Science.gov

Sample records for additional resistance genes

  1. DNA markers closely linked to nematode resistance genes in sugar beet (Beta vulgaris L.) mapped using chromosome additions and translocations originating from wild beets of the Procumbentes section.

    PubMed

    Jung, C; Koch, R; Fischer, F; Brandes, A; Wricke, G; Herrmann, R G

    1992-03-01

    Genes conferring resistance to the beet cyst nematode (Heterodera schachtii Schm.) have been transferred to sugar beet (Beta vulgaris L.) from three wild species of the Procumbentes section using monosomic addition and translocation lines, because no meiotic recombination occurs between chromosomes of cultured and wild species. In the course of a project to isolate the nematode resistance genes by strategies of reverse genetics, probes were cloned from DNA of a fragmented B. procumbens chromosome carrying a resistance gene, which had been isolated by pulsed-field gel electrophoresis. One probe (pRK643) hybridized with a short dispersed repetitive DNA element, which was found only in wild beets, and thus may be used as a molecular marker for nematode resistance to progeneis of monosomic addition lines segregating resistant and susceptible individuals. Additional probes for the resistance gene region were obtained with a polymerase chain reaction (PCR)-based strategy using repetitive primers to amplify DNA located between repetitive elements. One of these probes established the existence of at least six different chromosomes from wild beet species, each conferring resistance independently of the others. A strict correlation between the length of the wild beet chromatin introduced in fragment addition and translocation lines and the repeat copy number has been used physically to map the region conferring resistance to a chromosome segment of 0.5-3 Mb.

  2. Effect of red mud addition on tetracycline and copper resistance genes and microbial community during the full scale swine manure composting.

    PubMed

    Wang, Rui; Zhang, Junya; Sui, Qianwen; Wan, Hefeng; Tong, Juan; Chen, Meixue; Wei, Yuansong; Wei, Dongbin

    2016-09-01

    Swine manure has been considered as the reservoir of antibiotic resistance genes (ARGs). Composting is one of the most suitable technologies for treating livestock manures, and red mud was proved to have a positive effect on nitrogen conservation during composting. This study investigated the abundance of eight tetracycline and three copper resistance genes, the bacterial community during the full scale swine manure composting with or without addition of red mud. The results showed that ARGs in swine manure could be effectively removed through composting (reduced by 2.4log copies/g TS), especially during the thermophilic phase (reduced by 1.5log copies/g TS), which the main contributor might be temperature. Additionally, evolution of bacterial community could also have a great influence on ARGs. Although addition of red mud could enhance nitrogen conservation, it obviously hindered removal of ARGs (reduced by 1.7log copies/g TS) and affected shaping of bacterial community during composting.

  3. Transcriptome analysis of genes related to resistance against powdery mildew in wheat-Thinopyrum alien addition disomic line germplasm SN6306.

    PubMed

    Li, Quanquan; Niu, Zubiao; Bao, Yinguang; Tian, Qiuju; Wang, Honggang; Kong, Lingrang; Feng, Deshun

    2016-09-15

    Wheat powdery mildew, which is mainly caused by Blumeria graminis f. sp. tritici (Bgt), seriously damages wheat production. The wheat-Thinopyrum intermedium alien addition disomic line germplasm SN6306, being one of the important sources of genes for wheat resistance, is highly resistant to Bgt E09 and to many other powdery mildew physiological races. However, knowledge on the resistance mechanism of SN6306 remains limited. Our study employed high-throughput RNA sequencing based on next-generation sequencing technology (Illumina) to obtain an overview of the transcriptome characteristics of SN6306 and its parent wheat Yannong 15 (YN15) during Bgt infection. The sequencing generated 104,773 unigenes, 9909 of which showed varied expression levels. Among the 9909 unigenes, 1678 unigenes showed 0 reads in YN15. The expression levels in Bgt-inoculated SN6306 and YN15 of exactly 39 unigenes that showed 0 or considerably low reads in YN15 were validated to identify the genes involved in Bgt resistance. Among the 39 unigenes, 12 unigenes were upregulated in SN6306 by 3-45 times. These unigenes mainly encoded kinase, synthase, proteases, and signal transduction proteins, which may play an important role in the resistance against Bgt. To confirm whether the unigenes that showed 0 reads in YN15 are really unique to SN6306, 8 unigenes were cloned and sequenced. Results showed that the selected unigenes are more similar to SN6306 and Th. intermedium than to the wheat cultivar YN15. The sequencing results further confirmed that the unigenes showing 0 reads in YN15 are unique to SN6306 and are most likely derived from Th. intermedium (Host) Nevski. Thus, the genes from Th. intermedium most probably conferred the resistance of SN6306 to Bgt. PMID:27265028

  4. Reservoirs of antibiotic resistance genes.

    PubMed

    Salyers, Abigail; Shoemaker, Nadja B

    2006-01-01

    A potential concern about the use of antibiotics in animal husbundary is that, as antibiotic resistant bacteria move from the farm into the human diet, they may pass antibiotic resistance genes to bacteria that normally reside in a the human intestinal tract and from there to bacteria that cause human disease (reservoir hypothesis). In this article various approaches to evaluating the risk of agricultural use of antibiotics are assessed critically. In addition, the potential benefits of applying new technology and using new insights from the field of microbial ecology are explained.

  5. Development of a novel Sinapis arvensis disomic addition line in Brassica napus containing the restorer gene for Nsa CMS and improved resistance to Sclerotinia sclerotiorum and pod shattering.

    PubMed

    Wei, Wenhui; Li, Yunchang; Wang, Lijun; Liu, Shengyi; Yan, Xiaohong; Mei, Desheng; Li, Yinde; Xu, Yusong; Peng, Pengfei; Hu, Qiong

    2010-04-01

    An allo-cytoplasmic male sterile line, which was developed through somatic hybridization between Brassica napus and Sinapis arvensis (thus designated as Nsa CMS line), possesses high potential for hybrid production of rapeseed. In order to select for restorer lines, fertile plants derived from the same somatic hybridization combination were self-pollinated and testcrossed with the parental Nsa CMS line for six generations. A novel disomic alien addition line, B. napus-S. arvensis, has been successfully developed. GISH analysis showed that it contains one pair of chromosomes from S. arvensis and 19 pairs from B. napus, and retains stable and regular mitotic and meiotic processes. The addition line displays very strong restoration ability to Nsa CMS line, high resistance to Sclerotinia sclerotiorum and a low incidence of pod shattering. Because the addition line shares these very important agricultural characters, it is a valuable restorer to Nsa CMS line, and is named NR1 here (Nsa restorer no. 1).

  6. Gene amplification and insecticide resistance.

    PubMed

    Bass, Chris; Field, Linda M

    2011-08-01

    Pesticide resistance in arthropods has been shown to evolve by two main mechanisms, the enhanced production of metabolic enzymes, which bind to and/or detoxify the pesticide, and mutation of the target protein, which makes it less sensitive to the pesticide. One route that leads to enhanced metabolism is the duplication or amplification of the structural gene(s) encoding the detoxifying enzyme, and this has now been described for the three main families (esterases, glutathione S-transferases and cytochrome P450 monooxygenases) implicated in resistance. More recently, a direct or indirect role for gene duplication or amplification has been described for target-site resistance in several arthropod species. This mini-review summarises the involvement of gene duplication/amplification in the insecticide/acaricide resistance of insect and mite pests and highlights recent developments in this area in relation to P450-mediated and target-site resistance.

  7. Gene expression and fractionation resistance

    PubMed Central

    2014-01-01

    Background Previous work on whole genome doubling in plants established the importance of gene functional category in provoking or suppressing duplicate gene loss, or fractionation. Other studies, particularly in Paramecium have correlated levels of gene expression with vulnerability or resistance to duplicate loss. Results Here we analyze the simultaneous effect of function category and expression in two plant data sets, rosids and asterids. Conclusion We demonstrate function category and expression level have independent effects, though expression does not play the dominant role it does in Paramecium. PMID:25573431

  8. Obesity genes and insulin resistance

    PubMed Central

    Belkina, Anna C.; Denis, Gerald V.

    2011-01-01

    Purpose of review The exploding prevalence of insulin resistance and Type 2 diabetes (T2D) linked to obesity has become an alarming public health concern. Worldwide, approximately 171 million people suffer from obesity-induced diabetes and public health authorities expect this situation to deteriorate rapidly. An interesting clinical population of ‘metabolically healthy but obese’ (MHO) cases is relatively protected from T2D and its associated cardiovascular risk. The molecular basis for this protection is not well understood but is likely to involve reduced inflammatory responses. The inflammatory cells and pathways that respond to overnutrition are the primary subject matter for this review. Recent findings The chance discovery of a genetic mutation in the Brd2 gene, which is located in the class II major histocompatibility complex and makes mice enormously fat but protects them from diabetes, offers revolutionary new insights into the cellular mechanisms that link obesity to insulin resistance and T2D. These Brd2-hypomorphic mice have reduced inflammation in fat that is normally associated with insulin resistance, and resemble MHO patients, suggesting novel therapeutic pathways for obese patients at risk for T2D. Summary Deeper understanding of the functional links between genes that control inflammatory responses to diet-induced obesity is crucial to the development of therapies for obese, insulin-resistant patients. PMID:20585247

  9. Pronounced effects of additional resistance in Andreev reflection spectroscopy

    NASA Astrophysics Data System (ADS)

    Chen, T. Y.; Huang, S. X.; Chien, C. L.

    2010-06-01

    We present a systematic investigation of the additional resistance (RE) , which is an unavoidable consequence of pseudo-four-probe electrical measurements, on the point-contact Andreev reflection (PCAR) spectrum by both modeling and experiments. Instead of considering the total resistance between the two voltage leads across a point contact as a sum of a contact resistance (RC) and a fixed sample resistance (RS) , it is essential to treat the total resistance as a sum of the Andreev resistance RAR and the additional resistance RE , which are, respectively, the resistances affected and unaffected by the Andreev reflection process. We show a detailed formalism of taking RE into account in modeling and demonstrate that the PCAR spectrum can be drastically affected by the presence of RE . Experimentally, we have found that not only RE cannot be readily measured or even estimated, it is in fact different for each contact, depending on the contact resistance and whether the contact is near the purely ballistic regime or the purely diffusive regime. A self-consistent process is necessary to analyze the entire PCAR spectrum, properly normalize the conductance, determine RE , and other parameters including the spin polarization and the superconducting gap for each contact. We determine RE for various contacts on specimens with different resistivity and resolve the causes of RE . For contacts close to the diffusive regime, there are two sources of RE : a dominant contribution which is linearly proportional to the total resistance and a constant value from the sample resistance. We also address the effects of additional resistance when PCAR is administered in the ballistic limit and in the diffusive limit. With the proper treatment of the additional resistance, we demonstrate that PCAR can quantitatively extract essential information of spin polarization and superconducting gap.

  10. Reducing of internal resistance lithium ion battery using glucose addition

    NASA Astrophysics Data System (ADS)

    Salim, Andri Pratama; Hafidlullah, Noor; Purwanto, Agus

    2016-02-01

    There are two indicators of battery performance, i.e : capacity and the internal resistance of battery. In this research, the affect of glucose addition to decrease the internal resistance of lithium battery was investigated. The ratio of glucose addition were varied at weight ratio 1%, 3%, and 5% and one mixtures without glucose addition. Lithium ferri phosphate (LiFePO4), polyvinylidene fluoride (PVDF), acetylene black (AB) and glucose were materials that used in this study. Both of mixtures were mixed in the vacuum mixer until became homogeneous. The slurry was coated on an aluminium foil sheet and the coated thickness was 200 µm. The performance of battery lithium was examined by Eight Channel Battery Analyzer and the Internal resistance was examined by Internal Resistance of Battery Meter. The result from all analyzer were showed that the internal resistance reduced as well as the battery capacity. The best internal resistance value is owned by mixtures with 3wt% ratio glucose addition. It has an internal resistance value about 64 miliohm.

  11. Enhancing Plant Disease Resistance without R Genes.

    PubMed

    Sarma, Birinchi Kumar; Singh, Harikesh Bahadur; Fernando, Dilantha; Silva, Roberto Nascimento; Gupta, Vijai Kumar

    2016-07-01

    Crop plants encounter constant biotic challenges, and these challenges have historically been best managed with resistance (R) genes. However, the rapid evolution of new pathogenic strains along with the nonavailability or nonidentification of R genes in cultivated crop species against a large number of plant pathogens have led researchers to think beyond R genes. Biotechnological tools have shown promise in dealing with such challenges. Technologies such as transgenerational plant immunity, interspecies transfer of pattern recognition receptors (PRRs), pathogen-derived resistance (PDR), gene regulation, and expression of antimicrobial peptides (AMPs) in host plants from other plant species have led to enhanced disease resistance and increased food security. PMID:27113633

  12. Detection of integron-associated gene cassettes and other antimicrobial resistance genes in enterotoxigenic Bacteroides fragilis.

    PubMed

    Sarkar, Anirban; Pazhani, Gururaja P; Dharanidharan, Ramamurthy; Ghosh, Amit; Ramamurthy, Thandavarayan

    2015-06-01

    Twenty seven Enterotoxigenic Bacteroides fragilis (ETBF) strains isolated from children in Kolkata, India, were tested for their antimicrobial resistance, presence of integrons and resistance encoding genes. Almost all the strains (>90%) were resistant to two or more antimicrobials. About 59-92% of the strains were resistant to ampicillin, amoxicillin, streptomycin, tetracycline, ciprofloxacin and norfloxacin. Most of these antimicrobial agents have been used in the treatment of diarrhea and other infectious diseases. In addition, about half a number of strains (48-55%) were resistant to clindamycin, cefotaxime, ceftazidime, ampicillin/sulbactam and trimethoprim/sulfamethoxazole. Moxifloxacin and metronidazole resistance ranged from 30 to 40%. All strains however, were found to be susceptible to chloramphenicol and imipenem. Class 1 integrase (intI1) was detected in seven and class 2 integrase (intI2) in one of the twenty seven ETBF strains. Resistance gene cassettes carried by these integrons had different alleles of dfr or aad genes. Beside these integron-borne genes, other genes encoding different antimicrobial resistance were also detected. Resistance genes such as cep(A) and tet(Q) were detected in most of the ETBF strains. To the best of our knowledge, this work constituted the first extensive report from India on the detection of integrons and antimicrobial resistance genes in ETBF. PMID:25634362

  13. Antibiotic resistance genes in freshwater biofilms along a whole river.

    PubMed

    Winkworth, Cynthia L

    2013-06-01

    A key problem challenging public health officials' efforts to stem the spread of antibiotic resistance is the potential increase of resistance in the environment. Yet, despite recent and significant changes to agricultural land in New Zealand, as well as the sector's high antibiotic use, the influence on antibiotic resistance in the environment remained uncharacterised. Spatial and temporal dynamics of antibiotic resistance genes in freshwater biofilms from NZ's fourth longest river as it transitioned between low and high intensity farming were examined for 1 year. Polymerase chain reaction was employed to gauge the level of resistance present. Biofilms were screened for 10 genes conferring resistance to antibiotics used in humans only and both humans and agricultural animals. Three genes were detected, one which conferred resistance to the important human-only use antibiotic vancomycin. Detected at the two downstream sites only, and those subject to the highest combined land-use stressors, the three genes indicated an elevated presence of antibiotic resistance in relation to surrounding land use; 7.7% versus 2% across the whole river system. The detection of a gene conferring resistance to an important human-only use antibiotic was particularly concerning and highlighted human-based contamination sources along the river, in addition to those of agricultural origin.

  14. Characterization of antibiotic-resistance genes in antibiotic resistance Escherichia coli isolates from a lake.

    PubMed

    Wang, Chao; Gu, Xiucong; Zhang, Songhe; Wang, Peifang; Guo, Chuan; Gu, Ju; Hou, Jun

    2013-11-01

    The spread of antibiotic-resistance bacteria and antibiotic-resistance genes (ARGs) has been of concern worldwide. In this study, 114 Escherichia coli isolates were isolated from surface water samples of a lake to identify their susceptibility to antibiotics, including tetracycline (TC), gentamicin (GN), ampicillin (AMP), streptomycin (ST), oxytetracycline (OC), levofloxacin (LEV), nalidixic acid (NA), and sulfamethoxazole/trimethoprim (SFT). Isolates showing resistance to TC, GN, AMP, ST, OC, LEV, NA, and SFT occurred in 50, 76, 68, 71, 55, 32, 82, and 85 % of the total isolates, respectively. Thirty-seven different resistance patterns were identified, and the most abundant resistance profile (28 of 104) was TC/GN/AMP/ST/OC/LEV/NA/SFT. The occurrence of 29 ARGs were detected in their corresponding resistance clones, and 88 % of TC-resistance, 94 % of SFT-resistance, 90 % of AMP-resistance, 78 % of ST-resistance, and 72 % of quinolone-resistance clones can be described by their corresponding ARGs. It should be noted that most of these antibiotic-resistance clones harbored at least two corresponding ARGs, indicating that high frequencies of combined ARGs occurred in these isolates. In addition, 9 new types of DNA sequence of qnr(B) gene were obtained and were clustered into the same group as showed by phylogenetic trees analysis. These results suggest that the development of antibiotic resistance can be ascribed to the high frequency in the recombination of ARGs through horizontal gene transfer.

  15. Enhancement of Corrosion Resistance of Zinc Coatings Using Green Additives

    NASA Astrophysics Data System (ADS)

    Punith Kumar, M. K.; Srivastava, Chandan

    2014-10-01

    In the present work, morphology, microstructure, and electrochemical behavior of Zn coatings containing non-toxic additives have been investigated. Zn coatings were electrodeposited over mild steel substrates using Zn sulphate baths containing four different organic additives: sodium gluconate, dextrose, dextrin, and saccharin. All these additives are "green" and can be derived from food contents. Morphological and structural characterization using electron microscopy, x-ray diffraction, and texture co-efficient analysis revealed an appreciable alteration in the morphology and texture of the deposit depending on the type of additive used in the Zn plating bath. All the Zn coatings, however, were nano-crystalline irrespective of the type of additive used. Polarization and electrochemical impedance spectroscopic analysis, used to investigate the effect of the change in microstructure and morphology on corrosion resistance behavior, illustrated an improved corrosion resistance for Zn deposits obtained from plating bath containing additives as compared to the pure Zn coatings.

  16. Disease Resistance Gene Analogs (RGAs) in Plants

    PubMed Central

    Sekhwal, Manoj Kumar; Li, Pingchuan; Lam, Irene; Wang, Xiue; Cloutier, Sylvie; You, Frank M.

    2015-01-01

    Plants have developed effective mechanisms to recognize and respond to infections caused by pathogens. Plant resistance gene analogs (RGAs), as resistance (R) gene candidates, have conserved domains and motifs that play specific roles in pathogens’ resistance. Well-known RGAs are nucleotide binding site leucine rich repeats, receptor like kinases, and receptor like proteins. Others include pentatricopeptide repeats and apoplastic peroxidases. RGAs can be detected using bioinformatics tools based on their conserved structural features. Thousands of RGAs have been identified from sequenced plant genomes. High-density genome-wide RGA genetic maps are useful for designing diagnostic markers and identifying quantitative trait loci (QTL) or markers associated with plant disease resistance. This review focuses on recent advances in structures and mechanisms of RGAs, and their identification from sequenced genomes using bioinformatics tools. Applications in enhancing fine mapping and cloning of plant disease resistance genes are also discussed. PMID:26287177

  17. Disease Resistance Gene Analogs (RGAs) in Plants.

    PubMed

    Sekhwal, Manoj Kumar; Li, Pingchuan; Lam, Irene; Wang, Xiue; Cloutier, Sylvie; You, Frank M

    2015-01-01

    Plants have developed effective mechanisms to recognize and respond to infections caused by pathogens. Plant resistance gene analogs (RGAs), as resistance (R) gene candidates, have conserved domains and motifs that play specific roles in pathogens' resistance. Well-known RGAs are nucleotide binding site leucine rich repeats, receptor like kinases, and receptor like proteins. Others include pentatricopeptide repeats and apoplastic peroxidases. RGAs can be detected using bioinformatics tools based on their conserved structural features. Thousands of RGAs have been identified from sequenced plant genomes. High-density genome-wide RGA genetic maps are useful for designing diagnostic markers and identifying quantitative trait loci (QTL) or markers associated with plant disease resistance. This review focuses on recent advances in structures and mechanisms of RGAs, and their identification from sequenced genomes using bioinformatics tools. Applications in enhancing fine mapping and cloning of plant disease resistance genes are also discussed.

  18. Acquired Antibiotic Resistance Genes: An Overview

    PubMed Central

    van Hoek, Angela H. A. M.; Mevius, Dik; Guerra, Beatriz; Mullany, Peter; Roberts, Adam Paul; Aarts, Henk J. M.

    2011-01-01

    In this review an overview is given on antibiotic resistance (AR) mechanisms with special attentions to the AR genes described so far preceded by a short introduction on the discovery and mode of action of the different classes of antibiotics. As this review is only dealing with acquired resistance, attention is also paid to mobile genetic elements such as plasmids, transposons, and integrons, which are associated with AR genes, and involved in the dispersal of antimicrobial determinants between different bacteria. PMID:22046172

  19. Antibiotic resistance genes & susceptibility patterns in staphylococci

    PubMed Central

    Duran, Nizami; Ozer, Burcin; Duran, Gulay Gulbol; Onlen, Yusuf; Demir, Cemil

    2012-01-01

    Background & objectives: This study was carried out to evaluate the association between the antibiotic susceptibility patterns and the antibiotic resistance genes in staphylococcal isolates obtained from various clinical samples of patients attending a teaching hospital in Hatay, Turkey. Methods: A total of 298 staphylococci clinical isolates were subjected to antimicrobial susceptibility testing. The genes implicated in resistance to oxacillin (mecA), gentamicin (aac(6’)/aph(2”), aph(3’-IIIa, ant(4’)-Ia), erythromycin (ermA, ermB, ermC, and msrA), tetracyclin (tetK, tetM), and penicillin (blaZ) were amplified using multiplex PCR method. Results: Methicillin resistance rate among 139 Staphlococcus aureus isolates was 16.5 and 25.9 per cent of S. aureus carried mecA gene. Of the 159 CoNS isolates, methicillin resistance rate was 18.9 and 29.6 per cent carried mecA gene. Ninety four isolates identified as gentamicin resistant phenotypically, contained at least one of the gentamicin resistance genes [aac(6’)/aph(2”), aph(3’)-IIIa, ant(4’)-Ia], 17 gentamicin-susceptible isolates were found as positive in terms of one or more resistance genes [aac(6’)/aph(2”), aph(3’)-IIIa, ant(4’)-Ia] by multiplex PCR. A total of 165 isolates were resistant to erythromycin, and contained at least one of the erythromycin resistance genes (ermA, ermB, ermC and msrA). Phenotypically, 106 staphylococcal isolates were resistant to tetracycline, 121 isolates carried either tetK or tetM or both resistance genes. The majority of staphylococci tested possessed the blaZ gene (89.9%). Interpretation & conclusions: The present results showed that the phenotypic antibiotic susceptibility patterns were not similar to those obtained by genotyping done by multiplex PCR. Rapid and reliable methods for antibiotic susceptibility are important to determine the appropriate therapy decisions. Multiplex PCR can be used for confirmation of the results obtained by conventional

  20. Ornamental fish as a source of plasmid-mediated quinolone resistance genes and antibiotic resistance plasmids.

    PubMed

    Dobiasova, Hana; Kutilova, Iva; Piackova, Veronika; Vesely, Tomas; Cizek, Alois; Dolejska, Monika

    2014-07-16

    Growing ornamental fish industry is associated with public health concerns including extensive antibiotic use accompanied by increasing antibiotic resistance. The aim of this study was to analyze Aeromonas isolates from imported tropical ornamental fish and coldwater koi carps bred in the Czech Republic to assess the potential risk of ornamental fish as a source of plasmid-mediated quinolone resistance genes (PMQR) and antibiotic resistance plasmids. A collection of Aeromonas spp. with reduced susceptibility to ciprofloxacin (MIC ≥ 0.05 mg/L) was selected for the detection of PMQR genes. Isolates harbouring PMQR genes were further analyzed for the additional antibiotic resistance, integron content, clonality, biofilm production and transferability of PMQR genes by conjugation and transformation. Comparative analysis of plasmids carrying PMQR genes was performed. Fifteen (19%, n=80) isolates from koi carps and 18 (24%, n=76) isolates from imported ornamental fish were positive for qnrS2, aac(6')-Ib-cr or qnrB17 genes. PMQR-positive isolates from imported ornamental fish showed higher MIC levels to quinolones, multiresistance and diverse content of antibiotic resistance genes and integrons compared to the isolates from the carps. Related IncU plasmids harbouring qnrS2 and aac(6')-Ib-cr genes were found in Aeromonas spp. from imported ornamental fish and koi carps from various geographical areas. Ornamental fish may represent a potential source of multiresistant bacteria and mobile genetic elements for the environment and for humans.

  1. Exploring antibiotic resistance genes and metal resistance genes in plasmid metagenomes from wastewater treatment plants.

    PubMed

    Li, An-Dong; Li, Li-Guan; Zhang, Tong

    2015-01-01

    Plasmids operate as independent genetic elements in microorganism communities. Through horizontal gene transfer (HGT), they can provide their host microorganisms with important functions such as antibiotic resistance and heavy metal resistance. In this study, six metagenomic libraries were constructed with plasmid DNA extracted from influent, activated sludge (AS) and digested sludge (DS) of two wastewater treatment plants (WWTPs). Compared with the metagenomes of the total DNA extracted from the same sectors of the wastewater treatment plant, the plasmid metagenomes had significantly higher annotation rates, indicating that the functional genes on plasmids are commonly shared by those studied microorganisms. Meanwhile, the plasmid metagenomes also encoded many more genes related to defense mechanisms, including ARGs. Searching against an antibiotic resistance genes (ARGs) database and a metal resistance genes (MRGs) database revealed a broad-spectrum of antibiotic (323 out of a total 618 subtypes) and MRGs (23 out of a total 23 types) on these plasmid metagenomes. The influent plasmid metagenomes contained many more resistance genes (both ARGs and MRGs) than the AS and the DS metagenomes. Sixteen novel plasmids with a complete circular structure that carried these resistance genes were assembled from the plasmid metagenomes. The results of this study demonstrated that the plasmids in WWTPs could be important reservoirs for resistance genes, and may play a significant role in the horizontal transfer of these genes. PMID:26441947

  2. Exploring antibiotic resistance genes and metal resistance genes in plasmid metagenomes from wastewater treatment plants

    PubMed Central

    Li, An-Dong; Li, Li-Guan; Zhang, Tong

    2015-01-01

    Plasmids operate as independent genetic elements in microorganism communities. Through horizontal gene transfer (HGT), they can provide their host microorganisms with important functions such as antibiotic resistance and heavy metal resistance. In this study, six metagenomic libraries were constructed with plasmid DNA extracted from influent, activated sludge (AS) and digested sludge (DS) of two wastewater treatment plants (WWTPs). Compared with the metagenomes of the total DNA extracted from the same sectors of the wastewater treatment plant, the plasmid metagenomes had significantly higher annotation rates, indicating that the functional genes on plasmids are commonly shared by those studied microorganisms. Meanwhile, the plasmid metagenomes also encoded many more genes related to defense mechanisms, including ARGs. Searching against an antibiotic resistance genes (ARGs) database and a metal resistance genes (MRGs) database revealed a broad-spectrum of antibiotic (323 out of a total 618 subtypes) and MRGs (23 out of a total 23 types) on these plasmid metagenomes. The influent plasmid metagenomes contained many more resistance genes (both ARGs and MRGs) than the AS and the DS metagenomes. Sixteen novel plasmids with a complete circular structure that carried these resistance genes were assembled from the plasmid metagenomes. The results of this study demonstrated that the plasmids in WWTPs could be important reservoirs for resistance genes, and may play a significant role in the horizontal transfer of these genes. PMID:26441947

  3. Screening and incorporation of rust resistance from Allium cepa into bunching onion (Allium fistulosum) via alien chromosome addition.

    PubMed

    Wako, Tadayuki; Yamashita, Ken-ichiro; Tsukazaki, Hikaru; Ohara, Takayoshi; Kojima, Akio; Yaguchi, Shigenori; Shimazaki, Satoshi; Midorikawa, Naoko; Sakai, Takako; Yamauchi, Naoki; Shigyo, Masayoshi

    2015-04-01

    Bunching onion (Allium fistulosum L.; 2n = 16), bulb onion (Allium cepa L. Common onion group), and shallot (Allium cepa L. Aggregatum group) cultivars were inoculated with rust fungus, Puccinia allii, isolated from bunching onion. Bulb onions and shallots are highly resistant to rust, suggesting they would serve as useful resources for breeding rust resistant bunching onions. To identify the A. cepa chromosome(s) related to rust resistance, a complete set of eight A. fistulosum - shallot monosomic alien addition lines (MAALs) were inoculated with P. allii. At the seedling stage, FF+1A showed a high level of resistance in controlled-environment experiments, suggesting that the genes related to rust resistance could be located on shallot chromosome 1A. While MAAL, multi-chromosome addition line, and hypoallotriploid adult plants did not exhibit strong resistance to rust. In contrast to the high resistance of shallot, the addition line FF+1A+5A showed reproducibly high levels of rust resistance.

  4. Oxidation and sulfidation resistant alloys with silicon additions

    SciTech Connect

    Dunning, John S.; Alman, David E.; Poston, J.A., Jr.; Siriwardane, R.

    2003-01-01

    The Albany Research Center (ARC) has considerable experience in developing lean chromium, austenitic stainless steels with improved high temperature oxidation resistance. Using basic alloy design principles, a baseline composition of Fe-16Cr-16Ni-2Mn-1Mo alloys with Si and Al addition at a maximum of 5 weight percent was selected for potential application at temperatures above 700ºC for supercritical and ultra-supercritical power plant application. The alloys were fully austenitic. Cyclic oxidation tests in air for 1000 hours were carried out on alloys with Si only or combined Si and Al additions in the temperature range 700ºC to 800ºC. Oxidation resistances of alloys with Si only additions were outstanding, particularly at 800ºC (i.e., these alloys possessed weight gains 4 times less than a standard type-304 alloy). In addition, Si alloys pre-oxidized at 800ºC, showed a zero weight gain in subsequent testing for 1000 hours at 700ºC. Similar improvements were observed for Si only alloy after H2S exposure at 700ºC compared with type 304 stainless steel. SEM and ESCA analysis of the oxide films and base material at the oxide/base metal interface were conducted to study potential rate controlling mechanisms at ARC. Depth profile analysis and element concentration profiles (argon ion etching/x-ray photoelectron spectroscopy) were conducted on oxidized specimens and base material at the National Energy Technology Laboratory.

  5. A gene expression signature for insulin resistance.

    PubMed

    Konstantopoulos, Nicky; Foletta, Victoria C; Segal, David H; Shields, Katherine A; Sanigorski, Andrew; Windmill, Kelly; Swinton, Courtney; Connor, Tim; Wanyonyi, Stephen; Dyer, Thomas D; Fahey, Richard P; Watt, Rose A; Curran, Joanne E; Molero, Juan-Carlos; Krippner, Guy; Collier, Greg R; James, David E; Blangero, John; Jowett, Jeremy B; Walder, Ken R

    2011-02-11

    Insulin resistance is a heterogeneous disorder caused by a range of genetic and environmental factors, and we hypothesize that its etiology varies considerably between individuals. This heterogeneity provides significant challenges to the development of effective therapeutic regimes for long-term management of type 2 diabetes. We describe a novel strategy, using large-scale gene expression profiling, to develop a gene expression signature (GES) that reflects the overall state of insulin resistance in cells and patients. The GES was developed from 3T3-L1 adipocytes that were made "insulin resistant" by treatment with tumor necrosis factor-α (TNF-α) and then reversed with aspirin and troglitazone ("resensitized"). The GES consisted of five genes whose expression levels best discriminated between the insulin-resistant and insulin-resensitized states. We then used this GES to screen a compound library for agents that affected the GES genes in 3T3-L1 adipocytes in a way that most closely resembled the changes seen when insulin resistance was successfully reversed with aspirin and troglitazone. This screen identified both known and new insulin-sensitizing compounds including nonsteroidal anti-inflammatory agents, β-adrenergic antagonists, β-lactams, and sodium channel blockers. We tested the biological relevance of this GES in participants in the San Antonio Family Heart Study (n = 1,240) and showed that patients with the lowest GES scores were more insulin resistant (according to HOMA_IR and fasting plasma insulin levels; P < 0.001). These findings show that GES technology can be used for both the discovery of insulin-sensitizing compounds and the characterization of patients into subtypes of insulin resistance according to GES scores, opening the possibility of developing a personalized medicine approach to type 2 diabetes.

  6. Occurrence of antibiotic resistance and characterization of resistant genes and integrons in Enterobacteriaceae isolated from integrated fish farms south China

    USGS Publications Warehouse

    Su, Hao-Chang; Ying, Guang-Guo; Tao, Ran; Zhang, Rui-Quan; Fogarty, Lisa R.; Kolpin, Dana W.

    2011-01-01

    Antibiotics are still widely applied in animal husbandry to prevent diseases and used as feed additives to promote animal growth. This could result in antibiotic resistance to bacteria and antibiotic residues in animals. In this paper, Enterobacteriaceae isolated from four integrated fish farms in Zhongshan, South China were tested for antibiotic resistance, tetracycline resistance genes, sulfonamide resistance genes, and class 1 integrons. The Kirby-Bauer disk diffusion method and polymerase chain reaction (PCR) assays were carried out to test antibiotic susceptibility and resistance genes, respectively. Relatively high antibiotic resistance frequencies were found, especially for ampicillin (80%), tetracycline (52%), and trimethoprim (50%). Out of 203 Enterobacteriaceae isolates, 98.5% were resistant to one or more antibiotics tested. Multiple antibiotic resistance (MAR) was found highest in animal manures with a MAR index of 0.56. Tetracycline resistance genes (tet(A), tet(C)) and sulfonamide resistance genes (sul2) were detected in more than 50% of the isolates. The intI1 gene was found in 170 isolates (83.7%). Both classic and non-classic class 1 integrons were found. Four genes, aadA5, aadA22, dfr2, and dfrA17, were detected. To our knowledge, this is the first report for molecular characterization of antibiotic resistance genes in Enterobacteriaceae isolated from integrated fish farms in China and the first time that gene cassette array dfrA17-aadA5 has been detected in such fish farms. Results of this study indicated that fish farms may be a reservoir of highly diverse and abundant antibiotic resistant genes and gene cassettes. Integrons may play a key role in multiple antibiotic resistances posing potential health risks to the general public and aquaculture.

  7. Replacing and Additive Horizontal Gene Transfer in Streptococcus

    PubMed Central

    Choi, Sang Chul; Rasmussen, Matthew D.; Hubisz, Melissa J.; Gronau, Ilan; Stanhope, Michael J.; Siepel, Adam

    2012-01-01

    The prominent role of Horizontal Gene Transfer (HGT) in the evolution of bacteria is now well documented, but few studies have differentiated between evolutionary events that predominantly cause genes in one lineage to be replaced by homologs from another lineage (“replacing HGT”) and events that result in the addition of substantial new genomic material (“additive HGT”). Here in, we make use of the distinct phylogenetic signatures of replacing and additive HGTs in a genome-wide study of the important human pathogen Streptococcus pyogenes (SPY) and its close relatives S. dysgalactiae subspecies equisimilis (SDE) and S. dysgalactiae subspecies dysgalactiae (SDD). Using recently developed statistical models and computational methods, we find evidence for abundant gene flow of both kinds within each of the SPY and SDE clades and of reduced levels of exchange between SPY and SDD. In addition, our analysis strongly supports a pronounced asymmetry in SPY–SDE gene flow, favoring the SPY-to-SDE direction. This finding is of particular interest in light of the recent increase in virulence of pathogenic SDE. We find much stronger evidence for SPY–SDE gene flow among replacing than among additive transfers, suggesting a primary influence from homologous recombination between co-occurring SPY and SDE cells in human hosts. Putative virulence genes are correlated with transfer events, but this correlation is found to be driven by additive, not replacing, HGTs. The genes affected by additive HGTs are enriched for functions having to do with transposition, recombination, and DNA integration, consistent with previous findings, whereas replacing HGTs seen to influence a more diverse set of genes. Additive transfers are also found to be associated with evidence of positive selection. These findings shed new light on the manner in which HGT has shaped pathogenic bacterial genomes. PMID:22617954

  8. Transposon tagging of disease resistance genes

    SciTech Connect

    Michelmore, R.W. . Dept. of Physics)

    1989-01-01

    We are developing a transposon mutagenesis system for lettuce to clone genes for resistance to the fungal pathogen, Bremia lactucae. Activity of heterologous transposons is being studied in transgenic plants. Southern analysis of T{sub 1} and T{sub 2} plants containing Tam3 from Antirrhinum provided ambiguous results. Multiple endonuclease digests indicated that transposition had occurred; however, in no plant were all endonuclease digests consistent with a simple excision event. Southern or PCR analysis of over 50 plans containing Ac from maize have also failed to reveal clear evidence of transposition; this is contrast to experiments by others with the same constructs who have observed high rates of Ac excision in other plant species. Nearly all of 65 T{sub 2} families containing Ac interrupting a chimeric streptomycin resistance gene (Courtesy J. Jones, Sainsbury Lab., UK) clearly segregated for streptomycin resistance. Southern analyses, however, showed no evidence of transposition, indicating restoration of a functional message by other mechanisms, possibly mRNA processing. Transgenic plants have also been generated containing CaMV 35S or hsp70 promoters fused to transposase coding sequences or a Ds element interrupting a chimeric GUS gene (Courtesy M. Lassner, UC Davis). F{sub 1} plants containing both constructs were analyzed for transposition. Only two plants containing both constructs were obtained from 48 progeny, far fewer than expected, and neither showed evidence of transposition in Southerns and GUS assays. We are currently constructing further chimeric transposase fusions. To test for the stability of the targeted disease resistance genes, 50,000 F{sub 1} plants heterozygous for three resistance genes were generated; no mutants have been identified in the 5000 so far screened.

  9. [Effective prevention through nutritional and food additives: barriers and resistance].

    PubMed

    Lux, R; Walter, U

    2006-06-01

    The population-wide and individual preventive potentials of nutritional and food additives such as vitamins and trace elements are generally accepted in the international literature. Iodisation and fluoridation were and are a main focus of activity. The enrichment of food with folic acid is also partly population-related. Until now, however, the theoretical possibilities of nutritional supplementations have not been fully exploited. Various barriers and resistances arise in programme development and implementation. Interviews with key stakeholders and community groups can clarify decade-long discussions in the literature and the media. The study on hand is based on a structural analysis. It shows the various arguments as well as beneficial and impeding factors for a population-wide prevention programme, for specific target groups and individuals. The findings of this research could also be applied to other Public Health challenges.

  10. Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in ‘Thatcher’ Wheat

    PubMed Central

    Hiebert, Colin W.; Kolmer, James A.; McCartney, Curt A.; Briggs, Jordan; Fetch, Tom; Bariana, Harbans; Choulet, Frederic; Rouse, Matthew N.; Spielmeyer, Wolfgang

    2016-01-01

    Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. ‘Thatcher’ wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in ‘Thatcher’ and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for ‘Thatcher’-derived APR in several environments and this resistance was enhanced in the presence of Lr34. PMID:27309724

  11. Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in 'Thatcher' Wheat.

    PubMed

    Hiebert, Colin W; Kolmer, James A; McCartney, Curt A; Briggs, Jordan; Fetch, Tom; Bariana, Harbans; Choulet, Frederic; Rouse, Matthew N; Spielmeyer, Wolfgang

    2016-01-01

    Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. 'Thatcher' wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in 'Thatcher' and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for 'Thatcher'-derived APR in several environments and this resistance was enhanced in the presence of Lr34.

  12. Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in 'Thatcher' Wheat.

    PubMed

    Hiebert, Colin W; Kolmer, James A; McCartney, Curt A; Briggs, Jordan; Fetch, Tom; Bariana, Harbans; Choulet, Frederic; Rouse, Matthew N; Spielmeyer, Wolfgang

    2016-01-01

    Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. 'Thatcher' wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in 'Thatcher' and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for 'Thatcher'-derived APR in several environments and this resistance was enhanced in the presence of Lr34. PMID:27309724

  13. Functional Metagenome Mining of Soil for a Novel Gentamicin Resistance Gene.

    PubMed

    Im, Hyunjoo; Kim, Kyung Mo; Lee, Sang-Heon; Ryu, Choong-Min

    2016-03-01

    Extensive use of antibiotics over recent decades has led to bacterial resistance against antibiotics, including gentamicin, one of the most effective aminoglycosides. The emergence of resistance is problematic for hospitals, since gentamicin is an important broad-spectrum antibiotic for the control of bacterial pathogens in the clinic. Previous study to identify gentamicin resistance genes from environmental samples have been conducted using culture-dependent screening methods. To overcome these limitations, we employed a metagenome-based culture-independent protocol to identify gentamicin resistance genes. Through functional screening of metagenome libraries derived from soil samples, a fosmid clone was selected as it conferred strong gentamicin resistance. To identify a specific functioning gene conferring gentamicin resistance from a selected fosmid clone (35-40 kb), a shot-gun library was constructed and four shot-gun clones (2-3 kb) were selected. Further characterization of these clones revealed that they contained sequences similar to that of the RNA ligase, T4 rnlA that is known as a toxin gene. The overexpression of the rnlA-like gene in Escherichia coli increased gentamicin resistance, indicating that this toxin gene modulates this trait. The results of our metagenome library analysis suggest that the rnlA-like gene may represent a new class of gentamicin resistance genes in pathogenic bacteria. In addition, we demonstrate that the soil metagenome can provide an important resource for the identification of antibiotic resistance genes, which are valuable molecular targets in efforts to overcome antibiotic resistance. PMID:26699755

  14. Elevating crop disease resistance with cloned genes.

    PubMed

    Jones, Jonathan D G; Witek, Kamil; Verweij, Walter; Jupe, Florian; Cooke, David; Dorling, Stephen; Tomlinson, Laurence; Smoker, Matthew; Perkins, Sara; Foster, Simon

    2014-04-01

    Essentially all plant species exhibit heritable genetic variation for resistance to a variety of plant diseases caused by fungi, bacteria, oomycetes or viruses. Disease losses in crop monocultures are already significant, and would be greater but for applications of disease-controlling agrichemicals. For sustainable intensification of crop production, we argue that disease control should as far as possible be achieved using genetics rather than using costly recurrent chemical sprays. The latter imply CO₂ emissions from diesel fuel and potential soil compaction from tractor journeys. Great progress has been made in the past 25 years in our understanding of the molecular basis of plant disease resistance mechanisms, and of how pathogens circumvent them. These insights can inform more sophisticated approaches to elevating disease resistance in crops that help us tip the evolutionary balance in favour of the crop and away from the pathogen. We illustrate this theme with an account of a genetically modified (GM) blight-resistant potato trial in Norwich, using the Rpi-vnt1.1 gene isolated from a wild relative of potato, Solanum venturii, and introduced by GM methods into the potato variety Desiree. PMID:24535396

  15. Elevating crop disease resistance with cloned genes

    PubMed Central

    Jones, Jonathan D. G.; Witek, Kamil; Verweij, Walter; Jupe, Florian; Cooke, David; Dorling, Stephen; Tomlinson, Laurence; Smoker, Matthew; Perkins, Sara; Foster, Simon

    2014-01-01

    Essentially all plant species exhibit heritable genetic variation for resistance to a variety of plant diseases caused by fungi, bacteria, oomycetes or viruses. Disease losses in crop monocultures are already significant, and would be greater but for applications of disease-controlling agrichemicals. For sustainable intensification of crop production, we argue that disease control should as far as possible be achieved using genetics rather than using costly recurrent chemical sprays. The latter imply CO2 emissions from diesel fuel and potential soil compaction from tractor journeys. Great progress has been made in the past 25 years in our understanding of the molecular basis of plant disease resistance mechanisms, and of how pathogens circumvent them. These insights can inform more sophisticated approaches to elevating disease resistance in crops that help us tip the evolutionary balance in favour of the crop and away from the pathogen. We illustrate this theme with an account of a genetically modified (GM) blight-resistant potato trial in Norwich, using the Rpi-vnt1.1 gene isolated from a wild relative of potato, Solanum venturii, and introduced by GM methods into the potato variety Desiree. PMID:24535396

  16. Antibiotic resistance genes in water environment.

    PubMed

    Zhang, Xu-Xiang; Zhang, Tong; Fang, Herbert H P

    2009-03-01

    The use of antibiotics may accelerate the development of antibiotic resistance genes (ARGs) and bacteria which shade health risks to humans and animals. The emerging of ARGs in the water environment is becoming an increasing worldwide concern. Hundreds of various ARGs encoding resistance to a broad range of antibiotics have been found in microorganisms distributed not only in hospital wastewaters and animal production wastewaters, but also in sewage, wastewater treatment plants, surface water, groundwater, and even in drinking water. This review summarizes recently published information on the types, distributions, and horizontal transfer of ARGs in various aquatic environments, as well as the molecular methods used to detect environmental ARGs, including specific and multiplex PCR (polymerase chain reaction), real-time PCR, DNA sequencing, and hybridization based techniques. PMID:19130050

  17. Clusters of antibiotic resistance genes enriched together stay together in swine agriculture

    DOE PAGES

    Johnson, Timothy A.; Stedtfeld, Robert D.; Wang, Qiong; Cole, James R.; Hashsham, Syed A.; Looft, Torey; Zhu, Yong -Guan; Tiedje, James M.

    2016-04-12

    genes if they are genetically linked. No links to bacterial membership were observed for these clusters of resistance genes. These findings urge deeper understanding of colocalization of resistance genes and mobile genetic elements in resistance islands and their distribution throughout antibiotic-exposed microbiomes. In addition, as governments seek to combat the rise in antibiotic resistance, a balance is sought between ensuring proper animal health and welfare and preserving medically important antibiotics for therapeutic use. Metagenomic and genomic monitoring will be critical to determine if resistance genes can be reduced in animal microbiomes, or if these gene clusters will continue to be coselected by antibiotics not deemed medically important for human health but used for growth promotion or by medically important antibiotics used therapeutically.« less

  18. Transcriptomic analysis of colistin-susceptible and colistin-resistant isolates identifies genes associated with colistin resistance in Acinetobacter baumannii.

    PubMed

    Park, Y K; Lee, J-Y; Ko, K S

    2015-08-01

    The emergence of colistin-resistant Acinetobacter baumannii is concerning, as colistin is often regarded as the last option for treating multidrug-resistant (MDR) A. baumannii infections. Using mRNA sequencing, we compared whole transcriptomes of colistin-susceptible and colistin-resistant A. baumannii strains, with the aim of identifying genes involved in colistin resistance. A clinical colistin-susceptible strain (06AC-179) and a colistin-resistant strain (07AC-052) were analysed in this study. In addition, a colistin-resistant mutant (06AC-179-R1) derived from 06AC-179 was also included in this study. High throughput mRNA sequencing was performed with an Illumina HiSeq TM 2000. In total, six genes were identified as associated with colistin resistance in A. baumannii. These six genes encode PmrAB two-component regulatory enzymes, PmrC (a lipid A phosphoethanolamine transferase), a glycosyltransferase, a poly-β-1,6-N-acetylglucosamine deacetylase, and a putative membrane protein. Matrix-assisted laser desorption/ionization time of flight mass spectrometry revealed that all three colistin-resistant strains used in this study had modified lipid A structure by addition of phosphoethanolamine. As genes found in our results are all associated with either lipopolysaccharide biosynthesis or electrostatic changes in the bacterial cell membrane, lipopolysaccharide modification might be one of the principal modes of acquisition of colistin resistance in some A. baumannii strains.

  19. Recombination Rate Heterogeneity within Arabidopsis Disease Resistance Genes.

    PubMed

    Choi, Kyuha; Reinhard, Carsten; Serra, Heïdi; Ziolkowski, Piotr A; Underwood, Charles J; Zhao, Xiaohui; Hardcastle, Thomas J; Yelina, Nataliya E; Griffin, Catherine; Jackson, Matthew; Mézard, Christine; McVean, Gil; Copenhaver, Gregory P; Henderson, Ian R

    2016-07-01

    Meiotic crossover frequency varies extensively along chromosomes and is typically concentrated in hotspots. As recombination increases genetic diversity, hotspots are predicted to occur at immunity genes, where variation may be beneficial. A major component of plant immunity is recognition of pathogen Avirulence (Avr) effectors by resistance (R) genes that encode NBS-LRR domain proteins. Therefore, we sought to test whether NBS-LRR genes would overlap with meiotic crossover hotspots using experimental genetics in Arabidopsis thaliana. NBS-LRR genes tend to physically cluster in plant genomes; for example, in Arabidopsis most are located in large clusters on the south arms of chromosomes 1 and 5. We experimentally mapped 1,439 crossovers within these clusters and observed NBS-LRR gene associated hotspots, which were also detected as historical hotspots via analysis of linkage disequilibrium. However, we also observed NBS-LRR gene coldspots, which in some cases correlate with structural heterozygosity. To study recombination at the fine-scale we used high-throughput sequencing to analyze ~1,000 crossovers within the RESISTANCE TO ALBUGO CANDIDA1 (RAC1) R gene hotspot. This revealed elevated intragenic crossovers, overlapping nucleosome-occupied exons that encode the TIR, NBS and LRR domains. The highest RAC1 recombination frequency was promoter-proximal and overlapped CTT-repeat DNA sequence motifs, which have previously been associated with plant crossover hotspots. Additionally, we show a significant influence of natural genetic variation on NBS-LRR cluster recombination rates, using crosses between Arabidopsis ecotypes. In conclusion, we show that a subset of NBS-LRR genes are strong hotspots, whereas others are coldspots. This reveals a complex recombination landscape in Arabidopsis NBS-LRR genes, which we propose results from varying coevolutionary pressures exerted by host-pathogen relationships, and is influenced by structural heterozygosity.

  20. Recombination Rate Heterogeneity within Arabidopsis Disease Resistance Genes

    PubMed Central

    Serra, Heïdi; Ziolkowski, Piotr A.; Yelina, Nataliya E.; Jackson, Matthew; Mézard, Christine; McVean, Gil; Henderson, Ian R.

    2016-01-01

    Meiotic crossover frequency varies extensively along chromosomes and is typically concentrated in hotspots. As recombination increases genetic diversity, hotspots are predicted to occur at immunity genes, where variation may be beneficial. A major component of plant immunity is recognition of pathogen Avirulence (Avr) effectors by resistance (R) genes that encode NBS-LRR domain proteins. Therefore, we sought to test whether NBS-LRR genes would overlap with meiotic crossover hotspots using experimental genetics in Arabidopsis thaliana. NBS-LRR genes tend to physically cluster in plant genomes; for example, in Arabidopsis most are located in large clusters on the south arms of chromosomes 1 and 5. We experimentally mapped 1,439 crossovers within these clusters and observed NBS-LRR gene associated hotspots, which were also detected as historical hotspots via analysis of linkage disequilibrium. However, we also observed NBS-LRR gene coldspots, which in some cases correlate with structural heterozygosity. To study recombination at the fine-scale we used high-throughput sequencing to analyze ~1,000 crossovers within the RESISTANCE TO ALBUGO CANDIDA1 (RAC1) R gene hotspot. This revealed elevated intragenic crossovers, overlapping nucleosome-occupied exons that encode the TIR, NBS and LRR domains. The highest RAC1 recombination frequency was promoter-proximal and overlapped CTT-repeat DNA sequence motifs, which have previously been associated with plant crossover hotspots. Additionally, we show a significant influence of natural genetic variation on NBS-LRR cluster recombination rates, using crosses between Arabidopsis ecotypes. In conclusion, we show that a subset of NBS-LRR genes are strong hotspots, whereas others are coldspots. This reveals a complex recombination landscape in Arabidopsis NBS-LRR genes, which we propose results from varying coevolutionary pressures exerted by host-pathogen relationships, and is influenced by structural heterozygosity. PMID:27415776

  1. DNA microarray detection of antimicrobial resistance genes in Detection and Characterization of Antibiotic Resistance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Detection of antimicrobial resistance genes is essential for research and an important tool for clinical diagnostics. Most techniques used to identify resistance genes can only detect one or a few genes per assay, whereas DNA microarray technology can detect thousands of genes in a single assay. Sev...

  2. Genetic characteristics of vancomycin resistance gene cluster in Enterococcus spp.

    PubMed

    Chunhui, Chen; Xiaogang, Xu

    2015-05-01

    Vancomycin resistant enterococci has become an important nosocomial pathogen since it is discovered in late 1980s. The products, encoded by vancomycin resistant gene cluster in enterococci, catalyze the synthesis of peptidoglycan precursors with low affinity with glycopeptide antibiotics including vancomycin and teicoplanin and lead to resistance. These vancomycin resistant gene clusters are classified into nine types according to their gene sequences and organization, or D-Ala:D-Lac (VanA, VanB, VanD and VanM) and D-Ala:D-Ser (VanC, VanE, VanG, VanL and VanN) ligase gene clusters based on the differences of their encoded ligases. Moreover, these gene clusters are characterized by their different resistance levels and infection models. In this review, we summarize the classification, gene organization and infection model of vancomycin resistant gene cluster in Enterococcus spp.

  3. Functional metagenomic analysis reveals rivers are a reservoir for diverse antibiotic resistance genes.

    PubMed

    Amos, G C A; Zhang, L; Hawkey, P M; Gaze, W H; Wellington, E M

    2014-07-16

    The environment harbours a significant diversity of uncultured bacteria and a potential source of novel and extant resistance genes which may recombine with clinically important bacteria disseminated into environmental reservoirs. There is evidence that pollution can select for resistance due to the aggregation of adaptive genes on mobile elements. The aim of this study was to establish the impact of waste water treatment plant (WWTP) effluent disposal to a river by using culture independent methods to study diversity of resistance genes downstream of the WWTP in comparison to upstream. Metagenomic libraries were constructed in Escherichia coli and screened for phenotypic resistance to amikacin, gentamicin, neomycin, ampicillin and ciprofloxacin. Resistance genes were identified by using transposon mutagenesis. A significant increase downstream of the WWTP was observed in the number of phenotypic resistant clones recovered in metagenomic libraries. Common β-lactamases such as blaTEM were recovered as well as a diverse range of acetyltransferases and unusual transporter genes, with evidence for newly emerging resistance mechanisms. The similarities of the predicted proteins to known sequences suggested origins of genes from a very diverse range of bacteria. The study suggests that waste water disposal increases the reservoir of resistance mechanisms in the environment either by addition of resistance genes or by input of agents selective for resistant phenotypes.

  4. No fitness cost of glyphosate resistance endowed by massive EPSPS gene amplification in Amaranthus palmeri.

    PubMed

    Vila-Aiub, Martin M; Goh, Sou S; Gaines, Todd A; Han, Heping; Busi, Roberto; Yu, Qin; Powles, Stephen B

    2014-04-01

    Amplification of the EPSPS gene has been previously identified as the glyphosate resistance mechanism in many populations of Amaranthus palmeri, a major weed pest in US agriculture. Here, we evaluate the effects of EPSPS gene amplification on both the level of glyphosate resistance and fitness cost of resistance. A. palmeri individuals resistant to glyphosate by expressing a wide range of EPSPS gene copy numbers were evaluated under competitive conditions in the presence or absence of glyphosate. Survival rates to glyphosate and fitness traits of plants under intra-specific competition were assessed. Plants with higher amplification of the EPSPS gene (53-fold) showed high levels of glyphosate resistance, whereas less amplification of the EPSPS gene (21-fold) endowed a lower level of glyphosate resistance. Without glyphosate but under competitive conditions, plants exhibiting up to 76-fold EPSPS gene amplification exhibited similar height, and biomass allocation to vegetative and reproductive organs, compared to glyphosate susceptible A. palmeri plants with no amplification of the EPSPS gene. Both the additive effects of EPSPS gene amplification on the level of glyphosate resistance and the lack of associated fitness costs are key factors contributing to EPSPS gene amplification as a widespread and important glyphosate resistance mechanism likely to become much more evident in weed plant species.

  5. Major gene for field stem rust resistance co-locates with resistance gene Sr12 in "Thatcher" wheat

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effecting stem rust resistance genes. "Thatcher" wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was ...

  6. Tantalum Addition to Zirconium Diboride for Improved Oxidation Resistance

    NASA Technical Reports Server (NTRS)

    Levine, Stanley R.; Opila, Eliizabeth J.

    2003-01-01

    Ultrahigh temperature ceramics have performed unreliably due to material flaws and attachment design. These deficiencies are brought to the fore by the low fracture toughness and thermal shock resistance of UHTCs. If these deficiencies are overcome, we are still faced with poor oxidation resistance as a limitation on UHTC applicability to reusable launch vehicles. We have been addressing the deficiencies of UHTCs with our focus on composite constructions and functional grading to address the mechanical issues, and on composition modification to address the oxidation issue. The approaches and progress toward the latter are reported.

  7. Additive functions in boolean models of gene regulatory network modules.

    PubMed

    Darabos, Christian; Di Cunto, Ferdinando; Tomassini, Marco; Moore, Jason H; Provero, Paolo; Giacobini, Mario

    2011-01-01

    Gene-on-gene regulations are key components of every living organism. Dynamical abstract models of genetic regulatory networks help explain the genome's evolvability and robustness. These properties can be attributed to the structural topology of the graph formed by genes, as vertices, and regulatory interactions, as edges. Moreover, the actual gene interaction of each gene is believed to play a key role in the stability of the structure. With advances in biology, some effort was deployed to develop update functions in boolean models that include recent knowledge. We combine real-life gene interaction networks with novel update functions in a boolean model. We use two sub-networks of biological organisms, the yeast cell-cycle and the mouse embryonic stem cell, as topological support for our system. On these structures, we substitute the original random update functions by a novel threshold-based dynamic function in which the promoting and repressing effect of each interaction is considered. We use a third real-life regulatory network, along with its inferred boolean update functions to validate the proposed update function. Results of this validation hint to increased biological plausibility of the threshold-based function. To investigate the dynamical behavior of this new model, we visualized the phase transition between order and chaos into the critical regime using Derrida plots. We complement the qualitative nature of Derrida plots with an alternative measure, the criticality distance, that also allows to discriminate between regimes in a quantitative way. Simulation on both real-life genetic regulatory networks show that there exists a set of parameters that allows the systems to operate in the critical region. This new model includes experimentally derived biological information and recent discoveries, which makes it potentially useful to guide experimental research. The update function confers additional realism to the model, while reducing the complexity

  8. Additive Functions in Boolean Models of Gene Regulatory Network Modules

    PubMed Central

    Darabos, Christian; Di Cunto, Ferdinando; Tomassini, Marco; Moore, Jason H.; Provero, Paolo; Giacobini, Mario

    2011-01-01

    Gene-on-gene regulations are key components of every living organism. Dynamical abstract models of genetic regulatory networks help explain the genome's evolvability and robustness. These properties can be attributed to the structural topology of the graph formed by genes, as vertices, and regulatory interactions, as edges. Moreover, the actual gene interaction of each gene is believed to play a key role in the stability of the structure. With advances in biology, some effort was deployed to develop update functions in Boolean models that include recent knowledge. We combine real-life gene interaction networks with novel update functions in a Boolean model. We use two sub-networks of biological organisms, the yeast cell-cycle and the mouse embryonic stem cell, as topological support for our system. On these structures, we substitute the original random update functions by a novel threshold-based dynamic function in which the promoting and repressing effect of each interaction is considered. We use a third real-life regulatory network, along with its inferred Boolean update functions to validate the proposed update function. Results of this validation hint to increased biological plausibility of the threshold-based function. To investigate the dynamical behavior of this new model, we visualized the phase transition between order and chaos into the critical regime using Derrida plots. We complement the qualitative nature of Derrida plots with an alternative measure, the criticality distance, that also allows to discriminate between regimes in a quantitative way. Simulation on both real-life genetic regulatory networks show that there exists a set of parameters that allows the systems to operate in the critical region. This new model includes experimentally derived biological information and recent discoveries, which makes it potentially useful to guide experimental research. The update function confers additional realism to the model, while reducing the complexity

  9. Antibiotic resistance gene discovery in food-producing animals

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Numerous environmental reservoirs contribute to the widespread antibiotic resistance problem in human pathogens. One environmental reservoir of particular importance is the intestinal bacteria of food-producing animals. In this review I examine recent discoveries of antibiotic resistance genes in ...

  10. Dominant gene for rust resistance in pearl millet

    SciTech Connect

    Hanna, W.W.; Wells, H.D.; Burton, G.W.

    1985-01-01

    Rust (Puccinia substriata var. indica) resistance was discovered in three Pennisetum americanum (L.) Leeke subspecies monodii (Maire) Brunken accessions from Senegal. Resistant plant were free of rust, although the bottom one or two leaves of some plants did develop a brown discoloration without pustules. Resistance was controlled by a dominant gene assigned the gene symbol Rr1. Backcrossing has been effective in transferring resistance from the wild grassy, monodii to cultivated pearl millet. The Rr1 gene should be useful in the production of rust resistant pearl millet hybrids and cultivars. 6 references, 1 table.

  11. Gene expression profiling and identification of resistance genes to Aspergillus flavus infection in peanut through EST and microarray strategies.

    PubMed

    Guo, Baozhu; Fedorova, Natalie D; Chen, Xiaoping; Wan, Chun-Hua; Wang, Wei; Nierman, William C; Bhatnagar, Deepak; Yu, Jiujiang

    2011-07-01

    Aspergillus flavus and A. parasiticus infect peanut seeds and produce aflatoxins, which are associated with various diseases in domestic animals and humans throughout the world. The most cost-effective strategy to minimize aflatoxin contamination involves the development of peanut cultivars that are resistant to fungal infection and/or aflatoxin production. To identify peanut Aspergillus-interactive and peanut Aspergillus-resistance genes, we carried out a large scale peanut Expressed Sequence Tag (EST) project which we used to construct a peanut glass slide oligonucleotide microarray. The fabricated microarray represents over 40% of the protein coding genes in the peanut genome. For expression profiling, resistant and susceptible peanut cultivars were infected with a mixture of Aspergillusflavus and parasiticus spores. The subsequent microarray analysis identified 62 genes in resistant cultivars that were up-expressed in response to Aspergillus infection. In addition, we identified 22 putative Aspergillus-resistance genes that were constitutively up-expressed in the resistant cultivar in comparison to the susceptible cultivar. Some of these genes were homologous to peanut, corn, and soybean genes that were previously shown to confer resistance to fungal infection. This study is a first step towards a comprehensive genome-scale platform for developing Aspergillus-resistant peanut cultivars through targeted marker-assisted breeding and genetic engineering. PMID:22069737

  12. [Identification of Sorghum genes responsible for resistance to Green bug].

    PubMed

    Radchenko, E E

    2000-04-01

    Genes responsible for resistance to greenbug (Schizaphis graminum Rond.) were identified in sorghum. The dominant (Sgr1) and recessive (Sgr2) genes for resistance were revealed in sample k-457 (PI264453, United States). The samples i-589430 (PI264453, Spain) and k-3852 (Sarvasi, Hungary) carry gene Sgr1. These accessions are assumed to also have gene Sgr2. The samples k-9921 (Shallu, United States) and k-9922 (KS-30, United States) have incompletely dominant resistance gene Sgr3. A symbol Sgr4 was assigned to the dominant gene from sample k-6694 (Deer, United States). The dominant Sgr5 and recessive Sgr6 genes were revealed in the samples k-1362 (Durra Belaya, Syria) and k-1240 (Dzhugara Belaya, China). The cultivar Sorgogradskoe (k-9436, Rostovskaya oblast) has gene Sgr5. The samples k-10092 (Odesskii 360, Ukraine) and k-5091 (Cherhata, Marocco) are assumed to have genes Sgr5 and Sgr6. Sample k-924 (Dzhugara Belaya, China) is protected by the dominant gene Srg7 and recessive gene Sgr8. Sample k-923 (Dzhugara Belaya, China) has at least one of these genes. Two dominant complementary genes for resistance (Sgr9 and Sgr10) were revealed in sample k-930 (Dzhugara Belaya, China). One of two dominant genes of sample k-1237 (Dzhugara Belaya, China) was assigned the symbol Sgr11. Genes Sgr5-Sgr11 responsible for resistance to greenbug are new and were not previously used in breeding. PMID:10822813

  13. IS26-Mediated Formation of Transposons Carrying Antibiotic Resistance Genes.

    PubMed

    Harmer, Christopher J; Hall, Ruth M

    2016-01-01

    The IS26 transposase, Tnp26, catalyzes IS26 movement to a new site and deletion or inversion of adjacent DNA via a replicative route. The intramolecular deletion reaction produces a circular molecule consisting of a DNA segment and a single IS26, which we call a translocatable unit or TU. Recently, Tnp26 was shown to catalyze an additional intermolecular, conservative reaction between two preexisting copies of IS26 in different plasmids. Here, we have investigated the relative contributions of homologous recombination and Tnp26-catalyzed reactions to the generation of a transposon from a TU. Circular TUs containing the aphA1a kanamycin and neomycin resistance gene or the tet(D) tetracycline resistance determinant were generated in vitro and transformed into Escherichia coli recA cells carrying R388::IS26. The TU incorporated next to the IS26 in R388::IS26 forms a transposon with the insertion sequence (IS) in direct orientation. Introduction of a second TU produced regions containing both the aphA1a gene and the tet(D) determinant in either order but with only three copies of IS26. The integration reaction, which required a preexisting IS26, was precise and conservative and was 50-fold more efficient when both IS26 copies could produce an active Tnp26. When both ISs were inactivated by a frameshift in tnp26, TU incorporation was not detected in E. coli recA cells, but it did occur in E. coli recA (+) cells. However, the Tnp-catalyzed reaction was 100-fold more efficient than RecA-dependent homologous recombination. The ability of Tnp26 to function in either a replicative or conservative mode is likely to explain the prominence of IS26-bounded transposons in the resistance regions found in Gram-negative bacteria. IMPORTANCE In Gram-negative bacteria, IS26 recruits antibiotic resistance genes into the mobile gene pool by forming transposons carrying many different resistance genes. In addition to replicative transposition, IS26 was recently shown to use a novel

  14. High-Copy Overexpression Screening Reveals PDR5 as the Main Doxorubicin Resistance Gene in Yeast

    PubMed Central

    Demir, Ayse Banu; Koc, Ahmet

    2015-01-01

    Doxorubicin is one of the most potent anticancer drugs used in the treatment of various cancer types. The efficacy of doxorubicin is influenced by the drug resistance mechanisms and its cytotoxicity. In this study, we performed a high-copy screening analysis to find genes that play a role in doxorubicin resistance and found several genes (CUE5, AKL1, CAN1, YHR177W and PDR5) that provide resistance. Among these genes, overexpression of PDR5 provided a remarkable resistance, and deletion of it significantly rendered the tolerance level for the drug. Q-PCR analyses suggested that transcriptional regulation of these genes was not dependent on doxorubicin treatment. Additionally, we profiled the global expression pattern of cells in response to doxorubicin treatment and highlighted the genes and pathways that are important in doxorubicin tolerance/toxicity. Our results suggest that many efflux pumps and DNA metabolism genes are upregulated by the drug and required for doxorubicin tolerance. PMID:26690737

  15. Transport and transformation of genetic information in the critical zone: The case of antibiotic resistance genes

    NASA Astrophysics Data System (ADS)

    Zhu, Y. G.

    2015-12-01

    In addition to material and energy flows, the dynamics and functions of the Earth's critical zone are intensively mediated by biological actions performed by diverse organisms. These biological actions are modulated by the expression of functional genes and their translation into enzymes that catalyze geochemical reactions, such as nutrient turnover and pollutant biodegradation. Although geobiology, as an interdisciplinary research area, is playing and vital role in linking biological and geochemical processes at different temporal and spatial scales, the distribution and transport of functional genes have rarely been investigated from the Earth's critical zone perspectives. To illustrate the framework of studies on the transport and transformation of genetic information in the critical zone, antibiotic resistance is taken as an example. Antibiotic resistance genes are considered as a group of emerging contaminants, and their emergence and spread within the critical zone on one hand are induced by anthropogenic activities, and on other hand are threatening human health worldwide. The transport and transformation of antibiotic resistance genes are controlled by both horizontal gene transfer between bacterial cells and the movement of bacteria harboring antibiotic resistance genes. In this paper, the fate and behavior of antibiotic resistance genes will be discussed in the following aspects: 1) general overview of environmental antibiotic resistance; 2) high through quantification of the resistome in various environmental media; 3) pathways of resistance gene flow within the critical zone; and 4) potential strategies in mitigating antibiotic resistance, particularly from the critical zone perspectives.

  16. Discovery of genes related to formothion resistance in oriental fruit fly (Bactrocera dorsalis) by a constrained functional genomics analysis.

    PubMed

    Kuo, T C-Y; Hu, C-C; Chien, T-Y; Chen, M J M; Feng, H-T; Chen, L-F O; Chen, C-Y; Hsu, J-C

    2015-06-01

    Artificial selection can provide insights into how insecticide resistance mechanisms evolve in populations. The underlying basis of such phenomena can involve complex interactions of multiple genes, and the resolution of this complexity first necessitates confirmation that specific genes are involved in resistance mechanisms. Here, we used a novel approach invoking a constrained RNA sequencing analysis to refine the discovery of specific genes involved in insecticide resistance. Specifically, for gene discovery, an additional constraint was added to the traditional comparisons of susceptible vs. resistant flies by the incorporation of a line in which insecticide susceptibility was 'recovered' within a resistant line by the removal of insecticide stress. In our analysis, the criterion for the classification of any gene as related to insecticide resistance was based on evidence for differential expression in the resistant line as compared with both the susceptible and recovered lines. The incorporation of this additional constraint reduced the number of differentially expressed genes putatively involved in resistance to 464, compared with more than 1000 that had been identified previously using this same species. In addition, our analysis identified several key genes involved in metabolic detoxification processes that showed up-regulated expression. Furthermore, the involvement of acetylcholinesterase, a known target for modification in insecticide resistance, was associated with three key nonsynonymous amino acid substitutions within our data. In conclusion, the incorporation of an additional constraint using a 'recovered' line for gene discovery provides a higher degree of confidence in genes identified to be involved in insecticide resistance phenomena.

  17. Antibiotic resistance gene discovery in food-producing animals.

    PubMed

    Allen, Heather K

    2014-06-01

    Numerous environmental reservoirs contribute to the widespread antibiotic resistance problem in human pathogens. One environmental reservoir of particular importance is the intestinal bacteria of food-producing animals. In this review I examine recent discoveries of antibiotic resistance genes in agricultural animals. Two types of antibiotic resistance gene discoveries will be discussed: the use of classic microbiological and molecular techniques, such as culturing and PCR, to identify known genes not previously reported in animals; and the application of high-throughput technologies, such as metagenomics, to identify novel genes and gene transfer mechanisms. These discoveries confirm that antibiotics should be limited to prudent uses.

  18. Tetracycline resistance and Class 1 integron genes associated with indoor and outdoor aerosols.

    PubMed

    Ling, Alison L; Pace, Norman R; Hernandez, Mark T; LaPara, Timothy M

    2013-05-01

    Genes encoding tetracycline resistance and the integrase of Class 1 integrons were enumerated using quantitative PCR from aerosols collected from indoor and outdoor environments. Concentrated animal feeding operations (CAFOs) and human-occupied indoor environments (two clinics and a homeless shelter) were found to be a source of airborne tet(X) and tet(W) genes. The CAFOs had 10- to 100-times higher concentrations of airborne 16S rRNA, tet(X), and tet(W) genes than other environments sampled, and increased concentrations of aerosolized bacteria correlated with increased concentrations of airborne resistance genes. The two CAFOs studied had statistically similar concentrations of resistance genes in their aerosol samples, even though antibiotic use was markedly different between the two operations. Additionally, tet(W) genes were recovered in outdoor air within 2 km of livestock operations, which suggests that antibiotic resistance genes may be transported via aerosols on local scales. The integrase gene (intI1) from Class 1 integrons, which has been associated with multidrug resistance, was detected in CAFOs but not in human-occupied indoor environments, suggesting that CAFO aerosols could serve as a reservoir of multidrug resistance. In conclusion, our results show that CAFOs and clinics are sources of aerosolized antibiotic resistance genes that can potentially be transported via air movement. PMID:23517146

  19. Erythromycin resistance genes in group A streptococci in Finland. The Finnish Study Group for Antimicrobial Resistance.

    PubMed

    Kataja, J; Huovinen, P; Skurnik, M; Seppälä, H

    1999-01-01

    Streptococcus pyogenes isolates (group A streptococcus) of different erythromycin resistance phenotypes were collected from all over Finland in 1994 and 1995 and studied; they were evaluated for their susceptibilities to 14 antimicrobial agents (396 isolates) and the presence of different erythromycin resistance genes (45 isolates). The erythromycin-resistant isolates with the macrolide-resistant but lincosamide- and streptogramin B-susceptible phenotype (M phenotype) were further studied for their plasmid contents and the transferability of resistance genes. Resistance to antimicrobial agents other than macrolides, clindamycin, tetracycline, and chloramphenicol was not found. When compared to our previous study performed in 1990, the rate of resistance to tetracycline increased from 10 to 93% among isolates with the inducible resistance (IR) phenotype of macrolide, lincosamide, and streptogramin B (MLSB) resistance. Tetracycline resistance was also found among 75% of the MLSB-resistant isolates with the constitutive resistance (CR) phenotype. Resistance to chloramphenicol was found for the first time in S. pyogenes in Finland; 3% of the isolates with the IR phenotype were resistant. All the chloramphenicol-resistant isolates were also resistant to tetracycline. Detection of erythromycin resistance genes by PCR indicated that, with the exception of one isolate with the CR phenotype, all M-phenotype isolates had the macrolide efflux (mefA) gene and all the MLSB-resistant isolates had the erythromycin resistance methylase (ermTR) gene; the isolate with the CR phenotype contained the ermB gene. No plasmid DNA could be isolated from the M-phenotype isolates, but the mefA gene was transferred by conjugation.

  20. Screening and incorporation of rust resistance from Allium cepa into bunching onion (Allium fistulosum) via alien chromosome addition.

    PubMed

    Wako, Tadayuki; Yamashita, Ken-ichiro; Tsukazaki, Hikaru; Ohara, Takayoshi; Kojima, Akio; Yaguchi, Shigenori; Shimazaki, Satoshi; Midorikawa, Naoko; Sakai, Takako; Yamauchi, Naoki; Shigyo, Masayoshi

    2015-04-01

    Bunching onion (Allium fistulosum L.; 2n = 16), bulb onion (Allium cepa L. Common onion group), and shallot (Allium cepa L. Aggregatum group) cultivars were inoculated with rust fungus, Puccinia allii, isolated from bunching onion. Bulb onions and shallots are highly resistant to rust, suggesting they would serve as useful resources for breeding rust resistant bunching onions. To identify the A. cepa chromosome(s) related to rust resistance, a complete set of eight A. fistulosum - shallot monosomic alien addition lines (MAALs) were inoculated with P. allii. At the seedling stage, FF+1A showed a high level of resistance in controlled-environment experiments, suggesting that the genes related to rust resistance could be located on shallot chromosome 1A. While MAAL, multi-chromosome addition line, and hypoallotriploid adult plants did not exhibit strong resistance to rust. In contrast to the high resistance of shallot, the addition line FF+1A+5A showed reproducibly high levels of rust resistance. PMID:26218854

  1. What is a resistance gene? Ranking risk in resistomes.

    PubMed

    Martínez, José L; Coque, Teresa M; Baquero, Fernando

    2015-02-01

    Metagenomic studies have shown that antibiotic resistance genes are ubiquitous in the environment, which has led to the suggestion that there is a high risk that these genes will spread to bacteria that cause human infections. If this is true, estimating the real risk of dissemination of resistance genes from environmental reservoirs to human pathogens is therefore very difficult. In this Opinion article, we analyse the current definitions of antibiotic resistance and antibiotic resistance genes, and we describe the bottlenecks that affect the transfer of antibiotic resistance genes to human pathogens. We propose rules for estimating the risks associated with genes that are present in environmental resistomes by evaluating the likelihood of their introduction into human pathogens, and the consequences of such events for the treatment of infections.

  2. The Ocean as a Global Reservoir of Antibiotic Resistance Genes

    PubMed Central

    Hatosy, Stephen M.

