Science.gov

Sample records for additional sequence elements

  1. A simplified soil extraction sequence to monitor the main and trace element speciation in soil after compost and mineral fertilizer additions upon the composition of wheat grains

    NASA Astrophysics Data System (ADS)

    Sager, Manfred; Erhart, Eva

    2016-04-01

    High quality biological waste treatment aims at producing compost in order to maintain a clean environment and to sustain soil organic carbon levels. Fertilization with compost as a source of organic carbon, nutrients, and accessory elements, as well as fertilization with mineral N- and PK fertilizer have been tested in a field experiment on a calcaric Fluvisol in the Danube wetlands, at 4 levels each. Yields of wheat were recorded, and grains and soils were sampled from each treatment, and analyzed for main and trace element composition. The corresponding soils were characterized by mobile phases, obtained by leaching with 0,16M acetic acid to cover exchangeables plus carbonates, and subsequently by 0,1M oxalate buffer pH 3 to dissolve the pedogenic oxides. Total amounts were obtained from digests with perchloric- nitric-hydrofluoric acid. For quasi-total amounts, aqua regia was replaced by pressure decomposition with KClO3 in dilute nitric acid. The proposed extraction sequence permits to analyze and interpret soil for main elements, trace elements, nutrients and anions simultaneously. Factor analyses of soil extracts obtained from dilute acetic acid revealed Ba-Be-Cd-Cu-Li-S (traces), Ca-Mg-Mn (main carbonates), Al-Fe-B, Y, and P-K (nutrients) as chemically feasible principal components. Subsequent soil extracts from oxalate contained Al-B-Co-K-Na-Pb-Si-V-S (maybe acid silicate weathering), Cr-Li-Ni-Sr-Ti (maybe basic silicate weathering), Be-Cu-Fe-P, Co-Mg-Mn-Zn (Mn-oxides) and Ba-Sc as principal components. Factor analyses of total element data distinguished the principal components Ce-La-Li-Sc-Y-P (rare earths), Al-Ca-Fe-K-Mg-Na-P (main elements), Cd-Co-Cr-Cu-Ni-Zn (trace elements), As-Pb (contaminants), Ba-Mn-Sr, and Ti, which looks chemically feasible also. Factor analyses of those soil fractions which presumably form the main fractions of exchangeables, carbonates, pedogenic oxides and silicates, showed no cross connections, except for P. Oxalate

  2. Insertion sequence elements in Lactococcus garvieae.

    PubMed

    Eraclio, Giovanni; Ricci, Giovanni; Fortina, Maria Grazia

    2015-01-25

    Insertion sequences are the simplest intracellular Mobile Genetic Elements which can occur in very high numbers in prokaryotic genomes, where they play an important evolutionary role by promoting genome plasticity. As such, the studies on the diversity and distribution of insertion sequences in genomes not yet investigated can contribute to improve the knowledge on a bacterial species and to identify new transposable elements. The present work describes the occurrence of insertion sequences in Lactococcus garvieae, an opportunistic emerging zoonotic and human pathogen, also associated with different food matrices. To date, no insertion elements have been described for L. garvieae in the IS element database. The analysis of the twelve published L. garvieae genomes identified 15 distinct insertion sequences that are members of the IS3, IS982, IS6, IS21 and IS256 families, including five new elements. Most of the insertion sequences in L. garvieae show substantial homology to the Lactococcus lactis elements, suggesting the movement of IS between these two species phylogenetically closely related. ISLL6 elements belonging to IS3 family were most abundant, with several copies distributed in 9 of the 12 genomes analyzed. An alignment analysis of two complete genomes carrying multi-copies of this insertion sequence indicates a possible involvement of ISLL6 in chromosomal rearrangement.

  3. LINE-1 retrotransposons: from 'parasite' sequences to functional elements.

    PubMed

    Paço, Ana; Adega, Filomena; Chaves, Raquel

    2015-02-01

    Long interspersed nuclear elements-1 (LINE-1) are the most abundant and active retrotransposons in the mammalian genomes. Traditionally, the occurrence of LINE-1 sequences in the genome of mammals has been explained by the selfish DNA hypothesis. Nevertheless, recently, it has also been argued that these sequences could play important roles in these genomes, as in the regulation of gene expression, genome modelling and X-chromosome inactivation. The non-random chromosomal distribution is a striking feature of these retroelements that somehow reflects its functionality. In the present study, we have isolated and analysed a fraction of the open reading frame 2 (ORF2) LINE-1 sequence from three rodent species, Cricetus cricetus, Peromyscus eremicus and Praomys tullbergi. Physical mapping of the isolated sequences revealed an interspersed longitudinal AT pattern of distribution along all the chromosomes of the complement in the three genomes. A detailed analysis shows that these sequences are preferentially located in the euchromatic regions, although some signals could be detected in the heterochromatin. In addition, a coincidence between the location of imprinted gene regions (as Xist and Tsix gene regions) and the LINE-1 retroelements was also observed. According to these results, we propose an involvement of LINE-1 sequences in different genomic events as gene imprinting, X-chromosome inactivation and evolution of repetitive sequences located at the heterochromatic regions (e.g. satellite DNA sequences) of the rodents' genomes analysed.

  4. Methanogenesis from wastewater stimulated by addition of elemental manganese

    PubMed Central

    Qiao, Sen; Tian, Tian; Qi, Benyu; Zhou, Jiti

    2015-01-01

    This study presents a novel procedure for accelerating methanogenesis from wastewater by adding elemental manganese into the anaerobic digestion system. The results indicated that elemental manganese effectively enhanced both the methane yield and the production rate. Compared to the control test without elemental manganese, the total methane yield and production rate with 4 g/L manganese addition increased 3.4-fold (from 0.89 ± 0.03 to 2.99 ± 0.37 M/gVSS within 120 h) and 4.4-fold (from 6.2 ± 0.1 to 27.2 ± 2.2 mM/gVSS/h), respectively. Besides, more acetate consumption and less propionate generation were observed during the methanogenesis with manganese. Further studies demonstrated that the elemental manganese served as electron donors for the methanogenesis from carbon dioxide, and the final proportion of methane in the total generated gas with 4 g/L manganese addition reached 96.9%, which was 2.1-fold than that of the control (46.6%). PMID:26244609

  5. Motor programming when sequencing multiple elements of the same duration.

    PubMed

    Magnuson, Curt E; Robin, Donald A; Wright, David L

    2008-11-01

    Motor programming at the self-select paradigm was adopted in 2 experiments to examine the processing demands of independent processes. One process (INT) is responsible for organizing the internal features of the individual elements in a movement (e.g., response duration). The 2nd process (SEQ) is responsible for placing the elements into the proper serial order before execution. Participants in Experiment 1 performed tasks involving 1 key press or sequences of 4 key presses of the same duration. Implementing INT and SEQ was more time consuming for key-pressing sequences than for single key-press tasks. Experiment 2 examined whether the INT costs resulting from the increase in sequence length observed in Experiment 1 resulted from independent planning of each sequence element or via a separate "multiplier" process that handled repetitions of elements of the same duration. Findings from Experiment 2, in which participants performed single key presses or double or triple key sequences of the same duration, suggested that INT is involved with the independent organization of each element contained in the sequence. Researchers offer an elaboration of the 2-process account of motor programming to incorporate the present findings and the findings from other recent sequence-learning research.

  6. Multigenome DNA sequence conservation identifies Hox cis-regulatory elements

    PubMed Central

    Kuntz, Steven G.; Schwarz, Erich M.; DeModena, John A.; De Buysscher, Tristan; Trout, Diane; Shizuya, Hiroaki; Sternberg, Paul W.; Wold, Barbara J.

    2008-01-01

    To learn how well ungapped sequence comparisons of multiple species can predict cis-regulatory elements in Caenorhabditis elegans, we made such predictions across the large, complex ceh-13/lin-39 locus and tested them transgenically. We also examined how prediction quality varied with different genomes and parameters in our comparisons. Specifically, we sequenced ∼0.5% of the C. brenneri and C. sp. 3 PS1010 genomes, and compared five Caenorhabditis genomes (C. elegans, C. briggsae, C. brenneri, C. remanei, and C. sp. 3 PS1010) to find regulatory elements in 22.8 kb of noncoding sequence from the ceh-13/lin-39 Hox subcluster. We developed the MUSSA program to find ungapped DNA sequences with N-way transitive conservation, applied it to the ceh-13/lin-39 locus, and transgenically assayed 21 regions with both high and low degrees of conservation. This identified 10 functional regulatory elements whose activities matched known ceh-13/lin-39 expression, with 100% specificity and a 77% recovery rate. One element was so well conserved that a similar mouse Hox cluster sequence recapitulated the native nematode expression pattern when tested in worms. Our findings suggest that ungapped sequence comparisons can predict regulatory elements genome-wide. PMID:18981268

  7. Epigenetic nucleosomes: Alu sequences and CG as nucleosome positioning element.

    PubMed

    Salih, F; Salih, B; Kogan, S; Trifonov, E N

    2008-08-01

    Alu sequences carry periodical pattern with CG dinucleotides (CpG) repeating every 31-32 bases. Similar distances are observed in distribution of DNA curvature in crystallized nucleosomes, at positions +/-1.5 and +/-4.5 periods of DNA from nucleosome DNA dyad. Since CG elements are also found to impart to nucleosomes higher stability when positioned at +/-1.5 sites, it suggests that CG dinucleotides may play a role in modulation of the nucleosome strength when the CG elements are methylated. Thus, Alu sequences may harbor special epigenetic nucleosomes with methylation-dependent regulatory functions. Nucleosome DNA sequence probe is suggested to detect locations of such regulatory nucleosomes in the sequences.

  8. Close Sequence Comparisons are Sufficient to Identify Humancis-Regulatory Elements

    SciTech Connect

    Prabhakar, Shyam; Poulin, Francis; Shoukry, Malak; Afzal, Veena; Rubin, Edward M.; Couronne, Olivier; Pennacchio, Len A.

    2005-12-01

    Cross-species DNA sequence comparison is the primary method used to identify functional noncoding elements in human and other large genomes. However, little is known about the relative merits of evolutionarily close and distant sequence comparisons, due to the lack of a universal metric for sequence conservation, and also the paucity of empirically defined benchmark sets of cis-regulatory elements. To address this problem, we developed a general-purpose algorithm (Gumby) that detects slowly-evolving regions in primate, mammalian and more distant comparisons without requiring adjustment of parameters, and ranks conserved elements by P-value using Karlin-Altschul statistics. We benchmarked Gumby predictions against previously identified cis-regulatory elements at diverse genomic loci, and also tested numerous extremely conserved human-rodent sequences for transcriptional enhancer activity using reporter-gene assays in transgenic mice. Human regulatory elements were identified with acceptable sensitivity and specificity by comparison with 1-5 other eutherian mammals or 6 other simian primates. More distant comparisons (marsupial, avian, amphibian and fish) failed to identify many of the empirically defined functional noncoding elements. We derived an intuitive relationship between ancient and recent noncoding sequence conservation from whole genome comparative analysis, which explains some of these findings. Lastly, we determined that, in addition to strength of conservation, genomic location and/or density of surrounding conserved elements must also be considered in selecting candidate enhancers for testing at embryonic time points.

  9. Computational identification of transcriptional regulatory elements in DNA sequence

    PubMed Central

    GuhaThakurta, Debraj

    2006-01-01

    Identification and annotation of all the functional elements in the genome, including genes and the regulatory sequences, is a fundamental challenge in genomics and computational biology. Since regulatory elements are frequently short and variable, their identification and discovery using computational algorithms is difficult. However, significant advances have been made in the computational methods for modeling and detection of DNA regulatory elements. The availability of complete genome sequence from multiple organisms, as well as mRNA profiling and high-throughput experimental methods for mapping protein-binding sites in DNA, have contributed to the development of methods that utilize these auxiliary data to inform the detection of transcriptional regulatory elements. Progress is also being made in the identification of cis-regulatory modules and higher order structures of the regulatory sequences, which is essential to the understanding of transcription regulation in the metazoan genomes. This article reviews the computational approaches for modeling and identification of genomic regulatory elements, with an emphasis on the recent developments, and current challenges. PMID:16855295

  10. Telomerase RNA stem terminus element affects template boundary element function, telomere sequence, and shelterin binding.

    PubMed

    Webb, Christopher J; Zakian, Virginia A

    2015-09-08

    The stem terminus element (STE), which was discovered 13 y ago in human telomerase RNA, is required for telomerase activity, yet its mode of action is unknown. We report that the Schizosaccharomyces pombe telomerase RNA, TER1 (telomerase RNA 1), also contains a STE, which is essential for telomere maintenance. Cells expressing a partial loss-of-function TER1 STE allele maintained short stable telomeres by a recombination-independent mechanism. Remarkably, the mutant telomere sequence was different from that of wild-type cells. Generation of the altered sequence is explained by reverse transcription into the template boundary element, demonstrating that the STE helps maintain template boundary element function. The altered telomeres bound less Pot1 (protection of telomeres 1) and Taz1 (telomere-associated in Schizosaccharomyces pombe 1) in vivo. Thus, the S. pombe STE, although distant from the template, ensures proper telomere sequence, which in turn promotes proper assembly of the shelterin complex.

  11. Addition of higher order plate and shell elements into NASTRAN computer program

    NASA Technical Reports Server (NTRS)

    Narayanaswami, R.; Goglia, G. L.

    1976-01-01

    Two higher order plate elements, the linear strain triangular membrane element and the quintic bending element, along with a shallow shell element, suitable for inclusion into the NASTRAN (NASA Structural Analysis) program are described. Additions to the NASTRAN Theoretical Manual, Users' Manual, Programmers' Manual and the NASTRAN Demonstration Problem Manual, for inclusion of these elements into the NASTRAN program are also presented.

  12. Bifunctional air electrodes containing elemental iron powder charging additive

    DOEpatents

    Liu, Chia-tsun; Demczyk, Brian G.; Gongaware, Paul R.

    1982-01-01

    A bifunctional air electrode for use in electrochemical energy cells is made, comprising a hydrophilic layer and a hydrophobic layer, where the hydrophilic layer essentially comprises a hydrophilic composite which includes: (i) carbon; (ii) elemental iron particles having a particle size of between about 25 microns and about 700 microns diameter; (iii) an oxygen evolution material; (iv) a nonwetting agent; and (v) a catalyst, where at least one current collector is formed into said composite.

  13. Identification of an insertion sequence-like element in a subspecies of Mycobacterium kansasii.

    PubMed Central

    Yang, M; Ross, B C; Dwyer, B

    1993-01-01

    Analysis of a genomic DNA clone library of a strain from the genetic subspecies of Mycobacterium kansasii determined the existence of a repetitive insertion sequence-like element. The element is 947 bp long and is present in a minimum of 1 to 11 copies per genome. Similar to insertion sequences, it contains a 3-bp (TAG) direct repeat at its extremities and a transcription promoter-like sequence. In addition, for one of the clones sequenced, a potential cointegrate formation, a characteristic frequently observed with insertion sequences, was revealed. This insertion sequence does not contain short inverted repeats near the ends or a large open reading frame to code for a transposase enzyme. Its host range is restricted to a previously described genetic subspecies of M. kansasii and is not present in typical M. kansasii or other mycobacterial species. When used as a probe for Southern blot hybridization, significant heterogeneity between different isolates of the M. kansasii subspecies was observed. This repeated element will be useful in further studies on the characterization, diagnosis, and epidemiology of M. kansasii. Images PMID:8396588

  14. 41 CFR 60-2.17 - Additional required elements of affirmative action programs.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... elements of affirmative action programs. 60-2.17 Section 60-2.17 Public Contracts and Property Management... Action Programs § 60-2.17 Additional required elements of affirmative action programs. In addition to the elements required by § 60-2.10 through § 60-2.16, an acceptable affirmative action program must include...

  15. Genome Sequences of Five Additional Brevibacillus laterosporus Bacteriophages

    PubMed Central

    Merrill, Bryan D.; Berg, Jordan A.; Graves, Kiel A.; Ward, Andy T.; Hilton, Jared A.; Wake, Braden N.; Grose, Julianne H.; Breakwell, Donald P.

    2015-01-01

    Brevibacillus laterosporus has been isolated from many different environments, including beehives, and produces compounds that are toxic to many organisms. Five B. laterosporus phages have been isolated previously. Here, we announce five additional phages that infect this bacterium, including the first B. laterosporus siphoviruses to be discovered. PMID:26494658

  16. Genome Sequences of Five Additional Brevibacillus laterosporus Bacteriophages.

    PubMed

    Merrill, Bryan D; Berg, Jordan A; Graves, Kiel A; Ward, Andy T; Hilton, Jared A; Wake, Braden N; Grose, Julianne H; Breakwell, Donald P; Burnett, Sandra H

    2015-10-22

    Brevibacillus laterosporus has been isolated from many different environments, including beehives, and produces compounds that are toxic to many organisms. Five B. laterosporus phages have been isolated previously. Here, we announce five additional phages that infect this bacterium, including the first B. laterosporus siphoviruses to be discovered.

  17. Additive Manufacturing of Functional Elements on Sheet Metal

    NASA Astrophysics Data System (ADS)

    Schaub, Adam; Ahuja, Bhrigu; Butzhammer, Lorenz; Osterziel, Johannes; Schmidt, Michael; Merklein, Marion

    Laser Beam Melting (LBM) process with its advantages of high design flexibility and free form manufacturing methodology is often applied limitedly due to its low productivity and unsuitability for mass production compared to conventional manufacturing processes. In order to overcome these limitations, a hybrid manufacturing methodology is developed combining the additive manufacturing process of laser beam melting with sheet forming processes. With an interest towards aerospace and medical industry, the material in focus is Ti-6Al-4V. Although Ti-6Al-4V is a commercially established material and its application for LBM process has been extensively investigated, the combination of LBM of Ti-6Al-4V with sheet metal still needs to be researched. Process dynamics such as high temperature gradients and thermally induced stresses lead to complex stress states at the interaction zone between the sheet and LBM structure. Within the presented paper mechanical characterization of hybrid parts will be performed by shear testing. The association of shear strength with process parameters is further investigated by analyzing the internal structure of the hybrid geometry at varying energy inputs during the LBM process. In order to compare the hybrid manufacturing methodology with conventional fabrication, the conventional methodologies subtractive machining and state of the art Laser Beam Melting is evaluated within this work. These processes will be analyzed for their mechanical characteristics and productivity by determining the build time and raw material consumption for each case. The paper is concluded by presenting the characteristics of the hybrid manufacturing methodology compared to alternative manufacturing technologies.

  18. Reporting of NSC Additional (A2) Data Elements. Updated July 29, 2014

    ERIC Educational Resources Information Center

    National Student Clearinghouse, 2014

    2014-01-01

    Since the 2008-09 academic year, the National Student Clearinghouse has provided its participating institutions with the option to include 13 additional data elements in their enrollment submissions. These additional data elements help make Clearinghouse data more comprehensive and enable StudentTracker? participants to utilize a more robust data…

  19. Sequence Capture and Phylogenetic Utility of Genomic Ultraconserved Elements Obtained from Pinned Insect Specimens

    PubMed Central

    Lloyd, Michael W.; Guillory, Wilson X.; Brady, Seán G.

    2016-01-01

    Obtaining sequence data from historical museum specimens has been a growing research interest, invigorated by next-generation sequencing methods that allow inputs of highly degraded DNA. We applied a target enrichment and next-generation sequencing protocol to generate ultraconserved elements (UCEs) from 51 large carpenter bee specimens (genus Xylocopa), representing 25 species with specimen ages ranging from 2–121 years. We measured the correlation between specimen age and DNA yield (pre- and post-library preparation DNA concentration) and several UCE sequence capture statistics (raw read count, UCE reads on target, UCE mean contig length and UCE locus count) with linear regression models. We performed piecewise regression to test for specific breakpoints in the relationship of specimen age and DNA yield and sequence capture variables. Additionally, we compared UCE data from newer and older specimens of the same species and reconstructed their phylogeny in order to confirm the validity of our data. We recovered 6–972 UCE loci from samples with pre-library DNA concentrations ranging from 0.06–9.8 ng/μL. All investigated DNA yield and sequence capture variables were significantly but only moderately negatively correlated with specimen age. Specimens of age 20 years or less had significantly higher pre- and post-library concentrations, UCE contig lengths, and locus counts compared to specimens older than 20 years. We found breakpoints in our data indicating a decrease of the initial detrimental effect of specimen age on pre- and post-library DNA concentration and UCE contig length starting around 21–39 years after preservation. Our phylogenetic results confirmed the integrity of our data, giving preliminary insights into relationships within Xylocopa. We consider the effect of additional factors not measured in this study on our age-related sequence capture results, such as DNA fragmentation and preservation method, and discuss the promise of the UCE

  20. Sequence capture and next-generation sequencing of ultraconserved elements in a large-genome salamander.

    PubMed

    Newman, Catherine E; Austin, Christopher C

    2016-12-01

    Amidst the rapid advancement in next-generation sequencing (NGS) technology over the last few years, salamanders have been left behind. Salamanders have enormous genomes-up to 40 times the size of the human genome-and this poses challenges to generating NGS data sets of quality and quantity similar to those of other vertebrates. However, optimization of laboratory protocols is time-consuming and often cost prohibitive, and continued omission of salamanders from novel phylogeographic research is detrimental to species facing decline. Here, we use a salamander endemic to the southeastern United States, Plethodon serratus, to test the utility of an established protocol for sequence capture of ultraconserved elements (UCEs) in resolving intraspecific phylogeographic relationships and delimiting cryptic species. Without modifying the standard laboratory protocol, we generated a data set consisting of over 600 million reads for 85 P. serratus samples. Species delimitation analyses support recognition of seven species within P. serratus sensu lato, and all phylogenetic relationships among the seven species are fully resolved under a coalescent model. Results also corroborate previous data suggesting nonmonophyly of the Ouachita and Louisiana regions. Our results demonstrate that established UCE protocols can successfully be used in phylogeographic studies of salamander species, providing a powerful tool for future research on evolutionary history of amphibians and other organisms with large genomes.

  1. Four major sequence elements of simian virus 40 large T antigen coordinate its specific and nonspecific DNA binding.

    PubMed Central

    Simmons, D T; Loeber, G; Tegtmeyer, P

    1990-01-01

    By mutational analysis, we have identified a motif critical to the proper recognition and binding of simian virus 40 large tumor antigen (T antigen) to virus DNA sequences at the origin of DNA replication. This motif is tripartite and consists of two elements (termed A1 and B2) that are necessary for sequence-specific binding of the origin and a central element (B1) which is required for nonspecific DNA-binding activity. Certain amino acids in elements A1 (residues 152 to 155) and B2 (203 to 207) may make direct contact with the GAGGC pentanucleotide sequences in binding sites I and II on the DNA. Alternatively, these two elements could determine the proper structure of the DNA-binding domain, although for a number of reasons we favor the first possibility. In contrast, element B1 (183 to 187) is most likely important for recognizing a general structural feature of DNA. Elements A1 and B2 are nearly identical in all known papovavirus T antigens, whereas B1 is identical only in the closely related papovaviruses simian virus 40, BK virus, and JC virus. In addition to these three elements, a fourth (B3; residues 215 to 219) is necessary for the binding of T antigen to site II but not to site I. We propose that additional contact sites on T antigen are involved in the interaction with site II to initiate the replication of the viral DNA. PMID:2157865

  2. Candidate regulatory sequence elements for cell cycle-dependent transcription in Saccharomyces cerevisiae.

    PubMed

    Wolfsberg, T G; Gabrielian, A E; Campbell, M J; Cho, R J; Spouge, J L; Landsman, D

    1999-08-01

    Recent developments in genome-wide transcript monitoring have led to a rapid accumulation of data from gene expression studies. Such projects highlight the need for methods to predict the molecular basis of transcriptional coregulation. A microarray project identified the 420 yeast transcripts whose synthesis displays cell cycle-dependent periodicity. We present here a statistical technique we developed to identify the sequence elements that may be responsible for this cell cycle regulation. Because most gene regulatory sites contain a short string of highly conserved nucleotides, any such strings that are involved in gene regulation will occur frequently in the upstream regions of the genes that they regulate, and rarely in the upstream regions of other genes. Our strategy therefore utilizes statistical procedures to identify short oligomers, five or six nucleotides in length, that are over-represented in upstream regions of genes whose expression peaks at the same phase of the cell cycle. We report, with a high level of confidence, that 9 hexamers and 12 pentamers are over-represented in the upstream regions of genes whose expression peaks at the early G(1), late G(1), S, G(2), or M phase of the cell cycle. Some of these sequence elements show a preference for a particular orientation, and others, through a separate statistical test, for a particular position upstream of the ATG start codon. The finding that the majority of the statistically significant sequence elements are located in late G(1) upstream regions correlates with other experiments that identified the late G(1)/early S boundary as a vital cell cycle control point. Our results highlight the importance of MCB, an element implicated previously in late G(1)/early S gene regulation, as most of the late G(1) oligomers contain the MCB sequence or variations thereof. It is striking that most MCB-like sequences localize to a specific region upstream of the ATG start codon. Additional sequences that we have

  3. Analysis of transposable elements in the genome of Asparagus officinalis from high coverage sequence data.

    PubMed

    Li, Shu-Fen; Gao, Wu-Jun; Zhao, Xin-Peng; Dong, Tian-Yu; Deng, Chuan-Liang; Lu, Long-Dou

    2014-01-01

    Asparagus officinalis is an economically and nutritionally important vegetable crop that is widely cultivated and is used as a model dioecious species to study plant sex determination and sex chromosome evolution. To improve our understanding of its genome composition, especially with respect to transposable elements (TEs), which make up the majority of the genome, we performed Illumina HiSeq2000 sequencing of both male and female asparagus genomes followed by bioinformatics analysis. We generated 17 Gb of sequence (12×coverage) and assembled them into 163,406 scaffolds with a total cumulated length of 400 Mbp, which represent about 30% of asparagus genome. Overall, TEs masked about 53% of the A. officinalis assembly. Majority of the identified TEs belonged to LTR retrotransposons, which constitute about 28% of genomic DNA, with Ty1/copia elements being more diverse and accumulated to higher copy numbers than Ty3/gypsy. Compared with LTR retrotransposons, non-LTR retrotransposons and DNA transposons were relatively rare. In addition, comparison of the abundance of the TE groups between male and female genomes showed that the overall TE composition was highly similar, with only slight differences in the abundance of several TE groups, which is consistent with the relatively recent origin of asparagus sex chromosomes. This study greatly improves our knowledge of the repetitive sequence construction of asparagus, which facilitates the identification of TEs responsible for the early evolution of plant sex chromosomes and is helpful for further studies on this dioecious plant.

  4. Addition of three-dimensional isoparametric elements to NASA structural analysis program (NASTRAN)

    NASA Technical Reports Server (NTRS)

    Field, E. I.; Johnson, S. E.

    1973-01-01

    Implementation is made of the three-dimensional family of linear, quadratic and cubic isoparametric solid elements into the NASA Structural Analysis program, NASTRAN. This work included program development, installation, testing, and documentation. The addition of these elements to NASTRAN provides a significant increase in modeling capability particularly for structures requiring specification of temperatures, material properties, displacements, and stresses which vary throughout each individual element. Complete program documentation is presented in the form of new sections and updates for direct insertion to the three NASTRAN manuals. The results of demonstration test problems are summarized. Excellent results are obtained with the isoparametric elements for static, normal mode, and buckling analyses.

  5. Co-digestion of manure and industrial waste--The effects of trace element addition.

    PubMed

    Nordell, Erik; Nilsson, Britt; Nilsson Påledal, Sören; Karisalmi, Kaisa; Moestedt, Jan

    2016-01-01

    Manure is one of the most common substrates for biogas production. Manure from dairy- and swine animals are often considered to stabilize the biogas process by contributing nutrients and trace elements needed for the biogas process. In this study two lab-scale reactors were used to evaluate the effects of trace element addition during co-digestion of manure from swine- and dairy animals with industrial waste. The substrate used contained high background concentrations of both cobalt and nickel, which are considered to be the most important trace elements. In the reactor receiving additional trace elements, the volatile fatty acids (VFA) concentration was 89% lower than in the control reactor. The lower VFA concentration contributed to a more digested digestate, and thus lower methane emissions in the subsequent storage. Also, the biogas production rate increased with 24% and the biogas production yield with 10%, both as a result of the additional trace elements at high organic loading rates. All in all, even though 50% of the feedstock consisted of manure, trace element addition resulted in multiple positive effects and a more reliable process with stable and high yield.

  6. Analysis of synthetic motor oils for additive elements by ICP-AES

    SciTech Connect

    Williams, M.C.; Salmon, S.G.

    1995-12-31

    Standard motor oils are made by blending paraffinic or naphthenic mineral oil base stocks with additive packages containing anti-wear agents, dispersants, corrosion inhibitors, and viscosity index improvers. The blender can monitor the correct addition of the additives by determining the additive elements in samples dissolved in a solvent by ICP-AES. Internal standardization is required to control sample transport interferences due to differences in viscosity between samples and standards. Synthetic motor oils, made with poly-alpha-olefins and trimethylol propane esters, instead of mineral oils, pose an additional challenge since these compounds affect the plasma as well as having sample transport interference considerations. The synthetic lubricant base stocks add significant oxygen to the sample matrix, which makes the samples behave differently than standards prepared in mineral oil. Determination of additive elements in synthetic motor oils will be discussed.

  7. Effect of lubricant extreme pressure additives on rolling element fatigue life

    NASA Technical Reports Server (NTRS)

    Parker, R. J.; Zaretsky, E. V.

    1973-01-01

    The effects of surface active additives on rolling-element fatigue life were investigated with the five-ball fatigue tester at conditions where classical subsurface initiated rolling-element fatigue is the sole mode of failure. Test balls of AISI 52100, AISI M-50, and AISI 1018 were run with an acid-treated white oil containing either 2.5 percent sulfurized terpene, 1 percent didodecyl phosphite, or 5 percent chlorinated wax. In general, it was found that the influence of surface active additives was detrimental to rolling-element fatigue life. The chlorinated-wax additive significantly reduced fatigue life by a factor of 7. The base oil with the 2.5 percent sulfurized-terpene additive can reduce fatigue life by as much as 50 percent. No statistical change in fatigue life occurred with the base oil having the 1 percent didodecyl-phosphite additive. The additives used with the base oil did not change the ranking of the bearing steels where rolling-element fatigue life was of subsurface origin.

  8. Piriform spider silk sequences reveal unique repetitive elements.

    PubMed

    Perry, David J; Bittencourt, Daniela; Siltberg-Liberles, Jessica; Rech, Elibio L; Lewis, Randolph V

    2010-11-08

    Orb-weaving spider silk fibers are assembled from very large, highly repetitive proteins. The repeated segments contain, in turn, short, simple, and repetitive amino acid motifs that account for the physical and mechanical properties of the assembled fiber. Of the six orb-weaver silk fibroins, the piriform silk that makes the attachment discs, which lashes the joints of the web and attaches dragline silk to surfaces, has not been previously characterized. Piriform silk protein cDNAs were isolated from phage libraries of three species: A. trifasciata , N. clavipes , and N. cruentata . The deduced amino acid sequences from these genes revealed two new repetitive motifs: an alternating proline motif, where every other amino acid is proline, and a glutamine-rich motif of 6-8 amino acids. Similar to other spider silk proteins, the repeated segments are large (>200 amino acids) and highly homogenized within a species. There is also substantial sequence similarity across the genes from the three species, with particular conservation of the repetitive motifs. Northern blot analysis revealed that the mRNA is larger than 11 kb and is expressed exclusively in the piriform glands of the spider. Phylogenetic analysis of the C-terminal regions of the new proteins with published spidroins robustly shows that the piriform sequences form an ortholog group.

