Science.gov

Sample records for additional resistance genes

  1. Identification of the biosynthetic gene cluster and an additional gene for resistance to the antituberculosis drug capreomycin.

    PubMed

    Felnagle, Elizabeth A; Rondon, Michelle R; Berti, Andrew D; Crosby, Heidi A; Thomas, Michael G

    2007-07-01

    Capreomycin (CMN) belongs to the tuberactinomycin family of nonribosomal peptide antibiotics that are essential components of the drug arsenal for the treatment of multidrug-resistant tuberculosis. Members of this antibiotic family target the ribosomes of sensitive bacteria and disrupt the function of both subunits of the ribosome. Resistance to these antibiotics in Mycobacterium species arises due to mutations in the genes coding for the 16S or 23S rRNA but can also arise due to mutations in a gene coding for an rRNA-modifying enzyme, TlyA. While Mycobacterium species develop resistance due to alterations in the drug target, it has been proposed that the CMN-producing bacterium, Saccharothrix mutabilis subsp. capreolus, uses CMN modification as a mechanism for resistance rather than ribosome modification. To better understand CMN biosynthesis and resistance in S. mutabilis subsp. capreolus, we focused on the identification of the CMN biosynthetic gene cluster in this bacterium. Here, we describe the cloning and sequence analysis of the CMN biosynthetic gene cluster from S. mutabilis subsp. capreolus ATCC 23892. We provide evidence for the heterologous production of CMN in the genetically tractable bacterium Streptomyces lividans 1326. Finally, we present data supporting the existence of an additional CMN resistance gene. Initial work suggests that this resistance gene codes for an rRNA-modifying enzyme that results in the formation of CMN-resistant ribosomes that are also resistant to the aminoglycoside antibiotic kanamycin. Thus, S. mutabilis subsp. capreolus may also use ribosome modification as a mechanism for CMN resistance.

  2. An additional Meyerozyma guilliermondii IMH3 gene confers mycophenolic acid resistance in fungal CTG clade species.

    PubMed

    Defosse, Tatiana A; Mélin, Céline; Clastre, Marc; Besseau, Sébastien; Lanoue, Arnaud; Glévarec, Gaëlle; Oudin, Audrey; Dugé de Bernonville, Thomas; Vandeputte, Patrick; Linder, Tomas; Bouchara, Jean-Philippe; Courdavault, Vincent; Giglioli-Guivarc'h, Nathalie; Papon, Nicolas

    2016-09-01

    The fungal CTG clade comprises a number of well-known yeasts that impact human health or with high biotechnological potential. To further extend the set of molecular tools dedicated to these microorganisms, the initial focus of this study was to develop a mycophenolic acid (MPA) resistance cassette. Surprisingly, while we were carrying out preliminary susceptibility testing experiments in a set of yeast species, Meyerozyma guilliermondii, although not being a MPA producer, was found to be primarily resistant toward this drug, whereas a series of nine related species were susceptible to MPA. Using comparative and functional genomic approaches, we demonstrated that all MPA-susceptible CTG clade species display a single gene, referred to as IMH3.1, encoding the MPA target inosine monophosphate dehydrogenase (IMPDH) and that MPA resistance relies on the presence in the M. guilliermondii genome of an additional IMPDH-encoding gene (IMH3.2). The M. guilliermondii IMH3.2 gene displays marked differences compared to IMH3.1 including the lack of intron, a roughly 160-fold higher transcription level and a serine residue at position 251. Placed under the control of the M. guilliermondii actin 1 gene promoter, IMH3.2 was successfully used to transform Lodderomyces elongisporus, Clavispora lusitaniae, Scheffersomyces stipitis and Candida parapsilosis.

  3. Characterization of the Soluble NSF Attachment Protein gene family identifies two members involved in additive resistance to a plant pathogen

    PubMed Central

    Lakhssassi, Naoufal; Liu, Shiming; Bekal, Sadia; Zhou, Zhou; Colantonio, Vincent; Lambert, Kris; Barakat, Abdelali; Meksem, Khalid

    2017-01-01

    Proteins with Tetratricopeptide-repeat (TPR) domains are encoded by large gene families and distributed in all plant lineages. In this study, the Soluble NSF-Attachment Protein (SNAP) subfamily of TPR containing proteins is characterized. In soybean, five members constitute the SNAP gene family: GmSNAP18, GmSNAP11, GmSNAP14, GmSNAP02, and GmSNAP09. Recently, GmSNAP18 has been reported to mediate resistance to soybean cyst nematode (SCN). Using a population of recombinant inbred lines from resistant and susceptible parents, the divergence of the SNAP gene family is analysed over time. Phylogenetic analysis of SNAP genes from 22 diverse plant species showed that SNAPs were distributed in six monophyletic clades corresponding to the major plant lineages. Conservation of the four TPR motifs in all species, including ancestral lineages, supports the hypothesis that SNAPs were duplicated and derived from a common ancestor and unique gene still present in chlorophytic algae. Syntenic analysis of regions harbouring GmSNAP genes in soybean reveals that this family expanded from segmental and tandem duplications following a tetraploidization event. qRT-PCR analysis of GmSNAPs indicates a co-regulation following SCN infection. Finally, genetic analysis demonstrates that GmSNAP11 contributes to an additive resistance to SCN. Thus, GmSNAP11 is identified as a novel minor gene conferring resistance to SCN. PMID:28338077

  4. Effects of Copper Addition on Copper Resistance, Antibiotic Resistance Genes, and intl1 during Swine Manure Composting

    PubMed Central

    Yin, Yanan; Gu, Jie; Wang, Xiaojuan; Song, Wen; Zhang, Kaiyu; Sun, Wei; Zhang, Xin; Zhang, Yajun; Li, Haichao

    2017-01-01

    Copper is one of the most abundant heavy metals present in swine manure. In this study, a laboratory-scale aerobic composting system was amended with Cu at three levels (0, 200, and 2000 mg kg-1, i.e., control, Cu200, and Cu2000 treatments, respectively) to determine its effect on the fate of copper resistance genes [copper resistance genes (CRGs): pcoA, cusA, copA, and tcrB], antibiotic resistance genes [antibiotic resistance genes (ARGs): erm(A) and erm(B)], and intl1. The results showed that the absolute abundances of pcoA, tcrB, erm(A), erm(B), and intl1 were reduced, whereas those of copA and cusA increased after swine manure composting. Redundancy analysis showed that temperature significantly affected the variations in CRGs, ARGs, and intl1. The decreases in CRGs, ARGs, and intI1 were positively correlated with the exchangeable Cu levels. The bacterial community could be grouped according to the composting time under different treatments, where the high concentration of copper had a more persistent effect on the bacterial community. Network analysis determined that the co-occurrence of CRGs, ARGs, and intI1, and the bacterial community were the main contributors to the changes in CRGs, ARG, and intl1. Thus, temperature, copper, and changes in the bacterial community composition had important effects on the variations in CRGs, ARGs, and intl1 during manure composting in the presence of added copper. PMID:28316595

  5. Effects of Copper Addition on Copper Resistance, Antibiotic Resistance Genes, and intl1 during Swine Manure Composting.

    PubMed

    Yin, Yanan; Gu, Jie; Wang, Xiaojuan; Song, Wen; Zhang, Kaiyu; Sun, Wei; Zhang, Xin; Zhang, Yajun; Li, Haichao

    2017-01-01

    Copper is one of the most abundant heavy metals present in swine manure. In this study, a laboratory-scale aerobic composting system was amended with Cu at three levels (0, 200, and 2000 mg kg(-1), i.e., control, Cu200, and Cu2000 treatments, respectively) to determine its effect on the fate of copper resistance genes [copper resistance genes (CRGs): pcoA, cusA, copA, and tcrB], antibiotic resistance genes [antibiotic resistance genes (ARGs): erm(A) and erm(B)], and intl1. The results showed that the absolute abundances of pcoA, tcrB, erm(A), erm(B), and intl1 were reduced, whereas those of copA and cusA increased after swine manure composting. Redundancy analysis showed that temperature significantly affected the variations in CRGs, ARGs, and intl1. The decreases in CRGs, ARGs, and intI1 were positively correlated with the exchangeable Cu levels. The bacterial community could be grouped according to the composting time under different treatments, where the high concentration of copper had a more persistent effect on the bacterial community. Network analysis determined that the co-occurrence of CRGs, ARGs, and intI1, and the bacterial community were the main contributors to the changes in CRGs, ARG, and intl1. Thus, temperature, copper, and changes in the bacterial community composition had important effects on the variations in CRGs, ARGs, and intl1 during manure composting in the presence of added copper.

  6. Complete sequence of a plasmid from a bovine methicillin-resistant Staphylococcus aureus harbouring a novel ica-like gene cluster in addition to antimicrobial and heavy metal resistance genes.

    PubMed

    Feßler, Andrea T; Zhao, Qin; Schoenfelder, Sonja; Kadlec, Kristina; Brenner Michael, Geovana; Wang, Yang; Ziebuhr, Wilma; Shen, Jianzhong; Schwarz, Stefan

    2017-02-01

    The multiresistance plasmid pAFS11, obtained from a bovine methicillin-resistant Staphylococcus aureus (MRSA) isolate, was completely sequenced and analysed for its structure and organisation. Moreover, the susceptibility to the heavy metals cadmium and copper was determined by broth macrodilution. The 49,189-bp plasmid harboured the apramycin resistance gene apmA, two copies of the macrolide/lincosamide/streptogramin B resistance gene erm(B) (both located on remnants of a truncated transposon Tn917), the kanamycin/neomycin resistance gene aadD, the tetracycline resistance gene tet(L) and the trimethoprim resistance gene dfrK. The latter three genes were part of a 7,284-bp segment which was bracketed by two copies of IS431. In addition, the cadmium resistance operon cadDX as well as the copper resistance genes copA and mco were located on the plasmid and mediated a reduced susceptibility to cadmium and copper. Moreover, a complete novel ica-like gene cluster of so far unknown genetic origin was detected on this plasmid. The ica-like gene cluster comprised four different genes whose products showed 64.4-76.9% homology to the Ica proteins known to be involved in biofilm formation of the S. aureus strains Mu50, Mu3 and N315. However, 96.2-99.4% homology was seen to proteins from S. sciuri NS1 indicating an S. sciuri origin. The finding of five different antibiotic resistance genes co-located on a plasmid with heavy metal resistance genes and an ica-like gene cluster is alarming. With the acquisition of this plasmid, antimicrobial multiresistance, heavy metal resistances and potential virulence properties may be co-selected and spread via a single horizontal gene transfer event.

  7. Effect of red mud addition on tetracycline and copper resistance genes and microbial community during the full scale swine manure composting.

    PubMed

    Wang, Rui; Zhang, Junya; Sui, Qianwen; Wan, Hefeng; Tong, Juan; Chen, Meixue; Wei, Yuansong; Wei, Dongbin

    2016-09-01

    Swine manure has been considered as the reservoir of antibiotic resistance genes (ARGs). Composting is one of the most suitable technologies for treating livestock manures, and red mud was proved to have a positive effect on nitrogen conservation during composting. This study investigated the abundance of eight tetracycline and three copper resistance genes, the bacterial community during the full scale swine manure composting with or without addition of red mud. The results showed that ARGs in swine manure could be effectively removed through composting (reduced by 2.4log copies/g TS), especially during the thermophilic phase (reduced by 1.5log copies/g TS), which the main contributor might be temperature. Additionally, evolution of bacterial community could also have a great influence on ARGs. Although addition of red mud could enhance nitrogen conservation, it obviously hindered removal of ARGs (reduced by 1.7log copies/g TS) and affected shaping of bacterial community during composting.

  8. Transcriptome analysis of genes related to resistance against powdery mildew in wheat-Thinopyrum alien addition disomic line germplasm SN6306.

    PubMed

    Li, Quanquan; Niu, Zubiao; Bao, Yinguang; Tian, Qiuju; Wang, Honggang; Kong, Lingrang; Feng, Deshun

    2016-09-15

    Wheat powdery mildew, which is mainly caused by Blumeria graminis f. sp. tritici (Bgt), seriously damages wheat production. The wheat-Thinopyrum intermedium alien addition disomic line germplasm SN6306, being one of the important sources of genes for wheat resistance, is highly resistant to Bgt E09 and to many other powdery mildew physiological races. However, knowledge on the resistance mechanism of SN6306 remains limited. Our study employed high-throughput RNA sequencing based on next-generation sequencing technology (Illumina) to obtain an overview of the transcriptome characteristics of SN6306 and its parent wheat Yannong 15 (YN15) during Bgt infection. The sequencing generated 104,773 unigenes, 9909 of which showed varied expression levels. Among the 9909 unigenes, 1678 unigenes showed 0 reads in YN15. The expression levels in Bgt-inoculated SN6306 and YN15 of exactly 39 unigenes that showed 0 or considerably low reads in YN15 were validated to identify the genes involved in Bgt resistance. Among the 39 unigenes, 12 unigenes were upregulated in SN6306 by 3-45 times. These unigenes mainly encoded kinase, synthase, proteases, and signal transduction proteins, which may play an important role in the resistance against Bgt. To confirm whether the unigenes that showed 0 reads in YN15 are really unique to SN6306, 8 unigenes were cloned and sequenced. Results showed that the selected unigenes are more similar to SN6306 and Th. intermedium than to the wheat cultivar YN15. The sequencing results further confirmed that the unigenes showing 0 reads in YN15 are unique to SN6306 and are most likely derived from Th. intermedium (Host) Nevski. Thus, the genes from Th. intermedium most probably conferred the resistance of SN6306 to Bgt.

  9. Skin epidermis lacking the c-myc gene is resistant to Ras-driven tumorigenesis but can reacquire sensitivity upon additional lossof the p21Cip1 gene

    PubMed Central

    Oskarsson, Thordur; Essers, Marieke Alida Gertruda; Dubois, Nicole; Offner, Sandra; Dubey, Christelle; Roger, Catherine; Metzger, Daniel; Chambon, Pierre; Hummler, Edith; Beard, Peter; Trumpp, Andreas

    2006-01-01

    The target gene(s) required for Myc-mediated tumorigenesis are still elusive. Here we show that while endogenous c-Myc is surprisingly dispensable for skin homeostasis and TPA-induced hyperplasia, c-Myc-deficient epidermis is resistant to Ras-mediated DMBA/TPAinduced tumorigenesis. This is mechanistically linked to p21Cip1, which is induced in tumors by the activated Ras–ERK pathway but repressed by c-Myc. Acute elimination of c-Myc in established tumors leads to the up-regulation of p21Cip1, and epidermis lacking both p21Cip1 and c-Myc reacquires normal sensitivity to DMBA/TPA-induced tumorigenesis. This identifies c-Myc-mediated repression of p21Cip1 as a key step for Ras-driven epidermal tumorigenesis. PMID:16882980

  10. Co-addition of manure increases the dissipation rates of tylosin A and the numbers of resistance genes in laboratory incubation experiments.

    PubMed

    Li, Qian; Wang, Yan; Zou, Yong-De; Liao, Xin-Di; Liang, Juan-Boo; Xin, Wen; Wu, Yin-Bao

    2015-09-15

    The behavior of veterinary antibiotics in the soil is commonly studied using the following methods to add antibiotics to the soil: (A) adding manure collected from animals fed a diet that includes antibiotics; (B) adding antibiotic-free animal manure spiked with antibiotics; and (C) the direct addition of antibiotics. However, most studies have only used methods (B) and (C) in their research, and few studies have simultaneously compared the different antibiotic addition methods. This study used tylosin A (TYLA) as a model antibiotic to compare the effects of these three commonly used antibiotic addition methods on the dissipation rates of TYLA and the numbers of resistance genes in laboratory incubation experiments. The results showed that the three treatment methods produced similar TYLA degradation trends; however, there were significant differences (P<0.05) in the TYLA degradation half-life (t1/2) among the three methods. The half-life of TYLA degradation in treatments A, B and C was 2.44 ± 0.04, 1.21 ± 0.03 and 5.13 ± 0.11 days, respectively. The presence of manure resulted in a higher electrical conductivity (EC), higher relative abundance of Citrobacter amalonaticus, higher macrolide resistant gene (ermB, ermF and ermT) count and lower ecological toxicity in the soil, which could partially explain the higher TYLA degradation rate in the treatments containing manure. The higher degradation rate of TYLA in treatment B when compared to treatment A could be due to the lower concentrations of tylosin B (TYLB) and tylosin D (TYLD). The main route for veterinary antibiotics to enter the soil is via the manure of animals that have been administered antibiotics. Therefore, the more appropriate method to study the degradation and ecotoxicity of antibiotic residues in the soil is by using manure from animals fed/administered the particular antibiotic rather than by adding the antibiotic directly to the soil.

  11. Impacts of addition of natural zeolite or a nitrification inhibitor on antibiotic resistance genes during sludge composting.

    PubMed

    Zhang, Junya; Chen, Meixue; Sui, Qianwen; Tong, Juan; Jiang, Chao; Lu, Xueting; Zhang, Yuxiu; Wei, Yuansong

    2016-03-15

    Composting is commonly used for the treatment and resource utilization of sewage sludge, and natural zeolite and nitrification inhibitors can be used for nitrogen conservation during sludge composting, while their impacts on ARGs control are still unclear. Therefore, three lab-scale composting reactors, A (the control), B (natural zeolite addition) and C (nitrification inhibitor addition of 3,4-dimethylpyrazole phosphate, DMPP), were established. The impacts of natural zeolite and DMPP on the levels of ARGs were investigated, as were the roles that heavy metals, mobile genetic elements (MGEs) and the bacterial community play in ARGs evolution. The results showed that total ARGs copies were enriched 2.04 and 1.95 times in reactors A and C, respectively, but were reduced by 1.5% in reactor B due to the reduction of conjugation and co-selection of heavy metals caused by natural zeolite. Although some ARGs (blaCTX-M, blaTEM, ermB, ereA and tetW) were reduced by 0.3-2 logs, others (ermF, sulI, sulII, tetG, tetX, mefA and aac(6')-Ib-cr) increased by 0.3-1.3 logs after sludge composting. Although the contributors for the ARGs profiles in different stages were quite different, the results of a partial redundancy analysis, Mantel test and Procrustes analysis showed that the bacterial community was the main contributor to the changes in ARGs compared to MGEs and heavy metals. Network analysis determined the potential host bacteria for various ARGs and further confirmed our results.

  12. Addition of transcription activator-like effector binding sites to a pathogen strain-specific rice bacterial blight resistance gene makes it effective against additional strains and against bacterial leaf streak.

    PubMed

    Hummel, Aaron W; Doyle, Erin L; Bogdanove, Adam J

    2012-09-01

    Xanthomonas transcription activator-like (TAL) effectors promote disease in plants by binding to and activating host susceptibility genes. Plants counter with TAL effector-activated executor resistance genes, which cause host cell death and block disease progression. We asked whether the functional specificity of an executor gene could be broadened by adding different TAL effector binding elements (EBEs) to it. We added six EBEs to the rice Xa27 gene, which confers resistance to strains of the bacterial blight pathogen Xanthomonas oryzae pv. oryzae (Xoo) that deliver the TAL effector AvrXa27. The EBEs correspond to three other effectors from Xoo strain PXO99(A) and three from strain BLS256 of the bacterial leaf streak pathogen Xanthomonas oryzae pv. oryzicola (Xoc). Stable integration into rice produced healthy lines exhibiting gene activation by each TAL effector, and resistance to PXO99(A) , a PXO99(A) derivative lacking AvrXa27, and BLS256, as well as two other Xoo and 10 Xoc strains virulent toward wildtype Xa27 plants. Transcripts initiated primarily at a common site. Sequences in the EBEs were found to occur nonrandomly in rice promoters, suggesting an overlap with endogenous regulatory sequences. Thus, executor gene specificity can be broadened by adding EBEs, but caution is warranted because of the possible coincident introduction of endogenous regulatory elements.

  13. Resistance Gene Analogs in Cherries (Prunus spp.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genetic studies have shown that NBS-LRR Resistance Gene Analogs (RGAs) tend to occur in clusters and often map to major resistances gene or QTL. The identification and use of specific RGAs as molecular markers among plant material displaying differential resistance phenotypes has the potential to di...

  14. Additives in Bituminous Materials and Fuel-Resistant Sealers

    DTIC Science & Technology

    1994-08-01

    AD-A285 748 D)OT/FAAICT-94/78 DOT/FAAtRD-93/30 Additives in Bituminous FA Tehnia Cer Materials and Fuel-Resistant Atlantic City International Airport...Subtitle Ro Dat August 1394 Additives in Bituminous Materials and Fuel-Resistant S •O..M0aMtioiCOd5 Sealers I Amdirw S Polwo ovwm ’n New, No Gary L...bituminous materials and fuel-resistant sealers. Included in this report is a brief hisLory of these types of additives, the results of an airport

  15. Reducing of internal resistance lithium ion battery using glucose addition

    SciTech Connect

    Salim, Andri Pratama; Hafidlullah, Noor; Purwanto, Agus

    2016-02-08

    There are two indicators of battery performance, i.e : capacity and the internal resistance of battery. In this research, the affect of glucose addition to decrease the internal resistance of lithium battery was investigated. The ratio of glucose addition were varied at weight ratio 1%, 3%, and 5% and one mixtures without glucose addition. Lithium ferri phosphate (LiFePO{sub 4}), polyvinylidene fluoride (PVDF), acetylene black (AB) and glucose were materials that used in this study. Both of mixtures were mixed in the vacuum mixer until became homogeneous. The slurry was coated on an aluminium foil sheet and the coated thickness was 200 µm. The performance of battery lithium was examined by Eight Channel Battery Analyzer and the Internal resistance was examined by Internal Resistance of Battery Meter. The result from all analyzer were showed that the internal resistance reduced as well as the battery capacity. The best internal resistance value is owned by mixtures with 3wt% ratio glucose addition. It has an internal resistance value about 64 miliohm.

  16. Computational gene network study on antibiotic resistance genes of Acinetobacter baumannii.

    PubMed

    Anitha, P; Anbarasu, Anand; Ramaiah, Sudha

    2014-05-01

    Multi Drug Resistance (MDR) in Acinetobacter baumannii is one of the major threats for emerging nosocomial infections in hospital environment. Multidrug-resistance in A. baumannii may be due to the implementation of multi-combination resistance mechanisms such as β-lactamase synthesis, Penicillin-Binding Proteins (PBPs) changes, alteration in porin proteins and in efflux pumps against various existing classes of antibiotics. Multiple antibiotic resistance genes are involved in MDR. These resistance genes are transferred through plasmids, which are responsible for the dissemination of antibiotic resistance among Acinetobacter spp. In addition, these resistance genes may also have a tendency to interact with each other or with their gene products. Therefore, it becomes necessary to understand the impact of these interactions in antibiotic resistance mechanism. Hence, our study focuses on protein and gene network analysis on various resistance genes, to elucidate the role of the interacting proteins and to study their functional contribution towards antibiotic resistance. From the search tool for the retrieval of interacting gene/protein (STRING), a total of 168 functional partners for 15 resistance genes were extracted based on the confidence scoring system. The network study was then followed up with functional clustering of associated partners using molecular complex detection (MCODE). Later, we selected eight efficient clusters based on score. Interestingly, the associated protein we identified from the network possessed greater functional similarity with known resistance genes. This network-based approach on resistance genes of A. baumannii could help in identifying new genes/proteins and provide clues on their association in antibiotic resistance.

  17. Enhancement of Corrosion Resistance of Zinc Coatings Using Green Additives

    NASA Astrophysics Data System (ADS)

    Punith Kumar, M. K.; Srivastava, Chandan

    2014-10-01

    In the present work, morphology, microstructure, and electrochemical behavior of Zn coatings containing non-toxic additives have been investigated. Zn coatings were electrodeposited over mild steel substrates using Zn sulphate baths containing four different organic additives: sodium gluconate, dextrose, dextrin, and saccharin. All these additives are "green" and can be derived from food contents. Morphological and structural characterization using electron microscopy, x-ray diffraction, and texture co-efficient analysis revealed an appreciable alteration in the morphology and texture of the deposit depending on the type of additive used in the Zn plating bath. All the Zn coatings, however, were nano-crystalline irrespective of the type of additive used. Polarization and electrochemical impedance spectroscopic analysis, used to investigate the effect of the change in microstructure and morphology on corrosion resistance behavior, illustrated an improved corrosion resistance for Zn deposits obtained from plating bath containing additives as compared to the pure Zn coatings.

  18. Molecular Transfer of Nematode Resistance Genes

    PubMed Central

    Williamson, V. M.; Ho, J.-Y.; Ma, H. M.

    1992-01-01

    Recombinant DNA techniques have been used to introduce agronomically valuable traits, including resistance to viruses, herbicides, and insects, into crop plants. Introduction of these genes into plants frequently involves Agrobacterium-mediated gene transfer. The potential exists for applying this technology to nematode control by introducing genes conferring resistance to nematodes. Transferred genes could include those encoding products detrimental to nematode development or reproduction as well as cloned host resistance genes. Host genes that confer resistance to cyst or root-knot nematode species have been identified in many plants. The best characterized is Mi, a gene that confers resistance to root-knot nematodes in tomato. A map-based cloning approach is being used to isolate the gene. For development of a detailed map of the region of the genome surrounding Mi, DNA markers genetically linked to Mi have been identified and analyzed in tomato lines that have undergone a recombination event near Mi. The molecular map will be used to identify DNA corresponding to Mi. We estimate that a clone of Mi will be obtained in 2-5 years. An exciting prospect is that introduction of this gene will confer resistance in plant species without currently available sources of resistance. PMID:19282989

  19. Gene flow from glyphosate-resistant crops.

    PubMed

    Mallory-Smith, Carol; Zapiola, Maria

    2008-04-01

    Gene flow from transgenic glyphosate-resistant crops can result in the adventitious presence of the transgene, which may negatively impact markets. Gene flow can also produce glyphosate-resistant plants that may interfere with weed management systems. The objective of this article is to review the gene flow literature as it pertains to glyphosate-resistant crops. Gene flow is a natural phenomenon not unique to transgenic crops and can occur via pollen, seed and, in some cases, vegetative propagules. Gene flow via pollen can occur in all crops, even those that are considered to be self-pollinated, because all have low levels of outcrossing. Gene flow via seed or vegetative propagules occurs when they are moved naturally or by humans during crop production and commercialization. There are many factors that influence gene flow; therefore, it is difficult to prevent or predict. Gene flow via pollen and seed from glyphosate-resistant canola and creeping bentgrass fields has been documented. The adventitious presence of the transgene responsible for glyphosate resistance has been found in commercial seed lots of canola, corn and soybeans. In general, the glyphosate-resistant trait is not considered to provide an ecological advantage. However, regulators should consider the examples of gene flow from glyphosate-resistant crops when formulating rules for the release of crops with traits that could negatively impact the environment or human health.

  20. Potential impact of environmental bacteriophages in spreading antibiotic resistance genes.

    PubMed

    Muniesa, Maite; Colomer-Lluch, Marta; Jofre, Juan

    2013-06-01

    The idea that bacteriophage transduction plays a role in the horizontal transfer of antibiotic resistance genes is gaining momentum. Such transduction might be vital in horizontal transfer from environmental to human body-associated biomes and here we review many lines of evidence supporting this notion. It is well accepted that bacteriophages are the most abundant entities in most environments, where they have been shown to be quite persistent. This fact, together with the ability of many phages to infect bacteria belonging to different taxa, makes them suitable vehicles for gene transfer. Metagenomic studies confirm that substantial percentages of the bacteriophage particles present in most environments contain bacterial genes, including mobile genetic elements and antibiotic resistance genes. When specific genes of resistance to antibiotics are detected by real-time PCR in the bacteriophage populations of different environments, only tenfold lower numbers of these genes are observed, compared with those found in the corresponding bacterial populations. In addition, the antibiotic resistance genes from these bacteriophages are functional and generate resistance to the bacteria when these genes are transfected. Finally, reports about the transduction of antibiotic resistance genes are on the increase.

  1. Antibiotic resistance genes in freshwater biofilms along a whole river.

    PubMed

    Winkworth, Cynthia L

    2013-06-01

    A key problem challenging public health officials' efforts to stem the spread of antibiotic resistance is the potential increase of resistance in the environment. Yet, despite recent and significant changes to agricultural land in New Zealand, as well as the sector's high antibiotic use, the influence on antibiotic resistance in the environment remained uncharacterised. Spatial and temporal dynamics of antibiotic resistance genes in freshwater biofilms from NZ's fourth longest river as it transitioned between low and high intensity farming were examined for 1 year. Polymerase chain reaction was employed to gauge the level of resistance present. Biofilms were screened for 10 genes conferring resistance to antibiotics used in humans only and both humans and agricultural animals. Three genes were detected, one which conferred resistance to the important human-only use antibiotic vancomycin. Detected at the two downstream sites only, and those subject to the highest combined land-use stressors, the three genes indicated an elevated presence of antibiotic resistance in relation to surrounding land use; 7.7% versus 2% across the whole river system. The detection of a gene conferring resistance to an important human-only use antibiotic was particularly concerning and highlighted human-based contamination sources along the river, in addition to those of agricultural origin.

  2. Exploiting natural variation to identify insect-resistance genes.

    PubMed

    Broekgaarden, Colette; Snoeren, Tjeerd A L; Dicke, Marcel; Vosman, Ben

    2011-10-01

    Herbivorous insects are widespread and often serious constraints to crop production. The use of insect-resistant crops is a very effective way to control insect pests in agriculture, and the development of such crops can be greatly enhanced by knowledge on plant resistance mechanisms and the genes involved. Plants have evolved diverse ways to cope with insect attack that has resulted in natural variation for resistance towards herbivorous insects. Studying the molecular genetics and transcriptional background of this variation has facilitated the identification of resistance genes and processes that lead to resistance against insects. With the development of new technologies, molecular studies are not restricted to model plants anymore. This review addresses the need to exploit natural variation in resistance towards insects to increase our knowledge on resistance mechanisms and the genes involved. We will discuss how this knowledge can be exploited in breeding programmes to provide sustainable crop protection against insect pests. Additionally, we discuss the current status of genetic research on insect-resistance genes. We conclude that insect-resistance mechanisms are still unclear at the molecular level and that exploiting natural variation with novel technologies will contribute greatly to the development of insect-resistant crop varieties.

  3. Disease Resistance Gene Analogs (RGAs) in Plants

    PubMed Central

    Sekhwal, Manoj Kumar; Li, Pingchuan; Lam, Irene; Wang, Xiue; Cloutier, Sylvie; You, Frank M.

    2015-01-01

    Plants have developed effective mechanisms to recognize and respond to infections caused by pathogens. Plant resistance gene analogs (RGAs), as resistance (R) gene candidates, have conserved domains and motifs that play specific roles in pathogens’ resistance. Well-known RGAs are nucleotide binding site leucine rich repeats, receptor like kinases, and receptor like proteins. Others include pentatricopeptide repeats and apoplastic peroxidases. RGAs can be detected using bioinformatics tools based on their conserved structural features. Thousands of RGAs have been identified from sequenced plant genomes. High-density genome-wide RGA genetic maps are useful for designing diagnostic markers and identifying quantitative trait loci (QTL) or markers associated with plant disease resistance. This review focuses on recent advances in structures and mechanisms of RGAs, and their identification from sequenced genomes using bioinformatics tools. Applications in enhancing fine mapping and cloning of plant disease resistance genes are also discussed. PMID:26287177

  4. Acquired Antibiotic Resistance Genes: An Overview

    PubMed Central

    van Hoek, Angela H. A. M.; Mevius, Dik; Guerra, Beatriz; Mullany, Peter; Roberts, Adam Paul; Aarts, Henk J. M.

    2011-01-01

    In this review an overview is given on antibiotic resistance (AR) mechanisms with special attentions to the AR genes described so far preceded by a short introduction on the discovery and mode of action of the different classes of antibiotics. As this review is only dealing with acquired resistance, attention is also paid to mobile genetic elements such as plasmids, transposons, and integrons, which are associated with AR genes, and involved in the dispersal of antimicrobial determinants between different bacteria. PMID:22046172

  5. Identifying resistance gene analogs associated with resistances to different pathogens in common bean.

    PubMed

    López, Camilo E; Acosta, Iván F; Jara, Carlos; Pedraza, Fabio; Gaitán-Solís, Eliana; Gallego, Gerardo; Beebe, Steve; Tohme, Joe

    2003-01-01

    ABSTRACT A polymerase chain reaction approach using degenerate primers that targeted the conserved domains of cloned plant disease resistance genes (R genes) was used to isolate a set of 15 resistance gene analogs (RGAs) from common bean (Phaseolus vulgaris). Eight different classes of RGAs were obtained from nucleotide binding site (NBS)-based primers and seven from not previously described Toll/Interleukin-1 receptor-like (TIR)-based primers. Putative amino acid sequences of RGAs were significantly similar to R genes and contained additional conserved motifs. The NBS-type RGAs were classified in two subgroups according to the expected final residue in the kinase-2 motif. Eleven RGAs were mapped at 19 loci on eight linkage groups of the common bean genetic map constructed at Centro Internacional de Agricultura Tropical. Genetic linkage was shown for eight RGAs with partial resistance to anthracnose, angular leaf spot (ALS) and Bean golden yellow mosaic virus (BGYMV). RGA1 and RGA2 were associated with resistance loci to anthracnose and BGYMV and were part of two clusters of R genes previously described. A new major cluster was detected by RGA7 and explained up to 63.9% of resistance to ALS and has a putative contribution to anthracnose resistance. These results show the usefulness of RGAs as candidate genes to detect and eventually isolate numerous R genes in common bean.

  6. Genome-Wide Architecture of Disease Resistance Genes in Lettuce.

    PubMed

    Christopoulou, Marilena; Wo, Sebastian Reyes-Chin; Kozik, Alex; McHale, Leah K; Truco, Maria-Jose; Wroblewski, Tadeusz; Michelmore, Richard W

    2015-10-08

    Genome-wide motif searches identified 1134 genes in the lettuce reference genome of cv. Salinas that are potentially involved in pathogen recognition, of which 385 were predicted to encode nucleotide binding-leucine rich repeat receptor (NLR) proteins. Using a maximum-likelihood approach, we grouped the NLRs into 25 multigene families and 17 singletons. Forty-one percent of these NLR-encoding genes belong to three families, the largest being RGC16 with 62 genes in cv. Salinas. The majority of NLR-encoding genes are located in five major resistance clusters (MRCs) on chromosomes 1, 2, 3, 4, and 8 and cosegregate with multiple disease resistance phenotypes. Most MRCs contain primarily members of a single NLR gene family but a few are more complex. MRC2 spans 73 Mb and contains 61 NLRs of six different gene families that cosegregate with nine disease resistance phenotypes. MRC3, which is 25 Mb, contains 22 RGC21 genes and colocates with Dm13. A library of 33 transgenic RNA interference tester stocks was generated for functional analysis of NLR-encoding genes that cosegregated with disease resistance phenotypes in each of the MRCs. Members of four NLR-encoding families, RGC1, RGC2, RGC21, and RGC12 were shown to be required for 16 disease resistance phenotypes in lettuce. The general composition of MRCs is conserved across different genotypes; however, the specific repertoire of NLR-encoding genes varied particularly of the rapidly evolving Type I genes. These tester stocks are valuable resources for future analyses of additional resistance phenotypes.

  7. Ornamental fish as a source of plasmid-mediated quinolone resistance genes and antibiotic resistance plasmids.

    PubMed

    Dobiasova, Hana; Kutilova, Iva; Piackova, Veronika; Vesely, Tomas; Cizek, Alois; Dolejska, Monika

    2014-07-16

    Growing ornamental fish industry is associated with public health concerns including extensive antibiotic use accompanied by increasing antibiotic resistance. The aim of this study was to analyze Aeromonas isolates from imported tropical ornamental fish and coldwater koi carps bred in the Czech Republic to assess the potential risk of ornamental fish as a source of plasmid-mediated quinolone resistance genes (PMQR) and antibiotic resistance plasmids. A collection of Aeromonas spp. with reduced susceptibility to ciprofloxacin (MIC ≥ 0.05 mg/L) was selected for the detection of PMQR genes. Isolates harbouring PMQR genes were further analyzed for the additional antibiotic resistance, integron content, clonality, biofilm production and transferability of PMQR genes by conjugation and transformation. Comparative analysis of plasmids carrying PMQR genes was performed. Fifteen (19%, n=80) isolates from koi carps and 18 (24%, n=76) isolates from imported ornamental fish were positive for qnrS2, aac(6')-Ib-cr or qnrB17 genes. PMQR-positive isolates from imported ornamental fish showed higher MIC levels to quinolones, multiresistance and diverse content of antibiotic resistance genes and integrons compared to the isolates from the carps. Related IncU plasmids harbouring qnrS2 and aac(6')-Ib-cr genes were found in Aeromonas spp. from imported ornamental fish and koi carps from various geographical areas. Ornamental fish may represent a potential source of multiresistant bacteria and mobile genetic elements for the environment and for humans.

  8. Screening and incorporation of rust resistance from Allium cepa into bunching onion (Allium fistulosum) via alien chromosome addition.

    PubMed

    Wako, Tadayuki; Yamashita, Ken-ichiro; Tsukazaki, Hikaru; Ohara, Takayoshi; Kojima, Akio; Yaguchi, Shigenori; Shimazaki, Satoshi; Midorikawa, Naoko; Sakai, Takako; Yamauchi, Naoki; Shigyo, Masayoshi

    2015-04-01

    Bunching onion (Allium fistulosum L.; 2n = 16), bulb onion (Allium cepa L. Common onion group), and shallot (Allium cepa L. Aggregatum group) cultivars were inoculated with rust fungus, Puccinia allii, isolated from bunching onion. Bulb onions and shallots are highly resistant to rust, suggesting they would serve as useful resources for breeding rust resistant bunching onions. To identify the A. cepa chromosome(s) related to rust resistance, a complete set of eight A. fistulosum - shallot monosomic alien addition lines (MAALs) were inoculated with P. allii. At the seedling stage, FF+1A showed a high level of resistance in controlled-environment experiments, suggesting that the genes related to rust resistance could be located on shallot chromosome 1A. While MAAL, multi-chromosome addition line, and hypoallotriploid adult plants did not exhibit strong resistance to rust. In contrast to the high resistance of shallot, the addition line FF+1A+5A showed reproducibly high levels of rust resistance.

  9. Replacing and Additive Horizontal Gene Transfer in Streptococcus

    PubMed Central

    Choi, Sang Chul; Rasmussen, Matthew D.; Hubisz, Melissa J.; Gronau, Ilan; Stanhope, Michael J.; Siepel, Adam

    2012-01-01

    The prominent role of Horizontal Gene Transfer (HGT) in the evolution of bacteria is now well documented, but few studies have differentiated between evolutionary events that predominantly cause genes in one lineage to be replaced by homologs from another lineage (“replacing HGT”) and events that result in the addition of substantial new genomic material (“additive HGT”). Here in, we make use of the distinct phylogenetic signatures of replacing and additive HGTs in a genome-wide study of the important human pathogen Streptococcus pyogenes (SPY) and its close relatives S. dysgalactiae subspecies equisimilis (SDE) and S. dysgalactiae subspecies dysgalactiae (SDD). Using recently developed statistical models and computational methods, we find evidence for abundant gene flow of both kinds within each of the SPY and SDE clades and of reduced levels of exchange between SPY and SDD. In addition, our analysis strongly supports a pronounced asymmetry in SPY–SDE gene flow, favoring the SPY-to-SDE direction. This finding is of particular interest in light of the recent increase in virulence of pathogenic SDE. We find much stronger evidence for SPY–SDE gene flow among replacing than among additive transfers, suggesting a primary influence from homologous recombination between co-occurring SPY and SDE cells in human hosts. Putative virulence genes are correlated with transfer events, but this correlation is found to be driven by additive, not replacing, HGTs. The genes affected by additive HGTs are enriched for functions having to do with transposition, recombination, and DNA integration, consistent with previous findings, whereas replacing HGTs seen to influence a more diverse set of genes. Additive transfers are also found to be associated with evidence of positive selection. These findings shed new light on the manner in which HGT has shaped pathogenic bacterial genomes. PMID:22617954

  10. Additional Drug Resistance Patterns among Multidrug-Resistant Tuberculosis Patients in Korea: Implications for Regimen Design

    PubMed Central

    2017-01-01

    Detailed information on additional drug resistance patterns of multidrug-resistant tuberculosis (MDR-TB) is essential to build an effective treatment regimen; however, such data are scarce in Korea. We retrospectively analyzed the results of phenotypic drug susceptibility testing (DST) of culture confirmed-TB patients from January 2010 to December 2014 in 7 university hospitals in Korea. MDR-TB was identified among 6.8% (n = 378) of 5,599 isolates. A total of 57.1% (n = 216) of the MDR-TB patients had never been treated for TB. Strains from MDR-TB patients showed additional resistance to pyrazinamide (PZA) (35.7%), any second-line injectable drug (19.3%), and any fluoroquinolone (26.2%). Extensively drug resistant TB comprised 12.4% (n = 47) of the MDR-TB patients. Of 378 MDR-TB patients, 50.3% (n = 190) were eligible for the shorter MDR-TB regimen, and 50.0% (n = 189) were fully susceptible to the 5 drugs comprising the standard conventional regimen (PZA, kanamycin, ofloxoacin, prothionamide, and cycloserine). In conclusion, the proportion of new patients and the levels of additional drug resistance were high in MDR-TB patients. Considering the high levels of drug resistance, the shorter MDR-TB treatment regimen may not be feasible; instead, an individually tailored regimen based on the results of molecular and phenotypic DST may be more appropriate in MDR-TB patients in Korea. PMID:28244290

  11. Occurrence of antibiotic resistance and characterization of resistant genes and integrons in Enterobacteriaceae isolated from integrated fish farms south China

    USGS Publications Warehouse

    Su, Hao-Chang; Ying, Guang-Guo; Tao, Ran; Zhang, Rui-Quan; Fogarty, Lisa R.; Kolpin, Dana W.

    2011-01-01

    Antibiotics are still widely applied in animal husbandry to prevent diseases and used as feed additives to promote animal growth. This could result in antibiotic resistance to bacteria and antibiotic residues in animals. In this paper, Enterobacteriaceae isolated from four integrated fish farms in Zhongshan, South China were tested for antibiotic resistance, tetracycline resistance genes, sulfonamide resistance genes, and class 1 integrons. The Kirby-Bauer disk diffusion method and polymerase chain reaction (PCR) assays were carried out to test antibiotic susceptibility and resistance genes, respectively. Relatively high antibiotic resistance frequencies were found, especially for ampicillin (80%), tetracycline (52%), and trimethoprim (50%). Out of 203 Enterobacteriaceae isolates, 98.5% were resistant to one or more antibiotics tested. Multiple antibiotic resistance (MAR) was found highest in animal manures with a MAR index of 0.56. Tetracycline resistance genes (tet(A), tet(C)) and sulfonamide resistance genes (sul2) were detected in more than 50% of the isolates. The intI1 gene was found in 170 isolates (83.7%). Both classic and non-classic class 1 integrons were found. Four genes, aadA5, aadA22, dfr2, and dfrA17, were detected. To our knowledge, this is the first report for molecular characterization of antibiotic resistance genes in Enterobacteriaceae isolated from integrated fish farms in China and the first time that gene cassette array dfrA17-aadA5 has been detected in such fish farms. Results of this study indicated that fish farms may be a reservoir of highly diverse and abundant antibiotic resistant genes and gene cassettes. Integrons may play a key role in multiple antibiotic resistances posing potential health risks to the general public and aquaculture.

  12. Transposon tagging of disease resistance genes

    SciTech Connect

    Michelmore, R.W. . Dept. of Physics)

    1989-01-01

    We are developing a transposon mutagenesis system for lettuce to clone genes for resistance to the fungal pathogen, Bremia lactucae. Activity of heterologous transposons is being studied in transgenic plants. Southern analysis of T{sub 1} and T{sub 2} plants containing Tam3 from Antirrhinum provided ambiguous results. Multiple endonuclease digests indicated that transposition had occurred; however, in no plant were all endonuclease digests consistent with a simple excision event. Southern or PCR analysis of over 50 plans containing Ac from maize have also failed to reveal clear evidence of transposition; this is contrast to experiments by others with the same constructs who have observed high rates of Ac excision in other plant species. Nearly all of 65 T{sub 2} families containing Ac interrupting a chimeric streptomycin resistance gene (Courtesy J. Jones, Sainsbury Lab., UK) clearly segregated for streptomycin resistance. Southern analyses, however, showed no evidence of transposition, indicating restoration of a functional message by other mechanisms, possibly mRNA processing. Transgenic plants have also been generated containing CaMV 35S or hsp70 promoters fused to transposase coding sequences or a Ds element interrupting a chimeric GUS gene (Courtesy M. Lassner, UC Davis). F{sub 1} plants containing both constructs were analyzed for transposition. Only two plants containing both constructs were obtained from 48 progeny, far fewer than expected, and neither showed evidence of transposition in Southerns and GUS assays. We are currently constructing further chimeric transposase fusions. To test for the stability of the targeted disease resistance genes, 50,000 F{sub 1} plants heterozygous for three resistance genes were generated; no mutants have been identified in the 5000 so far screened.

  13. A genomic island provides Acidithiobacillus ferrooxidans ATCC 53993 additional copper resistance: a possible competitive advantage.

    PubMed

    Orellana, Luis H; Jerez, Carlos A

    2011-11-01

    There is great interest in understanding how extremophilic biomining bacteria adapt to exceptionally high copper concentrations in their environment. Acidithiobacillus ferrooxidans ATCC 53993 genome possesses the same copper resistance determinants as strain ATCC 23270. However, the former strain contains in its genome a 160-kb genomic island (GI), which is absent in ATCC 23270. This GI contains, amongst other genes, several genes coding for an additional putative copper ATPase and a Cus system. A. ferrooxidans ATCC 53993 showed a much higher resistance to CuSO(4) (>100 mM) than that of strain ATCC 23270 (<25 mM). When a similar number of bacteria from each strain were mixed and allowed to grow in the absence of copper, their respective final numbers remained approximately equal. However, in the presence of copper, there was a clear overgrowth of strain ATCC 53993 compared to ATCC 23270. This behavior is most likely explained by the presence of the additional copper-resistance genes in the GI of strain ATCC 53993. As determined by qRT-PCR, it was demonstrated that these genes are upregulated when A. ferrooxidans ATCC 53993 is grown in the presence of copper and were shown to be functional when expressed in copper-sensitive Escherichia coli mutants. Thus, the reason for resistance to copper of two strains of the same acidophilic microorganism could be determined by slight differences in their genomes, which may not only lead to changes in their capacities to adapt to their environment, but may also help to select the more fit microorganisms for industrial biomining operations.

  14. Relationship between Psidium species (Myrtaceae) by resistance gene analog markers: focus on nematode resistance.

    PubMed

    Noia, L R; Tuler, A C; Ferreira, A; Ferreira, M F S

    2017-03-16

    Guava (Psidium guajava L.) crop is severely affected by the nematode Meloidogyne enterolobii. Native Psidium species have been reported as sources of resistance against this nematode. Knowledge on the molecular relationship between Psidium species based on plant resistance gene analogs (RGA) can be useful in the genetic breeding of guava for resistance to M. enterolobii. In this study, RGA markers from conserved domains, and structural features of plant R genes, were employed to characterize Psidium species and establish genetic proximity, with a focus on nematode resistance. SSR markers were also applied owing to their neutral nature, thus differing from RGA markers. For this, species reported as sources of resistance to M. enterolobii, such as P. cattleianum and P. friedrichsthalianum, as well as species occurring in the Atlantic Rainforest and susceptible genotypes, were investigated. In 10 evaluated Psidium species, high interspecific genetic variability was verified through RGA and SSR markers, with intraspecific variation in P. guajava higher with SSR, as was expected. Resistant species were clustered by RGA markers, and differential amplicons among genotypes resistant and susceptible to M. enterolobii were identified. Knowledge on the molecular relationships between Psidium species constitutes useful information for breeding of the guava tree, providing direction for hybridization and material for rootstocks. Additionally, the genetic relationship between native species, which have been little studied, and P. guajava were estimated by RGAs, which were confirmed as important markers for genetic diversity related to pathogen resistance.

  15. Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in ‘Thatcher’ Wheat

    PubMed Central

    Hiebert, Colin W.; Kolmer, James A.; McCartney, Curt A.; Briggs, Jordan; Fetch, Tom; Bariana, Harbans; Choulet, Frederic; Rouse, Matthew N.; Spielmeyer, Wolfgang

    2016-01-01

    Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. ‘Thatcher’ wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in ‘Thatcher’ and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for ‘Thatcher’-derived APR in several environments and this resistance was enhanced in the presence of Lr34. PMID:27309724

  16. Genes Involved in Bacitracin Resistance in Streptococcus mutans†

    PubMed Central

    Tsuda, Hiromasa; Yamashita, Yoshihisa; Shibata, Yukie; Nakano, Yoshio; Koga, Toshihiko

    2002-01-01

    Streptococcus mutans is resistant to bacitracin, which is a peptide antibiotic produced by certain species of Bacillus. The purpose of this study was to clarify the bacitracin resistance mechanism of S. mutans. We cloned and sequenced two S. mutans loci that are involved in bacitracin resistance. The rgp locus, which is located downstream from rmlD, contains six rgp genes (rgpA to rgpF) that are involved in rhamnose-glucose polysaccharide (RGP) synthesis in S. mutans. The inactivation of RGP synthesis in S. mutans resulted in an approximately fivefold-higher sensitivity to bacitracin relative to that observed for the wild-type strain Xc. The second bacitracin resistance locus comprised four mbr genes (mbrA, mbrB, mbrC, and mbrD) and was located immediately downstream from gtfC, which encodes the water-insoluble glucan-synthesizing enzyme. Although the bacitracin sensitivities of mutants that had defects in flanking genes were similar to that of the parental strain Xc, mutants that were defective in mbrA, mbrB, mbrC, or mbrD were about 100 to 120 times more sensitive to bacitracin than strain Xc. In addition, a mutant that was defective in all of the mbrABCD genes and rgpA was more sensitive to bacitracin than either the RGP or Mbr mutants. We conclude that RGP synthesis is related to bacitracin resistance in S. mutans and that the mbr genes modulate resistance to bacitracin via an unknown mechanism that is independent of RGP synthesis. PMID:12435673

  17. Antimicrobial drug resistance affects broad changes in metabolomic phenotype in addition to secondary metabolism

    PubMed Central

    Derewacz, Dagmara K.; Goodwin, Cody R.; McNees, C. Ruth; McLean, John A.; Bachmann, Brian O.

    2013-01-01

    Bacteria develop resistance to many classes of antibiotics vertically, by engendering mutations in genes encoding transcriptional and translational apparatus. These severe adaptations affect global transcription, translation, and the correspondingly affected metabolism. Here, we characterize metabolome scale changes in transcriptional and translational mutants in a genomically characterized Nocardiopsis, a soil-derived actinomycete, in stationary phase. Analysis of ultra-performance liquid chromatography–ion mobility–mass spectrometry metabolomic features from a cohort of streptomycin- and rifampicin-resistant mutants grown in the absence of antibiotics exhibits clear metabolomic speciation, and loadings analysis catalogs a marked change in metabolic phenotype. Consistent with derepression, up to 311 features are observed in antibiotic-resistant mutants that are not detected in their progenitors. Mutants demonstrate changes in primary metabolism, such as modulation of fatty acid composition and the increased production of the osmoprotectant ectoine, in addition to the presence of abundant emergent potential secondary metabolites. Isolation of three of these metabolites followed by structure elucidation demonstrates them to be an unusual polyketide family with a previously uncharacterized xanthene framework resulting from sequential oxidative carbon skeletal rearrangements. Designated as “mutaxanthenes,” this family can be correlated to a type II polyketide gene cluster in the producing organism. Taken together, these data suggest that biosynthetic pathway derepression is a general consequence of some antibiotic resistance mutations. PMID:23341601

  18. Organization of a resistance gene cluster linked to rhizomania resistance in sugar beet

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genetic resistance to rhizomania has been in use for over 40 years. Characterization of the molecular basis for susceptibility and resistance has proved challenging. Nucleotide-binding leucine-rich-repeat-containing (NB-LRR) genes have been implicated in numerous gene-for-gene resistance interaction...

  19. A versatile element for gene addition in bacterial chromosomes

    PubMed Central

    Sibley, Marion H.; Raleigh, Elisabeth A.

    2012-01-01

    The increasing interest in genetic manipulation of bacterial host metabolic pathways for protein or small molecule production has led to a need to add new genes to a chromosome quickly and easily without leaving behind a selectable marker. The present report describes a vector and four-day procedure that enable site-specific chromosomal insertion of cloned genes in a context insulated from external transcription, usable once in a construction series. The use of rhamnose-inducible transcription from rhaBp allows regulation of the inserted genes independently of the commonly used IPTG and arabinose strategies. Using lacZ as a reporter, we first show that expression from the rhamnose promoter is tightly regulatable, exhibiting very low leakage of background expression compared with background, and moderate rhamnose-induced expression compared with IPTG-induced expression from lacp. Second, the expression of a DNA methyltransferase was used to show that rhamnose regulation yielded on-off expression of this enzyme, such that a resident high-copy plasmid was either fully sensitive or fully resistant to isoschizomer restriction enzyme cleavage. In both cases, growth medium manipulation allows intermediate levels of expression. The vehicle can also be adapted as an ORF-cloning vector. PMID:22123741

  20. Gene flow from herbicide-resistant crops: it's not just for transgenes.

    PubMed

    Mallory-Smith, Carol A; Sanchez Olguin, Elena

    2011-06-08

    Gene flow was raised as one of the first issues related to the development and release of genetically engineered (GE) crops. Gene flow has remained a topic of discussion for more than 20 years and is still used as an argument against the release of transgenic crops. With respect to herbicide-resistant crops, gene flow does not differ whether the herbicide resistance trait is introduced via genetic engineering or via conventional breeding techniques. Conventional breeding and genetic engineering techniques have been used to produce herbicide resistance in many of the same crop species. In addition, conventional breeding has been used to produce a broader range of herbicide-resistant crops than have been genetically engineered for herbicide resistance. Economic, political, and social concerns center on the breeding technique, but the results of gene flow for weed management are the same irrespective of breeding technique. This paper will focus on gene flow from nonGE herbicide-resistant crops in North America.

  1. Clusters of antibiotic resistance genes enriched together stay together in swine agriculture

    DOE PAGES

    Johnson, Timothy A.; Stedtfeld, Robert D.; Wang, Qiong; ...

    2016-04-12

    genes if they are genetically linked. No links to bacterial membership were observed for these clusters of resistance genes. These findings urge deeper understanding of colocalization of resistance genes and mobile genetic elements in resistance islands and their distribution throughout antibiotic-exposed microbiomes. In addition, as governments seek to combat the rise in antibiotic resistance, a balance is sought between ensuring proper animal health and welfare and preserving medically important antibiotics for therapeutic use. Metagenomic and genomic monitoring will be critical to determine if resistance genes can be reduced in animal microbiomes, or if these gene clusters will continue to be coselected by antibiotics not deemed medically important for human health but used for growth promotion or by medically important antibiotics used therapeutically.« less

  2. Clusters of antibiotic resistance genes enriched together stay together in swine agriculture

    SciTech Connect

    Johnson, Timothy A.; Stedtfeld, Robert D.; Wang, Qiong; Cole, James R.; Hashsham, Syed A.; Looft, Torey; Zhu, Yong -Guan; Tiedje, James M.

    2016-04-12

    resistance genes if they are genetically linked. No links to bacterial membership were observed for these clusters of resistance genes. These findings urge deeper understanding of colocalization of resistance genes and mobile genetic elements in resistance islands and their distribution throughout antibiotic-exposed microbiomes. In addition, as governments seek to combat the rise in antibiotic resistance, a balance is sought between ensuring proper animal health and welfare and preserving medically important antibiotics for therapeutic use. Metagenomic and genomic monitoring will be critical to determine if resistance genes can be reduced in animal microbiomes, or if these gene clusters will continue to be coselected by antibiotics not deemed medically important for human health but used for growth promotion or by medically important antibiotics used therapeutically.

  3. Elevating crop disease resistance with cloned genes

    PubMed Central

    Jones, Jonathan D. G.; Witek, Kamil; Verweij, Walter; Jupe, Florian; Cooke, David; Dorling, Stephen; Tomlinson, Laurence; Smoker, Matthew; Perkins, Sara; Foster, Simon

    2014-01-01

    Essentially all plant species exhibit heritable genetic variation for resistance to a variety of plant diseases caused by fungi, bacteria, oomycetes or viruses. Disease losses in crop monocultures are already significant, and would be greater but for applications of disease-controlling agrichemicals. For sustainable intensification of crop production, we argue that disease control should as far as possible be achieved using genetics rather than using costly recurrent chemical sprays. The latter imply CO2 emissions from diesel fuel and potential soil compaction from tractor journeys. Great progress has been made in the past 25 years in our understanding of the molecular basis of plant disease resistance mechanisms, and of how pathogens circumvent them. These insights can inform more sophisticated approaches to elevating disease resistance in crops that help us tip the evolutionary balance in favour of the crop and away from the pathogen. We illustrate this theme with an account of a genetically modified (GM) blight-resistant potato trial in Norwich, using the Rpi-vnt1.1 gene isolated from a wild relative of potato, Solanum venturii, and introduced by GM methods into the potato variety Desiree. PMID:24535396

  4. [Classification and prevalence of plasmid-mediated quinolone resistance qnr genes in China--A review].

    PubMed

    Yan, Lei; Xu, Hai

    2016-02-04

    Quinolone antibacterial drugs, developing from the treatment of urinary tract infection in early time and now from the treatment of intestinal infection and respiratory infection, have been widely used in clinical, animal husbandry and aquaculture. Bacteria gradually become resistant to them and resistance mechanism is more and more complicated. Quinolone resistance mechanism is mainly divided into chromosome mediated resistance and plasmid mediated resistance, the latter plays an important role in spreading of antibiotic resistance. In 1998, plasmid mediated quinolone resistance mechanism was reported for the first time, namely the qnr gene mediated fluoroquinolone resistance mechanism. qnr genes can spread rapidly in different bacteria, which causes the infection difficult to control, makes the nosocomial infection popular in a wide range. In addition, qnr genes are usually associated with β-lactamase resistance gene. They exist in complex integron and integrate with the other varieties of resistance genes, which narrows the space of clinical medicine choose or drug combinations use to treat related bacterial infection and brings us a serious challenge. In this review, we provide a detailed overview for the historical discovery, classification, the resistance mechanisms of qnr genes, and the prevalence of those genes in China.

  5. Tantalum Addition to Zirconium Diboride for Improved Oxidation Resistance

    NASA Technical Reports Server (NTRS)

    Levine, Stanley R.; Opila, Eliizabeth J.

    2003-01-01

    Ultrahigh temperature ceramics have performed unreliably due to material flaws and attachment design. These deficiencies are brought to the fore by the low fracture toughness and thermal shock resistance of UHTCs. If these deficiencies are overcome, we are still faced with poor oxidation resistance as a limitation on UHTC applicability to reusable launch vehicles. We have been addressing the deficiencies of UHTCs with our focus on composite constructions and functional grading to address the mechanical issues, and on composition modification to address the oxidation issue. The approaches and progress toward the latter are reported.

  6. Recombination Rate Heterogeneity within Arabidopsis Disease Resistance Genes.

    PubMed

    Choi, Kyuha; Reinhard, Carsten; Serra, Heïdi; Ziolkowski, Piotr A; Underwood, Charles J; Zhao, Xiaohui; Hardcastle, Thomas J; Yelina, Nataliya E; Griffin, Catherine; Jackson, Matthew; Mézard, Christine; McVean, Gil; Copenhaver, Gregory P; Henderson, Ian R

    2016-07-01

    Meiotic crossover frequency varies extensively along chromosomes and is typically concentrated in hotspots. As recombination increases genetic diversity, hotspots are predicted to occur at immunity genes, where variation may be beneficial. A major component of plant immunity is recognition of pathogen Avirulence (Avr) effectors by resistance (R) genes that encode NBS-LRR domain proteins. Therefore, we sought to test whether NBS-LRR genes would overlap with meiotic crossover hotspots using experimental genetics in Arabidopsis thaliana. NBS-LRR genes tend to physically cluster in plant genomes; for example, in Arabidopsis most are located in large clusters on the south arms of chromosomes 1 and 5. We experimentally mapped 1,439 crossovers within these clusters and observed NBS-LRR gene associated hotspots, which were also detected as historical hotspots via analysis of linkage disequilibrium. However, we also observed NBS-LRR gene coldspots, which in some cases correlate with structural heterozygosity. To study recombination at the fine-scale we used high-throughput sequencing to analyze ~1,000 crossovers within the RESISTANCE TO ALBUGO CANDIDA1 (RAC1) R gene hotspot. This revealed elevated intragenic crossovers, overlapping nucleosome-occupied exons that encode the TIR, NBS and LRR domains. The highest RAC1 recombination frequency was promoter-proximal and overlapped CTT-repeat DNA sequence motifs, which have previously been associated with plant crossover hotspots. Additionally, we show a significant influence of natural genetic variation on NBS-LRR cluster recombination rates, using crosses between Arabidopsis ecotypes. In conclusion, we show that a subset of NBS-LRR genes are strong hotspots, whereas others are coldspots. This reveals a complex recombination landscape in Arabidopsis NBS-LRR genes, which we propose results from varying coevolutionary pressures exerted by host-pathogen relationships, and is influenced by structural heterozygosity.

  7. Recombination Rate Heterogeneity within Arabidopsis Disease Resistance Genes

    PubMed Central

    Serra, Heïdi; Ziolkowski, Piotr A.; Yelina, Nataliya E.; Jackson, Matthew; Mézard, Christine; McVean, Gil; Henderson, Ian R.

    2016-01-01

    Meiotic crossover frequency varies extensively along chromosomes and is typically concentrated in hotspots. As recombination increases genetic diversity, hotspots are predicted to occur at immunity genes, where variation may be beneficial. A major component of plant immunity is recognition of pathogen Avirulence (Avr) effectors by resistance (R) genes that encode NBS-LRR domain proteins. Therefore, we sought to test whether NBS-LRR genes would overlap with meiotic crossover hotspots using experimental genetics in Arabidopsis thaliana. NBS-LRR genes tend to physically cluster in plant genomes; for example, in Arabidopsis most are located in large clusters on the south arms of chromosomes 1 and 5. We experimentally mapped 1,439 crossovers within these clusters and observed NBS-LRR gene associated hotspots, which were also detected as historical hotspots via analysis of linkage disequilibrium. However, we also observed NBS-LRR gene coldspots, which in some cases correlate with structural heterozygosity. To study recombination at the fine-scale we used high-throughput sequencing to analyze ~1,000 crossovers within the RESISTANCE TO ALBUGO CANDIDA1 (RAC1) R gene hotspot. This revealed elevated intragenic crossovers, overlapping nucleosome-occupied exons that encode the TIR, NBS and LRR domains. The highest RAC1 recombination frequency was promoter-proximal and overlapped CTT-repeat DNA sequence motifs, which have previously been associated with plant crossover hotspots. Additionally, we show a significant influence of natural genetic variation on NBS-LRR cluster recombination rates, using crosses between Arabidopsis ecotypes. In conclusion, we show that a subset of NBS-LRR genes are strong hotspots, whereas others are coldspots. This reveals a complex recombination landscape in Arabidopsis NBS-LRR genes, which we propose results from varying coevolutionary pressures exerted by host-pathogen relationships, and is influenced by structural heterozygosity. PMID:27415776

  8. Additive Functions in Boolean Models of Gene Regulatory Network Modules

    PubMed Central

    Darabos, Christian; Di Cunto, Ferdinando; Tomassini, Marco; Moore, Jason H.; Provero, Paolo; Giacobini, Mario

    2011-01-01

    Gene-on-gene regulations are key components of every living organism. Dynamical abstract models of genetic regulatory networks help explain the genome's evolvability and robustness. These properties can be attributed to the structural topology of the graph formed by genes, as vertices, and regulatory interactions, as edges. Moreover, the actual gene interaction of each gene is believed to play a key role in the stability of the structure. With advances in biology, some effort was deployed to develop update functions in Boolean models that include recent knowledge. We combine real-life gene interaction networks with novel update functions in a Boolean model. We use two sub-networks of biological organisms, the yeast cell-cycle and the mouse embryonic stem cell, as topological support for our system. On these structures, we substitute the original random update functions by a novel threshold-based dynamic function in which the promoting and repressing effect of each interaction is considered. We use a third real-life regulatory network, along with its inferred Boolean update functions to validate the proposed update function. Results of this validation hint to increased biological plausibility of the threshold-based function. To investigate the dynamical behavior of this new model, we visualized the phase transition between order and chaos into the critical regime using Derrida plots. We complement the qualitative nature of Derrida plots with an alternative measure, the criticality distance, that also allows to discriminate between regimes in a quantitative way. Simulation on both real-life genetic regulatory networks show that there exists a set of parameters that allows the systems to operate in the critical region. This new model includes experimentally derived biological information and recent discoveries, which makes it potentially useful to guide experimental research. The update function confers additional realism to the model, while reducing the complexity

  9. Additive functions in boolean models of gene regulatory network modules.

    PubMed

    Darabos, Christian; Di Cunto, Ferdinando; Tomassini, Marco; Moore, Jason H; Provero, Paolo; Giacobini, Mario

    2011-01-01

    Gene-on-gene regulations are key components of every living organism. Dynamical abstract models of genetic regulatory networks help explain the genome's evolvability and robustness. These properties can be attributed to the structural topology of the graph formed by genes, as vertices, and regulatory interactions, as edges. Moreover, the actual gene interaction of each gene is believed to play a key role in the stability of the structure. With advances in biology, some effort was deployed to develop update functions in boolean models that include recent knowledge. We combine real-life gene interaction networks with novel update functions in a boolean model. We use two sub-networks of biological organisms, the yeast cell-cycle and the mouse embryonic stem cell, as topological support for our system. On these structures, we substitute the original random update functions by a novel threshold-based dynamic function in which the promoting and repressing effect of each interaction is considered. We use a third real-life regulatory network, along with its inferred boolean update functions to validate the proposed update function. Results of this validation hint to increased biological plausibility of the threshold-based function. To investigate the dynamical behavior of this new model, we visualized the phase transition between order and chaos into the critical regime using Derrida plots. We complement the qualitative nature of Derrida plots with an alternative measure, the criticality distance, that also allows to discriminate between regimes in a quantitative way. Simulation on both real-life genetic regulatory networks show that there exists a set of parameters that allows the systems to operate in the critical region. This new model includes experimentally derived biological information and recent discoveries, which makes it potentially useful to guide experimental research. The update function confers additional realism to the model, while reducing the complexity

  10. Functional metagenomic analysis reveals rivers are a reservoir for diverse antibiotic resistance genes.

    PubMed

    Amos, G C A; Zhang, L; Hawkey, P M; Gaze, W H; Wellington, E M

    2014-07-16

    The environment harbours a significant diversity of uncultured bacteria and a potential source of novel and extant resistance genes which may recombine with clinically important bacteria disseminated into environmental reservoirs. There is evidence that pollution can select for resistance due to the aggregation of adaptive genes on mobile elements. The aim of this study was to establish the impact of waste water treatment plant (WWTP) effluent disposal to a river by using culture independent methods to study diversity of resistance genes downstream of the WWTP in comparison to upstream. Metagenomic libraries were constructed in Escherichia coli and screened for phenotypic resistance to amikacin, gentamicin, neomycin, ampicillin and ciprofloxacin. Resistance genes were identified by using transposon mutagenesis. A significant increase downstream of the WWTP was observed in the number of phenotypic resistant clones recovered in metagenomic libraries. Common β-lactamases such as blaTEM were recovered as well as a diverse range of acetyltransferases and unusual transporter genes, with evidence for newly emerging resistance mechanisms. The similarities of the predicted proteins to known sequences suggested origins of genes from a very diverse range of bacteria. The study suggests that waste water disposal increases the reservoir of resistance mechanisms in the environment either by addition of resistance genes or by input of agents selective for resistant phenotypes.

  11. Major gene for field stem rust resistance co-locates with resistance gene Sr12 in "Thatcher" wheat

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effecting stem rust resistance genes. "Thatcher" wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was ...

  12. A large scale analysis of resistance gene homologues in Arachis.

    PubMed

    Bertioli, D J; Leal-Bertioli, S C M; Lion, M B; Santos, V L; Pappas, G; Cannon, S B; Guimarães, P M

    2003-10-01

    Arachis hypogaea L., commonly known as the peanut or groundnut, is an important and widespread food legume. Because the crop has a narrow genetic base, genetic diversity in A. hypogaea is low and it lacks sources of resistance to many pests and diseases. In contrast, wild diploid Arachis species are genetically diverse and are rich sources of disease resistance genes. The majority of known plant disease resistance genes encode proteins with a nucleotide binding site domain (NBS). In this study, degenerate PCR primers designed to bind to DNA regions encoding conserved motifs within this domain were used to amplify NBS-encoding regions from Arachis spp. The Arachis spp. used were A. hypogaea var. Tatu and wild species that are known to be sources of disease resistance: A. cardenasii, A. duranensis, A. stenosperma and A. simpsonii. A total of 78 complete NBS-encoding regions were isolated, of which 63 had uninterrupted ORFs. Phylogenetic analysis of the Arachis NBS sequences derived in this study and other NBS sequences from Arabidopsis thaliana, Medicago trunculata, Glycine max, Lotus japonicus and Phaseolus vulgaris that are available in public databases This analysis indicates that most Arachis NBS sequences fall within legume-specific clades, some of which appear to have undergone extensive copy number expansions in the legumes. In addition, NBS motifs from A. thaliana and legumes were characterized. Differences in the TIR and non-TIR motifs were identified. The likely effect of these differences on the amplification of NBS-encoding sequences by PCR is discussed.

  13. [Advances in molecular mechanisms of bacterial resistance caused by stress-induced transfer of resistance genes--a review].

    PubMed

    Sun, Dongchang; Wang, Bing; Zhu, Lihong

    2013-07-04

    The transfer of resistance gene is one of the most important causes of bacterial resistance. Recent studies reveal that stresses induce the transfer of antibiotic resistance gene through multiple mechanisms. DNA damage stresses trigger bacterial SOS response and induce the transfer of resistance gene mediated by conjugative DNA. Antibiotic stresses induce natural bacterial competence for transformation in some bacteria which lack the SOS system. In addition, our latest studies show that the general stress response regulator RpoS regulates a novel type of resistance gene transfer which is mediated by double-stranded plasmid DNA and occurs exclusively on the solid surface. In this review, we summarized recent advances in SOS dependent and independent stress-induced DNA transfer which is mediated by conjugation and transformation respectively, and the transfer of double-stranded plasmid DNA on the solid surface which is regulated by RpoS. We propose that future work should address how stresses activate the key regulators and how these regulators control the expression of gene transfer related genes. Answers to the above questions would pave the way for searching for candidate targets for controlling bacterial resistance resulted from the transfer of antibiotic genes.

  14. Dominant gene for rust resistance in pearl millet

    SciTech Connect

    Hanna, W.W.; Wells, H.D.; Burton, G.W.

    1985-01-01

    Rust (Puccinia substriata var. indica) resistance was discovered in three Pennisetum americanum (L.) Leeke subspecies monodii (Maire) Brunken accessions from Senegal. Resistant plant were free of rust, although the bottom one or two leaves of some plants did develop a brown discoloration without pustules. Resistance was controlled by a dominant gene assigned the gene symbol Rr1. Backcrossing has been effective in transferring resistance from the wild grassy, monodii to cultivated pearl millet. The Rr1 gene should be useful in the production of rust resistant pearl millet hybrids and cultivars. 6 references, 1 table.

  15. IS26-Mediated Formation of Transposons Carrying Antibiotic Resistance Genes

    PubMed Central

    Harmer, Christopher J.