    2015-01-01

    Recent studies of natural environments have revealed vast genetic reservoirs of antibiotic resistance (AR) genes. Soil bacteria and human pathogens share AR genes, and AR genes have been discovered in a variety of habitats. However, there is little knowledge about the presence and diversity of AR genes in marine environments and which organisms host AR genes. To address this, we identified the diversity of genes conferring resistance to ampicillin, tetracycline, nitrofurantoin, and sulfadimethoxine in diverse marine environments using functional metagenomics (the cloning and screening of random DNA fragments). Marine environments were host to a diversity of AR-conferring genes. Antibiotic-resistant clones were found at all sites, with 28% of the genes identified as known AR genes (encoding beta-lactamases, bicyclomycin resistance pumps, etc.). However, the majority of AR genes were not previously classified as such but had products similar to proteins such as transport pumps, oxidoreductases, and hydrolases. Furthermore, 44% of the genes conferring antibiotic resistance were found in abundant marine taxa (e.g., Pelagibacter, Prochlorococcus, and Vibrio). Therefore, we uncovered a previously unknown diversity of genes that conferred an AR phenotype among marine environments, which makes the ocean a global reservoir of both clinically relevant and potentially novel AR genes. PMID:26296734

  3. Identification of I-7 expands the repertoire of genes for resistance to Fusarium wilt in tomato to three resistance gene classes.

    PubMed

    Gonzalez-Cendales, Yvonne; Catanzariti, Ann-Maree; Baker, Barbara; Mcgrath, Des J; Jones, David A

    2016-04-01

    The tomato I-3 and I-7 genes confer resistance to Fusarium oxysporum f. sp. lycopersici (Fol) race 3 and were introgressed into the cultivated tomato, Solanum lycopersicum, from the wild relative Solanum pennellii. I-3 has been identified previously on chromosome 7 and encodes an S-receptor-like kinase, but little is known about I-7. Molecular markers have been developed for the marker-assisted breeding of I-3, but none are available for I-7. We used an RNA-seq and single nucleotide polymorphism (SNP) analysis approach to map I-7 to a small introgression of S. pennellii DNA (c. 210 kb) on chromosome 8, and identified I-7 as a gene encoding a leucine-rich repeat receptor-like protein (LRR-RLP), thereby expanding the repertoire of resistance protein classes conferring resistance to Fol. Using an eds1 mutant of tomato, we showed that I-7, like many other LRR-RLPs conferring pathogen resistance in tomato, is EDS1 (Enhanced Disease Susceptibility 1) dependent. Using transgenic tomato plants carrying only the I-7 gene for Fol resistance, we found that I-7 also confers resistance to Fol races 1 and 2. Given that Fol race 1 carries Avr1, resistance to Fol race 1 indicates that I-7-mediated resistance, unlike I-2- or I-3-mediated resistance, is not suppressed by Avr1. This suggests that Avr1 is not a general suppressor of Fol resistance in tomato, leading us to hypothesize that Avr1 may be acting against an EDS1-independent pathway for resistance activation. The identification of I-7 has allowed us to develop molecular markers for marker-assisted breeding of both genes currently known to confer Fol race 3 resistance (I-3 and I-7). Given that I-7-mediated resistance is not suppressed by Avr1, I-7 may be a useful addition to I-3 in the tomato breeder's toolbox.

  4. The tomato I-3 gene: a novel gene for resistance to Fusarium wilt disease.

    PubMed

    Catanzariti, Ann-Maree; Lim, Ginny T T; Jones, David A

    2015-07-01

    Plant resistance proteins provide race-specific immunity through the recognition of pathogen effectors. The resistance genes I, I-2 and I-3 have been incorporated into cultivated tomato (Solanum lycopersicum) from wild tomato species to confer resistance against Fusarium oxysporum f. sp. lycopersici (Fol) races 1, 2 and 3, respectively. Although the Fol effectors corresponding to these resistance genes have all been identified, only the I-2 resistance gene has been isolated from tomato. To isolate the I-3 resistance gene, we employed a map-based cloning approach and used transgenic complementation to test candidate genes for resistance to Fol race 3. Here, we describe the fine mapping and sequencing of genes at the I-3 locus, which revealed a family of S-receptor-like kinase (SRLK) genes. Transgenic tomato lines were generated with three of these SRLK genes and one was found to confer Avr3-dependent resistance to Fol race 3, confirming it to be I-3. The finding that I-3 encodes an SRLK reveals a new pathway for Fol resistance and a new class of resistance genes, of which Pi-d2 from rice is also a member. The identification of I-3 also allows the investigation of the complex effector-resistance protein interaction involving Avr1-mediated suppression of I-2- and I-3-dependent resistance in tomato.

  5. Antimicrobial resistance gene distribution: a socioeconomic and sociocultural perspective

    PubMed Central

    Ojo, Kayode K.; Sapkota, Amy R.; Ojo, Tokunbo B.; Pottinger, Paul S.

    2008-01-01

    The appearance of resistance to many first-line antimicrobial agents presents a critical challenge to the successful treatment of bacterial infections. Antimicrobial resistant bacteria and resistance genes are globally distributed, but significant variations in prevalence have been observed in different geographical regions. This article discusses possible relationships between socioeconomic and sociocultural factors and regional differences in the prevalence of antibiotic-resistant bacteria and their associated resistance genes. Findings indicate that the few studies that have been conducted to understand relationships between socioeconomic and sociocultural factors and antimicrobial resistance have focused on patterns of phenotypic antibiotic resistance. Yet, a critical need exists for molecular studies of human influences on bacterial resistance and adaptation. We propose that the results of these studies, coupled with well-coordinated culturally appropriate interventions that address specific socioeconomic and sociocultural needs may be necessary to reduce the scourge of antimicrobial resistance in both developing and developed countries. PMID:20204098

  6. Methods for detecting additional genes underlying Alzheimer disease

    SciTech Connect

    Locke, P.A.; Haines, J.L.; Ter-Minassian, M.

    1994-09-01

    Alzheimer`s disease (AD) is a complex inherited disorder with proven genetic heterogeneity. To date, genes on chromosome 21 (APP) and 14 (not yet identified) are associated with early-onset familial AD, while the APOE gene on chromosome 19 is associated with both late onset familial and sporadic AD and early onset sporadic AD. Although these genes likely account for the majority of AD, many familial cases cannot be traced to any of these genes. From a set of 127 late-onset multiplex families screened for APOE, 43 (34%) families have at least one affected individual with no APOE-4 allele, suggesting an alternative genetic etiology. Simulation studies indicated that additional loci could be identified through a genomic screen with a 10 cM sieve on a subset of 21 well documented, non-APOE-4 families. Given the uncertainties in the mode of inheritance, reliance on a single analytical method could result in a missed linkage. Therefore, we have developed a strategy of using multiple overlapping yet complementary methods to detect linkage. These include sib-pair analysis and affected-pedigree-member analysis, neither of which makes assumptions about mode of inheritance, and lod score analysis (using two predefined genetic models). In order for a marker to qualify for follow-up, it must fit at least two of three criteria. These are nominal P values of 0.05 or less for the non-parametric methods, and/or a lod score greater than 1.0. Adjacent markers each fulfilling a single criterion also warrant follow-up. To date, we have screened 61 markers on chromosomes 1, 2, 3, 18, 19, 21, and 22. One marker, D2S163, generated a lod score of 1.06 ({theta} = 0.15) and an APMT statistic of 3.68 (P < 0.001). This region is currently being investigated in more detail. Updated results of this region plus additional screening data will be presented.

  7. Ancient hot and cold genes and chemotherapy resistance emergence

    PubMed Central

    Wu, Amy; Zhang, Qiucen; Lambert, Guillaume; Khin, Zayar; Gatenby, Robert A.; Kim, Hyunsung John; Pourmand, Nader; Bussey, Kimberly; Davies, Paul C. W.; Sturm, James C.; Austin, Robert H.

    2015-01-01

    We use a microfabricated ecology with a doxorubicin gradient and population fragmentation to produce a strong Darwinian selective pressure that drives forward the rapid emergence of doxorubicin resistance in multiple myeloma (MM) cancer cells. RNA sequencing of the resistant cells was used to examine (i) emergence of genes with high de novo substitution densities (i.e., hot genes) and (ii) genes never substituted (i.e., cold genes). The set of cold genes, which were 21% of the genes sequenced, were further winnowed down by examining excess expression levels. Both the most highly substituted genes and the most highly expressed never-substituted genes were biased in age toward the most ancient of genes. This would support the model that cancer represents a revision back to ancient forms of life adapted to high fitness under extreme stress, and suggests that these ancient genes may be targets for cancer therapy. PMID:26240372

  8. Integration and bioinformatics analysis of DNA-methylated genes associated with drug resistance in ovarian cancer

    PubMed Central

    YAN, BINGBING; YIN, FUQIANG; WANG, QI; ZHANG, WEI; LI, LI

    2016-01-01

    The main obstacle to the successful treatment of ovarian cancer is the development of drug resistance to combined chemotherapy. Among all the factors associated with drug resistance, DNA methylation apparently plays a critical role. In this study, we performed an integrative analysis of the 26 DNA-methylated genes associated with drug resistance in ovarian cancer, and the genes were further evaluated by comprehensive bioinformatics analysis including gene/protein interaction, biological process enrichment and annotation. The results from the protein interaction analyses revealed that at least 20 of these 26 methylated genes are present in the protein interaction network, indicating that they interact with each other, have a correlation in function, and may participate as a whole in the regulation of ovarian cancer drug resistance. There is a direct interaction between the phosphatase and tensin homolog (PTEN) gene and at least half of the other genes, indicating that PTEN may possess core regulatory functions among these genes. Biological process enrichment and annotation demonstrated that most of these methylated genes were significantly associated with apoptosis, which is possibly an essential way for these genes to be involved in the regulation of multidrug resistance in ovarian cancer. In addition, a comprehensive analysis of clinical factors revealed that the methylation level of genes that are associated with the regulation of drug resistance in ovarian cancer was significantly correlated with the prognosis of ovarian cancer. Overall, this study preliminarily explains the potential correlation between the genes with DNA methylation and drug resistance in ovarian cancer. This finding has significance for our understanding of the regulation of resistant ovarian cancer by methylated genes, the treatment of ovarian cancer, and improvement of the prognosis of ovarian cancer. PMID:27347118

  9. Gene expression analysis of two extensively drug-resistant tuberculosis isolates show that two-component response systems enhance drug resistance.

    PubMed

    Yu, Guohua; Cui, Zhenling; Sun, Xian; Peng, Jinfu; Jiang, Jun; Wu, Wei; Huang, Wenhua; Chu, Kaili; Zhang, Lu; Ge, Baoxue; Li, Yao

    2015-05-01

    Global analysis of expression profiles using DNA microarrays was performed between a reference strain H37Rv and two clinical extensively drug-resistant isolates in response to three anti-tuberculosis drug exposures (isoniazid, capreomycin, and rifampicin). A deep analysis was then conducted using a combination of genome sequences of the resistant isolates, resistance information, and related public microarray data. Certain known resistance-associated gene sets were significantly overrepresented in upregulated genes in the resistant isolates relative to that observed in H37Rv, which suggested a link between resistance and expression levels of particular genes. In addition, isoniazid and capreomycin response genes, but not rifampicin, either obtained from published works or our data, were highly consistent with the differentially expressed genes of resistant isolates compared to those of H37Rv, indicating a strong association between drug resistance of the isolates and genes differentially regulated by isoniazid and capreomycin exposures. Based on these results, 92 genes of the studied isolates were identified as candidate resistance genes, 10 of which are known resistance-related genes. Regulatory network analysis of candidate resistance genes using published networks and literature mining showed that three two-component regulatory systems and regulator CRP play significant roles in the resistance of the isolates by mediating the production of essential envelope components. Finally, drug sensitivity testing indicated strong correlations between expression levels of these regulatory genes and sensitivity to multiple anti-tuberculosis drugs in Mycobacterium tuberculosis. These findings may provide novel insights into the mechanism underlying the emergence and development of drug resistance in resistant tuberculosis isolates and useful clues for further studies on this issue.

  10. Search Engine for Antimicrobial Resistance: A Cloud Compatible Pipeline and Web Interface for Rapidly Detecting Antimicrobial Resistance Genes Directly from Sequence Data

    PubMed Central

    Rowe, Will; Baker, Kate S.; Verner-Jeffreys, David; Baker-Austin, Craig; Ryan, Jim J.; Maskell, Duncan; Pearce, Gareth

    2015-01-01

    Background Antimicrobial resistance remains a growing and significant concern in human and veterinary medicine. Current laboratory methods for the detection and surveillance of antimicrobial resistant bacteria are limited in their effectiveness and scope. With the rapidly developing field of whole genome sequencing beginning to be utilised in clinical practice, the ability to interrogate sequencing data quickly and easily for the presence of antimicrobial resistance genes will become increasingly important and useful for informing clinical decisions. Additionally, use of such tools will provide insight into the dynamics of antimicrobial resistance genes in metagenomic samples such as those used in environmental monitoring. Results Here we present the Search Engine for Antimicrobial Resistance (SEAR), a pipeline and web interface for detection of horizontally acquired antimicrobial resistance genes in raw sequencing data. The pipeline provides gene information, abundance estimation and the reconstructed sequence of antimicrobial resistance genes; it also provides web links to additional information on each gene. The pipeline utilises clustering and read mapping to annotate full-length genes relative to a user-defined database. It also uses local alignment of annotated genes to a range of online databases to provide additional information. We demonstrate SEAR’s application in the detection and abundance estimation of antimicrobial resistance genes in two novel environmental metagenomes, 32 human faecal microbiome datasets and 126 clinical isolates of Shigella sonnei. Conclusions We have developed a pipeline that contributes to the improved capacity for antimicrobial resistance detection afforded by next generation sequencing technologies, allowing for rapid detection of antimicrobial resistance genes directly from sequencing data. SEAR uses raw sequencing data via an intuitive interface so can be run rapidly without requiring advanced bioinformatic skills or

  11. Gene amplification confers glyphosate resistance in Amaranthus palmeri

    PubMed Central

    Gaines, Todd A.; Zhang, Wenli; Wang, Dafu; Bukun, Bekir; Chisholm, Stephen T.; Shaner, Dale L.; Nissen, Scott J.; Patzoldt, William L.; Tranel, Patrick J.; Culpepper, A. Stanley; Grey, Timothy L.; Webster, Theodore M.; Vencill, William K.; Sammons, R. Douglas; Jiang, Jiming; Preston, Christopher; Leach, Jan E.; Westra, Philip

    2009-01-01

    The herbicide glyphosate became widely used in the United States and other parts of the world after the commercialization of glyphosate-resistant crops. These crops have constitutive overexpression of a glyphosate-insensitive form of the herbicide target site gene, 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Increased use of glyphosate over multiple years imposes selective genetic pressure on weed populations. We investigated recently discovered glyphosate-resistant Amaranthus palmeri populations from Georgia, in comparison with normally sensitive populations. EPSPS enzyme activity from resistant and susceptible plants was equally inhibited by glyphosate, which led us to use quantitative PCR to measure relative copy numbers of the EPSPS gene. Genomes of resistant plants contained from 5-fold to more than 160-fold more copies of the EPSPS gene than did genomes of susceptible plants. Quantitative RT-PCR on cDNA revealed that EPSPS expression was positively correlated with genomic EPSPS relative copy number. Immunoblot analyses showed that increased EPSPS protein level also correlated with EPSPS genomic copy number. EPSPS gene amplification was heritable, correlated with resistance in pseudo-F2 populations, and is proposed to be the molecular basis of glyphosate resistance. FISH revealed that EPSPS genes were present on every chromosome and, therefore, gene amplification was likely not caused by unequal chromosome crossing over. This occurrence of gene amplification as an herbicide resistance mechanism in a naturally occurring weed population is particularly significant because it could threaten the sustainable use of glyphosate-resistant crop technology. PMID:20018685

  12. The genetics of resistance to powdery mildew in cultivated oats (Avena sativa L.): current status of major genes.

    PubMed

    Hsam, Sai L K; Mohler, Volker; Zeller, Friedrich J

    2014-05-01

    The genetics of resistance to powdery mildew caused by Blumeria graminis f. sp. avenae of four cultivated oats was studied using monosomic analysis. Cultivar 'Bruno' carries a gene (Pm6) that shows a recessive mode of inheritance and is located on chromosome 10D. Cultivar 'Jumbo' possesses a dominant resistance gene (Pm1) on chromosome 1C. In cultivar 'Rollo', in addition to the gene Pm3 on chromosome 17A, a second dominant resistance gene (Pm8) was identified and assigned to chromosome 4C. In breeding line APR 122, resistance was conditioned by a dominant resistance gene (Pm7) that was allocated to chromosome 13A. Genetic maps established for resistance genes Pm1, Pm6 and Pm7 employing amplified fragment length polymorphism (AFLP) markers indicated that these genes are independent of each other, supporting the results from monosomic analysis.

  13. Processable high temperature resistant addition type polyimide laminating resins

    NASA Technical Reports Server (NTRS)

    Serafini, T. T.; Delvigs, P.

    1973-01-01

    Basic studies that were performed using model compounds to elucidate the polymerization mechanism of the so-called addition-type (A-type) polyimides are reviewed. The fabrication and properties of polyimide/graphite fiber composites using A-type polyimide prepolymers as the matrix are also reviewed. An alternate method for preparing processable A-type polyimides by means of in situ polymerization of monomer reactants (PMR) on the fiber reinforcement is described. The elevated temperature properties of A-type PMR/graphite fiber composites are also presented.

  14. Engineering disease resistance with pectate lyase-like genes

    DOEpatents

    Vogel, John; Somerville, Shauna

    2005-03-08

    A mutant gene coding for pectate lyase and homologs thereof is provided, which when incorporated in transgenic plants effect an increased level disease resistance in such plants. Also is provided the polypeptide sequence for the pectate lyase of the present invention. Methods of obtaining the mutant gene, producing transgenic plants which include the nucleotide sequence for the mutant gene and producing improved disease resistance in a crop of such transgenic plants are also provided.

  15. Mobile antibiotic resistance - the spread of genes determining the resistance of bacteria through food products.

    PubMed

    Godziszewska, Jolanta; Guzek, Dominika; Głąbski, Krzysztof; Wierzbicka, Agnieszka

    2016-01-01

    In recent years, more and more antibiotics have become ineffective in the treatment of bacterial nfections. The acquisition of antibiotic resistance by bacteria is associated with circulation of genes in the environment. Determinants of antibiotic resistance may be transferred to pathogenic bacteria. It has been shown that conjugation is one of the key mechanisms responsible for spread of antibiotic resistance genes, which is highly efficient and allows the barrier to restrictions and modifications to be avoided. Some conjugative modules enable the transfer of plasmids even between phylogenetically distant bacterial species. Many scientific reports indicate that food is one of the main reservoirs of these genes. Antibiotic resistance genes have been identified in meat products, milk, fruits and vegetables. The reason for such a wide spread of antibiotic resistance genes is the overuse of antibiotics by breeders of plants and animals, as well as by horizontal gene transfer. It was shown, that resistance determinants located on mobile genetic elements, which are isolated from food products, can easily be transferred to another niche. The antibiotic resistance genes have been in the environment for 30 000 years. Their removal from food products is not possible, but the risks associated with the emergence of multiresistant pathogenic strains are very large. The only option is to control the emergence, selection and spread of these genes. Therefore measures are sought to prevent horizontal transfer of genes. Promising concepts involve the combination of developmental biology, evolution and ecology in the fight against the spread of antibiotic resistance. PMID:27383577

  16. Mobile antibiotic resistance - the spread of genes determining the resistance of bacteria through food products.

    PubMed

    Godziszewska, Jolanta; Guzek, Dominika; Głąbski, Krzysztof; Wierzbicka, Agnieszka

    2016-07-07

    In recent years, more and more antibiotics have become ineffective in the treatment of bacterial nfections. The acquisition of antibiotic resistance by bacteria is associated with circulation of genes in the environment. Determinants of antibiotic resistance may be transferred to pathogenic bacteria. It has been shown that conjugation is one of the key mechanisms responsible for spread of antibiotic resistance genes, which is highly efficient and allows the barrier to restrictions and modifications to be avoided. Some conjugative modules enable the transfer of plasmids even between phylogenetically distant bacterial species. Many scientific reports indicate that food is one of the main reservoirs of these genes. Antibiotic resistance genes have been identified in meat products, milk, fruits and vegetables. The reason for such a wide spread of antibiotic resistance genes is the overuse of antibiotics by breeders of plants and animals, as well as by horizontal gene transfer. It was shown, that resistance determinants located on mobile genetic elements, which are isolated from food products, can easily be transferred to another niche. The antibiotic resistance genes have been in the environment for 30 000 years. Their removal from food products is not possible, but the risks associated with the emergence of multiresistant pathogenic strains are very large. The only option is to control the emergence, selection and spread of these genes. Therefore measures are sought to prevent horizontal transfer of genes. Promising concepts involve the combination of developmental biology, evolution and ecology in the fight against the spread of antibiotic resistance.

  17. Amplification of a Gene Related to Mammalian mdr Genes in Drug-Resistant Plasmodium falciparum

    NASA Astrophysics Data System (ADS)

    Wilson, Craig M.; Serrano, Adelfa E.; Wasley, Annemarie; Bogenschutz, Michael P.; Shankar, Anuraj H.; Wirth, Dyann F.

    1989-06-01

    The malaria parasite Plasmodium falciparum contains at least two genes related to the mammalian multiple drug resistance genes, and at least one of the P. falciparum genes is expressed at a higher level and is present in higher copy number in a strain that is resistant to multiple drugs than in a strain that is sensitive to the drugs.

  18. Diversity of tet resistance genes in tetracycline-resistant bacteria isolated from a swine lagoon with low antibiotic impact.

    PubMed

    Macauley, John J; Adams, Craig D; Mormile, Melanie R

    2007-12-01

    Tetracycline resistance has been extensively studied and shown to be widespread. A number of previous studies have clearly demonstrated that a variety of tetracycline resistance genes are present in swine fecal material, treatment lagoons, and the environments surrounding concentrated animal feeding operations (CAFOs). The diversity of tetracycline resistance within a swine lagoon located at a CAFO that used only bacitricin methylene disalicylate as an antibiotic was evaluated by screening 85 tetracycline-resistant isolates for the presence of 18 different genes by performing PCR with primers that target tetracycline efflux genes of Gram-negative bacteria and ribosomal protection proteins. In addition, partial 16S rRNA sequences from each of these isolates were sequenced to determine the identity of these isolates. Of the 85 isolates examined, 17 may represent potential novel species based on BLAST results. Greater than 50% of the isolates (48 out of 85) were found to not contain targeted tet efflux genes. Though minimum inhibitory concentrations ranged widely (16 - >256 mg/L), these values did not give an indication of the tet genes present. Ten new genera were identified that contain at least one tet efflux gene. Five other genera possessed tet efflux genes that were not found in these organisms previously. Interestingly, none of the isolates possessed any of the selected ribosomal protection protein genes. Though tetracycline resistance was found in bacteria isolated from a swine CAFO lagoon, it appears that the limited antibiotic use at this CAFO might have impacted the presence and diversity of tetracycline resistance genes. PMID:18059563

  19. The transport of antibiotic resistance genes and residues in groundwater near swine production facilities

    NASA Astrophysics Data System (ADS)

    Lin, Y. F.; Yannarell, A. C.; Mackie, R. I.; Krapac, I. G.; Chee-Sanford, J. S.; Koike, S.

    2008-12-01

    The use of antibiotics at concentrated animal feeding operations (CAFOs) for disease prevention, disease treatment, and growth promotion can contribute to the spread of antibiotic compounds, their breakdown products, and antibiotic resistant bacteria and/or the genes that confer resistance. In addition, constitutive use of antibiotics at sub-therapeutic levels can select for antibiotic resistance among the bacteria that inhabit animal intestinal tracts, onsite manure treatment facilities, and any environments receiving significant inputs of manure (e.g. through waste lagoon leakage or fertilizer amendments to farm soils). If the antibiotic resistant organisms persist in these new environments, or if they participate in genetic exchanges with the native microflora, then CAFOs may constitute a significant reservoir for the spread of antibiotic resistance to the environment at large. Our results have demonstrated that leakage from waste treatment lagoons can influence the presence and persistence of tetracycline resistance genes in the shallow aquifer adjacent to swine CAFOs, and molecular phylogeny allowed us to distinguish "native" tetracycline resistance genes in control groundwater wells from manure-associated genes introduced from the lagoon. We have also been able to detect the presence of erythromycin resistance genes in CAFO surface and groundwater even though erythromycin is strictly reserved for use in humans and thus is not utilized at any of these sites. Ongoing research, including modeling of particle transport in groundwater, will help to determine the potential spatial and temporal extent of CAFO-derived antibiotic resistance.

  20. Plasmid encoded antibiotic resistance: acquisition and transfer of antibiotic resistance genes in bacteria

    PubMed Central

    Bennett, P M

    2008-01-01

    Bacteria have existed on Earth for three billion years or so and have become adept at protecting themselves against toxic chemicals. Antibiotics have been in clinical use for a little more than 6 decades. That antibiotic resistance is now a major clinical problem all over the world attests to the success and speed of bacterial adaptation. Mechanisms of antibiotic resistance in bacteria are varied and include target protection, target substitution, antibiotic detoxification and block of intracellular antibiotic accumulation. Acquisition of genes needed to elaborate the various mechanisms is greatly aided by a variety of promiscuous gene transfer systems, such as bacterial conjugative plasmids, transposable elements and integron systems, that move genes from one DNA system to another and from one bacterial cell to another, not necessarily one related to the gene donor. Bacterial plasmids serve as the scaffold on which are assembled arrays of antibiotic resistance genes, by transposition (transposable elements and ISCR mediated transposition) and site-specific recombination mechanisms (integron gene cassettes). The evidence suggests that antibiotic resistance genes in human bacterial pathogens originate from a multitude of bacterial sources, indicating that the genomes of all bacteria can be considered as a single global gene pool into which most, if not all, bacteria can dip for genes necessary for survival. In terms of antibiotic resistance, plasmids serve a central role, as the vehicles for resistance gene capture and their subsequent dissemination. These various aspects of bacterial resistance to antibiotics will be explored in this presentation. PMID:18193080

  1. Standardized Plant Disease Evaluations will Enhance Resistance Gene Discovery

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Gene discovery and marker development using DNA based tools require plant populations with well-documented phenotypes. Related crops such as apples and pears may share a number of genes, for example resistance to common diseases, and data mining in one crop may reveal genes for the other. However, u...

  2. Occurrence of antibiotic resistance and characterization of resistance genes and integrons in Enterobacteriaceae isolated from integrated fish farms in South China.

    PubMed

    Su, Hao-Chang; Ying, Guang-Guo; Tao, Ran; Zhang, Rui-Quan; Fogarty, Lisa Reynolds; Kolpin, Dana W

    2011-11-01

    Antibiotics are still widely applied in animal husbandry to prevent diseases and used as feed additives to promote animal growth. This could result in antibiotic resistance to bacteria and antibiotic residues in animals. In this paper, Enterobacteriaceae isolated from four integrated fish farms in Zhongshan, South China were tested for antibiotic resistance, tetracycline resistance genes, sulfonamide resistance genes, and class 1 integrons. The Kirby-Bauer disk diffusion method and polymerase chain reaction (PCR) assays were carried out to test antibiotic susceptibility and resistance genes, respectively. Relatively high antibiotic resistance frequencies were found, especially for ampicillin (80%), tetracycline (52%), and trimethoprim (50%). Out of 203 Enterobacteriaceae isolates, 98.5% were resistant to one or more antibiotics tested. Multiple antibiotic resistance (MAR) was found highest in animal manures with a MAR index of 0.56. Tetracycline resistance genes (tet(A), tet(C)) and sulfonamide resistance genes (sul2) were detected in more than 50% of the isolates. The intI1 gene was found in 170 isolates (83.7%). Both classic and non-classic class 1 integrons were found. Four genes, aadA5, aadA22, dfr2, and dfrA17, were detected. To our knowledge, this is the first report for molecular characterization of antibiotic resistance genes in Enterobacteriaceae isolated from integrated fish farms in China and the first time that gene cassette array dfrA17-aadA5 has been detected in such fish farms. Results of this study indicated that fish farms may be a reservoir of highly diverse and abundant antibiotic resistant genes and gene cassettes. Integrons may play a key role in multiple antibiotic resistances posing potential health risks to the general public and aquaculture.

  3. Molecular Cytogenetic Identification of a New Wheat-Rye 6R Chromosome Disomic Addition Line with Powdery Mildew Resistance.

    PubMed

    An, Diaoguo; Zheng, Qi; Luo, Qiaoling; Ma, Pengtao; Zhang, Hongxia; Li, Lihui; Han, Fangpu; Xu, Hongxing; Xu, Yunfeng; Zhang, Xiaotian; Zhou, Yilin

    2015-01-01

    Rye (Secale cereale L.) possesses many valuable genes that can be used for improving disease resistance, yield and environment adaptation of wheat (Triticum aestivum L.). However, the documented resistance stocks derived from rye is faced severe challenge due to the variation of virulent isolates in the pathogen populations. Therefore, it is necessary to develop desirable germplasm and search for novel resistance gene sources against constantly accumulated variation of the virulent isolates. In the present study, a new wheat-rye line designated as WR49-1 was produced through distant hybridization and chromosome engineering protocols between common wheat cultivar Xiaoyan 6 and rye cultivar German White. Using sequential GISH (genomic in situ hybridization), mc-FISH (multicolor fluorescence in situ hybridization), mc-GISH (multicolor GISH) and EST (expressed sequence tag)-based marker analysis, WR49-1 was proved to be a new wheat-rye 6R disomic addition line. As expected, WR49-1 showed high levels of resistance to wheat powdery mildew (Blumeria graminis f. sp. tritici, Bgt) pathogens prevalent in China at the adult growth stage and 19 of 23 Bgt isolates tested at the seedling stage. According to its reaction pattern to different Bgt isolates, WR49-1 may possess new resistance gene(s) for powdery mildew, which differed from the documented powdery mildew gene, including Pm20 on chromosome arm 6RL of rye. Additionally, WR49-1 was cytologically stable, had improved agronomic characteristics and therefore could serve as an important bridge for wheat breeding and chromosome engineering.

  4. Inactivation of antibiotics and the dissemination of resistance genes.

    PubMed

    Davies, J

    1994-04-15

    The emergence of multidrug-resistant bacteria is a phenomenon of concern to the clinician and the pharmaceutical industry, as it is the major cause of failure in the treatment of infectious diseases. The most common mechanism of resistance in pathogenic bacteria to antibiotics of the aminoglycoside, beta-lactam (penicillins and cephalosporins), and chloramphenicol types involves the enzymic inactivation of the antibiotic by hydrolysis or by formation of inactive derivatives. Such resistance determinants most probably were acquired by pathogenic bacteria from a pool of resistance genes in other microbial genera, including antibiotic-producing organisms. The resistance gene sequences were subsequently integrated by site-specific recombination into several classes of naturally occurring gene expression cassettes (typically "integrons") and disseminated within the microbial population by a variety of gene transfer mechanisms. Although bacterial conjugation once was believed to be restricted in host range, it now appears that this mechanism of transfer permits genetic exchange between many different bacterial genera in nature.

  5. Fate of antibiotic resistant bacteria and genes during wastewater chlorination: implication for antibiotic resistance control.

    PubMed

    Yuan, Qing-Bin; Guo, Mei-Ting; Yang, Jian

    2015-01-01

    This study investigated fates of nine antibiotic-resistant bacteria as well as two series of antibiotic resistance genes in wastewater treated by various doses of chlorine (0, 15, 30, 60, 150 and 300 mg Cl2 min/L). The results indicated that chlorination was effective in inactivating antibiotic-resistant bacteria. Most bacteria were inactivated completely at the lowest dose (15 mg Cl2 min/L). By comparison, sulfadiazine- and erythromycin-resistant bacteria exhibited tolerance to low chlorine dose (up to 60 mg Cl2 min/L). However, quantitative real-time PCRs revealed that chlorination decreased limited erythromycin or tetracycline resistance genes, with the removal levels of overall erythromycin and tetracycline resistance genes at 0.42 ± 0.12 log and 0.10 ± 0.02 log, respectively. About 40% of erythromycin-resistance genes and 80% of tetracycline resistance genes could not be removed by chlorination. Chlorination was considered not effective in controlling antimicrobial resistance. More concern needs to be paid to the potential risk of antibiotic resistance genes in the wastewater after chlorination.

  6. Fate of Antibiotic Resistant Bacteria and Genes during Wastewater Chlorination: Implication for Antibiotic Resistance Control

    PubMed Central

    Yuan, Qing-Bin; Guo, Mei-Ting; Yang, Jian

    2015-01-01

    This study investigated fates of nine antibiotic-resistant bacteria as well as two series of antibiotic resistance genes in wastewater treated by various doses of chlorine (0, 15, 30, 60, 150 and 300 mg Cl2 min/L). The results indicated that chlorination was effective in inactivating antibiotic-resistant bacteria. Most bacteria were inactivated completely at the lowest dose (15 mg Cl2 min/L). By comparison, sulfadiazine- and erythromycin-resistant bacteria exhibited tolerance to low chlorine dose (up to 60 mg Cl2 min/L). However, quantitative real-time PCRs revealed that chlorination decreased limited erythromycin or tetracycline resistance genes, with the removal levels of overall erythromycin and tetracycline resistance genes at 0.42 ± 0.12 log and 0.10 ± 0.02 log, respectively. About 40% of erythromycin-resistance genes and 80% of tetracycline resistance genes could not be removed by chlorination. Chlorination was considered not effective in controlling antimicrobial resistance. More concern needs to be paid to the potential risk of antibiotic resistance genes in the wastewater after chlorination. PMID:25738838

  7. Farther, slower, stronger: how the plant genetic background protects a major resistance gene from breakdown.

    PubMed

    Quenouille, Julie; Montarry, Josselin; Palloix, Alain; Moury, Benoit

    2013-02-01

    Genetic resistance provides efficient control of crop diseases, but is limited by pathogen evolution capacities which often result in resistance breakdown. It has been demonstrated recently, in three different pathosystems, that polygenic resistances combining a major-effect gene and quantitative resistance controlled by the genetic background are more durable than monogenic resistances (with the same major gene in a susceptible genetic background), but the underlying mechanisms are unknown. Using the pepper-Potato virus Y system, we examined three mechanisms that could account for the greater durability of the polygenic resistances: (i) the additional quantitative resistance conferred by the genetic background; (ii) the increase in the number of mutations required for resistance breakdown; and (iii) the slower selection of adapted resistance-breaking mutants within the viral population. The three mechanisms were experimentally validated. The first explained a large part of the variation in resistance breakdown frequency and is therefore expected to be a major determinant of resistance durability. Quantitative resistance factors also had an influence on the second mechanism by modifying the virus mutational pathways towards resistance breakdown and could also have an influence on the third mechanism by increasing genetic drift effects on the viral population. The relevance of these results for other plant-pathogen systems and their importance in plant breeding are discussed.

  8. AMINOGLYCOSIDE RESISTANCE GENES IN Pseudomonas aeruginosa ISOLATES FROM CUMANA, VENEZUELA

    PubMed Central

    TEIXEIRA, Bertinellys; RODULFO, Hectorina; CARREÑO, Numirin; GUZMÁN, Militza; SALAZAR, Elsa; DONATO, Marcos DE

    2016-01-01

    The enzymatic modification of aminoglycosides by aminoglycoside-acetyltransferases (AAC), aminoglycoside-adenyltransferases (AAD), and aminoglycoside-phosphotransferases (APH), is the most common resistance mechanism in P. aeruginosa and these enzymes can be coded on mobile genetic elements that contribute to their dispersion. One hundred and thirty seven P. aeruginosa isolates from the University Hospital, Cumana, Venezuela (HUAPA) were evaluated. Antimicrobial susceptibility was determined by the disk diffusion method and theaac, aadB and aph genes were detected by PCR. Most of the P. aeruginosa isolates (33/137) were identified from the Intensive Care Unit (ICU), mainly from discharges (96/137). The frequency of resistant P. aeruginosaisolates was found to be higher for the aminoglycosides tobramycin and amikacin (30.7 and 29.9%, respectively). Phenotype VI, resistant to these antibiotics, was the most frequent (14/49), followed by phenotype I, resistant to all the aminoglycosides tested (12/49). The aac(6´)-Ib,aphA1 and aadB genes were the most frequently detected, and the simultaneous presence of several resistance genes in the same isolate was demonstrated. Aminoglycoside resistance in isolates ofP. aeruginosa at the HUAPA is partly due to the presence of the aac(6´)-Ib, aphA1 andaadB genes, but the high rates of antimicrobial resistance suggest the existence of several mechanisms acting together. This is the first report of aminoglycoside resistance genes in Venezuela and one of the few in Latin America. PMID:27007556

  9. AMINOGLYCOSIDE RESISTANCE GENES IN Pseudomonas aeruginosa ISOLATES FROM CUMANA, VENEZUELA.

    PubMed

    Teixeira, Bertinellys; Rodulfo, Hectorina; Carreño, Numirin; Guzmán, Militza; Salazar, Elsa; De Donato, Marcos

    2016-01-01

    The enzymatic modification of aminoglycosides by aminoglycoside-acetyltransferases (AAC), aminoglycoside-adenyltransferases (AAD), and aminoglycoside-phosphotransferases (APH), is the most common resistance mechanism in P. aeruginosa and these enzymes can be coded on mobile genetic elements that contribute to their dispersion. One hundred and thirty seven P. aeruginosa isolates from the University Hospital, Cumana, Venezuela (HUAPA) were evaluated. Antimicrobial susceptibility was determined by the disk diffusion method and theaac, aadB and aph genes were detected by PCR. Most of the P. aeruginosa isolates (33/137) were identified from the Intensive Care Unit (ICU), mainly from discharges (96/137). The frequency of resistant P. aeruginosaisolates was found to be higher for the aminoglycosides tobramycin and amikacin (30.7 and 29.9%, respectively). Phenotype VI, resistant to these antibiotics, was the most frequent (14/49), followed by phenotype I, resistant to all the aminoglycosides tested (12/49). The aac(6´)-Ib,aphA1 and aadB genes were the most frequently detected, and the simultaneous presence of several resistance genes in the same isolate was demonstrated. Aminoglycoside resistance in isolates ofP. aeruginosa at the HUAPA is partly due to the presence of the aac(6´)-Ib, aphA1 andaadB genes, but the high rates of antimicrobial resistance suggest the existence of several mechanisms acting together. This is the first report of aminoglycoside resistance genes in Venezuela and one of the few in Latin America. PMID:27007556

  10. AMINOGLYCOSIDE RESISTANCE GENES IN Pseudomonas aeruginosa ISOLATES FROM CUMANA, VENEZUELA.

    PubMed

    Teixeira, Bertinellys; Rodulfo, Hectorina; Carreño, Numirin; Guzmán, Militza; Salazar, Elsa; De Donato, Marcos

    2016-01-01

    The enzymatic modification of aminoglycosides by aminoglycoside-acetyltransferases (AAC), aminoglycoside-adenyltransferases (AAD), and aminoglycoside-phosphotransferases (APH), is the most common resistance mechanism in P. aeruginosa and these enzymes can be coded on mobile genetic elements that contribute to their dispersion. One hundred and thirty seven P. aeruginosa isolates from the University Hospital, Cumana, Venezuela (HUAPA) were evaluated. Antimicrobial susceptibility was determined by the disk diffusion method and theaac, aadB and aph genes were detected by PCR. Most of the P. aeruginosa isolates (33/137) were identified from the Intensive Care Unit (ICU), mainly from discharges (96/137). The frequency of resistant P. aeruginosaisolates was found to be higher for the aminoglycosides tobramycin and amikacin (30.7 and 29.9%, respectively). Phenotype VI, resistant to these antibiotics, was the most frequent (14/49), followed by phenotype I, resistant to all the aminoglycosides tested (12/49). The aac(6´)-Ib,aphA1 and aadB genes were the most frequently detected, and the simultaneous presence of several resistance genes in the same isolate was demonstrated. Aminoglycoside resistance in isolates ofP. aeruginosa at the HUAPA is partly due to the presence of the aac(6´)-Ib, aphA1 andaadB genes, but the high rates of antimicrobial resistance suggest the existence of several mechanisms acting together. This is the first report of aminoglycoside resistance genes in Venezuela and one of the few in Latin America.

  11. Reprogramming of the ERRα and ERα target gene landscape triggers tamoxifen resistance in breast cancer.

    PubMed

    Thewes, Verena; Simon, Ronald; Schroeter, Petra; Schlotter, Magdalena; Anzeneder, Tobias; Büttner, Reinhard; Benes, Vladimir; Sauter, Guido; Burwinkel, Barbara; Nicholson, Robert I; Sinn, Hans-Peter; Schneeweiss, Andreas; Deuschle, Ulrich; Zapatka, Marc; Heck, Stefanie; Lichter, Peter

    2015-02-15

    Endocrine treatment regimens for breast cancer that target the estrogen receptor-α (ERα) are effective, but acquired resistance remains a limiting drawback. One mechanism of acquired resistance that has been hypothesized is functional substitution of the orphan receptor estrogen-related receptor-α (ERRα) for ERα. To examine this hypothesis, we analyzed ERRα and ERα in recurrent tamoxifen-resistant breast tumors and conducted a genome-wide target gene profiling analysis of MCF-7 breast cancer cell populations that were sensitive or resistant to tamoxifen treatment. This analysis uncovered a global redirection in the target genes controlled by ERα, ERRα, and their coactivator AIB1, defining a novel set of target genes in tamoxifen-resistant cells. Beyond differences in the ERα and ERRα target gene repertoires, both factors were engaged in similar pathobiologic processes relevant to acquired resistance. Functional analyses confirmed a requirement for ERRα in tamoxifen- and fulvestrant-resistant MCF-7 cells, with pharmacologic inhibition of ERRα sufficient to partly restore sensitivity to antiestrogens. In clinical specimens (n = 1041), increased expression of ERRα was associated with enhanced proliferation and aggressive disease parameters, including increased levels of p53 in ERα-positive cases. In addition, increased ERRα expression was linked to reduced overall survival in independent tamoxifen-treated patient cohorts. Taken together, our results suggest that ERα and ERRα cooperate to promote endocrine resistance, and they provide a rationale for the exploration of ERRα as a candidate drug target to treat endocrine-resistant breast cancer.

  12. Genes for resistance to zucchini yellow mosaic in tropical pumpkin.

    PubMed

    Pachner, Martin; Paris, Harry S; Lelley, Tamas

    2011-01-01

    Four cultigens of Cucurbita moschata resistant to zucchini yellow mosaic virus were crossed with the susceptible 'Waltham Butternut' and with each other in order to clarify the mode of inheritance of resistance and relationships among the genes involved. Five loci were segregating, with genes for resistance Zym-0 and Zym-4 carried by 'Nigerian Local' and one of them also carried by 'Nicklow's Delight,' Zym-1 carried by 'Menina,' and zym-6 carried by 'Soler.' A recessive gene carried by 'Waltham Butternut,' zym-5, is complementary with the dominant Zym-4 of 'Nigerian Local,' that is, the resistance conferred by Zym-4 is only expressed in zym-5/zym-5 individuals. Gene zym-6 appears to be linked to either Zym-0 or Zym-4, and it is also possible that Zym-1 is linked to one of them as well.

  13. Natural selection mapping of the warfarin-resistance gene

    PubMed Central

    Kohn, Michael H.; Pelz, Hans-Joachim; Wayne, Robert K.

    2000-01-01

    In theory, genes under natural selection can be revealed by unique patterns of linkage disequilibrium (LD) and polymorphism at physically linked loci. However, given the effects of recombination and mutation, the physical extent and persistence of LD patterns in natural populations is uncertain. To assess the LD signature of selection, we survey variation in 26 microsatellite loci spanning an ≈32-cM region that includes the warfarin-resistance gene (Rw) in five wild rat populations having resistance levels between 0 and 95%. We find a high frequency of heterozygote deficiency at microsatellite loci in resistant populations, and a negative association between gene diversity (H) and resistance. Contrary to previous studies, these data suggest that directional rather than overdominant selection may predominate during periods of intense anticoagulant treatment. In highly resistant populations, extensive LD was observed over a chromosome segment spanning ≈14% of rat chromosome 1. In contrast, LD in a moderately resistant population was more localized and, in conjunction with likelihood ratios, allowed assignment of Rw to a 2.2-cM interval. Within this genomic window, a diagnostic marker, D1Rat219, assigned 91% of rats to the correct resistance category. These results further demonstrate that “natural selection mapping” in field populations can detect and map major fitness-related genes, and question overdominance as the predominant mode of selection in anticoagulant-resistant rat populations. PMID:10884423

  14. Pediatric fecal microbiota harbor diverse and novel antibiotic resistance genes.

    PubMed

    Moore, Aimée M; Patel, Sanket; Forsberg, Kevin J; Wang, Bin; Bentley, Gayle; Razia, Yasmin; Qin, Xuan; Tarr, Phillip I; Dantas, Gautam

    2013-01-01

    Emerging antibiotic resistance threatens human health. Gut microbes are an epidemiologically important reservoir of resistance genes (resistome), yet prior studies indicate that the true diversity of gut-associated resistomes has been underestimated. To deeply characterize the pediatric gut-associated resistome, we created metagenomic recombinant libraries in an Escherichia coli host using fecal DNA from 22 healthy infants and children (most without recent antibiotic exposure), and performed functional selections for resistance to 18 antibiotics from eight drug classes. Resistance-conferring DNA fragments were sequenced (Illumina HiSeq 2000), and reads assembled and annotated with the PARFuMS computational pipeline. Resistance to 14 of the 18 antibiotics was found in stools of infants and children. Recovered genes included chloramphenicol acetyltransferases, drug-resistant dihydrofolate reductases, rRNA methyltransferases, transcriptional regulators, multidrug efflux pumps, and every major class of beta-lactamase, aminoglycoside-modifying enzyme, and tetracycline resistance protein. Many resistance-conferring sequences were mobilizable; some had low identity to any known organism, emphasizing cryptic organisms as potentially important resistance reservoirs. We functionally confirmed three novel resistance genes, including a 16S rRNA methylase conferring aminoglycoside resistance, and two tetracycline-resistance proteins nearly identical to a bifidobacterial MFS transporter (B. longum s. longum JDM301). We provide the first report to our knowledge of resistance to folate-synthesis inhibitors conferred by a predicted Nudix hydrolase (part of the folate synthesis pathway). This functional metagenomic survey of gut-associated resistomes, the largest of its kind to date, demonstrates that fecal resistomes of healthy children are far more diverse than previously suspected, that clinically relevant resistance genes are present even without recent selective antibiotic

  15. Phenotypic characterization of potato late blight resistance mediated by the broad-spectrum resistance gene RB.

    PubMed

    Chen, Yu; Halterman, Dennis A

    2011-02-01

    The potato gene RB, cloned from the wild potato species Solanum bulbocastanum, confers partial resistance to late blight, caused by the oomycete pathogen Phytophthora infestans. In order to better characterize this partial resistance phenotype, we have compared host resistance responses mediated by RB with those mediated by the S. demissum-derived R gene R9, which confers immunity to P. infestans carrying the corresponding avirulence gene avrR9. We found that both RB and R9 genes were capable of eliciting a hypersensitive cell death response (HR). However, in RB plants, the pathogen escaped HR lesions and continued to grow beyond the inoculation sites. We also found that callose deposition was negatively correlated with resistance levels in tested plants. Transcription patterns of pathogenesis-related (PR) genes PR-1 basic, PR-2 acidic, and PR-5 indicated that P. infestans inoculation induced transcription of these defense-related genes regardless of the host genotype; however, transcription was reduced in both the susceptible and partially resistant plants later in the infection process but remained elevated in the immune host. Most interestingly, transcription of the HR-associated gene Hin1 was suppressed in both Katahdin and RB-transgenic Katahdin but not in R9 4 days after inoculation. Together, this suggests that suppression of certain defense-related genes may allow P. infestans to spread beyond the site of infection in the partially resistant host despite elicitation of hypersensitive cell death.

  16. Emergence of macrolide resistance gene mph(B) in Streptococcus uberis and cooperative effects with rdmC-like gene.

    PubMed

    Achard, Adeline; Guérin-Faublée, Véronique; Pichereau, Vianney; Villers, Corinne; Leclercq, Roland

    2008-08-01

    Streptococcus uberis UCN60 was resistant to spiramycin (MIC = 8 microg/ml) but susceptible to erythromycin (MIC = 0.06 microg/ml), azithromycin (MIC = 0.12 microg/ml), josamycin (MIC = 0.25 microg/ml), and tylosin (MIC = 0.5 microg/ml). A 2.5-kb HindIII fragment was cloned from S. uberis UCN60 DNA on plasmid pUC18 and introduced into Escherichia coli AG100A, where it conferred resistance to spiramycin by inactivation. The sequence analysis of the fragment showed the presence of an rdmC-like gene that putatively encoded a protein belonging to the alpha/beta hydrolase family and of the first 196 nucleotides of the mph(B) gene putatively encoding a phosphotransferase known to inactivate 14-, 15-, and 16-membered macrolides in E. coli. The entire mph(B) gene was then identified in S. uberis UCN60. The two genes were expressed alone or in combination in E. coli, Staphylococcus aureus, and Enterococcus faecalis. Analysis of MICs revealed that rdmC-like alone did not confer resistance to erythromycin, tylosin, and josamycin in those three hosts. It conferred resistance to spiramycin in E. coli and E. faecalis but not in S. aureus. mph(B) conferred resistance in E. coli to erythromycin, tylosin, josamycin, and spiramycin but only low levels of resistance in E. faecalis and S. aureus to spiramycin (MIC = 8 microg/ml). The combination of mph(B) and rdmC-like genes resulted in a resistance to spiramycin and tylosin in the three hosts that significantly exceeded the mere addition of the resistance levels conferred by each resistance mechanism alone. PMID:18519724

  17. 75 FR 44881 - Black Stem Rust; Additions of Rust-Resistant Varieties

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-07-30

    .... (See 75 FR 29191-29193.) The direct final rule notified the public of our intention to amend the black stem rust quarantine and regulations by adding 21 varieties to the list of rust-resistant Berberis... Inspection Service 7 CFR Part 301 Black Stem Rust; Additions of Rust-Resistant Varieties AGENCY: Animal...

  18. De Novo Transcriptome Sequencing of Oryza officinalis Wall ex Watt to Identify Disease-Resistance Genes.

    PubMed

    He, Bin; Gu, Yinghong; Tao, Xiang; Cheng, Xiaojie; Wei, Changhe; Fu, Jian; Cheng, Zaiquan; Zhang, Yizheng

    2015-12-10

    Oryza officinalis Wall ex Watt is one of the most important wild relatives of cultivated rice and exhibits high resistance to many diseases. It has been used as a source of genes for introgression into cultivated rice. However, there are limited genomic resources and little genetic information publicly reported for this species. To better understand the pathways and factors involved in disease resistance and accelerating the process of rice breeding, we carried out a de novo transcriptome sequencing of O. officinalis. In this research, 137,229 contigs were obtained ranging from 200 to 19,214 bp with an N50 of 2331 bp through de novo assembly of leaves, stems and roots in O. officinalis using an Illumina HiSeq 2000 platform. Based on sequence similarity searches against a non-redundant protein database, a total of 88,249 contigs were annotated with gene descriptions and 75,589 transcripts were further assigned to GO terms. Candidate genes for plant-pathogen interaction and plant hormones regulation pathways involved in disease-resistance were identified. Further analyses of gene expression profiles showed that the majority of genes related to disease resistance were all expressed in the three tissues. In addition, there are two kinds of rice bacterial blight-resistant genes in O. officinalis, including two Xa1 genes and three Xa26 genes. All 2 Xa1 genes showed the highest expression level in stem, whereas one of Xa26 was expressed dominantly in leaf and other 2 Xa26 genes displayed low expression level in all three tissues. This transcriptomic database provides an opportunity for identifying the genes involved in disease-resistance and will provide a basis for studying functional genomics of O. officinalis and genetic improvement of cultivated rice in the future.

  19. De Novo Transcriptome Sequencing of Oryza officinalis Wall ex Watt to Identify Disease-Resistance Genes

    PubMed Central

    He, Bin; Gu, Yinghong; Tao, Xiang; Cheng, Xiaojie; Wei, Changhe; Fu, Jian; Cheng, Zaiquan; Zhang, Yizheng

    2015-01-01

    Oryza officinalis Wall ex Watt is one of the most important wild relatives of cultivated rice and exhibits high resistance to many diseases. It has been used as a source of genes for introgression into cultivated rice. However, there are limited genomic resources and little genetic information publicly reported for this species. To better understand the pathways and factors involved in disease resistance and accelerating the process of rice breeding, we carried out a de novo transcriptome sequencing of O. officinalis. In this research, 137,229 contigs were obtained ranging from 200 to 19,214 bp with an N50 of 2331 bp through de novo assembly of leaves, stems and roots in O. officinalis using an Illumina HiSeq 2000 platform. Based on sequence similarity searches against a non-redundant protein database, a total of 88,249 contigs were annotated with gene descriptions and 75,589 transcripts were further assigned to GO terms. Candidate genes for plant–pathogen interaction and plant hormones regulation pathways involved in disease-resistance were identified. Further analyses of gene expression profiles showed that the majority of genes related to disease resistance were all expressed in the three tissues. In addition, there are two kinds of rice bacterial blight-resistant genes in O. officinalis, including two Xa1 genes and three Xa26 genes. All 2 Xa1 genes showed the highest expression level in stem, whereas one of Xa26 was expressed dominantly in leaf and other 2 Xa26 genes displayed low expression level in all three tissues. This transcriptomic database provides an opportunity for identifying the genes involved in disease-resistance and will provide a basis for studying functional genomics of O. officinalis and genetic improvement of cultivated rice in the future. PMID:26690414

  20. Horizontal gene transfer in the human gastrointestinal tract: potential spread of antibiotic resistance genes

    PubMed Central

    Huddleston, Jennifer R

    2014-01-01

    Bacterial infections are becoming increasingly difficult to treat due to widespread antibiotic resistance among pathogens. This review aims to give an overview of the major horizontal transfer mechanisms and their evolution and then demonstrate the human lower gastrointestinal tract as an environment in which horizontal gene transfer of resistance determinants occurs. Finally, implications for antibiotic usage and the development of resistant infections and persistence of antibiotic resistance genes in populations as a result of horizontal gene transfer in the large intestine will be discussed. PMID:25018641

  1. Molecular cytogenetic identification of a wheat-rye 1R addition line with multiple spikelets and resistance to powdery mildew.

    PubMed

    Yang, Wujuan; Wang, Changyou; Chen, Chunhuan; Wang, Yajuan; Zhang, Hong; Liu, Xinlun; Ji, Wanquan

    2016-04-01

    Alien addition lines are important for transferring useful genes from alien species into common wheat. Rye is an important and valuable gene resource for improving wheat disease resistance, yield, and environment adaptation. A new wheat-rye addition line, N9436B, was developed from the progeny of the cross of common wheat (Triticum aestivum L., 2n = 6x = 42, AABBDD) cultivar Shaanmai 611 and rye (Secale cereal L., 2n = 2x = 14, RR) accession Austrian rye. We characterized this new line by cytology, genomic in situ hybridization (GISH), fluorescence in situ hybridization (FISH), molecular markers, and disease resistance screening. N9436B was stable in morphology and cytology, with a chromosome composition of 2n = 42 + 2t = 22II. GISH investigations showed that this line contained two rye chromosomes. GISH, FISH, and molecular maker identification suggested that the introduced R chromosome and the missing wheat chromosome arms were 1R chromosome and 2DL chromosome arm, respectively. N9436B exhibited 30-37 spikelets per spike and a high level of resistance to powdery mildew (Blumeria graminis f. sp. tritici, Bgt) isolate E09 at the seedling stage. N9436B was cytologically stable, had the trait of multiple spikelets, and was resistant to powdery mildew; this line should thus be useful in wheat improvement.

  2. Process for improving moisture resistance of epoxy resins by addition of chromium ions

    NASA Technical Reports Server (NTRS)

    St.clair, A. K.; Stoakley, D. M.; St.clair, T. L.; Singh, J. J. (Inventor)

    1985-01-01

    A process for improving the moisture resistance properties of epoxidized TGMDA and DGEBA resin system by chemically incorporating chromium ions is described. The addition of chromium ions is believed to prevent the absorption of water molecules.

  3. A Nomadic Subtelomeric Disease Resistance Gene Cluster in Common Bean

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The B4 resistance (R)-gene cluster, located in subtelomeric region of chromosome 4, is one of the largest clusters known in common bean (Phaseolus vulgaris, Pv). We sequenced 650 kb spanning this locus and annotated 97 genes, 26 of which correspond to Coiled-coil-Nucleotide-Binding-Site-Leucine-Rich...

  4. Identification of major blast resistance genes in the southern US

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Resistance (R) genes in rice play important roles in preventing infections of rice blast fungus, Magnaporthe oryzae. In order to identify more R genes for different rice growing areas in the Southern US, an extensive field survey of the blast fungus was performed from 2012 to 2013. A total of 500 is...

  5. Polymyxin Resistance of Pseudomonas aeruginosa phoQ Mutants Is Dependent on Additional Two-Component Regulatory Systems

    PubMed Central

    Gutu, Alina D.; Sgambati, Nicole; Strasbourger, Pnina; Brannon, Mark K.; Jacobs, Michael A.; Haugen, Eric; Kaul, Rajinder K.; Johansen, Helle Krogh; Høiby, Niels

    2013-01-01

    Pseudomonas aeruginosa can develop resistance to polymyxin as a consequence of mutations in the PhoPQ regulatory system, mediated by covalent lipid A modification. Transposon mutagenesis of a polymyxin-resistant phoQ mutant defined 41 novel loci required for resistance, including two regulatory systems, ColRS and CprRS. Deletion of the colRS genes, individually or in tandem, abrogated the polymyxin resistance of a ΔphoQ mutant, as did individual or tandem deletion of cprRS. Individual deletion of colR or colS in a ΔphoQ mutant also suppressed 4-amino-l-arabinose addition to lipid A, consistent with the known role of this modification in polymyxin resistance. Surprisingly, tandem deletion of colRS or cprRS in the ΔphoQ mutant or individual deletion of cprR or cprS failed to suppress 4-amino-l-arabinose addition to lipid A, indicating that this modification alone is not sufficient for PhoPQ-mediated polymyxin resistance in P. aeruginosa. Episomal expression of colRS or cprRS in tandem or of cprR individually complemented the Pm resistance phenotype in the ΔphoQ mutant, while episomal expression of colR, colS, or cprS individually did not. Highly polymyxin-resistant phoQ mutants of P. aeruginosa isolated from polymyxin-treated cystic fibrosis patients harbored mutant alleles of colRS and cprS; when expressed in a ΔphoQ background, these mutant alleles enhanced polymyxin resistance. These results define ColRS and CprRS as two-component systems regulating polymyxin resistance in P. aeruginosa, indicate that addition of 4-amino-l-arabinose to lipid A is not the only PhoPQ-regulated biochemical mechanism required for resistance, and demonstrate that colRS and cprS mutations can contribute to high-level clinical resistance. PMID:23459479

  6. Prediction of antibiotic resistance by gene expression profiles

    PubMed Central

    Suzuki, Shingo; Horinouchi, Takaaki; Furusawa, Chikara

    2014-01-01

    Although many mutations contributing to antibiotic resistance have been identified, the relationship between the mutations and the related phenotypic changes responsible for the resistance has yet to be fully elucidated. To better characterize phenotype–genotype mapping for drug resistance, here we analyse phenotypic and genotypic changes of antibiotic-resistant Escherichia coli strains obtained by laboratory evolution. We demonstrate that the resistances can be quantitatively predicted by the expression changes of a small number of genes. Several candidate mutations contributing to the resistances are identified, while phenotype–genotype mapping is suggested to be complex and includes various mutations that cause similar phenotypic changes. The integration of transcriptome and genome data enables us to extract essential phenotypic changes for drug resistances. PMID:25517437

  7. Ultraviolet reduction of erythromycin and tetracycline resistant heterotrophic bacteria and their resistance genes in municipal wastewater.

    PubMed

    Guo, Mei-Ting; Yuan, Qing-Bin; Yang, Jian

    2013-11-01

    Antibiotic resistance in wastewater is becoming a major public health concern, but poorly understood about impact of disinfection on antibiotic resistant bacteria and antibiotic resistance genes. The UV disinfection of antibiotic resistant heterotrophic bacteria and their relevant genes in the wastewater of a municipal wastewater treatment plant has been evaluated. Two commonly used antibiotics, erythromycin and tetracycline were selected because of their wide occurrences in regard to the antibiotic resistance problem. After UV treatment at a fluence of 5mJcm(-2), the log reductions of heterotrophic bacteria resistant to erythromycin and tetracycline in the wastewater were found to be 1.4±0.1 and 1.1±0.1, respectively. The proportion of tetracycline-resistant bacteria (5%) was nearly double of that before UV disinfection (3%). Tetracycline-resistant bacteria exhibited more tolerance to UV irradiation compared to the erythromycin-resistant bacteria (p<0.05). Gene copy numbers were quantified via qPCR and normalized to the volume of original sample. The total concentrations of erythromycin- and tetracycline-resistance genes were (3.6±0.2)×10(5) and (2.5±0.1)×10(5) copies L(-1), respectively. UV treatment at a fluence of 5mJcm(-2) removed the total erythromycin- and tetracycline-resistance genes by 3.0±0.1 log and 1.9±0.1 log, respectively. UV treatment was effective in reducing antibiotic resistance in the wastewater.

  8. Hygromycin-resistance vectors for gene expression in Pichia pastoris.

    PubMed

    Yang, Junjie; Nie, Lei; Chen, Biao; Liu, Yingmiao; Kong, Yimeng; Wang, Haibin; Diao, Liuyang

    2014-04-01

    Pichia pastoris is a common host organism for heterologous protein expression and metabolic engineering. Zeocin-, G418-, nourseothricin- and blasticidin-resistance genes are the only dominant selectable markers currently available for selecting P. pastoris transformants. We describe here new P. pastoris expression vectors that confer a hygromycin resistance base on the Klebsiella pneumoniae hph gene. To demonstrate the application of the vectors for intracellular and secreted protein expression, green fluorescent protein (GFP) and human serum albumin (HSA) were cloned into the vectors and transformed into P. pastoris cells. The resulting strains expressed GFP and HSA constitutively or inducibly. The hygromycin resistance marker was also suitable for post-transformational vector amplication (PTVA) for obtaining strains with high plasmid copy numbers. A strain with multiple copies of the HSA expression cassette after PTVA had increased HSA expression compared with a strain with a single copy of the plasmid. To demonstrate compatibility of the new vectors with other vectors bearing antibiotic-resistance genes, P. pastoris was transformed with the Saccharomyces cerevisiae genes GSH1, GSH2 or SAM2 on plasmids containing genes for resistance to Zeocin, G418 or hygromycin. The resulting strain produced glutathione and S-adenosyl-L-methionine at levels approximately twice those of the parent strain. The new hygromycin-resistance vectors allow greater flexibility and potential applications in recombinant protein production and other research using P. pastoris. PMID:24822243

  9. Distribution of the multidrug resistance gene cfr in Staphylococcus species isolates from swine farms in China.

    PubMed

    Wang, Yang; Zhang, Wanjiang; Wang, Juan; Wu, Congming; Shen, Zhangqi; Fu, Xiao; Yan, Yang; Zhang, Qijing; Schwarz, Stefan; Shen, Jianzhong

    2012-03-01

    A total of 149 porcine Staphylococcus isolates with florfenicol MICs of ≥ 16 μg/ml were screened for the presence of the multiresistance gene cfr, its location on plasmids, and its genetic environment. In total, 125 isolates carried either cfr (16 isolates), fexA (92 isolates), or both genes (17 isolates). The 33 cfr-carrying staphylococci, which included isolates of the species Staphylococcus cohnii, S. arlettae, and S. saprophyticus in which the cfr gene has not been described before, exhibited a wide variety of SmaI pulsed-field gel electrophoresis patterns. In 18 cases, the cfr gene was located on plasmids. Four different types of cfr-carrying plasmids--pSS-01 (n = 2; 40 kb), pSS-02 (n = 3; 35.4 kb), pSS-03 (n = 10; 7.1 kb), and pBS-01 (n = 3; 16.4 kb)--were differentiated on the basis of their sizes, restriction patterns, and additional resistance genes. Sequence analysis revealed that in plasmid pSS-01, the cfr gene was flanked in the upstream part by a complete aacA-aphD-carrying Tn4001-like transposon and in the downstream part by a complete fexA-carrying transposon Tn558. In plasmid pSS-02, an insertion sequence IS21-558 and the cfr gene were integrated into transposon Tn558 and thereby truncated the tnpA and tnpB genes. The smallest cfr-carrying plasmid pSS-03 carried the macrolide-lincosamide-streptogramin B resistance gene erm(C). Plasmid pBS-01, previously described in Bacillus spp., harbored a Tn917-like transposon, including the macrolide-lincosamide-streptogramin B resistance gene erm(B) in the cfr downstream region. Plasmids, which in part carry additional resistance genes, seem to play an important role in the dissemination of the gene cfr among porcine staphylococci.

  10. Distribution of the Multidrug Resistance Gene cfr in Staphylococcus Species Isolates from Swine Farms in China

    PubMed Central

    Wang, Yang; Zhang, Wanjiang; Wang, Juan; Wu, Congming; Shen, Zhangqi; Fu, Xiao; Yan, Yang; Zhang, Qijing

    2012-01-01

    A total of 149 porcine Staphylococcus isolates with florfenicol MICs of ≥16 μg/ml were screened for the presence of the multiresistance gene cfr, its location on plasmids, and its genetic environment. In total, 125 isolates carried either cfr (16 isolates), fexA (92 isolates), or both genes (17 isolates). The 33 cfr-carrying staphylococci, which included isolates of the species Staphylococcus cohnii, S. arlettae, and S. saprophyticus in which the cfr gene has not been described before, exhibited a wide variety of SmaI pulsed-field gel electrophoresis patterns. In 18 cases, the cfr gene was located on plasmids. Four different types of cfr-carrying plasmids—pSS-01 (n = 2; 40 kb), pSS-02 (n = 3; 35.4 kb), pSS-03 (n = 10; 7.1 kb), and pBS-01 (n = 3; 16.4 kb)—were differentiated on the basis of their sizes, restriction patterns, and additional resistance genes. Sequence analysis revealed that in plasmid pSS-01, the cfr gene was flanked in the upstream part by a complete aacA-aphD-carrying Tn4001-like transposon and in the downstream part by a complete fexA-carrying transposon Tn558. In plasmid pSS-02, an insertion sequence IS21-558 and the cfr gene were integrated into transposon Tn558 and thereby truncated the tnpA and tnpB genes. The smallest cfr-carrying plasmid pSS-03 carried the macrolide-lincosamide-streptogramin B resistance gene erm(C). Plasmid pBS-01, previously described in Bacillus spp., harbored a Tn917-like transposon, including the macrolide-lincosamide-streptogramin B resistance gene erm(B) in the cfr downstream region. Plasmids, which in part carry additional resistance genes, seem to play an important role in the dissemination of the gene cfr among porcine staphylococci. PMID:22183168

  11. Consolidating and Exploring Antibiotic Resistance Gene Data Resources.

    PubMed

    Xavier, Basil Britto; Das, Anupam J; Cochrane, Guy; De Ganck, Sandra; Kumar-Singh, Samir; Aarestrup, Frank Møller; Goossens, Herman; Malhotra-Kumar, Surbhi

    2016-04-01

    The unrestricted use of antibiotics has resulted in rapid acquisition of antibiotic resistance (AR) and spread of multidrug-resistant (MDR) bacterial pathogens. With the advent of next-generation sequencing technologies and their application in understanding MDR pathogen dynamics, it has become imperative to unify AR gene data resources for easy accessibility for researchers. However, due to the absence of a centralized platform for AR gene resources, availability, consistency, and accuracy of information vary considerably across different databases. In this article, we explore existing AR gene data resources in order to make them more visible to the clinical microbiology community, to identify their limitations, and to propose potential solutions.

  12. Consolidating and Exploring Antibiotic Resistance Gene Data Resources

    PubMed Central

    Xavier, Basil Britto; Das, Anupam J.; Cochrane, Guy; De Ganck, Sandra; Kumar-Singh, Samir; Aarestrup, Frank Møller; Goossens, Herman

    2016-01-01

    The unrestricted use of antibiotics has resulted in rapid acquisition of antibiotic resistance (AR) and spread of multidrug-resistant (MDR) bacterial pathogens. With the advent of next-generation sequencing technologies and their application in understanding MDR pathogen dynamics, it has become imperative to unify AR gene data resources for easy accessibility for researchers. However, due to the absence of a centralized platform for AR gene resources, availability, consistency, and accuracy of information vary considerably across different databases. In this article, we explore existing AR gene data resources in order to make them more visible to the clinical microbiology community, to identify their limitations, and to propose potential solutions. PMID:26818666

  13. Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance.

    PubMed

    Huang, Laurence; Crothers, Kristina; Atzori, Chiara; Benfield, Thomas; Miller, Robert; Rabodonirina, Meja; Helweg-Larsen, Jannik

    2004-10-01

    Pneumocystis pneumonia (PCP) remains a major cause of illness and death in HIV-infected persons. Sulfa drugs, trimethoprim-sulfamethoxazole (TMP-SMX) and dapsone are mainstays of PCP treatment and prophylaxis. While prophylaxis has reduced the incidence of PCP, its use has raised concerns about development of resistant organisms. The inability to culture human Pneumocystis, Pneumocystis jirovecii, in a standardized culture system prevents routine susceptibility testing and detection of drug resistance. In other microorganisms, sulfa drug resistance has resulted from specific point mutations in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim for PCP treatment remains unclear. We review studies of DHPS mutations in P. jirovecii and summarize the evidence for resistance to sulfamethoxazole and dapsone.

  14. Deinococcus geothermalis: The Pool of Extreme Radiation Resistance Genes Shrinks

    SciTech Connect

    Makarova, Kira S.; Omelchenko, Marina; Gaidamakova, Elena; Matrosova, Vera; Vasilenko, Alexander; Zhai, Min; Lapidus, Alla L.; Copeland, A; Kim, Edwin; Land, Miriam L; Mavromatis, K; Pitluck, Samual; Richardson, P M; Detter, J. Chris; Brettin, Tom; Saunders, Elizabeth H; Lai, Barry; Ravel, Bruce; Kemner, Kenneth M; Wolf, Yuri; Sorokin, Alexei; Gerasimova, Anna; Gelfand, Mikhail; Fredrickson, James K; Koonin, Eugene; Daly, Michael

    2007-01-01

    Bacteria of the genus Deinococcus are extremely resistant to ionizing radiation (IR), ultraviolet light (UV) and desiccation. The mesophile Deinococcus radiodurans was the first member of this group whose genome was completely sequenced. Analysis of the genome sequence of D. radiodurans, however, failed to identify unique DNA repair systems. To further delineate the genes underlying the resistance phenotypes, we report the whole-genome sequence of a second Deinococcus species, the thermophile Deinococcus geothermalis, which at its optimal growth temperature is as resistant to IR, UV and desiccation as D. radiodurans, and a comparative analysis of the two Deinococcus genomes. Many D. radiodurans genes previously implicated in resistance, but for which no sensitive phenotype was observed upon disruption, are absent in D. geothermalis. In contrast, most D. radiodurans genes whose mutants displayed a radiation-sensitive phenotype in D. radiodurans are conserved in D. geothermalis. Supporting the existence of a Deinococcus radiation response regulon, a common palindromic DNA motif was identified in a conserved set of genes associated with resistance, and a dedicated transcriptional regulator was predicted. We present the case that these two species evolved essentially the same diverse set of gene families, and that the extreme stress-resistance phenotypes of the Deinococcus lineage emerged progressively by amassing cell-cleaning systems from different sources, but not by acquisition of novel DNA repair systems. Our reconstruction of the genomic evolution of the Deinococcus-Thermus phylum indicates that the corresponding set of enzymes proliferated mainly in the common ancestor of Deinococcus. Results of the comparative analysis weaken the arguments for a role of higher-order chromosome alignment structures in resistance; more clearly define and substantially revise downward the number of uncharacterized genes that might participate in DNA repair and contribute to

  15. Deinococcus geothermalis: The Pool of Extreme Radiation Resistance Genes Shrinks

    SciTech Connect

    Makarova, Kira S.; Omelchenko, Marina V.; Gaidamakova, Elena K.; Matrosova, Vera Y.; Vasilenko, Alexander; Zhai, Min; Lapidus, Alla; Copeland, Alex; Kim, Edwin; Land, Miriam; Mavrommatis, Konstantinos; Pitluck, Samuel; Richardson, Paul M.; Detter, Chris; Brettin, Thomas; Saunders, Elizabeth; Lai, Barry; Ravel, Bruce; Kemner, Kenneth M.; Wolf, Yuri I.; Sorokin, Alexander; Gerasimova, Anna V.; Gelfand, Mikhail S.; Fredrickson, James K.; Koonin, Eugene V.; Daly, Michael J.

    2007-07-24

    Bacteria of the genus Deinococcus are extremely resistant to ionizing radiation (IR), ultraviolet light (UV) and desiccation. The mesophile Deinococcus radiodurans was the first member of this group whose genome was completely sequenced. Analysis of the genome sequence of D. radiodurans, however, failed to identify unique DNA repair systems. To further delineate the genes underlying the resistance phenotypes, we report the whole-genome sequence of a second Deinococcus species, the thermophile Deinococcus geothermalis, which at itsoptimal growth temperature is as resistant to IR, UV and desiccation as D. radiodurans, and a comparative analysis of the two Deinococcus genomes. Many D. radiodurans genes previously implicated in resistance, but for which no sensitive phenotype was observed upon disruption, are absent in D. geothermalis. In contrast, most D. radiodurans genes whose mutants displayed a radiation-sensitive phenotype in D. radiodurans are conserved in D. geothermalis. Supporting the existence of a Deinococcus radiation response regulon, a common palindromic DNA motif was identified in a conserved set of genes associated with resistance, and a dedicated transcriptional regulator was predicted. We present the case that these two species evolved essentially the same diverse set of gene families, and that the extreme stress-resistance phenotypes of the Deinococcus lineage emerged progressively by amassing cell-cleaning systems from different sources, but not by acquisition of novel DNA repair systems. Our reconstruction of the genomic evolution of the Deinococcus-Thermus phylum indicates that the corresponding set of enzymes proliferated mainly in the common ancestor of Deinococcus. Results of the comparative analysis weaken the arguments for a role of higher-order chromosome alignment structures in resistance; more clearly define and substantially revise downward the number of uncharacterized genes that might participate in DNA repair and contribute to

  16. Deinococcus geothermalis: The Pool of Extreme Radiation Resistance Genes Shrinks

    PubMed Central

    Makarova, Kira S.; Omelchenko, Marina V.; Gaidamakova, Elena K.; Matrosova, Vera Y.; Vasilenko, Alexander; Zhai, Min; Lapidus, Alla; Copeland, Alex; Kim, Edwin; Land, Miriam; Mavromatis, Konstantinos; Pitluck, Samuel; Richardson, Paul M.; Detter, Chris; Brettin, Thomas; Saunders, Elizabeth; Lai, Barry; Ravel, Bruce; Kemner, Kenneth M.; Wolf, Yuri I.; Sorokin, Alexander; Gerasimova, Anna V.; Gelfand, Mikhail S.; Fredrickson, James K.; Koonin, Eugene V.; Daly, Michael J.