  9. Sequence Assembly of Yarrowia lipolytica Strain W29/CLIB89 Shows Transposable Element Diversity

    PubMed Central

    Jahn, Ethan; Kanomata, Yuzo; Wu, Jenny; Zeller, Michael; Oakes, Melanie; Baldi, Pierre; Sandmeyer, Suzanne

    2016-01-01

    Yarrowia lipolytica, an oleaginous yeast, is capable of accumulating significant cellular mass in lipid making it an important source of biosustainable hydrocarbon-based chemicals. In spite of a similar number of protein-coding genes to that in other Hemiascomycetes, the Y. lipolytica genome is almost double that of model yeasts. Despite its economic importance and several distinct strains in common use, an independent genome assembly exists for only one strain. We report here a de novo annotated assembly of the chromosomal genome of an industrially-relevant strain, W29/CLIB89, determined by hybrid next-generation sequencing. For the first time, each Y. lipolytica chromosome is represented by a single contig. The telomeric rDNA repeats were localized by Irys long-range genome mapping and one complete copy of the rDNA sequence is reported. Two large structural variants and retroelement differences with reference strain CLIB122 including a full-length, novel Ty3/Gypsy long terminal repeat (LTR) retrotransposon and multiple LTR-like sequences are described. Strikingly, several of these are adjacent to RNA polymerase III-transcribed genes, which are almost double in number in Y. lipolytica compared to other Hemiascomycetes. In addition to previously-reported dimeric RNA polymerase III-transcribed genes, tRNA pseudogenes were identified. Multiple full-length and truncated LINE elements are also present. Therefore, although identified transposons do not constitute a significant fraction of the Y. lipolytica genome, they could have played an active role in its evolution. Differences between the sequence of this strain and of the existing reference strain underscore the utility of an additional independent genome assembly for this economically important organism. PMID:27603307

  10. In vivo "photofootprint" changes at sequences between the yeast GAL1 upstream activating sequence and "TATA" element require activated GAL4 protein but not a functional TATA element.

    PubMed Central

    Selleck, S B; Majors, J

    1988-01-01

    Transcription of the yeast GAL1 and GAL10 genes is induced by growth on galactose. Using the technique of photofootprinting in vivo, we previously documented equivalent transcription-dependent footprints within the putative "TATA" elements of both genes. To explore the functional significance of these observations, we created a 3-base-pair substitution mutation within the GAL1 promoter TATA element, which disrupted the ATATAA consensus sequence but left intact the photomodification targets. The mutation reduced galactose-induced RNA levels by a factor of 100. The mutant promoter no longer displayed the characteristic TATA sequence footprint, supporting the hypothesis that transcription activation involves the binding of a TATA box factor. We also observed a collection of transcription-correlated alterations in the modification pattern at sites between the UASG and the GAL1 TATA element, within sequences that are not required for inducible transcription. These patterns, characteristic of the induced wild-type GAL1 gene, were still galactose inducible with the TATA mutant GAl1 promoter, despite the low level of transcription from this promoter. We conclude that the GAL4-dependent protein/DNA structure responsible for the altered pattern within nonessential sequences is therefore not strictly coupled to an active TATA element or to high levels of expression. Nonetheless, the patterns probably reflect a stable protein-dependent structure that accompanies assembly of the transcription initiation complex. Images PMID:3041409

  11. A Coxiella burnetti repeated DNA element resembling a bacterial insertion sequence.

    PubMed Central

    Hoover, T A; Vodkin, M H; Williams, J C

    1992-01-01

    A DNA fragment located on the 3' side of the Coxiella burnetii htpAB operon was determined by Southern blotting to exist in approximately 19 copies in the Nine Mile I genome. The DNA sequences of this htpAB-associated repetitive element and two other independent copies were analyzed to determine the size and nature of the element. The three copies of the element were 1,450, 1,452, and 1,458 bp long, with less than 2% divergence among the three sequences. Several features characteristic of bacterial insertion sequences were discovered. These included a single significant open reading frame that would encode a 367-amino-acid polypeptide which was predicted to be highly basic, to have a DNA-binding helix-turn-helix motif, to have a leucine zipper motif, and to have homology to polypeptides found in several other bacterial insertion sequences. Identical 7-bp inverted repeats were found at the ends of all three copies of the element. However, duplications generated by many bacterial mobile elements in the recipient DNA during insertion events did not flank the inverted repeats of any of the three C. burnetii elements examined. A second pair of inverted repeats that flanked the open reading frame was also found in all three copies of the element. Most of the divergence among the three copies of the element occurred in the region between the two inverted repeat sequences in the 3' end of the element. Despite the sequence changes, all three copies of the element have retained significant dyad symmetry in this region. Images PMID:1324903

  12. 41 CFR 60-2.17 - Additional required elements of affirmative action programs.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 41 Public Contracts and Property Management 1 2014-07-01 2014-07-01 false Additional required elements of affirmative action programs. 60-2.17 Section 60-2.17 Public Contracts and Property Management... EMPLOYMENT OPPORTUNITY, DEPARTMENT OF LABOR 2-AFFIRMATIVE ACTION PROGRAMS Purpose and Contents of...

  13. 41 CFR 60-2.17 - Additional required elements of affirmative action programs.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 41 Public Contracts and Property Management 1 2012-07-01 2009-07-01 true Additional required elements of affirmative action programs. 60-2.17 Section 60-2.17 Public Contracts and Property Management... EMPLOYMENT OPPORTUNITY, DEPARTMENT OF LABOR 2-AFFIRMATIVE ACTION PROGRAMS Purpose and Contents of...

  14. Analysis of the chromatin domain organisation around the plastocyanin gene reveals an MAR-specific sequence element in Arabidopsis thaliana.

    PubMed Central

    van Drunen, C M; Oosterling, R W; Keultjes, G M; Weisbeek, P J; van Driel, R; Smeekens, S C

    1997-01-01

    The Arabidopsis thaliana genome is currently being sequenced, eventually leading towards the unravelling of all potential genes. We wanted to gain more insight into the way this genome might be organized at the ultrastructural level. To this extent we identified matrix attachment regions demarking potential chromatin domains, in a 16 kb region around the plastocyanin gene. The region was cloned and sequenced revealing six genes in addition to the plastocyanin gene. Using an heterologous in vitro nuclear matrix binding assay, to search for evolutionary conserved matrix attachment regions (MARs), we identified three such MARs. These three MARs divide the region into two small chromatin domains of 5 kb, each containing two genes. Comparison of the sequence of the three MARs revealed a degenerated 21 bp sequence that is shared between these MARs and that is not found elsewhere in the region. A similar sequence element is also present in four other MARs of Arabidopsis.Therefore, this sequence may constitute a landmark for the position of MARs in the genome of this plant. In a genomic sequence database of Arabidopsis the 21 bp element is found approximately once every 10 kb. The compactness of the Arabidopsis genome could account for the high incidence of MARs and MRSs we observed. PMID:9380515

  15. Annotation of cis-regulatory elements by identification, subclassification, and functional assessment of multispecies conserved sequences

    PubMed Central

    Hughes, Jim R.; Cheng, Jan-Fang; Ventress, Nicki; Prabhakar, Shyam; Clark, Kevin; Anguita, Eduardo; De Gobbi, Marco; de Jong, Pieter; Rubin, Eddy; Higgs, Douglas R.

    2005-01-01

    An important step toward improving the annotation of the human genome is to identify cis-acting regulatory elements from primary DNA sequence. One approach is to compare sequences from multiple, divergent species. This approach distinguishes multispecies conserved sequences (MCS) in noncoding regions from more rapidly evolving neutral DNA. Here, we have analyzed a region of ≈238kb containing the human α globin cluster that was sequenced and/or annotated across the syntenic region in 22 species spanning 500 million years of evolution. Using a variety of bioinformatic approaches and correlating the results with many aspects of chromosome structure and function in this region, we were able to identify and evaluate the importance of 24 individual MCSs. This approach sensitively and accurately identified previously characterized regulatory elements but also discovered unidentified promoters, exons, splicing, and transcriptional regulatory elements. Together, these studies demonstrate an integrated approach by which to identify, subclassify, and predict the potential importance of MCSs. PMID:15998734

  16. Nonconsensus Protein Binding to Repetitive DNA Sequence Elements Significantly Affects Eukaryotic Genomes

    PubMed Central

    Barber-Zucker, Shiran; Gordân, Raluca; Lukatsky, David B.

    2015-01-01

    Recent genome-wide experiments in different eukaryotic genomes provide an unprecedented view of transcription factor (TF) binding locations and of nucleosome occupancy. These experiments revealed that a large fraction of TF binding events occur in regions where only a small number of specific TF binding sites (TFBSs) have been detected. Furthermore, in vitro protein-DNA binding measurements performed for hundreds of TFs indicate that TFs are bound with wide range of affinities to different DNA sequences that lack known consensus motifs. These observations have thus challenged the classical picture of specific protein-DNA binding and strongly suggest the existence of additional recognition mechanisms that affect protein-DNA binding preferences. We have previously demonstrated that repetitive DNA sequence elements characterized by certain symmetries statistically affect protein-DNA binding preferences. We call this binding mechanism nonconsensus protein-DNA binding in order to emphasize the point that specific consensus TFBSs do not contribute to this effect. In this paper, using the simple statistical mechanics model developed previously, we calculate the nonconsensus protein-DNA binding free energy for the entire C. elegans and D. melanogaster genomes. Using the available chromatin immunoprecipitation followed by sequencing (ChIP-seq) results on TF-DNA binding preferences for ~100 TFs, we show that DNA sequences characterized by low predicted free energy of nonconsensus binding have statistically higher experimental TF occupancy and lower nucleosome occupancy than sequences characterized by high free energy of nonconsensus binding. This is in agreement with our previous analysis performed for the yeast genome. We suggest therefore that nonconsensus protein-DNA binding assists the formation of nucleosome-free regions, as TFs outcompete nucleosomes at genomic locations with enhanced nonconsensus binding. In addition, here we perform a new, large-scale analysis using

  17. Enhancing Surface Finish of Additively Manufactured Titanium and Cobalt Chrome Elements Using Laser Based Finishing

    NASA Astrophysics Data System (ADS)

    Gora, Wojciech S.; Tian, Yingtao; Cabo, Aldara Pan; Ardron, Marcus; Maier, Robert R. J.; Prangnell, Philip; Weston, Nicholas J.; Hand, Duncan P.

    Additive manufacturing (AM) offers the possibility of creating a complex free form object as a single element, which is not possible using traditional mechanical machining. Unfortunately the typically rough surface finish of additively manufactured parts is unsuitable for many applications. As a result AM parts must be post-processed; typically mechanically machined and/or and polished using either chemical or mechanical techniques (both of which have their limitations). Laser based polishing is based on remelting of a very thin surface layer and it offers potential as a highly repeatable, higher speed process capable of selective area polishing, and without any waste problems (no abrasives or liquids). In this paper an in-depth investigation of CW laser polishing of titanium and cobalt chrome AM elements is presented. The impact of different scanning strategies, laser parameters and initial surface condition on the achieved surface finish is evaluated.

  18. Comparative genome sequencing of drosophila pseudoobscura: Chromosomal, gene and cis-element evolution

    SciTech Connect

    Richards, Stephen; Liu, Yue; Bettencourt, Brian R.; Hradecky, Pavel; Letovsky, Stan; Nielsen, Rasmus; Thornton, Kevin; Todd, Melissa J.; Chen, Rui; Meisel, Richard P.; Couronne, Olivier; Hua, Sujun; Smith, Mark A.; Bussemaker, Harmen J.; van Batenburg, Marinus F.; Howells, Sally L.; Scherer, Steven E.; Sodergren, Erica; Matthews, Beverly B.; Crosby, Madeline A.; Schroeder, Andrew J.; Ortiz-Barrientos, Daniel; Rives, Catherine M.; Metzker, Michael L.; Muzny, Donna M.; Scott, Graham; Steffen, David; Wheeler, David A.; Worley, Kim C.; Havlak, Paul; Durbin, K. James; Egan, Amy; Gill, Rachel; Hume, Jennifer; Morgan, Margaret B.; Miner, George; Hamilton, Cerissa; Huang, Yanmei; Waldron, Lenee; Verduzco, Daniel; Blankenburg, Kerstin P.; Dubchak, Inna; Noor, Mohamed A.F.; Anderson, Wyatt; White, Kevin P.; Clark, Andrew G.; Schaeffer, Stephen W.; Gelbart, William; Weinstock, George M.; Gibbs, Richard A.

    2004-04-01

    The genome sequence of a second fruit fly, D. pseudoobscura, presents an opportunity for comparative analysis of a primary model organism D. melanogaster. The vast majority of Drosophila genes have remained on the same arm, but within each arm gene order has been extensively reshuffled leading to the identification of approximately 1300 syntenic blocks. A repetitive sequence is found in the D. pseudoobscura genome at many junctions between adjacent syntenic blocks. Analysis of this novel repetitive element family suggests that recombination between offset elements may have given rise to many paracentric inversions, thereby contributing to the shuffling of gene order in the D. pseudoobscura lineage. Based on sequence similarity and synteny, 10,516 putative orthologs have been identified as a core gene set conserved over 35 My since divergence. Genes expressed in the testes had higher amino acid sequence divergence than the genome wide average consistent with the rapid evolution of sex-specific proteins. Cis-regulatory sequences are more conserved than control sequences between the species but the difference is slight, suggesting that the evolution of cis-regulatory elements is flexible. Overall, a picture of repeat mediated chromosomal rearrangement, and high co-adaptation of both male genes and cis-regulatory sequences emerges as important themes of genome divergence between these species of Drosophila.

  19. Novel insertion sequence-like elements in phytoplasma strains of the aster yellows group are putative new members of the IS3 family.

    PubMed

    Lee, I-M; Zhao, Y; Bottner, K D

    2005-01-15

    Novel insertion sequence (IS)-like elements were isolated and characterized from phytoplasma strains in the aster yellows (AY) group (16SrI). The IS-like elements were cloned from phytoplasma strains AY1 and NJAY or PCR-amplified from 15 additional strains representing nine subgroups in the AY group using primers based on sequences of the putative transposases (Tpases). All IS-like elements contained sequences encoding similar Tpases of 321 amino acids (320 for strain CPh). Substantial amino acid sequence variability suggested multiple species of Tpases or IS-like elements exist in the AY phytoplasma group. These Tpases have an identical DDE motif that is most similar to the DDE consensus of Tpases in the IS3 family.

  20. The very large amplifiable element AUD2 from Streptomyces lividans 66 has insertion sequence-like repeats at its ends.

    PubMed Central

    Eichenseer, C; Altenbuchner, J

    1994-01-01

    In a spontaneous, chloramphenicol-sensitive (Cms), arginine-auxotrophic (Arg-) mutant of Streptomyces lividans 1326, two amplified DNA sequences were found. One of them was the well-characterized 5.7-kb ADS1 sequence, amplified to about 300 copies per chromosome. The second one was a 92-kb sequence called ADS2. ADS2 encoding the previously isolated mercury resistance genes of S. lividans was amplified to around 20 copies per chromosome. The complete ADS2 sequence was isolated from a genomic library of the mutant S. lividans 1326.32, constructed in the phage vector lambda EMBL4. In addition, the DNA sequences flanking the corresponding amplifiable element called AUD2 in the wild-type strain were isolated by using another genomic library prepared from S. lividans 1326 DNA. Analysis of the ends of AUD2 revealed the presence of an 846-bp sequence on both sides repeated in the same orientation. Each of the direct repeats ended with 18-bp inverted repeated sequences. This insertion sequence-like structure was confirmed by the DNA sequence determined from the amplified copy of the direct repeats which demonstrated a high degree of similarity of 65% identity in nucleic acid sequence to IS112 from Streptomyces albus. The recombination event leading to the amplification of AUD2 occurred within these direct repeats, as shown by DNA sequence analysis. The amplification of AUD2 was correlated with a deletion on one side of the flanking chromosomal region beginning very near or in the amplified DNA. Strains of S. lividans like TK20 and TK21 which are mercury sensitive have completely lost AUD2 together with flanking chromosomal DNA on one or both sides. Images PMID:7961479

  1. Whale phylogeny and rapid radiation events revealed using novel retroposed elements and their flanking sequences

    PubMed Central

    2011-01-01

    Background A diversity of hypotheses have been proposed based on both morphological and molecular data to reveal phylogenetic relationships within the order Cetacea (dolphins, porpoises, and whales), and great progress has been made in the past two decades. However, there is still some controversy concerning relationships among certain cetacean taxa such as river dolphins and delphinoid species, which needs to be further addressed with more markers in an effort to address unresolved portions of the phylogeny. Results An analysis of additional SINE insertions and SINE-flanking sequences supported the monophyly of the order Cetacea as well as Odontocete, Delphinoidea (Delphinidae + Phocoenidae + Mondontidae), and Delphinidae. A sister relationship between Delphinidae and Phocoenidae + Mondontidae was supported, and members of classical river dolphins and the genera Tursiops and Stenella were found to be paraphyletic. Estimates of divergence times revealed rapid divergences of basal Odontocete lineages in the Oligocene and Early Miocene, and a recent rapid diversification of Delphinidae in the Middle-Late Miocene and Pliocene within a narrow time frame. Conclusions Several novel SINEs were found to differentiate Delphinidae from the other two families (Monodontidae and Phocoenidae), whereas the sister grouping of the latter two families with exclusion of Delphinidae was further revealed using the SINE-flanking sequences. Interestingly, some anomalous PCR amplification patterns of SINE insertions were detected, which can be explained as the result of potential ancestral SINE polymorphisms and incomplete lineage sorting. Although a few loci were potentially anomalous, this study demonstrated that the SINE-based approach is a powerful tool in phylogenetic studies. Identifying additional SINE elements that resolve the relationships in the superfamily Delphinoidea and family Delphinidae will be important steps forward in completely resolving cetacean phylogenetic

  2. Engineering of Schroedinger cat states by a sequence of displacements and photon additions or subtractions

    SciTech Connect

    Podoshvedov, S. A.

    2011-04-15

    A method to generate Schroedinger cat states in free propagating optical fields based on the use of displaced states (or displacement operators) is developed. Some optical schemes with photon-added coherent states are studied. The schemes are modifications of the general method based on a sequence of displacements and photon additions or subtractions adjusted to generate Schroedinger cat states of a larger size. The effects of detection inefficiency are taken into account.

  3. Effects of extreme pressure additive chemistry on rolling element bearing surface durability

    SciTech Connect

    Evans, Ryan D.; Nixon, H. P.; Darragh, Craig V.; Howe, Jane Y; Coffey, Dorothy W

    2007-01-01

    Lubricant additives have been known to affect rolling element bearing surface durability for many years. Tapered roller bearings were used in fatigue testing of lubricants formulated with gear oil type additive systems. These systems have sulfur- and phosphoruscontaining compounds used for gear protection as well as bearing lubrication. Several variations of a commercially available base additive formulation were tested having modified sulfur components. The variations represent a range of ''active'' extreme pressure (EP) chemistries. The bearing fatigue test results were compared with respect to EP formulation and test conditions. Inner ring near-surface material in selected test bearings was evaluated on two scales: the micrometer scale using optical metallography and the nanometer scale using transmission electron microscopy (TEM). Focused-ion beam (FIB) techniques were used for TEM specimen preparation. Imaging and chemical analysis of the bearing samples revealed near-surface material and tribofilm characteristics. These results are discussed with respect to the relative fatigue lives.

  4. Genome-wide discovery of cis-elements in promoter sequences using gene expression.

    PubMed

    Troukhan, Maxim; Tatarinova, Tatiana; Bouck, John; Flavell, Richard B; Alexandrov, Nickolai N

    2009-04-01

    The availability of complete or nearly complete genome sequences, a large number of 5' expressed sequence tags, and significant public expression data allow for a more accurate identification of cis-elements regulating gene expression. We have implemented a global approach that takes advantage of available expression data, genomic sequences, and transcript information to predict cis-elements associated with specific expression patterns. The key components of our approach are: (1) precise identification of transcription start sites, (2) specific locations of cis-elements relative to the transcription start site, and (3) assessment of statistical significance for all sequence motifs. By applying our method to promoters of Arabidopsis thaliana and Mus musculus, we have identified motifs that affect gene expression under specific environmental conditions or in certain tissues. We also found that the presence of the TATA box is associated with increased variability of gene expression. Strong correlation between our results and experimentally determined motifs shows that the method is capable of predicting new functionally important cis-elements in promoter sequences.

  5. Cytoplasmic intron sequence-retaining transcripts can be dendritically targeted via ID element retrotransposons.

    PubMed

    Buckley, Peter T; Lee, Miler T; Sul, Jai-Yoon; Miyashiro, Kevin Y; Bell, Thomas J; Fisher, Stephen A; Kim, Junhyong; Eberwine, James

    2011-03-10

    RNA precursors give rise to mRNA after splicing of intronic sequences traditionally thought to occur in the nucleus. Here, we show that intron sequences are retained in a number of dendritically-targeted mRNAs, by using microarray and Illumina sequencing of isolated dendritic mRNA as well as in situ hybridization. Many of the retained introns contain ID elements, a class of SINE retrotransposon. A portion of these SINEs confers dendritic targeting to exogenous and endogenous transcripts showing the necessity of ID-mediated mechanisms for the targeting of different transcripts to dendrites. ID elements are capable of selectively altering the distribution of endogenous proteins, providing a link between intronic SINEs and protein function. As such, the ID element represents a common dendritic targeting element found across multiple RNAs. Retention of intronic sequence is a more general phenomenon than previously thought and plays a functional role in the biology of the neuron, partly mediated by co-opted repetitive sequences.

  6. Additives

    NASA Technical Reports Server (NTRS)

    Smalheer, C. V.

    1973-01-01

    The chemistry of lubricant additives is discussed to show what the additives are chemically and what functions they perform in the lubrication of various kinds of equipment. Current theories regarding the mode of action of lubricant additives are presented. The additive groups discussed include the following: (1) detergents and dispersants, (2) corrosion inhibitors, (3) antioxidants, (4) viscosity index improvers, (5) pour point depressants, and (6) antifouling agents.

  7. Impact of Zn, Mg, Ni and Co elements on glass alteration: Additive effects

    NASA Astrophysics Data System (ADS)

    Aréna, H.; Godon, N.; Rébiscoul, D.; Podor, R.; Garcès, E.; Cabie, M.; Mestre, J.-P.

    2016-03-01

    The minor elements present in the nuclear glass composition or coming from the groundwater of the future repository may impact glass alteration. In this study, the effects of Zn, Mg, Ni and Co on the International Simple Glass (ISG) alteration were studied throughout 511 days of aqueous leaching experiments. The aim was to determine their additive or competitive effect on glass alteration and the nature of the alteration products. The four elements were introduced separately or altogether in solution as XCl2 chloride salts (X = Zn, Mg, Ni or Co) with monthly additions to compensate for their consumption. The alteration kinetics were determined by leachate analyses (ICP-AES) and alteration products were characterized in terms of composition, morphology and microstructure (SEM, TEM-EDX, ToF-SIMS and XRD). Results indicate that when they are introduced separately, Zn, Mg, Ni and Co have the same qualitative and quantitative effect on glass alteration kinetics and on pH: they form secondary phases leading to a pH decrease and a significant increase in glass alteration. The secondary phases were identified as silicates of the added X element: trioctahedral smectites with a stoichiometry of[(Si(4-a) Ala) (X(3-b) Alb) O10 (OH)2](a+b)- [Xc Nad Cae] (2c+d+2e) + with a = 0.11 to 0.45, b = 0.00 to 0.29, c = 0, d = 0.19 to 0.74 and e = 0.10 to 0.14. . It was shown that as pH stabilizes at a minimum value, X-silicates no longer precipitate, thus leading to a significant drop in the glass alteration rate. This pH value depends on X and it has been identified as being 8 for Mg-silicates, probably around 7.3 for Ni and Co-silicates and less than 6.2 for Zn-silicates. When tested together, the effects of these four elements on glass alteration are additive and lead to the formation of a mix of X-silicates that precipitate as long as their constitutive elements are available and the pH is above their respective minimum value. This study brings new quantitative information about the

  8. Laser Additive Melting and Solidification of Inconel 718: Finite Element Simulation and Experiment

    NASA Astrophysics Data System (ADS)

    Romano, John; Ladani, Leila; Sadowski, Magda

    2016-03-01

    The field of powdered metal additive manufacturing is experiencing a surge in public interest finding uses in aerospace, defense, and biomedical industries. The relative youth of the technology coupled with public interest makes the field a vibrant research topic. The authors have expanded upon previously published finite element models used to analyze the processing of novel engineering materials through the use of laser- and electron beam-based additive manufacturing. In this work, the authors present a model for simulating fabrication of Inconel 718 using laser melting processes. Thermal transport phenomena and melt pool geometries are discussed and validation against experimental findings is presented. After comparing experimental and simulation results, the authors present two correction correlations to transform the modeling results into meaningful predictions of actual laser melting melt pool geometries in Inconel 718.

  9. The Wavelet Element Method. Part 2; Realization and Additional Features in 2D and 3D

    NASA Technical Reports Server (NTRS)

    Canuto, Claudio; Tabacco, Anita; Urban, Karsten

    1998-01-01

    The Wavelet Element Method (WEM) provides a construction of multiresolution systems and biorthogonal wavelets on fairly general domains. These are split into subdomains that are mapped to a single reference hypercube. Tensor products of scaling functions and wavelets defined on the unit interval are used on the reference domain. By introducing appropriate matching conditions across the interelement boundaries, a globally continuous biorthogonal wavelet basis on the general domain is obtained. This construction does not uniquely define the basis functions but rather leaves some freedom for fulfilling additional features. In this paper we detail the general construction principle of the WEM to the 1D, 2D and 3D cases. We address additional features such as symmetry, vanishing moments and minimal support of the wavelet functions in each particular dimension. The construction is illustrated by using biorthogonal spline wavelets on the interval.

  10. Researches on Mathematical Relationship of Five Elements of Containing Notes and Fibonacci Sequence Modulo 5

    PubMed Central

    Chen, Zhaoxue

    2015-01-01

    Considering the five periods and six qi's theory in TCM almost shares a common basis of stem-branch system with the five elements of containing notes, studying the principle or mathematical structure behind the five elements of containing notes can surely bring a novel view for the five periods and six qi's researches. By analyzing typical mathematical rules included in He tu, Luo shu, and stem-branch theory in TCM as well as the Fibonacci sequence especially widely existent in the biological world, novel researches are performed on mathematical relationship between the five elements of containing notes and the Fibonacci sequence modulo 5. Enlightened by elementary Yin or Yang number grouping principle of He tu, Luo shu, the 12534 and 31542 key number series of Fibonacci sequence modulo 5 are obtained. And three new arrangements about the five elements of containing notes are then introduced, which have shown close relationship with the two obtained key subsequences of the Fibonacci sequence modulo 5. The novel discovery is quite helpful to recover the scientific secret of the five periods and six qi's theory in TCM as well as that of whole traditional Chinese culture system, but more data is needed to elucidate the TCM theory further. PMID:26495418

  11. Researches on Mathematical Relationship of Five Elements of Containing Notes and Fibonacci Sequence Modulo 5.

    PubMed

    Chen, Zhaoxue

    2015-01-01

    Considering the five periods and six qi's theory in TCM almost shares a common basis of stem-branch system with the five elements of containing notes, studying the principle or mathematical structure behind the five elements of containing notes can surely bring a novel view for the five periods and six qi's researches. By analyzing typical mathematical rules included in He tu, Luo shu, and stem-branch theory in TCM as well as the Fibonacci sequence especially widely existent in the biological world, novel researches are performed on mathematical relationship between the five elements of containing notes and the Fibonacci sequence modulo 5. Enlightened by elementary Yin or Yang number grouping principle of He tu, Luo shu, the 12534 and 31542 key number series of Fibonacci sequence modulo 5 are obtained. And three new arrangements about the five elements of containing notes are then introduced, which have shown close relationship with the two obtained key subsequences of the Fibonacci sequence modulo 5. The novel discovery is quite helpful to recover the scientific secret of the five periods and six qi's theory in TCM as well as that of whole traditional Chinese culture system, but more data is needed to elucidate the TCM theory further.

  12. Seawater-derived rare earth element addition to abyssal peridotites during serpentinization

    NASA Astrophysics Data System (ADS)

    Frisby, Carl; Bizimis, Michael; Mallick, Soumen

    2016-04-01

    Serpentinized abyssal peridotites are evidence for active communication between the Earth's hydrosphere and the upper mantle, where exchange and retention of both major and trace elements occur. Bulk rock Nd isotopes in serpentinized abyssal peridotites imply interaction of seawater with the peridotite. In contrast, the Nd isotopes of clinopyroxenes from serpentinized abyssal peridotites retain their primary magmatic signature. It is currently unclear if, how and where seawater-derived Nd and other REE are being added or exchanged with the mantle peridotite minerals during serpentinization. To remedy this knowledge gap, we present in situ trace and major element concentrations, bulk rock and sequential leaching experiment trace element concentrations as well as Nd, Sr isotope data on refertilized and depleted serpentinized abyssal peridotites from the Southwest Indian Ridge. The secondary serpentine matrix and magnetite veins in these peridotites have elevated LREE concentrations, with variable negative Ce anomalies and large Rb, Sr, Pb and U enrichments that resemble seawater trace element patterns. The LREE concentrations in the serpentine phase are higher than those expected for the primary mantle mineralogy (olivine, orthopyroxene) based on data from relic clinopyroxenes and equilibrium partition coefficients. These data are consistent with seawater-derived REE addition to the peridotite during serpentinization. The bulk rocks have more radiogenic Sr and more unradiogenic Nd isotopes than their clinopyroxene (up to 8 εNd units lower than clinopyroxene). Sequential leaching experiments designed to mobilize secondary carbonates and Fe-oxides show even more unradiogenic Nd isotope ratios in the leachates than the bulk rock and clinopyroxene, approaching seawater compositions (up to 15 εNd units lower than clinopyroxene). Mass balance calculations using trace elements or Nd isotopes suggest that up to 30% of the bulk peridotite Nd budget is of seawater origin and

  13. An Acetobacter xylinum insertion sequence element associated with inactivation of cellulose production.

    PubMed Central

    Coucheron, D H

    1991-01-01

    An insertion sequence (IS) element, IS1031, caused insertions associated with spontaneous cellulose deficient (Cel-) mutants of Acetobacter xylinum ATCC 23769. The element was discovered during hybridization analysis of DNAs from Cel- mutants of A. xylinum ATCC 23769 with pAXC145, an indigenous plasmid from a Cel- mutant of A. xylinum NRCC 17005. An IS element, IS1031B, apparently identical to IS1031, was identified on pAXC145. IS1031 is about 950 bp. DNA sequencing showed that the two elements had identical termini with inverted repeats of 24 bp containing two mismatches and that they generated 3-bp target sequence duplications. The A. xylinum ATCC 23769 wild type carries seven copies of IS1031. Southern hybridization showed that 8 of 17 independently isolated spontaneous Cel- mutants of ATCC 23769 contained insertions of an element homologous to IS1031. Most insertions were in unique sites, indicating low insertion specificity. Significantly, two insertions were 0.5 kb upstream of a recently identified cellulose synthase gene. Attempts to isolate spontaneous cellulose-producing revertants of these two Cel- insertion mutants by selection in static cultures were unsuccessful. Instead, pseudorevertants that made waxlike films in the liquid-air interface were obtained. The two pseudorevertants carried new insertions of an IS1031-like element in nonidentical sites of the genome without excision of the previous insertions. Taken together, these results suggest that indigenous IS elements contribute to genetic instability in A. xylinum. The elements might also be useful as genetic tools in this organism and related species. Images PMID:1653216

  14. Simulation of Powder Layer Deposition in Additive Manufacturing Processes Using the Discrete Element Method

    SciTech Connect

    Herbold, E. B.; Walton, O.; Homel, M. A.

    2015-10-26

    This document serves as a final report to a small effort where several improvements were added to a LLNL code GEODYN-­L to develop Discrete Element Method (DEM) algorithms coupled to Lagrangian Finite Element (FE) solvers to investigate powder-­bed formation problems for additive manufacturing. The results from these simulations will be assessed for inclusion as the initial conditions for Direct Metal Laser Sintering (DMLS) simulations performed with ALE3D. The algorithms were written and performed on parallel computing platforms at LLNL. The total funding level was 3-­4 weeks of an FTE split amongst two staff scientists and one post-­doc. The DEM simulations emulated, as much as was feasible, the physical process of depositing a new layer of powder over a bed of existing powder. The DEM simulations utilized truncated size distributions spanning realistic size ranges with a size distribution profile consistent with realistic sample set. A minimum simulation sample size on the order of 40-­particles square by 10-­particles deep was utilized in these scoping studies in order to evaluate the potential effects of size segregation variation with distance displaced in front of a screed blade. A reasonable method for evaluating the problem was developed and validated. Several simulations were performed to show the viability of the approach. Future investigations will focus on running various simulations investigating powder particle sizing and screen geometries.