    2016-01-01

    ABSTRACT The IS26 transposase, Tnp26, catalyzes IS26 movement to a new site and deletion or inversion of adjacent DNA via a replicative route. The intramolecular deletion reaction produces a circular molecule consisting of a DNA segment and a single IS26, which we call a translocatable unit or TU. Recently, Tnp26 was shown to catalyze an additional intermolecular, conservative reaction between two preexisting copies of IS26 in different plasmids. Here, we have investigated the relative contributions of homologous recombination and Tnp26-catalyzed reactions to the generation of a transposon from a TU. Circular TUs containing the aphA1a kanamycin and neomycin resistance gene or the tet(D) tetracycline resistance determinant were generated in vitro and transformed into Escherichia coli recA cells carrying R388::IS26. The TU incorporated next to the IS26 in R388::IS26 forms a transposon with the insertion sequence (IS) in direct orientation. Introduction of a second TU produced regions containing both the aphA1a gene and the tet(D) determinant in either order but with only three copies of IS26. The integration reaction, which required a preexisting IS26, was precise and conservative and was 50-fold more efficient when both IS26 copies could produce an active Tnp26. When both ISs were inactivated by a frameshift in tnp26, TU incorporation was not detected in E. coli recA cells, but it did occur in E. coli recA+ cells. However, the Tnp-catalyzed reaction was 100-fold more efficient than RecA-dependent homologous recombination. The ability of Tnp26 to function in either a replicative or conservative mode is likely to explain the prominence of IS26-bounded transposons in the resistance regions found in Gram-negative bacteria. IMPORTANCE In Gram-negative bacteria, IS26 recruits antibiotic resistance genes into the mobile gene pool by forming transposons carrying many different resistance genes. In addition to replicative transposition, IS26 was recently shown to use a

  16. IS26-Mediated Formation of Transposons Carrying Antibiotic Resistance Genes.

    PubMed

    Harmer, Christopher J; Hall, Ruth M

    2016-01-01

    The IS26 transposase, Tnp26, catalyzes IS26 movement to a new site and deletion or inversion of adjacent DNA via a replicative route. The intramolecular deletion reaction produces a circular molecule consisting of a DNA segment and a single IS26, which we call a translocatable unit or TU. Recently, Tnp26 was shown to catalyze an additional intermolecular, conservative reaction between two preexisting copies of IS26 in different plasmids. Here, we have investigated the relative contributions of homologous recombination and Tnp26-catalyzed reactions to the generation of a transposon from a TU. Circular TUs containing the aphA1a kanamycin and neomycin resistance gene or the tet(D) tetracycline resistance determinant were generated in vitro and transformed into Escherichia coli recA cells carrying R388::IS26. The TU incorporated next to the IS26 in R388::IS26 forms a transposon with the insertion sequence (IS) in direct orientation. Introduction of a second TU produced regions containing both the aphA1a gene and the tet(D) determinant in either order but with only three copies of IS26. The integration reaction, which required a preexisting IS26, was precise and conservative and was 50-fold more efficient when both IS26 copies could produce an active Tnp26. When both ISs were inactivated by a frameshift in tnp26, TU incorporation was not detected in E. coli recA cells, but it did occur in E. coli recA (+) cells. However, the Tnp-catalyzed reaction was 100-fold more efficient than RecA-dependent homologous recombination. The ability of Tnp26 to function in either a replicative or conservative mode is likely to explain the prominence of IS26-bounded transposons in the resistance regions found in Gram-negative bacteria. IMPORTANCE In Gram-negative bacteria, IS26 recruits antibiotic resistance genes into the mobile gene pool by forming transposons carrying many different resistance genes. In addition to replicative transposition, IS26 was recently shown to use a novel

  17. Transport and transformation of genetic information in the critical zone: The case of antibiotic resistance genes

    NASA Astrophysics Data System (ADS)

    Zhu, Y. G.

    2015-12-01

    In addition to material and energy flows, the dynamics and functions of the Earth's critical zone are intensively mediated by biological actions performed by diverse organisms. These biological actions are modulated by the expression of functional genes and their translation into enzymes that catalyze geochemical reactions, such as nutrient turnover and pollutant biodegradation. Although geobiology, as an interdisciplinary research area, is playing and vital role in linking biological and geochemical processes at different temporal and spatial scales, the distribution and transport of functional genes have rarely been investigated from the Earth's critical zone perspectives. To illustrate the framework of studies on the transport and transformation of genetic information in the critical zone, antibiotic resistance is taken as an example. Antibiotic resistance genes are considered as a group of emerging contaminants, and their emergence and spread within the critical zone on one hand are induced by anthropogenic activities, and on other hand are threatening human health worldwide. The transport and transformation of antibiotic resistance genes are controlled by both horizontal gene transfer between bacterial cells and the movement of bacteria harboring antibiotic resistance genes. In this paper, the fate and behavior of antibiotic resistance genes will be discussed in the following aspects: 1) general overview of environmental antibiotic resistance; 2) high through quantification of the resistome in various environmental media; 3) pathways of resistance gene flow within the critical zone; and 4) potential strategies in mitigating antibiotic resistance, particularly from the critical zone perspectives.

  18. Methods for detecting additional genes underlying Alzheimer disease

    SciTech Connect

    Locke, P.A.; Haines, J.L.; Ter-Minassian, M.

    1994-09-01

    Alzheimer`s disease (AD) is a complex inherited disorder with proven genetic heterogeneity. To date, genes on chromosome 21 (APP) and 14 (not yet identified) are associated with early-onset familial AD, while the APOE gene on chromosome 19 is associated with both late onset familial and sporadic AD and early onset sporadic AD. Although these genes likely account for the majority of AD, many familial cases cannot be traced to any of these genes. From a set of 127 late-onset multiplex families screened for APOE, 43 (34%) families have at least one affected individual with no APOE-4 allele, suggesting an alternative genetic etiology. Simulation studies indicated that additional loci could be identified through a genomic screen with a 10 cM sieve on a subset of 21 well documented, non-APOE-4 families. Given the uncertainties in the mode of inheritance, reliance on a single analytical method could result in a missed linkage. Therefore, we have developed a strategy of using multiple overlapping yet complementary methods to detect linkage. These include sib-pair analysis and affected-pedigree-member analysis, neither of which makes assumptions about mode of inheritance, and lod score analysis (using two predefined genetic models). In order for a marker to qualify for follow-up, it must fit at least two of three criteria. These are nominal P values of 0.05 or less for the non-parametric methods, and/or a lod score greater than 1.0. Adjacent markers each fulfilling a single criterion also warrant follow-up. To date, we have screened 61 markers on chromosomes 1, 2, 3, 18, 19, 21, and 22. One marker, D2S163, generated a lod score of 1.06 ({theta} = 0.15) and an APMT statistic of 3.68 (P < 0.001). This region is currently being investigated in more detail. Updated results of this region plus additional screening data will be presented.

  19. Mosaic tetracycline resistance genes encoding ribosomal protection proteins.

    PubMed

    Warburton, Philip J; Amodeo, Nina; Roberts, Adam P

    2016-12-01

    First reported in 2003, mosaic tetracycline resistance genes are a subgroup of the genes encoding ribosomal protection proteins (RPPs). They are formed when two or more RPP-encoding genes recombine resulting in a functional chimera. To date, the majority of mosaic genes are derived from sections of three RPP genes, tet(O), tet(W) and tet(32), with others comprising tet(M) and tet(S). In this first review of mosaic genes, we report on their structure, diversity and prevalence, and suggest that these genes may be responsible for an under-reported contribution to tetracycline resistance in bacteria.

  20. Mosaic tetracycline resistance genes encoding ribosomal protection proteins

    PubMed Central

    Warburton, Philip J.; Amodeo, Nina; Roberts, Adam P.

    2016-01-01

    First reported in 2003, mosaic tetracycline resistance genes are a subgroup of the genes encoding ribosomal protection proteins (RPPs). They are formed when two or more RPP-encoding genes recombine resulting in a functional chimera. To date, the majority of mosaic genes are derived from sections of three RPP genes, tet(O), tet(W) and tet(32), with others comprising tet(M) and tet(S). In this first review of mosaic genes, we report on their structure, diversity and prevalence, and suggest that these genes may be responsible for an under-reported contribution to tetracycline resistance in bacteria. PMID:27494928

  1. Detection of the mcr-1 Colistin Resistance Gene in Carbapenem-Resistant Enterobacteriaceae from Different Hospitals in China

    PubMed Central

    Yu, Hua; Qu, Fen; Shan, Bin; Huang, Bin; Jia, Wei; Chen, Cha; Li, Aiqing; Miao, Minhui; Zhang, Xin; Bao, Chunmei; Xu, Yunmin; Chavda, Kalyan D.; Kreiswirth, Barry N.

    2016-01-01

    The spread of the plasmid-mediated colistin resistance gene, mcr-1, into carbapenem-resistant Enterobacteriaceae (CRE) clinical isolates poses a significant threat to global health. Here we report the identification of three mcr-1-harboring carbapenem-resistant Escherichia coli strains, collected from three patients in two provinces in China. Our results show that mcr-1-harboring CRE strains have started to spread in different hospitals in China. In addition, this report presents the first description of chromosomal integration of mcr-1 into a carbapenem-resistant E. coli strain. PMID:27216058

  2. What is a resistance gene? Ranking risk in resistomes.

    PubMed

    Martínez, José L; Coque, Teresa M; Baquero, Fernando

    2015-02-01

    Metagenomic studies have shown that antibiotic resistance genes are ubiquitous in the environment, which has led to the suggestion that there is a high risk that these genes will spread to bacteria that cause human infections. If this is true, estimating the real risk of dissemination of resistance genes from environmental reservoirs to human pathogens is therefore very difficult. In this Opinion article, we analyse the current definitions of antibiotic resistance and antibiotic resistance genes, and we describe the bottlenecks that affect the transfer of antibiotic resistance genes to human pathogens. We propose rules for estimating the risks associated with genes that are present in environmental resistomes by evaluating the likelihood of their introduction into human pathogens, and the consequences of such events for the treatment of infections.

  3. Processable high temperature resistant addition type polyimide laminating resins

    NASA Technical Reports Server (NTRS)

    Serafini, T. T.; Delvigs, P.

    1973-01-01

    Basic studies that were performed using model compounds to elucidate the polymerization mechanism of the so-called addition-type (A-type) polyimides are reviewed. The fabrication and properties of polyimide/graphite fiber composites using A-type polyimide prepolymers as the matrix are also reviewed. An alternate method for preparing processable A-type polyimides by means of in situ polymerization of monomer reactants (PMR) on the fiber reinforcement is described. The elevated temperature properties of A-type PMR/graphite fiber composites are also presented.

  4. Identification of I-7 expands the repertoire of genes for resistance to Fusarium wilt in tomato to three resistance gene classes.

    PubMed

    Gonzalez-Cendales, Yvonne; Catanzariti, Ann-Maree; Baker, Barbara; Mcgrath, Des J; Jones, David A

    2016-04-01

    The tomato I-3 and I-7 genes confer resistance to Fusarium oxysporum f. sp. lycopersici (Fol) race 3 and were introgressed into the cultivated tomato, Solanum lycopersicum, from the wild relative Solanum pennellii. I-3 has been identified previously on chromosome 7 and encodes an S-receptor-like kinase, but little is known about I-7. Molecular markers have been developed for the marker-assisted breeding of I-3, but none are available for I-7. We used an RNA-seq and single nucleotide polymorphism (SNP) analysis approach to map I-7 to a small introgression of S. pennellii DNA (c. 210 kb) on chromosome 8, and identified I-7 as a gene encoding a leucine-rich repeat receptor-like protein (LRR-RLP), thereby expanding the repertoire of resistance protein classes conferring resistance to Fol. Using an eds1 mutant of tomato, we showed that I-7, like many other LRR-RLPs conferring pathogen resistance in tomato, is EDS1 (Enhanced Disease Susceptibility 1) dependent. Using transgenic tomato plants carrying only the I-7 gene for Fol resistance, we found that I-7 also confers resistance to Fol races 1 and 2. Given that Fol race 1 carries Avr1, resistance to Fol race 1 indicates that I-7-mediated resistance, unlike I-2- or I-3-mediated resistance, is not suppressed by Avr1. This suggests that Avr1 is not a general suppressor of Fol resistance in tomato, leading us to hypothesize that Avr1 may be acting against an EDS1-independent pathway for resistance activation. The identification of I-7 has allowed us to develop molecular markers for marker-assisted breeding of both genes currently known to confer Fol race 3 resistance (I-3 and I-7). Given that I-7-mediated resistance is not suppressed by Avr1, I-7 may be a useful addition to I-3 in the tomato breeder's toolbox.

  5. Diverse and abundant antibiotic resistance genes in Chinese swine farms.

    PubMed

    Zhu, Yong-Guan; Johnson, Timothy A; Su, Jian-Qiang; Qiao, Min; Guo, Guang-Xia; Stedtfeld, Robert D; Hashsham, Syed A; Tiedje, James M

    2013-02-26

    Antibiotic resistance genes (ARGs) are emerging contaminants posing a potential worldwide human health risk. Intensive animal husbandry is believed to be a major contributor to the increased environmental burden of ARGs. Despite the volume of antibiotics used in China, little information is available regarding the corresponding ARGs associated with animal farms. We assessed type and concentrations of ARGs at three stages of manure processing to land disposal at three large-scale (10,000 animals per year) commercial swine farms in China. In-feed or therapeutic antibiotics used on these farms include all major classes of antibiotics except vancomycins. High-capacity quantitative PCR arrays detected 149 unique resistance genes among all of the farm samples, the top 63 ARGs being enriched 192-fold (median) up to 28,000-fold (maximum) compared with their respective antibiotic-free manure or soil controls. Antibiotics and heavy metals used as feed supplements were elevated in the manures, suggesting the potential for coselection of resistance traits. The potential for horizontal transfer of ARGs because of transposon-specific ARGs is implicated by the enrichment of transposases--the top six alleles being enriched 189-fold (median) up to 90,000-fold in manure--as well as the high correlation (r(2) = 0.96) between ARG and transposase abundance. In addition, abundance of ARGs correlated directly with antibiotic and metal concentrations, indicating their importance in selection of resistance genes. Diverse, abundant, and potentially mobile ARGs in farm samples suggest that unmonitored use of antibiotics and metals is causing the emergence and release of ARGs to the environment.

  6. Resistance to Sulfonamides and Dissemination of sul Genes Among Salmonella spp. Isolated from Food in Poland.

    PubMed

    Mąka, Łukasz; Maćkiw, Elżbieta; Ścieżyńska, Halina; Modzelewska, Magdalena; Popowska, Magdalena

    2015-05-01

    Antimicrobial resistance of pathogenic bacteria, including Salmonella spp., is an emerging problem of food safety. Antimicrobial use can result in selection of resistant organisms. The food chain is considered a route of transmission of resistant pathogens to humans. In many European countries, sulfonamides are one of the most commonly used antimicrobials. The aim of our investigation was to assess the prevalence of sul genes and plasmid occurrence among sulfonamide-resistant Salmonella spp. Eighty-four sulfonamide-resistant isolates were collected in 2008 and 2013 from retail products in Poland. Minimal inhibitory concentration of all of these isolates was ≥1024 μg/mL. Resistant isolates were tested for the presence of sul1, sul2, sul3, and int1 genes by using multiplex polymerase chain reaction. In total, 44.0% (37/84) isolates carried the sul1 gene, 46.4% (39/84) were sul2 positive, while the sul3 gene was not detected in any of the sulfonamide-resistant isolates tested. It was found that 3.6% (3/84) of resistant Salmonella spp. contained sul1, sul2, and intI genes. All 33 intI-positive isolates carried the sul1 gene. Eleven of the sulfonamide-resistant isolates were negative for all the sul genes. Most of the sulfonamide-resistant Salmonella spp. harbored plasmids; only in eight isolates were no plasmids detected. Generally, the size of the plasmids ranged from approximately 2 kb to ≥90 kb. Our results revealed a relatively a high prevalence of sulfonamides-resistant Salmonella spp. isolated from retail food. Additionally, we have detected a high dissemination of plasmids and class 1 integrons that may enhance the spread of resistance genes in the food chain.

  7. Differential gene expression and bioinformatics analysis of copper resistance gene afe_1073 in Acidithiobacillus ferrooxidans.

    PubMed

    Hu, Qi; Wu, Xueling; Jiang, Ying; Liu, Yuandong; Liang, Yili; Liu, Xueduan; Yin, Huaqun; Baba, Ngom

    2013-04-01

    Copper resistance of acidophilic bacteria is very significant in bioleaching of copper ore since high concentration of copper are harmful to the growth of organisms. Copper resistance gene afe_1073 was putatively considered to be involved in copper homeostasis in Acidithiobacillus ferrooxidans ATCC23270. In the present study, differential expression of afe_1073 in A. ferrooxidans strain DY26 and DC was assessed with quantitative reverse transcription polymerase chain reaction. The results showed the expression of afe_1073 in two strains increased with the increment of copper concentrations. The expression of DY26 was lower than that of DC at the same copper concentration although A. ferrooxidans strain DY26 possessed higher copper resistance than strain DC. In addition, bioinformatics analysis showed AFE_1073 was a typical transmembrane protein P1b1-ATPase, which could reduce the harm of Cu(+) by pumping it out from the cell. There were two mutation sites in AFE_1073 between DY26 and DC and one may change the hydrophobicity of AFE_1073, which could enhance the ability of DY26 to pump out Cu(+). Therefore, DY26 needed less gene expression of afe_1073 for resisting copper toxicity than that of DC at the same copper stress. Our study will be beneficial to understanding the copper resistance mechanism of A. ferrooxidans.

  8. The tomato I-3 gene: a novel gene for resistance to Fusarium wilt disease.

    PubMed

    Catanzariti, Ann-Maree; Lim, Ginny T T; Jones, David A

    2015-07-01

    Plant resistance proteins provide race-specific immunity through the recognition of pathogen effectors. The resistance genes I, I-2 and I-3 have been incorporated into cultivated tomato (Solanum lycopersicum) from wild tomato species to confer resistance against Fusarium oxysporum f. sp. lycopersici (Fol) races 1, 2 and 3, respectively. Although the Fol effectors corresponding to these resistance genes have all been identified, only the I-2 resistance gene has been isolated from tomato. To isolate the I-3 resistance gene, we employed a map-based cloning approach and used transgenic complementation to test candidate genes for resistance to Fol race 3. Here, we describe the fine mapping and sequencing of genes at the I-3 locus, which revealed a family of S-receptor-like kinase (SRLK) genes. Transgenic tomato lines were generated with three of these SRLK genes and one was found to confer Avr3-dependent resistance to Fol race 3, confirming it to be I-3. The finding that I-3 encodes an SRLK reveals a new pathway for Fol resistance and a new class of resistance genes, of which Pi-d2 from rice is also a member. The identification of I-3 also allows the investigation of the complex effector-resistance protein interaction involving Avr1-mediated suppression of I-2- and I-3-dependent resistance in tomato.

  9. Gene expression analysis of two extensively drug-resistant tuberculosis isolates show that two-component response systems enhance drug resistance.

    PubMed

    Yu, Guohua; Cui, Zhenling; Sun, Xian; Peng, Jinfu; Jiang, Jun; Wu, Wei; Huang, Wenhua; Chu, Kaili; Zhang, Lu; Ge, Baoxue; Li, Yao

    2015-05-01

    Global analysis of expression profiles using DNA microarrays was performed between a reference strain H37Rv and two clinical extensively drug-resistant isolates in response to three anti-tuberculosis drug exposures (isoniazid, capreomycin, and rifampicin). A deep analysis was then conducted using a combination of genome sequences of the resistant isolates, resistance information, and related public microarray data. Certain known resistance-associated gene sets were significantly overrepresented in upregulated genes in the resistant isolates relative to that observed in H37Rv, which suggested a link between resistance and expression levels of particular genes. In addition, isoniazid and capreomycin response genes, but not rifampicin, either obtained from published works or our data, were highly consistent with the differentially expressed genes of resistant isolates compared to those of H37Rv, indicating a strong association between drug resistance of the isolates and genes differentially regulated by isoniazid and capreomycin exposures. Based on these results, 92 genes of the studied isolates were identified as candidate resistance genes, 10 of which are known resistance-related genes. Regulatory network analysis of candidate resistance genes using published networks and literature mining showed that three two-component regulatory systems and regulator CRP play significant roles in the resistance of the isolates by mediating the production of essential envelope components. Finally, drug sensitivity testing indicated strong correlations between expression levels of these regulatory genes and sensitivity to multiple anti-tuberculosis drugs in Mycobacterium tuberculosis. These findings may provide novel insights into the mechanism underlying the emergence and development of drug resistance in resistant tuberculosis isolates and useful clues for further studies on this issue.

  10. Integration and bioinformatics analysis of DNA-methylated genes associated with drug resistance in ovarian cancer

    PubMed Central

    YAN, BINGBING; YIN, FUQIANG; WANG, QI; ZHANG, WEI; LI, LI

    2016-01-01

    The main obstacle to the successful treatment of ovarian cancer is the development of drug resistance to combined chemotherapy. Among all the factors associated with drug resistance, DNA methylation apparently plays a critical role. In this study, we performed an integrative analysis of the 26 DNA-methylated genes associated with drug resistance in ovarian cancer, and the genes were further evaluated by comprehensive bioinformatics analysis including gene/protein interaction, biological process enrichment and annotation. The results from the protein interaction analyses revealed that at least 20 of these 26 methylated genes are present in the protein interaction network, indicating that they interact with each other, have a correlation in function, and may participate as a whole in the regulation of ovarian cancer drug resistance. There is a direct interaction between the phosphatase and tensin homolog (PTEN) gene and at least half of the other genes, indicating that PTEN may possess core regulatory functions among these genes. Biological process enrichment and annotation demonstrated that most of these methylated genes were significantly associated with apoptosis, which is possibly an essential way for these genes to be involved in the regulation of multidrug resistance in ovarian cancer. In addition, a comprehensive analysis of clinical factors revealed that the methylation level of genes that are associated with the regulation of drug resistance in ovarian cancer was significantly correlated with the prognosis of ovarian cancer. Overall, this study preliminarily explains the potential correlation between the genes with DNA methylation and drug resistance in ovarian cancer. This finding has significance for our understanding of the regulation of resistant ovarian cancer by methylated genes, the treatment of ovarian cancer, and improvement of the prognosis of ovarian cancer. PMID:27347118

  11. The genetics of resistance to powdery mildew in cultivated oats (Avena sativa L.): current status of major genes.

    PubMed

    Hsam, Sai L K; Mohler, Volker; Zeller, Friedrich J

    2014-05-01

    The genetics of resistance to powdery mildew caused by Blumeria graminis f. sp. avenae of four cultivated oats was studied using monosomic analysis. Cultivar 'Bruno' carries a gene (Pm6) that shows a recessive mode of inheritance and is located on chromosome 10D. Cultivar 'Jumbo' possesses a dominant resistance gene (Pm1) on chromosome 1C. In cultivar 'Rollo', in addition to the gene Pm3 on chromosome 17A, a second dominant resistance gene (Pm8) was identified and assigned to chromosome 4C. In breeding line APR 122, resistance was conditioned by a dominant resistance gene (Pm7) that was allocated to chromosome 13A. Genetic maps established for resistance genes Pm1, Pm6 and Pm7 employing amplified fragment length polymorphism (AFLP) markers indicated that these genes are independent of each other, supporting the results from monosomic analysis.

  12. Gene-for-gene disease resistance: bridging insect pest and pathogen defense.

    PubMed

    Kaloshian, Isgouhi

    2004-12-01

    Active plant defense, also known as gene-for-gene resistance, is triggered when a plant resistance (R) gene recognizes the intrusion of a specific insect pest or pathogen. Activation of plant defense includes an array of physiological and transcriptional reprogramming. During the past decade, a large number of plant R genes that confer resistance to diverse group of pathogens have been cloned from a number of plant species. Based on predicted protein structures, these genes are classified into a small number of groups, indicating that structurally related R genes recognize phylogenetically distinct pathogens. An extreme example is the tomato Mi-1 gene, which confers resistance to potato aphid (Macrosiphum euphorbiae), whitefly (Bemisia tabaci), and root-knot nematodes (Meloidogyne spp.). While Mi-1 remains the only cloned insect R gene, there is evidence that gene-for-gene type of plant defense against piercing-sucking insects exists in a number of plant species.

  13. Gene amplification confers glyphosate resistance in Amaranthus palmeri

    PubMed Central

    Gaines, Todd A.; Zhang, Wenli; Wang, Dafu; Bukun, Bekir; Chisholm, Stephen T.; Shaner, Dale L.; Nissen, Scott J.; Patzoldt, William L.; Tranel, Patrick J.; Culpepper, A. Stanley; Grey, Timothy L.; Webster, Theodore M.; Vencill, William K.; Sammons, R. Douglas; Jiang, Jiming; Preston, Christopher; Leach, Jan E.; Westra, Philip

    2009-01-01

    The herbicide glyphosate became widely used in the United States and other parts of the world after the commercialization of glyphosate-resistant crops. These crops have constitutive overexpression of a glyphosate-insensitive form of the herbicide target site gene, 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Increased use of glyphosate over multiple years imposes selective genetic pressure on weed populations. We investigated recently discovered glyphosate-resistant Amaranthus palmeri populations from Georgia, in comparison with normally sensitive populations. EPSPS enzyme activity from resistant and susceptible plants was equally inhibited by glyphosate, which led us to use quantitative PCR to measure relative copy numbers of the EPSPS gene. Genomes of resistant plants contained from 5-fold to more than 160-fold more copies of the EPSPS gene than did genomes of susceptible plants. Quantitative RT-PCR on cDNA revealed that EPSPS expression was positively correlated with genomic EPSPS relative copy number. Immunoblot analyses showed that increased EPSPS protein level also correlated with EPSPS genomic copy number. EPSPS gene amplification was heritable, correlated with resistance in pseudo-F2 populations, and is proposed to be the molecular basis of glyphosate resistance. FISH revealed that EPSPS genes were present on every chromosome and, therefore, gene amplification was likely not caused by unequal chromosome crossing over. This occurrence of gene amplification as an herbicide resistance mechanism in a naturally occurring weed population is particularly significant because it could threaten the sustainable use of glyphosate-resistant crop technology. PMID:20018685

  14. Sponge Microbiota Are a Reservoir of Functional Antibiotic Resistance Genes

    PubMed Central

    Versluis, Dennis; Rodriguez de Evgrafov, Mari; Sommer, Morten O. A.; Sipkema, Detmer; Smidt, Hauke; van Passel, Mark W. J.

    2016-01-01

    Wide application of antibiotics has contributed to the evolution of multi-drug resistant human pathogens, resulting in poorer treatment outcomes for infections. In the marine environment, seawater samples have been investigated as a resistance reservoir; however, no studies have methodically examined sponges as a reservoir of antibiotic resistance. Sponges could be important in this respect because they often contain diverse microbial communities that have the capacity to produce bioactive metabolites. Here, we applied functional metagenomics to study the presence and diversity of functional resistance genes in the sponges Aplysina aerophoba, Petrosia ficiformis, and Corticium candelabrum. We obtained 37 insert sequences facilitating resistance to D-cycloserine (n = 6), gentamicin (n = 1), amikacin (n = 7), trimethoprim (n = 17), chloramphenicol (n = 1), rifampicin (n = 2) and ampicillin (n = 3). Fifteen of 37 inserts harbored resistance genes that shared <90% amino acid identity with known gene products, whereas on 13 inserts no resistance gene could be identified with high confidence, in which case we predicted resistance to be mainly mediated by antibiotic efflux. One marine-specific ampicillin-resistance-conferring β-lactamase was identified in the genus Pseudovibrio with 41% global amino acid identity to the closest β-lactamase with demonstrated functionality, and subsequently classified into a new family termed PSV. Taken together, our results show that sponge microbiota host diverse and novel resistance genes that may be harnessed by phylogenetically distinct bacteria. PMID:27909433

  15. Mobile antibiotic resistance - the spread of genes determining the resistance of bacteria through food products.

    PubMed

    Godziszewska, Jolanta; Guzek, Dominika; Głąbski, Krzysztof; Wierzbicka, Agnieszka

    2016-07-07

    In recent years, more and more antibiotics have become ineffective in the treatment of bacterial nfections. The acquisition of antibiotic resistance by bacteria is associated with circulation of genes in the environment. Determinants of antibiotic resistance may be transferred to pathogenic bacteria. It has been shown that conjugation is one of the key mechanisms responsible for spread of antibiotic resistance genes, which is highly efficient and allows the barrier to restrictions and modifications to be avoided. Some conjugative modules enable the transfer of plasmids even between phylogenetically distant bacterial species. Many scientific reports indicate that food is one of the main reservoirs of these genes. Antibiotic resistance genes have been identified in meat products, milk, fruits and vegetables. The reason for such a wide spread of antibiotic resistance genes is the overuse of antibiotics by breeders of plants and animals, as well as by horizontal gene transfer. It was shown, that resistance determinants located on mobile genetic elements, which are isolated from food products, can easily be transferred to another niche. The antibiotic resistance genes have been in the environment for 30 000 years. Their removal from food products is not possible, but the risks associated with the emergence of multiresistant pathogenic strains are very large. The only option is to control the emergence, selection and spread of these genes. Therefore measures are sought to prevent horizontal transfer of genes. Promising concepts involve the combination of developmental biology, evolution and ecology in the fight against the spread of antibiotic resistance.

  16. Engineering disease resistance with pectate lyase-like genes

    DOEpatents

    Vogel, John; Somerville, Shauna

    2005-03-08

    A mutant gene coding for pectate lyase and homologs thereof is provided, which when incorporated in transgenic plants effect an increased level disease resistance in such plants. Also is provided the polypeptide sequence for the pectate lyase of the present invention. Methods of obtaining the mutant gene, producing transgenic plants which include the nucleotide sequence for the mutant gene and producing improved disease resistance in a crop of such transgenic plants are also provided.

  17. The transport of antibiotic resistance genes and residues in groundwater near swine production facilities

    NASA Astrophysics Data System (ADS)

    Lin, Y. F.; Yannarell, A. C.; Mackie, R. I.; Krapac, I. G.; Chee-Sanford, J. S.; Koike, S.

    2008-12-01

    The use of antibiotics at concentrated animal feeding operations (CAFOs) for disease prevention, disease treatment, and growth promotion can contribute to the spread of antibiotic compounds, their breakdown products, and antibiotic resistant bacteria and/or the genes that confer resistance. In addition, constitutive use of antibiotics at sub-therapeutic levels can select for antibiotic resistance among the bacteria that inhabit animal intestinal tracts, onsite manure treatment facilities, and any environments receiving significant inputs of manure (e.g. through waste lagoon leakage or fertilizer amendments to farm soils). If the antibiotic resistant organisms persist in these new environments, or if they participate in genetic exchanges with the native microflora, then CAFOs may constitute a significant reservoir for the spread of antibiotic resistance to the environment at large. Our results have demonstrated that leakage from waste treatment lagoons can influence the presence and persistence of tetracycline resistance genes in the shallow aquifer adjacent to swine CAFOs, and molecular phylogeny allowed us to distinguish "native" tetracycline resistance genes in control groundwater wells from manure-associated genes introduced from the lagoon. We have also been able to detect the presence of erythromycin resistance genes in CAFO surface and groundwater even though erythromycin is strictly reserved for use in humans and thus is not utilized at any of these sites. Ongoing research, including modeling of particle transport in groundwater, will help to determine the potential spatial and temporal extent of CAFO-derived antibiotic resistance.

  18. Diverse antibiotic resistance genes in dairy cow manure.

    PubMed

    Wichmann, Fabienne; Udikovic-Kolic, Nikolina; Andrew, Sheila; Handelsman, Jo

    2014-04-22

    Application of manure from antibiotic-treated animals to crops facilitates the dissemination of antibiotic resistance determinants into the environment. However, our knowledge of the identity, diversity, and patterns of distribution of these antibiotic resistance determinants remains limited. We used a new combination of methods to examine the resistome of dairy cow manure, a common soil amendment. Metagenomic libraries constructed with DNA extracted from manure were screened for resistance to beta-lactams, phenicols, aminoglycosides, and tetracyclines. Functional screening of fosmid and small-insert libraries identified 80 different antibiotic resistance genes whose deduced protein sequences were on average 50 to 60% identical to sequences deposited in GenBank. The resistance genes were frequently found in clusters and originated from a taxonomically diverse set of species, suggesting that some microorganisms in manure harbor multiple resistance genes. Furthermore, amid the great genetic diversity in manure, we discovered a novel clade of chloramphenicol acetyltransferases. Our study combined functional metagenomics with third-generation PacBio sequencing to significantly extend the roster of functional antibiotic resistance genes found in animal gut bacteria, providing a particularly broad resource for understanding the origins and dispersal of antibiotic resistance genes in agriculture and clinical settings. IMPORTANCE The increasing prevalence of antibiotic resistance among bacteria is one of the most intractable challenges in 21st-century public health. The origins of resistance are complex, and a better understanding of the impacts of antibiotics used on farms would produce a more robust platform for public policy. Microbiomes of farm animals are reservoirs of antibiotic resistance genes, which may affect distribution of antibiotic resistance genes in human pathogens. Previous studies have focused on antibiotic resistance genes in manures of animals subjected

  19. Standardized Plant Disease Evaluations will Enhance Resistance Gene Discovery

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Gene discovery and marker development using DNA based tools require plant populations with well-documented phenotypes. Related crops such as apples and pears may share a number of genes, for example resistance to common diseases, and data mining in one crop may reveal genes for the other. However, u...

  20. New frontiers in the therapy of primary immunodeficiency: From gene addition to gene editing.

    PubMed

    Kohn, Donald B; Kuo, Caroline Y

    2017-03-01

    The most severe primary immune deficiency diseases (PIDs) have been successfully treated with allogeneic hematopoietic stem cell transplantation for more than 4 decades. However, such transplantations have the best outcomes when there is a well-matched donor available because immune complications, such as graft-versus-host disease, are greater without a matched sibling donor. Gene therapy has been developed as a method to perform autologous transplantations of a patient's own stem cells that are genetically corrected. Through an iterative bench-to-bedside-and-back process, methods to efficiently add new copies of the relevant gene to hematopoietic stem cells have led to safe and effective treatments for several PIDs, including forms of severe combined immune deficiency, Wiskott-Aldrich syndrome, and chronic granulomatous disease. New methods for gene editing might allow additional PIDs to be treated by gene therapy because they will allow the endogenous gene to be repaired and expressed under its native regulatory elements, which are essential for genes involved in cell processes of signaling, activation, and proliferation. Gene therapy is providing exciting new treatment options for patients with PIDs, and advances are sure to continue.

  1. Selection for increased desiccation resistance in Drosophila melanogaster: Additive genetic control and correlated responses for other stresses

    SciTech Connect

    Hoffmann, A.A.; Parsons, P.A. )

    1989-08-01

    Previously we found that Drosophila melanogaster lines selected for increased desiccation resistance have lowered metabolic rate and behavioral activity levels, and show correlated responses for resistance to starvation and a toxic ethanol level. These results were consistent with a prediction that increased resistance to many environmental stresses may be genetically correlated because of a reduction in metabolic energy expenditure. Here we present experiments on the genetic basis of the selection response and extend the study of correlated responses to other stresses. The response to selection was not sex-specific and involved X-linked and autosomal genes acting additively. Activity differences contributed little to differences in desiccation resistance between selected and control lines. Selected lines had lower metabolic rates than controls in darkness when activity was inhibited. Adults from selected lines showed increased resistance to a heat shock, {sup 60}Co-gamma-radiation, and acute ethanol and acetic acid stress. The desiccation, ethanol and starvation resistance of isofemale lines set up from the F2s of a cross between one of the selected and one of the control lines were correlated. Selected and control lines did not differ in ether-extractable lipid content or in resistance to acetone, ether or a cold shock.

  2. Fluoroquinolone resistance in atypical pneumococci and oral streptococci: evidence of horizontal gene transfer of fluoroquinolone resistance determinants from Streptococcus pneumoniae.

    PubMed

    Ip, Margaret; Chau, Shirley S L; Chi, Fang; Tang, Julian; Chan, Paul K

    2007-08-01

    Atypical strains, presumed to be pneumococcus, with ciprofloxacin MICs of > or =4.0 microg/ml and unique sequence variations within the quinolone resistance-determining regions (QRDRs) of the gyrase and topoisomerase genes in comparison with the Streptococcus pneumoniae R6 strain, were examined. These strains were reidentified using phenotypic methods, including detection of optochin susceptibility, bile solubility, and agglutination by serotype-specific antisera, and genotypic methods, including detection of pneumolysin and autolysin genes by PCR, 16S rRNA sequencing, and multilocus sequence typing (MLST). The analysis based on concatenated sequences of the six MLST loci distinguished the "atypical" strains from pneumococci, and these strains clustered closely with S. mitis. However, all these strains and five of nine strains from the viridans streptococcal group possessed one to three gyrA, gyrB, parC, and parE genes whose QRDR sequences clustered with those of S. pneumoniae, providing evidence of horizontal transfer of the QRDRs of the gyrase and topoisomerase genes from pneumococci into viridans streptococci. These genes also conferred fluoroquinolone resistance to viridans streptococci. In addition, the fluoroquinolone resistance determinants of 32 well-characterized Streptococcus mitis and Streptococcus oralis strains from bacteremic patients were also compared. These strains have unique amino acid substitutions in GyrA and ParC that were distinguishable from those in fluoroquinolone-resistant pneumococci and the "atypical" isolates. Both recombinational events and de novo mutations play an important role in the development of fluoroquinolone resistance.

  3. Exploring the diversity of arsenic resistance genes from acid mine drainage microorganisms.

    PubMed

    Morgante, Verónica; Mirete, Salvador; de Figueras, Carolina G; Postigo Cacho, Marina; González-Pastor, José E

    2015-06-01

    The microbial communities from the Tinto River, a natural acid mine drainage environment, were explored to search for novel genes involved in arsenic resistance using a functional metagenomic approach. Seven pentavalent arsenate resistance clones were selected and analysed to find the genes responsible for this phenotype. Insights about their possible mechanisms of resistance were obtained from sequence similarities and cellular arsenic concentration. A total of 19 individual open reading frames were analysed, and each one was individually cloned and assayed for its ability to confer arsenic resistance in Escherichia coli cells. A total of 13 functionally active genes involved in arsenic resistance were identified, and they could be classified into different global processes: transport, stress response, DNA damage repair, phospholipids biosynthesis, amino acid biosynthesis and RNA-modifying enzymes. Most genes (11) encode proteins not previously related to heavy metal resistance or hypothetical or unknown proteins. On the other hand, two genes were previously related to heavy metal resistance in microorganisms. In addition, the ClpB chaperone and the RNA-modifying enzymes retrieved in this work were shown to increase the cell survival under different stress conditions (heat shock, acid pH and UV radiation). Thus, these results reveal novel insights about unidentified mechanisms of arsenic resistance.

  4. 75 FR 54461 - Black Stem Rust; Additions of Rust-Resistant Varieties

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-09-08

    ... Health Inspection Service 7 CFR Part 301 Black Stem Rust; Additions of Rust-Resistant Varieties AGENCY... black stem rust quarantine and regulations by adding four varieties to the list of rust-resistant.... Prakash K. Hebbar, National Program Manager, Black Stem/Barberry Rust Program, PPQ, APHIS, 4700 River...

  5. 75 FR 44881 - Black Stem Rust; Additions of Rust-Resistant Varieties

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-07-30

    ... Part 301 [Docket No. APHIS-2010-0035] Black Stem Rust; Additions of Rust-Resistant Varieties AGENCY... black stem rust quarantine and regulations by adding 21 varieties to the list of rust-resistant Berberis... Program Manager, Black Stem/Barberry Rust Program, PPQ, APHIS, 4700 River Road Unit 26, Riverdale,...

  6. Diverse Antibiotic Resistance Genes in Dairy Cow Manure

    PubMed Central

    Wichmann, Fabienne; Udikovic-Kolic, Nikolina; Andrew, Sheila; Handelsman, Jo

    2014-01-01

    ABSTRACT Application of manure from antibiotic-treated animals to crops facilitates the dissemination of antibiotic resistance determinants into the environment. However, our knowledge of the identity, diversity, and patterns of distribution of these antibiotic resistance determinants remains limited. We used a new combination of methods to examine the resistome of dairy cow manure, a common soil amendment. Metagenomic libraries constructed with DNA extracted from manure were screened for resistance to beta-lactams, phenicols, aminoglycosides, and tetracyclines. Functional screening of fosmid and small-insert libraries identified 80 different antibiotic resistance genes whose deduced protein sequences were on average 50 to 60% identical to sequences deposited in GenBank. The resistance genes were frequently found in clusters and originated from a taxonomically diverse set of species, suggesting that some microorganisms in manure harbor multiple resistance genes. Furthermore, amid the great genetic diversity in manure, we discovered a novel clade of chloramphenicol acetyltransferases. Our study combined functional metagenomics with third-generation PacBio sequencing to significantly extend the roster of functional antibiotic resistance genes found in animal gut bacteria, providing a particularly broad resource for understanding the origins and dispersal of antibiotic resistance genes in agriculture and clinical settings. PMID:24757214

  7. AMINOGLYCOSIDE RESISTANCE GENES IN Pseudomonas aeruginosa ISOLATES FROM CUMANA, VENEZUELA.

    PubMed

    Teixeira, Bertinellys; Rodulfo, Hectorina; Carreño, Numirin; Guzmán, Militza; Salazar, Elsa; De Donato, Marcos

    2016-01-01

    The enzymatic modification of aminoglycosides by aminoglycoside-acetyltransferases (AAC), aminoglycoside-adenyltransferases (AAD), and aminoglycoside-phosphotransferases (APH), is the most common resistance mechanism in P. aeruginosa and these enzymes can be coded on mobile genetic elements that contribute to their dispersion. One hundred and thirty seven P. aeruginosa isolates from the University Hospital, Cumana, Venezuela (HUAPA) were evaluated. Antimicrobial susceptibility was determined by the disk diffusion method and theaac, aadB and aph genes were detected by PCR. Most of the P. aeruginosa isolates (33/137) were identified from the Intensive Care Unit (ICU), mainly from discharges (96/137). The frequency of resistant P. aeruginosaisolates was found to be higher for the aminoglycosides tobramycin and amikacin (30.7 and 29.9%, respectively). Phenotype VI, resistant to these antibiotics, was the most frequent (14/49), followed by phenotype I, resistant to all the aminoglycosides tested (12/49). The aac(6´)-Ib,aphA1 and aadB genes were the most frequently detected, and the simultaneous presence of several resistance genes in the same isolate was demonstrated. Aminoglycoside resistance in isolates ofP. aeruginosa at the HUAPA is partly due to the presence of the aac(6´)-Ib, aphA1 andaadB genes, but the high rates of antimicrobial resistance suggest the existence of several mechanisms acting together. This is the first report of aminoglycoside resistance genes in Venezuela and one of the few in Latin America.

  8. AMINOGLYCOSIDE RESISTANCE GENES IN Pseudomonas aeruginosa ISOLATES FROM CUMANA, VENEZUELA

    PubMed Central

    TEIXEIRA, Bertinellys; RODULFO, Hectorina; CARREÑO, Numirin; GUZMÁN, Militza; SALAZAR, Elsa; DONATO, Marcos DE

    2016-01-01

    The enzymatic modification of aminoglycosides by aminoglycoside-acetyltransferases (AAC), aminoglycoside-adenyltransferases (AAD), and aminoglycoside-phosphotransferases (APH), is the most common resistance mechanism in P. aeruginosa and these enzymes can be coded on mobile genetic elements that contribute to their dispersion. One hundred and thirty seven P. aeruginosa isolates from the University Hospital, Cumana, Venezuela (HUAPA) were evaluated. Antimicrobial susceptibility was determined by the disk diffusion method and theaac, aadB and aph genes were detected by PCR. Most of the P. aeruginosa isolates (33/137) were identified from the Intensive Care Unit (ICU), mainly from discharges (96/137). The frequency of resistant P. aeruginosaisolates was found to be higher for the aminoglycosides tobramycin and amikacin (30.7 and 29.9%, respectively). Phenotype VI, resistant to these antibiotics, was the most frequent (14/49), followed by phenotype I, resistant to all the aminoglycosides tested (12/49). The aac(6´)-Ib,aphA1 and aadB genes were the most frequently detected, and the simultaneous presence of several resistance genes in the same isolate was demonstrated. Aminoglycoside resistance in isolates ofP. aeruginosa at the HUAPA is partly due to the presence of the aac(6´)-Ib, aphA1 andaadB genes, but the high rates of antimicrobial resistance suggest the existence of several mechanisms acting together. This is the first report of aminoglycoside resistance genes in Venezuela and one of the few in Latin America. PMID:27007556

  9. Mapping of the apple scab-resistance gene Vb.

    PubMed

    Erdin, N; Tartarini, S; Broggini, G A L; Gennari, F; Sansavini, S; Gessler, C; Patocchi, A

    2006-10-01

    Apple scab, caused by the fungus Venturia inaequalis, is the major production constraint in temperate zones with humid springs. Normally, its control relies on frequent and regular fungicide applications. Because this control strategy has come under increasing criticism, major efforts are being directed toward the breeding of scab-resistant apple cultivars. Modern apple breeding programs include the use of molecular markers, making it possible to combine several different scab-resistance genes in 1 apple cultivar (pyramiding) and to speed up the breeding process. The apple scab-resistance gene Vb is derived from the Siberian crab apple 'Hansen's baccata #2', and is 1 of the 6 "historical" major apple scab-resistance genes (Vf, Va, Vr, Vbj, Vm, and Vb). Molecular markers have been published for all these genes, except Vr. In testcross experiments conducted in the 1960s, it was reported that Vb segregated independently from 3 other major resistance genes, including Vf. Recently, however, Vb and Vf have both been mapped on linkage group 1, a result that contrasts with the findings from former testcross experiments. In this study, simple sequence repeat (SSR) markers were used to identify the precise position of Vb in a cross of 'Golden Delicious' (vbvb) and 'Hansen's baccata #2' (Vbvb). A genome scanning approach, a fast method already used to map apple scab-resistance genes Vr2 and Vm, was used, and the Vb locus was identified on linkage group 12, between the SSR markers Hi02d05 and Hi07f01. This finding confirms the independent segregation of Vb from Vf. With the identification of SSR markers linked to Vb, another major apple scab-resistance gene has become available; breeders can use it to develop durable resistant cultivars with several different resistance genes.

  10. Molecular insights of co-trimoxazole resistance genes in Haemophilus influenzae isolated in Malaysia.

    PubMed

    Mohd-Zain, Z; Kamsani, N H; Ahmad, N

    2013-12-01

    In the last few decades, co-trimoxazole (SXT), an antibacterial combination of trimethoprim and sulfamethoxazole, has been used for treatment of upper respiratory tract infection due to Haemophilus influenzae. The usage of this antibiotic has become less important due to emergence of SXT-resistant strains worldwide. Most reports associate SXT resistance to the presence of variants of dihydrofolate reductase (DHFR) dfrA genes which are responsible for trimethoprim resistance; while the sulfamethoxazole (SMX) resistance are due to sulfonamide (SUL) genes sul1 and sul2 and/or mutation in the chromosomal (folP) gene encoding dihydropteroate synthetase (DHPS). This study aims to detect and analyse the genes that are involved in SXT resistance in H. influenzae strains that were isolated in Malaysia. Primers targeting for variants of dfrA, fol and sul genes were used to amplify the genes in nine SXT-resistant strains. The products of amplification were sequenced and multiple alignments of the assembled sequences of the local strains were compared to the sequences of other H. influenzae strains in the Genbank. Of the five variants of the dhfA genes, dfrA1 was detected in three out of the nine strains. In contrast to intermediate strains, at least one variant of folP genes was detected in the resistant strains. Multiple nucleotide alignment of this gene revealed that strain H152 was genetically different from the others due to a 15-bp nucleotide insert in folP gene. The sequence of the insert was similar to the insert in folP of H. influenzae strain A12, a strain isolated in United Kingdom. None of the strains had sul1 gene but sul2 gene was detected in four strains. Preliminary study on the limited number of samples shows that the TMP resistance was attributed to mainly to dfrA1 and the SMX was due to folP genes. Presence of sul2 in addition to folP in seven strains apparently had increased their level of resistance. A strain that lacked sul1 or sul2 gene, its resistance

  11. Process for improving moisture resistance of epoxy resins by addition of chromium ions

    NASA Technical Reports Server (NTRS)

    St.clair, A. K.; Stoakley, D. M.; St.clair, T. L.; Singh, J. J. (Inventor)

    1985-01-01

    A process for improving the moisture resistance properties of epoxidized TGMDA and DGEBA resin system by chemically incorporating chromium ions is described. The addition of chromium ions is believed to prevent the absorption of water molecules.

  12. Are duplicated genes responsible for anthracnose resistance in common bean?

    PubMed

    Costa, Larissa Carvalho; Nalin, Rafael Storto; Ramalho, Magno Antonio Patto; de Souza, Elaine Aparecida

    2017-01-01

    The race 65 of Colletotrichum lindemuthianum, etiologic agent of anthracnose in common bean, is distributed worldwide, having great importance in breeding programs for anthracnose resistance. Several resistance alleles have been identified promoting resistance to this race. However, the variability that has been detected within race has made it difficult to obtain cultivars with durable resistance, because cultivars may have different reactions to each strain of race 65. Thus, this work aimed at studying the resistance inheritance of common bean lines to different strains of C. lindemuthianum, race 65. We used six C. lindemuthianum strains previously characterized as belonging to the race 65 through the international set of differential cultivars of anthracnose and nine commercial cultivars, adapted to the Brazilian growing conditions and with potential ability to discriminate the variability within this race. To obtain information on the resistance inheritance related to nine commercial cultivars to six strains of race 65, these cultivars were crossed two by two in all possible combinations, resulting in 36 hybrids. Segregation in the F2 generations revealed that the resistance to each strain is conditioned by two independent genes with the same function, suggesting that they are duplicated genes, where the dominant allele promotes resistance. These results indicate that the specificity between host resistance genes and pathogen avirulence genes is not limited to races, it also occurs within strains of the same race. Further research may be carried out in order to establish if the alleles identified in these cultivars are different from those described in the literature.

  13. Are duplicated genes responsible for anthracnose resistance in common bean?

    PubMed Central

    2017-01-01

    The race 65 of Colletotrichum lindemuthianum, etiologic agent of anthracnose in common bean, is distributed worldwide, having great importance in breeding programs for anthracnose resistance. Several resistance alleles have been identified promoting resistance to this race. However, the variability that has been detected within race has made it difficult to obtain cultivars with durable resistance, because cultivars may have different reactions to each strain of race 65. Thus, this work aimed at studying the resistance inheritance of common bean lines to different strains of C. lindemuthianum, race 65. We used six C. lindemuthianum strains previously characterized as belonging to the race 65 through the international set of differential cultivars of anthracnose and nine commercial cultivars, adapted to the Brazilian growing conditions and with potential ability to discriminate the variability within this race. To obtain information on the resistance inheritance related to nine commercial cultivars to six strains of race 65, these cultivars were crossed two by two in all possible combinations, resulting in 36 hybrids. Segregation in the F2 generations revealed that the resistance to each strain is conditioned by two independent genes with the same function, suggesting that they are duplicated genes, where the dominant allele promotes resistance. These results indicate that the specificity between host resistance genes and pathogen avirulence genes is not limited to races, it also occurs within strains of the same race. Further research may be carried out in order to establish if the alleles identified in these cultivars are different from those described in the literature. PMID:28296933

  14. Molecular cytogenetic identification of a wheat-rye 1R addition line with multiple spikelets and resistance to powdery mildew.

    PubMed

    Yang, Wujuan; Wang, Changyou; Chen, Chunhuan; Wang, Yajuan; Zhang, Hong; Liu, Xinlun; Ji, Wanquan

    2016-04-01

    Alien addition lines are important for transferring useful genes from alien species into common wheat. Rye is an important and valuable gene resource for improving wheat disease resistance, yield, and environment adaptation. A new wheat-rye addition line, N9436B, was developed from the progeny of the cross of common wheat (Triticum aestivum L., 2n = 6x = 42, AABBDD) cultivar Shaanmai 611 and rye (Secale cereal L., 2n = 2x = 14, RR) accession Austrian rye. We characterized this new line by cytology, genomic in situ hybridization (GISH), fluorescence in situ hybridization (FISH), molecular markers, and disease resistance screening. N9436B was stable in morphology and cytology, with a chromosome composition of 2n = 42 + 2t = 22II. GISH investigations showed that this line contained two rye chromosomes. GISH, FISH, and molecular maker identification suggested that the introduced R chromosome and the missing wheat chromosome arms were 1R chromosome and 2DL chromosome arm, respectively. N9436B exhibited 30-37 spikelets per spike and a high level of resistance to powdery mildew (Blumeria graminis f. sp. tritici, Bgt) isolate E09 at the seedling stage. N9436B was cytologically stable, had the trait of multiple spikelets, and was resistant to powdery mildew; this line should thus be useful in wheat improvement.

  15. Detection of bacterial blight resistance genes in basmati rice landraces.

    PubMed

    Ullah, I; Jamil, S; Iqbal, M Z; Shaheen, H L; Hasni, S M; Jabeen, S; Mehmood, A; Akhter, M

    2012-07-20

    Aromatic basmati rice is vulnerable to bacterial blight disease. Genes conferring resistance to bacterial blight have been identified in coarse rice; however, their incorporation into basmati varieties compromises the prized basmati aroma. We identified bacterial blight resistance genes Xa4, xa5, Xa7, and xa13 in 52 basmati landraces and five basmati cultivars using PCR markers. The Xa7 gene was found to be the most prevalent among the cultivars and landraces. The cultivars Basmati-385 and Basmati-2000 also contained the Xa4 gene; however, xa5 and xa13 were confined to landraces only. Ten landraces were found to have multiple resistance genes. Landraces Basmati-106, Basmati-189 and Basmati-208 contained Xa4 and Xa7 genes. Whereas, landraces Basmati-122, Basmati-427, Basmati-433 were observed to have xa5 and Xa7 genes. Landraces Basmati-48, Basmati-51A, Basmati-334, and Basmati-370A possessed Xa7 and xa13 genes. The use of landraces containing recessive genes xa5 and xa13 as donor parents in hybridization with cultivars Basmati-385 and Basmati-2000, which contain the genes Xa4 and Xa7, will expedite efforts to develop bacterial blight-resistant basmati rice cultivars through marker assisted selection, based on a pyramiding approach, without compromising aroma and grain quality.

  16. Additives

    NASA Technical Reports Server (NTRS)

    Smalheer, C. V.

    1973-01-01

    The chemistry of lubricant additives is discussed to show what the additives are chemically and what functions they perform in the lubrication of various kinds of equipment. Current theories regarding the mode of action of lubricant additives are presented. The additive groups discussed include the following: (1) detergents and dispersants, (2) corrosion inhibitors, (3) antioxidants, (4) viscosity index improvers, (5) pour point depressants, and (6) antifouling agents.

  17. Marker-assisted combination of major genes for pathogen resistance in potato.

    PubMed

    Gebhardt, C; Bellin, D; Henselewski, H; Lehmann, W; Schwarzfischer, J; Valkonen, J P T

    2006-05-01

    Closely linked PCR-based markers facilitate the tracing and combining of resistance factors that have been introgressed previously into cultivated potato from different sources. Crosses were performed to combine the Ry ( adg ) gene for extreme resistance to Potato virus Y (PVY) with the Gro1 gene for resistance to the root cyst nematode Globodera rostochiensis and the Rx1 gene for extreme resistance to Potato virus X (PVX), or with resistance to potato wart (Synchytrium endobioticum). Marker-assisted selection (MAS) using four PCR-based diagnostic assays was applied to 110 F1 hybrids resulting from four 2x by 4x cross-combinations. Thirty tetraploid plants having the appropriate marker combinations were selected and tested for presence of the corresponding resistance traits. All plants tested showed the expected resistant phenotype. Unexpectedly, the plants segregated for additional resistance to pathotypes 1, 2 and 6 of S. endobioticum, which was subsequently shown to be inherited from the PVY resistant parents of the crosses. The selected plants can be used as sources of multiple resistance traits in pedigree breeding and are available from a potato germplasm bank.

  18. Genes for resistance to zucchini yellow mosaic in tropical pumpkin.

    PubMed

    Pachner, Martin; Paris, Harry S; Lelley, Tamas

    2011-01-01

    Four cultigens of Cucurbita moschata resistant to zucchini yellow mosaic virus were crossed with the susceptible 'Waltham Butternut' and with each other in order to clarify the mode of inheritance of resistance and relationships among the genes involved. Five loci were segregating, with genes for resistance Zym-0 and Zym-4 carried by 'Nigerian Local' and one of them also carried by 'Nicklow's Delight,' Zym-1 carried by 'Menina,' and zym-6 carried by 'Soler.' A recessive gene carried by 'Waltham Butternut,' zym-5, is complementary with the dominant Zym-4 of 'Nigerian Local,' that is, the resistance conferred by Zym-4 is only expressed in zym-5/zym-5 individuals. Gene zym-6 appears to be linked to either Zym-0 or Zym-4, and it is also possible that Zym-1 is linked to one of them as well.

  19. The anthracycline resistance-associated (ara) gene, a novel gene associated with multidrug resistance in a human leukaemia cell line.

    PubMed Central

    Longhurst, T. J.; O'Neill, G. M.; Harvie, R. M.; Davey, R. A.

    1996-01-01

    Multidrug resistance (MDR) in cancer cells is a major contributor to the failure of chemotherapy treatment. This paper describes a novel protein named the anthracycline resistance associated (ARA) protein. The ara gene is amplified in the MDR leukaemia line CCRF-CEM/E1000 and its mRNA is overexpressed. ARA belongs to the ATP binding cassette (ABC) family of proteins. Another ABC protein, the multidrug resistance-associated protein (MRP), has previously been reported to be overexpressed in the CEM/E1000 subline. The primary amino acid sequence of ARA indicates that it is 49.5 kDa without glycosylation, and that it has one potential glycosylation site. ARA has one ATP binding site and associated transmembrane regions. This is in contrast to MRP (190 kDa, 172 kDa deglycosylated) and most other higher eukaryote ABC proteins, which consist of two similar halves, each having one ATP binding site. In addition to ARA being coexpressed with MRP, comparison of amino acid sequences showed that, among known proteins, ARA is most similar to the C-terminal half of MRP. Images Figure 1 Figure 2 PMID:8912525

  20. Novel metal resistance genes from microorganisms: a functional metagenomic approach.

    PubMed

    González-Pastor, José E; Mirete, Salvador

    2010-01-01

    Most of the known metal resistance mechanisms are based on studies of cultured microorganisms, and the abundant uncultured fraction could be an important source of genes responsible for uncharacterized resistance mechanisms. A functional metagenomic approach was selected to recover metal resistance genes from the rhizosphere microbial community of an acid-mine drainage (AMD)-adapted plant, Erica andevalensis, from Rio Tinto, Spain. A total of 13 nickel resistant clones were isolated and analyzed, encoding hypothetical or conserved hypothetical proteins of uncertain functions, or well-characterized proteins, but not previously reported to be related to nickel resistance. The resistance clones were classified into two groups according to their nickel accumulation properties: those preventing or those favoring metal accumulation. Two clones encoding putative ABC transporter components and a serine O-acetyltransferase were found as representatives of each group, respectively.

  1. The antimicrobial resistance crisis: management through gene monitoring

    PubMed Central

    2016-01-01

    Antimicrobial resistance (AMR) is an acknowledged crisis for humanity. Its genetic origins and dire potential outcomes are increasingly well understood. However, diagnostic techniques for monitoring the crisis are currently largely limited to enumerating the increasing incidence of resistant pathogens. Being the end-stage of the evolutionary process that produces antimicrobial resistant pathogens, these measurements, while diagnostic, are not prognostic, and so are not optimal in managing this crisis. A better test is required. Here, using insights from an understanding of evolutionary processes ruling the changing abundance of genes under selective pressure, we suggest a predictive framework for the AMR crisis. We then discuss the likely progression of resistance for both existing and prospective antimicrobial therapies. Finally, we suggest that by the environmental monitoring of resistance gene frequency, resistance may be detected and tracked presumptively, and how this tool may be used to guide decision-making in the local and global use of antimicrobials. PMID:27831476

  2. Multidrug resistance in fungi: regulation of transporter-encoding gene expression

    PubMed Central

    Paul, Sanjoy; Moye-Rowley, W. Scott

    2014-01-01

    A critical risk to the continued success of antifungal chemotherapy is the acquisition of resistance; a risk exacerbated by the few classes of effective antifungal drugs. Predictably, as the use of these drugs increases in the clinic, more resistant organisms can be isolated from patients. A particularly problematic form of drug resistance that routinely emerges in the major fungal pathogens is known as multidrug resistance. Multidrug resistance refers to the simultaneous acquisition of tolerance to a range of drugs via a limited or even single genetic change. This review will focus on recent progress in understanding pathways of multidrug resistance in fungi including those of most medical relevance. Analyses of multidrug resistance in Saccharomyces cerevisiae have provided the most detailed outline of multidrug resistance in a eukaryotic microorganism. Multidrug resistant isolates of S. cerevisiae typically result from changes in the activity of a pair of related transcription factors that in turn elicit overproduction of several target genes. Chief among these is the ATP-binding cassette (ABC)-encoding gene PDR5. Interestingly, in the medically important Candida species, very similar pathways are involved in acquisition of multidrug resistance. In both C. albicans and C. glabrata, changes in the activity of transcriptional activator proteins elicits overproduction of a protein closely related to S. cerevisiae Pdr5 called Cdr1. The major filamentous fungal pathogen, Aspergillus fumigatus, was previously thought to acquire resistance to azole compounds (the principal antifungal drug class) via alterations in the azole drug target-encoding gene cyp51A. More recent data indicate that pathways in addition to changes in the cyp51A gene are important determinants in A. fumigatus azole resistance. We will discuss findings that suggest azole resistance in A. fumigatus and Candida species may share more mechanistic similarities than previously thought. PMID:24795641

  3. Apple contains receptor-like genes homologous to the Cladosporium fulvum resistance gene family of tomato with a cluster of genes cosegregating with Vf apple scab resistance.

    PubMed

    Vinatzer, B A; Patocchi, A; Gianfranceschi, L; Tartarini, S; Zhang, H B; Gessler, C; Sansavini, S

    2001-04-01

    Scab caused by the fungal pathogen Venturia inaequalis is the most common disease of cultivated apple (Malus x domestica Borkh.). Monogenic resistance against scab is found in some small-fruited wild Malus species and has been used in apple breeding for scab resistance. Vf resistance of Malus floribunda 821 is the most widely used scab resistance source. Because breeding a high-quality cultivar in perennial fruit trees takes dozens of years, cloning disease resistance genes and using them in the transformation of high-quality apple varieties would be advantageous. We report the identification of a cluster of receptor-like genes with homology to the Cladosporium fulvum (Cf) resistance gene family of tomato on bacterial artificial chromosome clones derived from the Vf scab resistance locus. Three members of the cluster were sequenced completely. Similar to the Cf gene family of tomato, the deduced amino acid sequences coded by these genes contain an extracellular leucine-rich repeat domain and a transmembrane domain. The transcription of three members of the cluster was determined by reverse transcriptionpolymerase chain reaction to be constitutive, and the transcription and translation start of one member was verified by 5' rapid amplification of cDNA ends. We discuss the parallels between Cf resistance of tomato and Vf resistance of apple and the possibility that one of the members of the gene cluster is the Vf gene. Cf homologs from other regions of the apple genome also were identified and are likely to present other scab resistance genes.

  4. Identification of candidate genes in rice for resistance to sheath blight disease by whole genome sequencing.

    PubMed

    Silva, James; Scheffler, Brian; Sanabria, Yamid; De Guzman, Christian; Galam, Dominique; Farmer, Andrew; Woodward, Jimmy; May, Gregory; Oard, James

    2012-01-01

    Recent advances in whole genome sequencing (WGS) have allowed identification of genes for disease susceptibility in humans. The objective of our research was to exploit whole genome sequences of 13 rice (Oryza sativa L.) inbred lines to identify non-synonymous SNPs (nsSNPs) and candidate genes for resistance to sheath blight, a disease of worldwide significance. WGS by the Illumina GA IIx platform produced an average 5× coverage with ~700 K variants detected per line when compared to the Nipponbare reference genome. Two filtering strategies were developed to identify nsSNPs between two groups of known resistant and susceptible lines. A total of 333 nsSNPs detected in the resistant lines were absent in the susceptible group. Selected variants associated with resistance were found in 11 of 12 chromosomes. More than 200 genes with selected nsSNPs were assigned to 42 categories based on gene family/gene ontology. Several candidate genes belonged to families reported in previous studies, and three new regions with novel candidates were also identified. A subset of 24 nsSNPs detected in 23 genes was selected for further study. Individual alleles of the 24 nsSNPs were evaluated by PCR whose presence or absence corresponded to known resistant or susceptible phenotypes of nine additional lines. Sanger sequencing confirmed presence of 12 selected nsSNPs in two lines. "Resistant" nsSNP alleles were detected in two accessions of O. nivara that suggests sources for resistance occur in additional Oryza sp. Results from this study provide a foundation for future basic research and marker-assisted breeding of rice for sheath blight resistance.

  5. Emergence of macrolide resistance gene mph(B) in Streptococcus uberis and cooperative effects with rdmC-like gene.

    PubMed

    Achard, Adeline; Guérin-Faublée, Véronique; Pichereau, Vianney; Villers, Corinne; Leclercq, Roland

    2008-08-01

    Streptococcus uberis UCN60 was resistant to spiramycin (MIC = 8 microg/ml) but susceptible to erythromycin (MIC = 0.06 microg/ml), azithromycin (MIC = 0.12 microg/ml), josamycin (MIC = 0.25 microg/ml), and tylosin (MIC = 0.5 microg/ml). A 2.5-kb HindIII fragment was cloned from S. uberis UCN60 DNA on plasmid pUC18 and introduced into Escherichia coli AG100A, where it conferred resistance to spiramycin by inactivation. The sequence analysis of the fragment showed the presence of an rdmC-like gene that putatively encoded a protein belonging to the alpha/beta hydrolase family and of the first 196 nucleotides of the mph(B) gene putatively encoding a phosphotransferase known to inactivate 14-, 15-, and 16-membered macrolides in E. coli. The entire mph(B) gene was then identified in S. uberis UCN60. The two genes were expressed alone or in combination in E. coli, Staphylococcus aureus, and Enterococcus faecalis. Analysis of MICs revealed that rdmC-like alone did not confer resistance to erythromycin, tylosin, and josamycin in those three hosts. It conferred resistance to spiramycin in E. coli and E. faecalis but not in S. aureus. mph(B) conferred resistance in E. coli to erythromycin, tylosin, josamycin, and spiramycin but only low levels of resistance in E. faecalis and S. aureus to spiramycin (MIC = 8 microg/ml). The combination of mph(B) and rdmC-like genes resulted in a resistance to spiramycin and tylosin in the three hosts that significantly exceeded the mere addition of the resistance levels conferred by each resistance mechanism alone.

  6. Transferring Sclerotinia Resistance Genes from Wild Helianthus into Cultivated Sunflower

    Technology Transfer Automated Retrieval System (TEKTRAN)

    To enhance resistance to Sclerotinia head and stalk rot in cultivated sunflower, mining and introgression of Sclerotinia resistance genes from diverse wild Helianthus accessions into cultivated sunflower has been conducted using backcrossing method since 2004. During the last four years, numerous in...

  7. Phenotypic characterization of potato late blight resistance mediated by the broad-spectrum resistance gene RB.

    PubMed

    Chen, Yu; Halterman, Dennis A

    2011-02-01

    The potato gene RB, cloned from the wild potato species Solanum bulbocastanum, confers partial resistance to late blight, caused by the oomycete pathogen Phytophthora infestans. In order to better characterize this partial resistance phenotype, we have compared host resistance responses mediated by RB with those mediated by the S. demissum-derived R gene R9, which confers immunity to P. infestans carrying the corresponding avirulence gene avrR9. We found that both RB and R9 genes were capable of eliciting a hypersensitive cell death response (HR). However, in RB plants, the pathogen escaped HR lesions and continued to grow beyond the inoculation sites. We also found that callose deposition was negatively correlated with resistance levels in tested plants. Transcription patterns of pathogenesis-related (PR) genes PR-1 basic, PR-2 acidic, and PR-5 indicated that P. infestans inoculation induced transcription of these defense-related genes regardless of the host genotype; however, transcription was reduced in both the susceptible and partially resistant plants later in the infection process but remained elevated in the immune host. Most interestingly, transcription of the HR-associated gene Hin1 was suppressed in both Katahdin and RB-transgenic Katahdin but not in R9 4 days after inoculation. Together, this suggests that suppression of certain defense-related genes may allow P. infestans to spread beyond the site of infection in the partially resistant host despite elicitation of hypersensitive cell death.

  8. De Novo Transcriptome Sequencing of Oryza officinalis Wall ex Watt to Identify Disease-Resistance Genes.

    PubMed

    He, Bin; Gu, Yinghong; Tao, Xiang; Cheng, Xiaojie; Wei, Changhe; Fu, Jian; Cheng, Zaiquan; Zhang, Yizheng

    2015-12-10

    Oryza officinalis Wall ex Watt is one of the most important wild relatives of cultivated rice and exhibits high resistance to many diseases. It has been used as a source of genes for introgression into cultivated rice. However, there are limited genomic resources and little genetic information publicly reported for this species. To better understand the pathways and factors involved in disease resistance and accelerating the process of rice breeding, we carried out a de novo transcriptome sequencing of O. officinalis. In this research, 137,229 contigs were obtained ranging from 200 to 19,214 bp with an N50 of 2331 bp through de novo assembly of leaves, stems and roots in O. officinalis using an Illumina HiSeq 2000 platform. Based on sequence similarity searches against a non-redundant protein database, a total of 88,249 contigs were annotated with gene descriptions and 75,589 transcripts were further assigned to GO terms. Candidate genes for plant-pathogen interaction and plant hormones regulation pathways involved in disease-resistance were identified. Further analyses of gene expression profiles showed that the majority of genes related to disease resistance were all expressed in the three tissues. In addition, there are two kinds of rice bacterial blight-resistant genes in O. officinalis, including two Xa1 genes and three Xa26 genes. All 2 Xa1 genes showed the highest expression level in stem, whereas one of Xa26 was expressed dominantly in leaf and other 2 Xa26 genes displayed low expression level in all three tissues. This transcriptomic database provides an opportunity for identifying the genes involved in disease-resistance and will provide a basis for studying functional genomics of O. officinalis and genetic improvement of cultivated rice in the future.

  9. Confirming QTLs and finding additional Loci responsible for resistance to Sheath Blight in Rice

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Rice sheath blight (ShB) caused by the soil borne pathogen Rhizoctonia solani, is one of the most destructive diseases of rice around the globe, causing severe losses in rice yield and quality annually. Major genes governing resistance to ShB have not been found in cultivated rice worldwide; however...

  10. Horizontal gene transfer in the human gastrointestinal tract: potential spread of antibiotic resistance genes

    PubMed Central

    Huddleston, Jennifer R

    2014-01-01

    Bacterial infections are becoming increasingly difficult to treat due to widespread antibiotic resistance among pathogens. This review aims to give an overview of the major horizontal transfer mechanisms and their evolution and then demonstrate the human lower gastrointestinal tract as an environment in which horizontal gene transfer of resistance determinants occurs. Finally, implications for antibiotic usage and the development of resistant infections and persistence of antibiotic resistance genes in populations as a result of horizontal gene transfer in the large intestine will be discussed. PMID:25018641

  11. Genetic mapping of the powdery mildew resistance gene in soybean PI 567301B.

    PubMed

    Jun, Tae-Hwan; Mian, M A Rouf; Kang, Sung-Taeg; Michel, Andrew P

    2012-10-01

    Powdery mildew (PMD) of soybean [Glycine max (L.) Merr.] is caused by the fungus Microsphaera diffusa. Severe infection of PMD on susceptible varieties often causes premature defoliation and chlorosis of the leaves, which can result in considerable yield losses under favorable environmental conditions for disease development in the field. A total of 334 F(7)-derived recombinant inbred lines (RILs) from a cross of a PMD susceptible soybean cultivar Wyandot and PMD-resistant PI 567301B were used for genetic mapping of PMD resistance in PI 567301B and for development of molecular markers tightly linked to the gene. The result of the PMD screening for each line in the field was in agreement with that in the greenhouse test. The genetic map containing the PMD resistance gene was constructed in a 3.3 cM interval flanked by two simple sequence repeat (SSR) markers on chromosome 16. The PMD resistance gene was mapped at the same location with SSR marker BARCSOYSSR_16_1291, indicating that there was no recombination between the 334 RILs and this marker. In addition, a single nucleotide polymorphism (SNP) marker developed by high-resolution melting curve analysis and a cleaved amplified polymorphic sequence (CAPS) marker with Rsa1 recognition site were used for the genetic mapping. These two markers were also mapped to the same genomic location with the PMD resistance gene. We validated three tightly linked markers to the PMD resistance gene using 38 BC(6)F(2) lines and corresponding BC(6)F(2:3) families. The three marker genotypes of the backcross lines predicted the observed PMD phenotypes of the lines with complete accuracy. We have mapped a putatively novel single dominant PMD resistance gene in PI 567301B and developed three new molecular markers closely linked to the gene. Molecular markers developed from this study may be used for high-throughput marker-assisted breeding for PMD resistance with the gene from PI 567301B.

