the crab-eating frog and its closely related saline-intolerant species, F. limnocharis, to explore the molecular basis of adaptations to such extreme environmental conditions. Analyses reveal the potential genetic mechanism underlying the adaptation to salinity for the crab-eating frog. Genes in categories associated with ion transport appear to have evolved rapidly in F. cancrivora. Both positively selected and differentially expressed genes exhibit enrichment in the GO category regulation of renal sodium excretion. In this category, the positively selected sites of ANPEP and AVPR2 encode CD13 and V2 receptors, respectively; they fall precisely on conserved domains. More differentially expressed rapidly evolved genes occur in the kidney of F. cancrivora than in F. limnocharis. Four genes involved in the regulation of body fluid levels show signs of positive selection and increased expression. Significant up-regulation occurs in several genes of F. cancrivora associated with renin-angiotensin system and aldosterone-regulated sodium reabsorption pathways, which relate to osmotic regulation. PMID:26619819

  8. Transcriptomes reveal the genetic mechanisms underlying ionic regulatory adaptations to salt in the crab-eating frog.

    PubMed

    Shao, Yong; Wang, Li-Jun; Zhong, Li; Hong, Mei-Ling; Chen, Hong-Man; Murphy, Robert W; Wu, Dong-Dong; Zhang, Ya-Ping; Che, Jing

    2015-01-01

    The crab-eating frog, Fejervarya cancrivora, is the only frog that lives near seas. It tolerates increased environmental concentrations of sodium, chloride and potassium partly by raising ion and urea levels in its blood plasma. The molecular mechanism of the adaptation remains rarely documented. Herein, we analyze transcriptomes of the crab-eating frog and its closely related saline-intolerant species, F. limnocharis, to explore the molecular basis of adaptations to such extreme environmental conditions. Analyses reveal the potential genetic mechanism underlying the adaptation to salinity for the crab-eating frog. Genes in categories associated with ion transport appear to have evolved rapidly in F. cancrivora. Both positively selected and differentially expressed genes exhibit enrichment in the GO category regulation of renal sodium excretion. In this category, the positively selected sites of ANPEP and AVPR2 encode CD13 and V2 receptors, respectively; they fall precisely on conserved domains. More differentially expressed rapidly evolved genes occur in the kidney of F. cancrivora than in F. limnocharis. Four genes involved in the regulation of body fluid levels show signs of positive selection and increased expression. Significant up-regulation occurs in several genes of F. cancrivora associated with renin-angiotensin system and aldosterone-regulated sodium reabsorption pathways, which relate to osmotic regulation. PMID:26619819

  9. Subchromoplast Sequestration of Carotenoids Affects Regulatory Mechanisms in Tomato Lines Expressing Different Carotenoid Gene Combinations[C][W

    PubMed Central

    Nogueira, Marilise; Mora, Leticia; Enfissi, Eugenia M.A.; Bramley, Peter M.; Fraser, Paul D.

    2013-01-01

    Metabolic engineering of the carotenoid pathway in recent years has successfully enhanced the carotenoid contents of crop plants. It is now clear that only increasing biosynthesis is restrictive, as mechanisms to sequestrate these increased levels in the cell or organelle should be exploited. In this study, biosynthetic pathway genes were overexpressed in tomato (Solanum lycopersicum) lines and the effects on carotenoid formation and sequestration revealed. The bacterial Crt carotenogenic genes, independently or in combination, and their zygosity affect the production of carotenoids. Transcription of the pathway genes was perturbed, whereby the tissue specificity of transcripts was altered. Changes in the steady state levels of metabolites in unrelated sectors of metabolism were found. Of particular interest was a concurrent increase of the plastid-localized lipid monogalactodiacylglycerol with carotenoids along with membranous subcellular structures. The carotenoids, proteins, and lipids in the subchromoplast fractions of the transgenic tomato fruit with increased carotenoid content suggest that cellular structures can adapt to facilitate the sequestration of the newly formed products. Moreover, phytoene, the precursor of the pathway, was identified in the plastoglobule, whereas the biosynthetic enzymes were in the membranes. The implications of these findings with respect to novel pathway regulation mechanisms are discussed. PMID:24249831

  10. The improved mechanical properties of β-CaSiO3 bioceramics with Si3N4 addition.

    PubMed

    Pan, Ying; Zuo, Kaihui; Yao, Dongxu; Yin, Jinwei; Xin, Yunchuan; Xia, Yongfeng; Liang, Hanqin; Zeng, Yuping

    2015-03-01

    The motivation of this study is to investigate the effect of Si3N4 addition on the sinterability of β-CaSiO3 ceramics. β-CaSiO3 ceramics with different content of Si3N4 were prepared at the sintering temperature ranging from 1000°C to 1150°C. The results showed that Si3N4 can be successfully used as sintering additive by being oxidized to form SiO2. The β-CaSiO3 ceramics with 3wt% Si3N4 sintered at 1100°C revealed flexural strength, hardness and fracture toughness of 157.2MPa, 4.4GPa and 2.3MPam(1/2) respectively, which was much higher than that of pure β-CaSiO3 ceramics (41.1MPa, 1.0GPa, 1.1MPam(1/2)). XRD analysis and SEM observation indicated that the main phase maintained to be β-phase after sintering. PMID:26580024

  11. Characterization of Mechanics and Cytocompatibility of Fibrin-Genipin Annulus Fibrosus Sealant with the Addition of Cell Adhesion Molecules

    PubMed Central

    Guterl, Clare C.; Torre, Olivia M.; Purmessur, Devina; Dave, Khyati; Likhitpanichkul, Morakot; Hecht, Andrew C.; Nicoll, Steven B.

    2014-01-01

    There is an unmet clinical need for a biomaterial sealant capable of repairing small annulus fibrosus (AF) defects. Causes of these defects include painful intervertebral disc herniations, microdiscectomy procedures, morbidity associated with needle puncture injury from discography, and future nucleus replacement procedures. This study describes the enhancements of a fibrin gel through genipin crosslinking (FibGen) and the addition of the cell adhesion molecules (CAMs), fibronectin and collagen. The gel's performance as a potential AF sealant is assessed using a series of in vitro tests. FibGen gels with CAMs had equivalent adhesive strength, gene expression, cytomorphology, and cell proliferation as fibrin alone. However, FibGen gels had enhanced material behaviors that were tunable to higher shear stiffness values and approximated human annulus tissue as compared with fibrin alone, were more dimensionally stable, and had a slower in vitro degradation rate. Cytomorphology of human AF cells cultured on FibGen gels exhibited increased elongation compared with fibrin alone, and the addition of CAMs to FibGen did not significantly affect elongation. This FibGen gel offers the promise of being used as a sealant material to repair small AF defects or to be used in combination with other biomaterials as an adhesive for larger defects. PMID:24684314

  12. Effects of h-BN addition on microstructures and mechanical properties of β-CaSiO3 bioceramics.

    PubMed

    Pan, Ying; Yao, Dongxu; Zuo, Kaihui; Xia, Yongfeng; Yin, Jinwei; Liang, Hanqin; Zeng, Yuping

    2016-09-01

    The main purpose of this study consists in investigating the effects of h-BN addition on the sinterability of β-CaSiO3 (β-CS) bioceramics. β-CS bioceramics with different contents of h-BN were prepared at the sintering temperature ranging from 800°C to 1100°C. The results showed that h-BN can be successfully used as sintering additive by being oxidized to form low melting point B2O3 related glassy phase and enhanced the flexural strength by the formation of rod-like β-CS grains. β-CS bioceramics with 1wt% h-BN sintered at 1000°C revealed flexural strength and fracture toughness of 182.2MPa and 2.4MPam(1/2) respectively, which were much higher than that of pure β-CS bioceramics (30.2MPa, 0.53MPam(1/2)) fabricated in the same processing condition. PMID:27227289

  13. Influence of Tin Additions on the Phase-Transformation Characteristics of Mechanical Alloyed Cu-Al-Ni Shape-Memory Alloy

    NASA Astrophysics Data System (ADS)

    Saud, Safaa N.; Hamzah, E.; Abubakar, T.; Bakhsheshi-Rad, H. R.; Mohammed, M. N.

    2016-07-01

    The influence of the addition of Sn to Cu-Al-Ni alloy as a fourth element with different percentages of 0.5, 1.0, and 1.5 wt pct on the microstructure, phase-transformation temperatures, mechanical properties, and corrosion behaviors was investigated. The modified and unmodified alloys were fabricated by mechanical alloying followed by microwave sintering. The sintered and homogenized alloys of Cu-Al-Ni-xSn shape-memory alloys had a refined particle structure with an average particle size of 40 to 50 µm associated with an improvement in the mechanical properties and corrosion resistance. With the addition of Sn, the porosity density tends to decrease, which can also lead to improvements in the properties of the modified alloys. The minimum porosity percentage was observed in the Cu-Al-Ni-1.0 wt pct Sn alloy, which resulted in enhancing the ductility, strain recovery, and corrosion resistance. Further increasing the Sn addition to 1.5 wt pct, the strength of the alloy increased because the highest volume fraction of precipitates was formed. Regarding the corrosion behavior, addition of Sn up to 1 wt pct increased the corrosion resistance of the base SMA from 2.97 to 19.20 kΩ cm2 because of formation of a protective film that contains hydrated tin oxyhydroxide, aluminum dihydroxychloride, and copper chloride on the alloy. However, further addition of Sn reduced the corrosion resistance.

  14. Modeling the mechanical and aging properties of silicone rubber and foam - stockpile-historical & additively manufactured materials

    SciTech Connect

    Maiti, A.; Weisgraber, T. H.; Gee, R. H.

    2014-09-30

    M97* and M9763 belong to the M97xx series of cellular silicone materials that have been deployed as stress cushions in some of the LLNL systems. Their purpose of these support foams is to distribute the stress between adjacent components, maintain relative positioning of various components, and mitigate the effects of component size variation due to manufacturing and temperature changes. In service these materials are subjected to a continuous compressive strain over long periods of time. In order to ensure their effectiveness, it is important to understand how their mechanical properties change over time. The properties we are primarily concerned about are: compression set, load retention, and stress-strain response (modulus).

  15. Phosphorylation-dephosphorylation process as a probable mechanism for the diurnal regulatory changes of phosphoenolpyruvate carboxylase in CAM plants.

    PubMed

    Brulfert, J; Vidal, J; Le Marechal, P; Gadal, P; Queiroz, O; Kluge, M; Kruger, I

    1986-04-14

    Day and night forms of phosphoenolpyruvate carboxylase (EC 4.1.1.31) (PEPC) were extracted from leaves of the CAM plants Kalanchoe daigremontiana, K. tubiflora and K. blossfeldiana previously fed with [32P] labelled phosphate solution. A one-step immunochemical purification followed by SDS polyacrylamide gel electrophoresis and autoradiography showed that, in all species, the night form of the enzyme was phosphorylated and not the day form. Limited acid hydrolysis of the night form and two-dimensional separation identified predominantly labelled phosphoserine and phosphothreonine. In vitro addition of exogenous acid phosphatase (EC 3.1.3.2) to desalted night form-containing extracts resulted within 30 min in a shift in PEPC enzymic properties similar to the in vivo changes from night to day form. It is suggested that phosphorylation-dephosphorylation of the enzyme could be the primary in vivo process which might explain the observed rhythmicity of enzymic properties. PMID:3707571

  16. Effect of C and Ce addition on the microstructure and magnetic property of the mechanically alloyed FeSiBAlNi high entropy alloys

    NASA Astrophysics Data System (ADS)

    Xu, Jing; Axinte, Eugen; Zhao, Zhengfeng; Wang, Yan

    2016-09-01

    The effects of elemental addition, C and Ce, on the microstructure, thermal property and magnetic property of mechanically alloyed FeSiBAlNi (based-W5) high entropy alloys (HEAs) have been investigated in depth in the present work. The amorphous HEAs have been successfully fabricated by mechanical alloying. The results reveal that Ce addition obviously shortens the formation time of fully amorphous phase, therefore leading to the enhanced glass forming ability (GFA) of the based-W5. The final products of as-milled FeSiBAlNiC alloy consist of the main amorphous phase and a small amount of Si nanocrystals. In addition, C and Ce addition are both beneficial to enhance the thermal stability. The coercivity force (Hc) of the tested samples lies in the range of 50-378 Oe, suggesting the semi-hard magnetic property. The saturation magnetization (Ms) becomes decreased with increasing the milling time. C addition effectively increases Ms exhibiting the good magnetic property, however, Ce addition presents the negative effect. It should be noted that the amorphous phase tends to be formed when the radius ratio (Rr) is larger than 1, and the GFA is enhanced with increasing Rr and valence electron concentration.

  17. GTP cyclohydrolase I inhibition by the prototypic inhibitor 2, 4-diamino-6-hydroxypyrimidine. Mechanisms and unanticipated role of GTP cyclohydrolase I feedback regulatory protein.

    PubMed

    Xie, L; Smith, J A; Gross, S S

    1998-08-14

    2,4-Diamino-6-hydroxypyrimidine (DAHP) is considered to be a selective and direct-acting inhibitor of GTP cyclohydrolase I (GTPCH), the first and rate-limiting enzyme in the pathway for synthesis of tetrahydrobiopterin (BH4). Accordingly, DAHP has been widely employed to distinguish whether de novo BH4 synthesis is required in a given biological system. Although it has been assumed that DAHP inhibits GTPCH by direct competition with substrate GTP, this has never been formally demonstrated. In view of apparent structural homology between DAHP and BH4, we questioned whether DAHP may mimic BH4 in its inhibition of GTPCH by an indirect mechanism, involving interaction with a recently cloned 9.5-kDa protein termed GTPCH Feedback Regulatory Protein (GFRP). We show by reverse transcription-polymerase chain reaction that GFRP mRNA is constitutively expressed in rat aortic smooth muscle cells and further induced by treatment with immunostimulants. Moreover, functional GFRP is expressed and immunostimulant-induced BH4 accumulates in sufficient quantity to trigger feedback inhibition of GTPCH. Studies with DAHP reveal that GFRP is also essential to achieve potent inhibition of GTPCH. Indeed, DAHP inhibits GTPCH by dual mechanisms. At a relatively low concentration, DAHP emulates BH4 and engages the GFRP-dependent feedback inhibitory system; at higher concentrations, DAHP competes directly for binding with GTP substrate. This knowledge predicts that DAHP would preferably target GTPCH in tissues with abundant GFRP. PMID:9694862

  18. Control of the Inflammatory Response Mechanisms Mediated by Natural and Induced Regulatory T-Cells in HCV-, HTLV-1-, and EBV-Associated Cancers

    PubMed Central

    Moralès, Olivier; Delhem, Nadira

    2014-01-01

    Virus infections are involved in chronic inflammation and, in some cases, cancer development. Although a viral infection activates the immune system's response that eradicates the pathogen mainly through inflammatory mechanisms, it is now recognized that this inflammatory condition is also favorable to the development of tumors. Indeed, it is well described that viruses, such as hepatitis C virus (HCV), Epstein Barr virus (EBV), human papillomavirus (HPV) or human T-cell lymphotropic virus type-1 (HTLV-1), are important risk factors for tumor malignancies. The inflammatory response is a fundamental immune mechanism which involves several molecular and cellular components consisting of cytokines and chemokines that are released by various proinflammatory cells. In parallel to this process, some endogenous recruited components release anti-inflammatory mediators to restore homeostasis. The development of tools and strategies using viruses to hijack the immune response is mostly linked to the presence of regulatory T-cells (Treg) that can inhibit inflammation and antiviral responses of other effector cells. In this review, we will focus on current understanding of the role of natural and induced Treg in the control and the resolution of inflammatory response in HCV-, HTLV-1-, and EBV-associated cancers. PMID:25525301

  19. High-throughput exploration of thermoelectric and mechanical properties of amorphous NbO2 with transition metal additions

    NASA Astrophysics Data System (ADS)

    Music, Denis; Geyer, Richard W.; Hans, Marcus

    2016-07-01

    To increase the thermoelectric efficiency and reduce the thermal fatigue upon cyclic heat loading, alloying of amorphous NbO2 with all 3d and 5d transition metals has systematically been investigated using density functional theory. It was found that Ta fulfills the key design criteria, namely, enhancement of the Seebeck coefficient and positive Cauchy pressure (ductility gauge). These quantum mechanical predictions were validated by assessing the thermoelectric and elastic properties on combinatorial thin films, which is a high-throughput approach. The maximum power factor is 2813 μW m-1 K-2 for the Ta/Nb ratio of 0.25, which is a hundredfold increment compared to pure NbO2 and exceeds many oxide thermoelectrics. Based on the elasticity measurements, the consistency between theory and experiment for the Cauchy pressure was attained within 2%. On the basis of the electronic structure analysis, these configurations can be perceived as metallic, which is consistent with low electrical resistivity and ductile behavior. Furthermore, a pronounced quantum confinement effect occurs, which is identified as the physical origin for the Seebeck coefficient enhancement.