  15. Failure location prediction by finite element analysis for an additive manufactured mandible implant.

    PubMed

    Huo, Jinxing; Dérand, Per; Rännar, Lars-Erik; Hirsch, Jan-Michaél; Gamstedt, E Kristofer

    2015-09-01

    In order to reconstruct a patient with a bone defect in the mandible, a porous scaffold attached to a plate, both in a titanium alloy, was designed and manufactured using additive manufacturing. Regrettably, the implant fractured in vivo several months after surgery. The aim of this study was to investigate the failure of the implant and show a way of predicting the mechanical properties of the implant before surgery. All computed tomography data of the patient were preprocessed to remove metallic artefacts with metal deletion technique before mandible geometry reconstruction. The three-dimensional geometry of the patient's mandible was also reconstructed, and the implant was fixed to the bone model with screws in Mimics medical imaging software. A finite element model was established from the assembly of the mandible and the implant to study stresses developed during mastication. The stress distribution in the load-bearing plate was computed, and the location of main stress concentration in the plate was determined. Comparison between the fracture region and the location of the stress concentration shows that finite element analysis could serve as a tool for optimizing the design of mandible implants.

  16. CASCADES AFTER K-VACANCY PRODUCTION AND ADDITIONAL IONIZATION OR EXCITATION IN ATOMS OF LIGHT ELEMENTS

    SciTech Connect

    Kucas, S.; Momkauskaitė, A.; Karazija, R.

    2015-09-01

    The results of Auger and radiative cascades after the production of a vacancy in the K-shell and the additional ionization or excitation of the other shell are presented for the various ions of astrophysically important elements, namely, Ne, Mg, Si, S, and Ar. The detailed level-by-level calculations are performed using a single-configuration quasi-relativistic approximation. The populations of the levels of the excited configurations produced during a cascade as well as for the final ions are presented. These data enable us to take into account two-electron processes at the K-shell ionization, and thus to supplement the results of our earlier investigation of K-vacancy cascades.

  17. Variation in sequence and organization of splicing regulatory elements in vertebrate genes

    PubMed Central

    Yeo, Gene; Hoon, Shawn; Venkatesh, Byrappa; Burge, Christopher B.

    2004-01-01

    Although core mechanisms and machinery of premRNA splicing are conserved from yeast to human, the details of intron recognition often differ, even between closely related organisms. For example, genes from the pufferfish Fugu rubripes generally contain one or more introns that are not properly spliced in mouse cells. Exploiting available genome sequence data, a battery of sequence analysis techniques was used to reach several conclusions about the organization and evolution of splicing regulatory elements in vertebrate genes. The classical splice site and putative branch site signals are completely conserved across the vertebrates studied (human, mouse, pufferfish, and zebrafish), and exonic splicing enhancers also appear broadly conserved in vertebrates. However, another class of splicing regulatory elements, the intronic splicing enhancers, appears to differ substantially between mammals and fish, with G triples (GGG) very abundant in mammalian introns but comparatively rare in fish. Conversely, short repeats of AC and GT are predicted to function as intronic splicing enhancers in fish but are not enriched in mammalian introns. Consistent with this pattern, exonic splicing enhancer-binding SR proteins are highly conserved across all vertebrates, whereas heterogeneous nuclear ribonucleoproteins, which bind many intronic sequences, vary in domain structure and even presence/absence between mammals and fish. Exploiting differences in intronic sequence composition, a statistical model was developed to predict the splicing phenotype of Fugu introns in mammalian systems and was used to engineer the spliceability of a Fugu intron in human cells by insertion of specific sequences, thereby rescuing splicing in human cells. PMID:15505203

  18. Relationship between the Sequencing and Timing of Vocal Motor Elements in Birdsong

    PubMed Central

    Matheson, Andrew M. M.; Sakata, Jon T.

    2015-01-01

    Accurate coordination of the sequencing and timing of motor gestures is important for the performance of complex and evolutionarily relevant behaviors. However, the degree to which motor sequencing and timing are related remains largely unknown. Birdsong is a communicative behavior that consists of discrete vocal motor elements (‘syllables’) that are sequenced and timed in a precise manner. To reveal the relationship between syllable sequencing and timing, we analyzed how variation in the probability of syllable transitions at branch points, nodes in song with variable sequencing across renditions, correlated with variation in the duration of silent gaps between syllable transitions (‘gap durations’) for adult Bengalese finch song. We observed a significant negative relationship between transition probability and gap duration: more prevalent transitions were produced with shorter gap durations. We then assessed the degree to which long-term age-dependent changes and acute context-dependent changes to syllable sequencing and timing followed this inverse relationship. Age- but not context-dependent changes to syllable sequencing and timing were inversely related. On average, gap durations at branch points decreased with age, and the magnitude of this decrease was greater for transitions that increased in prevalence than for transitions that decreased in prevalence. In contrast, there was no systematic relationship between acute context-dependent changes to syllable sequencing and timing. Gap durations at branch points decreased when birds produced female-directed courtship song compared to when they produced undirected song, and the magnitude of this decrease was not related to the direction and magnitude of changes to transition probabilities. These analyses suggest that neural mechanisms that regulate syllable sequencing could similarly control syllable timing but also highlight mechanisms that can independently regulate syllable sequencing and timing. PMID

  19. Identification of a novel insertion sequence element in Streptococcus agalactiae. bspeller@imib.rwth-aachen.de.

    PubMed

    Spellerberg, B; Martin, S; Franken, C; Berner, R; Lütticken, R

    2000-01-04

    Gain and loss of bacterial pathogenicity is often associated with mobile genetic elements. A novel insertion sequence (IS) element designated ISSa4 was identified in Streptococcus agalactiae (group B streptococci). The 963bp IS element is flanked by 25bp perfect inverted repeats and led to the duplication of a 9bp target sequence at the insertion site. ISSa4 contains one open reading frame coding for a putative transposase of 287 aa and exhibits closest similarities to insertion elements of the IS982 family which has previously not been identified in streptococci. Analysis of different S. agalactiae strains showed that the copy number of ISSa4 in S. agalactiae varies significantly between strains. The S. agalactiae strain with the highest copy number of ISSa4 was nonhemolytic and harbored one copy inserted in cylB, which encodes the membrane-spanning domain of the putative hemolysin transporter (Spellerberg et al., 1999. Identification of genetic determinants for the hemolytic activity of Streptococcus agalactiae by ISS1 transposition. J. Bacteriol. 181, 3212-3219). Determination of the distribution of ISSa4 in different S. agalactiae strains revealed that ISSa4 could be detected only in strains isolated after 1996, which might indicate a recent acquisition of this novel insertion element by S. agalactiae.

  20. Nitrogen addition alters elemental stoichiometry within soil aggregates in a temperate steppe

    NASA Astrophysics Data System (ADS)

    Yin, Jinfei; Wang, Ruzhen; Liu, Heyong; Feng, Xue; Xu, Zhuwen; Jiang, Yong

    2016-11-01

    Ongoing increases in anthropogenic nitrogen (N) inputs have largely affected soil carbon (C) and nutrient cycling in most terrestrial ecosystems. Numerous studies have concerned the effects of elevated N inputs on soil dissolved organic carbon (DOC), dissolved inorganic N (DIN), available phosphorus (AP), exchangeable calcium (Ca) and magnesium (Mg), and available iron (Fe) and manganese (Mn). However, few have emphasized the stoichiometric traits of these soil parameters, especially within different soil aggregate fractions. In a semiarid grassland of Inner Mongolia, we studied the effect of N addition on the ratios of DOC : DIN, DOC : AP, DIN : AP, exchangeable Ca : Mg, available Fe : Mn within three soil aggregate classes of large macroaggregates (> 2000 µm), small macroaggregates (250-2000 µm), and microaggregates (< 250 µm). Elevated N inputs significantly decreased the DOC : DIN ratio within three soil aggregates. The soil DOC : AP ratio significantly decreased along with increasing N gradients within large macroaggregates and microaggregates. Nitrogen significantly decreased the ratio of exchangeable Ca : Mg within soil macroaggregates. The ratio of available Fe : Mn decreased with N addition within three soil aggregate classes. Alteration of elemental stoichiometry within soil fractions that are characterized by different nutrient retention capacity will influence the chemical composition of soil microorganisms and plant quality.

  1. Holliday Junctions Are Associated with Transposable Element Sequences in the Human Genome.

    PubMed

    Ladias, Paris; Markopoulos, Georgios; Lazaros, Leandros; Markoula, Sofia; Tzavaras, Theodore; Georgiou, Ioannis

    2016-02-13

    Holliday junctions (HJs) constitute important intermediate structures for many cell functions such as DNA recombination and DNA repair. They derive from a 10-nt degenerate sequence, with a 3-nt core motif. In this study, we explored the human genome whether the HJ degenerate sequence associates with transposable elements (TEs) and mainly with those of the active and inactive ALU, LINE, SVA and HERV families. We identified six different forms of the HJ sequence motif, and we located the genomic coordinates of sequences containing both HJs and TEs. From 2982 total HJs, a significant number of 1319 TE-associated HJs were found, with a median distribution of 1 per 2.4 Mb. The HJs with higher GC content were observed more frequently at the genome. A high percentage of HJs were associated with all main TE families, with specificity for particular active or inactive elements: DNA elements and the retroelements ALUs, LINEs and HERVs up to 41.94%, 72.72%, 42.94% and 84.5%, respectively. Phylogenetic analysis revealed that HJs occur in both active and inactive TEs. Furthermore, the TE-associated HJs were almost exclusively found within a distance less than 1 Mb from human genes, while only 23 were not associated with any genes. This is the first report associating human HJs, with mobile elements. Our data pinpoint that particular HJ forms show preference for specific active retrotransposon families of ALUs and LINEs, suggesting that retrotransposon-incorporated HJs may relocate or replicate in the genome through retrotransposition, contributing to recombination, genome plasticity and DNA repair.

  2. A novel target-specific gene delivery system combining baculovirus and sequence-specific long interspersed nuclear elements.

    PubMed

    Kawashima, Tomoko; Osanai, Mizuko; Futahashi, Ryo; Kojima, Tetsuya; Fujiwara, Haruhiko

    2007-07-01

    Transposable elements are valuable for somatic and germ-line transformation. However, long interspersed nuclear elements (LINEs) have not been used because of poor information on the transposition mechanism. We have developed a novel gene delivery system combining baculovirus AcNPV and two silkworm LINEs, SART1 and R1, which integrate into specific sequences of telomeric repeats and 28S ribosomal DNA, respectively. When two LINEs containing the enhanced green fluorescent protein gene recombined into AcNPV were infected into fifth instar larvae of the silkworm, we observed target-specific retrotransposition of LINEs at 72h post-infection, using polymerase chain reaction amplification and sequencing. Telomere- and 28S rDNA-specific transposition occurred in all nine tissues tested, including the ovary and testis. This is the first demonstration of site-specific gene delivery in living larvae. Insertion efficiencies were dependent on the virus titer for injection and the host strains of Bombyx mori. Using this system, we successfully detected the intergeneration transmission of retrotransposed sequences. In addition, AcNPV-mediated SART1 also transposed into telomere of another lepidopteran, Orgyia recens, suggesting that this system is useful for a wide variety of AcNPV-infectious insects. Site-specific gene delivery by virus-mediated LINE will be a potential gene therapy tool to avoid harmful unexpected insertions.

  3. Effects of heavy metal and other elemental additives to activated sludge on growth of Eisenia foetida

    SciTech Connect

    Hartenstein, R.; Neuhauser, E.F.; Narahara, A.

    1981-09-01

    The approximate level at which added concentrations of certain elements would cause an activated sludge to induce a toxic effect upon the growth of Eisenia foetida was determined. During 43 trials on sludge samples obtained throughout 1 year of study, earthworms grew from 3 to 10 mg live wt at hatching to 792 mg +- 18% (mean +- C.V.) in 8 weeks, when sludge was 24/sup 0/C and contained no additives. None of several elements commonly used in microbial growth media enhanced the growth rate of the earthworm. At salt concentrations up to about 6.6% on a dry wt basis, none of six anions tested was in and of itself toxic, while five of 15 cations - Co, Hg, Cu, Ni, and Cd - appeared specifically to inhibit growth rate or cause death. Manganese, Cr, and Pb were innocuous even at the highest levels of application - 22,000, 46,000, and 52,000 mg/kg, respectively. Neither the anionic nor cationic component of certain salts, such as NaCl or NH/sub 4/Cl, could be said to inhibit growth, which occurred only at high concentrations of these salts (about 3.3 and/or 6.6%). Below 7 mmho/cm, toxicity could not be correlated with electrolytic conductance, though higher values may help to explain the nonspecific growth inhibitory effects of salts like NaCl and KCl. Nor could toxicity ever be ascribed to hydrogen ion activity, since sludge pH was not altered even at the highest salt dose. It is concluded that except under very extreme conditions, the levels of heavy metals and salts generally found in activated sludges will not have an adverse affect on the growth of E. foetida.

  4. Population genetics and molecular evolution of DNA sequences in transposable elements. I. A simulation framework.

    PubMed

    Kijima, T E; Innan, Hideki

    2013-11-01

    A population genetic simulation framework is developed to understand the behavior and molecular evolution of DNA sequences of transposable elements. Our model incorporates random transposition and excision of transposable element (TE) copies, two modes of selection against TEs, and degeneration of transpositional activity by point mutations. We first investigated the relationships between the behavior of the copy number of TEs and these parameters. Our results show that when selection is weak, the genome can maintain a relatively large number of TEs, but most of them are less active. In contrast, with strong selection, the genome can maintain only a limited number of TEs but the proportion of active copies is large. In such a case, there could be substantial fluctuations of the copy number over generations. We also explored how DNA sequences of TEs evolve through the simulations. In general, active copies form clusters around the original sequence, while less active copies have long branches specific to themselves, exhibiting a star-shaped phylogeny. It is demonstrated that the phylogeny of TE sequences could be informative to understand the dynamics of TE evolution.

  5. Extension to linear dynamics for hybrid stress finite element formulation based on additional displacements

    NASA Astrophysics Data System (ADS)

    Sumihara, K.

    Based upon legitimate variational principles, one microscopic-macroscopic finite element formulation for linear dynamics is presented by Hybrid Stress Finite Element Method. The microscopic application of Geometric Perturbation introduced by Pian and the introduction of infinitesimal limit core element (Baby Element) have been consistently combined according to the flexible and inherent interpretation of the legitimate variational principles initially originated by Pian and Tong. The conceptual development based upon Hybrid Finite Element Method is extended to linear dynamics with the introduction of physically meaningful higher modes.

  6. Genetic and functional analysis of HIV-1 Rev Responsive Element (RRE) sequences from North-India

    PubMed Central

    2010-01-01

    HIV-1 Rev protein regulates the expression of HIV-1 transcripts by binding to a highly structured stem loop structure called the Rev Responsive Element (RRE) present in the genomic and partially spliced RNAs. Genetic variation in this structure is likely to affect binding of Rev protein and ultimately overall gene expression and replication. We characterized RRE sequences from 13 HIV-1 infected individuals from North India which also included two mother-child pairs following vertical transmission. We observed high degree of conservation of sequences, including the 9-nt (CACUAUGGG) long sequence in stem-loop B, required for efficient binding of Rev protein. All of our 13 RRE sequences possessed G to A (position 66) mutation located in the critical branched-stem-loop B which is not present in consensus C or B sequence. We derived a consensus RRE structure which showed interesting changes in the stem-loop structures including the stem-loop B. Mother-Child RRE sequences showed conservation of unique polymorphisms as well as some new mutations in child RRE sequences. Despite these changes, the ability to form multiple essential stem-loop structures required for Rev binding was conserved. RRE RNA derived from one of the samples, VT5, retained the ability to bind Rev protein under in vitro conditions although it showed alternate secondary structure. This is the first study from India describing the structural and possible functional implications due to very unique RRE sequence heterogeneity and its possible role in vertical transmission and gene expression. PMID:20682034

  7. LINE-1 elements: analysis by fluorescence in-situ hybridization and nucleotide sequences.

    PubMed

    Waters, Paul D; Dobigny, Gauthier; Waddell, Peter J; Robinson, Terence J

    2008-01-01

    Long-interspersed nuclear element-1 (LINE-1) is a non-terminal repeat transposon that constitutes a major component of the mammalian genome. LINE-1 has a dynamic evolutionary history characterized by the rise, fall, and replacement of subfamilies. The distribution of LINE-1 elements can be viewed from a chromosomal perspective using fluorescence in-situ hybridization (FISH), as well as at the sequence level. We have designed LINE-1 primers from regions conserved among mouse, rat, rabbit, and human L1, which were able to amplify part of ORF2 from all eutherian (placental) mammals tested thus far. The product generated can be used as a FISH painting probe to examine the genomic distribution of L1 in different species. It can also be cloned and sequenced for phylogenetic analysis. Although FISH patterns resulting from LINE-1 chromosome painting and bioinformatic analyses have shown that this element accumulates in AT-rich regions of the genomes of mouse and human, our PCR amplified LINE-1 probe suggests that this is not a universal phenomenon, and that the patterns displayed in laurasiatherian, afrotherian and xenarthran species are less prominent. The "banding" like distribution of LINE-1 observed in human and mouse, therefore, appears to reflect aspects of genome architecture unique to Euarchontoglires (Supraprimates), the superordinal clade to which they belong. By sequencing the cloned amplicons used for FISH experiments and supplementing these with L1 sequences obtained from public databases, analysis by parsimony, distance-based, maximum likelihood, and "hierarchical Bayesian" or "marginal likelihood" methods provides a powerful adjunct to the FISH data. Using this approach, relatively intact LINE-1 from most placental orders tend to reflect accepted eutherian evolutionary relationships. This suggests that there were often only closely related copies active near branch points in the tree, that inactive copies tended to become extinct quite readily, and that for

  8. The Chinese hamster Alu-equivalent sequence: a conserved highly repetitious, interspersed deoxyribonucleic acid sequence in mammals has a structure suggestive of a transposable element.

    PubMed Central

    Haynes, S R; Toomey, T P; Leinwand, L; Jelinek, W R

    1981-01-01

    A consensus sequence has been determined for a major interspersed deoxyribonucleic acid repeat in the genome of Chinese hamster ovary cells (CHO cells). This sequence is extensively homologous to (i) the human Alu sequence (P. L. Deininger et al., J. Mol. Biol., in press), (ii) the mouse B1 interspersed repetitious sequence (Krayev et al., Nucleic Acids Res. 8:1201-1215, 1980) (iii) an interspersed repetitious sequence from African green monkey deoxyribonucleic acid (Dhruva et al., Proc. Natl. Acad. Sci. U.S.A. 77:4514-4518, 1980) and (iv) the CHO and mouse 4.5S ribonucleic acid (this report; F. Harada and N. Kato, Nucleic Acids Res. 8:1273-1285, 1980). Because the CHO consensus sequence shows significant homology to the human Alu sequence it is termed the CHO Alu-equivalent sequence. A conserved structure surrounding CHO Alu-equivalent family members can be recognized. It is similar to that surrounding the human Alu and the mouse B1 sequences, and is represented as follows: direct repeat-CHO-Alu-A-rich sequence-direct repeat. A composite interspersed repetitious sequence has been identified. Its structure is represented as follows: direct repeat-residue 47 to 107 of CHO-Alu-non-Alu repetitious sequence-A-rich sequence-direct repeat. Because the Alu flanking sequences resemble those that flank known transposable elements, we think it likely that the Alu sequence dispersed throughout the mammalian genome by transposition. Images PMID:9279371

  9. Addition of organic amendments contributes to C sequestration in trace element contaminated soils.

    NASA Astrophysics Data System (ADS)

    del Mar Montiel Rozas, María; Panettier, Marco; Madejón Rodríguez, Paula; Madejón Rodríguez, Engracia

    2015-04-01

    Nowadays, the study of global C cycle and the different natural sinks of C have become especially important in a climate change context. Fluxes of C have been modified by anthropogenic activities and, presently, the global objective is the decrease of net CO2 emission. For this purpose, many studies are being conducted at local level for evaluate different C sequestration strategies. These techniques must be, in addition to safe in the long term, environmentally friendly. Restoration of contaminated and degraded areas is considered as a strategy for SOC sequestration. Our study has been carried out in the Guadiamar Green Corridor (Seville, Spain) affected by the Aznalcóllar mining accident. This accident occurred 16 years ago, due to the failure of the tailing dam which contained 4-5 million m3 of toxic tailings (slurry and acid water).The affected soils had a layer of toxic sludge containing heavy metals as As, Cd, Cu, Pb and Zn. Restoration techniques began to be applied just after the accident, including the removal of the toxic sludge and a variable layer of topsoil (10-30 cm) from the surface. In a second phase, in a specific area (experimental area) of the Green Corridor the addition of organic amendments (Biosolid compost (BC) and Leonardite (LE), a low grade coal rich in humic acids) was carried out to increase pH, organic matter and fertility in a soil which lost its richest layer during the clean-up operation. In our experimental area, half of the plots (A) received amendments for four years (2002, 2003, 2006 and 2007) whereas the other half (B) received amendments only for two years (2002-2003). To compare, plots without amendments were also established. Net balance of C was carried out using values of Water Soluble Carbon (WSC) and Total Organic Carbon (TOC) for three years (2012, 2013 and 2015). To eliminate artificial changes carried out in the plots, amendment addition and withdrawal of biomass were taken into account to calculate balance of kg TOC

  10. Complete Plastome Sequences from Glycine syndetika and Six Additional Perennial Wild Relatives of Soybean

    PubMed Central

    Sherman-Broyles, Sue; Bombarely, Aureliano; Grimwood, Jane; Schmutz, Jeremy; Doyle, Jeff

    2014-01-01

    Organelle sequences have a long history of utility in phylogenetic analyses. Chloroplast sequences when combined with nuclear data can help resolve relationships among flowering plant genera, and within genera incongruence can point to reticulate evolution. Plastome sequences are becoming plentiful because they are increasingly easier to obtain. Complete plastome sequences allow us to detect rare rearrangements and test the tempo of sequence evolution. Chloroplast sequences are generally considered a nuisance to be kept to a minimum in bacterial artificial chromosome libraries. Here, we sequenced two bacterial artificial chromosomes per species to generate complete plastome sequences from seven species. The plastome sequences from Glycine syndetika and six other perennial Glycine species are similar in arrangement and gene content to the previously published soybean plastome. Repetitive sequences were detected in high frequencies as in soybean, but further analysis showed that repeat sequence numbers are inflated. Previous chloroplast-based phylogenetic trees for perennial Glycine were incongruent with nuclear gene–based phylogenetic trees. We tested whether the hypothesis of introgression was supported by the complete plastomes. Alignment of complete plastome sequences and Bayesian analysis allowed us to date putative hybridization events supporting the hypothesis of introgression and chloroplast “capture.” PMID:25155272

  11. Negative regulatory element associated with potentially functional promoter and enhancer elements in the long terminal repeats of endogenous murine leukemia virus-related proviral sequences

    SciTech Connect

    Ch'ang, L.Y.; Yang, W.K.; Myer, F.E.; Yang, D.M.

    1989-06-01

    Three series of recombinant DNA clones were constructed, with the bacterial chloramphenical acetyltransferase (CAT) gene as a quantitative indicator, to examine the activities of promoter and enhancer sequence elements in the 5' long terminal repeat (LTR) of murine leukemia virus (MuLV)-related proviral sequences isolated from the mouse genome. Transient CAT expression was determined in mouse NIH 3T3, human HT1080, and mink CCL64 cultured cells transfected with the LTR-CAT constructs. The 700-base pair (bp) LTRs of three polytropic MuLV-related proviral clones and the 750-bp LTRs of four modified polytropic proviral clones, in complete structures either with or without the adjacent downstream sequences, all showed very little or negligible activities for CAT expression, while ecotropic MuLV LTRs were highly active. The MuLV-related LTRs were divided into three portions and examined separately. The 3' portion of the MuLV-related LTRs that contains the CCAAC and TATAA boxes was found to be a functional promoter, being about one-half to one-third as active as the corresponding portion of the ecotropic MuLV LTRs. A MboI-Bg/II fragment, representing the distinct 190- to 200-pb inserted segment in the middle, was found to be a potential enhancer, especially when examined in combination with the simian virus 40 promoter in CCL64 cells. A PstI-MboI fragment of the 5' portion, which contains the protein-binding motifs on the enhancer segment as well as the upstream LTF sequences, showed moderate enhancer activities in CCL6 cells but was virtually inactive in NIH 3T3 cells and HT1080 cells; addition of this fragment to the ecotropic LTR-CAT constructs depressed CAT expression.

  12. GAGA factor binding to DNA via a single trinucleotide sequence element.

    PubMed Central

    Wilkins, R C; Lis, J T

    1998-01-01

    GAGA transcription factor (GAF) is an essential protein in Drosophila , important for the transcriptional regulation of numerous genes. GAF binds to GA repeats in the promoters of these genes via a DNA-binding domain containing a single zinc finger. While GAF binding sites are typically composed of 3.5 GA repeats, the Drosophila hsp70 gene contains much smaller elements, some of which are as little as three bases (GAG) in length. Interestingly, the binding of GAF to more distant trinucleotide elements is relatively strong and not appreciably affected by the removal of larger GA arrays in the promoter. Moreover, a simple synthetic GAG sequence is sufficient to bind GAF in vitro . Here we directly compare the affinity of GAF for different sequence elements by immunoprecipitation and gel mobility shift analysis. Furthermore, our measures of the concentration of GAF in vivo indicate that it is a highly abundant nuclear protein, prevalent enough to occupy a sizable fraction of correspondingly abundant trinucleotide sites. PMID:9592153

  13. Sequence element enrichment analysis to determine the genetic basis of bacterial phenotypes

    PubMed Central

    Lees, John A.; Vehkala, Minna; Välimäki, Niko; Harris, Simon R.; Chewapreecha, Claire; Croucher, Nicholas J.; Marttinen, Pekka; Davies, Mark R.; Steer, Andrew C.; Tong, Steven Y. C.; Honkela, Antti; Parkhill, Julian; Bentley, Stephen D.; Corander, Jukka

    2016-01-01

    Bacterial genomes vary extensively in terms of both gene content and gene sequence. This plasticity hampers the use of traditional SNP-based methods for identifying all genetic associations with phenotypic variation. Here we introduce a computationally scalable and widely applicable statistical method (SEER) for the identification of sequence elements that are significantly enriched in a phenotype of interest. SEER is applicable to tens of thousands of genomes by counting variable-length k-mers using a distributed string-mining algorithm. Robust options are provided for association analysis that also correct for the clonal population structure of bacteria. Using large collections of genomes of the major human pathogens Streptococcus pneumoniae and Streptococcus pyogenes, SEER identifies relevant previously characterized resistance determinants for several antibiotics and discovers potential novel factors related to the invasiveness of S. pyogenes. We thus demonstrate that our method can answer important biologically and medically relevant questions. PMID:27633831

  14. Comparative analysis of dioxin response elements in human, mouse and rat genomic sequences.

    PubMed

    Sun, Y V; Boverhof, D R; Burgoon, L D; Fielden, M R; Zacharewski, T R

    2004-01-01

    Comparative approaches were used to identify human, mouse and rat dioxin response elements (DREs) in genomic sequences unambiguously assigned to a nucleotide RefSeq accession number. A total of 13 bona fide DREs, all including the substitution intolerant core sequence (GCGTG) and adjacent variable sequences, were used to establish a position weight matrix and a matrix similarity (MS) score threshold to rank identified DREs. DREs with MS scores above the threshold were disproportionately distributed in close proximity to the transcription start site in all three species. Gene expression assays in hepatic mouse tissue confirmed the responsiveness of 192 genes possessing a putative DRE. Previously identified functional DREs in well-characterized AhR-regulated genes including Cyp1a1 and Cyp1b1 were corroborated. Putative DREs were identified in 48 out of 2437 human-mouse-rat orthologous genes between -1500 and the transcriptional start site, of which 19 of these genes possessed positionally conserved DREs as determined by multiple sequence alignment. Seven of these nineteen genes exhibited 2,3,7,8-tetrachlorodibenzo-p-dioxin-mediated regulation, although there were significant discrepancies between in vivo and in vitro results. Interestingly, of the mouse-rat orthologous genes with a DRE between -1500 and +1500, only 37% had an equivalent human ortholog. These results suggest that AhR-mediated gene expression may not be well conserved across species, which could have significant implications in human risk assessment.

  15. Comparative analysis of dioxin response elements in human, mouse and rat genomic sequences

    PubMed Central

    Sun, Y. V.; Boverhof, D. R.; Burgoon, L. D.; Fielden, M. R.; Zacharewski, T. R.

    2004-01-01

    Comparative approaches were used to identify human, mouse and rat dioxin response elements (DREs) in genomic sequences unambiguously assigned to a nucleotide RefSeq accession number. A total of 13 bona fide DREs, all including the substitution intolerant core sequence (GCGTG) and adjacent variable sequences, were used to establish a position weight matrix and a matrix similarity (MS) score threshold to rank identified DREs. DREs with MS scores above the threshold were disproportionately distributed in close proximity to the transcription start site in all three species. Gene expression assays in hepatic mouse tissue confirmed the responsiveness of 192 genes possessing a putative DRE. Previously identified functional DREs in well-characterized AhR-regulated genes including Cyp1a1 and Cyp1b1 were corroborated. Putative DREs were identified in 48 out of 2437 human–mouse–rat orthologous genes between −1500 and the transcriptional start site, of which 19 of these genes possessed positionally conserved DREs as determined by multiple sequence alignment. Seven of these nineteen genes exhibited 2,3,7,8-tetrachlorodibenzo-p-dioxin-mediated regulation, although there were significant discrepancies between in vivo and in vitro results. Interestingly, of the mouse–rat orthologous genes with a DRE between −1500 and +1500, only 37% had an equivalent human ortholog. These results suggest that AhR-mediated gene expression may not be well conserved across species, which could have significant implications in human risk assessment. PMID:15328365

  16. Identification of sequence elements contributing to the intrinsic curvature of the mouse satellite DNA repeat.

    PubMed Central

    Carrera, P; Martínez-Balbás, M A; Portugal, J; Azorín, F

    1991-01-01

    In this paper, the contribution of different sequence elements to the intrisic curvature of the mouse satellite DNA repeat was investigated. This DNA fragment contains nineteen groups of three or more consecutive adenines which are only poorly phased with respect to the helical repeat. The mouse satellite DNA repeat shows a sinusoidal pattern of cleavage by the hydroxyl radical; the waves of reactivity are phased with respect to the A-tracts. Some interesting observations arise from a detailed analysis of these cleavage patterns: a) the maxima of hydroxyl radical cleavage are more periodically spaced along the DNA sequence than the A-tracts themselves. As a consequence, the position of each maximum with respect to the A-tract is variable; b) the sequence 5' TGGAATATG/AA 3' shows a sinusoidal pattern of hydroxyl radical cleavage. This sequence shows a retarded migration in polyacrylamide gels indicating that it is actually intrinsically curved. These results are discussed in view of the current models for DNA curvature. Images PMID:1658737

  17. Identification and characterization of DNA sequences that prevent glucocorticoid receptor binding to nearby response elements.

    PubMed

    Telorac, Jonas; Prykhozhij, Sergey V; Schöne, Stefanie; Meierhofer, David; Sauer, Sascha; Thomas-Chollier, Morgane; Meijsing, Sebastiaan H

    2016-07-27

    Out of the myriad of potential DNA binding sites of the glucocorticoid receptor (GR) found in the human genome, only a cell-type specific minority is actually bound, indicating that the presence of a recognition sequence alone is insufficient to specify where GR binds. Cooperative interactions with other transcription factors (TFs) are known to contribute to binding specificity. Here, we reasoned that sequence signals preventing GR recruitment to certain loci provide an alternative means to confer specificity. Motif analyses uncovered candidate Negative Regulatory Sequences (NRSs) that interfere with genomic GR binding. Subsequent functional analyses demonstrated that NRSs indeed prevent GR binding to nearby response elements. We show that NRS activity is conserved across species, found in most tissues and that they also interfere with the genomic binding of other TFs. Interestingly, the effects of NRSs appear not to be a simple consequence of changes in chromatin accessibility. Instead, we find that NRSs interact with proteins found at sub-nuclear structures called paraspeckles and that these proteins might mediate the repressive effects of NRSs. Together, our studies suggest that the joint influence of positive and negative sequence signals partition the genome into regions where GR can bind and those where it cannot.