  12. Scab resistance in 'Geneva' apple is conditioned by a resistance gene cluster with complex genetic control.

    PubMed

    Bastiaanse, Héloïse; Bassett, Heather C M; Kirk, Christopher; Gardiner, Susan E; Deng, Cecilia; Groenworld, Remmelt; Chagné, David; Bus, Vincent G M

    2016-02-01

    Apple scab, caused by the fungal pathogen Venturia inaequalis, is one of the most severe diseases of apple worldwide. It is the most studied plant-pathogen interaction involving a woody species using modern genetic, genomic, proteomic and bioinformatic approaches in both species. Although 'Geneva' apple was recognized long ago as a potential source of resistance to scab, this resistance has not been characterized previously. Differential interactions between various monoconidial isolates of V. inaequalis and six segregating F1 and F2 populations indicate the presence of at least five loci governing the resistance in 'Geneva'. The 17 chromosomes of apple were screened using genotyping-by-sequencing, as well as single marker mapping, to position loci controlling the V. inaequalis resistance on linkage group 4. Next, we fine mapped a 5-cM region containing five loci conferring both dominant and recessive scab resistance to the distal end of the linkage group. This region corresponds to 2.2 Mbp (from 20.3 to 22.5 Mbp) on the physical map of 'Golden Delicious' containing nine candidate nucleotide-binding site leucine-rich repeat (NBS-LRR) resistance genes. This study increases our understanding of the complex genetic basis of apple scab resistance conferred by 'Geneva', as well as the gene-for-gene (GfG) relationships between the effector genes in the pathogen and resistance genes in the host.

  13. The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence.

    PubMed

    Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael

    2016-12-22

    The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat.

  14. Molecular characterizations of oxytetracycline resistant bacteria and their resistance genes from mariculture waters of China.

    PubMed

    Dang, Hongyue; Zhang, Xiaoxia; Song, Linsheng; Chang, Yaqing; Yang, Guanpin

    2006-11-01

    Oxytetracycline-resistant bacteria were isolated from a mariculture farm in China, and accounted for 32.23% and 5.63% of the total culturable microbes of the sea cucumber and the sea urchin rearing waters respectively. Marine vibrios, especially strains related to Vibrio splendidus or V. tasmaniensis, were the most abundant resistant isolates. For oxytetracycline resistance, tet(A), tet(B) and tet(D) genes were detected in both sea cucumber and sea urchin rearing ponds. The dominant resistance type for V. tasmaniensis-like strains was the combination of both tet(A) and tet(B) genes, while the major resistance type for V. splendidus-like strains was a single tet(D) gene. Most of the sea cucumber tet-positive isolates harbored a chloramphenicol-resistance gene, either cat IV or cat II, while only a few sea urchin tet-positive isolates harbored a cat gene, actually cat IV. The coexistence of tet and cat genes in the strains isolated from the mariculture farm studied was helpful in explaining some of the multi-resistance mechanisms.

  15. Identification of major blast resistance genes in the southern US

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Resistance (R) genes in rice play important roles in preventing infections of rice blast fungus, Magnaporthe oryzae. In order to identify more R genes for different rice growing areas in the Southern US, an extensive field survey of the blast fungus was performed from 2012 to 2013. A total of 500 is...

  16. A Nomadic Subtelomeric Disease Resistance Gene Cluster in Common Bean

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The B4 resistance (R)-gene cluster, located in subtelomeric region of chromosome 4, is one of the largest clusters known in common bean (Phaseolus vulgaris, Pv). We sequenced 650 kb spanning this locus and annotated 97 genes, 26 of which correspond to Coiled-coil-Nucleotide-Binding-Site-Leucine-Rich...

  17. Distribution of the multidrug resistance gene cfr in Staphylococcus species isolates from swine farms in China.

    PubMed

    Wang, Yang; Zhang, Wanjiang; Wang, Juan; Wu, Congming; Shen, Zhangqi; Fu, Xiao; Yan, Yang; Zhang, Qijing; Schwarz, Stefan; Shen, Jianzhong

    2012-03-01

    A total of 149 porcine Staphylococcus isolates with florfenicol MICs of ≥ 16 μg/ml were screened for the presence of the multiresistance gene cfr, its location on plasmids, and its genetic environment. In total, 125 isolates carried either cfr (16 isolates), fexA (92 isolates), or both genes (17 isolates). The 33 cfr-carrying staphylococci, which included isolates of the species Staphylococcus cohnii, S. arlettae, and S. saprophyticus in which the cfr gene has not been described before, exhibited a wide variety of SmaI pulsed-field gel electrophoresis patterns. In 18 cases, the cfr gene was located on plasmids. Four different types of cfr-carrying plasmids--pSS-01 (n = 2; 40 kb), pSS-02 (n = 3; 35.4 kb), pSS-03 (n = 10; 7.1 kb), and pBS-01 (n = 3; 16.4 kb)--were differentiated on the basis of their sizes, restriction patterns, and additional resistance genes. Sequence analysis revealed that in plasmid pSS-01, the cfr gene was flanked in the upstream part by a complete aacA-aphD-carrying Tn4001-like transposon and in the downstream part by a complete fexA-carrying transposon Tn558. In plasmid pSS-02, an insertion sequence IS21-558 and the cfr gene were integrated into transposon Tn558 and thereby truncated the tnpA and tnpB genes. The smallest cfr-carrying plasmid pSS-03 carried the macrolide-lincosamide-streptogramin B resistance gene erm(C). Plasmid pBS-01, previously described in Bacillus spp., harbored a Tn917-like transposon, including the macrolide-lincosamide-streptogramin B resistance gene erm(B) in the cfr downstream region. Plasmids, which in part carry additional resistance genes, seem to play an important role in the dissemination of the gene cfr among porcine staphylococci.

  18. Evaluation of efflux pumps gene expression in resistant Pseudomonas aeruginosa isolates in an Iranian referral hospital

    PubMed Central

    Pourakbari, Babak; Yaslianifard, Sahar; Yaslianifard, Somaye; Mahmoudi, Shima; Keshavarz-Valian, Sepideh; Mamishi, Setareh

    2016-01-01

    Background and Objectives: Pseudomonas aeruginosa (PA) is one of the most important causes of nosocomial infections and has an intrinsic resistance to many antibiotics. Among all the resistance-nodulation-division (RND) pumps of P. aeruginosa, MexAB-OprM is the first efflux pump found to target multiple classes of antibiotics. This study was aimed to evaluate the expression level of genes expressing MexAB-OprM in clinical isolates of P. aeruginosa. Materials and Methods: In this study, 45 P. aeruginosa strains were isolated from patients admitted to Children’s Medical Center Hospital, an Iranian referral hospital. Disk diffusion and Minimum Inhibitory Concentration (MIC) methods were used for determination of the patterns of resistance to antibiotics. Real-time PCR was used to investigate the expression level of genes of MexAB-OprM efflux pump. Results: Among 45 resistant PA isolates, the frequency of genes overexpression was as follows: MexA (n=25, 55.5%), MexB (n=24, 53.3%) and OprM (n=16, 35.5%). In addition, in 28 strains (62%) overexpression was observed in one of the studied three genes of MexAB-OprM efflux pump. Conclusion: In our study 28 isolates (62%) had increased expression level of efflux pumps genes, MexAB-OprM. Although the efflux pumps play important roles in increasing the resistance towards different antibiotics but the role of other agents and mechanisms in evolution of resistance should not be ignored. Since the concomitant overproduction of other Mex efflux systems might have additive effects on antibiotic resistance, the co-expressing of a multicomponent efflux pump is recommended. On the other hand, the concomitant overproduction of two Mex pumps might have additive effects on resistance to antibiotic. Therefore co-expressing of Mex efflux systems is recommended. PMID:28210464

  19. Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance.

    PubMed

    Huang, Laurence; Crothers, Kristina; Atzori, Chiara; Benfield, Thomas; Miller, Robert; Rabodonirina, Meja; Helweg-Larsen, Jannik

    2004-10-01

    Pneumocystis pneumonia (PCP) remains a major cause of illness and death in HIV-infected persons. Sulfa drugs, trimethoprim-sulfamethoxazole (TMP-SMX) and dapsone are mainstays of PCP treatment and prophylaxis. While prophylaxis has reduced the incidence of PCP, its use has raised concerns about development of resistant organisms. The inability to culture human Pneumocystis, Pneumocystis jirovecii, in a standardized culture system prevents routine susceptibility testing and detection of drug resistance. In other microorganisms, sulfa drug resistance has resulted from specific point mutations in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim for PCP treatment remains unclear. We review studies of DHPS mutations in P. jirovecii and summarize the evidence for resistance to sulfamethoxazole and dapsone.

  20. Deinococcus geothermalis: The Pool of Extreme Radiation Resistance Genes Shrinks

    SciTech Connect

    Makarova, Kira S.; Omelchenko, Marina V.; Gaidamakova, Elena K.; Matrosova, Vera Y.; Vasilenko, Alexander; Zhai, Min; Lapidus, Alla; Copeland, Alex; Kim, Edwin; Land, Miriam; Mavrommatis, Konstantinos; Pitluck, Samuel; Richardson, Paul M.; Detter, Chris; Brettin, Thomas; Saunders, Elizabeth; Lai, Barry; Ravel, Bruce; Kemner, Kenneth M.; Wolf, Yuri I.; Sorokin, Alexander; Gerasimova, Anna V.; Gelfand, Mikhail S.; Fredrickson, James K.; Koonin, Eugene V.; Daly, Michael J.

    2007-07-24

    Bacteria of the genus Deinococcus are extremely resistant to ionizing radiation (IR), ultraviolet light (UV) and desiccation. The mesophile Deinococcus radiodurans was the first member of this group whose genome was completely sequenced. Analysis of the genome sequence of D. radiodurans, however, failed to identify unique DNA repair systems. To further delineate the genes underlying the resistance phenotypes, we report the whole-genome sequence of a second Deinococcus species, the thermophile Deinococcus geothermalis, which at itsoptimal growth temperature is as resistant to IR, UV and desiccation as D. radiodurans, and a comparative analysis of the two Deinococcus genomes. Many D. radiodurans genes previously implicated in resistance, but for which no sensitive phenotype was observed upon disruption, are absent in D. geothermalis. In contrast, most D. radiodurans genes whose mutants displayed a radiation-sensitive phenotype in D. radiodurans are conserved in D. geothermalis. Supporting the existence of a Deinococcus radiation response regulon, a common palindromic DNA motif was identified in a conserved set of genes associated with resistance, and a dedicated transcriptional regulator was predicted. We present the case that these two species evolved essentially the same diverse set of gene families, and that the extreme stress-resistance phenotypes of the Deinococcus lineage emerged progressively by amassing cell-cleaning systems from different sources, but not by acquisition of novel DNA repair systems. Our reconstruction of the genomic evolution of the Deinococcus-Thermus phylum indicates that the corresponding set of enzymes proliferated mainly in the common ancestor of Deinococcus. Results of the comparative analysis weaken the arguments for a role of higher-order chromosome alignment structures in resistance; more clearly define and substantially revise downward the number of uncharacterized genes that might participate in DNA repair and contribute to

  1. Deinococcus geothermalis: The Pool of Extreme Radiation Resistance Genes Shrinks

    SciTech Connect

    Makarova, Kira S.; Omelchenko, Marina; Gaidamakova, Elena; Matrosova, Vera; Vasilenko, Alexander; Zhai, Min; Lapidus, Alla L.; Copeland, A; Kim, Edwin; Land, Miriam L; Mavromatis, K; Pitluck, Samual; Richardson, P M; Detter, J. Chris; Brettin, Tom; Saunders, Elizabeth H; Lai, Barry; Ravel, Bruce; Kemner, Kenneth M; Wolf, Yuri; Sorokin, Alexei; Gerasimova, Anna; Gelfand, Mikhail; Fredrickson, James K; Koonin, Eugene; Daly, Michael

    2007-01-01

    Bacteria of the genus Deinococcus are extremely resistant to ionizing radiation (IR), ultraviolet light (UV) and desiccation. The mesophile Deinococcus radiodurans was the first member of this group whose genome was completely sequenced. Analysis of the genome sequence of D. radiodurans, however, failed to identify unique DNA repair systems. To further delineate the genes underlying the resistance phenotypes, we report the whole-genome sequence of a second Deinococcus species, the thermophile Deinococcus geothermalis, which at its optimal growth temperature is as resistant to IR, UV and desiccation as D. radiodurans, and a comparative analysis of the two Deinococcus genomes. Many D. radiodurans genes previously implicated in resistance, but for which no sensitive phenotype was observed upon disruption, are absent in D. geothermalis. In contrast, most D. radiodurans genes whose mutants displayed a radiation-sensitive phenotype in D. radiodurans are conserved in D. geothermalis. Supporting the existence of a Deinococcus radiation response regulon, a common palindromic DNA motif was identified in a conserved set of genes associated with resistance, and a dedicated transcriptional regulator was predicted. We present the case that these two species evolved essentially the same diverse set of gene families, and that the extreme stress-resistance phenotypes of the Deinococcus lineage emerged progressively by amassing cell-cleaning systems from different sources, but not by acquisition of novel DNA repair systems. Our reconstruction of the genomic evolution of the Deinococcus-Thermus phylum indicates that the corresponding set of enzymes proliferated mainly in the common ancestor of Deinococcus. Results of the comparative analysis weaken the arguments for a role of higher-order chromosome alignment structures in resistance; more clearly define and substantially revise downward the number of uncharacterized genes that might participate in DNA repair and contribute to

  2. Congruence of additive and non-additive effects on gene expression estimated from pedigree and SNP data.

    PubMed

    Powell, Joseph E; Henders, Anjali K; McRae, Allan F; Kim, Jinhee; Hemani, Gibran; Martin, Nicholas G; Dermitzakis, Emmanouil T; Gibson, Greg; Montgomery, Grant W; Visscher, Peter M

    2013-05-01

    There is increasing evidence that heritable variation in gene expression underlies genetic variation in susceptibility to disease. Therefore, a comprehensive understanding of the similarity between relatives for transcript variation is warranted--in particular, dissection of phenotypic variation into additive and non-additive genetic factors and shared environmental effects. We conducted a gene expression study in blood samples of 862 individuals from 312 nuclear families containing MZ or DZ twin pairs using both pedigree and genotype information. From a pedigree analysis we show that the vast majority of genetic variation across 17,994 probes is additive, although non-additive genetic variation is identified for 960 transcripts. For 180 of the 960 transcripts with non-additive genetic variation, we identify expression quantitative trait loci (eQTL) with dominance effects in a sample of 339 unrelated individuals and replicate 31% of these associations in an independent sample of 139 unrelated individuals. Over-dominance was detected and replicated for a trans association between rs12313805 and ETV6, located 4MB apart on chromosome 12. Surprisingly, only 17 probes exhibit significant levels of common environmental effects, suggesting that environmental and lifestyle factors common to a family do not affect expression variation for most transcripts, at least those measured in blood. Consistent with the genetic architecture of common diseases, gene expression is predominantly additive, but a minority of transcripts display non-additive effects.

  3. Effect of Chromium Addition to the Low Temperature Hot Corrosion Resistance of Platinum Modified Aluminide Coatings.

    DTIC Science & Technology

    1985-12-01

    Diffusion aluminide coatings were the first coatings developed for hot corrosion resistance. Aluminum is applied to the surface of the superalloy by a...D.H., "Mechanisms of Formation of Diffusion Aluminide Coatings on Nickel-oase Superalloys , Oxidation of Metals, v. 3, pp. 475-477, 1971. 17. Lehnert...Classification) E.FFECT OF CHROMIUJM ADDITION TO THE LOW TEMPERATURE HOT CORROSION RESISTANCE OF PLATINUM MODIFIED ALUMINIDE COATINGS 2 PERSONAL AUTHOR(S) Dust

  4. The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence.

    PubMed

    Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael

    2016-09-29

    The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in seedlings under standard growth conditions. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or upregulation of senescence gene markers was apparent in these seedlings suggesting senescence is not required for Lr34 resistance. Several abiotic stress response genes were upregulated in these seedling in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Photoperiod and light intensity had significant effects on Lr34 phenotypes. These data demonstrate that expression of a highly durable, broad spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. This article is protected by copyright. All rights reserved.

  5. Molecular markers linked to the apple scab resistance gene Vbj derived from Malus baccata jackii.

    PubMed

    Gygax, M; Gianfranceschi, L; Liebhard, R; Kellerhals, M; Gessler, C; Patocchi, A

    2004-11-01

    Breeding for scab-resistant apple cultivars by pyramiding several resistance genes in the same genetic background is a promising way to control apple scab caused by the fungus Venturia inaequalis. To achieve this goal, DNA markers linked to the genes of interest are required in order to select seedlings with the desired resistance allele combinations. For several apple scab resistance genes, molecular markers are already available; but until now, none existed for the apple scab resistance gene Vbj originating from the crab apple Malus baccata jackii. Using bulk segregant analysis, three RAPD markers linked to Vbj were first identified. These markers were transformed into more reliable sequence-characterised amplified region (SCAR) markers that proved to be co-dominant. In addition, three SSR markers and one SCAR were identified by comparing homologous linkage groups of existing genetic maps. Discarding plants showing genotype-phenotype incongruence (GPI plants) plants, a linkage map was calculated. Vbj mapped between the markers CH05e03 (SSR) and T6-SCAR, at 0.6 cM from CH05e03 and at 3.9 cM from T6-SCAR. Without the removal of the GPI plants, Vbj was placed 15 cM away from the closest markers. Problems and pitfalls due to GPI plants and the consequences for mapping the resistance gene accurately are discussed. Finally, the usefulness of co-dominant markers for pedigree analysis is also demonstrated.

  6. Relationship between antibiotic resistance genes and metals in residential soil samples from Western Australia.

    PubMed

    Knapp, Charles W; Callan, Anna C; Aitken, Beatrice; Shearn, Rylan; Koenders, Annette; Hinwood, Andrea

    2017-01-01

    Increasing drug-resistant infections have drawn research interest towards examining environmental bacteria and the discovery that many factors, including elevated metal conditions, contribute to proliferation of antibiotic resistance (AR). This study examined 90 garden soils from Western Australia to evaluate predictions of antibiotic resistance genes from total metal conditions by comparing the concentrations of 12 metals and 13 genes related to tetracycline, beta-lactam and sulphonamide resistance. Relationships existed between metals and genes, but trends varied. All metals, except Se and Co, were related to at least one AR gene in terms of absolute gene numbers, but only Al, Mn and Pb were associated with a higher percentage of soil bacteria exhibiting resistance, which is a possible indicator of population selection. Correlations improved when multiple factors were considered simultaneously in a multiple linear regression model, suggesting the possibility of additive effects occurring. Soil-metal concentrations must be considered when determining risks of AR in the environment and the proliferation of resistance.

  7. Genetic analysis of resistance gene analogues from a sugarcane cultivar resistant to red rot disease

    Technology Transfer Automated Retrieval System (TEKTRAN)

    One of the important approaches for disease control in sugarcane is to develop a disease resistant variety; this may be accomplished through identification of resistance genes in sugarcane. In this study, PCR primers targeting the conserved motifs of the nucleotide-binding site (NBS) class and kinas...

  8. Antibiotic Resistance Genes in Freshwater Biofilms May Reflect Influences from High-Intensity Agriculture.

    PubMed

    Winkworth-Lawrence, Cynthia; Lange, Katharina

    2016-11-01

    Antibiotic resistance is a major public health concern with growing evidence of environmental gene reservoirs, especially in freshwater. However, the presence of antibiotic resistance genes in freshwater, in addition to the wide spectrum of land use contaminants like nitrogen and phosphate, that waterways are subjected to is inconclusive. Using molecular analyses, freshwater benthic rock biofilms were screened for genes conferring resistance to antibiotics used in both humans and farmed animals (aacA-aphD to aminoglycosides; mecA to ß-lactams; ermA and ermB to macrolides; tetA, tetB, tetK, and tetM to tetracyclines; vanA and vanB to glycopeptides). We detected widespread low levels of antibiotic resistance genes from 20 waterways across southern New Zealand throughout the year (1.3 % overall detection rate; 480 samples from three rocks per site, 20 sites, eight occasions; July 2010-May 2011). Three of the ten genes, ermB, tetK, and tetM, were detected in 62 of the 4800 individual screens; representatives confirmed using Sanger sequencing. No distinction could be made between human and agricultural land use contamination sources based on gene presence distribution alone. However, land use pressures are suggested by moderate correlations between antibiotic resistance genes and high-intensity farming in winter. The detection of antibiotic resistance genes at several sites not subject to known agricultural pressures suggests human sources of resistance, like waterway contamination resulting from unsatisfactory toilet facilities at recreational sites.

  9. Transfer of tetracycline resistance genes with aggregation substance in food-borne Enterococcus faecalis.

    PubMed

    Choi, Jong-Mi; Woo, Gun-Jo

    2015-04-01

    Enterococcus faecalis has the ability to conjugate with the aid of aggregation substance (AS) and inducible sex pheromones to exchange genetic elements in food matrix. To evaluate the food safety condition and the transferable factor, 250 tetracycline-resistant food-borne E. faecalis were collected in Korea. Among the isolates, a majority of tetracycline-resistant isolates (49.6 %) harbored both the tet(M) and tet(L) genes together, followed by tet(M) (19.6 %), and tet(L) (6.8 %) alone. Also, we found the combination of tet(L)/tet(M)/tet(O) or tet(M)/tet(O). We identified two tet(S) genes including the isolate carrying tet(M) + tet(S) genes. Additionally, most E. faecalis were positive for cpd and ccf (both 96.8 %) followed by cob (57.2 %). Through mating experiments, we confirmed E. faecalis possessing the Int-Tn gene and/or any AS gene successfully transferred tet genes to JH2-2 E. faecalis, whereas neither E. faecalis carrying AS genes nor the Int-Tn gene showed the conjugation. Pulsed-field gel electrophoresis results supported a distinct pattern, implying transfer of genetic information. Our study revealed a high occurrence of tetracycline resistance genes in E. faecalis from various foods. The widespread dissemination of tetracycline resistance genes would be promoted to transfer tetracycline resistance genes by pheromone-mediated conjugation systems.

  10. Mining metagenomic datasets for antibiotic resistance genes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Antibiotics are medicines that are used to kill, slow down, or prevent the growth of susceptible bacteria. They became widely used in the mid 20th century for controlling disease in humans, animals, and plants, and for a variety of industrial purposes. Antibiotic resistance is a broad term. There ...

  11. Corrosion Resistance of Powder Metallurgy Processed TiC/316L Composites with Mo Additions

    NASA Astrophysics Data System (ADS)

    Lin, Shaojiang; Xiong, Weihao

    2015-06-01

    To find out the effects of Mo addition on corrosion resistance of TiC/316L stainless steel composites, TiC/316L composites with addition of different contents of Mo were prepared by powder metallurgy. The corrosion resistance of these composites was evaluated by the immersion tests and polarization curves experiments. Results indicated that Mo addition decreased the corrosion rates of TiC/316L composites in H2SO4 solution in the case of Mo content below 2% whereas it displayed an opposite effect when Mo content was above that value. It was found that with an increase in the Mo content, the pitting corrosion resistance increased monotonically for TiC/316L composites in NaCl solution.

  12. Serotonin transporter gene polymorphisms and treatment-resistant depression.

    PubMed

    Bonvicini, Cristian; Minelli, Alessandra; Scassellati, Catia; Bortolomasi, Marco; Segala, Matilde; Sartori, Riccardo; Giacopuzzi, Mario; Gennarelli, Massimo

    2010-08-16

    Major Depression Disorder (MDD) is a serious mental illness that is one of the most disabling diseases worldwide. In addition, approximately 15% of depression patients are defined treatment-resistant (TRD). Preclinical and genetic studies show that serotonin modulation dysfunction exists in patients with TRD. Some polymorphisms in the promoter region of the serotonin transporter gene (SLC6A4) are likely to be involved in the pathogenesis/treatment of MDD; however, no data are available concerning TRD. Therefore, in order to investigate the possible influence of SLC6A4 polymorphisms on the risk of TRD, we genotyped 310 DSM-IV MDD treatment-resistant patients and 284 healthy volunteers. We analysed the most studied polymorphism 5-HTTLPR (L/S) and a single nucleotide substitution, rs25531 (A/G), in relation to different functional haplotype combinations. However the correct mapping of rs25531 is still debated whether it is within or outside the insertion. Our sequencing analysis showed that rs25531 is immediately outside of the 5-HTTLPR segment. Differences in 5-HTTLPR allele (p=0.04) and in L allele carriers (p<0.05) were observed between the two groups. Concerning the estimated haplotype analyses, L(A)L(A) homozygote haplotype was more represented among the control subjects (p=0.01, OR=0.64 95%CI: 0.45-0.91). In conclusion, this study reports a protective effect of the L(A)L(A) haplotype on TRD, supporting the hypothesis that lower serotonin transporter transcription alleles are correlated to a common resistant depression mechanism.

  13. Gene expression and evolution of antifungal drug resistance.

    PubMed

    Anderson, James B; Sirjusingh, Caroline; Syed, Nazia; Lafayette, Shantelle

    2009-05-01

    Permanent changes in gene expression result from certain forms of antifungal resistance. In this study, we asked whether any changes in gene expression are required for the evolution of a drug-resistant phenotype in populations. We examined the changes in gene expression resulting from the evolution of resistance in experimental populations of the yeast Saccharomyces cerevisiae with two antifungal drugs, fluconazole (FLC) in a previous study and amphotericin B (AmB) in this study, in which five populations were subjected to increasing concentrations of AmB, from 0.25 to 128 microg/ml in twofold increments. Six genes, YGR035C, YOR1, ICT1, GRE2, PDR16, and YPLO88W, were consistently overexpressed with resistance to AmB reported here and with resistance to FLC involving a mechanism of increased efflux reported previously. We then asked if the deletion of these genes impaired the ability of populations to evolve resistance to FLC over 108 generations of asexual reproduction in 32 and 128 microg/ml FLC, the same conditions under which FLC-resistant types evolved originally. For each of three deletion strains, YOR1, ICT1, and PDR16 strains, extinctions occurred in one of two replicate populations growing in 128 microg/ml FLC. Each of these three deletion strains was mixed 1:1 with a marked version of the wild type to measure the relative ability of the deletion strain to adapt over 108 generations. In these assays, only the PDR16 deletion strain consistently became extinct both at 32 and at 128 microg/ml FLC. The deletion of PDR16 reduces the capacity of a population to evolve to resistance to FLC.

  14. Modes and Modulations of Antibiotic Resistance Gene Expression

    PubMed Central

    Depardieu, Florence; Podglajen, Isabelle; Leclercq, Roland; Collatz, Ekkehard; Courvalin, Patrice

    2007-01-01

    Since antibiotic resistance usually affords a gain of function, there is an associated biological cost resulting in a loss of fitness of the bacterial host. Considering that antibiotic resistance is most often only transiently advantageous to bacteria, an efficient and elegant way for them to escape the lethal action of drugs is the alteration of resistance gene expression. It appears that expression of bacterial resistance to antibiotics is frequently regulated, which indicates that modulation of gene expression probably reflects a good compromise between energy saving and adjustment to a rapidly evolving environment. Modulation of gene expression can occur at the transcriptional or translational level following mutations or the movement of mobile genetic elements and may involve induction by the antibiotic. In the latter case, the antibiotic can have a triple activity: as an antibacterial agent, as an inducer of resistance to itself, and as an inducer of the dissemination of resistance determinants. We will review certain mechanisms, all reversible, that bacteria have elaborated to achieve antibiotic resistance by the fine-tuning of the expression of genetic information. PMID:17223624

  15. Improvement of sag resistance by the addition of tungsten in Si-Cr-Mo-V steels

    SciTech Connect

    Nam, W.J.; Lee, C.S.; Ban, D.Y.

    1997-06-01

    The sag resistance of automobile suspension springs is defined, in general, as the resistance to the plastic deformation of springs during repeated loading in service. Since it is one of the most important properties required for high strength spring steels, earlier works on high strength spring steels have concentrated on the improvement of the sag resistance by adding alloying elements or by changing processing treatments. However, the effect of W, a carbide former, on the sag resistance has not been clarified yet. It is, therefore, of interest to investigate the effect of the W addition on the sag resistance. The evaluation of the sag resistance is usually performed by direct static and dynamic tests on prototype springs. However, such a direct method leads to high costs and long testing time. Thus, Furr has proposed the torsional Bauschinger test as one of convenient testing methods, which is related to the Bauschinger effect. He has also shown that the size of hysteresis loops generated in the torsional Bauschinger test has a close relationship with the sag resistance of springs. Ohara, et al. have investigated the correlation between a direct testing on prototype springs and the torsional Bauschinger test, and have shown that a larger loop area in the torsional Bauschinger test represents a higher sag resistance. In view of the foregoing, the purposes of this investigation are to examine the effects of the W addition on (a) the microstructural evolution during tempering and (b) the sag resistance, using the torsional Bauschinger test, for 0.6C-1.5Si-0.5Cr-0.1Mo-0.2V (wt.%) spring steels.

  16. Genomes, diversity and resistance gene analogues in Musa species.

    PubMed

    Azhar, M; Heslop-Harrison, J S

    2008-01-01

    Resistance genes (R genes) in plants are abundant and may represent more than 1% of all the genes. Their diversity is critical to the recognition and response to attack from diverse pathogens. Like many other crops, banana and plantain face attacks from potentially devastating fungal and bacterial diseases, increased by a combination of worldwide spread of pathogens, exploitation of a small number of varieties, new pathogen mutations, and the lack of effective, benign and cheap chemical control. The challenge for plant breeders is to identify and exploit genetic resistances to diseases, which is particularly difficult in banana and plantain where the valuable cultivars are sterile, parthenocarpic and mostly triploid so conventional genetic analysis and breeding is impossible. In this paper, we review the nature of R genes and the key motifs, particularly in the Nucleotide Binding Sites (NBS), Leucine Rich Repeat (LRR) gene class. We present data about identity, nature and evolutionary diversity of the NBS domains of Musa R genes in diploid wild species with the Musa acuminata (A), M. balbisiana (B), M. schizocarpa (S), M. textilis (T), M. velutina and M. ornata genomes, and from various cultivated hybrid and triploid accessions, using PCR primers to isolate the domains from genomic DNA. Of 135 new sequences, 75% of the sequenced clones had uninterrupted open reading frames (ORFs), and phylogenetic UPGMA tree construction showed four clusters, one from Musa ornata, one largely from the B and T genomes, one from A and M. velutina, and the largest with A, B, T and S genomes. Only genes of the coiled-coil (non-TIR) class were found, typical of the grasses and presumably monocotyledons. The analysis of R genes in cultivated banana and plantain, and their wild relatives, has implications for identification and selection of resistance genes within the genus which may be useful for plant selection and breeding and also for defining relationships and genome evolution

  17. Transcriptome Analysis of an Anthracnose-Resistant Tea Plant Cultivar Reveals Genes Associated with Resistance to Colletotrichum camelliae

    PubMed Central

    Wang, Lu; Wang, Yuchun; Cao, Hongli; Hao, Xinyuan; Zeng, Jianming; Yang, Yajun; Wang, Xinchao

    2016-01-01

    Tea plant breeding is a topic of great economic importance. However, disease remains a major cause of yield and quality losses. In this study, an anthracnose-resistant cultivar, ZC108, was developed. An infection assay revealed different responses to Colletotrichum sp. infection between ZC108 and its parent cultivar LJ43. ZC108 had greater resistance than LJ43 to Colletotrichum camelliae. Additionally, ZC108 exhibited earlier sprouting in the spring, as well as different leaf shape and plant architecture. Microarray data revealed that the genes that are differentially expressed between LJ43 and ZC108 mapped to secondary metabolism-related pathways, including phenylpropanoid biosynthesis, phenylalanine metabolism, and flavonoid biosynthesis pathways. In addition, genes involved in plant hormone biosynthesis and signaling as well as plant-pathogen interaction pathways were also changed. Quantitative real-time PCR was used to examine the expression of 27 selected genes in infected and uninfected tea plant leaves. Genes encoding a MADS-box transcription factor, NBS-LRR disease-resistance protein, and phenylpropanoid metabolism pathway components (CAD, CCR, POD, beta-glucosidase, ALDH and PAL) were among those differentially expressed in ZC108. PMID:26849553

  18. SCAR markers linked to the common bean rust resistance gene Ur-13.

    PubMed

    Mienie, C M S; Liebenberg, M M; Pretorius, Z A; Miklas, P N

    2005-09-01

    Rust in common bean (Phaseolus vulgaris L.) is caused by Uromyces appendiculatus Pers.:Pers. (Unger) which exhibits a high level of pathogenic diversity. Resistance to this disease is conditioned by a considerable number of genes. Pyramiding resistance genes is desirable and could be simplified by the use of molecular markers closely linked to the genes. The resistance gene Ur-13, present in the South African large seeded cultivar Kranskop, has been used extensively in the local breeding program. The purpose of this study was the development of a molecular marker linked to Ur-13. An F(2) population derived from a cross between Kranskop and a susceptible (South African) cultivar Bonus was used in combination with bulked segregant analysis utilizing the amplified fragment length polymorphism (AFLP) technique. Seven AFLP fragments linked significantly to the rust resistance and five were successfully converted to sequence characterized amplified region (SCAR) markers. The co-dominant SCAR markers derived from a 405 bp EAACMACC fragment, KB 126, was located 1.6 cM from the gene. Two additional SCAR markers and one cleaved amplified polymorphic sequence marker were located further from the gene. The gene was mapped to linkage group B8 on the BAT 93/Jalo EEP 558 core map (chromosome 3).

  19. Allele Mining Strategies: Principles and Utilisation for Blast Resistance Genes in Rice (Oryza sativa L.).

    PubMed

    Ashkani, Sadegh; Yusop, Mohd Rafii; Shabanimofrad, Mahmoodreza; Azady, Amin; Ghasemzadeh, Ali; Azizi, Parisa; Latif, Mohammad Abdul

    2015-01-01

    Allele mining is a promising way to dissect naturally occurring allelic variants of candidate genes with essential agronomic qualities. With the identification, isolation and characterisation of blast resistance genes in rice, it is now possible to dissect the actual allelic variants of these genes within an array of rice cultivars via allele mining. Multiple alleles from the complex locus serve as a reservoir of variation to generate functional genes. The routine sequence exchange is one of the main mechanisms of R gene evolution and development. Allele mining for resistance genes can be an important method to identify additional resistance alleles and new haplotypes along with the development of allele-specific markers for use in marker-assisted selection. Allele mining can be visualised as a vital link between effective utilisation of genetic and genomic resources in genomics-driven modern plant breeding. This review studies the actual concepts and potential of mining approaches for the discovery of alleles and their utilisation for blast resistance genes in rice. The details provided here will be important to provide the rice breeder with a worthwhile introduction to allele mining and its methodology for breakthrough discovery of fresh alleles hidden in hereditary diversity, which is vital for crop improvement.

  20. High chlorpyrifos resistance in Culex pipiens mosquitoes: strong synergy between resistance genes

    PubMed Central

    Alout, H; Labbé, P; Berthomieu, A; Makoundou, P; Fort, P; Pasteur, N; Weill, M

    2016-01-01

    We investigated the genetic determinism of high chlorpyrifos resistance (HCR), a phenotype first described in 1999 in Culex pipiens mosquitoes surviving chlorpyrifos doses ⩾1 mg l−1 and more recently found in field samples from Tunisia, Israel or Indian Ocean islands. Through chlorpyrifos selection, we selected several HCR strains that displayed over 10 000-fold resistance. All strains were homozygous for resistant alleles at two main loci: the ace-1 gene, with the resistant ace-1R allele expressing the insensitive G119S acetylcholinesterase, and a resistant allele of an unknown gene (named T) linked to the sex and ace-2 genes. We constructed a strain carrying only the T-resistant allele and studied its resistance characteristics. By crossing this strain with strains harboring different alleles at the ace-1 locus, we showed that the resistant ace-1R and the T alleles act in strong synergy, as they elicited a resistance 100 times higher than expected from a simple multiplicative effect. This effect was specific to chlorpyrifos and parathion and was not affected by synergists. We also examined how HCR was expressed in strains carrying other ace-1-resistant alleles, such as ace-1V or the duplicated ace-1D allele, currently spreading worldwide. We identified two major parameters that influenced the level of resistance: the number and the nature of the ace-1-resistant alleles and the number of T alleles. Our data fit a model that predicts that the T allele acts by decreasing chlorpyrifos concentration in the compartment targeted in insects. PMID:26463842

  1. High chlorpyrifos resistance in Culex pipiens mosquitoes: strong synergy between resistance genes.

    PubMed

    Alout, H; Labbé, P; Berthomieu, A; Makoundou, P; Fort, P; Pasteur, N; Weill, M

    2016-02-01

    We investigated the genetic determinism of high chlorpyrifos resistance (HCR), a phenotype first described in 1999 in Culex pipiens mosquitoes surviving chlorpyrifos doses ⩾1 mg l(-1) and more recently found in field samples from Tunisia, Israel or Indian Ocean islands. Through chlorpyrifos selection, we selected several HCR strains that displayed over 10 000-fold resistance. All strains were homozygous for resistant alleles at two main loci: the ace-1 gene, with the resistant ace-1(R) allele expressing the insensitive G119S acetylcholinesterase, and a resistant allele of an unknown gene (named T) linked to the sex and ace-2 genes. We constructed a strain carrying only the T-resistant allele and studied its resistance characteristics. By crossing this strain with strains harboring different alleles at the ace-1 locus, we showed that the resistant ace-1(R) and the T alleles act in strong synergy, as they elicited a resistance 100 times higher than expected from a simple multiplicative effect. This effect was specific to chlorpyrifos and parathion and was not affected by synergists. We also examined how HCR was expressed in strains carrying other ace-1-resistant alleles, such as ace-1(V) or the duplicated ace-1(D) allele, currently spreading worldwide. We identified two major parameters that influenced the level of resistance: the number and the nature of the ace-1-resistant alleles and the number of T alleles. Our data fit a model that predicts that the T allele acts by decreasing chlorpyrifos concentration in the compartment targeted in insects.

  2. Recessive Resistance to Plant Viruses: Potential Resistance Genes Beyond Translation Initiation Factors

    PubMed Central

    Hashimoto, Masayoshi; Neriya, Yutaro; Yamaji, Yasuyuki; Namba, Shigetou

    2016-01-01

    The ability of plant viruses to propagate their genomes in host cells depends on many host factors. In the absence of an agrochemical that specifically targets plant viral infection cycles, one of the most effective methods for controlling viral diseases in plants is taking advantage of the host plant’s resistance machinery. Recessive resistance is conferred by a recessive gene mutation that encodes a host factor critical for viral infection. It is a branch of the resistance machinery and, as an inherited characteristic, is very durable. Moreover, recessive resistance may be acquired by a deficiency in a negative regulator of plant defense responses, possibly due to the autoactivation of defense signaling. Eukaryotic translation initiation factor (eIF) 4E and eIF4G and their isoforms are the most widely exploited recessive resistance genes in several crop species, and they are effective against a subset of viral species. However, the establishment of efficient, recessive resistance-type antiviral control strategies against a wider range of plant viral diseases requires genetic resources other than eIF4Es. In this review, we focus on recent advances related to antiviral recessive resistance genes evaluated in model plants and several crop species. We also address the roles of next-generation sequencing and genome editing technologies in improving plant genetic resources for recessive resistance-based antiviral breeding in various crop species. PMID:27833593

  3. Recessive Resistance to Plant Viruses: Potential Resistance Genes Beyond Translation Initiation Factors.

    PubMed

    Hashimoto, Masayoshi; Neriya, Yutaro; Yamaji, Yasuyuki; Namba, Shigetou

    2016-01-01

    The ability of plant viruses to propagate their genomes in host cells depends on many host factors. In the absence of an agrochemical that specifically targets plant viral infection cycles, one of the most effective methods for controlling viral diseases in plants is taking advantage of the host plant's resistance machinery. Recessive resistance is conferred by a recessive gene mutation that encodes a host factor critical for viral infection. It is a branch of the resistance machinery and, as an inherited characteristic, is very durable. Moreover, recessive resistance may be acquired by a deficiency in a negative regulator of plant defense responses, possibly due to the autoactivation of defense signaling. Eukaryotic translation initiation factor (eIF) 4E and eIF4G and their isoforms are the most widely exploited recessive resistance genes in several crop species, and they are effective against a subset of viral species. However, the establishment of efficient, recessive resistance-type antiviral control strategies against a wider range of plant viral diseases requires genetic resources other than eIF4Es. In this review, we focus on recent advances related to antiviral recessive resistance genes evaluated in model plants and several crop species. We also address the roles of next-generation sequencing and genome editing technologies in improving plant genetic resources for recessive resistance-based antiviral breeding in various crop species.

  4. Dissemination of metal resistance genes among animal methicillin-resistant coagulase-negative Staphylococci.

    PubMed

    Argudín, M Angeles; Butaye, Patrick

    2016-04-01

    The use of metals as feed supplement has been recognized as a potential driver for co-selection of methicillin-resistant Staphylococcus aureus in pigs. However, the prevalence of these determinants in methicillin-resistant coagulase-negative staphylococci (MRCoNS) is largely unknown. In this study, a collection of 130 MRCoNS from pigs and veal calves were investigated for the presence of metal-resistance genes (czrC, copB, cadD, arsA) associated to SCCmec. Near half of the isolates carried metal resistance genes (czrC 5.4%, copB 38.5%, cadD 7.7%, arsA 26.2%) regardless of their SCCmec type. The increased use of metals in livestock animals, especially zinc in pigs in several European countries may co-select for methicillin-resistance in several staphylococcal species.

  5. Gene expression and proliferation biomarkers for antidepressant treatment resistance.

    PubMed

    Breitfeld, J; Scholl, C; Steffens, M; Laje, G; Stingl, J C

    2017-03-14

    The neurotrophic hypothesis of depression suggests an association between effects on neuroplasticity and clinical response to antidepressant drug therapy. We studied individual variability in antidepressant drug effects on cell proliferation in lymphoblastoid cell lines (LCLs) from n=25 therapy-resistant patients versus n=25 first-line therapy responders from the Sequenced Treatment Alternatives to Relieve Depression (STAR*D) study. Furthermore, the variability in gene expression of genes associated with cell proliferation was analyzed for tentative candidate genes for prediction of individual LCL donor's treatment response. Cell proliferation was quantified by EdU (5-ethynyl-2'-deoxyuridine) assays after 21-day incubation of LCLs with fluoxetine (0.5 ng μl(-1)) and citalopram (0.3 ng μl(-1)) as developed and described earlier. Gene expression of a panel of candidate genes derived from genome-wide expression analyses of antidepressant effects on cell proliferation of LCLs from the Munich Antidepressant Response Signature (MARS) study was analyzed by real-time PCR. Significant differences in in vitro cell proliferation effects were detected between the group of LCLs from first-line therapy responders and LCLs from treatment-resistant patients. Gene expression analysis of the candidate gene panel revealed and confirmed influence of the candidate genes ABCB1, FZD7 and WNT2B on antidepressant drug resistance. The potential of these genes as tentative biomarkers for antidepressant drug resistance was confirmed. In vitro cell proliferation testing may serve as functional biomarker for individual neuroplasticity effects of antidepressants.

  6. A Modified Time-Delay Addition Method to Extract Resistive Leakage Current of MOSA

    NASA Astrophysics Data System (ADS)

    Khodsuz, Masume; Mirzaie, Mohammad

    2016-12-01

    Metal oxide surge arresters are one of the most important equipment for power system protection against switching and lightning over-voltages. High-energy stresses and environmental features are the main factors which degrade surge arresters. In order to verify surge arresters good condition, their monitoring is necessary. The majority of surge arrester monitoring techniques is based on total leakage current decomposition of their capacitive and resistive components. This paper introduces a new approach based on time-delay addition method to extract the resistive current from the total leakage current without measuring voltage signal. Surge arrester model for calculating leakage current has been performed in ATP-EMTP. In addition, the signal processing has been done using MATLAB software. To show the accuracy of the proposed method, experimental tests have been performed to extract resistive leakage current by the proposed method.

  7. Receiving Wear-Resistance Coverings Additives of Nanoparticles of Refractory Metals at a Laser Cladding

    NASA Astrophysics Data System (ADS)

    Murzakov, M. A.; Petrovskiy, V. N.; Bykovskiy, D. P.; Andreev, A. O.; Birukov, V. P.; Markushov, Y. V.

    2016-02-01

    Laser cladding technology was used to conduct experiments on production of wear-resistant coatings with additive nanoparticles of refractory metals (WC, TaC). Mechanical testing of coating abrasion was made using Brinell-Howarth method. The obtained data was compared with wear- resistance of commercial powder containing WC. It was found that at a concentration 10-15% coating with nanopowder additives shows a dramatic increase in wear-resistance by 4-6 times as compared to carbon steel substrate. There were conducted metallurgical studies of coatings on inverse electron reflection. There was determined elemental composition of deposited coating and substrate, and microhardness measured. It was found that structure of deposited coating with nanoparticles is fine.

  8. Hypertension genes are genetic markers for insulin sensitivity and resistance.

    PubMed

    Guo, Xiuqing; Cheng, Suzanne; Taylor, Kent D; Cui, Jinrui; Hughes, Randall; Quiñones, Manuel J; Bulnes-Enriquez, Isabel; De la Rosa, Roxana; Aurea, George; Yang, Huiying; Hsueh, Willa; Rotter, Jerome I

    2005-04-01

    Insulin resistance is a determinant of blood pressure variation and risk factor for hypertension. Because insulin resistance and blood pressure cosegregate in Mexican American families, we thus investigated the association between variations in 9 previously reported hypertension genes (ACE, AGT, AGTRI, ADDI, NPPA, ADDRB2, SCNN1A, GNB3, and NOS3) and insulin resistance. Families were ascertained via a coronary artery disease proband in the Mexican American Coronary Artery Disease Project. Individuals from 100 Mexican American families (n=656) were genotyped for 14 polymorphisms in the 9 genes and all adult offspring and offspring spouses were phenotyped for insulin sensitivity by hyperinsulinemic euglycemic clamp (n=449). AGT M235T and NOS3 A(-922)G and E298D polymorphisms were significantly associated with insulin sensitivity (P=0.018, 0.036, 0.039) but were not significant after adjusting for body mass index. ADD1 G460W was associated with insulin sensitivity only after adjusting for body mass index. The NPPA T2238C and SCNN1A A663T were associated with decreased fasting insulin levels after adjusting for body mass index (P=0.015 and 0.028). In conclusion, AGT, NOS3, NPPA, ADRB2, ADD1, and SCNN1A may well be genetic markers for insulin resistance, and adiposity was a potential modifier for only some gene/trait combinations. Our data support the hypothesis that genes in the blood pressure pathway may play a role in insulin resistance in Mexican Americans.

  9. Chromosomal Localization of Genes Conferring Desirable Agronomic Traits from Wheat-Agropyron cristatum Disomic Addition Line 5113.

    PubMed

    Li, Qingfeng; Lu, Yuqing; Pan, Cuili; Yao, Miaomiao; Zhang, Jinpeng; Yang, Xinming; Liu, Weihua; Li, Xiuquan; Xi, Yajun; Li, Lihui

    2016-01-01

    Creation of wheat-alien disomic addition lines and localization of desirable genes on alien chromosomes are important for utilization of these genes in genetic improvement of common wheat. In this study, wheat-Agropyron cristatum derivative line 5113 was characterized by genomic in situ hybridization (GISH) and specific-locus amplified fragment sequencing (SLAF-seq), and was demonstrated to be a novel wheat-A. cristatum disomic 6P addition line. Compared with its parent Fukuhokomugi (Fukuho), 5113 displayed multiple elite agronomic traits, including higher uppermost internode/plant height ratio, larger flag leaf, longer spike length, elevated grain number per spike and spikelet number per spike, more kernel number in the middle spikelet, more fertile tiller number per plant, and enhanced resistance to powdery mildew and leaf rust. Genes conferring these elite traits were localized on the A. cristatum 6P chromosome by using SLAF-seq markers and biparental populations (F1, BC1F1 and BC1F2 populations) produced from the crosses between Fukuho and 5113. Taken together, chromosomal localization of these desirable genes will facilitate transferring of high-yield and high-resistance genes from A. cristatum into common wheat, and serve as the foundation for the utilization of 5113 in wheat breeding.

  10. Chromosomal Localization of Genes Conferring Desirable Agronomic Traits from Wheat-Agropyron cristatum Disomic Addition Line 5113

    PubMed Central

    Pan, Cuili; Yao, Miaomiao; Zhang, Jinpeng; Yang, Xinming; Liu, Weihua; Li, Xiuquan; Xi, Yajun; Li, Lihui

    2016-01-01

    Creation of wheat-alien disomic addition lines and localization of desirable genes on alien chromosomes are important for utilization of these genes in genetic improvement of common wheat. In this study, wheat-Agropyron cristatum derivative line 5113 was characterized by genomic in situ hybridization (GISH) and specific-locus amplified fragment sequencing (SLAF-seq), and was demonstrated to be a novel wheat-A. cristatum disomic 6P addition line. Compared with its parent Fukuhokomugi (Fukuho), 5113 displayed multiple elite agronomic traits, including higher uppermost internode/plant height ratio, larger flag leaf, longer spike length, elevated grain number per spike and spikelet number per spike, more kernel number in the middle spikelet, more fertile tiller number per plant, and enhanced resistance to powdery mildew and leaf rust. Genes conferring these elite traits were localized on the A. cristatum 6P chromosome by using SLAF-seq markers and biparental populations (F1, BC1F1 and BC1F2 populations) produced from the crosses between Fukuho and 5113. Taken together, chromosomal localization of these desirable genes will facilitate transferring of high-yield and high-resistance genes from A. cristatum into common wheat, and serve as the foundation for the utilization of 5113 in wheat breeding. PMID:27824906

  11. In silico analysis of antibiotic resistance genes in the gut microflora of individuals from diverse geographies and age-groups.

    PubMed

    Ghosh, Tarini Shankar; Gupta, Sourav Sen; Nair, Gopinath Balakrish; Mande, Sharmila S

    2013-01-01

    The spread of antibiotic resistance, originating from the rampant and unrestrictive use of antibiotics in humans and livestock over the past few decades has emerged as a global health problem. This problem has been further compounded by recent reports implicating the gut microbial communities to act as reservoirs of antibiotic resistance. We have profiled the presence of probable antibiotic resistance genes in the gut flora of 275 individuals from eight different nationalities. For this purpose, available metagenomic data sets corresponding to 275 gut microbiomes were analyzed. Sequence similarity searches of the genomic fragments constituting each of these metagenomes were performed against genes conferring resistance to around 240 antibiotics. Potential antibiotic resistance genes conferring resistance against 53 different antibiotics were detected in the human gut microflora analysed in this study. In addition to several geography/country-specific patterns, four distinct clusters of gut microbiomes, referred to as 'Resistotypes', exhibiting similarities in their antibiotic resistance profiles, were identified. Groups of antibiotics having similarities in their resistance patterns within each of these clusters were also detected. Apart from this, mobile multi-drug resistance gene operons were detected in certain gut microbiomes. The study highlighted an alarmingly high abundance of antibiotic resistance genes in two infant gut microbiomes. The results obtained in the present study presents a holistic 'big picture' on the spectra of antibiotic resistance within our gut microbiota across different geographies. Such insights may help in implementation of new regulations and stringency on the existing ones.

  12. 76 FR 3011 - Black Stem Rust; Additions of Rust-Resistant Varieties

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-01-19

    ... Health Inspection Service 7 CFR Part 301 Black Stem Rust; Additions of Rust-Resistant Varieties AGENCY... final rule. The direct final rule notified the public of our intention to amend the black stem rust... INFORMATION CONTACT: Mr. Prakash K. Hebbar, National Program Manager, Black Stem/Barberry Rust Program,...

  13. 75 FR 29191 - Black Stem Rust; Additions of Rust-Resistant Varieties

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-05-25

    ... Animal and Plant Health Inspection Service 7 CFR Part 301 Black Stem Rust; Additions of Rust-Resistant... are amending the black stem rust quarantine and regulations by adding 21 varieties to the list of rust... Program Manager, Black Stem/Barberry Rust Program, PPQ, APHIS, 4700 River Road Unit 26, Riverdale,...

  14. A VSG expression site-associated gene confers resistance to human serum in Trypanosoma rhodesiense.

    PubMed

    Xong, H V; Vanhamme, L; Chamekh, M; Chimfwembe, C E; Van Den Abbeele, J; Pays, A; Van Meirvenne, N; Hamers, R; De Baetselier, P; Pays, E

    1998-12-11

    Infectivity of Trypanosoma brucei rhodesiense to humans is due to its resistance to a lytic factor present in human serum. In the ETat 1 strain this character was associated with antigenic variation, since expression of the ETat 1.10 variant surface glycoprotein was required to generate resistant (R) clones. In addition, in this strain transcription of a gene termed SRA was detected in R clones only. We show that the ETat 1.10 expression site is the one selectively transcribed in R variants. This expression site contains SRA as an expression site-associated gene (ESAG) and is characterized by the deletion of several ESAGs. Transfection of SRA into T.b. brucei was sufficient to confer resistance to human serum, identifying this gene as one of those responsible for T.b. rhodesiense adaptation to humans.

  15. Seedling Resistance to Stem Rust and Molecular Marker Analysis of Resistance Genes in Wheat Cultivars of Yunnan, China

    PubMed Central

    Li, Tian Ya; Cao, Yuan Yin; Wu, Xian Xin; Xu, Xiao Feng; Wang, Wan Lin

    2016-01-01

    Stem rust is one of the most potentially harmful wheat diseases, but has been effectively controlled in China since 1970s. However, the interest in breeding wheat with durable resistance to stem rust has been renewed with the emergence of Ug99 (TTKSK) virulent to the widely used resistance gene Sr31, and by which the wheat stem rust was controlled for 40 years in wheat production area worldwide. Yunnan Province, located on the Southwest border of China, is one of the main wheat growing regions, playing a pivotal role in the wheat stem rust epidemic in China. This study investigated the levels of resistance in key wheat cultivars (lines) of Yunnan Province. In addition, the existence of Sr25, Sr26, Sr28, Sr31, Sr32, and Sr38 genes in 119 wheat cultivars was assessed using specific DNA markers. The results indicated that 77 (64.7%) tested wheat varieties showed different levels of resistance to all the tested races of Puccinia graminis f. sp. tritici. Using molecular markers, we identified the resistance gene Sr31 in 43 samples; Sr38 in 10 samples; Sr28 in 12 samples, and one sample which was resistant against Ug99 (avirulent to Sr32). No Sr25 or Sr26 (effective against Ug99) was identified in any cultivars tested. Furthermore, 5 out of 119 cultivars tested carried both Sr31 and Sr38 and eight contained both Sr31 and Sr28. The results enable the development of appropriate strategies to breed varieties resistant to stem rust. PMID:27792757

  16. Spread of tetracycline resistance genes at a conventional dairy farm

    PubMed Central

    Kyselková, Martina; Jirout, Jiří; Vrchotová, Naděžda; Schmitt, Heike; Elhottová, Dana

    2015-01-01

    The use of antibiotics in animal husbandry contributes to the worldwide problem of increasing antibiotic resistance in animal and human pathogens. Intensive animal production is considered an important source of antibiotic resistance genes released to the environment, while the contribution of smaller farms remains to be evaluated. Here we monitor the spread of tetracycline resistance (TC-r) genes at a middle-size conventional dairy farm, where chlortetracycline (CTC, as intrauterine suppository) is prophylactically used after each calving. Our study has shown that animals at the farm acquired the TC-r genes in their early age (1–2 weeks), likely due to colonization with TC-resistant bacteria from their mothers and/or the farm environment. The relative abundance of the TC-r genes tet(W), tet(Q), and tet(M) in fresh excrements of calves was about 1–2 orders of magnitude higher compared to heifers and dairy cows, possibly due to the presence of antibiotic residues in milk fed to calves. The occurrence and abundance of TC-r genes in fresh excrements of heifers and adult cows remained unaffected by intrauterine CTC applications, with tet(O), tet(Q), and tet(W) representing a “core TC-resistome” of the farm, and tet(A), tet(M), tet(Y), and tet(X) occurring occasionally. The genes tet(A), tet(M), tet(Y), and tet(X) were shown to be respectively harbored by Shigella, Lactobacillus and Clostridium, Acinetobacter, and Wautersiella. Soil in the farm proximity, as well as field soil to which manure from the farm was applied, was contaminated with TC-r genes occurring in the farm, and some of the TC-r genes persisted in the field over 3 months following the manure application. Concluding, our study shows that antibiotic resistance genes may be a stable part of the intestinal metagenome of cattle even if antibiotics are not used for growth stimulation, and that smaller dairy farms may also contribute to environmental pollution with antibiotic resistance genes. PMID

  17. Ecology of Antibiotic Resistance Genes: Characterization of Enterococci from Houseflies Collected in Food Settings†

    PubMed Central

    Macovei, Lilia; Zurek, Ludek

    2006-01-01

    In this project, enterococci from the digestive tracts of 260 houseflies (Musca domestica L.) collected from five restaurants were characterized. Houseflies frequently (97% of the flies were positive) carried enterococci (mean, 3.1 × 103 CFU/fly). Using multiplex PCR, 205 of 355 randomly selected enterococcal isolates were identified and characterized. The majority of these isolates were Enterococcus faecalis (88.2%); in addition, 6.8% were E. faecium, and 4.9% were E. casseliflavus. E. faecalis isolates were phenotypically resistant to tetracycline (66.3%), erythromycin (23.8%), streptomycin (11.6%), ciprofloxacin (9.9%), and kanamycin (8.3%). Tetracycline resistance in E. faecalis was encoded by tet(M) (65.8%), tet(O) (1.7%), and tet(W) (0.8%). The majority (78.3%) of the erythromycin-resistant E. faecalis isolates carried erm(B). The conjugative transposon Tn916 and members of the Tn916/Tn1545 family were detected in 30.2% and 34.6% of the identified isolates, respectively. E. faecalis carried virulence genes, including a gelatinase gene (gelE; 70.7%), an aggregation substance gene (asa1; 33.2%), an enterococcus surface protein gene (esp; 8.8%), and a cytolysin gene (cylA; 8.8%). Phenotypic assays showed that 91.4% of the isolates with the gelE gene were gelatinolytic and that 46.7% of the isolates with the asa1 gene aggregated. All isolates with the cylA gene were hemolytic on human blood. This study showed that houseflies in food-handling and -serving facilities carry antibiotic-resistant and potentially virulent enterococci that have the capacity for horizontal transfer of antibiotic resistance genes to other bacteria. PMID:16751512

  18. Plant Genetic Background Increasing the Efficiency and Durability of Major Resistance Genes to Root-knot Nematodes Can Be Resolved into a Few Resistance QTLs

    PubMed Central

    Barbary, Arnaud; Djian-Caporalino, Caroline; Marteu, Nathalie; Fazari, Ariane; Caromel, Bernard; Castagnone-Sereno, Philippe; Palloix, Alain

    2016-01-01

    With the banning of most chemical nematicides, the control of root-knot nematodes (RKNs) in vegetable crops is now based essentially on the deployment of single, major resistance genes (R-genes). However, these genes are rare and their efficacy is threatened by the capacity of RKNs to adapt. In pepper, several dominant R-genes are effective against RKNs, and their efficacy and durability have been shown to be greater in a partially resistant genetic background. However, the genetic determinants of this partial resistance were unknown. Here, a quantitative trait loci (QTL) analysis was performed on the F2:3 population from the cross between Yolo Wonder, an accession considered partially resistant or resistant, depending on the RKN species, and Doux Long des Landes, a susceptible cultivar. A genetic linkage map was constructed from 130 F2 individuals, and the 130 F3 families were tested for resistance to the three main RKN species, Meloidogyne incognita, M. arenaria, and M. javanica. For the first time in the pepper-RKN pathosystem, four major QTLs were identified and mapped to two clusters. The cluster on chromosome P1 includes three tightly linked QTLs with specific effects against individual RKN species. The fourth QTL, providing specific resistance to M. javanica, mapped to pepper chromosome P9, which is known to carry multiple NBS–LRR repeats, together with major R-genes for resistance to nematodes and other pathogens. The newly discovered cluster on chromosome P1 has a broad spectrum of action with major additive effects on resistance. These data highlight the role of host QTLs involved in plant-RKN interactions and provide innovative potential for the breeding of new pepper cultivars or rootstocks combining quantitative resistance and major R-genes, to increase both the efficacy and durability of RKN control by resistance genes. PMID:27242835

  19. Effect of alloy additions on wear resistance of nickel based hardfacing

    SciTech Connect

    Su, Y.L.; Chen, K.Y.

    1997-03-01

    The purpose of this research is to study the influence of the microstructure and hardness of the nickel based hardfacing alloy on wear resistance of deposit layers when different alloy elements are added. Different deposit layers were obtained by SMAW in which AWS RNiCr bare electrodes were coated by fluxes, to which different measures of ferro-niobium, ferro-chromium, and carbon had been added. The result of the experiment showed that when subject to abrasive wear, if the abrasive particles were silicon carbide, the increase of the volume fraction of the hard phase had only a slight effect on improving the wear resistance of the deposit layers. On adhesive wear, the niobium added specimens formed some spherical niobium carbide particles in the matrix of the deposit layer which reduced the friction coefficient of the specimens. The addition of carbon and chromium can enhance macrohardness and wear resistance of the welding deposit significantly. This same addition will also aid wear resistance by forming a continuous phase in the microstructure of the deposit metal. While there was no significant difference between the macrohardnesses of the metals, the form of this precipitate in the deposit metals was actually the most important factor in their wear resistance.

  20. Effects of V addition on recrystallization resistance of 7150 aluminum alloy after simulative hot deformation

    SciTech Connect

    Lai, Jing; Shi, Cangji; Chen, X.-Grant

    2014-10-15

    The effects of different V contents (0.01 to 0.19 wt.%) on the recrystallization resistance of 7150 aluminum alloys during post-deformation heat treatment were investigated. The microstructural evolutions at as-cast, as-homogenized conditions and after post-deformation annealing were studied using optical, scanning electron and transmission electron microscopes and using the electron backscattered diffraction technique. The precipitation of Al{sub 21}V{sub 2} dispersoids was observed in alloys containing 0.11 to 0.19 wt.% V after homogenization. The dispersoids were mainly distributed in the dendrite cells, and the precipitate-free zones occurred in the interdendritic regions and near grain boundaries. V addition could significantly enhance the recrystallization resistance during post-deformation annealing, particularly in the presence of a great number of Al{sub 21}V{sub 2} dispersoids. Recrystallized grain growth was effectively restricted because of the dispersoid pinning effect. The alloy containing 0.15 wt.% V exhibited the highest recrystallization resistance amongst all V-containing alloys studied. - Highlights: • Investigated the effect of V level on microstructure and flow stress of 7150 alloys • Characterized microstructures using optical microscopy, SEM, TEM and EBSD • Described the precipitation behavior of V-dispersoids in the dendritic structure • Studied the V effect on recrystallization resistance during post heat treatment • V addition greatly enhanced the recrystallization resistance during annealing.

  1. Quantification of vancomycin-resistant enterococci and corresponding resistance genes in a sewage treatment plant.

    PubMed

    Furukawa, Takashi; Hashimoto, Reina; Mekata, Tohru

    2015-01-01

    This study aimed to analyze vancomycin-resistant enterococci (VRE) and their resistance genes, vanA and vanB, to examine their presence in sewage treatment systems. Water samples were collected from primary sedimentation tank inlet, aeration tank, final sedimentation tank overflow outlet, and disinfection tank. Enterococcal strains were determined their vancomycin susceptibility by the minimum inhibitory concentration (MIC) test. Vancomycin-resistance genes (vanA and vanB) were quantified by real-time PCR. The sewage treatment process indeed decreased the number of most enterococci contained in the entering sewage, with a removal rate of ≥ 5 log. The MIC test showed that two enterococcal strains resistant to a high concentration of vancomycin (>128 μg mL(-1)). However, most of the enterococcal strains exhibited sensitivity to vancomycin, indicating that VRE were virtually absent in the sewage treatment systems. On the other hand, vancomycin-resistance genes were detected in all the sewage samples, including those collected from the chlorination disinfection tank. The highest copy numbers of vanA (1.5 × 10(3) copies mL(-1)) and vanB (1.0 × 10(3) copies mL(-1)) were detected from the water sample of effluent water and chlorinated water, respectively. Therefore, antibiotic resistance genes remain in the sewage treatment plant and might discharged into water environments such as rivers and coastal areas.

  2. CRISPR-Cas and Restriction-Modification Act Additively against Conjugative Antibiotic Resistance Plasmid Transfer in Enterococcus faecalis

    PubMed Central

    Price, Valerie J.; Huo, Wenwen; Sharifi, Ardalan

    2016-01-01

    ABSTRACT Enterococcus faecalis is an opportunistic pathogen and a leading cause of nosocomial infections. Conjugative pheromone-responsive plasmids are narrow-host-range mobile genetic elements (MGEs) that are rapid disseminators of antibiotic resistance in the faecalis species. Clustered regularly interspaced short palindromic repeat (CRISPR)-Cas and restriction-modification confer acquired and innate immunity, respectively, against MGE acquisition in bacteria. Most multidrug-resistant E. faecalis isolates lack CRISPR-Cas and possess an orphan locus lacking cas genes, CRISPR2, that is of unknown function. Little is known about restriction-modification defense in E. faecalis. Here, we explore the hypothesis that multidrug-resistant E. faecalis strains are immunocompromised. We assessed MGE acquisition by E. faecalis T11, a strain closely related to the multidrug-resistant hospital isolate V583 but which lacks the ~620 kb of horizontally acquired genome content that characterizes V583. T11 possesses the E. faecalis CRISPR3-cas locus and a predicted restriction-modification system, neither of which occurs in V583. We demonstrate that CRISPR-Cas and restriction-modification together confer a 4-log reduction in acquisition of the pheromone-responsive plasmid pAM714 in biofilm matings. Additionally, we show that the orphan CRISPR2 locus is functional for genome defense against another pheromone-responsive plasmid, pCF10, only in the presence of cas9 derived from the E. faecalis CRISPR1-cas locus, which most multidrug-resistant E. faecalis isolates lack. Overall, our work demonstrated that the loss of only two loci led to a dramatic reduction in genome defense against a clinically relevant MGE, highlighting the critical importance of the E. faecalis accessory genome in modulating horizontal gene transfer. Our results rationalize the development of antimicrobial strategies that capitalize upon the immunocompromised status of multidrug-resistant E

  3. Functional Metagenomics Reveals Previously Unrecognized Diversity of Antibiotic Resistance Genes in Gulls

    PubMed Central

    Martiny, Adam C.; Martiny, Jennifer B. H.; Weihe, Claudia; Field, Andrew; Ellis, Julie C.

    2011-01-01

    Wildlife may facilitate the spread of antibiotic resistance (AR) between human-dominated habitats and the surrounding environment. Here, we use functional metagenomics to survey the diversity and genomic context of AR genes in gulls. Using this approach, we found a variety of AR genes not previously detected in gulls and wildlife, including class A and C β-lactamases as well as six tetracycline resistance gene types. An analysis of the flanking sequences indicates that most of these genes are present in Enterobacteriaceae and various Gram-positive bacteria. In addition to finding known gene types, we detected 31 previously undescribed AR genes. These undescribed genes include one most similar to an uncharacterized gene in Verrucomicrobium and another to a putative DNA repair protein in Lactobacillus. Overall, the study more than doubled the number of clinically relevant AR gene types known to be carried by gulls or by wildlife in general. Together with the propensity of gulls to visit human-dominated habitats, this high diversity of AR gene types suggests that gulls could facilitate the spread of AR. PMID:22347872

  4. Multiple Herbicide Resistance in Lolium multiflorum and Identification of Conserved Regulatory Elements of Herbicide Resistance Genes

    PubMed Central

    Mahmood, Khalid; Mathiassen, Solvejg K.; Kristensen, Michael; Kudsk, Per

    2016-01-01

    Herbicide resistance is a ubiquitous challenge to herbicide sustainability and a looming threat to control weeds in crops. Recently four genes were found constituently over-expressed in herbicide resistant individuals of Lolium rigidum, a close relative of Lolium multiflorum. These include two cytochrome P450s, one nitronate monooxygenase and one glycosyl-transferase. Higher expressions of these four herbicide metabolism related (HMR) genes were also observed after herbicides exposure in the gene expression databases, indicating them as reliable markers. In order to get an overview of herbicidal resistance status of L. multiflorum L, 19 field populations were collected. Among these populations, four populations were found to be resistant to acetolactate synthase (ALS) inhibitors while three exhibited resistance to acetyl-CoA carboxylase (ACCase) inhibitors in our initial screening and dose response study. The genotyping showed the presence of mutations Trp-574-Leu and Ile-2041-Asn in ALS and ACCase, respectively, and qPCR experiments revealed the enhanced expression of HMR genes in individuals of certain resistant populations. Moreover, co-expression networks and promoter analyses of HMR genes in O. sativa and A. thaliana resulted in the identification of a cis-regulatory motif and zinc finger transcription factors. The identified transcription factors were highly expressed similar to HMR genes in response to xenobiotics whereas the identified motif is known to play a vital role in coping with environmental stresses and maintaining genome stability. Overall, our findings provide an important step forward toward a better understanding of metabolism-based herbicide resistance that can be utilized to devise novel strategies of weed management. PMID:27547209

  5. Clinical and Microbiological Aspects of Linezolid Resistance Mediated by the cfr Gene Encoding a 23S rRNA Methyltransferase▿

    PubMed Central

    Arias, Cesar A.; Vallejo, Martha; Reyes, Jinnethe; Panesso, Diana; Moreno, Jaime; Castañeda, Elizabeth; Villegas, Maria V.; Murray, Barbara E.; Quinn, John P.

    2008-01-01

    The cfr (chloramphenicol-florfenicol resistance) gene encodes a 23S rRNA methyltransferase that confers resistance to linezolid. Detection of linezolid resistance was evaluated in the first cfr-carrying human hospital isolate of linezolid and methicillin-resistant Staphylococcus aureus (designated MRSA CM-05) by dilution and diffusion methods (including Etest). The presence of cfr was investigated in isolates of staphylococci colonizing the patient's household contacts and clinical isolates recovered from patients in the same unit where MRSA CM-05 was isolated. Additionally, 68 chloramphenicol-resistant Colombian MRSA isolates recovered from hospitals between 2001 and 2004 were screened for the presence of the cfr gene. In addition to erm(B), the erm(A) gene was also detected in CM-05. The isolate belonged to sequence type 5 and carried staphylococcal chromosomal cassette mec type I. We were unable to detect the cfr gene in any of the human staphylococci screened (either clinical or colonizing isolates). Agar and broth dilution methods detected linezolid resistance in CM-05. However, the Etest and disk diffusion methods failed to detect resistance after 24 h of incubation. Oxazolidinone resistance mediated by the cfr gene is rare, and acquisition by a human isolate appears to be a recent event in Colombia. The detection of cfr-mediated linezolid resistance might be compromised by the use of the disk diffusion or Etest method. PMID:18174304

  6. Statistical inference of selection and divergence of the rice blast resistance gene Pi-ta.

    PubMed

    Amei, Amei; Lee, Seonghee; Mysore, Kirankumar S; Jia, Yulin

    2014-10-21

    The resistance gene Pi-ta has been effectively used to control rice blast disease, but some populations of cultivated and wild rice have evolved resistance. Insights into the evolutionary processes that led to this resistance during crop domestication may be inferred from the population history of domesticated and wild rice strains. In this study, we applied a recently developed statistical method, time-dependent Poisson random field model, to examine the evolution of the Pi-ta gene in cultivated and weedy rice. Our study suggests that the Pi-ta gene may have more recently introgressed into cultivated rice, indica and japonica, and U.S. weedy rice from the wild species, O. rufipogon. In addition, the Pi-ta gene is under positive selection in japonica, tropical japonica, U.S. cultivars and U.S. weedy rice. We also found that sequences of two domains of the Pi-ta gene, the nucleotide binding site and leucine-rich repeat domain, are highly conserved among all rice accessions examined. Our results provide a valuable analytical tool for understanding the evolution of disease resistance genes in crop plants.