  20. [Effects and mechanism of alkaline wastes application and zinc fertilizer addition on Cd bioavailability in contaminated soil].

    PubMed

    Liu, Zhao-Bing; Ji, Xiong-Hui; Tian, Fa-Xiang; Peng, Hua; Wu, Jia-Mei; Shi, Li-Hong

    2011-04-01

    The effects of paper mill sludge, red mud and zinc fertilizer addition on remediation of acid cadmium contaminated paddy soil were studied in a pot experiment, and their beneficial effects were verified in a field experiment, by using lime as comparison. The pot experiment results showed that a single application (2 g x kg(-1)) of lime, paper mill sludge or red mud increased soil pH significantly. Compared with no applying alkaline substances, the soil exchangeable Ca content was increased by 33.1%-76.0% at 7 days after applying alkaline substances and 31.0%-78.3% at 30 days after rice transplanting, respectively. The soil available Cd content was significantly decreased by 38.4%-45.0% at 7 days after the three alkaline substances applications, and was decreased by 37.4%-52.9% and 33.2%-38.7% at 30 days and 60 days after rice transplanting, respectively. The Cd content in rice root and brown rice was decreased by 24.0%-48.5% and 26.3%-44.7%, respectively. With equal applications of lime, paper mill sludge and red mud, the effects on increase of soil pH and decrease in Cd accumulation by rice was lime > red mud > paper mill sludge. Compared with a single application (2 g x kg(-1)) of paper mill sludge or red mud, Cd accumulation decreased significantly following the application of zinc fertilizer (0.2 g x kg(-1)) field experimental results were similar to the pot experiment that Cd accumulation apparently declined in the first and second crops (late rice and autumn rape) following the application of paper mill sludge, red mud and addition of zinc fertilizer. The Cd content in brown rice and rape seeds was decreased by 27.1-65.1% and 16.4%-41.6%, respectively, compared with no alkaline substances application. The Cd content in brown rice reached the National Hygienic Standard for Grains (GB 2715-2005). Therefore, combined application of paper mill sludge or red mud with zinc fertilizer was a feasible method to remediate acid cadmium contaminated paddy soil. Rice

  1. Deciphering the molecular mechanisms underlying the binding of the TWIST1/E12 complex to regulatory E-box sequences.

    PubMed

    Bouard, Charlotte; Terreux, Raphael; Honorat, Mylène; Manship, Brigitte; Ansieau, Stéphane; Vigneron, Arnaud M; Puisieux, Alain; Payen, Léa

    2016-06-20

    The TWIST1 bHLH transcription factor controls embryonic development and cancer processes. Although molecular and genetic analyses have provided a wealth of data on the role of bHLH transcription factors, very little is known on the molecular mechanisms underlying their binding affinity to the E-box sequence of the promoter. Here, we used an in silico model of the TWIST1/E12 (TE) heterocomplex and performed molecular dynamics (MD) simulations of its binding to specific (TE-box) and modified E-box sequences. We focused on (i) active E-box and inactive E-box sequences, on (ii) modified active E-box sequences, as well as on (iii) two box sequences with modified adjacent bases the AT- and TA-boxes. Our in silico models were supported by functional in vitro binding assays. This exploration highlighted the predominant role of protein side-chain residues, close to the heart of the complex, at anchoring the dimer to DNA sequences, and unveiled a shift towards adjacent ((-1) and (-1*)) bases and conserved bases of modified E-box sequences. In conclusion, our study provides proof of the predictive value of these MD simulations, which may contribute to the characterization of specific inhibitors by docking approaches, and their use in pharmacological therapies by blocking the tumoral TWIST1/E12 function in cancers. PMID:27151200

  2. Comparative transcriptome and metabolome provides new insights into the regulatory mechanisms of accelerated senescence in litchi fruit after cold storage.

    PubMed

    Yun, Ze; Qu, Hongxia; Wang, Hui; Zhu, Feng; Zhang, Zhengke; Duan, Xuewu; Yang, Bao; Cheng, Yunjiang; Jiang, Yueming

    2016-01-01

    Litchi is a non-climacteric subtropical fruit of high commercial value. The shelf life of litchi fruit under ambient conditions (AC) is approximately 4-6 days. Post-harvest cold storage prolongs the life of litchi fruit for up to 30 days with few changes in pericarp browning and total soluble solids. However, the shelf life of litchi fruits at ambient temperatures after pre-cold storage (PCS) is only 1-2 days. To better understand the mechanisms involved in the rapid fruit senescence induced by pre-cold storage, a transcriptome of litchi pericarp was constructed to assemble the reference genes, followed by comparative transcriptomic and metabolomic analyses. Results suggested that the senescence of harvested litchi fruit was likely to be an oxidative process initiated by ABA, including oxidation of lipids, polyphenols and anthocyanins. After cold storage, PCS fruit exhibited energy deficiency, and respiratory burst was elicited through aerobic and anaerobic respiration, which was regulated specifically by an up-regulated calcium signal, G-protein-coupled receptor signalling pathway and small GTPase-mediated signal transduction. The respiratory burst was largely associated with increased production of reactive oxygen species, up-regulated peroxidase activity and initiation of the lipoxygenase pathway, which were closely related to the accelerated senescence of PCS fruit. PMID:26763309

  3. Deciphering the molecular mechanisms underlying the binding of the TWIST1/E12 complex to regulatory E-box sequences

    PubMed Central

    Bouard, Charlotte; Terreux, Raphael; Honorat, Mylène; Manship, Brigitte; Ansieau, Stéphane; Vigneron, Arnaud M.; Puisieux, Alain; Payen, Léa

    2016-01-01

    The TWIST1 bHLH transcription factor controls embryonic development and cancer processes. Although molecular and genetic analyses have provided a wealth of data on the role of bHLH transcription factors, very little is known on the molecular mechanisms underlying their binding affinity to the E-box sequence of the promoter. Here, we used an in silico model of the TWIST1/E12 (TE) heterocomplex and performed molecular dynamics (MD) simulations of its binding to specific (TE-box) and modified E-box sequences. We focused on (i) active E-box and inactive E-box sequences, on (ii) modified active E-box sequences, as well as on (iii) two box sequences with modified adjacent bases the AT- and TA-boxes. Our in silico models were supported by functional in vitro binding assays. This exploration highlighted the predominant role of protein side-chain residues, close to the heart of the complex, at anchoring the dimer to DNA sequences, and unveiled a shift towards adjacent ((-1) and (-1*)) bases and conserved bases of modified E-box sequences. In conclusion, our study provides proof of the predictive value of these MD simulations, which may contribute to the characterization of specific inhibitors by docking approaches, and their use in pharmacological therapies by blocking the tumoral TWIST1/E12 function in cancers. PMID:27151200

  4. Comparative transcriptome and metabolome provides new insights into the regulatory mechanisms of accelerated senescence in litchi fruit after cold storage

    PubMed Central

    Yun, Ze; Qu, Hongxia; Wang, Hui; Zhu, Feng; Zhang, Zhengke; Duan, Xuewu; Yang, Bao; Cheng, Yunjiang; Jiang, Yueming

    2016-01-01

    Litchi is a non-climacteric subtropical fruit of high commercial value. The shelf life of litchi fruit under ambient conditions (AC) is approximately 4–6 days. Post-harvest cold storage prolongs the life of litchi fruit for up to 30 days with few changes in pericarp browning and total soluble solids. However, the shelf life of litchi fruits at ambient temperatures after pre-cold storage (PCS) is only 1–2 days. To better understand the mechanisms involved in the rapid fruit senescence induced by pre-cold storage, a transcriptome of litchi pericarp was constructed to assemble the reference genes, followed by comparative transcriptomic and metabolomic analyses. Results suggested that the senescence of harvested litchi fruit was likely to be an oxidative process initiated by ABA, including oxidation of lipids, polyphenols and anthocyanins. After cold storage, PCS fruit exhibited energy deficiency, and respiratory burst was elicited through aerobic and anaerobic respiration, which was regulated specifically by an up-regulated calcium signal, G-protein-coupled receptor signalling pathway and small GTPase-mediated signal transduction. The respiratory burst was largely associated with increased production of reactive oxygen species, up-regulated peroxidase activity and initiation of the lipoxygenase pathway, which were closely related to the accelerated senescence of PCS fruit. PMID:26763309

  5. Studies on the regulatory effect of Peony-Glycyrrhiza Decoction on prolactin hyperactivity and underlying mechanism in hyperprolactinemia rat model.

    PubMed

    Wang, Di; Wang, Wei; Zhou, Yulin; Wang, Juan; Jia, Dongxu; Wong, Hei Kiu; Zhang, Zhang-Jin

    2015-10-01

    Clinical trials have demonstrated the beneficial effects of Peony-Glycyrrhiza Decoction (PGD) in alleviating antipsychotic-induced hyperprolactinemia (hyperPRL) in schizophrenic patients. In previous experiment, PGD suppressed prolactin (PRL) level in MMQ cells, involving modulating the expression of D2 receptor (DRD2) and dopamine transporter (DAT). In the present study, hyperPRL female rat model induced by dopamine blocker metoclopramide (MCP) was applied to further confirm the anti-hyperpPRL activity of PGD and underlying mechanism. In MCP-induced hyperPRL rats, the elevated serum PRL level was significantly suppressed by either PGD (2.5-10 g/kg) or bromocriptine (BMT) (0.6 mg/kg) administration for 14 days. However, in MCP-induced rats, only PGD restored the under-expressed serum progesterone (P) to control level. Both PGD and BMT administration restore the under-expression of DRD2, DAT and TH resulted from MCP in pituitary gland and hypothalamus. Compared to untreated group, hyperPRL animals had a marked reduction on DRD2 and DAT expression in the arcuate nucleus. PGD (10 g/kg) and BMT (0.6 mg/kg) treatment significant reversed the expression of DRD2 and DAT. Collectively, the anti-hyperPRL activity of PGD associates with the modulation of dopaminergic neuronal system and the restoration of serum progesterone level. Our finding supports PGD as an effective agent against hyperPRL. PMID:26297122

  6. Nek2A phosphorylates and stabilizes SuFu: A new strategy of Gli2/Hedgehog signaling regulatory mechanism.

    PubMed

    Wang, Yao; Li, Yong; Hu, Guanghui; Huang, Xuan; Rao, Hai; Xiong, Xiangyang; Luo, Zhijun; Lu, Quqin; Luo, Shiwen

    2016-09-01

    Suppressor of Fused (SuFu) plays a conservative role in the regulation of the Gli transcription factors within the Hedgehog (Hh) signaling pathway. Despite the central importance of SuFu in the Hh pathway, little is known about its regulation. Here, we performed a GAL4-based yeast two-hybrid screen using human SuFu as bait, and identified NIMA-related expressed kinase 2A (Nek2A) as a new SuFu-interacting protein, which was also confirmed by glutathione-S-transferase pull-down and co-immunoprecipitation assays. Intriguingly, Nek2A is found to stabilize SuFu at least partly depending on its kinase activity, thereby triggering phosphorylation of the SuFu protein. Moreover, the phosphorylated SuFu inhibits the nuclear localization and transcriptional activity of Gli2/Hh signaling. These findings reveal a new mechanism of mammalian SuFu regulation, and offers novel insights into Hh signaling regulation in development and human disease. PMID:27297360

  7. Systems Biological Approaches Reveal Non-additive Responses and Multiple Crosstalk Mechanisms between TLR and GPCR Signaling

    PubMed Central

    Krishnan, Jayalakshmi

    2012-01-01

    A variety of ligands differ in their capacity to bind the receptor, elicit gene expression, and modulate physiological responses. Such receptors include Toll-like receptors (TLRs), which recognize various patterns of pathogens and lead to primary innate immune activation against invaders, and G-protein coupled receptors (GPCRs), whose interaction with their cognate ligands activates heterotrimeric G proteins and regulates specific downstream effectors, including immuno-stimulating molecules. Once TLRs are activated, they lead to the expression of hundreds of genes together and bridge the arm of innate and adaptive immune responses. We characterized the gene expression profile of Toll-like receptor 4 (TLR4) in RAW 264.7 cells when it bound with its ligand, 2-keto-3-deoxyoctonate (KDO), the active part of lipopolysaccharide. In addition, to determine the network communications among the TLR, Janus kinase (JAK)/signal transducer and activator of transcription (STAT), and GPCR, we tested RAW 264.7 cells with KDO, interferon-β, or cAMP analog 8-Br. The ligands were also administered as a pair of double and triple combinations. PMID:23166526

  8. Effects of the addition of casein phosphopeptide-amorphous calcium phosphate (CPP-ACP) on mechanical properties of luting and lining glass ionomer cement

    NASA Astrophysics Data System (ADS)

    Heravi, Farzin; Bagheri, Hossein; Rangrazi, Abdolrasoul; Mojtaba Zebarjad, Seyed

    2016-07-01

    Recently, the addition of casein phosphopeptide-amorphous calcium phosphate (CPP-ACP) into glass ionomer cements (GICs) has attracted interest due to its remineralization of teeth and its antibacterial effects. However, it should be investigated to ensure that the incorporation of CPP-ACP does not have significant adverse effects on its mechanical properties. The purpose of this study was to evaluate the effects of the addition of CPP-ACP on the mechanical properties of luting and lining GIC. The first step was to synthesize the CPP-ACP. Then the CPP-ACP at concentrations of 1%, 1.56% and 2% of CPP-ACP was added into a luting and lining GIC. GIC without CPP-ACP was used as a control group. The results revealed that the incorporation of CPP-ACP up to 1.56%(w/w) increased the flexural strength (29%), diametral tensile strength (36%) and microhardness (18%), followed by a reduction in these mechanical properties at 2%(w/w) CPP-ACP. The wear rate was significantly decreased (23%) in 1.56%(w/w) concentration of CPP-ACP and it was increased in 2%(w/w). Accordingly, the addition of 1.56%(w/w) CPP-ACP into luting and lining GIC had no adverse effect on the mechanical properties of luting and lining GIC and could be used in clinical practice.

  9. Effect of addition of plants-derived polyamide 11 elastomer on the mechanical and tribological properties of hemp fiber reinforced polyamide 1010 composites

    NASA Astrophysics Data System (ADS)

    Mukaida, Jun; Nishitani, Yosuke; Kitano, Takeshi

    2015-05-01

    For the purpose of developing the new engineering materials such as structural materials and tribomaterials based on all plants-derived materials, the effect of the addition of plant-derived polyamide 11 Elastomer (PA11E) on the mechanical and tribological properties of hemp fiber(HF) reinforced polyamide 1010 (HF/PA1010) composites was investigated. PA1010 and PA11E (except the polyether groups used as soft segment) were made from plant-derived castor oil. Hemp fiber was surface-treated by two types of treatment: alkali treatment by NaOH solution and surface treatment by ureido silane coupling agent. HF/PA1010/PA11E ternary composites were extruded by a twin screw extruder and injection-molded. Their mechanical properties such as tensile, bending, Izod impact and tribological properties by ring-on-plate type sliding wear testing were evaluated. The effect of the addition of PA11E on the mechanical and tribological properties of HF/PA1010 composite differed for each property. Izod impact strength and specific wear rate improved with the addition of PA11E although tensile strength, modulus, and friction coefficient decreased with PA11E. It follows from these results that it may be possible to develop the new engineering materials with sufficient balance between mechanical and tribological properties.

  10. Effect of Zr, Nb and Ti addition on injection molded 316L stainless steel for bio-applications: Mechanical, electrochemical and biocompatibility properties.