    2007-01-01

    Bacteria of the genus Deinococcus are extremely resistant to ionizing radiation (IR), ultraviolet light (UV) and desiccation. The mesophile Deinococcus radiodurans was the first member of this group whose genome was completely sequenced. Analysis of the genome sequence of D. radiodurans, however, failed to identify unique DNA repair systems. To further delineate the genes underlying the resistance phenotypes, we report the whole-genome sequence of a second Deinococcus species, the thermophile Deinococcus geothermalis, which at its optimal growth temperature is as resistant to IR, UV and desiccation as D. radiodurans, and a comparative analysis of the two Deinococcus genomes. Many D. radiodurans genes previously implicated in resistance, but for which no sensitive phenotype was observed upon disruption, are absent in D. geothermalis. In contrast, most D. radiodurans genes whose mutants displayed a radiation-sensitive phenotype in D. radiodurans are conserved in D. geothermalis. Supporting the existence of a Deinococcus radiation response regulon, a common palindromic DNA motif was identified in a conserved set of genes associated with resistance, and a dedicated transcriptional regulator was predicted. We present the case that these two species evolved essentially the same diverse set of gene families, and that the extreme stress-resistance phenotypes of the Deinococcus lineage emerged progressively by amassing cell-cleaning systems from different sources, but not by acquisition of novel DNA repair systems. Our reconstruction of the genomic evolution of the Deinococcus-Thermus phylum indicates that the corresponding set of enzymes proliferated mainly in the common ancestor of Deinococcus. Results of the comparative analysis weaken the arguments for a role of higher-order chromosome alignment structures in resistance; more clearly define and substantially revise downward the number of uncharacterized genes that might participate in DNA repair and contribute to

  17. Cycloheximide resistance in yeast: the gene and its protein.

    PubMed Central

    Käufer, N F; Fried, H M; Schwindinger, W F; Jasin, M; Warner, J R

    1983-01-01

    Mutations in the yeast gene CYH2 can lead to resistance to cycloheximide, an inhibitor of eukaryotic protein synthesis. The gene product of CYH2 is ribosomal protein L29, a component of the 60S ribosomal subunit. We have cloned the wild-type and resistance alleles of CYH2 and determined their nucleotide sequence. Transcription of CYH2 appears to initiate and terminate at multiple sites, as judged by S1 nuclease analysis. The gene is transcribed into an RNA molecule of about 1082 nucleotides, containing an intervening sequence of 510 nucleotides. The splice junction of the intron resides within a codon near the 5' end of the gene. In confirmation of peptide analysis by Stocklein et al. (1) we find that resistance to cycloheximide is due to a transversion mutation resulting in the replacement of a glutamine by glutamic acid in position 37 of L29. Images PMID:6304624

  18. Distribution of mec regulator genes in methicillin-resistant Staphylococcus clinical strains.

    PubMed Central

    Suzuki, E; Kuwahara-Arai, K; Richardson, J F; Hiramatsu, K

    1993-01-01

    The distributions of the mec regulator genes mecI and mecR1, which were identified on the chromosome of mecA-carrying Staphylococcus aureus N315, in methicillin-resistant staphylococci isolated in Japan and various countries were studied. Screening by dot blot hybridization by using polymerase chain reaction (PCR)-amplified probes revealed that at least the 5'-end region of the mecR1 gene was present in all strains tested, whereas about 40% of the strains were negative for the mecI gene. The data suggested that these regulator genes were the original components of the additional mec region DNA of methicillin-resistant S. aureus as well as methicillin-resistant, coagulase-negative staphylococci of seven staphylococcal species (S. epidermidis, S. haemolyticus, S. hominis, S. sciuri, S. capitis, S. caprae, and S. warneri). The mecI gene, which presumably codes for the repressor protein of the mecA gene, was found to harbor a point mutation in all six mecI-positive methicillin-resistant S. aureus strains, and their basal level of mecA gene transcription was elevated compared with that of strain N315, which harbors a presumably intact counterpart of the mecI gene. The data suggested that the mecI gene encodes for a strong repressor function on mecA gene transcription and is deleted or mutated in clinical methicillin-resistant S. aureus strains with high levels of resistance to methicillin. Images PMID:8328773

  19. Detection of macrolide and disinfectant resistance genes in clinical Staphylococcus aureus and coagulase-negative staphylococci

    PubMed Central

    2011-01-01

    Background Staphylococcus aureus and Coagulase-negative staphylococci (CoNS) are a major source of infections associated with indwelling medical devices. Many antiseptic agents are used in hygienic handwash to prevent nosocomial infections by Staphylococci. Our aim was to determine the antibiotic susceptibility and resistance to quaternary ammonium compound of 46 S. aureus strains and 71 CoNS. Methods S. aureus (n = 46) isolated from auricular infection and CoNS (n = 71), 22 of the strains isolated from dialysis fluids and 49 of the strains isolated from needles cultures were investigated. Erythromycin resistance genes (ermA, ermB, ermC, msrA and mef) were analysed by multiplex PCR and disinfectant-resistant genes (qacA, qacB, and qacC) were studied by PCR-RFLP. Results The frequency of erythromycin resistance genes in S. aureus was: ermA+ 7.7%, ermB+ 13.7%, ermC+ 6% and msrA+ 10.2%. In addition, the number of positive isolates in CoNS was respectively ermA+ (9.4%), ermB+ (11.1%), ermC+ (27.4%), and msrA+ (41%). The MIC analyses revealed that 88 isolates (74%) were resistant to quaternary ammonium compound-based disinfectant benzalkonium chloride (BC). 56% of the BC-resistant staphylococcus isolates have at least one of the three resistant disinfectants genes (qacA, qacB and qacC). Nine strains (7.7%) among the CoNS species and two S. aureus strains (2%) harboured the three-qac genes. In addition, the qacC were detected in 41 strains. Conclusions Multi-resistant strains towards macrolide and disinfectant were recorded. The investigation of antibiotics and antiseptic-resistant CoNS may provide crucial information on the control of nosocomial infections. PMID:22032892

  20. Antibiotic preparations contain DNA: a source of drug resistance genes?

    PubMed Central

    Webb, V; Davies, J

    1993-01-01

    Fluorescence measurements and polymerase chain reaction amplification of streptomycete 16S ribosomal DNA sequences were used to show that a number of antibiotic preparations employed for human and animal use are contaminated with chromosomal DNA of the antibiotic-producing organism. The DNA contains identifiable antibiotic resistance gene sequences; the uptake of this DNA by bacteria and its functional incorporation into bacterial replicons would lead to the generation of antibiotic resistance determinants. We propose that the presence of DNA encoding drug resistance in antibiotic preparations has been a factor in the rapid development of multiple antibiotic resistance in bacteria. Images PMID:8285621

  1. Development and characterization of a Psathyrostachys huashanica Keng 7Ns chromosome addition line with leaf rust resistance.

    PubMed

    Du, Wanli; Wang, Jing; Wang, Liangming; Zhang, Jun; Chen, Xinhong; Zhao, Jixin; Yang, Qunhui; Wu, Jun

    2013-01-01

    The aim of this study was to characterize a Triticum aestivum-Psathyrostachys huashanica Keng (2n = 2x = 14, NsNs) disomic addition line 2-1-6-3. Individual line 2-1-6-3 plants were analyzed using cytological, genomic in situ hybridization (GISH), EST-SSR, and EST-STS techniques. The alien addition line 2-1-6-3 was shown to have two P. huashanica chromosomes, with a meiotic configuration of 2n = 44 = 22 II. We tested 55 EST-SSR and 336 EST-STS primer pairs that mapped onto seven different wheat chromosomes using DNA from parents and the P. huashanica addition line. One EST-SSR and nine EST-STS primer pairs indicated that the additional chromosome of P. huashanica belonged to homoeologous group 7, the diagnostic fragments of five EST-STS markers (BE404955, BE591127, BE637663, BF482781 and CD452422) were cloned, sequenced and compared. The results showed that the amplified polymorphic bands of P. huashanica and disomic addition line 2-1-6-3 shared 100% sequence identity, which was designated as the 7Ns disomic addition line. Disomic addition line 2-1-6-3 was evaluated to test the leaf rust resistance of adult stages in the field. We found that one pair of the 7Ns genome chromosomes carried new leaf rust resistance gene(s). Moreover, wheat line 2-1-6-3 had a superior numbers of florets and grains per spike, which were associated with the introgression of the paired P. huashanica chromosomes. These high levels of disease resistance and stable, excellent agronomic traits suggest that this line could be utilized as a novel donor in wheat breeding programs.

  2. Additional Drug Resistance of Multidrug-Resistant Tuberculosis in Patients in 9 Countries

    PubMed Central

    Dalton, Tracy; Ershova, Julia; Tupasi, Thelma; Caoili, Janice Campos; Van Der Walt, Martie; Kvasnovsky, Charlotte; Yagui, Martin; Bayona, Jaime; Contreras, Carmen; Leimane, Vaira; Via, Laura E.; Kim, HeeJin; Akksilp, Somsak; Kazennyy, Boris Y.; Volchenkov, Grigory V.; Jou, Ruwen; Kliiman, Kai; Demikhova, Olga V.; Cegielski, J. Peter

    2015-01-01

    Data from a large multicenter observational study of patients with multidrug-resistant tuberculosis (MDR TB) were analyzed to simulate the possible use of 2 new approaches to treatment of MDR TB: a short (9-month) regimen and a bedaquiline-containing regimen. Of 1,254 patients, 952 (75.9%) had no resistance to fluoroquinolones and second-line injectable drugs and thus would qualify as candidates for the 9-month regimen; 302 (24.1%) patients with resistance to a fluoroquinolone or second-line injectable drug would qualify as candidates for a bedaquiline-containing regimen in accordance with published guidelines. Among candidates for the 9-month regimen, standardized drug-susceptibility tests demonstrated susceptibility to a median of 5 (interquartile range 5–6) drugs. Among candidates for bedaquiline, drug-susceptibility tests demonstrated susceptibility to a median of 3 (interquartile range 2–4) drugs; 26% retained susceptibility to <2 drugs. These data may assist national TB programs in planning to implement new drugs and drug regimens. PMID:25988299

  3. Quantitative trait loci from the host genetic background modulate the durability of a resistance gene: a rational basis for sustainable resistance breeding in plants

    PubMed Central

    Quenouille, J; Paulhiac, E; Moury, B; Palloix, A

    2014-01-01

    The combination of major resistance genes with quantitative resistance factors is hypothesized as a promising breeding strategy to preserve the durability of resistant cultivar, as recently observed in different pathosystems. Using the pepper (Capsicum annuum)/Potato virus Y (PVY, genus Potyvirus) pathosystem, we aimed at identifying plant genetic factors directly affecting the frequency of virus adaptation to the major resistance gene pvr23 and at comparing them with genetic factors affecting quantitative resistance. The resistance breakdown frequency was a highly heritable trait (h2=0.87). Four loci including additive quantitative trait loci (QTLs) and epistatic interactions explained together 70% of the variance of pvr23 breakdown frequency. Three of the four QTLs controlling pvr23 breakdown frequency were also involved in quantitative resistance, strongly suggesting that QTLs controlling quantitative resistance have a pleiotropic effect on the durability of the major resistance gene. With the first mapping of QTLs directly affecting resistance durability, this study provides a rationale for sustainable resistance breeding. Surprisingly, a genetic trade-off was observed between the durability of PVY resistance controlled by pvr23 and the spectrum of the resistance against different potyviruses. This trade-off seemed to have been resolved by the combination of minor-effect durability QTLs under long-term farmer selection. PMID:24569635

  4. Additives

    NASA Technical Reports Server (NTRS)

    Smalheer, C. V.

    1973-01-01

    The chemistry of lubricant additives is discussed to show what the additives are chemically and what functions they perform in the lubrication of various kinds of equipment. Current theories regarding the mode of action of lubricant additives are presented. The additive groups discussed include the following: (1) detergents and dispersants, (2) corrosion inhibitors, (3) antioxidants, (4) viscosity index improvers, (5) pour point depressants, and (6) antifouling agents.

  5. Occurrence of sulfonamide and tetracycline-resistant bacteria and resistance genes in aquaculture environment.

    PubMed

    Gao, Panpan; Mao, Daqing; Luo, Yi; Wang, Limei; Xu, Bingjie; Xu, Lin

    2012-05-01

    The occurrence of sulfonamide and tetracycline resistance and their pollution profile in the aquaculture environment of Tianjin, northern China, were investigated. The presence of antibiotic-resistant bacteria was identified and the corresponding antibiotic resistance genes (ARGs) were quantified at 6 aquaculture farms in Tianjin. Sulfonamide-resistance genes were prevalent and their concentrations were the highest detected (3.0 × 10(-5) to 3.3 × 10(-4) for sul1/16S rDNA, 2.0 × 10(-4) to 1.8 × 10(-3) for sul2/16S rDNA) among the various ARGs, most likely because the use of sulfonamides is more prevalent than tetracyclines in this area. Bacillus was the most dominant bacterial genus in both sulfamethoxazole resistant bacteria (63.27% of the total resistant bacteria) and tetracycline-resistant bacteria (57.14% of the total resistant bacteria). At least two of those genes (tetM, tetO, tetT, tetW, sul1 and sul2) were detected in the isolates of Bacillus cereus, Bacillus subtilis, Bacillus megaterium and Acinetobacter lwofii, and all of the above genes were detected in B. cereus, suggesting the occurrence of multi-resistance in the studied area. The genetic transfer of sul1 between intestinal bacteria (e.g., Enterococcus spp.) and indigenous bacteria (e.g., Bacillus spp.) was implied by phylogenetic analysis. Several strains of resistant opportunistic pathogens (e.g., Acinetobacter spp.) were found in indigenous bacteria, which increase the risk of ARGs to public health. Overall, this is the first study to comprehensively investigate the antibiotic resistance profile by analyzing the species of antibiotic-resistant bacteria and adopting qualitative and quantitative methods to investigate ARGs at a typical aquaculture area in northern China.

  6. Transfer of tetracycline resistance genes with aggregation substance in food-borne Enterococcus faecalis.

    PubMed

    Choi, Jong-Mi; Woo, Gun-Jo

    2015-04-01

    Enterococcus faecalis has the ability to conjugate with the aid of aggregation substance (AS) and inducible sex pheromones to exchange genetic elements in food matrix. To evaluate the food safety condition and the transferable factor, 250 tetracycline-resistant food-borne E. faecalis were collected in Korea. Among the isolates, a majority of tetracycline-resistant isolates (49.6 %) harbored both the tet(M) and tet(L) genes together, followed by tet(M) (19.6 %), and tet(L) (6.8 %) alone. Also, we found the combination of tet(L)/tet(M)/tet(O) or tet(M)/tet(O). We identified two tet(S) genes including the isolate carrying tet(M) + tet(S) genes. Additionally, most E. faecalis were positive for cpd and ccf (both 96.8 %) followed by cob (57.2 %). Through mating experiments, we confirmed E. faecalis possessing the Int-Tn gene and/or any AS gene successfully transferred tet genes to JH2-2 E. faecalis, whereas neither E. faecalis carrying AS genes nor the Int-Tn gene showed the conjugation. Pulsed-field gel electrophoresis results supported a distinct pattern, implying transfer of genetic information. Our study revealed a high occurrence of tetracycline resistance genes in E. faecalis from various foods. The widespread dissemination of tetracycline resistance genes would be promoted to transfer tetracycline resistance genes by pheromone-mediated conjugation systems.

  7. tcrB, a Gene Conferring Transferable Copper Resistance in Enterococcus faecium: Occurrence, Transferability, and Linkage to Macrolide and Glycopeptide Resistance

    PubMed Central

    Hasman, Henrik; Aarestrup, Frank M.

    2002-01-01

    A newly discovered gene, designated tcrB, which is located on a conjugative plasmid conferring acquired copper resistance in Enterococcus faecium, was identified in an isolate from a pig. The tcrB gene encodes a putative protein belonging to the CPx-type ATPase family with homology (46%) to the CopB protein from Enterococcus hirae. The tcrB gene was found in E. faecium isolated from pigs (75%), broilers (34%), calves (16%), and humans (10%) but not in isolates from sheep. Resistant isolates, containing the tcrB gene, grew on brain heart infusion agar plates containing up to 28 mM CuSO4 compared to only 4 mM for the susceptible isolates. Copper resistance, and therefore the presence of the tcrB gene, was strongly correlated to macrolide and glycopeptide resistance in isolates from pigs, and the tcrB gene was shown to be located on the same conjugative plasmid as the genes responsible for resistance to these two antimicrobial agents. The frequent occurrence of this new copper resistance gene in isolates from pigs, where copper sulfate is being used in large amounts as feed additive, suggests that the use of copper has selected for resistance. PMID:11959576

  8. Vancomycin-resistance phenotypes, vancomycin-resistance genes, and resistance to antibiotics of enterococci isolated from food of animal origin.

    PubMed

    Gousia, Panagiota; Economou, Vangelis; Bozidis, Petros; Papadopoulou, Chrissanthy

    2015-03-01

    In the present study, 500 raw beef, pork, and chicken meat samples and 100 pooled egg samples were analyzed for the presence of vancomycin-resistant enterococci, vancomycin-resistance phenotypes, and resistance genes. Of 141 isolates of enterococci, 88 strains of Enterococcus faecium and 53 strains of E. faecalis were identified. The most prevalent species was E. faecium. Resistance to ampicillin (n = 93, 66%), ciprofloxacin (n = 74, 52.5%), erythromycin (n = 73, 51.8%), penicillin (n = 59, 41.8%) and tetracycline (n = 52, 36.9%) was observed, while 53.2% (n = 75) of the isolates were multiresistant and 15.6% (n = 22) were susceptible to all antibiotics. Resistance to vancomycin was exhibited in 34.1% (n = 30) of the E. faecium isolates (n = 88) and 1.9% (n = 1) of the E. faecalis isolates (n = 53) using the disc-diffusion test and the E-test. All isolates were tested for vanA and vanB using real-time polymerase chain reaction (PCR) and multiplex PCR, and for vanC, vanD, vanE, vanG genes using multiplex PCR only. Among E. faecalis isolates, no resistance genes were identified. Among the E. faecium isolates, 28 carried the vanA gene when tested by multiplex PCR and 29 when tested with real-time PCR. No isolate carrying the vanC, vanD, vanE, or vanG genes was identified. Melting-curve analysis of the positive real-time PCR E. faecium isolates showed that 22 isolates carried the vanA gene only, 2 isolates the vanB2,3 genes only, and seven isolates carried both the vanA and vanB2,3 genes. Enterococci should be considered a significant zoonotic pathogen and a possible reservoir of genes encoding resistance potentially transferred to other bacterial species. PMID:25562594

  9. Soil metatranscriptomics for mining eukaryotic heavy metal resistance genes.

    PubMed

    Lehembre, Frédéric; Doillon, Didier; David, Elise; Perrotto, Sandrine; Baude, Jessica; Foulon, Julie; Harfouche, Lamia; Vallon, Laurent; Poulain, Julie; Da Silva, Corinne; Wincker, Patrick; Oger-Desfeux, Christine; Richaud, Pierre; Colpaert, Jan V; Chalot, Michel; Fraissinet-Tachet, Laurence; Blaudez, Damien; Marmeisse, Roland

    2013-10-01

    Heavy metals are pollutants which affect all organisms. Since a small number of eukaryotes have been investigated with respect to metal resistance, we hypothesize that many genes that control this phenomenon remain to be identified. This was tested by screening soil eukaryotic metatranscriptomes which encompass RNA from organisms belonging to the main eukaryotic phyla. Soil-extracted polyadenylated mRNAs were converted into cDNAs and 35 of them were selected for their ability to rescue the metal (Cd or Zn) sensitive phenotype of yeast mutants. Few of the genes belonged to families known to confer metal resistance when overexpressed in yeast. Several of them were homologous to genes that had not been studied in the context of metal resistance. For instance, the BOLA ones, which conferred cross metal (Zn, Co, Cd, Mn) resistance may act by interfering with Fe homeostasis. Other genes, such as those encoding 110- to 130-amino-acid-long, cysteine-rich polypeptides, had no homologues in databases. This study confirms that functional metatranscriptomics represents a powerful approach to address basic biological processes in eukaryotes. The selected genes can be used to probe new pathways involved in metal homeostasis and to manipulate the resistance level of selected organisms.

  10. Serotonin transporter gene polymorphisms and treatment-resistant depression.

    PubMed

    Bonvicini, Cristian; Minelli, Alessandra; Scassellati, Catia; Bortolomasi, Marco; Segala, Matilde; Sartori, Riccardo; Giacopuzzi, Mario; Gennarelli, Massimo

    2010-08-16

    Major Depression Disorder (MDD) is a serious mental illness that is one of the most disabling diseases worldwide. In addition, approximately 15% of depression patients are defined treatment-resistant (TRD). Preclinical and genetic studies show that serotonin modulation dysfunction exists in patients with TRD. Some polymorphisms in the promoter region of the serotonin transporter gene (SLC6A4) are likely to be involved in the pathogenesis/treatment of MDD; however, no data are available concerning TRD. Therefore, in order to investigate the possible influence of SLC6A4 polymorphisms on the risk of TRD, we genotyped 310 DSM-IV MDD treatment-resistant patients and 284 healthy volunteers. We analysed the most studied polymorphism 5-HTTLPR (L/S) and a single nucleotide substitution, rs25531 (A/G), in relation to different functional haplotype combinations. However the correct mapping of rs25531 is still debated whether it is within or outside the insertion. Our sequencing analysis showed that rs25531 is immediately outside of the 5-HTTLPR segment. Differences in 5-HTTLPR allele (p=0.04) and in L allele carriers (p<0.05) were observed between the two groups. Concerning the estimated haplotype analyses, L(A)L(A) homozygote haplotype was more represented among the control subjects (p=0.01, OR=0.64 95%CI: 0.45-0.91). In conclusion, this study reports a protective effect of the L(A)L(A) haplotype on TRD, supporting the hypothesis that lower serotonin transporter transcription alleles are correlated to a common resistant depression mechanism.

  11. Diversity of plasmids and antimicrobial resistance genes in multidrug-resistant Escherichia coli isolated from healthy companion animals

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The presence and transfer of antimicrobial resistance genes from commensal bacteria in companion animals to more pathogenic bacteria may contribute to dissemination of antimicrobial resistance. The purpose of this study was to determine antimicrobial resistance gene content and the presence of gene...

  12. Genomes, diversity and resistance gene analogues in Musa species.

    PubMed

    Azhar, M; Heslop-Harrison, J S

    2008-01-01

    Resistance genes (R genes) in plants are abundant and may represent more than 1% of all the genes. Their diversity is critical to the recognition and response to attack from diverse pathogens. Like many other crops, banana and plantain face attacks from potentially devastating fungal and bacterial diseases, increased by a combination of worldwide spread of pathogens, exploitation of a small number of varieties, new pathogen mutations, and the lack of effective, benign and cheap chemical control. The challenge for plant breeders is to identify and exploit genetic resistances to diseases, which is particularly difficult in banana and plantain where the valuable cultivars are sterile, parthenocarpic and mostly triploid so conventional genetic analysis and breeding is impossible. In this paper, we review the nature of R genes and the key motifs, particularly in the Nucleotide Binding Sites (NBS), Leucine Rich Repeat (LRR) gene class. We present data about identity, nature and evolutionary diversity of the NBS domains of Musa R genes in diploid wild species with the Musa acuminata (A), M. balbisiana (B), M. schizocarpa (S), M. textilis (T), M. velutina and M. ornata genomes, and from various cultivated hybrid and triploid accessions, using PCR primers to isolate the domains from genomic DNA. Of 135 new sequences, 75% of the sequenced clones had uninterrupted open reading frames (ORFs), and phylogenetic UPGMA tree construction showed four clusters, one from Musa ornata, one largely from the B and T genomes, one from A and M. velutina, and the largest with A, B, T and S genomes. Only genes of the coiled-coil (non-TIR) class were found, typical of the grasses and presumably monocotyledons. The analysis of R genes in cultivated banana and plantain, and their wild relatives, has implications for identification and selection of resistance genes within the genus which may be useful for plant selection and breeding and also for defining relationships and genome evolution

  13. Genomes, diversity and resistance gene analogues in Musa species.

    PubMed

    Azhar, M; Heslop-Harrison, J S

    2008-01-01

    Resistance genes (R genes) in plants are abundant and may represent more than 1% of all the genes. Their diversity is critical to the recognition and response to attack from diverse pathogens. Like many other crops, banana and plantain face attacks from potentially devastating fungal and bacterial diseases, increased by a combination of worldwide spread of pathogens, exploitation of a small number of varieties, new pathogen mutations, and the lack of effective, benign and cheap chemical control. The challenge for plant breeders is to identify and exploit genetic resistances to diseases, which is particularly difficult in banana and plantain where the valuable cultivars are sterile, parthenocarpic and mostly triploid so conventional genetic analysis and breeding is impossible. In this paper, we review the nature of R genes and the key motifs, particularly in the Nucleotide Binding Sites (NBS), Leucine Rich Repeat (LRR) gene class. We present data about identity, nature and evolutionary diversity of the NBS domains of Musa R genes in diploid wild species with the Musa acuminata (A), M. balbisiana (B), M. schizocarpa (S), M. textilis (T), M. velutina and M. ornata genomes, and from various cultivated hybrid and triploid accessions, using PCR primers to isolate the domains from genomic DNA. Of 135 new sequences, 75% of the sequenced clones had uninterrupted open reading frames (ORFs), and phylogenetic UPGMA tree construction showed four clusters, one from Musa ornata, one largely from the B and T genomes, one from A and M. velutina, and the largest with A, B, T and S genomes. Only genes of the coiled-coil (non-TIR) class were found, typical of the grasses and presumably monocotyledons. The analysis of R genes in cultivated banana and plantain, and their wild relatives, has implications for identification and selection of resistance genes within the genus which may be useful for plant selection and breeding and also for defining relationships and genome evolution

  14. Transfer of resistance against the beet cyst nematode from radish (Raphanus sativus) to rape (Brassica napus) by monosomic chromosome addition.

    PubMed

    Peterka, H; Budahn, H; Schrader, O; Ahne, R; Schütze, W

    2004-06-01

    In rape ( Brassica napus), no resistance to the beet cyst nematode (BCN) Heterodera schachtii is available. This study was carried out to determine the specific chromosome(s) of resistant radish ( Raphanus sativus) carrying the gene(s) for nematode resistance as a prequisite to convert rape from a host into a trap crop for this pest. A Raphanobrassica progeny of 25 plants was analyzed which segregated for all nine chromosomes of the Raphanus genome in a genetic background of synthetic rape. The number of radish chromosomes was determined by fluorescence in situ hybridization, using the Raphanus-specific DNA probe pURsN; and their type was identified by chromosome-specific randomly amplified polymorphic DNA markers. Five different multiple rape-radish chromosome additions (comprising the whole set of nine radish chromosomes, a-i) were selected and crossed to rape. For each cross-progeny, the number of cysts on plant roots was counted 42 days after inoculation with a L2 larvae suspension. Simultaneously, the plants were characterized for the presence or absence of individual radish chromosomes, using sets of chromosome-specific markers. Thus, the effect of each radish chromosome on cyst number was tested. Chromosome d had a major resistance effect, whereas the presence/absence of the other radish chromosomes had nearly no influence on cyst number. Plants with added chromosome d showed a resistance level comparable with that of the radish donor parent. The analysis in the cross to rape of a plant monosomic only for chromosome d confirmed the strong effect of this chromosome on nematode resistance. A further experiment comprising seven crosses using winter rape breeding lines and monosomic addition line d as pollen parent provided the same results on a broader genetic basis. In each case, the added chromosome d in a single dosage caused nearly the full resistance of the radish donor. Resistance was independent of the glucosinolate content in the roots. The

  15. Transcriptome Analysis of an Anthracnose-Resistant Tea Plant Cultivar Reveals Genes Associated with Resistance to Colletotrichum camelliae

    PubMed Central

    Wang, Lu; Wang, Yuchun; Cao, Hongli; Hao, Xinyuan; Zeng, Jianming; Yang, Yajun; Wang, Xinchao

    2016-01-01

    Tea plant breeding is a topic of great economic importance. However, disease remains a major cause of yield and quality losses. In this study, an anthracnose-resistant cultivar, ZC108, was developed. An infection assay revealed different responses to Colletotrichum sp. infection between ZC108 and its parent cultivar LJ43. ZC108 had greater resistance than LJ43 to Colletotrichum camelliae. Additionally, ZC108 exhibited earlier sprouting in the spring, as well as different leaf shape and plant architecture. Microarray data revealed that the genes that are differentially expressed between LJ43 and ZC108 mapped to secondary metabolism-related pathways, including phenylpropanoid biosynthesis, phenylalanine metabolism, and flavonoid biosynthesis pathways. In addition, genes involved in plant hormone biosynthesis and signaling as well as plant-pathogen interaction pathways were also changed. Quantitative real-time PCR was used to examine the expression of 27 selected genes in infected and uninfected tea plant leaves. Genes encoding a MADS-box transcription factor, NBS-LRR disease-resistance protein, and phenylpropanoid metabolism pathway components (CAD, CCR, POD, beta-glucosidase, ALDH and PAL) were among those differentially expressed in ZC108. PMID:26849553

  16. Allele Mining Strategies: Principles and Utilisation for Blast Resistance Genes in Rice (Oryza sativa L.).

    PubMed

    Ashkani, Sadegh; Yusop, Mohd Rafii; Shabanimofrad, Mahmoodreza; Azady, Amin; Ghasemzadeh, Ali; Azizi, Parisa; Latif, Mohammad Abdul

    2015-01-01

    Allele mining is a promising way to dissect naturally occurring allelic variants of candidate genes with essential agronomic qualities. With the identification, isolation and characterisation of blast resistance genes in rice, it is now possible to dissect the actual allelic variants of these genes within an array of rice cultivars via allele mining. Multiple alleles from the complex locus serve as a reservoir of variation to generate functional genes. The routine sequence exchange is one of the main mechanisms of R gene evolution and development. Allele mining for resistance genes can be an important method to identify additional resistance alleles and new haplotypes along with the development of allele-specific markers for use in marker-assisted selection. Allele mining can be visualised as a vital link between effective utilisation of genetic and genomic resources in genomics-driven modern plant breeding. This review studies the actual concepts and potential of mining approaches for the discovery of alleles and their utilisation for blast resistance genes in rice. The details provided here will be important to provide the rice breeder with a worthwhile introduction to allele mining and its methodology for breakthrough discovery of fresh alleles hidden in hereditary diversity, which is vital for crop improvement.

  17. A survey of drug resistance bla genes originating from synthetic plasmid vectors in six Chinese rivers.

    PubMed

    Chen, Jian; Jin, Min; Qiu, Zhi-Gang; Guo, Cong; Chen, Zhao-Li; Shen, Zhi-Qiang; Wang, Xin-Wei; Li, Jun-Wen

    2012-12-18

    Antibiotic resistance poses a significant challenge to human health and its rate continues to rise globally. While antibiotic-selectable synthetic plasmid vectors have proved invaluable tools of genetic engineering, this class of artificial recombinant DNA sequences with high expression of antibiotic resistance genes presents an unknown risk beyond the laboratory setting. Contamination of environmental microbes with synthetic plasmid vector-sourced antibiotic resistance genes may represent a yet unrecognized source of antibiotic resistance. In this study, PCR and real-time quantitative PCR were used to investigate the synthetic plasmid vector-originated ampicillin resistance gene, β-lactam antibiotic (blá), in microbes from six Chinese rivers with significant human interactions. Various levels of blá were detected in all six rivers, with the highest levels in the Pearl and Haihe rivers. To validate the blá pollution, environmental plasmids in the river samples were captured by the E. coli transformants from the community plasmid metagenome. The resultant plasmid library of 205 ampicillin-resistant E. coli (transformants) showed a blá-positive rate of 27.3% by PCR. Sequencing results confirmed the synthetic plasmid vector sources. In addition, results of the Kirby-Bauer disc-diffusion test reinforced the ampicillin-resistant functions of the environmental plasmids. The resistance spectrum of transformants from the Pearl and Haihe rivers, in particular, had expanded to the third- and fourth-generation of cephalosporin drugs, while that of other transformants mainly involved first- and second-generation cephalosporins. This study not only reveals environmental contamination of synthetic plasmid vector-sourced blá drug resistance genes in Chinese rivers, but also suggests that synthetic plasmid vectors may represent a source of antibiotic resistance in humans.

  18. Horizontal gene transfer of stress resistance genes through plasmid transport.

    PubMed

    Shoeb, Erum; Badar, Uzma; Akhter, Jameela; Shams, Hina; Sultana, Maria; Ansari, Maqsood A

    2012-03-01

    The horizontal gene transfer of plasmid-determined stress tolerance was achieved under lab conditions. Bacterial isolates, Enterobacter cloacae (DGE50) and Escherichia coli (DGE57) were used throughout the study. Samples were collected from contaminated marine water and soil to isolate bacterial strains having tolerance against heavy metals and antimicrobial agents. We have demonstrated plasmid transfer, from Amp(+)Cu(+)Zn(-) strain (DGE50) to Amp(-)Cu(-)Zn(+) strain (DGE57), producing Amp(+)Cu(+)Zn(+) transconjugants (DGE(TC50→57)) and Amp(+)Cu(-)Zn(+) transformants (DGE(TF50→57)). DGE57 did not carry any plasmid, therefore, it can be speculated that zinc tolerance gene in DGE57 is located on chromosome. DGE50 was found to carry three plasmids, out of which two were transferred through conjugation into DGE57, and only one was transferred through transformation. Plasmid transferred through transformation was one out of the two transferred through conjugation. Through the results of transformation it was revealed that the genes of copper and ampicillin tolerance in DGE50 were located on separate plasmids, since only ampicillin tolerance genes were transferred through transformation as a result of one plasmid transfer. By showing transfer of plasmids under lab conditions and monitoring retention of respective phenotype via conjugation and transformation, it is very well demonstrated how multiple stress tolerant strains are generated in nature. PMID:22805823

  19. Identification of Genes Involved in Resistance to Interferon-α in Cutaneous T-Cell Lymphoma

    PubMed Central

    Tracey, Lorraine; Villuendas, Raquel; Ortiz, Pablo; Dopazo, Ana; Spiteri, Inmaculada; Lombardia, Luis; Rodríguez-Peralto, Jose L.; Fernández-Herrera, Jesús; Hernández, Almudena; Fraga, Javier; Dominguez, Orlando; Herrero, Javier; Alonso, Miguel A.; Dopazo, Joaquin; Piris, Miguel A.

    2002-01-01

    Interferon-α therapy has been shown to be active in the treatment of mycosis fungoides although the individual response to this therapy is unpredictable and dependent on essentially unknown factors. In an effort to better understand the molecular mechanisms of interferon-α resistance we have developed an interferon-α resistant variant from a sensitive cutaneous T-cell lymphoma cell line. We have performed expression analysis to detect genes differentially expressed between both variants using a cDNA microarray including 6386 cancer-implicated genes. The experiments showed that resistance to interferon-α is consistently associated with changes in the expression of a set of 39 genes, involved in signal transduction, apoptosis, transcription regulation, and cell growth. Additional studies performed confirm that STAT1 and STAT3 expression and interferon-α induction and activation are not altered between both variants. The gene MAL, highly overexpressed by resistant cells, was also found to be expressed by tumoral cells in a series of cutaneous T-cell lymphoma patients treated with interferon-α and/or photochemotherapy. MAL expression was associated with longer time to complete remission. Time-course experiments of the sensitive and resistant cells showed a differential expression of a subset of genes involved in interferon-response (1 to 4 hours), cell growth and apoptosis (24 to 48 hours.), and signal transduction. PMID:12414529

  20. The Human Gut Microbiome as a Transporter of Antibiotic Resistance Genes between Continents

    PubMed Central

    Bengtsson-Palme, Johan; Angelin, Martin; Huss, Mikael; Kjellqvist, Sanela; Kristiansson, Erik; Palmgren, Helena; Larsson, D. G. Joakim

    2015-01-01

    Previous studies of antibiotic resistance dissemination by travel have, by targeting only a select number of cultivable bacterial species, omitted most of the human microbiome. Here, we used explorative shotgun metagenomic sequencing to address the abundance of >300 antibiotic resistance genes in fecal specimens from 35 Swedish students taken before and after exchange programs on the Indian peninsula or in Central Africa. All specimens were additionally cultured for extended-spectrum beta-lactamase (ESBL)-producing enterobacteria, and the isolates obtained were genome sequenced. The overall taxonomic diversity and composition of the gut microbiome remained stable before and after travel, but there was an increasing abundance of Proteobacteria in 25/35 students. The relative abundance of antibiotic resistance genes increased, most prominently for genes encoding resistance to sulfonamide (2.6-fold increase), trimethoprim (7.7-fold), and beta-lactams (2.6-fold). Importantly, the increase observed occurred without any antibiotic intake. Of 18 students visiting the Indian peninsula, 12 acquired ESBL-producing Escherichia coli, while none returning from Africa were positive. Despite deep sequencing efforts, the sensitivity of metagenomics was not sufficient to detect acquisition of the low-abundant genes responsible for the observed ESBL phenotype. In conclusion, metagenomic sequencing of the intestinal microbiome of Swedish students returning from exchange programs in Central Africa or the Indian peninsula showed increased abundance of genes encoding resistance to widely used antibiotics. PMID:26259788

  1. The Human Gut Microbiome as a Transporter of Antibiotic Resistance Genes between Continents.

    PubMed

    Bengtsson-Palme, Johan; Angelin, Martin; Huss, Mikael; Kjellqvist, Sanela; Kristiansson, Erik; Palmgren, Helena; Larsson, D G Joakim; Johansson, Anders

    2015-10-01

    Previous studies of antibiotic resistance dissemination by travel have, by targeting only a select number of cultivable bacterial species, omitted most of the human microbiome. Here, we used explorative shotgun metagenomic sequencing to address the abundance of >300 antibiotic resistance genes in fecal specimens from 35 Swedish students taken before and after exchange programs on the Indian peninsula or in Central Africa. All specimens were additionally cultured for extended-spectrum beta-lactamase (ESBL)-producing enterobacteria, and the isolates obtained were genome sequenced. The overall taxonomic diversity and composition of the gut microbiome remained stable before and after travel, but there was an increasing abundance of Proteobacteria in 25/35 students. The relative abundance of antibiotic resistance genes increased, most prominently for genes encoding resistance to sulfonamide (2.6-fold increase), trimethoprim (7.7-fold), and beta-lactams (2.6-fold). Importantly, the increase observed occurred without any antibiotic intake. Of 18 students visiting the Indian peninsula, 12 acquired ESBL-producing Escherichia coli, while none returning from Africa were positive. Despite deep sequencing efforts, the sensitivity of metagenomics was not sufficient to detect acquisition of the low-abundant genes responsible for the observed ESBL phenotype. In conclusion, metagenomic sequencing of the intestinal microbiome of Swedish students returning from exchange programs in Central Africa or the Indian peninsula showed increased abundance of genes encoding resistance to widely used antibiotics.

  2. Quantitative gene monitoring of microbial tetracycline resistance using magnetic luminescent nanoparticles.

    PubMed

    Son, Ahjeong; Kennedy, Ian M; Scow, Kate M; Hristova, Krassimira R

    2010-06-01

    A magnetic/luminescent nanoparticles (MLNPs) based DNA hybridization method was developed for quantitative monitoring of antibiotic resistance genes and gene-expression in environmental samples. Manipulation of magnetic field enabled the separation of the MLNPs-DNA hybrids from the solution and the fluorescence of MLNPs normalized the quantity of target DNA. In our newly developed MLNPs-DNA assay, linear standard curves (R(2) = 0.99) of target gene was determined with the detection limit of 620 gene copies. The potential risk of increased bacterial antibiotic resistance was assessed by quantitative monitoring of tetracycline resistance (i.e., tetQ gene) in wastewater microcosms. The gene abundance and its expression showed a significant increase of tetQ gene copies with the addition of tetracycline, triclosan (TCS), or triclocarban (TCC). A real-time PCR assay was employed to verify the quantification capability of the MLNPs-DNA assay and accordingly both assays have shown strong correlation (R(2) = 0.93). This non-PCR based MLNPs-DNA assay has demonstrated its potential for gene quantification via a rapid, simple, and high throughput platform and its novel use of internal calibration standards.

  3. Seedling Resistance to Stem Rust and Molecular Marker Analysis of Resistance Genes in Wheat Cultivars of Yunnan, China

    PubMed Central

    Li, Tian Ya; Cao, Yuan Yin; Wu, Xian Xin; Xu, Xiao Feng; Wang, Wan Lin

    2016-01-01

    Stem rust is one of the most potentially harmful wheat diseases, but has been effectively controlled in China since 1970s. However, the interest in breeding wheat with durable resistance to stem rust has been renewed with the emergence of Ug99 (TTKSK) virulent to the widely used resistance gene Sr31, and by which the wheat stem rust was controlled for 40 years in wheat production area worldwide. Yunnan Province, located on the Southwest border of China, is one of the main wheat growing regions, playing a pivotal role in the wheat stem rust epidemic in China. This study investigated the levels of resistance in key wheat cultivars (lines) of Yunnan Province. In addition, the existence of Sr25, Sr26, Sr28, Sr31, Sr32, and Sr38 genes in 119 wheat cultivars was assessed using specific DNA markers. The results indicated that 77 (64.7%) tested wheat varieties showed different levels of resistance to all the tested races of Puccinia graminis f. sp. tritici. Using molecular markers, we identified the resistance gene Sr31 in 43 samples; Sr38 in 10 samples; Sr28 in 12 samples, and one sample which was resistant against Ug99 (avirulent to Sr32). No Sr25 or Sr26 (effective against Ug99) was identified in any cultivars tested. Furthermore, 5 out of 119 cultivars tested carried both Sr31 and Sr38 and eight contained both Sr31 and Sr28. The results enable the development of appropriate strategies to breed varieties resistant to stem rust. PMID:27792757

  4. Spread of tetracycline resistance genes at a conventional dairy farm

    PubMed Central

    Kyselková, Martina; Jirout, Jiří; Vrchotová, Naděžda; Schmitt, Heike; Elhottová, Dana

    2015-01-01

    The use of antibiotics in animal husbandry contributes to the worldwide problem of increasing antibiotic resistance in animal and human pathogens. Intensive animal production is considered an important source of antibiotic resistance genes released to the environment, while the contribution of smaller farms remains to be evaluated. Here we monitor the spread of tetracycline resistance (TC-r) genes at a middle-size conventional dairy farm, where chlortetracycline (CTC, as intrauterine suppository) is prophylactically used after each calving. Our study has shown that animals at the farm acquired the TC-r genes in their early age (1–2 weeks), likely due to colonization with TC-resistant bacteria from their mothers and/or the farm environment. The relative abundance of the TC-r genes tet(W), tet(Q), and tet(M) in fresh excrements of calves was about 1–2 orders of magnitude higher compared to heifers and dairy cows, possibly due to the presence of antibiotic residues in milk fed to calves. The occurrence and abundance of TC-r genes in fresh excrements of heifers and adult cows remained unaffected by intrauterine CTC applications, with tet(O), tet(Q), and tet(W) representing a “core TC-resistome” of the farm, and tet(A), tet(M), tet(Y), and tet(X) occurring occasionally. The genes tet(A), tet(M), tet(Y), and tet(X) were shown to be respectively harbored by Shigella, Lactobacillus and Clostridium, Acinetobacter, and Wautersiella. Soil in the farm proximity, as well as field soil to which manure from the farm was applied, was contaminated with TC-r genes occurring in the farm, and some of the TC-r genes persisted in the field over 3 months following the manure application. Concluding, our study shows that antibiotic resistance genes may be a stable part of the intestinal metagenome of cattle even if antibiotics are not used for growth stimulation, and that smaller dairy farms may also contribute to environmental pollution with antibiotic resistance genes. PMID

  5. Spread of tetracycline resistance genes at a conventional dairy farm.

    PubMed

    Kyselková, Martina; Jirout, Jiří; Vrchotová, Naděžda; Schmitt, Heike; Elhottová, Dana

    2015-01-01

    The use of antibiotics in animal husbandry contributes to the worldwide problem of increasing antibiotic resistance in animal and human pathogens. Intensive animal production is considered an important source of antibiotic resistance genes released to the environment, while the contribution of smaller farms remains to be evaluated. Here we monitor the spread of tetracycline resistance (TC-r) genes at a middle-size conventional dairy farm, where chlortetracycline (CTC, as intrauterine suppository) is prophylactically used after each calving. Our study has shown that animals at the farm acquired the TC-r genes in their early age (1-2 weeks), likely due to colonization with TC-resistant bacteria from their mothers and/or the farm environment. The relative abundance of the TC-r genes tet(W), tet(Q), and tet(M) in fresh excrements of calves was about 1-2 orders of magnitude higher compared to heifers and dairy cows, possibly due to the presence of antibiotic residues in milk fed to calves. The occurrence and abundance of TC-r genes in fresh excrements of heifers and adult cows remained unaffected by intrauterine CTC applications, with tet(O), tet(Q), and tet(W) representing a "core TC-resistome" of the farm, and tet(A), tet(M), tet(Y), and tet(X) occurring occasionally. The genes tet(A), tet(M), tet(Y), and tet(X) were shown to be respectively harbored by Shigella, Lactobacillus and Clostridium, Acinetobacter, and Wautersiella. Soil in the farm proximity, as well as field soil to which manure from the farm was applied, was contaminated with TC-r genes occurring in the farm, and some of the TC-r genes persisted in the field over 3 months following the manure application. Concluding, our study shows that antibiotic resistance genes may be a stable part of the intestinal metagenome of cattle even if antibiotics are not used for growth stimulation, and that smaller dairy farms may also contribute to environmental pollution with antibiotic resistance genes. PMID:26074912

  6. Breaking restricted taxonomic functionality by dual resistance genes.

    PubMed

    Narusaka, Mari; Kubo, Yasuyuki; Hatakeyama, Katsunori; Imamura, Jun; Ezura, Hiroshi; Nanasato, Yoshihiko; Tabei, Yutaka; Takano, Yoshitaka; Shirasu, Ken; Narusaka, Yoshihiro

    2013-06-01

    NB-LRR-type disease resistance (R) genes have been used in traditional breeding programs for crop protection. However, functional transfer of NB-LRR-type R genes to plants in taxonomically distinct families to establish pathogen resistance has not been successful. Here we demonstrate that a pair of Arabidopsis (Brassicaceae) NB-LRR-type R genes, RPS4 and RRS1, properly function in two other Brassicaceae, Brassica rapa and B. napus, but also in two Solanaceae, Nicotiana benthamiana and tomato (Solanum lycopersicum). The solanaceous plants transformed with RPS4/RRS1 confer bacterial effector-specific immunity responses. Furthermore, RPS4 and RRS1, which confer resistance to a fungal pathogen Colletotrichum higginsianum in Brassicaceae, also protect against Colletotrichum orbiculare in cucumber (Cucurbitaceae). Thus the successful transfer of two R genes at the family level overcomes restricted taxonomic functionality. This implies that the downstream components of R genes must be highly conserved and interfamily utilization of R genes can be a powerful strategy to combat pathogens.

  7. EDS1 in tomato is required for resistance mediated by TIR-class R genes and the receptor-like R gene Ve.

    PubMed

    Hu, Gongshe; deHart, Amy K A; Li, Yansu; Ustach, Carolyn; Handley, Vanessa; Navarre, Roy; Hwang, Chin-Feng; Aegerter, Brenna J; Williamson, Valerie M; Baker, Barbara

    2005-05-01

    In tobacco and other Solanaceae species, the tobacco N gene confers resistance to tobacco mosaic virus (TMV), and leads to induction of standard defense and resistance responses. Here, we report the use of N-transgenic tomato to identify a fast-neutron mutant, sun1-1 (suppressor of N), that is defective in N-mediated resistance. Induction of salicylic acid (SA) and expression of pathogenesis-related (PR) genes, each signatures of systemic acquired resistance, are both dramatically suppressed in sun1-1 plants after TMV treatment compared to wild-type plants. Application of exogenous SA restores PR gene expression, indicating that SUN1 acts upstream of SA. Upon challenge with additional pathogens, we found that the sun1-1 mutation impairs resistance mediated by certain resistance (R) genes, (Bs4, I, and Ve), but not others (Mi-1). In addition, sun1-1 plants exhibit enhanced susceptibility to TMV, as well as to virulent pathogens. sun1-1 has been identified as an EDS1 homolog present on chromosome 6 of tomato. The discovery of enhanced susceptibility in the sun1-1 (Le_eds1-1) mutant plant, which contrasts to reports in Nicotiana benthamiana using virus-induced gene silencing, provides evidence that the intersection of R gene-mediated pathways with general resistance pathways is conserved in a Solanaceous species. In tomato, EDS1 is important for mediating resistance to a broad range of pathogens (viral, bacterial, and fungal pathogens), yet shows specificity in the class of R genes that it affects (TIR-NBS-LRR as opposed to CC-NBS-LRR). In addition, a requirement for EDS1 for Ve-mediated resistance in tomato exposes that the receptor-like R gene class may also require EDS1.

  8. Quantification of vancomycin-resistant enterococci and corresponding resistance genes in a sewage treatment plant.

    PubMed

    Furukawa, Takashi; Hashimoto, Reina; Mekata, Tohru

    2015-01-01

    This study aimed to analyze vancomycin-resistant enterococci (VRE) and their resistance genes, vanA and vanB, to examine their presence in sewage treatment systems. Water samples were collected from primary sedimentation tank inlet, aeration tank, final sedimentation tank overflow outlet, and disinfection tank. Enterococcal strains were determined their vancomycin susceptibility by the minimum inhibitory concentration (MIC) test. Vancomycin-resistance genes (vanA and vanB) were quantified by real-time PCR. The sewage treatment process indeed decreased the number of most enterococci contained in the entering sewage, with a removal rate of ≥ 5 log. The MIC test showed that two enterococcal strains resistant to a high concentration of vancomycin (>128 μg mL(-1)). However, most of the enterococcal strains exhibited sensitivity to vancomycin, indicating that VRE were virtually absent in the sewage treatment systems. On the other hand, vancomycin-resistance genes were detected in all the sewage samples, including those collected from the chlorination disinfection tank. The highest copy numbers of vanA (1.5 × 10(3) copies mL(-1)) and vanB (1.0 × 10(3) copies mL(-1)) were detected from the water sample of effluent water and chlorinated water, respectively. Therefore, antibiotic resistance genes remain in the sewage treatment plant and might discharged into water environments such as rivers and coastal areas. PMID:26121014

  9. Functional Metagenomics Reveals Previously Unrecognized Diversity of Antibiotic Resistance Genes in Gulls

    PubMed Central

    Martiny, Adam C.; Martiny, Jennifer B. H.; Weihe, Claudia; Field, Andrew; Ellis, Julie C.

    2011-01-01

    Wildlife may facilitate the spread of antibiotic resistance (AR) between human-dominated habitats and the surrounding environment. Here, we use functional metagenomics to survey the diversity and genomic context of AR genes in gulls. Using this approach, we found a variety of AR genes not previously detected in gulls and wildlife, including class A and C β-lactamases as well as six tetracycline resistance gene types. An analysis of the flanking sequences indicates that most of these genes are present in Enterobacteriaceae and various Gram-positive bacteria. In addition to finding known gene types, we detected 31 previously undescribed AR genes. These undescribed genes include one most similar to an uncharacterized gene in Verrucomicrobium and another to a putative DNA repair protein in Lactobacillus. Overall, the study more than doubled the number of clinically relevant AR gene types known to be carried by gulls or by wildlife in general. Together with the propensity of gulls to visit human-dominated habitats, this high diversity of AR gene types suggests that gulls could facilitate the spread of AR. PMID:22347872

  10. Multiple Herbicide Resistance in Lolium multiflorum and Identification of Conserved Regulatory Elements of Herbicide Resistance Genes.

    PubMed

    Mahmood, Khalid; Mathiassen, Solvejg K; Kristensen, Michael; Kudsk, Per

    2016-01-01

    Herbicide resistance is a ubiquitous challenge to herbicide sustainability and a looming threat to control weeds in crops. Recently four genes were found constituently over-expressed in herbicide resistant individuals of Lolium rigidum, a close relative of Lolium multiflorum. These include two cytochrome P450s, one nitronate monooxygenase and one glycosyl-transferase. Higher expressions of these four herbicide metabolism related (HMR) genes were also observed after herbicides exposure in the gene expression databases, indicating them as reliable markers. In order to get an overview of herbicidal resistance status of L. multiflorum L, 19 field populations were collected. Among these populations, four populations were found to be resistant to acetolactate synthase (ALS) inhibitors while three exhibited resistance to acetyl-CoA carboxylase (ACCase) inhibitors in our initial screening and dose response study. The genotyping showed the presence of mutations Trp-574-Leu and Ile-2041-Asn in ALS and ACCase, respectively, and qPCR experiments revealed the enhanced expression of HMR genes in individuals of certain resistant populations. Moreover, co-expression networks and promoter analyses of HMR genes in O. sativa and A. thaliana resulted in the identification of a cis-regulatory motif and zinc finger transcription factors. The identified transcription factors were highly expressed similar to HMR genes in response to xenobiotics whereas the identified motif is known to play a vital role in coping with environmental stresses and maintaining genome stability. Overall, our findings provide an important step forward toward a better understanding of metabolism-based herbicide resistance that can be utilized to devise novel strategies of weed management. PMID:27547209

  11. Multiple Herbicide Resistance in Lolium multiflorum and Identification of Conserved Regulatory Elements of Herbicide Resistance Genes

    PubMed Central

    Mahmood, Khalid; Mathiassen, Solvejg K.; Kristensen, Michael; Kudsk, Per

    2016-01-01

    Herbicide resistance is a ubiquitous challenge to herbicide sustainability and a looming threat to control weeds in crops. Recently four genes were found constituently over-expressed in herbicide resistant individuals of Lolium rigidum, a close relative of Lolium multiflorum. These include two cytochrome P450s, one nitronate monooxygenase and one glycosyl-transferase. Higher expressions of these four herbicide metabolism related (HMR) genes were also observed after herbicides exposure in the gene expression databases, indicating them as reliable markers. In order to get an overview of herbicidal resistance status of L. multiflorum L, 19 field populations were collected. Among these populations, four populations were found to be resistant to acetolactate synthase (ALS) inhibitors while three exhibited resistance to acetyl-CoA carboxylase (ACCase) inhibitors in our initial screening and dose response study. The genotyping showed the presence of mutations Trp-574-Leu and Ile-2041-Asn in ALS and ACCase, respectively, and qPCR experiments revealed the enhanced expression of HMR genes in individuals of certain resistant populations. Moreover, co-expression networks and promoter analyses of HMR genes in O. sativa and A. thaliana resulted in the identification of a cis-regulatory motif and zinc finger transcription factors. The identified transcription factors were highly expressed similar to HMR genes in response to xenobiotics whereas the identified motif is known to play a vital role in coping with environmental stresses and maintaining genome stability. Overall, our findings provide an important step forward toward a better understanding of metabolism-based herbicide resistance that can be utilized to devise novel strategies of weed management. PMID:27547209

  12. Plant Genetic Background Increasing the Efficiency and Durability of Major Resistance Genes to Root-knot Nematodes Can Be Resolved into a Few Resistance QTLs

    PubMed Central

    Barbary, Arnaud; Djian-Caporalino, Caroline; Marteu, Nathalie; Fazari, Ariane; Caromel, Bernard; Castagnone-Sereno, Philippe; Palloix, Alain

    2016-01-01

    With the banning of most chemical nematicides, the control of root-knot nematodes (RKNs) in vegetable crops is now based essentially on the deployment of single, major resistance genes (R-genes). However, these genes are rare and their efficacy is threatened by the capacity of RKNs to adapt. In pepper, several dominant R-genes are effective against RKNs, and their efficacy and durability have been shown to be greater in a partially resistant genetic background. However, the genetic determinants of this partial resistance were unknown. Here, a quantitative trait loci (QTL) analysis was performed on the F2:3 population from the cross between Yolo Wonder, an accession considered partially resistant or resistant, depending on the RKN species, and Doux Long des Landes, a susceptible cultivar. A genetic linkage map was constructed from 130 F2 individuals, and the 130 F3 families were tested for resistance to the three main RKN species, Meloidogyne incognita, M. arenaria, and M. javanica. For the first time in the pepper-RKN pathosystem, four major QTLs were identified and mapped to two clusters. The cluster on chromosome P1 includes three tightly linked QTLs with specific effects against individual RKN species. The fourth QTL, providing specific resistance to M. javanica, mapped to pepper chromosome P9, which is known to carry multiple NBS–LRR repeats, together with major R-genes for resistance to nematodes and other pathogens. The newly discovered cluster on chromosome P1 has a broad spectrum of action with major additive effects on resistance. These data highlight the role of host QTLs involved in plant-RKN interactions and provide innovative potential for the breeding of new pepper cultivars or rootstocks combining quantitative resistance and major R-genes, to increase both the efficacy and durability of RKN control by resistance genes. PMID:27242835

  13. Plant Genetic Background Increasing the Efficiency and Durability of Major Resistance Genes to Root-knot Nematodes Can Be Resolved into a Few Resistance QTLs.

    PubMed

    Barbary, Arnaud; Djian-Caporalino, Caroline; Marteu, Nathalie; Fazari, Ariane; Caromel, Bernard; Castagnone-Sereno, Philippe; Palloix, Alain

    2016-01-01

    With the banning of most chemical nematicides, the control of root-knot nematodes (RKNs) in vegetable crops is now based essentially on the deployment of single, major resistance genes (R-genes). However, these genes are rare and their efficacy is threatened by the capacity of RKNs to adapt. In pepper, several dominant R-genes are effective against RKNs, and their efficacy and durability have been shown to be greater in a partially resistant genetic background. However, the genetic determinants of this partial resistance were unknown. Here, a quantitative trait loci (QTL) analysis was performed on the F2:3 population from the cross between Yolo Wonder, an accession considered partially resistant or resistant, depending on the RKN species, and Doux Long des Landes, a susceptible cultivar. A genetic linkage map was constructed from 130 F2 individuals, and the 130 F3 families were tested for resistance to the three main RKN species, Meloidogyne incognita, M. arenaria, and M. javanica. For the first time in the pepper-RKN pathosystem, four major QTLs were identified and mapped to two clusters. The cluster on chromosome P1 includes three tightly linked QTLs with specific effects against individual RKN species. The fourth QTL, providing specific resistance to M. javanica, mapped to pepper chromosome P9, which is known to carry multiple NBS-LRR repeats, together with major R-genes for resistance to nematodes and other pathogens. The newly discovered cluster on chromosome P1 has a broad spectrum of action with major additive effects on resistance. These data highlight the role of host QTLs involved in plant-RKN interactions and provide innovative potential for the breeding of new pepper cultivars or rootstocks combining quantitative resistance and major R-genes, to increase both the efficacy and durability of RKN control by resistance genes. PMID:27242835

  14. Fine Genetic Mapping Localizes Cucumber Scab Resistance Gene Ccu into an R Gene Cluster

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The scab caused by Cladosporium cucumerinum, is an important disease of cucumber, Cucumis sativus. In this study, we conducted fine genetic mapping of the single dominant scab resistance gene, Ccu, with 148 F9 recombination inbreeding lines (RILs) and 1,944 F2 plants derived from the resistant cucum...

  15. Paleo-evolutionary plasticity of plant disease resistance genes

    PubMed Central

    2014-01-01

    Background The recent access to a large set of genome sequences, combined with a robust evolutionary scenario of modern monocot (i.e. grasses) and eudicot (i.e. rosids) species from their founder ancestors, offered the opportunity to gain insights into disease resistance genes (R-genes) evolutionary plasticity. Results We unravel in the current article (i) a R-genes repertoire consisting in 7883 for monocots and 15758 for eudicots, (ii) a contrasted R-genes conservation with 23.8% for monocots and 6.6% for dicots, (iii) a minimal ancestral founder pool of 384 R-genes for the monocots and 150 R-genes for the eudicots, (iv) a general pattern of organization in clusters accounting for more than 60% of mapped R-genes, (v) a biased deletion of ancestral duplicated R-genes between paralogous blocks possibly compensated by clusterization, (vi) a bias in R-genes clusterization where Leucine-Rich Repeats act as a ‘glue’ for domain association, (vii) a R-genes/miRNAs interome enriched toward duplicated R-genes. Conclusions Together, our data may suggest that R-genes family plasticity operated during plant evolution (i) at the structural level through massive duplicates loss counterbalanced by massive clusterization following polyploidization; as well as at (ii) the regulation level through microRNA/R-gene interactions acting as a possible source of functional diploidization of structurally retained R-genes duplicates. Such evolutionary shuffling events leaded to CNVs (i.e. Copy Number Variation) and PAVs (i.e. Presence Absence Variation) between related species operating in the decay of R-genes colinearity between plant species. PMID:24617999

  16. The wheat Lr34 gene provides resistance against multiple fungal pathogens in barley.

    PubMed

    Risk, Joanna M; Selter, Liselotte L; Chauhan, Harsh; Krattinger, Simon G; Kumlehn, Jochen; Hensel, Goetz; Viccars, Libby A; Richardson, Terese M; Buesing, Gabriele; Troller, Anna; Lagudah, Evans S; Keller, Beat

    2013-09-01

    The Lr34 gene encodes an ABC transporter and has provided wheat with durable, broad-spectrum resistance against multiple fungal pathogens for over 100 years. Because barley does not have an Lr34 ortholog, we expressed Lr34 in barley to investigate its potential as a broad-spectrum resistance resource in another grass species. We found that introduction of the genomic Lr34 sequence confers resistance against barley leaf rust and barley powdery mildew, two pathogens specific for barley but not virulent on wheat. In addition, the barley lines showed enhanced resistance against wheat stem rust. Transformation with the Lr34 cDNA or the genomic susceptible Lr34 allele did not result in increased resistance. Unlike wheat, where Lr34-conferred resistance is associated with adult plants, the genomic Lr34 transgenic barley lines exhibited multipathogen resistance in seedlings. These transgenic barley lines also developed leaf tip necrosis (LTN) in young seedlings, which correlated with an up-regulation of senescence marker genes and several pathogenesis-related (PR) genes. In wheat, transcriptional expression of Lr34 is highest in adult plants and correlates with increased resistance and LTN affecting the last emerging leaf. The severe phenotype of transgenic Lr34 barley resulted in reduced plant growth and total grain weight. These results demonstrate that Lr34 provides enhanced multipathogen resistance early in barley plant development and implies the conservation of the substrate and mechanism of the LR34 transporter and its molecular action between wheat and barley. With controlled gene expression, the use of Lr34 may be valuable for many cereal breeding programmes, particularly given its proven durability.

  17. Evaluating antibiotic resistance genes in soils with applied manures

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Antibiotics are commonly used in livestock production to promote growth and combat disease. Recent studies have shown the potential for spread of antibiotic resistance genes (ARG) to the environment following application of livestock manures. In this study, concentrations of bacteria with ARG in soi...

  18. Multidrug resistance protein gene expression in Trichoplusia ni caterpillars.

    PubMed

    Simmons, Jason; D'Souza, Olivia; Rheault, Mark; Donly, Cam

    2013-02-01

    Many insect species exhibit pesticide-resistant phenotypes. One of the mechanisms capable of contributing to resistance is the overexpression of multidrug resistance (MDR) transporter proteins. Here we describe the cloning of three genes encoding MDR proteins from Trichoplusia ni: trnMDR1, trnMDR2 and trnMDR3. Real-time quantitative PCR (qPCR) detected trnMDR mRNA in the whole nervous system, midgut and Malpighian tubules of final instar T. ni caterpillars. To test whether these genes are upregulated in response to chemical challenge in this insect, qPCR was used to compare trnMDR mRNA levels in unchallenged insects with those of insects fed the synthetic pyrethroid, deltamethrin. Only limited increases were detected in a single gene, trnMDR2, which is the most weakly expressed of the three MDR genes, suggesting that increased multidrug resistance of this type is not a significant part of the response to deltamethrin exposure.

  19. Identification of blast resistance genes for managing rice blast disease

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Rice blast, caused by the fungal pathogen Magnaporthe oryzae, is one of the most devastating diseases worldwide. In the present study, an international set of monogenic differentials carrying 24 major blast resistance (R) genes (Pia, Pib, Pii, Pik, Pik-h, Pik-m, Pik-p, Pik-s, Pish, Pit, Pita, Pita2,...

  20. UDP-galactose and acetyl-CoA transporters as Plasmodium multidrug resistance genes.

    PubMed

    Lim, Michelle Yi-Xiu; LaMonte, Gregory; Lee, Marcus C S; Reimer, Christin; Tan, Bee Huat; Corey, Victoria; Tjahjadi, Bianca F; Chua, Adeline; Nachon, Marie; Wintjens, René; Gedeck, Peter; Malleret, Benoit; Renia, Laurent; Bonamy, Ghislain M C; Ho, Paul Chi-Lui; Yeung, Bryan K S; Chow, Eric D; Lim, Liting; Fidock, David A; Diagana, Thierry T; Winzeler, Elizabeth A; Bifani, Pablo

    2016-01-01

    A molecular understanding of drug resistance mechanisms enables surveillance of the effectiveness of new antimicrobial therapies during development and deployment in the field. We used conventional drug resistance selection as well as a regime of limiting dilution at early stages of drug treatment to probe two antimalarial imidazolopiperazines, KAF156 and GNF179. The latter approach permits the isolation of low-fitness mutants that might otherwise be out-competed during selection. Whole-genome sequencing of 24 independently derived resistant Plasmodium falciparum clones revealed four parasites with mutations in the known cyclic amine resistance locus (pfcarl) and a further 20 with mutations in two previously unreported P. falciparum drug resistance genes, an acetyl-CoA transporter (pfact) and a UDP-galactose transporter (pfugt). Mutations were validated both in vitro by CRISPR editing in P. falciparum and in vivo by evolution of resistant Plasmodium berghei mutants. Both PfACT and PfUGT were localized to the endoplasmic reticulum by fluorescence microscopy. As mutations in pfact and pfugt conveyed resistance against additional unrelated chemical scaffolds, these genes are probably involved in broad mechanisms of antimalarial drug resistance. PMID:27642791

  1. UDP-galactose and acetyl-CoA transporters as Plasmodium multidrug resistance genes.

    PubMed

    Lim, Michelle Yi-Xiu; LaMonte, Gregory; Lee, Marcus C S; Reimer, Christin; Tan, Bee Huat; Corey, Victoria; Tjahjadi, Bianca F; Chua, Adeline; Nachon, Marie; Wintjens, René; Gedeck, Peter; Malleret, Benoit; Renia, Laurent; Bonamy, Ghislain M C; Ho, Paul Chi-Lui; Yeung, Bryan K S; Chow, Eric D; Lim, Liting; Fidock, David A; Diagana, Thierry T; Winzeler, Elizabeth A; Bifani, Pablo

    2016-09-19

    A molecular understanding of drug resistance mechanisms enables surveillance of the effectiveness of new antimicrobial therapies during development and deployment in the field. We used conventional drug resistance selection as well as a regime of limiting dilution at early stages of drug treatment to probe two antimalarial imidazolopiperazines, KAF156 and GNF179. The latter approach permits the isolation of low-fitness mutants that might otherwise be out-competed during selection. Whole-genome sequencing of 24 independently derived resistant Plasmodium falciparum clones revealed four parasites with mutations in the known cyclic amine resistance locus (pfcarl) and a further 20 with mutations in two previously unreported P. falciparum drug resistance genes, an acetyl-CoA transporter (pfact) and a UDP-galactose transporter (pfugt). Mutations were validated both in vitro by CRISPR editing in P. falciparum and in vivo by evolution of resistant Plasmodium berghei mutants. Both PfACT and PfUGT were localized to the endoplasmic reticulum by fluorescence microscopy. As mutations in pfact and pfugt conveyed resistance against additional unrelated chemical scaffolds, these genes are probably involved in broad mechanisms of antimalarial drug resistance.

  2. Receiving Wear-Resistance Coverings Additives of Nanoparticles of Refractory Metals at a Laser Cladding

    NASA Astrophysics Data System (ADS)

    Murzakov, M. A.; Petrovskiy, V. N.; Bykovskiy, D. P.; Andreev, A. O.; Birukov, V. P.; Markushov, Y. V.

    2016-02-01

    Laser cladding technology was used to conduct experiments on production of wear-resistant coatings with additive nanoparticles of refractory metals (WC, TaC). Mechanical testing of coating abrasion was made using Brinell-Howarth method. The obtained data was compared with wear- resistance of commercial powder containing WC. It was found that at a concentration 10-15% coating with nanopowder additives shows a dramatic increase in wear-resistance by 4-6 times as compared to carbon steel substrate. There were conducted metallurgical studies of coatings on inverse electron reflection. There was determined elemental composition of deposited coating and substrate, and microhardness measured. It was found that structure of deposited coating with nanoparticles is fine.

  3. Positional cloning of the murine flavivirus resistance gene.

    PubMed

    Perelygin, Andrey A; Scherbik, Svetlana V; Zhulin, Igor B; Stockman, Bronislava M; Li, Yan; Brinton, Margo A

    2002-07-01

    Inbred mouse strains exhibit significant differences in their susceptibility to viruses in the genus Flavivirus, which includes human pathogens such as yellow fever, Dengue, and West Nile virus. A single gene, designated Flv, confers this differential susceptibility and was mapped previously to a region of mouse chromosome 5. A positional cloning strategy was used to identify 22 genes from the Flv gene interval including 10 members of the 2'-5'-oligoadenylate synthetase gene family. One 2'-5'-oligoadenylate synthetase gene, Oas1b, was identified as Flv by correlation between genotype and phenotype in nine mouse strains. Susceptible mouse strains produce a protein lacking 30% of the C-terminal sequence as compared with the resistant counterpart because of the presence of a premature stop codon. The Oas1b gene differs from all the other murine Oas genes by a unique four-amino acid deletion in the P-loop located within the conserved RNA binding domain. Expression of the resistant allele of Oas1b in susceptible embryo fibroblasts resulted in partial inhibition of the replication of a flavivirus but not of an alpha togavirus.

  4. 76 FR 3011 - Black Stem Rust; Additions of Rust-Resistant Varieties

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-01-19

    ... final rule published September 8, 2010, at 75 FR 54461, is confirmed as November 8, 2010. FOR FURTHER... Health Inspection Service 7 CFR Part 301 Black Stem Rust; Additions of Rust-Resistant Varieties AGENCY... final rule. The direct final rule notified the public of our intention to amend the black stem...

  5. Systemic acquired resistance delays race shifts to major resistance genes in bell pepper.

    PubMed

    Romero, A M; Ritchie, D F

    2004-12-01

    ABSTRACT The lack of durability of host plant disease resistance is a major problem in disease control. Genotype-specific resistance that involves major resistance (R) genes is especially prone to failure. The compatible (i.e., disease) host-pathogen interaction with systemic acquired resistance (SAR) has been studied extensively, but the incompatible (i.e., resistant) interaction less so. Using the pepper-bacterial spot (causal agent, Xanthomonas axonopodis pv. vesicatoria) pathosystem, we examined the effect of SAR in reducing the occurrence of race-change mutants that defeat R genes in laboratory, greenhouse, and field experiments. Pepper plants carrying one or more R genes were sprayed with the plant defense activator acibenzolar-S-methyl (ASM) and challenged with incompatible strains of the pathogen. In the greenhouse, disease lesions first were observed 3 weeks after inoculation. ASM-treated plants carrying a major R gene had significantly fewer lesions caused by both the incompatible (i.e., hypersensitive) and compatible (i.e., disease) responses than occurred on nonsprayed plants. Bacteria isolated from the disease lesions were confirmed to be race-change mutants. In field experiments, there was a delay in the detection of race-change mutants and a reduction in disease severity. Decreased disease severity was associated with a reduction in the number of race-change mutants and the suppression of disease caused by the race-change mutants. This suggests a possible mechanism related to a decrease in the pathogen population size, which subsequently reduces the number of race-change mutants for the selection pressure of R genes. Thus, inducers of SAR are potentially useful for increasing the durability of genotype-specific resistance conferred by major R genes.

  6. Gene expression patterns in near isogenic lines for wheat rust resistance gene lr34/yr18.

    PubMed

    Hulbert, S H; Bai, J; Fellers, J P; Pacheco, M G; Bowden, R L

    2007-09-01

    ABSTRACT The Lr34/Yr18 resistance gene provides durable, adult-plant, slow rusting resistance to leaf rust, yellow rust, and several other diseases of wheat. Flag leaves may exhibit spontaneous leaf tip necrosis and tips are more resistant than leaf bases. Despite the importance of this gene, the mechanism of resistance is unknown. Patterns of expression for 55,052 transcripts were examined by microarray analysis in mock-inoculated flag leaves of two pairs of wheat near isogenic lines for Lr34/Yr18 (Jupateco 73S/Jupateco 73R and Thatcher/Thatcher-Lr34). The Thatcher isolines were also examined for patterns of expression after inoculation with leaf rust. Mock-inoculated leaf tips of resistant plants showed up-regulation of 57 transcripts generally associated with ABA inducibility, osmotic stress, cold stress, and/or seed maturation. Several transcripts may be useful as expression markers for Lr34/Yr18. Five transcripts were also up-regulated in resistant leaf bases. The possible role of these transcripts in resistance is discussed. In mock-inoculated plants, pathogenesis-related (PR) proteins were not up-regulated in resistant flag leaves compared with that in susceptible flag leaves. In inoculated plants, the same set of PR proteins was up-regulated in both resistant and susceptible flag leaves. However, expression was often higher in resistant plants, suggesting a possible role for Lr34/Yr18 in priming of defense responses.

  7. Unraveling antimicrobial resistance genes and phenotype patterns among Enterococcus faecalis isolated from retail chicken products in Japan.

    PubMed

    Hidano, Arata; Yamamoto, Takehisa; Hayama, Yoko; Muroga, Norihiko; Kobayashi, Sota; Nishida, Takeshi; Tsutsui, Toshiyuki

    2015-01-01

    Multidrug-resistant enterococci are considered crucial drivers for the dissemination of antimicrobial resistance determinants within and beyond a genus. These organisms may pass numerous resistance determinants to other harmful pathogens, whose multiple resistances would cause adverse consequences. Therefore, an understanding of the coexistence epidemiology of resistance genes is critical, but such information remains limited. In this study, our first objective was to determine the prevalence of principal resistance phenotypes and genes among Enterococcus faecalis isolated from retail chicken domestic products collected throughout Japan. Subsequent analysis of these data by using an additive Bayesian network (ABN) model revealed the co-appearance patterns of resistance genes and identified the associations between resistance genes and phenotypes. The common phenotypes observed among E. faecalis isolated from the domestic products were the resistances to oxytetracycline (58.4%), dihydrostreptomycin (50.4%), and erythromycin (37.2%), and the gene tet(L) was detected in 46.0% of the isolates. The ABN model identified statistically significant associations between tet(L) and erm(B), tet(L) and ant(6)-Ia, ant(6)-Ia and aph(3')-IIIa, and aph(3')-IIIa and erm(B), which indicated that a multiple-resistance profile of tetracycline, erythromycin, streptomycin, and kanamycin is systematic rather than random. Conversely, the presence of tet(O) was only negatively associated with that of erm(B) and tet(M), which suggested that in the presence of tet(O), the aforementioned multiple resistance is unlikely to be observed. Such heterogeneity in linkages among genes that confer the same phenotypic resistance highlights the importance of incorporating genetic information when investigating the risk factors for the spread of resistance. The epidemiological factors that underlie the persistence of systematic multiple-resistance patterns warrant further investigations with appropriate

  8. Unraveling Antimicrobial Resistance Genes and Phenotype Patterns among Enterococcus faecalis Isolated from Retail Chicken Products in Japan

    PubMed Central

    Hidano, Arata; Yamamoto, Takehisa; Hayama, Yoko; Muroga, Norihiko; Kobayashi, Sota; Nishida, Takeshi; Tsutsui, Toshiyuki

    2015-01-01

    Multidrug-resistant enterococci are considered crucial drivers for the dissemination of antimicrobial resistance determinants within and beyond a genus. These organisms may pass numerous resistance determinants to other harmful pathogens, whose multiple resistances would cause adverse consequences. Therefore, an understanding of the coexistence epidemiology of resistance genes is critical, but such information remains limited. In this study, our first objective was to determine the prevalence of principal resistance phenotypes and genes among Enterococcus faecalis isolated from retail chicken domestic products collected throughout Japan. Subsequent analysis of these data by using an additive Bayesian network (ABN) model revealed the co-appearance patterns of resistance genes and identified the associations between resistance genes and phenotypes. The common phenotypes observed among E. faecalis isolated from the domestic products were the resistances to oxytetracycline (58.4%), dihydrostreptomycin (50.4%), and erythromycin (37.2%), and the gene tet(L) was detected in 46.0% of the isolates. The ABN model identified statistically significant associations between tet(L) and erm(B), tet(L) and ant(6)-Ia, ant(6)-Ia and aph(3’)-IIIa, and aph(3’)-IIIa and erm(B), which indicated that a multiple-resistance profile of tetracycline, erythromycin, streptomycin, and kanamycin is systematic rather than random. Conversely, the presence of tet(O) was only negatively associated with that of erm(B) and tet(M), which suggested that in the presence of tet(O), the aforementioned multiple resistance is unlikely to be observed. Such heterogeneity in linkages among genes that confer the same phenotypic resistance highlights the importance of incorporating genetic information when investigating the risk factors for the spread of resistance. The epidemiological factors that underlie the persistence of systematic multiple-resistance patterns warrant further investigations with

  9. CRISPR-Cas and Restriction-Modification Act Additively against Conjugative Antibiotic Resistance Plasmid Transfer in Enterococcus faecalis.

    PubMed

    Price, Valerie J; Huo, Wenwen; Sharifi, Ardalan; Palmer, Kelli L

    2016-01-01

    Enterococcus faecalis is an opportunistic pathogen and a leading cause of nosocomial infections. Conjugative pheromone-responsive plasmids are narrow-host-range mobile genetic elements (MGEs) that are rapid disseminators of antibiotic resistance in the faecalis species. Clustered regularly interspaced short palindromic repeat (CRISPR)-Cas and restriction-modification confer acquired and innate immunity, respectively, against MGE acquisition in bacteria. Most multidrug-resistant E. faecalis isolates lack CRISPR-Cas and possess an orphan locus lacking cas genes, CRISPR2, that is of unknown function. Little is known about restriction-modification defense in E. faecalis. Here, we explore the hypothesis that multidrug-resistant E. faecalis strains are immunocompromised. We assessed MGE acquisition by E. faecalis T11, a strain closely related to the multidrug-resistant hospital isolate V583 but which lacks the ~620 kb of horizontally acquired genome content that characterizes V583. T11 possesses the E. faecalis CRISPR3-cas locus and a predicted restriction-modification system, neither of which occurs in V583. We demonstrate that CRISPR-Cas and restriction-modification together confer a 4-log reduction in acquisition of the pheromone-responsive plasmid pAM714 in biofilm matings. Additionally, we show that the orphan CRISPR2 locus is functional for genome defense against another pheromone-responsive plasmid, pCF10, only in the presence of cas9 derived from the E. faecalis CRISPR1-cas locus, which most multidrug-resistant E. faecalis isolates lack. Overall, our work demonstrated that the loss of only two loci led to a dramatic reduction in genome defense against a clinically relevant MGE, highlighting the critical importance of the E. faecalis accessory genome in modulating horizontal gene transfer. Our results rationalize the development of antimicrobial strategies that capitalize upon the immunocompromised status of multidrug-resistant E. faecalis. IMPORTANCE

  10. CRISPR-Cas and Restriction-Modification Act Additively against Conjugative Antibiotic Resistance Plasmid Transfer in Enterococcus faecalis.