  7. Fine Genetic Mapping Localizes Cucumber Scab Resistance Gene Ccu into an R Gene Cluster

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The scab caused by Cladosporium cucumerinum, is an important disease of cucumber, Cucumis sativus. In this study, we conducted fine genetic mapping of the single dominant scab resistance gene, Ccu, with 148 F9 recombination inbreeding lines (RILs) and 1,944 F2 plants derived from the resistant cucum...

  8. Improving of Rice Blast Resistances in Japonica by Pyramiding Major R Genes.

    PubMed

    Xiao, Ning; Wu, Yunyu; Pan, Cunhong; Yu, Ling; Chen, Yu; Liu, Guangqing; Li, Yuhong; Zhang, Xiaoxiang; Wang, Zhiping; Dai, Zhengyuan; Liang, Chengzhi; Li, Aihong

    2016-01-01

    Rice blast, caused by the fungal pathogen Magnaporthe oryzae, is a major constraint to rice production worldwide. In this study, we developed monogenic near-isogenic lines (NILs) NIL (Pi9), NIL (Pizt) , and NIL (Pi54) carrying genes Pi9, Pizt, and Pi54, respectively, by marker assisted backcross breeding using 07GY31 as the japonica genetic background with good agronomic traits. Polygene pyramid lines (PPLs) PPL (Pi9+Pi54) combining Pi9 with Pi54, and PPL (Pizt+Pi54) combining Pizt with Pi54 were then developed using corresponding NILs with genetic background recovery rates of more than 97%. Compared to 07GY31, the above NILs and PPLs exhibited significantly enhanced resistance frequencies (RFs) for both leaf and panicle blasts. RFs of both PPLs for leaf blast were somewhat higher than those of their own parental NILs, respectively, and PPL (Pizt)(+)(Pi54) exhibited higher RF for panicle blast than NIL (Pizt) and NIL (Pi54) (P < 0.001), hinting an additive effect on the resistance. However, PPL (Pi9+Pi54) exhibited lower RF for panicle blast than NIL (Pi9) (P < 0.001), failing to realize an additive effect. PPL (Pizt)(+)(Pi54) showed higher resistant level for panicle blast and better additive effects on the resistance than PPL (Pi9+Pi54). It was suggested that major R genes interacted with each other in a way more complex than additive effect in determining panicle blast resistance levels. Genotyping by sequencing analysis and extreme-phenotype genome-wide association study further confirmed the above results. Moreover, data showed that pyramiding multiple resistance genes did not affect the performance of basic agronomic traits. So the way to enhance levels of leaf and panicle blast resistances for rice breeding in this study is effective and may serve as a reference for breeders. Key Message: Resistant levels of rice blast is resulted from different combinations of major R genes, PPL (Pizt)(+)(Pi54) showed higher resistant level and better additive effects on

  9. Improving of Rice Blast Resistances in Japonica by Pyramiding Major R Genes

    PubMed Central

    Xiao, Ning; Wu, Yunyu; Pan, Cunhong; Yu, Ling; Chen, Yu; Liu, Guangqing; Li, Yuhong; Zhang, Xiaoxiang; Wang, Zhiping; Dai, Zhengyuan; Liang, Chengzhi; Li, Aihong

    2017-01-01

    Rice blast, caused by the fungal pathogen Magnaporthe oryzae, is a major constraint to rice production worldwide. In this study, we developed monogenic near-isogenic lines (NILs) NILPi9, NILPizt, and NILPi54 carrying genes Pi9, Pizt, and Pi54, respectively, by marker assisted backcross breeding using 07GY31 as the japonica genetic background with good agronomic traits. Polygene pyramid lines (PPLs) PPLPi9+Pi54 combining Pi9 with Pi54, and PPLPizt+Pi54 combining Pizt with Pi54 were then developed using corresponding NILs with genetic background recovery rates of more than 97%. Compared to 07GY31, the above NILs and PPLs exhibited significantly enhanced resistance frequencies (RFs) for both leaf and panicle blasts. RFs of both PPLs for leaf blast were somewhat higher than those of their own parental NILs, respectively, and PPLPizt+Pi54 exhibited higher RF for panicle blast than NILPizt and NILPi54 (P < 0.001), hinting an additive effect on the resistance. However, PPLPi9+Pi54 exhibited lower RF for panicle blast than NILPi9 (P < 0.001), failing to realize an additive effect. PPLPizt+Pi54 showed higher resistant level for panicle blast and better additive effects on the resistance than PPLPi9+Pi54. It was suggested that major R genes interacted with each other in a way more complex than additive effect in determining panicle blast resistance levels. Genotyping by sequencing analysis and extreme-phenotype genome-wide association study further confirmed the above results. Moreover, data showed that pyramiding multiple resistance genes did not affect the performance of basic agronomic traits. So the way to enhance levels of leaf and panicle blast resistances for rice breeding in this study is effective and may serve as a reference for breeders. Key Message: Resistant levels of rice blast is resulted from different combinations of major R genes, PPLPizt+Pi54 showed higher resistant level and better additive effects on the panicle blast resistance than PPLPi9+Pi54. PMID

  10. Paleo-evolutionary plasticity of plant disease resistance genes

    PubMed Central

    2014-01-01

    Background The recent access to a large set of genome sequences, combined with a robust evolutionary scenario of modern monocot (i.e. grasses) and eudicot (i.e. rosids) species from their founder ancestors, offered the opportunity to gain insights into disease resistance genes (R-genes) evolutionary plasticity. Results We unravel in the current article (i) a R-genes repertoire consisting in 7883 for monocots and 15758 for eudicots, (ii) a contrasted R-genes conservation with 23.8% for monocots and 6.6% for dicots, (iii) a minimal ancestral founder pool of 384 R-genes for the monocots and 150 R-genes for the eudicots, (iv) a general pattern of organization in clusters accounting for more than 60% of mapped R-genes, (v) a biased deletion of ancestral duplicated R-genes between paralogous blocks possibly compensated by clusterization, (vi) a bias in R-genes clusterization where Leucine-Rich Repeats act as a ‘glue’ for domain association, (vii) a R-genes/miRNAs interome enriched toward duplicated R-genes. Conclusions Together, our data may suggest that R-genes family plasticity operated during plant evolution (i) at the structural level through massive duplicates loss counterbalanced by massive clusterization following polyploidization; as well as at (ii) the regulation level through microRNA/R-gene interactions acting as a possible source of functional diploidization of structurally retained R-genes duplicates. Such evolutionary shuffling events leaded to CNVs (i.e. Copy Number Variation) and PAVs (i.e. Presence Absence Variation) between related species operating in the decay of R-genes colinearity between plant species. PMID:24617999

  11. Identification of blast resistance genes for managing rice blast disease

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Rice blast, caused by the fungal pathogen Magnaporthe oryzae, is one of the most devastating diseases worldwide. In the present study, an international set of monogenic differentials carrying 24 major blast resistance (R) genes (Pia, Pib, Pii, Pik, Pik-h, Pik-m, Pik-p, Pik-s, Pish, Pit, Pita, Pita2,...

  12. Evaluating antibiotic resistance genes in soils with applied manures

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Antibiotics are commonly used in livestock production to promote growth and combat disease. Recent studies have shown the potential for spread of antibiotic resistance genes (ARG) to the environment following application of livestock manures. In this study, concentrations of bacteria with ARG in soi...

  13. Multidrug resistance protein gene expression in Trichoplusia ni caterpillars.

    PubMed

    Simmons, Jason; D'Souza, Olivia; Rheault, Mark; Donly, Cam

    2013-02-01

    Many insect species exhibit pesticide-resistant phenotypes. One of the mechanisms capable of contributing to resistance is the overexpression of multidrug resistance (MDR) transporter proteins. Here we describe the cloning of three genes encoding MDR proteins from Trichoplusia ni: trnMDR1, trnMDR2 and trnMDR3. Real-time quantitative PCR (qPCR) detected trnMDR mRNA in the whole nervous system, midgut and Malpighian tubules of final instar T. ni caterpillars. To test whether these genes are upregulated in response to chemical challenge in this insect, qPCR was used to compare trnMDR mRNA levels in unchallenged insects with those of insects fed the synthetic pyrethroid, deltamethrin. Only limited increases were detected in a single gene, trnMDR2, which is the most weakly expressed of the three MDR genes, suggesting that increased multidrug resistance of this type is not a significant part of the response to deltamethrin exposure.

  14. Association mapping and gene-gene interaction for stem rust resistance in CIMMYT spring wheat germplasm.

    PubMed

    Yu, Long-Xi; Lorenz, Aaron; Rutkoski, Jessica; Singh, Ravi P; Bhavani, Sridhar; Huerta-Espino, Julio; Sorrells, Mark E

    2011-12-01

    The recent emergence of wheat stem rust Ug99 and evolution of new races within the lineage threatens global wheat production because they overcome widely deployed stem rust resistance (Sr) genes that had been effective for many years. To identify loci conferring adult plant resistance to races of Ug99 in wheat, we employed an association mapping approach for 276 current spring wheat breeding lines from the International Maize and Wheat Improvement Center (CIMMYT). Breeding lines were genotyped with Diversity Array Technology (DArT) and microsatellite markers. Phenotypic data was collected on these lines for stem rust race Ug99 resistance at the adult plant stage in the stem rust resistance screening nursery in Njoro, Kenya in seasons 2008, 2009 and 2010. Fifteen marker loci were found to be significantly associated with stem rust resistance. Several markers appeared to be linked to known Sr genes, while other significant markers were located in chromosome regions where no Sr genes have been previously reported. Most of these new loci colocalized with QTLs identified recently in different biparental populations. Using the same data and Q + K covariate matrices, we investigated the interactions among marker loci using linear regression models to calculate P values for pairwise marker interactions. Resistance marker loci including the Sr2 locus on 3BS and the wPt1859 locus on 7DL had significant interaction effects with other loci in the same chromosome arm and with markers on chromosome 6B. Other resistance marker loci had significant pairwise interactions with markers on different chromosomes. Based on these results, we propose that a complex network of gene-gene interactions is, in part, responsible for resistance to Ug99. Further investigation may provide insight for understanding mechanisms that contribute to this resistance gene network.

  15. SOR1, a gene required for photosensitizer and singlet oxygen resistance in Cercospora fungi, is highly conserved in divergent organisms.

    PubMed

    Ehrenshaft, M; Jenns, A E; Chung, K R; Daub, M E

    1998-03-01

    Filamentous Cercospora fungi are resistant to photosensitizing compounds that generate singlet oxygen. C. nicotianae photosensitizer-sensitive mutants were restored to full resistance by transformation with SOR1 (Singlet Oxygen Resistance 1), a gene recovered from a wild-type genomic library. SOR1 null mutants generated via targeted gene replacement confirmed the requirement for SOR1 in photosensitizer resistance. SOR1 RNA is present throughout the growth cycle. Although resistance to singlet oxygen is rare in biological systems, SOR1, a gene with demonstrated activity against singlet-oxygen-generating photosensitizers, is highly conserved in organisms from widely diverse taxa. The characterization of SOR1 provides an additional phenotype to this large group of evolutionarily conserved genes.

  16. Macrophage-specific Mycobacterium tuberculosis genes: identification by green fluorescent protein and kanamycin resistance selection.

    PubMed

    Srivastava, Vikas; Rouanet, Carine; Srivastava, Ranjana; Ramalingam, B; Locht, Camille; Srivastava, Brahm S

    2007-03-01

    Mycobacterium tuberculosis survives and multiplies inside macrophages of its host by modulating the expression of several genes essential for in vivo survival. An in vivo expression system has been developed, based on green fluorescent protein and kanamycin resistance, to identify M. tuberculosis genes which appear to be up-regulated in infected macrophages. A promoter-trap shuttle vector, pLL192, was constructed, containing a streptomycin resistance gene as selection marker and an artificial bicistronic operon composed of the promoterless green fluorescent protein (gfp) gene, followed by the kanamycin resistance gene. A unique BamHI site upstream of the gfp gene allowed for insertion of promoter libraries. The vector was validated by the use of known regulated or constitutive M. tuberculosis promoters. In addition, an M. tuberculosis genomic DNA library was inserted into pLL192 and then introduced into Mycobacterium bovis BCG. The recombinant BCG cells were then used to infect the J774A.1 murine macrophage-like cell line in the presence of kanamycin. Several recombinant BCG cells were thereby selected that were resistant to kanamycin within infected macrophages, but were sensitive to kanamycin when grown in vitro. The kanamycin resistance phenotype was paralleled by the fluorescence phenotype. After nucleotide sequencing, the corresponding genes were identified as mce1A, PE_PGRS63(RV3097c), Rv2232, Rv1026, Rv1635c, viuB, Rv2231(cobC) and Rv0997. Real-time PCR analysis using RNA isolated at various time points from M. tuberculosis and M. bovis BCG grown in vitro and within macrophages, confirmed the up-regulation of these genes. The level of up-regulation varied from 2- to 40-fold in macrophages compared to growth in vitro.

  17. Resistance gene identification from Larimichthys crocea with machine learning techniques

    PubMed Central

    Cai, Yinyin; Liao, Zhijun; Ju, Ying; Liu, Juan; Mao, Yong; Liu, Xiangrong

    2016-01-01

    The research on resistance genes (R-gene) plays a vital role in bioinformatics as it has the capability of coping with adverse changes in the external environment, which can form the corresponding resistance protein by transcription and translation. It is meaningful to identify and predict R-gene of Larimichthys crocea (L.Crocea). It is friendly for breeding and the marine environment as well. Large amounts of L.Crocea’s immune mechanisms have been explored by biological methods. However, much about them is still unclear. In order to break the limited understanding of the L.Crocea’s immune mechanisms and to detect new R-gene and R-gene-like genes, this paper came up with a more useful combination prediction method, which is to extract and classify the feature of available genomic data by machine learning. The effectiveness of feature extraction and classification methods to identify potential novel R-gene was evaluated, and different statistical analyzes were utilized to explore the reliability of prediction method, which can help us further understand the immune mechanisms of L.Crocea against pathogens. In this paper, a webserver called LCRG-Pred is available at http://server.malab.cn/rg_lc/. PMID:27922074

  18. Resistance gene identification from Larimichthys crocea with machine learning techniques

    NASA Astrophysics Data System (ADS)

    Cai, Yinyin; Liao, Zhijun; Ju, Ying; Liu, Juan; Mao, Yong; Liu, Xiangrong

    2016-12-01

    The research on resistance genes (R-gene) plays a vital role in bioinformatics as it has the capability of coping with adverse changes in the external environment, which can form the corresponding resistance protein by transcription and translation. It is meaningful to identify and predict R-gene of Larimichthys crocea (L.Crocea). It is friendly for breeding and the marine environment as well. Large amounts of L.Crocea’s immune mechanisms have been explored by biological methods. However, much about them is still unclear. In order to break the limited understanding of the L.Crocea’s immune mechanisms and to detect new R-gene and R-gene-like genes, this paper came up with a more useful combination prediction method, which is to extract and classify the feature of available genomic data by machine learning. The effectiveness of feature extraction and classification methods to identify potential novel R-gene was evaluated, and different statistical analyzes were utilized to explore the reliability of prediction method, which can help us further understand the immune mechanisms of L.Crocea against pathogens. In this paper, a webserver called LCRG-Pred is available at http://server.malab.cn/rg_lc/.

  19. Linezolid-resistant Staphylococcus aureus strain 1128105, the first known clinical isolate possessing the cfr multidrug resistance gene.

    PubMed

    Locke, Jeffrey B; Zuill, Douglas E; Scharn, Caitlyn R; Deane, Jennifer; Sahm, Daniel F; Denys, Gerald A; Goering, Richard V; Shaw, Karen J

    2014-11-01

    The Cfr methyltransferase confers resistance to six classes of drugs which target the peptidyl transferase center of the 50S ribosomal subunit, including some oxazolidinones, such as linezolid (LZD). The mobile cfr gene was identified in European veterinary isolates from the late 1990s, although the earliest report of a clinical cfr-positive strain was the 2005 Colombian methicillin-resistant Staphylococcus aureus (MRSA) isolate CM05. Here, through retrospective analysis of LZD(r) clinical strains from a U.S. surveillance program, we identified a cfr-positive MRSA isolate, 1128105, from January 2005, predating CM05 by 5 months. Molecular typing of 1128105 revealed a unique pulsed-field gel electrophoresis (PFGE) profile most similar to that of USA100, spa type t002, and multilocus sequence type 5 (ST5). In addition to cfr, LZD resistance in 1128105 is partially attributed to the presence of a single copy of the 23S rRNA gene mutation T2500A. Transformation of the ∼37-kb conjugative p1128105 cfr-bearing plasmid from 1128105 into S. aureus ATCC 29213 background strains was successful in recapitulating the Cfr antibiogram, as well as resistance to aminoglycosides and trimethoprim. A 7-kb cfr-containing region of p1128105 possessed sequence nearly identical to that found in the Chinese veterinary Proteus vulgaris isolate PV-01 and in U.S. clinical S. aureus isolate 1900, although the presence of IS431-like sequences is unique to p1128105. The cfr gene environment in this early clinical cfr-positive isolate has now been identified in Gram-positive and Gram-negative strains of clinical and veterinary origin and has been associated with multiple mobile elements, highlighting the versatility of this multidrug resistance gene and its potential for further dissemination.

  20. Unraveling Antimicrobial Resistance Genes and Phenotype Patterns among Enterococcus faecalis Isolated from Retail Chicken Products in Japan

    PubMed Central

    Hidano, Arata; Yamamoto, Takehisa; Hayama, Yoko; Muroga, Norihiko; Kobayashi, Sota; Nishida, Takeshi; Tsutsui, Toshiyuki

    2015-01-01

    Multidrug-resistant enterococci are considered crucial drivers for the dissemination of antimicrobial resistance determinants within and beyond a genus. These organisms may pass numerous resistance determinants to other harmful pathogens, whose multiple resistances would cause adverse consequences. Therefore, an understanding of the coexistence epidemiology of resistance genes is critical, but such information remains limited. In this study, our first objective was to determine the prevalence of principal resistance phenotypes and genes among Enterococcus faecalis isolated from retail chicken domestic products collected throughout Japan. Subsequent analysis of these data by using an additive Bayesian network (ABN) model revealed the co-appearance patterns of resistance genes and identified the associations between resistance genes and phenotypes. The common phenotypes observed among E. faecalis isolated from the domestic products were the resistances to oxytetracycline (58.4%), dihydrostreptomycin (50.4%), and erythromycin (37.2%), and the gene tet(L) was detected in 46.0% of the isolates. The ABN model identified statistically significant associations between tet(L) and erm(B), tet(L) and ant(6)-Ia, ant(6)-Ia and aph(3’)-IIIa, and aph(3’)-IIIa and erm(B), which indicated that a multiple-resistance profile of tetracycline, erythromycin, streptomycin, and kanamycin is systematic rather than random. Conversely, the presence of tet(O) was only negatively associated with that of erm(B) and tet(M), which suggested that in the presence of tet(O), the aforementioned multiple resistance is unlikely to be observed. Such heterogeneity in linkages among genes that confer the same phenotypic resistance highlights the importance of incorporating genetic information when investigating the risk factors for the spread of resistance. The epidemiological factors that underlie the persistence of systematic multiple-resistance patterns warrant further investigations with

  1. Systemic acquired resistance delays race shifts to major resistance genes in bell pepper.

    PubMed

    Romero, A M; Ritchie, D F

    2004-12-01

    ABSTRACT The lack of durability of host plant disease resistance is a major problem in disease control. Genotype-specific resistance that involves major resistance (R) genes is especially prone to failure. The compatible (i.e., disease) host-pathogen interaction with systemic acquired resistance (SAR) has been studied extensively, but the incompatible (i.e., resistant) interaction less so. Using the pepper-bacterial spot (causal agent, Xanthomonas axonopodis pv. vesicatoria) pathosystem, we examined the effect of SAR in reducing the occurrence of race-change mutants that defeat R genes in laboratory, greenhouse, and field experiments. Pepper plants carrying one or more R genes were sprayed with the plant defense activator acibenzolar-S-methyl (ASM) and challenged with incompatible strains of the pathogen. In the greenhouse, disease lesions first were observed 3 weeks after inoculation. ASM-treated plants carrying a major R gene had significantly fewer lesions caused by both the incompatible (i.e., hypersensitive) and compatible (i.e., disease) responses than occurred on nonsprayed plants. Bacteria isolated from the disease lesions were confirmed to be race-change mutants. In field experiments, there was a delay in the detection of race-change mutants and a reduction in disease severity. Decreased disease severity was associated with a reduction in the number of race-change mutants and the suppression of disease caused by the race-change mutants. This suggests a possible mechanism related to a decrease in the pathogen population size, which subsequently reduces the number of race-change mutants for the selection pressure of R genes. Thus, inducers of SAR are potentially useful for increasing the durability of genotype-specific resistance conferred by major R genes.

  2. Anthropogenic antibiotic resistance genes mobilization to the polar regions.

    PubMed

    Hernández, Jorge; González-Acuña, Daniel

    2016-01-01

    Anthropogenic influences in the southern polar region have been rare, but lately microorganisms associated with humans have reached Antarctica, possibly from military bases, fishing boats, scientific expeditions, and/or ship-borne tourism. Studies of seawater in areas of human intervention and proximal to fresh penguin feces revealed the presence of Escherichia coli strains least resistant to antibiotics in penguins, whereas E. coli from seawater elsewhere showed resistance to one or more of the following antibiotics: ampicillin, tetracycline, streptomycin, and trim-sulfa. In seawater samples, bacteria were found carrying extended-spectrum β-lactamase (ESBL)-type CTX-M genes in which multilocus sequencing typing (MLST) showed different sequence types (STs), previously reported in humans. In the Arctic, on the contrary, people have been present for a long time, and the presence of antibiotic resistance genes (ARGs) appears to be much more wide-spread than was previously reported. Studies of E coli from Arctic birds (Bering Strait) revealed reduced susceptibility to antibiotics, but one globally spreading clone of E. coli genotype O25b-ST131, carrying genes of ESBL-type CTX-M, was identified. In the few years between sample collections in the same area, differences in resistance pattern were observed, with E. coli from birds showing resistance to a maximum of five different antibiotics. Presence of resistance-type ESBLs (TEM, SHV, and CTX-M) in E. coli and Klebsiella pneumoniae was also confirmed by specified PCR methods. MLST revealed that those bacteria carried STs that connect them to previously described strains in humans. In conclusion, bacteria previously related to humans could be found in relatively pristine environments, and presently human-associated, antibiotic-resistant bacteria have reached a high global level of distribution that they are now found even in the polar regions.

  3. Detection of glycopeptide resistance genes in enterococci by multiplex PCR

    PubMed Central

    Bhatt, Puneet; Sahni, A.K.; Praharaj, A.K.; Grover, Naveen; Kumar, Mahadevan; Chaudhari, C.N.; Khajuria, Atul

    2014-01-01

    Background Vancomycin Resistant Enterococci (VRE) are a major cause of nosocomial infections. There are various phenotypic and genotypic methods of detection of glycopeptide resistance in enterococci. This study utilizes multiplex PCR for reliable detection of various glycopeptides resistance genes in VRE. Method This study was conducted to detect and to assess the prevalence of vancomycin resistance among enterococci isolates. From October 2011 to June 2013, a total of 96 non-repetitive isolates of enterococci from various clinical samples were analyzed. VRE were identified by Kirby Bauer disc diffusion method with Clinical and Laboratory Standards Institute (CLSI) guidelines. Minimum inhibitory concentration (MIC) of all isolates for vancomycin and teicoplanin was determined by E-test. Multiplex PCR was carried out for all enterococci isolates using six sets of primers. Results Out of 96 isolates, 14 (14.6%) were found to be resistant to vancomycin by vancomycin E-test method (MIC ≥32 μg/ml). Out of these 14 isolates, 13 were also resistant to teicoplanin (MIC ≥16 μg/ml). VanA gene was detected in all the 14 isolates by Multiplex PCR. One of the PCR amplicons was sent for sequencing and the sequence received was submitted in the GenBank (GenBank accession no. KF181100). Conclusion Prevalence of VRE in this study was 14.6%. Multiplex PCR is a robust, sensitive and specific technique, which can be used for rapid detection of various glycopeptide resistance genes. Rapid identification of patients infected or colonized with VRE is essential for implementation of appropriate control measures to prevent their spread. PMID:25609863

  4. Anthropogenic antibiotic resistance genes mobilization to the polar regions

    PubMed Central

    Hernández, Jorge; González-Acuña, Daniel

    2016-01-01

    Anthropogenic influences in the southern polar region have been rare, but lately microorganisms associated with humans have reached Antarctica, possibly from military bases, fishing boats, scientific expeditions, and/or ship-borne tourism. Studies of seawater in areas of human intervention and proximal to fresh penguin feces revealed the presence of Escherichia coli strains least resistant to antibiotics in penguins, whereas E. coli from seawater elsewhere showed resistance to one or more of the following antibiotics: ampicillin, tetracycline, streptomycin, and trim-sulfa. In seawater samples, bacteria were found carrying extended-spectrum β-lactamase (ESBL)-type CTX-M genes in which multilocus sequencing typing (MLST) showed different sequence types (STs), previously reported in humans. In the Arctic, on the contrary, people have been present for a long time, and the presence of antibiotic resistance genes (ARGs) appears to be much more wide-spread than was previously reported. Studies of E coli from Arctic birds (Bering Strait) revealed reduced susceptibility to antibiotics, but one globally spreading clone of E. coli genotype O25b-ST131, carrying genes of ESBL-type CTX-M, was identified. In the few years between sample collections in the same area, differences in resistance pattern were observed, with E. coli from birds showing resistance to a maximum of five different antibiotics. Presence of resistance-type ESBLs (TEM, SHV, and CTX-M) in E. coli and Klebsiella pneumoniae was also confirmed by specified PCR methods. MLST revealed that those bacteria carried STs that connect them to previously described strains in humans. In conclusion, bacteria previously related to humans could be found in relatively pristine environments, and presently human-associated, antibiotic-resistant bacteria have reached a high global level of distribution that they are now found even in the polar regions. PMID:27938628

  5. Functional screening of antibiotic resistance genes from human gut microbiota reveals a novel gene fusion.

    PubMed

    Cheng, Gong; Hu, Yongfei; Yin, Yeshi; Yang, Xi; Xiang, Chunsheng; Wang, Baohong; Chen, Yanfei; Yang, Fengling; Lei, Fang; Wu, Na; Lu, Na; Li, Jing; Chen, Quanze; Li, Lanjuan; Zhu, Baoli

    2012-11-01

    The human gut microbiota has a high density of bacteria that are considered a reservoir for antibiotic resistance genes (ARGs). In this study, one fosmid metagenomic library generated from the gut microbiota of four healthy humans was used to screen for ARGs against seven antibiotics. Eight new ARGs were obtained: one against amoxicillin, six against d-cycloserine, and one against kanamycin. The new amoxicillin resistance gene encodes a protein with 53% identity to a class D β-lactamase from Riemerella anatipestifer RA-GD. The six new d-cycloserine resistance genes encode proteins with 73-81% identity to known d-alanine-d-alanine ligases. The new kanamycin resistance gene encodes a protein of 274 amino acids with an N-terminus (amino acids 1-189) that has 42% identity to the 6'-aminoglycoside acetyltransferase [AAC(6')] from Enterococcus hirae and a C-terminus (amino acids 190-274) with 35% identity to a hypothetical protein from Clostridiales sp. SSC/2. A functional study on the novel kanamycin resistance gene showed that only the N-terminus conferred kanamycin resistance. Our results showed that functional metagenomics is a useful tool for the identification of new ARGs.

  6. Gene set based association analyses for the WSSV resistance of Pacific white shrimp Litopenaeus vannamei.

    PubMed

    Yu, Yang; Liu, Jingwen; Li, Fuhua; Zhang, Xiaojun; Zhang, Chengsong; Xiang, Jianhai

    2017-01-17

    White Spot Syndrome Virus (WSSV) is regarded as a virus with the strongest pathogenicity to shrimp. For the threshold trait such as disease resistance, marker assisted selection (MAS) was considered to be a more effective approach. In the present study, association analyses of single nucleotide polymorphisms (SNPs) located in a set of immune related genes were conducted to identify markers associated with WSSV resistance. SNPs were detected by bioinformatics analysis on RNA sequencing data generated by Illimina sequencing platform and Roche 454 sequencing technology. A total of 681 SNPs located in the exons of immune related genes were selected as candidate SNPs. Among these SNPs, 77 loci were genotyped in WSSV susceptible group and resistant group. Association analysis was performed based on logistic regression method under an additive and dominance model in GenABEL package. As a result, five SNPs showed associations with WSSV resistance at a significant level of 0.05. Besides, SNP-SNP interaction analysis was conducted. The combination of SNP loci in TRAF6, Cu/Zn SOD and nLvALF2 exhibited a significant effect on the WSSV resistance of shrimp. Gene expression analysis revealed that these SNPs might influence the expression of these immune-related genes. This study provides a useful method for performing MAS in shrimp.

  7. Gene set based association analyses for the WSSV resistance of Pacific white shrimp Litopenaeus vannamei

    PubMed Central

    Yu, Yang; Liu, Jingwen; Li, Fuhua; Zhang, Xiaojun; Zhang, Chengsong; Xiang, Jianhai

    2017-01-01

    White Spot Syndrome Virus (WSSV) is regarded as a virus with the strongest pathogenicity to shrimp. For the threshold trait such as disease resistance, marker assisted selection (MAS) was considered to be a more effective approach. In the present study, association analyses of single nucleotide polymorphisms (SNPs) located in a set of immune related genes were conducted to identify markers associated with WSSV resistance. SNPs were detected by bioinformatics analysis on RNA sequencing data generated by Illimina sequencing platform and Roche 454 sequencing technology. A total of 681 SNPs located in the exons of immune related genes were selected as candidate SNPs. Among these SNPs, 77 loci were genotyped in WSSV susceptible group and resistant group. Association analysis was performed based on logistic regression method under an additive and dominance model in GenABEL package. As a result, five SNPs showed associations with WSSV resistance at a significant level of 0.05. Besides, SNP-SNP interaction analysis was conducted. The combination of SNP loci in TRAF6, Cu/Zn SOD and nLvALF2 exhibited a significant effect on the WSSV resistance of shrimp. Gene expression analysis revealed that these SNPs might influence the expression of these immune-related genes. This study provides a useful method for performing MAS in shrimp. PMID:28094323

  8. Novel Nickel Resistance Genes from the Rhizosphere Metagenome of Plants Adapted to Acid Mine Drainage▿ †

    PubMed Central

    Mirete, Salvador; de Figueras, Carolina G.; González-Pastor, Jose E.

    2007-01-01

    Metal resistance determinants have traditionally been found in cultivated bacteria. To search for genes involved in nickel resistance, we analyzed the bacterial community of the rhizosphere of Erica andevalensis, an endemic heather which grows at the banks of the Tinto River, a naturally metal-enriched and extremely acidic environment in southwestern Spain. 16S rRNA gene sequence analysis of rhizosphere DNA revealed the presence of members of five phylogenetic groups of Bacteria and the two main groups of Archaea mostly associated with sites impacted by acid mine drainage (AMD). The diversity observed and the presence of heavy metals in the rhizosphere led us to construct and screen five different metagenomic libraries hosted in Escherichia coli for searching novel nickel resistance determinants. A total of 13 positive clones were detected and analyzed. Insights about their possible mechanisms of resistance were obtained from cellular nickel content and sequence similarities. Two clones encoded putative ABC transporter components, and a novel mechanism of metal efflux is suggested. In addition, a nickel hyperaccumulation mechanism is proposed for a clone encoding a serine O-acetyltransferase. Five clones encoded proteins similar to well-characterized proteins but not previously reported to be related to nickel resistance, and the remaining six clones encoded hypothetical or conserved hypothetical proteins of uncertain functions. This is the first report documenting nickel resistance genes recovered from the metagenome of an AMD environment. PMID:17675438

  9. Transgenic Sugarcane Resistant to Sorghum mosaic virus Based on Coat Protein Gene Silencing by RNA Interference

    PubMed Central

    Guo, Jinlong; Gao, Shiwu; Lin, Qinliang; Wang, Hengbo; Que, Youxiong; Xu, Liping

    2015-01-01

    As one of the critical diseases of sugarcane, sugarcane mosaic disease can lead to serious decline in stalk yield and sucrose content. It is mainly caused by Potyvirus sugarcane mosaic virus (SCMV) and/or Sorghum mosaic virus (SrMV), with additional differences in viral strains. RNA interference (RNAi) is a novel strategy for producing viral resistant plants. In this study, based on multiple sequence alignment conducted on genomic sequences of different strains and isolates of SrMV, the conserved region of coat protein (CP) genes was selected as the target gene and the interference sequence with size of 423 bp in length was obtained through PCR amplification. The RNAi vector pGII00-HACP with an expression cassette containing both hairpin interference sequence and cp4-epsps herbicide-tolerant gene was transferred to sugarcane cultivar ROC22 via Agrobacterium-mediated transformation. After herbicide screening, PCR molecular identification, and artificial inoculation challenge, anti-SrMV positive transgenic lines were successfully obtained. SrMV resistance rate of the transgenic lines with the interference sequence was 87.5% based on SrMV challenge by artificial inoculation. The genetically modified SrMV-resistant lines of cultivar ROC22 provide resistant germplasm for breeding lines and can also serve as resistant lines having the same genetic background for study of resistance mechanisms. PMID:25685813

  10. Heavy metal and disinfectant resistance genes among livestock-associated methicillin-resistant Staphylococcus aureus isolates.

    PubMed

    Argudín, M Angeles; Lauzat, Birgit; Kraushaar, Britta; Alba, Patricia; Agerso, Yvonne; Cavaco, Lina; Butaye, Patrick; Porrero, M Concepción; Battisti, Antonio; Tenhagen, Bernd-Alois; Fetsch, Alexandra; Guerra, Beatriz

    2016-08-15

    Livestock associated methicillin-resistant Staphylococcus aureus (LA-MRSA) has emerged in animal production worldwide. Most LA-MRSA in Europe belong to the clonal complex (CC) 398. The reason for the LA-MRSA emergence is not fully understood. Besides antimicrobial agents used for therapy, other substances with antimicrobial activity applied in animal feed, including metal-containing compounds might contribute to their selection. Some of these genes have been found in various novel SCCmec cassettes. The aim of this study was to assess the occurrence of metal-resistance genes among a LA-S. aureus collection [n=554, including 542 MRSA and 12 methicillin-susceptible S. aureus (MSSA)] isolated from livestock and food thereof. Most LA-MRSA isolates (76%) carried at least one metal-resistance gene. Among the LA-MRSA CC398 isolates (n=456), 4.8%, 0.2%, 24.3% and 71.5% were positive for arsA (arsenic compounds), cadD (cadmium), copB (copper) and czrC (zinc/cadmium) resistance genes, respectively. In contrast, among the LA-MRSA non-CC398 isolates (n=86), 1.2%, 18.6% and 16.3% were positive for the cadD, copB and czrC genes, respectively, and none were positive for arsA. Of the LA-MRSA CC398 isolates, 72% carried one metal-resistance gene, and the remaining harboured two or more in different combinations. Differences between LA-MRSA CC398 and non-CC398 were statistically significant for arsA and czrC. The czrC gene was almost exclusively found (98%) in the presence of SCCmec V in both CC398 and non-CC398 LA-MRSA isolates from different sources. Regarding the LA-MSSA isolates (n=12), some (n=4) were also positive for metal-resistance genes. This study shows that genes potentially conferring metal-resistance are frequently present in LA-MRSA.

  11. Creep Resistance of Disk Alloy CH98 with Tungsten and Niobium Additions

    NASA Technical Reports Server (NTRS)

    Gayda, John

    2003-01-01

    Gas turbine engines for future subsonic transports will likely have higher pressure ratios which will require nickel-base superalloy disks with temperature capability up to 1400 F, an increase of about 200 F over current engines. Several advanced disk alloys are being developed to fill this need. One of these, CH98, is a promising candidate for gas turbine engines and is being studied in NASA's AST Program. Additions of the refractory elements tungsten and niobium have been shown to improve tensile and creep properties while maintaining good high temperature fatigue crack growth resistance. Further improvements in creep and crack growth resistance can be achieved with a coarse grain microstructure. The purpose of the present study is aimed at providing a detailed assessment of 0.2 percent creep rates for coarse grain CH98 with tungsten and niobium additions over a range of temperatures and stresses of interest to disk applications.

  12. Fine-scale analysis of parasite resistance genes in the red flour beetle, Tribolium castaneum.

    PubMed

    Zhong, Daibin; Pai, Aditi; Wang, Mei-Hui; Keech, Naomi; Yan, Guiyun

    2013-09-01

    Parasite infection impacts population dynamics through effects on fitness and fecundity of the individual host. In addition to the known roles of environmental factors, host susceptibility to parasites has a genetic basis that has not been well characterized. We previously mapped quantitative trait loci (QTL) for susceptibility to rat tapeworm (Hymenolepis diminuta) infection in Tribolium castaneum using dominant AFLP markers; however, the resistance genes were not identified. Here, we refined the QTL locations and increased the marker density in the QTL regions using new microsatellite markers, sequence-tagged site markers, and single-strand conformational polymorphism markers. Resistance QTL in three linkage groups (LG3, LG6, and LG8) were each mapped to intervals <1.0 cM between two codominant markers. The effects of 21 genes in the three QTL regions were investigated by using quantitative RT-PCR analysis, and transcription profiles were obtained from the resistant TIW1 and the susceptible cSM strains. Based on transcription data, eight genes were selected for RNA interference analysis to investigate their possible roles in H. diminuta resistance, including cytochrome P450 (LOC657454) and Toll-like receptor 13 (TLR13, LOC662131). The transcription of P450 and TLR13 genes in the resistant TIW1 strains was reduced more than ninefold relative to the control. Moreover, the effects of gene knockdown of P450 and TLR13 caused resistant beetles to become susceptible to tapeworm infection, which strongly suggests an important role for each in T. castaneum resistance to H. diminuta infection.

  13. Identification of wheat chromosomal regions containing expressed resistance genes.

    PubMed Central

    Dilbirligi, Muharrem; Erayman, Mustafa; Sandhu, Devinder; Sidhu, Deepak; Gill, Kulvinder S

    2004-01-01

    The objectives of this study were to isolate and physically localize expressed resistance (R) genes on wheat chromosomes. Irrespective of the host or pest type, most of the 46 cloned R genes from 12 plant species share a strong sequence similarity, especially for protein domains and motifs. By utilizing this structural similarity to perform modified RNA fingerprinting and data mining, we identified 184 putative expressed R genes of wheat. These include 87 NB/LRR types, 16 receptor-like kinases, and 13 Pto-like kinases. The remaining were seven Hm1 and two Hs1(pro-1) homologs, 17 pathogenicity related, and 42 unique NB/kinases. About 76% of the expressed R-gene candidates were rare transcripts, including 42 novel sequences. Physical mapping of 121 candidate R-gene sequences using 339 deletion lines localized 310 loci to 26 chromosomal regions encompassing approximately 16% of the wheat genome. Five major R-gene clusters that spanned only approximately 3% of the wheat genome but contained approximately 47% of the candidate R genes were observed. Comparative mapping localized 91% (82 of 90) of the phenotypically characterized R genes to 18 regions where 118 of the R-gene sequences mapped. PMID:15020436

  14. MicroRNAs suppress NB domain genes in tomato that confer resistance to Fusarium oxysporum.

    PubMed

    Ouyang, Shouqiang; Park, Gyungsoon; Atamian, Hagop S; Han, Cliff S; Stajich, Jason E; Kaloshian, Isgouhi; Borkovich, Katherine A

    2014-10-01

    MicroRNAs (miRNAs) suppress the transcriptional and post-transcriptional expression of genes in plants. Several miRNA families target genes encoding nucleotide-binding site-leucine-rich repeat (NB-LRR) plant innate immune receptors. The fungus Fusarium oxysporum f. sp. lycopersici causes vascular wilt disease in tomato. We explored a role for miRNAs in tomato defense against F. oxysporum using comparative miRNA profiling of susceptible (Moneymaker) and resistant (Motelle) tomato cultivars. slmiR482f and slmiR5300 were repressed during infection of Motelle with F. oxysporum. Two predicted mRNA targets each of slmiR482f and slmiR5300 exhibited increased expression in Motelle and the ability of these four targets to be regulated by the miRNAs was confirmed by co-expression in Nicotiana benthamiana. Silencing of the targets in the resistant Motelle cultivar revealed a role in fungal resistance for all four genes. All four targets encode proteins with full or partial nucleotide-binding (NB) domains. One slmiR5300 target corresponds to tm-2, a susceptible allele of the Tomato Mosaic Virus resistance gene, supporting functions in immunity to a fungal pathogen. The observation that none of the targets correspond to I-2, the only known resistance (R) gene for F. oxysporum in tomato, supports roles for additional R genes in the immune response. Taken together, our findings suggest that Moneymaker is highly susceptible because its potential resistance is insufficiently expressed due to the action of miRNAs.

  15. MicroRNAs Suppress NB Domain Genes in Tomato That Confer Resistance to Fusarium oxysporum

    DOE PAGES

    Ouyang, Shouqiang; Park, Gyungsoon; Atamian, Hagop S.; ...

    2014-10-16

    MicroRNAs (miRNAs) suppress the transcriptional and post-transcriptional expression of genes in plants. Several miRNA families target genes encoding nucleotide-binding site–leucine-rich repeat (NB-LRR) plant innate immune receptors. The fungus Fusarium oxysporum f. sp. lycopersici causes vascular wilt disease in tomato. Here, we explored a role for miRNAs in tomato defense against F. oxysporum using comparative miRNA profiling of susceptible (Moneymaker) and resistant (Motelle) tomato cultivars. slmiR482f and slmiR5300 were repressed during infection of Motelle with F. oxysporum. Two predicted mRNA targets each of slmiR482f and slmiR5300 exhibited increased expression in Motelle and the ability of these four targets to be regulatedmore » by the miRNAs was confirmed by co-expression in Nicotiana benthamiana. Silencing of the targets in the resistant Motelle cultivar revealed a role in fungal resistance for all four genes. All four targets encode proteins with full or partial nucleotide-binding (NB) domains. One slmiR5300 target corresponds to tm-2, a susceptible allele of the Tomato Mosaic Virus resistance gene, supporting functions in immunity to a fungal pathogen. The observation that none of the targets correspond to I-2, the only known resistance (R) gene for F. oxysporum in tomato, supports roles for additional R genes in the immune response. In conclusion, taken together, our findings suggest that Moneymaker is highly susceptible because its potential resistance is insufficiently expressed due to the action of miRNAs.« less

  16. MicroRNAs Suppress NB Domain Genes in Tomato That Confer Resistance to Fusarium oxysporum

    SciTech Connect

    Ouyang, Shouqiang; Park, Gyungsoon; Atamian, Hagop S.; Han, Cliff S.; Stajich, Jason E.; Kaloshian, Isgouhi; Borkovich, Katherine A.

    2014-10-16

    MicroRNAs (miRNAs) suppress the transcriptional and post-transcriptional expression of genes in plants. Several miRNA families target genes encoding nucleotide-binding site–leucine-rich repeat (NB-LRR) plant innate immune receptors. The fungus Fusarium oxysporum f. sp. lycopersici causes vascular wilt disease in tomato. Here, we explored a role for miRNAs in tomato defense against F. oxysporum using comparative miRNA profiling of susceptible (Moneymaker) and resistant (Motelle) tomato cultivars. slmiR482f and slmiR5300 were repressed during infection of Motelle with F. oxysporum. Two predicted mRNA targets each of slmiR482f and slmiR5300 exhibited increased expression in Motelle and the ability of these four targets to be regulated by the miRNAs was confirmed by co-expression in Nicotiana benthamiana. Silencing of the targets in the resistant Motelle cultivar revealed a role in fungal resistance for all four genes. All four targets encode proteins with full or partial nucleotide-binding (NB) domains. One slmiR5300 target corresponds to tm-2, a susceptible allele of the Tomato Mosaic Virus resistance gene, supporting functions in immunity to a fungal pathogen. The observation that none of the targets correspond to I-2, the only known resistance (R) gene for F. oxysporum in tomato, supports roles for additional R genes in the immune response. In conclusion, taken together, our findings suggest that Moneymaker is highly susceptible because its potential resistance is insufficiently expressed due to the action of miRNAs.

  17. Gene pyramiding enhances durable blast disease resistance in rice.

    PubMed

    Fukuoka, Shuichi; Saka, Norikuni; Mizukami, Yuko; Koga, Hironori; Yamanouchi, Utako; Yoshioka, Yosuke; Hayashi, Nagao; Ebana, Kaworu; Mizobuchi, Ritsuko; Yano, Masahiro

    2015-01-14

    Effective control of blast, a devastating fungal disease of rice, would increase and stabilize worldwide food production. Resistance mediated by quantitative trait loci (QTLs), which usually have smaller individual effects than R-genes but confer broad-spectrum or non-race-specific resistance, is a promising alternative to less durable race-specific resistance for crop improvement, yet evidence that validates the impact of QTL combinations (pyramids) on the durability of plant disease resistance has been lacking. Here, we developed near-isogenic experimental lines representing all possible combinations of four QTL alleles from a durably resistant cultivar. These lines enabled us to evaluate the QTLs singly and in combination in a homogeneous genetic background. We present evidence that pyramiding QTL alleles, each controlling a different response to M. oryzae, confers strong, non-race-specific, environmentally stable resistance to blast disease. Our results suggest that this robust defence system provides durable resistance, thus avoiding an evolutionary "arms race" between a crop and its pathogen.

  18. Cloning and characterization of the durable tomato mosaic virus resistance gene Tm-2(2) from Lycopersicon esculentum.

    PubMed

    Lanfermeijer, Frank C; Dijkhuis, Jos; Sturre, Marcel J G; de Haan, Peter; Hille, Jacques

    2003-07-01

    In tomato, infections by tomato mosaic virus are controlled by durable Tm-2(2) resistance. In order to gain insight into the processes underlying disease resistance and its durability, we cloned and analysed the Tm-2(2) resistance gene and the susceptible allele, tm-2. The Tm-2(20 gene was isolated by transposon tagging using a screen in which plants with a destroyed Tm-2(2) gene survive. The Tm-2(2) locus consists of a single gene that encodes an 861 amino acid polypeptide, which belongs to the CC-NBS-LRR class of resistance proteins. The putative tm-2 allele was cloned from susceptible tomato lines via PCR with primers based on the Tm-2(2) sequence. Interestingly, the tm-2 gene has an open reading frame that is comparable to the Tm-2(2) allele. Between the tm-2 and the Tm-2(2) polypeptide 38 amino acid differences are present of which 26 are located in the second half of the LRR-domain. Susceptible tomato plants, which were transformed with the Tm-2(2) gene, displayed resistance against ToMV infection. In addition, virus specificity, displayed by the Tm-2(2) resistance was conserved in these transgenic lines. To explain the durability of this resistance, it is proposed that the Tm-2(2)-encoded resistance is aimed at the Achilles' heel of the virus.

  19. Analysis of Genes Involved in Arsenic Resistance in Corynebacterium glutamicum ATCC 13032†

    PubMed Central

    Ordóñez, Efrén; Letek, Michal; Valbuena, Noelia; Gil, José A.; Mateos, Luis M.

    2005-01-01

    Corynebacterium glutamicum is able to grow in media containing up to 12 mM arsenite and 500 mM arsenate and is one of the most arsenic-resistant microorganisms described to date. Two operons (ars1 and ars2) involved in arsenate and arsenite resistance have been identified in the complete genome sequence of Corynebacterium glutamicum. The operons ars1 and ars2 are located some distance from each other in the bacterial chromosome, but they are both composed of genes encoding a regulatory protein (arsR), an arsenite permease (arsB), and an arsenate reductase (arsC); operon ars1 contains an additional arsenate reductase gene (arsC1′) located immediately downstream from arsC1. Additional arsenite permease and arsenate reductase genes (arsB3 and arsC4) scattered on the chromosome were also identified. The involvement of ars operons in arsenic resistance in C. glutamicum was confirmed by gene disruption experiments of the three arsenite permease genes present in its genome. Wild-type and arsB3 insertional mutant C. glutamicum strains were able to grow with up to 12 mM arsenite, whereas arsB1 and arsB2 C. glutamicum insertional mutants were resistant to 4 mM and 9 mM arsenite, respectively. The double arsB1-arsB2 insertional mutant was resistant to only 0.4 mM arsenite and 10 mM arsenate. Gene amplification assays of operons ars1 and ars2 in C. glutamicum revealed that the recombinant strains containing the ars1 operon were resistant to up to 60 mM arsenite, this being one of the highest levels of bacterial resistance to arsenite so far described, whereas recombinant strains containing operon ars2 were resistant to only 20 mM arsenite. Northern blot and reverse transcription-PCR analysis confirmed the presence of transcripts for all the ars genes, the expression of arsB3 and arsC4 being constitutive, and the expression of arsR1, arsB1, arsC1, arsC1′, arsR2, arsB2, and arsC2 being inducible by arsenite. PMID:16204540

  20. Resistance Gene Transfer during Treatments for Experimental Avian Colibacillosis

    PubMed Central

    Dheilly, Alexandra; Le Devendec, Laëtitia; Mourand, Gwenaëlle; Bouder, Axelle; Jouy, Eric

    2012-01-01

    An experiment was conducted in animal facilities to compare the impacts of four avian colibacillosis treatments—oxytetracycline (OTC), trimethoprim-sulfadimethoxine (SXT), amoxicillin (AMX), or enrofloxacin (ENR)—on the susceptibility of Escherichia coli in broiler intestinal tracts. Birds were first orally inoculated with rifampin-resistant E. coli strains bearing plasmid genes conferring resistance to fluoroquinolones (qnr), cephalosporins (blaCTX-M or blaFOX), trimethoprim-sulfonamides, aminoglycosides, or tetracyclines. Feces samples were collected before, during, and after antimicrobial treatments. The susceptibilities of E. coli strains were studied, and resistance gene transfer was analyzed. An increase in the tetracycline-resistant E. coli population was observed only in OTC-treated birds, whereas multiresistant E. coli was detected in the dominant E. coli populations of SXT-, AMX-, or ENR-treated birds. Most multiresistant E. coli strains were susceptible to rifampin and exhibited various pulsed-field gel electrophoresis profiles, suggesting the transfer of one of the multiresistance plasmids from the inoculated strains to other E. coli strains in the intestinal tract. In conclusion, this study clearly illustrates how, in E. coli, “old” antimicrobials may coselect antimicrobial resistance to recent and critical molecules. PMID:21986830

  1. Environmental and Public Health Implications of Water Reuse: Antibiotics, Antibiotic Resistant Bacteria, and Antibiotic Resistance Genes

    PubMed Central

    Hong, Pei-Ying; Al-Jassim, Nada; Ansari, Mohd Ikram; Mackie, Roderick I.

    2013-01-01

    Water scarcity is a global problem, and is particularly acute in certain regions like Africa, the Middle East, as well as the western states of America. A breakdown on water usage revealed that 70% of freshwater supplies are used for agricultural irrigation. The use of reclaimed water as an alternative water source for agricultural irrigation would greatly alleviate the demand on freshwater sources. This paradigm shift is gaining momentum in several water scarce countries like Saudi Arabia. However, microbial problems associated with reclaimed water may hinder the use of reclaimed water for agricultural irrigation. Of particular concern is that the occurrence of antibiotic residues in the reclaimed water can select for antibiotic resistance genes among the microbial community. Antibiotic resistance genes can be associated with mobile genetic elements, which in turn allow a promiscuous transfer of resistance traits from one bacterium to another. Together with the pathogens that are present in the reclaimed water, antibiotic resistant bacteria can potentially exchange mobile genetic elements to create the “perfect microbial storm”. Given the significance of this issue, a deeper understanding of the occurrence of antibiotics in reclaimed water, and their potential influence on the selection of resistant microorganisms would be essential. In this review paper, we collated literature over the past two decades to determine the occurrence of antibiotics in municipal wastewater and livestock manure. We then discuss how these antibiotic resistant bacteria may impose a potential microbial risk to the environment and public health, and the knowledge gaps that would have to be addressed in future studies. Overall, the collation of the literature in wastewater treatment and agriculture serves to frame and identify potential concerns with respect to antibiotics, antibiotic resistant bacteria, and antibiotic resistance genes in reclaimed water. PMID:27029309

  2. Characterization of the duodenase-1 gene and its associations with resistance to Streptococuus agalactiae in hybrid tilapia (Oreochromis spp.).

    PubMed

    Shen, Yubang; Fu, Gui Hong; Liu, Feng; Yue, Gen Hua

    2015-08-01

    Tilapia is a group of cultured teleost fishes whose production is threatened by some diseases. Identification of DNA markers associated with disease resistance in candidate genes may facilitate to accelerate the selection of disease resistance. The gene encoding a duodenase, which can trigger immune response, has not been studied in fish. We characterized the cDNA of duodenase-1 gene of hybrid tilapia. Its ORF is 759 bp, encoding a serine protease of 252 amino acids. This gene consisted of five exons and four introns. Its expression was detected in all 10 tissues examined, and it was highly expressed in the intestine and kidney. After a challenge with the bacterial pathogen, Streptococcus agalactiae, its expression was up-regulated significantly in the intestine, liver and spleen. We identified seven SNPs in the gene and found that four of them were significantly associated with the resistance to S. agalactiae (P < 0.05). The CGTCC haplotype, CAGTC/CGGTC and CGTCC/CGTCC diplotype were significantly associated with the resistance to S. agalactiae (P = 0.00, 0.04 and < 0.0001, respectively). In addition, one SNP was associated significantly with growth traits (P < 0.05). These findings suggest that the duodenase-1 gene plays an important role in the resistance to S. agalactiae in tilapia. The SNP markers in the duodenase-1 gene associated with resistance to the bacterial pathogen, may facilitate the selection of tilapia resistant to the bacterial disease.

  3. Continental-scale pollution of estuaries with antibiotic resistance genes.

    PubMed

    Zhu, Yong-Guan; Zhao, Yi; Li, Bing; Huang, Chu-Long; Zhang, Si-Yu; Yu, Shen; Chen, Yong-Shan; Zhang, Tong; Gillings, Michael R; Su, Jian-Qiang

    2017-01-30

    Antibiotic resistance genes (ARGs) have moved from the environmental resistome into human commensals and pathogens, driven by human selection with antimicrobial agents. These genes have increased in abundance in humans and domestic animals, to become common components of waste streams. Estuarine habitats lie between terrestrial/freshwater and marine ecosystems, acting as natural filtering points for pollutants. Here, we have profiled ARGs in sediments from 18 estuaries over 4,000 km of coastal China using high-throughput quantitative polymerase chain reaction, and investigated their relationship with bacterial communities, antibiotic residues and socio-economic factors. ARGs in estuarine sediments were diverse and abundant, with over 200 different resistance genes being detected, 18 of which were found in all 90 sediment samples. The strong correlations of identified resistance genes with known mobile elements, network analyses and partial redundancy analysis all led to the conclusion that human activity is responsible for the abundance and dissemination of these ARGs. Such widespread pollution with xenogenetic elements has environmental, agricultural and medical consequences.

  4. Evolution of Resistance Against CRISPR/Cas9 Gene Drive.

    PubMed

    Unckless, Robert L; Clark, Andrew G; Messer, Philipp W

    2017-02-01

    CRISPR/Cas9 gene drive (CGD) promises to be a highly adaptable approach for spreading genetically engineered alleles throughout a species, even if those alleles impair reproductive success. CGD has been shown to be effective in laboratory crosses of insects, yet it remains unclear to what extent potential resistance mechanisms will affect the dynamics of this process in large natural populations. Here we develop a comprehensive population genetic framework for modeling CGD dynamics, which incorporates potential resistance mechanisms as well as random genetic drift. Using this framework, we calculate the probability that resistance against CGD evolves from standing genetic variation, de novo mutation of wild-type alleles, or cleavage repair by nonhomologous end joining (NHEJ)-a likely by-product of CGD itself. We show that resistance to standard CGD approaches should evolve almost inevitably in most natural populations, unless repair of CGD-induced cleavage via NHEJ can be effectively suppressed, or resistance costs are on par with those of the driver. The key factor determining the probability that resistance evolves is the overall rate at which resistance alleles arise at the population level by mutation or NHEJ. By contrast, the conversion efficiency of the driver, its fitness cost, and its introduction frequency have only minor impact. Our results shed light on strategies that could facilitate the engineering of drivers with lower resistance potential, and motivate the possibility to embrace resistance as a possible mechanism for controlling a CGD approach. This study highlights the need for careful modeling of the population dynamics of CGD prior to the actual release of a driver construct into the wild.

  5. Evaluating the mobility potential of antibiotic resistance genes in environmental resistomes without metagenomics

    PubMed Central

    Pärnänen, Katariina; Karkman, Antti; Tamminen, Manu; Lyra, Christina; Hultman, Jenni; Paulin, Lars; Virta, Marko

    2016-01-01

    Antibiotic resistance genes are ubiquitous in the environment. However, only a fraction of them are mobile and able to spread to pathogenic bacteria. Until now, studying the mobility of antibiotic resistance genes in environmental resistomes has been challenging due to inadequate sensitivity and difficulties in contig assembly of metagenome based methods. We developed a new cost and labor efficient method based on Inverse PCR and long read sequencing for studying mobility potential of environmental resistance genes. We applied Inverse PCR on sediment samples and identified 79 different MGE clusters associated with the studied resistance genes, including novel mobile genetic elements, co-selected resistance genes and a new putative antibiotic resistance gene. The results show that the method can be used in antibiotic resistance early warning systems. In comparison to metagenomics, Inverse PCR was markedly more sensitive and provided more data on resistance gene mobility and co-selected resistances. PMID:27767072

  6. Using SNP genetic markers to elucidate the linkage of the Co-34/Phg-3 anthracnose and angular leaf spot resistance gene cluster with the Ur-14 resistance gene

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The Ouro Negro common bean cultivar contains the Co-34/Phg-3 gene cluster that confers resistance to the anthracnose (ANT) and angular leaf spot (ALS) pathogens. These genes are tightly linked on chromosome 4. Ouro Negro also has the Ur-14 rust resistance gene, reportedly in the vicinity of Co- 34; ...

  7. Preparation and ageing-resistant properties of polyester composites modified with functional nanoscale additives

    PubMed Central

    2014-01-01

    This study investigated ageing-resistant properties of carboxyl-terminated polyester (polyethylene glycol terephthalate) composites modified with nanoscale titanium dioxide particles (nano-TiO2). The nano-TiO2 was pretreated by a dry coating method, with aluminate coupling agent as a functional grafting additive. The agglomeration resistance was evaluated, which exhibited significant improvement for the modified nanoparticles. Then, the effects of the modified nano-TiO2 on the crosslinking and ageing-resistant properties of the composites were studied. With a real-time Fourier transform infrared (FT-IR) measurement, the nano-TiO2 displayed promoting effect on the crosslinking of polyester resin with triglycidyl isocyanurate (TGIC) as crosslinking agent. Moreover, the gloss retention, colour aberration and the surface morphologies of the composites during accelerated UV ageing (1500 hours) were investigated. The results demonstrated much less degree of ageing degradation for the nanocomposites, indicating an important role of the nano-TiO2 in improving the ageing-resistant properties of synthetic polymer composites. PMID:24872802

  8. Multiple drug resistance genes in malaria -- from epistasis to epidemiology.

    PubMed

    Duraisingh, Manoj T; Refour, Philippe

    2005-08-01

    A decline in our ability to successfully treat patients with malaria infections of the parasitic protozoan Plasmodium falciparum with cheap quinoline drugs has led to a huge escalation in morbidity and mortality in recent years. Many approaches have been taken, including classical genetics, reverse genetics and molecular epidemiology, to identify the molecular determinants underlying this resistance. The contribution of the P. falciparum multidrug resistance gene, pfmdr1, to antimalarial resistance has been a source of controversy for over a decade since it was first identified. In the current issue of Molecular Microbiology, Sidhu and colleagues use powerful reverse genetics to demonstrate the importance of commonly occurring alleles of pfmdr1 in conferring resistance to the second-line drugs quinine and sensitivity to the new alternatives mefloquine and artemisinin. They also elegantly highlight the importance of genetic background and epistasis between pfmdr1 and other potential modulators of drug resistance. Such molecular knowledge will facilitate surveillance/monitoring and aid the development of strategies for the reversal of resistance.

  9. Improved antibiotic resistance gene cassette for marker exchange mutagenesis in Ralstonia solanacearum and Burkholderia species.

    PubMed

    Um, Hae Young; Chung, Eunsook; Lee, Jai-Heon; Lee, Seon-Woo

    2011-04-01

    Marker exchange mutagenesis is a fundamental approach to understanding gene function at a molecular level in bacteria. New plasmids carrying a kanamycin resistance gene or a trimethoprim resistance gene were constructed to provide antibiotic resistance cassettes for marker exchange mutagenesis in Ralstonia solanacearum and many antibiotic-resistant Burkholderia spp. Insertion sequences present in the flanking sequences of the antibiotic resistance cassette were removed to prevent aberrant gene replacement and polar mutation during mutagenesis in wild-type bacteria. Plasmids provided in this study would be convenient for use in gene cassettes for gene replacement in other Gram-negative bacteria.

  10. Microbiological Quality and Prevalence of β-Lactam Antibiotic Resistance Genes in Oysters ( Crassostrea rhizophorae ).

    PubMed

    Brandão, Maria Aparecida da RessurreiÇão; Lopes, Amanda Teixeira Sampaio; Neta, Maria Tereza da Silva; de Oliveira, Rhyan Barros Farias; Rezende, Rachel Passos; Albuquerque, George Rêgo; Gonçalves, Verônica Dias; Rodrigues, Dália Dos Prazeres; Boehs, Guisla; Maciel, Bianca Mendes

    2017-03-01

    The microbiological quality of oysters reflects the microbiological quality of their habitats because they are filter feeders. The objective of this study was to assess the bacterial composition of the edible oyster Crassostrea rhizophorae in urban and preserved estuaries. Particularly, we assessed the presence of pathogenic bacteria, investigated antibiotic susceptibility in bacterial isolates, and quantified β-lactam antibiotic resistance genes (blaTEM, blaSHV, and blaKPC) via quantitative PCR of oyster DNA. Our results detected total coliforms, Escherichia coli , and enterobacteria in the oysters from urban estuaries, which is indicative of poor water quality. In addition, our detection of the eaeA and stxA2 virulence genes in 16.7% of E. coli isolates from oysters from this region suggests the presence of multiantibiotic-resistant enteropathogenic and enterohemorrhagic E. coli strains. During periods of low precipitation, increased contamination by E. coli (in winter) and Vibrio parahaemolyticus (in autumn) was observed. In contrast, cultivated oysters inhabiting monitored farms in preserved areas had low levels of bacterial contamination, emphasizing that oyster culture monitoring enhances food quality and makes oysters fit for human consumption. Distinct antibiotic resistance profiles were observed in bacteria isolated from oysters collected from different areas, including resistance to β-lactam antibiotics. The presence of the blaTEM gene in 91.3% of oyster samples indicated that microorganisms in estuarine water conferred the capability to produce β-lactamase. To our knowledge, this is the first study to directly quantify and detect β-lactam antibiotic resistance genes in oysters. We believe our study provides baseline data for bacterial dynamics in estuarine oysters; such knowledge contributes to developing risk assessments to determine the associated hazards and consequences of consuming oysters from aquatic environments containing pathogenic bacteria

  11. Abundance and persistence of antibiotic resistance genes in livestock farms: a comprehensive investigation in eastern China.

    PubMed

    Cheng, Weixiao; Chen, Hong; Su, Chao; Yan, Shuhai

    2013-11-01

    Increases of antibiotic resistance genes in the environment may pose a threat to public health. The purpose of this study was to investigate the abundance and diversity of tetracycline (tet) and sulfonamide (sul) resistance genes in eight livestock farms in Hangzhou, eastern China. Ten tet genes (tetA, tetB, tetC, tetG, tetL, tetM, tetO, tetQ, tetW, and tetX), two sul genes (sulI and sulII), and one genetic element associated with mobile antibiotic resistance genes [class 1 integron (intI1)] were quantified by real-time polymerase chain reaction. No significant difference was found in the abundance of the tet and sul genes in various scales of pig, chicken, and duck farms (P>0.05). The average abundance of ribosomal protection protein genes (tetQ, tetM, tetW, and tetO) in the manure and wastewater samples was higher than most of the efflux pump genes (tetA, tetB, tetC, and tetL) and enzymatic modification gene (tetX) (P<0.05), except for efflux pump gene tetG, which was abundant and showed no difference from tetM. Most ARGs had higher relative abundance in the wastewater lagoon than in manures even after treatment. Although the three ribosomal protection protein genes (tetQ, tetW, and tetO) had higher relative abundance, numbers were reduced during the complete wastewater treatment process in pig farms (P<0.05). The relative abundance of tetG, sulI, and sulII increased after the wastewater treatment and the removal of these three genes exhibited significant positive correlations with the intI1 gene (tetG: R(2)=0.60, P<0.05; sulI: R(2)=0.72, P<0.05; sulII: R(2)=0.62, P<0.05), suggesting that intI1 may be involved in their proliferation. As for tetM and sulII genes, a highly significant difference was found in manure samples between pig farms and duck farms (P<0.001). Phylogenetic analysis showed that tetM was more diverse in duck farms than in pig farms. Additionally, sulII sequence was conserved both in pig and duck farms. This is the first comprehensive study to

  12. Integrated Metabolo-Transcriptomics Reveals Fusarium Head Blight Candidate Resistance Genes in Wheat QTL-Fhb2

    PubMed Central

    Dhokane, Dhananjay; Karre, Shailesh; Kushalappa, Ajjamada C.; McCartney, Curt

    2016-01-01

    report that the wheat resistance QTL-Fhb2 is associated with high rachis resistance through additive resistance effects of genes, based on cell wall enforcement and detoxification of DON. Following further functional characterization and validation, these resistance genes can be used to replace the genes in susceptible commercial cultivars, if nonfunctional, based on genome editing to improve FHB resistance. PMID:27232496

  13. Nonlinear resistance of polymer composites with carbon nanotube additives in the percolation state

    NASA Astrophysics Data System (ADS)

    Bocharov, G. S.; Eletskii, A. V.; Knizhnik, A. A.

    2016-10-01

    The electrical properties of a polymer composite with carbon nanotube additives have been analyzed. The state of the system near the percolation threshold, when charge is transferred along a single percolation path, has been considered. For this state, the current-voltage characteristics of a percolation chain made up of carbon nanotubes have been calculated under the assumption that the contact resistance between neighboring nanotubes is much higher than the intrinsic resistance of the nanotubes. According to recent data, the distance between neighboring (contacting) nanotubes has been assumed to be randomly distributed. It has been shown that, under the given conditions, the current-voltage characteristic is essentially nonlinear. This indicates the nonohmic conductivity of the composites. The dependence of the current-voltage characteristic on the spread of the contact distribution over distances has been discussed.

  14. Identification of genes differentially expressed in the phytopathogenic fungus Cercospora nicotianae between cercosporin toxin-resistant and -susceptible strains.

    PubMed

    Herrero, Sonia; Amnuaykanjanasin, Alongkorn; Daub, Margaret E

    2007-10-01

    Plant pathogens from the genus Cercospora produce cercosporin, a photoactivated fungal toxin that generates toxic reactive oxygen species. Mechanisms governing toxin auto-resistance in Cercospora spp. are poorly understood. In this work, suppressive subtractive hybridization was used to identify genes differentially expressed between the cercosporin-resistant wild-type (WT) Cercospora nicotianae and a sensitive strain lacking a transcription factor (CRG1) that regulates resistance. Out of 338 sequences recovered, 185 unique expressed sequence tags (ESTs) were obtained and classified into functional categories. The majority of genes showed predicted expression differences, and 38.5% were differentially expressed at least twofold between the WT and mutant strain. ESTs were recovered with homology to genes involved in detoxification of noxious compounds, multidrug membrane transporters and antioxidant and polyketide biosynthetic enzymes as well as to ATPases and ATP synthases. The findings suggest that CRG1 regulates genes involved in pH responses in addition to those involved in toxin resistance and biosynthesis.

  15. Inheritance and molecular mapping of a gene conferring seedling resistance against Puccinia hordei in the barley cultivar Ricardo.

    PubMed

    Sandhu, K S; Forrest, K L; Kong, S; Bansal, U K; Singh, D; Hayden, M J; Park, R F

    2012-11-01

    Genetic studies were undertaken to determine the inheritance and genomic location of uncharacterised seedling resistance to leaf rust, caused by Puccinia hordei, in the barley cultivar Ricardo. The resistance was shown to be conferred by a single dominant gene, which was tentatively designated RphRic. Bulk segregant analysis (BSA) and genetic mapping of an F(3) mapping population using multiplex-ready SSR genotyping and Illumina GoldenGate SNP assay located RphRic in chromosome 4H. Given that this is the first gene for leaf rust resistance mapped on chromosome 4H, it was designated Rph21. The presence of an additional gene, Rph2, in Ricardo, was confirmed by the test of allelism. The seedling gene Rph21 has shown effectiveness against all Australian pathotypes of P. hordei tested since at least 1992 and hence represents a new and useful source of resistance to this pathogen.

  16. Additional duplicated Hox genes in the earthworm: Perionyx excavatus Hox genes consist of eleven paralog groups.

    PubMed

    Cho, Sung-Jin; Vallès, Yvonne; Kim, Kyong Min; Ji, Seong Chul; Han, Seock Jung; Park, Soon Cheol

    2012-02-10

    Annelida is a lophotrochozoan phylum whose members have a high degree of diversity in body plan morphology, reproductive strategies and ecological niches among others. Of the two traditional classes pertaining to the phylum Annelida (Polychaete and Clitellata), the structure and function of the Hox genes has not been clearly defined within the Oligochaeta class. Using a PCR-based survey, we were able to identify five new Hox genes from the earthworm Perionyx excavatus: a Hox3 gene (Pex-Hox3b), two Dfd genes (Pex-Lox6 and Pex-Lox18), and two posterior genes (Pex-post1 and -post2a). Our result suggests that the eleven earthworm Hox genes contain at least four paralog groups (PG) that have duplicated. We found the clitellates-diagnostic signature residues and annelid signature motif. Also, we show by semi-quantitative RT-PCR that duplicated Hox gene orthologs are differentially expressed in six different anterior-posterior body regions. These results provide essential data for comparative evolution of the Hox cluster within the Annelida.

  17. Metabolo-proteomics to discover plant biotic stress resistance genes.

    PubMed

    Kushalappa, Ajjamada C; Gunnaiah, Raghavendra

    2013-09-01

    Plants continuously encounter various environmental stresses and use qualitative and quantitative measures to resist pathogen attack. Qualitative stress responses, based on monogenic inheritance, have been elucidated and successfully used in plant improvement. By contrast, quantitative stress responses remain largely unexplored in plant breeding, due to complex polygenic inheritance, although hundreds of quantitative trait loci for resistance have been identified. Recent advances in metabolomic and proteomic technologies now offer opportunities to overcome the hurdle of polygenic inheritance and identify candidate genes for use in plant breeding, thus improving the global food security. In this review, we describe a conceptual background to the plant-pathogen relationship and propose ten heuristic steps streamlining the application of metabolo-proteomics to improve plant resistance to biotic stress.

  18. Treatment-resistant depression in adolescents: is the addition of cognitive behavioral therapy of benefit?

    PubMed Central

    Hetrick, Sarah E; Cox, Georgina R; Merry, Sally N

    2011-01-01

    Background Many young people with major depression fail first-line treatments. Treatment-resistant depression has various definitions in the literature but typically assumes nonresponse to medication. In young people, cognitive behavioral therapy (CBT) is the recommended first-line intervention, thus the definition of treatment resistance should be expanded. Therefore, our aim was to synthesize the existing evidence of any interventions for treatment-resistant depression, broadly defined, in children and adolescents and to investigate the effectiveness of CBT in this context. Methods We used Cochrane Collaboration methodology, with electronic searches of Medline, PsycINFO, Embase, and the Cochrane Depression Anxiety and Neurosis Group trials registers. Only randomized controlled trials were included, and were assessed for risk of bias. Meta- analysis was undertaken where possible and appropriate. Results Of 953 articles retrieved, four trials were eligible for inclusion. For one study, only the trial registration document was available, because the study was never completed. All other studies were well conducted with a low risk of bias, although one study had a high dropout rate. Two studies assessed the effect of adding CBT to medication. While an assertive trial of antidepressants does appear to lead to benefit, when compared with placebo, there was no significant advantage, in either study, or in a meta-analysis of data from these trials, that clearly demonstrated an additional benefit of CBT. The third trial showed little advantage of a tricyclic antidepressant over placebo in the context of an inpatient admission. Conclusion Few randomized controlled trials have investigated interventions for treatment-resistant depression in young people, and results from these show modest benefit from antidepressants with no additional benefit over medication from CBT. Overall, there is a lack of evidence about effective interventions to treat young people who have failed to

  19. Transport of tylosin and tylosin-resistance genes in subsurface drainage water from manured fields

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Animal agriculture appears to contribute to the spread of antibiotic resistance genes, but few studies have quantified gene transport in agricultural fields. The transport of tylosin, tylosin-resistance genes (erm B, F, A) and tylosin-resistant Enterococcus were measured in tile drainage water from ...