    PubMed

    Gulsoy, H Ozkan; Pazarlioglu, Serdar; Gulsoy, Nagihan; Gundede, Busra; Mutlu, Ozal

    2015-11-01

    The research investigated the effect of Zr, Nb and Ti additions on mechanical, electrochemical properties and biocompatibility of injection molded 316L stainless steel. Addition of elemental powder is promoted to get high performance of sintered 316L stainless steels. The amount of additive powder plays a role in determining the sintered microstructure and all properties. In this study, 316L stainless steel powders used with the elemental Zr, Nb and Ti powders. A feedstock containing 62.5 wt% powders loading was molded at different injection molded temperature. The binders were completely removed from molded components by solvent and thermal debinding at different temperatures. The debinded samples were sintered at 1350°C for 60 min. Mechanical, electrochemical property and biocompatibility of the sintered samples were performed mechanical, electrochemical, SBF immersion tests and cell culture experiments. Results of study showed that sintered 316L and 316L with additives samples exhibited high corrosion properties and biocompatibility in a physiological environment. PMID:26275484

  11. Lipid binding by the Unique and SH3 domains of c-Src suggests a new regulatory mechanism

    PubMed Central

    Pérez, Yolanda; Maffei, Mariano; Igea, Ana; Amata, Irene; Gairí, Margarida; Nebreda, Angel R.; Bernadó, Pau; Pons, Miquel

    2013-01-01

    c-Src is a non-receptor tyrosine kinase involved in numerous signal transduction pathways. The kinase, SH3 and SH2 domains of c-Src are attached to the membrane-anchoring SH4 domain through the flexible Unique domain. Here we show intra- and intermolecular interactions involving the Unique and SH3 domains suggesting the presence of a previously unrecognized additional regulation layer in c-Src. We have characterized lipid binding by the Unique and SH3 domains, their intramolecular interaction and its allosteric modulation by a SH3-binding peptide or by Calcium-loaded calmodulin binding to the Unique domain. We also show reduced lipid binding following phosphorylation at conserved sites of the Unique domain. Finally, we show that injection of full-length c-Src with mutations that abolish lipid binding by the Unique domain causes a strong in vivo phenotype distinct from that of wild-type c-Src in a Xenopus oocyte model system, confirming the functional role of the Unique domain in c-Src regulation. PMID:23416516

  12. Structural basis of the regulatory mechanism of the plant CIPK family of protein kinases controlling ion homeostasis and abiotic stress

    PubMed Central

    Chaves-Sanjuan, Antonio; Sanchez-Barrena, Maria Jose; Gonzalez-Rubio, Juana Maria; Moreno, Maria; Ragel, Paula; Jimenez, Marta; Pardo, Jose M.; Martinez-Ripoll, Martin; Quintero, Francisco J.; Albert, Armando

    2014-01-01

    Plant cells have developed specific protective molecular machinery against environmental stresses. The family of CBL-interacting protein kinases (CIPK) and their interacting activators, the calcium sensors calcineurin B-like (CBLs), work together to decode calcium signals elicited by stress situations. The molecular basis of biological activation of CIPKs relies on the calcium-dependent interaction of a self-inhibitory NAF motif with a particular CBL, the phosphorylation of the activation loop by upstream kinases, and the subsequent phosphorylation of the CBL by the CIPK. We present the crystal structures of the NAF-truncated and pseudophosphorylated kinase domains of CIPK23 and CIPK24/SOS2. In addition, we provide biochemical data showing that although CIPK23 is intrinsically inactive and requires an external stimulation, CIPK24/SOS2 displays basal activity. This data correlates well with the observed conformation of the respective activation loops: Although the loop of CIPK23 is folded into a well-ordered structure that blocks the active site access to substrates, the loop of CIPK24/SOS2 protrudes out of the active site and allows catalysis. These structures together with biochemical and biophysical data show that CIPK kinase activity necessarily requires the coordinated releases of the activation loop from the active site and of the NAF motif from the nucleotide-binding site. Taken all together, we postulate the basis for a conserved calcium-dependent NAF-mediated regulation of CIPKs and a variable regulation by upstream kinases. PMID:25288725

  13. S-nitrosation of β-catenin and p120 catenin: a novel regulatory mechanism in endothelial hyperpermeability

    PubMed Central

    Marín, N.; Zamorano, P.; Carrasco, R.; Mujica, P.; González, FG.; Quezada, C.; Meininger, CJ.; Boric, MP.; Durán, WN.; Sánchez, FA.

    2014-01-01

    Rationale Endothelial adherens junction proteins constitute an important element in the control of microvascular permeability. Platelet-activating factor (PAF) increases permeability to macromolecules via translocation of eNOS to cytosol and stimulation of eNOS-derived NO signaling cascade. The mechanisms by which NO signaling regulates permeability at adherens junctions are still incompletely understood. Objective We explored the hypothesis that PAF stimulates hyperpermeability via S-nitrosation (SNO) of adherens junction proteins. Methods and Results We measured PAF-stimulated S-nitrosation of β-catenin and p120-catenin (p120) in three cell lines: ECV-eNOSGFP, EAhy926 (derived from human umbilical vein) and CVEC (derived from bovine heart endothelium) and in the mouse cremaster muscle in vivo. SNO correlated with diminished abundance of β-catenin and p120 at the adherens junction and with hyperpermeability. TNF-α increased NO production and caused similar increase in S-nitrosation as PAF. To ascertain the importance of eNOS subcellular location in this process, we used ECV-304 cells transfected with cytosolic eNOS (GFPeNOSG2A) and plasma membrane eNOS (GFPeNOSCAAX). PAF induced S-nitrosation of β-catenin and p120 and significantly diminished association between these proteins in cells with cytosolic eNOS but not in cells wherein eNOS is anchored to the cell membrane. Inhibitors of NO production and of S-nitrosation blocked PAF-induced S-nitrosation and hyperpermeability whereas inhibition of the cGMP pathway had no effect. Mass spectrometry analysis of purified p120 identified cysteine 579 as the main S-nitrosated residue in the region that putatively interacts with VE-cadherin. Conclusions Our results demonstrate that agonist-induced SNO contributes to junctional membrane protein changes that enhance endothelial permeability. PMID:22777005

  14. Lycopene treatment against loss of bone mass, microarchitecture and strength in relation to regulatory mechanisms in a postmenopausal osteoporosis model.

    PubMed

    Ardawi, Mohammed-Salleh M; Badawoud, Mohammed H; Hassan, Sherif M; Rouzi, Abdulrahim A; Ardawi, Jumanah M S; AlNosani, Nouf M; Qari, Mohammed H; Mousa, Shaker A

    2016-02-01

    Lycopene supplementation decreases oxidative stress and exhibits beneficial effects on bone health, but the mechanisms through which it alters bone metabolism in vivo remain unclear. The present study aims to evaluate the effects of lycopene treatment on postmenopausal osteoporosis. Six-month-old female Wistar rats (n=264) were sham-operated (SHAM) or ovariectomized (OVX). The SHAM group received oral vehicle only and the OVX rats were randomized into five groups receiving oral daily lycopene treatment (mg/kg body weight per day): 0 OVX (control), 15 OVX, 30 OVX, and 45 OVX, and one group receiving alendronate (ALN) (2μg/kg body weight per day), for 12weeks. Bone densitometry measurements, bone turnover markers, biomechanical testing, and histomorphometric analysis were conducted. Micro computed tomography was also used to evaluate changes in microarchitecture. Lycopene treatment suppressed the OVX-induced increase in bone turnover, as indicated by changes in biomarkers of bone metabolism: serum osteocalcin (s-OC), serum N-terminal propeptide of type 1 collagen (s-PINP), serum crosslinked carboxyterminal telopeptides (s-CTX-1), and urinary deoxypyridinoline (u-DPD). Significant improvement in OVX-induced loss of bone mass, bone strength, and microarchitectural deterioration was observed in lycopene-treated OVX animals. These effects were observed mainly at sites rich in trabecular bone, with less effect in cortical bone. Lycopene treatment down-regulated osteoclast differentiation concurrent with up-regulating osteoblast together with glutathione peroxidase (GPx) catalase (CAT) and superoxide dismutase (SOD) activities. These findings demonstrate that lycopene treatment in OVX rats primarily suppressed bone turnover to restore bone strength and microarchitecture. PMID:26549245

  15. Study on the molecular regulatory mechanism of MicroRNA-195 in the invasion and metastasis of colorectal carcinoma

    PubMed Central

    Yang, Bin; Tan, Zhigang; Song, Yan

    2015-01-01

    Objective: This study aims to identify the target gene of hsa-miR-195 and to research the molecular mechanism of hsa-miR-195 which is through its target genes in the colorectal cancer invasion and metastasis. Methods: We used biological informatics (RNAhybrid and Target Scan analysis database) to predict the target genes of hsa-miR-195. Collected colon cancer tissues from clinical colorectal cancer patients by surgical removal of the carcinoma and control tissues, and researched the expression of Bcl-2 in tissues by immunohistochemical. Next, Real-time PCR was used to research the expression of hsa-miR-195 in Caco-2 and NCM460 cell line. hsa -miR-195 Mimics was transient transfered to Caco-2 cells, western blot was used to analysis the expression changes of Bcl-2. To analysis the possibility that hsa-miR-195 can affect the invasive ability of tumor cells by Bcl-2, we transferred hsa-miR-195 Mimics and Bcl-2 expression plasmid, and used the cell invasion experiment to discusses hsa-miR-195 effect on the ability of tumor cell invasion. Results: the immunohistochemical results showed that, the semi-quantitative parameters for the Bcl-2: control by 0.89 ± 0.51, 6 colon cancer by 31 ± 0.79. The expression of has-miR-195 in Caco-2 is 0.39 ± 1.5 while the value in control is2.01 ± 0.2, **P < 0.01. Conclusion: In colorectal cancer, has-miR-195 can promote cell apoptosis and inhibit the invasion and metastasis by inhibiting the expression of Bcl-2. PMID:26064276

  16. Dynamic Changes in ANGUSTIFOLIA3 Complex Composition Reveal a Growth Regulatory Mechanism in the Maize Leaf[OPEN

    PubMed Central

    Nelissen, Hilde; Eeckhout, Dominique; Demuynck, Kirin; Persiau, Geert; Walton, Alan; van Bel, Michiel; Vervoort, Marieke; Candaele, Jasper; De Block, Jolien; Aesaert, Stijn; Van Lijsebettens, Mieke; Goormachtig, Sofie; Vandepoele, Klaas; Van Leene, Jelle; Muszynski, Michael; Gevaert, Kris; Inzé, Dirk; De Jaeger, Geert

    2015-01-01

    Most molecular processes during plant development occur with a particular spatio-temporal specificity. Thus far, it has remained technically challenging to capture dynamic protein-protein interactions within a growing organ, where the interplay between cell division and cell expansion is instrumental. Here, we combined high-resolution sampling of the growing maize (Zea mays) leaf with tandem affinity purification followed by mass spectrometry. Our results indicate that the growth-regulating SWI/SNF chromatin remodeling complex associated with ANGUSTIFOLIA3 (AN3) was conserved within growing organs and between dicots and monocots. Moreover, we were able to demonstrate the dynamics of the AN3-interacting proteins within the growing leaf, since copurified GROWTH-REGULATING FACTORs (GRFs) varied throughout the growing leaf. Indeed, GRF1, GRF6, GRF7, GRF12, GRF15, and GRF17 were significantly enriched in the division zone of the growing leaf, while GRF4 and GRF10 levels were comparable between division zone and expansion zone in the growing leaf. These dynamics were also reflected at the mRNA and protein levels, indicating tight developmental regulation of the AN3-associated chromatin remodeling complex. In addition, the phenotypes of maize plants overexpressing miRNA396a-resistant GRF1 support a model proposing that distinct associations of the chromatin remodeling complex with specific GRFs tightly regulate the transition between cell division and cell expansion. Together, our data demonstrate that advancing from static to dynamic protein-protein interaction analysis in a growing organ adds insights in how developmental switches are regulated. PMID:26036253

  17. Network-based integration of molecular and physiological data elucidates regulatory mechanisms underlying adaptation to high-fat diet.

    PubMed

    Derous, Davina; Kelder, Thomas; van Schothorst, Evert M; van Erk, Marjan; Voigt, Anja; Klaus, Susanne; Keijer, Jaap; Radonjic, Marijana

    2015-07-01

    Health is influenced by interplay of molecular, physiological and environmental factors. To effectively maintain health and prevent disease, health-relevant relations need to be understood at multiple levels of biological complexity. Network-based methods provide a powerful platform for integration and mining of data and knowledge characterizing different aspects of health. Previously, we have reported physiological and gene expression changes associated with adaptation of murine epididymal white adipose tissue (eWAT) to 5 days and 12 weeks of high-fat diet (HFD) and low-fat diet feeding (Voigt et al. in Mol Nutr Food Res 57:1423-1434, 2013. doi: 10.1002/mnfr.201200671 ). In the current study, we apply network analysis on this dataset to comprehensively characterize mechanisms driving the short- and long-term adaptation of eWAT to HFD across multiple levels of complexity. We built a three-layered interaction network comprising enriched biological processes, their transcriptional regulators and associated changes in physiological parameters. The multi-layered network model reveals that early eWAT adaptation to HFD feeding involves major changes at a molecular level, including activation of TGF-β signalling pathway, immune and stress response and downregulation of mitochondrial functioning. Upon prolonged HFD intake, initial transcriptional response tails off, mitochondrial functioning is even further diminished, and in turn the relation between eWAT gene expression and physiological changes becomes more prominent. In particular, eWAT weight and total energy intake negatively correlate with cellular respiration process, revealing mitochondrial dysfunction as a hallmark of late eWAT adaptation to HFD. Apart from global understanding of the time-resolved adaptation to HFD, the multi-layered network model allows several novel mechanistic hypotheses to emerge: (1) early activation of TGF-β signalling as a trigger for structural and morphological changes in

  18. Adsorption mechanism and dispersion efficiency of three anionic additives [poly(acrylic acid), poly(styrene sulfonate) and HEDP] on zinc oxide.

    PubMed

    Dange, C; Phan, T N T; André, V; Rieger, J; Persello, J; Foissy, A

    2007-11-01

    Adsorption on ZnO of sodium poly(acrylate) (PAA), sodium poly(styrene sulfonate) (PSS) and a monomer surfactant [hydroxyethylidene diphosphonate (HEDP)] was investigated in suspensions initially equilibrated at pH 7. Results demonstrate interplay in the adsorption mechanism between zinc complexation, salt precipitation, and ZnO dissolution. In the case of PAA, the adsorption isotherm exhibits a maximum attributed to the precipitation of zinc polyacrylate. PSS and HEDP formed high-affinity adsorption isotherms, but the plateau adsorption of HEDP was significantly lower than that of PSS. The adsorption isotherm of each additive is divided into two areas. At low additive concentration (high zinc/additive ratio), the total zinc concentration in the solution decreased and the pH increased upon addition. At a higher additive ratio, zinc concentration and pH increased with the organic concentration. The increase in pH is due to the displacement of hydroxyl ions from the surface and the increase in zinc concentration results from the dissolution of ZnO due to the complexation of zinc ions by the organics. The stability of the ZnO dispersions was investigated by measurement of the particle size distribution after addition of various amounts of polymers. The three additives stabilized the ZnO dispersions efficiently once full surface coverage was reached. PMID:17720181

  19. Integrative Modeling of eQTLs and Cis-Regulatory Elements Suggests Mechanisms Underlying Cell Type Specificity of eQTLs

    PubMed Central

    Brown, Christopher D.; Mangravite, Lara M.; Engelhardt, Barbara E.

    2013-01-01

    Genetic variants in cis-regulatory elements or trans-acting regulators frequently influence the quantity and spatiotemporal distribution of gene transcription. Recent interest in expression quantitative trait locus (eQTL) mapping has paralleled the adoption of genome-wide association studies (GWAS) for the analysis of complex traits and disease in humans. Under the hypothesis that many GWAS associations tag non-coding SNPs with small effects, and that these SNPs exert phenotypic control by modifying gene expression, it has become common to interpret GWAS associations using eQTL data. To fully exploit the mechanistic interpretability of eQTL-GWAS comparisons, an improved understanding of the genetic architecture and causal mechanisms of cell type specificity of eQTLs is required. We address this need by performing an eQTL analysis in three parts: first we identified eQTLs from eleven studies on seven cell types; then we integrated eQTL data with cis-regulatory element (CRE) data from the ENCODE project; finally we built a set of classifiers to predict the cell type specificity of eQTLs. The cell type specificity of eQTLs is associated with eQTL SNP overlap with hundreds of cell type specific CRE classes, including enhancer, promoter, and repressive chromatin marks, regions of open chromatin, and many classes of DNA binding proteins. These associations provide insight into the molecular mechanisms generating the cell type specificity of eQTLs and the mode of regulation of corresponding eQTLs. Using a random forest classifier with cell specific CRE-SNP overlap as features, we demonstrate the feasibility of predicting the cell type specificity of eQTLs. We then demonstrate that CREs from a trait-associated cell type can be used to annotate GWAS associations in the absence of eQTL data for that cell type. We anticipate that such integrative, predictive modeling of cell specificity will improve our ability to understand the mechanistic basis of human complex phenotypic

  20. Mechanisms of formation of hardening precipitates and hardening in aging of Al-Li-Cu-Mg model alloys with silver additions

    NASA Astrophysics Data System (ADS)

    Alekseev, A. A.; Zhuravleva, P. L.; Onuchina, M. R.; Klochkova, Yu. Yu.

    2015-11-01

    The mechanisms of the influence of silver additions on the phase transformations that occur in aging are revealed. The contribution of Ω'-phase particles to the deformation stress in Al alloys is estimated. The mechanisms of the effect of low (up to 0.5 wt %) silver additions and the copper content on the structure of the Ω'-phase precipitates in Al alloys are found. According to the proposed model, silver atoms remain immobile during the decomposition of a solid solution and nucleation centers of the Ω' phase form near them in low-temperature aging. Upon hardening aging, fragmented Ω'-phase particles intersect with each other, and the contribution of the intersection regions to the hardening of alloys by Ω'-phase particles is principal.