  18. Ultraconserved Elements Sequencing as a Low-Cost Source of Complete Mitochondrial Genomes and Microsatellite Markers in Non-Model Amniotes

    PubMed Central

    Raposo do Amaral, Fábio; Neves, Leandro G.; Resende, Márcio F. R.; Mobili, Flávia; Miyaki, Cristina Y.; Pellegrino, Katia C. M.; Biondo, Cibele

    2015-01-01

    Sequence capture of ultraconserved elements (UCEs) associated with massively parallel sequencing has become a common source of nuclear data for studies of animal systematics and phylogeography. However, mitochondrial and microsatellite variation are still commonly used in various kinds of molecular studies, and probably will complement genomic data in years to come. Here we show that besides providing abundant genomic data, UCE sequencing is an excellent source of both sequences for microsatellite loci design and complete mitochondrial genomes with high sequencing depth. Identification of dozens of microsatellite loci and assembly of complete mitogenomes is exemplified here using three species of Poospiza warbling finches from southern and southeastern Brazil. This strategy opens exciting opportunities to simultaneously analyze genome-wide nuclear datasets and traditionally used mtDNA and microsatellite markers in non-model amniotes at no additional cost. PMID:26379155

  19. Transcription of the Drosophila melanogaster 5S RNA gene requires an upstream promoter and four intragenic sequence elements

    SciTech Connect

    Sharp, S.J.; Garcia, A.D.

    1988-03-01

    Linker-scanning (LS) mutations were constructed spanning the length of the Drosophila melanogaster 5S RNA gene. In vitro transcription analysis of the LS 5S DNAs revealed five transcription control regions. One control region essential for the transcription initiation was identified in the 5'-flanking sequence. The major sequence determinants of this upstream promoter region were located between coordinates -39 and -26 (-30 region), but important sequences extended to the transcription start site at position 1. Since mutations in the upstream promoter did not alter the ability of 5S DNA to sequester transcription factors into a stable transcription complex, it appears that this control region involved the interaction of RNA polymerase III. Active 5S DNA transcription additionally required the four intragenic control regions (ICRs) located between coordinates 3 and 18 (ICR I), 37 and 44 (ICR II), 48 and 61 (ICR III), and 78 and 98 (ICR IV). LS mutations in each ICR decreased the ability of 5S DNA to sequester transcription factors. ICR III, ICR IV, and the spacer sequence between were similar in sequence and position to the determinant elements of the multipartite ICR of Xenopus 5S DNA. The importance of ICR III and ICR IV in transcription initiation and in sequestering transcription factors suggests the presence of an activity in D. melanogaster similar to transcription factor TFIIIA of Xenopus laevis and HeLa cells. Transcription initiation of Drosophila 5S DNA was not eliminated by LS mutations in the spacer region even though these mutations reduced the ability of the TFIIIA-like activity to bind.

  20. The effect of trace element addition to mono-digestion of grass silage at high organic loading rates.

    PubMed

    Wall, David M; Allen, Eoin; Straccialini, Barbara; O'Kiely, Padraig; Murphy, Jerry D

    2014-11-01

    This study investigated the effect of trace element addition to mono-digestion of grass silage at high organic loading rates. Two continuous reactors were compared. The first mono-digested grass silage whilst the second operated in co-digestion, 80% grass silage with 20% dairy slurry (VS basis). The reactors were run for 65weeks with a further 5weeks taken for trace element supplementation for the mono-digestion of grass silage. The co-digestion reactor reported a higher biomethane efficiency (1.01) than mono-digestion (0.90) at an OLR of 4.0kgVSm(-3)d(-1) prior to addition of trace elements. Addition of cobalt, iron and nickel, led to an increase in the SMY in mono-digestion of grass silage by 12% to 404LCH4kg(-1)VS and attained a biomethane efficiency of 1.01.

  1. Occurrence of Tn4371-related mobile elements and sequences in (chloro)biphenyl-degrading bacteria.

    PubMed

    Springael, D; Ryngaert, A; Merlin, C; Toussaint, A; Mergeay, M

    2001-01-01

    Tn4371, a 55-kb transposable element involved in the degradation and biphenyl or 4-chlorobiphenyl identified in Ralstonia eutropha A5, displays a modular structure including a phage-like integrase gene (int), a Pseudomonas-like (chloro)biphenyl catabolic gene cluster (bph), and RP4- and Ti-plasmid-like transfer genes (trb) (C. Merlin, D. Springael, and A. Toussaint, Plasmid 41:40-54, 1999). Southern blot hybridization was used to examine the presence of different regions of Tn4371 in a collection of (chloro)biphenyl-degrading bacteria originating from different habitats and belonging to different bacterial genera. Tn4371-related sequences were never detected on endogenous plasmids. Although the gene probes containing only bph sequences hybridized to genomic DNA from most strains tested, a limited selection of strains, all beta-proteobacteria, displayed hybridization patterns similar to the Tn4371 bph cluster. Homology between Tn4371 and DNA of two of those strains, originating from the same area as strain A5, extended outside the catabolic genes and covered the putative transfer region of Tn4371. On the other hand, none of the (chloro)biphenyl degraders hybridized with the outer left part of Tn4371 containing the int gene. The bph catabolic determinant of the two strains displaying homology to the Tn4371 transfer genes and a third strain isolated from the A5 area could be mobilized to a R. eutropha recipient, after insertion into an endogenous or introduced IncP1 plasmid. The mobilized DNA of those strains included all Tn4371 homologous sequences previously identified in their genome. Our observations show that the bph genes present on Tn4371 are highly conserved between different (chloro)biphenyl-degrading hosts, isolated globally but belonging mainly to the beta-proteobacteria. On the other hand, Tn4371-related mobile elements carrying bph genes are apparently only found in isolates from the environment that provided the Tn4371-bearing isolate A5.

  2. Characterization of an Insertion Sequence Element Associated with Genetically Diverse Plant Pathogenic Streptomyces spp.

    PubMed Central

    Healy, Frank G.; Bukhalid, Raghida A.; Loria, Rosemary

    1999-01-01

    Streptomycetes are common soil inhabitants, yet few described species are plant pathogens. While the pathogenicity mechanisms remain unclear, previous work identified a gene, nec1, which encodes a putative pathogenicity or virulence factor. nec1 and a neighboring transposase pseudogene, ORFtnp, are conserved among unrelated plant pathogens and absent from nonpathogens. The atypical GC content of nec1 suggests that it was acquired through horizontal transfer events. Our investigation of the genetic organization of regions adjacent to the 3′ end of nec1 in Streptomyces scabies 84.34 identified a new insertion sequence (IS) element, IS1629, with homology to other IS elements from prokaryotic animal pathogens. IS1629 is 1,462 bp with 26-bp terminal inverted repeats and encodes a putative 431-amino-acid (aa) transposase. Transposition of IS1629 generates a 10-bp target site duplication. A 77-nucleotide (nt) sequence encompassing the start codon and upstream region of the transposase was identified which could function in the posttranscritpional regulation of transposase synthesis. A functional copy of IS1629 from S. turgidiscabies 94.09 (Hi-C-13) was selected in the transposon trap pCZA126, through its insertion into the λ cI857 repressor. IS1629 is present in multiple copies in some S. scabies strains and is present in all S. acidiscabies and S. turgidiscabies strains examined. A second copy of IS1629 was identified between ORFtnp and nec1 in S. acidiscabies strains. The diversity of IS1629 hybridization profiles was greatest within S. scabies. IS1629 was absent from the 27 nonpathogenic Streptomyces strains tested. The genetic organization and nucleotide sequence of the nec1-IS1629 region was conserved and identical among representatives of S. acidiscabies and S. turgidiscabies. These findings support our current model for the unidirectional transfer of the ORFtnp-nec1-IS1629 locus from IS1629-containing S. scabies (type II) to S. acidiscabies and S. turgidiscabies

  3. Additional variability at the D12S391 STR locus in an Austrian population sample: sequencing data and allele distribution.

    PubMed

    Glock, B; Dauber, E M; Schwartz, D W; Mayr, W R

    1997-12-01

    The highly polymorphic STR locus D12S391 was investigated in an Austrian population sample (N = 150) by PCR-amplification, comparative detection on native and denaturing polyacrylamide gels and solid phase single stranded sequencing of three size variant alleles and several additional alleles. A total of 15 alleles, distinguishable by size under denaturing conditions, could be detected. No deviations from Hardy-Weinberg equilibrium were observed in the population investigated (P = 0.52). Sequencing of size variants designated 17.3 and 18.3 showed an incomplete (GAT) repeat unit at position two of the tandem region. Additional new sequence variants due to varying compositions of the number of (AGAT) and (AGAC) repeats could be identified. Due to distinct electrophoretical mobilities of alleles of the same size but different sequence structures, denaturing detection conditions should be employed when the aim is standardization.

  4. Identification of a sequence element directing a protein to nuclear speckles.

    PubMed

    Eilbracht, J; Schmidt-Zachmann, M S

    2001-03-27

    SF3b(155) is an essential spliceosomal protein, highly conserved during evolution. It has been identified as a subunit of splicing factor SF3b, which, together with a second multimeric complex termed SF3a, interacts specifically with the 12S U2 snRNP and converts it into the active 17S form. The protein displays a characteristic intranuclear localization. It is diffusely distributed in the nucleoplasm but highly concentrated in defined intranuclear structures termed "speckles," a subnuclear compartment enriched in small ribonucleoprotein particles and various splicing factors. The primary sequence of SF3b(155) suggests a multidomain structure, different from those of other nuclear speckles components. To identify which part of SF3b(155) determines its specific intranuclear localization, we have constructed expression vectors encoding a series of epitope-tagged SF3b(155) deletion mutants as well as chimeric combinations of SF3b(155) sequences with the soluble cytoplasmic protein pyruvate kinase. Following transfection of cultured mammalian cells, we have identified (i) a functional nuclear localization signal of the monopartite type (KRKRR, amino acids 196--200) and (ii) a molecular segment with multiple threonine-proline repeats (amino acids 208--513), which is essential and sufficient to confer a specific accumulation in nuclear speckles. This latter sequence element, in particular amino acids 208--440, is required for correct subcellular localization of SF3b(155) and is also sufficient to target a reporter protein to nuclear speckles. Moreover, this "speckle-targeting sequence" transfers the capacity for interaction with other U2 snRNP components.

  5. Genomic Heat Shock Element Sequences Drive Cooperative Human Heat Shock Factor 1 DNA Binding and Selectivity*

    PubMed Central

    Jaeger, Alex M.; Makley, Leah N.; Gestwicki, Jason E.; Thiele, Dennis J.

    2014-01-01

    The heat shock transcription factor 1 (HSF1) activates expression of a variety of genes involved in cell survival, including protein chaperones, the protein degradation machinery, anti-apoptotic proteins, and transcription factors. Although HSF1 activation has been linked to amelioration of neurodegenerative disease, cancer cells exhibit a dependence on HSF1 for survival. Indeed, HSF1 drives a program of gene expression in cancer cells that is distinct from that activated in response to proteotoxic stress, and HSF1 DNA binding activity is elevated in cycling cells as compared with arrested cells. Active HSF1 homotrimerizes and binds to a DNA sequence consisting of inverted repeats of the pentameric sequence nGAAn, known as heat shock elements (HSEs). Recent comprehensive ChIP-seq experiments demonstrated that the architecture of HSEs is very diverse in the human genome, with deviations from the consensus sequence in the spacing, orientation, and extent of HSE repeats that could influence HSF1 DNA binding efficacy and the kinetics and magnitude of target gene expression. To understand the mechanisms that dictate binding specificity, HSF1 was purified as either a monomer or trimer and used to evaluate DNA-binding site preferences in vitro using fluorescence polarization and thermal denaturation profiling. These results were compared with quantitative chromatin immunoprecipitation assays in vivo. We demonstrate a role for specific orientations of extended HSE sequences in driving preferential HSF1 DNA binding to target loci in vivo. These studies provide a biochemical basis for understanding differential HSF1 target gene recognition and transcription in neurodegenerative disease and in cancer. PMID:25204655

  6. Control of Gas Tungsten Arc welding pool shape by trace element addition to the weld pool

    DOEpatents

    Heiple, C.R.; Burgardt, P.

    1984-03-13

    An improved process for Gas Tungsten Arc welding maximizes the depth/width ratio of the weld pool by adding a sufficient amount of a surface active element to insure inward fluid flow, resulting in deep, narrow welds. The process is especially useful to eliminate variable weld penetration and shape in GTA welding of steels and stainless steels, particularly by using a sulfur-doped weld wire in a cold wire feed technique.

  7. Photon mass energy transfer coefficients for elements z=1 to 92 and 48 additional substances of dosimetric interest.

    PubMed

    Kato, Hideki

    2014-07-01

    Photon mass energy transfer coefficient is an essential factor when converting photon energy fluence into kinetic energy released per unit mass (kerma). Although mass attenuation coefficient and mass energy absorption coefficients can be looked up in databases, the mass energy transfer coefficient values are still controversial. In this paper, the photon mass energy transfer coefficients for elements Z=1-92 were calculated based on cross-sectional data for each photon interaction type. Mass energy transfer coefficients for 48 compounds and/or mixtures of dosimetric interest were calculated from coefficient data for elements using Bragg's additivity rule. We additionally developed software that can search these coefficient data for any element or substance of dosimetric interest. The database and software created in this paper should prove useful for radiation measurements and/or dose calculations.

  8. New cfiA variant and novel insertion sequence elements in carbapenem-resistant Bacteroides fragilis isolates from Korea.

    PubMed

    Roh, Kyoung Ho; Kim, Sinyoung; Kim, Chang-Ki; Yum, Jong Hwa; Kim, Myung Sook; Yong, Dongeun; Jeong, Seok Hoon; Lee, Kyungwon; Kim, June Myung; Chong, Yunsop

    2010-04-01

    Of 276 nonduplicate Bacteroides fragilis clinical isolates recovered from 1997 to 2004, 3 were resistant to carbapenem. cepA and cfiA alleles were detected by polymerase chain reaction in 240 (87.0%) and 11 (4.0%) of the isolates, respectively. Insertion sequence (IS) elements were found only in the 3 carbapenem-resistant B. fragilis isolates, which produced metallo-beta-lactamase at a level detectable by UV spectrophotometry. Sequence analysis showed 1 new cfiA variant, cfiA(11), and 2 novel IS elements. The cfiA(11) gene revealed 5 amino acid substitutions compared to cfiA, with 97.6% amino acid identity. The transposase, terminal inverted repeat sequence, and target site duplication sequence of the 2 novel IS elements were unique. This study reconfirmed the correlation between ISs and carbapenem resistance in B. fragilis.

  9. Determination of rare earth elements and other trace elements (Y, Mn, Co, Cr) in seawater using Tm addition and Mg(OH)₂ co-precipitation.

    PubMed

    Freslon, Nicolas; Bayon, Germain; Birot, Dominique; Bollinger, Claire; Barrat, Jean Alix

    2011-07-15

    This paper reports on a novel procedure for determining trace element abundances (REE and Y, Cr, Mn, Co) in seawater by inductively coupled plasma sector field mass spectrometry (ICP-SFMS). The procedure uses a combination of pre-concentration using co-precipitation onto magnesium hydroxides and addition of thulium spike. The validity of the method was assessed onto 25 ml volumes of certified reference materials (NASS- and CASS-4) and in house seawater standard. Procedural blanks were determined by applying the same procedure to aliquots of seawater previously depleted in trace elements by successive Mg(OH)(2) co-precipitations, yielding estimated contributions to the studied samples better than 1.1% for all elements, with the exception of Cr (<3.3%) and Co (up to 8%). The reproducibility of the method over the six month duration of the study was smaller than 11% RSD for all the studied elements. Results obtained for NASS-5 and CASS-4 agree well with published working values for trace elements.

  10. Sequence analyses and chromosomal distribution of the Tc1/Mariner element in Parodontidae fish (Teleostei: Characiformes).

    PubMed

    Schemberger, Michelle Orane; Nogaroto, Viviane; Almeida, Mara Cristina; Artoni, Roberto Ferreira; Valente, Guilherme Targino; Martins, Cesar; Moreira-Filho, Orlando; Cestari, Marta Margarete; Vicari, Marcelo Ricardo

    2016-11-30

    Transposable elements are able to move along eukaryotic genomes. They are divided into two classes according to their transposition intermediate: RNA (class I or retrotransposons) or DNA (class II or DNA transposons). Most of these sequences are inactive or non-autonomous in eukaryotic genomes. Inactivate transposons can accumulate mutations at neutral rates until losing their molecular identity. They may either be eliminated from the genome or take on different molecular functions. Transposable elements may also participate in the differentiation of sex chromosomes. Therefore, the structural variations and nucleotide similarity of Tc1/Mariner sequences were analyzed along with their potential participation in the differentiation processes of sex chromosomes in the genomes of Parodontidae fish. All Parodontidae species presented non-autonomous copies of Tc1/Mariner with structural variation, different levels of deterioration (genetic distance), and variations in insertion and deletion patterns. The physical mapping of Tc1/Mariner on chromosomes revealed dispersed signals in euchromatins, with small accumulations in terminal regions and in the sex chromosomes. The gene dosage ratios indicated copy number variations of Tc1/Mariner among the genomes and high transposase open reading frame deterioration in Parodon hilarii and Parodon pongoensis genomes. This transposon presented transcriptional activity in gonads, but there was no significant difference between sexes. This may indicate non-functional protein expression or may correspond to DNA binding proteins derived from Tc1/Mariner. Thus, our results show Tc1/Mariner inactivation along with a diversity in Parodontidae genomes and its participation in the differentiation of the W sex chromosome.

  11. Competition between planar and central chiral control elements in nucleophilic addition to ferrocenyl imine derivatives.

    PubMed

    Joly, Kévin M; Wilson, Claire; Blake, Alexander J; Tucker, James H R; Moody, Christopher J

    2008-11-07

    Planar chirality associated with the ferrocene in ferrocenyl oximes and hydrazones bearing chiral auxiliaries effectively competes with or overrides the normally excellent stereocontrol afforded by the auxiliary in determining the diastereoselectivity of addition to the C=N bond.

  12. The effect of selected alloying element additions on properties of Mg-based alloy as bioimplants: A literature review

    NASA Astrophysics Data System (ADS)

    Zhang, Li-Nan; Hou, Zeng-Tao; Ye, Xin; Xu, Zhao-Bin; Bai, Xue-Ling; Shang, Peng

    2013-09-01

    This review investigates the current application limitations of Mg and Mg alloys. The key issues hindering the application of biodegradable Mg alloys as implants are their fast degradation rate and biological consideration. We have discussed the effect of some selected alloying element additions on the properties of the Mg-based alloy, especially the nutrient elements in human (Zn, Mn, Ca, Sr). Different grain sizes, phase constituents and distributions consequently influence the mechanical properties of the Mg alloys. Solution strengthening and precipitation strengthening are enhanced by the addition of alloying elements, generally improving the mechanical properties. Besides, the hot working process can also improve the mechanical properties. Combination of different processing steps is suggested to be adopted in the fabrication of Mg-based alloys. Corrosion properties of these Mg-based alloys have been measured in vitro and in vivo. The degradation mechanism is also discussed in terms of corrosion types, rates, byproducts and response of the surrounding tissues. Moreover, the clinical response and requirements of degradable implants are presented, especially for the nutrient elements (Ca, Mn, Zn, Sr). This review provides information related to different Mg alloying elements and presents the promising candidates for an ideal implant.

  13. Characterization of sequence elements from Malvastrum yellow vein betasatellite regulating promoter activity and DNA replication

    PubMed Central

    2012-01-01

    Background Many monopartite begomoviruses are associated with betasatellites, but only several promoters from which were isolated and studied. In this study, the βC1 promoter from Malvastrum yellow vein betasatellite (MYVB) was characterized and important sequence elements were identified to modulate promoter activity and replication of MYVB. Results A 991 nucleotide (nt) fragment upstream of the translation start site of the βC1 open reading frame of MYVB and a series of deletions within this fragment were constructed and fused to the β-glucuronidase (GUS) and green fluorescent protein (GFP) reporter genes, respectively. Agrobacterium-mediated transient expression assays showed that the 991 nt fragment was functional and that a 28 nt region (between −390 nt and −418 nt), which includes a 5′UTR Py-rich stretch motif, was important for promoter activity. Replication assays using Nicotiana benthamiana leaf discs and whole plants showed that deletion of the 5′UTR Py-rich stretch impaired viral satellite replication in the presence of the helper virus. Transgenic assays demonstrated that the 991 nt fragment conferred a constitutive expression pattern in transgenic tobacco plants and that a 214 nt fragment at the 3'-end of this sequence was sufficient to drive this expression pattern. Conclusion Our results showed that the βC1 promoter of MYVB displayed a constitutive expression pattern and a 5′UTR Py-rich stretch motif regulated both βC1 promoter activity and MYVB replication. PMID:23057573

  14. Precise quantitative addition of multiple reagents into droplets in sequence using glass fiber-induced droplet coalescence.

    PubMed

    Li, Chunyu; Xu, Jian; Ma, Bo

    2015-02-07

    Precise quantitative addition of multiple reagents into droplets in sequence is still a bottleneck in droplet-based analysis. To address this issue, we presented a simple and robust glass fiber-induced droplet coalescence method. The hydrophilic glass fiber embedded in the microchannels can induce the deformation of droplets and trigger the coalescence. Serial addition of reagents with controlled volumes was performed by this method without the requirement for an external power source.

  15. Emergence of Sequence Type 779 Methicillin-Resistant Staphylococcus aureus Harboring a Novel Pseudo Staphylococcal Cassette Chromosome mec (SCCmec)-SCC-SCCCRISPR Composite Element in Irish Hospitals

    PubMed Central

    Kinnevey, Peter M.; Shore, Anna C.; Brennan, Grainne I.; Sullivan, Derek J.; Ehricht, Ralf; Monecke, Stefan; Slickers, Peter

    2013-01-01

    Methicillin-resistant Staphylococcus aureus (MRSA) has been a major cause of nosocomial infection in Irish hospitals for 4 decades, and replacement of predominant MRSA clones has occurred several times. An MRSA isolate recovered in 2006 as part of a larger study of sporadic MRSA exhibited a rare spa (t878) and multilocus sequence (ST779) type and was nontypeable by PCR- and DNA microarray-based staphylococcal cassette chromosome mec (SCCmec) element typing. Whole-genome sequencing revealed the presence of a novel 51-kb composite island (CI) element with three distinct domains, each flanked by direct repeat and inverted repeat sequences, including (i) a pseudo SCCmec element (16.3 kb) carrying mecA with a novel mec class region, a fusidic acid resistance gene (fusC), and two copper resistance genes (copB and copC) but lacking ccr genes; (ii) an SCC element (17.5 kb) carrying a novel ccrAB4 allele; and (iii) an SCC element (17.4 kb) carrying a novel ccrC allele and a clustered regularly interspaced short palindromic repeat (CRISPR) region. The novel CI was subsequently identified by PCR in an additional 13 t878/ST779 MRSA isolates, six from bloodstream infections, recovered between 2006 and 2011 in 11 hospitals. Analysis of open reading frames (ORFs) carried by the CI showed amino acid sequence similarity of 44 to 100% to ORFs from S. aureus and coagulase-negative staphylococci (CoNS). These findings provide further evidence of genetic transfer between S. aureus and CoNS and show how this contributes to the emergence of novel SCCmec elements and MRSA strains. Ongoing surveillance of this MRSA strain is warranted and will require updating of currently used SCCmec typing methods. PMID:23147725

  16. Short Interspersed Nuclear Element (SINE) Sequences in the Genome of the Human Pathogenic Fungus Aspergillus fumigatus Af293

    PubMed Central

    Kanhayuwa, Lakkhana; Coutts, Robert H. A.

    2016-01-01

    Novel families of short interspersed nuclear element (SINE) sequences in the human pathogenic fungus Aspergillus fumigatus, clinical isolate Af293, were identified and categorised into tRNA-related and 5S rRNA-related SINEs. Eight predicted tRNA-related SINE families originating from different tRNAs, and nominated as AfuSINE2 sequences, contained target site duplications of short direct repeat sequences (4–14 bp) flanking the elements, an extended tRNA-unrelated region and typical features of RNA polymerase III promoter sequences. The elements ranged in size from 140–493 bp and were present in low copy number in the genome and five out of eight were actively transcribed. One putative tRNAArg-derived sequence, AfuSINE2-1a possessed a unique feature of repeated trinucleotide ACT residues at its 3’-terminus. This element was similar in sequence to the I-4_AO element found in A. oryzae and an I-1_AF long nuclear interspersed element-like sequence identified in A. fumigatus Af293. Families of 5S rRNA-related SINE sequences, nominated as AfuSINE3, were also identified and their 5'-5S rRNA-related regions show 50–65% and 60–75% similarity to respectively A. fumigatus 5S rRNAs and SINE3-1_AO found in A. oryzae. A. fumigatus Af293 contains five copies of AfuSINE3 sequences ranging in size from 259–343 bp and two out of five AfuSINE3 sequences were actively transcribed. Investigations on AfuSINE distribution in the fungal genome revealed that the elements are enriched in pericentromeric and subtelomeric regions and inserted within gene-rich regions. We also demonstrated that some, but not all, AfuSINE sequences are targeted by host RNA silencing mechanisms. Finally, we demonstrated that infection of the fungus with mycoviruses had no apparent effects on SINE activity. PMID:27736869

  17. Sorting out relationships among the grouse and ptarmigan using intron, mitochondrial, and ultra-conserved element sequences.

    PubMed

    Persons, Nicholas W; Hosner, Peter A; Meiklejohn, Kelly A; Braun, Edward L; Kimball, Rebecca T

    2016-05-01

    The Holarctic phasianid clade of the grouse and ptarmigan has received substantial attention in areas such as evolution of mating systems, display behavior, and population ecology related to their conservation and management as wild game species. There are multiple molecular phylogenetic studies that focus on grouse and ptarmigan. In spite of this, there is little consensus regarding historical relationships, particularly among genera, which has led to unstable and partial taxonomic revisions. We estimated the phylogeny of all currently recognized species using a combination of novel data from seven nuclear loci (largely intron sequences) and published data from one additional autosomal locus, two W-linked loci, and four mitochondrial regions. To explore relationships among genera and assess paraphyly of one genus more rigorously, we then added over 3000 ultra-conserved element (UCE) loci (over 1.7million bp) gathered using Illumina sequencing. The UCE topology agreed with that of the combined nuclear intron and previously published sequence data with 100% bootstrap support for all relationships. These data strongly support previous studies separating Bonasa from Tetrastes and Dendragapus from Falcipennis. However, the placement of Lagopus differed from previous studies, and we found no support for Falcipennis monophyly. Biogeographic analysis suggests that the ancestors of grouse and ptarmigan were distributed in the New World and subsequently underwent at least four dispersal events between the Old and New Worlds. Divergence time estimates from maternally-inherited and autosomal markers show stark differences across this clade, with divergence time estimates from maternally-inherited markers being nearly half that of the autosomal markers at some nodes, and nearly twice that at other nodes.

  18. Exact de Rham Sequences of Spaces Defined on Macro-elements in Two and Three Spatial Dimensions

    SciTech Connect

    Pasciak, J; Vassilevski, P

    2007-07-23

    This paper proposes new finite element spaces that can be constructed for agglomerates of standard elements that have certain regular structure. The main requirement is that the agglomerates share faces that have closed boundaries composed of 1-d edges. The spaces resulting from the agglomerated elements are subspaces of the original de Rham sequence of H{sup 1}-conforming, H(curl) conforming, H(div) conforming and piecewise constant spaces associated with an unstructured 'fine' mesh. The procedure can be recursively applied so that a sequence of nested de Rham complexes can be constructed. As an illustration we generate coarser spaces from the sequence corresponding to the lowest order Nedelec spaces, lowest order Raviart-Thomas spaces, and for piecewise linear H{sup 1}-conforming spaces, all in three-dimensions. The resulting V-cycle multigrid methods used in preconditioned conjugate gradient iterations appear to perform similar to those of the geometrically refined case.

  19. Structural features of the murine dihydrofolate reductase transcription termination region: identification of a conserved DNA sequence element.

    PubMed Central

    Frayne, E G; Kellems, R E

    1986-01-01

    Structural features of the transcription termination region for the mouse dihydrofolate reductase gene have been determined and compared with those of several other known termination regions for protein coding genes. A common feature identified among these termination regions was the presence of a 20 bp consensus DNA sequence element (ATCAGAATATAGGAAAGTAGCAAT). The results imply that the 20 bp consensus DNA sequence element is important for signaling RNA polymerase II transcription termination at least in the several vertebrate species investigated. Furthermore, the results suggest that for the dhfr gene and possibly for other genes in mice as well, the potential termination consensus sequence can exist as part of a long interspersed repetitive DNA element. Images PMID:3714472

  20. Palladium-catalyzed cyclization/Heck- and cyclization/conjugate-addition-type sequences in the preparation of polysubstituted furans.

    PubMed

    Aurrecoechea, José M; Durana, Aritz; Pérez, Elena

    2008-05-02

    Palladium-catalyzed heterocyclization-coupling sequences have been developed starting from buta-1,2,3-trienyl carbinols and electron-deficient alkenes. Polysubstituted furans are formed where the heterocyclic ring originates from the elements of the butatrienyl carbinol while the electron-deficient olefin is incorporated as a C-3 substituent. In most cases, the reaction proceeds via a Heck-type pathway leading to the efficient formation of 3-vinylfurans. However, couplings with methyl vinyl ketone display a divergent behavior to afford selectively either Heck- or hydroarylation-type products depending on reaction conditions.

  1. Differential distribution and association of repeat DNA sequences in the lateral element of the synaptonemal complex in rat spermatocytes.

    PubMed

    Hernández-Hernández, Abrahan; Rincón-Arano, Héctor; Recillas-Targa, Félix; Ortiz, Rosario; Valdes-Quezada, Christian; Echeverría, Olga M; Benavente, Ricardo; Vázquez-Nin, Gerardo H

    2008-02-01

    The synaptonemal complex (SC) is an evolutionarily conserved structure that mediates synapsis of homologous chromosomes during meiotic prophase I. Previous studies have established that the chromatin of homologous chromosomes is organized in loops that are attached to the lateral elements (LEs) of the SC. The characterization of the genomic sequences associated with LEs of the SC represents an important step toward understanding meiotic chromosome organization and function. To isolate these genomic sequences, we performed chromatin immunoprecipitation assays in rat spermatocytes using an antibody against SYCP3, a major structural component of the LEs of the SC. Our results demonstrated the reproducible and exclusive isolation of repeat deoxyribonucleic acid (DNA) sequences, in particular long interspersed elements, short interspersed elements, long terminal direct repeats, satellite, and simple repeats. The association of these repeat sequences to the LEs of the SC was confirmed by in situ hybridization of meiotic nuclei shown by both light and electron microscopy. Signals were also detected over the chromatin surrounding SCs and in small loops protruding from the lateral elements into the SC central region. We propose that genomic repeat DNA sequences play a key role in anchoring the chromosome to the protein scaffold of the SC.

  2. Automatic Recognition of Element Classes and Boundaries in the Birdsong with Variable Sequences

    PubMed Central

    Okanoya, Kazuo

    2016-01-01

    Researches on sequential vocalization often require analysis of vocalizations in long continuous sounds. In such studies as developmental ones or studies across generations in which days or months of vocalizations must be analyzed, methods for automatic recognition would be strongly desired. Although methods for automatic speech recognition for application purposes have been intensively studied, blindly applying them for biological purposes may not be an optimal solution. This is because, unlike human speech recognition, analysis of sequential vocalizations often requires accurate extraction of timing information. In the present study we propose automated systems suitable for recognizing birdsong, one of the most intensively investigated sequential vocalizations, focusing on the three properties of the birdsong. First, a song is a sequence of vocal elements, called notes, which can be grouped into categories. Second, temporal structure of birdsong is precisely controlled, meaning that temporal information is important in song analysis. Finally, notes are produced according to certain probabilistic rules, which may facilitate the accurate song recognition. We divided the procedure of song recognition into three sub-steps: local classification, boundary detection, and global sequencing, each of which corresponds to each of the three properties of birdsong. We compared the performances of several different ways to arrange these three steps. As results, we demonstrated a hybrid model of a deep convolutional neural network and a hidden Markov model was effective. We propose suitable arrangements of methods according to whether accurate boundary detection is needed. Also we designed the new measure to jointly evaluate the accuracy of note classification and boundary detection. Our methods should be applicable, with small modification and tuning, to the songs in other species that hold the three properties of the sequential vocalization. PMID:27442240

  3. Automatic Recognition of Element Classes and Boundaries in the Birdsong with Variable Sequences.

    PubMed

    Koumura, Takuya; Okanoya, Kazuo

    2016-01-01

    Researches on sequential vocalization often require analysis of vocalizations in long continuous sounds. In such studies as developmental ones or studies across generations in which days or months of vocalizations must be analyzed, methods for automatic recognition would be strongly desired. Although methods for automatic speech recognition for application purposes have been intensively studied, blindly applying them for biological purposes may not be an optimal solution. This is because, unlike human speech recognition, analysis of sequential vocalizations often requires accurate extraction of timing information. In the present study we propose automated systems suitable for recognizing birdsong, one of the most intensively investigated sequential vocalizations, focusing on the three properties of the birdsong. First, a song is a sequence of vocal elements, called notes, which can be grouped into categories. Second, temporal structure of birdsong is precisely controlled, meaning that temporal information is important in song analysis. Finally, notes are produced according to certain probabilistic rules, which may facilitate the accurate song recognition. We divided the procedure of song recognition into three sub-steps: local classification, boundary detection, and global sequencing, each of which corresponds to each of the three properties of birdsong. We compared the performances of several different ways to arrange these three steps. As results, we demonstrated a hybrid model of a deep convolutional neural network and a hidden Markov model was effective. We propose suitable arrangements of methods according to whether accurate boundary detection is needed. Also we designed the new measure to jointly evaluate the accuracy of note classification and boundary detection. Our methods should be applicable, with small modification and tuning, to the songs in other species that hold the three properties of the sequential vocalization.