  20. Characterization of Resistance Genes and Plasmids from Outbreaks and Illness Clusters Caused by Salmonella Resistant to Ceftriaxone in the United States, 2011-2012.

    PubMed

    Folster, Jason P; Grass, Julian E; Bicknese, Amelia; Taylor, Julia; Friedman, Cindy R; Whichard, Jean M

    2017-03-01

    Salmonella is an important cause of foodborne illness; however, quickly identifying the source of these infections can be difficult, and source identification is a crucial step in preventing additional illnesses. Although most infections are self-limited, invasive salmonellosis may require antimicrobial treatment. Ceftriaxone, an extended-spectrum cephalosporin, is commonly used for treatment of salmonellosis. Previous studies have identified a correlation between the food animal/retail meat source of ceftriaxone-resistant Salmonella and the type of resistance gene and plasmid it carries. In this study, we examined seven outbreaks of ceftriaxone-resistant Salmonella infections, caused by serotypes Typhimurium, Newport, Heidelberg, and Infantis. All isolates were positive for a plasmid-encoded blaCMY gene. Plasmid incompatibility typing identified five IncI1 and two IncA/C plasmids. Both outbreaks containing blaCMY-IncA/C plasmids were linked to consumption of cattle products. Three of five outbreaks with blaCMY-IncI1 (ST12) plasmids were linked to a poultry source. The remaining IncI1 outbreaks were associated with ground beef (ST20) and tomatoes (ST12). In addition, we examined isolates from five unsolved clusters of ceftriaxone-resistant Salmonella infections and used our plasmid-encoded gene findings to predict the source. Overall, we identified a likely association between the source of ceftriaxone-resistant Salmonella outbreaks and the type of resistance gene/plasmid it carries.

  1. Transcriptome analyses and virus induced gene silencing identify genes in the Rpp4-mediated Asian soybean rust resistance pathway

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Rpp4 (Resistance to Phakopsora pachyrhizi 4) confers resistance to P. pachyrhizi, the causal agent of Asian soybean rust (ASR). By combining expression profiling and virus induced gene silencing (VIGS), we are developing a genetic framework for Rpp4-mediated resistance. We measured gene expression i...

  2. Gene expression profiling of epithelial ovarian cancer reveals key genes and pathways associated with chemotherapy resistance.

    PubMed

    Zhang, M; Luo, S C

    2016-01-22

    The aim of this study is to analyze gene expression data to identify key genes and pathways associated with resistance to platinum-based chemotherapy in epithelial ovarian cancer (EOC) and to improve clinical treatment strategies. The gene expression data set was downloaded from Gene Expression Omnibus and included 12 chemotherapy-resistant EOC samples and 16 chemotherapy-sensitive EOC samples. A differential analysis was performed to screen out differentially expressed genes (DEGs). A functional enrichment analysis was conducted for the DEGs using the database for annotation, visualization, and integration discovery. A protein-protein interaction (PPI) network was constructed with information from the human protein reference database. Pathway-pathway interactions were determined with a test based on the hypergeometric distribution. A total of 1564 DEGs were identified in chemotherapy-sensitive EOC, including 654 upregulated genes and 910 downregulated genes. The top three upregulated genes were HIST1H3G, AKT3, and RTN3, while the top three downregulated genes were NBLA00301, TRIM62, and EPHA5. A Gene Ontology enrichment analysis showed that cell adhesion, biological adhesion, and intracellular signaling cascades were significantly enriched in the DEGs. A KEGG pathway enrichment analysis revealed that the calcium, mitogen-activated protein kinase, and B cell receptor signaling pathways were significantly over-represented in the DEGs. A PPI network containing 101 interactions was acquired. The top three hub genes were RAC1, CAV1, and BCL2. Five modules were identified from the PPI network. Taken together, these findings could advance the understanding of the molecular mechanisms underlying intrinsic chemotherapy resistance in EOC.

  3. Quantitative detection of antibiotic resistance genes using magnetic/luminescent core-shell nanoparticles

    NASA Astrophysics Data System (ADS)

    Son, Ahjeong; Hristova, Krassimira R.; Dosev, Dosi; Kennedy, Ian M.

    2008-02-01

    Nanoscale magnetic/luminescent core-shell particles were used for DNA quantification in a hybridization-in-solution format. We demonstrated a simple, high-throughput, and non-PCR based DNA assay for quantifying antibiotic resistance gene tetQ. Fe 3O 4/Eu:Gd IIO 3 nanoparticles (NPs) synthesized by spray pyrolysis were biofunctionalized by passive adsorption of NeutrAvidin. Following immobilization of biotinylated probe DNA on the particles' surfaces, target dsDNA and signaling probe DNA labeled with Cy3 were hybridized with NPs-probe DNA. Hybridized DNA complexes were separated from solution by a magnet, while non-hybridized DNA remained in solution. A linear quantification (R2 = 0.99) of a target tetQ gene was achieved based on the normalized fluorescence (Cy3/NPs) of DNANP hybrids. A real-time qPCR assay was used for evaluation of the NPs assay sensitivity and range of quantification. The quantity of antibiotic resistance tetQ genes in activated sludge microcosms, with and without addition of tetracycline or triclosan has been determined, indicating the potential of the optimized assay for monitoring the level of antibiotic resistance in environmental samples. In addition, the tetQ gene copy numbers in microcosms determined by NPhybridization were well correlated with the numbers measured by real-time qPCR assay (R2 = 0.92).

  4. Microstructure and Corrosion Resistance of Laser Additively Manufactured 316L Stainless Steel

    NASA Astrophysics Data System (ADS)

    Trelewicz, Jason R.; Halada, Gary P.; Donaldson, Olivia K.; Manogharan, Guha

    2016-03-01

    Additive manufacturing (AM) of metal alloys to produce complex part designs via powder bed fusion methods such as laser melting promises to be a transformative technology for advanced materials processing. However, effective implementation of AM processes requires a clear understanding of the processing-structure-properties-performance relationships in fabricated components. In this study, we report on the formation of micro and nanoscale structures in 316L stainless steel samples printed by laser AM and their implications for general corrosion resistance. A variety of techniques including x-ray diffraction, optical, scanning and transmission electron microscopy, x-ray fluorescence, and energy dispersive x-ray spectroscopy were employed to characterize the microstructure and chemistry of the laser additively manufactured 316L stainless steel, which are compared with wrought 316L coupons via electrochemical polarization. Apparent segregation of Mo has been found to contribute to a loss of passivity and an increased anodic current density. While porosity will also likely impact the environmental performance (e.g., facilitating crevice corrosion) of AM alloys, this work demonstrates the critical influence of microstructure and heterogeneous solute distributions on the corrosion resistance of laser additively manufactured 316L stainless steel.

  5. The Effect of Silicon and Aluminum Additions on the Oxidation Resistance of Lean Chromium Stainless Steels

    SciTech Connect

    Dunning, J.S.; Alman, D.E.; Rawers, J.C.

    2001-09-01

    The effect of Si and Al additions on the oxidation of lean chromium austenitic stainless steels has been studied. A baseline composition of Fe-16Cr-16Ni-2Mn-1Mo was selected to allow combined Si and Al additions of up to 5 wt. pct. in a fully austenitic alloy. The baseline composition was selected using a net Cr equivalent equation to predict the onset of G-ferrite formation in austenite. Cyclic oxidation tests in air for 1000 hours were carried out on alloys with Si only or combined Si and Al additions in the temperature range 700 C to 800 C. Oxidation resistance of alloys with Si only additions were outstanding, particularly at 800 C. It was evident that different rate controlling mechanisms for oxidation were operative at 700 C and 800 C in the Si alloys. In addition, Si alloys pre-oxidized at 800 C, showed a zero weight gain in subsequent testing for 1000 hours at 700 C. The rate controlling mechanism in alloys with combined Si and Al addition for oxidation at 800 C was also different than alloys with Si only. SEM and ESCA analysis of the oxide films and base material at the oxide/base metal interface were conducted to study potential rate controlling mechanisms.

  6. Candidate Genes That May Be Responsible for the Unusual Resistances Exhibited by Bacillus pumilus SAFR-032 Spores

    PubMed Central

    Tirumalai, Madhan R.; Rastogi, Rajat; Zamani, Nader; O’Bryant Williams, Elisha; Allen, Shamail; Diouf, Fatma; Kwende, Sharon; Weinstock, George M.; Venkateswaran, Kasthuri J.; Fox, George E.

    2013-01-01

    The spores of several Bacillus species, including Bacillus pumilus SAFR-032 and B. safensis FO-36b, which were isolated from the spacecraft assembly facility at NASA's Jet Propulsion Laboratory, are unusually resistant to UV radiation and hydrogen peroxide. In order to identify candidate genes that might be associated with these resistances, the whole genome of B. pumilus SAFR-032, and the draft genome of B. safensis FO-36b were compared in detail with the very closely related type strain B. pumilus ATCC7061T. 170 genes are considered characteristic of SAFR-032, because they are absent from both FO-36b and ATCC7061T. Forty of these SAFR-032 characteristic genes are entirely unique open reading frames. In addition, four genes are unique to the genomes of the resistant SAFR-032 and FO-36b. Fifty three genes involved in spore coat formation, regulation and germination, DNA repair, and peroxide resistance, are missing from all three genomes. The vast majority of these are cleanly deleted from their usual genomic context without any obvious replacement. Several DNA repair and peroxide resistance genes earlier reported to be unique to SAFR-032 are in fact shared with ATCC7061T and no longer considered to be promising candidates for association with the elevated resistances. Instead, several SAFR-032 characteristic genes were identified, which along with one or more of the unique SAFR-032 genes may be responsible for the elevated resistances. These new candidates include five genes associated with DNA repair, namely, BPUM_0608 a helicase, BPUM_0652 an ATP binding protein, BPUM_0653 an endonuclease, BPUM_0656 a DNA cytosine-5- methyltransferase, and BPUM_3674 a DNA helicase. Three of these candidate genes are in immediate proximity of two conserved hypothetical proteins, BPUM_0654 and BPUM_0655 that are also absent from both FO-36b and ATCC7061T. This cluster of five genes is considered to be an especially promising target for future experimental work. PMID:23799069

  7. Candidate genes that may be responsible for the unusual resistances exhibited by Bacillus pumilus SAFR-032 spores.

    PubMed

    Tirumalai, Madhan R; Rastogi, Rajat; Zamani, Nader; O'Bryant Williams, Elisha; Allen, Shamail; Diouf, Fatma; Kwende, Sharon; Weinstock, George M; Venkateswaran, Kasthuri J; Fox, George E

    2013-01-01

    The spores of several Bacillus species, including Bacillus pumilus SAFR-032 and B. safensis FO-36b, which were isolated from the spacecraft assembly facility at NASA's Jet Propulsion Laboratory, are unusually resistant to UV radiation and hydrogen peroxide. In order to identify candidate genes that might be associated with these resistances, the whole genome of B. pumilus SAFR-032, and the draft genome of B. safensis FO-36b were compared in detail with the very closely related type strain B. pumilus ATCC7061(T). 170 genes are considered characteristic of SAFR-032, because they are absent from both FO-36b and ATCC7061(T). Forty of these SAFR-032 characteristic genes are entirely unique open reading frames. In addition, four genes are unique to the genomes of the resistant SAFR-032 and FO-36b. Fifty three genes involved in spore coat formation, regulation and germination, DNA repair, and peroxide resistance, are missing from all three genomes. The vast majority of these are cleanly deleted from their usual genomic context without any obvious replacement. Several DNA repair and peroxide resistance genes earlier reported to be unique to SAFR-032 are in fact shared with ATCC7061(T) and no longer considered to be promising candidates for association with the elevated resistances. Instead, several SAFR-032 characteristic genes were identified, which along with one or more of the unique SAFR-032 genes may be responsible for the elevated resistances. These new candidates include five genes associated with DNA repair, namely, BPUM_0608 a helicase, BPUM_0652 an ATP binding protein, BPUM_0653 an endonuclease, BPUM_0656 a DNA cytosine-5- methyltransferase, and BPUM_3674 a DNA helicase. Three of these candidate genes are in immediate proximity of two conserved hypothetical proteins, BPUM_0654 and BPUM_0655 that are also absent from both FO-36b and ATCC7061(T). This cluster of five genes is considered to be an especially promising target for future experimental work.

  8. Analysis of Differentially Expressed Genes Related to Resistance in Spinosad- and Neonicotinoid-Resistant Musca domestica L. (Diptera: Muscidae) Strains

    PubMed Central

    Højland, Dorte H.

    2017-01-01

    Background The housefly is a global pest that has developed resistance to most insecticides applied against it. Resistance of the spinosad-resistant strain 791spin and the neonicotinoid-resistant 766b strain is believed to be due to metabolism. We investigate differentially expressed genes in these two resistant strains related to metabolism in comparison with an insecticide-susceptible reference strain. Results Genes involved in metabolism of xenobiotics were primarily up-regulated in resistant flies with some differences between resistant strains. The cyp4g98 and cyp6g4 genes proved interesting in terms of neonicotinoid resistance, while cyp4d9 was overexpressed in 791spin compared to spinosad-susceptible strains. GSTs, ESTs and UGTs were mostly overexpressed, but not to the same degree as P450s. We present a comprehensive and comparative picture of gene expression in three housefly strains differing significantly in their response to insecticides. High differential expression of P450s and genes coding for cuticle protein indicates a combination of factors involved in metabolic neonicotinoid and spinosad resistance. Conclusion Resistance in these strains is apparently not linked to the alteration of a single gene but is composed of several changes including differential expression of genes encoding metabolic detoxification enzymes. PMID:28125739

  9. Novel Streptomycin and Spectinomycin Resistance Gene as a Gene Cassette within a Class 1 Integron Isolated from Escherichia coli

    PubMed Central

    Sandvang, Dorthe

    1999-01-01

    The aadA genes, encoding resistance to streptomycin and spectinomycin, have been found as gene cassettes in different gram-negative and gram-positive bacterial species. The present study has revealed the sequence of a new gene, aadA5, integrated as a gene cassette together with the trimethoprim resistance gene dfr7 in a class 1 integron. The integron was located on a plasmid and was identified in a pathogenic porcine Escherichia coli isolate. PMID:10582907

  10. Host-mediated gene silencing of a single effector gene from the potato pathogen Phytophthora infestans imparts partial resistance to late blight disease.

    PubMed

    Sanju, Suman; Siddappa, Sundaresha; Thakur, Aditi; Shukla, Pradeep K; Srivastava, Nidhi; Pattanayak, Debasis; Sharma, Sanjeev; Singh, B P

    2015-11-01

    RNA interference (RNAi) has proved a powerful genetic tool for silencing genes in plants. Host-induced gene silencing of pathogen genes has provided a gene knockout strategy for a wide range of biotechnological applications. The RXLR effector Avr3a gene is largely responsible for virulence of oomycete plant pathogen Phytophthora infestans. In this study, we attempted to silence the Avr3a gene of P. infestans through RNAi technology. The P. infestans inoculation resulted in lower disease progression and a reduction in pathogen load, as demonstrated by disease scoring and quantification of pathogen biomass in terms of Pi08 repetitive elements, respectively. Transgenic plants induced moderate silencing of Avr3a, and the presence and/or expression of small interfering RNAs, as determined through Northern hybridization, indicated siRNA targeted against Avr3a conferred moderate resistance to P. infestans. The single effector gene did not provide complete resistance against P. infestans. Although the Avr3a effector gene could confer moderate resistance, for complete resistance, the cumulative effect of effector genes in addition to Avr3a needs to be considered. In this study, we demonstrated that host-induced RNAi is an effective strategy for functional genomics in oomycetes.

  11. Screening for Escherichia coli K-12 genes conferring glyoxal resistance or sensitivity by transposon insertions.

    PubMed

    Lee, Changhan; Kim, Jihong; Kwon, Minsuk; Lee, Kihyun; Min, Haeyoung; Kim, Seong Hun; Kim, Dongkyu; Lee, Nayoung; Kim, Jiyeun; Kim, Doyun; Ko, Changmin; Park, Chankyu

    2016-09-01

    Glyoxal (GO) belongs to the reactive electrophilic species generated in vivo in all organisms. In order to identify targets of GO and their response mechanisms, we attempted to screen for GO-sensitive mutants by random insertions of TnphoA-132. The genes responsible for GO susceptibility were functionally classified as the following: (i) tRNA modification; trmE, gidA and truA, (ii) DNA repair; recA and recC, (iii) toxin-antitoxin; mqsA and (iv) redox metabolism; yqhD and caiC In addition, an insertion in the crp gene, encoding the cAMP responsive transcription factor, exhibits a GO-resistant phenotype, which is consistent with the phenotype of adenylate cyclase (cya) mutant showing GO resistance. This suggests that global regulation involving cAMP is operated in a stress response to GO. To further characterize the CRP-regulated genes directly associated with GO resistance, we created double mutants deficient in both crp and one of the candidate genes including yqhD, gloA and sodB The results indicate that these genes are negatively regulated by CRP as confirmed by real-time RT-PCR. We propose that tRNA as well as DNA are the targets of GO and that toxin/antitoxin, antioxidant and cAMP are involved in cellular response to GO.

  12. Molecular characterizations of chloramphenicol- and oxytetracycline-resistant bacteria and resistance genes in mariculture waters of China.

    PubMed

    Dang, Hongyue; Zhao, Jingyi; Song, Linsheng; Chen, Mingna; Chang, Yaqing

    2009-07-01

    In order to gain an understanding of the diversity and distribution of antimicrobial-resistant bacteria and their resistance genes in maricultural environments, multidrug-resistant bacteria were screened for the rearing waters from a mariculture farm of China. Both abalone Haliotis discushannai and turbot Scophthalmus maximus rearing waters were populated with abundant chloramphenicol-resistant bacteria. These bacteria were also multidrug resistant, with Vibriosplendidus and Vibriotasmaniensis being the most predominant species. The chloramphenicol-resistance gene cat II, cat IV or floR could be detected in most of the multidrug-resistant isolates, and the oxytetracycline-resistance gene tet(B), tet(D), tet(E) or tet(M) could also be detected for most of the isolates. Coexistence of chloramphenicol- and oxytetracycline-resistance genes partially explains the molecular mechanism of multidrug resistance in the studied maricultural environments. Comparative studies with different antimicrobial agents as the starting isolation reagents may help detect a wider diversity of the antimicrobial-resistant bacteria and their resistance genes.

  13. Improvement of activated sludge resistance to shock loading by fungal enzyme addition during textile wastewater treatment.

    PubMed

    Manai, Imène; Miladi, Baligh; El Mselmi, Abdellatif; Hamdi, Moktar; Bouallagui, Hassib

    2017-04-01

    The effects of the additions of the fungal enzymatic extract were investigated in relation to the treatment of real textile wastewater (RTW) by the activated sludge process (ASP). The used enzyme cocktail was produced by a new isolated fungal Chaetomium globosum IMA1. The system that was operated with enzyme addition showed a better chemical oxygen demand (COD) removal efficiency (95%) compared to the control system (75%). In addition, the improvement of color removal (OD620) efficiencies was around 15%, when the newly consortium fungal enzymes was added. As the organic loading rate (OLR) increased from 0.33 g to 0.66 g COD L(-1) d(-1), a decrease in the performance of the two reactors was observed by monitoring the quality of treated effluents. However, the ASP working with enzyme addition showed a strong resistance to shock loadings and restored after few days compared to the control system, which was strongly inhibited. In fact, the enzyme addition improved the sludge volume index (SVI) and the activity of microorganisms. A high activity of laccase (300 U.L(-1)) enzyme was observed throughout the decolorization process in the improved system.

  14. The wheat durable, multipathogen resistance gene Lr34 confers partial blast resistance in rice.

    PubMed

    Krattinger, Simon G; Sucher, Justine; Selter, Liselotte L; Chauhan, Harsh; Zhou, Bo; Tang, Mingzhi; Upadhyaya, Narayana M; Mieulet, Delphine; Guiderdoni, Emmanuel; Weidenbach, Denise; Schaffrath, Ulrich; Lagudah, Evans S; Keller, Beat

    2016-05-01

    The wheat gene Lr34 confers durable and partial field resistance against the obligate biotrophic, pathogenic rust fungi and powdery mildew in adult wheat plants. The resistant Lr34 allele evolved after wheat domestication through two gain-of-function mutations in an ATP-binding cassette transporter gene. An Lr34-like fungal disease resistance with a similar broad-spectrum specificity and durability has not been described in other cereals. Here, we transformed the resistant Lr34 allele into the japonica rice cultivar Nipponbare. Transgenic rice plants expressing Lr34 showed increased resistance against multiple isolates of the hemibiotrophic pathogen Magnaporthe oryzae, the causal agent of rice blast disease. Host cell invasion during the biotrophic growth phase of rice blast was delayed in Lr34-expressing rice plants, resulting in smaller necrotic lesions on leaves. Lines with Lr34 also developed a typical, senescence-based leaf tip necrosis (LTN) phenotype. Development of LTN during early seedling growth had a negative impact on formation of axillary shoots and spikelets in some transgenic lines. One transgenic line developed LTN only at adult plant stage which was correlated with lower Lr34 expression levels at seedling stage. This line showed normal tiller formation and more importantly, disease resistance in this particular line was not compromised. Interestingly, Lr34 in rice is effective against a hemibiotrophic pathogen with a lifestyle and infection strategy that is different from obligate biotrophic rusts and mildew fungi. Lr34 might therefore be used as a source in rice breeding to improve broad-spectrum disease resistance against the most devastating fungal disease of rice.

  15. Cloning of novel rice blast resistance genes from two rapidly evolving NBS-LRR gene families in rice.

    PubMed

    Guo, Changjiang; Sun, Xiaoguang; Chen, Xiao; Yang, Sihai; Li, Jing; Wang, Long; Zhang, Xiaohui

    2016-01-01

    Most rice blast resistance genes (R-genes) encode proteins with nucleotide-binding site (NBS) and leucine-rich repeat (LRR) domains. Our previous study has shown that more rice blast R-genes can be cloned in rapidly evolving NBS-LRR gene families. In the present study, two rapidly evolving R-gene families in rice were selected for cloning a subset of genes from their paralogs in three resistant rice lines. A total of eight functional blast R-genes were identified among nine NBS-LRR genes, and some of these showed resistance to three or more blast strains. Evolutionary analysis indicated that high nucleotide diversity of coding regions served as important parameters in the determination of gene resistance. We also observed that amino-acid variants (nonsynonymous mutations, insertions, or deletions) in essential motifs of the NBS domain contribute to the blast resistance capacity of NBS-LRR genes. These results suggested that the NBS regions might also play an important role in resistance specificity determination. On the other hand, different splicing patterns of introns were commonly observed in R-genes. The results of the present study contribute to improving the effectiveness of R-gene identification by using evolutionary analysis method and acquisition of novel blast resistance genes.

  16. Alternatively spliced transcripts of Pi-ta blast resistance gene in Oryza sativa

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The Pi-ta gene in rice (Oryza sativa L.) confers resistance to races of Magnaporthe oryzae containing its cognate avirulence gene AVR-Pita. Pi-ta is a single-copy gene belonging to the nucleotide-binding site leucine-rich repeat (NBS-LRR) class of plant resistance (R) genes. In the present study, w...

  17. Modification of silicone sealant to improve gamma radiation resistance, by addition of protective agents

    NASA Astrophysics Data System (ADS)

    González-Pérez, Giovanni; Burillo, Guillermina

    2013-09-01

    Poly (dimethylsiloxane) (PDMS) sealant (SS) was modified with the addition of different protective compounds to conserve its physical-chemical properties during gamma irradiation. 2-Vinyl naphthalene (2-VN), bisphenol-A (BPA) and poly (vinyl carbazole) (PVK) were used to evaluate radiation protection through the crosslinking effect of radiation. The samples were irradiated with doses from 100 kGy to 500 kGy at room temperature in air, with a 60Co gamma source, and the changes in molecular weight, thermal behavior, elastic properties and infrared spectra (FTIR-ATR) absorbance analysis were determined. The molecular weight of unmodified silicone sealant increases with the absorbed dose because of crosslinking as predominant effect. However, the crosslinking effect was inhibited with the addition of protective agent due to the aromatic compounds present. Modified silicone sealant films present better radiation resistance than unmodified system.

  18. Triclosan Resistome from Metagenome Reveals Diverse Enoyl Acyl Carrier Protein Reductases and Selective Enrichment of Triclosan Resistance Genes

    PubMed Central

    Khan, Raees; Kong, Hyun Gi; Jung, Yong-Hoon; Choi, Jinhee; Baek, Kwang-Yeol; Hwang, Eul Chul; Lee, Seon-Woo

    2016-01-01

    Triclosan (TCS) is a widely used antimicrobial agent and TCS resistance is considered to have evolved in diverse organisms with extensive use of TCS, but distribution of TCS resistance has not been well characterized. Functional screening of the soil metagenome in this study has revealed that a variety of target enoyl acyl carrier protein reductases (ENR) homologues are responsible for the majority of TCS resistance. Diverse ENRs similar to 7-α-hydroxysteroid dehydrogenase (7-α-HSDH), FabG, or the unusual YX7K-type ENR conferred extreme tolerance to TCS. The TCS-refractory 7-α HSDH-like ENR and the TCS-resistant YX7K-type ENR seem to be prevalent in human pathogenic bacteria, suggesting that a selective enrichment occurred in pathogenic bacteria in soil. Additionally, resistance to multiple antibiotics was found to be mediated by antibiotic resistance genes that co-localize with TCS resistance determinants. Further comparative analysis of ENRs from 13 different environments has revealed a huge diversity of both prototypic and metagenomic TCS-resistant ENRs, in addition to a selective enrichment of TCS-resistant specific ENRs in presumably TCS-contaminated environments with reduced ENR diversity. Our results suggest that long-term extensive use of TCS can lead to the selective emergence of TCS-resistant bacterial pathogens, possibly with additional resistance to multiple antibiotics, in natural environments. PMID:27577999

  19. Amantadine as an additive treatment in patients suffering from drug-resistant unipolar depression.

    PubMed

    Rogóz, Zofia; Skuza, Grazyna; Daniel, Władysława A; Wójcikowski, Jacek; Dudek, Dominika; Wróbel, Andrzej

    2007-01-01

    The paper describes the effect of amantadine addition to imipramine therapy in patients suffering from treatment-resistant unipolar depression who fulfilled DSM IV criteria for major (unipolar) depression. Fifty patients were enrolled in the study on the basis of their histories of illness and therapy. After a 2-week drug-free period, 25 subjects belonging to the first group were treated only with imipramine twice daily (100 mg/day) for 12 weeks, and 25 subjects belonging to the second group were treated with imipramine twice daily (100 mg/day) for 6 weeks and then amantadine was introduced (150 mg/day, twice daily) and administered jointly with imipramine for the successive 6 weeks. Hamilton Depression Rating Scale (HDRS) was used to assess the efficacy of antidepressant therapy. Imipramine did not change the HDRS score after 3, 6 or 12 weeks of treatment when compared with the washout (before treatment). The addition of amantadine to the classic antidepressant reduced HDRS scores after 6-week joint treatment. Moreover, the obtained pharmacokinetic data indicated that amantadine did not significantly influence the plasma concentration of imipramine and its metabolite desipramine in patients treated jointly with imipramine and amantadine, which suggests lack of a pharmacokinetic interaction. The obtained results indicate that joint therapy with an antidepressant and amantadine may be effective in treatment-resistant unipolar depression.

  20. Identification and expression analysis of chitinase genes related to biotic stress resistance in Brassica.

    PubMed

    Ahmed, Nasar Uddin; Park, Jong-In; Seo, Mi-Suk; Kumar, Thamilarasan Senthil; Lee, In-Ho; Park, Beom-Seok; Nou, Ill-Sup

    2012-04-01

    Brassica is a very important vegetable group because of its contribution to human nutrition and consequent economic benefits. However, biotic stress is a major concern for these crops and molecular biology techniques offer the most efficient of approaches to address this concern. Chitinase is an important biotic stress resistance-related gene. We identified three genes designated as Brassica chitinase like protein (BrCLP1), BrCLP2 and BrCLP3 from a full-length cDNA library of Brassica rapa cv. Osome. Sequence analysis of these genes confirmed that BrCLP1 was a class IV chitinase, and BrCLP2 and BrCLP3 were class VII chitinases. Also, these genes showed a high degree of homology with other biotic stress resistance-related plant chitinases. In expression analysis, organ-specific expression of all three genes was high except BrCLP1 in all the organs tested and BrCLP2 showed the highest expression compared to the other genes in flower buds. All these genes also showed expression during all developmental growth stages of Chinese cabbage. In addition, BrCLP1 was up-regulated with certain time of infection by Pectobacterium carotovorum subsp. carotovorum in Chinese cabbage plants during microarray expression analysis. On the other hand, expression of BrCLP2 and BrCLP3 were increased after 6 h post inoculation (hpi) but decreased from 12 hpi. All these data suggest that these three chitinase genes may be involved in plant resistance against biotic stresses.

  1. Resistance to Ag(I) Cations in Bacteria: Environments, Genes and Proteins

    PubMed Central

    Gupta, Amit; Matsui, Kazuaki; Lo, Jeng-Fan

    1999-01-01

    Bacterial resistance to Ag(I) has been reported periodically with isolates from many environments where toxic levels of silver might be expected to occur, but initial reports were limited to the occurrence of resistant bacteria. The availability of silver-resistance conferring DNA sequences now allow genetic and mechanistic studies that had basically been missing. The genes determining Ag(I) resistance were sequenced from a plasmid found in a burn ward isolate. The 14.2 kb determinant contains seven recognized genes, arranged in three mRNA transcriptional units. The silE gene determines an extracellular (periplasmic space) metal-binding protein of 123 amino acids, including ten histidine residues implicated in Ag(I) binding. SilE is homologous to PcoE, of copper resistance. The next two genes, silR and silS, determine a two protein, histidine-kinase membrane sensor and aspartyl phosphate transcriptional responder, similar to other two component systems such as CzcR and CzcS (for cadmium, zinc and cobalt resistance) and PcoR and PcoS (for copper resistance). The remaining four genes, silCBAP, are co-transcribed and appear to determine Ag+ efflux, with SilCBA homologous to CzcCBA, a three component cation/proton antiporter, and SilP a novel P-type ATPase with a amino-terminal histidine-rich cation-specificity region. The effects of increasing Ag+ concentrations and growth medium halides (Cl-, Br- and I-) have been characterized, with lower Cl- concentrations facilitating resistance and higher concentrations toxicity. The properties of this unique Ag(I)-binding SilE protein are being characterized. Sequences similar to the silver-resistance DNA are being characterized by Southern blot DNA/DNA hybridization, PCR in vitro DNA synthesis and DNA sequencing. More than 25 additional closely related sequences have been identified in bacteria from diverse sources. Initial DNA sequencing results shows approximately 5-20% differences in DNA sequences. PMID:18475907

  2. Novel Genes Related to Ceftriaxone Resistance Found among Ceftriaxone-Resistant Neisseria gonorrhoeae Strains Selected In Vitro

    PubMed Central

    Gong, Zijian; Liu, Min; Hua, Zhengshuang; Sun, Yayin; Xu, Qingfang; Xia, Yue; Zhao, Yue; Xie, Xiaoyuan

    2016-01-01

    The emergence of ceftriaxone-resistant Neisseria gonorrhoeae is currently a global public health concern. However, the mechanism of ceftriaxone resistance is not yet fully understood. To investigate the potential genes related to ceftriaxone resistance in Neisseria gonorrhoeae, we subcultured six gonococcal strains with increasing concentrations of ceftriaxone and isolated the strains that became resistant. After analyzing several frequently reported genes involved in ceftriaxone resistance, we found only a single mutation in penA (A501V). However, differential analysis of the genomes and transcriptomes between pre- and postselection strains revealed many other mutated genes as well as up- and downregulated genes. Transformation of the mutated penA gene into nonresistant strains increased the MIC between 2.0- and 5.3-fold, and transformation of mutated ftsX increased the MIC between 3.3- and 13.3-fold. Genes encoding the ABC transporters FarB, Tfq, Hfq, and ExbB were overexpressed, while pilM, pilN, and pilQ were downregulated. Furthermore, the resistant strain developed cross-resistance to penicillin and cefuroxime, had an increased biochemical metabolic rate, and presented fitness defects such as prolonged growth time and downregulated PilMNQ. In conclusion, antimicrobial pressure could result in the emergence of ceftriaxone resistance, and the evolution of resistance of Neisseria gonorrhoeae to ceftriaxone is a complicated process at both the pretranscriptional and posttranscriptional levels, involving several resistance mechanisms of increased efflux and decreased entry. PMID:26787702

  3. Inverse gene-for-gene interactions contribute additively to tan spot susceptibility in wheat

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Tan spot of wheat, caused by Pyrenophora tritici-repentis, is an important disease in almost all wheat-growing areas of the world. The disease system is known to involve at least three fungal-produced necrotrophic effectors (NEs) that interact with corresponding host sensitivity (S) genes in an inv...

  4. Mutations in the Pneumocystis jirovecii DHPS gene confer cross-resistance to sulfa drugs.

    PubMed

    Iliades, Peter; Meshnick, Steven R; Macreadie, Ian G

    2005-02-01

    Pneumocystis jirovecii is a major opportunistic pathogen that causes Pneumocystis pneumonia (PCP) and results in a high degree of mortality in immunocompromised individuals. The drug of choice for PCP is typically sulfamethoxazole (SMX) or dapsone in conjunction with trimethoprim. Drug treatment failure and sulfa drug resistance have been implicated epidemiologically with point mutations in dihydropteroate synthase (DHPS) of P. jirovecii. P. jirovecii cannot be cultured in vitro; however, heterologous complementation of the P. jirovecii trifunctional folic acid synthesis (PjFAS) genes with an E. coli DHPS-disrupted strain was recently achieved. This enabled the evaluation of SMX resistance conferred by DHPS mutations. In this study, we sought to determine whether DHPS mutations conferred sulfa drug cross-resistance to 15 commonly available sulfa drugs. It was established that the presence of amino acid substitutions (T(517)A or P(519)S) in the DHPS domain of PjFAS led to cross-resistance against most sulfa drugs evaluated. The presence of both mutations led to increased sulfa drug resistance, suggesting cooperativity and the incremental evolution of sulfa drug resistance. Two sulfa drugs (sulfachloropyridazine [SCP] and sulfamethoxypyridazine [SMP]) that had a higher inhibitory potential than SMX were identified. In addition, SCP, SMP, and sulfadiazine (SDZ) were found to be capable of inhibiting the clinically observed drug-resistant mutants. We propose that SCP, SMP, and SDZ should be considered for clinical evaluation against PCP or for future development of novel sulfa drug compounds.

  5. Molecular detection of antibiotic resistance genes from positive blood cultures.

    PubMed

    Hindiyeh, Musa Y; Smollan, Gill; Gefen-Halevi, Shiraz; Mendelson, Ella; Keller, Nathan

    2015-01-01

    Rapid detection of the bacterial causative agent causing sepsis must be coupled with rapid identification of the antibiotic resistant mechanism that the pathogen might possess. Real-time PCR (qPCR)-based assays have been extensively utilized in the clinical microbiology field as diagnostic tools for the rapid detection of specific nucleic acid (NA) targets. In this chapter, we will discuss the technical aspects of using an internally controlled qPCR assay for the rapid detection of Klebsiella pneumoniae carbapenemase gene (bla KPC) in positive Bactec blood culture bottles. The multiplex qPCR (bla KPC/RNase P) utilizes specific primers and probes for the detection of the bacterial carbapenem resistance mechanism, bla KPC gene, and the internal control RNase P. The internal control of the qPCR assay is vital for detecting any inhibitors that are well known to be present in the blood culture bottles. Rapid detection of the antibiotic resistant mechanism present in the bacterial pathogen causing sepsis can help in better managing patients' infection.

  6. Additional shear resistance from fault roughness and stress levels on geometrically complex faults

    NASA Astrophysics Data System (ADS)

    Fang, Zijun; Dunham, Eric M.

    2013-07-01

    The majority of crustal faults host earthquakes when the ratio of average background shear stress τb to effective normal stress σeff is τb/σeff≈0.6. In contrast, mature plate-boundary faults like the San Andreas Fault (SAF) operate at τb/σeff≈0.2. Dynamic weakening, the dramatic reduction in frictional resistance at coseismic slip velocities that is commonly observed in laboratory experiments, provides a leading explanation for low stress levels on mature faults. Strongly velocity-weakening friction laws permit rupture propagation on flat faults above a critical stress level τpulse/σeff≈0.25. Provided that dynamic weakening is not restricted to mature faults, the higher stress levels on most faults are puzzling. In this work, we present a self-consistent explanation for the relatively high stress levels on immature faults that is compatible with low coseismic frictional resistance, from dynamic weakening, for all faults. We appeal to differences in structural complexity with the premise that geometric irregularities introduce resistance to slip in addition to frictional resistance. This general idea is quantified for the special case of self-similar fractal roughness of the fault surface. Natural faults have roughness characterized by amplitude-to-wavelength ratios α between 10-3 and 10-2. Through a second-order boundary perturbation analysis of quasi-static frictionless sliding across a band-limited self-similar interface in an ideally elastic solid, we demonstrate that roughness induces an additional shear resistance to slip, or roughness drag, given by τdrag=8π3α2G∗Δ/λmin, for G∗=G/(1-ν) with shear modulus Gand Poisson's ratio ν, slip Δ, and minimum roughness wavelength λmin. The influence of roughness drag on fault mechanics is verified through an extensive set of dynamic rupture simulations of earthquakes on strongly rate-weakening fractal faults with elastic-plastic off-fault response. The simulations suggest that fault rupture, in

  7. A Novel Phytophthora sojae Resistance Rps12 Gene Mapped to a Genomic Region That Contains Several Rps Genes

    PubMed Central

    Sahoo, Dipak K.; Abeysekara, Nilwala S.; Cianzio, Silvia R.; Robertson, Alison E.

    2017-01-01

    Phytophthora sojae Kaufmann and Gerdemann, which causes Phytophthora root rot, is a widespread pathogen that limits soybean production worldwide. Development of Phytophthora resistant cultivars carrying Phytophthora resistance Rps genes is a cost-effective approach in controlling this disease. For this mapping study of a novel Rps gene, 290 recombinant inbred lines (RILs) (F7 families) were developed by crossing the P. sojae resistant cultivar PI399036 with the P. sojae susceptible AR2 line, and were phenotyped for responses to a mixture of three P. sojae isolates that overcome most of the known Rps genes. Of these 290 RILs, 130 were homozygous resistant, 12 heterzygous and segregating for Phytophthora resistance, and 148 were recessive homozygous and susceptible. From this population, 59 RILs homozygous for Phytophthora sojae resistance and 61 susceptible to a mixture of P. sojae isolates R17 and Val12-11 or P7074 that overcome resistance encoded by known Rps genes mapped to Chromosome 18 were selected for mapping novel Rps gene. A single gene accounted for the 1:1 segregation of resistance and susceptibility among the RILs. The gene encoding the Phytophthora resistance mapped to a 5.8 cM interval between the SSR markers BARCSOYSSR_18_1840 and Sat_064 located in the lower arm of Chromosome 18. The gene is mapped 2.2 cM proximal to the NBSRps4/6-like sequence that was reported to co-segregate with the Phytophthora resistance genes Rps4 and Rps6. The gene is mapped to a highly recombinogenic, gene-rich genomic region carrying several nucleotide binding site-leucine rich repeat (NBS-LRR)-like genes. We named this novel gene as Rps12, which is expected to be an invaluable resource in breeding soybeans for Phytophthora resistance. PMID:28081566

  8. Monitoring and Comparison of Antibiotic Resistant Bacteria and Their Resistance Genes in Municipal and Hospital Wastewaters

    PubMed Central

    Aali, Rahim; Nikaeen, Mahnaz; Khanahmad, Hossein; Hassanzadeh, Akbar

    2014-01-01

    Background: Human exposure to antibiotic resistant bacteria (ARB) is a public health concern which could occur in a number of ways. Wastewaters seem to play an important role in the dissemination of bacteria and antibiotic resistant genes (ARGs) in our environment. The aim of this study was to evaluate the occurrence of three groups of ARB and their resistance genes in hospital and municipal wastewaters (MWs) as possible sources. Methods: A total of 66 samples were collected from raw MWs and hospital wastewaters (HWs) and final effluents of related wastewater treatment plants (WWTPs). Samples were analyzed for the detection of three groups of ARB including gentamicin (GM), chloramphenicol (CHL) and ceftazidime resistant bacteria and their ARGs (aac (3)-1, cmlA1 and ctx-m-32, respectively). Results: The mean concentration of GM, CHL and ceftazidime resistant bacteria in raw wastewater samples was 1.24 × 107, 3.29 × 107 and 5.54 × 107 colony forming unit/100 ml, respectively. There is a variation in prevalence of different groups of ARB in MWs and HWs. All WWTPs decreased the concentration of ARB. However, high concentration of ARB was found in the final effluent of WWTPs. Similar to ARB, different groups of ARGs were found frequently in both MWs and HWs. All genes also detected with a relative high frequency in effluent samples of MWs WWTPs. Conclusions: Discharge of final effluent from conventional WWTPs is a potential route for dissemination of ARB and ARGs into the natural environment and poses a hazard to environmental and public health. PMID:25105001

  9. Natural variation in the Pto pathogen resistance gene within species of wild tomato (Lycopersicon). I. Functional analysis of Pto alleles.

    PubMed

    Rose, Laura E; Langley, Charles H; Bernal, Adriana J; Michelmore, Richard W

    2005-09-01

    Disease resistance to the bacterial pathogen Pseudomonas syringae pv. tomato (Pst) in the cultivated tomato, Lycopersicon esculentum, and the closely related L. pimpinellifolium is triggered by the physical interaction between plant disease resistance protein, Pto, and the pathogen avirulence protein, AvrPto. To investigate the extent to which variation in the Pto gene is responsible for naturally occurring variation in resistance to Pst, we determined the resistance phenotype of 51 accessions from seven species of Lycopersicon to isogenic strains of Pst differing in the presence of avrPto. One-third of the plants displayed resistance specifically when the pathogen expressed AvrPto, consistent with a gene-for-gene interaction. To test whether this resistance in these species was conferred specifically by the Pto gene, alleles of Pto were amplified and sequenced from 49 individuals and a subset (16) of these alleles was tested in planta using Agrobacterium-mediated transient assays. Eleven alleles conferred a hypersensitive resistance response (HR) in the presence of AvrPto, while 5 did not. Ten amino acid substitutions associated with the absence of AvrPto recognition and HR were identified, none of which had been identified in previous structure-function studies. Additionally, 3 alleles encoding putative pseudogenes of Pto were isolated from two species of Lycopersicon. Therefore, a large proportion, but not all, of the natural variation in the reaction to strains of Pst expressing AvrPto can be attributed to sequence variation in the Pto gene.

  10. Natural Variation in the Pto Pathogen Resistance Gene Within Species of Wild Tomato (Lycopersicon). I. Functional Analysis of Pto Alleles

    PubMed Central

    Rose, Laura E.; Langley, Charles H.; Bernal, Adriana J.; Michelmore, Richard W.

    2005-01-01

    Disease resistance to the bacterial pathogen Pseudomonas syringae pv. tomato (Pst) in the cultivated tomato, Lycopersicon esculentum, and the closely related L. pimpinellifolium is triggered by the physical interaction between plant disease resistance protein, Pto, and the pathogen avirulence protein, AvrPto. To investigate the extent to which variation in the Pto gene is responsible for naturally occurring variation in resistance to Pst, we determined the resistance phenotype of 51 accessions from seven species of Lycopersicon to isogenic strains of Pst differing in the presence of avrPto. One-third of the plants displayed resistance specifically when the pathogen expressed AvrPto, consistent with a gene-for-gene interaction. To test whether this resistance in these species was conferred specifically by the Pto gene, alleles of Pto were amplified and sequenced from 49 individuals and a subset (16) of these alleles was tested in planta using Agrobacterium-mediated transient assays. Eleven alleles conferred a hypersensitive resistance response (HR) in the presence of AvrPto, while 5 did not. Ten amino acid substitutions associated with the absence of AvrPto recognition and HR were identified, none of which had been identified in previous structure-function studies. Additionally, 3 alleles encoding putative pseudogenes of Pto were isolated from two species of Lycopersicon. Therefore, a large proportion, but not all, of the natural variation in the reaction to strains of Pst expressing AvrPto can be attributed to sequence variation in the Pto gene. PMID:15944360

  11. The Composition and Spatial Patterns of Bacterial Virulence Factors and Antibiotic Resistance Genes in 19 Wastewater Treatment Plants

    PubMed Central

    Zhang, Bing; Xia, Yu; Wen, Xianghua; Wang, Xiaohui; Yang, Yunfeng; Zhou, Jizhong; Zhang, Yu

    2016-01-01

    Bacterial pathogenicity and antibiotic resistance are of concern for environmental safety and public health. Accumulating evidence suggests that wastewater treatment plants (WWTPs) are as an important sink and source of pathogens and antibiotic resistance genes (ARGs). Virulence genes (encoding virulence factors) are good indicators for bacterial pathogenic potentials. To achieve a comprehensive understanding of bacterial pathogenic potentials and antibiotic resistance in WWTPs, bacterial virulence genes and ARGs in 19 WWTPs covering a majority of latitudinal zones of China were surveyed by using GeoChip 4.2. A total of 1610 genes covering 13 virulence factors and 1903 genes belonging to 11 ARG families were detected respectively. The bacterial virulence genes exhibited significant spatial distribution patterns of a latitudinal biodiversity gradient and a distance-decay relationship across China. Moreover, virulence genes tended to coexist with ARGs as shown by their strongly positive associations. In addition, key environmental factors shaping the overall virulence gene structure were identified. This study profiles the occurrence, composition and distribution of virulence genes and ARGs in current WWTPs in China, and uncovers spatial patterns and important environmental variables shaping their structure, which may provide the basis for further studies of bacterial virulence factors and antibiotic resistance in WWTPs. PMID:27907117

  12. The Composition and Spatial Patterns of Bacterial Virulence Factors and Antibiotic Resistance Genes in 19 Wastewater Treatment Plants.

    PubMed

    Zhang, Bing; Xia, Yu; Wen, Xianghua; Wang, Xiaohui; Yang, Yunfeng; Zhou, Jizhong; Zhang, Yu

    2016-01-01

    Bacterial pathogenicity and antibiotic resistance are of concern for environmental safety and public health. Accumulating evidence suggests that wastewater treatment plants (WWTPs) are as an important sink and source of pathogens and antibiotic resistance genes (ARGs). Virulence genes (encoding virulence factors) are good indicators for bacterial pathogenic potentials. To achieve a comprehensive understanding of bacterial pathogenic potentials and antibiotic resistance in WWTPs, bacterial virulence genes and ARGs in 19 WWTPs covering a majority of latitudinal zones of China were surveyed by using GeoChip 4.2. A total of 1610 genes covering 13 virulence factors and 1903 genes belonging to 11 ARG families were detected respectively. The bacterial virulence genes exhibited significant spatial distribution patterns of a latitudinal biodiversity gradient and a distance-decay relationship across China. Moreover, virulence genes tended to coexist with ARGs as shown by their strongly positive associations. In addition, key environmental factors shaping the overall virulence gene structure were identified. This study profiles the occurrence, composition and distribution of virulence genes and ARGs in current WWTPs in China, and uncovers spatial patterns and important environmental variables shaping their structure, which may provide the basis for further studies of bacterial virulence factors and antibiotic resistance in WWTPs.

  13. pncA Gene Mutations Associated with Pyrazinamide Resistance in Drug-Resistant Tuberculosis, South Africa and Georgia.

    PubMed

    Allana, Salim; Shashkina, Elena; Mathema, Barun; Bablishvili, Nino; Tukvadze, Nestani; Shah, N Sarita; Kempker, Russell R; Blumberg, Henry M; Moodley, Pravi; Mlisana, Koleka; Brust, James C M; Gandhi, Neel R

    2017-03-01

    Although pyrazinamide is commonly used for tuberculosis treatment, drug-susceptibility testing is not routinely available. We found polymorphisms in the pncA gene for 70% of multidrug-resistant and 96% of extensively drug-resistant Mycobacterium tuberculosis isolates from South Africa and Georgia. Assessment of pyrazinamide susceptibility may be prudent before using it in regimens for drug-resistant tuberculosis.

  14. Multiplex characterization of human pathogens including species and antibiotic-resistance gene identification.

    PubMed

    Barisˇ ić, Ivan; Petzka, Josefine; Schoenthaler, Silvia; Vierlinger, Klemens; Noehammer, Christa; Wiesinger-Mayr, Herbert

    2016-01-01

    The efficient medical treatment of infections requires detailed information about the pathogens involved and potential antibiotic-resistance mechanisms. The dramatically increasing incidence of multidrug-resistant bacteria especially highlights the importance of sophisticated diagnostic tests enabling a fast patient-customized therapy. However, the current molecular detection methods are limited to either the detection of species or only a few antibiotic-resistance genes.In this work, we present a human pathogen characterization assay using a rRNA gene microarray identifying 75 species comprising bacteria and fungi. A statistical classifier was developed to facilitate the automated species identification. Additionally, the clinically most important β-lactamases were identified simultaneously in a 100-plex reaction using padlock probes and the same microarray. The specificity and sensitivity of the combined assay was determined using clinical isolates. The detection limit was 10(5) c.f.u. ml(-1), recovering 89 % of the detectable β-lactamase-encoding genes specifically. The total assay time was less than 7 hand the modular character of the antibiotic-resistance detection allows the easy integration of further genetic targets. In summary, we present a fast, highly specific and sensitive multiplex pathogen characterization assay.

  15. Prevalence and dissemination of antibiotic resistance genes and coselection of heavy metals in Chinese dairy farms.

    PubMed

    Zhou, Bingrui; Wang, Chong; Zhao, Qin; Wang, Yang; Huo, Meijun; Wang, Jundong; Wang, Shaolin

    2016-12-15

    This study aims to explore prevalence and dissemination of antibiotic resistance genes (ARGs) in dairy farms. A variety of ARGs conferring resistance to most classes of antibiotics were detected in feces and soil samples obtained from dairy farms, using a high-throughput metagenomic sequencing approach. The ARGs observed in the feces and the soil samples were significantly correlated (p<0.01). The abundance of mobile genetics elements, such as transposase, was also examined to evaluate the potential risk of horizontal ARGs transfer. The positive correlation (p<0.001) between the total abundance of transposase genes and ARGs in the soil samples suggested strong dissemination capacity of ARGs in soil. In addition, the ARGs and metal resistance genes (MRGs) were significantly correlated with heavy metals in the feces (p<0.01), suggesting that the heavy metals promoted the emergence of metal resistance, and participated in the coselection processes for ARGs. The prevalence of ARGs with high levels of genetic mobile elements in the dairy farms suggests that cattle excrement is a major reservoir of ARGs with a high risk of dissemination, which increases the potential risk of environmental pollution and threatens public health.

  16. Detection and Genetic Environment of Pleuromutilin-Lincosamide-Streptogramin A Resistance Genes in Staphylococci Isolated from Pets

    PubMed Central

    Deng, Fengru; Wang, Huiwen; Liao, Yifei; Li, Jun; Feßler, Andrea T.; Michael, Geovana B.; Schwarz, Stefan; Wang, Yang

    2017-01-01

    Increasing emergence of staphylococci resistant to pleuromutilins, lincosamides, and streptogramin A (PLSA) and isolated from humans and pets is a growing public health concern worldwide. Currently, there was only one published study regarding one of the PLSA genes, vga(A) detected in staphylococci isolated from cat. In this study, eleven pleuromutilin-resistant staphylococci from pets and two from their owners were isolated and further characterized for their antimicrobial susceptibilities, plasmid profiles, genotypes, and genetic context of the PLSA resistance genes. The gene sal(A) identified in 11 staphylococcal isolates was found for the first time in Staphylococcus haemolyticus, Staphylococcus epidermidis, and Staphylococcus xylosus. Moreover, these 11 isolates shared the identical regions flanking the sal(A) gene located in the chromosomal DNA. Two S. haemolyticus isolates from a cat and its owner carried similar vga(A)LC plasmids and displayed indistinguishable PFGE patterns. A novel chromosomal multidrug resistance genomic island (MDRGI) containing 13 resistance genes, including lsa(E), was firstly identified in S. epidermidis. In addition, vga(A)LC, sal(A), and lsa(E) were for the first time identified in staphylococcal isolates originating from pet animals. The plasmids, chromosomal DNA region, and MDRGI associated with the PLSA resistance genes vga(A), vga(A)LC, sal(A), and lsa(E) are present in staphylococci isolated from pets and humans and present significant challenges for the clinical management of infections by limiting therapeutic options. PMID:28261187

  17. A review of the influence of treatment strategies on antibiotic resistant bacteria and antibiotic resistance genes.

    PubMed

    Sharma, Virender K; Johnson, Natalie; Cizmas, Leslie; McDonald, Thomas J; Kim, Hyunook

    2016-05-01

    Antibiotic resistant bacteria (ARB) and antibiotic resistance genes (ARG) in the aquatic environment have become an emerging contaminant issue, which has implications for human and ecological health. This review begins with an introduction to the occurrence of ARB and ARG in different environmental systems such as natural environments and drinking water resources. For example, ARG or ARB with resistance to ciprofloxacin, sulfamethoxazole, trimethoprim, quinolone, vancomycin, or tetracycline (e.g., tet(A), tet(B), tet(C), tet(G), tet(O), tet(M), tet(W), sul I, and sul II) have been detected in the environment. The development of resistance may be intrinsic, may be acquired through spontaneous mutations (de novo), or may occur due to horizontal gene transfer from donor bacteria, phages, or free DNA to recipient bacteria. An overview is also provided of the current knowledge regarding inactivation of ARB and ARG, and the mechanism of the effects of different disinfection processes in water and wastewater (chlorination, UV irradiation, Fenton reaction, ozonation, and photocatalytic oxidation). The effects of constructed wetlands and nanotechnology on ARB and ARG are also summarized.

  18. Microstructure Refinement After the Addition of Titanium Particles in AZ31 Magnesium Alloy Resistance Spot Welds

    NASA Astrophysics Data System (ADS)

    Xiao, L.; Liu, L.; Esmaeili, S.; Zhou, Y.

    2012-02-01

    Microstructural evolution of AZ31 magnesium alloy welds without and with the addition of titanium powders during resistance spot welding was studied using optical microscopy, scanning electron microscopy, and transmission electron microscopy (TEM). The fusion zone of AZ31 magnesium alloy welds could be divided into columnar dendritic zone (CDZ) and equiaxed dendritic zone (EDZ). The well-developed CDZ in the vicinity of the fusion boundary was clearly restricted and the coarse EDZ in the central region was efficiently refined by adding titanium powders into the molten pool, compared with the as-received alloy welds. A microstructural analysis showed that these titanium particles of approximately 8 µm diameter acted as inoculants and promoted the nucleation of α-Mg grains and the formation of equiaxed dendritic grains during resistance spot welding. Tensile-shear testing was applied to evaluate the effect of titanium addition on the mechanical properties of welds. It was found that both strength and ductility of magnesium alloy welds were increased after the titanium addition. A TEM examination showed the existence of an orientation matching relationship between the added Ti particles and Mg matrix, i.e., [ {0 1bar{1}0} ]_{{Mg}} // [ { 1bar{2} 1bar{3}} ]_{{Ti}} {{and}} ( {000 2} )_{{Mg}} // ( 10bar{1}0)_{{Ti}} in some grains of Ti polycrystal particles. This local crystallographic matching could promote heterogeneous nucleation of the Mg matrix during welding. The diameter of the added Ti inoculant should be larger than 1.8 µm to make it a potent inoculant.

  19. A Bacteroides tetracycline resistance gene represents a new class of ribosome protection tetracycline resistance.

    PubMed Central

    Nikolich, M P; Shoemaker, N B; Salyers, A A

    1992-01-01

    The ribosome protection type of tetracycline resistance (Tcr) has been found in a variety of bacterial species, but the only two classes described previously, Tet(M) and Tet(O), shared a high degree of amino acid sequence identity (greater than 75%). Thus, it appeared that this type of resistance emerged recently in evolution and spread among different species of bacteria by horizontal transmission. We obtained the DNA sequence of a Tcr gene from Bacteroides, a genus of gram-negative, obligately anaerobic bacteria that is phylogenetically distant from the diverse species in which tet(M) and tet(O) have been found. The Bacteroides Tcr gene defines a new class of ribosome protection resistance genes, Tet(Q), and has a deduced amino acid sequence that was only 40% identical to Tet(M) or Tet(O). Like tet(M) and tet(O), tet(Q) appears to have spread by horizontal transmission, but only within the Bacteroides group. Images PMID:1339256

  20. Cry1F Resistance in Fall Armyworm Spodoptera frugiperda: Single Gene versus Pyramided Bt Maize

    PubMed Central

    Huang, Fangneng; Qureshi, Jawwad A.; Meagher, Robert L.; Reisig, Dominic D.; Head, Graham P.; Andow, David A.; Ni, Xinzi; Kerns, David; Buntin, G. David; Niu, Ying; Yang, Fei; Dangal, Vikash

    2014-01-01

    Evolution of insect resistance to transgenic crops containing Bacillus thuringiensis (Bt) genes is a serious threat to the sustainability of this technology. However, field resistance related to the reduced efficacy of Bt maize has not been documented in any lepidopteran pest in the mainland U.S. after 18 years of intensive Bt maize planting. Here we report compelling evidence of field resistance in the fall armyworm, Spodoptera frugiperda (J.E. Smith), to Cry1F maize (TC 3507) in the southeastern region of the U.S. An F2 screen showed a surprisingly high (0.293) Cry1F resistance allele frequency in a population collected in 2011 from non-Bt maize in south Florida. Field populations from non-Bt maize in 2012–2013 exhibited 18.8-fold to >85.4-fold resistance to purified Cry1F protein and those collected from unexpectedly damaged Bt maize plants at several locations in Florida and North Carolina had >85.4-fold resistance. In addition, reduced efficacy and control failure of Cry1F maize against natural populations of S. frugiperda were documented in field trials using Cry1F-based and pyramided Bt maize products in south Florida. The Cry1F-resistant S. frugiperda also showed a low level of cross-resistance to Cry1A.105 and related maize products, but not to Cry2Ab2 or Vip3A. The occurrence of Cry1F resistance in the U.S. mainland populations of S. frugiperda likely represents migration of insects from Puerto Rico, indicating the great challenges faced in achieving effective resistance management for long-distance migratory pests like S. frugiperda. PMID:25401494

  1. Cry1F resistance in fall armyworm Spodoptera frugiperda: single gene versus pyramided Bt maize.

    PubMed

    Huang, Fangneng; Qureshi, Jawwad A; Meagher, Robert L; Reisig, Dominic D; Head, Graham P; Andow, David A; Ni, Xinzi; Kerns, David; Buntin, G David; Niu, Ying; Yang, Fei; Dangal, Vikash

    2014-01-01

    Evolution of insect resistance to transgenic crops containing Bacillus thuringiensis (Bt) genes is a serious threat to the sustainability of this technology. However, field resistance related to the reduced efficacy of Bt maize has not been documented in any lepidopteran pest in the mainland U.S. after 18 years of intensive Bt maize planting. Here we report compelling evidence of field resistance in the fall armyworm, Spodoptera frugiperda (J.E. Smith), to Cry1F maize (TC 3507) in the southeastern region of the U.S. An F2 screen showed a surprisingly high (0.293) Cry1F resistance allele frequency in a population collected in 2011 from non-Bt maize in south Florida. Field populations from non-Bt maize in 2012-2013 exhibited 18.8-fold to >85.4-fold resistance to purified Cry1F protein and those collected from unexpectedly damaged Bt maize plants at several locations in Florida and North Carolina had >85.4-fold resistance. In addition, reduced efficacy and control failure of Cry1F maize against natural populations of S. frugiperda were documented in field trials using Cry1F-based and pyramided Bt maize products in south Florida. The Cry1F-resistant S. frugiperda also showed a low level of cross-resistance to Cry1A.105 and related maize products, but not to Cry2Ab2 or Vip3A. The occurrence of Cry1F resistance in the U.S. mainland populations of S. frugiperda likely represents migration of insects from Puerto Rico, indicating the great challenges faced in achieving effective resistance management for long-distance migratory pests like S. frugiperda.

  2. Impact of dairy manure pre-application treatment on manure composition, soil dynamics of antibiotic resistance genes, and abundance of antibiotic-resistance genes on vegetables at harvest.

    PubMed

    Tien, Yuan-Ching; Li, Bing; Zhang, Tong; Scott, Andrew; Murray, Roger; Sabourin, Lyne; Marti, Romain; Topp, Edward

    2017-03-01

    Manuring ground used for crop production is an important agricultural practice. Should antibiotic-resistant enteric bacteria carried in the manure be transferred to crops that are consumed raw, their consumption by humans or animals will represent a route of exposure to antibiotic resistance genes. Treatment of manures prior to land application is a potential management option to reduce the abundance of antibiotic resistance genes entrained with manure application. In this study, dairy manure that was untreated, anaerobically digested, mechanically dewatered or composted was applied to field plots that were then cropped to lettuce, carrots and radishes. The impact of treatment on manure composition, persistence of antibiotic resistance gene targets in soil following application, and distribution of antibiotic resistance genes and bacteria on vegetables at harvest was determined. Composted manure had the lowest abundance of antibiotic resistance gene targets compared to the other manures. There was no significant difference in the persistence characteristics of antibiotic resistance genes following land application of the various manures. Compared to unmanured soil, antibiotic resistance genes were detected more frequently in soil receiving raw or digested manure, whereas they were not in soil receiving composted manure. The present study suggests that vegetables grown in ground receiving raw or digested manure are at risk of contamination with manure-borne antibiotic resistant bacteria, whereas vegetables grown in ground receiving composted manure are less so.

  3. Pyramiding, alternating or mixing: comparative performances of deployment strategies of nematode resistance genes to promote plant resistance efficiency and durability

    PubMed Central

    2014-01-01

    Background Resistant cultivars are key elements for pathogen control and pesticide reduction, but their repeated use may lead to the emergence of virulent pathogen populations, able to overcome the resistance. Increased research efforts, mainly based on theoretical studies, explore spatio-temporal deployment strategies of resistance genes in order to maximize their durability. We evaluated experimentally three of these strategies to control root-knot nematodes: cultivar mixtures, alternating and pyramiding resistance genes, under controlled and field conditions over a 3-years period, assessing the efficiency and the durability of resistance in a protected crop rotation system with pepper as summer crop and lettuce as winter crop. Results The choice of the resistance gene and the genetic background in which it is introgressed, affected the frequency of resistance breakdown. The pyramiding of two different resistance genes in one genotype suppressed the emergence of virulent isolates. Alternating different resistance genes in rotation was also efficient to decrease virulent populations in fields due to the specificity of the virulence and the trapping effect of resistant plants. Mixing resistant cultivars together appeared as a less efficient strategy to control nematodes. Conclusions This work provides experimental evidence that, in a cropping system with seasonal sequences of vegetable species, pyramiding or alternating resistance genes benefit yields in the long-term by increasing the durability of resistant cultivars and improving the long-term control of a soil-borne pest. To our knowledge, this result is the first one obtained for a plant-nematode interaction, which helps demonstrate the general applicability of such strategies for breeding and sustainable management of resistant cultivars against pathogens. PMID:24559060

  4. Effects of thermophilic composting on oxytetracycline, sulfamethazine, and their corresponding resistance genes in swine manure.

    PubMed

    Wang, Jian; Ben, Weiwei; Zhang, Yu; Yang, Min; Qiang, Zhimin

    2015-09-01

    Environmental contamination caused by residual antibiotics and antibiotic resistance genes (ARGs) in concentrated animal feeding operations has drawn increasing attention. This study investigated the removal of oxytetracycline (OTC) and sulfamethazine (SMN) as well as the behavior of their corresponding ARGs through a series of simulated composting tests with swine manure. The results indicate that the composting piles became fully mature after 32 days when the thermophilic stage was maintained at 55 °C for 3.5 days. At an initial spiked concentration of 50 (SMN) and 32 mg kg(-1) (OTC), their removal efficiency could reach 89.8% and 100%, respectively. An abiotic process was mainly responsible for the degradation of SMN, whereas both abiotic and biotic processes were responsible for the degradation of OTC. Among all the studied ARGs, only the tetracycline resistance genes (TRGs) encoding ribosomal protection proteins remained relatively stable throughout the composting process, while those encoding efflux pump (EFP) and enzymatic inactivation (EI) proteins and sulfonamide resistance genes (SRGs) obviously increased when the composting was complete. The addition of antibiotics inhibited the microbial activity in the early stage of composting but promoted the proliferation of ARGs particularly in the mesophilic stage. Integron-mediated horizontal gene transfers played an important role in the proliferation of most ARG types studied (i.e., EFP TRGs, EI TRG and SRGs). In summary, thermophilic composting of swine manure could remove the studied antibiotics effectively, but failed to prevent the proliferation of their corresponding ARGs.

  5. Identification of antibiotic resistance genes in the multidrug-resistant Acinetobacter baumannii strain, MDR-SHH02, using whole-genome sequencing.

    PubMed

    Wang, Hualiang; Wang, Jinghua; Yu, Peijuan; Ge, Ping; Jiang, Yanqun; Xu, Rong; Chen, Rong; Liu, Xuejie

    2017-02-01

    This study aimed to investigate antibiotic resistance genes in the multidrug-resistant (MDR) Acinetobacter baumannii (A. baumanii) strain, MDR-SHH02, using whole‑genome sequencing (WGS). The antibiotic resistance of MDR-SHH02 isolated from a patient with breast cancer to 19 types of antibiotics was determined using the Kirby‑Bauer method. WGS of MDR-SHH02 was then performed. Following quality control and transcriptome assembly, functional annotation of genes was conducted, and the phylogenetic tree of MDR-SHH02, along with another 5 A. baumanii species and 2 Acinetobacter species, was constructed using PHYLIP 3.695 and FigTree v1.4.2. Furthermore, pathogenicity islands (PAIs) were predicted by the pathogenicity island database. Potential antibiotic resistance genes in MDR-SHH02 were predicted based on the information in the Antibiotic Resistance Genes Database (ARDB). MDR-SHH02 was found to be resistant to all of the tested antibiotics. The total draft genome length of MDR-SHH02 was 4,003,808 bp. There were 74.25% of coding sequences to be annotated into 21 of the Clusters of Orthologous Groups (COGs) of protein terms, such as 'transcription' and 'amino acid transport and metabolism'. Furthermore, there were 45 PAIs homologous to the sequence MDRSHH02000806. Additionally, a total of 12 gene sequences in MDR-SHH02 were highly similar to the sequences of antibiotic resistance genes in ARDB, including genes encoding aminoglycoside‑modifying enzymes [e.g., aac(3)-Ia, ant(2'')‑Ia, aph33ib and aph(3')-Ia], β-lactamase genes (bl2b_tem and bl2b_tem1), sulfonamide-resistant dihydropteroate synthase genes (sul1 and sul2), catb3 and tetb. These results suggest that numerous genes mediate resistance to various antibiotics in MDR-SHH02, and provide a clinical guidance for the personalized therapy of A. baumannii-infected patients.

  6. Identification of antibiotic resistance genes in the multidrug-resistant Acinetobacter baumannii strain, MDR-SHH02, using whole-genome sequencing

    PubMed Central

    Wang, Hualiang; Wang, Jinghua; Yu, Peijuan; Ge, Ping; Jiang, Yanqun; Xu, Rong; Chen, Rong; Liu, Xuejie

    2017-01-01

    This study aimed to investigate antibiotic resistance genes in the multidrug-resistant (MDR) Acinetobacter baumannii (A. baumanii) strain, MDR-SHH02, using whole-genome sequencing (WGS). The antibiotic resistance of MDR-SHH02 isolated from a patient with breast cancer to 19 types of antibiotics was determined using the Kirby-Bauer method. WGS of MDR-SHH02 was then performed. Following quality control and transcriptome assembly, functional annotation of genes was conducted, and the phylogenetic tree of MDR-SHH02, along with another 5 A. baumanii species and 2 Acinetobacter species, was constructed using PHYLIP 3.695 and FigTree v1.4.2. Furthermore, pathogenicity islands (PAIs) were predicted by the pathogenicity island database. Potential antibiotic resistance genes in MDR-SHH02 were predicted based on the information in the Antibiotic Resistance Genes Database (ARDB). MDR-SHH02 was found to be resistant to all of the tested antibiotics. The total draft genome length of MDR-SHH02 was 4,003,808 bp. There were 74.25% of coding sequences to be annotated into 21 of the Clusters of Orthologous Groups (COGs) of protein terms, such as 'transcription' and 'amino acid transport and metabolism'. Furthermore, there were 45 PAIs homologous to the sequence MDRSHH02000806. Additionally, a total of 12 gene sequences in MDR-SHH02 were highly similar to the sequences of antibiotic resistance genes in ARDB, including genes encoding aminoglycoside-modifying enzymes [e.g., aac(3)-Ia, ant(2″)-Ia, aph33ib and aph(3′)-Ia], β-lactamase genes (bl2b_tem and bl2b_tem1), sulfonamide-resistant dihydropteroate synthase genes (sul1 and sul2), catb3 and tetb. These results suggest that numerous genes mediate resistance to various antibiotics in MDR-SHH02, and provide a clinical guidance for the personalized therapy of A. baumannii-infected patients. PMID:28035408

  7. Diversity of antimicrobial resistance and virulence genes in methicillin-resistant non-Staphylococcus aureus staphylococci from veal calves.

    PubMed

    Argudín, M Angeles; Vanderhaeghen, Wannes; Butaye, Patrick

    2015-04-01

    In this study we determined whether methicillin-resistant non-Staphylococcus aureus (MRNAS) from veal calves may be a potential reservoir of antimicrobial-resistance and virulence genes. Fifty-eight MRNAS were studied by means of DNA-microarray and PCR for detection of antimicrobial resistance and virulence genes. The isolates carried a variety of antimicrobial-resistance genes [aacA-aphD, aadD, aph3, aadE, sat, spc, ampA, erm(A), erm(B), erm(C), erm(F), erm(T), lnu(A), msr(A)-msr(B), vga(A), mph(C), tet(K), tet(M), tet(L), cat, fexA, dfrA, dfrD, dfrG, dfrK, cfr, fusB, fosB, qacA, qacC, merA-merB]. Some isolates carried resistance genes without showing the corresponding resistance phenotype. Most MRNAS carried typical S. aureus virulence factors like proteases (sspP) and enterotoxins (seg) genes. Most Staphylococcus epidermidis isolates carried the arginine catabolic element, and nearly 40% of the Staphylococcus sciuri isolates carried leukocidins, and/or fibronectin-binding protein genes. MRNAS were highly multi-resistant and represent an important reservoir of antimicrobial resistance and virulence genes.

  8. Distribution and Quantification of Antibiotic Resistant Genes and Bacteria across Agricultural and Non-Agricultural Metagenomes

    PubMed Central

    Durso, Lisa M.; Miller, Daniel N.; Wienhold, Brian J.