  1. Influence of Addition of Thermoplastic Elastomer on Mechanical and Tribological Properties of Vapor-Grown-Carbon-Fiber Filled Polybutylene Terephthalate Composites

    NASA Astrophysics Data System (ADS)

    Naito, Takahito; Nishitani, Yosuke; Sekiguchi, Isamu; Ishii, Chiharu; Kitano, Takeshi

    In order to develop the new high-performance tribomaterials for mechanical and electrical micro-devices, the influence of adding thermoplastic elastomer (TPE) on the mechanical and tribological properties of vapor-grown-carbon-fiber (VGCF) filled polybutylene telephthalate (PBT) composites (VGCF/PBT) was investigated. In this study, three types of functionalized TPE based on styrene butadiene elastomer: epoxy group grafted SBS (SBS-EP), hydroxyl group grafted SEEPS (SEEPS-OH) and amine group grafted SBBS (SBBS-NH2) were added with PBT and VGCF/PBT composites. These composites were compounded with a twin screw extruder and injection-molded, and their morphology, tensile, impact and tribological properties were evaluated. The internal structure of the ternary composites (VGCF/PBT/TPE) was changed by the addition of TPE and VGCF. Moreover, the size of dispersed TPE particles changed with the types of functionalized TPE. The influence of the addition of TPE on the mechanical and tribological properties of VGCF/PBT was differed from each property item. Izod impact properties and wear resistance were remarkably improved with the addition of various functionalized TPE, however, the tensile properties and frictional coefficient were slightly changed by the addition. From the relation between various properties and internal structure of these ternary composites, it was found that the tensile elongation at break, izod impact strength and specific wear rate correlate closely with the size of dispersed TPE particles. It follows from these results that it may be possible to develop the new tribomaterials with sufficient balances of mechanical and tribological properties for micro-devices.

  2. Identification of novel estrogen receptor (ER) agonists that have additional and complementary anti-cancer activities via ER-independent mechanism.

    PubMed

    Kim, Taelim; Kim, Hye-In; An, Ji-Young; Lee, Jun; Lee, Na-Rae; Heo, Jinyuk; Kim, Ji-Eun; Yu, Jihyun; Lee, Yong Sup; Inn, Kyung-Soo; Kim, Nam-Jung

    2016-04-01

    In this study, a series of bis(4-hydroxy)benzophenone oxime ether derivatives such as 12c, 12e and 12h were identified as novel estrogen receptor (ER) agonists that have additional and complementary anti-proliferative activities via ER-independent mechanism in cancer cells. These compounds are expected to overcome the therapeutic limitation of existing ER agonists such as estradiol and tamoxifen, which have been known to induce the proliferation of cancer cells. PMID:26905830

  3. Preparation and characterization of new dental porcelains, using K-feldspar and quartz raw materials. Effect of B2O3 additions on sintering and mechanical properties.

    PubMed

    Harabi, Abdelhamid; Guerfa, Fatiha; Harabi, Esma; Benhassine, Mohamed-Tayeb; Foughali, Lazhar; Zaiou, Soumia

    2016-08-01

    The aim of this work was to determine the effect of temperature and boric oxide (B2O3) addition on sintering and mechanical properties of a newly developed dental porcelain (DP) prepared from local Algerian raw materials. Based on a preliminary work, the new selected composition was 75wt.% feldspar, 20wt.% quartz and 5wt.% kaolin. It was prepared by sintering the mixture at different temperatures (1100-1250°C). The optimum sintering conditions gave a relatively higher density (2.47g/cm(3)) and excellent mechanical properties. The three point flexural strength (3PFS) and Martens micro-hardness of dental porcelains were 149MPa and 2600MPa, respectively. This obtained 3PFS value is more than four times greater than that of hydroxyapatite (HA) value (about 37MPa) sintered under the same conditions. However, the sintering temperature was lowered by about 25 and 50°C for 3 and 5wt.% B2O3 additions, respectively. But, it did not improve furthermore the samples density and their mechanical properties. It has also been found that B2O3 additions provoke a glass matrix composition variation which delays the leucite formation during sintering. PMID:27157725

  4. Numerical investigation of the mechanical properties of the additive manufactured bone scaffolds fabricated by FDM: The effect of layer penetration and post-heating.

    PubMed

    Naghieh, S; Karamooz Ravari, M R; Badrossamay, M; Foroozmehr, E; Kadkhodaei, M

    2016-06-01

    In recent years, thanks to additive manufacturing technology, researchers have gone towards the optimization of bone scaffolds for the bone reconstruction. Bone scaffolds should have appropriate biological as well as mechanical properties in order to play a decisive role in bone healing. Since the fabrication of scaffolds is time consuming and expensive, numerical methods are often utilized to simulate their mechanical properties in order to find a nearly optimum one. Finite element analysis is one of the most common numerical methods that is used in this regard. In this paper, a parametric finite element model is developed to assess the effects of layers penetration׳s effect on inter-layer adhesion, which is reflected on the mechanical properties of bone scaffolds. To be able to validate this model, some compression test specimens as well as bone scaffolds are fabricated with biocompatible and biodegradable poly lactic acid using fused deposition modeling. All these specimens are tested in compression and their elastic modulus is obtained. Using the material parameters of the compression test specimens, the finite element analysis of the bone scaffold is performed. The obtained elastic modulus is compared with experiment indicating a good agreement. Accordingly, the proposed finite element model is able to predict the mechanical behavior of fabricated bone scaffolds accurately. In addition, the effect of post-heating of bone scaffolds on their elastic modulus is investigated. The results demonstrate that the numerically predicted elastic modulus of scaffold is closer to experimental outcomes in comparison with as-built samples. PMID:26874065

  5. Microbial infection-induced expansion of effector T cells overcomes the suppressive effects of regulatory T cells via an IL-2 deprivation mechanism.

    PubMed

    Benson, Alicia; Murray, Sean; Divakar, Prashanthi; Burnaevskiy, Nikolay; Pifer, Reed; Forman, James; Yarovinsky, Felix

    2012-01-15

    Foxp3(+) regulatory T (Treg) cells are a critical cell population that suppresses T cell activation in response to microbial and viral pathogens. We identify a cell-intrinsic mechanism by which effector CD4(+) T cells overcome the suppressive effects of Treg cells in the context of three distinct infections: Toxoplasma gondii, Listeria monocytogenes, and vaccinia virus. The acute responses to the parasitic, bacterial, and viral pathogens resulted in a transient reduction in frequency and absolute number of Treg cells. The infection-induced partial loss of Treg cells was essential for the initiation of potent Th1 responses and host protection against the pathogens. The observed disappearance of Treg cells was a result of insufficiency in IL-2 caused by the expansion of pathogen-specific CD4(+) T cells with a limited capacity of IL-2 production. Exogenous IL-2 treatment during the parasitic, bacterial, and viral infections completely prevented the loss of Treg cells, but restoration of Treg cells resulted in a greatly enhanced susceptibility to the pathogens. These results demonstrate that the transient reduction in Treg cells induced by pathogens via IL-2 deprivation is essential for optimal T cell responses and host resistance to microbial and viral pathogens. PMID:22147768

  6. Crosstalk between bone marrow-derived mesenchymal stem cells and regulatory T cells through a glucocorticoid-induced leucine zipper/developmental endothelial locus-1-dependent mechanism.

    PubMed

    Yang, Nianlan; Baban, Babak; Isales, Carlos M; Shi, Xing-Ming

    2015-09-01

    Bone marrow is a reservoir for regulatory T (T(reg)) cells, but how T(reg) cells are regulated in that environment remains poorly understood. We show that expression of glucocorticoid (GC)-induced leucine zipper (GILZ) in bone marrow mesenchymal lineage cells or bone marrow-derived mesenchymal stem cells (BMSCs) increases the production of T(reg) cells via a mechanism involving the up-regulation of developmental endothelial locus-1 (Del-1), an endogenous leukocyte-endothelial adhesion inhibitor. We found that the expression of Del-1 is increased ∼4-fold in the bone tissues of GILZ transgenic (Tg) mice, and this increase is coupled with a significant increase in the production of IL-10 (2.80 vs. 0.83) and decrease in the production of IL-6 (0.80 vs. 2.33) and IL-12 (0.25 vs. 1.67). We also show that GILZ-expressing BMSCs present antigen in a way that favors T(reg) cells. These results indicate that GILZ plays a critical role mediating the crosstalk between BMSCs and T(reg) in the bone marrow microenvironment. These data, together with our previous findings that overexpression of GILZ in BMSCs antagonizes TNF-α-elicited inflammatory responses, suggest that GILZ plays important roles in bone-immune cell communication and BMSC immune suppressive functions. PMID:26038125

  7. The mechanism of potent GTP cyclohydrolase I inhibition by 2,4-diamino-6-hydroxypyrimidine: requirement of the GTP cyclohydrolase I feedback regulatory protein.

    PubMed

    Kolinsky, Monica A; Gross, Steven S

    2004-09-24

    Inhibition of GTP cyclohydrolase I (GTPCH) has been used as a selective tool to assess the role of de novo synthesis of (6R)-5,6,7,8-tetrahydro-L-biopterin (BH4) in a biological system. Toward this end, 2,4-diamino-6-hydroxypyrimidine (DAHP) has been used as the prototypical GTPCH inhibitor. Using a novel real-time kinetic microplate assay for GTPCH activity and purified prokaryote-expressed recombinant proteins, we show that potent inhibition by DAHP is not the result of a direct interaction with GTPCH. Rather, inhibition by DAHP in phosphate buffer occurs via an indirect mechanism that requires the presence of GTPCH feedback regulatory protein (GFRP). Notably, GFRP was previously discovered as the essential factor that reconstitutes inhibition of pure recombinant GTPCH by the pathway end product BH4. Thus, DAHP inhibits GTPCH by engaging the endogenous feedback inhibitory system. We further demonstrate that L-Phe fully reverses the inhibition of GTPCH by DAHP/GFRP, which is also a feature in common with inhibition by BH4/GFRP. These findings suggest that DAHP is not an indiscriminate inhibitor of GTPCH in biological systems; instead, it is predicted to preferentially attenuate GTPCH activity in cells that most abundantly express GFRP and/or contain the lowest levels of L-Phe. PMID:15292175

  8. Stable Suppression of Lactate Dehydrogenase Activity during Anoxia in the Foot Muscle of Littorina littorea and the Potential Role of Acetylation as a Novel Posttranslational Regulatory Mechanism.

    PubMed

    Shahriari, Ali; Dawson, Neal J; Bell, Ryan A V; Storey, Kenneth B

    2013-01-01

    The intertidal marine snail, Littorina littorea, has evolved to withstand extended bouts of oxygen deprivation brought about by changing tides or other potentially harmful environmental conditions. Survival is dependent on a strong suppression of its metabolic rate and a drastic reorganization of its cellular biochemistry in order to maintain energy balance under fixed fuel reserves. Lactate dehydrogenase (LDH) is a crucial enzyme of anaerobic metabolism as it is typically responsible for the regeneration of NAD(+), which allows for the continued functioning of glycolysis in the absence of oxygen. This study compared the kinetic and structural characteristics of the D-lactate specific LDH (E.C. 1.1.1.28) from foot muscle of aerobic control versus 24 h anoxia-exposed L. littorea. Anoxic LDH displayed a near 50% decrease in V max (pyruvate-reducing direction) as compared to control LDH. These kinetic differences suggest that there may be a stable modification and regulation of LDH during anoxia, and indeed, subsequent dot-blot analyses identified anoxic LDH as being significantly less acetylated than the corresponding control enzyme. Therefore, acetylation may be the regulatory mechanism that is responsible for the suppression of LDH activity during anoxia, which could allow for the production of alternative glycolytic end products that in turn would increase the ATP yield under fixed fuel reserves. PMID:24233354

  9. Stable Suppression of Lactate Dehydrogenase Activity during Anoxia in the Foot Muscle of Littorina littorea and the Potential Role of Acetylation as a Novel Posttranslational Regulatory Mechanism

    PubMed Central

    Shahriari, Ali; Dawson, Neal J.; Bell, Ryan A. V.; Storey, Kenneth B.

    2013-01-01

    The intertidal marine snail, Littorina littorea, has evolved to withstand extended bouts of oxygen deprivation brought about by changing tides or other potentially harmful environmental conditions. Survival is dependent on a strong suppression of its metabolic rate and a drastic reorganization of its cellular biochemistry in order to maintain energy balance under fixed fuel reserves. Lactate dehydrogenase (LDH) is a crucial enzyme of anaerobic metabolism as it is typically responsible for the regeneration of NAD+, which allows for the continued functioning of glycolysis in the absence of oxygen. This study compared the kinetic and structural characteristics of the D-lactate specific LDH (E.C. 1.1.1.28) from foot muscle of aerobic control versus 24 h anoxia-exposed L. littorea. Anoxic LDH displayed a near 50% decrease in Vmax (pyruvate-reducing direction) as compared to control LDH. These kinetic differences suggest that there may be a stable modification and regulation of LDH during anoxia, and indeed, subsequent dot-blot analyses identified anoxic LDH as being significantly less acetylated than the corresponding control enzyme. Therefore, acetylation may be the regulatory mechanism that is responsible for the suppression of LDH activity during anoxia, which could allow for the production of alternative glycolytic end products that in turn would increase the ATP yield under fixed fuel reserves. PMID:24233354

  10. Role of enzymatic activity in muscle damage and cytotoxicity induced by Bothrops asper Asp49 phospholipase A2 myotoxins: are there additional effector mechanisms involved?

    PubMed Central

    Mora-Obando, Diana; Díaz, Cecilia; Angulo, Yamileth; Gutiérrez, José María

    2014-01-01

    Viperid venoms often contain mixtures of Asp49 and Lys49 PLA2 myotoxin isoforms, relevant to development of myonecrosis. Given their difference in catalytic activity, mechanistic studies on each type require highly purified samples. Studies on Asp49 PLA2s have shown that enzyme inactivation using p-bromophenacyl bromide (p-BPB) drastically affects toxicity. However, based on the variable levels of residual toxicity observed in some studies, it has been suggested that effector mechanisms independent of catalysis may additionally be involved in the toxicity of these enzymes, possibly resembling those of the enzymatically inactive Lys49 myotoxins. A possibility that Lys49 isoforms could be present in Asp49 PLA2 preparations exists and, if undetected in previous studies, could explain the variable residual toxicity. This question is here addressed by using an enzyme preparation ascertained to be free of Lys49 myotoxins. In agreement with previous reports, inactivation of the catalytic activity of an Asp49 myotoxin preparation led to major inhibition of toxic effects in vitro and in vivo. The very low residual levels of myotoxicity (7%) and cytotoxicity (4%) observed can be attributed to the low, although detectable, enzyme remaining active after p-BPB treatment (2.7%), and would be difficult to reconcile with the proposed existence of additional catalytic-independent toxic mechanisms. These findings favor the concept that the effector mechanism of toxicity of Asp49 PLA2 myotoxins from viperids fundamentally relies on their ability to hydrolyze phospholipids, arguing against the proposal that membrane disruption may also be caused by additional mechanisms that are independent of catalysis. PMID:25276503

  11. Effects of Sodium Butyrate Treatment on Histone Modifications and the Expression of Genes Related to Epigenetic Regulatory Mechanisms and Immune Response in European Sea Bass (Dicentrarchus Labrax) Fed a Plant-Based Diet

    PubMed Central

    Díaz, Noelia; Rimoldi, Simona; Ceccotti, Chiara; Gliozheni, Emi; Piferrer, Francesc

    2016-01-01

    Bacteria that inhabit the epithelium of the animals’ digestive tract provide the essential biochemical pathways for fermenting otherwise indigestible dietary fibers, leading to the production of short-chain fatty acids (SCFAs). Of the major SCFAs, butyrate has received particular attention due to its numerous positive effects on the health of the intestinal tract and peripheral tissues. The mechanisms of action of this four-carbon chain organic acid are different; many of these are related to its potent regulatory effect on gene expression since butyrate is a histone deacetylase inhibitor that play a predominant role in the epigenetic regulation of gene expression and cell function. In the present work, we investigated in the European sea bass (Dicentrarchus labrax) the effects of butyrate used as a feed additive on fish epigenetics as well as its regulatory role in mucosal protection and immune homeostasis through impact on gene expression. Seven target genes related to inflammatory response and reinforcement of the epithelial defense barrier [tnfα (tumor necrosis factor alpha) il1β, (interleukin 1beta), il-6, il-8, il-10, and muc2 (mucin 2)] and five target genes related to epigenetic modifications [dicer1(double-stranded RNA-specific endoribonuclease), ehmt2 (euchromatic histone-lysine-N-methyltransferase 2), pcgf2 (polycomb group ring finger 2), hdac11 (histone deacetylase-11), and jarid2a (jumonji)] were analyzed in fish intestine and liver. We also investigated the effect of dietary butyrate supplementation on histone acetylation, by performing an immunoblotting analysis on liver core histone extracts. Results of the eight-week-long feeding trial showed no significant differences in weight gain or SGR (specific growth rate) of sea bass that received 0.2% sodium butyrate supplementation in the diet in comparison to control fish that received a diet without Na-butyrate. Dietary butyrate led to a twofold increase in the acetylation level of histone H4 at

  12. Effects of Sodium Butyrate Treatment on Histone Modifications and the Expression of Genes Related to Epigenetic Regulatory Mechanisms and Immune Response in European Sea Bass (Dicentrarchus Labrax) Fed a Plant-Based Diet.