  4. Synthesis of a Fluorescent Acridone Using a Grignard Addition, Oxidation, and Nucleophilic Aromatic Substitution Reaction Sequence

    ERIC Educational Resources Information Center

    Goodrich, Samuel; Patel, Miloni; Woydziak, Zachary R.

    2015-01-01

    A three-pot synthesis oriented for an undergraduate organic chemistry laboratory was developed to construct a fluorescent acridone molecule. This laboratory experiment utilizes Grignard addition to an aldehyde, alcohol oxidation, and iterative nucleophilic aromatic substitution steps to produce the final product. Each of the intermediates and the…

  5. The effect of oxidant addition on ferrous iron removal from multi-element acidic sulphate solutions

    NASA Astrophysics Data System (ADS)

    Mbedzi, Ndishavhelafhi; Ibana, Don; Dyer, Laurence; Browner, Richard

    2017-01-01

    This study was an investigation on the hydrolytic precipitation of iron from simulated pregnant leach solution (PLS) of nickel laterite atmospheric leaching. The effect of equilibrium pH, temperature and the addition of oxidant on total iron (ferrous (Fe (II)) and ferric (Fe (III)), aluminium and chromium removal was investigated together with the associated nickel and cobalt losses to the precipitate. Systematic variations of the experimental variables revealed ≥99% of the ferric iron can be removed from solution at conditions similar to those used in standard partial neutralisation in zinc and nickel production, pH of 2.5 and temperature less than 100 °C with minimal losses (<0.5%) of both nickel and cobalt. Temperature variation from 55 to 90 °C had no significant effect on the magnitude of Fe (III) precipitation but led to a significant increase in aluminium removal from 67% to 95% and improved the filterability of the precipitates. There was no ferrous iron precipitation even at a pH of 3.75 in the absence of an oxidant with its removal (98%) achieved by oxidative precipitation with oxygen gas at pH 3.5. Unlike Fe (III) precipitation, the operating temperature significantly affects oxidative precipitation of Fe (II). Hence, in practical application, the hydrolytic precipitation and oxidation to remove iron must be operated at 85 °C to ensure both ferrous and ferric iron are precipitated.

  6. HIV-1 conserved-element vaccines: relationship between sequence conservation and replicative capacity.

    PubMed

    Rolland, Morgane; Manocheewa, Siriphan; Swain, J Victor; Lanxon-Cookson, Erinn C; Kim, Moon; Westfall, Dylan H; Larsen, Brendan B; Gilbert, Peter B; Mullins, James I

    2013-05-01

    To overcome the problem of HIV-1 variability, candidate vaccine antigens have been designed to be composed of conserved elements of the HIV-1 proteome. Such candidate vaccines could be improved with a better understanding of both HIV-1 evolutionary constraints and the fitness cost of specific mutations. We evaluated the in vitro fitness cost of 23 mutations engineered in the HIV-1 subtype B Gag-p24 Center-of-Tree (COT) protein through fitness competition assays. While some mutations at conserved sites exacted a high fitness cost, as expected under the assumption that the most conserved residue confers the highest fitness, there was no overall strong relationship between sequence conservation and replicative capacity. By comparing sites that have evolved since the beginning of the epidemic to those that have remain unchanged, we found that sites that have evolved over time were more likely to correspond to HLA-associated sites and that their mutation had limited fitness costs. Our data showed no transcendent link between high conservation and high fitness cost, indicating that merely focusing on conserved segments of HIV-1 would not be sufficient for a successful vaccine strategy. Nonetheless, a subset of sites exacted a high fitness cost upon mutation--these sites have been under selective pressure to change since the beginning of the epidemic but have proved virtually nonmutable and could constitute preferred targets for vaccine design.

  7. Effect of solvent addition sequence on lycopene extraction efficiency from membrane neutralized caustic peeled tomato waste.

    PubMed

    Phinney, David M; Frelka, John C; Cooperstone, Jessica L; Schwartz, Steven J; Heldman, Dennis R

    2017-01-15

    Lycopene is a high value nutraceutical and its isolation from waste streams is often desirable to maximize profits. This research investigated solvent addition order and composition on lycopene extraction efficiency from a commercial tomato waste stream (pH 12.5, solids ∼5%) that was neutralized using membrane filtration. Constant volume dilution (CVD) was used to desalinate the caustic salt to neutralize the waste. Acetone, ethanol and hexane were used as direct or blended additions. Extraction efficiency was defined as the amount of lycopene extracted divided by the total lycopene in the sample. The CVD operation reduced the active alkali of the waste from 0.66 to <0.01M and the moisture content of the pulp increased from 93% to 97% (wet basis), showing the removal of caustic salts from the waste. Extraction efficiency varied from 32.5% to 94.5%. This study demonstrates a lab scale feasibility to extract lycopene efficiently from tomato processing byproducts.

  8. Multivariate sequence analysis reveals additional function impacting residues in the SDR superfamily.

    PubMed

    Tiwari, Pratibha; Singh, Noopur; Dixit, Aparna; Choudhury, Devapriya

    2014-10-01

    The "extended" type of short chain dehydrogenases/reductases (SDR), share a remarkable similarity in their tertiary structures inspite of being highly divergent in their functions and sequences. We have carried out principal component analysis (PCA) on structurally equivalent residue positions of 10 SDR families using information theoretic measures like Jensen-Shannon divergence and average shannon entropy as variables. The results classify residue positions in the SDR fold into six groups, one of which is characterized by low Shannon entropies but high Jensen-Shannon divergence against the reference family SDR1E, suggesting that these positions are responsible for the specific functional identities of individual SDR families, distinguishing them from the reference family SDR1E. Site directed mutagenesis of three residues from this group in the enzyme UDP-Galactose 4-epimerase belonging to SDR1E shows that the mutants promote the formation of NADH containing abortive complexes. Finally, molecular dynamics simulations have been used to suggest a mechanism by which the mutants interfere with the re-oxidation of NADH leading to the formation of abortive complexes.

  9. Characterization of insertion sequence IS892 and related elements from the cyanobacterium Anabaena sp. strain PCC 7120.

    PubMed Central

    Cai, Y

    1991-01-01

    IS892, one of the several insertion sequence (IS) elements discovered in Anabaena sp. strain PCC 7120 (Y. Cai and C. P. Wolk, J. Bacteriol. 172:3138-3145, 1990), is 1,675 bp with 24-bp near-perfect inverted terminal repeats and has two open reading frames (ORFs) that could code for proteins of 233 and 137 amino acids. Upon insertion into target sites, this IS generates an 8-bp directly repeated target duplication. A 32-bp sequence in the region between ORF1 and ORF2 is similar to the sequence of the inverted termini. Similar inverted repeats are found within each of those three segments, and the sequences of these repeats bear some similarity to the 11-bp direct repeats flanking the 11-kb insertion interrupting the nifD gene of this strain (J. W. Golden, S. J. Robinson, and R. Haselkorn, Nature [London] 314:419-423, 1985). A sequence similar to that of a binding site for the Escherichia coli integration host factor is found about 120 bp from the left end of IS892. Partial nucleotide sequences of active IS elements IS892N and IS892T, members of the IS892 family from the same Anabaena strain, were shown to be very similar to the sequence of IS892. Images PMID:1653218

  10. Addition of Polyadenylate Sequences to Virus-Specific RNA during Adenovirus Replication

    PubMed Central

    Philipson, L.; Wall, R.; Glickman, G.; Darnell, J. E.

    1971-01-01

    Adenovirus-specific nuclear and polysomal RNA, both early and late in the infectious cycle, contain a covalently linked region of polyadenylic acid 150-250 nucleotides long. A large proportion of the adenovirus-specific messenger RNA contains poly(A). As revealed by hybridization experiments, the poly(A) is not transcribed from adenovirus DNA. Furthermore, an adenosine analogue, cordycepin, blocks the synthesis of poly(A) and also inhibits the accumulation of adenovirus messenger RNA on polysomes. Addition of poly(A) to viral RNA may involve a host-controlled mechanism that regulates the processing and transport of messenger RNA. PMID:5315962

  11. Addition of polyadenylate sequences to virus-specific RNA during adenovirus replication.

    PubMed

    Philipson, L; Wall, R; Glickman, G; Darnell, J E

    1971-11-01

    Adenovirus-specific nuclear and polysomal RNA, both early and late in the infectious cycle, contain a covalently linked region of polyadenylic acid 150-250 nucleotides long. A large proportion of the adenovirus-specific messenger RNA contains poly(A). As revealed by hybridization experiments, the poly(A) is not transcribed from adenovirus DNA. Furthermore, an adenosine analogue, cordycepin, blocks the synthesis of poly(A) and also inhibits the accumulation of adenovirus messenger RNA on polysomes. Addition of poly(A) to viral RNA may involve a host-controlled mechanism that regulates the processing and transport of messenger RNA.

  12. Synthesis of a Fluorescent Acridone using a Grignard Addition, Oxidation, and Nucleophilic Aromatic Substitution Reaction Sequence.

    PubMed

    Goodrich, Samuel; Patel, Miloni; Woydziak, Zachary R

    2015-07-14

    A three-pot synthesis oriented for an undergraduate organic chemistry laboratory was developed to construct a fluorescent acridone molecule. This laboratory experiment utilizes Grignard addition to an aldehyde, alcohol oxidation, and iterative nucleophilic aromatic substitution steps to produce the final product. Each of the intermediates and the acridone product of the synthesis are analyzed by common techniques available in most undergraduate chemistry laboratories, such as melting point, TLC, IR spectroscopy, UV-Vis spectroscopy, and fluorescence spectroscopy. Yields for each transformation in the synthesis are generally moderately low to good (20-90%) and nearly all of the students (>90%) who attempted the synthesis were able to produce the final acridone product.

  13. Structural analysis of the regulatory elements of the type-II procollagen gene. Conservation of promoter and first intron sequences between human and mouse.

    PubMed Central

    Vikkula, M; Metsäranta, M; Syvänen, A C; Ala-Kokko, L; Vuorio, E; Peltonen, L

    1992-01-01

    Transcription of the type-II procollagen gene (COL2A1) is very specifically restricted to a limited number of tissues, particularly cartilages. In order to identify transcription-control motifs we have sequenced the promoter region and the first intron of the human and mouse COL2A1 genes. With the assumption that these motifs should be well conserved during evolution, we have searched for potential elements important for the tissue-specific transcription of the COL2A1 gene by aligning the two sequences with each other and with the available rat type-II procollagen sequence for the promoter. With this approach we could identify specific evolutionarily well-conserved motifs in the promoter area. On the other hand, several suggested regulatory elements in the promoter region did not show evolutionary conservation. In the middle of the first intron we found a cluster of well-conserved transcription-control elements and we conclude that these conserved motifs most probably possess a significant function in the control of the tissue-specific transcription of the COL2A1 gene. We also describe locations of additional, highly conserved nucleotide stretches, which are good candidate regions in the search for binding sites of yet-uncharacterized cartilage-specific transcription regulators of the COL2A1 gene. PMID:1637314

  14. Multi-element fingerprinting and high throughput sequencing identify multiple elements that affect fungal communities in Quercus macrocarpa foliage.

    PubMed

    Jumpponen, Ari; Keating, Karen; Gadbury, Gary; Jones, Kenneth L; Mattox, J David

    2010-09-01

    Diverse fungal mutualists, pathogens and saprobes colonize plant leaves. These fungi face a complex environment, in which stochastic dispersal interplays with abiotic and biotic filters. However, identification of the specific factors that drive the community assembly seems unattainable. We mined two broad data sets and identified chemical elements, to which dominant molecular operational taxonomic units (OTUs) in the foliage of a native tree respond most extremely. While many associations could be identified, potential complicating issues emerged. Those were related to unevenly distributed OTU frequency data, a large number of potentially explanatory variables, and the disproportionate effects of outlier observations.

  15. Effect of Element Composition on Streaming and the Ordering of Repeating Sequences

    ERIC Educational Resources Information Center

    McNally, Kathleen A.; Handel, Stephen

    1977-01-01

    The relatedness of four elements (tone, white noise, click, and a buzz) making up a recycled pattern was varied to determine the effects of streaming (sounds that break into separate channels) on the ease of correctly ordering the elements. Results suggest the organization of elements into streams by similarity supplants the organization by…

  16. Application of prestressed structural elements in the erection of heavy viscoelastic arched structures with the use of an additive technology

    NASA Astrophysics Data System (ADS)

    Manzhirov, A. V.; Parshin, D. A.

    2016-11-01

    The process of erection an object under the action of gravity forces in the absence of additional loads is studied together with the technology of application of prestressed structure elements. The mathematically two-dimensional engineering problem of mechanics of gradual building of a heavy semicircular vault from a prestressed viscoelastic homogeneously aging material is solved analytically. The vault fixation on a rigid horizontal base by sliding fixation, which ensures continuous smooth contact between the vault foot and the base, is considered. The performed computations permit demonstrating high efficiency of preliminary stress creation in the material elements added to the vault in the process of its building in order to control its technological stress state. It is shown that this measure permits significantly decreasing the final values of the separating contact stresses on the foot of the built vault and obtaining the final state of the whole structure which is safer with respect to the level of tensile stresses than that obtain by using unstressed elements.

  17. Activation of IFN-beta element by IRF-1 requires a posttranslational event in addition to IRF-1 synthesis.

    PubMed Central

    Watanabe, N; Sakakibara, J; Hovanessian, A G; Taniguchi, T; Fujita, T

    1991-01-01

    Expression of the Type I IFN (i.e., IFN-alpha s and IFN-beta) genes is efficiently induced by viruses at the transcriptional level. This induction is mediated by at least two types of positive regulatory elements located in the human IFN-beta gene promoter: (1) the repeated elements which bind both the transcriptional activator IRF-1 and the repressor IRF-2 (IRF-elements; IRF-Es), and (2) the kappa B element (kappa B-E), which binds NF kappa B and is located between the IRF-Es and the TATA box. In this study we demonstrate that a promoter containing synthetic IRF-E, which displays high affinity for the IRFs can be efficiently activated by Newcastle disease virus (NDV). In contrast, such activation was either very weak or nil when cells were treated by IFN-beta or tumor necrosis factor-alpha (TNF-alpha), despite the fact they both efficiently induce de novo synthesis of the short-lived IRF-1 in L929 cells. In fact, efficient activation of the IRF-E apparently requires an event in addition to de novo IRF-1 induction, which can be elicited by NDV even in the presence of protein synthesis inhibitor, cycloheximide. Moreover, efficient activation of the IRF-E by NDV is specifically inhibited by the protein kinase inhibitor, Staurosporin. Hence our results suggest the importance of IRF-1 synthesis and post-translational modification event(s), possibly phosphorylation for the efficient activation of IRF-Es, which are otherwise under negative regulation by IRF-2. Images PMID:1886766

  18. Identification of sequence elements that confer cell-type-specific control of MF alpha 1 expression in Saccharomyces cerevisiae.

    PubMed Central

    Inokuchi, K; Nakayama, A; Hishinuma, F

    1987-01-01

    The MF alpha 1 gene of Saccharomyces cerevisiae, a major structural gene for mating pheromone alpha factor, is an alpha-specific gene whose expression is regulated by the mating-type locus. To study the role of sequences upstream of MF alpha 1 in its expression and regulation, we generated two sets of promoter deletions: upstream deletions and internal deletions. By analyzing these deletions, we have identified a TATA box and two closely related, tandemly arranged upstream activation sites as necessary elements for MF alpha 1 expression. Two upstream activation sites were located ca. 300 and 250 base pairs upstream of the MF alpha 1 transcription start points, which were also determined in this study. Each site contained a homologous 22-base-pair sequence, and both sites were required for maximum transcription level. The distance between the upstream activation sites and the transcription start points could be altered without causing loss of transcription efficiency, and the sites were active in either orientation with respect to the coding region. These elements conferred cell type-specific expression on a heterologous promoter. Analysis with host mating-type locus mutants indicates that these sequences are the sites through which the MAT alpha 1 product exerts its action to activate the MF alpha 1 gene. Homologous sequences with these elements were found in other alpha-specific genes, MF alpha 2 and STE3, and may mediate activation of this set of genes by MAT alpha 1. Images PMID:2959859

  19. Identification of a signal transduction response sequence element necessary for induction of a Dictyostelium discoideum gene by extracellular cyclic AMP.

    PubMed Central

    Pavlovic, J; Haribabu, B; Dottin, R P

    1989-01-01

    The signal transduction pathways that lead to gene induction are being intensively investigated in Dictyostelium discoideum. We have identified by deletion and transformation analysis a sequence element necessary for induction of a gene coding for uridine diphosphoglucose pyrophosphorylase (UDPGP1) of D. discoideum in response to extracellular cyclic AMP (cAMP). This regulatory element is located 380 base pairs upstream of the transcription start site and contains a G+C-rich partially palindromic sequence. It is not required for transcription per se but is required for induction of the gene in response to the stimulus of extracellular cAMP. The cAMP response sequence is also required for induction of the gene during normal development. A second A+T-rich cis-acting region located immediately downstream of the cAMP response sequence appears to be essential for the basal level of expression of the UDPGP1 gene. The position of the cAMP response element coincides with a DNase I-hypersensitive site that is observed when the UDPGP1 gene is actively transcribed. Images PMID:2557538

  20. Organocatalytic, Enantioselective Synthesis of Cyclohexadienone Containing Hindered Spirocyclic Ethers through an Oxidative Dearomatization/Oxa-Michael Addition Sequence.

    PubMed

    Reddy, Reddy Rajasekhar; Gudup, Satish Sonbarao; Ghorai, Prasanta

    2016-11-21

    An unprecedented enantioselective oxa-Michael reaction of α-tertiary alcohols using cinchona-alkaloid-based chiral bifunctional squaramide catalysts is reported. An oxidative dearomatization of phenol followed by an enantioselective oxa-Michael addition sequence provided a broad array of chiral sterically hindered tetrahydrofurans and tetrahydropyrans attached to a cyclohexadienone moiety in spiro fashion. In general, good yields and excellent enantioselectivities (up to 99 %) were observed. The chiral oxo-cycles obtained have easily been transformed into chromans without disturbing the enantioselectivity.

  1. An Organocatalytic Asymmetric Friedel-Crafts Addition/Fluorination Sequence: Construction of Oxindole-Pyrazolone Conjugates Bearing Vicinal Tetrasubstituted Stereocenters.

    PubMed

    Bao, Xiaoze; Wang, Baomin; Cui, Longchen; Zhu, Guodong; He, Yuli; Qu, Jingping; Song, Yuming

    2015-11-06

    A highly efficient and practical one-pot sequential process, consisting of an organocatalytic enantioselective Friedel-Crafts-type addition of 4-nonsubstituted pyrazolones to isatin-derived N-Boc ketimines and a subsequent diastereoselective fluorination of the pyrazolone moiety, is developed. This reaction sequence delivers novel oxindole-pyrazolone adducts featuring vicinal tetrasubstituted stereocenters with a 0.5 mol % catalyst loading in high yield with excellent enantio- and diastereocontrol. Notably, chloro, bromo, and thioether functionalities can be readily incorporated, rendering a broad diversity of the product.

  2. Melting temperature highlights functionally important RNA structure and sequence elements in yeast mRNA coding regions.

    PubMed

    Qi, Fei; Frishman, Dmitrij

    2017-03-07

    Secondary structure elements in the coding regions of mRNAs play an important role in gene expression and regulation, but distinguishing functional from non-functional structures remains challenging. Here we investigate the dependence of sequence-structure relationships in the coding regions on temperature based on the recent PARTE data by Wan et al. Our main finding is that the regions with high and low thermostability (high Tm and low Tm regions) are under evolutionary pressure to preserve RNA secondary structure and primary sequence, respectively. Sequences of low Tm regions display a higher degree of evolutionary conservation compared to high Tm regions. Low Tm regions are under strong synonymous constraint, while high Tm regions are not. These findings imply that high Tm regions contain thermo-stable functionally important RNA structures, which impose relaxed evolutionary constraint on sequence as long as the base-pairing patterns remain intact. By contrast, low thermostability regions contain single-stranded functionally important conserved RNA sequence elements accessible for binding by other molecules. We also find that theoretically predicted structures of paralogous mRNA pairs become more similar with growing temperature, while experimentally measured structures tend to diverge, which implies that the melting pathways of RNA structures cannot be fully captured by current computational approaches.

  3. Sequence elements in the human osteocalcin gene confer basal activation and inducible response to hormonal vitamin D3.

    PubMed

    Kerner, S A; Scott, R A; Pike, J W

    1989-06-01

    Osteoblast-specific expression of the bone protein osteocalcin is controlled at the transcriptional level by the steroid hormone 1 alpha,25-dihydroxyvitamin D3. As this protein may represent a marker for bone activity in human disease, we examined the regulation of its expression at the molecular level by evaluating human osteocalcin gene promoter function. We describe regions within the promoter that contribute to basal expression of the gene in osteoblast-like cells in culture. Further, we define a 21-base-pair DNA element with the sequence 5'-GTGACTCACCGGGTGAACGGG-3', which acts in cis to mediate 1 alpha,25-dihydroxyvitamin D3 inducibility of the osteocalcin gene. This response element bears sequence similarity with other short DNA segments, particularly those for estrogen and thyroid hormone, which act together with their respective trans-acting receptors to modulate gene transcription.

  4. Identification of the core sequence elements in Penaeus stylirostris densovirus promoters

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This manuscript describes the role of different core elements in the transcriptional activity of promoters in a marine parvovirus, Penaeus stylirostris densovirus (PstDNV) that infects shrimp. Although comprehensive information on the role of different elements in the promoters of several animal par...

  5. Analysis of the laser powder bed fusion additive manufacturing process through experimental measurement and finite element modeling

    NASA Astrophysics Data System (ADS)

    Dunbar, Alexander Jay

    The objective in this work is to provide rigourous experimental measurements to aid in the development of laser powder bed fusion (LPBF) additive manufacturing (AM). A specialized enclosed instrumented measurement system is designed to provide in situ experimental measurements of temperature and distortion. Experiments include comparisons of process parameters, materials and LPBF machines. In situ measurements of distortion and temperature made throughout the build process highlight inter-layer distortion effects previously undocumented for laser powder bed fusion. Results from these experiments are also be implemented in the development and validation of finite element models of the powder bed build process. Experimental analysis is extended from small-scale to larger part-scale builds where experimental post-build measurements are used in analysis of distortion profiles. Experimental results provided from this study are utilized in the validation of a finite element model capable of simulating production scale parts. The validated finite element model is then implemented in the analysis of the part to provide information regarding the distortion evolution process. A combination of experimental measurements and simulation results are used to identify the mechanism that results in the measured distortion profile for this geometry. Optimization of support structure primarily focuses on the minimization of material use and scan time, but no information regarding failure criteria for support structure is available. Tensile test samples of LPBF built support structure are designed, built, and tested to provide measurements of mechanical properties of the support structure. Experimental tests show that LPBF built support structure has only 30-40% of the ultimate tensile strength of solid material built in the same machine. Experimental measurement of LPBF built support structure provides clear failure criteria to be utilized in the future design and implementation of

  6. A P Element Chimera Containing Captured Genomic Sequences Was Recovered at the Vestigial Locus in Drosophila following Targeted Transposition

    PubMed Central

    Heslip, T. R.; Williams, J. A.; Bell, J. B.; Hodgetts, R. B.

    1992-01-01

    A P element carrying the Dopa decarboxylase gene, P[Ddc], was targeted into vg(21), a cryptic P element induced mutant allele of the vestigial (vg) locus. The resulting allele, vg(28w), contained the expected P[Ddc] plus an additional 9.5 kb of DNA, captured from elsewhere on chromosome II. Reversion of the vg(28w) mutant allele demonstrated that the entire insert can excise but cannot reinsert at an appreciable frequency. We explain the targeted transposition as the repair of a double stranded gap, created by the excision of the P element at vg(21), and suggest that the formation of chimeric elements may be an important component of P element dependent genomic instability. PMID:1325388

  7. A dispersed family of repetitive DNA sequences exhibits characteristics of a transposable element in the genus Lycopersicon.

    PubMed

    Young, R J; Francis, D M; St Clair, D A; Taylor, B H

    1994-06-01

    A segment of DNA 5' to the transcribed region of an auxin-regulated gene, ARPI, from Lycopersicon esculentum Mill. cv. VFN8 contains a sequence with the structural characteristics of a transposable element. The putative element (Lyt1) is 1340 bp long, has terminal inverted repeats of approximately 235 bp and is flanked by 9-bp direct repeats. Lyt1 has a structure similar to the Robertson's Mutator (Mu) family from maize. The terminal inverted repeats are 80% AT-rich, are 96.6% identical, and define a larger family of repetitive elements. Southern analysis and genomic dot-blot reconstructions detected at least 41 copies of Lyt1-hybridizing sequences in red-fruited Lycopersicon spp. (L. esculentum, L. pimpinellifolium and L. cheesmanii), and 2-8 copies in the green-fruited species (L. hirsutum, L. pennellii, L. peruvianum, L. chilense and L. chmielewskii). There were two to four copies in the Solanum spp. closely allied with the genus Lycopersicon (S. lycopersicoides, S. ochranthum and S. juglandifolium), while the more distantly related Solanum spp. showed little (one to two copies in S. tuberosum) to no (S. quitoense) detectable hybridization under stringent conditions. Linkage analysis in the F2 progeny of a cross between L. esculentum and L. cheesmanii indicated that at least six loci that hybridize to the Lyt1 sequence are dispersed in the genome. Polymerase chain reaction and Southern analyses revealed that some red-fruited accessions and L. chmielewskii lacked Lyt1 5' to the transcribed region of ARPI. Subsequent sequence analysis indicated that only one copy of the 9-bp direct repeat (target site) was present, suggesting that transposition of the element into the ARPI gene occurred after the divergence of the red-fruited and green-fruited Lycopersicon species.

  8. Identification of protein structural elements responsible for the diversity of sequence preferences among Mini-III RNases

    PubMed Central

    Głów, Dawid; Kurkowska, Małgorzata; Czarnecka, Justyna; Szczepaniak, Krzysztof; Pianka, Dariusz; Kappert, Verena; Bujnicki, Janusz M.; Skowronek, Krzysztof J.

    2016-01-01

    Many known endoribonucleases select their substrates based on the presence of one or a few specific nucleotides at or near the cleavage site. In some cases, selectivity is also determined by the structural features of the substrate. We recently described the sequence-specific cleavage of double-stranded RNA by Mini-III RNase from Bacillus subtilis in vitro. Here, we characterized the sequence specificity of eight other members of the Mini-III RNase family from different bacterial species. High-throughput analysis of the cleavage products of Φ6 bacteriophage dsRNA indicated subtle differences in sequence preference between these RNases, which were confirmed and characterized by systematic analysis of the cleavage kinetics of a set of short dsRNA substrates. We also showed that the sequence specificities of Mini-III RNases are not reflected by different binding affinities for cognate and non-cognate sequences, suggesting that target selection occurs predominantly at the cleavage step. We were able to identify two structural elements, the α4 helix and α5b-α6 loop that were involved in target selection. Characterization of the sequence specificity of the eight Mini-III RNases may provide a basis for better understanding RNA substrate recognition by Mini-III RNases and adopting these enzymes and their engineered derivatives as tools for RNA research. PMID:27924926

  9. Identification of protein structural elements responsible for the diversity of sequence preferences among Mini-III RNases.

    PubMed

    Głów, Dawid; Kurkowska, Małgorzata; Czarnecka, Justyna; Szczepaniak, Krzysztof; Pianka, Dariusz; Kappert, Verena; Bujnicki, Janusz M; Skowronek, Krzysztof J

    2016-12-07

    Many known endoribonucleases select their substrates based on the presence of one or a few specific nucleotides at or near the cleavage site. In some cases, selectivity is also determined by the structural features of the substrate. We recently described the sequence-specific cleavage of double-stranded RNA by Mini-III RNase from Bacillus subtilis in vitro. Here, we characterized the sequence specificity of eight other members of the Mini-III RNase family from different bacterial species. High-throughput analysis of the cleavage products of Φ6 bacteriophage dsRNA indicated subtle differences in sequence preference between these RNases, which were confirmed and characterized by systematic analysis of the cleavage kinetics of a set of short dsRNA substrates. We also showed that the sequence specificities of Mini-III RNases are not reflected by different binding affinities for cognate and non-cognate sequences, suggesting that target selection occurs predominantly at the cleavage step. We were able to identify two structural elements, the α4 helix and α5b-α6 loop that were involved in target selection. Characterization of the sequence specificity of the eight Mini-III RNases may provide a basis for better understanding RNA substrate recognition by Mini-III RNases and adopting these enzymes and their engineered derivatives as tools for RNA research.

  10. Sequence of human tryptophan 2,3-dioxygenase (TDO2): Presence of a glucocorticoid response-like element composed of a GTT repeat and an intronic CCCCT repeat

    SciTech Connect

    Comings, D.E.; Muhleman, D.; Dietz, G.

    1995-09-20

    Abnormalities in serotonin levels have been implicated in a wide range of psychiatric disorders. Tryptophan 2,3-dioxygenase is the rate-limiting enzyme in the catabolism of tryptophan, the precursor of serotonin. As such it is a potential major candidate gene in psychiatric genetics. The regulatory, intron, and exon regions of the human TDO2 gene have been sequenced. Twelve exons were identified. The amino acid sequence of the enzyme was 88% homologous to that of the rat. Compared to the rat, the regulatory region of the human TDO2 gene had an insertion of approximately 1064 bp of random DNA beginning at -293 bp and extending to -1357 bp. This displaced the glucocorticoid response element (GRE) occurring at -1174 bp in the rat to -1500 in the human. The proximal GRE at -419 in the rat was missing in the human. However, within the DNA insert there was a GRE-like microsatellite region containing multiple GTT repeats plus additional GT(n) sequences. This could produce several staggered regions of the sequence TGTTGTnnnTGTTGT similiar to a GRE consensus sequence of TGTTCAnnnTGTTCT. The intron regions 5` and 3` to each exon were sequenced. This allowed each exon to be screened for mutations. This showed a His{r_arrow}Val mutation polymorphism in exon 7. Three introns, 1, 5, and 6, were completely sequenced and examined for polymorphisms. This identified two polymorphisms consisting of G{r_arrow}T and G{r_arrow}A mutations 2 bp apart in intron 6. The 3` end of intron 5` showed an extensive CCCCT pentanucleotide repeat that was markedly polymorphic. These polymorphisms allow the TDO2 gene to be examined for a possible role in psychiatric disorders. 35 refs., 4 figs., 1 tab.

  11. In situ detection of a heat-shock regulatory element binding protein using a soluble synthetic enhancer sequence.

    PubMed Central

    Harel-Bellan, A; Brini, A T; Ferris, D K; Robin, P; Farrar, W L

    1989-01-01

    In various studies, enhancer binding proteins have been successfully absorbed out by competing sequences inserted into plasmids, resulting in the inhibition of the plasmid expression. Theoretically, such a result could be achieved using synthetic enhancer sequences not inserted into plasmids. In this study, a double stranded DNA sequence corresponding to the human heat shock regulatory element was chemically synthesized. By in vitro retardation assays, the synthetic sequence was shown to bind specifically a protein in extracts from the human T cell line Jurkat. When the synthetic enhancer was electroporated into Jurkat cells, not only the enhancer was shown to remain undegraded into the cells for up to 2 days, but also it was shown to bind intracellularly a protein. The binding was specific and was modulated upon heat shock. Furthermore, the binding protein was shown to be of the expected molecular weight by UV crosslinking. However, when the synthetic enhancer element was co-electroporated with an HSP 70-CAT reporter construct, the expression of the reporter plasmid was consistently enhanced in the presence of the exogenous synthetic enhancer. Images PMID:2740211

  12. Insertion sequence element single nucleotide polymorphism typing provides insights into the population structure and evolution of Mycobacterium ulcerans across Africa.