    2012-01-01

    There is concern that antibiotic resistance can potentially be transferred from animals to humans through the food chain. The relationship between specific antibiotic resistant bacteria and the genes they carry remains to be described. Few details are known about the ecology of antibiotic resistant genes and bacteria in food production systems, or how antibiotic resistance genes in food animals compare to antibiotic resistance genes in other ecosystems. Here we report the distribution of antibiotic resistant genes in publicly available agricultural and non-agricultural metagenomic samples and identify which bacteria are likely to be carrying those genes. Antibiotic resistance, as coded for in the genes used in this study, is a process that was associated with all natural, agricultural, and human-impacted ecosystems examined, with between 0.7 to 4.4% of all classified genes in each habitat coding for resistance to antibiotic and toxic compounds (RATC). Agricultural, human, and coastal-marine metagenomes have characteristic distributions of antibiotic resistance genes, and different bacteria that carry the genes. There is a larger percentage of the total genome associated with antibiotic resistance in gastrointestinal-associated and agricultural metagenomes compared to marine and Antarctic samples. Since antibiotic resistance genes are a natural part of both human-impacted and pristine habitats, presence of these resistance genes in any specific habitat is therefore not sufficient to indicate or determine impact of anthropogenic antibiotic use. We recommend that baseline studies and control samples be taken in order to determine natural background levels of antibiotic resistant bacteria and/or antibiotic resistance genes when investigating the impacts of veterinary use of antibiotics on human health. We raise questions regarding whether the underlying biology of each type of bacteria contributes to the likelihood of transfer via the food chain. PMID:23133629

  9. Survival of Antibiotic Resistant Bacteria and Horizontal Gene Transfer Control Antibiotic Resistance Gene Content in Anaerobic Digesters

    PubMed Central

    Miller, Jennifer H.; Novak, John T.; Knocke, William R.; Pruden, Amy

    2016-01-01

    Understanding fate of antibiotic resistant bacteria (ARB) vs. their antibiotic resistance genes (ARGs) during wastewater sludge treatment is critical in order to reduce the spread of antibiotic resistance through process optimization. Here, we spiked high concentrations of tetracycline-resistant bacteria, isolated from mesophilic (Iso M1-1—a Pseudomonas sp.) and thermophilic (Iso T10—a Bacillus sp.) anaerobic digested sludge, into batch digesters and monitored their fate by plate counts and quantitative polymerase chain reaction (QPCR) of their corresponding tetracycline ARGs. In batch studies, spiked ARB plate counts returned to baseline (thermophilic) or 1-log above baseline (mesophilic) while levels of the ARG present in the spiked isolate [tet(G)] remained high in mesophilic batch reactors. To compare results under semi-continuous flow conditions with natural influent variation, tet(O), tet(W), and sul1 ARGs, along with the intI1 integrase gene, were monitored over a 9-month period in the raw feed sludge and effluent sludge of lab-scale thermophilic and mesophilic anaerobic digesters. sul1 and intI1 in mesophilic and thermophilic digesters correlated positively (Spearman rho = 0.457–0.829, P < 0.05) with the raw feed sludge. There was no correlation in tet(O) or tet(W) ratios in raw sludge and mesophilic digested sludge or thermophilic digested sludge (Spearman rho = 0.130–0.486, P = 0.075–0.612). However, in the thermophilic digester, the tet(O) and tet(W) ratios remained consistently low over the entire monitoring period. We conclude that the influent sludge microbial composition can influence the ARG content of a digester, apparently as a result of differential survival or death of ARBs or horizontal gene transfer of genes between raw sludge ARBs and the digester microbial community. Notably, mesophilic digestion was more susceptible to ARG intrusion than thermophilic digestion, which may be attributed to a higher rate of ARB survival and

  10. Proteomic characterization of the Rph15 barley resistance gene-mediated defence responses to leaf rust

    PubMed Central

    2012-01-01

    Background Leaf rust, caused by the biotrophic fungal pathogen Puccinia hordei, is one of the most important foliar disease of barley (Hordeum vulgare) and represents a serious threat in many production regions of the world. The leaf rust resistance gene Rph15 is of outstanding interest for resistance breeding because it confers resistance to over 350 Puccinia hordei isolates collected from around the world. Molecular and biochemical mechanisms responsible for the Rph15 effectiveness are currently not investigated. The aim of the present work was to study the Rph15-based defence responses using a proteomic approach. Results Protein pattern changes in response to the leaf rust pathogen infection were investigated in two barley near isogenic lines (NILs), Bowman (leaf rust susceptible) and Bowman-Rph15 (leaf rust resistant), differing for the introgression of the leaf rust resistance gene Rph15. Two infection time points, 24 hours and four days post inoculation (dpi), were analysed. No statistically significant differences were identified at the early time point, while at 4 dpi eighteen protein spots were significantly up or down regulated with a fold-change equal or higher than two in response to pathogen infection. Almost all the pathogen-responsive proteins were identified in the Bowman-Rph15 resistant NIL. Protein spots were characterized by LC-MS/MS analysis and found to be involved in photosynthesis and energy metabolism, carbohydrate metabolism, protein degradation and defence. Proteomic data were complemented by transcriptional analysis of the respective genes. The identified proteins can be related to modulation of the photosynthetic apparatus components, re-direction of the metabolism to sustain defence responses and deployment of defence proteins. Conclusions The identification of leaf rust infection-modulated defence responses restricted to the resistant NIL support the hypothesis that basal defence responses of Bowman, but not the Rph15 resistance gene

  11. The Effect of Carbon Additions on the Creep Resistance of Fe-25Al-5Zr Alloy

    NASA Astrophysics Data System (ADS)

    Dobeš, Ferdinand; Vodičková, Věra; Veselý, Jozef; Kratochvíl, Petr

    2016-12-01

    Creep experiments were conducted on Fe-25 at. pct Al-5 at. pct Zr alloy with carbon additions at the temperatures of 973 K and 1173 K (700 °C and 900 °C). The alloys were tested in two different states: (i) cast and (ii) annealed at 1273 K (1000 °C) for 50 hours. Stress exponents and activation energies were estimated. The values of the stress exponent n could be explained by the dislocation motion controlled by climb. The increased values of n in the high-carbon alloy at the temperature of 1173 K (900 °C) can be described by means of the threshold stress concept. The creep resistance at 973 K (700 °C) decreased with the increasing content of carbon. This result is discussed in terms of the ratio of zirconium to carbon in the alloy. An increase of the creep resistance with increasing ratio Zr:C is in agreement with the behavior observed previously in alloys with substantially lower concentrations of zirconium.

  12. A review of processable high temperature resistant addition-type laminating resins

    NASA Technical Reports Server (NTRS)

    Serafini, T. T.; Delvigs, P.

    1973-01-01

    An important finding that resulted from research that was conducted to develop improved ablative resins was the discovery of a novel approach to synthesize processable high temperature resistant polymers. Low molecular weight polyimide prepolymers end-capped with norbornene groups were polymerized into thermo-oxidatively stable modified polyimides without the evolution of void producing volatile materials. This paper reviews basic studies that were performed using model compounds to elucidate the polymerization mechanism of the so-called addition-type polyimides. The fabrication and properties of polyimide/graphite fiber composites using A-type polyimide prepolymer as the matrix are described. An alternate method for preparing processable A-type polyimides by means of in situ polymerization of monomeric reactants on the fiber reinforcement is also described. Polyimide/graphite fiber composite performance at elevated temperatures is presented for A-type polyimides.

  13. 40 CFR 174.513 - Potato Leaf Roll Virus Resistance Gene (also known as orf1/orf2 gene); exemption from the...

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Potato Leaf Roll Virus Resistance Gene... Virus Resistance Gene (also known as orf1/orf2 gene); exemption from the requirement of a tolerance. An... protectant Potato Leaf Roll Virus Resistance Gene (also known as orf1/orf2 gene) in or on all...

  14. 40 CFR 174.513 - Potato Leaf Roll Virus Resistance Gene (also known as orf1/orf2 gene); exemption from the...

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 24 2011-07-01 2011-07-01 false Potato Leaf Roll Virus Resistance Gene... Virus Resistance Gene (also known as orf1/orf2 gene); exemption from the requirement of a tolerance. An... protectant Potato Leaf Roll Virus Resistance Gene (also known as orf1/orf2 gene) in or on all...

  15. Distribution and quantification of antibiotic resistance genes and bacteria across agricultural and non-agricultural metagenomes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    There is concern that antibiotic resistance can potentially be transferred from animals to humans through the food chain. The relationship between specific antibiotic resistant bacteria and the genes they carry remains to be described and few details are known about how antibiotic resistance genes i...

  16. Effect of Chlorine Exposure on the Survival and Antibiotic Gene Expression of Multidrug Resistant Acinetobacter baumannii in Water

    PubMed Central

    Karumathil, Deepti Prasad; Yin, Hsin-Bai; Kollanoor-Johny, Anup; Venkitanarayanan, Kumar

    2014-01-01

    Acinetobacter baumannii is a multidrug resistant pathogen capable of causing a wide spectrum of clinical conditions in humans. Acinetobacter spp. is ubiquitously found in different water sources. Chlorine being the most commonly used disinfectant in water, the study investigated the effect of chlorine on the survival of A. baumannii in water and transcription of genes conferring antibiotic resistance. Eight clinical isolates of A. baumannii, including a fatal meningitis isolate (ATCC 17978) (~108 CFU/mL) were separately exposed to free chlorine concentrations (0.2, 1, 2, 3 and 4 ppm) with a contact time of 30, 60, 90 and 120 second. The surviving pathogen counts at each specified contact time were determined using broth dilution assay. In addition, real-time quantitative PCR (RT-qPCR) analysis of the antibiotic resistance genes (efflux pump genes and those encoding resistance to specific antibiotics) of three selected A. baumannii strains following exposure to chlorine was performed. Results revealed that all eight A. baumannii isolates survived the tested chlorine levels during all exposure times (p > 0.05). Additionally, there was an up-regulation of all or some of the antibiotic resistance genes in A. baumannii, indicating a chlorine-associated induction of antibiotic resistance in the pathogen. PMID:24514427

  17. Effect of chlorine exposure on the survival and antibiotic gene expression of multidrug resistant Acinetobacter baumannii in water.

    PubMed

    Karumathil, Deepti Prasad; Yin, Hsin-Bai; Kollanoor-Johny, Anup; Venkitanarayanan, Kumar

    2014-02-07

    Acinetobacter baumannii is a multidrug resistant pathogen capable of causing a wide spectrum of clinical conditions in humans. Acinetobacter spp. is ubiquitously found in different water sources. Chlorine being the most commonly used disinfectant in water, the study investigated the effect of chlorine on the survival of A. baumannii in water and transcription of genes conferring antibiotic resistance. Eight clinical isolates of A. baumannii, including a fatal meningitis isolate (ATCC 17978) (~108 CFU/mL) were separately exposed to free chlorine concentrations (0.2, 1, 2, 3 and 4 ppm) with a contact time of 30, 60, 90 and 120 second. The surviving pathogen counts at each specified contact time were determined using broth dilution assay. In addition, real-time quantitative PCR (RT-qPCR) analysis of the antibiotic resistance genes (efflux pump genes and those encoding resistance to specific antibiotics) of three selected A. baumannii strains following exposure to chlorine was performed. Results revealed that all eight A. baumannii isolates survived the tested chlorine levels during all exposure times (p > 0.05). Additionally, there was an up-regulation of all or some of the antibiotic resistance genes in A. baumannii, indicating a chlorine-associated induction of antibiotic resistance in the pathogen.

  18. Antibiotic resistance, plasmid-mediated quinolone resistance (PMQR) genes and ampC gene in two typical municipal wastewater treatment plants.

    PubMed

    Su, Hao-Chang; Ying, Guang-Guo; He, Liang-Ying; Liu, You-Sheng; Zhang, Rui-Quan; Tao, Ran

    2014-02-01

    Antibiotic resistant bacteria and plasmid-mediated quinolone resistance genes and ampC gene were investigated for Escherichia coli isolates from two typical municipal wastewater treatment plants in both dry and wet seasons by using the antibiotic susceptibility test and PCR assay, respectively. The results showed that 98.4% of the isolates (1056) were found resistant to antibiotic(s) tested and 90.6% showed multiple resistances to at least three antibiotics. Tetracycline was found to have the highest resistance frequency (70.8%), followed by ampicillin (65.1%), whereas ceftazidime had the lowest resistance frequency of 9.0%. Moreover, 39.2% of the E. coli isolates were carrying plasmids. intI1 had the highest detection rate in the plasmids (38.1%), followed by qnrS, ampC, qnrB, intI2 and aac(6')-Ib-cr. The disinfection process (UV and chlorination) could significantly reduce the number of bacteria, but percentage of the resistant bacteria, resistance frequency for each antibiotic, MAR index and detection rate of the plasmid-mediated resistance genes were all found increasing in the effluents of biological units. The results of this study showed that a more frequent horizontal gene transfer occurred in the biological units. Wastewater treatment plants were an important medium for the recombination and dissemination of antibiotic resistance genes in the environment.

  19. Bioaerosol emissions and detection of airborne antibiotic resistance genes from a wastewater treatment plant

    NASA Astrophysics Data System (ADS)

    Li, Jing; Zhou, Liantong; Zhang, Xiangyu; Xu, Caijia; Dong, Liming; Yao, Maosheng

    2016-01-01

    Air samples from twelve sampling sites (including seven intra-plant sites, one upwind site and four downwind sites) from a wastewater treatment plant (WWTP) in Beijing were collected using a Reuter Centrifugal Sampler High Flow (RCS); and their microbial fractions were studied using culturing and high throughput gene sequence. In addition, the viable (fluorescent) bioaerosol concentrations for 7 intra-plant sites were also monitored for 30 min each using an ultraviolet aerodynamic particle sizer (UV-APS). Both air and water samples collected from the plant were investigated for possible bacterial antibiotic resistance genes and integrons using polymerase chain reaction (PCR) coupled with gel electrophoresis. The results showed that the air near sludge thickening basin was detected to have the highest level of culturable bacterial aerosols (up to 1697 CFU/m3) and fungal aerosols (up to 930 CFU/m3). For most sampling sites, fluorescent peaks were observed at around 3-4 μm, except the office building with a peak at 1.5 μm, with a number concentration level up to 1233-6533 Particles/m3. About 300 unique bacterial species, including human opportunistic pathogens, such as Comamonas Testosteroni and Moraxella Osloensis, were detected from the air samples collected over the biological reaction basin. In addition, we have detected the sul2 gene resistant to cotrimoxazole (also known as septra, bactrim and TMP-SMX) and class 1 integrase gene from the air samples collected from the screen room and the biological reaction basin. Overall, the screen room, sludge thickening basin and biological reaction basin imposed significant microbial exposure risks, including those from airborne antibiotic resistance genes.

  20. vanE gene cluster of vancomycin-resistant Enterococcus faecalis BM4405.

    PubMed

    Abadía Patiño, Lorena; Courvalin, Patrice; Perichon, Bruno

    2002-12-01

    Acquired VanE-type resistance to low levels of vancomycin (MIC = 16 microg/ml) in Enterococcus faecalis BM4405 is due to the inducible synthesis of peptidoglyean precursors terminating in D-alanine-D-serine (Fines,M., B. Prichon, P. Reynolds, D. Sahm, and P. Courvalin, Antimicrob. Agents Chemother. 43:2161-2164, 1999). A chromosomal location was assigned to the vanE operon by pulsed-field gel electrophoresis and hybridization, and its sequence was determined. Three genes, encoding the VanE ligase, the VanXYE DD-peptidase, and the VanTE serine racemase, that displayed 43 to 53% identity with the corresponding genes in the vanC operon were found. In addition, two genes coding for a two-component regulatory system, VanRE-VanSE, exhibiting 60 and 44% identity with VanR,-VanS, were present downstream from vanTE. However, because of a stop codon at position 78, VanSE was probably not functional. The five genes, with the same orientation, were shown to be cotranscribed by Northern analysis and reverse transcription-PCR. The vanE, vanXYE, and vanTE genes conferred inducible low-level resistance to vancomycin after cloning in E. faecalis JH2-2, probably following cross talk with a two-component regulatory system of the host.

  1. The CAPN10 Gene Is Associated with Insulin Resistance Phenotypes in the Spanish Population

    PubMed Central

    Sáez, María E.; González-Sánchez, José L.; Ramírez-Lorca, Reposo; Martínez-Larrad, María T.; Zabena, Carina; González, Alejandro; Morón, Francisco J.; Ruiz, Agustín; Serrano-Ríos, Manuel

    2008-01-01

    Cardiovascular disease is the leading cause of morbidity and mortality in the industrialized world. Familial aggregation of cardiovascular risk factors is a frequent finding, but genetic factors affecting its presentation are still poorly understood. The calpain 10 gene (CAPN10) has been associated with type 2 diabetes (T2DM), a complex metabolic disorder with increased risk of cardiovascular disease. Moreover, the CAPN10 gene has been associated with the presence of metabolic syndrome (MS) in T2DM and in polycystic ovary syndrome (PCOS). In this work, we have analysed whether the polymorphisms UCSNP44, -43, -19 and -63 are related to several cardiovascular risk factors in the context of MS. Molecular analysis of CAPN10 gene was performed in 899 individuals randomly chosen from a cross-sectional population-based epidemiological survey. We have found that CAPN10 gene in our population is mainly associated with two indicators of the presence of insulin resistance: glucose levels two hours after a 75-g oral glucose tolerance test (OGTT) and HOMA values, although cholesterol levels and blood pressure values are also influenced by CAPN10 variants. In addition, the 1221/1121 haplogenotype is under-represented in individuals that fulfil the International Diabetes Federation (IDF) diagnostic criteria for MS. Our results suggest that CAPN10 gene is associated with insulin resistance phenotypes in the Spanish population. PMID:18698425

  2. Isolation and Diversity Analysis of Resistance Gene Homologues from Switchgrass

    PubMed Central

    Zhu, Qihui; Bennetzen, Jeffrey L.; Smith, Shavannor M.

    2013-01-01

    Resistance gene homologs (RGHs) were isolated from the switchgrass variety Alamo by a combination of polymerase chain reaction and expressed sequence tag (EST) database mining. Fifty-eight RGHs were isolated by polymerase chain reaction and 295 RGHs were identified in 424,545 switchgrass ESTs. Four nucleotide binding site−leucine-rich repeat RGHs were selected to investigate RGH haplotypic diversity in seven switchgrass varieties chosen for their representation of a broad range of the switchgrass germplasm. Lowland and upland ecotypes were found to be less similar, even from nearby populations, than were more distant populations with similar growth environments. Most (83.5%) of the variability in these four RGHs was found to be attributable to the within-population component. The difference in nucleotide diversity between and within populations was observed to be small, whereas this diversity is maintained to similar degrees at both population and ecotype levels. The results also revealed that the analyzed RGHs were under positive selection in the studied switchgrass accessions. Intragenic recombination was detected in switchgrass RGHs, thereby demonstrating an active genetic process that has the potential to generate new resistance genes with new specificities that might act against newly-arising pathogen races. PMID:23589518

  3. The Identification of Intrinsic Chloramphenicol and Tetracycline Resistance Genes in Members of the Bacillus cereus Group (sensu lato).

    PubMed

    Glenwright, Helen; Pohl, Susanne; Navarro, Ferran; Miro, Elisenda; Jiménez, Guillermo; Blanch, Anicet R; Harwood, Colin R

    2016-01-01

    Bacillus toyonensis strain BCT-7112(T) (NCIMB 14858(T)) has been widely used as an additive in animal nutrition for more than 30 years without reports of adverse toxigenic effects. However, this strain is resistant to chloramphenicol and tetracycline and it is generally considered inadvisable to introduce into the food chain resistance determinants capable of being transferred to other bacterial strains, thereby adding to the pool of such determinants in the gastro-enteric systems of livestock species. We therefore characterized the resistance phenotypes of this strain and its close relatives to determine whether they were of recent origin, and therefore likely to be transmissible. To this end we identified the genes responsible for chloramphenicol (catQ) and tetracycline (tetM) resistance and confirmed the presence of homologs in other members of the B. toyonensis taxonomic unit. Unexpectedly, closely related strains encoding these genes did not exhibit chloramphenicol and tetracycline resistance phenotypes. To understand the differences in the behaviors, we cloned and expressed the genes, together with their upstream regulatory regions, into Bacillus subtilis. The data showed that the genes encoded functional proteins, but were expressed inefficiently from their native promoters. B. toyonensis is a taxonomic unit member of the Bacillus cereus group (sensu lato). We therefore extended the analysis to determine the extent to which homologous chloramphenicol and tetracycline resistance genes were present in other species within this group. This analysis revealed that homologous genes were present in nearly all representative species within the B. cereus group (sensu lato). The absence of known transposition elements and the observations that they are found at the same genomic locations, indicates that these chloramphenicol and tetracycline resistance genes are of ancient origin and intrinsic to this taxonomic group, rather than recent acquisitions. In this context

  4. The Identification of Intrinsic Chloramphenicol and Tetracycline Resistance Genes in Members of the Bacillus cereus Group (sensu lato)

    PubMed Central

    Glenwright, Helen; Pohl, Susanne; Navarro, Ferran; Miro, Elisenda; Jiménez, Guillermo; Blanch, Anicet R.; Harwood, Colin R.

    2017-01-01

    Bacillus toyonensis strain BCT-7112T (NCIMB 14858T) has been widely used as an additive in animal nutrition for more than 30 years without reports of adverse toxigenic effects. However, this strain is resistant to chloramphenicol and tetracycline and it is generally considered inadvisable to introduce into the food chain resistance determinants capable of being transferred to other bacterial strains, thereby adding to the pool of such determinants in the gastro-enteric systems of livestock species. We therefore characterized the resistance phenotypes of this strain and its close relatives to determine whether they were of recent origin, and therefore likely to be transmissible. To this end we identified the genes responsible for chloramphenicol (catQ) and tetracycline (tetM) resistance and confirmed the presence of homologs in other members of the B. toyonensis taxonomic unit. Unexpectedly, closely related strains encoding these genes did not exhibit chloramphenicol and tetracycline resistance phenotypes. To understand the differences in the behaviors, we cloned and expressed the genes, together with their upstream regulatory regions, into Bacillus subtilis. The data showed that the genes encoded functional proteins, but were expressed inefficiently from their native promoters. B. toyonensis is a taxonomic unit member of the Bacillus cereus group (sensu lato). We therefore extended the analysis to determine the extent to which homologous chloramphenicol and tetracycline resistance genes were present in other species within this group. This analysis revealed that homologous genes were present in nearly all representative species within the B. cereus group (sensu lato). The absence of known transposition elements and the observations that they are found at the same genomic locations, indicates that these chloramphenicol and tetracycline resistance genes are of ancient origin and intrinsic to this taxonomic group, rather than recent acquisitions. In this context we

  5. Cyclic nucleotide gated channel gene family in tomato: genome-wide identification and functional analyses in disease resistance

    PubMed Central

    Saand, Mumtaz A.; Xu, You-Ping; Li, Wen; Wang, Ji-Peng; Cai, Xin-Zhong

    2015-01-01

    The cyclic nucleotide gated channel (CNGC) is suggested to be one of the important calcium conducting channels. Nevertheless, genome-wide identification and systemic functional analysis of CNGC gene family in crop plant species have not yet been conducted. In this study, we performed genome-wide identification of CNGC gene family in the economically important crop tomato (Solanum lycopersicum L.) and analyzed function of the group IVb SlCNGC genes in disease resistance. Eighteen CNGC genes were identified in tomato genome, and four CNGC loci that were misannotated at database were corrected by cloning and sequencing. Detailed bioinformatics analyses on gene structure, domain composition and phylogenetic relationship of the SlCNGC gene family were conducted and the group-specific feature was revealed. Comprehensive expression analyses demonstrated that SlCNGC genes were highly, widely but differently responsive to diverse stimuli. Pharmacological assays showed that the putative CNGC activators cGMP and cAMP enhanced resistance against Sclerotinia sclerotiorum. Silencing of group IVb SlCNGC genes significantly enhanced resistance to fungal pathogens Pythium aphanidermatum and S. sclerotiorum, strongly reduced resistance to viral pathogen Tobacco rattle virus, while attenuated PAMP- and DAMP-triggered immunity as shown by obvious decrease of the flg22- and AtPep1-elicited hydrogen peroxide accumulation in SlCNGC-silenced plants. Additionally, silencing of these SlCNGC genes significantly altered expression of a set of Ca2+ signaling genes including SlCaMs, SlCDPKs, and SlCAMTA3. Collectively, our results reveal that group IV SlCNGC genes regulate a wide range of resistance in tomato probably by affecting Ca2+ signaling. PMID:25999969

  6. Apramycin resistance as a selective marker for gene transfer in mycobacteria.

    PubMed Central

    Paget, E; Davies, J

    1996-01-01

    We have explored the potential of using the apramycin resistance gene as a marker in mycobacterial gene transfer studies. Shuttle plasmids available for both electroporation and conjugation studies have been constructed, and we have successfully validated the use of the apramycin resistance gene as a component of cloning vectors for Mycobacterium smegmatis, M. bovis BCG, and M. tuberculosis. PMID:8892841

  7. Influence of Rice Development on the Function of Bacterial Blight Resistance Genes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Disease resistance genes most commonly used in breeding programs are single, dominant, resistance (R) genes with relative effectiveness influenced by plant developmental stage. Knowing the developmental stages at which an R gene is functional is important for disease management. In rice, resistanc...

  8. Multiple Genetic Processes Result in Heterogeneous Rates of Evolution within the Major Cluster Disease Resistance Genes in LettuceW⃞

    PubMed Central

    Kuang, Hanhui; Woo, Sung-Sick; Meyers, Blake C.; Nevo, Eviatar; Michelmore, Richard W.

    2004-01-01

    Resistance Gene Candidate2 (RGC2) genes belong to a large, highly duplicated family of nucleotide binding site–leucine rich repeat (NBS-LRR) encoding disease resistance genes located at a single locus in lettuce (Lactuca sativa). To investigate the genetic events occurring during the evolution of this locus, ∼1.5- to 2-kb 3′ fragments of 126 RGC2 genes from seven genotypes were sequenced from three species of Lactuca, and 107 additional RGC2 sequences were obtained from 40 wild accessions of Lactuca spp. The copy number of RGC2 genes varied from 12 to 32 per genome in the seven genotypes studied extensively. LRR number varied from 40 to 47; most of this variation had resulted from 13 events duplicating two to five LRRs because of unequal crossing-over within or between RGC2 genes at one of two recombination hot spots. Two types of RGC2 genes (Type I and Type II) were initially distinguished based on the pattern of sequence identities between their 3′ regions. The existence of two types of RGC2 genes was further supported by intron similarities, the frequency of sequence exchange, and their prevalence in natural populations. Type I genes are extensive chimeras caused by frequent sequence exchanges. Frequent sequence exchanges between Type I genes homogenized intron sequences, but not coding sequences, and obscured allelic/orthologous relationships. Sequencing of Type I genes from additional wild accessions confirmed the high frequency of sequence exchange and the presence of numerous chimeric RGC2 genes in nature. Unlike Type I genes, Type II genes exhibited infrequent sequence exchange between paralogous sequences. Type II genes from different genotype/species within the genus Lactuca showed obvious allelic/orthologous relationships. Trans-specific polymorphism was observed for different groups of orthologs, suggesting balancing selection. Unequal crossover, insertion/deletion, and point mutation events were distributed unequally through the gene. Different

  9. The Effect of Zirconium Addition on the Oxidation Resistance of Aluminide Coatings

    NASA Astrophysics Data System (ADS)

    Zagula-Yavorska, Maryana; Pytel, Maciej; Romanowska, Jolanta; Sieniawski, Jan

    2015-04-01

    Nickel, Mar M247, and Mar M200 superalloys were coated with zirconium-doped aluminide deposited by the chemical vapor deposition method. All coatings consisted of two layers: an additive one, comprising of the β-NiAl phase and the interdiffusion one. The interdiffusion layer on pure nickel consisted of the γ'-Ni3Al phase and β-NiAl phase on superalloys. Precipitations of zirconium-rich particles were found near the coating's surface and at the interface between the additive and the interdiffusion layer. Zirconium doping of aluminide coating improved the oxidation resistance of aluminide coatings deposited both on the nickel substrate and on the Mar M200 superalloy. Precipitations of ZrO2 embedded by the Al2O3 oxide were formed during oxidation. It seems that the ZrO2 oxide increases adhesion of the Al2O3 oxide to the coating and decreases the propensity of the Al2O3 oxide rumpling and spalling.

  10. A tetracycline efflux gene on Bacteroides transposon Tn4400 does not contribute to tetracycline resistance.

    PubMed Central

    Speer, B S; Salyers, A A

    1990-01-01

    Previously, we demonstrated that the Bacteroides transposon Tn4351, which confers tetracycline resistance only on aerobically grown Escherichia coli, carries a gene that codes for a tetracycline-inactivating enzyme (B. S. Speer and A. A. Salyers, J. Bacteriol. 170:1423-1429, 1988). However, Park et al. (B. H. Park, M. Hendricks, M. H. Malamy, F. P. Tally, and S. B. Levy, Antimicrob. Agents Chemother. 31:1739-1743, 1987) showed that E. coli carrying a closely related transposon, Tn4400, exhibits energy-dependent efflux of tetracycline as well as tetracycline-inactivating activity (B. H. Park and S. B. Levy, Antimicrob. Agents Chemother. 32:1797-1800, 1988). This result raised the question of whether efflux or inactivation or a combination of the two was necessary for resistance conferred by both transposons. We showed that cells carrying Tn4351 did not exhibit the clear-cut efflux activity seen with cells carrying Tn4400 but rather exhibited a tetracycline accumulation profile which could be explained solely on the basis of inactivation of tetracycline in the cytoplasm and rapid diffusion of altered tetracycline out of the cell. Additionally, we were able to clone the efflux and tetracycline-modifying genes of Tn4400 separately. The region carrying the efflux gene spanned one of the two regions in which Tn4400 differs from Tn4351. A clone containing the corresponding region of Tn4351 did not exhibit efflux. Thus, it appears that Tn4351 does not have the efflux gene and that efflux makes no contribution to the resistance conferred by Tn4351. The MIC for cells carrying the subclone from Tn4400 that contained only the gene for tetracycline inactivation was the same that for cells carrying both the inactivation and efflux genes. Cells carrying only the gene for tetracycline efflux were tetracycline sensitive. This was true even when the efflux gene was on a high-copy-number plasmid which increased the level of efflux to that associated with the Tcr gene on pBR328. These

  11. Avirulence (AVR) Gene-Based Diagnosis Complements Existing Pathogen Surveillance Tools for Effective Deployment of Resistance (R) Genes Against Rice Blast Disease.

    PubMed

    Selisana, S M; Yanoria, M J; Quime, B; Chaipanya, C; Lu, G; Opulencia, R; Wang, G-L; Mitchell, T; Correll, J; Talbot, N; Leung, H; Zhou, B

    2017-04-03

    Avirulence (AVR) genes in Magnaporthe oryzae, the fungal pathogen that causes the devastating rice blast disease, have been documented to be major targets subject to mutations to avoid recognition by resistance (R) genes. In this study, an AVR-gene-based diagnosis tool for determining the virulence spectrum of a rice blast pathogen population was developed and validated. A set of 77 single-spore field isolates was subjected to pathotype analysis using differential lines, each containing a single R gene, and classified into 20 virulent pathotypes, except for 4 isolates that lost pathogenicity. In all, 10 differential lines showed low frequency (<24%) of resistance whereas 8 lines showed a high frequency (>95%), inferring the effectiveness of R genes present in the respective differential lines. In addition, the haplotypes of seven AVR genes were determined by polymerase chain reaction amplification and sequencing, if applicable. The calculated frequency of different AVR genes displayed significant variations in the population. AVRPiz-t and AVR-Pii were detected in 100 and 84.9% of the isolates, respectively. Five AVR genes such as AVR-Pik-D (20.5%) and AVR-Pik-E (1.4%), AVRPiz-t (2.7%), AVR-Pita (0%), AVR-Pia (0%), and AVR1-CO39 (0%) displayed low or even zero frequency. The frequency of AVR genes correlated almost perfectly with the resistance frequency of the cognate R genes in differential lines, except for International Rice Research Institute-bred blast-resistant lines IRBLzt-T, IRBLta-K1, and IRBLkp-K60. Both genetic analysis and molecular marker validation revealed an additional R gene, most likely Pi19 or its allele, in these three differential lines. This can explain the spuriously higher resistance frequency of each target R gene based on conventional pathotyping. This study demonstrates that AVR-gene-based diagnosis provides a precise, R-gene-specific, and differential line-free assessment method that can be used for determining the virulence spectrum of

  12. Cross-Family Transcription Factor Interactions: An Additional Layer of Gene Regulation.

    PubMed

    Bemer, Marian; van Dijk, Aalt D J; Immink, Richard G H; Angenent, Gerco C

    2017-01-01

    Specific and dynamic gene expression strongly depends on transcription factor (TF) activity and most plant TFs function in a combinatorial fashion. They can bind to DNA and control the expression of the corresponding gene in an additive fashion or cooperate by physical interactions, forming larger protein complexes. The importance of protein-protein interactions between members of a particular plant TF family has long been recognised; however, a significant number of interfamily TF interactions has recently been reported. The biological implications and the molecular mechanisms involved in cross-family interactions have now started to be elucidated and the examples illustrate potential roles in the bridging of biological processes. Hence, cross-family TF interactions expand the molecular toolbox for plants with additional mechanisms to control and fine-tune robust gene expression patterns and to adapt to their continuously changing environment.

  13. Orsomucoid: A new variant and additional duplicated ORM1 gene in Qatari population

    SciTech Connect

    Sebetan, I.M.; Alali, K.A.; Alzaman, A.

    1994-09-01

    A new genetically determined ORM2 variant and additional duplicated ORM1 gene were observed in Qatari population using isoelectric focusing in ultra thin layer polyacrylamide gels. The studied population samples indicate occurence of six ORM1 alleles and three ORM2 ones. A simple reliable method for separation of orsomucoid variations with comparison of different reported methods will be presented.

  14. Antagonistic control of a dual-input mammalian gene switch by food additives

    PubMed Central

    Xie, Mingqi; Ye, Haifeng; Hamri, Ghislaine Charpin-El; Fussenegger, Martin

    2014-01-01

    Synthetic biology has significantly advanced the design of mammalian trigger-inducible transgene-control devices that are able to programme complex cellular behaviour. Fruit-based benzoate derivatives licensed as food additives, such as flavours (e.g. vanillate) and preservatives (e.g. benzoate), are a particularly attractive class of trigger compounds for orthogonal mammalian transgene control devices because of their innocuousness, physiological compatibility and simple oral administration. Capitalizing on the genetic componentry of the soil bacterium Comamonas testosteroni, which has evolved to catabolize a variety of aromatic compounds, we have designed different mammalian gene expression systems that could be induced and repressed by the food additives benzoate and vanillate. When implanting designer cells engineered for gene switch-driven expression of the human placental secreted alkaline phosphatase (SEAP) into mice, blood SEAP levels of treated animals directly correlated with a benzoate-enriched drinking programme. Additionally, the benzoate-/vanillate-responsive device was compatible with other transgene control systems and could be assembled into higher-order control networks providing expression dynamics reminiscent of a lap-timing stopwatch. Designer gene switches using licensed food additives as trigger compounds to achieve antagonistic dual-input expression profiles and provide novel control topologies and regulation dynamics may advance future gene- and cell-based therapies. PMID:25030908

  15. Antagonistic control of a dual-input mammalian gene switch by food additives.

    PubMed

    Xie, Mingqi; Ye, Haifeng; Hamri, Ghislaine Charpin-El; Fussenegger, Martin

    2014-08-01

    Synthetic biology has significantly advanced the design of mammalian trigger-inducible transgene-control devices that are able to programme complex cellular behaviour. Fruit-based benzoate derivatives licensed as food additives, such as flavours (e.g. vanillate) and preservatives (e.g. benzoate), are a particularly attractive class of trigger compounds for orthogonal mammalian transgene control devices because of their innocuousness, physiological compatibility and simple oral administration. Capitalizing on the genetic componentry of the soil bacterium Comamonas testosteroni, which has evolved to catabolize a variety of aromatic compounds, we have designed different mammalian gene expression systems that could be induced and repressed by the food additives benzoate and vanillate. When implanting designer cells engineered for gene switch-driven expression of the human placental secreted alkaline phosphatase (SEAP) into mice, blood SEAP levels of treated animals directly correlated with a benzoate-enriched drinking programme. Additionally, the benzoate-/vanillate-responsive device was compatible with other transgene control systems and could be assembled into higher-order control networks providing expression dynamics reminiscent of a lap-timing stopwatch. Designer gene switches using licensed food additives as trigger compounds to achieve antagonistic dual-input expression profiles and provide novel control topologies and regulation dynamics may advance future gene- and cell-based therapies.

  16. RNA expression analysis of efflux pump genes in clinical isolates of multidrug-resistant and extensively drug-resistant Mycobacterium tuberculosis in South Korea.

    PubMed

    Oh, Tae Sang; Kim, Young Jin; Kang, Hee Yoon; Kim, Chang-Ki; Cho, Sun Young; Lee, Hee Joo

    2017-04-01

    Tuberculosis (TB), caused by infection with Mycobacterium tuberculosis, is an important communicable disease. Various mechanisms of resistance to antituberculosis drugs have been reported; these are principally mutations in target genes. However, not all M. tuberculosis resistance can be explained by mutations in such genes. Other resistance mechanisms associated with drug transport, such as efflux pumps, have also been reported. In this study, we investigated the expression levels of three putative efflux pumps and mutations in target genes associated with injectable agents and fluoroquinolones with clinical MDR and XDR-TB isolates. Thirty clinical isolates of M. tuberculosis that had been phenotypically characterized were obtained from the Korean Institute of Tuberculosis. Of these, 14 were MDR-TB isolates resistant to at least one injectable aminoglycoside (amikacin; AMK, kanamycin; KAN, and/or capreomycin; CPM) and 16 were XDR-TB isolates. M. tuberculosis H37Rv (ATCC 27249) was used as a reference strain. Five putative genes (Rv1258c, Rv2686c, Rv2687c, Rv2688c and pstB) were selected for analysis in this study. Sequencing was performed to detect mutations in rrs and eis genes. qRT-PCR was performed to investigate expression levels of five efflux pump genes. Of the 30 isolates, 25 strains had mutations in rrs associated with resistance to KAN, CPM and AMK and two strains had eis mutations, as well as mutations in rrs. pstB (Rv0933) exhibited increased expression and Rv2687c and Rv2688c exhibited decreased expression compared to the reference strain. Increased expression of pstB in clinical drug-resistant tuberculosis isolates may contribute to drug resistance in M. tuberculosis. In our case, overexpression of Rv1258c may have been associated with resistance to kanamycin. No correlation was evident between Rv2686c, Rv2687c or Rv2688c expression and fluoroquinolone resistance. To explore the details of efflux pump drug-resistance mechanisms, further studies on

  17. Involvement of Fanconi anemia genes FANCD2 and FANCF in the molecular basis of drug resistance in leukemia.

    PubMed

    Yao, Chenjiao; Du, Wei; Chen, Haibiug; Xiao, Sheng; Huang, Lihua; Chen, Fang-Ping

    2015-06-01

    The Fanconi anemia (FA)‑associated proteins FANCF and FANCD2 are important components of the FA pathway of DNA crosslink repair. FANCF and FANCD2 have been found to be involved in drug‑resistant multiple myeloma, ovarian cancer, non‑small‑cell lung cancer, and head and neck cancer. However, it is unclear whether these two genes participate in adriamycin (ADR)‑resistant leukemia. Therefore, the aim of the current study was to investigate FANCF and FANCD2 expression in drug‑resistant and drug‑sensitive leukemia cells. Western blot analysis revealed enhanced FANCF expression and monoubiquitination of FANCD2 in ADR‑resistant cells. Additionally, it was observed that drug‑resistant cells had reduced DNA damage compared with drug‑sensitive cells. The results of this study indicate that the FA pathway may confer leukemia resistance to ADR via enhanced DNA interstrand crosslink repair.

  18. Influence of molybdenum silicide additions on high-temperature oxidation resistance of silicon nitride materials

    SciTech Connect

    Klemm, H.; Tangermann, K.; Schubert, C.; Hermel, W.

    1996-09-01

    The influence of additions of molybdenum disilicide (MoSi{sub 2}) on the microstructure and the mechanical properties of a silicon nitride (Si{sub 3}N{sub 4}) material, with neodymium oxide (Nd{sub 2}O{sub 3}) and aluminum nitride (AlN) as sintering aids, was studied. The composites, containing 5, 10, and 17.6 wt% MoSi{sub 2}, were fabricated by hot pressing. All materials exhibited a similar phase composition, detected by X-ray diffractometry. Up to MoSi{sub 2} additions of 10 wt%, mechanical properties such as strength, fracture toughness, or creep at 1,400 C were not affected significantly, in comparison to that of monolithic Si{sub 3}N{sub 4}. The oxidation resistance of the composites, in terms of weight gain, degraded. After 1,000 h of oxidation at 1,400 and 1,450 C in air, a greater weight gain (by a factor of approximately three) was obtained, in comparison to that of the material without MoSi{sub 2}. Nevertheless, after 1,000 h of oxidation, the degradation in strength of the composites was considerably less severe than that of the material without MoSi{sub 2}. An additional layer was formed, caused by processes at the surface of the Si{sub 3}N{sub 4} material, preventing the formation of pores, cracks, or glassy-phase-rich areas, which are common features of oxidation damage in Si{sub 3}N{sub 4} materials. This surface layer, containing Mo{sub 5}Si{sub 3} and silicon oxynitride (Si{sub 2}ON{sub 2}), was the result of reactions between MoSi{sub 2}, Si{sub 3}N{sub 4}, and the oxygen penetrating by diffusion into the material during the high-temperature treatment.

  19. Close linkage of a blast resistance gene, Pias(t), with a bacterial leaf blight resistance gene, Xa1-as(t), in a rice cultivar 'Asominori'.

    PubMed

    Endo, Takashi; Yamaguchi, Masayuki; Kaji, Ryota; Nakagomi, Koji; Kataoka, Tomomori; Yokogami, Narifumi; Nakamura, Toshiki; Ishikawa, Goro; Yonemaru, Jun-Ichi; Nishio, Takeshi

    2012-12-01

    It has long been known that a bacterial leaf blight-resistant line in rice obtained from a crossing using 'Asominori' as a resistant parent also has resistance to blast, but a blast resistance gene in 'Asominori' has not been investigated in detail. In the present study, a blast resistance gene in 'Asominori', tentatively named Pias(t), was revealed to be located within 162-kb region between DNA markers YX4-3 and NX4-1 on chromosome 4 and to be linked with an 'Asominori' allele of the bacterial leaf blight resistance gene Xa1, tentatively named Xa1-as(t). An 'Asominori' allele of Pias(t) was found to be dominant and difference of disease severity between lines having the 'Asominori' allele of Pias(t) and those without it was 1.2 in disease index from 0 to 10. Pias(t) was also closely linked with the Ph gene controlling phenol reaction, suggesting the possibility of successful selection of blast resistance using the phenol reaction. Since blast-resistant commercial cultivars have been developed using 'Asominori' as a parent, Pias(t) is considered to be a useful gene in rice breeding for blast resistance.

  20. Identification of Two Genes Required in Tomato for Full Cf-9-Dependent Resistance to Cladosporium fulvum.

    PubMed Central

    Hammond-Kosack, K. E.; Jones, D. A.; Jones, JDG.

    1994-01-01

    Mutagenesis was used to identify and characterize plant genes required for fungal disease resistance gene function in tomato. Seed of a stock homozygous for the Cf-9 gene for resistance to Cladosporium fulvum were treated with ethyl methanesulfonate, and 568 M2 families were screened for mutations to C. fulvum sensitivity. Eight mutants with reduced resistance were isolated. Four mutations, all of which mapped to the Cf-9 gene, lost both resistance and response to the race-specific AVR9 elicitor. The other four mutations partially lost resistance and response to the AVR9 elicitor. Cytological analysis revealed that a unique host cell staining pattern accompanied the reduced-resistance phenotype in three mutants. Two of the mutants with reduced resistance mapped to Cf-9, and two mapped to two distinct loci designated Rcr-1 and Rcr-2 (Required for Cladosporium resistance) that are unlinked to Cf-9. PMID:12244240

  1. Application of resistance gene analog markers to analyses of genetic structure and diversity in rice.

    PubMed

    Ren, Juansheng; Yu, Yuchao; Gao, Fangyuan; Zeng, Lihua; Lu, Xianjun; Wu, Xianting; Yan, Wengui; Ren, Guangjun

    2013-07-01

    Plant disease resistance gene analog (RGA) markers were designed according to the conserved sequence of known RGAs and used to map resistance genes. We used genome-wide RGA markers for genetic analyses of structure and diversity in a global rice germplasm collection. Of the 472 RGA markers, 138 were polymorphic and these were applied to 178 entries selected from the USDA rice core collection. Results from the RGA markers were similar between two methods, UPGMA and STRUCTURE. Additionally, the results from RGA markers in our study were agreeable with those previously reported from SSR markers, including cluster of ancestral classification, genetic diversity estimates, genetic relatedness, and cluster of geographic origins. These results suggest that RGA markers are applicable for analyses of genetic structure and diversity in rice. However, unlike SSR markers, the RGA markers failed to differentiate temperate japonica, tropical japonica, and aromatic subgroups. The restricted way for developing RGA markers from the cDNA sequence might limit the polymorphism of RGA markers in the genome, thus limiting the discriminatory power in comparison with SSR markers. Genetic differentiation obtained using RGA markers may be useful for defining genetic diversity of a suite of random R genes in plants, as many studies show a differentiation of resistance to a wide array of pathogens. They could also help to characterize the genetic structure and geographic distribution in crops, including rice, wheat, barley, and banana.

  2. Transcriptional and posttranscriptional regulation of the tomato leaf mould disease resistance gene Cf-9.

    PubMed

    Li, Wen; Xu, You-Ping; Cai, Xin-Zhong

    2016-01-29

    Plant disease resistance (R) genes confer effector-triggered immunity (ETI) to pathogens carrying complementary effector/avirulence (Avr) genes. They are traditionally recognized to function at translational and/or posttranslational levels. In this study, however, transcriptional and posttranscriptional regulation of Cf-9, a tomato R gene conferring resistance to leaf mould fungal pathogen carrying Avr9, was demonstrated. Expression of the Cf-9 gene was 10.8-54.7 folds higher in the Cf-9/Avr9 tomato lines than in the Cf-9 lines depending on the seedling age, indicating that the Cf-9 gene expression was strongly induced by Avr9. Moreover, expression of the Cf-9 gene in the 5-day-old Cf-9/Avr9 seedlings at 33 °C was approximately 80 folds lower than that at 25 °C, and was enhanced by 23.4 folds at only 4 h post temperature shift from 33 °C to 25 °C, demonstrating that the Avr9-mediated induction of the Cf-9 gene expression is reversibly repressed by high temperature. Expression of the Cf-9 gene in the Cf-9 seedlings was similarly affected by temperature as in the Cf-9/Avr9 seedlings, implying that the genetic control of temperature sensitivity of the Cf-9 gene expression is epistasis to its Avr9-mediated induction. Additionally, a miRNA sly-miR6022, TGGAAGGGAGAATATCCAGGA, targeting the leucine-rich repeat (LRR) domain spanning LRR13-LRR14 of the Cf-9 gene transcript was predicted. Over-expression of this miRNA resulted in over 88% reduction of the Cf-9 gene transcripts in both Nicotiana benthamiana and tomato, and thus verifying the function of sly-miR6022 in degrading the Cf-9 gene transcripts. Collectively, our results reveal that the tomato R gene Cf-9 is strongly regulated at transcriptional level by pathogen Avr9 in a temperature-sensitive manner and is also regulated at posttranscriptional level by a miRNA sly-miR6022.

  3. Antimicrobial-Resistant Bacterial Populations and Antimicrobial Resistance Genes Obtained from Environments Impacted by Livestock and Municipal Waste

    PubMed Central

    Durso, Lisa M.; Harhay, Dayna M.; Schmidt, John W.

    2015-01-01

    This study compared the populations of antimicrobial-resistant bacteria and the repertoire of antimicrobial resistance genes in four environments: effluent of three municipal wastewater treatment facilities, three cattle feedlot runoff catchment ponds, three swine waste lagoons, and two “low impact” environments (an urban lake and a relict prairie). Multiple liquid and solid samples were collected from each environment. The prevalences and concentrations of antimicrobial-resistant (AMR) Gram-negative (Escherichia coli and Salmonella enterica) and Gram-positive (enterococci) bacteria were determined from individual samples (n = 174). The prevalences of 84 antimicrobial resistance genes in metagenomic DNA isolated from samples pooled (n = 44) by collection date, location, and sample type were determined. The prevalences and concentrations of AMR E. coli and Salmonella were similar among the livestock and municipal sample sources. The levels of erythromycin-resistant enterococci were significantly higher in liquid samples from cattle catchment ponds and swine waste lagoons than in liquid samples from municipal wastewater treatment facilities, but solid samples from these environments did not differ significantly. Similarly, trimethoprim/sulfamethoxazole-resistant E. coli concentrations were significantly higher in swine liquid than in municipal liquid samples, but there was no difference in solid samples. Multivariate analysis of the distribution of antimicrobial resistance genes using principal coordinate analysis showed distinct clustering of samples with livestock (cattle and swine), low impact environment and municipal samples forming three separate clusters. The numbers of class A beta-lactamase, class C beta-lactamase, and fluoroquinolone resistance genes detected were significantly higher (P < 0.05) in municipal samples than in cattle runoff or swine lagoon samples. In conclusion, we report that AMR is a very widespread phenomenon and that similar

  4. Coral Thermal Tolerance: Tuning Gene Expression to Resist Thermal Stress

    PubMed Central

    Bellantuono, Anthony J.; Granados-Cifuentes, Camila; Miller, David J.; Hoegh-Guldberg, Ove; Rodriguez-Lanetty, Mauricio

    2012-01-01

    The acclimatization capacity of corals is a critical consideration in the persistence of coral reefs under stresses imposed by global climate change. The stress history of corals plays a role in subsequent response to heat stress, but the transcriptomic changes associated with these plastic changes have not been previously explored. In order to identify host transcriptomic changes associated with acquired thermal tolerance in the scleractinian coral Acropora millepora, corals preconditioned to a sub-lethal temperature of 3°C below bleaching threshold temperature were compared to both non-preconditioned corals and untreated controls using a cDNA microarray platform. After eight days of hyperthermal challenge, conditions under which non-preconditioned corals bleached and preconditioned corals (thermal-tolerant) maintained Symbiodinium density, a clear differentiation in the transcriptional profiles was revealed among the condition examined. Among these changes, nine differentially expressed genes separated preconditioned corals from non-preconditioned corals, with 42 genes differentially expressed between control and preconditioned treatments, and 70 genes between non-preconditioned corals and controls. Differentially expressed genes included components of an apoptotic signaling cascade, which suggest the inhibition of apoptosis in preconditioned corals. Additionally, lectins and genes involved in response to oxidative stress were also detected. One dominant pattern was the apparent tuning of gene expression observed between preconditioned and non-preconditioned treatments; that is, differences in expression magnitude were more apparent than differences in the identity of genes differentially expressed. Our work revealed a transcriptomic signature underlying the tolerance associated with coral thermal history, and suggests that understanding the molecular mechanisms behind physiological acclimatization would be critical for the modeling of reefs in impending climate

  5. Coral thermal tolerance: tuning gene expression to resist thermal stress.

    PubMed

    Bellantuono, Anthony J; Granados-Cifuentes, Camila; Miller, David J; Hoegh-Guldberg, Ove; Rodriguez-Lanetty, Mauricio

    2012-01-01

    The acclimatization capacity of corals is a critical consideration in the persistence of coral reefs under stresses imposed by global climate change. The stress history of corals plays a role in subsequent response to heat stress, but the transcriptomic changes associated with these plastic changes have not been previously explored. In order to identify host transcriptomic changes associated with acquired thermal tolerance in the scleractinian coral Acropora millepora, corals preconditioned to a sub-lethal temperature of 3°C below bleaching threshold temperature were compared to both non-preconditioned corals and untreated controls using a cDNA microarray platform. After eight days of hyperthermal challenge, conditions under which non-preconditioned corals bleached and preconditioned corals (thermal-tolerant) maintained Symbiodinium density, a clear differentiation in the transcriptional profiles was revealed among the condition examined. Among these changes, nine differentially expressed genes separated preconditioned corals from non-preconditioned corals, with 42 genes differentially expressed between control and preconditioned treatments, and 70 genes between non-preconditioned corals and controls. Differentially expressed genes included components of an apoptotic signaling cascade, which suggest the inhibition of apoptosis in preconditioned corals. Additionally, lectins and genes involved in response to oxidative stress were also detected. One dominant pattern was the apparent tuning of gene expression observed between preconditioned and non-preconditioned treatments; that is, differences in expression magnitude were more apparent than differences in the identity of genes differentially expressed. Our work revealed a transcriptomic signature underlying the tolerance associated with coral thermal history, and suggests that understanding the molecular mechanisms behind physiological acclimatization would be critical for the modeling of reefs in impending climate

  6. Resistance Genes and Genetic Elements Associated with Antibiotic Resistance in Clinical and Commensal Isolates of Streptococcus salivarius

    PubMed Central

    Chaffanel, Fanny; Charron-Bourgoin, Florence; Libante, Virginie; Leblond-Bourget, Nathalie

    2015-01-01

    The diversity of clinical (n = 92) and oral and digestive commensal (n = 120) isolates of Streptococcus salivarius was analyzed by multilocus sequence typing (MLST). No clustering of clinical or commensal strains can be observed in the phylogenetic tree. Selected strains (92 clinical and 46 commensal strains) were then examined for their susceptibilities to tetracyclines, macrolides, lincosamides, aminoglycosides, and phenicol antibiotics. The presence of resistance genes tet(M), tet(O), erm(A), erm(B), mef(A/E), and catQ and associated genetic elements was investigated by PCR, as was the genetic linkage of resistance genes. High rates of erythromycin and tetracycline resistance were observed among the strains. Clinical strains displayed either the erm(B) (macrolide-lincosamide-streptogramin B [MLSB] phenotype) or mef(A/E) (M phenotype) resistance determinant, whereas almost all the commensal strains harbored the mef(A/E) resistance gene, carried by a macrolide efflux genetic assembly (MEGA) element. A genetic linkage between a macrolide resistance gene and genes of Tn916 was detected in 23 clinical strains and 5 commensal strains, with a predominance of Tn3872 elements (n = 13), followed by Tn6002 (n = 11) and Tn2009 (n = 4) elements. Four strains harboring a mef(A/E) gene were also resistant to chloramphenicol and carried a catQ gene. Sequencing of the genome of one of these strains revealed that these genes colocalized on an IQ-like element, as already described for other viridans group streptococci. ICESt3-related elements were also detected in half of the isolates. This work highlights the potential role of S. salivarius in the spread of antibiotic resistance genes both in the oral sphere and in the gut. PMID:25862227

  7. Housefly Larva Vermicomposting Efficiently Attenuates Antibiotic Resistance Genes in Swine Manure, with Concomitant Bacterial Population Changes

    PubMed Central

    Wang, Hang; Li, Hongyi; Gilbert, Jack A.; Li, Haibo; Wu, Longhua; Liu, Meng; Wang, Liling; Zhou, Qiansheng; Yuan, Junxiang

    2015-01-01

    Manure from swine treated with antimicrobials as feed additives is a major source for the expansion of the antibiotic resistance gene (ARG) reservoir in the environment. Vermicomposting via housefly larvae (Musca domestica) can be efficiently used to treat manure and regenerate biofertilizer, but few studies have investigated its effect on ARG attenuation. Here, we tracked the abundances of 9 ARGs and the composition and structure of the bacterial communities in manure samples across 6 days of full-scale manure vermicomposting. On day 6, the abundances of genes encoding tetracycline resistance [tet(M), tet(O), tet(Q), and tet(W)] were reduced (P < 0.05), while those of genes encoding sulfonamide resistance (sul1 and sul2) were increased (P < 0.05) when normalized to 16S rRNA. The abundances of tetracycline resistance genes were correlated (P < 0.05) with the changing concentrations of tetracyclines in the manure. The overall diversity and richness of the bacteria significantly decreased during vermicomposting, accompanied by a 100 times increase in the relative abundance of Flavobacteriaceae spp. Variations in the abundances of ARGs were correlated with the changing microbial community structure and the relative abundances of the family Ruminococcaceae, class Bacilli, or phylum Proteobacteria. Vermicomposting, as a waste management practice, can reduce the overall abundance of ARGs. More research is warranted to assess the use of this waste management practice as a measure to attenuate the dissemination of antimicrobial residues and ARGs from livestock production before vermicompost can be safely used as biofertilizer in agroecosystems. PMID:26296728

  8. Housefly Larva Vermicomposting Efficiently Attenuates Antibiotic Resistance Genes in Swine Manure, with Concomitant Bacterial Population Changes.

    PubMed

    Wang, Hang; Li, Hongyi; Gilbert, Jack A; Li, Haibo; Wu, Longhua; Liu, Meng; Wang, Liling; Zhou, Qiansheng; Yuan, Junxiang; Zhang, Zhijian

    2015-11-01

    Manure from swine treated with antimicrobials as feed additives is a major source for the expansion of the antibiotic resistance gene (ARG) reservoir in the environment. Vermicomposting via housefly larvae (Musca domestica) can be efficiently used to treat manure and regenerate biofertilizer, but few studies have investigated its effect on ARG attenuation. Here, we tracked the abundances of 9 ARGs and the composition and structure of the bacterial communities in manure samples across 6 days of full-scale manure vermicomposting. On day 6, the abundances of genes encoding tetracycline resistance [tet(M), tet(O), tet(Q), and tet(W)] were reduced (P < 0.05), while those of genes encoding sulfonamide resistance (sul1 and sul2) were increased (P < 0.05) when normalized to 16S rRNA. The abundances of tetracycline resistance genes were correlated (P < 0.05) with the changing concentrations of tetracyclines in the manure. The overall diversity and richness of the bacteria significantly decreased during vermicomposting, accompanied by a 100 times increase in the relative abundance of Flavobacteriaceae spp. Variations in the abundances of ARGs were correlated with the changing microbial community structure and the relative abundances of the family Ruminococcaceae, class Bacilli, or phylum Proteobacteria. Vermicomposting, as a waste management practice, can reduce the overall abundance of ARGs. More research is warranted to assess the use of this waste management practice as a measure to attenuate the dissemination of antimicrobial residues and ARGs from livestock production before vermicompost can be safely used as biofertilizer in agroecosystems.

  9. Molecular Screening of Blast Resistance Genes in Rice using SSR Markers.

    PubMed

    Singh, A K; Singh, P K; Arya, Madhuri; Singh, N K; Singh, U S

    2015-03-01

    Rice Blast is the most devastating disease causing major yield losses in every year worldwide. It had been proved that using resistant rice varieties would be the most effective way to control this disease. Molecular screening and genetic diversities of major rice blast resistance genes were determined in 192 rice germplasm accessions using simple sequence repeat (SSR) markers. The genetic frequencies of the 10 major rice blast resistance genes varied from 19.79% to 54.69%. Seven accessions IC337593, IC346002, IC346004, IC346813, IC356117, IC356422 and IC383441 had maximum eight blast resistance gene, while FR13B, Hourakani, Kala Rata 1-24, Lemont, Brown Gora, IR87756-20-2-2-3, IC282418, IC356419, PKSLGR-1 and PKSLGR-39 had seven blast resistance genes. Twenty accessions possessed six genes, 36 accessions had five genes, 41 accessions had four genes, 38 accessions had three genes, 26 accessions had two genes, 13 accessions had single R gene and only one accession IC438644 does not possess any one blast resistant gene. Out of 192 accessions only 17 accessions harboured 7 to 8 blast resistance genes.

  10. Microarray-Based Detection of 90 Antibiotic Resistance Genes of Gram-Positive Bacteria

    PubMed Central

    Perreten, Vincent; Vorlet-Fawer, Lorianne; Slickers, Peter; Ehricht, Ralf; Kuhnert, Peter; Frey, Joachim

    2005-01-01

    A disposable microarray was developed for detection of up to 90 antibiotic resistance genes in gram-positive bacteria by hybridization. Each antibiotic resistance gene is represented by two specific oligonucleotides chosen from consensus sequences of gene families, except for nine genes for which only one specific oligonucleotide could be developed. A total of 137 oligonucleotides (26 to 33 nucleotides in length with similar physicochemical parameters) were spotted onto the microarray. The microarrays (ArrayTubes) were hybridized with 36 strains carrying specific antibiotic resistance genes that allowed testing of the sensitivity and specificity of 125 oligonucleotides. Among these were well-characterized multidrug-resistant strains of Enterococcus faecalis, Enterococcus faecium, and Lactococcus lactis and an avirulent strain of Bacillus anthracis harboring the broad-host-range resistance plasmid pRE25. Analysis of two multidrug-resistant field strains allowed the detection of 12 different antibiotic resistance genes in a Staphylococcus haemolyticus strain isolated from mastitis milk and 6 resistance genes in a Clostridium perfringens strain isolated from a calf. In both cases, the microarray genotyping corresponded to the phenotype of the strains. The ArrayTube platform presents the advantage of rapidly screening bacteria for the presence of antibiotic resistance genes known in gram-positive bacteria. This technology has a large potential for applications in basic research, food safety, and surveillance programs for antimicrobial resistance. PMID:15872258

  11. Screening for differential resistance responses to Phakopsora pachyrhizi between Rpp3, Rpp?(Hyuuga) and 12 additional soybean accessions

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Asian soybean rust (ASR) is an economically significant disease caused by the fungus Phakopsora pachyrhizi. Five soybean genes that confer resistance to specific isolates of P. pachyrhizi (Rpp1 – Rpp5) were previously identified. More recently, the soybean cultivar Hyuuga (PI506764) was found to b...

  12. Genome-Wide Identification and Mapping of NBS-Encoding Resistance Genes in Solanum tuberosum Group Phureja

    PubMed Central

    Lozano, Roberto; Ponce, Olga; Ramirez, Manuel; Mostajo, Nelly; Orjeda, Gisella

    2012-01-01

    The majority of disease resistance (R) genes identified to date in plants encode a nucleotide-binding site (NBS) and leucine-rich repeat (LRR) domain containing protein. Additional domains such as coiled-coil (CC) and TOLL/interleukin-1 receptor (TIR) domains can also be present. In the recently sequenced Solanum tuberosum group phureja genome we used HMM models and manual curation to annotate 435 NBS-encoding R gene homologs and 142 NBS-derived genes that lack the NBS domain. Highly similar homologs for most previously documented Solanaceae R genes were identified. A surprising ∼41% (179) of the 435 NBS-encoding genes are pseudogenes primarily caused by premature stop codons or frameshift mutations. Alignment of 81.80% of the 577 homologs to S. tuberosum group phureja pseudomolecules revealed non-random distribution of the R-genes; 362 of 470 genes were found in high density clusters on 11 chromosomes. PMID:22493716

  13. Bacterial plasmid-mediated quinolone resistance genes in aquatic environments in China

    PubMed Central

    Yan, Lei; Liu, Dan; Wang, Xin-Hua; Wang, Yunkun; Zhang, Bo; Wang, Mingyu; Xu, Hai

    2017-01-01

    Emerging antimicrobial resistance is a major threat to human’s health in the 21st century. Understanding and combating this issue requires a full and unbiased assessment of the current status on the prevalence of antimicrobial resistance genes and their correlation with each other and bacterial groups. In aquatic environments that are known reservoirs for antimicrobial resistance genes, we were able to reach this goal on plasmid-mediated quinolone resistance (PMQR) genes that lead to resistance to quinolones and possibly also to the co-emergence of resistance to β-lactams. Novel findings were made that qepA and aac-(6′)-Ib genes that were previously regarded as similarly abundant with qnr genes are now dominant among PMQR genes in aquatic environments. Further statistical analysis suggested that the correlation between PMQR and β-lactam resistance genes in the environment is still weak, that the correlations between antimicrobial resistance genes could be weakened by sufficient wastewater treatment, and that the prevalence of PMQR has been implicated in environmental, pathogenic, predatory, anaerobic, and more importantly, human symbiotic bacteria. This work provides a comprehensive analysis of PMQR genes in aquatic environments in Jinan, China, and provides information with which combat with the antimicrobial resistance problem may be fought. PMID:28094345

  14. Combining Selective Pressures to Enhance the Durability of Disease Resistance Genes

    PubMed Central

    Bourguet, Denis

    2016-01-01

    The efficacy of disease resistance genes in plants decreases over time because of the selection of virulent pathogen genotypes. A key goal of crop protection programs is to increase the durability of the resistance conferred by these genes. The spatial and temporal deployment of plant disease resistance genes is considered to be a major factor determining their durability. In the literature, four principal strategies combining resistance genes over time and space have been considered to delay the evolution of virulent pathogen genotypes. We reviewed this literature with the aim of determining which deployment strategy results in the greatest durability of resistance genes. Although theoretical and empirical studies comparing deployment strategies of more than one resistance gene are very scarce, they suggest that the overall durability of disease resistance genes can be increased by combining their presence in the same plant (pyramiding). Retrospective analyses of field monitoring data also suggest that the pyramiding of disease resistance genes within a plant is the most durable strategy. By extension, we suggest that the combination of disease resistance genes with other practices for pathogen control (pesticides, farming practices) may be a relevant management strategy to slow down the evolution of virulent pathogen genotypes. PMID:28066472

  15. Bacterial plasmid-mediated quinolone resistance genes in aquatic environments in China.

    PubMed

    Yan, Lei; Liu, Dan; Wang, Xin-Hua; Wang, Yunkun; Zhang, Bo; Wang, Mingyu; Xu, Hai

    2017-01-17

    Emerging antimicrobial resistance is a major threat to human's health in the 21(st) century. Understanding and combating this issue requires a full and unbiased assessment of the current status on the prevalence of antimicrobial resistance genes and their correlation with each other and bacterial groups. In aquatic environments that are known reservoirs for antimicrobial resistance genes, we were able to reach this goal on plasmid-mediated quinolone resistance (PMQR) genes that lead to resistance to quinolones and possibly also to the co-emergence of resistance to β-lactams. Novel findings were made that qepA and aac-(6')-Ib genes that were previously regarded as similarly abundant with qnr genes are now dominant among PMQR genes in aquatic environments. Further statistical analysis suggested that the correlation between PMQR and β-lactam resistance genes in the environment is still weak, that the correlations between antimicrobial resistance genes could be weakened by sufficient wastewater treatment, and that the prevalence of PMQR has been implicated in environmental, pathogenic, predatory, anaerobic, and more importantly, human symbiotic bacteria. This work provides a comprehensive analysis of PMQR genes in aquatic environments in Jinan, China, and provides information with which combat with the antimicrobial resistance problem may be fought.

  16. Genome-wide transcript analysis of maize hybrids: allelic additive gene expression and yield heterosis.

    PubMed

    Guo, Mei; Rupe, Mary A; Yang, Xiaofeng; Crasta, Oswald; Zinselmeier, Christopher; Smith, Oscar S; Bowen, Ben

    2006-09-01

    Heterosis, or hybrid vigor, has been widely exploited in plant breeding for many decades, but the molecular mechanisms underlying the phenomenon remain unknown. In this study, we applied genome-wide transcript profiling to gain a global picture of the ways in which a large proportion of genes are expressed in the immature ear tissues of a series of 16 maize hybrids that vary in their degree of heterosis. Key observations include: (1) the proportion of allelic additively expressed genes is positively associated with hybrid yield and heterosis; (2) the proportion of genes that exhibit a bias towards the expression level of the paternal parent is negatively correlated with hybrid yield and heterosis; and (3) there is no correlation between the over- or under-expression of specific genes in maize hybrids with either yield or heterosis. The relationship of the expression patterns with hybrid performance is substantiated by analysis of a genetically improved modern hybrid (Pioneer hybrid 3394) versus a less improved older hybrid (Pioneer hybrid 3306) grown at different levels of plant density stress. The proportion of allelic additively expressed genes is positively associated with the modern high yielding hybrid, heterosis and high yielding environments, whereas the converse is true for the paternally biased gene expression. The dynamic changes of gene expression in hybrids responding to genotype and environment may result from differential regulation of the two parental alleles. Our findings suggest that differential allele regulation may play an important role in hybrid yield or heterosis, and provide a new insight to the molecular understanding of the underlying mechanisms of heterosis.

  17. Genetic evidence for an additional function of phage T4 gene 32 protein: interaction with ligase.

    PubMed

    Mosig, G; Breschkin, A M

    1975-04-01

    Gene 32 of bacteriophage T4 is essential for DNA replication, recombination, and repair. In an attempt to clarify the role of the corresponding gene product, we have looked for mutations that specifically inactivate one but not all of its functions and for compensating suppressor mutations in other genes. Here we describe a gene 32 ts mutant that does not produce progeny, but in contrast to an am mutant investigated by others, is capable of some primary and secondary DNA replication and of forming "joint" recombinational intermediates after infection of Escherichia coli B at the restrictive temperature. However, parental and progeny DNA strands are not ligated to covalently linked "recombinant" molecules, and single strands of vegetative DNA do not exceed unit length. Progeny production as well as capacity for covalent linkage in this gene 32 ts mutant are partially restored by additional rII mutations. Suppression by rII depends on functioning host ligase [EC 6.5.1.2; poly(deoxyribonucleotide):poly(deoxyribonucleotide) ligase (AMP-forming, NMN-forming)]. This gene 32 ts mutation (unlike some others) in turn suppresses the characteristic plaque morphology of rII mutants. We conclude that gene 32 protein, in addition to its role in DNA replication and in the formation of "joint" recombinational intermediates, interacts with T4 ligase [EC 6.5.1.1; poly(deoxyribonucleotide):poly(deoxyribonucleotide) ligase (AMP-forming)] when recombining DNA strands are covalently linked. The protein of the mutant that we describe here is mainly defective in this interaction, thus inactivating T4 ligase in recombination. Suppressing rII mutations facilitate substitution of host ligase. There is suggestive evidence that these interactions occur at the membrane.

  18. Dissemination of Novel Antimicrobial Resistance Mechanisms through the Insertion Sequence Mediated Spread of Metabolic Genes.

    PubMed

    Furi, Leonardo; Haigh, Richard; Al Jabri, Zaaima J H; Morrissey, Ian; Ou, Hong-Yu; León-Sampedro, Ricardo; Martinez, Jose L; Coque, Teresa M; Oggioni, Marco R

    2016-01-01

    The widely used biocide triclosan selectively targets FabI, the NADH-dependent trans-2-enoyl-acyl carrier protein (ACP) reductase, which is also an important target for the development of narrow spectrum antibiotics. The analysis of triclosan resistant Staphylococcus aureus isolates had previously shown that in about half of the strains, the mechanism of triclosan resistance consists on the heterologous duplication of the triclosan target gene due to the acquisition of an additional fabI allele derived from Staphylococcus haemolyticus (sh-fabI). In the current work, the genomic sequencing of 10 of these strains allowed the characterization of two novel composite transposons TnSha1 and TnSha2 involved in the spread of sh-fabI. TnSha1 harbors one copy of IS1272, whereas TnSha2 is a 11.7 kb plasmid carrying TnSha1 present either as plasmid or in an integrated form generally flanked by two IS1272 elements. The target and mechanism of integration for IS1272 and TnSha1 are novel and include targeting of DNA secondary structures, generation of blunt-end deletions of the stem-loop and absence of target duplication. Database analyses showed widespread occurrence of these two elements in chromosomes and plasmids, with TnSha1 mainly in S. aureus and with TnSha2 mainly in S. haemolyticus and S. epidermidis. The acquisition of resistance by means of an insertion sequence-based mobilization and consequent duplication of drug-target metabolic genes, as observed here for sh-fabI, is highly reminiscent of the situation with the ileS2 gene conferring mupirocin resistance, and the dfrA and dfrG genes conferring trimethoprim resistance both of which are mobilized by IS257. These three examples, which show similar mechanisms and levels of spread of metabolic genes linked to IS elements, highlight the importance of this genetic strategy for recruitment and rapid distribution of novel resistance mechanisms in staphylococci.

  19. Dissemination of Novel Antimicrobial Resistance Mechanisms through the Insertion Sequence Mediated Spread of Metabolic Genes

    PubMed Central

    Furi, Leonardo; Haigh, Richard; Al Jabri, Zaaima J. H.; Morrissey, Ian; Ou, Hong-Yu; León-Sampedro, Ricardo; Martinez, Jose L.; Coque, Teresa M.; Oggioni, Marco R.