    PubMed

    Terova, Genciana; Díaz, Noelia; Rimoldi, Simona; Ceccotti, Chiara; Gliozheni, Emi; Piferrer, Francesc

    2016-01-01

    Bacteria that inhabit the epithelium of the animals' digestive tract provide the essential biochemical pathways for fermenting otherwise indigestible dietary fibers, leading to the production of short-chain fatty acids (SCFAs). Of the major SCFAs, butyrate has received particular attention due to its numerous positive effects on the health of the intestinal tract and peripheral tissues. The mechanisms of action of this four-carbon chain organic acid are different; many of these are related to its potent regulatory effect on gene expression since butyrate is a histone deacetylase inhibitor that play a predominant role in the epigenetic regulation of gene expression and cell function. In the present work, we investigated in the European sea bass (Dicentrarchus labrax) the effects of butyrate used as a feed additive on fish epigenetics as well as its regulatory role in mucosal protection and immune homeostasis through impact on gene expression. Seven target genes related to inflammatory response and reinforcement of the epithelial defense barrier [tnfα (tumor necrosis factor alpha) il1β, (interleukin 1beta), il-6, il-8, il-10, and muc2 (mucin 2)] and five target genes related to epigenetic modifications [dicer1(double-stranded RNA-specific endoribonuclease), ehmt2 (euchromatic histone-lysine-N-methyltransferase 2), pcgf2 (polycomb group ring finger 2), hdac11 (histone deacetylase-11), and jarid2a (jumonji)] were analyzed in fish intestine and liver. We also investigated the effect of dietary butyrate supplementation on histone acetylation, by performing an immunoblotting analysis on liver core histone extracts. Results of the eight-week-long feeding trial showed no significant differences in weight gain or SGR (specific growth rate) of sea bass that received 0.2% sodium butyrate supplementation in the diet in comparison to control fish that received a diet without Na-butyrate. Dietary butyrate led to a twofold increase in the acetylation level of histone H4 at

  13. Mechanical Properties Evaluation of Zr Addition in L12-Al3(Sc1- x Zr x ) Using First-Principles Calculation

    NASA Astrophysics Data System (ADS)

    Qian, Yi; Xue, Jilai; Wang, Zengjie; Yang, Zhenhai; Qian, Ping

    2016-05-01

    L12-Al3(Sc1- x Zr x ) can be used as a grain refiner and recrystallization inhibitor in forming and heat-treatment of wrought aluminum alloy. In this work, the mechanical properties of L12-Al3(Sc1- x Zr x ) (0 < x< 0.5) have been systematically evaluated using first principles calculations. The optimized structural parameters obtained through the virtual crystal approximation were in good agreement with available experimental and calculated data. The computed bulk modulus of L12-Al3(Sc1- x Zr x ) increased while the shear modulus and Young's modulus decreased with increasing Zr addition. The ductility of L12-Al3(Sc1- x Zr x ) estimated by Pugh empirical criterion and Cauchy pressure were improved with Zr addition. The calculated ideal strength of L12-Al3(Sc1- x Zr x ) along the [001], [110] and { 111} [1bar{1}0] directions increased linearly with Zr additions. The addition of Zr gave great improvements in the ideal strength along the [110] direction and the ductility in the [001] direction, respectively. The calculated electronic density of states and the charge density distribution revealed that the valence electron increased with Zr addition and hence strengthened the p-d covalent bonding and d-d bonding, resulting in the improvements in ideal strength and ductility. The evaluation data would be useful in materials design and process optimization for Al alloys in forming and heat treatment.

  14. Effects of Cu, Fe and Co addition on the glass-forming ability and mechanical properties of Zr-Al-Ni bulk metallic glasses

    NASA Astrophysics Data System (ADS)

    Li, YanHui; Zhang, Wei; Dong, Chuang; Makino, Akihiro

    2012-12-01

    The thermal stability, glass-forming ability (GFA) and mechanical properties of Zr60Al15Ni25- x TM x (TM = Cu, Fe and Co, x = 0-10) bulk metallic glasses (BMGs) were systematically investigated. Additional 5-10 at.% Cu greatly enhances the thermal stability and GFA of the base alloy. Zr60Al15Ni15Cu10 BMG exhibits the largest supercooled liquid region of 104 K and critical diameter of 18 mm. However, addition of 5-10 at.% Fe or Co decrease the thermal stability and GFA. In addition, the plasticity of the BMG can be improved by adding of Cu, while the strength is decreased slightly. Zr60Al15Ni20Cu5 BMG has the largest plastic strain of 5.5% with a yield stress of 1755 MPa and Young's modulus of 83 GPa. Addition of Co brings an increase of strength but a lower of plasticity, and additional Fe reduces the strength and plasticity simultaneously.

  15. Investigating the addition of SiO₂-CaO-ZnO-Na₂O-TiO₂ bioactive glass to hydroxyapatite: Characterization, mechanical properties and bioactivity.

    PubMed

    Yatongchai, Chokchai; Placek, Lana M; Curran, Declan J; Towler, Mark R; Wren, Anthony W

    2015-11-01

    Hydroxyapatite (Ca10(PO4)6(OH)2) is widely investigated as an implantable material for hard tissue restoration due to its osteoconductive properties. However, hydroxyapatite in bulk form is limited as its mechanical properties are insufficient for load-bearing orthopedic applications. Attempts have been made to improve the mechanical properties of hydroxyapatite, by incorporating ceramic fillers, but the resultant composite materials require high sintering temperatures to facilitate densification, leading to the decomposition of hydroxyapatite into tricalcium phosphate, tetra-calcium phosphate and CaO phases. One method of improving the properties of hydroxyapatite is to incorporate bioactive glass particles as a second phase. These typically have lower softening points which could possibly facilitate sintering at lower temperatures. In this work, a bioactive glass (SiO2-CaO-ZnO-Na2O-TiO2) is incorporated (10, 20 and 30 wt%) into hydroxyapatite as a reinforcing phase. X-ray diffraction confirmed that no additional phases (other than hydroxyapatite) were formed at a sintering temperature of 560 ℃ with up to 30 wt% glass addition. The addition of the glass phase increased the % crystallinity and the relative density of the composites. The biaxial flexural strength increased to 36 MPa with glass addition, and there was no significant change in hardness as a function of maturation. The pH of the incubation media increased to pH 10 or 11 through glass addition, and ion release profiles determined that Si, Na and P were released from the composites. Calcium phosphate precipitation was encouraged in simulated body fluid with the incorporation of the bioactive glass phase, and cell culture testing in MC-3T3 osteoblasts determined that the composite materials did not significantly reduce cell viability. PMID:26116020

  16. Influence of type and level of water-soluble additives on drug release and surface and mechanical properties of Surelease films.

    PubMed

    Rohera, Bhagwan D; Parikh, Nilesh H

    2002-11-01

    Ethylcellulose in combination with water-soluble additives has been used in the development of microporous membrane-coated dosage forms. In the present study, application of three types of water-soluble additives, namely polyethylene glycols (PEG 400, 3350, and 8000), maltodextrins (Maltrin M150, M100, and M040 in the order of lower to higher average polymer size and molecular weight; dextrose equivalence 16.9, 11.1, and 4.8, respectively), and xylitol, as porosity modifiers in the films of a commercially available aqueous ethylcellulose dispersion (Surelease/E-7-7060 plasticized with glyceryl tricaprylate/caprate) was investigated. The effect of type and level of these additives on drug release characteristics and surface and mechanical properties of the polymeric films was studied. Each additive was incorporated at 20 and 30% levels in the polymeric dispersion based on its solids content. Ibuprofen tablets were coated using the polymeric dispersion with and without additive at 3% w/w coat level in a fluid-bed equipment. The coated tablets were evaluated for their drug release rate, coat reflectivity (gloss), Brinell hardness, and elastic modulus. Differential scanning calorimetric analysis of the films was performed to determine the physico-chemical changes in the applied film-coats. The rate of drug release, hence film porosity, was observed to be dependent on the type and level of the additive added. The molecular weight of the additive and its concentration in the polymeric dispersion had significant influence on the rate of drug release, hardness, and elasticity of the film-coats. PMID:12503524

  17. Dual mechanisms of action of the RNA-binding protein human antigen R explains its regulatory effect on melanoma cell migration.

    PubMed

    Moradi, Farnaz; Berglund, Pontus; Linnskog, Rickard; Leandersson, Karin; Andersson, Tommy; Prasad, Chandra Prakash

    2016-06-01

    Overexpression of wingless-type MMTV integration site family 5A (WNT5A) plays a significant role in melanoma cancer progression; however, the mechanism(s) involved remains unknown. In breast cancer, the human antigen R (HuR) has been implicated in the regulation of WNT5A expression. Here, we demonstrate that endogenous expression of WNT5A correlates with levels of active HuR in HTB63 and WM852 melanoma cells and that HuR binds to WNT5A messenger RNA in both cell lines. Although the HuR inhibitor MS-444 significantly impaired migration in both melanoma cell lines, it reduced WNT5A expression only in HTB63 cells, as did small interfering RNA knockdown of HuR. Consistent with this finding, MS-444-induced inhibition of HTB63 cell migration was restored by the addition of recombinant WNT5A, whereas MS-444-induced inhibition of WM852 cell migration was restored by the addition of recombinant matrix metalloproteinase-9, another HuR-regulated protein. Clearly, HuR positively regulates melanoma cell migration via at least 2 distinct mechanisms making HuR an attractive therapeutic target for halting melanoma dissemination. PMID:26970271

  18. Effects of small amount of additional elements on control of interstitial impurities and mechanical properties of V?4Cr?4Ti?Si?Al?Y alloys

    NASA Astrophysics Data System (ADS)

    Chuto, Toshinori; Satou, Manabu; Hasegawa, Akira; Abe, Katsunori; Muroga, Takeo; Yamamoto, Norikazu

    2004-03-01

    In order to improve the mechanical properties of low activation vanadium alloys for fusion structural applications, effects of small addition of Si, Al and Y on the control of interstitial impurities (O, C and N) during the fabrication process were examined for several V-4Cr-4Ti-Si-Al-Y alloys produced by the levitation melting method. Charpy impact tests and tensile tests were carried out for five kinds of V-4Cr-4Ti-Si-Al-Y alloys using miniaturized specimens for the purpose of evaluating the effects of these elements on mechanical properties. Oxygen concentration decreased almost linearly with increasing loss of yttrium during melting. This oxygen reduction with yttrium loss during the melting process may have been achieved by two types of mechanisms, they are, (i) suppression of oxygen penetration into the molten materials from the environment and (ii) getting of oxygen from the matrix by forming Y 2O 3, which floats to the surface during the melting. There was no effect of Si and Al addition to control the concentration of interstitial impurities. V-4Cr-4Ti-0.1Si-0.1Al-0.1Y alloy showed the best impact properties out of the alloys investigated. Upper-shelf energy of the alloys decreased with increasing yttrium content. High number density of coarse inclusions containing yttrium could cause the degradation of impact properties, though they hardly affect tensile properties of the alloys. Even at higher yttrium contents, V-4Cr-4Ti-Y alloys without addition of Si and Al showed relatively high upper-shelf energy.

  19. Effect of glycine addition on the structural, thermal, optical, mechanical and electrical properties of Sr (HCOO)2·2H2O crystals

    NASA Astrophysics Data System (ADS)

    Muthupoongodi, S.; Theodore David Manickam, S.; Mahadevan, C. K.; Angel Mary Greena, J.; Balakumar, S.; Sahaya Shajan, X.

    2015-10-01

    Pure and glycine doped strontium formate dihydrate (SFD) single crystals were grown by the free evaporation method to understand the effect of glycine addition on the structural, thermal, optical, mechanical and electrical properties of SFD crystal. The grown crystals were characterized by carrying out powder X-ray diffraction, high resolution X-ray diffraction, Fourier transform infrared spectral, Raman spectral, UV-vis-NIR spectral, thermogravimetric (TG/DTA), second harmonic generation (SHG), microhardness and DC electrical conductivity measurements. Results obtained in the present study indicate improvement in crystalline perfection, optical transmittance, and SHG efficiency, and change in microhardness, and DC electrical conductivity on doping SFD with glycine. In addition, a large size (~1.9 cm length, ~1.2 cm breath and ~0.6 cm height) SFD crystal with good optical quality could be grown successfully by the seeded free evaporation method.

  20. Effects of Ti and B Addition on Microstructures and Mechanical Properties of Hot-Rolled High-Strength Nb-Containing Steels

    NASA Astrophysics Data System (ADS)

    Meng, Xianna; Li, Cong; Chen, Wanglin

    2016-06-01

    Four microalloyed samples were designed to study the effects of Ti and B additions on microstructures and mechanical properties. Experimental results show that the samples without B addition mainly contain well-developed pearlite and polygonal ferrite, whereas the B-containing samples consist of degenerated pearlite, polygonal ferrite, and Widmanstätten ferrite (WF). The B addition promotes the precipitation of the complex (Ti,Al,Nb)N and (Ti,Al,Nb)2CS phases during the hot-rolling process. Grain sizes are significantly refined by the combinations of undissolved (Ti,Al)N, (Ti,Al,Nb)N complex, (Ti,Al,Nb)2CS, and fine inclusions, which act as the nucleation sites of intragranular ferrite. The core of complex (Ti,Al,Nb)N precipitate is undissolved Ti-N-rich (Ti,Al)N phase, and the cap is Nb-N-rich (Nb,Ti)N phase. The property measurements show that the B addition enhances comprehensive properties of tensile strength and elongation, but decreases fracture toughness due to higher contents of the WF and subgrains.

  1. The Functional and Regulatory Mechanisms of the Thellungiella salsuginea Ascorbate Peroxidase 6 (TsAPX6) in Response to Salinity and Water Deficit Stresses

    PubMed Central

    Li, Zeqin; Zhang, Jilong; Li, Jingxiao; Li, Hongjie; Zhang, Genfa

    2016-01-01

    Soil salinization is a resource and ecological problem in the world. Thellungiella salsuginea is becoming a new model plant because it resembles its relative species, Arabidopsis thaliana, in small genome and short life cycle. It is highly tolerant to salinity and drought stresses. Ascorbate peroxidase (APX) is an enzyme that clears H2O2 in plants. The function and molecular and regulation mechanisms of APX in T. salsuginea have rarely been reported. In this study, an APX gene, TsApx6, was cloned from T. salsuginea and its responses to abiotic stresses in transgenic Arabidopsis were studied. Under high salinity treatment, the expression of TsApx6 was significantly induced. Under drought treatment, overexpression of TsApx6 increased the survival rate and reduced leaf water loss rate in Arabidopsis. Compared to the wild type plants, high salinity treatment reduced the concentrations of MDA, H2O2 and proline but elevated the activities of APX, GPX, CAT and SOD in the TsApx6-overexpressing plants. Meanwhile, germination rate, cotyledon greening, and root length were improved in the transgenic plants compared to the wild type plants under salt and water deficit conditions. Based on these findings, TsApx6 has an important function in the resistance of plants to certain abiotic stresses. The TsApx6 promoter sequence was obtained using Genome Walking technology. Bioinformatics analysis indicated that it contains some cis-acting elements related to stress response. The treatments of salt, dehydration, and ABA induced the expression of Gus gene under the regulation of the TsApx6 promoter. Mutation analysis showed that the MBS motif present in the TsApx6 promoter might be a key negative regulatory element which has an important effect on the growth and developmental process of plants. PMID:27097028

  2. Cloning, biochemical characterisation, tissue localisation and possible post-translational regulatory mechanism of the cytosolic phosphoglucose isomerase from developing sunflower seeds.