    PubMed

    Vandelannoote, Koen; Jordaens, Kurt; Bomans, Pieter; Leirs, Herwig; Durnez, Lies; Affolabi, Dissou; Sopoh, Ghislain; Aguiar, Julia; Phanzu, Delphin Mavinga; Kibadi, Kapay; Eyangoh, Sara; Manou, Louis Bayonne; Phillips, Richard Odame; Adjei, Ohene; Ablordey, Anthony; Rigouts, Leen; Portaels, Françoise; Eddyani, Miriam; de Jong, Bouke C

    2014-02-01

    Buruli ulcer is an indolent, slowly progressing necrotizing disease of the skin caused by infection with Mycobacterium ulcerans. In the present study, we applied a redesigned technique to a vast panel of M. ulcerans disease isolates and clinical samples originating from multiple African disease foci in order to (i) gain fundamental insights into the population structure and evolutionary history of the pathogen and (ii) disentangle the phylogeographic relationships within the genetically conserved cluster of African M. ulcerans. Our analyses identified 23 different African insertion sequence element single nucleotide polymorphism (ISE-SNP) types that dominate in different areas where Buruli ulcer is endemic. These ISE-SNP types appear to be the initial stages of clonal diversification from a common, possibly ancestral ISE-SNP type. ISE-SNP types were found unevenly distributed over the greater West African hydrological drainage basins. Our findings suggest that geographical barriers bordering the basins to some extent prevented bacterial gene flow between basins and that this resulted in independent focal transmission clusters associated with the hydrological drainage areas. Different phylogenetic methods yielded two well-supported sister clades within the African ISE-SNP types. The ISE-SNP types from the "pan-African clade" were found to be widespread throughout Africa, while the ISE-SNP types of the "Gabonese/Cameroonian clade" were much rarer and found in a more restricted area, which suggested that the latter clade evolved more recently. Additionally, the Gabonese/Cameroonian clade was found to form a strongly supported monophyletic group with Papua New Guinean ISE-SNP type 8, which is unrelated to other Southeast Asian ISE-SNP types.

  13. Insertion Sequence Element Single Nucleotide Polymorphism Typing Provides Insights into the Population Structure and Evolution of Mycobacterium ulcerans across Africa

    PubMed Central

    Jordaens, Kurt; Bomans, Pieter; Leirs, Herwig; Durnez, Lies; Affolabi, Dissou; Sopoh, Ghislain; Aguiar, Julia; Phanzu, Delphin Mavinga; Kibadi, Kapay; Eyangoh, Sara; Manou, Louis Bayonne; Phillips, Richard Odame; Adjei, Ohene; Ablordey, Anthony; Rigouts, Leen; Portaels, Françoise; Eddyani, Miriam; de Jong, Bouke C.

    2014-01-01

    Buruli ulcer is an indolent, slowly progressing necrotizing disease of the skin caused by infection with Mycobacterium ulcerans. In the present study, we applied a redesigned technique to a vast panel of M. ulcerans disease isolates and clinical samples originating from multiple African disease foci in order to (i) gain fundamental insights into the population structure and evolutionary history of the pathogen and (ii) disentangle the phylogeographic relationships within the genetically conserved cluster of African M. ulcerans. Our analyses identified 23 different African insertion sequence element single nucleotide polymorphism (ISE-SNP) types that dominate in different areas where Buruli ulcer is endemic. These ISE-SNP types appear to be the initial stages of clonal diversification from a common, possibly ancestral ISE-SNP type. ISE-SNP types were found unevenly distributed over the greater West African hydrological drainage basins. Our findings suggest that geographical barriers bordering the basins to some extent prevented bacterial gene flow between basins and that this resulted in independent focal transmission clusters associated with the hydrological drainage areas. Different phylogenetic methods yielded two well-supported sister clades within the African ISE-SNP types. The ISE-SNP types from the “pan-African clade” were found to be widespread throughout Africa, while the ISE-SNP types of the “Gabonese/Cameroonian clade” were much rarer and found in a more restricted area, which suggested that the latter clade evolved more recently. Additionally, the Gabonese/Cameroonian clade was found to form a strongly supported monophyletic group with Papua New Guinean ISE-SNP type 8, which is unrelated to other Southeast Asian ISE-SNP types. PMID:24296504

  14. A Possible Mechanism of Zika Virus Associated Microcephaly: Imperative Role of Retinoic Acid Response Element (RARE) Consensus Sequence Repeats in the Viral Genome

    PubMed Central

    Kumar, Ashutosh; Singh, Himanshu N.; Pareek, Vikas; Raza, Khursheed; Dantham, Subrahamanyam; Kumar, Pavan; Mochan, Sankat; Faiq, Muneeb A.

    2016-01-01

    Owing to the reports of microcephaly as a consistent outcome in the fetuses of pregnant women infected with ZIKV in Brazil, Zika virus (ZIKV)—microcephaly etiomechanistic relationship has recently been implicated. Researchers, however, are still struggling to establish an embryological basis for this interesting causal handcuff. The present study reveals robust evidence in favor of a plausible ZIKV-microcephaly cause-effect liaison. The rationale is based on: (1) sequence homology between ZIKV genome and the response element of an early neural tube developmental marker “retinoic acid” in human DNA and (2) comprehensive similarities between the details of brain defects in ZIKV-microcephaly and retinoic acid embryopathy. Retinoic acid is considered as the earliest factor for regulating anteroposterior axis of neural tube and positioning of structures in developing brain through retinoic acid response elements (RARE) consensus sequence (5′–AGGTCA–3′) in promoter regions of retinoic acid-dependent genes. We screened genomic sequences of already reported virulent ZIKV strains (including those linked to microcephaly) and other viruses available in National Institute of Health genetic sequence database (GenBank) for the RARE consensus repeats and obtained results strongly bolstering our hypothesis that ZIKV strains associated with microcephaly may act through precipitation of dysregulation in retinoic acid-dependent genes by introducing extra stretches of RARE consensus sequence repeats in the genome of developing brain cells. Additional support to our hypothesis comes from our findings that screening of other viruses for RARE consensus sequence repeats is positive only for those known to display neurotropism and cause fetal brain defects (for which maternal-fetal transmission during developing stage may be required). The numbers of RARE sequence repeats appeared to match with the virulence of screened positive viruses. Although, bioinformatic evidence and

  15. DNA sequences of Alu elements indicate a recent replacement of the human autosomal genetic complement

    SciTech Connect

    Knight, A.; Deininger, P.L.; Batzer, M.A.

    1996-04-30

    DNA sequences of neutral nuclear autosomal loci, compared across diverse human populations, provide a previously untapped perspective into the mode and tempo of the emergence of modern humans and a critical comparison with published clonally inherited mitochondrial DNA and Y chromosome measurements of human diversity. We obtained over 55 kilobases of sequence from three autosomal loci encompassing Alu repeats for representatives of diverse human populations as well as orthologous sequences for other hominoid species at one of these loci. Nucleotide diversity was exceedingly low. Most individuals and populations were identical. Only a single nucleotide difference distinguished presumed ancestral alleles from descendants. These results differ from those expected if alleles from divergent archaic populations were maintained through multiregional continuity. The observed virtual lack of sequence polymorphism is the signature of a recent single origin for modern humans, with general replacement of archaic populations. 47 refs., 2 figs., 1 tab.

  16. Sequence analysis of a group of low molecular-weight plasmids carrying multiple IS903 elements flanking a kanamycin resistance aph gene in Salmonella enterica serovars

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A group of low molecular-weight ColE1-like plasmids carrying the aph sequence type aph(ii), from three different Salmonella serovars were sequenced. These plasmids carry 2 or more copies of IS903 elements, with up to 21 bp sequence differences to one another, two of which flank the aph gene. This g...

  17. Representation of individual elements of a complex call sequence in primary auditory cortex

    PubMed Central

    Wallace, Mark N.; Grimsley, Jasmine M. S.; Anderson, Lucy A.; Palmer, Alan R.

    2013-01-01

    Conspecific communication calls can be rhythmic or contain extended, discontinuous series of either constant or frequency modulated harmonic tones and noise bursts separated by brief periods of silence. In the guinea pig, rhythmic calls can produce isomorphic responses within the primary auditory cortex (AI) where single units respond to every call element. Other calls such as the chutter comprise a series of short irregular syllables that vary in their spectral content and are more like human speech. These calls can also evoke isomorphic responses, but may only do so in fields in the auditory belt and not in AI. Here we present evidence that cells in AI treat the individual elements within a syllable as separate auditory objects and respond selectively to one or a subset of them. We used a single chutter exemplar to compare single/multi-unit responses in the low-frequency portion of AI—AI(LF) and the low-frequency part of the thalamic medial geniculate body—MGB(LF) in urethane anaesthetized guinea pigs. Both thalamic and cortical cells responded with brief increases in firing rate to one, or more, of the 8 main elements present in the chutter call. Almost none of the units responded to all 8 elements. While there were many different combinations of responses to between one and five of the elements, MBG(LF) and AI(LF) neurons exhibited the same specific types of response combinations. Nearby units in the upper layers of the cortex tended to respond to similar combinations of elements while the deep layers were less responsive. Thus, the responses from a number of AI units would need to be combined in order to represent the entire chutter call. Our results don't rule out the possibility of constructive convergence but there was no evidence that a convergence of inputs within AI led to a complete representation of all eight elements. PMID:24198766

  18. Can the Isolated-Elements Strategy Be Improved by Targeting Points of High Cognitive Load for Additional Practice?

    ERIC Educational Resources Information Center

    Ayres, Paul

    2013-01-01

    Reducing problem complexity by isolating elements has been shown to be an effective instructional strategy. Novices, in particular, benefit from learning from worked examples that contain partially interacting elements rather than worked examples that provide full interacting elements. This study investigated whether the isolating-elements…

  19. Sequence elements critical for efficient RNA editing of a tobacco chloroplast transcript in vivo and in vitro

    PubMed Central

    Hayes, Michael L.; Reed, Martha L.; Hegeman, Carla E.; Hanson, Maureen R.

    2006-01-01

    In tobacco chloroplast transcripts 34 nt are efficiently edited to U. No common consensus region is present around all editing sites; however, sites can be grouped in clusters that share short common sequences. Transgene transcripts carrying either the wild-type −31/+22 or −31/+60 sequence near NTrpoB C473, an editing site within tobacco rpoB transcripts, or three different mutated sequences, were all highly edited in vivo. Endogenous transcripts of rpoB, psbL and rps14, all of which contain common sequences S1, S2 and S3 5′ to NTrpoB C473, NTpsbL C2 and NTrps14 C80, were less edited in transgenic plants that over-express transcripts from NTrpoB C473 transgenes. Extent of reduction of endogenous editing differed between transgenic lines expressing mutated −31/+22 regions, depending on the abundance of the transgene transcripts. The −20/−5 sequence contains critical 5′ sequence elements. Synthetic RNA templates with alterations within this 5′ region were less efficiently edited in vitro than wild-type templates, by either tobacco or maize chloroplast extracts. The tobacco chloroplast extract supports both RNA editing and processing of 3′ transcript termini. We conclude that within the −20/−5 region, sequences common to editing sites in the transcripts of rpoB, psbL and rps14 are critical for efficient NTrpoB C473 editing. PMID:16893957

  20. Chironomus riparius (Diptera) genome sequencing reveals the impact of minisatellite transposable elements on population divergence.

    PubMed

    Oppold, Ann-Marie; Schmidt, Hanno; Rose, Marcel; Hellmann, Sören Lukas; Dolze, Florian; Ripp, Fabian; Weich, Bettina; Schmidt-Ott, Urs; Schmidt, Erwin; Kofler, Robert; Hankeln, Thomas; Pfenninger, Markus

    2017-03-18

    Active transposable elements (TEs) may result in divergent genomic insertion and abundance patterns among conspecific populations. Upon secondary contact, such divergent genetic backgrounds can theoretically give rise to classical Dobzhansky-Muller incompatibilities (DMI), thus contributing to the evolution of endogenous genetic barriers and eventually cause population divergence. We investigated differential TE abundance among conspecific populations of the non-biting midge Chironomus riparius and evaluated their potential role in causing endogenous genetic incompatibilities between these populations. We focussed on a Chironomus-specific TE, the minisatellite-like Cla-element, whose activity is associated with speciation in the genus. Using a newly generated and annotated draft genome for a genomic study with five natural C. riparius populations, we found highly population-specific TE insertion patterns with many private insertions. A significant correlation of the pairwise FST estimated from genome-wide single nucleotide polymorphisms (SNPs) and the FST estimated from TEs, is consistent with drift as the major force driving TE population differentiation. However, the significantly higher Cla-element FST level due to a high proportion of differentially fixed Cla-element insertions also indicates selection against segregating (i.e. heterozygous) insertions. With reciprocal crossing experiments and fluorescent in-situ hybridisation of Cla-elements to polytene chromosomes, we documented phenotypic effects on female fertility and chromosomal mispairings. We propose that the inferred negative selection on heterozygous Cla-element insertions may cause endogenous genetic barriers and therefore acts as DMI among C. riparius populations. The intrinsic genomic turnover exerted by TEs may thus have a direct impact on population divergence that is operationally different from drift and local adaptation. This article is protected by copyright. All rights reserved.

  1. Analysis of core promoter sequences located downstream from the TATA element in the hsp70 promoter from Drosophila melanogaster.

    PubMed

    Wu, C H; Madabusi, L; Nishioka, H; Emanuel, P; Sypes, M; Arkhipova, I; Gilmour, D S

    2001-03-01

    TFIID recognizes multiple sequence elements in the hsp70 promoter of Drosophila. Here, we investigate the function of sequences downstream from the TATA element. A mutation in the initiator was identified that caused an eightfold reduction in binding of TFIID and a fourfold reduction in transcription in vitro. Another mutation in the +24 to +29 region was somewhat less inhibitory, but a mutation in the +14 to +19 region had essentially no effect. The normal promoter and the mutants in the initiator and the +24 to +29 region were transformed into flies by P element-mediated transformation. The initiator mutation reduced expression an average of twofold in adult flies, whereas the mutation in the +24 to +29 region had essentially no effect. In contrast, a promoter combining the two mutations was expressed an average of sixfold less than the wild type. The results suggest that the initiator and the +24 to +29 region could serve overlapping functions in vivo. Protein-DNA cross-linking was used to identify which subunits of TFIID contact the +24 to +29 region and the initiator. No specific subunits were found to cross-link to the +24 to +29 region. In contrast, the initiator cross-linked exclusively to dTAF230. Remarkably, dTAF230 cross-links approximately 10 times more efficiently to the nontranscribed strand than to the transcribed strand at the initiator.

  2. In Turkish: Sentence Structure and Possible Sentences According to the Sequence of Elements

    ERIC Educational Resources Information Center

    Mete, Filiz

    2016-01-01

    This study aims to investigate the structure according to the order of the elements in the Turkish sentence and to determine the possible sentences that are produced according to this structure. In order to examine the possible sentences, the question raised is: "How many possible canonical clauses (regular), inverted sentences (irregular)…

  3. V(D)J recombination frequency is affected by the sequence interposed between a pair of recombination signals: sequence comparison reveals a putative recombinational enhancer element.

    PubMed

    Roch, F A; Hobi, R; Berchtold, M W; Kuenzle, C C

    1997-06-15

    The immunoglobulin heavy chain intron enhancer (Emu) not only stimulates transcription but also V(D)J recombination of chromosomally integrated recombination substrates. We aimed at reproducing this effect in recombination competent cells by transient transfection of extrachromosomal substrates. These we prepared by interposing between the recombination signal sequences (RSS) of the plasmid pBlueRec various fragments, including Emu, possibly affecting V(D)J recombination. Our work shows that sequences inserted between RSS 23 and RSS 12, with distances from their proximal ends of 26 and 284 bp respectively, can markedly affect the frequency of V(D)J recombination. We report that the entire Emu, the Emu core as well as its flanking 5' and 3' matrix associated regions (5' and 3' MARs) upregulate V(D)J recombination while the downstream section of the 3' MAR of Emu does not. Also, prokaryotic sequences markedly suppress V(D)J recombination. This confirms previous results obtained with chromosomally integrated substrates, except for the finding that the full length 3' MAR of Emu stimulates V(D)J recombination in an episomal but not in a chromosomal context. The fact that other MARs do not share this activity suggests that the effect is no mediated through attachment of the recombination substrate to a nuclear matrix-associated recombination complex but through cis-activation. The presence of a 26 bp A-T-rich sequence motif in the 5' and 3' MARs of Emu and in all of the other upregulating fragments investigated, leads us to propose that the motif represents a novel recombinational enhancer element distinct from those constituting the Emu core.

  4. Thermal aging of traditional and additively manufactured foams: analysis by time-temperature-superposition, constitutive, and finite-element models

    SciTech Connect

    Maiti, A.; Weisgraber, T. H.; Small, W.; Lewicki, J. P.; Duoss, E. B.; Spadaccini, C. M.; Pearson, M. A.; Chinn, S. C.; Wilson, T. S.; Maxwell, R. S.

    2016-12-08

    Cellular solids or foams are a very important class of materials with diverse applications ranging from thermal insulation and shock absorbing support cushions, to light-weight structural and floatation components, and constitute crucial components in a large number of industries including automotive, aerospace, electronics, marine, biomedical, packaging, and defense. In many of these applications the foam material is subjected to long periods of continuous stress, which can, over time, lead to a permanent change in structure and a degradation in performance. In this report we summarize our modeling efforts to date on polysiloxane foam materials that form an important component in our systems. Aging of the materials was characterized by two measured quantities, i.e., compression set and load retention. Results of accelerated aging experiments were analyzed by an automated time-temperaturesuperposition (TTS) approach, which creates a master curve that can be used for long-term predictions (over decades) under ambient conditions. When comparing such master curves for traditional (stochastic) foams with those for recently 3D-printed (i.e., additively manufactured, or AM) foams, it became clear that AM foams have superior aging behavior. To gain deeper understanding, we imaged the microstructure of both foams using X-ray computed tomography, and performed finite-element analysis of the mechanical response within these microstructures. This indicates a wider stress variation in the stochastic foam with points of more extreme local stress as compared to the 3D printed material.

  5. Rearrangement of mouse immunoglobulin kappa deleting element recombining sequence promotes immune tolerance and lambda B cell production.

    PubMed

    Vela, José Luis; Aït-Azzouzene, Djemel; Duong, Bao Hoa; Ota, Takayuki; Nemazee, David

    2008-02-01

    The recombining sequence (RS) of mouse and its human equivalent, the immunoglobulin (Ig) kappa deleting element (IGKDE), are sequences found at the 3' end of the Ig kappa locus (Igk) that rearrange to inactivate Igk in developing B cells. RS recombination correlates with Ig lambda (Iglambda) light (L) chain expression and likely plays a role in receptor editing by eliminating Igk genes encoding autoantibodies. A mouse strain was generated in which the recombination signal of RS was removed, blocking RS-mediated Igk inactivation. In RS mutant mice, receptor editing and self-tolerance were impaired, in some cases leading to autoantibody formation. Surprisingly, mutant mice also made fewer B cells expressing lambda chain, whereas lambda versus kappa isotype exclusion was only modestly affected. These results provide insight into the mechanism of L chain isotype exclusion and indicate that RS has a physiological role in promoting the formation of lambda L chain-expressing B cells.

  6. Long Interspersed Element Sequencing (L1-Seq): A Method to Identify Somatic LINE-1 Insertions in the Human Genome

    PubMed Central

    Doucet, Tara T.; Kazazian, Haig H.

    2017-01-01

    L1-seq is a high-throughput sequencing technique which is utilized to identify novel L1 insertions in genomic DNA samples of interest. Using special diagnostic nucleotides unique to the youngest and most active L1 sequence, we can amplify new somatic insertions. This technique has helped to establish the number of L1 insertions present in the general population as well as the variation among individuals with regard to their complement of active L1 elements. More recently, this technique has been employed to assess the level of retrotransposition occurring in various diseases such as cancer. These efforts try to establish a connection between the process of retrotransposition and disease development and/or progression. PMID:26895047

  7. Rearrangements involving repeated sequences within a P element preferentially occur between units close to the transposon extremities

    SciTech Connect

    Paques, F.; Bucheton, B.; Wegnez, M.

    1996-02-01

    In a previous report we described rearrangements occurring at a high rate (30% of the progeny of dysgenic flies) within a cluster of 5S genes internal to a P element. These events were characterized as precise amplifications and deletions of 5S units. Here we analyze recombination events within P elements containing two repeated arrays of 5S genes flanking a central white gene. Deletions (50%) and duplications (3%) of the white gene together with various amounts of flanking 5S genes were observed. These recombinations occur preferentially between the most external 5S units of P transposons. Such rearrangements could be favored by interactions between the proteins bound to the P terminal sequences. 39 refs., 7 figs.

  8. Multiple DNA sequence elements are necessary for the function of an immunoglobulin heavy chain promoter.

    PubMed Central

    Eaton, S; Calame, K

    1987-01-01

    Sequences required for the function of the mouse V1 immunoglobulin heavy chain variable-region (VH) promoter were identified by transient transfection of the normal and mutated promoters into plasmacytoma cells. Our results identify four regions required for normal promoter function: (i) the octamer ATGCAAAT, previously identified by others; (ii) a heptamer, CTAATGA; (iii) a pyrimidine-rich region; and (iv) a region between positions -125 and -251 relative to the transcription start site. Sequence analysis of 19 mouse and human VH 5' flanking regions shows that the heptamer and pyrimidine stretch are strongly conserved. We have also demonstrated that the octamer functions in an orientation independent manner in the VH promoter. Images PMID:3118372

  9. A conserved 11 nucleotide sequence contains an essential promoter element of the maize mitochondrial atp1 gene.

    PubMed Central

    Rapp, W D; Stern, D B

    1992-01-01

    To determine the structure of a functional plant mitochondrial promoter, we have partially purified an RNA polymerase activity that correctly initiates transcription at the maize mitochondrial atp1 promoter in vitro. Using a series of 5' deletion constructs, we found that essential sequences are located within--19 nucleotides (nt) of the transcription initiation site. The region surrounding the initiation site includes conserved sequence motifs previously proposed to be maize mitochondrial promoter elements. Deletion of a conserved 11 nt sequence showed that it is critical for promoter function, but deletion or alteration of conserved upstream G(A/T)3-4 repeats had no effect. When the atp1 11 nt sequence was inserted into different plasmids lacking mitochondrial promoter activity, transcription was only observed for one of these constructs. We infer from these data that the functional promoter extends beyond this motif, most likely in the 5' direction. The maize mitochondrial cox3 and atp6 promoters also direct transcription initiation in this in vitro system, suggesting that it may be widely applicable for studies of mitochondrial transcription in this species. Images PMID:1372246

  10. Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia.

    PubMed

    Sacramento, C B; Moraes, J Z; Denapolis, P M A; Han, S W

    2010-08-01

    The main objective of the present study was to find suitable DNA-targeting sequences (DTS) for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS) and hypoxia-responsive element (HRE) sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF). The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2) and hypoxia (less than 5% O2) were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line) in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.

  11. Tandem insertion sequence-like elements define the expression site for variable antigen genes of Borrelia hermsii.

    PubMed Central

    Barbour, A G; Carter, C J; Burman, N; Freitag, C S; Garon, C F; Bergström, S

    1991-01-01

    The spirochete Borrelia hermsii avoids the immune response of its mammalian host through multiphasic antigenic variation. Serotype specificity is determined by variable antigens, Vmp proteins, in the outer membrane. Through nonreciprocal recombination between linear plasmids, a formerly silent vmp gene replaces another vmp gene downstream from a common expression site. To further characterize this activating site, we determined the nucleotide sequence of 6.9 kb of the common upstream expression region of strain HS1 of B. hermsii. Preceding the vmp gene promoter and a poly(dT.dA) run were three imperfectly repeated segments of 2 kb. Each of the 2-kb segments contained 1-kb elements with inverted repeats of approximately 0.2 kb each at their termini. The potential of the 1-kb elements to form stem-and-loop structures was demonstrated by heteroduplex analysis. There was no evidence of the presence of the elements elsewhere in the genome of B. hermsii. One or more of these elements may confer the unidirectionality that characterizes vmp gene switches. Images PMID:1987053

  12. Natural Selection and Functional Potentials of Human Noncoding Elements Revealed by Analysis of Next Generation Sequencing Data.

    PubMed

    Jha, Pankaj; Lu, Dongsheng; Xu, Shuhua

    2015-01-01

    Noncoding DNA sequences (NCS) have attracted much attention recently due to their functional potentials. Here we attempted to reveal the functional roles of noncoding sequences from the point of view of natural selection that typically indicates the functional potentials of certain genomic elements. We analyzed nearly 37 million single nucleotide polymorphisms (SNPs) of Phase I data of the 1000 Genomes Project. We estimated a series of key parameters of population genetics and molecular evolution to characterize sequence variations of the noncoding genome within and between populations, and identified the natural selection footprints in NCS in worldwide human populations. Our results showed that purifying selection is prevalent and there is substantial constraint of variations in NCS, while positive selectionis more likely to be specific to some particular genomic regions and regional populations. Intriguingly, we observed larger fraction of non-conserved NCS variants with lower derived allele frequency in the genome, indicating possible functional gain of non-conserved NCS. Notably, NCS elements are enriched for potentially functional markers such as eQTLs, TF motif, and DNase I footprints in the genome. More interestingly, some NCS variants associated with diseases such as Alzheimer's disease, Type 1 diabetes, and immune-related bowel disorder (IBD) showed signatures of positive selection, although the majority of NCS variants, reported as risk alleles by genome-wide association studies, showed signatures of negative selection. Our analyses provided compelling evidence of natural selection forces on noncoding sequences in the human genome and advanced our understanding of their functional potentials that play important roles in disease etiology and human evolution.

  13. Efficient and precise calculation of the b-matrix elements in diffusion-weighted imaging pulse sequences

    NASA Astrophysics Data System (ADS)

    Zubkov, Mikhail; Stait-Gardner, Timothy; Price, William S.

    2014-06-01

    Precise NMR diffusion measurements require detailed knowledge of the cumulative dephasing effect caused by the numerous gradient pulses present in most NMR pulse sequences. This effect, which ultimately manifests itself as the diffusion-related NMR signal attenuation, is usually described by the b-value or the b-matrix in the case of multidirectional diffusion weighting, the latter being common in diffusion-weighted NMR imaging. Neglecting some of the gradient pulses introduces an error in the calculated diffusion coefficient reaching in some cases 100% of the expected value. Therefore, ensuring the b-matrix calculation includes all the known gradient pulses leads to significant error reduction. Calculation of the b-matrix for simple gradient waveforms is rather straightforward, yet it grows cumbersome when complexly shaped and/or numerous gradient pulses are introduced. Making three broad assumptions about the gradient pulse arrangement in a sequence results in an efficient framework for calculation of b-matrices as well providing some insight into optimal gradient pulse placement. The framework allows accounting for the diffusion-sensitising effect of complexly shaped gradient waveforms with modest computational time and power. This is achieved by using the b-matrix elements of the simple unmodified pulse sequence and minimising the integration of the complexly shaped gradient waveform in the modified sequence. Such re-evaluation of the b-matrix elements retains all the analytical relevance of the straightforward approach, yet at least halves the amount of symbolic integration required. The application of the framework is demonstrated with the evaluation of the expression describing the diffusion-sensitizing effect, caused by different bipolar gradient pulse modules.

  14. Efficient and precise calculation of the b-matrix elements in diffusion-weighted imaging pulse sequences.

    PubMed

    Zubkov, Mikhail; Stait-Gardner, Timothy; Price, William S

    2014-06-01

    Precise NMR diffusion measurements require detailed knowledge of the cumulative dephasing effect caused by the numerous gradient pulses present in most NMR pulse sequences. This effect, which ultimately manifests itself as the diffusion-related NMR signal attenuation, is usually described by the b-value or the b-matrix in the case of multidirectional diffusion weighting, the latter being common in diffusion-weighted NMR imaging. Neglecting some of the gradient pulses introduces an error in the calculated diffusion coefficient reaching in some cases 100% of the expected value. Therefore, ensuring the b-matrix calculation includes all the known gradient pulses leads to significant error reduction. Calculation of the b-matrix for simple gradient waveforms is rather straightforward, yet it grows cumbersome when complexly shaped and/or numerous gradient pulses are introduced. Making three broad assumptions about the gradient pulse arrangement in a sequence results in an efficient framework for calculation of b-matrices as well providing some insight into optimal gradient pulse placement. The framework allows accounting for the diffusion-sensitising effect of complexly shaped gradient waveforms with modest computational time and power. This is achieved by using the b-matrix elements of the simple unmodified pulse sequence and minimising the integration of the complexly shaped gradient waveform in the modified sequence. Such re-evaluation of the b-matrix elements retains all the analytical relevance of the straightforward approach, yet at least halves the amount of symbolic integration required. The application of the framework is demonstrated with the evaluation of the expression describing the diffusion-sensitizing effect, caused by different bipolar gradient pulse modules.

  15. Treatment of a simulated textile wastewater in a sequencing batch reactor (SBR) with addition of a low-cost adsorbent.

    PubMed

    Santos, Sílvia C R; Boaventura, Rui A R

    2015-06-30

    Color removal from textile wastewaters, at a low-cost and consistent technology, is even today a challenge. Simultaneous biological treatment and adsorption is a known alternative to the treatment of wastewaters containing biodegradable and non-biodegradable contaminants. The present work aims at evaluating the treatability of a simulated textile wastewater by simultaneously combining biological treatment and adsorption in a SBR (sequencing batch reactor), but using a low-cost adsorbent, instead of a commercial one. The selected adsorbent was a metal hydroxide sludge (WS) from an electroplating industry. Direct Blue 85 dye (DB) was used in the preparation of the synthetic wastewater. Firstly, adsorption kinetics and equilibrium were studied, in respect to many factors (temperature, pH, WS dosage and presence of salts and dyeing auxiliary chemicals in the aqueous media). At 25 °C and pH 4, 7 and 10, maximum DB adsorption capacities in aqueous solution were 600, 339 and 98.7 mg/g, respectively. These values are quite considerable, compared to other reported in literature, but proved to be significantly reduced by the presence of dyeing auxiliary chemicals in the wastewater. The simulated textile wastewater treatment in SBR led to BOD5 removals of 53-79%, but color removal was rather limited (10-18%). The performance was significantly enhanced by the addition of WS, with BOD5 removals above 91% and average color removals of 60-69%.

  16. Effect of Si additions on thermal stability and the phase transition sequence of sputtered amorphous alumina thin films

    SciTech Connect

    Bolvardi, H.; Baben, M. to; Nahif, F.; Music, D. Schnabel, V.; Shaha, K. P.; Mráz, S.; Schneider, J. M.; Bednarcik, J.; Michalikova, J.

    2015-01-14

    Si-alloyed amorphous alumina coatings having a silicon concentration of 0 to 2.7 at. % were deposited by combinatorial reactive pulsed DC magnetron sputtering of Al and Al-Si (90-10 at. %) split segments in Ar/O{sub 2} atmosphere. The effect of Si alloying on thermal stability of the as-deposited amorphous alumina thin films and the phase formation sequence was evaluated by using differential scanning calorimetry and X-ray diffraction. The thermal stability window of the amorphous phase containing 2.7 at. % of Si was increased by more than 100 °C compared to that of the unalloyed phase. A similar retarding effect of Si alloying was also observed for the α-Al{sub 2}O{sub 3} formation temperature, which increased by more than 120 °C. While for the latter retardation, the evidence for the presence of SiO{sub 2} at the grain boundaries was presented previously, this obviously cannot explain the stability enhancement reported here for the amorphous phase. Based on density functional theory molecular dynamics simulations and synchrotron X-ray diffraction experiments for amorphous Al{sub 2}O{sub 3} with and without Si incorporation, we suggest that the experimentally identified enhanced thermal stability of amorphous alumina with addition of Si is due to the formation of shorter and stronger Si–O bonds as compared to Al–O bonds.