    PubMed

    Price, Valerie J; Huo, Wenwen; Sharifi, Ardalan; Palmer, Kelli L

    2016-01-01

    Enterococcus faecalis is an opportunistic pathogen and a leading cause of nosocomial infections. Conjugative pheromone-responsive plasmids are narrow-host-range mobile genetic elements (MGEs) that are rapid disseminators of antibiotic resistance in the faecalis species. Clustered regularly interspaced short palindromic repeat (CRISPR)-Cas and restriction-modification confer acquired and innate immunity, respectively, against MGE acquisition in bacteria. Most multidrug-resistant E. faecalis isolates lack CRISPR-Cas and possess an orphan locus lacking cas genes, CRISPR2, that is of unknown function. Little is known about restriction-modification defense in E. faecalis. Here, we explore the hypothesis that multidrug-resistant E. faecalis strains are immunocompromised. We assessed MGE acquisition by E. faecalis T11, a strain closely related to the multidrug-resistant hospital isolate V583 but which lacks the ~620 kb of horizontally acquired genome content that characterizes V583. T11 possesses the E. faecalis CRISPR3-cas locus and a predicted restriction-modification system, neither of which occurs in V583. We demonstrate that CRISPR-Cas and restriction-modification together confer a 4-log reduction in acquisition of the pheromone-responsive plasmid pAM714 in biofilm matings. Additionally, we show that the orphan CRISPR2 locus is functional for genome defense against another pheromone-responsive plasmid, pCF10, only in the presence of cas9 derived from the E. faecalis CRISPR1-cas locus, which most multidrug-resistant E. faecalis isolates lack. Overall, our work demonstrated that the loss of only two loci led to a dramatic reduction in genome defense against a clinically relevant MGE, highlighting the critical importance of the E. faecalis accessory genome in modulating horizontal gene transfer. Our results rationalize the development of antimicrobial strategies that capitalize upon the immunocompromised status of multidrug-resistant E. faecalis. IMPORTANCE

  11. CRISPR-Cas and Restriction-Modification Act Additively against Conjugative Antibiotic Resistance Plasmid Transfer in Enterococcus faecalis

    PubMed Central

    Price, Valerie J.; Huo, Wenwen; Sharifi, Ardalan

    2016-01-01

    ABSTRACT Enterococcus faecalis is an opportunistic pathogen and a leading cause of nosocomial infections. Conjugative pheromone-responsive plasmids are narrow-host-range mobile genetic elements (MGEs) that are rapid disseminators of antibiotic resistance in the faecalis species. Clustered regularly interspaced short palindromic repeat (CRISPR)-Cas and restriction-modification confer acquired and innate immunity, respectively, against MGE acquisition in bacteria. Most multidrug-resistant E. faecalis isolates lack CRISPR-Cas and possess an orphan locus lacking cas genes, CRISPR2, that is of unknown function. Little is known about restriction-modification defense in E. faecalis. Here, we explore the hypothesis that multidrug-resistant E. faecalis strains are immunocompromised. We assessed MGE acquisition by E. faecalis T11, a strain closely related to the multidrug-resistant hospital isolate V583 but which lacks the ~620 kb of horizontally acquired genome content that characterizes V583. T11 possesses the E. faecalis CRISPR3-cas locus and a predicted restriction-modification system, neither of which occurs in V583. We demonstrate that CRISPR-Cas and restriction-modification together confer a 4-log reduction in acquisition of the pheromone-responsive plasmid pAM714 in biofilm matings. Additionally, we show that the orphan CRISPR2 locus is functional for genome defense against another pheromone-responsive plasmid, pCF10, only in the presence of cas9 derived from the E. faecalis CRISPR1-cas locus, which most multidrug-resistant E. faecalis isolates lack. Overall, our work demonstrated that the loss of only two loci led to a dramatic reduction in genome defense against a clinically relevant MGE, highlighting the critical importance of the E. faecalis accessory genome in modulating horizontal gene transfer. Our results rationalize the development of antimicrobial strategies that capitalize upon the immunocompromised status of multidrug-resistant E

  12. Heavy metal and disinfectant resistance genes among livestock-associated methicillin-resistant Staphylococcus aureus isolates.

    PubMed

    Argudín, M Angeles; Lauzat, Birgit; Kraushaar, Britta; Alba, Patricia; Agerso, Yvonne; Cavaco, Lina; Butaye, Patrick; Porrero, M Concepción; Battisti, Antonio; Tenhagen, Bernd-Alois; Fetsch, Alexandra; Guerra, Beatriz

    2016-08-15

    Livestock associated methicillin-resistant Staphylococcus aureus (LA-MRSA) has emerged in animal production worldwide. Most LA-MRSA in Europe belong to the clonal complex (CC) 398. The reason for the LA-MRSA emergence is not fully understood. Besides antimicrobial agents used for therapy, other substances with antimicrobial activity applied in animal feed, including metal-containing compounds might contribute to their selection. Some of these genes have been found in various novel SCCmec cassettes. The aim of this study was to assess the occurrence of metal-resistance genes among a LA-S. aureus collection [n=554, including 542 MRSA and 12 methicillin-susceptible S. aureus (MSSA)] isolated from livestock and food thereof. Most LA-MRSA isolates (76%) carried at least one metal-resistance gene. Among the LA-MRSA CC398 isolates (n=456), 4.8%, 0.2%, 24.3% and 71.5% were positive for arsA (arsenic compounds), cadD (cadmium), copB (copper) and czrC (zinc/cadmium) resistance genes, respectively. In contrast, among the LA-MRSA non-CC398 isolates (n=86), 1.2%, 18.6% and 16.3% were positive for the cadD, copB and czrC genes, respectively, and none were positive for arsA. Of the LA-MRSA CC398 isolates, 72% carried one metal-resistance gene, and the remaining harboured two or more in different combinations. Differences between LA-MRSA CC398 and non-CC398 were statistically significant for arsA and czrC. The czrC gene was almost exclusively found (98%) in the presence of SCCmec V in both CC398 and non-CC398 LA-MRSA isolates from different sources. Regarding the LA-MSSA isolates (n=12), some (n=4) were also positive for metal-resistance genes. This study shows that genes potentially conferring metal-resistance are frequently present in LA-MRSA.

  13. Identification of wheat chromosomal regions containing expressed resistance genes.

    PubMed Central

    Dilbirligi, Muharrem; Erayman, Mustafa; Sandhu, Devinder; Sidhu, Deepak; Gill, Kulvinder S

    2004-01-01

    The objectives of this study were to isolate and physically localize expressed resistance (R) genes on wheat chromosomes. Irrespective of the host or pest type, most of the 46 cloned R genes from 12 plant species share a strong sequence similarity, especially for protein domains and motifs. By utilizing this structural similarity to perform modified RNA fingerprinting and data mining, we identified 184 putative expressed R genes of wheat. These include 87 NB/LRR types, 16 receptor-like kinases, and 13 Pto-like kinases. The remaining were seven Hm1 and two Hs1(pro-1) homologs, 17 pathogenicity related, and 42 unique NB/kinases. About 76% of the expressed R-gene candidates were rare transcripts, including 42 novel sequences. Physical mapping of 121 candidate R-gene sequences using 339 deletion lines localized 310 loci to 26 chromosomal regions encompassing approximately 16% of the wheat genome. Five major R-gene clusters that spanned only approximately 3% of the wheat genome but contained approximately 47% of the candidate R genes were observed. Comparative mapping localized 91% (82 of 90) of the phenotypically characterized R genes to 18 regions where 118 of the R-gene sequences mapped. PMID:15020436

  14. Effects of V addition on recrystallization resistance of 7150 aluminum alloy after simulative hot deformation

    SciTech Connect

    Lai, Jing; Shi, Cangji; Chen, X.-Grant

    2014-10-15

    The effects of different V contents (0.01 to 0.19 wt.%) on the recrystallization resistance of 7150 aluminum alloys during post-deformation heat treatment were investigated. The microstructural evolutions at as-cast, as-homogenized conditions and after post-deformation annealing were studied using optical, scanning electron and transmission electron microscopes and using the electron backscattered diffraction technique. The precipitation of Al{sub 21}V{sub 2} dispersoids was observed in alloys containing 0.11 to 0.19 wt.% V after homogenization. The dispersoids were mainly distributed in the dendrite cells, and the precipitate-free zones occurred in the interdendritic regions and near grain boundaries. V addition could significantly enhance the recrystallization resistance during post-deformation annealing, particularly in the presence of a great number of Al{sub 21}V{sub 2} dispersoids. Recrystallized grain growth was effectively restricted because of the dispersoid pinning effect. The alloy containing 0.15 wt.% V exhibited the highest recrystallization resistance amongst all V-containing alloys studied. - Highlights: • Investigated the effect of V level on microstructure and flow stress of 7150 alloys • Characterized microstructures using optical microscopy, SEM, TEM and EBSD • Described the precipitation behavior of V-dispersoids in the dendritic structure • Studied the V effect on recrystallization resistance during post heat treatment • V addition greatly enhanced the recrystallization resistance during annealing.

  15. Transgenic sugarcane resistant to Sorghum mosaic virus based on coat protein gene silencing by RNA interference.

    PubMed

    Guo, Jinlong; Gao, Shiwu; Lin, Qinliang; Wang, Hengbo; Que, Youxiong; Xu, Liping

    2015-01-01

    As one of the critical diseases of sugarcane, sugarcane mosaic disease can lead to serious decline in stalk yield and sucrose content. It is mainly caused by Potyvirus sugarcane mosaic virus (SCMV) and/or Sorghum mosaic virus (SrMV), with additional differences in viral strains. RNA interference (RNAi) is a novel strategy for producing viral resistant plants. In this study, based on multiple sequence alignment conducted on genomic sequences of different strains and isolates of SrMV, the conserved region of coat protein (CP) genes was selected as the target gene and the interference sequence with size of 423 bp in length was obtained through PCR amplification. The RNAi vector pGII00-HACP with an expression cassette containing both hairpin interference sequence and cp4-epsps herbicide-tolerant gene was transferred to sugarcane cultivar ROC22 via Agrobacterium-mediated transformation. After herbicide screening, PCR molecular identification, and artificial inoculation challenge, anti-SrMV positive transgenic lines were successfully obtained. SrMV resistance rate of the transgenic lines with the interference sequence was 87.5% based on SrMV challenge by artificial inoculation. The genetically modified SrMV-resistant lines of cultivar ROC22 provide resistant germplasm for breeding lines and can also serve as resistant lines having the same genetic background for study of resistance mechanisms.

  16. Novel Nickel Resistance Genes from the Rhizosphere Metagenome of Plants Adapted to Acid Mine Drainage▿ †

    PubMed Central

    Mirete, Salvador; de Figueras, Carolina G.; González-Pastor, Jose E.

    2007-01-01

    Metal resistance determinants have traditionally been found in cultivated bacteria. To search for genes involved in nickel resistance, we analyzed the bacterial community of the rhizosphere of Erica andevalensis, an endemic heather which grows at the banks of the Tinto River, a naturally metal-enriched and extremely acidic environment in southwestern Spain. 16S rRNA gene sequence analysis of rhizosphere DNA revealed the presence of members of five phylogenetic groups of Bacteria and the two main groups of Archaea mostly associated with sites impacted by acid mine drainage (AMD). The diversity observed and the presence of heavy metals in the rhizosphere led us to construct and screen five different metagenomic libraries hosted in Escherichia coli for searching novel nickel resistance determinants. A total of 13 positive clones were detected and analyzed. Insights about their possible mechanisms of resistance were obtained from cellular nickel content and sequence similarities. Two clones encoded putative ABC transporter components, and a novel mechanism of metal efflux is suggested. In addition, a nickel hyperaccumulation mechanism is proposed for a clone encoding a serine O-acetyltransferase. Five clones encoded proteins similar to well-characterized proteins but not previously reported to be related to nickel resistance, and the remaining six clones encoded hypothetical or conserved hypothetical proteins of uncertain functions. This is the first report documenting nickel resistance genes recovered from the metagenome of an AMD environment. PMID:17675438

  17. Relation between Resistance to Antipseudomonal β-Lactams and ampC and mexC Genes of Pseudomonas aeruginosa

    PubMed Central

    Rezaei, Fatemeh; Saderi, Horieh; Boroumandi, Shahrsam; Faghihzadeh, Soghrat

    2016-01-01

    Background: In order to select a better antibiotic choice for treatment of Pseudomonas aeruginosa infections, this study was conducted to determine the frequency of resistance to some antipseudomonal β-lactams in P. aeruginosa isolates from patients in Tehran, Iran. In addition, the relation between presence of genes known to be responsible for resistance to β-lactams (ampC, mexC1,2, and mexC3,4 genes) and resistance phenotype among P. aeroginosa isolates was evaluated. Methods: P. aeruginosa strains were isolated and identified by routine methods and PCR for oprL gene. Disk diffusion method was employed to determine the antimicrobial susceptibility pattern according to CLSI recommendations. PCR was used to detect the resistance genes. Results: Among 100 isolates of P. aeruginosa, 82% had ampC, 86% mexC1,2 and 89% mexC3,4 genes and combinations of these genes were seen in most of isolates and only 3% of isolates had none of these genes. Resistance to mezlocillin, cefepime, ceftazidime and piperacillin/ tazobactam was seen in 46%, 41%, 36% and 29% of isolates, respectively. Significant relation (P value ≤0.05 by Chi-square or Fisher Exact test) was observed between the presence of ampC gene and resistance to all the studied β-lactams in this study. No relation was observed for mexC genes, although many of isolates containing these two genes were phenotypically resistant. Discussion: This study had shown for the first time, the presence of ampC and mexC genes in significant percent of clinical isolates of P. aeruginosa in Tehran, Iran, and relation between presence of ampC gene and resistance to β-lactams. PMID:26870143

  18. Fine-scale analysis of parasite resistance genes in the red flour beetle, Tribolium castaneum.

    PubMed

    Zhong, Daibin; Pai, Aditi; Wang, Mei-Hui; Keech, Naomi; Yan, Guiyun

    2013-09-01

    Parasite infection impacts population dynamics through effects on fitness and fecundity of the individual host. In addition to the known roles of environmental factors, host susceptibility to parasites has a genetic basis that has not been well characterized. We previously mapped quantitative trait loci (QTL) for susceptibility to rat tapeworm (Hymenolepis diminuta) infection in Tribolium castaneum using dominant AFLP markers; however, the resistance genes were not identified. Here, we refined the QTL locations and increased the marker density in the QTL regions using new microsatellite markers, sequence-tagged site markers, and single-strand conformational polymorphism markers. Resistance QTL in three linkage groups (LG3, LG6, and LG8) were each mapped to intervals <1.0 cM between two codominant markers. The effects of 21 genes in the three QTL regions were investigated by using quantitative RT-PCR analysis, and transcription profiles were obtained from the resistant TIW1 and the susceptible cSM strains. Based on transcription data, eight genes were selected for RNA interference analysis to investigate their possible roles in H. diminuta resistance, including cytochrome P450 (LOC657454) and Toll-like receptor 13 (TLR13, LOC662131). The transcription of P450 and TLR13 genes in the resistant TIW1 strains was reduced more than ninefold relative to the control. Moreover, the effects of gene knockdown of P450 and TLR13 caused resistant beetles to become susceptible to tapeworm infection, which strongly suggests an important role for each in T. castaneum resistance to H. diminuta infection.

  19. A role for Lon protease in the control of the acid resistance genes of Escherichia coli.

    PubMed

    Heuveling, Johanna; Possling, Alexandra; Hengge, Regine

    2008-07-01

    Lon protease is a major protease in cellular protein quality control, but also plays an important regulatory role by degrading various naturally unstable regulators. Here, we traced additional such regulators by identifying regulons with co-ordinately altered expression in a lon mutant by genome-wide transcriptional profiling. Besides many members of the RcsA regulon (which validates our approach as RcsA is a known Lon substrate), many genes of the sigmaS-dependent general stress response were upregulated in the lon mutant. However, the lon mutation did not affect sigmaS levels nor sigmaS activity in general, suggesting specific effects of Lon on secondary regulators involved in the control of subsets of sigmaS-controlled genes. Lon-affected genes also included the major acid resistance genes (gadA, gadBC, gadE, hdeAB and hdeD), which led to the discovery that the essential acid resistance regulator GadE (whose expression is sigmaS-controlled) is degraded in vivo in a Lon-dependent manner. GadE proteolysis is constitutive as it was observed even under conditions that induce the system (i.e. at low pH or during entry into stationary phase). GadE degradation was found to rapidly terminate the acid resistance response upon shift back to neutral pH and to avoid overexpression of acid resistance genes in stationary phase.

  20. Evaluation for Additional Resistance by Lightweight Thrust Restraint on Pressure Pipe Bend

    NASA Astrophysics Data System (ADS)

    Sawada, Yutaka; Kawabata, Toshinori; Mohri, Yoshiyuki; Uchida, Kazunori

    Thrust force acts on pipe bend due to internal pressure. In previous study, the lightweight thrust restraint with geogrid and anchor plate has proposed and the effect has been proved by conducting lateral loading model tests. In the present study, a series of model tests for changing depth of cover and length of restraint were carried out, and image analysis for the ground surface in the model tests were carried out to discuss the failure mechanism of proposed method. Furthermore, the failure mechanisms in front of the anchor plate were assumed and the additional resistances due to the proposed method were calculated based on the force equilibrium. In addition, in order to examine the accuracy for the proposed formula, calculated values were compared with experimental values. As the results, additional resistance from calculation was corresponding to experimental value.

  1. MicroRNAs Suppress NB Domain Genes in Tomato That Confer Resistance to Fusarium oxysporum

    DOE PAGES

    Ouyang, Shouqiang; Park, Gyungsoon; Atamian, Hagop S.; Han, Cliff S.; Stajich, Jason E.; Kaloshian, Isgouhi; Borkovich, Katherine A.

    2014-10-16

    MicroRNAs (miRNAs) suppress the transcriptional and post-transcriptional expression of genes in plants. Several miRNA families target genes encoding nucleotide-binding site–leucine-rich repeat (NB-LRR) plant innate immune receptors. The fungus Fusarium oxysporum f. sp. lycopersici causes vascular wilt disease in tomato. Here, we explored a role for miRNAs in tomato defense against F. oxysporum using comparative miRNA profiling of susceptible (Moneymaker) and resistant (Motelle) tomato cultivars. slmiR482f and slmiR5300 were repressed during infection of Motelle with F. oxysporum. Two predicted mRNA targets each of slmiR482f and slmiR5300 exhibited increased expression in Motelle and the ability of these four targets to be regulatedmore » by the miRNAs was confirmed by co-expression in Nicotiana benthamiana. Silencing of the targets in the resistant Motelle cultivar revealed a role in fungal resistance for all four genes. All four targets encode proteins with full or partial nucleotide-binding (NB) domains. One slmiR5300 target corresponds to tm-2, a susceptible allele of the Tomato Mosaic Virus resistance gene, supporting functions in immunity to a fungal pathogen. The observation that none of the targets correspond to I-2, the only known resistance (R) gene for F. oxysporum in tomato, supports roles for additional R genes in the immune response. In conclusion, taken together, our findings suggest that Moneymaker is highly susceptible because its potential resistance is insufficiently expressed due to the action of miRNAs.« less

  2. MicroRNAs Suppress NB Domain Genes in Tomato That Confer Resistance to Fusarium oxysporum

    SciTech Connect

    Ouyang, Shouqiang; Park, Gyungsoon; Atamian, Hagop S.; Han, Cliff S.; Stajich, Jason E.; Kaloshian, Isgouhi; Borkovich, Katherine A.

    2014-10-16

    MicroRNAs (miRNAs) suppress the transcriptional and post-transcriptional expression of genes in plants. Several miRNA families target genes encoding nucleotide-binding site–leucine-rich repeat (NB-LRR) plant innate immune receptors. The fungus Fusarium oxysporum f. sp. lycopersici causes vascular wilt disease in tomato. Here, we explored a role for miRNAs in tomato defense against F. oxysporum using comparative miRNA profiling of susceptible (Moneymaker) and resistant (Motelle) tomato cultivars. slmiR482f and slmiR5300 were repressed during infection of Motelle with F. oxysporum. Two predicted mRNA targets each of slmiR482f and slmiR5300 exhibited increased expression in Motelle and the ability of these four targets to be regulated by the miRNAs was confirmed by co-expression in Nicotiana benthamiana. Silencing of the targets in the resistant Motelle cultivar revealed a role in fungal resistance for all four genes. All four targets encode proteins with full or partial nucleotide-binding (NB) domains. One slmiR5300 target corresponds to tm-2, a susceptible allele of the Tomato Mosaic Virus resistance gene, supporting functions in immunity to a fungal pathogen. The observation that none of the targets correspond to I-2, the only known resistance (R) gene for F. oxysporum in tomato, supports roles for additional R genes in the immune response. In conclusion, taken together, our findings suggest that Moneymaker is highly susceptible because its potential resistance is insufficiently expressed due to the action of miRNAs.

  3. MicroRNAs Suppress NB Domain Genes in Tomato That Confer Resistance to Fusarium oxysporum

    PubMed Central

    Ouyang, Shouqiang; Park, Gyungsoon; Atamian, Hagop S.; Han, Cliff S.; Stajich, Jason E.; Kaloshian, Isgouhi; Borkovich, Katherine A.

    2014-01-01

    MicroRNAs (miRNAs) suppress the transcriptional and post-transcriptional expression of genes in plants. Several miRNA families target genes encoding nucleotide-binding site–leucine-rich repeat (NB-LRR) plant innate immune receptors. The fungus Fusarium oxysporum f. sp. lycopersici causes vascular wilt disease in tomato. We explored a role for miRNAs in tomato defense against F. oxysporum using comparative miRNA profiling of susceptible (Moneymaker) and resistant (Motelle) tomato cultivars. slmiR482f and slmiR5300 were repressed during infection of Motelle with F. oxysporum. Two predicted mRNA targets each of slmiR482f and slmiR5300 exhibited increased expression in Motelle and the ability of these four targets to be regulated by the miRNAs was confirmed by co-expression in Nicotiana benthamiana. Silencing of the targets in the resistant Motelle cultivar revealed a role in fungal resistance for all four genes. All four targets encode proteins with full or partial nucleotide-binding (NB) domains. One slmiR5300 target corresponds to tm-2, a susceptible allele of the Tomato Mosaic Virus resistance gene, supporting functions in immunity to a fungal pathogen. The observation that none of the targets correspond to I-2, the only known resistance (R) gene for F. oxysporum in tomato, supports roles for additional R genes in the immune response. Taken together, our findings suggest that Moneymaker is highly susceptible because its potential resistance is insufficiently expressed due to the action of miRNAs. PMID:25330340

  4. EPSPS variability, gene expression, and enzymatic activity in glyphosate-resistant biotypes of Digitaria insularis.

    PubMed

    Galeano, E; Barroso, A A M; Vasconcelos, T S; López-Rubio, A; Albrecht, A J P; Victoria Filho, R; Carrer, H

    2016-01-01

    Weed resistance to herbicides is a natural phenomenon that exerts selection on individuals in a population. In Brazil, glyphosate resistance was recently detected in Digitaria insularis. The objective of this study was to elucidate mechanisms of weed resistance in this plant, including genetic variability, allelism, amino acid substitutions, gene expression, and enzymatic activity levels. Most of these have not previously been studied in this species. D. insularis DNA sequences were used to analyze genetic variability. cDNA from resistant and susceptible plants was used to identify mutations, alleles, and 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) expression, using real-time quantitative reverse transcription-polymerase chain reaction. In addition, EPSPS activity was measured. We found a decrease in genetic variability between populations related to glyphosate application. Substitutions from proline to threonine and tyrosine to cysteine led to a decrease in EPSPS affinity for the glyphosate. In addition, the EPSPS enzymatic activity was slightly higher in resistant plants, whereas EPSPS gene expression was almost identical in both biotypes, suggesting feedback regulation at different levels. To conclude, our results suggest new molecular mechanisms used by D. insularis to increase glyphosate resistance. PMID:27525929

  5. EPSPS variability, gene expression, and enzymatic activity in glyphosate-resistant biotypes of Digitaria insularis.

    PubMed

    Galeano, E; Barroso, A A M; Vasconcelos, T S; López-Rubio, A; Albrecht, A J P; Victoria Filho, R; Carrer, H

    2016-08-12

    Weed resistance to herbicides is a natural phenomenon that exerts selection on individuals in a population. In Brazil, glyphosate resistance was recently detected in Digitaria insularis. The objective of this study was to elucidate mechanisms of weed resistance in this plant, including genetic variability, allelism, amino acid substitutions, gene expression, and enzymatic activity levels. Most of these have not previously been studied in this species. D. insularis DNA sequences were used to analyze genetic variability. cDNA from resistant and susceptible plants was used to identify mutations, alleles, and 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) expression, using real-time quantitative reverse transcription-polymerase chain reaction. In addition, EPSPS activity was measured. We found a decrease in genetic variability between populations related to glyphosate application. Substitutions from proline to threonine and tyrosine to cysteine led to a decrease in EPSPS affinity for the glyphosate. In addition, the EPSPS enzymatic activity was slightly higher in resistant plants, whereas EPSPS gene expression was almost identical in both biotypes, suggesting feedback regulation at different levels. To conclude, our results suggest new molecular mechanisms used by D. insularis to increase glyphosate resistance.

  6. Tagging and mapping of rice sheath blight resistant gene.

    PubMed

    Che, K P; Zhan, Q C; Xing, Q H; Wang, Z P; Jin, D M; He, D J; Wang, B

    2003-01-01

    Sheath blight (Rhizoctonia solani Kühn) is one of the severe rice diseases worldwide. In this study, an F(2) population from a cross between "4011" and "Xiangzaoxian19" is used to identify molecular markers linked with the resistant trait. "4011" was a transgenic rice cultivar carrying a resistant gene to sheath blight, while "Xiangzaoxian19" is a highly susceptible one. As a result, five molecular markers, including three RFLP markers converted from RAPD and AFLP markers, and two SSR markers were identified to link with the sheath blight resistant gene. This dominant resistant gene was named as R sb 1 and mapped on rice chromosome 5. The linkage distance between the markers (E-AT:M-CAC(120), E-AT:M-CTA(230), OPN-16(2000), RM164(320) and RM39(300)) and R sb 1 was 1.6 cM, 9.9 cM, 1.6 cM, 15.2 cM and 1.6 cM, respectively.

  7. Data on the phylogenetic typing, integron gene cassette array analysis, multi-drug resistance analysis and correlation between antimicrobial resistance determinants in Klebsiella strains.

    PubMed

    Wu, Hao; Wang, Mingyu; Liu, Yuqing; Wang, Xinhua; Wang, Yunkun; Lu, Jinxing; Xu, Hai

    2016-09-01

    The antimicrobial resistance of Klebsiella species in the poultry industry is becoming a public concern. In support our recent publication "Characterization of antimicrobial resistance in Klebsiella species isolated from chicken broilers" (Wu et al., 2016) [1], multilocus sequence typing (MLST) and gyrA PCR-RFLP assays were conducted to identify the genetic relationships between and phylogenetic groups of the 90 antimicrobial resistant Klebsiella species isolated from a commercial broiler slaughter plant in Shandong, China. In addition, PCR-RFLP was performed to identify different gene cassette arrays in class 1 and 2 integrons, and the correlations between different antimicrobial resistance determinants were analyzed. PMID:27570806

  8. Environmental and Public Health Implications of Water Reuse: Antibiotics, Antibiotic Resistant Bacteria, and Antibiotic Resistance Genes.

    PubMed

    Hong, Pei-Ying; Al-Jassim, Nada; Ansari, Mohd Ikram; Mackie, Roderick I

    2013-01-01

    Water scarcity is a global problem, and is particularly acute in certain regions like Africa, the Middle East, as well as the western states of America. A breakdown on water usage revealed that 70% of freshwater supplies are used for agricultural irrigation. The use of reclaimed water as an alternative water source for agricultural irrigation would greatly alleviate the demand on freshwater sources. This paradigm shift is gaining momentum in several water scarce countries like Saudi Arabia. However, microbial problems associated with reclaimed water may hinder the use of reclaimed water for agricultural irrigation. Of particular concern is that the occurrence of antibiotic residues in the reclaimed water can select for antibiotic resistance genes among the microbial community. Antibiotic resistance genes can be associated with mobile genetic elements, which in turn allow a promiscuous transfer of resistance traits from one bacterium to another. Together with the pathogens that are present in the reclaimed water, antibiotic resistant bacteria can potentially exchange mobile genetic elements to create the "perfect microbial storm". Given the significance of this issue, a deeper understanding of the occurrence of antibiotics in reclaimed water, and their potential influence on the selection of resistant microorganisms would be essential. In this review paper, we collated literature over the past two decades to determine the occurrence of antibiotics in municipal wastewater and livestock manure. We then discuss how these antibiotic resistant bacteria may impose a potential microbial risk to the environment and public health, and the knowledge gaps that would have to be addressed in future studies. Overall, the collation of the literature in wastewater treatment and agriculture serves to frame and identify potential concerns with respect to antibiotics, antibiotic resistant bacteria, and antibiotic resistance genes in reclaimed water.

  9. Environmental and Public Health Implications of Water Reuse: Antibiotics, Antibiotic Resistant Bacteria, and Antibiotic Resistance Genes

    PubMed Central

    Hong, Pei-Ying; Al-Jassim, Nada; Ansari, Mohd Ikram; Mackie, Roderick I.

    2013-01-01

    Water scarcity is a global problem, and is particularly acute in certain regions like Africa, the Middle East, as well as the western states of America. A breakdown on water usage revealed that 70% of freshwater supplies are used for agricultural irrigation. The use of reclaimed water as an alternative water source for agricultural irrigation would greatly alleviate the demand on freshwater sources. This paradigm shift is gaining momentum in several water scarce countries like Saudi Arabia. However, microbial problems associated with reclaimed water may hinder the use of reclaimed water for agricultural irrigation. Of particular concern is that the occurrence of antibiotic residues in the reclaimed water can select for antibiotic resistance genes among the microbial community. Antibiotic resistance genes can be associated with mobile genetic elements, which in turn allow a promiscuous transfer of resistance traits from one bacterium to another. Together with the pathogens that are present in the reclaimed water, antibiotic resistant bacteria can potentially exchange mobile genetic elements to create the “perfect microbial storm”. Given the significance of this issue, a deeper understanding of the occurrence of antibiotics in reclaimed water, and their potential influence on the selection of resistant microorganisms would be essential. In this review paper, we collated literature over the past two decades to determine the occurrence of antibiotics in municipal wastewater and livestock manure. We then discuss how these antibiotic resistant bacteria may impose a potential microbial risk to the environment and public health, and the knowledge gaps that would have to be addressed in future studies. Overall, the collation of the literature in wastewater treatment and agriculture serves to frame and identify potential concerns with respect to antibiotics, antibiotic resistant bacteria, and antibiotic resistance genes in reclaimed water. PMID:27029309

  10. Characterization of the duodenase-1 gene and its associations with resistance to Streptococuus agalactiae in hybrid tilapia (Oreochromis spp.).

    PubMed

    Shen, Yubang; Fu, Gui Hong; Liu, Feng; Yue, Gen Hua

    2015-08-01

    Tilapia is a group of cultured teleost fishes whose production is threatened by some diseases. Identification of DNA markers associated with disease resistance in candidate genes may facilitate to accelerate the selection of disease resistance. The gene encoding a duodenase, which can trigger immune response, has not been studied in fish. We characterized the cDNA of duodenase-1 gene of hybrid tilapia. Its ORF is 759 bp, encoding a serine protease of 252 amino acids. This gene consisted of five exons and four introns. Its expression was detected in all 10 tissues examined, and it was highly expressed in the intestine and kidney. After a challenge with the bacterial pathogen, Streptococcus agalactiae, its expression was up-regulated significantly in the intestine, liver and spleen. We identified seven SNPs in the gene and found that four of them were significantly associated with the resistance to S. agalactiae (P < 0.05). The CGTCC haplotype, CAGTC/CGGTC and CGTCC/CGTCC diplotype were significantly associated with the resistance to S. agalactiae (P = 0.00, 0.04 and < 0.0001, respectively). In addition, one SNP was associated significantly with growth traits (P < 0.05). These findings suggest that the duodenase-1 gene plays an important role in the resistance to S. agalactiae in tilapia. The SNP markers in the duodenase-1 gene associated with resistance to the bacterial pathogen, may facilitate the selection of tilapia resistant to the bacterial disease. PMID:26052009

  11. Evaluating the mobility potential of antibiotic resistance genes in environmental resistomes without metagenomics

    PubMed Central

    Pärnänen, Katariina; Karkman, Antti; Tamminen, Manu; Lyra, Christina; Hultman, Jenni; Paulin, Lars; Virta, Marko

    2016-01-01

    Antibiotic resistance genes are ubiquitous in the environment. However, only a fraction of them are mobile and able to spread to pathogenic bacteria. Until now, studying the mobility of antibiotic resistance genes in environmental resistomes has been challenging due to inadequate sensitivity and difficulties in contig assembly of metagenome based methods. We developed a new cost and labor efficient method based on Inverse PCR and long read sequencing for studying mobility potential of environmental resistance genes. We applied Inverse PCR on sediment samples and identified 79 different MGE clusters associated with the studied resistance genes, including novel mobile genetic elements, co-selected resistance genes and a new putative antibiotic resistance gene. The results show that the method can be used in antibiotic resistance early warning systems. In comparison to metagenomics, Inverse PCR was markedly more sensitive and provided more data on resistance gene mobility and co-selected resistances. PMID:27767072

  12. A Novel Tryptophanyl-tRNA Synthetase Gene Confers High-Level Resistance to Indolmycin▿ †

    PubMed Central

    Vecchione, James J.; Sello, Jason K.

    2009-01-01

    Indolmycin, a potential antibacterial drug, competitively inhibits bacterial tryptophanyl-tRNA synthetases. An effort to identify indolmycin resistance genes led to the discovery of a gene encoding an indolmycin-resistant isoform of tryptophanyl-tRNA synthetase. Overexpression of this gene in an indolmycin-sensitive strain increased the indolmycin MIC 60-fold. Its transcription and distribution in various bacterial genera were assessed. The level of resistance conferred by this gene was compared to that of a known indolmycin resistance gene and to those of genes with resistance-conferring point mutations. PMID:19546369

  13. Creep Resistance of Disk Alloy CH98 with Tungsten and Niobium Additions

    NASA Technical Reports Server (NTRS)

    Gayda, John

    2003-01-01

    Gas turbine engines for future subsonic transports will likely have higher pressure ratios which will require nickel-base superalloy disks with temperature capability up to 1400 F, an increase of about 200 F over current engines. Several advanced disk alloys are being developed to fill this need. One of these, CH98, is a promising candidate for gas turbine engines and is being studied in NASA's AST Program. Additions of the refractory elements tungsten and niobium have been shown to improve tensile and creep properties while maintaining good high temperature fatigue crack growth resistance. Further improvements in creep and crack growth resistance can be achieved with a coarse grain microstructure. The purpose of the present study is aimed at providing a detailed assessment of 0.2 percent creep rates for coarse grain CH98 with tungsten and niobium additions over a range of temperatures and stresses of interest to disk applications.

  14. Abundance and persistence of antibiotic resistance genes in livestock farms: a comprehensive investigation in eastern China.

    PubMed

    Cheng, Weixiao; Chen, Hong; Su, Chao; Yan, Shuhai

    2013-11-01

    Increases of antibiotic resistance genes in the environment may pose a threat to public health. The purpose of this study was to investigate the abundance and diversity of tetracycline (tet) and sulfonamide (sul) resistance genes in eight livestock farms in Hangzhou, eastern China. Ten tet genes (tetA, tetB, tetC, tetG, tetL, tetM, tetO, tetQ, tetW, and tetX), two sul genes (sulI and sulII), and one genetic element associated with mobile antibiotic resistance genes [class 1 integron (intI1)] were quantified by real-time polymerase chain reaction. No significant difference was found in the abundance of the tet and sul genes in various scales of pig, chicken, and duck farms (P>0.05). The average abundance of ribosomal protection protein genes (tetQ, tetM, tetW, and tetO) in the manure and wastewater samples was higher than most of the efflux pump genes (tetA, tetB, tetC, and tetL) and enzymatic modification gene (tetX) (P<0.05), except for efflux pump gene tetG, which was abundant and showed no difference from tetM. Most ARGs had higher relative abundance in the wastewater lagoon than in manures even after treatment. Although the three ribosomal protection protein genes (tetQ, tetW, and tetO) had higher relative abundance, numbers were reduced during the complete wastewater treatment process in pig farms (P<0.05). The relative abundance of tetG, sulI, and sulII increased after the wastewater treatment and the removal of these three genes exhibited significant positive correlations with the intI1 gene (tetG: R(2)=0.60, P<0.05; sulI: R(2)=0.72, P<0.05; sulII: R(2)=0.62, P<0.05), suggesting that intI1 may be involved in their proliferation. As for tetM and sulII genes, a highly significant difference was found in manure samples between pig farms and duck farms (P<0.001). Phylogenetic analysis showed that tetM was more diverse in duck farms than in pig farms. Additionally, sulII sequence was conserved both in pig and duck farms. This is the first comprehensive study to

  15. Integrated Metabolo-Transcriptomics Reveals Fusarium Head Blight Candidate Resistance Genes in Wheat QTL-Fhb2

    PubMed Central

    Dhokane, Dhananjay; Karre, Shailesh; Kushalappa, Ajjamada C.; McCartney, Curt

    2016-01-01

    report that the wheat resistance QTL-Fhb2 is associated with high rachis resistance through additive resistance effects of genes, based on cell wall enforcement and detoxification of DON. Following further functional characterization and validation, these resistance genes can be used to replace the genes in susceptible commercial cultivars, if nonfunctional, based on genome editing to improve FHB resistance. PMID:27232496

  16. Beta-lactamase gene expression in a penicillin-resistant Bacillus anthracis strain.

    PubMed

    Chen, Yahua; Tenover, Fred C; Koehler, Theresa M

    2004-12-01

    Expression of the bla1 and bla2 genes in an archetypal Bacillus anthracis strain is insufficient for penicillin resistance. In a penicillin-resistant clinical isolate, both genes are highly transcribed, but bla1 is the major contributor to high-level resistance to ampicillin. Differential expression of the bla genes is dependent upon strain background. PMID:15561870

  17. Transport of tylosin and tylosin-resistance genes in subsurface drainage water from manured fields

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Animal agriculture appears to contribute to the spread of antibiotic resistance genes, but few studies have quantified gene transport in agricultural fields. The transport of tylosin, tylosin-resistance genes (erm B, F, A) and tylosin-resistant Enterococcus were measured in tile drainage water from ...

  18. Methylation of WTH3, a possible drug resistant gene, inhibits p53 regulated expression

    PubMed Central

    Tian, Kegui; Wang, Yuezeng; Huang, Yu; Sun, Boqiao; Li, Yuxin; Xu, Haopeng

    2008-01-01

    Background Previous results showed that over-expression of the WTH3 gene in MDR cells reduced MDR1 gene expression and converted their resistance to sensitivity to various anticancer drugs. In addition, the WTH3 gene promoter was hypermethylated in the MCF7/AdrR cell line and primary drug resistant breast cancer epithelial cells. WTH3 was also found to be directly targeted and up regulated by the p53 gene. Furthermore, over expression of the WTH3 gene promoted the apoptotic phenotype in various host cells. Methods To further confirm WTH3's drug resistant related characteristics, we recently employed the small hairpin RNA (shRNA) strategy to knockdown its expression in HEK293 cells. In addition, since the WTH3 promoter's p53-binding site was located in a CpG island that was targeted by methylation, we were interested in testing the possible effect this epigenetic modification had on the p53 transcription factor relative to WTH3 expression. To do so, the in vitro methylation method was utilized to examine the p53 transgene's influence on either the methylated or non-methylated WTH3 promoter. Results The results generated from the gene knockdown strategy showed that reduction of WTH3 expression increased MDR1 expression and elevated resistance to Doxorubicin as compared to the original control cells. Data produced from the methylation studies demonstrated that DNA methylation adversely affected the positive impact of p53 on WTH3 promoter activity. Conclusion Taken together, our studies provided further evidence that WTH3 played an important role in MDR development and revealed one of its transcription regulatory mechanisms, DNA methylation, which antagonized p53's positive impact on WTH3 expression. PMID:18992151

  19. Transcriptome analyses and virus induced gene silencing identify genes in the Rpp4-mediated Asian soybean rust resistance pathway

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Rpp4 (Resistance to Phakopsora pachyrhizi 4) confers resistance to P. pachyrhizi, the causal agent of Asian soybean rust (ASR). By combining expression profiling and virus induced gene silencing (VIGS), we are developing a genetic framework for Rpp4-mediated resistance. We measured gene expression i...

  20. Response of Two Heat Shock Genes to Selection for Knockdown Heat Resistance in Drosophila Melanogaster

    PubMed Central

    McColl, G.; Hoffmann, A. A.; McKechnie, S. W.

    1996-01-01

    To identify genes involved in stress resistance and heat hardening, replicate lines of Drosophila melanogaster were selected for increased resistance to knockdown by a 39° heat stress. Two selective regimes were used, one with and one without prior hardening. Mean knockdown times were increased from ~5 min to >20 min after 18 generations. Initial realized heritabilities were as high as 10% for lines selected without hardening, and crosses between lines indicated simple additive gene effects for the selected phenotypes. To survey allelic variation and correlated selection responses in two candidate stress genes, hsr-omega and hsp68, we applied denaturing gradient gel electrophoresis to amplified DNA sequences from small regions of these genes. After eight generations of selection, allele frequencies at both loci showed correlated responses for selection following hardening, but not without hardening. The hardening process itself was associated with a hsp68 frequency change in the opposite direction to that associated with selection that followed hardening. These stress loci are closely linked on chromosome III, and the hardening selection established a disequilibrium, suggesting an epistatic effect on resistance. The data indicate that molecular variation in both hsr-omega and hsp68 contribute to natural heritable variation for hardened heat resistance. PMID:8844150

  1. Quantitative detection of antibiotic resistance genes using magnetic/luminescent core-shell nanoparticles

    NASA Astrophysics Data System (ADS)

    Son, Ahjeong; Hristova, Krassimira R.; Dosev, Dosi; Kennedy, Ian M.

    2008-02-01

    Nanoscale magnetic/luminescent core-shell particles were used for DNA quantification in a hybridization-in-solution format. We demonstrated a simple, high-throughput, and non-PCR based DNA assay for quantifying antibiotic resistance gene tetQ. Fe 3O 4/Eu:Gd IIO 3 nanoparticles (NPs) synthesized by spray pyrolysis were biofunctionalized by passive adsorption of NeutrAvidin. Following immobilization of biotinylated probe DNA on the particles' surfaces, target dsDNA and signaling probe DNA labeled with Cy3 were hybridized with NPs-probe DNA. Hybridized DNA complexes were separated from solution by a magnet, while non-hybridized DNA remained in solution. A linear quantification (R2 = 0.99) of a target tetQ gene was achieved based on the normalized fluorescence (Cy3/NPs) of DNANP hybrids. A real-time qPCR assay was used for evaluation of the NPs assay sensitivity and range of quantification. The quantity of antibiotic resistance tetQ genes in activated sludge microcosms, with and without addition of tetracycline or triclosan has been determined, indicating the potential of the optimized assay for monitoring the level of antibiotic resistance in environmental samples. In addition, the tetQ gene copy numbers in microcosms determined by NPhybridization were well correlated with the numbers measured by real-time qPCR assay (R2 = 0.92).

  2. Variability in the cadherin gene in an Ostrinia nubilalis strain selected for Cry1Ab resistance.

    PubMed

    Bel, Yolanda; Siqueira, Herbert A A; Siegfried, Blair D; Ferré, Juan; Escriche, Baltasar

    2009-03-01

    Transgenic corn expressing Cry1Ab (a Bacillus thuringiensis toxin) is highly effective in the control of Ostrinia nubilalis. For its toxic action, Cry1Ab has to bind to specific insect midgut proteins. To date, in three Lepidoptera species resistance to a Cry1A toxin has been conferred by mutations in cadherin, a protein of the Lepidoptera midgut membrane. The implication of cadherin in the resistance of an Ostrinia nubilalis colony (Europe-R) selected with Bacillus thuringiensis Cry1Ab protoxin was investigated. Several major mutations in the cadherin (cdh) gene were found, which introduced premature termination codons and/or large deletions (ranging from 1383 to 1701bp). The contribution of these major mutations to the resistance was analyzed in resistant individuals that survived exposure to a high concentration of Cry1Ab protoxin. The results indicated that the presence of major mutations was drastically reduced in individuals that survived exposure. Previous inheritance experiments with the Europe-R strain indicated the involvement of more than one genetic locus and reduced amounts of the cadherin receptor. The results of the present work support a polygenic inheritance of resistance in the Europe-R strain, in which mutations in the cdh gene would contribute to resistance by means of an additive effect. PMID:19114103

  3. Candidate Genes That May Be Responsible for the Unusual Resistances Exhibited by Bacillus pumilus SAFR-032 Spores

    PubMed Central

    Tirumalai, Madhan R.; Rastogi, Rajat; Zamani, Nader; O’Bryant Williams, Elisha; Allen, Shamail; Diouf, Fatma; Kwende, Sharon; Weinstock, George M.; Venkateswaran, Kasthuri J.; Fox, George E.

    2013-01-01

    The spores of several Bacillus species, including Bacillus pumilus SAFR-032 and B. safensis FO-36b, which were isolated from the spacecraft assembly facility at NASA's Jet Propulsion Laboratory, are unusually resistant to UV radiation and hydrogen peroxide. In order to identify candidate genes that might be associated with these resistances, the whole genome of B. pumilus SAFR-032, and the draft genome of B. safensis FO-36b were compared in detail with the very closely related type strain B. pumilus ATCC7061T. 170 genes are considered characteristic of SAFR-032, because they are absent from both FO-36b and ATCC7061T. Forty of these SAFR-032 characteristic genes are entirely unique open reading frames. In addition, four genes are unique to the genomes of the resistant SAFR-032 and FO-36b. Fifty three genes involved in spore coat formation, regulation and germination, DNA repair, and peroxide resistance, are missing from all three genomes. The vast majority of these are cleanly deleted from their usual genomic context without any obvious replacement. Several DNA repair and peroxide resistance genes earlier reported to be unique to SAFR-032 are in fact shared with ATCC7061T and no longer considered to be promising candidates for association with the elevated resistances. Instead, several SAFR-032 characteristic genes were identified, which along with one or more of the unique SAFR-032 genes may be responsible for the elevated resistances. These new candidates include five genes associated with DNA repair, namely, BPUM_0608 a helicase, BPUM_0652 an ATP binding protein, BPUM_0653 an endonuclease, BPUM_0656 a DNA cytosine-5- methyltransferase, and BPUM_3674 a DNA helicase. Three of these candidate genes are in immediate proximity of two conserved hypothetical proteins, BPUM_0654 and BPUM_0655 that are also absent from both FO-36b and ATCC7061T. This cluster of five genes is considered to be an especially promising target for future experimental work. PMID:23799069

  4. Fast and Accurate Large-Scale Detection of β-Lactamase Genes Conferring Antibiotic Resistance.

    PubMed

    Lee, Jae Jin; Lee, Jung Hun; Kwon, Dae Beom; Jeon, Jeong Ho; Park, Kwang Seung; Lee, Chang-Ro; Lee, Sang Hee

    2015-10-01

    Fast detection of β-lactamase (bla) genes allows improved surveillance studies and infection control measures, which can minimize the spread of antibiotic resistance. Although several molecular diagnostic methods have been developed to detect limited bla gene types, these methods have significant limitations, such as their failure to detect almost all clinically available bla genes. We developed a fast and accurate molecular method to overcome these limitations using 62 primer pairs, which were designed through elaborate optimization processes. To verify the ability of this large-scale bla detection method (large-scaleblaFinder), assays were performed on previously reported bacterial control isolates/strains. To confirm the applicability of the large-scaleblaFinder, the assays were performed on unreported clinical isolates. With perfect specificity and sensitivity in 189 control isolates/strains and 403 clinical isolates, the large-scaleblaFinder detected almost all clinically available bla genes. Notably, the large-scaleblaFinder detected 24 additional unreported bla genes in the isolates/strains that were previously studied, suggesting that previous methods detecting only limited types of bla genes can miss unexpected bla genes existing in pathogenic bacteria, and our method has the ability to detect almost all bla genes existing in a clinical isolate. The ability of large-scaleblaFinder to detect bla genes on a large scale enables prompt application to the detection of almost all bla genes present in bacterial pathogens. The widespread use of the large-scaleblaFinder in the future will provide an important aid for monitoring the emergence and dissemination of bla genes and minimizing the spread of resistant bacteria. PMID:26169415

  5. Fast and Accurate Large-Scale Detection of β-Lactamase Genes Conferring Antibiotic Resistance

    PubMed Central

    Lee, Jae Jin; Lee, Jung Hun; Kwon, Dae Beom; Jeon, Jeong Ho; Park, Kwang Seung; Lee, Chang-Ro

    2015-01-01

    Fast detection of β-lactamase (bla) genes allows improved surveillance studies and infection control measures, which can minimize the spread of antibiotic resistance. Although several molecular diagnostic methods have been developed to detect limited bla gene types, these methods have significant limitations, such as their failure to detect almost all clinically available bla genes. We developed a fast and accurate molecular method to overcome these limitations using 62 primer pairs, which were designed through elaborate optimization processes. To verify the ability of this large-scale bla detection method (large-scaleblaFinder), assays were performed on previously reported bacterial control isolates/strains. To confirm the applicability of the large-scaleblaFinder, the assays were performed on unreported clinical isolates. With perfect specificity and sensitivity in 189 control isolates/strains and 403 clinical isolates, the large-scaleblaFinder detected almost all clinically available bla genes. Notably, the large-scaleblaFinder detected 24 additional unreported bla genes in the isolates/strains that were previously studied, suggesting that previous methods detecting only limited types of bla genes can miss unexpected bla genes existing in pathogenic bacteria, and our method has the ability to detect almost all bla genes existing in a clinical isolate. The ability of large-scaleblaFinder to detect bla genes on a large scale enables prompt application to the detection of almost all bla genes present in bacterial pathogens. The widespread use of the large-scaleblaFinder in the future will provide an important aid for monitoring the emergence and dissemination of bla genes and minimizing the spread of resistant bacteria. PMID:26169415

  6. Screening for Escherichia coli K-12 genes conferring glyoxal resistance or sensitivity by transposon insertions.

    PubMed

    Lee, Changhan; Kim, Jihong; Kwon, Minsuk; Lee, Kihyun; Min, Haeyoung; Kim, Seong Hun; Kim, Dongkyu; Lee, Nayoung; Kim, Jiyeun; Kim, Doyun; Ko, Changmin; Park, Chankyu

    2016-09-01

    Glyoxal (GO) belongs to the reactive electrophilic species generated in vivo in all organisms. In order to identify targets of GO and their response mechanisms, we attempted to screen for GO-sensitive mutants by random insertions of TnphoA-132. The genes responsible for GO susceptibility were functionally classified as the following: (i) tRNA modification; trmE, gidA and truA, (ii) DNA repair; recA and recC, (iii) toxin-antitoxin; mqsA and (iv) redox metabolism; yqhD and caiC In addition, an insertion in the crp gene, encoding the cAMP responsive transcription factor, exhibits a GO-resistant phenotype, which is consistent with the phenotype of adenylate cyclase (cya) mutant showing GO resistance. This suggests that global regulation involving cAMP is operated in a stress response to GO. To further characterize the CRP-regulated genes directly associated with GO resistance, we created double mutants deficient in both crp and one of the candidate genes including yqhD, gloA and sodB The results indicate that these genes are negatively regulated by CRP as confirmed by real-time RT-PCR. We propose that tRNA as well as DNA are the targets of GO and that toxin/antitoxin, antioxidant and cAMP are involved in cellular response to GO.

  7. Screening for Escherichia coli K-12 genes conferring glyoxal resistance or sensitivity by transposon insertions.

    PubMed

    Lee, Changhan; Kim, Jihong; Kwon, Minsuk; Lee, Kihyun; Min, Haeyoung; Kim, Seong Hun; Kim, Dongkyu; Lee, Nayoung; Kim, Jiyeun; Kim, Doyun; Ko, Changmin; Park, Chankyu

    2016-09-01

    Glyoxal (GO) belongs to the reactive electrophilic species generated in vivo in all organisms. In order to identify targets of GO and their response mechanisms, we attempted to screen for GO-sensitive mutants by random insertions of TnphoA-132. The genes responsible for GO susceptibility were functionally classified as the following: (i) tRNA modification; trmE, gidA and truA, (ii) DNA repair; recA and recC, (iii) toxin-antitoxin; mqsA and (iv) redox metabolism; yqhD and caiC In addition, an insertion in the crp gene, encoding the cAMP responsive transcription factor, exhibits a GO-resistant phenotype, which is consistent with the phenotype of adenylate cyclase (cya) mutant showing GO resistance. This suggests that global regulation involving cAMP is operated in a stress response to GO. To further characterize the CRP-regulated genes directly associated with GO resistance, we created double mutants deficient in both crp and one of the candidate genes including yqhD, gloA and sodB The results indicate that these genes are negatively regulated by CRP as confirmed by real-time RT-PCR. We propose that tRNA as well as DNA are the targets of GO and that toxin/antitoxin, antioxidant and cAMP are involved in cellular response to GO. PMID:27535647

  8. Surveillance of Travellers: An Additional Tool for Tracking Antimalarial Drug Resistance in Endemic Countries

    PubMed Central

    Gharbi, Myriam; Flegg, Jennifer A.; Pradines, Bruno; Berenger, Ako; Ndiaye, Magatte; Djimdé, Abdoulaye A.; Roper, Cally; Hubert, Véronique; Kendjo, Eric; Venkatesan, Meera; Brasseur, Philippe; Gaye, Oumar; Offianan, André T.; Penali, Louis; Le Bras, Jacques; Guérin, Philippe J.; Study, Members of the French National Reference Center for Imported Malaria

    2013-01-01

    Introduction There are growing concerns about the emergence of resistance to artemisinin-based combination therapies (ACTs). Since the widespread adoption of ACTs, there has been a decrease in the systematic surveillance of antimalarial drug resistance in many malaria-endemic countries. The aim of this work was to test whether data on travellers returning from Africa with malaria could serve as an additional surveillance system of local information sources for the emergence of drug resistance in endemic-countries. Methodology Data were collected from travellers with symptomatic Plasmodium falciparum malaria returning from Senegal (n = 1,993), Mali (n = 2,372), Cote d’Ivoire (n = 4,778) or Cameroon (n = 3,272) and recorded in the French Malaria Reference Centre during the period 1996–2011. Temporal trends of the proportion of parasite isolates that carried the mutant genotype, pfcrt 76T, a marker of resistance to chloroquine (CQ) and pfdhfr 108N, a marker of resistance to pyrimethamine, were compared for travellers and within-country surveys that were identified through a literature review in PubMed. The in vitro response to CQ was also compared between these two groups for parasites from Senegal. Results The trends in the proportion of parasites that carried pfcrt 76T, and pfdhfr 108N, were compared for parasites from travellers and patients within-country using the slopes of the curves over time; no significant differences in the trends were found for any of the 4 countries. These results were supported by in vitro analysis of parasites from the field in Senegal and travellers returning to France, where the trends were also not significantly different. Conclusion The results have not shown different trends in resistance between parasites derived from travellers or from parasites within-country. This work highlights the value of an international database of drug responses in travellers as an additional tool to assess the emergence of drug

  9. Preparation and ageing-resistant properties of polyester composites modified with functional nanoscale additives.

    PubMed

    Guo, Gang; Shi, Qiwu; Luo, Yanbing; Fan, Rangrang; Zhou, Liangxue; Qian, Zhiyong; Yu, Jie

    2014-01-01

    This study investigated ageing-resistant properties of carboxyl-terminated polyester (polyethylene glycol terephthalate) composites modified with nanoscale titanium dioxide particles (nano-TiO2). The nano-TiO2 was pretreated by a dry coating method, with aluminate coupling agent as a functional grafting additive. The agglomeration resistance was evaluated, which exhibited significant improvement for the modified nanoparticles. Then, the effects of the modified nano-TiO2 on the crosslinking and ageing-resistant properties of the composites were studied. With a real-time Fourier transform infrared (FT-IR) measurement, the nano-TiO2 displayed promoting effect on the crosslinking of polyester resin with triglycidyl isocyanurate (TGIC) as crosslinking agent. Moreover, the gloss retention, colour aberration and the surface morphologies of the composites during accelerated UV ageing (1500 hours) were investigated. The results demonstrated much less degree of ageing degradation for the nanocomposites, indicating an important role of the nano-TiO2 in improving the ageing-resistant properties of synthetic polymer composites. PMID:24872802

  10. Preparation and ageing-resistant properties of polyester composites modified with functional nanoscale additives.

    PubMed

    Guo, Gang; Shi, Qiwu; Luo, Yanbing; Fan, Rangrang; Zhou, Liangxue; Qian, Zhiyong; Yu, Jie

    2014-01-01

    This study investigated ageing-resistant properties of carboxyl-terminated polyester (polyethylene glycol terephthalate) composites modified with nanoscale titanium dioxide particles (nano-TiO2). The nano-TiO2 was pretreated by a dry coating method, with aluminate coupling agent as a functional grafting additive. The agglomeration resistance was evaluated, which exhibited significant improvement for the modified nanoparticles. Then, the effects of the modified nano-TiO2 on the crosslinking and ageing-resistant properties of the composites were studied. With a real-time Fourier transform infrared (FT-IR) measurement, the nano-TiO2 displayed promoting effect on the crosslinking of polyester resin with triglycidyl isocyanurate (TGIC) as crosslinking agent. Moreover, the gloss retention, colour aberration and the surface morphologies of the composites during accelerated UV ageing (1500 hours) were investigated. The results demonstrated much less degree of ageing degradation for the nanocomposites, indicating an important role of the nano-TiO2 in improving the ageing-resistant properties of synthetic polymer composites.

  11. Preparation and ageing-resistant properties of polyester composites modified with functional nanoscale additives

    NASA Astrophysics Data System (ADS)

    Guo, Gang; Shi, Qiwu; Luo, Yanbing; Fan, Rangrang; Zhou, Liangxue; Qian, Zhiyong; Yu, Jie

    2014-05-01

    This study investigated ageing-resistant properties of carboxyl-terminated polyester (polyethylene glycol terephthalate) composites modified with nanoscale titanium dioxide particles (nano-TiO2). The nano-TiO2 was pretreated by a dry coating method, with aluminate coupling agent as a functional grafting additive. The agglomeration resistance was evaluated, which exhibited significant improvement for the modified nanoparticles. Then, the effects of the modified nano-TiO2 on the crosslinking and ageing-resistant properties of the composites were studied. With a real-time Fourier transform infrared (FT-IR) measurement, the nano-TiO2 displayed promoting effect on the crosslinking of polyester resin with triglycidyl isocyanurate (TGIC) as crosslinking agent. Moreover, the gloss retention, colour aberration and the surface morphologies of the composites during accelerated UV ageing (1500 hours) were investigated. The results demonstrated much less degree of ageing degradation for the nanocomposites, indicating an important role of the nano-TiO2 in improving the ageing-resistant properties of synthetic polymer composites.

  12. Preparation and ageing-resistant properties of polyester composites modified with functional nanoscale additives

    PubMed Central

    2014-01-01

    This study investigated ageing-resistant properties of carboxyl-terminated polyester (polyethylene glycol terephthalate) composites modified with nanoscale titanium dioxide particles (nano-TiO2). The nano-TiO2 was pretreated by a dry coating method, with aluminate coupling agent as a functional grafting additive. The agglomeration resistance was evaluated, which exhibited significant improvement for the modified nanoparticles. Then, the effects of the modified nano-TiO2 on the crosslinking and ageing-resistant properties of the composites were studied. With a real-time Fourier transform infrared (FT-IR) measurement, the nano-TiO2 displayed promoting effect on the crosslinking of polyester resin with triglycidyl isocyanurate (TGIC) as crosslinking agent. Moreover, the gloss retention, colour aberration and the surface morphologies of the composites during accelerated UV ageing (1500 hours) were investigated. The results demonstrated much less degree of ageing degradation for the nanocomposites, indicating an important role of the nano-TiO2 in improving the ageing-resistant properties of synthetic polymer composites. PMID:24872802

  13. Microarray analysis of gene regulations and potential association with acephate-resistance and fitness cost in Lygus lineolaris.

    PubMed

    Zhu, Yu Cheng; Guo, Zibiao; He, Yueping; Luttrell, Randall

    2012-01-01

    The tarnished plant bug has become increasingly resistant to organophosphates in recent years. To better understand acephate resistance mechanisms, biological, biochemical, and molecular experiments were systematically conducted with susceptible (LLS) and acephate-selected (LLR) strains. Selection of a field population with acephate significantly increased resistance ratio to 5.9-fold, coupled with a significant increase of esterase activities by 2-fold. Microarray analysis of 6,688 genes revealed 329 up- and 333 down-regulated (≥2-fold) genes in LLR. Six esterase, three P450, and one glutathione S-transferase genes were significantly up-regulated, and no such genes were down-regulated in LLR. All vitellogenin and eggshell protein genes were significantly down-regulated in LLR. Thirteen protease genes were significantly down-regulated and only 3 were up-regulated in LLR. More than twice the number of catalysis genes and more than 3.6-fold of metabolic genes were up-regulated, respectively, as compared to those down-regulated with the same molecular and biological functions. The large portion of metabolic or catalysis genes with significant up-regulations indicated a substantial increase of metabolic detoxification in LLR. Significant increase of acephate resistance, increases of esterase activities and gene expressions, and variable esterase sequences between LLS and LLR consistently demonstrated a major esterase-mediated resistance in LLR, which was functionally provable by abolishing the resistance with esterase inhibitors. In addition, significant elevation of P450 gene expression and reduced susceptibility to imidacloprid in LLR indicated a concurrent resistance risk that may impact other classes of insecticides. This study demonstrated the first association of down-regulation of reproductive- and digestive-related genes with resistance to conventional insecticides, suggesting potential fitness costs associated with resistance development. This study shed new

  14. Incidence of antimicrobial-resistance genes and integrons in antibiotic-resistant bacteria isolated from eels and aquaculture ponds.

    PubMed

    Lin, Mao; Wu, Xiaomei; Yan, Qingpi; Ma, Ying; Huang, Lixing; Qin, Yingxue; Xu, Xiaojin

    2016-07-01

    The overuse of antimicrobials in aquaculture has promoted the selection of antimicrobial-resistant bacteria. Here we investigated the abundance of antimicrobial-resistance genes and integrons in 108 strains of antibiotic-resistant bacteria isolated from eels and aquaculture ponds in China. Conventional PCR was implemented to examine common antibiotic-resistance genes, integrons, and their gene cassette arrays. The results showed that the antibiotic-resistance genes blaTEM, tetC, sulI, aadA, floR, and qnrB were detected at high percentages, as were a number of other resistance genes. Class I integrons were present in 79.63% of the strains, and 10 out of 108 isolates carried class II integrons. Class III integrons were not detected. Three strains carried both class I and class II integrons, and 73.26% of the class I integron-positive isolates contained the qacEΔ1/sul1 gene. Fourteen types of integron cassette arrays were found among class I integron-positive isolates. A new array, dfrB4-catB3-blaOXA-10-aadA1, was discovered in this study. The gene cassette array dfrA12-orfF-aadA2 was the most widely distributed. In summary, 23 different gene cassettes encoding resistance to 8 classes of antibiotics were identified in the class I integrons, and the main cassettes contained genes encoding resistance to aminoglycosides (aad) and trimethoprim (dfr). All class II integron-positive strains had only a single gene cassette array, viz. dfrA1-catB2-sat2-aadA1. High levels of antimicrobial-resistance genes and integrons in eels and auqauculture ponds suggest that the overuse of antimicrobials should be strictly controlled and that the levels of bacterial antimicrobial-resistance genes in aquaculture should be monitored. PMID:27409235

  15. Incidence of antimicrobial-resistance genes and integrons in antibiotic-resistant bacteria isolated from eels and aquaculture ponds.

    PubMed

    Lin, Mao; Wu, Xiaomei; Yan, Qingpi; Ma, Ying; Huang, Lixing; Qin, Yingxue; Xu, Xiaojin

    2016-07-01

    The overuse of antimicrobials in aquaculture has promoted the selection of antimicrobial-resistant bacteria. Here we investigated the abundance of antimicrobial-resistance genes and integrons in 108 strains of antibiotic-resistant bacteria isolated from eels and aquaculture ponds in China. Conventional PCR was implemented to examine common antibiotic-resistance genes, integrons, and their gene cassette arrays. The results showed that the antibiotic-resistance genes blaTEM, tetC, sulI, aadA, floR, and qnrB were detected at high percentages, as were a number of other resistance genes. Class I integrons were present in 79.63% of the strains, and 10 out of 108 isolates carried class II integrons. Class III integrons were not detected. Three strains carried both class I and class II integrons, and 73.26% of the class I integron-positive isolates contained the qacEΔ1/sul1 gene. Fourteen types of integron cassette arrays were found among class I integron-positive isolates. A new array, dfrB4-catB3-blaOXA-10-aadA1, was discovered in this study. The gene cassette array dfrA12-orfF-aadA2 was the most widely distributed. In summary, 23 different gene cassettes encoding resistance to 8 classes of antibiotics were identified in the class I integrons, and the main cassettes contained genes encoding resistance to aminoglycosides (aad) and trimethoprim (dfr). All class II integron-positive strains had only a single gene cassette array, viz. dfrA1-catB2-sat2-aadA1. High levels of antimicrobial-resistance genes and integrons in eels and auqauculture ponds suggest that the overuse of antimicrobials should be strictly controlled and that the levels of bacterial antimicrobial-resistance genes in aquaculture should be monitored.

  16. Cloning of novel rice blast resistance genes from two rapidly evolving NBS-LRR gene families in rice.

    PubMed

    Guo, Changjiang; Sun, Xiaoguang; Chen, Xiao; Yang, Sihai; Li, Jing; Wang, Long; Zhang, Xiaohui

    2016-01-01

    Most rice blast resistance genes (R-genes) encode proteins with nucleotide-binding site (NBS) and leucine-rich repeat (LRR) domains. Our previous study has shown that more rice blast R-genes can be cloned in rapidly evolving NBS-LRR gene families. In the present study, two rapidly evolving R-gene families in rice were selected for cloning a subset of genes from their paralogs in three resistant rice lines. A total of eight functional blast R-genes were identified among nine NBS-LRR genes, and some of these showed resistance to three or more blast strains. Evolutionary analysis indicated that high nucleotide diversity of coding regions served as important parameters in the determination of gene resistance. We also observed that amino-acid variants (nonsynonymous mutations, insertions, or deletions) in essential motifs of the NBS domain contribute to the blast resistance capacity of NBS-LRR genes. These results suggested that the NBS regions might also play an important role in resistance specificity determination. On the other hand, different splicing patterns of introns were commonly observed in R-genes. The results of the present study contribute to improving the effectiveness of R-gene identification by using evolutionary analysis method and acquisition of novel blast resistance genes.

  17. The wheat durable, multipathogen resistance gene Lr34 confers partial blast resistance in rice.

    PubMed

    Krattinger, Simon G; Sucher, Justine; Selter, Liselotte L; Chauhan, Harsh; Zhou, Bo; Tang, Mingzhi; Upadhyaya, Narayana M; Mieulet, Delphine; Guiderdoni, Emmanuel; Weidenbach, Denise; Schaffrath, Ulrich; Lagudah, Evans S; Keller, Beat

    2016-05-01

    The wheat gene Lr34 confers durable and partial field resistance against the obligate biotrophic, pathogenic rust fungi and powdery mildew in adult wheat plants. The resistant Lr34 allele evolved after wheat domestication through two gain-of-function mutations in an ATP-binding cassette transporter gene. An Lr34-like fungal disease resistance with a similar broad-spectrum specificity and durability has not been described in other cereals. Here, we transformed the resistant Lr34 allele into the japonica rice cultivar Nipponbare. Transgenic rice plants expressing Lr34 showed increased resistance against multiple isolates of the hemibiotrophic pathogen Magnaporthe oryzae, the causal agent of rice blast disease. Host cell invasion during the biotrophic growth phase of rice blast was delayed in Lr34-expressing rice plants, resulting in smaller necrotic lesions on leaves. Lines with Lr34 also developed a typical, senescence-based leaf tip necrosis (LTN) phenotype. Development of LTN during early seedling growth had a negative impact on formation of axillary shoots and spikelets in some transgenic lines. One transgenic line developed LTN only at adult plant stage which was correlated with lower Lr34 expression levels at seedling stage. This line showed normal tiller formation and more importantly, disease resistance in this particular line was not compromised. Interestingly, Lr34 in rice is effective against a hemibiotrophic pathogen with a lifestyle and infection strategy that is different from obligate biotrophic rusts and mildew fungi. Lr34 might therefore be used as a source in rice breeding to improve broad-spectrum disease resistance against the most devastating fungal disease of rice. PMID:26471973

  18. The wheat durable, multipathogen resistance gene Lr34 confers partial blast resistance in rice.

    PubMed

    Krattinger, Simon G; Sucher, Justine; Selter, Liselotte L; Chauhan, Harsh; Zhou, Bo; Tang, Mingzhi; Upadhyaya, Narayana M; Mieulet, Delphine; Guiderdoni, Emmanuel; Weidenbach, Denise; Schaffrath, Ulrich; Lagudah, Evans S; Keller, Beat

    2016-05-01

    The wheat gene Lr34 confers durable and partial field resistance against the obligate biotrophic, pathogenic rust fungi and powdery mildew in adult wheat plants. The resistant Lr34 allele evolved after wheat domestication through two gain-of-function mutations in an ATP-binding cassette transporter gene. An Lr34-like fungal disease resistance with a similar broad-spectrum specificity and durability has not been described in other cereals. Here, we transformed the resistant Lr34 allele into the japonica rice cultivar Nipponbare. Transgenic rice plants expressing Lr34 showed increased resistance against multiple isolates of the hemibiotrophic pathogen Magnaporthe oryzae, the causal agent of rice blast disease. Host cell invasion during the biotrophic growth phase of rice blast was delayed in Lr34-expressing rice plants, resulting in smaller necrotic lesions on leaves. Lines with Lr34 also developed a typical, senescence-based leaf tip necrosis (LTN) phenotype. Development of LTN during early seedling growth had a negative impact on formation of axillary shoots and spikelets in some transgenic lines. One transgenic line developed LTN only at adult plant stage which was correlated with lower Lr34 expression levels at seedling stage. This line showed normal tiller formation and more importantly, disease resistance in this particular line was not compromised. Interestingly, Lr34 in rice is effective against a hemibiotrophic pathogen with a lifestyle and infection strategy that is different from obligate biotrophic rusts and mildew fungi. Lr34 might therefore be used as a source in rice breeding to improve broad-spectrum disease resistance against the most devastating fungal disease of rice.

  19. The expression of antibiotic resistance genes in antibiotic-producing bacteria.

    PubMed

    Mak, Stefanie; Xu, Ye; Nodwell, Justin R

    2014-08-01

    Antibiotic-producing bacteria encode antibiotic resistance genes that protect them from the biologically active molecules that they produce. The expression of these genes needs to occur in a timely manner: either in advance of or concomitantly with biosynthesis. It appears that there have been at least two general solutions to this problem. In many cases, the expression of resistance genes is tightly linked to that of antibiotic biosynthetic genes. In others, the resistance genes can be induced by their cognate antibiotics or by intermediate molecules from their biosynthetic pathways. The regulatory mechanisms that couple resistance to antibiotic biosynthesis are mechanistically diverse and potentially relevant to the origins of clinical antibiotic resistance.

  20. Functional characterization of an arrestin gene on insecticide resistance of Culex pipiens pallens

    PubMed Central

    2012-01-01

    Background Continuous and excessive application of insecticides has resulted in the rapid development of insecticide resistance in several mosquito species, including Culex pipiens pallens. Previous studies in our laboratory found that arrestin gene expression was higher in the deltamethrin-resistant (DR) strain than in the deltamethrin-susceptible (DS) strain of Cx. pipiens pallens. Similarly, other studies reported that arrestin was highly expressed in permethrin-resistant Cx. quinquefasciatus and in dichlorodiphenyltrichloroethane (DDT)-resistant Drosophila melanogaster. Methods Full-length cDNAs of an arrestin gene were cloned from Cx. pipiens pallens via polymerase chain reaction (PCR) and rapid amplification of cDNA end (RACE). The mRNA levels of the arrestin gene in the whole life cycle of DR and DS strains of Cx. pipiens pallens were investigated via quantitative real-time PCR. In addition, the relationship between arrestin and deltamethrin (DM) resistance were identified using genetic overexpression strategies and arrestin RNAi in mosquito cells. Cell viability was analyzed with cholecystokinin octapeptide after DM treatment. Moreover, the mRNA levels of cytochrome P450 6A1 (CYP6A1) and opsin in the transfected cells and controls were analyzed. Results Complete arrestin gene sequence was cloned and expressed throughout the life cycle of Cx. pipiens pallens. Moreover, arrestin was significantly upregulated in the DR strain, compared with that in the DS strain at the egg, pupae, and adult stages. Arrestin overexpression comparably increased the mosquito cell viability, whereas arrestin knockdown by siRNA decreased mosquito cell viability with deltamethrin (DM) treatment. Meanwhile, the mRNA levels of CYP6A1 and opsin were upregulated in mosquito cells transfected with arrestin and downregulated in mosquito cells with arrestin knockdown. Conclusion This study presented the first evidence that arrestin might be associated with insecticide resistance in Cx

  1. Identification and expression analysis of chitinase genes related to biotic stress resistance in Brassica.

    PubMed

    Ahmed, Nasar Uddin; Park, Jong-In; Seo, Mi-Suk; Kumar, Thamilarasan Senthil; Lee, In-Ho; Park, Beom-Seok; Nou, Ill-Sup

    2012-04-01

    Brassica is a very important vegetable group because of its contribution to human nutrition and consequent economic benefits. However, biotic stress is a major concern for these crops and molecular biology techniques offer the most efficient of approaches to address this concern. Chitinase is an important biotic stress resistance-related gene. We identified three genes designated as Brassica chitinase like protein (BrCLP1), BrCLP2 and BrCLP3 from a full-length cDNA library of Brassica rapa cv. Osome. Sequence analysis of these genes confirmed that BrCLP1 was a class IV chitinase, and BrCLP2 and BrCLP3 were class VII chitinases. Also, these genes showed a high degree of homology with other biotic stress resistance-related plant chitinases. In expression analysis, organ-specific expression of all three genes was high except BrCLP1 in all the organs tested and BrCLP2 showed the highest expression compared to the other genes in flower buds. All these genes also showed expression during all developmental growth stages of Chinese cabbage. In addition, BrCLP1 was up-regulated with certain time of infection by Pectobacterium carotovorum subsp. carotovorum in Chinese cabbage plants during microarray expression analysis. On the other hand, expression of BrCLP2 and BrCLP3 were increased after 6 h post inoculation (hpi) but decreased from 12 hpi. All these data suggest that these three chitinase genes may be involved in plant resistance against biotic stresses.