    PubMed

    Troncoso-Ponce, M A; Rivoal, J; Cejudo, F J; Dorion, S; Garcés, R; Martínez-Force, E

    2010-09-01

    Lipid biosynthesis in developing sunflower (Helianthus annuus L.) seeds requires reducing power. One of the main sources of cellular NADPH is the oxidative pentose phosphate pathway (OPPP), generated from the oxidation of glucose-6-phosphate. This glycolytic intermediate, which can be imported to the plastid and enter in the OPPP, is the substrate and product of cytosolic phosphoglucose isomerase (cPGI, EC 5.3.1.9). In this report, we describe the cloning of a full-length cDNA encoding cPGI from developing sunflower seeds. The sequence was predicted to code for a protein of 566 residues characterised by the presence of two sugar isomerase domains. This cDNA was heterologously expressed in Escherichia coli as a His-tagged protein. The recombinant protein was purified using immobilised metal ion affinity chromatography and biochemically characterised. The enzyme had a specific activity of 1,436 micromol min(-1) mg(-1) and 1,011 micromol min(-1) mg(-1) protein when the reaction was initiated with glucose-6-phosphate and fructose-6-phosphate, respectively. Activity was not affected by erythrose-4-phosphate, but was inhibited by 6-P gluconate and glyceraldehyde-3-phosphate. A polyclonal immune serum was raised against the purified enzyme, allowing the study of protein levels during the period of active lipid synthesis in seeds. These results were compared with PGI activity profiles and mRNA expression levels obtained from Q-PCR studies. Our results point to the existence of a possible post-translational regulatory mechanism during seed development. Immunolocalisation of the protein in seed tissues further indicated that cPGI is highly expressed in the procambial ring. PMID:20628759

  3. Mathematical model of a telomerase transcriptional regulatory network developed by cell-based screening: analysis of inhibitor effects and telomerase expression mechanisms.

    PubMed

    Bilsland, Alan E; Stevenson, Katrina; Liu, Yu; Hoare, Stacey; Cairney, Claire J; Roffey, Jon; Keith, W Nicol

    2014-02-01

    Cancer cells depend on transcription of telomerase reverse transcriptase (TERT). Many transcription factors affect TERT, though regulation occurs in context of a broader network. Network effects on telomerase regulation have not been investigated, though deeper understanding of TERT transcription requires a systems view. However, control over individual interactions in complex networks is not easily achievable. Mathematical modelling provides an attractive approach for analysis of complex systems and some models may prove useful in systems pharmacology approaches to drug discovery. In this report, we used transfection screening to test interactions among 14 TERT regulatory transcription factors and their respective promoters in ovarian cancer cells. The results were used to generate a network model of TERT transcription and to implement a dynamic Boolean model whose steady states were analysed. Modelled effects of signal transduction inhibitors successfully predicted TERT repression by Src-family inhibitor SU6656 and lack of repression by ERK inhibitor FR180204, results confirmed by RT-QPCR analysis of endogenous TERT expression in treated cells. Modelled effects of GSK3 inhibitor 6-bromoindirubin-3'-oxime (BIO) predicted unstable TERT repression dependent on noise and expression of JUN, corresponding with observations from a previous study. MYC expression is critical in TERT activation in the model, consistent with its well known function in endogenous TERT regulation. Loss of MYC caused complete TERT suppression in our model, substantially rescued only by co-suppression of AR. Interestingly expression was easily rescued under modelled Ets-factor gain of function, as occurs in TERT promoter mutation. RNAi targeting AR, JUN, MXD1, SP3, or TP53, showed that AR suppression does rescue endogenous TERT expression following MYC knockdown in these cells and SP3 or TP53 siRNA also cause partial recovery. The model therefore successfully predicted several aspects of TERT

  4. The Functional and Regulatory Mechanisms of the Thellungiella salsuginea Ascorbate Peroxidase 6 (TsAPX6) in Response to Salinity and Water Deficit Stresses.

    PubMed

    Li, Zeqin; Zhang, Jilong; Li, Jingxiao; Li, Hongjie; Zhang, Genfa

    2016-01-01

    Soil salinization is a resource and ecological problem in the world. Thellungiella salsuginea is becoming a new model plant because it resembles its relative species, Arabidopsis thaliana, in small genome and short life cycle. It is highly tolerant to salinity and drought stresses. Ascorbate peroxidase (APX) is an enzyme that clears H2O2 in plants. The function and molecular and regulation mechanisms of APX in T. salsuginea have rarely been reported. In this study, an APX gene, TsApx6, was cloned from T. salsuginea and its responses to abiotic stresses in transgenic Arabidopsis were studied. Under high salinity treatment, the expression of TsApx6 was significantly induced. Under drought treatment, overexpression of TsApx6 increased the survival rate and reduced leaf water loss rate in Arabidopsis. Compared to the wild type plants, high salinity treatment reduced the concentrations of MDA, H2O2 and proline but elevated the activities of APX, GPX, CAT and SOD in the TsApx6-overexpressing plants. Meanwhile, germination rate, cotyledon greening, and root length were improved in the transgenic plants compared to the wild type plants under salt and water deficit conditions. Based on these findings, TsApx6 has an important function in the resistance of plants to certain abiotic stresses. The TsApx6 promoter sequence was obtained using Genome Walking technology. Bioinformatics analysis indicated that it contains some cis-acting elements related to stress response. The treatments of salt, dehydration, and ABA induced the expression of Gus gene under the regulation of the TsApx6 promoter. Mutation analysis showed that the MBS motif present in the TsApx6 promoter might be a key negative regulatory element which has an important effect on the growth and developmental process of plants. PMID:27097028

  5. Unfolding-resistant translocase targeting: a novel mechanism for outer mitochondrial membrane localization exemplified by the Bbeta2 regulatory subunit of protein phosphatase 2A.

    PubMed

    Dagda, Ruben K; Barwacz, Chris A; Cribbs, J Thomas; Strack, Stefan

    2005-07-22

    Heterotrimeric serine/threonine protein phosphatase 2A (PP2A) consists of scaffolding (A), catalytic (C), and variable (B, B', and B'') subunits. Variable subunits dictate subcellular localization and substrate specificity of the PP2A holoenzyme. The Bbeta regulatory subunit gene is mutated in spinocerebellar ataxia type 12, and one of its splice variants, Bbeta2, targets PP2A to mitochondria to promote apoptosis in PC12 cells (Dagda, R. K., Zaucha, J. A., Wadzinski, B. E., and Strack, S. (2003) J. Biol. Chem. 278, 24976-24985). Here, we report that Bbeta2 is localized to the outer mitochondrial membrane by a novel mechanism, combining a cryptic mitochondrial import signal with a structural arrest domain. Scanning mutagenesis demonstrates that basic and hydrophobic residues mediate mitochondrial association and the proapoptotic activity of Bbeta2. When fused to green fluorescent protein, the N terminus of Bbeta2 acts as a cleavable mitochondrial import signal. Surprisingly, full-length Bbeta2 is not detectably cleaved and is retained at the outer mitochondrial membrane, even though it interacts with the TOM22 import receptor, as shown by luciferase complementation in intact cells. Mutations that open the C-terminal beta-propeller of Bbeta2 facilitate mitochondrial import, indicating that this rigid fold acts as a stop-transfer domain by resisting the partial unfolding step prerequisite for matrix translocation. Because hybrids of prototypical import and beta-propeller domains recapitulate this behavior, we predict the existence of other similarly localized proteins and a selection against highly stable protein folds in the mitochondrial matrix. This unfolding-resistant targeting to the mitochondrial translocase is necessary but not sufficient for the proapoptotic activity of Bbeta2, which also requires association with the rest of the PP2A holoenzyme. PMID:15923182

  6. Rab27a negatively regulates CFTR chloride channel function in colonic epithelia: Involvement of the effector proteins in the regulatory mechanism

    SciTech Connect

    Saxena, Sunil K. . E-mail: ssaxena@stevens.edu; Kaur, Simarna

    2006-07-21

    Cystic fibrosis, an autosomal recessive disorder, is caused by the disruption of biosynthesis or function of CFTR. CFTR regulatory mechanisms include channel transport to plasma membrane and protein-protein interactions. Rab proteins are small GTPases involved in vesicle transport, docking, and fusion. The colorectal epithelial HT-29 cells natively express CFTR and respond to cAMP with an increase in CFTR-mediated currents. DPC-inhibited currents could be completely eliminated with CFTR-specific SiRNA. Over-expression of Rab27a inhibited, while isoform specific SiRNA and Rab27a antibody stimulated CFTR-mediated currents in HT-29 cells. CFTR activity is inhibited both by Rab27a (Q78L) (constitutive active GTP-bound form of Rab27a) and Rab27a (T23N) (constitutive negative form that mimics the GDP-bound form). Rab27a mediated effects could be reversed by Rab27a-binding proteins, the synaptotagmin-like protein (SLP-5) and Munc13-4 accessory protein (a putative priming factor for exocytosis). The SLP reversal of Rab27a effect was restricted to C2A/C2B domains while the SHD motif imparted little more inhibition. The CFTR-mediated currents remain unaffected by Rab3 though SLP-5 appears to weakly bind it. The immunoprecipitation experiments suggest protein-protein interactions between Rab27a and CFTR. Rab27a appears to impair CFTR appearance at the cell surface by trapping CFTR in the intracellular compartments. Munc13-4 and SLP-5, on the other hand, limit Rab27a availability to CFTR, thus minimizing its effect on channel function. These observations decisively prove that Rab27a is involved in CFTR channel regulation through protein-protein interactions involving Munc13-4 and SLP-5 effector proteins, and thus could be a potential target for cystic fibrosis therapy.

  7. Regulatory mechanism of the light-activable allosteric switch LOV-TAP for the control of DNA binding: a computer simulation study.

    PubMed

    Peter, Emanuel; Dick, Bernhard; Baeurle, Stephan A

    2013-03-01

    The spatio-temporal control of gene expression is fundamental to elucidate cell proliferation and deregulation phenomena in living systems. Novel approaches based on light-sensitive multiprotein complexes have recently been devised, showing promising perspectives for the noninvasive and reversible modulation of the DNA-transcriptional activity in vivo. This has lately been demonstrated in a striking way through the generation of the artificial protein construct light-oxygen-voltage (LOV)-tryptophan-activated protein (TAP), in which the LOV-2-Jα photoswitch of phototropin1 from Avena sativa (AsLOV2-Jα) has been ligated to the tryptophan-repressor (TrpR) protein from Escherichia coli. Although tremendous progress has been achieved on the generation of such protein constructs, a detailed understanding of their functioning as opto-genetical tools is still in its infancy. Here, we elucidate the early stages of the light-induced regulatory mechanism of LOV-TAP at the molecular level, using the noninvasive molecular dynamics simulation technique. More specifically, we find that Cys450-FMN-adduct formation in the AsLOV2-Jα-binding pocket after photoexcitation induces the cleavage of the peripheral Jα-helix from the LOV core, causing a change of its polarity and electrostatic attraction of the photoswitch onto the DNA surface. This goes along with the flexibilization through unfolding of a hairpin-like helix-loop-helix region interlinking the AsLOV2-Jα- and TrpR-domains, ultimately enabling the condensation of LOV-TAP onto the DNA surface. By contrast, in the dark state the AsLOV2-Jα photoswitch remains inactive and exerts a repulsive electrostatic force on the DNA surface. This leads to a distortion of the hairpin region, which finally relieves its tension by causing the disruption of LOV-TAP from the DNA. PMID:23042418

  8. Influence of the season on vitamin D levels and regulatory T cells in patients with polymorphic light eruption† †Electronic supplementary information (ESI) available. See DOI: 10.1039/c5pp00398a Click here for additional data file. Click here for additional data file.

    PubMed Central

    Schweintzger, N. A.; Gruber-Wackernagel, A.; Shirsath, N.; Quehenberger, F.; Obermayer-Pietsch, B.

    2016-01-01

    The exact mechanisms of photohardening in polymorphic light eruption (PLE) are still unknown, but medical photohardening was shown to increase regulatory T cell (Treg) numbers in the blood of PLE patients, similar to natural hardening. Furthermore, oral vitamin D supplementation increased peripheral Tregs in healthy individuals. We herein report on a post hoc analysis of 26 screened PLE patients of a clinical trial (ClinicalTrials.gov No. NCT01595893), in which the influence of the progressing season was investigated on baseline CD4+CD25+FoxP3+CD127– Treg numbers by flow cytometry and Treg suppressive function by co-culture assays with T effector cells as a secondary endpoint, together with 25-hydroxy vitamin D (25(OH)D) serum levels at the study's screening visit, taking place in the period from January to June. The mean 25(OH)D serum level of all patients was 33.2 ng ml–1. Ten of those patients (38.5%) were identified with low 25(OH)D levels (<30 ng ml–1). Significantly higher baseline 25(OH)D serum levels (plus 34.4%; P = 0.0182) as well as higher relative Treg percentages in CD4+ population (plus 62.8%; P = 0.0157) and in total lymphocyte population (plus 59.6%; P = 0.0372) and higher absolute Treg numbers (plus 100.2%; P = 0.0042) were observed in the late spring/early summer period (April to June) compared to the winter period (January to February). No significant relationship was observed when Treg numbers and function were correlated with 25(OH)D levels. These data indicate that in PLE patients Treg numbers and their suppressive function are independent of vitamin D serum levels and suggest that UV light and/or other seasonal factors may affect these cells via the non-vitamin D related pathway(s). PMID:26911519

  9. [On improvement of the mechanism for establishing and changing indicators of quality and food safety in the regulatory and legal acts of the Eurasian Economical Union].

    PubMed

    Arnautov, O V

    2016-01-01

    In accordance with the Treaty on the Eurasian Economic Union (EAEU) to ensure the sanitary and epidemiological welfare of the population within the Union, a coordinated policy in agreed policy in the sphere of application of sanitary measures is carried out. Sanitary measures are the obligatory requirements and procedures, including requirements for the final product, processing methods, production, transportation, storage and disposal, sampling procedures, methods of research (tests), risk assessment, the state registration, requirements for packaging directly aimed at ensuring the safety of products (goods) in order to protect human welfare, and they should be applied on the basis having a scientific explanation, and only to the extent that is necessary to protect human welfare. Sanitary measures applied within the Union should be based on international and regional standards, guidelines and (or) the recommendations, except when they based on appropriate scientific studies and explanations. In this case sanitary measures which could provide a higher level of sanitary protection are introduced. At present, the mechanism of the development, justification and approval of common sanitary and epidemiological requirements (ESR) and procedures of the Eurasian Economic Commission (the Commission) is not installed. The absence of a clear mechanism for the development, approval and implementation of the ESR to the products (goods) on the basis having a scientific explanation on the one hand could lead to the creation of unjustified barriers to foreign and mutual trade, on the other--to weaken the level of safety for human life and health of products (goods) placed on markets of the Union. In order to bring the regulatory legal acts of the Customs Union in accordance with the Treaty on the Eurasian Economic Union the Commission in cooperation with the competent authorities of the Member States in the field of sanitary and epidemiological welfare developed the project of

  10. Reinforcement of acrylic resins for provisional fixed restorations. Part III: effects of addition of titania and zirconia mixtures on some mechanical and physical properties.