  17. A view of an elemental naturalist at the DNA world (base composition, sequences, methylation).

    PubMed

    Vanyushin, B F

    2007-12-01

    The pioneering data on base composition and pyrimidine sequences in DNA of pro- and eukaryotes are considered, and their significance for the origin of genosystematics is discussed. The modern views on specificity and functional role of enzymatic DNA methylation in eukaryotes are described. DNA methylation controls all genetic functions and is a mechanism of cellular differentiation and gene silencing. A model of regulation of DNA replication by methylation is suggested. Adenine DNA methylation in higher eukaryotes (higher plants) was first observed, and it was established that one and the same gene can be methylated at both cytosine and adenine moieties. Thus, there are at least two different and seemingly interdependent DNA methylation systems present in eukaryotic cells. The first eukaryotic adenine DNA-methyltransferase is isolated from wheat seedlings and described: the enzyme methylates DNA with formation of N6-methyladenine in the sequence TGATCA-->TGm6ATCA. It is found that higher plants have endonucleases that are dependent on S-adenosyl-L-methionine (SAM) and sensitive to DNA methylation status. Therefore, as in bacteria, plants seem to have a restriction-modification (R-M) system. A system of conjugated up- and down-regulation of SAM-dependent endonucleases by SAM modulations is found in plants. Revelation of an essential role of DNA methylation in regulation of genetic processes is a fundament of materialization of epigenetics and epigenomics.

  18. An amphipathic trans-acting phosphorothioate DNA element delivers uncharged PNA and PMO nucleic acid sequences in mammalian cells

    PubMed Central

    Jain, Harsh V.; Beaucage, Serge L.

    2016-01-01

    An innovative approach to the delivery of uncharged peptide nucleic acids (PNA) and phosphorodiamidate morpholino (PMO) oligomers in mammalian cells is described and consists of extending the sequence of those oligomers with a short PNA-polyA or PMO-polyA tail. Recognition of the polyA-tailed PNA or PMO oligomers by an amphipathic trans-acting polythymidylic thiophosphate triester element (dTtaPS) results in efficient internalization of those oligomers in several cell lines. Our findings indicate that cellular uptake of the oligomers occurs through an energy-dependent mechanism and macropinocytosis appears to be the predo-minant endocytic pathway used for internalization. The functionality of the internalized oligomers is demonstrated by alternate splicing of the pre-mRNA encoding luciferase in HeLa pLuc 705 cells. Amphipathic phosphorothioate DNA elements may represent a unique class of cellular transporters for robust delivery of uncharged nucleic acid sequences in live mammalian cells. PMID:27516815

  19. Non-additive interactions involving two distinct elements mediate sloppy-paired regulation by pair-rule transcription factors

    PubMed Central

    Prazak, Lisa; Fujioka, Miki; Gergen, J. Peter

    2010-01-01

    The relatively simple combinatorial rules responsible for establishing the initial metameric expression of sloppy-paired-1 (slp1) in the Drosophila blastoderm embryo make this system an attractive model for investigating the mechanism of regulation by pair rule transcription factors. This investigation of slp1 cis-regulatory architecture identifies two distinct elements, a proximal early stripe element (PESE) and a distal early stripe element (DESE) located from −3.1 kb to −2.5 kb and from −8.1 kb to −7.1 kb upstream of the slp1 promoter, respectively, that mediate this early regulation. The proximal element expresses only even-numbered stripes and mediates repression by Even-skipped (Eve) as well as by the combination of Runt and Fushi-tarazu (Ftz). A 272 basepair sub-element of PESE retains Eve-dependent repression, but is expressed throughout the even-numbered parasegments due to the loss of repression by Runt and Ftz. In contrast, the distal element expresses both odd and even-numbered stripes and also drives inappropriate expression in the anterior half of the odd-numbered parasegments due to an inability to respond to repression by Eve. Importantly, a composite reporter gene containing both early stripe elements recapitulates pair-rule gene-dependent regulation in a manner beyond what is expected from combining their individual patterns. These results indicate interactions involving distinct cis-elements contribute to the proper integration of pair-rule regulatory information. A model fully accounting for these results proposes that metameric slp1 expression is achieved through the Runt-dependent regulation of interactions between these two pair-rule response elements and the slp1 promoter. PMID:20435028

  20. Coordinate action of distinct sequence elements localizes checkpoint kinase Hsl1 to the septin collar at the bud neck in Saccharomyces cerevisiae.

    PubMed

    Finnigan, Gregory C; Sterling, Sarah M; Duvalyan, Angela; Liao, Elizabeth N; Sargsyan, Aspram; Garcia, Galo; Nogales, Eva; Thorner, Jeremy

    2016-07-15

    Passage through the eukaryotic cell cycle requires processes that are tightly regulated both spatially and temporally. Surveillance mechanisms (checkpoints) exert quality control and impose order on the timing and organization of downstream events by impeding cell cycle progression until the necessary components are available and undamaged and have acted in the proper sequence. In budding yeast, a checkpoint exists that does not allow timely execution of the G2/M transition unless and until a collar of septin filaments has properly assembled at the bud neck, which is the site where subsequent cytokinesis will occur. An essential component of this checkpoint is the large (1518-residue) protein kinase Hsl1, which localizes to the bud neck only if the septin collar has been correctly formed. Hsl1 reportedly interacts with particular septins; however, the precise molecular determinants in Hsl1 responsible for its recruitment to this cellular location during G2 have not been elucidated. We performed a comprehensive mutational dissection and accompanying image analysis to identify the sequence elements within Hsl1 responsible for its localization to the septins at the bud neck. Unexpectedly, we found that this targeting is multipartite. A segment of the central region of Hsl1 (residues 611-950), composed of two tandem, semiredundant but distinct septin-associating elements, is necessary and sufficient for binding to septin filaments both in vitro and in vivo. However, in addition to 611-950, efficient localization of Hsl1 to the septin collar in the cell obligatorily requires generalized targeting to the cytosolic face of the plasma membrane, a function normally provided by the C-terminal phosphatidylserine-binding KA1 domain (residues 1379-1518) in Hsl1 but that can be replaced by other, heterologous phosphatidylserine-binding sequences.

  1. Coordinate action of distinct sequence elements localizes checkpoint kinase Hsl1 to the septin collar at the bud neck in Saccharomyces cerevisiae

    PubMed Central

    Finnigan, Gregory C.; Sterling, Sarah M.; Duvalyan, Angela; Liao, Elizabeth N.; Sargsyan, Aspram; Garcia, Galo; Nogales, Eva; Thorner, Jeremy

    2016-01-01

    Passage through the eukaryotic cell cycle requires processes that are tightly regulated both spatially and temporally. Surveillance mechanisms (checkpoints) exert quality control and impose order on the timing and organization of downstream events by impeding cell cycle progression until the necessary components are available and undamaged and have acted in the proper sequence. In budding yeast, a checkpoint exists that does not allow timely execution of the G2/M transition unless and until a collar of septin filaments has properly assembled at the bud neck, which is the site where subsequent cytokinesis will occur. An essential component of this checkpoint is the large (1518-residue) protein kinase Hsl1, which localizes to the bud neck only if the septin collar has been correctly formed. Hsl1 reportedly interacts with particular septins; however, the precise molecular determinants in Hsl1 responsible for its recruitment to this cellular location during G2 have not been elucidated. We performed a comprehensive mutational dissection and accompanying image analysis to identify the sequence elements within Hsl1 responsible for its localization to the septins at the bud neck. Unexpectedly, we found that this targeting is multipartite. A segment of the central region of Hsl1 (residues 611–950), composed of two tandem, semiredundant but distinct septin-associating elements, is necessary and sufficient for binding to septin filaments both in vitro and in vivo. However, in addition to 611–950, efficient localization of Hsl1 to the septin collar in the cell obligatorily requires generalized targeting to the cytosolic face of the plasma membrane, a function normally provided by the C-terminal phosphatidylserine-binding KA1 domain (residues 1379–1518) in Hsl1 but that can be replaced by other, heterologous phosphatidylserine-binding sequences. PMID:27193302

  2. Modular Evolution of TnGBSs, a New Family of Integrative and Conjugative Elements Associating Insertion Sequence Transposition, Plasmid Replication, and Conjugation for Their Spreading

    PubMed Central

    Guérillot, Romain; Da Cunha, Violette; Sauvage, Elisabeth; Bouchier, Christiane

    2013-01-01

    Integrative and conjugative elements (ICEs) have a major impact on gene flow and genome dynamics in bacteria. The ICEs TnGBS1 and TnGBS2, first identified in Streptococcus agalactiae, use a DDE transposase, unlike most characterized ICEs, which depend on a phage-like integrase for their mobility. Here we identified 56 additional TnGBS-related ICEs by systematic genome analysis. Interestingly, all except one are inserted in streptococcal genomes. Sequence comparison of the proteins conserved among these ICEs defined two subtypes related to TnGBS1 or TnGBS2. We showed that both types encode different conjugation modules: a type IV secretion system, a VirD4 coupling protein, and a relaxase and its cognate oriT site, shared with distinct lineages of conjugative elements of Firmicutes. Phylogenetic analysis suggested that TnGBSs evolved from two conjugative elements of different origins by the successive recruitment of a transposition module derived from insertion sequences (ISs). Furthermore, TnGBSs share replication modules with different plasmids. Mutational analyses and conjugation experiments showed that TnGBS1 and TnGBS2 combine replication and transposition upstream promoters for their transfer and stabilization. Despite an evolutionarily successful horizontal dissemination within the genus Streptococcus, these ICEs have a restricted host range. However, we reveal that for TnGBS1 and TnGBS2, this host restriction is not due to a transfer incompatibility linked to the conjugation machineries but most likely to their ability for transient maintenance through replication after their transfer. PMID:23435978

  3. Modular evolution of TnGBSs, a new family of integrative and conjugative elements associating insertion sequence transposition, plasmid replication, and conjugation for their spreading.

    PubMed

    Guérillot, Romain; Da Cunha, Violette; Sauvage, Elisabeth; Bouchier, Christiane; Glaser, Philippe

    2013-05-01

    Integrative and conjugative elements (ICEs) have a major impact on gene flow and genome dynamics in bacteria. The ICEs TnGBS1 and TnGBS2, first identified in Streptococcus agalactiae, use a DDE transposase, unlike most characterized ICEs, which depend on a phage-like integrase for their mobility. Here we identified 56 additional TnGBS-related ICEs by systematic genome analysis. Interestingly, all except one are inserted in streptococcal genomes. Sequence comparison of the proteins conserved among these ICEs defined two subtypes related to TnGBS1 or TnGBS2. We showed that both types encode different conjugation modules: a type IV secretion system, a VirD4 coupling protein, and a relaxase and its cognate oriT site, shared with distinct lineages of conjugative elements of Firmicutes. Phylogenetic analysis suggested that TnGBSs evolved from two conjugative elements of different origins by the successive recruitment of a transposition module derived from insertion sequences (ISs). Furthermore, TnGBSs share replication modules with different plasmids. Mutational analyses and conjugation experiments showed that TnGBS1 and TnGBS2 combine replication and transposition upstream promoters for their transfer and stabilization. Despite an evolutionarily successful horizontal dissemination within the genus Streptococcus, these ICEs have a restricted host range. However, we reveal that for TnGBS1 and TnGBS2, this host restriction is not due to a transfer incompatibility linked to the conjugation machineries but most likely to their ability for transient maintenance through replication after their transfer.

  4. DNA sequence analysis of a mouse pro alpha 1 (I) procollagen gene: evidence for a mouse B1 element within the gene.

    PubMed Central

    Monson, J M; Friedman, J; McCarthy, B J

    1982-01-01

    In a 3.8-kilobase mouse DNA sequence encoding amino acid sequences for the pro alpha 1(I) chain of type I procollagen, 14 coding sequences were identified which specify a sequence 95% homologous to amino acid residues 568 to 963 of the bovine alpha 1(I) chain. All of these coding sequences were flanked by appropriate splice junctions following the GT/AG rule. These observations suggest, but do not prove, that this pro alpha 1(I) gene is transcriptionally active. Of the 14 coding sequences, 7 were 54 base pairs in length, whereas the remainder were higher multiples of 54 base pairs. Nonrandom utilization of codons pertained throughout all of the coding sequences showing a preference (56%) for U in the wobble position. Two of the intervening sequences encoded imperfect vestiges of coding sequences which exhibited a codon preference different from that of the pro alpha 1(I) gene proper and were not flanked by splice junctions. One intervening sequence encoded a member of the mouse B1 family of middle repetitive sequences. It was flanked by 8-base-pair direct repeats and had a truncated A-rich region, suggesting that it may be a mobile element. Within this element were sequences which could function as a RNA polymerase III split promoter. Images PMID:6298597

  5. Identification of an activator protein-1-like sequence as the glucocorticoid response element in the rat tyrosine hydroxylase gene.

    PubMed

    Rani, C S Sheela; Elango, Narayanasamy; Wang, Shou-Shu; Kobayashi, Kazuto; Strong, Randy

    2009-03-01

    Glucocorticoids (GCs) generally stimulate gene transcription via consensus glucocorticoid response elements (GREs) located in the promoter region. To identify the GRE in the rat tyrosine hydroxylase (TH) gene promoter, we transiently transfected PC12 cells with a 9-kilobase (kb) TH promoter-luciferase (Luc) construct. Dexamethasone (Dex) stimulated Luc activity, which was abolished by mifepristone (RU486). Serial deletion mutations revealed a Dex-responsive 7-base pair (bp) sequence, TGACTAA, located at -5734 to -5728. Deletion of just these seven nucleotides from the 9-kb promoter completely abolished the Dex response and partially reduced the response to phorbol ester but not to forskolin. The Dex response was fully retained in a construct in which most of the 9-kb promoter was deleted, except for 100 bp around the -5.7-kb region, clearly identifying this 7-bp sequence as solely responsible for GC responsiveness. Conversely, deletion of the proximal cAMP-response element (-45/-38) or activator protein-1 (AP-1) (-207/-201) sites in the 9-kb promoter did not affect Dex and phorbol ester responses. A radiolabeled 25-bp promoter fragment bearing the 7-bp TH-GRE/AP-1 showed specific binding to PC12 nuclear proteins. Using antibodies against the glucocorticoid receptors and AP-1 family of proteins and primers for the TH-GRE/AP-1 region, we detected a specific DNA amplicon in a chromatin immunoprecipitation assay. This 7-bp TH-GRE/AP-1 sequence (TGACTAA) does not bear similarity to any known GRE but closely resembles the consensus AP-1 binding site, TGACTCA. Our studies describe for the first time a novel GRE/AP-1 site present in the TH gene promoter that is critical for glucocorticoid regulation of the TH gene.

  6. Whole-Genome Sequencing Analysis from the Chikungunya Virus Caribbean Outbreak Reveals Novel Evolutionary Genomic Elements

    PubMed Central

    Stapleford, Kenneth A.; Moratorio, Gonzalo; Henningsson, Rasmus; Chen, Rubing; Matheus, Séverine; Enfissi, Antoine; Weissglas-Volkov, Daphna; Isakov, Ofer; Blanc, Hervé; Mounce, Bryan C.; Dupont-Rouzeyrol, Myrielle; Shomron, Noam; Weaver, Scott; Fontes, Magnus; Rousset, Dominique; Vignuzzi, Marco

    2016-01-01

    Background Chikungunya virus (CHIKV), an alphavirus and member of the Togaviridae family, is capable of causing severe febrile disease in humans. In December of 2013 the Asian Lineage of CHIKV spread from the Old World to the Americas, spreading rapidly throughout the New World. Given this new emergence in naïve populations we studied the viral genetic diversity present in infected individuals to understand how CHIKV may have evolved during this continuing outbreak. Methodology/Principle Findings We used deep-sequencing technologies coupled with well-established bioinformatics pipelines to characterize the minority variants and diversity present in CHIKV infected individuals from Guadeloupe and Martinique, two islands in the center of the epidemic. We observed changes in the consensus sequence as well as a diverse range of minority variants present at various levels in the population. Furthermore, we found that overall diversity was dramatically reduced after single passages in cell lines. Finally, we constructed an infectious clone from this outbreak and identified a novel 3’ untranslated region (UTR) structure, not previously found in nature, that led to increased replication in insect cells. Conclusions/Significance Here we preformed an intrahost quasispecies analysis of the new CHIKV outbreak in the Caribbean. We identified novel variants present in infected individuals, as well as a new 3’UTR structure, suggesting that CHIKV has rapidly evolved in a short period of time once it entered this naïve population. These studies highlight the need to continue viral diversity surveillance over time as this epidemic evolves in order to understand the evolutionary potential of CHIKV. PMID:26807575

  7. Conservation of position and sequence of a novel, widely expressed gene containing the major human {alpha}-globin regulatory element

    SciTech Connect

    Vyas, P.; Vickers, M.A.; Picketts, D.J.; Higgs, D.R.

    1995-10-10

    We have determined the cDNA and genomic structure of a gene (-14 gene) that lies adjacent to the human {alpha}-globin cluster. Although it is expressed in a wide range of cell lines and tissues, a previously described erythroid-specific regulatory element that controls expression of the {alpha}-globin genes lies within intron 5 of this gene. Analysis of the -14 gene promoter shows that it is GC rich and associated with a constitutively expressed DNase 1 hypersensitive site; unlike the {alpha}-globin promoter, it does not contain a TATA or CCAAT box. These and other differences in promoter structure may explain why the erythroid regulatory element interacts specifically with the {alpha}-globin promoters and not the -14 gene promoter, which lies between the {alpha} promoters and their regulatory element. Interspecies comparisons demonstrate that the sequence and location of the -14 gene adjacent to the a cluster have been maintained since the bird/mammal divergence, 270 million years ago. 38 refs., 6 figs.

  8. Effect of the addition of low rare earth elements (lanthanum, neodymium, cerium) on the biodegradation and biocompatibility of magnesium.

    PubMed

    Willbold, Elmar; Gu, Xuenan; Albert, Devon; Kalla, Katharina; Bobe, Katharina; Brauneis, Maria; Janning, Carla; Nellesen, Jens; Czayka, Wolfgang; Tillmann, Wolfgang; Zheng, Yufeng; Witte, Frank

    2015-01-01

    Rare earth elements are promising alloying element candidates for magnesium alloys used as biodegradable devices in biomedical applications. Rare earth elements have significant effects on the high temperature strength as well as the creep resistance of alloys and they improve magnesium corrosion resistance. We focused on lanthanum, neodymium and cerium to produce magnesium alloys with commonly used rare earth element concentrations. We showed that low concentrations of rare earth elements do not promote bone growth inside a 750 μm broad area around the implant. However, increased bone growth was observed at a greater distance from the degrading alloys. Clinically and histologically, the alloys and their corrosion products caused no systematic or local cytotoxicological effects. Using microtomography and in vitro experiments, we could show that the magnesium-rare earth element alloys showed low corrosion rates, both in in vitro and in vivo. The lanthanum- and cerium-containing alloys degraded at comparable rates, whereas the neodymium-containing alloy showed the lowest corrosion rates.

  9. The cyclic oxidation resistance at 1200 C of beta-NiAl, FeAl, and CoAl alloys with selected third element additions

    NASA Technical Reports Server (NTRS)

    Barrett, C. A.; Titran, R. H.

    1992-01-01

    The intermetallic compounds Beta-NiAl, FeAl, and CoAl were tested in cyclic oxidation with selected third element alloy additions. Tests in static air for 200 1-hr cycles at 1200 C indicated by specific weight change/time data and x-ray diffraction analysis that the 5 at percent alloy additions did not significantly improve the oxidation resistance over the alumina forming baseline alloys without the additions. Many of the alloy additions were actually deleterious. Ta and Nb were the only alloy additions that actually altered the nature of the oxide(s) formed and still maintained the oxidation resistance of the protective alumina scale.

  10. Photographic Atlas and Three-Dimensional Reconstruction of the Holotype Skull of Euhelopus zdanskyi with Description of Additional Cranial Elements

    PubMed Central

    Poropat, Stephen F.; Kear, Benjamin P.

    2013-01-01

    Background Euhelopus zdanskyi is one of relatively few sauropod taxa known from an almost complete skull and mandible. Recent phylogenetic analyses suggest that Euhelopus is a somphospondylan titanosauriform, and that it is a member of the clade (Euhelopodidae) which is the sister taxon to the hugely successful, dominantly Cretaceous sauropod group Titanosauria. Methodology/Principal Findings The skull elements of Euhelopus were CT scanned at Uppsala Akademiska Sjukhuset. Three-dimensional models of the elements were constructed from the DICOM data using Mimics 14.0, InVesalius 3.0, and GeoMagic Studio 2012, the skull was rearticulated in Rhinoceros 4.0, and the final version was rendered in GeoMagic Studio 2012. Conclusions/Significance The fact that relatively complete sauropod skulls are so rare in the fossil record, particularly among titanosauriforms, means that the skulls that are known should be as thoroughly described and well-illustrated as possible. This contribution supplements previous descriptions of the cranial elements of Euhelopus, one of the few euhelopodid taxa for which cranial material is known, by presenting a comprehensive photographic atlas of the skull elements to facilitate a better understanding of their morphology. We describe several elements which have been overlooked in past studies of Euhelopus, and also provide as accurate a reconstruction of the skull as possible (in the absence of the braincase), the most significant components of which are the articulations of the palate and the mandible. PMID:24278222

  11. Hx, a novel fluorescent, minor groove and sequence specific recognition element: design, synthesis, and DNA binding properties of p-anisylbenzimidazole-imidazole/pyrrole-containing polyamides.

    PubMed

    Chavda, Sameer; Liu, Yang; Babu, Balaji; Davis, Ryan; Sielaff, Alan; Ruprich, Jennifer; Westrate, Laura; Tronrud, Christopher; Ferguson, Amanda; Franks, Andrew; Tzou, Samuel; Adkins, Chandler; Rice, Toni; Mackay, Hilary; Kluza, Jerome; Tahir, Sharjeel A; Lin, Shicai; Kiakos, Konstantinos; Bruce, Chrystal D; Wilson, W David; Hartley, John A; Lee, Moses

    2011-04-19

    With the aim of incorporating a recognition element that acts as a fluorescent probe upon binding to DNA, three novel pyrrole (P) and imidazole (I)-containing polyamides were synthesized. The compounds contain a p-anisylbenzimidazolecarboxamido (Hx) moiety attached to a PP, IP, or PI unit, giving compounds HxPP (2), HxIP (3), and HxPI (4), respectively. These fluorescent hybrids were tested against their complementary nonfluorescent, non-formamido tetraamide counterparts, namely, PPPP (5), PPIP (6), and PPPI (7) (cognate sequences 5'-AAATTT-3', 5'-ATCGAT-3', and 5'-ACATGT-3', respectively). The binding affinities for both series of polyamides for their cognate and noncognate sequences were ascertained by surface plasmon resonance (SPR) studies, which revealed that the Hx-containing polyamides gave binding constants in the 10(6) M(-1) range while little binding was observed for the noncognates. The binding data were further compared to the corresponding and previously reported formamido-triamides f-PPP (8), f-PIP (9), and f-PPI (10). DNase I footprinting studies provided additional evidence that the Hx moiety behaved similarly to two consecutive pyrroles (PP found in 5-7), which also behaved like a formamido-pyrrole (f-P) unit found in distamycin and many formamido-triamides, including 8-10. The biophysical characterization of polyamides 2-7 on their binding to the abovementioned DNA sequences was determined using thermal melts (ΔT(M)), circular dichroism (CD), and isothermal titration calorimetry (ITC) studies. Density functional calculations (B3LYP) provided a theoretical framework that explains the similarity between PP and Hx on the basis of molecular electrostatic surfaces and dipole moments. Furthermore, emission studies on polyamides 2 and 3 showed that upon excitation at 322 nm binding to their respective cognate sequences resulted in an increase in fluorescence at 370 nm. These low molecular weight polyamides show promise for use as probes for monitoring

  12. Identification of a cis-acting element in the class I major histocompatibility complex gene promoter responsive to activation by retroviral sequences.

    PubMed Central

    Choi, S Y; van de Mark, K; Faller, D V

    1997-01-01

    The infection of cells with Moloney murine leukemia virus (M-MuLV) causes an increase in specific cellular gene products, including the major histocompatibility complex (MHC) class I antigens. This upregulation occurs through a transactivation process mediated by the long terminal repeat (LTR) of M-MuLV, and we show here that the gene activation response to the LTR requires at least one specific cis element within the MHC proximal promoter region. Nested deletions of MHC class I H-2Kb gene promoter sequence were subcloned into a chloramphenicol acetyltransferase (CAT) reporter vector and then transiently introduced into BALB/c-3T3 cells expressing M-MuLV or cotransfected into BALB/c-3T3 cells with a vector containing subgenomic portions of the virus, including the LTR. CAT activity assays demonstrated that a minimal H-2Kb gene promoter (-64 to +12) contained elements sufficient for this transactivation. DNase I footprinting assays located a protein-binding site in the region of -64 to -34 bp from the transcriptional start site, and point mutation analysis confirmed the location of this cis-acting element, designated the let response element (LRE), and defined a binding motif. This LRE is distinct from binding sites for currently known transcription factors in the class I MHC gene promoter and is conserved in the promoters of human and murine MHC class I genes. Mutation of the LRE resulted in dramatic reduction in both DNA-protein binding activity in electrophoretic mobility shift assay and in the ability of the mutated promoter to respond to retroviral transactivation. Addition of the LRE to a heterologous promoter conferred the ability to respond to retroviral transactivation. PMID:8995614

  13. Developmental rearrangement of cyanobacterial nif genes: nucleotide sequence, open reading frames, and cytochrome P-450 homology of the Anabaena sp. strain PCC 7120 nifD element.

    PubMed

    Lammers, P J; McLaughlin, S; Papin, S; Trujillo-Provencio, C; Ryncarz, A J

    1990-12-01

    An 11-kbp DNA element of unknown function interrupts the nifD gene in vegetative cells of Anabaena sp. strain PCC 7120. In developing heterocysts the nifD element excises from the chromosome via site-specific recombination between short repeat sequences that flank the element. The nucleotide sequence of the nifH-proximal half of the element was determined to elucidate the genetic potential of the element. Four open reading frames with the same relative orientation as the nifD element-encoded xisA gene were identified in the sequenced region. Each of the open reading frames was preceded by a reasonable ribosome-binding site and had biased codon utilization preferences consistent with low levels of expression. Open reading frame 3 was highly homologous with three cytochrome P-450 omega-hydroxylase proteins and showed regional homology to functionally significant domains common to the cytochrome P-450 superfamily. The sequence encoding open reading frame 2 was the most highly conserved portion of the sequenced region based on heterologous hybridization experiments with three genera of heterocystous cyanobacteria.

  14. Developmental rearrangement of cyanobacterial nif genes: nucleotide sequence, open reading frames, and cytochrome P-450 homology of the Anabaena sp. strain PCC 7120 nifD element.

    PubMed Central

    Lammers, P J; McLaughlin, S; Papin, S; Trujillo-Provencio, C; Ryncarz, A J

    1990-01-01

    An 11-kbp DNA element of unknown function interrupts the nifD gene in vegetative cells of Anabaena sp. strain PCC 7120. In developing heterocysts the nifD element excises from the chromosome via site-specific recombination between short repeat sequences that flank the element. The nucleotide sequence of the nifH-proximal half of the element was determined to elucidate the genetic potential of the element. Four open reading frames with the same relative orientation as the nifD element-encoded xisA gene were identified in the sequenced region. Each of the open reading frames was preceded by a reasonable ribosome-binding site and had biased codon utilization preferences consistent with low levels of expression. Open reading frame 3 was highly homologous with three cytochrome P-450 omega-hydroxylase proteins and showed regional homology to functionally significant domains common to the cytochrome P-450 superfamily. The sequence encoding open reading frame 2 was the most highly conserved portion of the sequenced region based on heterologous hybridization experiments with three genera of heterocystous cyanobacteria. Images PMID:2123860

  15. The sequential addition and migration method to generate representative volume elements for the homogenization of short fiber reinforced plastics

    NASA Astrophysics Data System (ADS)

    Schneider, Matti

    2017-02-01

    We present an algorithm for generating volume elements of short fiber reinforced plastic microstructures for prescribed fourth order fiber orientation tensor, fiber aspect ratio and solid volume fraction. The algorithm inserts fibers randomly into an existing microstructure, and removes the resulting overlap systematically based on a gradient descent method. In contrast to existing methods, large fiber aspect ratios (up to 150) and large volume fractions (60 vol% for isotropic orientation and aspect ratio of 33) can be reached. We study the effective linear elastic properties of the resulting microstructures, depending on fiber orientation, volume fraction as well as aspect ratio, and examine the size of a corresponding representative volume element.

  16. Expansion for the Brachylophosaurus canadensis Collagen I Sequence and Additional Evidence of the Preservation of Cretaceous Protein.

    PubMed

    Schroeter, Elena R; DeHart, Caroline J; Cleland, Timothy P; Zheng, Wenxia; Thomas, Paul M; Kelleher, Neil L; Bern, Marshall; Schweitzer, Mary H

    2017-02-03

    Sequence data from biomolecules such as DNA and proteins, which provide critical information for evolutionary studies, have been assumed to be forever outside the reach of dinosaur paleontology. Proteins, which are predicted to have greater longevity than DNA, have been recovered from two nonavian dinosaurs, but these results remain controversial. For proteomic data derived from extinct Mesozoic organisms to reach their greatest potential for investigating questions of phylogeny and paleobiology, it must be shown that peptide sequences can be reliably and reproducibly obtained from fossils and that fragmentary sequences for ancient proteins can be increasingly expanded. To test the hypothesis that peptides can be repeatedly detected and validated from fossil tissues many millions of years old, we applied updated extraction methodology, high-resolution mass spectrometry, and bioinformatics analyses on a Brachylophosaurus canadensis specimen (MOR 2598) from which collagen I peptides were recovered in 2009. We recovered eight peptide sequences of collagen I: two identical to peptides recovered in 2009 and six new peptides. Phylogenetic analyses place the recovered sequences within basal archosauria. When only the new sequences are considered, B. canadensis is grouped more closely to crocodylians, but when all sequences (current and those reported in 2009) are analyzed, B. canadensis is placed more closely to basal birds. The data robustly support the hypothesis of an endogenous origin for these peptides, confirm the idea that peptides can survive in specimens tens of millions of years old, and bolster the validity of the 2009 study. Furthermore, the new data expand the coverage of B. canadensis collagen I (a 33.6% increase in collagen I alpha 1 and 116.7% in alpha 2). Finally, this study demonstrates the importance of reexamining previously studied specimens with updated methods and instrumentation, as we obtained roughly the same amount of sequence data as the

  17. Representation of the quantum Fourier transform on multilevel basic elements by a sequence of selective rotation operators

    NASA Astrophysics Data System (ADS)

    Ermilov, A. S.; Zobov, V. E.

    2007-12-01

    To experimentally realize quantum computations on d-level basic elements (qudits) at d > 2, it is necessary to develop schemes for the technical realization of elementary logical operators. We have found sequences of selective rotation operators that represent the operators of the quantum Fourier transform (Walsh-Hadamard matrices) for d = 3-10. For the prime numbers 3, 5, and 7, the well-known method of linear algebra is applied, whereas, for the factorable numbers 6, 9, and 10, the representation of virtual spins is used (which we previously applied for d = 4, 8). Selective rotations can be realized, for example, by means of pulses of an RF magnetic field for systems of quadrupole nuclei or laser pulses for atoms and ions in traps.

  18. Rapid characterization of CRISPR-Cas9 protospacer adjacent motif sequence elements.

    PubMed

    Karvelis, Tautvydas; Gasiunas, Giedrius; Young, Joshua; Bigelyte, Greta; Silanskas, Arunas; Cigan, Mark; Siksnys, Virginijus

    2015-11-19

    To expand the repertoire of Cas9s available for genome targeting, we present a new in vitro method for the simultaneous examination of guide RNA and protospacer adjacent motif (PAM) requirements. The method relies on the in vitro cleavage of plasmid libraries containing a randomized PAM as a function of Cas9-guide RNA complex concentration. Using this method, we accurately reproduce the canonical PAM preferences for Streptococcus pyogenes, Streptococcus thermophilus CRISPR3 (Sth3), and CRISPR1 (Sth1). Additionally, PAM and sgRNA solutions for a novel Cas9 protein from Brevibacillus laterosporus are provided by the assay and are demonstrated to support functional activity in vitro and in plants.