    2016-01-01

    The widely used biocide triclosan selectively targets FabI, the NADH-dependent trans-2-enoyl-acyl carrier protein (ACP) reductase, which is also an important target for the development of narrow spectrum antibiotics. The analysis of triclosan resistant Staphylococcus aureus isolates had previously shown that in about half of the strains, the mechanism of triclosan resistance consists on the heterologous duplication of the triclosan target gene due to the acquisition of an additional fabI allele derived from Staphylococcus haemolyticus (sh-fabI). In the current work, the genomic sequencing of 10 of these strains allowed the characterization of two novel composite transposons TnSha1 and TnSha2 involved in the spread of sh-fabI. TnSha1 harbors one copy of IS1272, whereas TnSha2 is a 11.7 kb plasmid carrying TnSha1 present either as plasmid or in an integrated form generally flanked by two IS1272 elements. The target and mechanism of integration for IS1272 and TnSha1 are novel and include targeting of DNA secondary structures, generation of blunt-end deletions of the stem-loop and absence of target duplication. Database analyses showed widespread occurrence of these two elements in chromosomes and plasmids, with TnSha1 mainly in S. aureus and with TnSha2 mainly in S. haemolyticus and S. epidermidis. The acquisition of resistance by means of an insertion sequence-based mobilization and consequent duplication of drug-target metabolic genes, as observed here for sh-fabI, is highly reminiscent of the situation with the ileS2 gene conferring mupirocin resistance, and the dfrA and dfrG genes conferring trimethoprim resistance both of which are mobilized by IS257. These three examples, which show similar mechanisms and levels of spread of metabolic genes linked to IS elements, highlight the importance of this genetic strategy for recruitment and rapid distribution of novel resistance mechanisms in staphylococci. PMID:27446047

  20. Discovery of Genes Related to Insecticide Resistance in Bactrocera dorsalis by Functional Genomic Analysis of a De Novo Assembled Transcriptome

    PubMed Central

    Hsu, Ju-Chun; Wu, Wen-Jer; Feng, Hai-Tung; Haymer, David S.; Chen, Chien-Yu

    2012-01-01

    Insecticide resistance has recently become a critical concern for control of many insect pest species. Genome sequencing and global quantization of gene expression through analysis of the transcriptome can provide useful information relevant to this challenging problem. The oriental fruit fly, Bactrocera dorsalis, is one of the world's most destructive agricultural pests, and recently it has been used as a target for studies of genetic mechanisms related to insecticide resistance. However, prior to this study, the molecular data available for this species was largely limited to genes identified through homology. To provide a broader pool of gene sequences of potential interest with regard to insecticide resistance, this study uses whole transcriptome analysis developed through de novo assembly of short reads generated by next-generation sequencing (NGS). The transcriptome of B. dorsalis was initially constructed using Illumina's Solexa sequencing technology. Qualified reads were assembled into contigs and potential splicing variants (isotigs). A total of 29,067 isotigs have putative homologues in the non-redundant (nr) protein database from NCBI, and 11,073 of these correspond to distinct D. melanogaster proteins in the RefSeq database. Approximately 5,546 isotigs contain coding sequences that are at least 80% complete and appear to represent B. dorsalis genes. We observed a strong correlation between the completeness of the assembled sequences and the expression intensity of the transcripts. The assembled sequences were also used to identify large numbers of genes potentially belonging to families related to insecticide resistance. A total of 90 P450-, 42 GST-and 37 COE-related genes, representing three major enzyme families involved in insecticide metabolism and resistance, were identified. In addition, 36 isotigs were discovered to contain target site sequences related to four classes of resistance genes. Identified sequence motifs were also analyzed to

  1. The biofilm-specific antibiotic resistance gene ndvB is important for expression of ethanol oxidation genes in Pseudomonas aeruginosa biofilms.

    PubMed

    Beaudoin, Trevor; Zhang, Li; Hinz, Aaron J; Parr, Christopher J; Mah, Thien-Fah

    2012-06-01

    Bacteria growing in biofilms are responsible for a large number of persistent infections and are often more resistant to antibiotics than are free-floating bacteria. In a previous study, we identified a Pseudomonas aeruginosa gene, ndvB, which is important for the formation of periplasmic glucans. We established that these glucans function in biofilm-specific antibiotic resistance by sequestering antibiotic molecules away from their cellular targets. In this study, we investigate another function of ndvB in biofilm-specific antibiotic resistance. DNA microarray analysis identified 24 genes that were responsive to the presence of ndvB. A subset of 20 genes, including 8 ethanol oxidation genes (ercS', erbR, exaA, exaB, eraR, pqqB, pqqC, and pqqE), was highly expressed in wild-type biofilm cells but not in ΔndvB biofilms, while 4 genes displayed the reciprocal expression pattern. Using quantitative real-time PCR, we confirmed the ndvB-dependent expression of the ethanol oxidation genes and additionally demonstrated that these genes were more highly expressed in biofilms than in planktonic cultures. Expression of erbR in ΔndvB biofilms was restored after the treatment of the biofilm with periplasmic extracts derived from wild-type biofilm cells. Inactivation of ethanol oxidation genes increased the sensitivity of biofilms to tobramycin. Together, these results reveal that ndvB affects the expression of multiple genes in biofilms and that ethanol oxidation genes are linked to biofilm-specific antibiotic resistance.

  2. Novel Role for the yceGH Tellurite Resistance Genes in the Pathogenesis of Bacillus anthracis

    PubMed Central

    Franks, Sarah E.; Ebrahimi, Celia; Hollands, Andrew; Okumura, Cheryl Y.; Aroian, Raffi V.; Nizet, Victor

    2014-01-01

    Bacillus anthracis, the causative agent of anthrax, relies on multiple virulence factors to subvert the host immune defense. Using Caenorhabditis elegans as an infection model, we screened approximately 5,000 transposon mutants of B. anthracis Sterne for decreased virulence. One of the attenuated mutants resulted in loss of expression of yceG and yceH, the last two genes in a six-gene cluster of tellurite resistance genes. We generated an analogous insertional mutant to confirm the phenotype and characterize the role of yceGH in resistance to host defenses. Loss of yceGH rendered the mutants more sensitive to tellurite toxicity as well as to host defenses such as reactive oxygen species and the cathelicidin family of antimicrobial peptides. Additionally, we see decreased survival in mammalian models of infection, including human whole blood and in mice. We identify a novel role for the yceGH genes in B. anthracis Sterne virulence and suggest that C. elegans is a useful infection model to study anthrax pathogenesis. PMID:24366250

  3. Mutations in Novel Lipopolysaccharide Biogenesis Genes Confer Resistance to Amoebal Grazing in Synechococcus elongatus

    PubMed Central

    Effner, Emily E.; Iglesias-Sánchez, Maria José; Golden, Susan S.

    2016-01-01

    In natural and artificial aquatic environments, population structures and dynamics of photosynthetic microbes are heavily influenced by the grazing activity of protistan predators. Understanding the molecular factors that affect predation is critical for controlling toxic cyanobacterial blooms and maintaining cyanobacterial biomass production ponds for generating biofuels and other bioproducts. We previously demonstrated that impairment of the synthesis or transport of the O-antigen component of lipopolysaccharide (LPS) enables resistance to amoebal grazing in the model predator-prey system consisting of the heterolobosean amoeba HGG1 and the cyanobacterium Synechococcus elongatus PCC 7942 (R. S. Simkovsky et al., Proc Natl Acad Sci U S A 109:16678–16683, 2012, http://dx.doi.org/10.1073/pnas.1214904109). In this study, we used this model system to identify additional gene products involved in the synthesis of O antigen, the ligation of O antigen to the lipid A-core conjugated molecule (including a novel ligase gene), the generation of GDP-fucose, and the incorporation of sugars into the lipid A core oligosaccharide of S. elongatus. Knockout of any of these genes enables resistance to HGG1, and of these, only disruption of the genes involved in synthesis or incorporation of GDP-fucose into the lipid A-core molecule impairs growth. Because these LPS synthesis genes are well conserved across the diverse range of cyanobacteria, they enable a broader understanding of the structure and synthesis of cyanobacterial LPS and represent mutational targets for generating resistance to amoebal grazers in novel biomass production strains. PMID:26921432

  4. Chlorhexidine Induces VanA-Type Vancomycin Resistance Genes in Enterococci

    PubMed Central

    Bhardwaj, Pooja; Ziegler, Elizabeth

    2016-01-01

    Chlorhexidine is a bisbiguanide antiseptic used for infection control. Vancomycin-resistant E. faecium (VREfm) is among the leading causes of hospital-acquired infections. VREfm may be exposed to chlorhexidine at supra- and subinhibitory concentrations as a result of chlorhexidine bathing and chlorhexidine-impregnated central venous catheter use. We used RNA sequencing to investigate how VREfm responds to chlorhexidine gluconate exposure. Among the 35 genes upregulated ≥10-fold after 15 min of exposure to the MIC of chlorhexidine gluconate were those encoding VanA-type vancomycin resistance (vanHAX) and those associated with reduced daptomycin susceptibility (liaXYZ). We confirmed that vanA upregulation was not strain or species specific by querying other VanA-type VRE. VanB-type genes were not induced. The vanH promoter was found to be responsive to subinhibitory chlorhexidine gluconate in VREfm, as was production of the VanX protein. Using vanH reporter experiments with Bacillus subtilis and deletion analysis in VREfm, we found that this phenomenon is VanR dependent. Deletion of vanR did not result in increased chlorhexidine susceptibility, demonstrating that vanHAX induction is not protective against chlorhexidine. As expected, VanA-type VRE is more susceptible to ceftriaxone in the presence of sub-MIC chlorhexidine. Unexpectedly, VREfm is also more susceptible to vancomycin in the presence of subinhibitory chlorhexidine, suggesting that chlorhexidine-induced gene expression changes lead to additional alterations in cell wall synthesis. We conclude that chlorhexidine induces expression of VanA-type vancomycin resistance genes and genes associated with daptomycin nonsusceptibility. Overall, our results indicate that the impacts of subinhibitory chlorhexidine exposure on hospital-associated pathogens should be further investigated in laboratory studies. PMID:26810654

  5. Mining microbial metatranscriptomes for expression of antibiotic resistance genes under natural conditions

    NASA Astrophysics Data System (ADS)

    Versluis, Dennis; D'Andrea, Marco Maria; Ramiro Garcia, Javier; Leimena, Milkha M.; Hugenholtz, Floor; Zhang, Jing; Öztürk, Başak; Nylund, Lotta; Sipkema, Detmer; Schaik, Willem Van; de Vos, Willem M.; Kleerebezem, Michiel; Smidt, Hauke; Passel, Mark W. J. Van

    2015-07-01

    Antibiotic resistance genes are found in a broad range of ecological niches associated with complex microbiota. Here we investigated if resistance genes are not only present, but also transcribed under natural conditions. Furthermore, we examined the potential for antibiotic production by assessing the expression of associated secondary metabolite biosynthesis gene clusters. Metatranscriptome datasets from intestinal microbiota of four human adults, one human infant, 15 mice and six pigs, of which only the latter have received antibiotics prior to the study, as well as from sea bacterioplankton, a marine sponge, forest soil and sub-seafloor sediment, were investigated. We found that resistance genes are expressed in all studied ecological niches, albeit with niche-specific differences in relative expression levels and diversity of transcripts. For example, in mice and human infant microbiota predominantly tetracycline resistance genes were expressed while in human adult microbiota the spectrum of expressed genes was more diverse, and also included β-lactam, aminoglycoside and macrolide resistance genes. Resistance gene expression could result from the presence of natural antibiotics in the environment, although we could not link it to expression of corresponding secondary metabolites biosynthesis clusters. Alternatively, resistance gene expression could be constitutive, or these genes serve alternative roles besides antibiotic resistance.

  6. Mining microbial metatranscriptomes for expression of antibiotic resistance genes under natural conditions.

    PubMed

    Versluis, Dennis; D'Andrea, Marco Maria; Ramiro Garcia, Javier; Leimena, Milkha M; Hugenholtz, Floor; Zhang, Jing; Öztürk, Başak; Nylund, Lotta; Sipkema, Detmer; van Schaik, Willem; de Vos, Willem M; Kleerebezem, Michiel; Smidt, Hauke; van Passel, Mark W J

    2015-07-08

    Antibiotic resistance genes are found in a broad range of ecological niches associated with complex microbiota. Here we investigated if resistance genes are not only present, but also transcribed under natural conditions. Furthermore, we examined the potential for antibiotic production by assessing the expression of associated secondary metabolite biosynthesis gene clusters. Metatranscriptome datasets from intestinal microbiota of four human adults, one human infant, 15 mice and six pigs, of which only the latter have received antibiotics prior to the study, as well as from sea bacterioplankton, a marine sponge, forest soil and sub-seafloor sediment, were investigated. We found that resistance genes are expressed in all studied ecological niches, albeit with niche-specific differences in relative expression levels and diversity of transcripts. For example, in mice and human infant microbiota predominantly tetracycline resistance genes were expressed while in human adult microbiota the spectrum of expressed genes was more diverse, and also included β-lactam, aminoglycoside and macrolide resistance genes. Resistance gene expression could result from the presence of natural antibiotics in the environment, although we could not link it to expression of corresponding secondary metabolites biosynthesis clusters. Alternatively, resistance gene expression could be constitutive, or these genes serve alternative roles besides antibiotic resistance.

  7. Multifunctional Nanographene Oxide for Targeted Gene-Mediated Thermochemotherapy of Drug-resistant Tumour

    PubMed Central

    Zeng, Yiping; Yang, Zhangyou; Li, Hong; Hao, Yuhui; Liu, Cong; Zhu, Lin; Liu, Jing; Lu, Binghui; Li, Rong

    2017-01-01

    Drug resistance remains a major challenge for anticancer treatment, and one of the major mechanisms of drug resistance is the overexpression of drug efflux transporters in cancer. A new approach for defeating drug resistance is the use of a co-delivery strategy that utilizes small interfering RNA (siRNA) to silence the expression of efflux transporters together with a suitable anticancer drug for drug-resistant cells. In this work, multifunctional graphene capable of integrating multiple functions in one system was employed as a novel co-delivery system for siRNA and doxorubicin (Dox), as well as for the controlled release of intracellular pH-triggered and heat-triggered Dox. Additionally, it was used as a synergistic therapy based on the photothermal effect of graphene oxide (GO) under near-infrared (NIR) irradiation and the chemotherapeutic effect of Dox. The nanocomplex exhibited high drug and siRNA loading. Furthermore, the dual delivery of siRNA and Dox by folic acid (FA)-conjugated polyethylenimine-modified PEGylated nanographene (PPG-FA/siRNA/Dox) exhibited a satisfactory gene silencing effect as well as efficient intracellular delivery of Dox. Thus, Dox could access the nucleus and induce greater cytotoxicity compared with siRNA-absent delivery systems. Significantly, under irradiation, the combined treatment showed more synergistic effect for overcoming drug resistance compared with chemotherapy effect alone. PMID:28272412

  8. The effect of pyramiding Phytophthora infestans resistance genes R Pi-mcd1 and R Pi-ber in potato.

    PubMed

    Tan, M Y Adillah; Hutten, Ronald C B; Visser, Richard G F; van Eck, Herman J

    2010-06-01

    Despite efforts to control late blight in potatoes by introducing R(pi)-genes from wild species into cultivated potato, there are still concerns regarding the durability and level of resistance. Pyramiding R(pi)-genes can be a solution to increase both durability and level of resistance. In this study, two resistance genes, R(Pi-mcd1) and R(Pi-ber), introgressed from the wild tuber-bearing potato species Solanum microdontum and S. berthaultii were combined in a diploid S. tuberosum population. Individual genotypes from this population were classified after four groups, carrying no R(pi)-gene, with only R (Pi-mcd1), with only R(Pi-ber), and a group with the pyramided R(Pi-mcd1) and R (Pi-ber) by means of tightly linked molecular markers. The levels of resistance between the groups were compared in a field experiment in 2007. The group with R(Pi-mcd1) showed a significant delay to reach 50% infection of the leaf area of 3 days. The group with R ( Pi-ber ) showed a delay of 3 weeks. The resistance level in the pyramid group suggested an additive effect of R (Pi-mcd1) with R(Pi-ber). This suggests that potato breeding can benefit from combining individual R(pi)-genes, irrespective of the weak effect of R(Pi-mcd1) or the strong effect of R(Pi-ber).

  9. Gene quantification by the NanoGene assay is resistant to inhibition by humic acids.

    PubMed

    Kim, Gha-Young; Wang, Xiaofang; Ahn, Hosang; Son, Ahjeong

    2011-10-15

    NanoGene assay is a magnetic bead and quantum dot nanoparticles based gene quantification assay. It relies on a set of probe and signaling probe DNAs to capture the target DNA via hybridization. We have demonstrated the inhibition resistance of the NanoGene assay using humic acids laden genomic DNA (gDNA). At 1 μg of humic acid per mL, quantitiative PCR (qPCR) was inhibited to 0% of its quantification capability whereas NanoGene assay was able to maintain more than 60% of its quantification capability. To further increase the inhibition resistance of NanoGene assay at high concentration of humic acids, we have identified the specific mechanisms that are responsible for the inhibition. We examined five potential mechanisms with which the humic acids can partially inhibit our NanoGene assay. The mechanisms examined were (1) adsorption of humic acids on the particle surface; (2) particle aggregation induced by humic acids; (3) fluorescence quenching of quantum dots by humic acids during hybridization; (4) humic acids mimicking of target DNA; and (5) nonspecific binding between humic acids and target gDNA. The investigation showed that no adsorption of humic acids onto the particles' surface was observed for the humic acids' concentration. Particle aggregation and fluorescence quenching were also negligible. Humic acids also did not mimic the target gDNA except 1000 μg of humic acids per mL and hence should not contribute to the partial inhibition. Four of the above mechanisms were not related to the inhibition effect of humic acids particularly at the environmentally relevant concentrations (<100 μg/mL). However, a substantial amount of nonspecific binding was observed between the humic acids and target gDNA. This possibly results in lesser amount of target gDNA being captured by the probe and signaling DNA.

  10. Are PECTIN ESTERASE INHIBITOR Genes Involved in Mediating Resistance to Rhynchosporium commune in Barley?

    PubMed Central

    Marzin, Stephan; Hanemann, Anja; Sharma, Shailendra; Hensel, Götz; Kumlehn, Jochen; Schweizer, Günther; Röder, Marion S.

    2016-01-01

    A family of putative PECTIN ESTERASE INHIBITOR (PEI) genes, which were detected in the genomic region co-segregating with the resistance gene Rrs2 against scald caused by Rhynchosporium commune in barley, were characterized and tested for their possible involvement in mediating resistance to the pathogen by complementation and overexpression analysis. The sequences of the respective genes were derived from two BAC contigs originating from the susceptible cultivar ‘Morex’. For the genes HvPEI2, HvPEI3, HvPEI4 and HvPEI6, specific haplotypes for 18 resistant and 23 susceptible cultivars were detected after PCR-amplification and haplotype-specific CAPS-markers were developed. None of the tested candidate genes HvPEI2, HvPEI3 and HvPEI4 alone conferred a high resistance level in transgenic over-expression plants, though an improvement of the resistance level was observed especially with OE-lines for gene HvPEI4. These results do not confirm but also do not exclude an involvement of the PEI gene family in the response to the pathogen. A candidate for the resistance gene Rrs2 could not be identified yet. It is possible that Rrs2 is a PEI gene or another type of gene which has not been detected in the susceptible cultivar ‘Morex’ or the full resistance reaction requires the presence of several PEI genes. PMID:26937960

  11. Are PECTIN ESTERASE INHIBITOR Genes Involved in Mediating Resistance to Rhynchosporium commune in Barley?

    PubMed

    Marzin, Stephan; Hanemann, Anja; Sharma, Shailendra; Hensel, Götz; Kumlehn, Jochen; Schweizer, Günther; Röder, Marion S

    2016-01-01

    A family of putative PECTIN ESTERASE INHIBITOR (PEI) genes, which were detected in the genomic region co-segregating with the resistance gene Rrs2 against scald caused by Rhynchosporium commune in barley, were characterized and tested for their possible involvement in mediating resistance to the pathogen by complementation and overexpression analysis. The sequences of the respective genes were derived from two BAC contigs originating from the susceptible cultivar 'Morex'. For the genes HvPEI2, HvPEI3, HvPEI4 and HvPEI6, specific haplotypes for 18 resistant and 23 susceptible cultivars were detected after PCR-amplification and haplotype-specific CAPS-markers were developed. None of the tested candidate genes HvPEI2, HvPEI3 and HvPEI4 alone conferred a high resistance level in transgenic over-expression plants, though an improvement of the resistance level was observed especially with OE-lines for gene HvPEI4. These results do not confirm but also do not exclude an involvement of the PEI gene family in the response to the pathogen. A candidate for the resistance gene Rrs2 could not be identified yet. It is possible that Rrs2 is a PEI gene or another type of gene which has not been detected in the susceptible cultivar 'Morex' or the full resistance reaction requires the presence of several PEI genes.

  12. In silico analysis of gene content in tomato genomic regions mapped to the Ty-2 resistance gene.

    PubMed

    Liu, Y F; Wan, H J; Wei, Y P; Wang, R Q; Ruan, M Y; Ye, Q J; Li, Z M; Zhou, G Z; Yao, Z P; Yang, Y J

    2015-07-17

    Tomato yellow leaf curl virus is one of the main diseases affecting tomato production worldwide. Previous studies have shown that Ty-2 is an important resistance gene located between molecular markers C2_At2g28250 (82.3 cM) and T0302 (89.0 cM), and exhibits strong resistance to tomato yellow leaf curl virus in Asia. In this study, Ty-2 candidate genes were subjected to bioinformatic analysis for the sequenced tomato genome. We identified 69 genes between molecular markers C2_At2g28250 and T0302, 22 of which were disease-related resistant genes, including nucleotide binding site-leucine-rich repeat disease resistance genes, protease genes (protein kinase, kinase receptor, and protein isomerase), cytochromes, and transcription factors. Expressed sequence tag analysis revealed that 77.3% (17/22) of candidate disease-resistance genes were expressed, involving 143 expressed sequence tags. Based on full-length cDNA sequence analysis, 7 candidate genes were found, 4 of which were involved in tomato responses to pathogens. Microarray expression analysis also showed that most candidate genes were involved in the tomato responses to multiple pathogens, including fungi, viruses, and bacteria. RNA-seq expression analysis revealed that all candidate genes participated in tomato growth and development.

  13. Antimicrobial-resistant bacterial populations and antimicrobial resistance genes obtained from environments impacted by livestock and municipal waste

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study compared the populations of antimicrobial-resistant bacteria and the repertoire of antimicrobial resistance genes in four environments: effluent of three municipal waste water treatment facilities, three cattle feedlot runoff catchment ponds, three swine waste lagoons, and two "low impact...

  14. pncA Gene Mutations Associated with Pyrazinamide Resistance in Drug-Resistant Tuberculosis, South Africa and Georgia

    PubMed Central

    Allana, Salim; Shashkina, Elena; Mathema, Barun; Bablishvili, Nino; Tukvadze, Nestani; Shah, N. Sarita; Kempker, Russell R.; Blumberg, Henry M.; Moodley, Pravi; Mlisana, Koleka; Brust, James C.M.

    2017-01-01

    Although pyrazinamide is commonly used for tuberculosis treatment, drug-susceptibility testing is not routinely available. We found polymorphisms in the pncA gene for 70% of multidrug-resistant and 96% of extensively drug-resistant Mycobacterium tuberculosis isolates from South Africa and Georgia. Assessment of pyrazinamide susceptibility may be prudent before using it in regimens for drug-resistant tuberculosis. PMID:28221108

  15. Gene silencing using the recessive rice bacterial blight resistance gene xa13 as a new paradigm in plant breeding.

    PubMed

    Li, Changyan; Wei, Jing; Lin, Yongjun; Chen, Hao

    2012-05-01

    Resistant germplasm resources are valuable for developing resistant varieties in agricultural production. However, recessive resistance genes are usually overlooked in hybrid breeding. Compared with dominant traits, however, they may confer resistance to different pathogenic races or pest biotypes with different mechanisms of action. The recessive rice bacterial blight resistance gene xa13, also involved in pollen development, has been cloned and its resistance mechanism has been recently characterized. This report describes the conversion of bacterial blight resistance mediated by the recessive xa13 gene into a dominant trait to facilitate its use in a breeding program. This was achieved by knockdown of the corresponding dominant allele Xa13 in transgenic rice using recently developed artificial microRNA technology. Tissue-specific promoters were used to exclude most of the expression of artificial microRNA in the anther to ensure that Xa13 functioned normally during pollen development. A battery of highly bacterial blight resistant transgenic plants with normal seed setting rates were acquired, indicating that highly specific gene silencing had been achieved. Our success with xa13 provides a paradigm that can be adapted to other recessive resistance genes.

  16. A novel approach to locate Phytophthora infestans resistance genes on the potato genetic map.

    PubMed

    Jacobs, Mirjam M J; Vosman, Ben; Vleeshouwers, Vivianne G A A; Visser, Richard G F; Henken, Betty; van den Berg, Ronald G

    2010-02-01

    Mapping resistance genes is usually accomplished by phenotyping a segregating population for the resistance trait and genotyping it using a large number of markers. Most resistance genes are of the NBS-LRR type, of which an increasing number is sequenced. These genes and their analogs (RGAs) are often organized in clusters. Clusters tend to be rather homogenous, viz. containing genes that show high sequence similarity with each other. From many of these clusters the map position is known. In this study we present and test a novel method to quickly identify to which cluster a new resistance gene belongs and to produce markers that can be used for introgression breeding. We used NBS profiling to identify markers in bulked DNA samples prepared from resistant and susceptible genotypes of small segregating populations. Markers co-segregating with resistance can be tested on individual plants and directly used for breeding. To identify the resistance gene cluster a gene belongs to, the fragments were sequenced and the sequences analyzed using bioinformatics tools. Putative map positions arising from this analysis were validated using markers mapped in the segregating population. The versatility of the approach is demonstrated with a number of populations derived from wild Solanum species segregating for P. infestans resistance. Newly identified P. infestans resistance genes originating from S. verrucosum, S. schenckii, and S. capsicibaccatum could be mapped to potato chromosomes 6, 4, and 11, respectively.

  17. Identification of a major QTL together with several minor additive or epistatic QTLs for resistance to fire blight in apple in two related progenies.

    PubMed

    Calenge, F; Drouet, D; Denancé, C; Van de Weg, W E; Brisset, M-N; Paulin, J-P; Durel, C-E

    2005-06-01

    Although fire blight, caused by the bacterium Erwinia amylovora, is one of the most destructive diseases of apple (Malus x domestica) worldwide, no major, qualitative gene for resistance to this disease has been identified to date in apple. We conducted a quantitative trait locus (QTL) analysis in two F(1) progenies derived from crosses between the cultivars Fiesta and either Discovery or Prima. Both progenies were inoculated in the greenhouse with the same strain of E. amylovora, and the length of necrosis was scored 7 days and 14 days after inoculation. Additive QTLs were identified using the MAPQTL: software, and digenic epistatic interactions, which are an indication of putative epistatic QTLs, were detected by two-way analyses of variance. A major QTL explaining 34.3--46.6% of the phenotypic variation was identified on linkage group (LG) 7 of Fiesta in both progenies at the same genetic position. Four minor QTLs were also identified on LGs 3, 12 and 13. In addition, several significant digenic interactions were identified in both progenies. These results confirm the complex polygenic nature of resistance to fire blight in the progenies studied and also reveal the existence of a major QTL on LG7 that is stable in two distinct genetic backgrounds. This QTL could be a valuable target in marker-assisted selection to obtain new, fire blight-resistant apple cultivars and forms a starting point for discovering the function of the genes underlying such QTLs involved in fire blight control.

  18. Physical Mapping of Amplified Copies of the 5-Enolpyruvylshikimate-3-Phosphate Synthase Gene in Glyphosate-Resistant Amaranthus tuberculatus.

    PubMed

    Dillon, Andrew; Varanasi, Vijay K; Danilova, Tatiana V; Koo, Dal-Hoe; Nakka, Sridevi; Peterson, Dallas E; Tranel, Patrick J; Friebe, Bernd; Gill, Bikram S; Jugulam, Mithila

    2017-02-01

    Recent and rapid evolution of resistance to glyphosate, the most widely used herbicides, in several weed species, including common waterhemp (Amaranthus tuberculatus), poses a serious threat to sustained crop production. We report that glyphosate resistance in A tuberculatus was due to amplification of the 5-enolpyruvylshikimate-3-P synthase (EPSPS) gene, which encodes the molecular target of glyphosate. There was a positive correlation between EPSPS gene copies and its transcript expression. We analyzed the distribution of EPSPS copies in the genome of A tuberculatus using fluorescence in situ hybridization on mitotic metaphase chromosomes and interphase nuclei. Fluorescence in situ hybridization analysis mapped the EPSPS gene to pericentromeric regions of two homologous chromosomes in glyphosate sensitive A tuberculatus In glyphosate-resistant plants, a cluster of EPSPS genes on the pericentromeric region on one pair of homologous chromosomes was detected. Intriguingly, two highly glyphosate-resistant plants harbored an additional chromosome with several EPSPS copies besides the native chromosome pair with EPSPS copies. These results suggest that the initial event of EPSPS gene duplication may have occurred because of unequal recombination mediated by repetitive DNA. Subsequently, gene amplification may have resulted via several other mechanisms, such as chromosomal rearrangements, deletion/insertion, transposon-mediated dispersion, or possibly by interspecific hybridization. This report illustrates the physical mapping of amplified EPSPS copies in A tuberculatus.

  19. Identification of Genes in a Partially Resistant Genotype of Avena sativa Expressed in Response to Puccinia coronata Infection

    PubMed Central

    Loarce, Yolanda; Navas, Elisa; Paniagua, Carlos; Fominaya, Araceli; Manjón, José L.; Ferrer, Esther

    2016-01-01

    Cultivated oat (Avena sativa), an important crop in many countries, can suffer significant losses through infection by the fungus Puccinia coronata, the causal agent of crown rust disease. Understanding the molecular basis of existing partial resistance to this disease might provide targets of interest for crop improvement programs. A suppressive subtractive hybridization (SSH) library was constructed using cDNA from the partially resistant oat genotype MN841801-1 after inoculation with the pathogen. A total of 929 genes returned a BLASTx hit and were annotated under different GO terms, including 139 genes previously described as participants in mechanisms related to the defense response and signal transduction. Among these were genes involved in pathogen recognition, cell-wall modification, oxidative burst/ROS scavenging, and abscisic acid biosynthesis, as well genes related to inducible defense responses mediated by salicylic and jasmonic acid (although none of which had been previously reported involved in strong responses). These findings support the hypothesis that basal defense mechanisms are the main systems operating in oat partial resistance to P. coronata. When the expression profiles of 20 selected genes were examined at different times following inoculation with the pathogen, the partially resistant genotype was much quicker in mounting a response than a susceptible genotype. Additionally, a number of genes not previously described in oat transcriptomes were identified in this work, increasing our molecular knowledge of this crop. PMID:27303424

  20. Identification of Genes in a Partially Resistant Genotype of Avena sativa Expressed in Response to Puccinia coronata Infection.

    PubMed

    Loarce, Yolanda; Navas, Elisa; Paniagua, Carlos; Fominaya, Araceli; Manjón, José L; Ferrer, Esther

    2016-01-01

    Cultivated oat (Avena sativa), an important crop in many countries, can suffer significant losses through infection by the fungus Puccinia coronata, the causal agent of crown rust disease. Understanding the molecular basis of existing partial resistance to this disease might provide targets of interest for crop improvement programs. A suppressive subtractive hybridization (SSH) library was constructed using cDNA from the partially resistant oat genotype MN841801-1 after inoculation with the pathogen. A total of 929 genes returned a BLASTx hit and were annotated under different GO terms, including 139 genes previously described as participants in mechanisms related to the defense response and signal transduction. Among these were genes involved in pathogen recognition, cell-wall modification, oxidative burst/ROS scavenging, and abscisic acid biosynthesis, as well genes related to inducible defense responses mediated by salicylic and jasmonic acid (although none of which had been previously reported involved in strong responses). These findings support the hypothesis that basal defense mechanisms are the main systems operating in oat partial resistance to P. coronata. When the expression profiles of 20 selected genes were examined at different times following inoculation with the pathogen, the partially resistant genotype was much quicker in mounting a response than a susceptible genotype. Additionally, a number of genes not previously described in oat transcriptomes were identified in this work, increasing our molecular knowledge of this crop.

  1. Uncoupling PR gene expression from NPR1 and bacterial resistance: characterization of the dominant Arabidopsis cpr6-1 mutant.

    PubMed Central

    Clarke, J D; Liu, Y; Klessig, D F; Dong, X

    1998-01-01

    In Arabidopsis, NPR1 mediates the salicylic acid (SA)-induced expression of pathogenesis-related (PR) genes and systemic acquired resistance (SAR). Here, we report the identification of another component, CPR 6, that may function with NPR1 in regulating PR gene expression. The dominant CPR 6-1 mutant expresses the SA/NPR1-regulated PR genes (PR-1, BGL 2, and PR-5) and displays enhanced resistance to Pseudomonas syringae pv maculicola ES4326 and Peronospora parasitica Noco2 in the absence of SAR induction. cpr 6-1-induced PR gene expression is not suppressed in the cpr 6-1 npr1-1 double mutant but is suppressed when SA is removed by salicylate hydroxylase. Thus, constitutive PR gene expression in cpr 6-1 requires SA but not NPR1. In addition, resistance to P. s. maculicola ES4326 is suppressed in the cpr 6-1 npr1-1 double mutant, despite expression of PR-1, BGL 2, and PR-5. Resistance to P. s. maculicola ES4326 must therefore be accomplished through unidentified antibacterial gene products that are regulated through NPR1. These results show that CPR 6 is an important regulator of multiple signal transduction pathways involved in plant defense. PMID:9548982

  2. Intrinsic Macrolide Resistance in Mycobacterium smegmatis Is Conferred by a Novel erm Gene, erm(38)

    PubMed Central

    Nash, Kevin A.

    2003-01-01

    High-level, acquired macrolide resistance in mycobacteria is conferred by mutation within the 23S rRNA gene. However, several mycobacteria are naturally resistant to macrolides, including the Mycobacterium smegmatis group and Mycobacterium tuberculosis complex. Thus, the aim of this study was to characterize this resistance. Intrinsic macrolide resistance in M. smegmatis was inducible and showed cross-resistance to lincosamides but not to streptogramin B (i.e., ML resistance). A similar phenotype was found with Mycobacterium microti and macrolide-resistant Mycobacterium fortuitum. A search of the DNA sequence data for M. smegmatis strain mc2155 identified a novel erm gene, erm(38), and expression analysis showed that erm(38) RNA levels increased >10-fold after a 2-h incubation with macrolide. Inducible ML resistance was not expressed by an erm(38) knockout mutant, and complementation of this mutant with intact erm(38) in trans resulted in high-level ML resistance (e.g., clarithromycin MIC of >512 μg/ml). Thus, the results indicate that erm(38) confers the intrinsic ML resistance of M. smegmatis. Southern blot analysis with an erm(38)-specific probe indicated that a similar gene may be present in macrolide-resistant M. fortuitum. This finding, with the presence of the erm(37) gene (Rv1988) in the M. tuberculosis complex, suggests that such genes are widespread in mycobacteria with intrinsic macrolide resistance. PMID:14506008

  3. Resistance of Escherichia coli to nourseothricin (streptothricin): reduced penetrability of the cell wall as an additional, possibly unspecific mechanism.

    PubMed

    Seltmann, G

    1989-01-01

    The resistance of E. coli strains to the antibiotic nourseothricin is known to be caused by an acetyltransferase acetylating the beta-lysine chain of the antibiotic. In addition, most of the resistant strains exhibit reduced penetrability of the outer membrane, presumably caused by a reduced amount of available negative charges. This was shown using crystal violet, Congo red, or the hydrophobic antibiotic novobiocin as indicators.

  4. Fluoroquinolone induction of phage-mediated gene transfer in multidrug-resistant Salmonella.

    PubMed

    Bearson, Bradley L; Brunelle, Brian W

    2015-08-01

    Fluoroquinolones are broad-spectrum antibiotics that inhibit bacterial DNA gyrase and topoisomerase activity, which can cause DNA damage and result in bacterial cell death. In response to DNA damage, bacteria induce an SOS response to stimulate DNA repair. However, the SOS response may also induce prophage with production of infectious virions. Salmonella strains typically contain multiple prophages, and certain strains including phage types DT120 and DT104 contain prophage that upon induction are capable of generalised transduction. In this study, strains of multidrug-resistant (MDR) Salmonella enterica serovar Typhimurium DT120 and DT104 were exposed to fluoroquinolones important for use in human and veterinary disease therapy to determine whether prophage(s) are induced that could facilitate phage-mediated gene transfer. Cultures of MDR S. Typhimurium DT120 and DT104 containing a kanamycin resistance plasmid were lysed after exposure to fluoroquinolones (ciprofloxacin, enrofloxacin and danofloxacin). Bacterial cell lysates were able to transfer the plasmid to a recipient kanamycin-susceptible Salmonella strain by generalised transduction. In addition, exposure of DT120 to ciprofloxacin induced the recA gene of the bacterial SOS response and genes encoded in a P22-like generalised transducing prophage. This research indicates that fluoroquinolone exposure of MDR Salmonella can facilitate horizontal gene transfer, suggesting that fluoroquinolone usage in human and veterinary medicine may have unintended consequences, including the induction of phage-mediated gene transfer from MDR Salmonella. Stimulation of gene transfer following bacterial exposure to fluoroquinolones should be considered an adverse effect, and clinical decisions regarding antibiotic selection for infectious disease therapy should include this potential risk.

  5. Biofilm processes in treating mariculture wastewater may be a reservoir of antibiotic resistance genes.

    PubMed

    Li, Shuai; Zhang, Shenghua; Ye, Chengsong; Lin, Wenfang; Zhang, Menglu; Chen, Lihua; Li, Jinmei; Yu, Xin

    2017-03-09

    Antibiotics are heavily used in Chinese mariculture, but only a small portion of the added antibiotics are absorbed by living creatures. Biofilm processes are universally used in mariculture wastewater treatment. In this study, removal of antibiotics (norfloxacin, rifampicin, and oxytetracycline) from wastewater by moving bed biofilm reactors (MBBRs) and the influence of antibiotics on reactor biofilm were investigated. The results demonstrated that there was no significant effect of sub-μg/L-sub-mg/L concentrations of antibiotics on TOC removal. Moreover, the relative abundance of antibiotic resistance genes (ARGs) and antibiotic resistance bacteria (ARB) in MBBR biofilm increased because of selective pressure of antibiotics. In addition, antibiotics decreased the diversity of the biofilm bacterial community and altered bacterial community structure. These findings provide an empirical basis for the development of appropriate practices for mariculture, and suggest that disinfection and advanced oxidation should be applied to eliminate antibiotics, ARGs, and ARB from mariculture wastewater.

  6. Supercoiled Minivector DNA resists shear forces associated with gene therapy delivery

    PubMed Central

    Catanese, D J; Fogg, J M; Schrock, D E; Gilbert, B E; Zechiedrich, L

    2012-01-01

    Supercoiled DNAs varying from 281 to 5302 bp were subjected to shear forces generated by aerosolization or sonication. DNA shearing strongly correlated with length. Typical sized plasmids (⩾3000 bp) degraded rapidly. DNAs 2000–3000 bp persisted ∼10 min. Even in the absence of condensing agents, supercoiled DNA <1200 bp survived nebulization, and increased forces of sonication were necessary to shear it. Circular vectors were considerably more resistant to shearing than linear vectors of the same length. DNA supercoiling afforded additional protection. These results show the potential of shear-resistant Minivector DNAs to overcome one of the major challenges associated with gene therapy delivery. PMID:21633394

  7. Cloning of three genes involved in the flavonoid metabolic pathway and their expression during insect resistance in Pinus massoniana Lamb.

    PubMed

    Yang, Z Q; Chen, H; Tan, J H; Xu, H L; Jia, J; Feng, Y H

    2016-12-23

    Pinus massoniana Lamb. is an important timber and turpentine-producing tree species in China. Dendrolimus punctatus and Dasychira axutha are leaf-eating pests that have harmful effects on P. massoniana production. Few studies have focused on the molecular mechanisms underlying pest resistance in P. massoniana. Based on sequencing analysis of the transcriptomes of insect-resistant P. massoniana, three key genes involved in the flavonoid metabolic pathway were identified in the present study (PmF3H, PmF3'5'H, and PmC4H). Structural domain analysis showed that the PmF3H gene contains typical binding sites for the 2OG-Fe (II) oxygenase superfamily, while PmF3'5'H and PmC4H both contain the cytochrome P450 structural domain, which is specific for P450 enzymes. Phylogenetic analysis showed that each of the three P. massoniana genes, and the homologous genes in gymnosperms, clustered into a group. Expression of these three genes was highest in the stems, and was higher in the insect-resistant P. massoniana varieties than in the controls. The extent of the increased expression in the insect-resistant P. massoniana varieties indicated that these three genes are involved in defense mechanisms against pests in this species. In the insect-resistant varieties, rapid induction of PmF3H increased the levels of PmF3'5'H and PmC4H expression. The enhanced anti-pest capability of the insect-resistant varieties could be related to temperature and humidity. In addition, these results suggest that these three genes maycontribute to the change in flower color during female cone development.

  8. Caenorhabditis elegans PI3K mutants reveal novel genes underlying exceptional stress resistance and lifespan

    PubMed Central

    Ayyadevara, Srinivas; Tazearslan, Çagdaþ; Bharill, Puneet; Alla, Ramani; Siegel, Eric; Shmookler Reis, Robert J.

    2010-01-01

    Summary Two age-1 nonsense mutants, truncating the class-I phosphatidylinositol 3-kinase catalytic subunit (PI3KCS) before its kinase domain, confer extraordinary longevity and stress-resistance to Caenorhabditis elegans. These traits, unique to second-generation homozygotes, are blunted at the first generation and are largely reversed by additional mutations to DAF-16/FOXO, a transcription factor downstream of AGE-1 in insulin-like signaling. The strong age-1 alleles (mg44, m333) were compared with the weaker hx546 allele on expression microarrays, testing four independent cohorts of each allele. Among 276 genes with significantly differential expression, 92% showed fewer transcripts in adults carrying strong age-1 alleles rather than hx546. This proportion is significantly greater than the slight bias observed when contrasting age-1 alleles to wild-type worms. Thus, transcriptional changes peculiar to nonsense alleles primarily involve either gene silencing or failure of transcriptional activation. A subset of genes responding preferentially to age-1-nonsense alleles was reassessed by real-time polymerase chain reaction, in worms bearing strong or weak age-1 alleles; nearly all of these were significantly more responsive to the age-1(mg44) allele than to age-1(hx546). Additional mutation of daf-16 reverted the majority of altered mg44-F2 expression levels to approximately wild-type values, although a substantial number of genes remained significantly distinct from wild-type, implying that age-1(mg44) modulates transcription through both DAF-16/FOXO-dependent and –independent channels. When age-1-inhibited genes were targeted by RNA interference (RNAi) in wild-type or age-1(hx546) adults, most conferred significant oxidative-stress protection. RNAi constructs targeting two of those genes were shown previously to extend life, and RNAi’s targeting five novel genes were found here to increase lifespan. PI3K-null mutants may thus implicate novel mechanisms of life

  9. Genes controlling vaccine responses and disease resistance to respiratory viral pathogens in cattle

    PubMed Central

    Glass, Elizabeth J.; Baxter, Rebecca; Leach, Richard J.; Jann, Oliver C.

    2012-01-01

    addition, provision of high-density SNP chips should make it possible to link phenotypes with genotypes in field populations without the need for structured populations or pedigree information. This will hopefully enable fine mapping of QTL and ultimate identification of the causal gene(s). The research could lead to selection of animals that are more resistant to disease and new ways to improve vaccine efficacy. PMID:21621277

  10. Effect of Operating Parameters and Chemical Additives on Crystal Habit and Specific Cake Resistance of Zinc Hydroxide Precipitates

    SciTech Connect

    Alwin, Jennifer Louise

    1999-08-01

    The effect of process parameters and chemical additives on the specific cake resistance of zinc hydroxide precipitates was investigated. The ability of a slurry to be filtered is dependent upon the particle habit of the solid and the particle habit is influenced by certain process variables. The process variables studied include neutralization temperature, agitation type, and alkalinity source used for neutralization. Several commercially available chemical additives advertised to aid in solid/liquid separation were also examined in conjunction with hydroxide precipitation. A statistical analysis revealed that the neutralization temperature and the source of alkalinity were statistically significant in influencing the specific cake resistance of zinc hydroxide precipitates in this study. The type of agitation did not significantly effect the specific cake resistance of zinc hydroxide precipitates. The use of chemical additives in conjunction with hydroxide precipitation had a favorable effect on the filterability. The morphology of the hydroxide precipitates was analyzed using scanning electron microscopy.

  11. New polymorphism of the influenza virus resistance Mx1 gene in Iberian domestic pigs

    PubMed Central

    Godino, RF; Fernández, AI

    2016-01-01

    Mx1 (Myxovirus (Influenza virus) resistance 1, interferon-inducible protein p78) gene has been implicated in the resistance to a wide range of RNA viruses including influenza A in several species such as Sus scrofa. In the present study a 28-bp deletion in exon 14 of the Mx1 gene has been identified in Iberian domestic pigs but not in other domestic breeds neither in wild boars. The mutation produces a frameshift giving a protein with 6 amino acid substitutions and the extension of the C-terminal region with additional 20 amino acids with respect to the wild type MX1 protein. The new allelic polymorphism affects the antiviral domain of the MX1 protein and therefore might impact its anti-influenza virus activity. It has been demonstrated that polymorphisms in the Mx1 murine locus, affect the survival rate of mice upon experimental infection with influenza virus. It might be possible to improve the innate resistance of pigs to influenza virus infection by determining the porcine Mx1 alleles with more potent antiviral activity and genetically selecting animals bearing such alleles. PMID:27774491

  12. Identifying clinically relevant drug resistance genes in drug-induced resistant cancer cell lines and post-chemotherapy tissues.

    PubMed

    Tong, Mengsha; Zheng, Weicheng; Lu, Xingrong; Ao, Lu; Li, Xiangyu; Guan, Qingzhou; Cai, Hao; Li, Mengyao; Yan, Haidan; Guo, You; Chi, Pan; Guo, Zheng

    2015-12-01

    Until recently, few molecular signatures of drug resistance identified in drug-induced resistant cancer cell models can be translated into clinical practice. Here, we defined differentially expressed genes (DEGs) between pre-chemotherapy colorectal cancer (CRC) tissue samples of non-responders and responders for 5-fluorouracil and oxaliplatin-based therapy as clinically relevant drug resistance genes (CRG5-FU/L-OHP). Taking CRG5-FU/L-OHP as reference, we evaluated the clinical relevance of several types of genes derived from HCT116 CRC cells with resistance to 5-fluorouracil and oxaliplatin, respectively. The results revealed that DEGs between parental and resistant cells, when both were treated with the corresponding drug for a certain time, were significantly consistent with the CRG5-FU/L-OHP as well as the DEGs between the post-chemotherapy CRC specimens of responders and non-responders. This study suggests a novel strategy to extract clinically relevant drug resistance genes from both drug-induced resistant cell models and post-chemotherapy cancer tissue specimens.

  13. Influence of tetracycline on tetracycline-resistant heterotrophs and tet genes in activated sludge process.

    PubMed

    Yu, Jie; Liu, Dongfang; Li, Kexun

    2015-03-01

    The concentrations of tetracycline-intermediate resistant, tetracycline-resistant heterotrophic bacteria, and total heterotrophic bacteria were examined to assess the influence of tetracycline on tetracycline-resistant heterotrophs by the R2A agar cultivation method in the tetracycline fortified activated sludge process and in the natural background. Results showed that the percentages of both tetracycline-intermediate resistant and tetracycline-resistant heterotrophic bacteria in total heterotrophic bacteria were significantly increased, after tetracycline was fed to activated sludge for a 3 months period under four different operating conditions, as compared with the background. In order to investigate the mechanism of activated sludge resistance to tetracycline, polymerase chain reaction experiments were carried out to analyze the existence and evolution of tet genes in the presence of tetracycline. Results revealed that only tet A and tet B genes out of the 11 target tet genes were observed in tetracycline treated activated sludge while no tet gene was detected in background. This indicated that tet A gene could accumulate in activated sludge with slower and continuous influent, while the accumulation of tet B gene could be attributed to shorter hydraulic retention time. Therefore, it was proposed in this study that tetracycline-resistant genes created by efflux pumps spread earlier and quicker to encode resistance to tetracycline, which facilitated the increase in tetracycline-resistance.

  14. Development of High-Antifouling PPSU Ultrafiltration Membrane by Using Compound Additives: Preparation, Morphologies, and Filtration Resistant Properties

    PubMed Central

    Liu, Jie; Zhong, Zhencheng; Ma, Rui; Zhang, Weichen; Li, Jiding

    2016-01-01

    In this study, flat sheet asymmetric polyphenylsulfone (PPSU) ultrafiltration membranes with enhanced antifouling properties were prepared with a non-solvent induced phase separation (NIPS) method through compound additives containing a polymeric pore-forming agent, a small molecular non-solvent and a surfactant. The formation processes of the porous asymmetric membranes with different kinds of additives were studied in detail, and the microstructure controllable preparation of membrane was achieved by establishing a bridge between the membrane preparation parameters and separation performances. All prepared membranes were characterized by using a scanning electron microscope (SEM), contact angle analysis, porosity, maximum pore size, water and BSA solution permeability studies. The performance efficiency of the membrane was evaluated by using BSA as a model foulant in terms of permeability, solute rejection (R), Rm (membrane inherent resistance), Rc (cake layer resistance), and Rp (pore plugging resistance). The results showed that when the compound additives were used, the inter-connected pores were observed, maximum pore size, contact angle and membrane filtration resistance decreased, while the porosity increased. When PVP compound additives were added, the water flux increased from 80.4 to 148.1 L/(m2·h), the BSA rejection increased from 53.2% to 81.5%. A similar trend was observed for membranes with added PEG compound additives; the water flux and BSA rejection simultaneously increased. The filtration resistance decreased as a result of compound additives. The uniformity of membrane and the number of effective pores could be enhanced by adding compound additives through the cooperation of different additives. PMID:27338487

  15. Development of High-Antifouling PPSU Ultrafiltration Membrane by Using Compound Additives: Preparation, Morphologies, and Filtration Resistant Properties.

    PubMed

    Liu, Jie; Zhong, Zhencheng; Ma, Rui; Zhang, Weichen; Li, Jiding

    2016-06-21

    In this study, flat sheet asymmetric polyphenylsulfone (PPSU) ultrafiltration membranes with enhanced antifouling properties were prepared with a non-solvent induced phase separation (NIPS) method through compound additives containing a polymeric pore-forming agent, a small molecular non-solvent and a surfactant. The formation processes of the porous asymmetric membranes with different kinds of additives were studied in detail, and the microstructure controllable preparation of membrane was achieved by establishing a bridge between the membrane preparation parameters and separation performances. All prepared membranes were characterized by using a scanning electron microscope (SEM), contact angle analysis, porosity, maximum pore size, water and BSA solution permeability studies. The performance efficiency of the membrane was evaluated by using BSA as a model foulant in terms of permeability, solute rejection (R), Rm (membrane inherent resistance), Rc (cake layer resistance), and Rp (pore plugging resistance). The results showed that when the compound additives were used, the inter-connected pores were observed, maximum pore size, contact angle and membrane filtration resistance decreased, while the porosity increased. When PVP compound additives were added, the water flux increased from 80.4 to 148.1 L/(m²·h), the BSA rejection increased from 53.2% to 81.5%. A similar trend was observed for membranes with added PEG compound additives; the water flux and BSA rejection simultaneously increased. The filtration resistance decreased as a result of compound additives. The uniformity of membrane and the number of effective pores could be enhanced by adding compound additives through the cooperation of different additives.

  16. Reduced Fitness of Virulent Aphis glycines (Hemiptera: Aphididae) Biotypes May Influence the Longevity of Resistance Genes in Soybean.

    PubMed

    Varenhorst, Adam J; McCarville, Michael T; O'Neal, Matthew E

    2015-01-01

    Sustainable use of insect resistance in crops require insect resistance management plans that may include a refuge to limit the spread of virulence to this resistance. However, without a loss of fitness associated with virulence, a refuge may not prevent virulence from becoming fixed within a population of parthenogenetically reproducing insects like aphids. Aphid-resistance in soybeans (i.e., Rag genes) prevent outbreaks of soybean aphid (Aphis glycines), yet four biotypes defined by their capacity to survive on aphid-resistant soybeans (e.g., biotype-2 survives on Rag1 soybean) are found in North America. Although fitness costs are reported for biotype-3 on aphid susceptible and Rag1 soybean, it is not clear if virulence to aphid resistance in general is associated with a decrease in fitness on aphid susceptible soybeans. In laboratory assays, we measured fitness costs for biotype 2, 3 and 4 on an aphid-susceptible soybean cultivar. In addition, we also observed negative cross-resistance for biotype-2 on Rag3, and biotype-3 on Rag1 soybean. We utilized a simple deterministic, single-locus, four compartment genetic model to account for the impact of these findings on the frequency of virulence alleles. When a refuge of aphid susceptible was included within this model, fitness costs and negative cross-resistance delayed the increase of virulence alleles when virulence was inherited recessively or additively. If virulence were inherited additively, fitness costs decreased the frequency of virulence. Combined, these results suggest that a refuge may prevent virulent A. glycines biotypes from overcoming Rag genes if this aphid-resistance were used commercially in North America.

  17. Impact of Manure Fertilization on the Abundance of Antibiotic-Resistant Bacteria and Frequency of Detection of Antibiotic Resistance Genes in Soil and on Vegetables at Harvest

    PubMed Central

    Marti, Romain; Scott, Andrew; Tien, Yuan-Ching; Murray, Roger; Sabourin, Lyne; Zhang, Yun

    2013-01-01

    Consumption of vegetables represents a route of direct human exposure to bacteria found in soil. The present study evaluated the complement of bacteria resistant to various antibiotics on vegetables often eaten raw (tomato, cucumber, pepper, carrot, radish, lettuce) and how this might vary with growth in soil fertilized inorganically or with dairy or swine manure. Vegetables were sown into field plots immediately following fertilization and harvested when of marketable quality. Vegetable and soil samples were evaluated for viable antibiotic-resistant bacteria by plate count on Chromocult medium supplemented with antibiotics at clinical breakpoint concentrations. DNA was extracted from soil and vegetables and evaluated by PCR for the presence of 46 gene targets associated with plasmid incompatibility groups, integrons, or antibiotic resistance genes. Soil receiving manure was enriched in antibiotic-resistant bacteria and various antibiotic resistance determinants. There was no coherent corresponding increase in the abundance of antibiotic-resistant bacteria enumerated from any vegetable grown in manure-fertilized soil. Numerous antibiotic resistance determinants were detected in DNA extracted from vegetables grown in unmanured soil. A smaller number of determinants were additionally detected on vegetables grown only in manured and not in unmanured soil. Overall, consumption of raw vegetables represents a route of human exposure to antibiotic-resistant bacteria and resistance determinants naturally present in soil. However, the detection of some determinants on vegetables grown only in freshly manured soil reinforces the advisability of pretreating manure through composting or other stabilization processes or mandating offset times between manuring and harvesting vegetables for human consumption. PMID:23851089

  18. Impact of manure fertilization on the abundance of antibiotic-resistant bacteria and frequency of detection of antibiotic resistance genes in soil and on vegetables at harvest.

    PubMed

    Marti, Romain; Scott, Andrew; Tien, Yuan-Ching; Murray, Roger; Sabourin, Lyne; Zhang, Yun; Topp, Edward

    2013-09-01

    Consumption of vegetables represents a route of direct human exposure to bacteria found in soil. The present study evaluated the complement of bacteria resistant to various antibiotics on vegetables often eaten raw (tomato, cucumber, pepper, carrot, radish, lettuce) and how this might vary with growth in soil fertilized inorganically or with dairy or swine manure. Vegetables were sown into field plots immediately following fertilization and harvested when of marketable quality. Vegetable and soil samples were evaluated for viable antibiotic-resistant bacteria by plate count on Chromocult medium supplemented with antibiotics at clinical breakpoint concentrations. DNA was extracted from soil and vegetables and evaluated by PCR for the presence of 46 gene targets associated with plasmid incompatibility groups, integrons, or antibiotic resistance genes. Soil receiving manure was enriched in antibiotic-resistant bacteria and various antibiotic resistance determinants. There was no coherent corresponding increase in the abundance of antibiotic-resistant bacteria enumerated from any vegetable grown in manure-fertilized soil. Numerous antibiotic resistance determinants were detected in DNA extracted from vegetables grown in unmanured soil. A smaller number of determinants were additionally detected on vegetables grown only in manured and not in unmanured soil. Overall, consumption of raw vegetables represents a route of human exposure to antibiotic-resistant bacteria and resistance determinants naturally present in soil. However, the detection of some determinants on vegetables grown only in freshly manured soil reinforces the advisability of pretreating manure through composting or other stabilization processes or mandating offset times between manuring and harvesting vegetables for human consumption.

  19. In Silico Assigned Resistance Genes Confer Bifidobacterium with Partial Resistance to Aminoglycosides but Not to Β-Lactams

    PubMed Central

    Fouhy, Fiona; O’Connell Motherway, Mary; Fitzgerald, Gerald F.; Ross, R. Paul; Stanton, Catherine; van Sinderen, Douwe; Cotter, Paul D.

    2013-01-01

    Bifidobacteria have received significant attention due to their contribution to human gut health and the use of specific strains as probiotics. It is thus not surprising that there has also been significant interest with respect to their antibiotic resistance profile. Numerous culture-based studies have demonstrated that bifidobacteria are resistant to the majority of aminoglycosides, but are sensitive to β-lactams. However, limited research exists with respect to the genetic basis for the resistance of bifidobacteria to aminoglycosides. Here we performed an in-depth in silico analysis of putative Bifidobacterium-encoded aminoglycoside resistance proteins and β-lactamases and assess the contribution of these proteins to antibiotic resistance. The in silico-based screen detected putative aminoglycoside and β-lactam resistance proteins across the Bifidobacterium genus. Laboratory-based investigations of a number of representative bifidobacteria strains confirmed that despite containing putative β-lactamases, these strains were sensitive to β-lactams. In contrast, all strains were resistant to the aminoglycosides tested. To assess the contribution of genes encoding putative aminoglycoside resistance proteins in Bifidobacterium sp. two genes, namely Bbr_0651 and Bbr_1586, were targeted for insertional inactivation in B. breve UCC2003. As compared to the wild-type, the UCC2003 insertion mutant strains exhibited decreased resistance to gentamycin, kanamycin and streptomycin. This study highlights the associated risks of relying on the in silico assignment of gene function. Although several putative β-lactam resistance proteins are located in bifidobacteria, their presence does not coincide with resistance to these antibiotics. In contrast however, this approach has resulted in the identification of two loci that contribute to the aminoglycoside resistance of B. breve UCC2003 and, potentially, many other bifidobacteria. PMID:24324818

  20. Breeding Pierce's Disease resistant table and raisin grapes and the development of markers for additional sources of resistance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A total of 10 (6 table and 4 raisin) seedless x seedless crosses to develop mBC3, mBC4, and mBC5 V. arizonica x V. vinifera families were made. The crosses consisted of 44,187 emasculations and produced 4,974 ovules and 871 (17.5%) embryos for PD resistance. An example of increased fruit quality i...

  1. Natural variation of rice blast resistance gene Pi-d2

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Studying natural variation of rice resistance (R) genes in cultivated and wild rice relatives can predict resistance stability to rice blast fungus. In the present study, the protein coding regions of rice R gene Pi-d2 in 35 rice accessions of subgroups, aus (AUS), indica (IND), temperate japonica (...

  2. Worldwide distribution and origin of rice blast resistance gene Pi-ta

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Pi-ta is a single resistance (R) gene encoding a putative NBS type receptor with single amino acid alanine at position 918 (G at 6640) determining the resistance specificity. The distribution and origin of the Pi-ta gene were investigated in a germplasm core collection consisting of 1790 accessions ...

  3. A New Anthracnose Resistance Gene in Andean Common Bean Cultivar Jalo Listras Pretas

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Anthracnose is one of the most widespread and economically important diseases of common bean worldwide. Most anthracnose resistance genes in common bean are from beans of the Mesoamerican gene pool. The resistant reaction of the Andean common bean cultivar Jalo Listras Pretas to races 9, 64, 65 and ...

  4. mmr, a Mycobacterium tuberculosis Gene Conferring Resistance to Small Cationic Dyes and Inhibitors

    PubMed Central

    De Rossi, Edda; Branzoni, Manuela; Cantoni, Rita; Milano, Anna; Riccardi, Giovanna; Ciferri, Orio

    1998-01-01

    The mmr gene, cloned from Mycobacterium tuberculosis, was shown to confer to Mycobacterium smegmatis resistance to tetraphenylphosphonium (TPP), erythromycin, ethidium bromide, acriflavine, safranin O, and pyronin Y. The gene appears to code for a protein containing four transmembrane domains. Studies of [3H]TPP intracellular accumulation strongly suggest that the resistance mediated by the Mmr protein involves active extrusion of TPP. PMID:9811672

  5. Identification of disease resistance genes for enhancement of existing potato cultivars

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A plant’s ability to defend itself against host-specific microbes is specified by disease resistance (R) genes. Upon recognition of an invading pathogen, R proteins are responsible for the activation of a multitude of responses ultimately leading to resistance. The majority of R genes are dominant a...

  6. Down-regulation of Fusarium oxysporum endogenous genes by Host-Delivered RNA interference enhances disease resistance

    NASA Astrophysics Data System (ADS)

    Hu, Zongli; Parekh, Urvi; Maruta, Natsumi; Trusov, Yuri; Botella, Jimmy

    2015-01-01

    Fusarium oxysporum is a devastating pathogen causing extensive yield losses in a variety of crops and development of sustainable, environmentally friendly methods to improve crop resistance is crucial. We have used Host-Derived RNA interference (HD-RNAi) technology to partially silence three different genes (FOW2, FRP1 and OPR) in the hemi-biotrophic fungus Fusarium oxysporum f. sp. conglutinans. Expression of double stranded RNA molecules targeting fungal pathogen genes was achieved in a number of transgenic Arabidopsis lines. F. oxysporum infecting the transgenic lines displayed substantially reduced mRNA levels on all three targeted genes, with an average of 75%, 83% and 72% reduction for FOW2, FRP1 and OPR respectively. The silencing of pathogen genes had a clear positive effect on the ability of the transgenic lines to fight infection. All transgenic lines displayed enhanced resistance to F. oxysporum with delayed disease symptom development, especially FRP1 and OPR lines. Survival rates after fungal infection were higher in the transgenic lines compared to control wild type plants which consistently showed survival rates of 10%, with FOW2 lines showing 25% survival; FRP1 lines 30-50% survival and FOW2 between 45-70% survival. The down-regulation effect was specific for the targeted genes without unintended effects in related genes. In addition to producing resistant crops, HD-RNAi can provide a useful tool to rapidly screen candidate fungal pathogenicity genes without the need to produce fungal knockout mutants.

  7. Down-regulation of Fusarium oxysporum endogenous genes by Host-Delivered RNA interference enhances disease resistance

    PubMed Central

    Hu, Zongli; Parekh, Urvi; Maruta, Natsumi; Trusov, Yuri; Botella, Jose R.

    2015-01-01

    Fusarium oxysporum is a devastating pathogen causing extensive yield losses in a variety of crops and development of sustainable, environmentally friendly methods to improve crop resistance is crucial. We have used Host-Delivered RNA interference (HD-RNAi) technology to partially silence three different genes (FOW2, FRP1, and OPR) in the hemi-biotrophic fungus F. oxysporum f. sp. conglutinans. Expression of double stranded RNA (dsRNA) molecules targeting fungal pathogen genes was achieved in a number of transgenic Arabidopsis lines. F. oxysporum infecting the transgenic lines displayed substantially reduced mRNA levels on all three targeted genes, with an average of 75, 83, and 72% reduction for FOW2, FRP1, and OPR, respectively. The silencing of pathogen genes had a clear positive effect on the ability of the transgenic lines to fight infection. All transgenic lines displayed enhanced resistance to F. oxysporum with delayed disease symptom development, especially FRP1 and OPR lines. Survival rates after fungal infection were higher in the transgenic lines compared to control wild type plants which consistently showed survival rates of 10%, with FOW2 lines showing 25% survival; FRP1 lines 30–50% survival and OPR between 45 and 70% survival. The down-regulation effect was specific for the targeted genes without unintended effects in related genes. In addition to producing resistant crops, HD-RNAi can provide a useful tool to rapidly screen candidate fungal pathogenicity genes without the need to produce fungal knockout mutants. PMID:25654075

  8. Risk assessment for Helicoverpa zea (Lepidoptera: Noctuidae) resistance on dual-gene versus single-gene corn.

    PubMed

    Edwards, Kristine T; Caprio, Michael A; Allen, K Clint; Musser, Fred R

    2013-02-01

    Recent Environmental Protection Agency (EPA) decisions regarding resistance management in Bt-cropping systems have prompted concern in some experts that dual-gene Bt-corn (CrylA.105 and Cry2Ab2 toxins) may result in more rapid selection for resistance in Helicoverpa zea (Boddie) than single-gene Bacillus thuringiensis (Bt)-corn (CrylAb toxin). The concern is that Bt-toxin longevity could be significantly reduced with recent adoption of a natural refuge for dual-gene Bt-cotton (CrylAc and Cry2Ab2 toxins) and concurrent reduction in dual-gene corn refuge from 50 to 20%. A population genetics framework that simulates complex landscapes was applied to risk assessment. Expert opinions on effectiveness of several transgenic corn and cotton varieties were captured and used to assign probabilities to different scenarios in the assessment. At least 350 replicate simulations with randomly drawn parameters were completed for each of four risk assessments. Resistance evolved within 30 yr in 22.5% of simulations with single-gene corn and cotton with no volunteer corn. When volunteer corn was added to this assessment, risk of resistance evolving within 30 yr declined to 13.8%. When dual-gene Bt-cotton planted with a natural refuge and single-gene corn planted with a 50% structured refuge was simulated, simultaneous resistance to both toxins never occurred within 30 yr, but in 38.5% of simulations, resistance evolved to toxin present in single-gene Bt-corn (CrylAb). When both corn and cotton were simulated as dual-gene products, cotton with a natural refuge and corn with a 20% refuge, 3% of simulations evolved resistance to both toxins simultaneously within 30 yr, while 10.4% of simulations evolved resistance to CrylAb/c toxin.

  9. Novel ISCR1-linked resistance genes found in multidrug-resistant Gram-negative bacteria in southern China.

    PubMed

    Wang, Fengping; Wu, Kuihai; Sun, Jingjing; Wang, Qian; Chen, Qing; Yu, Shouyi; Rui, Yongyu

    2012-11-01

    Non-duplicate multidrug-resistant (MDR) Gram-negative bacteria (n=1329) isolated from southern China between January 2008 and December 2009 were investigated for the presence of ISCR1 as well as characterisation of ISCR1-linked resistance genes. Of 433 ISCR1-positive strains, 151 appeared to carry ISCR1-linked resistance genes. Seven different ISCR1-linked resistance gene arrays were identified by restriction fragment length polymorphism (RFLP) and DNA sequencing analysis. Many of these arrays are reported in some species for the first time. A total of 12 genes, including a novel ABC transporter (GenBank accession no. GU944725), qnrA1, qnrB2, qnrB6, bla(DHA-1), ampR, bla(CTX-M-9), bla(PER-1), insB, sapA-like peptide transport periplasmic protein, putative glutathione S-transferase and short-chain dehydrogenase/reductase, were detected. This study was the first to employ PCR-RFLP using HinfI and RsaI to analyse ISCR1-linked genes. ISCR1 was widely disseminated among MDR Gram-negative bacteria and was in close association with quinolone resistance and β-lactamase genes (class A and class C) in southern China.

  10. Gene expression analysis of endometrium reveals progesterone resistance and candidate susceptibility genes in women with endometriosis.

    PubMed

    Burney, Richard O; Talbi, Said; Hamilton, Amy E; Vo, Kim Chi; Nyegaard, Mette; Nezhat, Camran R; Lessey, Bruce A; Giudice, Linda C

    2007-08-01

    The identification of molecular differences in the endometrium of women with endometriosis is an important step toward understanding the pathogenesis of this condition and toward developing novel strategies for the treatment of associated infertility and pain. In this study, we conducted global gene expression analysis of endometrium from women with and without moderate/severe stage endometriosis and compared the gene expression signatures across various phases of the menstrual cycle. The transcriptome analysis revealed molecular dysregulation of the proliferative-to-secretory transition in endometrium of women with endometriosis. Paralleled gene expression analysis of endometrial specimens obtained during the early secretory phase demonstrated a signature of enhanced cellular survival and persistent expression of genes involved in DNA synthesis and cellular mitosis in the setting of endometriosis. Comparative gene expression analysis of progesterone-regulated genes in secretory phase endometrium confirmed the observation of attenuated progesterone response. Additionally, interesting candidate susceptibility genes were identified that may be associated with this disorder, including FOXO1A, MIG6, and CYP26A1. Collectively these findings provide a framework for further investigations on causality and mechanisms underlying attenuated progesterone response in endometrium of women with endometriosis.

  11. Antibiotic resistance gene cassettes derived from the omega interposon for use in E. coli and Streptomyces.

    PubMed

    Blondelet-Rouault, M H; Weiser, J; Lebrihi, A; Branny, P; Pernodet, J L

    1997-05-06

    Three antibiotic resistance gene cassettes, derived from the omega interposon (Prentki and Krisch (1984) Gene 29, 303-313) were constructed. These cassettes carry different antibiotic resistance genes, conferring resistance to geneticin, hygromycin or viomycin, flanked by short inverted repeats containing transcription and translation termination signals and synthetic polylinkers. These cassettes were designated omega aac, omega hyg and omega vph. Resistance phenotypes conferred by these constructions are selectable in E. coli and Streptomyces. These cassettes can be used for insertional mutagenesis or for vector construction.

  12. Evaluation of Ciprofloxacin (gyrA, parC Genes) and Tetracycline (tetB Gene) Resistance in Nosocomial Acinetobacter baumannii Infections

    PubMed Central

    Nowroozi, Jamileh; Akhavan Sepahi, Abbas; Tahmasebinejad Kamarposhti, Lida; Razavipour, Roya; Mazhar, Flor

    2014-01-01

    Background: Acinetobacter baumannii plays an important role in some types of nosocomial infections as an opportunist microorganism which increases levels of resistance to antibacterial drugs and disinfectants. Objectives: The aim of this study was to determine the resistance and sensitivity of A. baumannii to different antibiotics and evaluate the minimal inhibitory concentration (MIC) for Ciprofloxacin and Tetracycline; in addition to Surfanios, Citron and Aniosyme DD1 disinfectants, and also to detect the presence of gyrA, parC and tetB gene bands in the isolates. Materials and Methods: In this study, 65 A. baumannii isolates were collected from the hospitalized patients in NIOC hospital (National Iranian Oil Company hospital) of Tehran, Iran during 2010-2011. The pattern of sensitivity to antibiotics was determined using CSLI disk diffusion and MIC methods. Furthermore, resistance of isolates to the common disinfectants (Surfanios Citron and Aniosyme DD1) was determined in different hospital wards. Presence of gyrA, parC and tetB gene bands was also detected by PCR method. Results: Frequency of Acinetobacter resistance to Amikacin, Ciprofloxacin, co-Trimoxazole, Ceftazidime and Ceftriaxone was 100% in the isolates reviewed in this study. The frequency of resistance to Gentamicin and Tetracycline were 86.1% in the isolates. The MIC of Ciprofloxacin in all (100%) of isolates was 32-64 μg/mL which showed the resistance to Ciprofloxacin In 86.1% of cases the Gentamicin and Tetracycline MIC were ≥ 16 μg/mL and in 13.9% of isolates the Gentamicin and Tetracycline MIC were 4 μg/mL, these results showed the resistance and sensitivity to the Gentamicin and Tetracycline, respectively. Additionally, all (100%) of the A. baumannii isolates were resistant to disinfectant concentrations, which were used with the methods recommended by manufacturers (0.5%). In 100% of the isolates parC and gyrA genes bands were detected, and tetB gene was also detected in 86.1% of

  13. Sequence-Modified Antibiotic Resistance Genes Provide Sustained Plasmid-Mediated Transgene Expression in Mammals.

    PubMed

    Lu, Jiamiao; Zhang, Feijie; Fire, Andrew Z; Kay, Mark A

    2017-03-30

    Conventional plasmid vectors are incapable of achieving sustained levels of transgene expression in vivo even in quiescent mammalian tissues because the transgene expression cassette is silenced. Transcriptional silencing results from the presence of the bacterial plasmid backbone or virtually any DNA sequence of >1 kb in length placed outside of the expression cassette. Here, we show that transcriptional silencing can be substantially forestalled by increasing the An/Tn sequence composition in the plasmid bacterial backbone. Increasing numbers of An/Tn sequences increased sustained transcription of both backbone sequences and adjacent expression cassettes. In order to recapitulate these expression profiles in compact and portable plasmid DNA backbones, we engineered the standard kanamycin or ampicillin antibiotic resistance genes, optimizing the number of An/Tn sequence without altering the encoded amino acids. The resulting vector backbones yield sustained transgene expression from mouse liver, providing generic DNA vectors capable of sustained transgene expression without additional genes or mammalian regulatory elements.