    PubMed

    Panyayong, W; Oshida, Y; Andres, C J; Barco, T M; Brown, D T; Hovijitra, S

    2002-01-01

    Acrylic resins have been used in many different applications in dentistry, especially in the fabrication of provisional fixed partial dentures. Ideally, a provisional crown and bridge material should be easy to handle and should protect teeth against physical, chemical, and thermal injuries. Some of the problems associated with this use are related to the material's poor mechanical properties. It has been demonstrated that acrylic resin can be strengthened through the addition of structural component of different size distributed in the acrylic matrix, thus forming a composite structure. The purpose of this study was to investigate the addition effects of mixtures of titania (titanium dioxide, TiO(2)) powder and zirconia (zirconium dioxide, ZrO(2)) powder being incorporated with pre-polymerized beads mixed in monomer liquid, on some mechanical and physical properties of PMMA resin. The pre-polymerized powder poly(methyl methacrylate) resin was admixed with titania and zirconia powder. A mixing ratio was controlled by volume % of 0, 1.0, 2.0, and 3.0 (samples with 0 v/o served as control groups). For using mixture of titania and zirconia, total amount of the mixture was controlled by volume % of 1.0, 2.0, and 3.0, in which titania and zirconia were mixed at the ratio 1 :1, 1 :2 and 2 :1. Prior to mechanical tests, all rectangular-shaped samples (25 mm x 2 mm x 5 mm) were stored in 37 degrees C distilled water for 7 days after polishing all six sides of samples. Samples were then subjected to the three-point bending flexion test to evaluate the bending strength as well as the modulus of elasticity. Weight gain and exothermic reaction survey were investigated as well. All data were collected and analyzed with one-way analysis of variance (ANOVA) and Sidak method (p=0.05). It was found that the addition of particles generally decreased the water absorbed by the composite system. Only 1 percent by volume concentration of 1 :1 ratio and 2 percent by volume concentration

  11. The Influence of Sc and Zr Additions on the Microstructure and Mechanical Behavior of Ultrafine Grained Al-Mg Alloys Processed by Powder Metallurgy

    NASA Astrophysics Data System (ADS)

    Harrell, Tammy Jeanne

    Additions of Sc and Zr to an Al-Mg matrix were investigated, paying particular attention to the influence of Al3Sc precipitates and other dispersoids, as well as grain size, on mechanical behavior. Prior studies have shown that Sc and Zr significantly increase the strength of coarse-grained Al-Mg alloys. Prompted by these findings, we hypothesized that it would be of fundamental and technological interest to study the behavior of Sc additions to an ultra-fine-grained (UFG) microstructure (e.g., 100's nm). Accordingly, we investigate the microstructural evolution and mechanical behavior of four powder metallurgy UFG Al-Mg-Sc-(Zr) compositions and compared the results to those of equivalent fine-grained (FG) compositions - Al-5Mg-0.1Sc, Al-3Mg-0.5Sc, Al-5Mg-0.4Sc and Al-5Mg-0.2Sc-0.2Zr (wt.%). Experimental materials were consolidated by hot isostatic pressing (HIP'ing) followed by extrusion or dual mode dynamic (DMD) forging. Under identical processing conditions, UFG ternary Al-5Mg-0.4Sc materials generate large Al3Sc precipitates with an average diameter of 154 nm and spaced approximately 1 - 3 μm apart, while precipitates in the FG materials have an average diameter of 24 nm and are spaced 50 - 200 nm apart. The strengthening mechanisms are quantitatively evaluated for all materials and it is determined that the greatest strengthening contributions for the UFG and FG materials are dispersion strengthening due to the presence of Mg-rich oxides/nitrides and precipitate strengthening, respectively. Preliminary results suggest that replacing 0.2 wt% Sc with Zr results in higher strength, lower ductility and a change in precipitate distribution.

  12. Cognitive training with and without additional physical activity in healthy older adults: cognitive effects, neurobiological mechanisms, and prediction of training success

    PubMed Central

    Rahe, Julia; Becker, Jutta; Fink, Gereon R.; Kessler, Josef; Kukolja, Juraj; Rahn, Andreas; Rosen, Jan B.; Szabados, Florian; Wirth, Brunhilde; Kalbe, Elke

    2015-01-01

    Data is inconsistent concerning the question whether cognitive-physical training (CPT) yields stronger cognitive gains than cognitive training (CT). Effects of additional counseling, neurobiological mechanisms, and predictors have scarcely been studied. Healthy older adults were trained with CT (n = 20), CPT (n = 25), or CPT with counseling (CPT+C; n = 23). Cognition, physical fitness, BDNF, IGF-1, and VEGF were assessed at pre- and post-test. No interaction effects were found except for one effect showing that CPT+C led to stronger gains in verbal fluency than CPT (p = 0.03). However, this superiority could not be assigned to additional physical training gains. Low baseline cognitive performance and BDNF, not carrying apoE4, gains in physical fitness and the moderation of gains in physical fitness × gains in BDNF predicted training success. Although all types of interventions seem successful to enhance cognition, our data do not support the hypotheses that CPT shows superior CT gains compared to CT or that CPT+C adds merit to CPT. However, as CPT leads to additional gains in physical fitness which in turn is known to have positive impact on cognition in the long-term, CPT seems more beneficial. Training success can partly be predicted by neuropsychological, neurobiological, and genetic parameters. Unique Identifier: WHO ICTRP (http://www.who.int/ictrp); ID: DRKS00005194. PMID:26528177

  13. Influence of the simultaneous addition of bentonite and cellulose fibers on the mechanical and barrier properties of starch composite-films.

    PubMed

    de Moraes, J Oliveira; Müller, C M O; Laurindo, J B

    2012-02-01

    The addition of nanoclay or cellulose fibers has been presented in the literature as a suitable alternative for reinforcing starch films. The aim of the present work was to evaluate the effect of the simultaneous incorporation of nanoclay (bentonite) and cellulose fibers on the mechanical and water barrier properties of the resultant composite-films. Films were prepared by casting with 3% in weight of cassava starch, using glycerol as plasticizer (0.30 g per g of starch), cellulose fibers at a concentration of 0.30 g of fibers per g of starch and nanoclay (0.05 g clay per g starch and 0.10 g clay per g starch). The addition of cellulose fibers and nanoclay increased the tensile strength of the films 8.5 times and the Young modulus 24 times but reduced the elongation capacity 14 times. The water barrier properties of the composite-films to which bentonite and cellulose fibers were added were approximately 60% inferior to those of starch films. Diffractograms showed that the nanoclay was intercalated in the polymeric matrix. These results indicate that the simultaneous addition of bentonite and cellulose fibers is a suitable alternative to increase the tensile strength of the films and decrease their water vapor permeabilities. PMID:22049161

  14. Effect of Y, Sr, and Nd additions on the microstructure and microfracture mechanism of squeeze-cast AZ91-X magnesium alloys

    SciTech Connect

    Lee, S.; Lee, S.H.; Kim, D.H.

    1998-04-01

    This study aims to investigate the effects of Y, Sr, and Nd additions on the microstructure and microfracture mechanism of the four squeeze-cast magnesium alloys based on the commercial AZ91 alloy. Microstructural observation, in situ fracture tests, fractographic observation were conducted on the alloys to clarify the microfracture process. Microstructural analyses indicated that grain refinement could be achieved by small additions of alloying elements, although the discontinuously precipitated Mg{sub 17}Al{sub 12} phases still existed on grain boundaries. From in situ fracture observation of an AZ91-Sr alloy, it was seen that coarse needle-shaped compound particles and Mg{sub 17}Al{sub 12} phases located on the grain boundary provided easy intergranular fracture sites under low stress intensity factor levels, resulting in the drop in toughness. On the other hand, the AZ91-Y and AZ91-Nd alloys showed improved fracture toughness, since deformation and fracture paths proceeded into grains rather than to grain boundaries, as the planar slip bands and twinnings actively developed inside the grains. These findings suggested, on the basis of the well-developed planar slip bands and twinnings, that the small addition of Y or Nd was very effective in improving fracture toughness.

  15. Mechanical properties of PP/PA blends in addition with PP-g-MAH with different PP molecular weight and MAH content

    NASA Astrophysics Data System (ADS)

    Tokumitsu, Katuhisa; Nakajima, Yuki; Aoki, Kenji

    2016-03-01

    The mechanical properties and morphological changes of PP/PA6/PP-g-MAH blends were investigated. In particular, various kinds of PP-g-MAH, which have a series of different Mw of PP and MAH content, were investigated. From the tensile test results of PP/PA6 blends, although the elongation at break and yield stress can be improved by adding PP-g-MAH, modulus slightly decreased. In particular, elongation at break of PP/PA in addition with PP-g-MAH increased twentyfold from 27.0% (without PP-g-MAH) to 570%. On the basis of Charpy impact test results, the impact strength can also be improved by adding PP-g-MAH. From SEM observation, it was found that the diameter of the dispersed PA6 phase in PP matrix was getting much smaller with PP-g-MAH content. From the TEM observation, the boundary of the PA phase in PP/PA blends without PP-g-MAH compatibilizer can be observed clearly, but it becomes hard to see the boundary part of the PA phase in PP/PA blend with compatibilizer. Furthermore, when comparing the inside of the PA phase, small amount of PP phase can be observed in the PA phase of PP/PA blend with compatibilizer. Here, we defined a parameter, Comprehensive Mechanical Property Factor (CMPF), which can be calculated by multiple each mechanical property (elongation at break, yield stress, modulus and impact strength) against each maximum value, and it was found that CMPF has a good correlation with the diameter of PA6 phase. In conclusion, an optimum mechanical property of PP/PA6 can be obtained by using PP-g-MAH with Mw around 35,000 ˜ 50,000 g mol-1 and MAH content around 2.0 ˜ 3.5 %.

  16. Influencing the arc and the mechanical properties of the weld metal in GMA-welding processes by additive elements on the wire electrode surface

    NASA Astrophysics Data System (ADS)

    Wesling, V.; Schram, A.; Müller, T.; Treutler, K.

    2016-03-01

    Under the premise of an increasing scarcity of raw materials and increasing demands on construction materials, the mechanical properties of steels and its joints are gaining highly important. In particular high- and highest-strength steels are getting in the focus of the research and the manufacturing industry. To the same extent, the requirements for filler metals are increasing as well. At present, these low-alloy materials are protected by a copper coating (<1μm) against corrosion. In addition, the coating realizes a good ohmic contact and good sliding properties between the welding machine and the wire during the welding process. By exchanging the copper with other elements it should be possible to change the mechanical properties of the weld metal and the arc stability during gas metal arc welding processes and keep the basic functions of the coating nearly untouched. On a laboratory scale solid wire electrodes with coatings of various elements and compounds such as titanium oxide were made and processed with a Gas Metal Arc Welding process. During the processing a different process behavior between the wire electrodes, coated and original, could be observed. The influences ranges from greater/shorter arc-length over increasing/decreasing droplets to larger/smaller arc foot point. Furthermore, the weld metal of the coated electrodes has significantly different mechanical and technological characteristics as the weld metal from the copper coated ground wire. The yield strength and tensile strength can be increased by up to 50%. In addition, the chemical composition of the weld metal was influenced by the application of coatings with layer thicknesses to 15 microns in the lower percentage range (up to about 3%). Another effect of the coating is a modified penetration. The normally occurring “argon finger” can be suppressed or enhanced by the choice of the coating. With the help of the presented studies it will be shown that Gas Metal Arc Welding processes

  17. Emerging regulatory paradigms in glutathione metabolism.

    PubMed

    Liu, Yilin; Hyde, Annastasia S; Simpson, Melanie A; Barycki, Joseph J

    2014-01-01

    One of the hallmarks of cancer is the ability to generate and withstand unusual levels of oxidative stress. In part, this property of tumor cells is conferred by elevation of the cellular redox buffer glutathione. Though enzymes of the glutathione synthesis and salvage pathways have been characterized for several decades, we still lack a comprehensive understanding of their independent and coordinate regulatory mechanisms. Recent studies have further revealed that overall central metabolic pathways are frequently altered in various tumor types, resulting in significant increases in biosynthetic capacity and feeding into glutathione synthesis. In this review, we will discuss the enzymes and pathways affecting glutathione flux in cancer and summarize current models for regulating cellular glutathione through both de novo synthesis and efficient salvage. In addition, we examine the integration of glutathione metabolism with other altered fates of intermediary metabolites and highlight remaining questions about molecular details of the accepted regulatory modes. PMID:24974179

  18. Emerging regulatory paradigms in glutathione metabolism

    PubMed Central

    Liu, Yilin; Hyde, Annastasia S.; Simpson, Melanie A.; Barycki, Joseph J.

    2015-01-01

    One of the hallmarks of cancer is the ability to generate and withstand unusual levels of oxidative stress. In part, this property of tumor cells is conferred by elevation of the cellular redox buffer glutathione. Though enzymes of the glutathione synthesis and salvage pathways have been characterized for several decades, we still lack a comprehensive understanding of their independent and coordinate regulatory mechanisms. Recent studies have further revealed that overall central metabolic pathways are frequently altered in various tumor types, resulting in significant increases in biosynthetic capacity, and feeding into glutathione synthesis. In this review, we will discuss the enzymes and pathways affecting glutathione flux in cancer, and summarize current models for regulating cellular glutathione through both de novo synthesis and efficient salvage. In addition, we examine the integration of glutathione metabolism with other altered fates of intermediary metabolites, and highlight remaining questions about molecular details of the accepted regulatory modes. PMID:24974179

  19. Variation in mechanical behavior due to different build directions of Titanium6Aluminum4Vanadium fabricated by electron beam additive manufacturing technology

    NASA Astrophysics Data System (ADS)

    Roy, Lalit

    Titanium has always been a metal of great interest since its discovery especially for critical applications because of its excellent mechanical properties such as light weight (almost half of that of the steel), low density (4.4 gm/cc) and high strength (almost similar to steel). It creates a stable and adherent oxide layer on its surface upon exposure to air or water which gives it a great resistance to corrosion and has made it a great choice for structures in severe corrosive environment and sea water. Its non-allergic property has made it suitable for biomedical application for manufacturing implants. Having a very high melting temperature, it has a very good potential for high temperature applications. But high production and processing cost has limited its application. Ti6Al4V is the most used titanium alloy for which it has acquired the title as `workhouse' of the Ti family. Additive layer Manufacturing (ALM) has brought revolution in manufacturing industries. Today, this additive manufacturing has developed into several methods and formed a family. This method fabricates a product by adding layer after layer as per the geometry given as input into the system. Though the conception was developed to fabricate prototypes and making tools initially, but its highly economic aspect i.e., very little waste material for less machining and comparatively lower production lead time, obviation of machine tools have drawn attention for its further development towards mass production. Electron Beam Melting (EBM) is the latest addition to ALM family developed by Arcam, ABRTM located in Sweden. The electron beam that is used as heat source melts metal powder to form layers. For this thesis work, three different types of specimens have been fabricated using EBM system. These specimens differ in regard of direction of layer addition. Mechanical properties such as ultimate tensile strength, elastic modulus and yield strength, have been measured and compared with standard data

  20. Study on the Regulatory Mechanism of the Lipid Metabolism Pathways during Chicken Male Germ Cell Differentiation Based on RNA-Seq

    PubMed Central

    Zuo, Qisheng; Li, Dong; Zhang, Lei; Elsayed, Ahmed Kamel; Lian, Chao; Shi, Qingqing; Zhang, Zhentao; Zhu, Rui; Wang, Yinjie; Jin, Kai; Zhang, Yani; Li, Bichun

    2015-01-01

    Here, we explore the regulatory mechanism of lipid metabolic signaling pathways and related genes during differentiation of male germ cells in chickens, with the hope that better understanding of these pathways may improve in vitro induction. Fluorescence-activated cell sorting was used to obtain highly purified cultures of embryonic stem cells (ESCs), primitive germ cells (PGCs), and spermatogonial stem cells (SSCs). The total RNA was then extracted from each type of cell. High-throughput analysis methods (RNA-seq) were used to sequence the transcriptome of these cells. Gene Ontology (GO) analysis and the KEGG database were used to identify lipid metabolism pathways and related genes. Retinoic acid (RA), the end-product of the retinol metabolism pathway, induced in vitro differentiation of ESC into male germ cells. Quantitative real-time PCR (qRT-PCR) was used to detect changes in the expression of the genes involved in the retinol metabolic pathways. From the results of RNA-seq and the database analyses, we concluded that there are 328 genes in 27 lipid metabolic pathways continuously involved in lipid metabolism during the differentiation of ESC into SSC in vivo, including retinol metabolism. Alcohol dehydrogenase 5 (ADH5) and aldehyde dehydrogenase 1 family member A1 (ALDH1A1) are involved in RA synthesis in the cell. ADH5 was specifically expressed in PGC in our experiments and aldehyde dehydrogenase 1 family member A1 (ALDH1A1) persistently increased throughout development. CYP26b1, a member of the cytochrome P450 superfamily, is involved in the degradation of RA. Expression of CYP26b1, in contrast, decreased throughout development. Exogenous RA in the culture medium induced differentiation of ESC to SSC-like cells. The expression patterns of ADH5, ALDH1A1, and CYP26b1 were consistent with RNA-seq results. We conclude that the retinol metabolism pathway plays an important role in the process of chicken male germ cell differentiation. PMID:25658587

  1. Fe-24 wt.%Cr-4.1 wt.%C hardfacing alloy: Microstructure and carbide refinement mechanisms with ceria additive

    SciTech Connect

    Zhou, Y.F.; Yang, Y.L.; Jiang, Y.W.; Yang, J.; Ren, X.J.; Yang, Q.X.