  2. Novel Genes Related to Ceftriaxone Resistance Found among Ceftriaxone-Resistant Neisseria gonorrhoeae Strains Selected In Vitro

    PubMed Central

    Gong, Zijian; Liu, Min; Hua, Zhengshuang; Sun, Yayin; Xu, Qingfang; Xia, Yue; Zhao, Yue; Xie, Xiaoyuan

    2016-01-01

    The emergence of ceftriaxone-resistant Neisseria gonorrhoeae is currently a global public health concern. However, the mechanism of ceftriaxone resistance is not yet fully understood. To investigate the potential genes related to ceftriaxone resistance in Neisseria gonorrhoeae, we subcultured six gonococcal strains with increasing concentrations of ceftriaxone and isolated the strains that became resistant. After analyzing several frequently reported genes involved in ceftriaxone resistance, we found only a single mutation in penA (A501V). However, differential analysis of the genomes and transcriptomes between pre- and postselection strains revealed many other mutated genes as well as up- and downregulated genes. Transformation of the mutated penA gene into nonresistant strains increased the MIC between 2.0- and 5.3-fold, and transformation of mutated ftsX increased the MIC between 3.3- and 13.3-fold. Genes encoding the ABC transporters FarB, Tfq, Hfq, and ExbB were overexpressed, while pilM, pilN, and pilQ were downregulated. Furthermore, the resistant strain developed cross-resistance to penicillin and cefuroxime, had an increased biochemical metabolic rate, and presented fitness defects such as prolonged growth time and downregulated PilMNQ. In conclusion, antimicrobial pressure could result in the emergence of ceftriaxone resistance, and the evolution of resistance of Neisseria gonorrhoeae to ceftriaxone is a complicated process at both the pretranscriptional and posttranscriptional levels, involving several resistance mechanisms of increased efflux and decreased entry. PMID:26787702

  3. Triclosan Resistome from Metagenome Reveals Diverse Enoyl Acyl Carrier Protein Reductases and Selective Enrichment of Triclosan Resistance Genes

    PubMed Central

    Khan, Raees; Kong, Hyun Gi; Jung, Yong-Hoon; Choi, Jinhee; Baek, Kwang-Yeol; Hwang, Eul Chul; Lee, Seon-Woo

    2016-01-01

    Triclosan (TCS) is a widely used antimicrobial agent and TCS resistance is considered to have evolved in diverse organisms with extensive use of TCS, but distribution of TCS resistance has not been well characterized. Functional screening of the soil metagenome in this study has revealed that a variety of target enoyl acyl carrier protein reductases (ENR) homologues are responsible for the majority of TCS resistance. Diverse ENRs similar to 7-α-hydroxysteroid dehydrogenase (7-α-HSDH), FabG, or the unusual YX7K-type ENR conferred extreme tolerance to TCS. The TCS-refractory 7-α HSDH-like ENR and the TCS-resistant YX7K-type ENR seem to be prevalent in human pathogenic bacteria, suggesting that a selective enrichment occurred in pathogenic bacteria in soil. Additionally, resistance to multiple antibiotics was found to be mediated by antibiotic resistance genes that co-localize with TCS resistance determinants. Further comparative analysis of ENRs from 13 different environments has revealed a huge diversity of both prototypic and metagenomic TCS-resistant ENRs, in addition to a selective enrichment of TCS-resistant specific ENRs in presumably TCS-contaminated environments with reduced ENR diversity. Our results suggest that long-term extensive use of TCS can lead to the selective emergence of TCS-resistant bacterial pathogens, possibly with additional resistance to multiple antibiotics, in natural environments. PMID:27577999

  4. Triclosan Resistome from Metagenome Reveals Diverse Enoyl Acyl Carrier Protein Reductases and Selective Enrichment of Triclosan Resistance Genes.

    PubMed

    Khan, Raees; Kong, Hyun Gi; Jung, Yong-Hoon; Choi, Jinhee; Baek, Kwang-Yeol; Hwang, Eul Chul; Lee, Seon-Woo

    2016-01-01

    Triclosan (TCS) is a widely used antimicrobial agent and TCS resistance is considered to have evolved in diverse organisms with extensive use of TCS, but distribution of TCS resistance has not been well characterized. Functional screening of the soil metagenome in this study has revealed that a variety of target enoyl acyl carrier protein reductases (ENR) homologues are responsible for the majority of TCS resistance. Diverse ENRs similar to 7-α-hydroxysteroid dehydrogenase (7-α-HSDH), FabG, or the unusual YX7K-type ENR conferred extreme tolerance to TCS. The TCS-refractory 7-α HSDH-like ENR and the TCS-resistant YX7K-type ENR seem to be prevalent in human pathogenic bacteria, suggesting that a selective enrichment occurred in pathogenic bacteria in soil. Additionally, resistance to multiple antibiotics was found to be mediated by antibiotic resistance genes that co-localize with TCS resistance determinants. Further comparative analysis of ENRs from 13 different environments has revealed a huge diversity of both prototypic and metagenomic TCS-resistant ENRs, in addition to a selective enrichment of TCS-resistant specific ENRs in presumably TCS-contaminated environments with reduced ENR diversity. Our results suggest that long-term extensive use of TCS can lead to the selective emergence of TCS-resistant bacterial pathogens, possibly with additional resistance to multiple antibiotics, in natural environments. PMID:27577999

  5. Antimicrobial Resistance and Resistance Genes in Aerobic Bacteria Isolated from Pork at Slaughter.

    PubMed

    Li, Lili; Heidemann Olsen, Rikke; Ye, Lei; Yan, He; Nie, Qing; Meng, Hecheng; Shi, Lei

    2016-04-01

    The aim of this study was to investigate the phenotypic and genotypic antimicrobial resistance, integrons, and transferability of resistance markers in 243 aerobic bacteria recovered from pork at slaughter in the People's Republic of China. The organisms belonged to 22 genera of gram-negative bacteria (92.2%) and gram-positive bacteria (7.8%). High levels of resistance were detected to tetracycline, trimethoprim-sulfamethoxazole, and ampicillin (36.2 to 54.3%), and lower levels were detected to nitrofurantoin, cefotaxime, gentamicin, ciprofloxacin, and chloramphenicol (7.8 to 29.2%). Across species, genes conferring antimicrobial resistance were observed with the following frequencies: blaTEM, 40.7%; blaCMY-2, 15.2%; blaCTX-M, 11.5%; sul2, 27.2%; sul1, 14.4%; tet(A), 5.4%; tet(L), 5.4%; tet(M), 5.0%; tet(E), 3.7%; tet(C), 3.3%; tet(S), 2.5%; and tet(K), 0.8%. Various antimicrobial resistance genes were found in new carriers: blaTEM in Lactococcus garvieae, Myroides odoratimimus, Aeromonas hydrophila, Staphylococcus sciuri, Raoultella terrigena, Macrococcus caseolyticus, Acinetobacter ursingii, Sphingobacterium sp., and Oceanobacillus sp.; blaCMY-2 in Lactococcus lactis, Klebsiella oxytoca, Serratia marcescens, Acinetobacter baumannii, and Myroides phaeus; tet(L) in M. caseolyticus; sul1 in Vibrio cincinnatiensis; sul2 in Acinetobacter bereziniae, Acinetobacter johnsonii, and V. cincinnatiensis; and the class 1 integron and gene cassette aadA2 in V. cincinnatiensis. Approximately 6.6% of isolates contained class 1 integrons, and one isolate harbored class 2 integrons. Plasmid associated intI1 and androgen receptor- encoding genes were transferred into Escherichia coli J53 and E. coli DH5α by conjugation and transformation experiments, respectively. Our study highlights the importance of aerobic bacteria from pork as reservoirs for antimicrobial resistance genes and mobile genetic elements that can readily be transferred intra- and interspecies. PMID:27052863

  6. Monitoring and Comparison of Antibiotic Resistant Bacteria and Their Resistance Genes in Municipal and Hospital Wastewaters

    PubMed Central

    Aali, Rahim; Nikaeen, Mahnaz; Khanahmad, Hossein; Hassanzadeh, Akbar

    2014-01-01

    Background: Human exposure to antibiotic resistant bacteria (ARB) is a public health concern which could occur in a number of ways. Wastewaters seem to play an important role in the dissemination of bacteria and antibiotic resistant genes (ARGs) in our environment. The aim of this study was to evaluate the occurrence of three groups of ARB and their resistance genes in hospital and municipal wastewaters (MWs) as possible sources. Methods: A total of 66 samples were collected from raw MWs and hospital wastewaters (HWs) and final effluents of related wastewater treatment plants (WWTPs). Samples were analyzed for the detection of three groups of ARB including gentamicin (GM), chloramphenicol (CHL) and ceftazidime resistant bacteria and their ARGs (aac (3)-1, cmlA1 and ctx-m-32, respectively). Results: The mean concentration of GM, CHL and ceftazidime resistant bacteria in raw wastewater samples was 1.24 × 107, 3.29 × 107 and 5.54 × 107 colony forming unit/100 ml, respectively. There is a variation in prevalence of different groups of ARB in MWs and HWs. All WWTPs decreased the concentration of ARB. However, high concentration of ARB was found in the final effluent of WWTPs. Similar to ARB, different groups of ARGs were found frequently in both MWs and HWs. All genes also detected with a relative high frequency in effluent samples of MWs WWTPs. Conclusions: Discharge of final effluent from conventional WWTPs is a potential route for dissemination of ARB and ARGs into the natural environment and poses a hazard to environmental and public health. PMID:25105001

  7. Microstructure and Corrosion Resistance of Laser Additively Manufactured 316L Stainless Steel

    NASA Astrophysics Data System (ADS)

    Trelewicz, Jason R.; Halada, Gary P.; Donaldson, Olivia K.; Manogharan, Guha

    2016-03-01

    Additive manufacturing (AM) of metal alloys to produce complex part designs via powder bed fusion methods such as laser melting promises to be a transformative technology for advanced materials processing. However, effective implementation of AM processes requires a clear understanding of the processing-structure-properties-performance relationships in fabricated components. In this study, we report on the formation of micro and nanoscale structures in 316L stainless steel samples printed by laser AM and their implications for general corrosion resistance. A variety of techniques including x-ray diffraction, optical, scanning and transmission electron microscopy, x-ray fluorescence, and energy dispersive x-ray spectroscopy were employed to characterize the microstructure and chemistry of the laser additively manufactured 316L stainless steel, which are compared with wrought 316L coupons via electrochemical polarization. Apparent segregation of Mo has been found to contribute to a loss of passivity and an increased anodic current density. While porosity will also likely impact the environmental performance (e.g., facilitating crevice corrosion) of AM alloys, this work demonstrates the critical influence of microstructure and heterogeneous solute distributions on the corrosion resistance of laser additively manufactured 316L stainless steel.

  8. Mutations in the Pneumocystis jirovecii DHPS gene confer cross-resistance to sulfa drugs.

    PubMed

    Iliades, Peter; Meshnick, Steven R; Macreadie, Ian G

    2005-02-01

    Pneumocystis jirovecii is a major opportunistic pathogen that causes Pneumocystis pneumonia (PCP) and results in a high degree of mortality in immunocompromised individuals. The drug of choice for PCP is typically sulfamethoxazole (SMX) or dapsone in conjunction with trimethoprim. Drug treatment failure and sulfa drug resistance have been implicated epidemiologically with point mutations in dihydropteroate synthase (DHPS) of P. jirovecii. P. jirovecii cannot be cultured in vitro; however, heterologous complementation of the P. jirovecii trifunctional folic acid synthesis (PjFAS) genes with an E. coli DHPS-disrupted strain was recently achieved. This enabled the evaluation of SMX resistance conferred by DHPS mutations. In this study, we sought to determine whether DHPS mutations conferred sulfa drug cross-resistance to 15 commonly available sulfa drugs. It was established that the presence of amino acid substitutions (T(517)A or P(519)S) in the DHPS domain of PjFAS led to cross-resistance against most sulfa drugs evaluated. The presence of both mutations led to increased sulfa drug resistance, suggesting cooperativity and the incremental evolution of sulfa drug resistance. Two sulfa drugs (sulfachloropyridazine [SCP] and sulfamethoxypyridazine [SMP]) that had a higher inhibitory potential than SMX were identified. In addition, SCP, SMP, and sulfadiazine (SDZ) were found to be capable of inhibiting the clinically observed drug-resistant mutants. We propose that SCP, SMP, and SDZ should be considered for clinical evaluation against PCP or for future development of novel sulfa drug compounds.

  9. Mutations in the Pneumocystis jirovecii DHPS Gene Confer Cross-Resistance to Sulfa Drugs

    PubMed Central

    Iliades, Peter; Meshnick, Steven R.; Macreadie, Ian G.

    2005-01-01

    Pneumocystis jirovecii is a major opportunistic pathogen that causes Pneumocystis pneumonia (PCP) and results in a high degree of mortality in immunocompromised individuals. The drug of choice for PCP is typically sulfamethoxazole (SMX) or dapsone in conjunction with trimethoprim. Drug treatment failure and sulfa drug resistance have been implicated epidemiologically with point mutations in dihydropteroate synthase (DHPS) of P. jirovecii. P. jirovecii cannot be cultured in vitro; however, heterologous complementation of the P. jirovecii trifunctional folic acid synthesis (PjFAS) genes with an E. coli DHPS-disrupted strain was recently achieved. This enabled the evaluation of SMX resistance conferred by DHPS mutations. In this study, we sought to determine whether DHPS mutations conferred sulfa drug cross-resistance to 15 commonly available sulfa drugs. It was established that the presence of amino acid substitutions (T517A or P519S) in the DHPS domain of PjFAS led to cross-resistance against most sulfa drugs evaluated. The presence of both mutations led to increased sulfa drug resistance, suggesting cooperativity and the incremental evolution of sulfa drug resistance. Two sulfa drugs (sulfachloropyridazine [SCP] and sulfamethoxypyridazine [SMP]) that had a higher inhibitory potential than SMX were identified. In addition, SCP, SMP, and sulfadiazine (SDZ) were found to be capable of inhibiting the clinically observed drug-resistant mutants. We propose that SCP, SMP, and SDZ should be considered for clinical evaluation against PCP or for future development of novel sulfa drug compounds. PMID:15673759

  10. The Effect of Silicon and Aluminum Additions on the Oxidation Resistance of Lean Chromium Stainless Steels

    SciTech Connect

    Dunning, J.S.; Alman, D.E.; Rawers, J.C.

    2001-09-01

    The effect of Si and Al additions on the oxidation of lean chromium austenitic stainless steels has been studied. A baseline composition of Fe-16Cr-16Ni-2Mn-1Mo was selected to allow combined Si and Al additions of up to 5 wt. pct. in a fully austenitic alloy. The baseline composition was selected using a net Cr equivalent equation to predict the onset of G-ferrite formation in austenite. Cyclic oxidation tests in air for 1000 hours were carried out on alloys with Si only or combined Si and Al additions in the temperature range 700 C to 800 C. Oxidation resistance of alloys with Si only additions were outstanding, particularly at 800 C. It was evident that different rate controlling mechanisms for oxidation were operative at 700 C and 800 C in the Si alloys. In addition, Si alloys pre-oxidized at 800 C, showed a zero weight gain in subsequent testing for 1000 hours at 700 C. The rate controlling mechanism in alloys with combined Si and Al addition for oxidation at 800 C was also different than alloys with Si only. SEM and ESCA analysis of the oxide films and base material at the oxide/base metal interface were conducted to study potential rate controlling mechanisms.

  11. Antibiotic resistance and enterotoxin genes in Staphylococcus sp. isolates from polluted water in Southern Brazil.

    PubMed

    Basso, Ana P; Martins, Paula D; Nachtigall, Gisele; Van Der Sand, Sueli; De Moura, Tiane M; Frazzon, Ana Paula G

    2014-12-01

    The aim of this study was to evaluate the species distribution, antibiotic-resistance profile and presence of enterotoxin (SE) genes in staphylococci isolated from the Dilúvio stream in South Brazil. Eighty-eight staphylococci were identified, 93.18% were identified as coagulase-negative (CNS) and 6.82% coagulase-positive (CPS). Fourteen Staphylococcus species were detected and the most frequently were Staphylococcus cohnii (30.48%) and S. haemolyticus (21.95%). Resistance to erythromycin was verified in 37.50% of the strains, followed by 27.27% to penicillin, 12.50% to clindamycin, 6.81% to trimethoprim-sulfamethoxazole, 5.68% to chloramphenicol and 2.27% to norfloxacin. None of the investigated strains showed gentamicin and ciprofloxacin resistance. The strains were tested for the presence of sea, seb, sec, sed and see genes by PCR and only CNS strains (43.18%) showed positive results to one or more SE genes. The scientific importance of our results is due to the lack of data about these topics in polluted waters in Brazil. In conclusion, polluted waters from the Dilúvio stream may constitute a reservoir for disseminating antibiotic-resistance and enterotoxin into the community. In addition, the detection of staphylococci in the polluted waters of the Dilúvio stream indicated a situation of environmental contamination and poor sanitation conditions.

  12. Antibiotic resistance and enterotoxin genes in Staphylococcus sp. isolates from polluted water in Southern Brazil.

    PubMed

    Basso, Ana P; Martins, Paula D; Nachtigall, Gisele; Sand, Sueli VAN DER; Moura, Tiane M DE; Frazzon, Ana Paula G

    2014-10-01

    The aim of this study was to evaluate the species distribution, antibiotic-resistance profile and presence of enterotoxin (SE) genes in staphylococci isolated from the Dilúvio stream in South Brazil. Eighty-eight staphylococci were identified, 93.18% were identified as coagulase-negative (CNS) and 6.82% coagulase-positive (CPS). Fourteen Staphylococcus species were detected and the most frequently were Staphylococcus cohnii (30.48%) and S. haemolyticus (21.95%). Resistance to erythromycin was verified in 37.50% of the strains, followed by 27.27% to penicillin, 12.50% to clindamycin, 6.81% to trimethoprim-sulfamethoxazole, 5.68% to chloramphenicol and 2.27% to norfloxacin. None of the investigated strains showed gentamicin and ciprofloxacin resistance. The strains were tested for the presence of sea, seb, sec, sed and see genes by PCR and only CNS strains (43.18%) showed positive results to one or more SE genes. The scientific importance of our results is due to the lack of data about these topics in polluted waters in Brazil. In conclusion, polluted waters from the Dilúvio stream may constitute a reservoir for disseminating antibiotic-resistance and enterotoxin into the community. In addition, the detection of staphylococci in the polluted waters of the Dilúvio stream indicated a situation of environmental contamination and poor sanitation conditions.

  13. Multiplex characterization of human pathogens including species and antibiotic-resistance gene identification.

    PubMed

    Barisˇ ić, Ivan; Petzka, Josefine; Schoenthaler, Silvia; Vierlinger, Klemens; Noehammer, Christa; Wiesinger-Mayr, Herbert

    2016-01-01

    The efficient medical treatment of infections requires detailed information about the pathogens involved and potential antibiotic-resistance mechanisms. The dramatically increasing incidence of multidrug-resistant bacteria especially highlights the importance of sophisticated diagnostic tests enabling a fast patient-customized therapy. However, the current molecular detection methods are limited to either the detection of species or only a few antibiotic-resistance genes.In this work, we present a human pathogen characterization assay using a rRNA gene microarray identifying 75 species comprising bacteria and fungi. A statistical classifier was developed to facilitate the automated species identification. Additionally, the clinically most important β-lactamases were identified simultaneously in a 100-plex reaction using padlock probes and the same microarray. The specificity and sensitivity of the combined assay was determined using clinical isolates. The detection limit was 10(5) c.f.u. ml(-1), recovering 89 % of the detectable β-lactamase-encoding genes specifically. The total assay time was less than 7 hand the modular character of the antibiotic-resistance detection allows the easy integration of further genetic targets. In summary, we present a fast, highly specific and sensitive multiplex pathogen characterization assay.

  14. Fate of antibiotic resistant cultivable heterotrophic bacteria and antibiotic resistance genes in wastewater treatment processes.

    PubMed

    Zhang, Songhe; Han, Bing; Gu, Ju; Wang, Chao; Wang, Peifang; Ma, Yanyan; Cao, Jiashun; He, Zhenli

    2015-09-01

    Antibiotic resistant bacteria (ARB) and antibiotic resistance genes (ARGs) are emerging contaminants of environmental concern. Heterotrophic bacteria in activated sludge have an important role in wastewater treatment plants (WWTPs). However, the fate of cultivable heterotrophic ARB and ARGs in WWPTs process remains unclear. In the present study, we investigated the antibiotic-resistant phenotypes of cultivable heterotrophic bacteria from influent and effluent water of three WWTPs and analysed thirteen ARGs in ARB and in activated sludge from anoxic, anaerobic and aerobic compartments. From each influent or effluent sample of the three plants, 200 isolates were randomly tested for susceptibility to 12 antibiotics. In these samples, between 5% and 64% isolates showed resistance to >9 antibiotics and the proportion of >9-drug-resistant bacteria was lower in isolates from effluent than from influent. Eighteen genera were identified in 188 isolates from influent (n=94) and effluent (n=94) of one WWTP. Six genera (Aeromonas, Bacillus, Lysinibacillus, Microbacterium, Providencia, and Staphylococcus) were detected in both influent and effluent samples. Gram-negative and -positive isolates dominated in influent and effluent, respectively. The 13 tetracycline-, sulphonamide-, streptomycin- and β-lactam-resistance genes were detected at a higher frequency in ARB from influent than from effluent, except for sulA and CTX-M, while in general, the abundances of ARGs in activated sludge from two of the three plants were higher in aerobic compartments than in anoxic ones, indicating abundant ARGs exit in the excess sledges and/or in uncultivable bacteria. These findings may be useful for elucidating the effect of WWTP on ARB and ARGs.

  15. Identification and mapping of resistance genes to Phakopsora pachyrhizi in soybean (Glycine max L.) accession PI 594767-A.

    PubMed

    Rocha, G A F; Alves, D P; Oliveira, J C; Brommonschenke, S H

    2016-08-05

    The goal of this study was to study resistance inheritance in the soybean (Glycine max L.) accession PI 594767-A to the Phakopsora pachyrhizi isolate PPUFV02, and map the resistance gene(s) identified using microsatellite markers. Crosses between PI 594767-A and the susceptible cultivar 'Conquista' gave rise to the segregating subpopulations 26C-2 and 26C-5, which in the F2 generation were evaluated for their reactions to PPUFV02. In addition, analyses with microsatellite markers linked to the Rpp1-Rpp5 loci were also performed. The segregation pattern obtained in 26C-2 revealed that resistance was governed by a recessive gene; a 1:2:1 segregation pattern was observed in 26C-5, indicating control by a gene with partial dominance. This variability may have been caused because environmental conditions, particularly temperature, when 26C-5 was assessed were unfavorable for pathogen development, allowing the phenotypic expression of heterozygous alleles in PI 594767-A. A resistance gene was located in the soybean linkage group G, in the genomic region between Sct_187r2 and Sat_064 that contains the Rpp1 locus. Resistance in PI 594767-A is probably conferred by a new Rpp1 gene allele, because this accession has a haplotype for Sct_187r2 and Sat_064, which differs from haplotypes of accessions that also contain resistance alleles that map the Rpp1 locus. The use of Sct_187r2 and Sat_064 will facilitate the introgression of the resistance allele from PI 594767-A and its pyramiding with other resistance genes into genotypes with superior agronomic characteristics, in order to obtain cultivars with broad-spectrum resistance to P. pachyrhizi.

  16. Identification and mapping of resistance genes to Phakopsora pachyrhizi in soybean (Glycine max L.) accession PI 594767-A.

    PubMed

    Rocha, G A F; Alves, D P; Oliveira, J C; Brommonschenke, S H

    2016-01-01

    The goal of this study was to study resistance inheritance in the soybean (Glycine max L.) accession PI 594767-A to the Phakopsora pachyrhizi isolate PPUFV02, and map the resistance gene(s) identified using microsatellite markers. Crosses between PI 594767-A and the susceptible cultivar 'Conquista' gave rise to the segregating subpopulations 26C-2 and 26C-5, which in the F2 generation were evaluated for their reactions to PPUFV02. In addition, analyses with microsatellite markers linked to the Rpp1-Rpp5 loci were also performed. The segregation pattern obtained in 26C-2 revealed that resistance was governed by a recessive gene; a 1:2:1 segregation pattern was observed in 26C-5, indicating control by a gene with partial dominance. This variability may have been caused because environmental conditions, particularly temperature, when 26C-5 was assessed were unfavorable for pathogen development, allowing the phenotypic expression of heterozygous alleles in PI 594767-A. A resistance gene was located in the soybean linkage group G, in the genomic region between Sct_187r2 and Sat_064 that contains the Rpp1 locus. Resistance in PI 594767-A is probably conferred by a new Rpp1 gene allele, because this accession has a haplotype for Sct_187r2 and Sat_064, which differs from haplotypes of accessions that also contain resistance alleles that map the Rpp1 locus. The use of Sct_187r2 and Sat_064 will facilitate the introgression of the resistance allele from PI 594767-A and its pyramiding with other resistance genes into genotypes with superior agronomic characteristics, in order to obtain cultivars with broad-spectrum resistance to P. pachyrhizi. PMID:27525918

  17. Characterization of Stripe Rust Resistance in Wheat Lines with Resistance Gene Yr17 and Implications for Evaluating Resistance and Virulence.

    PubMed

    Milus, Eugene A; Lee, Kevin D; Brown-Guedira, Gina

    2015-08-01

    Stripe rust, caused by Puccinia striiformis f. sp. tritici, has been the most important foliar wheat disease in south central United States since 2000 when a new strain of the pathogen emerged. The resistance gene Yr17 was used by many breeding programs to develop resistant cultivars. Although Yr17 was classified as a seedling (all-stage) resistance gene conferring a low infection type, seedlings with Yr17 frequently had intermediate to high infection types when inoculated with isolates that caused little or no disease on adult plants of the same wheat lines. The objectives of this study were to determine how to best evaluate Yr17 resistance in wheat lines and to determine which factors made seedling tests involving Yr17 so variable. Stripe rust reactions on wheat seedlings with Yr17 were influenced by temperature, wheat genotype, pathogen isolate, and the leaf (first or second) used to assess the seedling reaction. The most critical factors for accurately evaluating Yr17 reactions at the seedling stage were to avoid night temperatures below 12°C, to use the first leaf to assess the seedling reaction, to use multiple differentials with Yr17 and known avirulent, partially virulent and virulent isolates as controls, and to recognize that intermediate infection types likely represent a level of partial virulence in the pathogen that is insufficient to cause disease on adult plants in the field.

  18. Functional cloning and characterization of antibiotic resistance genes from the chicken gut microbiome.

    PubMed

    Zhou, Wei; Wang, Ying; Lin, Jun

    2012-04-01

    Culture-independent sampling in conjunction with a functional cloning approach identified diverse antibiotic resistance genes for different classes of antibiotics in gut microbiomes from both conventionally raised and free-range chickens. Many of the genes are phylogenetically distant from known resistance genes. Two unique genes that conferred ampicillin and spectinomycin resistance were also functional in Campylobacter, a distant relative of the Escherichia coli host used to generate the genomic libraries.

  19. Pyramiding, alternating or mixing: comparative performances of deployment strategies of nematode resistance genes to promote plant resistance efficiency and durability

    PubMed Central

    2014-01-01

    Background Resistant cultivars are key elements for pathogen control and pesticide reduction, but their repeated use may lead to the emergence of virulent pathogen populations, able to overcome the resistance. Increased research efforts, mainly based on theoretical studies, explore spatio-temporal deployment strategies of resistance genes in order to maximize their durability. We evaluated experimentally three of these strategies to control root-knot nematodes: cultivar mixtures, alternating and pyramiding resistance genes, under controlled and field conditions over a 3-years period, assessing the efficiency and the durability of resistance in a protected crop rotation system with pepper as summer crop and lettuce as winter crop. Results The choice of the resistance gene and the genetic background in which it is introgressed, affected the frequency of resistance breakdown. The pyramiding of two different resistance genes in one genotype suppressed the emergence of virulent isolates. Alternating different resistance genes in rotation was also efficient to decrease virulent populations in fields due to the specificity of the virulence and the trapping effect of resistant plants. Mixing resistant cultivars together appeared as a less efficient strategy to control nematodes. Conclusions This work provides experimental evidence that, in a cropping system with seasonal sequences of vegetable species, pyramiding or alternating resistance genes benefit yields in the long-term by increasing the durability of resistant cultivars and improving the long-term control of a soil-borne pest. To our knowledge, this result is the first one obtained for a plant-nematode interaction, which helps demonstrate the general applicability of such strategies for breeding and sustainable management of resistant cultivars against pathogens. PMID:24559060

  20. Fertilizing with Animal Manure Disseminates Antibiotic Resistance Genes to the Farm Environment.

    PubMed

    Ruuskanen, Matti; Muurinen, Johanna; Meierjohan, Axel; Pärnänen, Katariina; Tamminen, Manu; Lyra, Christina; Kronberg, Leif; Virta, Marko

    2016-03-01

    The dissemination of antibiotic resistance genes to the environment is an important factor causing increased prevalence of resistant pathogens. Manure is an important fertilizer, but it contains diverse resistance genes. Therefore, its application to fields may lead to increased abundance of resistance genes in the environment. Farming environments exposed to animal manure have not been studied extensively in countries with comparably low antibiotic use, such as Finland. The effects of manure storage and application to fields on the abundance of resistance genes were studied on two dairy cattle farms and two swine farms in southern Finland. Samples were taken from farms during the 2013 cropping season. Copy numbers of carbapenem (), sulfonamide (), and tetracycline () resistance genes were measured with quantitative polymerase chain reaction, and the data were analyzed using linear mixed models. The relative abundance of antibiotic resistance genes increased about fourfold in soil after manure application. Carbapenemase encoding was detected on all of the studied farms, which indicated that the gene is dispersed in the farm environment. The relative abundance of antibiotic resistance genes increased in stored manure compared with fresh manure roughly fivefold. This study shows that antibiotic resistance genes are disseminated on Finnish production animal farms. The spreading of resistance genes in farm-associated environments could possibly be limited by experimenting with new manure handling methods that could reduce the abundance of the genes in manure used for land application. PMID:27065395

  1. Diversity of antimicrobial resistance and virulence genes in methicillin-resistant non-Staphylococcus aureus staphylococci from veal calves.

    PubMed

    Argudín, M Angeles; Vanderhaeghen, Wannes; Butaye, Patrick

    2015-04-01

    In this study we determined whether methicillin-resistant non-Staphylococcus aureus (MRNAS) from veal calves may be a potential reservoir of antimicrobial-resistance and virulence genes. Fifty-eight MRNAS were studied by means of DNA-microarray and PCR for detection of antimicrobial resistance and virulence genes. The isolates carried a variety of antimicrobial-resistance genes [aacA-aphD, aadD, aph3, aadE, sat, spc, ampA, erm(A), erm(B), erm(C), erm(F), erm(T), lnu(A), msr(A)-msr(B), vga(A), mph(C), tet(K), tet(M), tet(L), cat, fexA, dfrA, dfrD, dfrG, dfrK, cfr, fusB, fosB, qacA, qacC, merA-merB]. Some isolates carried resistance genes without showing the corresponding resistance phenotype. Most MRNAS carried typical S. aureus virulence factors like proteases (sspP) and enterotoxins (seg) genes. Most Staphylococcus epidermidis isolates carried the arginine catabolic element, and nearly 40% of the Staphylococcus sciuri isolates carried leukocidins, and/or fibronectin-binding protein genes. MRNAS were highly multi-resistant and represent an important reservoir of antimicrobial resistance and virulence genes.

  2. Novel Genes Related to Ceftriaxone Resistance Found among Ceftriaxone-Resistant Neisseria gonorrhoeae Strains Selected In Vitro.

    PubMed

    Gong, Zijian; Lai, Wei; Liu, Min; Hua, Zhengshuang; Sun, Yayin; Xu, Qingfang; Xia, Yue; Zhao, Yue; Xie, Xiaoyuan

    2016-04-01

    The emergence of ceftriaxone-resistantNeisseria gonorrhoeaeis currently a global public health concern. However, the mechanism of ceftriaxone resistance is not yet fully understood. To investigate the potential genes related to ceftriaxone resistance inNeisseria gonorrhoeae, we subcultured six gonococcal strains with increasing concentrations of ceftriaxone and isolated the strains that became resistant. After analyzing several frequently reported genes involved in ceftriaxone resistance, we found only a single mutation inpenA(A501V). However, differential analysis of the genomes and transcriptomes between pre- and postselection strains revealed many other mutated genes as well as up- and downregulated genes. Transformation of the mutatedpenAgene into nonresistant strains increased the MIC between 2.0- and 5.3-fold, and transformation of mutatedftsXincreased the MIC between 3.3- and 13.3-fold. Genes encoding the ABC transporters FarB, Tfq, Hfq, and ExbB were overexpressed, whilepilM,pilN, andpilQwere downregulated. Furthermore, the resistant strain developed cross-resistance to penicillin and cefuroxime, had an increased biochemical metabolic rate, and presented fitness defects such as prolonged growth time and downregulated PilMNQ. In conclusion, antimicrobial pressure could result in the emergence of ceftriaxone resistance, and the evolution of resistance ofNeisseria gonorrhoeaeto ceftriaxone is a complicated process at both the pretranscriptional and posttranscriptional levels, involving several resistance mechanisms of increased efflux and decreased entry.

  3. Novel Genes Related to Ceftriaxone Resistance Found among Ceftriaxone-Resistant Neisseria gonorrhoeae Strains Selected In Vitro.

    PubMed

    Gong, Zijian; Lai, Wei; Liu, Min; Hua, Zhengshuang; Sun, Yayin; Xu, Qingfang; Xia, Yue; Zhao, Yue; Xie, Xiaoyuan

    2016-04-01

    The emergence of ceftriaxone-resistantNeisseria gonorrhoeaeis currently a global public health concern. However, the mechanism of ceftriaxone resistance is not yet fully understood. To investigate the potential genes related to ceftriaxone resistance inNeisseria gonorrhoeae, we subcultured six gonococcal strains with increasing concentrations of ceftriaxone and isolated the strains that became resistant. After analyzing several frequently reported genes involved in ceftriaxone resistance, we found only a single mutation inpenA(A501V). However, differential analysis of the genomes and transcriptomes between pre- and postselection strains revealed many other mutated genes as well as up- and downregulated genes. Transformation of the mutatedpenAgene into nonresistant strains increased the MIC between 2.0- and 5.3-fold, and transformation of mutatedftsXincreased the MIC between 3.3- and 13.3-fold. Genes encoding the ABC transporters FarB, Tfq, Hfq, and ExbB were overexpressed, whilepilM,pilN, andpilQwere downregulated. Furthermore, the resistant strain developed cross-resistance to penicillin and cefuroxime, had an increased biochemical metabolic rate, and presented fitness defects such as prolonged growth time and downregulated PilMNQ. In conclusion, antimicrobial pressure could result in the emergence of ceftriaxone resistance, and the evolution of resistance ofNeisseria gonorrhoeaeto ceftriaxone is a complicated process at both the pretranscriptional and posttranscriptional levels, involving several resistance mechanisms of increased efflux and decreased entry. PMID:26787702

  4. Response of NBS encoding resistance genes linked to both heat and fungal stress in Brassica oleracea.

    PubMed

    Kim, Young-Wook; Jung, Hee-Jeong; Park, Jong-In; Hur, Yoonkang; Nou, Ill-Sup

    2015-01-01

    Environmental stresses, including both abiotic and biotic stresses, cause considerable yield loss in crops and can significantly affect their development. Under field conditions, crops are exposed to a variety of concurrent stresses. Among abiotic and biotic stresses, heat and Fusarium oxysporum, are the most important factors affecting development and yield productivity of Brassica oleracea. Genes encoding the nucleotide-binding site (NBS) motif are known to be related to responses to abiotic and biotic stresses in many plants. Hence, this study was conducted to characterize the NBS encoding genes obtained from transcriptome profiles of two cabbage genotypes with contrasting responses to heat stress, and to test expression levels of selected NBS- leucine reich repeat (LRR) genes in F. oxysporum infected plants. We selected 80 up-regulated genes from a total of 264 loci, among which 17 were confirmed to be complete and incomplete members of the TIR-NBS-LRR (TNL) class families, and another identified as an NFYA-HAP2 family member. Expression analysis using qRT-PCR revealed that eight genes showed significant responses to heat shock treatment and F. oxysporum infection. Additionally, in the commercial B. oleracea cultivars with resistance to F. oxysporum, the Bol007132, Bol016084, and Bol030522 genes showed dramatically higher expression in the F. oxysporum resistant line than in the intermediate and susceptible lines. The results of this study will facilitate the identification and the development of molecular markers based on multiple stress resistance genes related to heat and fungal stress under field conditions in B. oleracea. PMID:25461701

  5. Survival of Antibiotic Resistant Bacteria and Horizontal Gene Transfer Control Antibiotic Resistance Gene Content in Anaerobic Digesters

    PubMed Central

    Miller, Jennifer H.; Novak, John T.; Knocke, William R.; Pruden, Amy

    2016-01-01

    Understanding fate of antibiotic resistant bacteria (ARB) vs. their antibiotic resistance genes (ARGs) during wastewater sludge treatment is critical in order to reduce the spread of antibiotic resistance through process optimization. Here, we spiked high concentrations of tetracycline-resistant bacteria, isolated from mesophilic (Iso M1-1—a Pseudomonas sp.) and thermophilic (Iso T10—a Bacillus sp.) anaerobic digested sludge, into batch digesters and monitored their fate by plate counts and quantitative polymerase chain reaction (QPCR) of their corresponding tetracycline ARGs. In batch studies, spiked ARB plate counts returned to baseline (thermophilic) or 1-log above baseline (mesophilic) while levels of the ARG present in the spiked isolate [tet(G)] remained high in mesophilic batch reactors. To compare results under semi-continuous flow conditions with natural influent variation, tet(O), tet(W), and sul1 ARGs, along with the intI1 integrase gene, were monitored over a 9-month period in the raw feed sludge and effluent sludge of lab-scale thermophilic and mesophilic anaerobic digesters. sul1 and intI1 in mesophilic and thermophilic digesters correlated positively (Spearman rho = 0.457–0.829, P < 0.05) with the raw feed sludge. There was no correlation in tet(O) or tet(W) ratios in raw sludge and mesophilic digested sludge or thermophilic digested sludge (Spearman rho = 0.130–0.486, P = 0.075–0.612). However, in the thermophilic digester, the tet(O) and tet(W) ratios remained consistently low over the entire monitoring period. We conclude that the influent sludge microbial composition can influence the ARG content of a digester, apparently as a result of differential survival or death of ARBs or horizontal gene transfer of genes between raw sludge ARBs and the digester microbial community. Notably, mesophilic digestion was more susceptible to ARG intrusion than thermophilic digestion, which may be attributed to a higher rate of ARB survival and

  6. Survival of Antibiotic Resistant Bacteria and Horizontal Gene Transfer Control Antibiotic Resistance Gene Content in Anaerobic Digesters.

    PubMed

    Miller, Jennifer H; Novak, John T; Knocke, William R; Pruden, Amy

    2016-01-01

    Understanding fate of antibiotic resistant bacteria (ARB) vs. their antibiotic resistance genes (ARGs) during wastewater sludge treatment is critical in order to reduce the spread of antibiotic resistance through process optimization. Here, we spiked high concentrations of tetracycline-resistant bacteria, isolated from mesophilic (Iso M1-1-a Pseudomonas sp.) and thermophilic (Iso T10-a Bacillus sp.) anaerobic digested sludge, into batch digesters and monitored their fate by plate counts and quantitative polymerase chain reaction (QPCR) of their corresponding tetracycline ARGs. In batch studies, spiked ARB plate counts returned to baseline (thermophilic) or 1-log above baseline (mesophilic) while levels of the ARG present in the spiked isolate [tet(G)] remained high in mesophilic batch reactors. To compare results under semi-continuous flow conditions with natural influent variation, tet(O), tet(W), and sul1 ARGs, along with the intI1 integrase gene, were monitored over a 9-month period in the raw feed sludge and effluent sludge of lab-scale thermophilic and mesophilic anaerobic digesters. sul1 and intI1 in mesophilic and thermophilic digesters correlated positively (Spearman rho = 0.457-0.829, P < 0.05) with the raw feed sludge. There was no correlation in tet(O) or tet(W) ratios in raw sludge and mesophilic digested sludge or thermophilic digested sludge (Spearman rho = 0.130-0.486, P = 0.075-0.612). However, in the thermophilic digester, the tet(O) and tet(W) ratios remained consistently low over the entire monitoring period. We conclude that the influent sludge microbial composition can influence the ARG content of a digester, apparently as a result of differential survival or death of ARBs or horizontal gene transfer of genes between raw sludge ARBs and the digester microbial community. Notably, mesophilic digestion was more susceptible to ARG intrusion than thermophilic digestion, which may be attributed to a higher rate of ARB survival and/or horizontal gene

  7. Formation and transmission of Staphylococcus aureus (including MRSA) aerosols carrying antibiotic-resistant genes in a poultry farming environment.

    PubMed

    Liu, Dunjiang; Chai, Tongjie; Xia, Xianzhu; Gao, Yuwei; Cai, Yumei; Li, Xiaoxia; Miao, Zengming; Sun, Lingyu; Hao, Haiyu; Roesler, Uwe; Wang, Jian

    2012-06-01

    There is a rather limited understanding concerning the antibiotic-resistance of the airborne S. aureus and the transmission of the antibiotic-resistant genes it carries Therefore, we isolated 149 S. aureus strains from the samples collected from the feces, the indoor air and the outdoor air of 6 chicken farms, and performed the research on them with 15 types of antibiotics and the REP-PCR trace identification. The 100% homologous strains were selected to conduct the research on the carrying and transmission status of the antibiotic-resistant genes. The results revealed that 5.37% strains (8/149) were resistant to methicillins (MRSA), and 94% strains (140/149) were resistant to compound sulfamethoxazole, etc. In addition, these strains displayed a resistance to multiple antibiotics (4, 5 or 6 types) and there were also 3 strains resistant to 9 antibiotics. It should be noted that the antibiotic-resistance of some strains isolated from the feces, the indoor and outdoor air was basically the same, and the strains with the same REP-PCR trace identification result carried the same type of antibiotic-resistant genes. The results showed that airborne transmission not only causes the spread of epidemic diseases but also exerts threats to the public health of a community.

  8. Distribution and quantification of antibiotic resistant genes and bacteria across agricultural and non-agricultural metagenomes.

    PubMed

    Durso, Lisa M; Miller, Daniel N; Wienhold, Brian J

    2012-01-01

    There is concern that antibiotic resistance can potentially be transferred from animals to humans through the food chain. The relationship between specific antibiotic resistant bacteria and the genes they carry remains to be described. Few details are known about the ecology of antibiotic resistant genes and bacteria in food production systems, or how antibiotic resistance genes in food animals compare to antibiotic resistance genes in other ecosystems. Here we report the distribution of antibiotic resistant genes in publicly available agricultural and non-agricultural metagenomic samples and identify which bacteria are likely to be carrying those genes. Antibiotic resistance, as coded for in the genes used in this study, is a process that was associated with all natural, agricultural, and human-impacted ecosystems examined, with between 0.7 to 4.4% of all classified genes in each habitat coding for resistance to antibiotic and toxic compounds (RATC). Agricultural, human, and coastal-marine metagenomes have characteristic distributions of antibiotic resistance genes, and different bacteria that carry the genes. There is a larger percentage of the total genome associated with antibiotic resistance in gastrointestinal-associated and agricultural metagenomes compared to marine and Antarctic samples. Since antibiotic resistance genes are a natural part of both human-impacted and pristine habitats, presence of these resistance genes in any specific habitat is therefore not sufficient to indicate or determine impact of anthropogenic antibiotic use. We recommend that baseline studies and control samples be taken in order to determine natural background levels of antibiotic resistant bacteria and/or antibiotic resistance genes when investigating the impacts of veterinary use of antibiotics on human health. We raise questions regarding whether the underlying biology of each type of bacteria contributes to the likelihood of transfer via the food chain.

  9. Modification of silicone sealant to improve gamma radiation resistance, by addition of protective agents

    NASA Astrophysics Data System (ADS)

    González-Pérez, Giovanni; Burillo, Guillermina

    2013-09-01

    Poly (dimethylsiloxane) (PDMS) sealant (SS) was modified with the addition of different protective compounds to conserve its physical-chemical properties during gamma irradiation. 2-Vinyl naphthalene (2-VN), bisphenol-A (BPA) and poly (vinyl carbazole) (PVK) were used to evaluate radiation protection through the crosslinking effect of radiation. The samples were irradiated with doses from 100 kGy to 500 kGy at room temperature in air, with a 60Co gamma source, and the changes in molecular weight, thermal behavior, elastic properties and infrared spectra (FTIR-ATR) absorbance analysis were determined. The molecular weight of unmodified silicone sealant increases with the absorbed dose because of crosslinking as predominant effect. However, the crosslinking effect was inhibited with the addition of protective agent due to the aromatic compounds present. Modified silicone sealant films present better radiation resistance than unmodified system.

  10. Malathion Resistance Status and Mutations in Acetylcholinesterase Gene (Ace) in Japanese Encephalitis and Filariasis Vectors from Endemic Area in India.

    PubMed

    Misra, Brij Ranjan; Gore, Milind

    2015-05-01

    Japanese encephalitis (JE) and lymphatic filariasis (LF) are endemic in estern part of Uttar Pradesh in India and transmitted by Culex mosquitoes (Diptera: Culicidae). JE vaccination and mass drug administration for JE and LF management is being undertaken respectively. In addition to this, indoor residual spraying and fogging are used for the control of mosquito vectors. Organophosphate resistance in mosquito is dependent on alteration in acetylcholinesterase (Ace) gene. Hence, it is important to evaluate organophosphate resistance in Culex tritaeniorhynchus Giles (JE vector) and Culex quinquefasciatus Say (LF vector). The current study showed the presence of resistant populations and F331W mutation in Cx. tritaeniorhynchus and G119S mutation in Cx. quinquefasciatus insensitive Ace genes. Resistant populations of these two vectors increase the chances of spreading of resistance in the natural population and may cause failure of intervention programs that include organophosphates against these two vectors in future.

  11. Metagenomic Analysis Revealing Antibiotic Resistance Genes (ARGs) and Their Genetic Compartments in the Tibetan Environment.

    PubMed

    Chen, Baowei; Yuan, Ke; Chen, Xin; Yang, Ying; Zhang, Tong; Wang, Yawei; Luan, Tiangang; Zou, Shichun; Li, Xiangdong

    2016-07-01

    Comprehensive profiles of antibiotic resistance genes (ARGs) and mobile genetic elements (MGEs) in a minimally impacted environment are essential to understanding the evolution and dissemination of modern antibiotic resistance. Chemical analyses of the samples collected from Tibet demonstrated that the region under investigation was almost devoid of anthropogenic antibiotics. The soils, animal wastes, and sediments were different from each other in terms of bacterial community structures, and in the typical profiles of ARGs and MGEs. Diverse ARGs that encoded resistance to common antibiotics (e.g., beta-lactams, fluoroquinolones, etc.) were found mainly via an efflux mechanism completely distinct from modern antibiotic resistome. In addition, a very small fraction of ARGs in the Tibetan environment were carried by MGEs, indicating the low potential of these ARGs to be transferred among bacteria. In comparison to the ARG profiles in relatively pristine Tibet, contemporary ARGs and MGEs in human-impacted environments have evolved substantially since the broad use of anthropogenic antibiotics. PMID:27111002

  12. Metagenomic Analysis Revealing Antibiotic Resistance Genes (ARGs) and Their Genetic Compartments in the Tibetan Environment.

    PubMed

    Chen, Baowei; Yuan, Ke; Chen, Xin; Yang, Ying; Zhang, Tong; Wang, Yawei; Luan, Tiangang; Zou, Shichun; Li, Xiangdong

    2016-07-01

    Comprehensive profiles of antibiotic resistance genes (ARGs) and mobile genetic elements (MGEs) in a minimally impacted environment are essential to understanding the evolution and dissemination of modern antibiotic resistance. Chemical analyses of the samples collected from Tibet demonstrated that the region under investigation was almost devoid of anthropogenic antibiotics. The soils, animal wastes, and sediments were different from each other in terms of bacterial community structures, and in the typical profiles of ARGs and MGEs. Diverse ARGs that encoded resistance to common antibiotics (e.g., beta-lactams, fluoroquinolones, etc.) were found mainly via an efflux mechanism completely distinct from modern antibiotic resistome. In addition, a very small fraction of ARGs in the Tibetan environment were carried by MGEs, indicating the low potential of these ARGs to be transferred among bacteria. In comparison to the ARG profiles in relatively pristine Tibet, contemporary ARGs and MGEs in human-impacted environments have evolved substantially since the broad use of anthropogenic antibiotics.

  13. Isolation and characterization of a wheat--Psathyrostachys huashanica 'Keng' 3Ns disomic addition line with resistance to stripe rust.

    PubMed

    Du, Wanli; Wang, Jing; Pang, Yuhui; Wang, Liangming; Wu, Jun; Zhao, Jixin; Yang, Qunhui; Chen, Xinhong

    2014-01-01

    We isolated a wheat germplasm line, 22-2, which was derived from common wheat (Triticum aestivum '7182') and Psathyrostachys huashanica 'Keng' (2n = 2x = 14, NsNs). Genomic composition and homoeologous relationships of 22-2 was analyzed using cytology, genomic in situ hybridization (GISH), EST-SSR, and EST-STS to characterize the alien chromatin in the transfer line. The cytological investigations showed that the chromosome number and configuration were 2n = 44 = 22 II. Mitotic and meiotic GISH using P. huashanica genomic DNA as the probe indicated that 22-2 contained a pair of P. huashanica chromosomes. The genomic affinities of the introduced P. huashanica chromosomes were determined by EST-SSR and EST-STS using multiple-loci markers from seven wheat homoeologous groups between the parents and addition line. One EST-SSR and 17 EST-STS markers, which were located on the homoeologous group 3 chromosomes of wheat, amplified polymorphic bands in 22-2 that were unique to P. huashanica. Thus, these markers suggested that the introduced Ns chromosome pair belonged to homoeologous group 3, so we designated 22-2 as a 3Ns disomic addition line. Based on disease reaction to mixed races (CYR31, CYR32, and Shuiyuan14) of stripe rust in the adult stages, 22-2 was found to have high resistance to stripe rust, which was possibly derived from its P. huashanica parent. Consequently, the new disomic addition line 22-2 could be a valuable donor source for wheat improvement depending on the excellent agronomic traits, especially, the introduction of novel disease resistance genes into wheat during breeding programs.

  14. Isolation and characterization of a wheat--Psathyrostachys huashanica 'Keng' 3Ns disomic addition line with resistance to stripe rust.

    PubMed

    Du, Wanli; Wang, Jing; Pang, Yuhui; Wang, Liangming; Wu, Jun; Zhao, Jixin; Yang, Qunhui; Chen, Xinhong

    2014-01-01

    We isolated a wheat germplasm line, 22-2, which was derived from common wheat (Triticum aestivum '7182') and Psathyrostachys huashanica 'Keng' (2n = 2x = 14, NsNs). Genomic composition and homoeologous relationships of 22-2 was analyzed using cytology, genomic in situ hybridization (GISH), EST-SSR, and EST-STS to characterize the alien chromatin in the transfer line. The cytological investigations showed that the chromosome number and configuration were 2n = 44 = 22 II. Mitotic and meiotic GISH using P. huashanica genomic DNA as the probe indicated that 22-2 contained a pair of P. huashanica chromosomes. The genomic affinities of the introduced P. huashanica chromosomes were determined by EST-SSR and EST-STS using multiple-loci markers from seven wheat homoeologous groups between the parents and addition line. One EST-SSR and 17 EST-STS markers, which were located on the homoeologous group 3 chromosomes of wheat, amplified polymorphic bands in 22-2 that were unique to P. huashanica. Thus, these markers suggested that the introduced Ns chromosome pair belonged to homoeologous group 3, so we designated 22-2 as a 3Ns disomic addition line. Based on disease reaction to mixed races (CYR31, CYR32, and Shuiyuan14) of stripe rust in the adult stages, 22-2 was found to have high resistance to stripe rust, which was possibly derived from its P. huashanica parent. Consequently, the new disomic addition line 22-2 could be a valuable donor source for wheat improvement depending on the excellent agronomic traits, especially, the introduction of novel disease resistance genes into wheat during breeding programs. PMID:24564214

  15. [Genetic mapping of resistant gene to southern corn rust and the tagging analysis on different genetic background].

    PubMed

    Chen, Cui-Xia; Xing, Quan-Hua; Liang, Chun-Yang; Yu, Yuan-Jie; Liang, Feng-Shan; Wang, Hong-Gang; Wang, Zhen-Lin; Wang, Bin

    2003-04-01

    Southern corn rust (SCR) is a destructive disease in maize. The inbred line Qi319 is highly resistant to southern corn rust. SSR technique was employed to preliminary mapping of the resistance gene. Bulked segregant analysis revealed that two primers, phi 118 and phi 041, amplified polymorphic bands. SSR analysis on populations indicated the two primers were linked to the rust resistance gene, which was mapped on the short arm of chromosome 10. In addition, comparative analysis of the amplification bands among different populations revealed that the amplification products with the same primer in different populations were dissimilar. This result indicates that the genetic background may affect results of gene mapping and tagging. So, it is important to select suitable population to performing molecular marker analysis and gene mapping.

  16. Analysis of hepatitis B virus genotyping and drug resistance gene mutations based on massively parallel sequencing.

    PubMed

    Han, Yingxin; Zhang, Yinxin; Mei, Yanhua; Wang, Yuqi; Liu, Tao; Guan, Yanfang; Tan, Deming; Liang, Yu; Yang, Ling; Yi, Xin

    2013-11-01

    Drug resistance to nucleoside analogs is a serious problem worldwide. Both drug resistance gene mutation detection and HBV genotyping are helpful for guiding clinical treatment. Total HBV DNA from 395 patients who were treated with single or multiple drugs including Lamivudine, Adefovir, Entecavir, Telbivudine, Tenofovir and Emtricitabine were sequenced using the HiSeq 2000 sequencing system and validated using the 3730 sequencing system. In addition, a mixed sample of HBV plasmid DNA was used to determine the cutoff value for HiSeq-sequencing, and 52 of the 395 samples were sequenced three times to evaluate the repeatability and stability of this technology. Of the 395 samples sequenced using both HiSeq and 3730 sequencing, the results from 346 were consistent, and the results from 49 were inconsistent. Among the 49 inconsistent results, 13 samples were detected as drug-resistance-positive using HiSeq but negative using 3730, and the other 36 samples showed a higher number of drug-resistance-positive gene mutations using HiSeq 2000 than using 3730. Gene mutations had an apparent frequency of 1% as assessed by the plasmid testing. Therefore, a 1% cutoff value was adopted. Furthermore, the experiment was repeated three times, and the same results were obtained in 49/52 samples using the HiSeq sequencing system. HiSeq sequencing can be used to analyze HBV gene mutations with high sensitivity, high fidelity, high throughput and automation and is a potential method for hepatitis B virus gene mutation detection and genotyping.

  17. Effect of silver nanoparticles and antibiotics on antibiotic resistance genes in anaerobic digestion.

    PubMed

    Miller, Jennifer H; Novak, John T; Knocke, William R; Young, Katherine; Hong, Yanjuan; Vikesland, Peter J; Hull, Matthew S; Pruden, Amy

    2013-05-01

    Water resource recovery facilities have been described as creating breeding ground conditions for the selection, transfer, and dissemination of antibiotic resistance genes (ARGs) among various bacteria. The objective of this study was to determine the effect of direct addition of antibiotic and silver nanoparticles (Ag NPs, or nanosilver) on the occurrence of ARGs in thermophilic anaerobic digesters. Test thermophilic digesters were amended with environmentally-relevant concentrations of Ag NP (0.01, 0.1, and 1.0 mg-Ag/L; corresponding to approximately 0.7, 7.0, and 70 mg-Ag/kg total solids) and sulfamethoxazole (SMX) that span susceptible to resistant classifications (1, 5, and 50 mg/L) as potential selection pressures for ARGs. Tetracycline (tet(O), tet(W)) and sulfonamide (sulI, sulII) ARGs and the integrase enzyme gene (intI1) associated with Class 1 integrons were measured in raw sludge, test thermophilic digesters, a control thermophilic digester, and a control mesophilic digester. There was no apparent effect of Ag NPs on thermophilic anaerobic digester performance. The maximum SMX addition (50 mg/L) resulted in accumulation of volatile fatty acids and low pH, alkalinity, and volatile solids reduction. There was no significant difference between ARG gene copy numbers (absolute or normalized to 16S rRNA genes) in amended thermophilic digesters and the control thermophilic digester. Antibiotic resistance gene copy numbers in digested sludge ranged from 10(3) to 10(6) copies per microL (approximately 8 x10(1) to 8 x 10(4) copies per microg) of sludge as result of a 1-log reduction of ARGs (2-log reduction for intI1). Quantities of the five ARGs in raw sludge ranged from 10(4) to 10(8) copies per microL (approximately 4 x 10(2) to 4 x 10(6) per microg) of sludge. Test and control thermophilic digesters (53 degrees C, 12-day solids retention time [SRT]) consistently reduced but did not eliminate levels of all analyzed genes. The mesophilic digester (37 degrees C

  18. PREVALENCE OF SULFONAMIDE AND FLORFENICOL RESISTANCE GENES IN ESCHERICHIA COLI ISOLATED FROM YAKS (BOS GRUNNIENS) AND HERDSMEN IN THE TIBETAN PASTURE.

    PubMed

    Zhang, Anyun; Yang, Yunfei; Wang, Hongning; Lei, Changwei; Xu, Changwen; Guan, Zhongbin; Liu, Bihui; Huang, Xi; Peng, Linyao

    2015-07-01

    To determine the antimicrobial susceptibility profiles and prevalence of resistance genes in Escherichia coli isolated from yaks (Bos grunniens) and herdsmen in nine plateau pastures in Tibet, we isolated 184 nonidentical strains of E. coli from yaks and herdsmen. Antimicrobial susceptibility testing of 15 antimicrobials was conducted and the prevalence of sulfonamide resistance genes (sul1, sul2, and sul3) and florfenicol resistance genes (floR, cfr, cmlA, fexA, pexA, and estDL136) was determined. Escherichia coli isolated from yaks had a high resistance rate to sulfamethoxazole (44%), sulphafurazole (40.4%), and florfenicol (11.4%). Escherichia coli isolated from herdsmen had a high resistance rate to sulfamethoxazole (57%) and sulphafurazole (51%). In addition, sul genes were present in 93% of sulfonamide-resistant isolates (84/90), and 17 floR genes and four cmlA genes were found in 19 florfenicol-resistant isolates. Even though florfenicol is prohibited from use in humans, three floR genes were detected in strains isolated from herdsmen. The three floR-positive isolates from herdsmen had pulsed-field gel electrophoresis patterns similar to isolates from yaks. In addition to documenting the sul and floR genes in E. coli isolated from yaks and herdsmen in the Tibetan pasture, we demonstrated the potential risk that antimicrobial-resistant E. coli could spread among herdsmen and yaks. PMID:25973625

  19. PREVALENCE OF SULFONAMIDE AND FLORFENICOL RESISTANCE GENES IN ESCHERICHIA COLI ISOLATED FROM YAKS (BOS GRUNNIENS) AND HERDSMEN IN THE TIBETAN PASTURE.

    PubMed

    Zhang, Anyun; Yang, Yunfei; Wang, Hongning; Lei, Changwei; Xu, Changwen; Guan, Zhongbin; Liu, Bihui; Huang, Xi; Peng, Linyao

    2015-07-01

    To determine the antimicrobial susceptibility profiles and prevalence of resistance genes in Escherichia coli isolated from yaks (Bos grunniens) and herdsmen in nine plateau pastures in Tibet, we isolated 184 nonidentical strains of E. coli from yaks and herdsmen. Antimicrobial susceptibility testing of 15 antimicrobials was conducted and the prevalence of sulfonamide resistance genes (sul1, sul2, and sul3) and florfenicol resistance genes (floR, cfr, cmlA, fexA, pexA, and estDL136) was determined. Escherichia coli isolated from yaks had a high resistance rate to sulfamethoxazole (44%), sulphafurazole (40.4%), and florfenicol (11.4%). Escherichia coli isolated from herdsmen had a high resistance rate to sulfamethoxazole (57%) and sulphafurazole (51%). In addition, sul genes were present in 93% of sulfonamide-resistant isolates (84/90), and 17 floR genes and four cmlA genes were found in 19 florfenicol-resistant isolates. Even though florfenicol is prohibited from use in humans, three floR genes were detected in strains isolated from herdsmen. The three floR-positive isolates from herdsmen had pulsed-field gel electrophoresis patterns similar to isolates from yaks. In addition to documenting the sul and floR genes in E. coli isolated from yaks and herdsmen in the Tibetan pasture, we demonstrated the potential risk that antimicrobial-resistant E. coli could spread among herdsmen and yaks.

  20. In vitro additive effect of imipenem combined with vancomycin against multiple-drug resistant, coagulase-negative Staphylococci.

    PubMed

    Traub, W H; Spohr, M; Bauer, D

    1986-09-01

    Imipenem combined with vancomycin resulted in a marked additive effect in vitro against 9 clinical isolates of multiple-drug resistant (MDR), coagulase-negative staphylococci, including strains resistant against imipenem. The additive effect was documented with the aid of checkerboard MIC determinations and with time kill curve experiments. In contrast, imipenem combined with vancomycin merely yielded weak additive or indifferent effects against 10 MDR isolates of Staphylococcus aureus, all of which were susceptible to imipenem.

  1. Effect of chlorine exposure on the survival and antibiotic gene expression of multidrug resistant Acinetobacter baumannii in water.

    PubMed

    Karumathil, Deepti Prasad; Yin, Hsin-Bai; Kollanoor-Johny, Anup; Venkitanarayanan, Kumar

    2014-02-07

    Acinetobacter baumannii is a multidrug resistant pathogen capable of causing a wide spectrum of clinical conditions in humans. Acinetobacter spp. is ubiquitously found in different water sources. Chlorine being the most commonly used disinfectant in water, the study investigated the effect of chlorine on the survival of A. baumannii in water and transcription of genes conferring antibiotic resistance. Eight clinical isolates of A. baumannii, including a fatal meningitis isolate (ATCC 17978) (~108 CFU/mL) were separately exposed to free chlorine concentrations (0.2, 1, 2, 3 and 4 ppm) with a contact time of 30, 60, 90 and 120 second. The surviving pathogen counts at each specified contact time were determined using broth dilution assay. In addition, real-time quantitative PCR (RT-qPCR) analysis of the antibiotic resistance genes (efflux pump genes and those encoding resistance to specific antibiotics) of three selected A. baumannii strains following exposure to chlorine was performed. Results revealed that all eight A. baumannii isolates survived the tested chlorine levels during all exposure times (p > 0.05). Additionally, there was an up-regulation of all or some of the antibiotic resistance genes in A. baumannii, indicating a chlorine-associated induction of antibiotic resistance in the pathogen.

  2. Effect of Chlorine Exposure on the Survival and Antibiotic Gene Expression of Multidrug Resistant Acinetobacter baumannii in Water

    PubMed Central

    Karumathil, Deepti Prasad; Yin, Hsin-Bai; Kollanoor-Johny, Anup; Venkitanarayanan, Kumar

    2014-01-01

    Acinetobacter baumannii is a multidrug resistant pathogen capable of causing a wide spectrum of clinical conditions in humans. Acinetobacter spp. is ubiquitously found in different water sources. Chlorine being the most commonly used disinfectant in water, the study investigated the effect of chlorine on the survival of A. baumannii in water and transcription of genes conferring antibiotic resistance. Eight clinical isolates of A. baumannii, including a fatal meningitis isolate (ATCC 17978) (~108 CFU/mL) were separately exposed to free chlorine concentrations (0.2, 1, 2, 3 and 4 ppm) with a contact time of 30, 60, 90 and 120 second. The surviving pathogen counts at each specified contact time were determined using broth dilution assay. In addition, real-time quantitative PCR (RT-qPCR) analysis of the antibiotic resistance genes (efflux pump genes and those encoding resistance to specific antibiotics) of three selected A. baumannii strains following exposure to chlorine was performed. Results revealed that all eight A. baumannii isolates survived the tested chlorine levels during all exposure times (p > 0.05). Additionally, there was an up-regulation of all or some of the antibiotic resistance genes in A. baumannii, indicating a chlorine-associated induction of antibiotic resistance in the pathogen. PMID:24514427

  3. Bioaerosol emissions and detection of airborne antibiotic resistance genes from a wastewater treatment plant

    NASA Astrophysics Data System (ADS)

    Li, Jing; Zhou, Liantong; Zhang, Xiangyu; Xu, Caijia; Dong, Liming; Yao, Maosheng

    2016-01-01

    Air samples from twelve sampling sites (including seven intra-plant sites, one upwind site and four downwind sites) from a wastewater treatment plant (WWTP) in Beijing were collected using a Reuter Centrifugal Sampler High Flow (RCS); and their microbial fractions were studied using culturing and high throughput gene sequence. In addition, the viable (fluorescent) bioaerosol concentrations for 7 intra-plant sites were also monitored for 30 min each using an ultraviolet aerodynamic particle sizer (UV-APS). Both air and water samples collected from the plant were investigated for possible bacterial antibiotic resistance genes and integrons using polymerase chain reaction (PCR) coupled with gel electrophoresis. The results showed that the air near sludge thickening basin was detected to have the highest level of culturable bacterial aerosols (up to 1697 CFU/m3) and fungal aerosols (up to 930 CFU/m3). For most sampling sites, fluorescent peaks were observed at around 3-4 μm, except the office building with a peak at 1.5 μm, with a number concentration level up to 1233-6533 Particles/m3. About 300 unique bacterial species, including human opportunistic pathogens, such as Comamonas Testosteroni and Moraxella Osloensis, were detected from the air samples collected over the biological reaction basin. In addition, we have detected the sul2 gene resistant to cotrimoxazole (also known as septra, bactrim and TMP-SMX) and class 1 integrase gene from the air samples collected from the screen room and the biological reaction basin. Overall, the screen room, sludge thickening basin and biological reaction basin imposed significant microbial exposure risks, including those from airborne antibiotic resistance genes.

  4. DBDiaSNP: An Open-Source Knowledgebase of Genetic Polymorphisms and Resistance Genes Related to Diarrheal Pathogens

    PubMed Central

    Mehla, Kusum

    2015-01-01

    Abstract Diarrhea is a highly common infection among children, responsible for significant morbidity and mortality rate worldwide. After pneumonia, diarrhea remains the second leading cause of neonatal deaths. Numerous viral, bacterial, and parasitic enteric pathogens are associated with diarrhea. With increasing antibiotic resistance among enteric pathogens, there is an urgent need for global surveillance of the mutations and resistance genes primarily responsible for resistance to antibiotic treatment. Single Nucleotide Polymorphisms are important in this regard as they have a vast potential to be utilized as molecular diagnostics for gene-disease or pharmacogenomics association studies linking genotype to phenotype. DBDiaSNP is a comprehensive repository of mutations and resistance genes among various diarrheal pathogens and hosts to advance breakthroughs that will find applications from development of sequence-based diagnostic tools to drug discovery. It contains information about 946 mutations and 326 resistance genes compiled from literature and various web resources. As of March 2015, it houses various pathogen genes and the mutations responsible for antibiotic resistance. The pathogens include, for example, DEC (Diarrheagenic E.coli), Salmonella spp., Campylobacter spp., Shigella spp., Clostridium difficile, Aeromonas spp., Helicobacter pylori, Entamoeba histolytica, Vibrio cholera, and viruses. It also includes mutations from hosts (e.g., humans, pigs, others) that render them either susceptible or resistant to a certain type of diarrhea. DBDiaSNP is therefore intended as an integrated open access database for researchers and clinicians working on diarrheal diseases. Additionally, we note that the DBDiaSNP is one of the first antibiotic resistance databases for the diarrheal pathogens covering mutations and resistance genes that have clinical relevance from a broad range of pathogens and hosts. For future translational research involving integrative

  5. Full-genome identification and characterization of NBS-encoding disease resistance genes in wheat.

    PubMed

    Bouktila, Dhia; Khalfallah, Yosra; Habachi-Houimli, Yosra; Mezghani-Khemakhem, Maha; Makni, Mohamed; Makni, Hanem

    2015-02-01

    Host resistance is the most economical, effective and ecologically sustainable method of controlling diseases in crop plants. In bread wheat, despite the high number of resistance loci that have been cataloged to date, only few have been cloned, underlying the need for genomics-guided investigations capable of providing a prompt and acute knowledge on the identity of effective resistance genes that can be used in breeding programs. Proteins with a nucleotide-binding site (NBS) encoded by the major plant disease resistance (R) genes play an important role in the responses of plants to various pathogens. In this study, a comprehensive analysis of NBS-encoding genes within the whole wheat genome was performed, and the genome scale characterization of this gene family was established. From the recently published wheat genome sequence, we used a data mining and automatic prediction pipeline to identify 580 complete ORF candidate NBS-encoding genes and 1,099 partial-ORF ones. Among complete gene models, 464 were longer than 200 aa, among them 436 had less than 70 % of sequence identity to each other. This gene models set was deeply characterized. (1) First, we have analyzed domain architecture and identified, in addition to typical domain combinations, the presence of particular domains like signal peptides, zinc fingers, kinases, heavy-metal-associated and WRKY DNA-binding domains. (2) Functional and expression annotation via homology searches in protein and transcript databases, based on sufficient criteria, enabled identifying similar proteins for 60 % of the studied gene models and expression evidence for 13 % of them. (3) Shared orthologous groups were defined using NBS-domain proteins of rice and Brachypodium distachyon. (4) Finally, alignment of the 436 NBS-containing gene models to the full set of scaffolds from the IWGSC's wheat chromosome survey sequence enabled high-stringence anchoring to chromosome arms. The distribution of the R genes was found balanced

  6. Stripe rust resistance genes in the UK winter wheat cultivar Claire.

    PubMed

    Powell, N M; Lewis, C M; Berry, S T; Maccormack, R; Boyd, L A

    2013-06-01

    Stripe rust resistance in the winter wheat cultivar Claire had remained effective in the UK and Europe since its release in 1999 and consequently has been used extensively in wheat breeding programs. However, in 2012, reports indicated that this valuable resistance may now have been compromised. To characterise stripe rust resistance in Claire and determine which genes may still confer effective resistance a cross was made between Claire and the stripe rust susceptible cultivar Lemhi. A genetic linkage map, constructed using SSR, AFLP, DArT and NBS-AFLP markers had a total map length of 1,730 cM. To improve the definition of two quantitative trait loci (QTL) identified on the long arm of chromosome 2D further markers were developed from wheat EST. Stripe rust resistance was evaluated on adult plants under field and glasshouse conditions by measuring the extent of fungal growth and sporulation, percentage infection (Pi) and the necrotic/chlorotic responses of the plant to infection, infection type (IT). Four QTL contributing to stripe rust adult plant resistance (APR) were identified in Claire, QYr.niab-2D.1, QYr.niab-2D.2, QYr.niab-2B and QYr.niab-7B. For Pi QYr.niab-2D.1 explained up to 25.4 % of the phenotypic variation, QYr.niab-2D.2 up to 28.7 %, QYr.niab-2B up to 21.7 % and QYr.niab-7B up to 13.0 %. For IT the percentages of phenotypic variation explained were 23.4, 31.8, 17.2 and 12.6 %, respectively. In addition to the four QTL conferring APR in Claire, a race-specific, seedling expressed resistance gene was identified on chromosome 3B.

  7. Cyclic nucleotide gated channel gene family in tomato: genome-wide identification and functional analyses in disease resistance

    PubMed Central

    Saand, Mumtaz A.; Xu, You-Ping; Li, Wen; Wang, Ji-Peng; Cai, Xin-Zhong

    2015-01-01

    The cyclic nucleotide gated channel (CNGC) is suggested to be one of the important calcium conducting channels. Nevertheless, genome-wide identification and systemic functional analysis of CNGC gene family in crop plant species have not yet been conducted. In this study, we performed genome-wide identification of CNGC gene family in the economically important crop tomato (Solanum lycopersicum L.) and analyzed function of the group IVb SlCNGC genes in disease resistance. Eighteen CNGC genes were identified in tomato genome, and four CNGC loci that were misannotated at database were corrected by cloning and sequencing. Detailed bioinformatics analyses on gene structure, domain composition and phylogenetic relationship of the SlCNGC gene family were conducted and the group-specific feature was revealed. Comprehensive expression analyses demonstrated that SlCNGC genes were highly, widely but differently responsive to diverse stimuli. Pharmacological assays showed that the putative CNGC activators cGMP and cAMP enhanced resistance against Sclerotinia sclerotiorum. Silencing of group IVb SlCNGC genes significantly enhanced resistance to fungal pathogens Pythium aphanidermatum and S. sclerotiorum, strongly reduced resistance to viral pathogen Tobacco rattle virus, while attenuated PAMP- and DAMP-triggered immunity as shown by obvious decrease of the flg22- and AtPep1-elicited hydrogen peroxide accumulation in SlCNGC-silenced plants. Additionally, silencing of these SlCNGC genes significantly altered expression of a set of Ca2+ signaling genes including SlCaMs, SlCDPKs, and SlCAMTA3. Collectively, our results reveal that group IV SlCNGC genes regulate a wide range of resistance in tomato probably by affecting Ca2+ signaling. PMID:25999969

  8. Apramycin resistance as a selective marker for gene transfer in mycobacteria.

    PubMed Central

    Paget, E; Davies, J

    1996-01-01

    We have explored the potential of using the apramycin resistance gene as a marker in mycobacterial gene transfer studies. Shuttle plasmids available for both electroporation and conjugation studies have been constructed, and we have successfully validated the use of the apramycin resistance gene as a component of cloning vectors for Mycobacterium smegmatis, M. bovis BCG, and M. tuberculosis. PMID:8892841

  9. Multiple Genetic Processes Result in Heterogeneous Rates of Evolution within the Major Cluster Disease Resistance Genes in LettuceW⃞

    PubMed Central

    Kuang, Hanhui; Woo, Sung-Sick; Meyers, Blake C.; Nevo, Eviatar; Michelmore, Richard W.

    2004-01-01

    Resistance Gene Candidate2 (RGC2) genes belong to a large, highly duplicated family of nucleotide binding site–leucine rich repeat (NBS-LRR) encoding disease resistance genes located at a single locus in lettuce (Lactuca sativa). To investigate the genetic events occurring during the evolution of this locus, ∼1.5- to 2-kb 3′ fragments of 126 RGC2 genes from seven genotypes were sequenced from three species of Lactuca, and 107 additional RGC2 sequences were obtained from 40 wild accessions of Lactuca spp. The copy number of RGC2 genes varied from 12 to 32 per genome in the seven genotypes studied extensively. LRR number varied from 40 to 47; most of this variation had resulted from 13 events duplicating two to five LRRs because of unequal crossing-over within or between RGC2 genes at one of two recombination hot spots. Two types of RGC2 genes (Type I and Type II) were initially distinguished based on the pattern of sequence identities between their 3′ regions. The existence of two types of RGC2 genes was further supported by intron similarities, the frequency of sequence exchange, and their prevalence in natural populations. Type I genes are extensive chimeras caused by frequent sequence exchanges. Frequent sequence exchanges between Type I genes homogenized intron sequences, but not coding sequences, and obscured allelic/orthologous relationships. Sequencing of Type I genes from additional wild accessions confirmed the high frequency of sequence exchange and the presence of numerous chimeric RGC2 genes in nature. Unlike Type I genes, Type II genes exhibited infrequent sequence exchange between paralogous sequences. Type II genes from different genotype/species within the genus Lactuca showed obvious allelic/orthologous relationships. Trans-specific polymorphism was observed for different groups of orthologs, suggesting balancing selection. Unequal crossover, insertion/deletion, and point mutation events were distributed unequally through the gene. Different

  10. Gene expression patterns of wheat rust resistance gene Lr34/Yr18 indicate novel mode of action

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The Lr34/Yr18 resistance gene provides durable, adult-plant, slow-rusting resistance to leaf rust and yellow rust of wheat. Patterns of gene expression were examined by microarray analysis in inoculated and mock-inoculated flag leaves of two pairs of near isogenic lines for Lr34/Yr18 (Thatcher/Thatc...

  11. Can chlorination co-select antibiotic-resistance genes?

    PubMed

    Lin, Wenfang; Zhang, Menglu; Zhang, Shenghua; Yu, Xin

    2016-08-01

    Selective pressures, such as chemical or heavy metal pollution, may co-select for bacterial antibiotic resistance in the environment. However, whether chlorination in water treatment can co-select antibiotic-resistant bacteria is controversial. In this study, high capacity quantitative polymerase chain reaction (qPCR) analysis was applied to target almost all known antibiotic-resistance genes (ARGs) (282 types) and 13 mobile genetic elements (MGEs) in bacteria detected in secondary effluents from a municipal wastewater treatment plant after chlorination. The results revealed that 125 unique ARGs were detected in non-chlorinated samples, and the number decreased (79-91 types) as the chlorine concentration was increased. Moreover, 7.49 × 10(4)-3.92 × 10(7) copies/100 ml water reduction of ARGs occurred with 4 mg Cl2/l. Considering the relative abundance of ARGs (i.e., ARG copies normalized to 16S rRNA gene copies), 119 ARGs decreased in response to chlorination, whereas only six ARGs, such as dfrA1, tetPB-03, tetPA, ampC-04, tetA-02, and erm(36), were potentially enriched by 10.90-, 10.06-, 8.63-, 6.86-, 3.77-, and 1.09-fold, respectively. Furthermore, the relative abundance of 12 detected MGEs was lower after chlorination. Therefore, chlorination was effective in reducing ARGs and MGEs rather than co-selecting them.