  14. Genes involved in copper resistance influence survival of Pseudomonas aeruginosa on copper surfaces

    PubMed Central

    Elguindi, Jutta; Wagner, Janine; Rensing, Christopher

    2013-01-01

    Aims To evaluate the killing of Pseudomonas aeruginosa PAO1 on copper cast alloys and the influence of genes on survival on copper containing medium and surfaces. Methods and Results Different strains of P. aeruginosa were inoculated on copper containing medium or different copper cast alloys and the survival rate determined. The survival rates were compared to rates on copper-free medium and stainless steel as control. In addition, the effect of temperature on survival was examined. Conclusions Copper cast alloys had previously shown to be bactericidal to various bacteria but the mechanism of copper-mediated killing is still not known. In this report we demonstrate that P. aeruginosa PAO1 is rapidly killed on different copper cast alloys and that genes involved in conferring copper resistance in copper-containing medium also influenced survival on copper cast alloys. We also show that the rate of killing is influenced by temperature. PMID:19239551

  15. Fine Mapping of Two Additive Effect Genes for Awn Development in Rice (Oryza sativa L.)

    PubMed Central

    Li, Jinjie; Yao, Guoxin; Pan, Huiqiao; Hu, Guanglong; Chen, Chao; Zhang, Hongliang; Li, Zichao

    2016-01-01

    Awns, important domestication and agronomic traits in rice (Oryza sativa L.), are conferred by polygenes and the environment. Near isogenic line (NIL) pairs BM33 and BM38 were constructed from crosses between awnless japonica cv Nipponbare as recurrent parent, and lines SLG or Funingxiaohongmang (awned japonica accessions), respectively, as donors. In order to study the genetic and molecular mechanism of awning, two unknown, independent genes with additive effects were identified in a cross between the NILs. To map and clone the two genes, a BC4F4 population of 8,103 individuals and a BC4F6 population of 11,206 individuals were constructed. Awn3-1 was fine mapped to a 101.13 kb genomic region between Indel marker In316 and SNP marker S9-1 on chromosome 3. Nine predicted genes in the interval were annotated in the Rice Annotation Project Database (RAP-DB), and Os03g0418600 was identified as the most likely candidate for Awn3-1 through sequence comparisons and RT-PCR assays. Awn4-2 was fine mapped to a 62.4 kb genomic region flanked by simple sequence repeat (SSR) marker M1126 and Indel maker In73 on chromosome 4L. This region contained the previously reported gene An-1 that regulates awn development. Thus, An-1 may be the candidate gene of Awn4-2. These results will facilitate cloning of the awn genes and thereby provide an understanding of the molecular basis of awn development. PMID:27494628

  16. Multiple Mutations on the Second Acetylcholinesterase Gene Associated With Dimethoate Resistance in the Melon Aphid, Aphis gossypii (Hemiptera: Aphididae).

    PubMed

    Lokeshwari, D; Krishna Kumar, N K; Manjunatha, H

    2016-04-01

    The melon aphid, Aphis gossypii Glover (Hemiptera: Aphididae), is an important cosmopolitan and extremely polyphagous species capable of causing direct and indirect damage to various crops. Insecticide resistance in melon aphids is of particular concern. To determine the basis of resistance, organophosphate (OP)-resistant strains of A. gossypii were obtained by continuous selection with dimethoate in the laboratory, and resistance mechanisms were investigated along with susceptible strains. Three resistant strains LKR-1, LKR-2, and LKR-3 exhibiting 270-, 243-, and 210-fold resistance obtained after 30 generations of selection with dimethoate, respectively, were utilized in this study. The role of acetylcholinesterase (AChE), a target enzyme for OPs and carbamates (CMs), was investigated. AChE enzyme assay revealed that there was no significant change in the activities of AChE in resistant and susceptible strains. However, AChE inhibitory assay showed that 50% of the enzyme activity in resistant strains was inhibited at significantly higher concentration of dimethoate (131.87, 158.65, and 99.29 µmolL(−1)) as compared with susceptible strains (1.75 and 2.01 µmolL(−1)), indicating AChE insensitivity owing to altered AChE. Molecular diagnostic tool polymerase chain reaction-restriction fragment length polymorphism revealed the existence of two consistent non-synonymous point mutations, single-nucleotide polymorphism, viz., A302S (equivalent to A201 in Torpedo californica Ayres) and S431F (equivalent to F331 in T. californica), in the AChE gene Ace2 of resistant strains. Further, cloning and sequencing of a partial fragment of Ace2 (897 bp) gene from susceptible and resistant strains revealed an additional novel mutation G221A in resistant strains, LKR-1 and LKR-2. Susceptible Ace2 genes shared 99.6 and 98.9% identity at the nucleic acid and amino acid levels with resistant ones, respectively. Functional analysis of these point mutations was assessed by in

  17. Identification and molecular tagging of two complementary dominant resistance genes to maize dwarf mosaic virus.

    PubMed

    Wu, Jian-Yu; Ding, Jun-Qiang; Du, Yan-Xiu; Chen, Wei-Cheng

    2002-12-01

    Maize dwarf mosaic is one of the devastating and widespread viral diseases in the world. So far, only a few genes were identified and mapped in the resistant materials. A new resistant elite inbred line Siyi was identified with resistance to maize dwarf mosaic virus strain B at early and adult stage. Two complementary dominant genes conditioned the resistance, with a new genetic model, of the maize inbred line were found at adult stage by the genetic analysis based on parents, F1, F2 and backcrosses in two years. The microsatellite analysis of a F2 population from the cross between Siyi and Mo17 was used to identify the two resistance genes on chromosome 3 and 6 respectively by 87 pairs of microsatellite markers. The linkage distance between phi029 and the one resistance gene on chromosome 3 is 14.5 cM, and phi126 to the other on chromosome 6 is 7.2 cM.

  18. Identifying associations in Escherichia coli antimicrobial resistance patterns using additive Bayesian networks.

    PubMed

    Ludwig, Antoinette; Berthiaume, Philippe; Boerlin, Patrick; Gow, Sheryl; Léger, David; Lewis, Fraser I

    2013-05-15

    While the genesis of antimicrobial resistance (AMR) in animal production is a high profile topic in the media and the scientific community, it is still not well understood. The epidemiology of AMR is complex. This complexity is demonstrated by extensive biological and evolutionary mechanisms which are potentially impacted by farm management and husbandry practices - the risk factors. Many parts of this system have yet to be fully described. Notably, the occurrence of multiple resistance patterns is the rule rather than exception - the multivariate problem. A first essential step in the development of any comprehensive risk factor analysis - whose goal is the prevention or reduction of AMR - is to describe those associations between different patterns of resistance which are systematic. That is, have sufficient statistical support for these patterns to be considered robust features of the underlying epidemiological system, and whose presence must therefore be incorporated into any risk factor analysis of AMR for it to be meaningful with respect to the farm environment. Presented here is a case study that seeks to identify systematic associations between patterns of resistance to 13 different antimicrobials in Escherichia coli isolates obtained from composite finisher (>80 kg) pig faecal samples obtained from Canada's five major pork producing provinces. The use of a Bayesian network analysis approach allowed us to identify many systematic associations between individual antimicrobial resistances. Sixteen of these resistances are corroborated with existing literature. These associations are distributed between several important classes of antimicrobials including the β-lactams, folate biosynthesis inhibitors, tetracyclines, aminoglycosides and quinolones. This study presents an exciting first step towards the larger and far more ambitious goal of developing generic and holistic risk factor analyses for on-farm occurrence of AMR. Analyses of this nature would combine

  19. Expression of a multidrug-resistance gene in human tumors and tissues

    SciTech Connect

    Fojo, A.T.; Ueda, K.; Slamon, D.J.; Poplack, D.G.; Gottesman, M.M.; Pastan, I.

    1987-01-01

    The identification and cloning of a segment of a human multidrug resistance gene (mdr1) was reported recently. To examine, the molecular basis of one type of multidrug resistance, the authors have prepared RNA from human tumors and normal tissues and measured their content of mdr1 RNA. They find that the mdr1 gene is expressed at a very high level in the adrenal gland; at a high level in the kidney; at intermediate levels in the lung, liver, lower jejunum, colon, and rectum; and at low levels in many other tissues. The mdr1 gene is also expressed in several human tumors, including many but not all tumors derived from the adrenal gland and the colon. In addition, increased expression was detected in a few tumors at the time of relapse following initial chemotherapy. Although controlled clinical studies will be required, the results suggest that measurement of mdr1 RNA may prove to be a valuable tool in the design of chemotherapy protocols.

  20. Induced mutations in the starch branching enzyme II (SBEII) genes increase amylose and resistant starch content in durum wheat

    PubMed Central

    Hazard, Brittany; Zhang, Xiaoqin; Colasuonno, Pasqualina; Uauy, Cristobal; Beckles, Diane M.; Dubcovsky, Jorge

    2016-01-01

    Starch is the largest component of the wheat (Triticum aestivum L.) grain and consists of approximately 70-80% amylopectin and 20-30% amylose. Amylopectin is a highly-branched, readily digested polysaccharide, whereas amylose has few branches and forms complexes that resist digestion and mimic dietary fiber (resistant starch). Down-regulation of the starch branching enzyme II (SBEII) gene by RNA interference (RNAi) was previously shown to increase amylose content in both hexaploid and tetraploid wheat. We generated ethyl methane sulphonate (EMS) mutants for the SBEIIa-A and SBEIIa-B homoeologs in the tetraploid durum wheat variety Kronos (T. turgidum ssp. durum L.). Single-gene mutants showed non-significant increases in amylose and resistant starch content, but a double mutant combining a SBEIIa-A knock-out mutation with a SBEIIa-B splice-site mutation showed a 22% increase in amylose content (P<0.0001) and a 115% increase in resistant starch content (P<0.0001). In addition, we obtained mutants for the A and B genome copies of the paralogous SBEIIb gene, mapped them 1-2 cM from SBEIIa, and generated double SBEIIa-SBEIIb mutants to study the effect of the SBEIIb gene in the absence of SBEIIa. These mutants are available to those interested in increasing amylose content and resistant starch in durum wheat. PMID:26924849

  1. A New SNP Haplotype associated with blue disease resistance gene in cotton (Gossypium hirsutum L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Resistance to cotton blue disease (CBD) was evaluated in 364 F2.3 families of 3 populations derived from resistant variety ‘Delta Opal’. The CBD resistance in ‘Delta Opal’ was controlled by one single dominant gene designated Cbd. Two simple sequence repeat (SSR) markers were identified as linked t...

  2. Prevalence of ColE1-like plasmids and kanamycinr resistance genes in Salmonella enterica serotypes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Multi-antibiotic resistant Salmonella enterica serotypes are increasing in prevalence and concern in human and animal health. Many strains carry resistance determinants on plasmids; current practices focus heavily on large plasmids, and the role that small plasmids play in resistance gene transfer ...

  3. Targeted gene addition into a specified location in the human genome using designed zinc finger nucleases

    PubMed Central

    Moehle, Erica A.; Rock, Jeremy M.; Lee, Ya-Li; Jouvenot, Yann; DeKelver, Russell C.; Gregory, Philip D.; Urnov, Fyodor D.; Holmes, Michael C.

    2007-01-01

    Efficient incorporation of novel DNA sequences into a specific site in the genome of living human cells remains a challenge despite its potential utility to genetic medicine, biotechnology, and basic research. We find that a precisely placed double-strand break induced by engineered zinc finger nucleases (ZFNs) can stimulate integration of long DNA stretches into a predetermined genomic location, resulting in high-efficiency site-specific gene addition. Using an extrachromosomal DNA donor carrying a 12-bp tag, a 900-bp ORF, or a 1.5-kb promoter-transcription unit flanked by locus-specific homology arms, we find targeted integration frequencies of 15%, 6%, and 5%, respectively, within 72 h of treatment, and with no selection for the desired event. Importantly, we find that the integration event occurs in a homology-directed manner and leads to the accurate reconstruction of the donor-specified genotype at the endogenous chromosomal locus, and hence presumably results from synthesis-dependent strand annealing repair of the break using the donor DNA as a template. This site-specific gene addition occurs with no measurable increase in the rate of random integration. Remarkably, we also find that ZFNs can drive the addition of an 8-kb sequence carrying three distinct promoter-transcription units into an endogenous locus at a frequency of 6%, also in the absence of any selection. These data reveal the surprising versatility of the specialized polymerase machinery involved in double-strand break repair, illuminate a powerful approach to mammalian cell engineering, and open the possibility of ZFN-driven gene addition therapy for human genetic disease. PMID:17360608

  4. Identification of the tetracycline resistance gene, tet(M), in Erysipelothrix rhusiopathiae.

    PubMed

    Yamamoto, K; Sasaki, Y; Ogikubo, Y; Noguchi, N; Sasatsu, M; Takahashi, T

    2001-05-01

    This is the first report to demonstrate the presence of tet(M) in naturally occurring isolates of tetracycline-resistant Erysipelothrix rbusiopathiae, which causes swine erysipelas. The tet(M) gene was isolated from E. rhusiopathiae strain KY5-42. The nucleotide and the deduced amino acid sequence were 99% identical to the tet(M) gene from Enterococcus faecalis. The gene was necessary and sufficient for the expression of tetracycline resistance in Escherichia coli. The presence of the tet(M) gene in the 114 tetracycline-resistant E. rhusiopathiae isolates from diseased pigs was detected by the polymerase chain reaction assay. The specific amplified DNA fragment was obtained from all 114 tetracycline-resistant strains. It was suggested that the tet(M) gene was widely present in the field isolates of E. rhusiopathiae resistant to tetracycline.

  5. Identification of I-7 expands the repertoire of genes for resistance to Fusarium wilt in tomato to three resistance gene classes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The tomato I-3 and I-7 genes confer resistance to Fusarium oxysporum f. sp. lycopersici (Fol) race 3 and both genes were introgressed into the cultivated tomato, Solanum lycopersicum, from the wild relative Solanum pennellii. I-3 was identified previously and encodes a S-receptor-like kinase, but li...

  6. Antibiotic resistance genes detected in the marine sponge Petromica citrina from Brazilian coast.

    PubMed

    Laport, Marinella Silva; Pontes, Paula Veronesi Marinho; Dos Santos, Daniela Silva; Santos-Gandelman, Juliana de Fátima; Muricy, Guilherme; Bauwens, Mathieu; Giambiagi-deMarval, Marcia; George, Isabelle

    2016-01-01

    Although antibiotic-resistant pathogens pose a significant threat to human health, the environmental reservoirs of the resistance determinants are still poorly understood. This study reports the detection of resistance genes (ermB, mecA, mupA, qnrA, qnrB and tetL) to antibiotics among certain culturable and unculturable bacteria associated with the marine sponge Petromica citrina. The antimicrobial activities elicited by P. citrina and its associated bacteria are also described. The results indicate that the marine environment could play an important role in the development of antibiotic resistance and the dissemination of resistance genes among bacteria.

  7. Improved Acetic Acid Resistance in Saccharomyces cerevisiae by Overexpression of the WHI2 Gene Identified through Inverse Metabolic Engineering.

    PubMed

    Chen, Yingying; Stabryla, Lisa; Wei, Na

    2016-01-29

    Development of acetic acid-resistant Saccharomyces cerevisiae is important for economically viable production of biofuels from lignocellulosic biomass, but the goal remains a critical challenge due to limited information on effective genetic perturbation targets for improving acetic acid resistance in the yeast. This study employed a genomic-library-based inverse metabolic engineering approach to successfully identify a novel gene target, WHI2 (encoding a cytoplasmatic globular scaffold protein), which elicited improved acetic acid resistance in S. cerevisiae. Overexpression of WHI2 significantly improved glucose and/or xylose fermentation under acetic acid stress in engineered yeast. The WHI2-overexpressing strain had 5-times-higher specific ethanol productivity than the control in glucose fermentation with acetic acid. Analysis of the expression of WHI2 gene products (including protein and transcript) determined that acetic acid induced endogenous expression of Whi2 in S. cerevisiae. Meanwhile, the whi2Δ mutant strain had substantially higher susceptibility to acetic acid than the wild type, suggesting the important role of Whi2 in the acetic acid response in S. cerevisiae. Additionally, overexpression of WHI2 and of a cognate phosphatase gene, PSR1, had a synergistic effect in improving acetic acid resistance, suggesting that Whi2 might function in combination with Psr1 to elicit the acetic acid resistance mechanism. These results improve our understanding of the yeast response to acetic acid stress and provide a new strategy to breed acetic acid-resistant yeast strains for renewable biofuel production.

  8. Next-Generation Sequencing of Plasmodium vivax Patient Samples Shows Evidence of Direct Evolution in Drug-Resistance Genes

    PubMed Central

    Flannery, Erika L.; Wang, Tina; Akbari, Ali; Corey, Victoria C.; Gunawan, Felicia; Bright, A. Taylor; Abraham, Matthew; Sanchez, Juan F.; Santolalla, Meddly L.; Baldeviano, G. Christian; Edgel, Kimberly A.; Rosales, Luis A.; Lescano, Andrés G.; Bafna, Vineet; Vinetz, Joseph M.; Winzeler, Elizabeth A.

    2015-01-01

    Understanding the mechanisms of drug resistance in Plasmodium vivax, the parasite that causes the most widespread form of human malaria, is complicated by the lack of a suitable long-term cell culture system for this parasite. In contrast to P. falciparum, which can be more readily manipulated in the laboratory, insights about parasite biology need to be inferred from human studies. Here we analyze the genomes of parasites within 10 human P. vivax infections from the Peruvian Amazon. Using next-generation sequencing we show that some P. vivax infections analyzed from the region are likely polyclonal. Despite their polyclonality we observe limited parasite genetic diversity by showing that three or fewer haplotypes comprise 94% of the examined genomes, suggesting the recent introduction of parasites into this geographic region. In contrast we find more than three haplotypes in putative drug-resistance genes, including the gene encoding dihydrofolate reductase-thymidylate synthase and the P. vivax multidrug resistance associated transporter, suggesting that resistance mutations have arisen independently. Additionally, several drug-resistance genes are located in genomic regions with evidence of increased copy number. Our data suggest that whole genome sequencing of malaria parasites from patients may provide more insight about the evolution of drug resistance than genetic linkage or association studies, especially in geographical regions with limited parasite genetic diversity. PMID:26719854

  9. Improved Acetic Acid Resistance in Saccharomyces cerevisiae by Overexpression of the WHI2 Gene Identified through Inverse Metabolic Engineering

    PubMed Central

    Chen, Yingying; Stabryla, Lisa

    2016-01-01

    Development of acetic acid-resistant Saccharomyces cerevisiae is important for economically viable production of biofuels from lignocellulosic biomass, but the goal remains a critical challenge due to limited information on effective genetic perturbation targets for improving acetic acid resistance in the yeast. This study employed a genomic-library-based inverse metabolic engineering approach to successfully identify a novel gene target, WHI2 (encoding a cytoplasmatic globular scaffold protein), which elicited improved acetic acid resistance in S. cerevisiae. Overexpression of WHI2 significantly improved glucose and/or xylose fermentation under acetic acid stress in engineered yeast. The WHI2-overexpressing strain had 5-times-higher specific ethanol productivity than the control in glucose fermentation with acetic acid. Analysis of the expression of WHI2 gene products (including protein and transcript) determined that acetic acid induced endogenous expression of Whi2 in S. cerevisiae. Meanwhile, the whi2Δ mutant strain had substantially higher susceptibility to acetic acid than the wild type, suggesting the important role of Whi2 in the acetic acid response in S. cerevisiae. Additionally, overexpression of WHI2 and of a cognate phosphatase gene, PSR1, had a synergistic effect in improving acetic acid resistance, suggesting that Whi2 might function in combination with Psr1 to elicit the acetic acid resistance mechanism. These results improve our understanding of the yeast response to acetic acid stress and provide a new strategy to breed acetic acid-resistant yeast strains for renewable biofuel production. PMID:26826231

  10. Additive effects of serotonin transporter and tryptophan hydroxylase-2 gene variation on emotional processing.

    PubMed

    Herrmann, Martin J; Huter, Theresa; Müller, Frauke; Mühlberger, Andreas; Pauli, Paul; Reif, Andreas; Renner, Tobias; Canli, Turhan; Fallgatter, Andreas J; Lesch, Klaus-Peter

    2007-05-01

    Prior studies reported that functional variants of both the serotonin transporter (5-HTT) and tryptophan hydroxylase-2 genes (TPH2), 2 key regulators of the serotonergic signaling pathway, modulate amygdala activation during emotional processing. We addressed the question whether these 2 gene variants modulate each other, using an emotional picture-processing task. Specifically, we measured event-related potentials (ERPs) during a passive emotional picture perception task, focusing on ERPs for the early posterior negativity (EPN) around 240 ms and for the slow wave starting at 315 ms. We found evidence for increased neural activity at 240 ms in individuals who carried 1 or 2 copies of the low-expression short variant of the 5-HTT. Carriers of T variant of the TPH2 also showed a tendency toward increased neural activity at 240 ms. Moreover, we observed an additive effect of both genotypes for EPN, with highest neural activity to emotional stimuli in individuals carrying combination of both short variant of 5-HTT and T variant of TPH2. Our results indicate that both the 5-HTT and the TPH2 genotypes modulate the sensory encoding of affective stimuli during early steps of visual processing and reveal additive effects of 2 genes in the serotonergic control of emotion regulation.

  11. Presence of antibiotic resistance genes in a sewage treatment plant in Thibodaux, Louisiana, USA.

    PubMed

    Naquin, Anthony; Shrestha, Arsen; Sherpa, Mingma; Nathaniel, Rajkumar; Boopathy, Raj

    2015-01-01

    Increasing uses and disposals of antibiotics to the environment have increased emergence of various antibiotic resistance. One of the sources for the spread of antibiotic resistance is wastewater treatment plant, where bacteria and antibiotics can come in contact and can acquire antibiotics resistance. There are very few studies on this subject from a small town sewage treatment plant. Therefore, this study was conducted using raw sewage as well as treated sewage from a sewage treatment plant in Thibodaux in rural southeast Louisiana in USA. Samples were collected monthly from the Thibodaux sewage treatment plant and the presence of antibiotic resistance genes was monitored. The study showed the presence of antibiotic resistance genes in both raw and treated sewage in every month of the study period. The genetic transformation assay showed the successful transformation of methicillin resistant gene, mecA to an antibiotic sensitive Staphylococcus aureus, which became antibiotic resistant within 24h.

  12. LASS6, an additional member of the longevity assurance gene family.

    PubMed

    Weinmann, Arndt; Galle, Peter R; Teufel, Andreas

    2005-11-01

    Longevity assurance genes (LAGs) represent a subgroup of the homeobox gene family. Five mammalian homologs have been reported, and the corresponding proteins have previously been investigated with respect to their key role in ceramide synthesis. However, members of the LAG family have been shown to be involved in cell growth regulation and cancer differentiation. In an effort to characterize additional members of the LAG family, we have screened the latest releases of genomic databases and report on the bioinformatic characterization of yet another member, LAG1 longevity assurance homolog 6 (LASS6). Like other LAG family members, the LASS6 protein contained a homeodomain and LAG1 domain. In phylogenetic analyses, it displayed highest homology to LASS5. The corresponding gene was localized to human chromosome 2q24.3, spanning a rather large genomic region of 318 kb. Orthologous sequences in mouse and zebrafish suggested a conservation of LASS6 in vertebrates as the protein and corresponding genomic sequences were highly conserved. LASS6 expression was analyzed in silico, and the gene was shown to be broadly expressed in a wide range of tissues. Furthermore, available microarray data suggested a role in cancer differentiation and early embryonic development.

  13. Resistance to Colletotrichum lindemuthianum in Phaseolus vulgaris: a case study for mapping two independent genes.

    PubMed

    Geffroy, Valérie; Sévignac, Mireille; Billant, Paul; Dron, Michel; Langin, Thierry

    2008-02-01

    Anthracnose, caused by the hemibiotrophic fungal pathogen Colletotrichum lindemuthianum is a devastating disease of common bean. Resistant cultivars are economical means for defense against this pathogen. In the present study, we mapped resistance specificities against 7 C. lindemuthianum strains of various geographical origins revealing differential reactions on BAT93 and JaloEEP558, two parents of a recombinant inbred lines (RILs) population, of Meso-american and Andean origin, respectively. Six strains revealed the segregation of two independent resistance genes. A specific numerical code calculating the LOD score in the case of two independent segregating genes (i.e. genes with duplicate effects) in a RILs population was developed in order to provide a recombination value (r) between each of the two resistance genes and the tested marker. We mapped two closely linked Andean resistance genes (Co-x, Co-w) at the end of linkage group (LG) B1 and mapped one Meso-american resistance genes (Co-u) at the end of LG B2. We also confirmed the complexity of the previously identified B4 resistance gene cluster, because four of the seven tested strains revealed a resistance specificity near Co-y from JaloEEP558 and two strains identified a resistance specificity near Co-9 from BAT93. Resistance genes found within the same cluster confer resistance to different strains of a single pathogen such as the two anthracnose specificities Co-x and Co-w clustered at the end of LG B1. Clustering of resistance specificities to multiple pathogens such as fungi (Co-u) and viruses (I) was also observed at the end of LG B2.

  14. The allelic relationship of genes giving resistance to mungbean yellow mosaic virus in blackgram.

    PubMed

    Verma, R P; Singh, D P

    1986-09-01

    The allelic relationship of resistance genes for MYMV was studied in blackgram (V. mungo (L.) Hepper). The resistant donors to MYMV - 'Pant U84' and 'UPU 2', and their F1, F2 and F3 generations - were inoculated artificially using an insect vector, whitefly (Bemisia tabaci Genn.). The two recessive genes previously reported for resistance were found to be the same in both donors.

  15. Genetic engineering of crop plants for fungal resistance: role of antifungal genes.

    PubMed

    Ceasar, S Antony; Ignacimuthu, S

    2012-06-01

    Fungal diseases damage crop plants and affect agricultural production. Transgenic plants have been produced by inserting antifungal genes to confer resistance against fungal pathogens. Genes of fungal cell wall-degrading enzymes, such as chitinase and glucanase, are frequently used to produce fungal-resistant transgenic crop plants. In this review, we summarize the details of various transformation studies to develop fungal resistance in crop plants.

  16. Isolation and characterization of NBS-LRR- resistance gene candidates in turmeric (Curcuma longa cv. surama).

    PubMed

    Joshi, R K; Mohanty, S; Subudhi, E; Nayak, S

    2010-09-08

    Turmeric (Curcuma longa), an important asexually reproducing spice crop of the family Zingiberaceae is highly susceptible to bacterial and fungal pathogens. The identification of resistance gene analogs holds great promise for development of resistant turmeric cultivars. Degenerate primers designed based on known resistance genes (R-genes) were used in combinations to elucidate resistance gene analogs from Curcuma longa cultivar surama. The three primers resulted in amplicons with expected sizes of 450-600 bp. The nucleotide sequence of these amplicons was obtained through sequencing; their predicted amino acid sequences compared to each other and to the amino acid sequences of known R-genes revealed significant sequence similarity. The finding of conserved domains, viz., kinase-1a, kinase-2 and hydrophobic motif, provided evidence that the sequences belong to the NBS-LRR class gene family. The presence of tryptophan as the last residue of kinase-2 motif further qualified them to be in the non-TIR-NBS-LRR subfamily of resistance genes. A cluster analysis based on the neighbor-joining method was carried out using Curcuma NBS analogs together with several resistance gene analogs and known R-genes, which classified them into two distinct subclasses, corresponding to clades N3 and N4 of non-TIR-NBS sequences described in plants. The NBS analogs that we isolated can be used as guidelines to eventually isolate numerous R-genes in turmeric.

  17. A recessive resistance to rice yellow mottle virus is associated with a rice homolog of the CPR5 gene, a regulator of active defense mechanisms.

    PubMed

    Orjuela, Julie; Deless, E F Thiémélé; Kolade, Olufisayo; Chéron, Sophie; Ghesquière, Alain; Albar, Laurence

    2013-12-01

    RYMV2 is a major recessive resistance gene identified in cultivated African rice (Oryza glaberrima) which confers high resistance to the Rice yellow mottle virus (RYMV). We mapped RYMV2 in an approximately 30-kb interval in which four genes have been annotated. Sequencing of the candidate region in the resistant Tog7291 accession revealed a single mutation affecting a predicted gene, as compared with the RYMV-susceptible O. glaberrima CG14 reference sequence. This mutation was found to be a one-base deletion leading to a truncated and probably nonfunctional protein. It affected a gene homologous to the Arabidopsis thaliana CPR5 gene, known to be a defense mechanism regulator. Only seven O. glaberrima accessions showing this deletion were identified in a collection consisting of 417 accessions from three rice species. All seven accessions were resistant to RYMV, which is an additional argument in favor of the involvement of the deletion in resistance. In addition, fine mapping of a resistance quantitative trait locus in O. sativa advanced backcrossed lines pinpointed a 151-kb interval containing RYMV2, suggesting that allelic variants of the same gene may control both high and partial resistance.

  18. Adriamycin resistance-associated prohibitin gene inhibits proliferation of human osteosarcoma MG63 cells by interacting with oncogenes and tumor suppressor genes.

    PubMed

    Du, Min-Dong; He, Kai-Yi; Qin, Gang; Chen, Jin; Li, Jin-Yi

    2016-09-01

    The resistance of cancer cells to chemotherapeutic agents is a major obstacle for successful chemotherapy, and the mechanism of chemoresistance remains unclear. The present study developed an adriamycin-resistant human osteosarcoma MG-63 sub-line (MG-63/ADR), and identified differentially expressed proteins that may be associated with adriamycin resistance. Two dimensional gel electrophoresis, matrix-assisted laser desorption ionization time-of-flight mass spectrometry analysis and a protein identification assay were performed. Western blot analysis was used to examine the prohibitin (PHB) levels in the MG-63/ADR cells. Quantitative polymerase chain reaction was utilized to detect adriamycin resistant-associated genes. Laser-scanning confocal microscope was employed to examine the colocalization of PHB with v-myc avian myelocytomatosis viral oncogene homolog (c-myc), FBJ murine osteosarcoma viral oncogene homolog (c-fos), tumor protein p53 and retinoblastoma 1 (Rb). In addition, the full length of the open reading frame of human PHB was subcloned into a lentiviral vector pLVX-puro. The proliferative rate of MG-63 cells was also investigated. The overall protein expression in MG-63/ADR cells was clearly suppressed. Three notable protein regions, representing high mobility group box 1, Ras homolog gene family, member A, and PHB, were identified to be significantly altered in MG-63/ADR cells when compared with its parental cells. Therefore, PHB modulated the chemoresistance of MG-63/ADR cells by interacting with multiple oncogenes or tumor suppressor genes (c-myc, c-fos, p53 and Rb). In addition, overexpression of PHB decreases the proliferative rate of MG-63 cells. In conclusion, PHB is an adriamycin resistance-associated gene, which may inhibit the proliferation of human osteosarcoma MG-63 cells by interacting with the oncogenes or tumor suppressor genes, c-myc, c-fos, p53 and Rb.

  19. RNAi validation of resistance genes and their interactions in the highly DDT-resistant 91-R strain of Drosophila melanogaster.

    PubMed

    Gellatly, Kyle J; Yoon, Kyong Sup; Doherty, Jeffery J; Sun, Weilin; Pittendrigh, Barry R; Clark, J Marshall

    2015-06-01

    4,4'-dichlorodiphenyltrichloroethane (DDT) has been re-recommended by the World Health Organization for malaria mosquito control. Previous DDT use has resulted in resistance, and with continued use resistance will increase in terms of level and extent. Drosophila melanogaster is a model dipteran that has many available genetic tools, numerous studies done on insecticide resistance mechanisms, and is related to malaria mosquitoes allowing for extrapolation. The 91-R strain of D. melanogaster is highly resistant to DDT (>1500-fold), however, there is no mechanistic scheme that accounts for this level of resistance. Recently, reduced penetration, increased detoxification, and direct excretion have been identified as resistance mechanisms in the 91-R strain. Their interactions, however, remain unclear. Use of UAS-RNAi transgenic lines of D. melanogaster allowed for the targeted knockdown of genes putatively involved in DDT resistance and has validated the role of several cuticular proteins (Cyp4g1 and Lcp1), cytochrome P450 monooxygenases (Cyp6g1 and Cyp12d1), and ATP binding cassette transporters (Mdr50, Mdr65, and Mrp1) involved in DDT resistance. Further, increased sensitivity to DDT in the 91-R strain after intra-abdominal dsRNA injection for Mdr50, Mdr65, and Mrp1 was determined by a DDT contact bioassay, directly implicating these genes in DDT efflux and resistance.

  20. Identification of positive and negative regulators of disease resistance to rice blast fungus using constitutive gene expression patterns.

    PubMed

    Grand, Xavier; Espinoza, Rocio; Michel, Corinne; Cros, Sandrine; Chalvon, Véronique; Jacobs, John; Morel, Jean-Benoit

    2012-09-01

    Elevated constitutive expression of components of the defence arsenal is associated with quantitative resistance to the rice blast fungus, a phenomenon called preformed defence. While the role of many disease regulators in inducible defence systems has been extensively studied, little attention has been paid so far to genes that regulate preformed defence. In this study, we show by microarray analysis across rice diversity that the preformed defence phenomenon impacts on a large number of defence-related genes without apparently affecting other biological processes. Using a guilt-by-association strategy, we identified two positive regulators that promote constitutive expression of known defence markers and partial resistance to rice blast. The HSF23 gene encodes for a putative member of the heat shock transcription factor family, while CaMBP encodes for a putative Calmodulin-binding protein. Both HSF23 and CaMBP strongly affect preformed defence and also plant growth. Additionally, we identified the OB-fold gene as a negative regulator of blast resistance, which could be involved in RNA stabilization. The OB-fold mutants do not suffer from obvious developmental defects. Taken together, our results prove that our strategy of combining analysis of gene expression diversity with guilt-by-association is a powerful way to identify disease resistance regulators in rice.

  1. Copy Number Variation in Acetolactate Synthase Genes of Thifensulfuron-Methyl Resistant Alopecurus aequalis (Shortawn Foxtail) Accessions in Japan

    PubMed Central

    Iwakami, Satoshi; Shimono, Yoshiko; Manabe, Yohei; Endo, Masaki; Shibaike, Hiroyuki; Uchino, Akira; Tominaga, Tohru

    2017-01-01

    Severe infestations of Alopecurus aequalis (shortawn foxtail), a noxious weed in wheat and barley cropping systems in Japan, can occur even after application of thifensulfuron-methyl, a sulfonylurea (SU) herbicide. In the present study, nine accessions of A. aequalis growing in a single wheat field were tested for sensitivity to thifensulfuron-methyl. Seven of the nine accessions survived application of standard field rates of thifensulfuron-methyl, indicating that severe infestations likely result from herbicide resistance. Acetolactate synthase (ALS) is the target enzyme of SU herbicides. Full-length genes encoding ALS were therefore isolated to determine the mechanism of SU resistance. As a result, differences in ALS gene copy numbers among accessions were revealed. Two copies, ALS1 and ALS2, were conserved in all accessions, while some carried two additional copies, ALS3 and ALS4. A single-base deletion in ALS3 and ALS4 further indicated that they represent pseudogenes. No differences in ploidy level were observed between accessions with two or four copies of the ALS gene, suggesting that copy number varies. Resistant plants were found to carry a mutation in either the ALS1 or ALS2 gene, with all mutations causing an amino acid substitution at the Pro197 residue, which is known to confer SU resistance. Transcription of each ALS gene copy was confirmed by reverse transcription PCR, supporting involvement of these mutations in SU resistance. The information on the copy number and full-length sequences of ALS genes in A. aequalis will aid future analysis of the mechanism of resistance. PMID:28303143

  2. Effect of Alloying Additions on Phase Equilibria and Creep Resistance of Alumina-Forming Austenitic Stainless Steels

    NASA Astrophysics Data System (ADS)

    Yamamoto, Y.; Santella, M. L.; Brady, M. P.; Bei, H.; Maziasz, P. J.

    2009-08-01

    The high-temperature creep properties of a series of alumina-forming austenitic (AFA) stainless steels based on Fe-20Ni-(12-14)Cr-(2.5-4)Al-(0.2-3.3)Nb-0.1C (weight percent) were studied. Computational thermodynamics were used to aid in the interpretation of data on microstructural stability, phase equilibria, and creep resistance. Phases of MC (M: mainly Nb), M23C6 (M: mainly Cr), B2 [ β-(Ni,Fe)Al], and Laves [Fe2(Mo,Nb)] were observed after creep-rupture testing at 750 °C and 170 MPa; this was generally consistent with the thermodynamic calculations. The creep resistance increased with increasing Nb additions up to 1 wt pct in the 2.5 and 3 Al wt pct alloy series, due to the stabilization of nanoscale MC particles relative to M23C6. Additions of Nb greater than 1 wt pct decreased creep resistance in the alloy series due to stabilization of the Laves phase and increased amounts of undissolved, coarse MC, which effectively reduced the precipitation of nanoscale MC particles. The additions of Al also increased the creep resistance moderately due to the increase in the volume fraction of B2 phase precipitates. Calculations suggested that optimum creep resistance would be achieved at approximately 1.5 wt pct Nb in the 4 wt pct Al alloy series.

  3. Effect of alloying additions on phase equilibria and creep resistance of alumina-forming austenitic stainless steels

    SciTech Connect

    Yamamoto, Yukinori; Santella, Michael L; Brady, Michael P; Bei, Hongbin; Maziasz, Philip J

    2009-01-01

    The high-temperature creep properties of a series of alumina-forming austenitic (AFA) stainless steels based on Fe-20Ni-(12-14)Cr-(2.5-4)Al-(0.2-3.3)Nb-0.1C (weight percent) were studied. Computational thermodynamics were used to aid in the interpretation of data on microstructural stability, phase equilibria, and creep resistance. Phases of MC (M: mainly Nb), M{sub 23}C{sub 6} (M: mainly Cr), B2 [{beta}-(Ni,Fe)Al], and Laves [Fe{sub 2}(Mo,Nb)] were observed after creep-rupture testing at 750 C and 170 MPa; this was generally consistent with the thermodynamic calculations. The creep resistance increased with increasing Nb additions up to 1 wt pct in the 2.5 and 3 Al wt pct alloy series, due to the stabilization of nanoscale MC particles relative to M{sub 23}C{sub 6}. Additions of Nb greater than 1 wt pct decreased creep resistance in the alloy series due to stabilization of the Laves phase and increased amounts of undissolved, coarse MC, which effectively reduced the precipitation of nanoscale MC particles. The additions of Al also increased the creep resistance moderately due to the increase in the volume fraction of B2 phase precipitates. Calculations suggested that optimum creep resistance would be achieved at approximately 1.5 wt pct Nb in the 4 wt pct Al alloy series.

  4. Genetic mapping and transcription analyses of resistance gene loci in potato using NBS profiling.

    PubMed

    Brugmans, Bart; Wouters, Doret; van Os, Hans; Hutten, Ronald; van der Linden, Gerard; Visser, Richard G F; van Eck, Herman J; van der Vossen, Edwin A G

    2008-11-01

    NBS profiling is a method for the identification of resistance gene analog (RGA) derived fragments. Here we report the use of NBS profiling for the genome wide mapping of RGA loci in potato. NBS profiling analyses on a minimal set of F1 genotypes of the diploid mapping population previously used to generate the ultra dense (UHD) genetic map of potato, allowed us to efficiently map polymorphic RGA fragments relative to 10,000 existing AFLP markers. In total, 34 RGA loci were mapped, of which only 13 contained RGA sequences homologous to RGAs genetically positioned at approximately similar positions in potato or tomato. The remaining RGA loci mapped either at approximate chromosomal regions previously shown to contain RGAs in potato or tomato without sharing homology to these RGAs, or mapped at positions not yet identified as RGA-containing regions. In addition to markers representing RGAs with unknown functions, segregating markers were detected that were closely linked to four functional R genes that segregate in the UHD mapping population. To explore the potential of NBS profiling in RGA transcription analyses, RNA isolated from different tissues was used as template for NBS profiling. Of all the fragments amplified approximately 15% showed putative intensity or absent/present differences between different tissues suggesting putative tissue specific RGA or R gene transcription. Putative absent/present differences between individuals were also found. In addition to being a powerful tool for generating candidate gene markers linked to R gene loci, NBS profiling, when applied to cDNA, can be instrumental in identifying those members of an R gene cluster that are transcribed, and thus putatively functional.

  5. Safety of raw meat and shellfish in Vietnam: an analysis of Escherichia coli isolations for antibiotic resistance and virulence genes.

    PubMed

    Van, Thi Thu Hao; Chin, James; Chapman, Toni; Tran, Linh Thuoc; Coloe, Peter J

    2008-06-10

    This study was conducted to examine a current baseline profile of antimicrobial resistance and virulence of Escherichia coli isolated from foods commonly sold in the market place in Vietnam. E. coli were isolated from 180 samples of raw meat, poultry and shellfish and also isolated from 43 chicken faeces samples. Ninety-nine E. coli isolates recovered from all sources were selected for the investigation of their susceptibility to 15 antimicrobial agents by the disk diffusion method. Eighty-four percent of the isolates were resistant to one or more antibiotics, and multi-resistance, defined as resistance to at least 3 different classes of antibiotics, was detected in all sources. The rates of multi-resistance were up to 89.5% in chicken, 95% in chicken faeces and 75% in pork isolates. Resistance was most frequently observed to tetracycline (77.8%), sulfafurazole (60.6%), ampicillin (50.5%), amoxicillin (50.5%), trimethoprim (51.5%), chloramphenicol (43.4%), streptomycin (39.4%), nalidixic acid (34.3%) and gentamicin (24.2%). In addition, the isolates also displayed resistance to fluoroquinolones (ciprofloxacin 16.2%, norfloxacin 17.2%, and enrofloxacin 21.2%), with chicken isolates showing the highest rates of resistance to these antibiotics (52.6-63.2%). Thirty-eight multi-resistant isolates were selected for further the examination of antibiotic resistance genes and were also evaluated for virulence gene profiles by multiplex and uniplex polymerase chain reaction. The beta-lactam TEM gene and tetracycline resistance tetA, tetB genes were frequently detected in the tested isolates (84.2% and 89.5% respectively). Genes which are responsible for resistance to streptomycin (aadA) (68.4%), chloramphenicol (cmlA) (42.1%), sulfonamides (sulI) (39.5%), trimethoprim (dhfrV) (26.3%) and kanamycin (aphA-1) (23.7%) were also widely distributed. Plasmid-mediated ampC genes were detected in E. coli isolates from chicken and pork. The isolates were tested for the presence of 58

  6. Pollen-mediated gene flow from glyphosate-resistant common waterhemp (Amaranthus rudis Sauer): consequences for the dispersal of resistance genes

    PubMed Central

    Sarangi, Debalin; Tyre, Andrew J.; Patterson, Eric L.; Gaines, Todd A.; Irmak, Suat; Knezevic, Stevan Z.; Lindquist, John L.; Jhala, Amit J.

    2017-01-01

    Gene flow is an important component in evolutionary biology; however, the role of gene flow in dispersal of herbicide-resistant alleles among weed populations is poorly understood. Field experiments were conducted at the University of Nebraska-Lincoln to quantify pollen-mediated gene flow (PMGF) from glyphosate-resistant (GR) to -susceptible (GS) common waterhemp using a concentric donor-receptor design. More than 130,000 common waterhemp plants were screened and 26,199 plants were confirmed resistant to glyphosate. Frequency of gene flow from all distances, directions, and years was estimated with a double exponential decay model using Generalized Nonlinear Model (package gnm) in R. PMGF declined by 50% at <3 m distance from the pollen source, whereas 90% reduction was found at 88 m (maximum) depending on the direction of the pollen-receptor blocks. Amplification of the target site gene, 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), was identified as the mechanism of glyphosate resistance in parent biotype. The EPSPS gene amplification was heritable in common waterhemp and can be transferred via PMGF, and also correlated with glyphosate resistance in pseudo-F2 progeny. This is the first report of PMGF in GR common waterhemp and the results are critical in explaining the rapid dispersal of GR common waterhemp in Midwestern United States. PMID:28327669

  7. Incorporation of Bacterial Blight Resistance Genes Into Lowland Rice Cultivar Through Marker-Assisted Backcross Breeding.

    PubMed

    Pradhan, Sharat Kumar; Nayak, Deepak Kumar; Pandit, Elssa; Behera, Lambodar; Anandan, Annamalai; Mukherjee, Arup Kumar; Lenka, Srikanta; Barik, Durga Prasad

    2016-07-01

    Bacterial blight (BB) of rice caused by Xanthomonas oryzae pv. oryzae is a major disease of rice in many rice growing countries. Pyramided lines carrying two BB resistance gene combinations (Xa21+xa13 and Xa21+xa5) were developed in a lowland cultivar Jalmagna background through backcross breeding by integrating molecular markers. In each backcross generation, markers closely linked to the disease resistance genes were used to select plants possessing the target genes. Background selection was continued in those plants carrying resistant genes until BC(3) generation. Plants having the maximum contribution from the recurrent parent genome were selected in each generation and hybridized with the recipient parent. The BB-pyramided line having the maximum recipient parent genome recovery of 95% was selected among BC3F1 plants and selfed to isolate homozygous BC(3)F(2) plants with different combinations of BB resistance genes. Twenty pyramided lines with two resistance gene combinations exhibited high levels of tolerance against the BB pathogen. In order to confirm the resistance, the pyramided lines were inoculated with different X. oryzae pv. oryzae strains of Odisha for bioassay. The genotypes with combination of two BB resistance genes conferred high levels of resistance to the predominant X. oryzae pv. oryzae isolates prevalent in the region. The pyramided lines showed similarity with the recipient parent with respect to major agro-morphologic traits.

  8. Molecular Identification and Quantification of Tetracycline and Erythromycin Resistance Genes in Spanish and Italian Retail Cheeses

    PubMed Central

    Flórez, Ana Belén; Alegría, Ángel; Delgado, Susana

    2014-01-01

    Large antibiotic resistance gene pools in the microbiota of foods may ultimately pose a risk for human health. This study reports the identification and quantification of tetracycline- and erythromycin-resistant populations, resistance genes, and gene diversity in traditional Spanish and Italian cheeses, via culturing, conventional PCR, real-time quantitative PCR (qPCR), and denaturing gradient gel electrophoresis (DGGE). The numbers of resistant bacteria varied widely among the antibiotics and the different cheese varieties; in some cheeses, all the bacterial populations seemed to be resistant. Up to eight antibiotic resistance genes were sought by gene-specific PCR, six with respect to tetracycline, that is, tet(K), tet(L), tet(M), tet(O), tet(S), and tet(W), and two with respect to erythromycin, that is, erm(B) and erm(F). The most common resistance genes in the analysed cheeses were tet(S), tet(W), tet(M), and erm(B). The copy numbers of these genes, as quantified by qPCR, ranged widely between cheeses (from 4.94 to 10.18log⁡10/g). DGGE analysis revealed distinct banding profiles and two polymorphic nucleotide positions for tet(W)-carrying cheeses, though the similarity of the sequences suggests this tet(W) to have a monophyletic origin. Traditional cheeses would therefore appear to act as reservoirs for large numbers of many types of antibiotic resistance determinants. PMID:25302306

  9. Breeding Pierce’s disease resistant table and raisin grapes and the development of markers for additional sources of resistance 2008

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Twenty-two seedless x seedless crosses to develop additional BC2 and BC3 V. arizonica and BC1 SEUS BD5-117 families were made in 2008. Powdery mildew resistance was included in five of these crosses. These crosses produced 5,148 berries, 8,824 ovules and 1,861 embryos. Nine seeded BC1 crosses bas...

  10. Clusters of Antibiotic Resistance Genes Enriched Together Stay Together in Swine Agriculture

    PubMed Central

    Johnson, Timothy A.; Stedtfeld, Robert D.; Wang, Qiong; Cole, James R.; Hashsham, Syed A.; Looft, Torey; Zhu, Yong-Guan

    2016-01-01

    ABSTRACT   Antibiotic resistance is a worldwide health risk, but the influence of animal agriculture on the genetic context and enrichment of individual antibiotic resistance alleles remains unclear. Using quantitative PCR followed by amplicon sequencing, we quantified and sequenced 44 genes related to antibiotic resistance, mobile genetic elements, and bacterial phylogeny in microbiomes from U.S. laboratory swine and from swine farms from three Chinese regions. We identified highly abundant resistance clusters: groups of resistance and mobile genetic element alleles that cooccur. For example, the abundance of genes conferring resistance to six classes of antibiotics together with class 1 integrase and the abundance of IS6100-type transposons in three Chinese regions are directly correlated. These resistance cluster genes likely colocalize in microbial genomes in the farms. Resistance cluster alleles were dramatically enriched (up to 1 to 10% as abundant as 16S rRNA) and indicate that multidrug-resistant bacteria are likely the norm rather than an exception in these communities. This enrichment largely occurred independently of phylogenetic composition; thus, resistance clusters are likely present in many bacterial taxa. Furthermore, resistance clusters contain resistance genes that confer resistance to antibiotics independently of their particular use on the farms. Selection for these clusters is likely due to the use of only a subset of the broad range of chemicals to which the clusters confer resistance. The scale of animal agriculture and its wastes, the enrichment and horizontal gene transfer potential of the clusters, and the vicinity of large human populations suggest that managing this resistance reservoir is important for minimizing human risk. PMID:27073098

  11. Pyramiding B genes in cotton achieves broader but not always higher resistance to bacterial blight.

    PubMed

    Essenberg, Margaret; Bayles, Melanie B; Pierce, Margaret L; Verhalen, Laval M

    2014-10-01

    Near-isogenic lines of upland cotton (Gossypium hirsutum) carrying single, race-specific genes B4, BIn, and b7 for resistance to bacterial blight were used to develop a pyramid of lines with all possible combinations of two and three genes to learn whether the pyramid could achieve broad and high resistance approaching that of L. A. Brinkerhoff's exceptional line Im216. Isogenic strains of Xanthomonas axonopodis pv. malvacearum carrying single avirulence (avr) genes were used to identify plants carrying specific resistance (B) genes. Under field conditions in north-central Oklahoma, pyramid lines exhibited broader resistance to individual races and, consequently, higher resistance to a race mixture. It was predicted that lines carrying two or three B genes would also exhibit higher resistance to race 1, which possesses many avr genes. Although some enhancements were observed, they did not approach the level of resistance of Im216. In a growth chamber, bacterial populations attained by race 1 in and on leaves of the pyramid lines decreased significantly with increasing number of B genes in only one of four experiments. The older lines, Im216 and AcHR, exhibited considerably lower bacterial populations than any of the one-, two-, or three-B-gene lines. A spreading collapse of spray-inoculated AcBIn and AcBInb7 leaves appears to be a defense response (conditioned by BIn) that is out of control.

  12. Antimicrobial Resistance Genes in Pigeons from Public Parks in Costa Rica.

    PubMed

    Blanco-Peña, K; Esperón, F; Torres-Mejía, A M; de la Torre, A; de la Cruz, E; Jiménez-Soto, M

    2017-02-24

    Antimicrobial resistance is known to be an emerging problem, but the extent of the issue remains incomplete. The aim of this study was to determine the presence or absence of nine resistance genes (blaTEM , catI, mecA, qnrS, sulI, sulII, tet(A), tet(Q), vanA) in the faeces of 141 pigeons from four urban parks in Alajuela, Guadalupe, Tres Ríos and San José in Costa Rica. The genes were identified by real-time PCR directly from enema samples. About 30% of the samples were positive for genes catI and sulI; between 13% and 17% were positive for qnrS, sulII, tet(A) and tet(Q); and 4% were positive for blaTEM . The mecA and vanA genes were not detected. The average of antimicrobial resistance genes detected per pigeon was 2. Eight different patterns of resistance were identified, without differences in the sampling areas, being the most common pattern 2 (sulII positive samples). During rainy season, the genes more frequently found were sulI and tet(A). In conclusion, the urban inhabiting pigeons tested are currently carrying antimicrobial resistance genes, potentially acting as reservoirs of resistant bacteria and vectors to humans. To the authors' knowledge, this is the first study carried out on direct detection of resistance genes in the digestive metagenomes of pigeons.

  13. Organization, expression and evolution of a disease resistance gene cluster in soybean.

    PubMed Central

    Graham, Michelle A; Marek, Laura Fredrick; Shoemaker, Randy C

    2002-01-01

    PCR amplification was previously used to identify a cluster of resistance gene analogues (RGAs) on soybean linkage group J. Resistance to powdery mildew (Rmd-c), Phytophthora stem and root rot (Rps2), and an ineffective nodulation gene (Rj2) map within this cluster. BAC fingerprinting and RGA-specific primers were used to develop a contig of BAC clones spanning this region in cultivar "Williams 82" [rps2, Rmd (adult onset), rj2]. Two cDNAs with homology to the TIR/NBD/LRR family of R-genes have also been mapped to opposite ends of a BAC in the contig Gm_Isb001_091F11 (BAC 91F11). Sequence analyses of BAC 91F11 identified 16 different resistance-like gene (RLG) sequences with homology to the TIR/NBD/LRR family of disease resistance genes. Four of these RLGs represent two potentially novel classes of disease resistance genes: TIR/NBD domains fused inframe to a putative defense-related protein (NtPRp27-like) and TIR domains fused inframe to soybean calmodulin Ca(2+)-binding domains. RT-PCR analyses using gene-specific primers allowed us to monitor the expression of individual genes in different tissues and developmental stages. Three genes appeared to be constitutively expressed, while three were differentially expressed. Analyses of the R-genes within this BAC suggest that R-gene evolution in soybean is a complex and dynamic process. PMID:12524363

  14. Characterization of integrons and resistance genes in multidrug-resistant Salmonella enterica isolated from meat and dairy products in Egypt.

    PubMed

    Ahmed, Ashraf M; Shimamoto, Toshi; Shimamoto, Tadashi

    2014-10-17

    Foodborne pathogens are a leading cause of illness and death, especially in developing countries. The problem is exacerbated if bacteria attain multidrug resistance. Little is currently known about the extent of antibiotic resistance in foodborne pathogens and the molecular mechanisms underlying this resistance in Africa. Therefore, the current study was carried out to characterize, at the molecular level, the mechanism of multidrug resistance in Salmonella enterica isolated from 1600 food samples (800 meat products and 800 dairy products) collected from different street venders, butchers, retail markets and slaughterhouses in Egypt. Forty-seven out of 69 isolates (68.1%) showed multidrug resistance phenotypes to at least three classes of antimicrobials. The incidence of multidrug-resistant isolates was higher in meat products (37, 69.8%) than in dairy products (10, 62.5%). The multidrug-resistant serovars included, S. enterica serovar Typhimurium (24 isolates, 34.8%), S. enterica serovar Enteritidis, (15 isolates, 21.8%), S. enterica serovar Infantis (7 isolates, 10.1%) and S. enterica non-typable serovar (1 isolate, 1.4%). The highest resistance was to ampicillin (95.7%), then to kanamycin (93.6%), spectinomycin (93.6%), streptomycin (91.5%) and sulfamethoxazole/trimethoprim (91.5%). PCR and DNA sequencing were used to screen and characterize integrons and antibiotic resistance genes and 39.1% and 8.7% of isolates were positive for class 1 and class 2 integrons, respectively. β-lactamase-encoding genes were identified in 75.4% of isolates and plasmid-mediated quinolone resistance genes were identified in 27.5% of isolates. Finally, the florphenicol resistance gene, floR, was identified in 18.8% of isolates. PCR screening identified S. enterica serovar Typhimurium DT104 in both meat and dairy products. This is the first study to report many of these resistance genes in dairy products. This study highlights the high incidence of multidrug-resistant S. enterica in

  15. Extracellular complementation and the identification of additional genes involved in aerial mycelium formation in Streptomyces coelicolor.

    PubMed

    Nodwell, J R; Yang, M; Kuo, D; Losick, R

    1999-02-01

    Morphogenesis in the bacterium Streptomyces coelicolor involves the formation of a lawn of hair-like aerial hyphae on the colony surface that stands up in the air and differentiates into chains of spores. bld mutants are defective in the formation of this aerial mycelium and grow as smooth, hairless colonies. When certain pairs of bld mutants are grown close to one another on rich sporulation medium, they exhibit extracellular complementation such that one mutant restores aerial mycelium formation to the other. The extracellular complementation relationships of most of the previously isolated bld mutants placed them in a hierarchy of extracellular complementation groups. We have screened for further bld mutants with precautions intended to maximize the discovery of additional genes. Most of the 50 newly isolated mutant strains occupy one of three of the previously described positions in the hierarchy, behaving like bldK, bldC, or bldD mutants. We show that the mutations in some of the strains that behave like bldK are bldK alleles but that others fall in a cluster at a position on the chromosome distinct from that of any known bld gene. We name this locus bldL. By introducing cloned genes into the strains that exhibit bldC or bldD-like extracellular complementation phenotypes, we show that most of these strains are likely to contain mutations in genes other than bldC or bldD. These results indicate that the genetic control of aerial mycelium formation is more complex than previously recognized and support the idea that a high proportion of bld genes are directly or indirectly involved in the production of substances that are exchanged between cells during morphological differentiation.

  16. Extracellular complementation and the identification of additional genes involved in aerial mycelium formation in Streptomyces coelicolor.

    PubMed Central

    Nodwell, J R; Yang, M; Kuo, D; Losick, R

    1999-01-01

    Morphogenesis in the bacterium Streptomyces coelicolor involves the formation of a lawn of hair-like aerial hyphae on the colony surface that stands up in the air and differentiates into chains of spores. bld mutants are defective in the formation of this aerial mycelium and grow as smooth, hairless colonies. When certain pairs of bld mutants are grown close to one another on rich sporulation medium, they exhibit extracellular complementation such that one mutant restores aerial mycelium formation to the other. The extracellular complementation relationships of most of the previously isolated bld mutants placed them in a hierarchy of extracellular complementation groups. We have screened for further bld mutants with precautions intended to maximize the discovery of additional genes. Most of the 50 newly isolated mutant strains occupy one of three of the previously described positions in the hierarchy, behaving like bldK, bldC, or bldD mutants. We show that the mutations in some of the strains that behave like bldK are bldK alleles but that others fall in a cluster at a position on the chromosome distinct from that of any known bld gene. We name this locus bldL. By introducing cloned genes into the strains that exhibit bldC or bldD-like extracellular complementation phenotypes, we show that most of these strains are likely to contain mutations in genes other than bldC or bldD. These results indicate that the genetic control of aerial mycelium formation is more complex than previously recognized and support the idea that a high proportion of bld genes are directly or indirectly involved in the production of substances that are exchanged between cells during morphological differentiation. PMID:9927452

  17. rym15 from the Japanese cultivar Chikurin Ibaraki 1 is a new barley mild mosaic virus (BaMMV) resistance gene mapped on chromosome 6H.

    PubMed

    Le Gouis, J; Devaux, P; Werner, K; Hariri, D; Bahrman, N; Béghin, D; Ordon, F

    2004-05-01

    Breeding for resistant cultivars is the only way to prevent high yield loss in barley caused by the soil-borne barley mild mosaic virus (BaMMV) complex. We have characterized the BaMMV resistance of barley cv. Chikurin Ibaraki 1. Doubled haploid lines were obtained from the F(1) between the susceptible six-rowed winter barley cultivar, Plaisant, and Chikurin Ibaraki 1. Each line was tested for reaction to BaMMV by mechanical inoculation followed by DAS-ELISA. Of 44 microsatellites that covered the genome, 22 polymorphic markers were tested on one susceptible and one resistant bulk, each comprising 30 lines. Differential markers and additional microsatellite markers in the same region were then tested on the whole population. A bootstrap analysis was used to compute confidence intervals of distances and to test the orders of the resistance gene and the closest markers. A segregation of 84 resistant/98 susceptible lines fitted a 1:1 ratio (chi(2)=1.08, P=0.30), which corresponds to a single gene in this DH lines population. The resistance gene was flanked by two markers near the centromeric region of chromosome 6HS-Bmag0173, at 0.6+/-1.2 cM, and EBmac0874, at 5.8 +/- 3.4 cM. We propose to name this new resistance gene rym15. This resistance gene and associated markers will increase the possibilities to breed efficiently for new cultivars resistant to the barley mosaic disease.

  18. Tagging and mapping of SSR marker for rust resistance gene in lentil (Lens culinaris Medikus subsp. culinaris).

    PubMed

    Dikshit, H K; Singh, Akanksha; Singh, D; Aski, M; Jain, Neelu; Hegde, V S; Basandrai, A K; Basandrai, D; Sharma, T R

    2016-06-01

    Lentil, as an economical source of protein, minerals and vitamins, plays important role in nutritional security of the common man. Grown mainly in West Asia, North Africa (WANA) region and South Asia, it suffers from several biotic stresses such as wilt, rust, blight and broomrape. Lentil rust caused by autoecious fungus Uromyces viciae fabae (Pers.) Schroet is a serious lentil disease in Algeria, Bangladesh, Ethiopia, India, Italy, Morocco, Pakistan and Nepal. The disease symptoms are observed during flowering and early podding stages. Rust causes severe yield losses in lentil. It can only be effectively controlled by identifying the resistant source, understanding its inheritance and breeding for host resistance. The obligate parasitic nature of pathogen makes it difficult to maintain the pathogen in culture and to apply it to screen segregating progenies under controlled growth conditions. Hence, the use of molecular markers will compliment in identification of resistant types in different breeding programs. Here, we studied the inheritance of resistance to rust in lentil using F₁, F₂ and F₂:₃ from cross PL 8 (susceptible) x L 4149 (resistant) varieties. The phenotyping of lentil population was carried out at Sirmour, India. The result of genetic analysis revealed that a single dominant gene controls rust resistance in lentil genotype L 4149. The F2 population from this cross was used to tag and map the rust resistance gene using SSR and SRAP markers. Markers such as 270 SRAP and 162 SSR were studied for polymorphism and 101 SRAP and 33 SSRs were found to be polymorphic between the parents. Two SRAP and two SSR markers differentiated the resistant and susceptible bulks. SSR marker Gllc 527 was estimated to be linked to rust resistant locus at a distance of 5.9 cM. The Gllc 527 marker can be used for marker assisted selection for rust resistance; however, additional markers closer to rust resistant locus are required. The markers linked to the rust

  19. Application of genomic and quantitative genetic tools to identify candidate resistance genes for brown rot resistance in peach.

    PubMed

    Martínez-García, Pedro J; Parfitt, Dan E; Bostock, Richard M; Fresnedo-Ramírez, Jonathan; Vazquez-Lobo, Alejandra; Ogundiwin, Ebenezer A; Gradziel, Thomas M; Crisosto, Carlos H

    2013-01-01

    The availability of a complete peach genome assembly and three different peach genome sequences created by our group provide new opportunities for application of genomic data and can improve the power of the classical Quantitative Trait Loci (QTL) approaches to identify candidate genes for peach disease resistance. Brown rot caused by Monilinia spp., is the most important fungal disease of stone fruits worldwide. Improved levels of peach fruit rot resistance have been identified in some cultivars and advanced selections developed in the UC Davis and USDA breeding programs. Whole genome sequencing of the Pop-DF parents lead to discovery of high-quality SNP markers for QTL genome scanning in this experimental population. Pop-DF created by crossing a brown rot moderately resistant cultivar 'Dr. Davis' and a brown rot resistant introgression line, 'F8,1-42', derived from an initial almond × peach interspecific hybrid, was evaluated for brown rot resistance in fruit of harvest maturity over three seasons. Using the SNP linkage map of Pop-DF and phenotypic data collected with inoculated fruit, a genome scan for QTL identified several SNP markers associated with brown rot resistance. Two of these QTLs were placed on linkage group 1, covering a large (physical) region on chromosome 1. The genome scan for QTL and SNP effects predicted several candidate genes associated with disease resistance responses in other host-pathogen systems. Two potential candidate genes, ppa011763m and ppa026453m, may be the genes primarily responsible for M. fructicola recognition in peach, activating both PAMP-triggered immunity (PTI) and effector-triggered immunity (ETI) responses. Our results provide a foundation for further genetic dissection, marker assisted breeding for brown rot resistance, and development of peach cultivars resistant to brown rot.

  20. Detection and Characterizations of Genes Resistant to Tetracycline and Sulfa among the Bacteria in Mariculture Water

    NASA Astrophysics Data System (ADS)

    Qu, L.; Li, Y.; Zhu, P.

    2013-12-01

    One hundred and thirty-five bacteria from maricultural environments were tested for sensitivity to tetracycline and sulfa. Result show that 72% of the bacteria were sulfa-resistant, 36% of the bacteria were tetracycline-resistant, and 16.5% of bacteria showed resistance to both tetracyclines and sulfa ,indicating that the proportion of sulfa and tetracycline resistance bacteria isvery large in the maricultural environments. PCR methods were used to detect if these resistant bacteria carry tetracycline and sulfa resistance genes. Out of the 33 tetracycline-resistant bacteria screened, 3 were positive for tetA, 6 were positive for tetB and no isolate wasboth positive for tetA and tetB. Of the 97 sulfa-resistant bacteria screened, 9 were positive for sul2, 6 were positive for sul1, 1 isolate was positive for bothsul1 and sul2. The minimum inhibitory concentration (MIC) of tetracycline for tetA-carrying isolates were higher than those tetB-carrying isolates.while The MIC of sulfa for sul2-carrying isolates were higher than those sul1-carrying isolates. Indicating that tetA and sul2 gene may play ubknown roles in resisting tetracycline and sulfa than tetB and sul1 genes. The results showed the 4 kinds of genes (tetA,tetB,sul1,sul2) has no host specificity. All these 16S sequence are from the isolates which are positive for the above genes, it indicated the above antibiotic resistance genes are widespread in the environment regardless of the host. While the DNA sequence of these four genes showed tetA, sul1, sul2 genes are conservative in different bacteria , etB gene conserved poorly. The research aim is to get a preliminary understanding of resistance mechanism related to the resistant bacteria and the resistance genes in marine aquaculture environment through the analysis of resistant genes, providing research base for the prevention and treatment of drug-resistant bacteria so as to reduce the threat to the ecological environment, aquaculture and human health.

  1. Impact of pre-application treatment on municipal sludge composition, soil dynamics of antibiotic resistance genes, and abundance of antibiotic-resistance genes on vegetables at harvest.

    PubMed

    Lau, Calvin Ho-Fung; Li, Bing; Zhang, Tong; Tien, Yuan-Ching; Scott, Andrew; Murray, Roger; Sabourin, Lyne; Lapen, David R; Duenk, Peter; Topp, Edward

    2017-06-01

    In many jurisdictions sludge recovered from the sewage treatment process is a valued fertilizer for crop production. Pre-treatment of sewage sludge prior to land application offers the potential to abate enteric microorganisms that carry genes conferring resistance to antibiotics. Pre-treatment practices that accomplish this should have the desirable effect of reducing the risk of contamination of crops or adjacent water with antibiotic resistance genes carried in these materials. In the present study, we obtained municipal sludge that had been subjected to one of five treatments. There were, anaerobic-digestion or aerobic-digestion, in both instances with and without dewatering; and heat-treatment and pelletization. Each of the five types of biosolids was applied to an agricultural field at commercial rates, following which lettuce, carrots and radishes were planted. Based on qPCR, the estimated antibiotic gene loading rates were comparable with each of the five biosolids. However, the gene abundance in soil following application of the pelletized biosolids was anomalously lower than expected. Following application, the abundance of antibiotic resistance genes decreased in a generally coherent fashion, except sul1 which increased in abundance during the growing season in the soil fertilized with pelletized biosolids. Based on qPCR and high throughput sequencing evidence for transfer of antibiotic resistance genes from the biosolids to the vegetables at harvest was weak. Clostridia were more abundant in soils receiving any of the biosolids except the pelletized. Overall, the behavior of antibiotic resistance genes in soils receiving aerobically or anaerobically-digested biosolids was consistent and coherent with previous studies. However, dynamics of antibiotic resistance genes in soils receiving the heat treated pelletized biosolids were very different, and the underlying mechanisms merit investigation.

  2. Arsenic resistance genes of As-resistant purple nonsulfur bacteria isolated from As-contaminated sites for bioremediation application.

    PubMed

    Nookongbut, Phitthaya; Kantachote, Duangporn; Krishnan, Kannan; Megharaj, Mallavarapu

    2017-04-01

    This study aimed to identify arsenic resistant mechanisms in As-resistant purple nonsulfur bacteria (PNSB) by screening them for presence of As-resistance genes and related enzymes. Resistance to As(III) and As(V) of four As-resistant PNSB determined in terms of median inhibition concentration (IC50 values) were in the order of strains Rhodopseudomonas palustris C1 > R. palustris AB3 > Rubrivivax benzoatilyticus C31 > R. palustris L28 which corresponded to the presence of As-resistance genes in these bacteria. The strain C1 showed all As-marker genes; arsC, arsM, aioA, and acr3, while aioA was not detected in strain AB3. Strains C31 and L28 had only Arsenite-transporter gene, acr3. Translation of all these detected gene sequences of strain C1 to amino acid sequences showed that these proteins have vicinal cysteine; Cys126, Cys105, and Cys178 of Acr3, ArsC, AioA, respectively. Tertiary structure of proteins Acr3, ArsC, AioA, and ArsM showed strain C1 exhibits the high activities of arsenite oxidase and arsenate reductase enzymes that are encoded by aioA and arsC genes, respectively. Moreover, strain C1 with arsM gene produced volatile-methylated As-compounds; monomethylarsonic acid (MMA), dimethylarsenic acid (DMA), and arsenobetaine (AsB) in the presence of either As(III) or As(V). In conclusion, the strain C1 has great potential for its application in bioremediation of As-contaminated sites.

  3. Older paternal age and fresh gene mutation: data on additional disorders.

    PubMed

    Jones, K L; Smith, D W; Harvey, M A; Hall, B D; Quan, L

    1975-01-01

    Older paternal age has previously been documented as a factor in sporadic fresh mutational cases of several autosomal dominant disorders. In this collaborative study, an older mean paternal age has been documented in sporadic cases of at least five additional dominantly inheritable disorders; the basal cell nevus syndrome, the Waardenburg syndrome, the Crouzon syndrome, the oculo-dental-digital sysdrome, and the Treacher-Collins syndrome. It was also found to be a factor in acrodysostosis and progeria, suggesting a fresh mutant gene etiology for these two conditions in which virtually all cases have been sporadic and the mode of genetic etiology has been unknown.

  4. De Novo Characterization of Genes That Contribute to High-Level Ciprofloxacin Resistance in Escherichia coli

    PubMed Central

    Tran, Thu; Ran, Qinghong; Ostrer, Lev

    2016-01-01

    Sensitization of resistant bacteria to existing antibiotics depends on the identification of candidate targets whose activities contribute to resistance. Using a transposon insertion library in an Escherichia coli mutant that was 2,000 times less susceptible to ciprofloxacin than its parent and the relative fitness scores, we identified 19 genes that contributed to the acquired ciprofloxacin resistance and mapped the shortest genetic path that increased the antibiotic susceptibility of the resistant bacteria back to a near wild-type level. PMID:27431218

  5. Tetracycline and Phenicol Resistance Genes and Mechanisms: Importance for Agriculture, the Environment, and Humans.

    PubMed

    Roberts, Marilyn C; Schwarz, Stefan

    2016-03-01

    Recent reports have speculated on the future impact that antibiotic-resistant bacteria will have on food production, human health, and global economics. This review examines microbial resistance to tetracyclines and phenicols, antibiotics that are widely used in global food production. The mechanisms of resistance, mode of spread between agriculturally and human-impacted environments and ecosystems, distribution among bacteria, and the genes most likely to be associated with agricultural and environmental settings are included. Forty-six different tetracycline resistance () genes have been identified in 126 genera, with (M) having the broadest taxonomic distribution among all bacteria and (B) having the broadest coverage among the Gram-negative genera. Phenicol resistance genes are organized into 37 groups and have been identified in 70 bacterial genera. The review provides the latest information on tetracycline and phenicol resistance genes, including their association with mobile genetic elements in bacteria of environmental, medical, and veterinary relevance. Knowing what specific antibiotic-resistance genes (ARGs) are found in specific bacterial species and/o