    2012-10-15

    The microstructure and carbide refinement mechanisms of Fe-24 wt.%Cr-4.1 wt.%C hardfacing alloys with 0 wt.%, 0.5 wt.%, 1.0 wt.%, 2 wt.%, and 4 wt.% ceria additives have been systematically investigated in this work. Optical microscopy, field emission scanning electron microscopy with energy dispersive spectrometer, and X-ray diffraction were collectively used to study the microstructure, the phase components, and the chemical formation of inclusion formed in the welding process. Wear-resistance of the alloys was comparatively studied using an abrasive wear testing machine. The structure analysis results show that the Fe-Cr-C hardfacing alloy mainly consists of martensite, retained austenite, MC carbide and M{sub 7}C{sub 3} carbide. With increasing ceria additive contents, the average size of the primary M{sub 7}C{sub 3} carbide decreases and reaches a most refined state in the alloy with 2 wt.% ceria additives. Comparative wear tests data shows that the wear resistance of the hardfacing alloys with ceria additives is better than that without ceria additive. In a good agreement with the carbide refinement results, the wear resistance of the alloy reaches an optimum level in the sample with 2 wt.% ceria additive. The main RE inclusion type identified with in-situ XRD analysis is RE inclusion Ce{sub 2}O{sub 2}S. Thermodynamics calculation confirms that this type of RE inclusion could precipitate prior to M{sub 7}C{sub 3} carbides, and act as a heterogeneous nucleus for M{sub 7}C{sub 3} in the welding process, which effectively provides a mechanism for significant refinement of the M{sub 7}C{sub 3} carbide and improves its wear resistance. - Graphical Abstract: Rare Earth inclusion (Ce{sub 2}O{sub 2}S) distributes in the primary M{sub 7}C{sub 3} carbide. Moreover, Ce{sub 2}O{sub 2}S, which acts as heterogeneous nuclei of the primary M{sub 7}C{sub 3} carbide, is medium effective. Therefore, the primary M{sub 7}C{sub 3} carbide has been refined. Highlights: Black

  2. Effect of the addition of by-product ash of date palms on the mechanical characteristics of gypsum-calcareous materials used in road construction

    NASA Astrophysics Data System (ADS)

    Khellou, A.; Kriker, A.; Hafssi, A.; Belbarka, K.; Baali, K.

    2016-07-01

    The gypsum-calcareous materials, also known as the crusting tuff, are used in the pavement layers of low -traffic road and considered as the materials of first choice in the Saharan region of Algeria. The objective of this paper is to study the mechanical characteristics of tuff of Ouargla town that is situated in the Southeast of Algeria, by adding different percentage of ash resulted from the combustion of by-products of date palms, such as 4%, 8% and l2%, to the tuff. The results obtained have shown a remarkable improvement both in compressive strength at different ages and in the bearing index in the two cases immediate and after immersion in water. These characteristics of the mixture (tuff+ash) reach their maximum values at the 8% of ash addition.

  3. Asymmetric Michael Addition of Aldimino Esters with Chalcones Catalyzed by Silver/Xing-Phos: Mechanism-Oriented Divergent Synthesis of Chiral Pyrrolines.

    PubMed

    Bai, Xing-Feng; Li, Li; Xu, Zheng; Zheng, Zhan-Jiang; Xia, Chun-Gu; Cui, Yu-Ming; Xu, Li-Wen

    2016-07-18

    The mechanism-oriented reaction design for the divergent synthesis of chiral molecules from simple starting materials is highly desirable. In this work, aromatic amide-derived nonbiarylatropisomer/silver (silver/Xing-Phos) complex was used to catalyze the Michael addition of glycine aldimino esters to chalcones and successfully applied to the subsequent cyclocondensation to afford substituted cis-Δ(1)-pyrroline derivatives with up to 98 % ee. Besides the inherent performance of the chiral Ag/Xing-Phos catalyst system, it was found that the workup of such reactions played an important role for the stereoselective construction of stereodivergent Δ(1)-pyrrolines, in which an epimerization of the cis-Δ(1)-pyrrolines to the trans-isomers during was revealed. PMID:27198615

  4. [International regulation of ethics committees on biomedical research as protection mechanisms for people: analysis of the Additional Protocol to the Convention on Human Rights and Biomedicine, concerning Biomedical Research of the Council of Europe].

    PubMed

    de Lecuona, Itziar

    2013-01-01

    The article explores and analyses the content of the Council of Europe's Additional Protocol to the Convention on Human Rights and Biomedicine concerning Biomedical Research regarding the standard legal instrument in biomedical research, issued by an international organization with leadership in bioethics. This implies ethics committees are mechanisms of protection of humans in biomedical research and not mere bureaucratic agencies and that a sound inescapable international regulatory framework exists for States to regulate biomedical research. The methodology used focuses on the analysis of the background, the context in which it is made and the nature and scope of the Protocol. It also identifies and analyses the characteristics and functions of ethics committees in biomedical research and, in particular, the information that should be provided to this bodies to develop their functions previously, during and at the end of research projects. This analysis will provide guidelines, suggestions and conclusions for the awareness and training of members of these committees in order to influence the daily practice. This paper may also be of interest to legal practitioners who work in different areas of biomedical research. From this practical perspective, the article examines the legal treatment of the Protocol to meet new challenges and classic issues in research: the treatment of human biological samples, the use of placebos, avoiding double standards, human vulnerability, undue influence and conflicts of interest, among others. Also, from a critical view, this work links the legal responses to develop work procedures that are required for an effective performance of the functions assigned of ethics committees in biomedical research. An existing international legal response that lacks doctrinal standards and provides little support should, however, serve as a guide and standard to develop actions that allow ethics committees -as key bodies for States- to advance in

  5. Effect of Ni and Pd Addition on Mechanical, Thermodynamic, and Electronic Properties of AuSn4-Based Intermetallics: A Density Functional Investigation

    NASA Astrophysics Data System (ADS)

    Tian, Yali; Zhou, Wei; Wu, Ping

    2016-05-01

    The effects of Ni and Pd addition on the mechanical, thermodynamic, and electronic properties of AuSn4-based intermetallic compounds (IMCs) have been investigated by first-principles calculations to reveal the essence of Au embrittlement. Three kinds of doped (namely Ni-doped, Pd-doped, and Ni/Pd-codoped) IMCs are considered in this work. The polycrystalline elastic properties are deduced from single-crystal elastic constants. It is found that the doped systems together with nondoped AuSn4 are all ductile phases. For Ni-doped AuSn4, the modulus, hardness, brittleness, Debye temperature, and minimum thermal conductivity increase with the Ni fraction, but this is not the case for the Pd-doped material, since Au0.75Pd0.25Sn4 is the more brittle phase. For Au0.5Pd0.25Ni0.25Sn4, the mechanical, thermodynamic, and electronic properties are similar to those of Au0.5Pd0.5Sn4.

  6. Effect of Ni and Pd Addition on Mechanical, Thermodynamic, and Electronic Properties of AuSn4-Based Intermetallics: A Density Functional Investigation

    NASA Astrophysics Data System (ADS)

    Tian, Yali; Zhou, Wei; Wu, Ping

    2016-08-01

    The effects of Ni and Pd addition on the mechanical, thermodynamic, and electronic properties of AuSn4-based intermetallic compounds (IMCs) have been investigated by first-principles calculations to reveal the essence of Au embrittlement. Three kinds of doped (namely Ni-doped, Pd-doped, and Ni/Pd-codoped) IMCs are considered in this work. The polycrystalline elastic properties are deduced from single-crystal elastic constants. It is found that the doped systems together with nondoped AuSn4 are all ductile phases. For Ni-doped AuSn4, the modulus, hardness, brittleness, Debye temperature, and minimum thermal conductivity increase with the Ni fraction, but this is not the case for the Pd-doped material, since Au0.75Pd0.25Sn4 is the more brittle phase. For Au0.5Pd0.25Ni0.25Sn4, the mechanical, thermodynamic, and electronic properties are similar to those of Au0.5Pd0.5Sn4.

  7. Effects of Sn Addition on the Microstructures and Mechanical Properties of Mg-6Zn-3Cu- xSn Magnesium Alloys

    NASA Astrophysics Data System (ADS)

    Zhang, Tao; Shen, Jun; Sang, Jia-Xin; Li, Yang; He, Pei-Pei

    2015-08-01

    In this paper, Mg-6Zn-3Cu- xSn (ZC63- xSn) magnesium alloys with different Sn contents (0, 1, 2, 4 wt pct) were fabricated and subjected to different heat treatments. The microstructures and mechanical properties of the obtained ZC63- xSn samples were investigated by optical microscopy, X-ray diffraction, scanning electron microscopy, Vickers hardness testing, and tensile testing. It was found that the As-cast Mg-6Zn-3Cu (ZC63) magnesium alloy mainly contained α-Mg grains and Mg(Zn,Cu) particles. Sn dissolved in α-Mg grains when Sn content was below 2 wt pct while Mg2Sn phase forms in the case of Sn content was above 4 wt pct. Addition of Sn refined both α-Mg grains and Mg(Zn,Cu) particles, and increased the volume fraction of Mg(Zn,Cu) particles. Compared with the Sn-free alloy, the microhardness of Sn-containing alloys increased greatly and that of As-extrude ZC63-4Sn sample achieved the highest value. The strength of ZC63 magnesium alloy was significantly enhanced because of Sn addition, which was attributed to grain refinement strengthening, solid solution strengthening, and precipitation strengthening. Furthermore, the ultimate yield stress, yield strength, and elongation of ZC63- xSn magnesium alloys were increased owing to the deceasing grain size induced by extrusion process.

  8. Food additives

    MedlinePlus

    Food additives are substances that become part of a food product when they are added during the processing or making of that food. "Direct" food additives are often added during processing to: Add nutrients ...

  9. The importance of heat evolution during the overcharge process and the protection mechanism of electrolyte additives for prismatic lithium ion batteries

    NASA Astrophysics Data System (ADS)

    Chen, Yi-Shiun; Hu, Chi-Chang; Li, Yuan-Yao

    In this work, the rate of heat generation in the overcharge period for 103450 prismatic lithium ion batteries (LIBs) of the LiCoO 2-graphite jellyroll type with a basic electrolyte consisting of 1 M LiPF 6-PC/EC/EMC (1/3/5 in weight ratio) has been found to be more important than the gas evolution which was traditionally considered as the main reason in the overcharge protection mechanism. The cell voltage, charge current, and skin temperature were monitored during the charge process. For a single battery or batteries in parallel, LIBs without any additives is an acceptable design if the cell voltage is not charged above 4.55 V under the common charge program. The rate of heat generation from the polymerization of 3 wt% cyclohexyl benzene (CHB) is high enough to cause the explosion or thermal runaway of a battery, which is not found for an LIB containing 2 wt% CHB + 1 wt% tert-amyl benzene (TAB). In the 12 V overcharge test at 1C, the thermal fuse was broken by the high skin temperature (ca. 80 °C) due to the polymerization of 3 wt% CHB, which was also the case for LIBs containing 2 wt% CHB + 1 wt% TAB. The disconnection of the thermal fuse, however, did not interrupt the thermal runaway of LIBs without any additives because the battery voltage was too high (ca. 4.9 V). The influence of specific surface area of active materials in the anode on the polymerization kinetics of additives has to be carefully considered in order to add correct amount of overcharge protection agents.

  10. Mechanical and Combustion Performance of Multi-Walled Carbon Nanotubes as an Additive to Paraffin-Based Solid Fuels for Hybrid Rockets

    NASA Technical Reports Server (NTRS)

    Larson, Daniel B.; Boyer, Eric; Wachs, Trevor; Kuo, Kenneth, K.; Koo, Joseph H.; Story, George

    2012-01-01

    Paraffin-based solid fuels for hybrid rocket motor applications are recognized as a fastburning alternative to other fuel binders such as HTPB, but efforts to further improve the burning rate and mechanical properties of paraffin are still necessary. One approach that is considered in this study is to use multi-walled carbon nanotubes (MWNT) as an additive to paraffin wax. Carbon nanotubes provide increased electrical and thermal conductivity to the solid-fuel grains to which they are added, which can improve the mass burning rate. Furthermore, the addition of ultra-fine aluminum particles to the paraffin/MWNT fuel grains can enhance regression rate of the solid fuel and the density impulse of the hybrid rocket. The multi-walled carbon nanotubes also present the possibility of greatly improving the mechanical properties (e.g., tensile strength) of the paraffin-based solid-fuel grains. For casting these solid-fuel grains, various percentages of MWNT and aluminum particles will be added to the paraffin wax. Previous work has been published about the dispersion and mixing of carbon nanotubes.1 Another manufacturing method has been used for mixing the MWNT with a phenolic resin for ablative applications, and the manufacturing and mixing processes are well-documented in the literature.2 The cost of MWNT is a small fraction of single-walled nanotubes. This is a scale-up advantage as future applications and projects will require low cost additives to maintain cost effectiveness. Testing of the solid-fuel grains will be conducted in several steps. Dog bone samples will be cast and prepared for tensile testing. The fuel samples will also be analyzed using thermogravimetric analysis and a high-resolution scanning electron microscope (SEM). The SEM will allow for examination of the solid fuel grain for uniformity and consistency. The paraffin-based fuel grains will also be tested using two hybrid rocket test motors located at the Pennsylvania State University s High Pressure

  11. Regulatory Mechanisms Underlying Oil Palm Fruit Mesocarp Maturation, Ripening, and Functional Specialization in Lipid and Carotenoid Metabolism1[W][OA

    PubMed Central

    Tranbarger, Timothy J.; Dussert, Stéphane; Joët, Thierry; Argout, Xavier; Summo, Marilyne; Champion, Antony; Cros, David; Omore, Alphonse; Nouy, Bruno; Morcillo, Fabienne

    2011-01-01

    Fruit provide essential nutrients and vitamins for the human diet. Not only is the lipid-rich fleshy mesocarp tissue of the oil palm (Elaeis guineensis) fruit the main source of edible oil for the world, but it is also the richest dietary source of provitamin A. This study examines the transcriptional basis of these two outstanding metabolic characters in the oil palm mesocarp. Morphological, cellular, biochemical, and hormonal features defined key phases of mesocarp development. A 454 pyrosequencing-derived transcriptome was then assembled for the developmental phases preceding and during maturation and ripening, when high rates of lipid and carotenoid biosynthesis occur. A total of 2,629 contigs with differential representation revealed coordination of metabolic and regulatory components. Further analysis focused on the fatty acid and triacylglycerol assembly pathways and during carotenogenesis. Notably, a contig similar to the Arabidopsis (Arabidopsis thaliana) seed oil transcription factor WRINKLED1 was identified with a transcript profile coordinated with those of several fatty acid biosynthetic genes and the high rates of lipid accumulation, suggesting some common regulatory features between seeds and fruits. We also focused on transcriptional regulatory networks of the fruit, in particular those related to ethylene transcriptional and GLOBOSA/PISTILLATA-like proteins in the mesocarp and a central role for ethylene-coordinated transcriptional regulation of type VII ethylene response factors during ripening. Our results suggest that divergence has occurred in the regulatory components in this monocot fruit compared with those identified in the dicot tomato (Solanum lycopersicum) fleshy fruit model. PMID:21487046

  12. Food additives

    PubMed Central

    Spencer, Michael

    1974-01-01

    Food additives are discussed from the food technology point of view. The reasons for their use are summarized: (1) to protect food from chemical and microbiological attack; (2) to even out seasonal supplies; (3) to improve their eating quality; (4) to improve their nutritional value. The various types of food additives are considered, e.g. colours, flavours, emulsifiers, bread and flour additives, preservatives, and nutritional additives. The paper concludes with consideration of those circumstances in which the use of additives is (a) justified and (b) unjustified. PMID:4467857

  13. Regulatory T Cells and Their Role in Animal Disease.

    PubMed

    Veiga-Parga, T

    2016-07-01

    In humans and mouse models, Foxp3(+) regulatory T cells are known to control all aspects of immune responses. However, only limited information exists on these cells' role in diseases of other animals. In this review, we cover the most important features and different types of regulatory T cells, which include those that are thymus-derived and peripherally induced, the mechanisms by which they control immune responses by targeting effector T cells and antigen-presenting cells, and most important, their role in animal health and diseases including cancer, infections, and other conditions such as hypersensitivities and autoimmunity. Although the literature regarding regulatory T cells in domestic animal species is still limited, multiple articles have recently emerged and are discussed. Moreover, we also discuss the evidence suggesting that regulatory T cells might limit the magnitude of effector responses, which can have either a positive or negative result, depending on the context of animal and human disease. In addition, the issue of plasticity is discussed because plasticity in regulatory T cells can result in the loss of their protective function in some microenvironments during disease. Lastly, the manipulation of regulatory T cells is discussed in assessing the possibility of their use as a treatment in the future. PMID:26945003

  14. Conservation and Evolution of Cis-Regulatory Systems in Ascomycete Fungi

    PubMed Central

    2004-01-01

    Relatively little is known about the mechanisms through which gene expression regulation evolves. To investigate this, we systematically explored the conservation of regulatory networks in fungi by examining the cis-regulatory elements that govern the expression of coregulated genes. We first identified groups of coregulated Saccharomyces cerevisiae genes enriched for genes with known upstream or downstream cis-regulatory sequences. Reasoning that many of these gene groups are coregulated in related species as well, we performed similar analyses on orthologs of coregulated S. cerevisiae genes in 13 other ascomycete species. We find that many species-specific gene groups are enriched for the same flanking regulatory sequences as those found in the orthologous gene groups from S. cerevisiae, indicating that those regulatory systems have been conserved in multiple ascomycete species. In addition