  12. Can chlorination co-select antibiotic-resistance genes?

    PubMed

    Lin, Wenfang; Zhang, Menglu; Zhang, Shenghua; Yu, Xin

    2016-08-01

    Selective pressures, such as chemical or heavy metal pollution, may co-select for bacterial antibiotic resistance in the environment. However, whether chlorination in water treatment can co-select antibiotic-resistant bacteria is controversial. In this study, high capacity quantitative polymerase chain reaction (qPCR) analysis was applied to target almost all known antibiotic-resistance genes (ARGs) (282 types) and 13 mobile genetic elements (MGEs) in bacteria detected in secondary effluents from a municipal wastewater treatment plant after chlorination. The results revealed that 125 unique ARGs were detected in non-chlorinated samples, and the number decreased (79-91 types) as the chlorine concentration was increased. Moreover, 7.49 × 10(4)-3.92 × 10(7) copies/100 ml water reduction of ARGs occurred with 4 mg Cl2/l. Considering the relative abundance of ARGs (i.e., ARG copies normalized to 16S rRNA gene copies), 119 ARGs decreased in response to chlorination, whereas only six ARGs, such as dfrA1, tetPB-03, tetPA, ampC-04, tetA-02, and erm(36), were potentially enriched by 10.90-, 10.06-, 8.63-, 6.86-, 3.77-, and 1.09-fold, respectively. Furthermore, the relative abundance of 12 detected MGEs was lower after chlorination. Therefore, chlorination was effective in reducing ARGs and MGEs rather than co-selecting them. PMID:27192478

  13. Gene expression profiling of the androgen independent prostate cancer cells demonstrates complex mechanisms mediating resistance to docetaxel

    PubMed Central

    Desarnaud, Frank; Geck, Peter; Parkin, Christopher; Carpinito, Gino

    2011-01-01

    The molecular mechanisms conferring resistance to docetaxel in prostate cancer patients remain partially understood. We generated docetaxel resistant derivatives of the androgen independent prostate cancer cell lines PC-3 and DU-145. Docetaxel rapidly induces DU-145 cell death via apoptosis and the drug resistant cells were produced by periodically exposing proliferating DU-145 cultures to small doses of docetaxel. In PC-3 cells docetaxel induces delayed cell death via mitotic catastrophe evident by profound multinucleation and formation of giant cells. Mononucleated progeny of the giant PC-3 cells shows significant resistance to docetaxel. Gene expression profiling of these docetaxel resistant PC-3 cells revealed sets of docetaxel inducible and constitutively expressed genes associated with major cancer pathways. A contradictory overlap with DU-145 docetaxel resistant cells was also found. Analyses suggested significant changes associated with apoptotic function, DNA repair, cell growth, survival and proliferation, metabolism, maintenance of cytoskeleton and extracellular matrix formation. These cellular processes often contribute to drug resistance and our study identified a set of genes managing this phenotype. Additional analyses of the drug resistant PC-3 cells using shRNA constructs determined direct relevance of Cyclin G2 to docetaxel resistance as well as prevention of multinucleation, whereas the knockdown of upregulated CYP1B1 showed no effect on either of these processes. Downregulated GBP1 was explored by ectopic overexpression and even though GBP1 has a potential to mediate resistance to docetaxel, it was not utilized in PC-3 cells. The results suggest complex combination of gene expression pattern changes that enables resistance to docetaxel while preventing death via multinucleation. PMID:21057205

  14. Insulin resistance and alterations in angiogenesis: additive insults that may lead to preeclampsia.

    PubMed

    Thadhani, Ravi; Ecker, Jeffrey L; Mutter, Walter P; Wolf, Myles; Smirnakis, Karen V; Sukhatme, Vikas P; Levine, Richard J; Karumanchi, S Ananth

    2004-05-01

    Altered angiogenesis and insulin resistance, which are intimately related at a molecular level, characterize preeclampsia. To test if an epidemiological interaction exists between these two alterations, we performed a nested case-control study of 28 women who developed preeclampsia and 57 contemporaneous controls. Serum samples at 12 weeks of gestation were measured for sex hormone binding globulin (SHBG; low levels correlate with insulin resistance) and placental growth factor (PlGF; a proangiogenic molecule). Compared with controls, women who developed preeclampsia had lower serum levels of SHBG (208+/-116 versus 256+/-101 nmol/L, P=0.05) and PlGF (16+/-14 versus 67+/-150 pg/mL, P<0.001), and in multivariable analysis, women with serum levels of PlGF < or =20 pg/mL had an increased risk of developing preeclampsia (odds ratio [OR] 7.6, 95% CI 1.4 to 38.4). Stratified by levels of serum SHBG (< or =175 versus >175 mg/dL), women with low levels of SHBG and PlGF had a 25.5-fold increased risk of developing preeclampsia (P=0.10), compared with 1.8 (P=0.38) among women with high levels of SHBG and low levels of PlGF. Formal testing for interaction (PlGFxSHBG) was significant (P=0.02). In a model with 3 (n-1) interaction terms (high PlGF and high SHBG, reference), the risk for developing preeclampsia was as follows: low PlGF and low SHBG, OR 15.1, 95% CI 1.7 to 134.9; high PlGF and low SHBG, OR 4.1, 95% CI 0.45 to 38.2; low PlGF and high SHBG, OR 8.7, 95% CI 1.2 to 60.3. Altered angiogenesis and insulin resistance are additive insults that lead to preeclampsia.

  15. MOS1 epigenetically regulates the expression of plant Resistance gene SNC1

    PubMed Central

    Li, Yingzhong; Dong, Oliver X; Johnson, Kaeli; Li, Xin

    2011-01-01

    MOS1 (MODIFIER OF snc1) was identified through a genetic screen for suppressors of snc1, an autoimmune mutant caused by a gain-of-function mutation in a TIR-NB-LRR-type Resistance gene. Loss of MOS1 function completely suppresses snc1-mediated autoimmunity. The MOS1 protein contains a BAT2 domain and regulates the expression of SNC1 in a locus-specific manner, but the mechanism on how MOS1 epigenetically regulates SNC1 gene expression is unclear. Here, we report the gene expression pattern and subcellular localization of MOS1. In addition, we analyze and discuss the roles of DNA and histone methylation in mos1-mediated suppression of SNC1 expression. PMID:21350329

  16. The Effect of Carbon Additions on the Creep Resistance of Fe-25Al-5Zr Alloy

    NASA Astrophysics Data System (ADS)

    Dobeš, Ferdinand; Vodičková, Věra; Veselý, Jozef; Kratochvíl, Petr

    2016-09-01

    Creep experiments were conducted on Fe-25 at. pct Al-5 at. pct Zr alloy with carbon additions at the temperatures of 973 K and 1173 K (700 °C and 900 °C). The alloys were tested in two different states: (i) cast and (ii) annealed at 1273 K (1000 °C) for 50 hours. Stress exponents and activation energies were estimated. The values of the stress exponent n could be explained by the dislocation motion controlled by climb. The increased values of n in the high-carbon alloy at the temperature of 1173 K (900 °C) can be described by means of the threshold stress concept. The creep resistance at 973 K (700 °C) decreased with the increasing content of carbon. This result is discussed in terms of the ratio of zirconium to carbon in the alloy. An increase of the creep resistance with increasing ratio Zr:C is in agreement with the behavior observed previously in alloys with substantially lower concentrations of zirconium.

  17. Close linkage of a blast resistance gene, Pias(t), with a bacterial leaf blight resistance gene, Xa1-as(t), in a rice cultivar 'Asominori'.

    PubMed

    Endo, Takashi; Yamaguchi, Masayuki; Kaji, Ryota; Nakagomi, Koji; Kataoka, Tomomori; Yokogami, Narifumi; Nakamura, Toshiki; Ishikawa, Goro; Yonemaru, Jun-Ichi; Nishio, Takeshi

    2012-12-01

    It has long been known that a bacterial leaf blight-resistant line in rice obtained from a crossing using 'Asominori' as a resistant parent also has resistance to blast, but a blast resistance gene in 'Asominori' has not been investigated in detail. In the present study, a blast resistance gene in 'Asominori', tentatively named Pias(t), was revealed to be located within 162-kb region between DNA markers YX4-3 and NX4-1 on chromosome 4 and to be linked with an 'Asominori' allele of the bacterial leaf blight resistance gene Xa1, tentatively named Xa1-as(t). An 'Asominori' allele of Pias(t) was found to be dominant and difference of disease severity between lines having the 'Asominori' allele of Pias(t) and those without it was 1.2 in disease index from 0 to 10. Pias(t) was also closely linked with the Ph gene controlling phenol reaction, suggesting the possibility of successful selection of blast resistance using the phenol reaction. Since blast-resistant commercial cultivars have been developed using 'Asominori' as a parent, Pias(t) is considered to be a useful gene in rice breeding for blast resistance. PMID:23341747

  18. Transcriptional and posttranscriptional regulation of the tomato leaf mould disease resistance gene Cf-9.

    PubMed

    Li, Wen; Xu, You-Ping; Cai, Xin-Zhong

    2016-01-29

    Plant disease resistance (R) genes confer effector-triggered immunity (ETI) to pathogens carrying complementary effector/avirulence (Avr) genes. They are traditionally recognized to function at translational and/or posttranslational levels. In this study, however, transcriptional and posttranscriptional regulation of Cf-9, a tomato R gene conferring resistance to leaf mould fungal pathogen carrying Avr9, was demonstrated. Expression of the Cf-9 gene was 10.8-54.7 folds higher in the Cf-9/Avr9 tomato lines than in the Cf-9 lines depending on the seedling age, indicating that the Cf-9 gene expression was strongly induced by Avr9. Moreover, expression of the Cf-9 gene in the 5-day-old Cf-9/Avr9 seedlings at 33 °C was approximately 80 folds lower than that at 25 °C, and was enhanced by 23.4 folds at only 4 h post temperature shift from 33 °C to 25 °C, demonstrating that the Avr9-mediated induction of the Cf-9 gene expression is reversibly repressed by high temperature. Expression of the Cf-9 gene in the Cf-9 seedlings was similarly affected by temperature as in the Cf-9/Avr9 seedlings, implying that the genetic control of temperature sensitivity of the Cf-9 gene expression is epistasis to its Avr9-mediated induction. Additionally, a miRNA sly-miR6022, TGGAAGGGAGAATATCCAGGA, targeting the leucine-rich repeat (LRR) domain spanning LRR13-LRR14 of the Cf-9 gene transcript was predicted. Over-expression of this miRNA resulted in over 88% reduction of the Cf-9 gene transcripts in both Nicotiana benthamiana and tomato, and thus verifying the function of sly-miR6022 in degrading the Cf-9 gene transcripts. Collectively, our results reveal that the tomato R gene Cf-9 is strongly regulated at transcriptional level by pathogen Avr9 in a temperature-sensitive manner and is also regulated at posttranscriptional level by a miRNA sly-miR6022. PMID:26768363

  19. Coral thermal tolerance: tuning gene expression to resist thermal stress.

    PubMed

    Bellantuono, Anthony J; Granados-Cifuentes, Camila; Miller, David J; Hoegh-Guldberg, Ove; Rodriguez-Lanetty, Mauricio

    2012-01-01

    The acclimatization capacity of corals is a critical consideration in the persistence of coral reefs under stresses imposed by global climate change. The stress history of corals plays a role in subsequent response to heat stress, but the transcriptomic changes associated with these plastic changes have not been previously explored. In order to identify host transcriptomic changes associated with acquired thermal tolerance in the scleractinian coral Acropora millepora, corals preconditioned to a sub-lethal temperature of 3°C below bleaching threshold temperature were compared to both non-preconditioned corals and untreated controls using a cDNA microarray platform. After eight days of hyperthermal challenge, conditions under which non-preconditioned corals bleached and preconditioned corals (thermal-tolerant) maintained Symbiodinium density, a clear differentiation in the transcriptional profiles was revealed among the condition examined. Among these changes, nine differentially expressed genes separated preconditioned corals from non-preconditioned corals, with 42 genes differentially expressed between control and preconditioned treatments, and 70 genes between non-preconditioned corals and controls. Differentially expressed genes included components of an apoptotic signaling cascade, which suggest the inhibition of apoptosis in preconditioned corals. Additionally, lectins and genes involved in response to oxidative stress were also detected. One dominant pattern was the apparent tuning of gene expression observed between preconditioned and non-preconditioned treatments; that is, differences in expression magnitude were more apparent than differences in the identity of genes differentially expressed. Our work revealed a transcriptomic signature underlying the tolerance associated with coral thermal history, and suggests that understanding the molecular mechanisms behind physiological acclimatization would be critical for the modeling of reefs in impending climate

  20. Virulence genes and antimicrobial resistance of Pasteurella multocida isolated from poultry and swine.

    PubMed

    Furian, Thales Quedi; Borges, Karen Apellanis; Laviniki, Vanessa; Rocha, Silvio Luis da Silveira; de Almeida, Camila Neves; do Nascimento, Vladimir Pinheiro; Salle, Carlos Tadeu Pippi; Moraes, Hamilton Luiz de Souza

    2016-01-01

    Pasteurella multocida causes atrophic rhinitis in swine and fowl cholera in birds, and is a secondary agent in respiratory syndromes. Pathogenesis and virulence factors involved are still poorly understood. The aim of this study was to detect 22 virulence-associated genes by PCR, including capsular serogroups A, B and D genes and to evaluate the antimicrobial susceptibility of P. multocida strains from poultry and swine. ompH, oma87, plpB, psl, exbD-tonB, fur, hgbA, nanB, sodA, sodC, ptfA were detected in more than 90% of the strains of both hosts. 91% and 92% of avian and swine strains, respectively, were classified in serogroup A. toxA and hsf-1 showed a significant association to serogroup D; pmHAS and pfhA to serogroup A. Gentamicin and amoxicillin were the most effective drugs with susceptibility higher than 97%; however, 76.79% of poultry strains and 85% of swine strains were resistant to sulphonamides. Furthermore, 19.64% and 36.58% of avian and swine strains, respectively, were multi-resistant. Virulence genes studied were not specific to a host and may be the result of horizontal transmission throughout evolution. High multidrug resistance demonstrates the need for responsible use of antimicrobials in animals intended for human consumption, in addition to antimicrobial susceptibility testing to P. multocida. PMID:26887247

  1. Application of resistance gene analog markers to analyses of genetic structure and diversity in rice.

    PubMed

    Ren, Juansheng; Yu, Yuchao; Gao, Fangyuan; Zeng, Lihua; Lu, Xianjun; Wu, Xianting; Yan, Wengui; Ren, Guangjun

    2013-07-01

    Plant disease resistance gene analog (RGA) markers were designed according to the conserved sequence of known RGAs and used to map resistance genes. We used genome-wide RGA markers for genetic analyses of structure and diversity in a global rice germplasm collection. Of the 472 RGA markers, 138 were polymorphic and these were applied to 178 entries selected from the USDA rice core collection. Results from the RGA markers were similar between two methods, UPGMA and STRUCTURE. Additionally, the results from RGA markers in our study were agreeable with those previously reported from SSR markers, including cluster of ancestral classification, genetic diversity estimates, genetic relatedness, and cluster of geographic origins. These results suggest that RGA markers are applicable for analyses of genetic structure and diversity in rice. However, unlike SSR markers, the RGA markers failed to differentiate temperate japonica, tropical japonica, and aromatic subgroups. The restricted way for developing RGA markers from the cDNA sequence might limit the polymorphism of RGA markers in the genome, thus limiting the discriminatory power in comparison with SSR markers. Genetic differentiation obtained using RGA markers may be useful for defining genetic diversity of a suite of random R genes in plants, as many studies show a differentiation of resistance to a wide array of pathogens. They could also help to characterize the genetic structure and geographic distribution in crops, including rice, wheat, barley, and banana.

  2. Application of resistance gene analog markers to analyses of genetic structure and diversity in rice.

    PubMed

    Ren, Juansheng; Yu, Yuchao; Gao, Fangyuan; Zeng, Lihua; Lu, Xianjun; Wu, Xianting; Yan, Wengui; Ren, Guangjun

    2013-07-01

    Plant disease resistance gene analog (RGA) markers were designed according to the conserved sequence of known RGAs and used to map resistance genes. We used genome-wide RGA markers for genetic analyses of structure and diversity in a global rice germplasm collection. Of the 472 RGA markers, 138 were polymorphic and these were applied to 178 entries selected from the USDA rice core collection. Results from the RGA markers were similar between two methods, UPGMA and STRUCTURE. Additionally, the results from RGA markers in our study were agreeable with those previously reported from SSR markers, including cluster of ancestral classification, genetic diversity estimates, genetic relatedness, and cluster of geographic origins. These results suggest that RGA markers are applicable for analyses of genetic structure and diversity in rice. However, unlike SSR markers, the RGA markers failed to differentiate temperate japonica, tropical japonica, and aromatic subgroups. The restricted way for developing RGA markers from the cDNA sequence might limit the polymorphism of RGA markers in the genome, thus limiting the discriminatory power in comparison with SSR markers. Genetic differentiation obtained using RGA markers may be useful for defining genetic diversity of a suite of random R genes in plants, as many studies show a differentiation of resistance to a wide array of pathogens. They could also help to characterize the genetic structure and geographic distribution in crops, including rice, wheat, barley, and banana. PMID:24099390

  3. Resistance gene analogs involved in tolerant cassava--geminivirus interaction that shows a recovery phenotype.

    PubMed

    Louis, Bengyella; Rey, Chrissie

    2015-12-01

    The current literature describes recovery from virus-induced symptoms as a RNA silencing defense, but immunity-related genes, including the structurally specific resistance gene analogs (RGAs) that may play a key role in tolerance and recovery is not yet reported. In this study, the transcriptome data of tolerant cassava TME3 (which exhibits a recovery phenotype) and susceptible cassava T200 infected with South African cassava mosaic virus were explored for RGAs. Putative resistance protein analogs (RPAs) with amide-like indole-3-acetic acid-Ile-Leu-Arg (IAA-ILR) and leucine-rich repeat (LRR)-kinase conserved domains were unique to TME3. Common responsive RPAs in TME3 and T200 were the dirigent-like protein, coil-coil nucleotide-binding site (NBS) and toll-interleukin-resistance, disease resistance zinc finger chromosome condensation-like protein (DZC), and NBS-apoptosis repressor with caspase recruitment (ARC)-LRR domains. Mutations in RPAs in the MHD motif of the NBS-ARC2 subdomain associated with the recovery phase in TME3 were observed. Additionally, a cohort of 25 RGAs mined solely during the recovery process in TME3 was identified. Phylogenetic and expression analyses support that diverse RGAs are differentially expressed during tolerance and recovery. This study reveals that in cassava, a perennial crop, RGAs participate in tolerance and differentially accumulate during recovery as a complementary defense mechanism to natural occurring RNA silencing to impair viral replication.

  4. Abundance and dynamics of antibiotic resistance genes and integrons in lake sediment microcosms.

    PubMed

    Berglund, Björn; Khan, Ghazanfar Ali; Lindberg, Richard; Fick, Jerker; Lindgren, Per-Eric

    2014-01-01

    Antibiotic resistance in bacteria causing disease is an ever growing threat to the world. Recently, environmental bacteria have become established as important both as sources of antibiotic resistance genes and in disseminating resistance genes. Low levels of antibiotics and other pharmaceuticals are regularly released into water environments via wastewater, and the concern is that such environmental contamination may serve to create hotspots for antibiotic resistance gene selection and dissemination. In this study, microcosms were created from water and sediments gathered from a lake in Sweden only lightly affected by human activities. The microcosms were exposed to a mixture of antibiotics of varying environmentally relevant concentrations (i.e., concentrations commonly encountered in wastewaters) in order to investigate the effect of low levels of antibiotics on antibiotic resistance gene abundances and dynamics in a previously uncontaminated environment. Antibiotic concentrations were measured using liquid chromatography-tandem mass spectrometry. Abundances of seven antibiotic resistance genes and the class 1 integron integrase gene, intI1, were quantified using real-time PCR. Resistance genes sulI and ermB were quantified in the microcosm sediments with mean abundances 5 and 15 gene copies/10(6) 16S rRNA gene copies, respectively. Class 1 integrons were determined in the sediments with a mean concentration of 3.8 × 10(4) copies/106 16S rRNA gene copies. The antibiotic treatment had no observable effect on antibiotic resistance gene or integron abundances. PMID:25247418

  5. Usefulness of gene pg10 as a source of stem rust resistance in oat breeding.

    PubMed

    Harder, D E

    1999-12-01

    ABSTRACT Infection types produced by Puccinia graminis f. sp. avenae on plants of Avena sativa with the stem rust resistance gene Pg10 are characterized by moderate-sized uredinia surrounded by an area of chlorosis and a larger variable zone of dark brown necrosis. This study was undertaken to assess the effectiveness of gene Pg10 as a source of resistance to stem rust and to determine the interactions of this gene with other common Pg genes. A derived Pg10 line was tested with 58 distinct pathotypes of P. graminis f. sp. avenae and was crossed to substituted single-gene lines carrying the resistance gene Pg1, Pg2, Pg3, Pg4, Pg8, Pg9, Pg13, Pg15, Pg16, or Pga. The Pg10 line showed moderate resistance to all 58 patho-types, and there was no indication of specificity in virulence by any isolate. Gene Pg10 was inherited independently of the other Pg genes and had a complementary effect on the expression of resistance by these genes. An effective level of resistance conferred by Pg10 was demonstrated in a field nursery artificially inoculated with P. graminis f. sp. avenae. It was concluded that Pg10 is a potentially useful source of stem rust resistance in oat breeding, with its main attributes being an apparent broad base of resistance, ease of combining with other Pg genes, and complementary effects on the expression of other Pg genes.

  6. Antimicrobial-Resistant Bacterial Populations and Antimicrobial Resistance Genes Obtained from Environments Impacted by Livestock and Municipal Waste.

    PubMed

    Agga, Getahun E; Arthur, Terrance M; Durso, Lisa M; Harhay, Dayna M; Schmidt, John W

    2015-01-01

    This study compared the populations of antimicrobial-resistant bacteria and the repertoire of antimicrobial resistance genes in four environments: effluent of three municipal wastewater treatment facilities, three cattle feedlot runoff catchment ponds, three swine waste lagoons, and two "low impact" environments (an urban lake and a relict prairie). Multiple liquid and solid samples were collected from each environment. The prevalences and concentrations of antimicrobial-resistant (AMR) Gram-negative (Escherichia coli and Salmonella enterica) and Gram-positive (enterococci) bacteria were determined from individual samples (n = 174). The prevalences of 84 antimicrobial resistance genes in metagenomic DNA isolated from samples pooled (n = 44) by collection date, location, and sample type were determined. The prevalences and concentrations of AMR E. coli and Salmonella were similar among the livestock and municipal sample sources. The levels of erythromycin-resistant enterococci were significantly higher in liquid samples from cattle catchment ponds and swine waste lagoons than in liquid samples from municipal wastewater treatment facilities, but solid samples from these environments did not differ significantly. Similarly, trimethoprim/sulfamethoxazole-resistant E. coli concentrations were significantly higher in swine liquid than in municipal liquid samples, but there was no difference in solid samples. Multivariate analysis of the distribution of antimicrobial resistance genes using principal coordinate analysis showed distinct clustering of samples with livestock (cattle and swine), low impact environment and municipal samples forming three separate clusters. The numbers of class A beta-lactamase, class C beta-lactamase, and fluoroquinolone resistance genes detected were significantly higher (P < 0.05) in municipal samples than in cattle runoff or swine lagoon samples. In conclusion, we report that AMR is a very widespread phenomenon and that similar prevalences

  7. Antimicrobial-Resistant Bacterial Populations and Antimicrobial Resistance Genes Obtained from Environments Impacted by Livestock and Municipal Waste.

    PubMed

    Agga, Getahun E; Arthur, Terrance M; Durso, Lisa M; Harhay, Dayna M; Schmidt, John W

    2015-01-01

    This study compared the populations of antimicrobial-resistant bacteria and the repertoire of antimicrobial resistance genes in four environments: effluent of three municipal wastewater treatment facilities, three cattle feedlot runoff catchment ponds, three swine waste lagoons, and two "low impact" environments (an urban lake and a relict prairie). Multiple liquid and solid samples were collected from each environment. The prevalences and concentrations of antimicrobial-resistant (AMR) Gram-negative (Escherichia coli and Salmonella enterica) and Gram-positive (enterococci) bacteria were determined from individual samples (n = 174). The prevalences of 84 antimicrobial resistance genes in metagenomic DNA isolated from samples pooled (n = 44) by collection date, location, and sample type were determined. The prevalences and concentrations of AMR E. coli and Salmonella were similar among the livestock and municipal sample sources. The levels of erythromycin-resistant enterococci were significantly higher in liquid samples from cattle catchment ponds and swine waste lagoons than in liquid samples from municipal wastewater treatment facilities, but solid samples from these environments did not differ significantly. Similarly, trimethoprim/sulfamethoxazole-resistant E. coli concentrations were significantly higher in swine liquid than in municipal liquid samples, but there was no difference in solid samples. Multivariate analysis of the distribution of antimicrobial resistance genes using principal coordinate analysis showed distinct clustering of samples with livestock (cattle and swine), low impact environment and municipal samples forming three separate clusters. The numbers of class A beta-lactamase, class C beta-lactamase, and fluoroquinolone resistance genes detected were significantly higher (P < 0.05) in municipal samples than in cattle runoff or swine lagoon samples. In conclusion, we report that AMR is a very widespread phenomenon and that similar prevalences

  8. Antimicrobial-Resistant Bacterial Populations and Antimicrobial Resistance Genes Obtained from Environments Impacted by Livestock and Municipal Waste

    PubMed Central

    Durso, Lisa M.; Harhay, Dayna M.; Schmidt, John W.

    2015-01-01

    This study compared the populations of antimicrobial-resistant bacteria and the repertoire of antimicrobial resistance genes in four environments: effluent of three municipal wastewater treatment facilities, three cattle feedlot runoff catchment ponds, three swine waste lagoons, and two “low impact” environments (an urban lake and a relict prairie). Multiple liquid and solid samples were collected from each environment. The prevalences and concentrations of antimicrobial-resistant (AMR) Gram-negative (Escherichia coli and Salmonella enterica) and Gram-positive (enterococci) bacteria were determined from individual samples (n = 174). The prevalences of 84 antimicrobial resistance genes in metagenomic DNA isolated from samples pooled (n = 44) by collection date, location, and sample type were determined. The prevalences and concentrations of AMR E. coli and Salmonella were similar among the livestock and municipal sample sources. The levels of erythromycin-resistant enterococci were significantly higher in liquid samples from cattle catchment ponds and swine waste lagoons than in liquid samples from municipal wastewater treatment facilities, but solid samples from these environments did not differ significantly. Similarly, trimethoprim/sulfamethoxazole-resistant E. coli concentrations were significantly higher in swine liquid than in municipal liquid samples, but there was no difference in solid samples. Multivariate analysis of the distribution of antimicrobial resistance genes using principal coordinate analysis showed distinct clustering of samples with livestock (cattle and swine), low impact environment and municipal samples forming three separate clusters. The numbers of class A beta-lactamase, class C beta-lactamase, and fluoroquinolone resistance genes detected were significantly higher (P < 0.05) in municipal samples than in cattle runoff or swine lagoon samples. In conclusion, we report that AMR is a very widespread phenomenon and that similar

  9. Resistance Genes and Genetic Elements Associated with Antibiotic Resistance in Clinical and Commensal Isolates of Streptococcus salivarius.

    PubMed

    Chaffanel, Fanny; Charron-Bourgoin, Florence; Libante, Virginie; Leblond-Bourget, Nathalie; Payot, Sophie

    2015-06-15

    The diversity of clinical (n = 92) and oral and digestive commensal (n = 120) isolates of Streptococcus salivarius was analyzed by multilocus sequence typing (MLST). No clustering of clinical or commensal strains can be observed in the phylogenetic tree. Selected strains (92 clinical and 46 commensal strains) were then examined for their susceptibilities to tetracyclines, macrolides, lincosamides, aminoglycosides, and phenicol antibiotics. The presence of resistance genes tet(M), tet(O), erm(A), erm(B), mef(A/E), and catQ and associated genetic elements was investigated by PCR, as was the genetic linkage of resistance genes. High rates of erythromycin and tetracycline resistance were observed among the strains. Clinical strains displayed either the erm(B) (macrolide-lincosamide-streptogramin B [MLSB] phenotype) or mef(A/E) (M phenotype) resistance determinant, whereas almost all the commensal strains harbored the mef(A/E) resistance gene, carried by a macrolide efflux genetic assembly (MEGA) element. A genetic linkage between a macrolide resistance gene and genes of Tn916 was detected in 23 clinical strains and 5 commensal strains, with a predominance of Tn3872 elements (n = 13), followed by Tn6002 (n = 11) and Tn2009 (n = 4) elements. Four strains harboring a mef(A/E) gene were also resistant to chloramphenicol and carried a catQ gene. Sequencing of the genome of one of these strains revealed that these genes colocalized on an IQ-like element, as already described for other viridans group streptococci. ICESt3-related elements were also detected in half of the isolates. This work highlights the potential role of S. salivarius in the spread of antibiotic resistance genes both in the oral sphere and in the gut. PMID:25862227

  10. Resistance Genes and Genetic Elements Associated with Antibiotic Resistance in Clinical and Commensal Isolates of Streptococcus salivarius.

    PubMed

    Chaffanel, Fanny; Charron-Bourgoin, Florence; Libante, Virginie; Leblond-Bourget, Nathalie; Payot, Sophie

    2015-06-15

    The diversity of clinical (n = 92) and oral and digestive commensal (n = 120) isolates of Streptococcus salivarius was analyzed by multilocus sequence typing (MLST). No clustering of clinical or commensal strains can be observed in the phylogenetic tree. Selected strains (92 clinical and 46 commensal strains) were then examined for their susceptibilities to tetracyclines, macrolides, lincosamides, aminoglycosides, and phenicol antibiotics. The presence of resistance genes tet(M), tet(O), erm(A), erm(B), mef(A/E), and catQ and associated genetic elements was investigated by PCR, as was the genetic linkage of resistance genes. High rates of erythromycin and tetracycline resistance were observed among the strains. Clinical strains displayed either the erm(B) (macrolide-lincosamide-streptogramin B [MLSB] phenotype) or mef(A/E) (M phenotype) resistance determinant, whereas almost all the commensal strains harbored the mef(A/E) resistance gene, carried by a macrolide efflux genetic assembly (MEGA) element. A genetic linkage between a macrolide resistance gene and genes of Tn916 was detected in 23 clinical strains and 5 commensal strains, with a predominance of Tn3872 elements (n = 13), followed by Tn6002 (n = 11) and Tn2009 (n = 4) elements. Four strains harboring a mef(A/E) gene were also resistant to chloramphenicol and carried a catQ gene. Sequencing of the genome of one of these strains revealed that these genes colocalized on an IQ-like element, as already described for other viridans group streptococci. ICESt3-related elements were also detected in half of the isolates. This work highlights the potential role of S. salivarius in the spread of antibiotic resistance genes both in the oral sphere and in the gut.

  11. Resistance Genes and Genetic Elements Associated with Antibiotic Resistance in Clinical and Commensal Isolates of Streptococcus salivarius

    PubMed Central

    Chaffanel, Fanny; Charron-Bourgoin, Florence; Libante, Virginie; Leblond-Bourget, Nathalie

    2015-01-01

    The diversity of clinical (n = 92) and oral and digestive commensal (n = 120) isolates of Streptococcus salivarius was analyzed by multilocus sequence typing (MLST). No clustering of clinical or commensal strains can be observed in the phylogenetic tree. Selected strains (92 clinical and 46 commensal strains) were then examined for their susceptibilities to tetracyclines, macrolides, lincosamides, aminoglycosides, and phenicol antibiotics. The presence of resistance genes tet(M), tet(O), erm(A), erm(B), mef(A/E), and catQ and associated genetic elements was investigated by PCR, as was the genetic linkage of resistance genes. High rates of erythromycin and tetracycline resistance were observed among the strains. Clinical strains displayed either the erm(B) (macrolide-lincosamide-streptogramin B [MLSB] phenotype) or mef(A/E) (M phenotype) resistance determinant, whereas almost all the commensal strains harbored the mef(A/E) resistance gene, carried by a macrolide efflux genetic assembly (MEGA) element. A genetic linkage between a macrolide resistance gene and genes of Tn916 was detected in 23 clinical strains and 5 commensal strains, with a predominance of Tn3872 elements (n = 13), followed by Tn6002 (n = 11) and Tn2009 (n = 4) elements. Four strains harboring a mef(A/E) gene were also resistant to chloramphenicol and carried a catQ gene. Sequencing of the genome of one of these strains revealed that these genes colocalized on an IQ-like element, as already described for other viridans group streptococci. ICESt3-related elements were also detected in half of the isolates. This work highlights the potential role of S. salivarius in the spread of antibiotic resistance genes both in the oral sphere and in the gut. PMID:25862227

  12. Rapid Detection of rpoB Gene Mutations Conferring Rifampin Resistance in Mycobacterium tuberculosis

    PubMed Central

    Ao, Wanyuan; Aldous, Stephen; Woodruff, Evelyn; Hicke, Brian; Rea, Larry; Kreiswirth, Barry

    2012-01-01

    Multidrug-resistant Mycobacterium tuberculosis strains are widespread and present a challenge to effective treatment of this infection. The need for a low-cost and rapid detection method for clinically relevant mutations in Mycobacterium tuberculosis that confer multidrug resistance is urgent, particularly for developing countries. We report here a novel test that detects the majority of clinically relevant mutations in the beta subunit of the RNA polymerase (rpoB) gene that confer resistance to rifampin (RIF), the treatment of choice for tuberculosis (TB). The test, termed TB ID/R, combines a novel target and temperature-dependent RNase H2-mediated cleavage of blocked DNA primers to initiate isothermal helicase-dependent amplification of a rpoB gene target sequence. Amplified products are detected by probes arrayed on a modified silicon chip that permits visible detection of both RIF-sensitive and RIF-resistant strains of M. tuberculosis. DNA templates of clinically relevant single-nucleotide mutations in the rpoB gene were created to validate the performance of the TB ID/R test. Except for one rare mutation, all mutations were unambiguously detected. Additionally, 11 RIF-sensitive and 25 RIF-resistant clinical isolates were tested by the TB ID/R test, and 35/36 samples were classified correctly (96.2%). This test is being configured in a low-cost test platform to provide rapid diagnosis and drug susceptibility information for TB in the point-of-care setting in the developing world, where the need is acute. PMID:22518852

  13. Housefly Larva Vermicomposting Efficiently Attenuates Antibiotic Resistance Genes in Swine Manure, with Concomitant Bacterial Population Changes

    PubMed Central

    Wang, Hang; Li, Hongyi; Gilbert, Jack A.; Li, Haibo; Wu, Longhua; Liu, Meng; Wang, Liling; Zhou, Qiansheng; Yuan, Junxiang

    2015-01-01

    Manure from swine treated with antimicrobials as feed additives is a major source for the expansion of the antibiotic resistance gene (ARG) reservoir in the environment. Vermicomposting via housefly larvae (Musca domestica) can be efficiently used to treat manure and regenerate biofertilizer, but few studies have investigated its effect on ARG attenuation. Here, we tracked the abundances of 9 ARGs and the composition and structure of the bacterial communities in manure samples across 6 days of full-scale manure vermicomposting. On day 6, the abundances of genes encoding tetracycline resistance [tet(M), tet(O), tet(Q), and tet(W)] were reduced (P < 0.05), while those of genes encoding sulfonamide resistance (sul1 and sul2) were increased (P < 0.05) when normalized to 16S rRNA. The abundances of tetracycline resistance genes were correlated (P < 0.05) with the changing concentrations of tetracyclines in the manure. The overall diversity and richness of the bacteria significantly decreased during vermicomposting, accompanied by a 100 times increase in the relative abundance of Flavobacteriaceae spp. Variations in the abundances of ARGs were correlated with the changing microbial community structure and the relative abundances of the family Ruminococcaceae, class Bacilli, or phylum Proteobacteria. Vermicomposting, as a waste management practice, can reduce the overall abundance of ARGs. More research is warranted to assess the use of this waste management practice as a measure to attenuate the dissemination of antimicrobial residues and ARGs from livestock production before vermicompost can be safely used as biofertilizer in agroecosystems. PMID:26296728

  14. Housefly Larva Vermicomposting Efficiently Attenuates Antibiotic Resistance Genes in Swine Manure, with Concomitant Bacterial Population Changes.

    PubMed

    Wang, Hang; Li, Hongyi; Gilbert, Jack A; Li, Haibo; Wu, Longhua; Liu, Meng; Wang, Liling; Zhou, Qiansheng; Yuan, Junxiang; Zhang, Zhijian

    2015-11-01

    Manure from swine treated with antimicrobials as feed additives is a major source for the expansion of the antibiotic resistance gene (ARG) reservoir in the environment. Vermicomposting via housefly larvae (Musca domestica) can be efficiently used to treat manure and regenerate biofertilizer, but few studies have investigated its effect on ARG attenuation. Here, we tracked the abundances of 9 ARGs and the composition and structure of the bacterial communities in manure samples across 6 days of full-scale manure vermicomposting. On day 6, the abundances of genes encoding tetracycline resistance [tet(M), tet(O), tet(Q), and tet(W)] were reduced (P < 0.05), while those of genes encoding sulfonamide resistance (sul1 and sul2) were increased (P < 0.05) when normalized to 16S rRNA. The abundances of tetracycline resistance genes were correlated (P < 0.05) with the changing concentrations of tetracyclines in the manure. The overall diversity and richness of the bacteria significantly decreased during vermicomposting, accompanied by a 100 times increase in the relative abundance of Flavobacteriaceae spp. Variations in the abundances of ARGs were correlated with the changing microbial community structure and the relative abundances of the family Ruminococcaceae, class Bacilli, or phylum Proteobacteria. Vermicomposting, as a waste management practice, can reduce the overall abundance of ARGs. More research is warranted to assess the use of this waste management practice as a measure to attenuate the dissemination of antimicrobial residues and ARGs from livestock production before vermicompost can be safely used as biofertilizer in agroecosystems. PMID:26296728

  15. Housefly Larva Vermicomposting Efficiently Attenuates Antibiotic Resistance Genes in Swine Manure, with Concomitant Bacterial Population Changes.

    PubMed

    Wang, Hang; Li, Hongyi; Gilbert, Jack A; Li, Haibo; Wu, Longhua; Liu, Meng; Wang, Liling; Zhou, Qiansheng; Yuan, Junxiang; Zhang, Zhijian

    2015-11-01

    Manure from swine treated with antimicrobials as feed additives is a major source for the expansion of the antibiotic resistance gene (ARG) reservoir in the environment. Vermicomposting via housefly larvae (Musca domestica) can be efficiently used to treat manure and regenerate biofertilizer, but few studies have investigated its effect on ARG attenuation. Here, we tracked the abundances of 9 ARGs and the composition and structure of the bacterial communities in manure samples across 6 days of full-scale manure vermicomposting. On day 6, the abundances of genes encoding tetracycline resistance [tet(M), tet(O), tet(Q), and tet(W)] were reduced (P < 0.05), while those of genes encoding sulfonamide resistance (sul1 and sul2) were increased (P < 0.05) when normalized to 16S rRNA. The abundances of tetracycline resistance genes were correlated (P < 0.05) with the changing concentrations of tetracyclines in the manure. The overall diversity and richness of the bacteria significantly decreased during vermicomposting, accompanied by a 100 times increase in the relative abundance of Flavobacteriaceae spp. Variations in the abundances of ARGs were correlated with the changing microbial community structure and the relative abundances of the family Ruminococcaceae, class Bacilli, or phylum Proteobacteria. Vermicomposting, as a waste management practice, can reduce the overall abundance of ARGs. More research is warranted to assess the use of this waste management practice as a measure to attenuate the dissemination of antimicrobial residues and ARGs from livestock production before vermicompost can be safely used as biofertilizer in agroecosystems.

  16. Molecular Screening of Blast Resistance Genes in Rice using SSR Markers

    PubMed Central

    Singh, A. K.; Singh, P. K.; Arya, Madhuri; Singh, N. K.; Singh, U. S.

    2015-01-01

    Rice Blast is the most devastating disease causing major yield losses in every year worldwide. It had been proved that using resistant rice varieties would be the most effective way to control this disease. Molecular screening and genetic diversities of major rice blast resistance genes were determined in 192 rice germplasm accessions using simple sequence repeat (SSR) markers. The genetic frequencies of the 10 major rice blast resistance genes varied from 19.79% to 54.69%. Seven accessions IC337593, IC346002, IC346004, IC346813, IC356117, IC356422 and IC383441 had maximum eight blast resistance gene, while FR13B, Hourakani, Kala Rata 1–24, Lemont, Brown Gora, IR87756-20-2-2-3, IC282418, IC356419, PKSLGR-1 and PKSLGR-39 had seven blast resistance genes. Twenty accessions possessed six genes, 36 accessions had five genes, 41 accessions had four genes, 38 accessions had three genes, 26 accessions had two genes, 13 accessions had single R gene and only one accession IC438644 does not possess any one blast resistant gene. Out of 192 accessions only 17 accessions harboured 7 to 8 blast resistance genes. PMID:25774106

  17. Heteroplasmy of the cytochrome b gene in Venturia inaequalis and its involvement in quantitative and practical resistance to trifloxystrobin.

    PubMed

    Villani, Sara M; Cox, Kerik D

    2014-09-01

    Quantitative (partial) and qualitative (complete) resistance responses to quinone outside inhibitor (QoI) fungicides have been documented for the apple scab pathogen Venturia inaequalis. Resistance monitoring efforts have traditionally focused on the detection of qualitative resistance based on a single point mutation, G143A, within the cytochrome b (cyt b) gene. In order to better understand the role of heteroplasmy of the cyt b gene in the QoI resistance response for isolates and populations of V. inaequalis, an allele-specific quantitative polymerase chain reaction was developed to quantify the relative abundance of the A143 (resistant) allele in 45 isolates of V. inaequalis with differing in vitro resistance responses to the QoI fungicide trifloxystrobin. Although a high relative abundance of the A143 allele (>62%) was associated with isolates with high resistance responses (50 to 100% relative growth on trifloxystrobin-amended medium), heteroplasmy of the cyt b gene was not the primary factor involved in isolates with moderate resistance responses (29 to 49% relative growth). The relative abundance of the A143 allele in isolates with moderate resistance to trifloxystrobin rarely exceeded 8%, suggesting that other resistance mechanisms are involved in moderate resistance and, therefore, that the Qol resistance response is polygenic. In research orchards where QoI fungicides failed to control apple scab (practical resistance), field trials were conducted to demonstrate the link between practical resistance and the abundance of the A143 allele. Relative abundance of the A143 allele in these orchard populations exceeded 20% in 2011 and 2012. Similarly, of the eight additional commercial orchards screened in 2011, the relative abundance of the A143 allele always exceeded 20% in those with QoI practical resistance. Although heteroplasmy of the cyt b gene did not entirely explain the response of isolates with moderate resistance to QoIs, the relative abundance of A

  18. Gene expression study using real-time PCR identifies an NTR gene as a major marker of resistance to benznidazole in Trypanosoma cruzi

    PubMed Central

    2011-01-01

    Background Chagas disease is a neglected illness, with limited treatments, caused by the parasite Trypanosoma cruzi. Two drugs are prescribed to treat the disease, nifurtimox and benznidazole, which have been previously reported to have limited efficacy and the appearance of resistance by T. cruzi. Acquisition of drug-resistant phenotypes is a complex physiological process based on single or multiple changes of the genes involved, probably in its mechanisms of action. Results The differential genes expression of a sensitive Trypanosoma cruzi strain and its induced in vitro benznidazole-resistant phenotypes was studied. The stepwise increasing concentration of BZ in the parental strain generated five different resistant populations assessed by the IC50 ranging from 10.49 to 93.7 μM. The resistant populations maintained their phenotype when the BZ was depleted from the culture for many passages. Additionally, the benznidazole-resistant phenotypes presented a cross-resistance to nifurtimox but not to G418 sulfate. On the other hand, four of the five phenotypes resistant to different concentrations of drugs had different expression levels for the 12 genes evaluated by real-time PCR. However, in the most resistant phenotype (TcR5x), the levels of mRNA from these 12 genes and seven more were similar to the parental strain but not for NTR and OYE genes, which were down-regulated and over-expressed, respectively. The number of copies for these two genes was evaluated for the parental strain and the TcR5x phenotype, revealing that the NTR gene had lost a copy in this last phenotype. No changes were found in the enzyme activity of CPR and SOD in the most resistant population. Finally, there was no variability of genetic profiles among all the parasite populations evaluated by performing low-stringency single-specific primer PCR (LSSP-PCR) and random amplified polymorphic DNA RAPD techniques, indicating that no clonal selection or drastic genetic changes had occurred for the

  19. Dissemination of Novel Antimicrobial Resistance Mechanisms through the Insertion Sequence Mediated Spread of Metabolic Genes.

    PubMed

    Furi, Leonardo; Haigh, Richard; Al Jabri, Zaaima J H; Morrissey, Ian; Ou, Hong-Yu; León-Sampedro, Ricardo; Martinez, Jose L; Coque, Teresa M; Oggioni, Marco R

    2016-01-01

    The widely used biocide triclosan selectively targets FabI, the NADH-dependent trans-2-enoyl-acyl carrier protein (ACP) reductase, which is also an important target for the development of narrow spectrum antibiotics. The analysis of triclosan resistant Staphylococcus aureus isolates had previously shown that in about half of the strains, the mechanism of triclosan resistance consists on the heterologous duplication of the triclosan target gene due to the acquisition of an additional fabI allele derived from Staphylococcus haemolyticus (sh-fabI). In the current work, the genomic sequencing of 10 of these strains allowed the characterization of two novel composite transposons TnSha1 and TnSha2 involved in the spread of sh-fabI. TnSha1 harbors one copy of IS1272, whereas TnSha2 is a 11.7 kb plasmid carrying TnSha1 present either as plasmid or in an integrated form generally flanked by two IS1272 elements. The target and mechanism of integration for IS1272 and TnSha1 are novel and include targeting of DNA secondary structures, generation of blunt-end deletions of the stem-loop and absence of target duplication. Database analyses showed widespread occurrence of these two elements in chromosomes and plasmids, with TnSha1 mainly in S. aureus and with TnSha2 mainly in S. haemolyticus and S. epidermidis. The acquisition of resistance by means of an insertion sequence-based mobilization and consequent duplication of drug-target metabolic genes, as observed here for sh-fabI, is highly reminiscent of the situation with the ileS2 gene conferring mupirocin resistance, and the dfrA and dfrG genes conferring trimethoprim resistance both of which are mobilized by IS257. These three examples, which show similar mechanisms and levels of spread of metabolic genes linked to IS elements, highlight the importance of this genetic strategy for recruitment and rapid distribution of novel resistance mechanisms in staphylococci.

  20. Dissemination of Novel Antimicrobial Resistance Mechanisms through the Insertion Sequence Mediated Spread of Metabolic Genes.

    PubMed

    Furi, Leonardo; Haigh, Richard; Al Jabri, Zaaima J H; Morrissey, Ian; Ou, Hong-Yu; León-Sampedro, Ricardo; Martinez, Jose L; Coque, Teresa M; Oggioni, Marco R

    2016-01-01

    The widely used biocide triclosan selectively targets FabI, the NADH-dependent trans-2-enoyl-acyl carrier protein (ACP) reductase, which is also an important target for the development of narrow spectrum antibiotics. The analysis of triclosan resistant Staphylococcus aureus isolates had previously shown that in about half of the strains, the mechanism of triclosan resistance consists on the heterologous duplication of the triclosan target gene due to the acquisition of an additional fabI allele derived from Staphylococcus haemolyticus (sh-fabI). In the current work, the genomic sequencing of 10 of these strains allowed the characterization of two novel composite transposons TnSha1 and TnSha2 involved in the spread of sh-fabI. TnSha1 harbors one copy of IS1272, whereas TnSha2 is a 11.7 kb plasmid carrying TnSha1 present either as plasmid or in an integrated form generally flanked by two IS1272 elements. The target and mechanism of integration for IS1272 and TnSha1 are novel and include targeting of DNA secondary structures, generation of blunt-end deletions of the stem-loop and absence of target duplication. Database analyses showed widespread occurrence of these two elements in chromosomes and plasmids, with TnSha1 mainly in S. aureus and with TnSha2 mainly in S. haemolyticus and S. epidermidis. The acquisition of resistance by means of an insertion sequence-based mobilization and consequent duplication of drug-target metabolic genes, as observed here for sh-fabI, is highly reminiscent of the situation with the ileS2 gene conferring mupirocin resistance, and the dfrA and dfrG genes conferring trimethoprim resistance both of which are mobilized by IS257. These three examples, which show similar mechanisms and levels of spread of metabolic genes linked to IS elements, highlight the importance of this genetic strategy for recruitment and rapid distribution of novel resistance mechanisms in staphylococci. PMID:27446047

  1. Dissemination of Novel Antimicrobial Resistance Mechanisms through the Insertion Sequence Mediated Spread of Metabolic Genes

    PubMed Central

    Furi, Leonardo; Haigh, Richard; Al Jabri, Zaaima J. H.; Morrissey, Ian; Ou, Hong-Yu; León-Sampedro, Ricardo; Martinez, Jose L.; Coque, Teresa M.; Oggioni, Marco R.

    2016-01-01

    The widely used biocide triclosan selectively targets FabI, the NADH-dependent trans-2-enoyl-acyl carrier protein (ACP) reductase, which is also an important target for the development of narrow spectrum antibiotics. The analysis of triclosan resistant Staphylococcus aureus isolates had previously shown that in about half of the strains, the mechanism of triclosan resistance consists on the heterologous duplication of the triclosan target gene due to the acquisition of an additional fabI allele derived from Staphylococcus haemolyticus (sh-fabI). In the current work, the genomic sequencing of 10 of these strains allowed the characterization of two novel composite transposons TnSha1 and TnSha2 involved in the spread of sh-fabI. TnSha1 harbors one copy of IS1272, whereas TnSha2 is a 11.7 kb plasmid carrying TnSha1 present either as plasmid or in an integrated form generally flanked by two IS1272 elements. The target and mechanism of integration for IS1272 and TnSha1 are novel and include targeting of DNA secondary structures, generation of blunt-end deletions of the stem-loop and absence of target duplication. Database analyses showed widespread occurrence of these two elements in chromosomes and plasmids, with TnSha1 mainly in S. aureus and with TnSha2 mainly in S. haemolyticus and S. epidermidis. The acquisition of resistance by means of an insertion sequence-based mobilization and consequent duplication of drug-target metabolic genes, as observed here for sh-fabI, is highly reminiscent of the situation with the ileS2 gene conferring mupirocin resistance, and the dfrA and dfrG genes conferring trimethoprim resistance both of which are mobilized by IS257. These three examples, which show similar mechanisms and levels of spread of metabolic genes linked to IS elements, highlight the importance of this genetic strategy for recruitment and rapid distribution of novel resistance mechanisms in staphylococci. PMID:27446047

  2. The biofilm-specific antibiotic resistance gene ndvB is important for expression of ethanol oxidation genes in Pseudomonas aeruginosa biofilms.

    PubMed

    Beaudoin, Trevor; Zhang, Li; Hinz, Aaron J; Parr, Christopher J; Mah, Thien-Fah

    2012-06-01

    Bacteria growing in biofilms are responsible for a large number of persistent infections and are often more resistant to antibiotics than are free-floating bacteria. In a previous study, we identified a Pseudomonas aeruginosa gene, ndvB, which is important for the formation of periplasmic glucans. We established that these glucans function in biofilm-specific antibiotic resistance by sequestering antibiotic molecules away from their cellular targets. In this study, we investigate another function of ndvB in biofilm-specific antibiotic resistance. DNA microarray analysis identified 24 genes that were responsive to the presence of ndvB. A subset of 20 genes, including 8 ethanol oxidation genes (ercS', erbR, exaA, exaB, eraR, pqqB, pqqC, and pqqE), was highly expressed in wild-type biofilm cells but not in ΔndvB biofilms, while 4 genes displayed the reciprocal expression pattern. Using quantitative real-time PCR, we confirmed the ndvB-dependent expression of the ethanol oxidation genes and additionally demonstrated that these genes were more highly expressed in biofilms than in planktonic cultures. Expression of erbR in ΔndvB biofilms was restored after the treatment of the biofilm with periplasmic extracts derived from wild-type biofilm cells. Inactivation of ethanol oxidation genes increased the sensitivity of biofilms to tobramycin. Together, these results reveal that ndvB affects the expression of multiple genes in biofilms and that ethanol oxidation genes are linked to biofilm-specific antibiotic resistance.

  3. Anti-peptidyl transferase leader peptides of attenuation-regulated chloramphenicol-resistance genes.

    PubMed Central

    Gu, Z; Harrod, R; Rogers, E J; Lovett, P S

    1994-01-01

    The chloramphenicol (Cm)-inducible cmlA gene of Tn1696 specifies nonenzymatic resistance to Cm and is regulated by attenuation. The first eight codons of the leader specify a peptide that inhibits peptidyl transferase in vitro. Functionally similar, but less inhibitory, peptides are encoded by the leaders of Cm-inducible cat genes. However, the cat and cmlA coding sequences are unrelated and specify proteins of unrelated function. The inhibition of peptidyl transferase by the leader peptides is additive with that of Cm. Erythromycin competes with the inhibitory action of the peptides, and erythromycin and the peptides footprint to overlapping sites at the peptidyl transferase center of 23S rRNA. It is proposed that translation of the cmlA and cat leaders transiently pauses upon synthesis of the inhibitor peptides. The predicted site of pausing is identical to the leader site where long-term occupancy by a ribosome (ribosome stalling) will activate downstream gene expression. We therefore propose the inducer, Cm, converts a peptide-paused ribosome to the stalled state. We discuss the idea that cooperativity between leader peptide and inducer is necessary for ribosome stalling and may link the activation of a specific drug-resistance gene with a particular antibiotic. Images PMID:7515506

  4. Mining microbial metatranscriptomes for expression of antibiotic resistance genes under natural conditions

    PubMed Central

    Versluis, Dennis; D’Andrea, Marco Maria; Ramiro Garcia, Javier; Leimena, Milkha M.; Hugenholtz, Floor; Zhang, Jing; Öztürk, Başak; Nylund, Lotta; Sipkema, Detmer; Schaik, Willem van; de Vos, Willem M.; Kleerebezem, Michiel; Smidt, Hauke; Passel, Mark W.J. van

    2015-01-01

    Antibiotic resistance genes are found in a broad range of ecological niches associated with complex microbiota. Here we investigated if resistance genes are not only present, but also transcribed under natural conditions. Furthermore, we examined the potential for antibiotic production by assessing the expression of associated secondary metabolite biosynthesis gene clusters. Metatranscriptome datasets from intestinal microbiota of four human adults, one human infant, 15 mice and six pigs, of which only the latter have received antibiotics prior to the study, as well as from sea bacterioplankton, a marine sponge, forest soil and sub-seafloor sediment, were investigated. We found that resistance genes are expressed in all studied ecological niches, albeit with niche-specific differences in relative expression levels and diversity of transcripts. For example, in mice and human infant microbiota predominantly tetracycline resistance genes were expressed while in human adult microbiota the spectrum of expressed genes was more diverse, and also included β-lactam, aminoglycoside and macrolide resistance genes. Resistance gene expression could result from the presence of natural antibiotics in the environment, although we could not link it to expression of corresponding secondary metabolites biosynthesis clusters. Alternatively, resistance gene expression could be constitutive, or these genes serve alternative roles besides antibiotic resistance. PMID:26153129

  5. Mining microbial metatranscriptomes for expression of antibiotic resistance genes under natural conditions

    NASA Astrophysics Data System (ADS)

    Versluis, Dennis; D'Andrea, Marco Maria; Ramiro Garcia, Javier; Leimena, Milkha M.; Hugenholtz, Floor; Zhang, Jing; Öztürk, Başak; Nylund, Lotta; Sipkema, Detmer; Schaik, Willem Van; de Vos, Willem M.; Kleerebezem, Michiel; Smidt, Hauke; Passel, Mark W. J. Van

    2015-07-01

    Antibiotic resistance genes are found in a broad range of ecological niches associated with complex microbiota. Here we investigated if resistance genes are not only present, but also transcribed under natural conditions. Furthermore, we examined the potential for antibiotic production by assessing the expression of associated secondary metabolite biosynthesis gene clusters. Metatranscriptome datasets from intestinal microbiota of four human adults, one human infant, 15 mice and six pigs, of which only the latter have received antibiotics prior to the study, as well as from sea bacterioplankton, a marine sponge, forest soil and sub-seafloor sediment, were investigated. We found that resistance genes are expressed in all studied ecological niches, albeit with niche-specific differences in relative expression levels and diversity of transcripts. For example, in mice and human infant microbiota predominantly tetracycline resistance genes were expressed while in human adult microbiota the spectrum of expressed genes was more diverse, and also included β-lactam, aminoglycoside and macrolide resistance genes. Resistance gene expression could result from the presence of natural antibiotics in the environment, although we could not link it to expression of corresponding secondary metabolites biosynthesis clusters. Alternatively, resistance gene expression could be constitutive, or these genes serve alternative roles besides antibiotic resistance.

  6. Antagonistic control of a dual-input mammalian gene switch by food additives.

    PubMed

    Xie, Mingqi; Ye, Haifeng; Hamri, Ghislaine Charpin-El; Fussenegger, Martin

    2014-08-01

    Synthetic biology has significantly advanced the design of mammalian trigger-inducible transgene-control devices that are able to programme complex cellular behaviour. Fruit-based benzoate derivatives licensed as food additives, such as flavours (e.g. vanillate) and preservatives (e.g. benzoate), are a particularly attractive class of trigger compounds for orthogonal mammalian transgene control devices because of their innocuousness, physiological compatibility and simple oral administration. Capitalizing on the genetic componentry of the soil bacterium Comamonas testosteroni, which has evolved to catabolize a variety of aromatic compounds, we have designed different mammalian gene expression systems that could be induced and repressed by the food additives benzoate and vanillate. When implanting designer cells engineered for gene switch-driven expression of the human placental secreted alkaline phosphatase (SEAP) into mice, blood SEAP levels of treated animals directly correlated with a benzoate-enriched drinking programme. Additionally, the benzoate-/vanillate-responsive device was compatible with other transgene control systems and could be assembled into higher-order control networks providing expression dynamics reminiscent of a lap-timing stopwatch. Designer gene switches using licensed food additives as trigger compounds to achieve antagonistic dual-input expression profiles and provide novel control topologies and regulation dynamics may advance future gene- and cell-based therapies.

  7. Antagonistic control of a dual-input mammalian gene switch by food additives

    PubMed Central

    Xie, Mingqi; Ye, Haifeng; Hamri, Ghislaine Charpin-El; Fussenegger, Martin

    2014-01-01

    Synthetic biology has significantly advanced the design of mammalian trigger-inducible transgene-control devices that are able to programme complex cellular behaviour. Fruit-based benzoate derivatives licensed as food additives, such as flavours (e.g. vanillate) and preservatives (e.g. benzoate), are a particularly attractive class of trigger compounds for orthogonal mammalian transgene control devices because of their innocuousness, physiological compatibility and simple oral administration. Capitalizing on the genetic componentry of the soil bacterium Comamonas testosteroni, which has evolved to catabolize a variety of aromatic compounds, we have designed different mammalian gene expression systems that could be induced and repressed by the food additives benzoate and vanillate. When implanting designer cells engineered for gene switch-driven expression of the human placental secreted alkaline phosphatase (SEAP) into mice, blood SEAP levels of treated animals directly correlated with a benzoate-enriched drinking programme. Additionally, the benzoate-/vanillate-responsive device was compatible with other transgene control systems and could be assembled into higher-order control networks providing expression dynamics reminiscent of a lap-timing stopwatch. Designer gene switches using licensed food additives as trigger compounds to achieve antagonistic dual-input expression profiles and provide novel control topologies and regulation dynamics may advance future gene- and cell-based therapies. PMID:25030908

  8. Mutations in Novel Lipopolysaccharide Biogenesis Genes Confer Resistance to Amoebal Grazing in Synechococcus elongatus.

    PubMed

    Simkovsky, Ryan; Effner, Emily E; Iglesias-Sánchez, Maria José; Golden, Susan S

    2016-05-01

    In natural and artificial aquatic environments, population structures and dynamics of photosynthetic microbes are heavily influenced by the grazing activity of protistan predators. Understanding the molecular factors that affect predation is critical for controlling toxic cyanobacterial blooms and maintaining cyanobacterial biomass production ponds for generating biofuels and other bioproducts. We previously demonstrated that impairment of the synthesis or transport of the O-antigen component of lipopolysaccharide (LPS) enables resistance to amoebal grazing in the model predator-prey system consisting of the heterolobosean amoeba HGG1 and the cyanobacterium Synechococcus elongates PCC 7942 (R. S. Simkovsky et al., Proc Natl Acad Sci U S A 109:16678-16683, 2012,http://dx.doi.org/10.1073/pnas.1214904109). In this study, we used this model system to identify additional gene products involved in the synthesis of O antigen, the ligation of O antigen to the lipid A-core conjugated molecule (including a novel ligase gene), the generation of GDP-fucose, and the incorporation of sugars into the lipid A core oligosaccharide ofS. elongatus Knockout of any of these genes enables resistance to HGG1, and of these, only disruption of the genes involved in synthesis or incorporation of GDP-fucose into the lipid A-core molecule impairs growth. Because these LPS synthesis genes are well conserved across the diverse range of cyanobacteria, they enable a broader understanding of the structure and synthesis of cyanobacterial LPS and represent mutational targets for generating resistance to amoebal grazers in novel biomass production strains. PMID:26921432

  9. Chlorhexidine Induces VanA-Type Vancomycin Resistance Genes in Enterococci

    PubMed Central

    Bhardwaj, Pooja; Ziegler, Elizabeth

    2016-01-01

    Chlorhexidine is a bisbiguanide antiseptic used for infection control. Vancomycin-resistant E. faecium (VREfm) is among the leading causes of hospital-acquired infections. VREfm may be exposed to chlorhexidine at supra- and subinhibitory concentrations as a result of chlorhexidine bathing and chlorhexidine-impregnated central venous catheter use. We used RNA sequencing to investigate how VREfm responds to chlorhexidine gluconate exposure. Among the 35 genes upregulated ≥10-fold after 15 min of exposure to the MIC of chlorhexidine gluconate were those encoding VanA-type vancomycin resistance (vanHAX) and those associated with reduced daptomycin susceptibility (liaXYZ). We confirmed that vanA upregulation was not strain or species specific by querying other VanA-type VRE. VanB-type genes were not induced. The vanH promoter was found to be responsive to subinhibitory chlorhexidine gluconate in VREfm, as was production of the VanX protein. Using vanH reporter experiments with Bacillus subtilis and deletion analysis in VREfm, we found that this phenomenon is VanR dependent. Deletion of vanR did not result in increased chlorhexidine susceptibility, demonstrating that vanHAX induction is not protective against chlorhexidine. As expected, VanA-type VRE is more susceptible to ceftriaxone in the presence of sub-MIC chlorhexidine. Unexpectedly, VREfm is also more susceptible to vancomycin in the presence of subinhibitory chlorhexidine, suggesting that chlorhexidine-induced gene expression changes lead to additional alterations in cell wall synthesis. We conclude that chlorhexidine induces expression of VanA-type vancomycin resistance genes and genes associated with daptomycin nonsusceptibility. Overall, our results indicate that the impacts of subinhibitory chlorhexidine exposure on hospital-associated pathogens should be further investigated in laboratory studies. PMID:26810654

  10. Mutations in Novel Lipopolysaccharide Biogenesis Genes Confer Resistance to Amoebal Grazing in Synechococcus elongatus

    PubMed Central

    Effner, Emily E.; Iglesias-Sánchez, Maria José; Golden, Susan S.

    2016-01-01

    In natural and artificial aquatic environments, population structures and dynamics of photosynthetic microbes are heavily influenced by the grazing activity of protistan predators. Understanding the molecular factors that affect predation is critical for controlling toxic cyanobacterial blooms and maintaining cyanobacterial biomass production ponds for generating biofuels and other bioproducts. We previously demonstrated that impairment of the synthesis or transport of the O-antigen component of lipopolysaccharide (LPS) enables resistance to amoebal grazing in the model predator-prey system consisting of the heterolobosean amoeba HGG1 and the cyanobacterium Synechococcus elongatus PCC 7942 (R. S. Simkovsky et al., Proc Natl Acad Sci U S A 109:16678–16683, 2012, http://dx.doi.org/10.1073/pnas.1214904109). In this study, we used this model system to identify additional gene products involved in the synthesis of O antigen, the ligation of O antigen to the lipid A-core conjugated molecule (including a novel ligase gene), the generation of GDP-fucose, and the incorporation of sugars into the lipid A core oligosaccharide of S. elongatus. Knockout of any of these genes enables resistance to HGG1, and of these, only disruption of the genes involved in synthesis or incorporation of GDP-fucose into the lipid A-core molecule impairs growth. Because these LPS synthesis genes are well conserved across the diverse range of cyanobacteria, they enable a broader understanding of the structure and synthesis of cyanobacterial LPS and represent mutational targets for generating resistance to amoebal grazers in novel biomass production strains. PMID:26921432

  11. Functional variability of the Lr34 durable resistance gene in transgenic wheat.

    PubMed

    Risk, Joanna M; Selter, Liselotte L; Krattinger, Simon G; Viccars, Libby A; Richardson, Terese M; Buesing, Gabriele; Herren, Gerhard; Lagudah, Evans S; Keller, Beat

    2012-05-01

    Breeding for durable disease resistance is challenging, yet essential to improve crops for sustainable agriculture. The wheat Lr34 gene is one of the few cloned, durable resistance genes in plants. It encodes an ATP binding cassette transporter and has been a source of resistance against biotrophic pathogens, such as leaf rust (Puccinina triticina), for over 100 years. As endogenous Lr34 confers quantitative resistance, we wanted to determine the effects of transgenic Lr34 with specific reference to how expression levels affect resistance. Transgenic Lr34 wheat lines were made in two different, susceptible genetic backgrounds. We found that the introduction of the Lr34 resistance allele was sufficient to provide comparable levels of leaf rust resistance as the endogenous Lr34 gene. As with the endogenous gene, we observed resistance in seedlings after cold treatment and in flag leaves of adult plants, as well as Lr34-associated leaf tip necrosis. The transgene-based Lr34 resistance did not involve a hypersensitive response, altered callose deposition or up-regulation of PR genes. Higher expression levels compared to endogenous Lr34 were observed in the transgenic lines both at seedling as well as adult stage and some improvement of resistance was seen in the flag leaf. Interestingly, in one genetic background the transgenic Lr34-based resistance resulted in improved seedling resistance without cold treatment. These data indicate that functional variability in Lr34-based resistance can be created using a transgenic approach.

  12. Identification of aminoglycoside resistance genes by Triplex PCR in Enterococcus spp. isolated from ICUs.

    PubMed

    Mirnejad, Reza; Sajjadi, Nikta; Masoumi Zavaryani, Sara; Piranfar, Vahhab; Hajihosseini, Maryam; Roshanfekr, Maliheh

    2016-09-01

    Early detection of antibiotic-resistant enterococci is an important part of patient treatment. Therefore, the aim of the present study was to evaluate the resistance patterns and simultaneously identify and characterise the resistance genes in Enterococcus spp. using a triplex polymerase chain reaction (PCR) method. In all, 150 consecutive Enterococcus spp were collected from several hospitals in Tehran (Iran) from January to December 2015. The Enterococcus species were identified by standard phenotypic/biochemical tests and PCR. The antimicrobial resistance patterns were determined using a disk diffusion method. The triplex PCR method was designed to identify gentamicin and other aminoglycoside resistance genes. Among the 150 Enterococcus specimens, 87 cases (58%) were Enterococcus faecalis, and 63 cases (42%) were Enterococcus faecium. The highest frequency of resistance was observed for tetracycline while the lowest was found for vancomycin. Among the identified samples, 56.9% contained the aac(6')-Ie-aph(2'')-Ia gene, 22.2% contained the aph(3')-IIIa gene, and 38.8% contained the ant(4')-?a gene. Eight percent of the isolates contained the three aminoglycoside resistance genes. Data analysis showed that there was a significant correlation between the phenotypic gentamicin resistance and the presence of the aminoglycoside resistance genes (18.9%, p <0.05), while the correlation between the phenotypic streptomycin resistance and the corresponding genes was not significant (2.8%, p ≥0.5). Nearly half of the identified Enterococcus strains had increased aminoglycoside resistance. The direct correlation between resistance genes, such as the aminoglycoside resistance factor, and phenotypic resistance was not significant (p > 0.05). PMID:27668903

  13. Identification of aminoglycoside resistance genes by Triplex PCR in Enterococcus spp. isolated from ICUs.

    PubMed

    Mirnejad, Reza; Sajjadi, Nikta; Masoumi Zavaryani, Sara; Piranfar, Vahhab; Hajihosseini, Maryam; Roshanfekr, Maliheh

    2016-09-01

    Early detection of antibiotic-resistant enterococci is an important part of patient treatment. Therefore, the aim of the present study was to evaluate the resistance patterns and simultaneously identify and characterise the resistance genes in Enterococcus spp. using a triplex polymerase chain reaction (PCR) method. In all, 150 consecutive Enterococcus spp were collected from several hospitals in Tehran (Iran) from January to December 2015. The Enterococcus species were identified by standard phenotypic/biochemical tests and PCR. The antimicrobial resistance patterns were determined using a disk diffusion method. The triplex PCR method was designed to identify gentamicin and other aminoglycoside resistance genes. Among the 150 Enterococcus specimens, 87 cases (58%) were Enterococcus faecalis, and 63 cases (42%) were Enterococcus faecium. The highest frequency of resistance was observed for tetracycline while the lowest was found for vancomycin. Among the identified samples, 56.9% contained the aac(6')-Ie-aph(2'')-Ia gene, 22.2% contained the aph(3')-IIIa gene, and 38.8% contained the ant(4')-?a gene. Eight percent of the isolates contained the three aminoglycoside resistance genes. Data analysis showed that there was a significant correlation between the phenotypic gentamicin resistance and the presence of the aminoglycoside resistance genes (18.9%, p <0.05), while the correlation between the phenotypic streptomycin resistance and the corresponding genes was not significant (2.8%, p ≥0.5). Nearly half of the identified Enterococcus strains had increased aminoglycoside resistance. The direct correlation between resistance genes, such as the aminoglycoside resistance factor, and phenotypic resistance was not significant (p > 0.05).

  14. The Effect of Zirconium Addition on the Oxidation Resistance of Aluminide Coatings

    NASA Astrophysics Data System (ADS)

    Zagula-Yavorska, Maryana; Pytel, Maciej; Romanowska, Jolanta; Sieniawski, Jan

    2015-04-01

    Nickel, Mar M247, and Mar M200 superalloys were coated with zirconium-doped aluminide deposited by the chemical vapor deposition method. All coatings consisted of two layers: an additive one, comprising of the β-NiAl phase and the interdiffusion one. The interdiffusion layer on pure nickel consisted of the γ'-Ni3Al phase and β-NiAl phase on superalloys. Precipitations of zirconium-rich particles were found near the coating's surface and at the interface between the additive and the interdiffusion layer. Zirconium doping of aluminide coating improved the oxidation resistance of aluminide coatings deposited both on the nickel substrate and on the Mar M200 superalloy. Precipitations of ZrO2 embedded by the Al2O3 oxide were formed during oxidation. It seems that the ZrO2 oxide increases adhesion of the Al2O3 oxide to the coating and decreases the propensity of the Al2O3 oxide rumpling and spalling.

  15. Transgenic wheat expressing a barley class II chitinase gene has enhanced resistance against Fusarium graminearum

    PubMed Central

    Shin, Sanghyun; Mackintosh, Caroline A.; Lewis, Janet; Heinen, Shane J.; Radmer, Lorien; Dill-Macky, Ruth; Baldridge, Gerald D.; Zeyen, Richard J.; Muehlbauer, Gary J.

    2008-01-01

    Fusarium head blight (FHB; scab), primarily caused by Fusarium graminearum, is a devastating disease of wheat worldwide. FHB causes yield reductions and contamination of grains with trichothecene mycotoxins such as deoxynivalenol (DON). The genetic variation in existing wheat germplasm pools for FHB resistance is low and may not provide sufficient resistance to develop cultivars through traditional breeding approaches. Thus, genetic engineering provides an additional approach to enhance FHB resistance. The objectives of this study were to develop transgenic wheat expressing a barley class II chitinase and to test the transgenic lines against F. graminearum infection under greenhouse and field conditions. A barley class II chitinase gene was introduced into the spring wheat cultivar, Bobwhite, by biolistic bombardment. Seven transgenic lines were identified that expressed the chitinase transgene and exhibited enhanced Type II resistance in the greenhouse evaluations. These seven transgenic lines were tested under field conditions for percentage FHB severity, percentage visually scabby kernels (VSK), and DON accumulation. Two lines (C8 and C17) that exhibited high chitinase protein levels also showed reduced FHB severity and VSK compared to Bobwhite. One of the lines (C8) also exhibited reduced DON concentration compared with Bobwhite. These results showed that transgenic wheat expressing a barley class II chitinase exhibited enhanced resistance against F. graminearum in greenhouse and field conditions. PMID:18467324

  16. Are PECTIN ESTERASE INHIBITOR Genes Involved in Mediating Resistance to Rhynchosporium commune in Barley?

    PubMed Central

    Marzin, Stephan; Hanemann, Anja; Sharma, Shailendra; Hensel, Götz; Kumlehn, Jochen; Schweizer, Günther; Röder, Marion S.

    2016-01-01

    A family of putative PECTIN ESTERASE INHIBITOR (PEI) genes, which were detected in the genomic region co-segregating with the resistance gene Rrs2 against scald caused by Rhynchosporium commune in barley, were characterized and tested for their possible involvement in mediating resistance to the pathogen by complementation and overexpression analysis. The sequences of the respective genes were derived from two BAC contigs originating from the susceptible cultivar ‘Morex’. For the genes HvPEI2, HvPEI3, HvPEI4 and HvPEI6, specific haplotypes for 18 resistant and 23 susceptible cultivars were detected after PCR-amplification and haplotype-specific CAPS-markers were developed. None of the tested candidate genes HvPEI2, HvPEI3 and HvPEI4 alone conferred a high resistance level in transgenic over-expression plants, though an improvement of the resistance level was observed especially with OE-lines for gene HvPEI4. These results do not confirm but also do not exclude an involvement of the PEI gene family in the response to the pathogen. A candidate for the resistance gene Rrs2 could not be identified yet. It is possible that Rrs2 is a PEI gene or another type of gene which has not been detected in the susceptible cultivar ‘Morex’ or the full resistance reaction requires the presence of several PEI genes. PMID:26937960

  17. The effect of pyramiding Phytophthora infestans resistance genes RPi-mcd1 and RPi-ber in potato

    PubMed Central

    Tan, M. Y. Adillah; Hutten, Ronald C. B.; Visser, Richard G. F.

    2010-01-01

    Despite efforts to control late blight in potatoes by introducing Rpi-genes from wild species into cultivated potato, there are still concerns regarding the durability and level of resistance. Pyramiding Rpi-genes can be a solution to increase both durability and level of resistance. In this study, two resistance genes, RPi-mcd1 and RPi-ber, introgressed from the wild tuber-bearing potato species Solanum microdontum and S. berthaultii were combined in a diploid S. tuberosum population. Individual genotypes from this population were classified after four groups, carrying no Rpi-gene, with only RPi-mcd1, with only RPi-ber, and a group with the pyramided RPi-mcd1 and RPi-ber by means of tightly linked molecular markers. The levels of resistance between the groups were compared in a field experiment in 2007. The group with RPi-mcd1 showed a significant delay to reach 50% infection of the leaf area of 3 days. The group with RPi-ber showed a delay of 3 weeks. The resistance level in the pyramid group suggested an additive effect of RPi-mcd1 with RPi-ber. This suggests that potato breeding can benefit from combining individual Rpi-genes, irrespective of the weak effect of RPi-mcd1 or the strong effect of RPi-ber. PMID:20204320

  18. Additional Routes to Staphylococcus aureus Daptomycin Resistance as Revealed by Comparative Genome Sequencing, Transcriptional Profiling, and Phenotypic Studies

    PubMed Central

    Song, Yang; Rubio, Aileen; Jayaswal, Radheshyam K.; Silverman, Jared A.; Wilkinson, Brian J.

    2013-01-01

    Daptomycin is an extensively used anti-staphylococcal agent due to the rise in methicillin-resistant Staphylococcus aureus, but the mechanism(s) of resistance is poorly understood. Comparative genome sequencing, transcriptomics, ultrastructure, and cell envelope studies were carried out on two relatively higher level (4 and 8 µg/ml−1) laboratory-derived daptomycin-resistant strains (strains CB1541 and CB1540 respectively) compared to their parent strain (CB1118; MW2). Several mutations were found in the strains. Both strains had the same mutations in the two-component system genes walK and agrA. In strain CB1540 mutations were also detected in the ribose phosphate pyrophosphokinase (prs) and polyribonucleotide nucleotidyltransferase genes (pnpA), a hypothetical protein gene, and in an intergenic region. In strain CB1541 there were mutations in clpP, an ATP-dependent protease, and two different hypothetical protein genes. The strain CB1540 transcriptome was characterized by upregulation of cap (capsule) operon genes, genes involved in the accumulation of the compatible solute glycine betaine, ure genes of the urease operon, and mscL encoding a mechanosensitive chanel. Downregulated genes included smpB, femAB and femH involved in the formation of the pentaglycine interpeptide bridge, genes involved in protein synthesis and fermentation, and spa encoding protein A. Genes altered in their expression common to both transcriptomes included some involved in glycine betaine accumulation, mscL, ure genes, femH, spa and smpB. However, the CB1541 transcriptome was further characterized by upregulation of various heat shock chaperone and protease genes, consistent with a mutation in clpP, and lytM and sceD. Both strains showed slow growth, and strongly decreased autolytic activity that appeared to be mainly due to decreased autolysin production. In contrast to previous common findings, we did not find any mutations in phospholipid biosynthesis genes, and it appears there

  19. Identification of candidate genes for Fusarium yellows resistance in Chinese cabbage by differential expression analysis.

    PubMed

    Shimizu, Motoki; Fujimoto, Ryo; Ying, Hua; Pu, Zi-jing; Ebe, Yusuke; Kawanabe, Takahiro; Saeki, Natsumi; Taylor, Jennifer M; Kaji, Makoto; Dennis, Elizabeth S; Okazaki, Keiichi

    2014-06-01

    Fusarium yellows caused by Fusarium oxysporum f. sp. conglutinans is an important disease of Brassica worldwide. To identify a resistance (R) gene against Fusarium yellows in Chinese cabbage (Brassica rapa var. pekinensis), we analyzed differential expression at the whole genome level between resistant and susceptible inbred lines using RNA sequencing. Four hundred and eighteen genes were significantly differentially expressed, and these were enriched for genes involved in response to stress or stimulus. Seven dominant DNA markers at putative R-genes were identified. Presence and absence of the sequence of the putative R-genes, Bra012688 and Bra012689, correlated with the resistance of six inbred lines and susceptibility of four inbred lines, respectively. In F(2) populations derived from crosses between resistant and susceptible inbred lines, presence of Bra012688 and Bra012689 cosegregated with resistance, suggesting that Bra012688 and Bra012689 are good candidates for fusarium yellows resistance in Chinese cabbage.

  20. Ultraviolet disinfection of antibiotic resistant bacteria and their antibiotic resistance genes in water and wastewater.

    PubMed

    McKinney, Chad W; Pruden, Amy

    2012-12-18

    Disinfection of wastewater treatment plant effluent may be an important barrier for limiting the spread of antibiotic-resistant bacteria (ARBs) and antibiotic resistance genes (ARGs). While ideally disinfection should destroy ARGs, to prevent horizontal gene transfer to downstream bacteria, little is known about the effect of conventional water disinfection technologies on ARGs. This study examined the potential of UV disinfection to damage four ARGs, mec(A), van(A), tet(A), and amp(C), both in extracellular form and present within a host ARBs: methicillin-resistant Staphylococcus aureus (MRSA), vancomycin-resistant Enterococcus faecium (VRE), Escherichia coli SMS-3-5, and Pseudomonas aeruginosa 01, respectively. An extended amplicon-length quantitative polymerase chain reaction assay was developed to enhance capture of ARG damage events and also to normalize to an equivalent length of target DNA (∼1000 bp) for comparison. It was found that the two Gram-positive ARBs (MRSA and VRE) were more resistant to UV disinfection than the two Gram-negative ARBs (E. coli and P. aeruginosa). The two Gram-positive organisms also possessed smaller total genome sizes, which could also have reduced their susceptibility to UV because of fewer potential pyrimidine dimer targets. An effect of cell type on damage to ARGs was only observed in VRE and P. aeruginosa, the latter potentially because of extracellular polymeric substances. In general, damage of ARGs required much greater UV doses (200-400 mJ/cm² for 3- to 4-log reduction) than ARB inactivation (10-20 mJ/cm² for 4- to 5-log reduction). The proportion of amplifiable ARGs following UV treatment exhibited a strong negative correlation with the number of adjacent thymines (Pearson r < -0.9; p < 0.0001). ARBs surviving UV treatment were negatively correlated with total genome size (Pearson r < -0.9; p < 0.0001) and adjacent cytosines (Pearson r < -0.88; p < 0.0001) but positively correlated with adjacent thymines (Pearson r

  1. Antimicrobial-resistant bacterial populations and antimicrobial resistance genes obtained from environments impacted by livestock and municipal waste

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study compared the populations of antimicrobial-resistant bacteria and the repertoire of antimicrobial resistance genes in four environments: effluent of three municipal waste water treatment facilities, three cattle feedlot runoff catchment ponds, three swine waste lagoons, and two "low impact...

  2. Metagenomic analysis of virulence-associated and antibiotic resistance genes of microbes in rumen of Indian buffalo (Bubalus bubalis).

    PubMed

    Singh, K M; Jakhesara, S J; Koringa, P G; Rank, D N; Joshi, C G

    2012-10-10

    A major research goal in rumen microbial ecology is to understand the relationship between community composition and its function, particularly involved in fermentation process is of a potential interest. The buffalo rumen microbiota impacts human food safety as well as animal health. Although the bacteria of bovine rumen have been well characterized, techniques have been lacking to correlate total community structure with gene function. We applied 454 next generations sequencing technology to characterize general microbial diversity present in buffalo rumen metagenome and also identified the repertoire of microbial genes present, including genes associated with antibiotic resistance and bacterial virulence. Results suggest that over six percent (6.44%) of the sequences from our buffalo rumen pool sample could be categorized as virulence genes and genes associated with resistance to antibiotic and toxic compounds (RATC), which is a higher proportion of virulence genes reported from metagenome samples of chicken cecum (5.39%), cow rumen (4.43%) and Sargasso sea (2.95%). However, it was lower than the proportion found in cow milk (11.33%) cattle faeces (8.4%), Antarctic marine derived lake (8.45%), human fecal (7.7%) and farm soil (7.79%). The dynamic nature of metagenomic data, together with the large number of RATC classes observed in samples from widely different ecologies indicates that metagenomic data can be used to track potential targets and relative amounts of antibiotic resistance genes in individual animals. In addition, these data can be also used to generate antibiotic resistance gene profiles to facilitate an understanding of the ecology of the microbial communities in each habitat as well as the epidemiology of antibiotic resistant gene transport between and among habitats.

  3. Metagenomic analysis of virulence-associated and antibiotic resistance genes of microbes in rumen of Indian buffalo (Bubalus bubalis).

    PubMed

    Singh, K M; Jakhesara, S J; Koringa, P G; Rank, D N; Joshi, C G

    2012-10-10

    A major research goal in rumen microbial ecology is to understand the relationship between community composition and its function, particularly involved in fermentation process is of a potential interest. The buffalo rumen microbiota impacts human food safety as well as animal health. Although the bacteria of bovine rumen have been well characterized, techniques have been lacking to correlate total community structure with gene function. We applied 454 next generations sequencing technology to characterize general microbial diversity present in buffalo rumen metagenome and also identified the repertoire of microbial genes present, including genes associated with antibiotic resistance and bacterial virulence. Results suggest that over six percent (6.44%) of the sequences from our buffalo rumen pool sample could be categorized as virulence genes and genes associated with resistance to antibiotic and toxic compounds (RATC), which is a higher proportion of virulence genes reported from metagenome samples of chicken cecum (5.39%), cow rumen (4.43%) and Sargasso sea (2.95%). However, it was lower than the proportion found in cow milk (11.33%) cattle faeces (8.4%), Antarctic marine derived lake (8.45%), human fecal (7.7%) and farm soil (7.79%). The dynamic nature of metagenomic data, together with the large number of RATC classes observed in samples from widely different ecologies indicates that metagenomic data can be used to track potential targets and relative amounts of antibiotic resistance genes in individual animals. In addition, these data can be also used to generate antibiotic resistance gene profiles to facilitate an understanding of the ecology of the microbial communities in each habitat as well as the epidemiology of antibiotic resistant gene transport between and among habitats. PMID:22850272

  4. Overcoming of multidrug resistance by introducing the apoptosis gene, bcl-Xs, into MRP-overexpressing drug resistant cells.

    PubMed

    Ohi, Y; Kim, R; Toge, T

    2000-05-01

    Multidrug resistance associated protein (MRP) is one of drug transport membranes that confer multidrug resistance in cancer cells. Multidrug resistance has been known to be associated with resistance to apoptosis. In this study, using MRP overexpressing multidrug resistant nasopharyngeal cancer cells, we examined the expression of apoptosis related genes including p53, p21WAF1, bax and bcl-Xs between drug sensitive KB and its resistant KB/7D cells. We also examined whether the introduction of apoptosis related gene could increase the sensitivity to anticancer drugs in association with apoptotic cell death. The relative resistances to anticancer drugs in KB/7D cells evaluated by IC50 values were 3.6, 61.3, 10.4 and 10.5 to adriamycin (ADM), etoposide (VP-16), vincristine (VCR) and vindesine (VDS), respectively. The resistance to anticancer drugs in KB/7D cells was associated with the attenuation of internucleosomal DNA ladder formation in apoptosis. Of important, the mRNA expression of bcl-Xs gene in KB/7D cells was decreased in one-fourth as compared to that of KB cells among the apoptosis genes. The mRNA expression of bcl-Xs gene in a bcl-Xs transfected clone (KB/7Dbcl-Xs) was increased about 2-fold compared to that of KB/7Dneo cells, while the mRNA expression of MRP gene was not significantly different in KB/7bcl-Xs and KB/7Dneo cells. The sensitivities to anticancer drugs including ADM, VCR and VDS except VP-16 were increased in KB/7Dbcl-Xs cells, in turn, the relative resistance in KB/7Dbcl-Xs cells was decreased to 1.4, 4.0, and 3.0 in ADM, VCR and VDS, respectively, as compared to those of KB/7Dneo cells. Of interest, the studies on the accumulation of [3H]VCR showed that the decrease of [3H]VCR accumulation in KB/7Dbcl-Xs was not significantly different from that of KB/7Dneo cells. Collectively, these results indicated that the mechanism(s) of drug resistance in KB/7D cells could be explained at least by two factors: a) reduced drug accumulation mediated by

  5. Characterization of bromadiolone resistance in a danish strain of Norway rats, Rattus norvegicus, by hepatic gene expression profiling of genes involved in vitamin K-dependent gamma-carboxylation.

    PubMed

    Markussen, Mette Drude; Heiberg, Ann-Charlotte; Fredholm, Merete; Kristensen, Michael

    2007-01-01

    The present study characterizes the anticoagulant resistance mechanism in a Danish bromadiolone-resistant strain of Norway rats (Rattus norvegicus), with a Y139C VKORC1 mutation. We compared liver expression of the VKORC1 gene, which encodes a protein of the vitamin K 2,3-epoxide reductase complex, the NQO1 gene, which encodes a NAD(P)H quinone dehydrogenase and the Calumenin gene between bromadiolone-resistant and anticoagulant-susceptible rats upon saline and bromadiolone administration. Additionally, we established the effect of bromadiolone on the gene expression in the resistant and susceptible phenotype. Bromadiolone had no effect on VKORC1 and NQO1 expression in resistant rats, but induced significantly Calumenin expression in the susceptible rats. Calumenin expression was similar between the resistant and the susceptible rats upon saline administration but twofold lower in resistant rats after bromadiolone treatment. These results indicate that Danish bromadiolone resistance does not involve an overexpression of calumenin. Independent of the treatment, we observed a low VKORC1 expression in resistant rats, which in conjugation with the Y139C polymorphism most likely explains the low VKOR activity and the enhanced need for vitamin K observed in Danish resistant rats. Furthermore the bromadiolone resistance was found to be associated with a low expression of the NQO1 gene. PMID:17994578

  6. Mathematical modelling of antimicrobial resistance in agricultural waste highlights importance of gene transfer rate.

    PubMed

    Baker, Michelle; Hobman, Jon L; Dodd, Christine E R; Ramsden, Stephen J; Stekel, Dov J

    2016-04-01

    Antimicrobial resistance is of global concern. Most antimicrobial use is in agriculture; manures and slurry are especially important because they contain a mix of bacteria, including potential pathogens, antimicrobial resistance genes and antimicrobials. In many countries, manures and slurry are stored, especially over winter, before spreading onto fields as organic fertilizer. Thus, these are a potential location for gene exchange and selection for resistance. We develop and analyse a mathematical model to quantify the spread of antimicrobial resistance in stored agricultural waste. We use parameters from a slurry tank on a UK dairy farm as an exemplar. We show that the spread of resistance depends in a subtle way on the rates of gene transfer and antibiotic inflow. If the gene transfer rate is high, then its reduction controls resistance, while cutting antibiotic inflow has little impact. If the gene transfer rate is low, then reducing antibiotic inflow controls resistance. Reducing length of storage can also control spread of resistance. Bacterial growth rate, fitness costs of carrying antimicrobial resistance and proportion of resistant bacteria in animal faeces have little impact on spread of resistance. Therefore, effective treatment strategies depend critically on knowledge of gene transfer rates. PMID:26906100

  7. Deletions in a ribosomal protein-coding gene are associated with tigecycline resistance in Enterococcus faecium.

    PubMed

    Niebel, Marc; Quick, Joshua; Prieto, Ana Maria Guzman; Hill, Robert L R; Pike, Rachel; Huber, Damon; David, Miruna; Hornsey, Michael; Wareham, David; Oppenheim, Beryl; Woodford, Neil; van Schaik, Willem; Loman, Nicholas

    2015-11-01

    Enterococcus faecium is an emerging nosocomial pathogen associated with antibiotic therapy in the hospital environment. Whole-genome sequences were determined for three pairs of related, consecutively collected E. faecium clinical isolates to determine putative mechanisms of resistance to tigecycline. The first isolates (1S, 2S and 3S) in each of the three pairs were sensitive to tigecycline [minimum inhibitory concentration (MIC) of 0.125 mg/L]. Following tigecycline therapy, the second isolate in each pair demonstrated increased resistance to tigecycline. Two isolates (1R and 2R) were resistant (MIC of 8 mg/L) and one isolate (3I) demonstrated reduced susceptibility (MIC of 0.5 mg/L). Mutations distinguishing each pair of sensitive and resistant isolates were determined through alignment to a reference genome and variant detection. In addition, a de novo assembly of each isolate genome was constructed to confirm mutations. A total of 16 mutations in eleven coding sequences were determined. Mutations in the rpsJ gene, which encodes a structural protein forming part of the 30S ribosomal subunit, were detected in each of the pairs. Mutations were in regions proximal to the predicted tigecycline-binding site. Predicted amino acid substitutions were detected in 1R and 3I. The resistant strains were additionally associated with deletions of 15 nucleotides (2R) and 3 nucleotides (1R). This study confirms that amino acid substitutions in rpsJ contribute towards reduced susceptibility to tigecycline and suggests that deletions may be required for tigecycline resistance in E. faecium.

  8. Identification of Genes in a Partially Resistant Genotype of Avena sativa Expressed in Response to Puccinia coronata Infection.

    PubMed

    Loarce, Yolanda; Navas, Elisa; Paniagua, Carlos; Fominaya, Araceli; Manjón, José L; Ferrer, Esther

    2016-01-01

    Cultivated oat (Avena sativa), an important crop in many countries, can suffer significant losses through infection by the fungus Puccinia coronata, the causal agent of crown rust disease. Understanding the molecular basis of existing partial resistance to this disease might provide targets of interest for crop improvement programs. A suppressive subtractive hybridization (SSH) library was constructed using cDNA from the partially resistant oat genotype MN841801-1 after inoculation with the pathogen. A total of 929 genes returned a BLASTx hit and were annotated under different GO terms, including 139 genes previously described as participants in mechanisms related to the defense response and signal transduction. Among these were genes involved in pathogen recognition, cell-wall modification, oxidative burst/ROS scavenging, and abscisic acid biosynthesis, as well genes related to inducible defense responses mediated by salicylic and jasmonic acid (although none of which had been previously reported involved in strong responses). These findings support the hypothesis that basal defense mechanisms are the main systems operating in oat partial resistance to P. coronata. When the expression profiles of 20 selected genes were examined at different times following inoculation with the pathogen, the partially resistant genotype was much quicker in mounting a response than a susceptible genotype. Additionally, a number of genes not previously described in oat transcriptomes were identified in this work, increasing our molecular knowledge of this crop. PMID:27303424

  9. Identification of Genes in a Partially Resistant Genotype of Avena sativa Expressed in Response to Puccinia coronata Infection

    PubMed Central

    Loarce, Yolanda; Navas, Elisa; Paniagua, Carlos; Fominaya, Araceli; Manjón, José L.; Ferrer, Esther

    2016-01-01

    Cultivated oat (Avena sativa), an important crop in many countries, can suffer significant losses through infection by the fungus Puccinia coronata, the causal agent of crown rust disease. Understanding the molecular basis of existing partial resistance to this disease might provide targets of interest for crop improvement programs. A suppressive subtractive hybridization (SSH) library was constructed using cDNA from the partially resistant oat genotype MN841801-1 after inoculation with the pathogen. A total of 929 genes returned a BLASTx hit and were annotated under different GO terms, including 139 genes previously described as participants in mechanisms related to the defense response and signal transduction. Among these were genes involved in pathogen recognition, cell-wall modification, oxidative burst/ROS scavenging, and abscisic acid biosynthesis, as well genes related to inducible defense responses mediated by salicylic and jasmonic acid (although none of which had been previously reported involved in strong responses). These findings support the hypothesis that basal defense mechanisms are the main systems operating in oat partial resistance to P. coronata. When the expression profiles of 20 selected genes were examined at different times following inoculation with the pathogen, the partially resistant genotype was much quicker in mounting a response than a susceptible genotype. Additionally, a number of genes not previously described in oat transcriptomes were identified in this work, increasing our molecular knowledge of this crop. PMID:27303424

  10. Identification of Genes in a Partially Resistant Genotype of Avena sativa Expressed in Response to Puccinia coronata Infection.

    PubMed

    Loarce, Yolanda; Navas, Elisa; Paniagua, Carlos; Fominaya, Araceli; Manjón, José L; Ferrer, Esther

    2016-01-01

    Cultivated oat (Avena sativa), an important crop in many countries, can suffer significant losses through infection by the fungus Puccinia coronata, the causal agent of crown rust disease. Understanding the molecular basis of existing partial resistance to this disease might provide targets of interest for crop improvement programs. A suppressive subtractive hybridization (SSH) library was constructed using cDNA from the partially resistant oat genotype MN841801-1 after inoculation with the pathogen. A total of 929 genes returned a BLASTx hit and were annotated under different GO terms, including 139 genes previously described as participants in mechanisms related to the defense response and signal transduction. Among these were genes involved in pathogen recognition, cell-wall modification, oxidative burst/ROS scavenging, and abscisic acid biosynthesis, as well genes related to inducible defense responses mediated by salicylic and jasmonic acid (although none of which had been previously reported involved in strong responses). These findings support the hypothesis that basal defense mechanisms are the main systems operating in oat partial resistance to P. coronata. When the expression profiles of 20 selected genes were examined at different times following inoculation with the pathogen, the partially resistant genotype was much quicker in mounting a response than a susceptible genotype. Additionally, a number of genes not previously described in oat transcriptomes were identified in this work, increasing our molecular knowledge of this crop.

  11. Historical introgression of the downy mildew resistance gene Rpv12 from the Asian species Vitis amurensis into grapevine varieties.

    PubMed

    Venuti, Silvia; Copetti, Dario; Foria, Serena; Falginella, Luigi; Hoffmann, Sarolta; Bellin, Diana; Cindrić, Petar; Kozma, Pál; Scalabrin, Simone; Morgante, Michele; Testolin, Raffaele; Di Gaspero, Gabriele

    2013-01-01

    The Amur grape (Vitis amurensis Rupr.) thrives naturally in cool climates of Northeast Asia. Resistance against the introduced pathogen Plasmopara viticola is common among wild ecotypes that were propagated from Manchuria into Chinese vineyards or collected by Soviet botanists in Siberia, and used for the introgression of resistance into wine grapes (Vitis vinifera L.). A QTL analysis revealed a dominant gene Rpv12 that explained 79% of the phenotypic variance for downy mildew resistance and was inherited independently of other resistance genes. A Mendelian component of resistance-a hypersensitive response in leaves challenged with P. viticola-was mapped in an interval of 0.2 cM containing an array of coiled-coil NB-LRR genes on chromosome 14. We sequenced 10-kb genic regions in the Rpv12(+) haplotype and identified polymorphisms in 12 varieties of V. vinifera using next-generation sequencing. The combination of two SNPs in single-copy genes flanking the NB-LRR cluster distinguished the resistant haplotype from all others found in 200 accessions of V. vinifera, V. amurensis, and V. amurensis x V. vinifera crosses. The Rpv12(+) haplotype is shared by 15 varieties, the most ancestral of which are the century-old 'Zarja severa' and 'Michurinets'. Before this knowledge, the chromosome segment around Rpv12(+) became introgressed, shortened, and pyramided with another downy mildew resistance gene from North American grapevines (Rpv3) only by phenotypic selection. Rpv12(+) has an additive effect with Rpv3(+) to protect vines against natural infections, and confers foliar resistance to strains that are virulent on Rpv3(+) plants.

  12. Identification and Characterization of Two Novel blaKLUC Resistance Genes through Large-Scale Resistance Plasmids Sequencing

    PubMed Central

    Yao, Xiaoding; Song, Yulong; Ma, Ping; Bao, Bokan; Jiang, Weiyan; Wu, Xinmei; Tou, Huifen; Li, Peizhen; Ren, Ping; Fei, Jingxian; Yang, Lei; Liu, Qi; Xu, Zuyuan; Zhou, Tieli; Ni, Liyan; Bao, Qiyu

    2012-01-01

    Plasmids are important antibiotic resistance determinant carriers that can disseminate various drug resistance genes among species or genera. By using a high throughput sequencing approach, two groups of plasmids of Escherichia coli (named E1 and E2, each consisting of 160 clinical E. coli strains isolated from different periods of time) were sequenced and analyzed. A total of 20 million reads were obtained and mapped onto the known resistance gene sequences. As a result, a total of 9 classes, including 36 types of antibiotic resistant genes, were identified. Among these genes, 25 and 27 single nucleotide polymorphisms (SNPs) appeared, of which 9 and 12 SNPs are nonsynonymous substitutions in the E1 and E2 samples. It is interesting to find that a novel genotype of blaKLUC, whose close relatives, blaKLUC-1 and blaKLUC-2, have been previously reported as carried on the Kluyvera cryocrescens chromosome and Enterobacter cloacae plasmid, was identified. It shares 99% and 98% amino acid identities with Kluc-1 and Kluc-2, respectively. Further PCR screening of 608 Enterobacteriaceae family isolates yielded a second variant (named blaKLUC-4). It was interesting to find that Kluc-3 showed resistance to several cephalosporins including cefotaxime, whereas blaKLUC-4 did not show any resistance to the antibiotics tested. This may be due to a positively charged residue, Arg, replaced by a neutral residue, Leu, at position 167, which is located within an omega-loop. This work represents large-scale studies on resistance gene distribution, diversification and genetic variation in pooled multi-drug resistance plasmids, and provides insight into the use of high throughput sequencing technology for microbial resistance gene detection. PMID:23056610

  13. Multi-drug resistance in Salmonella enterica: efflux mechanisms and their relationships with the development of chromosomal resistance gene clusters.

    PubMed

    Quinn, Teresa; O'Mahony, Rebecca; Baird, Alan W; Drudy, Denise; Whyte, Paul; Fanning, Séamus

    2006-07-01

    Bacterial drug resistance represents one of the most crucial problems in present day antibacterial chemotherapy. Of particular concern to public health is the continuing worldwide epidemic spread of Salmonella enterica serovar Typhimurium phage type DT104 harbouring a genomic island called Salmonella genomic island I (SGI-1). This island contains an antibiotic gene cluster conferring resistance to ampicillin, chloramphenicol, florfenicol, streptomycin, sulfonamides and tetracyclines. These resistance genes are assembled in a mosaic pattern, indicative of several independent recombinational events. The mobility of SGI-1 coupled with the ability of various antibiotic resistance genes to be integrated and lost from the chromosomal resistance locus allows for the transfer of stable antibiotic resistance to most of the commonly used antibiotics and adaptation to new antibiotic challenges. This, coupled with the incidence of increasing fluoroquinolone resistance in these strains increases the risk of therapeutic failure in cases of life-threatening salmonellosis. Fluoroquinolone resistance has largely been attributed to mutations occurring in the genes coding for intracellular targets of these drugs. However, efflux by the AcrAB-TolC multi-drug efflux pump has recently been shown to directly contribute to fluoroquinolone resistance. Furthermore, the resistance to chloramphenicol-florfenicol and tetracyclines in DT104 isolates, is due to interaction between specific transporters for these antibiotics encoded by genes mapping to the SGI-1 and the AcrAB-TolC tripartite efflux pump. The potential for the use of efflux pump inhibitors to restore therapeutic efficacy to fluoroquinolones and other antibiotics offers an exciting developmental area for drug discovery. PMID:16842216

  14. The Biopesticide Paenibacillus popilliae Has a Vancomycin Resistance Gene Cluster Homologous to the Enterococcal VanA Vancomycin Resistance Gene Cluster

    PubMed Central

    Patel, Robin; Piper, Kerryl; Cockerill, Franklin R.; Steckelberg, James M.; Yousten, Allan A.

    2000-01-01

    We have previously identified, in Paenibacillus popilliae, a 708-bp sequence which has homology to the sequence of the enterococcal vanA gene. We have performed further studies revealing five genes encoding homologues of VanY, VanZ, VanH, VanA, and VanX in P. popilliae. The predicted amino acid sequences are similar to those in VanA vancomycin-resistant enterococci: 61% identity for VanY, 21% for VanZ, 74% for VanH, 77% for VanA, and 79% for VanX. The genes in P. popilliae may have been a precursor to or have had ancestral genes in common with vancomycin resistance genes in enterococci. The use of P. popilliae biopesticidal preparations in agricultural practice may have an impact on bacterial resistance in human pathogens. PMID:10681342

  15. Low temperature induced defence gene expression in winter wheat in relation to resistance to snow moulds and other wheat diseases.

    PubMed

    Gaudet, D A; Wang, Y; Frick, M; Puchalski, B; Penniket, C; Ouellet, T; Robert, L; Singh, J; Laroche, A

    2011-01-01

    Cold hardening of winter wheat at 2 °C for 1-6 wks increased resistance to the snow mould pathogens LTB, Typhula incarnata, and Microdochium nivale as well as to powdery mildew (Blumaria graminis f. sp. graminis) and stripe rust (Puccinia striiformis). Using microarrays and hardening of winter wheat for 0.25, 0.5, 1, 7, 21 and 49 d, an upregulation of a wide range of stress-response genes that include defence-related and abiotic stress-related genes, transcription factors including several lipoxygenases and ethylene responsive factors, and WRKY genes was observed. For the majority of these genes, the upregulation occurred later in the 21-49 d hardening treatments and coincided with the highest expression levels of snow mould resistance. Defence-related sequences were upregulated to a greater extent and were more numerous in the snow mould resistant line CI14106 compared to cold hardy DH+268. Transcript profiling of candidate defence and other stress-related genes under prolonged conditions at -3 °C with or without snow mould infection showed that there was a decline in transcripts of the defence-related genes PR1.1b and NPR3 during the 12wks incubation. Additionally, 14 d hardening was insufficient to permit full expression of the jasmonic acid synthesis gene, allene oxide synthase (AOS) and the fructan degrading enzyme β-fructofuranosidase compared the 42 d hardening treatment. The snow mould resistant line CI14106 was able to maintain higher transcript levels of AOS for longer conditions compared to the susceptible line Norstar under artificial snow mould conditions. These results explain the nature of cold-induced resistance to snow moulds and provide direction on establishing selection criteria for improving resistance and cold tolerance in winter wheat.

  16. Supercoiled Minivector DNA resists shear forces associated with gene therapy delivery

    PubMed Central

    Catanese, D J; Fogg, J M; Schrock, D E; Gilbert, B E; Zechiedrich, L

    2012-01-01

    Supercoiled DNAs varying from 281 to 5302 bp were subjected to shear forces generated by aerosolization or sonication. DNA shearing strongly correlated with length. Typical sized plasmids (⩾3000 bp) degraded rapidly. DNAs 2000–3000 bp persisted ∼10 min. Even in the absence of condensing agents, supercoiled DNA <1200 bp survived nebulization, and increased forces of sonication were necessary to shear it. Circular vectors were considerably more resistant to shearing than linear vectors of the same length. DNA supercoiling afforded additional protection. These results show the potential of shear-resistant Minivector DNAs to overcome one of the major challenges associated with gene therapy delivery. PMID:21633394

  17. The midgut cadherin-like gene is not associated with resistance to Bacillus thuringiensis toxin Cry1Ac in Plutella xylostella (L.).

    PubMed

    Guo, Zhaojiang; Kang, Shi; Zhu, Xun; Wu, Qingjun; Wang, Shaoli; Xie, Wen; Zhang, Youjun

    2015-03-01

    The Gram-positive bacterium Bacillus thuringiensis (Bt) produces Cry toxins that have been used to control important agricultural pests. Evolution of resistance in target pests threatens the effectiveness of these toxins when used either in sprayed biopesticides or in Bt transgenic crops. Although alterations of the midgut cadherin-like receptor can lead to Bt Cry toxin resistance in many insects, whether the cadherin gene is involved in Cry1Ac resistance of Plutella xylostella (L.) remains unclear. Here, we present experimental evidence that resistance to Cry1Ac or Bt var. kurstaki (Btk) in P. xylostella is not due to alterations of the cadherin gene. The bona fide P. xylostella cadherin cDNA sequence was cloned and analyzed, and comparisons of the cadherin cDNA sequence among susceptible and resistant P. xylostella strains confirmed that Cry1Ac resistance was independent of mutations in this gene. In addition, real-time quantitative PCR (qPCR) indicated that cadherin transcript levels did not significantly differ among susceptible and resistant P. xylostella strains. RNA interference (RNAi)-mediated suppression of cadherin gene expression did not affect larval susceptibility to Cry1Ac toxin. Furthermore, genetic linkage assays using four cadherin gDNA allelic biomarkers confirmed that the cadherin gene is not linked to resistance against Cry1Ac in P. xylostella. Taken together, our findings demonstrate that Cry1Ac resistance of P. xylostella is independent of the cadherin gene. PMID:25595643

  18. D-subgenome bias of Xcm resistance genes in tetraploid Gossypium (cotton) suggests that polyploid formation has created novel avenues for evolution.

    PubMed

    Wright, R J; Thaxton, P M; El-Zik, K M; Paterson, A H

    1998-08-01

    A detailed RFLP map was used to determine the chromosomal locations and subgenomic distributions of cotton (Gossypium) genes/QTLs that confer resistance to the bacterial blight pathogen, Xanthomonas campestris pv. malvacearum (Xcm). Genetic mapping generally corroborated classic predictions regarding the number and dosage effects of genes conferring Xcm resistance. One recessive allele (b6) was a noteworthy exception to the genetic dominance of most plant resistance alleles. This recessive allele appeared to uncover additional QTLs from both resistant and ostensibly susceptible genotypes, some of which corresponded in location to resistance (R)-genes effective against other Xcm races. One putatively "defeated" resistance allele (B3) reduced severity of Xcm damage by "virulent" races. Among the six resistance genes derived from tetraploid cottons, five (83%) mapped to D-subgenome chromosomes-if each subgenome were equally likely to evolve new R-gene alleles, this level of bias would occur in only about 1.6% of cases. Possible explanations of this bias include biogeographic factors, differences in evolutionary rates between subgenomes, gene conversion or other intergenomic exchanges that escaped detection by genetic mapping, or other factors. A significant D-subgenome bias of Xcm resistance genes may suggest that polyploid formation has offered novel avenues for phenotypic response to selection.

  19. Transformation of LTP gene into Brassica napus to enhance its resistance to Sclerotinia sclerotiorum.

    PubMed

    Fan, Y; Du, K; Gao, Y; Kong, Y; Chu, C; Sokolov, V; Wang, Y

    2013-04-01

    Rapeseed (Brassica napus L.) is one of the most important economic crops worldwide, and Sclerotinia sclerotiorum is the most dangerous disease that affects its yield greatly. Lipid transfer protein (LTP) has broad-spectrum anti-bacterial and fungal activities. In this study, B. napus was transformed using Agrobacterium tumefaciens harboring the plasmid-containing LTP gene to study its possible capability of increasing plant's resistance. First, we optimized the petiole genetic transformation system by adjusting the days of explants, bacterial concentrations, ratio of hormones, and cultivating condition. Second, we obtained 8 positive plants by PCR analysis of T0 generation. The PCR results of T1 generation were positive, indicating that the LTP gene had been integrated into B. napus. Third, T1 transgenic plants inoculated by detached leaves with mycelia of S. sclerotiorum showed better disease resistance than non-transformants. Oxalic acid belongs to secondary metabolites of S. sclerotiorum, and several studies have demonstrated that the resistance of rapeseed to oxalic acid is significantly consistent with its resistance to S. sclerotiorum. The result from the seed germination assay showed that when T1 seeds were exposed to oxalic acid stress, their germination rate was evidently higher than that of non-transformant seeds. In addition, we measured some physiological changes in T1 plants and control plants under oxalic acid stress. The results showed that T1 transgenic plants had lower malondialdehyde (MDA) content, higher super oxide dismutase (SOD), and peroxidase (POD) activities than non-transformants, whereas disease resistance was related to low MDA content and high SOD and POD activities. PMID:23866620

  20. Benzothiadiazole, a novel class of inducers of systemic acquired resistance, activates gene expression and disease resistance in wheat.

    PubMed Central

    Görlach, J; Volrath, S; Knauf-Beiter, G; Hengy, G; Beckhove, U; Kogel, K H; Oostendorp, M; Staub, T; Ward, E; Kessmann, H; Ryals, J

    1996-01-01

    Systemic acquired resistance is an important component of the disease resistance repertoire of plants. In this study, a novel synthetic chemical, benzo(1,2,3)thiadiazole-7-carbothioic acid S-methyl ester (BTH), was shown to induce acquired resistance in wheat. BTH protected wheat systemically against powdery mildew infection by affecting multiple steps in the life cycle of the pathogen. The onset of resistance was accompanied by the induction of a number of newly described wheat chemically induced (WCI) genes, including genes encoding a lipoxygenase and a sulfur-rich protein. With respect to both timing and effectiveness, a tight correlation existed between the onset of resistance and the induction of the WCI genes. Compared with other plant activators, such as 2,6-dichloroisonicotinic acid and salicylic acid, BTH was the most potent inducer of both resistance and gene induction. BTH is being developed commercially as a novel type of plant protection compound that works by inducing the plant's inherent disease resistance mechanisms. PMID:8624439

  1. Identifying clinically relevant drug resistance genes in drug-induced resistant cancer cell lines and post-chemotherapy tissues.

    PubMed

    Tong, Mengsha; Zheng, Weicheng; Lu, Xingrong; Ao, Lu; Li, Xiangyu; Guan, Qingzhou; Cai, Hao; Li, Mengyao; Yan, Haidan; Guo, You; Chi, Pan; Guo, Zheng

    2015-12-01

    Until recently, few molecular signatures of drug resistance identified in drug-induced resistant cancer cell models can be translated into clinical practice. Here, we defined differentially expressed genes (DEGs) between pre-chemotherapy colorectal cancer (CRC) tissue samples of non-responders and responders for 5-fluorouracil and oxaliplatin-based therapy as clinically relevant drug resistance genes (CRG5-FU/L-OHP). Taking CRG5-FU/L-OHP as reference, we evaluated the clinical relevance of several types of genes derived from HCT116 CRC cells with resistance to 5-fluorouracil and oxaliplatin, respectively. The results revealed that DEGs between parental and resistant cells, when both were treated with the corresponding drug for a certain time, were significantly consistent with the CRG5-FU/L-OHP as well as the DEGs between the post-chemotherapy CRC specimens of responders and non-responders. This study suggests a novel strategy to extract clinically relevant drug resistance genes from both drug-induced resistant cell models and post-chemotherapy cancer tissue specimens.

  2. New polymorphism of the influenza virus resistance Mx1 gene in Iberian domestic pigs

    PubMed Central

    Godino, RF; Fernández, AI

    2016-01-01

    Mx1 (Myxovirus (Influenza virus) resistance 1, interferon-inducible protein p78) gene has been implicated in the resistance to a wide range of RNA viruses including influenza A in several species such as Sus scrofa. In the present study a 28-bp deletion in exon 14 of the Mx1 gene has been identified in Iberian domestic pigs but not in other domestic breeds neither in wild boars. The mutation produces a frameshift giving a protein with 6 amino acid substitutions and the extension of the C-terminal region with additional 20 amino acids with respect to the wild type MX1 protein. The new allelic polymorphism affects the antiviral domain of the MX1 protein and therefore might impact its anti-influenza virus activity. It has been demonstrated that polymorphisms in the Mx1 murine locus, affect the survival rate of mice upon experimental infection with influenza virus. It might be possible to improve the innate resistance of pigs to influenza virus infection by determining the porcine Mx1 alleles with more potent antiviral activity and genetically selecting animals bearing such alleles.

  3. Prevalence, toxin gene profiles, and antimicrobial resistance of Staphylococcus aureus isolated from quick-frozen dumplings.

    PubMed

    Hao, Dan; Xing, Xiaonan; Li, Guanghui; Wang, Xin; Zhang, Min; Zhang, Weisong; Xia, Xiaodong; Meng, Jianghong

    2015-01-01

    The aim of this study was to investigate the prevalence of Staphylococcus aureus in quick-frozen dumplings and to characterize these strains. A total of 120 dumpling samples, including lamb (n = 13), vegetarian (n = 14), seafood (n = 12), and pork (n = 81) stuffing, were collected in Shaanxi province in China and screened for S. aureus. All S. aureus isolates were characterized by antimicrobial susceptibility testing, and detection of genes encoding staphylococcal enterotoxins, exfoliative toxins A and B (eta and etb), toxic shock syndrome toxin 1 (tsst-1), and resistance to methicillin-oxacillin (mecA). In all, 60.0% of all samples were positive for S. aureus, and 117 S. aureus isolates, including seven mecA-positive strains, were recovered from these positive samples. In addition, all mecA-positive S. aureus isolates were recovered from products of animal origin. In these S. aureus isolates, resistance was observed most frequently to ampicillin (92.3%) and penicillin (86.3%), followed by clarithromycin, erythromycin, midecamycin, tetracycline, and kanahemycin (from 53.8 to 28.2%). All isolates were sensitive to cefoperazone, minocycline, vancomycin, and ofloxacin. The predominant toxin gene was sec (38.5%), followed by seg (19.7%), sej (16.2%), see (12.8%), sea (11.1%), and seb (10.3%), whereas eta, etb, and tsst-1 genes were not detected. These findings indicate that S. aureus was present commonly in quick-frozen dumplings, accompanied by multiple antimicrobial resistance and toxin genes. Our findings highlight the urgency for stricter hygiene strategies in food production and the prudent use of antibiotics in the breeding industry.

  4. Decreased susceptibility to chlorhexidine and prevalence of disinfectant resistance genes among clinical isolates of Staphylococcus epidermidis.

    PubMed

    Prag, Gustaf; Falk-Brynhildsen, Karin; Jacobsson, Susanne; Hellmark, Bengt; Unemo, Magnus; Söderquist, Bo

    2014-10-01

    Staphylococcus epidermidis is a versatile agent, being both a commensal and a nosocomial pathogen usually with an opportunistic role in association with implanted foreign body materials. Pre-operative antiseptic preparation is an important strategy for reducing the risk of complications such as surgical site infection (SSI). Currently, the most widely used antiseptics are alcohols, quaternary ammonium compounds (QACs), and the bisbiguanide chlorhexidine. Occurrence of resistance to the latter agent has drawn increasing attention. The aim of this study was to investigate if decreased susceptibility to chlorhexidine among S. epidermidis was present in our setting, a Swedish university hospital. Staphylococcus epidermidis (n = 143), retrospectively collected, were obtained from prosthetic joint infections (PJI) (n = 61), post-operative infections after cardiac surgery (n = 31), and the skin of the chest after routine disinfection prior to cardiac surgery (n = 27). In addition, 24 commensal isolates were included. Minimum inhibitory concentration (MIC) of chlorhexidine was determined on Mueller Hinton agar plates supplemented with serial dilutions of chlorhexidine. Five QAC resistance genes, qacA/B, smr, qacH, qacJ, and qacG, were detected using PCR. Decreased susceptibility to chlorhexidine was found in 54% of PJI isolates, 68% of cardiac isolates, 21% of commensal isolates, and 7% of skin isolates from cardiac patients, respectively. The qacA/B gene was present in 62/143 isolates (43%), smr in 8/143 (6%), and qacH in one isolate (0.7%). The qacA/B gene was found in 52% of PJI isolates, 61% of cardiac isolates, 25% of commensal isolates, and 19% of the skin isolates. In conclusion, decreased susceptibility to chlorhexidine, as well as QAC resistance genes, were prevalent among S. epidermidis isolates associated with deep SSIs.

  5. Risk assessment for Helicoverpa zea (Lepidoptera: Noctuidae) resistance on dual-gene versus single-gene corn.

    PubMed

    Edwards, Kristine T; Caprio, Michael A; Allen, K Clint; Musser, Fred R

    2013-02-01

    Recent Environmental Protection Agency (EPA) decisions regarding resistance management in Bt-cropping systems have prompted concern in some experts that dual-gene Bt-corn (CrylA.105 and Cry2Ab2 toxins) may result in more rapid selection for resistance in Helicoverpa zea (Boddie) than single-gene Bacillus thuringiensis (Bt)-corn (CrylAb toxin). The concern is that Bt-toxin longevity could be significantly reduced with recent adoption of a natural refuge for dual-gene Bt-cotton (CrylAc and Cry2Ab2 toxins) and concurrent reduction in dual-gene corn refuge from 50 to 20%. A population genetics framework that simulates complex landscapes was applied to risk assessment. Expert opinions on effectiveness of several transgenic corn and cotton varieties were captured and used to assign probabilities to different scenarios in the assessment. At least 350 replicate simulations with randomly drawn parameters were completed for each of four risk assessments. Resistance evolved within 30 yr in 22.5% of simulations with single-gene corn and cotton with no volunteer corn. When volunteer corn was added to this assessment, risk of resistance evolving within 30 yr declined to 13.8%. When dual-gene Bt-cotton planted with a natural refuge and single-gene corn planted with a 50% structured refuge was simulated, simultaneous resistance to both toxins never occurred within 30 yr, but in 38.5% of simulations, resistance evolved to toxin present in single-gene Bt-corn (CrylAb). When both corn and cotton were simulated as dual-gene products, cotton with a natural refuge and corn with a 20% refuge, 3% of simulations evolved resistance to both toxins simultaneously within 30 yr, while 10.4% of simulations evolved resistance to CrylAb/c toxin.

  6. Molecular characterization of the CRa gene conferring clubroot resistance in Brassica rapa.

    PubMed

    Ueno, Hiroki; Matsumoto, Etsuo; Aruga, Daisuke; Kitagawa, Satoshi; Matsumura, Hideo; Hayashida, Nobuaki

    2012-12-01

    Clubroot disease is one of the major diseases affecting Brassicaceae crops, and a number of these crops grown commercially, such as Chinese cabbage (Brassica rapa L. ssp. pekinensis), are known to be highly susceptible to clubroot disease. To provide protection from this disease, plant breeders have introduced genes for resistance to clubroot from the European turnip into susceptible lines. The CRa gene confers specific resistance to the clubroot pathogen Plasmodiophora brassicae isolate M85. Fine mapping of the CRa locus using synteny to the Arabidopsis thaliana genome and partial genome sequences of B. rapa revealed a candidate gene encoding a TIR-NBS-LRR protein. Several structural differences in this candidate gene were found between susceptible and resistant lines, and CRa expression was observed only in the resistant line. Four mutant lines lacking clubroot resistance were obtained by the UV irradiation of pollen from a resistant line, and all of these mutant lines carried independent mutations in the candidate TIR-NBS-LRR gene. This genetic and molecular evidence strongly suggests that the identified gene is CRa. This is the first report on the molecular characterization of a clubroot Resistance gene in Brassicaceae and of the disease resistance gene in B. rapa.

  7. Identification and mapping of nucleotide binding site-leucine rich repeat resistance gene analogs in bermudagrass

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Thirty-one bermudagrass (Cynodon spp.) disease resistance gene homologs (BRGH) were cloned and sequenced from diploid, triploid, and hexaploid bermudagrass using degenerate primers to target the nucleotide binding site (NBS) of the NBS- leucine rich repeat (LRR) resistance gene family. Alignment of ...

  8. Isolation of an Yr5 candidate gene for resistance to wheat stripe rust

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The Yr5 gene from the Triticum spelta album wheat confers resistance to all races of the wheat stripe rust pathogen (Puccinia striiformis f. sp. tritici) identified so far in the US. To cloneYr5, a sequence tagged site (STS) marker developed from resistance gene analog polymorphism (RGAP) markers co...

  9. Identification of disease resistance genes for enhancement of existing potato cultivars

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A plant’s ability to defend itself against host-specific microbes is specified by disease resistance (R) genes. Upon recognition of an invading pathogen, R proteins are responsible for the activation of a multitude of responses ultimately leading to resistance. The majority of R genes are dominant a...

  10. Identification and Analyses of Candidate Genes for Rpp4-Mediated Resistance to Asian Soybean Rust in Soybean1[W][OA

    PubMed Central

    Meyer, Jenelle D.F.; Silva, Danielle C.G.; Yang, Chunling; Pedley, Kerry F.; Zhang, Chunquan; van de Mortel, Martijn; Hill, John H.; Shoemaker, Randy C.; Abdelnoor, Ricardo V.; Whitham, Steven A.; Graham, Michelle A.

    2009-01-01

    Asian soybean rust is a formidable threat to soybean (Glycine max) production in many areas of the world, including the United States. Only five sources of resistance have been identified (Resistance to Phakopsora pachyrhizi1 [Rpp1], Rpp2, Rpp3, Rpp4, and Rpp5). Rpp4 was previously identified in the resistant genotype PI459025B and mapped within 2 centimorgans of Satt288 on soybean chromosome 18 (linkage group G). Using simple sequence repeat markers, we developed a bacterial artificial chromosome contig for the Rpp4 locus in the susceptible cv Williams82 (Wm82). Sequencing within this region identified three Rpp4 candidate disease resistance genes (Rpp4C1–Rpp4C3 [Wm82]) with greatest similarity to the lettuce (Lactuca sativa) RGC2 family of coiled coil-nucleotide binding site-leucine rich repeat disease resistance genes. Constructs containing regions of the Wm82 Rpp4 candidate genes were used for virus-induced gene silencing experiments to silence resistance in PI459025B, confirming that orthologous genes confer resistance. Using primers developed from conserved sequences in the Wm82 Rpp4 candidate genes, we identified five Rpp4 candidate genes (Rpp4C1–Rpp4C5 [PI459025B]) from the resistant genotype. Additional markers developed from the Wm82 Rpp4 bacterial artificial chromosome contig further defined the region containing Rpp4 and eliminated Rpp4C1 (PI459025B) and Rpp4C3 (PI459025B) as candidate genes. Sequencing of reverse transcription-polymerase chain reaction products revealed that Rpp4C4 (PI459025B) was highly expressed in the resistant genotype, while expression of the other candidate genes was nearly undetectable. These data support Rpp4C4 (PI459025B) as the single candidate gene for Rpp4-mediated resistance to Asian soybean rust. PMID:19251904

  11. Down-regulation of Fusarium oxysporum endogenous genes by Host-Delivered RNA interference enhances disease resistance

    NASA Astrophysics Data System (ADS)

    Hu, Zongli; Parekh, Urvi; Maruta, Natsumi; Trusov, Yuri; Botella, Jimmy

    2015-01-01

    Fusarium oxysporum is a devastating pathogen causing extensive yield losses in a variety of crops and development of sustainable, environmentally friendly methods to improve crop resistance is crucial. We have used Host-Derived RNA interference (HD-RNAi) technology to partially silence three different genes (FOW2, FRP1 and OPR) in the hemi-biotrophic fungus Fusarium oxysporum f. sp. conglutinans. Expression of double stranded RNA molecules targeting fungal pathogen genes was achieved in a number of transgenic Arabidopsis lines. F. oxysporum infecting the transgenic lines displayed substantially reduced mRNA levels on all three targeted genes, with an average of 75%, 83% and 72% reduction for FOW2, FRP1 and OPR respectively. The silencing of pathogen genes had a clear positive effect on the ability of the transgenic lines to fight infection. All transgenic lines displayed enhanced resistance to F. oxysporum with delayed disease symptom development, especially FRP1 and OPR lines. Survival rates after fungal infection were higher in the transgenic lines compared to control wild type plants which consistently showed survival rates of 10%, with FOW2 lines showing 25% survival; FRP1 lines 30-50% survival and FOW2 between 45-70% survival. The down-regulation effect was specific for the targeted genes without unintended effects in related genes. In addition to producing resistant crops, HD-RNAi can provide a useful tool to rapidly screen candidate fungal pathogenicity genes without the need to produce fungal knockout mutants.

  12. Down-regulation of Fusarium oxysporum endogenous genes by Host-Delivered RNA interference enhances disease resistance

    PubMed Central

    Hu, Zongli; Parekh, Urvi; Maruta, Natsumi; Trusov, Yuri; Botella, Jose R.

    2015-01-01

    Fusarium oxysporum is a devastating pathogen causing extensive yield losses in a variety of crops and development of sustainable, environmentally friendly methods to improve crop resistance is crucial. We have used Host-Delivered RNA interference (HD-RNAi) technology to partially silence three different genes (FOW2, FRP1, and OPR) in the hemi-biotrophic fungus F. oxysporum f. sp. conglutinans. Expression of double stranded RNA (dsRNA) molecules targeting fungal pathogen genes was achieved in a number of transgenic Arabidopsis lines. F. oxysporum infecting the transgenic lines displayed substantially reduced mRNA levels on all three targeted genes, with an average of 75, 83, and 72% reduction for FOW2, FRP1, and OPR, respectively. The silencing of pathogen genes had a clear positive effect on the ability of the transgenic lines to fight infection. All transgenic lines displayed enhanced resistance to F. oxysporum with delayed disease symptom development, especially FRP1 and OPR lines. Survival rates after fungal infection were higher in the transgenic lines compared to control wild type plants which consistently showed survival rates of 10%, with FOW2 lines showing 25% survival; FRP1 lines 30–50% survival and OPR between 45 and 70% survival. The down-regulation effect was specific for the targeted genes without unintended effects in related genes. In addition to producing resistant crops, HD-RNAi can provide a useful tool to rapidly screen candidate fungal pathogenicity genes without the need to produce fungal knockout mutants. PMID:25654075

  13. High-Throughput Screening of Tyrosine Kinase Inhibitor Resistant Genes in CML.

    PubMed

    Ma, Leyuan; Roderick, Justine; Kelliher, Michelle A; Green, Michael R

    2016-01-01

    Genome-wide RNA interference (RNAi) screening in mammalian cells has proven to be a powerful tool for identifying new genes and molecular pathways relevant to many cellular processes and diseases. For example, screening for genes that, when inactivated, lead to resistance to cancer therapeutic drugs can reveal new mechanisms for how resistance develops and identify potential targetable strategies to overcome drug resistance. Here, we describe a detailed procedure for performing a high-throughput RNAi screen using a genome-wide human short hairpin RNA (shRNA) library for identifying tyrosine kinase inhibitor (TKI)-resistance genes in a human CML cell line model. PMID:27581147

  14. Impact of Manure Fertilization on the Abundance of Antibiotic-Resistant Bacteria and Frequency of Detection of Antibiotic Resistance Genes in Soil and on Vegetables at Harvest

    PubMed Central

    Marti, Romain; Scott, Andrew; Tien, Yuan-Ching; Murray, Roger; Sabourin, Lyne; Zhang, Yun

    2013-01-01

    Consumption of vegetables represents a route of direct human exposure to bacteria found in soil. The present study evaluated the complement of bacteria resistant to various antibiotics on vegetables often eaten raw (tomato, cucumber, pepper, carrot, radish, lettuce) and how this might vary with growth in soil fertilized inorganically or with dairy or swine manure. Vegetables were sown into field plots immediately following fertilization and harvested when of marketable quality. Vegetable and soil samples were evaluated for viable antibiotic-resistant bacteria by plate count on Chromocult medium supplemented with antibiotics at clinical breakpoint concentrations. DNA was extracted from soil and vegetables and evaluated by PCR for the presence of 46 gene targets associated with plasmid incompatibility groups, integrons, or antibiotic resistance genes. Soil receiving manure was enriched in antibiotic-resistant bacteria and various antibiotic resistance determinants. There was no coherent corresponding increase in the abundance of antibiotic-resistant bacteria enumerated from any vegetable grown in manure-fertilized soil. Numerous antibiotic resistance determinants were detected in DNA extracted from vegetables grown in unmanured soil. A smaller number of determinants were additionally detected on vegetables grown only in manured and not in unmanured soil. Overall, consumption of raw vegetables represents a route of human exposure to antibiotic-resistant bacteria and resistance determinants naturally present in soil. However, the detection of some determinants on vegetables grown only in freshly manured soil reinforces the advisability of pretreating manure through composting or other stabilization processes or mandating offset times between manuring and harvesting vegetables for human consumption. PMID:23851089

  15. Impact of manure fertilization on the abundance of antibiotic-resistant bacteria and frequency of detection of antibiotic resistance genes in soil and on vegetables at harvest.

    PubMed

    Marti, Romain; Scott, Andrew; Tien, Yuan-Ching; Murray, Roger; Sabourin, Lyne; Zhang, Yun; Topp, Edward

    2013-09-01

    Consumption of vegetables represents a route of direct human exposure to bacteria found in soil. The present study evaluated the complement of bacteria resistant to various antibiotics on vegetables often eaten raw (tomato, cucumber, pepper, carrot, radish, lettuce) and how this might vary with growth in soil fertilized inorganically or with dairy or swine manure. Vegetables were sown into field plots immediately following fertilization and harvested when of marketable quality. Vegetable and soil samples were evaluated for viable antibiotic-resistant bacteria by plate count on Chromocult medium supplemented with antibiotics at clinical breakpoint concentrations. DNA was extracted from soil and vegetables and evaluated by PCR for the presence of 46 gene targets associated with plasmid incompatibility groups, integrons, or antibiotic resistance genes. Soil receiving manure was enriched in antibiotic-resistant bacteria and various antibiotic resistance determinants. There was no coherent corresponding increase in the abundance of antibiotic-resistant bacteria enumerated from any vegetable grown in manure-fertilized soil. Numerous antibiotic resistance determinants were detected in DNA extracted from vegetables grown in unmanured soil. A smaller number of determinants were additionally detected on vegetables grown only in manured and not in unmanured soil. Overall, consumption of raw vegetables represents a route of human exposure to antibiotic-resistant bacteria and resistance determinants naturally present in soil. However, the detection of some determinants on vegetables grown only in freshly manured soil reinforces the advisability of pretreating manure through composting or other stabilization processes or mandating offset times between manuring and harvesting vegetables for human consumption.

  16. Identification and mapping of resistance gene analogs and a white rust resistance locus in Brassica rapa ssp. oleifera.

    PubMed

    Tanhuanpää, P

    2004-04-01

    The objective of this investigation was to tag a locus for white rust resistance in a Brassica rapa ssp. oleifera F(2) population segregating for this trait, using bulked segregant analysis with random amplified polymorphic DNA (RAPD) markers, linkage mapping and a candidate gene approach based on resistance gene analogs (RGAs). The resistance source was the Finnish line Bor4109. The reaction against white rust races 7a and 7v was scored in 20 seedlings from each self-pollinated F(2 )individual. The proportion of resistant plants among these F(3) families varied from 0 to 67%. Bulked segregant analysis did not reveal any markers linked with resistance and, therefore, a linkage map with 81 markers was created. A locus that accounted for 18.4% of the variation in resistance to white rust was mapped to linkage group (LG) 2 near the RAPD marker Z19a. During the study, a bacterial resistance gene homologous to Arabidopsis RPS2 and six different RGAs were sequenced. RPS2 and five of the RGAs were mapped to linkage groups LG1, LG4 and LG9. Unfortunately, none of the RGAs could be shown to be associated with white rust resistance.

  17. Reduced Fitness of Virulent Aphis glycines (Hemiptera: Aphididae) Biotypes May Influence the Longevity of Resistance Genes in Soybean

    PubMed Central

    Varenhorst, Adam J.; McCarville, Michael T.; O’Neal, Matthew E.

    2015-01-01

    Sustainable use of insect resistance in crops require insect resistance management plans that may include a refuge to limit the spread of virulence to this resistance. However, without a loss of fitness associated with virulence, a refuge may not prevent virulence from becoming fixed within a population of parthenogenetically reproducing insects like aphids. Aphid-resistance in soybeans (i.e., Rag genes) prevent outbreaks of soybean aphid (Aphis glycines), yet four biotypes defined by their capacity to survive on aphid-resistant soybeans (e.g., biotype-2 survives on Rag1 soybean) are found in North America. Although fitness costs are reported for biotype-3 on aphid susceptible and Rag1 soybean, it is not clear if virulence to aphid resistance in general is associated with a decrease in fitness on aphid susceptible soybeans. In laboratory assays, we measured fitness costs for biotype 2, 3 and 4 on an aphid-susceptible soybean cultivar. In addition, we also observed negative cross-resistance for biotype-2 on Rag3, and biotype-3 on Rag1 soybean. We utilized a simple deterministic, single-locus, four compartment genetic model to account for the impact of these findings on the frequency of virulence alleles. When a refuge of aphid susceptible was included within this model, fitness costs and negative cross-resistance delayed the increase of virulence alleles when virulence was inherited recessively or additively. If virulence were inherited additively, fitness costs decreased the frequency of virulence. Combined, these results suggest that a refuge may prevent virulent A. glycines biotypes from overcoming Rag genes if this aphid-resistance were used commercially in North America. PMID:26372106

  18. Detection of sulfonamide resistance genes via in situ PCR-FISH.

    PubMed

    Gnida, Anna; Kunda, Katarzyna; Ziembińska, Aleksandra; Luczkiewicz, Aneta; Felis, Ewa; Surmacz-Górska, Joanna

    2014-01-01

    Due to the rising use of antibiotics and as a consequence of their concentration in the environment an increasing number of antibiotic resistant bacteria is observed. The phenomenon has a hazardous impact on human and animal life. Sulfamethoxazole is one of the sulfonamides commonly detected in surface waters and soil. The aim of the study was to detect sulfamethoxazole resistance genes in activated sludge biocenosis by use of in situ PCR and/or hybridization. So far no FISH probes for the detection of SMX resistance genes have been described in the literature. We have tested common PCR primers used for SMX resistance genes detection as FISH probes as well as a combination of in situ PCR and FISH. Despite the presence of SMX resistance genes in activated sludge confirmed via traditional PCR, the detection of the genes via microscopic visualization failed. PMID:25115110

  19. Multiple Mutations on the Second Acetylcholinesterase Gene Associated With Dimethoate Resistance in the Melon Aphid, Aphis gossypii (Hemiptera: Aphididae).

    PubMed

    Lokeshwari, D; Krishna Kumar, N K; Manjunatha, H

    2016-04-01

    The melon aphid, Aphis gossypii Glover (Hemiptera: Aphididae), is an important cosmopolitan and extremely polyphagous species capable of causing direct and indirect damage to various crops. Insecticide resistance in melon aphids is of particular concern. To determine the basis of resistance, organophosphate (OP)-resistant strains of A. gossypii were obtained by continuous selection with dimethoate in the laboratory, and resistance mechanisms were investigated along with susceptible strains. Three resistant strains LKR-1, LKR-2, and LKR-3 exhibiting 270-, 243-, and 210-fold resistance obtained after 30 generations of selection with dimethoate, respectively, were utilized in this study. The role of acetylcholinesterase (AChE), a target enzyme for OPs and carbamates (CMs), was investigated. AChE enzyme assay revealed that there was no significant change in the activities of AChE in resistant and susceptible strains. However, AChE inhibitory assay showed that 50% of the enzyme activity in resistant strains was inhibited at significantly higher concentration of dimethoate (131.87, 158.65, and 99.29 µmolL(−1)) as compared with susceptible strains (1.75 and 2.01 µmolL(−1)), indicating AChE insensitivity owing to altered AChE. Molecular diagnostic tool polymerase chain reaction-restriction fragment length polymorphism revealed the existence of two consistent non-synonymous point mutations, single-nucleotide polymorphism, viz., A302S (equivalent to A201 in Torpedo californica Ayres) and S431F (equivalent to F331 in T. californica), in the AChE gene Ace2 of resistant strains. Further, cloning and sequencing of a partial fragment of Ace2 (897 bp) gene from susceptible and resistant strains revealed an additional novel mutation G221A in resistant strains, LKR-1 and LKR-2. Susceptible Ace2 genes shared 99.6 and 98.9% identity at the nucleic acid and amino acid levels with resistant ones, respectively. Functional analysis of these point mutations was assessed by in

  20. Microbial ecology, bacterial pathogens, and antibiotic resistant genes in swine manure wastewater as influenced by three swine management systems.

    PubMed

    Brooks, John P; Adeli, Ardeshir; McLaughlin, Michael R

    2014-06-15

    The environmental influence of farm management in concentrated animal feeding operations (CAFO) can yield vast changes to the microbial biota and ecological structure of both the pig and waste manure lagoon wastewater. While some of these changes may not be negative, it is possible that CAFOs can enrich antibiotic resistant bacteria or pathogens based on farm type, thereby influencing the impact imparted by the land application of its respective wastewater. The purpose of this study was to measure the microbial constituents of swine-sow, -nursery, and -finisher farm manure lagoon wastewater and determine the changes induced by farm management. A total of 37 farms were visited in the Mid-South USA and analyzed for the genes 16S rRNA, spaQ (Salmonella spp.), Camp-16S (Campylobacter spp.), tetA, tetB, ermF, ermA, mecA, and intI using quantitative PCR. Additionally, 16S rRNA sequence libraries were created. Overall, it appeared that finisher farms were significantly different from nursery and sow farms in nearly all genes measured and in 16S rRNA clone libraries. Nearly all antibiotic resistance genes were detected in all farms. Interestingly, the mecA resistance gene (e.g. methicillin resistant Staphylococcus aureus) was below detection limits on most farms, and decreased as the pigs aged. Finisher farms generally had fewer antibiotic resistance genes, which corroborated previous phenotypic data; additionally, finisher farms produced a less diverse 16S rRNA sequence library. Comparisons of Camp-16S and spaQ GU (genomic unit) values to previous culture data demonstrated ratios from 10 to 10,000:1 depending on farm type, indicating viable but not cultivatable bacteria were dominant. The current study indicated that swine farm management schemes positively and negatively affect microbial and antibiotic resistant populations in CAFO wastewater which has future "downstream" implications from both an environmental and public health perspective.

  1. Microbial ecology, bacterial pathogens, and antibiotic resistant genes in swine manure wastewater as influenced by three swine management systems.

    PubMed

    Brooks, John P; Adeli, Ardeshir; McLaughlin, Michael R

    2014-06-15

    The environmental influence of farm management in concentrated animal feeding operations (CAFO) can yield vast changes to the microbial biota and ecological structure of both the pig and waste manure lagoon wastewater. While some of these changes may not be negative, it is possible that CAFOs can enrich antibiotic resistant bacteria or pathogens based on farm type, thereby influencing the impact imparted by the land application of its respective wastewater. The purpose of this study was to measure the microbial constituents of swine-sow, -nursery, and -finisher farm manure lagoon wastewater and determine the changes induced by farm management. A total of 37 farms were visited in the Mid-South USA and analyzed for the genes 16S rRNA, spaQ (Salmonella spp.), Camp-16S (Campylobacter spp.), tetA, tetB, ermF, ermA, mecA, and intI using quantitative PCR. Additionally, 16S rRNA sequence libraries were created. Overall, it appeared that finisher farms were significantly different from nursery and sow farms in nearly all genes measured and in 16S rRNA clone libraries. Nearly all antibiotic resistance genes were detected in all farms. Interestingly, the mecA resistance gene (e.g. methicillin resistant Staphylococcus aureus) was below detection limits on most farms, and decreased as the pigs aged. Finisher farms generally had fewer antibiotic resistance genes, which corroborated previous phenotypic data; additionally, finisher farms produced a less diverse 16S rRNA sequence library. Comparisons of Camp-16S and spaQ GU (genomic unit) values to previous culture data demonstrated ratios from 10 to 10,000:1 depending on farm type, indicating viable but not cultivatable bacteria were dominant. The current study indicated that swine farm management schemes positively and negatively affect microbial and antibiotic resistant populations in CAFO wastewater which has future "downstream" implications from both an environmental and public health perspective. PMID:24704907

  2. Antibiotic resistance genes detected in the marine sponge Petromica citrina from Brazilian coast.

    PubMed

    Laport, Marinella Silva; Pontes, Paula Veronesi Marinho; Dos Santos, Daniela Silva; Santos-Gandelman, Juliana de Fátima; Muricy, Guilherme; Bauwens, Mathieu; Giambiagi-deMarval, Marcia; George, Isabelle

    2016-01-01

    Although antibiotic-resistant pathogens pose a significant threat to human health, the environmental reservoirs of the resistance determinants are still poorly understood. This study reports the detection of resistance genes (ermB, mecA, mupA, qnrA, qnrB and tetL) to antibiotics among certain culturable and unculturable bacteria associated with the marine sponge Petromica citrina. The antimicrobial activities elicited by P. citrina and its associated bacteria are also described. The results indicate that the marine environment could play an important role in the development of antibiotic resistance and the dissemination of resistance genes among bacteria. PMID:27287338

  3. Induced mutations in the starch branching enzyme II (SBEII) genes increase amylose and resistant starch content in durum wheat

    PubMed Central

    Hazard, Brittany; Zhang, Xiaoqin; Colasuonno, Pasqualina; Uauy, Cristobal; Beckles, Diane M.; Dubcovsky, Jorge

    2016-01-01

    Starch is the largest component of the wheat (Triticum aestivum L.) grain and consists of approximately 70-80% amylopectin and 20-30% amylose. Amylopectin is a highly-branched, readily digested polysaccharide, whereas amylose has few branches and forms complexes that resist digestion and mimic dietary fiber (resistant starch). Down-regulation of the starch branching enzyme II (SBEII) gene by RNA interference (RNAi) was previously shown to increase amylose content in both hexaploid and tetraploid wheat. We generated ethyl methane sulphonate (EMS) mutants for the SBEIIa-A and SBEIIa-B homoeologs in the tetraploid durum wheat variety Kronos (T. turgidum ssp. durum L.). Single-gene mutants showed non-significant increases in amylose and resistant starch content, but a double mutant combining a SBEIIa-A knock-out mutation with a SBEIIa-B splice-site mutation showed a 22% increase in amylose content (P<0.0001) and a 115% increase in resistant starch content (P<0.0001). In addition, we obtained mutants for the A and B genome copies of the paralogous SBEIIb gene, mapped them 1-2 cM from SBEIIa, and generated double SBEIIa-SBEIIb mutants to study the effect of the SBEIIb gene in the absence of SBEIIa. These mutants are available to those interested in increasing amylose content and resistant starch in durum wheat. PMID:26924849

  4. Potential impacts of disinfection processes on elimination and deactivation of antibiotic resistance genes during water and wastewater treatment.

    PubMed

    Dodd, Michael C

    2012-07-01

    Antibiotic resistance genes (ARGs), in association with antibiotic resistant bacteria (ARB), have been identified as widespread contaminants of treated drinking waters and wastewaters. As a consequence, concerns have been raised that ARB or ARG transport between aquatic compartments may enhance the spread of antibiotic resistance amongst non-resistant bacterial communities by means of horizontal gene transfer processes. Most often, discussion of horizontal gene transfer focuses on the probable role of conjugative plasmid or transposon exchange, which requires live ARB donor cells. Conventional water and wastewater disinfection processes generally provide highly effective means for mitigating the transport of live ARB; thereby minimizing risks of conjugative gene transfer. However, even if ARB present in a treated water are fully inactivated during a disinfection process, the possibility remains that intact remnants of DNA contained within the resulting cell debris could still confer resistance genotypes to downstream bacterial populations by means of natural transformation and/or transduction, which do not require live donor cells. Thus, a systematic evaluation of the capability of common disinfection technologies to ensure the destruction of bacterial DNA, in addition to pathogen inactivation, seems warranted. With that objective in mind, this review seeks to provide a concise introduction to the significance of ARB and ARG occurrence in environmental systems, coupled with a review of the role that commonly used water and wastewater disinfection processes may play in minimizing ARG transport and dissemination.

  5. Presence of antibiotic resistance genes in a sewage treatment plant in Thibodaux, Louisiana, USA.

    PubMed

    Naquin, Anthony; Shrestha, Arsen; Sherpa, Mingma; Nathaniel, Rajkumar; Boopathy, Raj

    2015-01-01

    Increasing uses and disposals of antibiotics to the environment have increased emergence of various antibiotic resistance. One of the sources for the spread of antibiotic resistance is wastewater treatment plant, where bacteria and antibiotics can come in contact and can acquire antibiotics resistance. There are very few studies on this subject from a small town sewage treatment plant. Therefore, this study was conducted using raw sewage as well as treated sewage from a sewage treatment plant in Thibodaux in rural southeast Louisiana in USA. Samples were collected monthly from the Thibodaux sewage treatment plant and the presence of antibiotic resistance genes was monitored. The study showed the presence of antibiotic resistance genes in both raw and treated sewage in every month of the study period. The genetic transformation assay showed the successful transformation of methicillin resistant gene, mecA to an antibiotic sensitive Staphylococcus aureus, which became antibiotic resistant within 24h. PMID:25662190

  6. Presence of antibiotic resistance genes in a sewage treatment plant in Thibodaux, Louisiana, USA.

    PubMed

    Naquin, Anthony; Shrestha, Arsen; Sherpa, Mingma; Nathaniel, Rajkumar; Boopathy, Raj

    2015-01-01

    Increasing uses and disposals of antibiotics to the environment have increased emergence of various antibiotic resistance. One of the sources for the spread of antibiotic resistance is wastewater treatment plant, where bacteria and antibiotics can come in contact and can acquire antibiotics resistance. There are very few studies on this subject from a small town sewage treatment plant. Therefore, this study was conducted using raw sewage as well as treated sewage from a sewage treatment plant in Thibodaux in rural southeast Louisiana in USA. Samples were collected monthly from the Thibodaux sewage treatment plant and the presence of antibiotic resistance genes was monitored. The study showed the presence of antibiotic resistance genes in both raw and treated sewage in every month of the study period. The genetic transformation assay showed the successful transformation of methicillin resistant gene, mecA to an antibiotic sensitive Staphylococcus aureus, which became antibiotic resistant within 24h.

  7. Isolation and characterization of NBS-LRR- resistance gene candidates in turmeric (Curcuma longa cv. surama).

    PubMed

    Joshi, R K; Mohanty, S; Subudhi, E; Nayak, S

    2010-09-08

    Turmeric (Curcuma longa), an important asexually reproducing spice crop of the family Zingiberaceae is highly susceptible to bacterial and fungal pathogens. The identification of resistance gene analogs holds great promise for development of resistant turmeric cultivars. Degenerate primers designed based on known resistance genes (R-genes) were used in combinations to elucidate resistance gene analogs from Curcuma longa cultivar surama. The three primers resulted in amplicons with expected sizes of 450-600 bp. The nucleotide sequence of these amplicons was obtained through sequencing; their predicted amino acid sequences compared to each other and to the amino acid sequences of known R-genes revealed significant sequence similarity. The finding of conserved domains, viz., kinase-1a, kinase-2 and hydrophobic motif, provided evidence that the sequences belong to the NBS-LRR class gene family. The presence of tryptophan as the last residue of kinase-2 motif further qualified them to be in the non-TIR-NBS-LRR subfamily of resistance genes. A cluster analysis based on the neighbor-joining method was carried out using Curcuma NBS analogs together with several resistance gene analogs and known R-genes, which classified them into two distinct subclasses, corresponding to clades N3 and N4 of non-TIR-NBS sequences described in plants. The NBS analogs that we isolated can be used as guidelines to eventually isolate numerous R-genes in turmeric.

  8. Improved Acetic Acid Resistance in Saccharomyces cerevisiae by Overexpression of the WHI2 Gene Identified through Inverse Metabolic Engineering.

    PubMed

    Chen, Yingying; Stabryla, Lisa; Wei, Na

    2016-01-29

    Development of acetic acid-resistant Saccharomyces cerevisiae is important for economically viable production of biofuels from lignocellulosic biomass, but the goal remains a critical challenge due to limited information on effective genetic perturbation targets for improving acetic acid resistance in the yeast. This study employed a genomic-library-based inverse metabolic engineering approach to successfully identify a novel gene target, WHI2 (encoding a cytoplasmatic globular scaffold protein), which elicited improved acetic acid resistance in S. cerevisiae. Overexpression of WHI2 significantly improved glucose and/or xylose fermentation under acetic acid stress in engineered yeast. The WHI2-overexpressing strain had 5-times-higher specific ethanol productivity than the control in glucose fermentation with acetic acid. Analysis of the expression of WHI2 gene products (including protein and transcript) determined that acetic acid induced endogenous expression of Whi2 in S. cerevisiae. Meanwhile, the whi2Δ mutant strain had substantially higher susceptibility to acetic acid than the wild type, suggesting the important role of Whi2 in the acetic acid response in S. cerevisiae. Additionally, overexpression of WHI2 and of a cognate phosphatase gene, PSR1, had a synergistic effect in improving acetic acid resistance, suggesting that Whi2 might function in combination with Psr1 to elicit the acetic acid resistance mechanism. These results improve our understanding of the yeast response to acetic acid stress and provide a new strategy to breed acetic acid-resistant yeast strains for renewable biofuel production.

  9. Association of gene polymorphism of the fat-mass and obesity-associated gene with insulin resistance in Japanese.

    PubMed

    Shimaoka, Izumi; Kamide, Kei; Ohishi, Mitsuru; Katsuya, Tomohiro; Akasaka, Hiroshi; Saitoh, Shigeyuki; Sugimoto, Ken; Oguro, Ryousuke; Congrains, Ada; Fujisawa, Tomomi; Shimamoto, Kazuaki; Ogihara, Toshio; Rakugi, Hiromi

    2010-03-01

    It was reported that gene polymorphisms in the fat-mass and obesity-associated gene (FTO) were associated with obesity and diabetes in several genome-wide association studies. A recent report indicated that FTO-knockout mice exhibited phenotypes of skinny body shape and normal metabolic profiles. Thus, FTO could be important in metabolic disorders. The aim of this study was to clarify the role of single nucleotide polymorphisms (SNPs) in FTO in metabolic disorders such as hypertension, obesity, diabetes, dyslipidemia, insulin resistance and metabolic syndrome in the Japanese general population using data from a cohort study in Hokkaido, namely the Tanno-Sobetsu study. Written informed consent for the genetic analysis was obtained from each subject participating in the study. A total of 1514 subjects were genotyped by TaqMan PCR methods for three SNPs, rs9939609, rs1121980 and rs1558902, in FTO. Association analyses between the SNPs and metabolic parameters were performed. Although two SNPs, rs9939609 and rs1558902, were not significantly associated with hypertension, obesity, metabolic syndrome or any metabolic parameters, additive and recessive models of rs1121980 were strongly associated with plasma immunoreactive insulin (IRI) level and homeostasis model assessment insulin resistance (HOMA-IR), even after adjusting for confounding factors such as age, gender and body mass index. A haplotype of three SNPs was also significantly associated with IRI and HOMA-IR. One SNP, rs1121980, and a haplotype of three SNPs in FTO that contains this SNP, might be important in the progression of insulin resistance in Japanese subjects.

  10. Plasmid metagenomics reveals multiple antibiotic resistance gene classes among the gut microbiomes of hospitalised patients.

    PubMed

    Jitwasinkul, Tossawan; Suriyaphol, Prapat; Tangphatsornruang, Sithichoke; Hansen, Martin Asser; Hansen, Lars Hestbjerg; Sørensen, Søren Johannes; Permpikul, Chairat; Rongrungruang, Yong; Tribuddharat, Chanwit

    2016-09-01

    Antibiotic resistance genes are rapidly spread between pathogens and the normal flora, with plasmids playing an important role in their circulation. This study aimed to investigate antibiotic resistance plasmids in the gut microbiome of hospitalised patients. Stool samples were collected from seven inpatients at Siriraj Hospital (Bangkok, Thailand) and were compared with a sample from a healthy volunteer. Plasmids from the gut microbiomes extracted from the stool samples were subjected to high-throughput DNA sequencing (GS Junior). Newbler-assembled DNA reads were categorised into known and unknown sequences (using >80% alignment length as the cut-off), and ResFinder was used to classify the antibiotic resistance gene pools. Plasmid replicon modules were used for plasmid typing. Forty-six genes conferring resistance to several classes of antibiotics were identified in the stool samples. Several antibiotic resistance genes were shared by the patients; interestingly, most were reported previously in food animals and healthy humans. Four antibiotic resistance genes were found in the healthy subject. One gene (aph3-III) was identified in the patients and the healthy subject and was related to that in cattle. Uncommon genes of hospital origin such as blaTEM-124-like and fosA, which confer resistance to extended-spectrum β-lactams and fosfomycin, respectively, were identified. The resistance genes did not match the patients' drug treatments. In conclusion, several plasmid types were identified in the gut microbiome; however, it was difficult to link these to the antibiotic resistance genes identified. That the antibiotic resistance genes came from hospital and community environments is worrying. PMID:27530840

  11. Plasmid metagenomics reveals multiple antibiotic resistance gene classes among the gut microbiomes of hospitalised patients.

    PubMed

    Jitwasinkul, Tossawan; Suriyaphol, Prapat; Tangphatsornruang, Sithichoke; Hansen, Martin Asser; Hansen, Lars Hestbjerg; Sørensen, Søren Johannes; Permpikul, Chairat; Rongrungruang, Yong; Tribuddharat, Chanwit

    2016-09-01

    Antibiotic resistance genes are rapidly spread between pathogens and the normal flora, with plasmids playing an important role in their circulation. This study aimed to investigate antibiotic resistance plasmids in the gut microbiome of hospitalised patients. Stool samples were collected from seven inpatients at Siriraj Hospital (Bangkok, Thailand) and were compared with a sample from a healthy volunteer. Plasmids from the gut microbiomes extracted from the stool samples were subjected to high-throughput DNA sequencing (GS Junior). Newbler-assembled DNA reads were categorised into known and unknown sequences (using >80% alignment length as the cut-off), and ResFinder was used to classify the antibiotic resistance gene pools. Plasmid replicon modules were used for plasmid typing. Forty-six genes conferring resistance to several classes of antibiotics were identified in the stool samples. Several antibiotic resistance genes were shared by the patients; interestingly, most were reported previously in food animals and healthy humans. Four antibiotic resistance genes were found in the healthy subject. One gene (aph3-III) was identified in the patients and the healthy subject and was related to that in cattle. Uncommon genes of hospital origin such as blaTEM-124-like and fosA, which confer resistance to extended-spectrum β-lactams and fosfomycin, respectively, were identified. The resistance genes did not match the patients' drug treatments. In conclusion, several plasmid types were identified in the gut microbiome; however, it was difficult to link these to the antibiotic resistance genes identified. That the antibiotic resistance genes came from hospital and community environments is worrying.

  12. Historical Introgression of the Downy Mildew Resistance Gene Rpv12 from the Asian Species Vitis amurensis into Grapevine Varieties

    PubMed Central

    Venuti, Silvia; Copetti, Dario; Foria, Serena; Falginella, Luigi; Hoffmann, Sarolta; Bellin, Diana; Cindrić, Petar; Kozma, Pál; Scalabrin, Simone; Morgante, Michele; Testolin, Raffaele; Di Gaspero, Gabriele

    2013-01-01

    The Amur grape (Vitis amurensis Rupr.) thrives naturally in cool climates of Northeast Asia. Resistance against the introduced pathogen Plasmopara viticola is common among wild ecotypes that were propagated from Manchuria into Chinese vineyards or collected by Soviet botanists in Siberia, and used for the introgression of resistance into wine grapes (Vitis vinifera L.). A QTL analysis revealed a dominant gene Rpv12 that explained 79% of the phenotypic variance for downy mildew resistance and was inherited independently of other resistance genes. A Mendelian component of resistance–a hypersensitive response in leaves challenged with P. viticola–was mapped in an interval of 0.2 cM containing an array of coiled-coil NB-LRR genes on chromosome 14. We sequenced 10-kb genic regions in the Rpv12+ haplotype and identified polymorphisms in 12 varieties of V. vinifera using next-generation sequencing. The combination of two SNPs in single-copy genes flanking the NB-LRR cluster distinguished the resistant haplotype from all others found in 200 accessions of V. vinifera, V. amurensis, and V. amurensis x V. vinifera crosses. The Rpv12+ haplotype is shared by 15 varieties, the most ancestral of which are the century-old ‘Zarja severa’ and ‘Michurinets’. Before this knowledge, the chromosome segment around Rpv12+ became introgressed, shortened, and pyramided with another downy mildew resistance gene from North American grapevines (Rpv3) only by phenotypic selection. Rpv12+ has an additive effect with Rpv3+ to protect vines against natural infections, and confers foliar resistance to strains that are virulent on Rpv3+ plants. PMID:23593440

  13. Adriamycin resistance-associated prohibitin gene inhibits proliferation of human osteosarcoma MG63 cells by interacting with oncogenes and tumor suppressor genes

    PubMed Central

    Du, Min-Dong; He, Kai-Yi; Qin, Gang; Chen, Jin; Li, Jin-Yi

    2016-01-01

    The resistance of cancer cells to chemotherapeutic agents is a major obstacle for successful chemotherapy, and the mechanism of chemoresistance remains unclear. The present study developed an adriamycin-resistant human osteosarcoma MG-63 sub-line (MG-63/ADR), and identified differentially expressed proteins that may be associated with adriamycin resistance. Two dimensional gel electrophoresis, matrix-assisted laser desorption ionization time-of-flight mass spectrometry analysis and a protein identification assay were performed. Western blot analysis was used to examine the prohibitin (PHB) levels in the MG-63/ADR cells. Quantitative polymerase chain reaction was utilized to detect adriamycin resistant-associated genes. Laser-scanning confocal microscope was employed to examine the colocalization of PHB with v-myc avian myelocytomatosis viral oncogene homolog (c-myc), FBJ murine osteosarcoma viral oncogene homolog (c-fos), tumor protein p53 and retinoblastoma 1 (Rb). In addition, the full length of the open reading frame of human PHB was subcloned into a lentiviral vector pLVX-puro. The proliferative rate of MG-63 cells was also investigated. The overall protein expression in MG-63/ADR cells was clearly suppressed. Three notable protein regions, representing high mobility group box 1, Ras homolog gene family, member A, and PHB, were identified to be significantly altered in MG-63/ADR cells when compared with its parental cells. Therefore, PHB modulated the chemoresistance of MG-63/ADR cells by interacting with multiple oncogenes or tumor suppressor genes (c-myc, c-fos, p53 and Rb). In addition, overexpression of PHB decreases the proliferative rate of MG-63 cells. In conclusion, PHB is an adriamycin resistance-associated gene, which may inhibit the proliferation of human osteosarcoma MG-63 cells by interacting with the oncogenes or tumor suppressor genes, c-myc, c-fos, p53 and Rb. PMID:27602127

  14. Adriamycin resistance-associated prohibitin gene inhibits proliferation of human osteosarcoma MG63 cells by interacting with oncogenes and tumor suppressor genes

    PubMed Central

    Du, Min-Dong; He, Kai-Yi; Qin, Gang; Chen, Jin; Li, Jin-Yi

    2016-01-01

    The resistance of cancer cells to chemotherapeutic agents is a major obstacle for successful chemotherapy, and the mechanism of chemoresistance remains unclear. The present study developed an adriamycin-resistant human osteosarcoma MG-63 sub-line (MG-63/ADR), and identified differentially expressed proteins that may be associated with adriamycin resistance. Two dimensional gel electrophoresis, matrix-assisted laser desorption ionization time-of-flight mass spectrometry analysis and a protein identification assay were performed. Western blot analysis was used to examine the prohibitin (PHB) levels in the MG-63/ADR cells. Quantitative polymerase chain reaction was utilized to detect adriamycin resistant-associated genes. Laser-scanning confocal microscope was employed to examine the colocalization of PHB with v-myc avian myelocytomatosis viral oncogene homolog (c-myc), FBJ murine osteosarcoma viral oncogene homolog (c-fos), tumor protein p53 and retinoblastoma 1 (Rb). In addition, the full length of the open reading frame of human PHB was subcloned into a lentiviral vector pLVX-puro. The proliferative rate of MG-63 cells was also investigated. The overall protein expression in MG-63/ADR cells was clearly suppressed. Three notable protein regions, representing high mobility group box 1, Ras homolog gene family, member A, and PHB, were identified to be significantly altered in MG-63/ADR cells when compared with its parental cells. Therefore, PHB modulated the chemoresistance of MG-63/ADR cells by interacting with multiple oncogenes or tumor suppressor genes (c-myc, c-fos, p53 and Rb). In addition, overexpression of PHB decreases the proliferative rate of MG-63 cells. In conclusion, PHB is an adriamycin resistance-associated gene, which may inhibit the proliferation of human osteosarcoma MG-63 cells by interacting with the oncogenes or tumor suppressor genes, c-myc, c-fos, p53 and Rb.

  15. RNAi validation of resistance genes and their interactions in the highly DDT-resistant 91-R strain of Drosophila melanogaster.

    PubMed

    Gellatly, Kyle J; Yoon, Kyong Sup; Doherty, Jeffery J; Sun, Weilin; Pittendrigh, Barry R; Clark, J Marshall

    2015-06-01

    4,4'-dichlorodiphenyltrichloroethane (DDT) has been re-recommended by the World Health Organization for malaria mosquito control. Previous DDT use has resulted in resistance, and with continued use resistance will increase in terms of level and extent. Drosophila melanogaster is a model dipteran that has many available genetic tools, numerous studies done on insecticide resistance mechanisms, and is related to malaria mosquitoes allowing for extrapolation. The 91-R strain of D. melanogaster is highly resistant to DDT (>1500-fold), however, there is no mechanistic scheme that accounts for this level of resistance. Recently, reduced penetration, increased detoxification, and direct excretion have been identified as resistance mechanisms in the 91-R strain. Their interactions, however, remain unclear. Use of UAS-RNAi transgenic lines of D. melanogaster allowed for the targeted knockdown of genes putatively involved in DDT resistance and has validated the role of several cuticular proteins (Cyp4g1 and Lcp1), cytochrome P450 monooxygenases (Cyp6g1 and Cyp12d1), and ATP binding cassette transporters (Mdr50, Mdr65, and Mrp1) involved in DDT resistance. Further, increased sensitivity to DDT in the 91-R strain after intra-abdominal dsRNA injection for Mdr50, Mdr65, and Mrp1 was determined by a DDT contact bioassay, directly implicating these genes in DDT efflux and resistance. PMID:26047118

  16. RNAi validation of resistance genes and their interactions in the highly DDT-resistant 91-R strain of Drosophila melanogaster.

    PubMed

    Gellatly, Kyle J; Yoon, Kyong Sup; Doherty, Jeffery J; Sun, Weilin; Pittendrigh, Barry R; Clark, J Marshall

    2015-06-01

    4,4'-dichlorodiphenyltrichloroethane (DDT) has been re-recommended by the World Health Organization for malaria mosquito control. Previous DDT use has resulted in resistance, and with continued use resistance will increase in terms of level and extent. Drosophila melanogaster is a model dipteran that has many available genetic tools, numerous studies done on insecticide resistance mechanisms, and is related to malaria mosquitoes allowing for extrapolation. The 91-R strain of D. melanogaster is highly resistant to DDT (>1500-fold), however, there is no mechanistic scheme that accounts for this level of resistance. Recently, reduced penetration, increased detoxification, and direct excretion have been identified as resistance mechanisms in the 91-R strain. Their interactions, however, remain unclear. Use of UAS-RNAi transgenic lines of D. melanogaster allowed for the targeted knockdown of genes putatively involved in DDT resistance and has validated the role of several cuticular proteins (Cyp4g1 and Lcp1), cytochrome P450 monooxygenases (Cyp6g1 and Cyp12d1), and ATP binding cassette transporters (Mdr50, Mdr65, and Mrp1) involved in DDT resistance. Further, increased sensitivity to DDT in the 91-R strain after intra-abdominal dsRNA injection for Mdr50, Mdr65, and Mrp1 was determined by a DDT contact bioassay, directly implicating these genes in DDT efflux and resistance.

  17. Downy mildew (Peronospora parasitica) resistance genes in Arabidopsis vary in functional requirements for NDR1, EDS1, NPR1 and salicylic acid accumulation.

    PubMed

    McDowell, J M; Cuzick, A; Can, C; Beynon, J; Dangl, J L; Holub, E B

    2000-06-01

    To better understand the genetic requirements for R gene-dependent defense activation in Arabidopsis, we tested the effect of several defense response mutants on resistance specified by eight RPP genes (for resistance to Peronospora parasitica) expressed in the Col-0 background. In most cases, resistance was not suppressed by a mutation in the SAR regulatory gene NPR1 or by expression of the NahG transgene. Thus, salicylic acid accumulation and NPR1 function are not necessary for resistance mediated by these RPP genes. In addition, resistance conferred by two of these genes, RPP7 and RPP8, was not significantly suppressed by mutations in either EDS1 or NDR1. RPP7 resistance was also not compromised by mutations in EIN2, JAR1 or COI1 which affect ethylene or jasmonic acid signaling. Double mutants were therefore tested. RPP7 and RPP8 were weakly suppressed in an eds1-2/ndr1-1 background, suggesting that these RPP genes operate additively through EDS1, NDR1 and as-yet-undefined signaling components. RPP7 was not compromised in coi1/npr1 or coi1/NahG backgrounds. These observations suggest that RPP7 initiates resistance through a novel signaling pathway that functions independently of salicylic acid accumulation or jasmonic acid response components.

  18. Genes Expressed Differentially in Hessian Fly Larvae Feeding in Resistant and Susceptible Plants.

    PubMed

    Chen, Ming-Shun; Liu, Sanzhen; Wang, Haiyan; Cheng, Xiaoyan; El Bouhssini, Mustapha; Whitworth, R Jeff

    2016-01-01

    The Hessian fly, Mayetiola destructor, is a destructive pest of wheat worldwide and mainly controlled by deploying resistant cultivars. In this study, we investigated the genes that were expressed differentially between larvae in resistant plants and those in susceptible plants through RNA sequencing on the Illumina platform. Informative genes were 11,832, 14,861, 15,708, and 15,071 for the comparisons between larvae in resistant versus susceptible plants for 0.5, 1, 3, and 5 days, respectively, after larvae had reached the feeding site. The transcript abundance corresponding to 5401, 6902, 8457, and 5202 of the informative genes exhibited significant differences (p ≤ 0.05) in the respective paired comparisons. Overall, genes involved in nutrient metabolism, RNA and protein synthesis exhibited lower transcript abundance in larvae from resistant plants, indicating that resistant plants inhibited nutrient metabolism and protein production in larvae. Interestingly, the numbers of cytochrome P450 genes with higher transcript abundance in larvae from resistant plants were comparable to, or higher than those with lower transcript abundance, indicating that toxic chemicals from resistant plants may have played important roles in Hessian fly larval death. Our study also identified several families of genes encoding secreted salivary gland proteins (SSGPs) that were expressed at early stage of 1(st) instar larvae and with more genes with higher transcript abundance in larvae from resistant plants. Those SSGPs are candidate effectors with important roles in plant manipulation. PMID:27529231

  19. Incorporation of Bacterial Blight Resistance Genes Into Lowland Rice Cultivar Through Marker-Assisted Backcross Breeding.

    PubMed

    Pradhan, Sharat Kumar; Nayak, Deepak Kumar; Pandit, Elssa; Behera, Lambodar; Anandan, Annamalai; Mukherjee, Arup Kumar; Lenka, Srikanta; Barik, Durga Prasad

    2016-07-01

    Bacterial blight (BB) of rice caused by Xanthomonas oryzae pv. oryzae is a major disease of rice in many rice growing countries. Pyramided lines carrying two BB resistance gene combinations (Xa21+xa13 and Xa21+xa5) were developed in a lowland cultivar Jalmagna background through backcross breeding by integrating molecular markers. In each backcross generation, markers closely linked to the disease resistance genes were used to select plants possessing the target genes. Background selection was continued in those plants carrying resistant genes until BC(3) generation. Plants having the maximum contribution from the recurrent parent genome were selected in each generation and hybridized with the recipient parent. The BB-pyramided line having the maximum recipient parent genome recovery of 95% was selected among BC3F1 plants and selfed to isolate homozygous BC(3)F(2) plants with different combinations of BB resistance genes. Twenty pyramided lines with two resistance gene combinations exhibited high levels of tolerance against the BB pathogen. In order to confirm the resistance, the pyramided lines were inoculated with different X. oryzae pv. oryzae strains of Odisha for bioassay. The genotypes with combination of two BB resistance genes conferred high levels of resistance to the predominant X. oryzae pv. oryzae isolates prevalent in the region. The pyramided lines showed similarity with the recipient parent with respect to major agro-morphologic traits.

  20. Identification of an integron containing the quinolone resistance gene qnrA1 in Shewanella xiamenensis.

    PubMed

    Zhao, Jing-yi; Mu, Xiao-dong; Zhu, Yuan-qi; Xi, Lijun; Xiao, Zijun

    2015-09-01

    This study investigated multidrug resistance in Shewanella xiamenensis isolated from an estuarine water sample in China during 2014. This strain displayed resistance or decreased susceptibility to ampicillin, aztreonam, cefepime, cefotaxime, chloramphenicol, ciprofloxacin, erythromycin, kanamycin and trimethoprim-sulfamethoxazole. The antimicrobial resistance genes aacA3, blaOXA-199, qnrA1 and sul1 were identified by PCR amplification and by sequencing. Pulsed-field gel electrophoresis and DNA hybridization experiments showed that the quinolone resistance gene qnrA1 was chromosomally located. qnrA1 was located in a complex class 1 integron, downstream from an ISCR1, and bracketed by two copies of qacEΔ1-sul1 genes. This integron is similar to In825 with four gene cassettes aacA3, catB11c, dfrA1z and aadA2az. An IS26-mel-mph2-IS26 structure was also detected in the flanking sequences, conferring resistance to macrolides. This is the first identification of the class 1 integron in S. xiamenensis. This is also the first identification of the qnrA1 gene and IS26-mediated macrolide resistance genes in S. xiamenensis. Presence of a variety of resistance genetic determinants in environmental S. xiamenensis suggests the possibility that this species may serve as a potential vehicle of antimicrobial resistance genes in aquatic environments.

  1. Genes Expressed Differentially in Hessian Fly Larvae Feeding in Resistant and Susceptible Plants

    PubMed Central

    Chen, Ming-Shun; Liu, Sanzhen; Wang, Haiyan; Cheng, Xiaoyan; El Bouhssini, Mustapha; Whitworth, R. Jeff

    2016-01-01

    The Hessian fly, Mayetiola destructor, is a destructive pest of wheat worldwide and mainly controlled by deploying resistant cultivars. In this study, we investigated the genes that were expressed differentially between larvae in resistant plants and those in susceptible plants through RNA sequencing on the Illumina platform. Informative genes were 11,832, 14,861, 15,708, and 15,071 for the comparisons between larvae in resistant versus susceptible plants for 0.5, 1, 3, and 5 days, respectively, after larvae had reached the feeding site. The transcript abundance corresponding to 5401, 6902, 8457, and 5202 of the informative genes exhibited significant differences (p ≤ 0.05) in the respective paired comparisons. Overall, genes involved in nutrient metabolism, RNA and protein synthesis exhibited lower transcript abundance in larvae from resistant plants, indicating that resistant plants inhibited nutrient metabolism and protein production in larvae. Interestingly, the numbers of cytochrome P450 genes with higher transcript abundance in larvae from resistant plants were comparable to, or higher than those with lower transcript abundance, indicating that toxic chemicals from resistant plants may have played important roles in Hessian fly larval death. Our study also identified several families of genes encoding secreted salivary gland proteins (SSGPs) that were expressed at early stage of 1st instar larvae and with more genes with higher transcript abundance in larvae from resistant plants. Those SSGPs are candidate effectors with important roles in plant manipulation. PMID:27529231

  2. Molecular identification and quantification of tetracycline and erythromycin resistance genes in Spanish and Italian retail cheeses.

    PubMed

    Belén Flórez, Ana; Alegría, Ángel; Rossi, Franca; Delgado, Susana; Felis, Giovanna E; Torriani, Sandra; Mayo, Baltasar

    2014-01-01

    Large antibiotic resistance gene pools in the microbiota of foods may ultimately pose a risk for human health. This study reports the identification and quantification of tetracycline- and erythromycin-resistant populations, resistance genes, and gene diversity in traditional Spanish and Italian cheeses, via culturing, conventional PCR, real-time quantitative PCR (qPCR), and denaturing gradient gel electrophoresis (DGGE). The numbers of resistant bacteria varied widely among the antibiotics and the different cheese varieties; in some cheeses, all the bacterial populations seemed to be resistant. Up to eight antibiotic resistance genes were sought by gene-specific PCR, six with respect to tetracycline, that is, tet(K), tet(L), tet(M), tet(O), tet(S), and tet(W), and two with respect to erythromycin, that is, erm(B) and erm(F). The most common resistance genes in the analysed cheeses were tet(S), tet(W), tet(M), and erm(B). The copy numbers of these genes, as quantified by qPCR, ranged widely between cheeses (from 4.94 to 10.18log10/g). DGGE analysis revealed distinct banding profiles and two polymorphic nucleotide positions for tet(W)-carrying cheeses, though the similarity of the sequences suggests this tet(W) to have a monophyletic origin. Traditional cheeses would therefore appear to act as reservoirs for large numbers of many types of antibiotic resistance determinants. PMID:25302306

  3. Molecular Identification and Quantification of Tetracycline and Erythromycin Resistance Genes in Spanish and Italian Retail Cheeses

    PubMed Central

    Flórez, Ana Belén; Alegría, Ángel; Delgado, Susana

    2014-01-01

    Large antibiotic resistance gene pools in the microbiota of foods may ultimately pose a risk for human health. This study reports the identification and quantification of tetracycline- and erythromycin-resistant populations, resistance genes, and gene diversity in traditional Spanish and Italian cheeses, via culturing, conventional PCR, real-time quantitative PCR (qPCR), and denaturing gradient gel electrophoresis (DGGE). The numbers of resistant bacteria varied widely among the antibiotics and the different cheese varieties; in some cheeses, all the bacterial populations seemed to be resistant. Up to eight antibiotic resistance genes were sought by gene-specific PCR, six with respect to tetracycline, that is, tet(K), tet(L), tet(M), tet(O), tet(S), and tet(W), and two with respect to erythromycin, that is, erm(B) and erm(F). The most common resistance genes in the analysed cheeses were tet(S), tet(W), tet(M), and erm(B). The copy numbers of these genes, as quantified by qPCR, ranged widely between cheeses (from 4.94 to 10.18log⁡10/g). DGGE analysis revealed distinct banding profiles and two polymorphic nucleotide positions for tet(W)-carrying cheeses, though the similarity of the sequences suggests this tet(W) to have a monophyletic origin. Traditional cheeses would therefore appear to act as reservoirs for large numbers of many types of antibiotic resistance determinants. PMID:25302306

  4. Comparative analysis of Phytophthora infestans induced gene expression in potato cultivars with different levels of resistance.

    PubMed

    Ros, B; Thümmler, F; Wenzel, G

    2005-11-01

    Differential gene expression was analyzed after infection with Phytophthora infestans in six potato cultivars with different levels of resistance to late blight. To verify the infection of the potato leaflets, the amount of phytopathogen mRNA within the plant material was quantified by real-time quantitative PCR. The expression of 182 genes selected from two subtracted cDNA libraries was studied with cDNA array hybridization using RNA from non-infected and infected potato leaflets. Gene up- and down-regulation were clearly detectable in all cultivars 72 h post inoculation. Gene expression patterns in susceptible cultivars differed from those in potato varieties with a higher level of resistance. In general, a stronger gene induction was observed in the susceptible cultivars compared to the moderately to highly resistant potato varieties. Five genes with the highest homology to stress and/or defence-related genes were induced specifically in the susceptible cultivars. Four genes responded to pathogen attack independently of the level of resistance of the cultivar used, and three genes were repressed in infected tissue of most cultivars. Even in the absence of P. infestans infection, six genes showed higher expression levels in the somewhat resistant cultivars Bettina and Matilda. Possible reasons for the different levels of gene expression are discussed.

  5. Clusters of Antibiotic Resistance Genes Enriched Together Stay Together in Swine Agriculture

    PubMed Central

    Johnson, Timothy A.; Stedtfeld, Robert D.; Wang, Qiong; Cole, James R.; Hashsham, Syed A.; Looft, Torey; Zhu, Yong-Guan

    2016-01-01

    ABSTRACT   Antibiotic resistance is a worldwide health risk, but the influence of animal agriculture on the genetic context and enrichment of individual antibiotic resistance alleles remains unclear. Using quantitative PCR followed by amplicon sequencing, we quantified and sequenced 44 genes related to antibiotic resistance, mobile genetic elements, and bacterial phylogeny in microbiomes from U.S. laboratory swine and from swine farms from three Chinese regions. We identified highly abundant resistance clusters: groups of resistance and mobile genetic element alleles that cooccur. For example, the abundance of genes conferring resistance to six classes of antibiotics together with class 1 integrase and the abundance of IS6100-type transposons in three Chinese regions are directly correlated. These resistance cluster genes likely colocalize in microbial genomes in the farms. Resistance cluster alleles were dramatically enriched (up to 1 to 10% as abundant as 16S rRNA) and indicate that multidrug-resistant bacteria are likely the norm rather than an exception in these communities. This enrichment largely occurred independently of phylogenetic composition; thus, resistance clusters are likely present in many bacterial taxa. Furthermore, resistance clusters contain resistance genes that confer resistance to antibiotics independently of their particular use on the farms. Selection for these clusters is likely due to the use of only a subset of the broad range of chemicals to which the clusters confer resistance. The scale of animal agriculture and its wastes, the enrichment and horizontal gene transfer potential of the clusters, and the vicinity of large human populations suggest that managing this resistance reservoir is important for minimizing human risk. PMID:27073098

  6. Pyramiding B genes in cotton achieves broader but not always higher resistance to bacterial blight.

    PubMed

    Essenberg, Margaret; Bayles, Melanie B; Pierce, Margaret L; Verhalen, Laval M

    2014-10-01

    Near-isogenic lines of upland cotton (Gossypium hirsutum) carrying single, race-specific genes B4, BIn, and b7 for resistance to bacterial blight were used to develop a pyramid of lines with all possible combinations of two and three genes to learn whether the pyramid could achieve broad and high resistance approaching that of L. A. Brinkerhoff's exceptional line Im216. Isogenic strains of Xanthomonas axonopodis pv. malvacearum carrying single avirulence (avr) genes were used to identify plants carrying specific resistance (B) genes. Under field conditions in north-central Oklahoma, pyramid lines exhibited broader resistance to individual races and, consequently, higher resistance to a race mixture. It was predicted that lines carrying two or three B genes would also exhibit higher resistance to race 1, which possesses many avr genes. Although some enhancements were observed, they did not approach the level of resistance of Im216. In a growth chamber, bacterial populations attained by race 1 in and on leaves of the pyramid lines decreased significantly with increasing number of B genes in only one of four experiments. The older lines, Im216 and AcHR, exhibited considerably lower bacterial populations than any of the one-, two-, or three-B-gene lines. A spreading collapse of spray-inoculated AcBIn and AcBInb7 leaves appears to be a defense response (conditioned by BIn) that is out of control. PMID:24655289

  7. Genetic mapping of the rice resistance-breaking gene of the brown planthopper Nilaparvata lugens

    PubMed Central

    Kobayashi, Tetsuya; Yamamoto, Kimiko; Suetsugu, Yoshitaka; Kuwazaki, Seigo; Hattori, Makoto; Jairin, Jirapong; Sanada-Morimura, Sachiyo; Matsumura, Masaya

    2014-01-01

    Host plant resistance has been widely used for controlling the major rice pest brown planthopper (BPH, Nilaparvata lugens). However, adaptation of the wild BPH population to resistance limits the effective use of resistant rice varieties. Quantitative trait locus (QTL) analysis was conducted to identify resistance-breaking genes against the anti-feeding mechanism mediated by the rice resistance gene Bph1. QTL analysis in iso-female BPH lines with single-nucleotide polymorphism (SNP) markers detected a single region on the 10th linkage group responsible for the virulence. The QTL explained from 57 to 84% of the total phenotypic variation. Bulked segregant analysis with next-generation sequencing in F2 progenies identified five SNPs genetically linked to the virulence. These analyses showed that virulence to Bph1 was controlled by a single recessive gene. In contrast to previous studies, the gene-for-gene relationship between the major resistance gene Bph1 and virulence gene of BPH was confirmed. Identified markers are available for map-based cloning of the major gene controlling BPH virulence to rice resistance. PMID:24870048

  8. Identification of resistance gene analogs in Korean wild apple germplasm collections.

    PubMed

    Baek, D E; Choi, C

    2013-02-27

    Several plant disease resistance gene (R-gene) classes have been identified on the basis of specific conserved functional domains. Cloning of disease-resistance apple genes would be useful for breeding programs and for studying resistance mechanisms. We used a PCR approach with degenerate primers designed from conserved NBS-LRR (nucleotide binding site-leucine-rich repeat) regions of known R-genes to amplify and clone homologous sequences from six Korean wild apple germplasm collections and an individual plant of the Siberian wild apple, Malus baccata. One hundred and twenty-four sequenced clones showed high similarity at multiple NBS motifs with the R-genes of other plants. The clones OLE 2-9, BP 6-11, OLE 1-22, and OLE 5-13 shared 45% identity with the R-gene of other plants. The conserved sequence, which plays an important role in resistance, was found in our isolated resistance gene analogs (RGAs). The sequences of isolated apple RGAs showed more similarity to Toll/interleukin-1 receptor (TIR)-NBS-LRR than non-TIR-NBS-LRR. We suggest using a marker for this resistance gene region as well as for identifying potential material for disease-resistant breeding among Korea wild apple germplasms. This is the first step in preparing a comprehensive analysis of the RGAs in Korean wild apple germplasm.

  9. A pigeonpea gene confers resistance to Asian soybean rust in soybean.

    PubMed

    Kawashima, Cintia G; Guimarães, Gustavo Augusto; Nogueira, Sônia Regina; MacLean, Dan; Cook, Doug R; Steuernagel, Burkhard; Baek, Jongmin; Bouyioukos, Costas; Melo, Bernardo do V A; Tristão, Gustavo; de Oliveira, Jamile Camargos; Rauscher, Gilda; Mittal, Shipra; Panichelli, Lisa; Bacot, Karen; Johnson, Ebony; Iyer, Geeta; Tabor, Girma; Wulff, Brande B H; Ward, Eric; Rairdan, Gregory J; Broglie, Karen E; Wu, Gusui; van Esse, H Peter; Jones, Jonathan D G; Brommonschenkel, Sérgio H

    2016-06-01

    Asian soybean rust (ASR), caused by the fungus Phakopsora pachyrhizi, is one of the most economically important crop diseases, but is only treatable with fungicides, which are becoming less effective owing to the emergence of fungicide resistance. There are no commercial soybean cultivars with durable resistance to P. pachyrhizi, and although soybean resistance loci have been mapped, no resistance genes have been cloned. We report the cloning of a P. pachyrhizi resistance gene CcRpp1 (Cajanus cajan Resistance against Phakopsora pachyrhizi 1) from pigeonpea (Cajanus cajan) and show that CcRpp1 confers full resistance to P. pachyrhizi in soybean. Our findings show that legume species related to soybean such as pigeonpea, cowpea, common bean and others could provide a valuable and diverse pool of resistance traits for crop improvement. PMID:27111723

  10. Characterization of integrons and resistance genes in multidrug-resistant Salmonella enterica isolated from meat and dairy products in Egypt.

    PubMed

    Ahmed, Ashraf M; Shimamoto, Toshi; Shimamoto, Tadashi

    2014-10-17

    Foodborne pathogens are a leading cause of illness and death, especially in developing countries. The problem is exacerbated if bacteria attain multidrug resistance. Little is currently known about the extent of antibiotic resistance in foodborne pathogens and the molecular mechanisms underlying this resistance in Africa. Therefore, the current study was carried out to characterize, at the molecular level, the mechanism of multidrug resistance in Salmonella enterica isolated from 1600 food samples (800 meat products and 800 dairy products) collected from different street venders, butchers, retail markets and slaughterhouses in Egypt. Forty-seven out of 69 isolates (68.1%) showed multidrug resistance phenotypes to at least three classes of antimicrobials. The incidence of multidrug-resistant isolates was higher in meat products (37, 69.8%) than in dairy products (10, 62.5%). The multidrug-resistant serovars included, S. enterica serovar Typhimurium (24 isolates, 34.8%), S. enterica serovar Enteritidis, (15 isolates, 21.8%), S. enterica serovar Infantis (7 isolates, 10.1%) and S. enterica non-typable serovar (1 isolate, 1.4%). The highest resistance was to ampicillin (95.7%), then to kanamycin (93.6%), spectinomycin (93.6%), streptomycin (91.5%) and sulfamethoxazole/trimethoprim (91.5%). PCR and DNA sequencing were used to screen and characterize integrons and antibiotic resistance genes and 39.1% and 8.7% of isolates were positive for class 1 and class 2 integrons, respectively. β-lactamase-encoding genes were identified in 75.4% of isolates and plasmid-mediated quinolone resistance genes were identified in 27.5% of isolates. Finally, the florphenicol resistance gene, floR, was identified in 18.8% of isolates. PCR screening identified S. enterica serovar Typhimurium DT104 in both meat and dairy products. This is the first study to report many of these resistance genes in dairy products. This study highlights the high incidence of multidrug-resistant S. enterica in

  11. Effect of Operating Parameters and Chemical Additives on Crystal Habit and Specific Cake Resistance of Zinc Hydroxide Precipitates

    SciTech Connect

    Alwin, Jennifer Louise

    1999-08-01

    The effect of process parameters and chemical additives on the specific cake resistance of zinc hydroxide precipitates was investigated. The ability of a slurry to be filtered is dependent upon the particle habit of the solid and the particle habit is influenced by certain process variables. The process variables studied include neutralization temperature, agitation type, and alkalinity source used for neutralization. Several commercially available chemical additives advertised to aid in solid/liquid separation were also examined in conjunction with hydroxide precipitation. A statistical analysis revealed that the neutralization temperature and the source of alkalinity were statistically significant in influencing the specific cake resistance of zinc hydroxide precipitates in this study. The type of agitation did not significantly effect the specific cake resistance of zinc hydroxide precipitates. The use of chemical additives in conjunction with hydroxide precipitation had a favorable effect on the filterability. The morphology of the hydroxide precipitates was analyzed using scanning electron microscopy.

  12. Detection and Characterizations of Genes Resistant to Tetracycline and Sulfa among the Bacteria in Mariculture Water

    NASA Astrophysics Data System (ADS)

    Qu, L.; Li, Y.; Zhu, P.

    2013-12-01

    One hundred and thirty-five bacteria from maricultural environments were tested for sensitivity to tetracycline and sulfa. Result show that 72% of the bacteria were sulfa-resistant, 36% of the bacteria were tetracycline-resistant, and 16.5% of bacteria showed resistance to both tetracyclines and sulfa ,indicating that the proportion of sulfa and tetracycline resistance bacteria isvery large in the maricultural environments. PCR methods were used to detect if these resistant bacteria carry tetracycline and sulfa resistance genes. Out of the 33 tetracycline-resistant bacteria screened, 3 were positive for tetA, 6 were positive for tetB and no isolate wasboth positive for tetA and tetB. Of the 97 sulfa-resistant bacteria screened, 9 were positive for sul2, 6 were positive for sul1, 1 isolate was positive for bothsul1 and sul2. The minimum inhibitory concentration (MIC) of tetracycline for tetA-carrying isolates were higher than those tetB-carrying isolates.while The MIC of sulfa for sul2-carrying isolates were higher than those sul1-carrying isolates. Indicating that tetA and sul2 gene may play ubknown roles in resisting tetracycline and sulfa than tetB and sul1 genes. The results showed the 4 kinds of genes (tetA,tetB,sul1,sul2) has no host specificity. All these 16S sequence are from the isolates which are positive for the above genes, it indicated the above antibiotic resistance genes are widespread in the environment regardless of the host. While the DNA sequence of these four genes showed tetA, sul1, sul2 genes are conservative in different bacteria , etB gene conserved poorly. The research aim is to get a preliminary understanding of resistance mechanism related to the resistant bacteria and the resistance genes in marine aquaculture environment through the analysis of resistant genes, providing research base for the prevention and treatment of drug-resistant bacteria so as to reduce the threat to the ecological environment, aquaculture and human health.

  13. Application of Genomic and Quantitative Genetic Tools to Identify Candidate Resistance Genes for Brown Rot Resistance in Peach

    PubMed Central

    Martínez-García, Pedro J.; Parfitt, Dan E.; Bostock, Richard M.; Fresnedo-Ramírez, Jonathan; Vazquez-Lobo, Alejandra; Ogundiwin, Ebenezer A.; Gradziel, Thomas M.; Crisosto, Carlos H.

    2013-01-01

    The availability of a complete peach genome assembly and three different peach genome sequences created by our group provide new opportunities for application of genomic data and can improve the power of the classical Quantitative Trait Loci (QTL) approaches to identify candidate genes for peach disease resistance. Brown rot caused by Monilinia spp., is the most important fungal disease of stone fruits worldwide. Improved levels of peach fruit rot resistance have been identified in some cultivars and advanced selections developed in the UC Davis and USDA breeding programs. Whole genome sequencing of the Pop-DF parents lead to discovery of high-quality SNP markers for QTL genome scanning in this experimental population. Pop-DF created by crossing a brown rot moderately resistant cultivar ‘Dr. Davis’ and a brown rot resistant introgression line, ‘F8,1–42’, derived from an initial almond × peach interspecific hybrid, was evaluated for brown rot resistance in fruit of harvest maturity over three seasons. Using the SNP linkage map of Pop-DF and phenotypic data collected with inoculated fruit, a genome scan for QTL identified several SNP markers associated with brown rot resistance. Two of these QTLs were placed on linkage group 1, covering a large (physical) region on chromosome 1. The genome scan for QTL and SNP effects predicted several candidate genes associated with disease resistance responses in other host-pathogen systems. Two potential candidate genes, ppa011763m and ppa026453m, may be the genes primarily responsible for M. fructicola recognition in peach, activating both PAMP-triggered immunity (PTI) and effector-triggered immunity (ETI) responses. Our results provide a foundation for further genetic dissection, marker assisted breeding for brown rot resistance, and development of peach cultivars resistant to brown rot. PMID:24244329

  14. Tagging and mapping of SSR marker for rust resistance gene in lentil (Lens culinaris Medikus subsp. culinaris).

    PubMed

    Dikshit, H K; Singh, Akanksha; Singh, D; Aski, M; Jain, Neelu; Hegde, V S; Basandrai, A K; Basandrai, D; Sharma, T R

    2016-06-01

    Lentil, as an economical source of protein, minerals and vitamins, plays important role in nutritional security of the common man. Grown mainly in West Asia, North Africa (WANA) region and South Asia, it suffers from several biotic stresses such as wilt, rust, blight and broomrape. Lentil rust caused by autoecious fungus Uromyces viciae fabae (Pers.) Schroet is a serious lentil disease in Algeria, Bangladesh, Ethiopia, India, Italy, Morocco, Pakistan and Nepal. The disease symptoms are observed during flowering and early podding stages. Rust causes severe yield losses in lentil. It can only be effectively controlled by identifying the resistant source, understanding its inheritance and breeding for host resistance. The obligate parasitic nature of pathogen makes it difficult to maintain the pathogen in culture and to apply it to screen segregating progenies under controlled growth conditions. Hence, the use of molecular markers will compliment in identification of resistant types in different breeding programs. Here, we studied the inheritance of resistance to rust in lentil using F₁, F₂ and F₂:₃ from cross PL 8 (susceptible) x L 4149 (resistant) varieties. The phenotyping of lentil population was carried out at Sirmour, India. The result of genetic analysis revealed that a single dominant gene controls rust resistance in lentil genotype L 4149. The F2 population from this cross was used to tag and map the rust resistance gene using SSR and SRAP markers. Markers such as 270 SRAP and 162 SSR were studied for polymorphism and 101 SRAP and 33 SSRs were found to be polymorphic between the parents. Two SRAP and two SSR markers differentiated the resistant and susceptible bulks. SSR marker Gllc 527 was estimated to be linked to rust resistant locus at a distance of 5.9 cM. The Gllc 527 marker can be used for marker assisted selection for rust resistance; however, additional markers closer to rust resistant locus are required. The markers linked to the rust

  15. Tagging and mapping of SSR marker for rust resistance gene in lentil (Lens culinaris Medikus subsp. culinaris).

    PubMed

    Dikshit, H K; Singh, Akanksha; Singh, D; Aski, M; Jain, Neelu; Hegde, V S; Basandrai, A K; Basandrai, D; Sharma, T R

    2016-06-01

    Lentil, as an economical source of protein, minerals and vitamins, plays important role in nutritional security of the common man. Grown mainly in West Asia, North Africa (WANA) region and South Asia, it suffers from several biotic stresses such as wilt, rust, blight and broomrape. Lentil rust caused by autoecious fungus Uromyces viciae fabae (Pers.) Schroet is a serious lentil disease in Algeria, Bangladesh, Ethiopia, India, Italy, Morocco, Pakistan and Nepal. The disease symptoms are observed during flowering and early podding stages. Rust causes severe yield losses in lentil. It can only be effectively controlled by identifying the resistant source, understanding its inheritance and breeding for host resistance. The obligate parasitic nature of pathogen makes it difficult to maintain the pathogen in culture and to apply it to screen segregating progenies under controlled growth conditions. Hence, the use of molecular markers will compliment in identification of resistant types in different breeding programs. Here, we studied the inheritance of resistance to rust in lentil using F₁, F₂ and F₂:₃ from cross PL 8 (susceptible) x L 4149 (resistant) varieties. The phenotyping of lentil population was carried out at Sirmour, India. The result of genetic analysis revealed that a single dominant gene controls rust resistance in lentil genotype L 4149. The F2 population from this cross was used to tag and map the rust resistance gene using SSR and SRAP markers. Markers such as 270 SRAP and 162 SSR were studied for polymorphism and 101 SRAP and 33 SSRs were found to be polymorphic between the parents. Two SRAP and two SSR markers differentiated the resistant and susceptible bulks. SSR marker Gllc 527 was estimated to be linked to rust resistant locus at a distance of 5.9 cM. The Gllc 527 marker can be used for marker assisted selection for rust resistance; however, additional markers closer to rust resistant locus are required. The markers linked to the rust

  16. Fine Mapping of Two Additive Effect Genes for Awn Development in Rice (Oryza sativa L.)

    PubMed Central

    Li, Jinjie; Yao, Guoxin; Pan, Huiqiao; Hu, Guanglong; Chen, Chao; Zhang, Hongliang; Li, Zichao

    2016-01-01

    Awns, important domestication and agronomic traits in rice (Oryza sativa L.), are conferred by polygenes and the environment. Near isogenic line (NIL) pairs BM33 and BM38 were constructed from crosses between awnless japonica cv Nipponbare as recurrent parent, and lines SLG or Funingxiaohongmang (awned japonica accessions), respectively, as donors. In order to study the genetic and molecular mechanism of awning, two unknown, independent genes with additive effects were identified in a cross between the NILs. To map and clone the two genes, a BC4F4 population of 8,103 individuals and a BC4F6 population of 11,206 individuals were constructed. Awn3-1 was fine mapped to a 101.13 kb genomic region between Indel marker In316 and SNP marker S9-1 on chromosome 3. Nine predicted genes in the interval were annotated in the Rice Annotation Project Database (RAP-DB), and Os03g0418600 was identified as the most likely candidate for Awn3-1 through sequence comparisons and RT-PCR assays. Awn4-2 was fine mapped to a 62.4 kb genomic region flanked by simple sequence repeat (SSR) marker M1126 and Indel maker In73 on chromosome 4L. This region contained the previously reported gene An-1 that regulates awn development. Thus, An-1 may be the candidate gene of Awn4-2. These results will facilitate cloning of the awn genes and thereby provide an understanding of the molecular basis of awn development. PMID:27494628

  17. Fine Mapping of Two Additive Effect Genes for Awn Development in Rice (Oryza sativa L.).

    PubMed

    Li, Ben; Zhang, Yanpei; Li, Jinjie; Yao, Guoxin; Pan, Huiqiao; Hu, Guanglong; Chen, Chao; Zhang, Hongliang; Li, Zichao

    2016-01-01

    Awns, important domestication and agronomic traits in rice (Oryza sativa L.), are conferred by polygenes and the environment. Near isogenic line (NIL) pairs BM33 and BM38 were constructed from crosses between awnless japonica cv Nipponbare as recurrent parent, and lines SLG or Funingxiaohongmang (awned japonica accessions), respectively, as donors. In order to study the genetic and molecular mechanism of awning, two unknown, independent genes with additive effects were identified in a cross between the NILs. To map and clone the two genes, a BC4F4 population of 8,103 individuals and a BC4F6 population of 11,206 individuals were constructed. Awn3-1 was fine mapped to a 101.13 kb genomic region between Indel marker In316 and SNP marker S9-1 on chromosome 3. Nine predicted genes in the interval were annotated in the Rice Annotation Project Database (RAP-DB), and Os03g0418600 was identified as the most likely candidate for Awn3-1 through sequence comparisons and RT-PCR assays. Awn4-2 was fine mapped to a 62.4 kb genomic region flanked by simple sequence repeat (SSR) marker M1126 and Indel maker In73 on chromosome 4L. This region contained the previously reported gene An-1 that regulates awn development. Thus, An-1 may be the candidate gene of Awn4-2. These results will facilitate cloning of the awn genes and thereby provide an understanding of the molecular basis of awn development. PMID:27494628

  18. Characterization of the Maize Chitinase Genes and Their Effect on Aspergillus flavus and Aflatoxin Accumulation Resistance

    PubMed Central

    Hawkins, Leigh K.; Mylroie, J. Erik; Oliveira, Dafne A.; Smith, J. Spencer; Ozkan, Seval; Windham, Gary L.; Williams, W. Paul; Warburton, Marilyn L.

    2015-01-01

    Maize (Zea mays L.) is a crop of global importance, but prone to contamination by aflatoxins produced by fungi in the genus Aspergillus. The development of resistant germplasm and the identification of genes contributing to resistance would aid in the reduction of the problem with a minimal need for intervention by farmers. Chitinolytic enzymes respond to attack by potential pathogens and have been demonstrated to increase insect and fungal resistance in plants. Here, all chitinase genes in the maize genome were characterized via sequence diversity and expression patterns. Recent evolution within this gene family was noted. Markers from within each gene were developed and used to map the phenotypic effect on resistance of each gene in up to four QTL mapping populations and one association panel. Seven chitinase genes were identified that had alleles associated with increased resistance to aflatoxin accumulation and A. flavus infection in field grown maize. The chitinase in bin 1.05 identified a new and highly significant QTL, while chitinase genes in bins 2.04 and 5.03 fell directly beneath the peaks of previously published QTL. The expression patterns of these genes corroborate possible grain resistance mechanisms. Markers from within the gene sequences or very closely linked to them are presented to aid in the use of marker assisted selection to improve this trait. PMID:26090679

  19. chr genes from adaptive replicons are responsible for chromate resistance by Burkholderia xenovorans LB400.

    PubMed

    Reyes-Gallegos, Rosa I; Ramírez-Díaz, Martha I; Cervantes, Carlos

    2016-03-01

    The chromate ion transporter (CHR) superfamily includes proteins that confer chromate resistance by extruding toxic chromate ions from cytoplasm. Burkholderia xenovorans strain LB400 encodes six CHR homologues in its multireplicon genome and has been reported as highly chromate-resistant. The objective of this work was to analyze the involvement of chr redundant genes in chromate resistance by LB400. It was found that B. xenovorans plant rhizosphere strains lacking the megaplasmid are chromate-sensitive, suggesting that the chr gene present in this replicon is responsible for the chromate-resistance phenotype of the LB400 strain. Transformation of a chromate-sensitive B. xenovorans strain with each of the six cloned LB400 chr genes showed that genes from 'adaptive replicons' (chrA1b and chr1NCb from chromosome 2 and chrA2 from the megaplasmid) conferred higher chromate resistance levels than chr genes from 'central' chromosome 1 (chrA1a, chrA6, and chr1NCa). An LB400 insertion mutant affected in the chrA2 gene displayed a chromate-sensitive phenotype, which was fully reverted by transferring the chrA2 wild-type gene, and partially reverted by chrA1b or chr1NCb genes. These data indicate that chr genes from adaptive replicons, mainly chrA2 from the megaplasmid, are responsible for the B. xenovorans LB400 chromate-resistance phenotype.

  20. Characterization of the Maize Chitinase Genes and Their Effect on Aspergillus flavus and Aflatoxin Accumulation Resistance.

    PubMed

    Hawkins, Leigh K; Mylroie, J Erik; Oliveira, Dafne A; Smith, J Spencer; Ozkan, Seval; Windham, Gary L; Williams, W Paul; Warburton, Marilyn L

    2015-01-01

    Maize (Zea mays L.) is a crop of global importance, but prone to contamination by aflatoxins produced by fungi in the genus Aspergillus. The development of resistant germplasm and the identification of genes contributing to resistance would aid in the reduction of the problem with a minimal need for intervention by farmers. Chitinolytic enzymes respond to attack by potential pathogens and have been demonstrated to increase insect and fungal resistance in plants. Here, all chitinase genes in the maize genome were characterized via sequence diversity and expression patterns. Recent evolution within this gene family was noted. Markers from within each gene were developed and used to map the phenotypic effect on resistance of each gene in up to four QTL mapping populations and one association panel. Seven chitinase genes were identified that had alleles associated with increased resistance to aflatoxin accumulation and A. flavus infection in field grown maize. The chitinase in bin 1.05 identified a new and highly significant QTL, while chitinase genes in bins 2.04 and 5.03 fell directly beneath the peaks of previously published QTL. The expression patterns of these genes corroborate possible grain resistance mechanisms. Markers from within the gene sequences or very closely linked to them are presented to aid in the use of marker assisted selection to improve this trait. PMID:26090679

  1. Tetracycline and Phenicol Resistance Genes and Mechanisms: Importance for Agriculture, the Environment, and Humans.

    PubMed

    Roberts, Marilyn C; Schwarz, Stefan

    2016-03-01

    Recent reports have speculated on the future impact that antibiotic-resistant bacteria will have on food production, human health, and global economics. This review examines microbial resistance to tetracyclines and phenicols, antibiotics that are widely used in global food production. The mechanisms of resistance, mode of spread between agriculturally and human-impacted environments and ecosystems, distribution among bacteria, and the genes most likely to be associated with agricultural and environmental settings are included. Forty-six different tetracycline resistance () genes have been identified in 126 genera, with (M) having the broadest taxonomic distribution among all bacteria and (B) having the broadest coverage among the Gram-negative genera. Phenicol resistance genes are organized into 37 groups and have been identified in 70 bacterial genera. The review provides the latest information on tetracycline and phenicol resistance genes, including their association with mobile genetic elements in bacteria of environmental, medical, and veterinary relevance. Knowing what specific antibiotic-resistance genes (ARGs) are found in specific bacterial species and/or genera is critical when using a selective suite of ARGs for detection or surveillance studies. As detection methods move to molecular techniques, our knowledge about which type of bacteria carry which resistance gene(s) will become more important to ensure that the whole spectrum of bacteria are included in future surveillance studies. This review provides information needed to integrate the biology, taxonomy, and ecology of tetracycline- and phenicol-resistant bacteria and their resistance genes so that informative surveillance strategies can be developed and the correct genes selected.

  2. Development of High-Antifouling PPSU Ultrafiltration Membrane by Using Compound Additives: Preparation, Morphologies, and Filtration Resistant Properties.

    PubMed

    Liu, Jie; Zhong, Zhencheng; Ma, Rui; Zhang, Weichen; Li, Jiding

    2016-01-01

    In this study, flat sheet asymmetric polyphenylsulfone (PPSU) ultrafiltration membranes with enhanced antifouling properties were prepared with a non-solvent induced phase separation (NIPS) method through compound additives containing a polymeric pore-forming agent, a small molecular non-solvent and a surfactant. The formation processes of the porous asymmetric membranes with different kinds of additives were studied in detail, and the microstructure controllable preparation of membrane was achieved by establishing a bridge between the membrane preparation parameters and separation performances. All prepared membranes were characterized by using a scanning electron microscope (SEM), contact angle analysis, porosity, maximum pore size, water and BSA solution permeability studies. The performance efficiency of the membrane was evaluated by using BSA as a model foulant in terms of permeability, solute rejection (R), Rm (membrane inherent resistance), Rc (cake layer resistance), and Rp (pore plugging resistance). The results showed that when the compound additives were used, the inter-connected pores were observed, maximum pore size, contact angle and membrane filtration resistance decreased, while the porosity increased. When PVP compound additives were added, the water flux increased from 80.4 to 148.1 L/(m²·h), the BSA rejection increased from 53.2% to 81.5%. A similar trend was observed for membranes with added PEG compound additives; the water flux and BSA rejection simultaneously increased. The filtration resistance decreased as a result of compound additives. The uniformity of membrane and the number of effective pores could be enhanced by adding compound additives through the cooperation of different additives.

  3. Development of High-Antifouling PPSU Ultrafiltration Membrane by Using Compound Additives: Preparation, Morphologies, and Filtration Resistant Properties.

    PubMed

    Liu, Jie; Zhong, Zhencheng; Ma, Rui; Zhang, Weichen; Li, Jiding

    2016-01-01

    In this study, flat sheet asymmetric polyphenylsulfone (PPSU) ultrafiltration membranes with enhanced antifouling properties were prepared with a non-solvent induced phase separation (NIPS) method through compound additives containing a polymeric pore-forming agent, a small molecular non-solvent and a surfactant. The formation processes of the porous asymmetric membranes with different kinds of additives were studied in detail, and the microstructure controllable preparation of membrane was achieved by establishing a bridge between the membrane preparation parameters and separation performances. All prepared membranes were characterized by using a scanning electron microscope (SEM), contact angle analysis, porosity, maximum pore size, water and BSA solution permeability studies. The performance efficiency of the membrane was evaluated by using BSA as a model foulant in terms of permeability, solute rejection (R), Rm (membrane inherent resistance), Rc (cake layer resistance), and Rp (pore plugging resistance). The results showed that when the compound additives were used, the inter-connected pores were observed, maximum pore size, contact angle and membrane filtration resistance decreased, while the porosity increased. When PVP compound additives were added, the water flux increased from 80.4 to 148.1 L/(m²·h), the BSA rejection increased from 53.2% to 81.5%. A similar trend was observed for membranes with added PEG compound additives; the water flux and BSA rejection simultaneously increased. The filtration resistance decreased as a result of compound additives. The uniformity of membrane and the number of effective pores could be enhanced by adding compound additives through the cooperation of different additives. PMID:27338487

  4. Development of High-Antifouling PPSU Ultrafiltration Membrane by Using Compound Additives: Preparation, Morphologies, and Filtration Resistant Properties

    PubMed Central

    Liu, Jie; Zhong, Zhencheng; Ma, Rui; Zhang, Weichen; Li, Jiding

    2016-01-01

    In this study, flat sheet asymmetric polyphenylsulfone (PPSU) ultrafiltration membranes with enhanced antifouling properties were prepared with a non-solvent induced phase separation (NIPS) method through compound additives containing a polymeric pore-forming agent, a small molecular non-solvent and a surfactant. The formation processes of the porous asymmetric membranes with different kinds of additives were studied in detail, and the microstructure controllable preparation of membrane was achieved by establishing a bridge between the membrane preparation parameters and separation performances. All prepared membranes were characterized by using a scanning electron microscope (SEM), contact angle analysis, porosity, maximum pore size, water and BSA solution permeability studies. The performance efficiency of the membrane was evaluated by using BSA as a model foulant in terms of permeability, solute rejection (R), Rm (membrane inherent resistance), Rc (cake layer resistance), and Rp (pore plugging resistance). The results showed that when the compound additives were used, the inter-connected pores were observed, maximum pore size, contact angle and membrane filtration resistance decreased, while the porosity increased. When PVP compound additives were added, the water flux increased from 80.4 to 148.1 L/(m2·h), the BSA rejection increased from 53.2% to 81.5%. A similar trend was observed for membranes with added PEG compound additives; the water flux and BSA rejection simultaneously increased. The filtration resistance decreased as a result of compound additives. The uniformity of membrane and the number of effective pores could be enhanced by adding compound additives through the cooperation of different additives. PMID:27338487

  5. Detection of drug-resistance genes using single bronchoscopy biopsy specimens.

    PubMed

    Trussardi-Regnier, Aurelie; Millot, Jean-Marc; Gorisse, Marie-Claude; Delvincourt, Chantal; Prevost, Alain

    2007-09-01

    Expression of three major resistance genes MDR1, MRP1 and LRP was investigated in small cell lung cancer, non-small cell lung cancer and metastasis. Single biopsies of bronchoscopy from 73 patients were performed to investigate expression of these three resistance genes by reverse transcriptase-polymerase chain reaction. Relations between gene expression and patient age, smoking status, histology, and chemotherapy were evaluated. A more frequent expression of MDR1 (77 versus 66%), MRP1 (91 versus 72%) and LRP (77 versus 63%) genes was detected in the malignant biopsies than in the non-malignant, respectively. In the metastasis biopsies, expression of these genes was markedly increased. No significant difference was observed between specimens before and after chemotherapy. Biopsies from progressing cancer showed higher MDR1, MRP1 and LRP gene expression. In conclusion, these data reveal a major role of MRP1 in intrinsic resistance and the high gene expression of MDR1 and MRP1 in relapsed diseases.

  6. Genetic diversity of OXA-51-like genes among multidrug-resistant Acinetobacter baumannii in Riyadh, Saudi Arabia.

    PubMed

    Aly, M; Tayeb, H T; Al Johani, S M; Alyamani, E J; Aldughaishem, F; Alabdulkarim, I; Balkhy, H H

    2014-07-01

    We explore the genetic diversity of class D oxacillinases, including OXA-23, -24 (-40), -58 and, particularly, the intrinsic OXA-51-like genes, among multidrug-resistant (MDR) Acinetobacter baumannii strains from inpatients at a tertiary care hospital in Riyadh, Saudi Arabia. Sequence-based typing (SBT) of the OXA-51-like gene was carried out on 253 isolates. Selected isolates (n = 66) were subjected to multilocus sequence typing (MLST). The polymerase chain reaction (PCR) typing results showed that all isolates (n = 253) contained the OXA-51-like and OXA-23 genes. However, the OXA-58 gene was detected in five isolates. Further, none of the isolates had the OXA-40 (identical to the OXA-24) gene. SBT revealed a high OXA-51-like genotypic diversity and showed that all isolates were clustered into four main groups: OXA-66 (62.3 %), followed by OXA-69 (19.1 %), OXA-132 (7.6 %) and other OXA-51-like genes (10.3 %), including OXA-79, -82, -92, -131 and -197. MLST revealed four main sequence types (STs), 2, 19, 20 and 25, among the isolates, in addition to six isolates with newly designated ST194-ST197 singletons. Further, a high prevalence (81.4 %) of OXA-66 and OXA-69-like genes in A. baumannii was identified. More studies are essential in order to explore the molecular mechanisms that confer carbapenem-resistant phenotypes for A. baumannii isolates and to investigate the genetic diversity of other OXA-D genes.

  7. Occurrence and removal of antibiotic resistance genes in municipal wastewater and rural domestic sewage treatment systems in eastern China.

    PubMed

    Chen, Hong; Zhang, Mingmei

    2013-05-01

    Antibiotic resistance genes (ARGs) are emerging environmental contaminants and pose a threat to public health. In this study, four tetracycline resistance genes (tetM, tetO, tetQ and tetW) and two sulfonamide resistance genes (sulI and sulII) were evaluated in 4 municipal wastewater and 8 rural domestic sewage treatment systems with different wastewater handling abilities and treatment processes using quantitative polymerase chain reaction (qPCR). In the influents, the relative abundance of different ARGs showed significant variations among the sampling sites. In addition, significant correlations (tetQ: R(2)=0.712, P<0.05; tetO: R(2)=0.394, P<0.05) between the gene copy numbers and wastewater-receiving capacity were observed. Statistical analysis revealed a positive correlation (R(2)=0.756, P<0.05) between the gene copy numbers of sulI and intI1, whereas the gene numbers of tetM and sulI were strongly correlated with 16S rDNA. Significant reductions (1-3 orders of magnitude) in ARGs were observed in municipal wastewater treatment systems, but a smaller reduction was found in the rural domestic sewage treatment systems. These results provide insights into the occurrence and removal of ARGs in wastewater treatment systems in both rural and urban areas in eastern China.

  8. Targeted gene addition into a specified location in the human genome using designed zinc finger nucleases

    PubMed Central

    Moehle, Erica A.; Rock, Jeremy M.; Lee, Ya-Li; Jouvenot, Yann; DeKelver, Russell C.; Gregory, Philip D.; Urnov, Fyodor D.; Holmes, Michael C.

    2007-01-01

    Efficient incorporation of novel DNA sequences into a specific site in the genome of living human cells remains a challenge despite its potential utility to genetic medicine, biotechnology, and basic research. We find that a precisely placed double-strand break induced by engineered zinc finger nucleases (ZFNs) can stimulate integration of long DNA stretches into a predetermined genomic location, resulting in high-efficiency site-specific gene addition. Using an extrachromosomal DNA donor carrying a 12-bp tag, a 900-bp ORF, or a 1.5-kb promoter-transcription unit flanked by locus-specific homology arms, we find targeted integration frequencies of 15%, 6%, and 5%, respectively, within 72 h of treatment, and with no selection for the desired event. Importantly, we find that the integration event occurs in a homology-directed manner and leads to the accurate reconstruction of the donor-specified genotype at the endogenous chromosomal locus, and hence presumably results from synthesis-dependent strand annealing repair of the break using the donor DNA as a template. This site-specific gene addition occurs with no measurable increase in the rate of random integration. Remarkably, we also find that ZFNs can drive the addition of an 8-kb sequence carrying three distinct promoter-transcription units into an endogenous locus at a frequency of 6%, also in the absence of any selection. These data reveal the surprising versatility of the specialized polymerase machinery involved in double-strand break repair, illuminate a powerful approach to mammalian cell engineering, and open the possibility of ZFN-driven gene addition therapy for human genetic disease. PMID:17360608

  9. Structure, Function, Interaction, Co-evolution of Rice Blast Resistance Genes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Rice blast disease caused by the fungal pathogen Magnaporthe oryzae is one of the most destructive rice diseases worldwide. Resistance (R) genes to blast encode proteins that detect pathogen signaling molecules encoded by M. oryzae avirulence (AVR) genes. R genes can be a single or a member of clu...

  10. Natural variation of rice blast resistant gene Pi-ta in Oryza species

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The Pi-ta gene in rice is a putative NBS type cytoplasmic receptor conferring resistance to races of Magnaporthe oryzae in a gene-for-gene manner. A Functional Nucleotide Polymorphism (FNP) change resulting in an amino acid substitution of Alanine to Serine at position 918 (nucleotide G to T at posi...

  11. Risk assessment for Helicoverpa zea (Lepidoptera: Noctuidae) resistance on dual-gene versus single-gene corn

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Recent changes in EPA regulations have prompted concern in some experts that transgenic corn expressing two lepidopteran-active genes from the soil bacterium Bacillus thuringiensis (Bt) (dual-gene) may result in more rapid selection for resistance in Helicoverpa zea (Boddie) than corn expressing a s...

  12. An aphid-resistance locus is tightly linked to the nematode-resistance gene, Mi, in tomato.

    PubMed Central

    Kaloshian, I; Lange, W H; Williamson, V M

    1995-01-01

    Tomato lines from diverse breeding programs were evaluated in the field for resistance to a natural infestation of the potato aphid, Macrosiphum euphorbiae, in Davis, CA. It was noted that all lines that carried the nematode-resistance gene, Mi, displayed aphid resistance. A greenhouse assay for aphid resistance was developed to investigate this relationship. Association of nematode and aphid resistances in near-isogenic lines suggested that these traits are tightly linked. Analysis of an F2 population segregating for nematode resistance indicated that aphid resistance segregated as a single major locus genetically linked to Mi. The name Meu1 is proposed for this locus. It is likely that Meu1 was introduced into tomato along with Mi from the wild species Lycopersicon peruvianum. The presence of aphid resistance in the line Motelle, which contains a very small region of introgressed DNA, and the lack of recombinants suggest that Meu1 is tightly linked to Mi or possibly is the same gene. The map-based strategy currently being used to clone Mi should be applicable to cloning Meu1. Images Fig. 1 PMID:11607509

  13. Distribution of specific tetracycline and erythromycin resistance genes in environmental samples assessed by macroarray detection.

    PubMed

    Patterson, Andrea J; Colangeli, Roberto; Spigaglia, Patrizia; Scott, Karen P

    2007-03-01

    A macroarray system was developed to screen environmental samples for the presence of specific tetracycline (Tc(R)) and erythromycin (erm(R)) resistance genes. The macroarray was loaded with polymerase chain reaction (PCR) amplicons of 23 Tc(R) genes and 10 erm(R) genes. Total bacterial genomic DNA was extracted from soil and animal faecal samples collected from different European countries. Macroarray hybridization was performed under stringent conditions and the results were analysed by fluorescence scanning. Pig herds in Norway, reared without antibiotic use, had a significantly lower incidence of antibiotic resistant bacteria than those reared in other European countries, and organic herds contained lower numbers of resistant bacteria than intensively farmed animals. The relative proportions of the different genes were constant across the different countries. Ribosome protection type Tc(R) genes were the most common resistance genes in animal faecal samples, with the tet(W) gene the most abundant, followed by tet(O) and tet(Q). Different resistance genes were present in soil samples, where erm(V) and erm(E) were the most prevalent followed by the efflux type Tc(R) genes. The macroarray proved a powerful tool to screen DNA extracted from environmental samples to identify the most abundant Tc(R) and erm(R) genes within those tested, avoiding the need for culturing and biased PCR amplification steps.

  14. Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants

    SciTech Connect

    Somerville, Chris R.; Scieble, Wolf

    2000-10-11

    Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  15. Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

    DOEpatents

    Somerville, Chris R.; Scheible, Wolf

    2007-07-10

    Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  16. Plant eR Genes That Encode Photorespiratory Enzymes Confer Resistance against Disease

    PubMed Central

    Taler, Dvir; Galperin, Marjana; Benjamin, Ido; Cohen, Yigal; Kenigsbuch, David

    2004-01-01

    Downy mildew caused by the oomycete pathogen Pseudoperonospora cubensis is a devastating foliar disease of cucurbits worldwide. We previously demonstrated that the wild melon line PI 124111F (PI) is highly resistant to all pathotypes of P. cubensis. That resistance was controlled genetically by two partially dominant, complementary loci. Here, we show that unlike other plant disease resistance genes, which confer an ability to resist infection by pathogens expressing corresponding avirulence genes, the resistance of PI to P. cubensis is controlled by enhanced expression of the enzymatic resistance (eR) genes At1 and At2. These constitutively expressed genes encode the photorespiratory peroxisomal enzyme proteins glyoxylate aminotransferases. The low expression of At1 and At2 in susceptible melon lines is regulated mainly at the transcriptional level. This regulation is independent of infection with the pathogen. Transgenic melon plants overexpressing either of these eR genes displayed enhanced activity of glyoxylate aminotransferases and remarkable resistance against P. cubensis. The cloned eR genes provide a new resource for developing downy mildew–resistant melon varieties. PMID:14688292

  17. sugE: A gene involved in tributyltin (TBT) resistance of Aeromonas molluscorum Av27.

    PubMed

    Cruz, Andreia; Micaelo, Nuno; Félix, Vitor; Song, Jun-Young; Kitamura, Shin-Ichi; Suzuki, Satoru; Mendo, Sónia

    2013-01-01

    The mechanism of bacterial resistance to tributyltin (TBT) is still unclear. The results herein presented contribute to clarify that mechanism in the TBT-resistant bacterium Aeromonas molluscorum Av27. We have identified and cloned a new gene that is involved in TBT resistance in this strain. The gene is highly homologous (84%) to the Aeromonas hydrophila-sugE gene belonging to the small multidrug resistance gene family (SMR), which includes genes involved in the transport of lipophilic drugs. In Av27, expression of the Av27-sugE was observed at the early logarithmic growth phase in the presence of a high TBT concentration (500 μM), thus suggesting the contribution of this gene for TBT resistance. E. coli cells transformed with Av27-sugE become resistant to ethidium bromide (EtBr), chloramphenicol (CP) and tetracycline (TE), besides TBT. According to the Moriguchi logP (miLogP) values, EtBr, CP and TE have similar properties and are substrates for the sugE-efflux system. Despite the different miLogP of TBT, E. coli cells transformed with Av27-sugE become resistant to this compound. So it seems that TBT is also a substrate for the SugE protein. The modelling studies performed also support this hypothesis. The data herein presented clearly indicate that sugE is involved in TBT resistance of this bacterium.

  18. A functional variomics tool for discovering drug resistance genes and drug targets

    PubMed Central

    Huang, Zhiwei; Chen, Kaifu; Zhang, Jianhuai; Li, Yongxiang; Wang, Hui; Cui, Dandan; Tang, Jiangwu; Liu, Yong; Shi, Xiaomin; Li, Wei; Liu, Dan; Chen, Rui; Sucgang, Richard S.; Pan, Xuewen

    2013-01-01

    Comprehensive discovery of genetic mechanisms of drug resistance and identification of in vivo drug targets represent significant challenges. Here we present a functional variomics technology in the model organism Saccharomyces cerevisiae. This tool analyzes numerous genetic variants and effectively tackles both problems simultaneously. Using this tool, we discovered almost all genes that, due to mutations or modest overexpression, confer resistance to rapamycin, cycloheximide, and amphotericin B. Most significant among the resistance genes were drug targets, including multiple targets of a given drug. With amphotericin B, we discovered the highly conserved membrane protein Pmp3 as a potent resistance factor and a possible novel target. Widespread application of this tool should allow rapid identification of conserved resistance mechanisms and targets of many more compounds. New genes and alleles that confer resistance to other stresses can also be discovered. Similar tools in other systems such as human cell lines will also be useful. PMID:23416056

  19. Shotgun metagenomics reveals a wide array of antibiotic resistance genes and mobile elements in a polluted lake in India

    PubMed Central

    Bengtsson-Palme, Johan; Boulund, Fredrik; Fick, Jerker; Kristiansson, Erik; Larsson, D. G. Joakim

    2014-01-01

    There is increasing evidence for an environmental origin of many antibiotic resistance genes. Consequently, it is important to identify environments of particular risk for selecting and maintaining such resistance factors. In this study, we described the diversity of antibiotic resistance genes in an Indian lake subjected to industrial pollution with fluoroquinolone antibiotics. We also assessed the genetic context of the identified resistance genes, to try to predict their genetic transferability. The lake harbored a wide range of resistance genes (81 identified gene types) against essentially every major class of antibiotics, as well as genes responsible for mobilization of genetic material. Resistance genes were estimated to be 7000 times more abundant than in a Swedish lake included for comparison, where only eight resistance genes were found. The sul2 and qnrD genes were the most common resistance genes in the Indian lake. Twenty-six known and 21 putative novel plasmids were recovered in the Indian lake metagenome, which, together with the genes found, indicate a large potential for horizontal gene transfer through conjugation. Interestingly, the microbial community of the lake still included a wide range of taxa, suggesting that, across most phyla, bacteria has adapted relatively well to this highly polluted environment. Based on the wide range and high abundance of known resistance factors we have detected, it is plausible that yet unrecognized resistance genes are also present in the lake. Thus, we conclude that environments polluted with waste from antibiotic manufacturing could be important reservoirs for mobile antibiotic resistance genes. PMID:25520706

  20. Genetic linkage analysis to identify a gene required for the addition of phosphoethanolamine to meningococcal lipopolysaccharide.

    PubMed

    Tang, Christoph M; Stroud, Dave; Mackinnon, Fiona; Makepeace, Katherine; Plested, Joyce; Moxon, E Richard; Chalmers, Ronald

    2002-02-01

    Lipopolysaccharide (LPS) is important for the virulence of Neisseria meningitidis, and is the target of immune responses. We took advantage of a monoclonal antibody (Mab B5) that recognises phosphoethanolamine (PEtn) attached to the inner core of meningococcal LPS to identify genes required for the addition of PEtn to LPS. Insertional mutants that lost Mab B5 reactivity were isolated and characterised, but failed to yield genes directly responsible for PEtn substitution. Subsequent genetic linkage analysis was used to define a region of DNA containing a single intact open reading frame which is sufficient to confer B5 reactivity to a B5 negative meningococcal isolate. The results provide an initial characterisation of the genetic basis of a key, immunodominant epitope of meningococcal LPS.

  1. SSTAR, a Stand-Alone Easy-To-Use Antimicrobial Resistance Gene Predictor.

    PubMed

    de Man, Tom J B; Limbago, Brandi M

    2016-01-01

    We present the easy-to-use Sequence Search Tool for Antimicrobial Resistance, SSTAR. It combines a locally executed BLASTN search against a customizable database with an intuitive graphical user interface for identifying antimicrobial resistance (AR) genes from genomic data. Although the database is initially populated from a public repository of acquired resistance determinants (i.e., ARG-ANNOT), it can be customized for particular pathogen groups and resistance mechanisms. For instance, outer membrane porin sequences associated with carbapenem resistance phenotypes can be added, and known intrinsic mechanisms can be included. Unique about this tool is the ability to easily detect putative new alleles and truncated versions of existing AR genes. Variants and potential new alleles are brought to the attention of the user for further investigation. For instance, SSTAR is able to identify modified or truncated versions of porins, which may be of great importance in carbapenemase-negative carbapenem-resistant Enterobacteriaceae. SSTAR is written in Java and is therefore platform independent and compatible with both Windows and Unix operating systems. SSTAR and its manual, which includes a simple installation guide, are freely available from https://github.com/tomdeman-bio/Sequence-Search-Tool-for-Antimicrobial-Resistance-SSTAR-. IMPORTANCE Whole-genome sequencing (WGS) is quickly becoming a routine method for identifying genes associated with antimicrobial resistance (AR). However, for many microbiologists, the use and analysis of WGS data present a substantial challenge. We developed SSTAR, software with a graphical user interface that enables the identification of known AR genes from WGS and has the unique capacity to easily detect new variants of known AR genes, including truncated protein variants. Current software solutions do not notify the user when genes are truncated and, therefore, likely nonfunctional, which makes phenotype predictions less accurate. SSTAR

  2. Genome-Wide Scan and Test of Candidate Genes in the Snail Biomphalaria glabrata Reveal New Locus Influencing Resistance to Schistosoma mansoni

    PubMed Central

    Tennessen, Jacob A.; Bonner, Kaitlin M.; Bollmann, Stephanie R.; Johnstun, Joel A.; Yeh, Jan-Ying; Marine, Melanie; Tavalire, Hannah F.; Bayne, Christopher J.; Blouin, Michael S.

    2015-01-01

    Background New strategies to combat the global scourge of schistosomiasis may be revealed by increased understanding of the mechanisms by which the obligate snail host can resist the schistosome parasite. However, few molecular markers linked to resistance have been identified and characterized in snails. Methodology/Principal Findings Here we test six independent genetic loci for their influence on resistance to Schistosoma mansoni strain PR1 in the 13-16-R1 strain of the snail Biomphalaria glabrata. We first identify a genomic region, RADres, showing the highest differentiation between susceptible and resistant inbred lines among 1611 informative restriction-site associated DNA (RAD) markers, and show that it significantly influences resistance in an independent set of 439 outbred snails. The additive effect of each RADres resistance allele is 2-fold, similar to that of the previously identified resistance gene sod1. The data fit a model in which both loci contribute independently and additively to resistance, such that the odds of infection in homozygotes for the resistance alleles at both loci (13% infected) is 16-fold lower than the odds of infection in snails without any resistance alleles (70% infected). Genome-wide linkage disequilibrium is high, with both sod1 and RADres residing on haplotype blocks >2Mb, and with other markers in each block also showing significant effects on resistance; thus the causal genes within these blocks remain to be demonstrated. Other candidate loci had no effect on resistance, including the Guadeloupe Resistance Complex and three genes (aif, infPhox, and prx1) with immunological roles and expression patterns tied to resistance, which must therefore be trans-regulated. Conclusions/Significance The loci RADres and sod1 both have strong effects on resistance to S. mansoni. Future approaches to control schistosomiasis may benefit from further efforts to characterize and harness this natural genetic variation. PMID:26372103