  19. Sequencing of Pooled DNA Samples (Pool-Seq) Uncovers Complex Dynamics of Transposable Element Insertions in Drosophila melanogaster

    PubMed Central

    Schlötterer, Christian

    2012-01-01

    Transposable elements (TEs) are mobile genetic elements that parasitize genomes by semi-autonomously increasing their own copy number within the host genome. While TEs are important for genome evolution, appropriate methods for performing unbiased genome-wide surveys of TE variation in natural populations have been lacking. Here, we describe a novel and cost-effective approach for estimating population frequencies of TE insertions using paired-end Illumina reads from a pooled population sample. Importantly, the method treats insertions present in and absent from the reference genome identically, allowing unbiased TE population frequency estimates. We apply this method to data from a natural Drosophila melanogaster population from Portugal. Consistent with previous reports, we show that low recombining genomic regions harbor more TE insertions and maintain insertions at higher frequencies than do high recombining regions. We conservatively estimate that there are almost twice as many “novel” TE insertion sites as sites known from the reference sequence in our population sample (6,824 novel versus 3,639 reference sites, with on average a 31-fold coverage per insertion site). Different families of transposable elements show large differences in their insertion densities and population frequencies. Our analyses suggest that the history of TE activity significantly contributes to this pattern, with recently active families segregating at lower frequencies than those active in the more distant past. Finally, using our high-resolution TE abundance measurements, we identified 13 candidate positively selected TE insertions based on their high population frequencies and on low Tajima's D values in their neighborhoods. PMID:22291611

  20. Uranium hydrogeochemical and stream sediment reconnasissance of the Trinidad NTMS Quadrangle, Colorado, including concentrations of forty-two additional elements

    SciTech Connect

    Shannon, S.S. Jr.

    1980-05-01

    Uranium and other elemental data resulting from the Hydrogeochemical and Stream Sediment Reconnaissance (HSSR) of the Trinidad National Topographic Map Series (NTMS) quadrangle, Colorado, by the Los Alamos Scientific Laboratory (LASL) are reported herein. This study was conducted as part of the United States Department of Energy's National Uranium Resource Evaluation (NURE), which is designed to provide improved estimates of the availability and economics of nuclear fuel resources and to make available to industry information for use in exploration and development of uranium resources. The HSSR data will ultimately be integrated with other NURE data (e.g., airborne radiometric surveys and geological investigations) to complete the entire NURE program. This report is a supplement to the HSSR uranium evaluation report for the Trinidad quadrange (Morris et al, 1978), which presented the field and uranium data for the 1060 water and 1240 sediment samples collected from 1768 locations in the quadrangle. The earlier report contains an evaluation of the uranium concentrations of the samples as well as descriptions of the geology, hydrology, climate, and uranium occurrences of the quadrange. This supplement presents the sediment field and uranium data again and the analyses of 42 other elements in the sediments. All uranium samples were redetermined by delayed-neutron counting (DNC) when the sediment samples were analyzed for 31 elements by neutron activation. For 99.6% of the sediment samples analyzed, the differences between the uranium contents first determined (Morris et al, 1978) and the analyses reported herein are less than 10%.

  1. Asymmetric synthesis of functionalized cyclohexanes bearing five stereocenters via a one-pot organocatalytic Michael-Michael-1,2-addition sequence.

    PubMed

    Chauhan, Pankaj; Urbanietz, Gregor; Raabe, Gerhard; Enders, Dieter

    2014-07-04

    A highly stereoselective one-pot procedure involving an enantioselective Michael addition promoted by low loading of an amino-squaramide catalyst followed by an achiral base catalyzed domino Michael-Knoevenagel-type 1,2-addition sequence provides efficient access to fully substituted cyclohexanes bearing five contiguous stereogenic centers in good yields (68-86%) and excellent stereoselectivities (>30 : 1 dr and 96-99% ee).

  2. Mitochondrial genome sequence and gene order of Sipunculus nudus give additional support for an inclusion of Sipuncula into Annelida

    PubMed Central

    Mwinyi, Adina; Meyer, Achim; Bleidorn, Christoph; Lieb, Bernhard; Bartolomaeus, Thomas; Podsiadlowski, Lars

    2009-01-01

    Background Mitochondrial genomes are a valuable source of data for analysing phylogenetic relationships. Besides sequence information, mitochondrial gene order may add phylogenetically useful information, too. Sipuncula are unsegmented marine worms, traditionally placed in their own phylum. Recent molecular and morphological findings suggest a close affinity to the segmented Annelida. Results The first complete mitochondrial genome of a member of Sipuncula, Sipunculus nudus, is presented. All 37 genes characteristic for metazoan mtDNA were detected and are encoded on the same strand. The mitochondrial gene order (protein-coding and ribosomal RNA genes) resembles that of annelids, but shows several derivations so far found only in Sipuncula. Sequence based phylogenetic analysis of mitochondrial protein-coding genes results in significant bootstrap support for Annelida sensu lato, combining Annelida together with Sipuncula, Echiura, Pogonophora and Myzostomida. Conclusion The mitochondrial sequence data support a close relationship of Annelida and Sipuncula. Also the most parsimonious explanation of changes in gene order favours a derivation from the annelid gene order. These results complement findings from recent phylogenetic analyses of nuclear encoded genes as well as a report of a segmental neural patterning in Sipuncula. PMID:19149868

  3. Under-representation of repetitive sequences in whole-genome shotgun sequence databases: an illustration using a recently acquired transposable element.

    PubMed

    Koga, Akihiko

    2012-02-01

    It is widely accepted in a conceptual framework that repetitive sequences, especially those with high sequence homogeneity among copies, tend to be under-represented in whole-genome shotgun sequence databases, because of the difficulty of assembling sequence reads into contigs. Although this is easily inferred, there is no quantitative illustration of this phenomenon. An example using a currently used database is expected to contribute to the intuitive understanding of how serious the under-representation is. The present study provides the first quantitative example (in the case of 16 copies of virtually identical, 4.7-kb sequences in a genome of 7 × 10 (8) bp) by comparing the results of BLAST searches of a sequence database (contig N50; 9.8 kb) with those of Southern blot analysis of genomic DNA. This has revealed that the internal regions of the repetitive sequences are under-represented to a striking extent.

  4. Regio- and stereoselective 1,2-dihydropyridine alkylation/addition sequence for the synthesis of piperidines with quaternary centers.

    PubMed

    Duttwyler, Simon; Chen, Shuming; Lu, Colin; Mercado, Brandon Q; Bergman, Robert G; Ellman, Jonathan A

    2014-04-07

    The first example of C alkylation of 1,2-dihydropyridines with alkyl triflates and Michael acceptors was developed to introduce quaternary carbon centers with high regio- and diastereoselectivity. Hydride or carbon nucleophile addition to the resultant iminium ion also proceeded with high diastereoselectivity. Carbon nucleophile addition results in an unprecedented level of substitution to provide piperidine rings with adjacent tetrasubstituted carbon atoms.

  5. Measuring Productive Elements of Multi-Word Phrase Vocabulary Knowledge among Children with English as an Additional or Only Language

    ERIC Educational Resources Information Center

    Smith, Sara A.; Murphy, Victoria A.

    2015-01-01

    Vocabulary plays a critical role in language and reading development for children, particularly those learning English as an additional language (EAL) (Stahl & Nagy, 2006). Previous research on vocabulary has mainly focused on measuring individual words without considering multi-word phrase knowledge, despite evidence that these items occur…

  6. THE LATTICE PARAMETERS AND SOLUBILITY LIMITS OF ALPHA IRON AS AFFECTED BY SOME BINARY TRANSITION-ELEMENT ADDITIONS.

    DTIC Science & Technology

    The lattice parameters of alpha iron with binary additions of all the transition metals, except technetium, have been accurately determined on solid...samples. No direct correlation with solute size is observed, but an effect of electron configuration is noted. The solubility limits of alpha iron with

  7. Biochemical methane potential from sewage sludge: Effect of an aerobic pretreatment and fly ash addition as source of trace elements.

    PubMed

    Huiliñir, César; Pinto-Villegas, Paula; Castillo, Alejandra; Montalvo, Silvio; Guerrero, Lorna

    2017-03-18

    The effect of aerobic pretreatment and fly ash addition on the production of methane from mixed sludge is studied. Three assays with pretreated and not pretreated mixed sludge in the presence of fly ash (concentrations of 0, 10, 25, 50, 250 and 500mg/L) were run at mesophilic condition. It was found that the combined use of aerobic pretreatment and fly ash addition increases methane production up to 70% when the fly ash concentrations were lower than 50mg/L, while concentrations higher than 250mg/L cause up to 11% decrease of methane production. For the anaerobic treatment of mixed sludge without pretreatment, the fly ash improved methane generation at all the concentrations studied, with a maximum of 56%. The removal of volatile solids does not show an improvement compared to the separate use of an aerobic pre-treatment and fly ash addition. Therefore, the combined use of the aerobic pre-treatment and fly ash addition improves only the production of methane.

  8. Tardigrade workbench: comparing stress-related proteins, sequence-similar and functional protein clusters as well as RNA elements in tardigrades

    PubMed Central

    2009-01-01

    Background Tardigrades represent an animal phylum with extraordinary resistance to environmental stress. Results To gain insights into their stress-specific adaptation potential, major clusters of related and similar proteins are identified, as well as specific functional clusters delineated comparing all tardigrades and individual species (Milnesium tardigradum, Hypsibius dujardini, Echiniscus testudo, Tulinus stephaniae, Richtersius coronifer) and functional elements in tardigrade mRNAs are analysed. We find that 39.3% of the total sequences clustered in 58 clusters of more than 20 proteins. Among these are ten tardigrade specific as well as a number of stress-specific protein clusters. Tardigrade-specific functional adaptations include strong protein, DNA- and redox protection, maintenance and protein recycling. Specific regulatory elements regulate tardigrade mRNA stability such as lox P DICE elements whereas 14 other RNA elements of higher eukaryotes are not found. Further features of tardigrade specific adaption are rapidly identified by sequence and/or pattern search on the web-tool tardigrade analyzer http://waterbear.bioapps.biozentrum.uni-wuerzburg.de. The work-bench offers nucleotide pattern analysis for promotor and regulatory element detection (tardigrade specific; nrdb) as well as rapid COG search for function assignments including species-specific repositories of all analysed data. Conclusion Different protein clusters and regulatory elements implicated in tardigrade stress adaptations are analysed including unpublished tardigrade sequences. PMID:19821996

  9. Uranium hydrogeochemical and stream sediment reconnaissance of the Newcastle NTMS quadrangle, Wyoming, including concentrations of forty-two additional elements

    SciTech Connect

    Goff, S.J.; Sandoval, W.F.; Gallimore, D.L.; Talcott, C.L.; Martinez, R.G.; Minor, M.E.; Mills, C.F.

    1980-06-01

    During the summer and fall of 1977, 533 water and 1226 sediment samples were collected from 1740 locations within the 18,000 km/sup 2/ area of the Newcastle quadrangle, Wyoming. Water samples were collected from wells and springs; sediment samples were collected from stream channels and from springs. Each water sample was analyzed for uranium, and each sediment sample was analyzed for 43 elements, including uranium and thorium. Uranium concentrations in water samples range from below the detection limit of 0.02 ppB to 702.26 ppB and have a median of 1.73 ppB and a mean of 11.76 ppB. Water samples containing high uranium concentrations (>20 ppB) generally are associated with known uranium mining activity or units known to be uranium bearing. About one-third of the water samples containing high uranium concentrations were collected from locations within the Pumpkin Buttes and Turnercrest-Ross Districts. Nearly half of the water samples containing high uranium concentrations were collected from locations just west of the Monument Hill and Highland Flats-Box Creek Districts. Similar anomalous uranium concentrations in this region have been reported updip from Exxon's Highland uranium deposits. High uranium concentrations were also found associated with the Lance Creek-Old Woman Anticline District.

  10. Uranium hydrogeochemical and stream sediment reconnaissance of the Newcastle NTMS Quadrangle, Wyoming, including concentrations of forty-two additional elements

    SciTech Connect

    Goff, S.J.; Sandoval, W.F.; Gallimore, D.L.; Talcott, C.L.; Martinez, R.G.; Minor, M.E.; Mills, C.F.

    1980-06-01

    Water and sediment samples were collected and each water sample was analyzed for U, and each sediment sample was analyzed for 43 elements, including U and Th. Uranium concentrations in water samples range from below the detection limit of 0.02 ppB to 702.26 ppB and have a median of 1.73 ppB and a mean of 11.76 ppB. Water samples containing high uranium concentrations generally are associated with known uranium mining activity or units known to be uranium bearing. About one-third of the water samples containing high uranium concentrations were collected from locations within the Pumpkin Buttes and Turnercrest-Ross Districts. Nearly half of the water samples containing high uranium concentrations were collected from locations just west of the Monument Hill and Highland Flats-Box Creek Districts. Similar anomalous uranium concentrations in this region have been reported updip from Exxon's Highland uranium deposits. High uranium concentrations were also found associated with the Lance Creek-Old Woman Anticline District. Uranium concentrations in sediment samples range from 1.14 to 220.70 ppM and have a median of 3.37 ppM and a mean of 4.03 ppM. Throughout the major uranium mining districts of the Powder River Basin, sediment samples with high uranium concentrations were collected from dry streams located near wells producing water samples with high uranium concentrations. High uranium concentrations were also found associated with the Lance Creek oil field where uranium mineralization is known in the White River formation. High uranium concentrations were also found in sediment samples in areas where uranium mineralization is not known. These samples are from dry streams in areas underlain by the White River formation, the Niobrara formation, and the Pierre, Carlisle, Belle Fourche, and Mowry shales.

  11. The atomic-scale mechanism for the enhanced glass-forming-ability of a Cu-Zr based bulk metallic glass with minor element additions

    NASA Astrophysics Data System (ADS)

    Wang, Q.; Liu, C. T.; Yang, Y.; Liu, J. B.; Dong, Y. D.; Lu, J.

    2014-04-01

    It is known that the glass forming-ability (GFA) of bulk metallic glasses (BMGs) can be greatly enhanced via minor element additions. However, direct evidence has been lacking to reveal its structural origin despite different theories hitherto proposed. Through the high-resolution transmission-electron-microscopy (HRTEM) analysis, here we show that the content of local crystal-like orders increases significantly in a Cu-Zr-Al BMG after a 2-at% Y addition. Contrasting the previous studies, our current results indicate that the formation of crystal-like order at the atomic scale plays an important role in enhancing the GFA of the Cu-Zr-Al base BMG.

  12. Interplay between estrogen response element sequence and ligands controls in vivo binding of estrogen receptor to regulated genes.

    PubMed

    Krieg, Adam J; Krieg, Sacha A; Ahn, Bonnie S; Shapiro, David J

    2004-02-06

    To examine the role of the estrogen response element (ERE) sequence in binding of liganded estrogen receptor (ER) to promoters, we analyzed in vivo interaction of liganded ER with the imperfect ERE in the pS2 gene and the composite estrogen-responsive unit (ERU) in the proteinase inhibitor 9 (PI-9) gene. In transient transfections of ER-positive HepG2-ER7 cells, PI-9 was strongly induced by estrogen, moxestrol (MOX), and 4-hydroxytamoxifen (OHT). PI-9 was not induced by raloxifene or ICI 182,780. Quantitative reverse transcriptase-PCR showed that moxestrol strongly induced cellular PI-9 and pS2 mRNAs, whereas OHT moderately induced PI-9 mRNA and weakly induced pS2 mRNA. Chromatin immunoprecipitation experiments demonstrated strong and similar association of 17beta-estradiol-hERalpha and MOX-hERalpha with the PI-9 ERU and with the pS2 ERE. Binding of MOX-hERalpha to the PI-9 ERU and the pS2 ERE was rapid and continuous. Although MOX-hERalpha bound strongly to the PI-9 ERU and less well to the pS2 ERE in chromatin immunoprecipitation, gel shift assays showed that estrogen-hERalpha binds with higher affinity to the deproteinized pS2 ERE than to the PI-9 ERU. Across a broad range of OHT concentrations, OHT-hERalpha associated strongly with the pS2 ERE and weakly with the PI-9 ERU. ICI-hERalpha bound poorly to the PI-9 ERU and effectively to the pS2 ERE. Raloxifene-hERalpha and MOX-hERalpha exhibited similar binding to the PI-9 ERU and the pS2 ERE. These studies demonstrate that ER ligand and ERE sequence work together to regulate in vivo binding of ER to estrogen-responsive promoters.

  13. Dipeptide-Derived Multifunctional Quaternary Phosphonium Salt Catalyzed Asymmetric Cyclizations via a Tandem Michael Addition/SN 2 Sequence.

    PubMed

    Cao, Dongdong; Zhang, Jiaxing; Wang, Hongyu; Zhao, Gang

    2015-07-06

    A novel family of dipeptide-based multifunctional quaternary phosphonium salts has been developed as chiral phase-transfer catalysts, which feature ready accessibility and structure modularity, allowing easy fine-tunings of activity. They demonstrated high efficiency in catalyzing the tandem asymmetric Michael addition/intramolecular SN 2 reaction between 6 or 7-substituted conjugate enones and malonates, providing synthetically important five or six-membered carbocycles and heterocycles in good yields and with good to excellent enantioselectivities.

  14. An unusual antithrombin-binding heparin octasaccharide with an additional 3-O-sulfated glucosamine in the active pentasaccharide sequence.

    PubMed

    Guerrini, Marco; Elli, Stefano; Mourier, Pierre; Rudd, Timothy R; Gaudesi, Davide; Casu, Benito; Boudier, Christian; Torri, Giangiacomo; Viskov, Christian

    2013-01-15

    The 3-O-sulfation of N-sulfated glucosamine is the last event in the biosynthesis of heparin/heparan sulfate, giving rise to the antithrombin-binding pentasaccharide sequence AGA*IA, which is largely associated with the antithrombotic activity of these molecules. The aim of the present study was the structural and biochemical characterization of a previously unreported AGA*IA*-containing octasaccharide isolated from the very-low-molecular-mass heparin semuloparin, in which both glucosamine residues of the pentasaccharide moiety located at the non-reducing end bear 3-O-sulfate groups. Two-dimensional and STD (saturation transfer difference) NMR experiments clearly confirmed its structure and identified its ligand epitope binding to antithrombin. The molecular conformation of the octasaccharide-antithrombin complex has been determined by NMR experiments and docking/energy minimization. The presence of the second 3-O-sulfated glucosamine in the octasaccharide induced more than one order of magnitude increase in affinity to antithrombin compared to the pentasaccharide AGA*IA.

  15. Mechanical properties and phase composition of potential biodegradable Mg-Zn-Mn-base alloys with addition of rare earth elements

    SciTech Connect

    Stulikova, Ivana; Smola, Bohumil

    2010-10-15

    Mechanical properties and creep resistance of the MgY4Zn1Mn1 alloy in the as cast as well as in the T5 condition were compared to those of the MgCe4Zn1Mn1 alloy in the same conditions. Yield tensile stress and ultimate tensile strength of the MgY4Zn1Mn1 alloy are slightly better in the temperature range 20 deg. C-400 deg. C than these of the MgCe4Zn1Mn1 alloy. Better thermal stability of ultimate tensile strength was observed in the T5 treated MgCe4Zn1Mn1 alloy than in this material in the as cast condition. An outstanding creep resistance at 225 deg. C-350 deg. C found in the MgY4Zn1Mn1 alloy is due to the existence of the 18R long period stacking structure persisting in this alloy even a long heat treatment of 500 deg. C/32 h. No similar stacking effects happen when Ce substitutes Y in approximately the same concentration. The creep resistance deteriorates considerably in the MgCe4Zn1Mn1 alloy. Rectangular particles of the equilibrium Mg{sub 12}Ce phase dominate in the microstructure of as cast as well as of high temperature heat-treated MgCe4Zn1Mn1 alloy. A population of small oval particles containing Mg and Zn develops additionally during annealing of this alloy. These particles pin effectively dislocations and can be responsible for the better thermal stability of the T5 treated material.

  16. The Runt domain of AML1 (RUNX1) binds a sequence-conserved RNA motif that mimics a DNA element

    PubMed Central

    Fukunaga, Junichi; Nomura, Yusuke; Tanaka, Yoichiro; Amano, Ryo; Tanaka, Taku; Nakamura, Yoshikazu; Kawai, Gota; Sakamoto, Taiichi; Kozu, Tomoko

    2013-01-01

    AML1 (RUNX1) is a key transcription factor for hematopoiesis that binds to the Runt-binding double-stranded DNA element (RDE) of target genes through its N-terminal Runt domain. Aberrations in the AML1 gene are frequently found in human leukemia. To better understand AML1 and its potential utility for diagnosis and therapy, we obtained RNA aptamers that bind specifically to the AML1 Runt domain. Enzymatic probing and NMR analyses revealed that Apt1-S, which is a truncated variant of one of the aptamers, has a CACG tetraloop and two stem regions separated by an internal loop. All the isolated aptamers were found to contain the conserved sequence motif 5′-NNCCAC-3′ and 5′-GCGMGN′N′-3′ (M:A or C; N and N′ form Watson–Crick base pairs). The motif contains one AC mismatch and one base bulged out. Mutational analysis of Apt1-S showed that three guanines of the motif are important for Runt binding as are the three guanines of RDE, which are directly recognized by three arginine residues of the Runt domain. Mutational analyses of the Runt domain revealed that the amino acid residues used for Apt1-S binding were similar to those used for RDE binding. Furthermore, the aptamer competed with RDE for binding to the Runt domain in vitro. These results demonstrated that the Runt domain of the AML1 protein binds to the motif of the aptamer that mimics DNA. Our findings should provide new insights into RNA function and utility in both basic and applied sciences. PMID:23709277

  17. Effect of surfactant addition on ultrasonic leaching of trace elements from plant samples in inductively coupled plasma-atomic emission spectrometry

    NASA Astrophysics Data System (ADS)

    Borkowska-Burnecka, Jolanta; Jankowiak, Urszula; Zyrnicki, Wieslaw; Anna Wilk, Kazimiera

    2004-04-01

    The applicability of surfactants in sample preparation of plant materials followed by analysis by inductively coupled plasma atomic emission spectrometry has been examined. Reference materials (INCT-MPH-2-Mixed Polish Herbs, INCT-TL-1 black tea leaves and CTA-VTL-2 -Virginia tobacco leaves) and commercially available tea leaves were analyzed. Effects of addition surfactants (Triton X-100, didodecyldimethylammonium bromide and cetyltrimethylammonium bromide) on efficiency of ultrasonic leaching of elements from the plant samples and on plasma parameters were investigated. Low concentrations of the surfactants in solutions did not affect, in practice, analytical line intensities and the nebulization process. Quantitative recovery of some elements could be obtained by ultrasonic diluted acid leaching with the aid of surfactants. However, the element recovery depended on type of surfactant, as well as element and sample material. Plasma parameters, i.e. the excitation temperatures of Ar I, Fe II and Ca II as well as the electron number density and the Mg II/Mg I intensity ratio did not vary significantly due to the surfactants in solutions.

  18. Long-range RNA interaction of two sequence elements required for endonucleolytic cleavage of human insulin-like growth factor II mRNAs.

    PubMed Central

    Scheper, W; Meinsma, D; Holthuizen, P E; Sussenbach, J S

    1995-01-01

    Human insulin-like growth factor II (IGF-II) mRNAs are subject to site-specific endonucleolytic cleavage in the 3' untranslated region, leading to an unstable 5' cleavage product containing the IGF-II coding region and a very stable 3' cleavage product of 1.8 kb. This endonucleolytic cleavage is most probably the first and rate-limiting step in degradation of IGF-II mRNAs. Two sequence elements within the 3' untranslated region are required for cleavage: element I, located approximately 2 kb upstream of the cleavage site, and element II, encompassing the cleavage site itself. We have identified a stable double-stranded RNA stem structure (delta G = -100 kcal/mol [418.4 kJ/mol]) that can be formed between element I and a region downstream of the cleavage site in element II. This structure is conserved among human, rat, and mouse mRNAs. Detailed analysis of the requirements for cleavage shows that the relative position of the elements is not essential for cleavage. Furthermore, the distance between the coding region and the cleavage site does not affect the cleavage reaction. Mutational analysis of the long-range RNA-RNA interaction shows that not only the double-stranded character but also the sequence of the stable RNA stem is important for cleavage. PMID:7799930

  19. Recombinant albumins containing additional peptide sequences smaller than barbourin retain the ability of barbourin-albumin to inhibit platelet aggregation.

    PubMed

    Sheffield, William P; Wilson, Brianna; Eltringham-Smith, Louise J; Gataiance, Sharon; Bhakta, Varsha

    2005-05-01

    The previously described fusion protein BLAH(6) (Marques JA et al.,Thromb Haemost 2001; 86: 902-8) is a recombinant protein that combines the small disintegrin barbourin with hexahistidine-tagged rabbit serumalbumin (RSA) produced in Pichia pastoris yeast. We sought to determine: (1) if BLAH(6) was immunogenic; and (2) if its barbourin domain could be productively replaced with smaller peptides. Purified BLAH(6) was injected into rabbits, and anti-barbourin antibodies were universally detected in plasma 28 days later; BLAH(6) was, however, equally effective in reducing platelet aggregation in both naive and pre-treated rabbits. Thrombocytopenia was not observed, and complexing BLAH(6) to alpha(IIb)beta(3) had no effect on antibody detection. The barbourin moiety of BLAH(6) was replaced with each of four sequences: Pep I (VCKGDWPC); PepII (VCRGDWPC); PepIII (bar-bourin 41-54); and PepIV (LPSPGDWR). The corresponding fusion proteins were tested for their ability to inhibit ADP-induced platelet aggregation. PepIII-LAH(6) inhibited neither rabbit nor human platelets. PepI-LAH(6) and PepIV-LAH(6) inhibited rabbit platelet aggregation as effectively as BLAH(6), but PepIV-LAH(6) did not inhibit human platelet aggregation. PepI-LAH(6) and PepIILAH(6) inhibited human platelet aggregation with IC(50)s 10- and 20-fold higher than BLAH(6). Cross-immunoprecipitation assays with human platelet lysates confirmed that all proteins and peptides interacted with the platelet integrin alpha(IIb)beta(3), but with greatly varying affinities. Our results suggest that the antiplatelet activity of BLAH(6) can be retained in albumin fusion proteins in which smaller peptides replace the barbourin domain; these proteins may be less immunogenic than BLAH(6).

  20. Impact of trace element addition on degradation efficiency of volatile fatty acids, oleic acid and phenyl acetate and on microbial populations in a biogas digester.

    PubMed

    Karlsson, Anna; Einarsson, Peter; Schnürer, Anna; Sundberg, Carina; Ejlertsson, Jörgen; Svensson, Bo H

    2012-10-01

    The effect of trace element addition on anaerobic digestion of food industry- and household waste was studied using two semi-continuous lab-scale reactors, one (R30+) was supplied with Fe, Co and Ni, while the other (R30) acted as a control. Tracer analysis illustrated that methane production from acetate proceeded through syntrophic acetate oxidation (SAO) in both digesters. The effect of the trace elements was also evaluated in batch assays to determine the capacity of the microorganisms of the two digesters to degrade acetate, phenyl acetate, oleic acid or propionate, butyrate and valerate provided as a cocktail. The trace elements addition improved the performance of the process giving higher methane yields during start-up and early operation and lower levels of mainly acetate and propionate in the R30+ reactor. The batch assay showed that material from R30+ gave effects on methane production from all substrates tested. Phenyl acetate was observed to inhibit methane formation in the R30 but not in the R30+ assay. A real-time PCR analysis targeting methanogens on the order level as well as three SAO bacteria showed an increase in Methanosarcinales in the R30+ reactor over time, even though SAO continuously was the dominating pathway for methane production. Possibly, this increase explains the low VFA-levels and higher degradation rates observed in the R30+ batch incubations. These results show that the added trace elements affected the ability of the microflora to degrade VFAs as well as oleic acid and phenyl acetate in a community, where acetate utilization is dominated by SAO.

  1. Monosomy 1p36 breakpoints indicate repetitive DNA sequence elements may be involved in generating and/or stabilizing some terminal deletions.

    PubMed

    Ballif, Blake C; Gajecka, Marzena; Shaffer, Lisa G

    2004-01-01

    Monosomy 1p36 is the most commonly observed terminal deletion syndrome in humans. Our previous molecular studies on a large cohort of subjects suggest that monosomy 1p36 can result from a variety of chromosomal rearrangements including terminal truncations, interstitial deletions, derivative chromosomes, inverted duplications, and complex rearrangements. However, the mechanism(s) by which rearrangements of 1p36 are generated and/or stabilized is not understood. Sequence analysis of breakpoint junctions may provide valuable clues to the underlying mechanisms of many chromosomal aberrations. In this report, we analyze the breakpoints at the DNA-sequence level in four subjects with variable-sized deletions of 1p36. All four breakpoints fall within repetitive DNA-sequence elements (LINEs, SINEs, etc). This suggests that repetitive DNA-sequence elements may play an important role in generating and/or stabilizing terminal deletions of 1p36. Mechanisms by which repetitive elements may be involved in the process of terminal deletion formation and stabilization are discussed.

  2. Translational enhancement of H-ferritin mRNA by interleukin-1 beta acts through 5' leader sequences distinct from the iron responsive element.

    PubMed Central

    Rogers, J T; Andriotakis, J L; Lacroix, L; Durmowicz, G P; Kasschau, K D; Bridges, K R

    1994-01-01

    Interleukin-1 beta (Il-1 beta), a key cytokine in the acute phase response, elevates hepatic expression of both the heavy (H) and light (L) ferritin subunits without influencing the steady-state levels of either ferritin transcript. Transfection experiments with human hepatoma cells reveal that sequences within the 5' untranslated region (5'UTR) of H-ferritin mRNA confer translational regulation to chimaeric chloramphenicol acetyl transferase (CAT) mRNAs in response to Il-1 beta in the absence of marked changes in CAT mRNA levels. Il-1 beta dependent translational enhancement is mediated by a distinct G + C rich RNA sequence within 70 nucleotides (nt) of the start codon. The upstream Iron Responsive Element RNA stemloop does not confer increased expression to CAT mRNA in Il-1 beta stimulated hepatoma transfectants. A 38 nucleotide consensus sequence within the 5'UTRs of the mRNAs encoding the hepatic acute phase proteins alpha 1-antitrypsin (alpha 1AT), alpha 1-acid glycoprotein (AGP) and haptoglobin (Dente et al., 1985) is similar to sequences in the G + C rich H-ferritin mRNA translational regulatory element. Deletion of three nucleotides from this region of the 61 nt G + C rich element in the H-ferritin mRNA 5' leader eliminates Il-1 beta translational enhancement of the CAT reporter transcripts. Images PMID:8041631

  3. TE-Locate: A Tool to Locate and Group Transposable Element Occurrences Using Paired-End Next-Generation Sequencing Data.

    PubMed

    Platzer, Alexander; Nizhynska, Viktoria; Long, Quan

    2012-09-12

    Transposable elements (TEs) are common mobile DNA elements present in nearly all genomes. Since the movement of TEs within a genome can sometimes have phenotypic consequences, an accurate report of TE actions is desirable. To this end, we developed TE-Locate, a computational tool that uses paired-end reads to identify the novel locations of known TEs. TE-Locate can utilize either a database of TE sequences, or annotated TEs within the reference sequence of interest. This makes TE-Locate useful in the search for any mobile sequence, including retrotransposed gene copies. One major concern is to act on the correct hierarchy level, thereby avoiding an incorrect calling of a single insertion as multiple events of TEs with high sequence similarity. We used the (super)family level, but TE-Locate can also use any other level, right down to the individual transposable element. As an example of analysis with TE-Locate, we used the Swedish population in the 1,001 Arabidopsis genomes project, and presented the biological insights gained from the novel TEs, inducing the association between different TE superfamilies. The program is freely available, and the URL is provided in the end of the paper.

  4. The expression of human H2A-H2B histone gene pairs is regulated by multiple sequence elements in their joint promoters.

    PubMed

    Trappe, R; Doenecke, D; Albig, W

    1999-09-03

    The majority of human H2A and H2B histone genes are organized as gene pairs: 14 H2A-H2B gene pairs, one solitary H2A gene and three solitary H2B genes have been described. Two of the H2A genes and two of the H2B genes arranged within gene pairs are pseudogenes. The gene pairs are organized with divergent transcriptional orientation, and the coding regions of the respective H2A and H2B genes are separated by about 320 nucleotide pairs that form overlapping promoter regions. Comparison of promoters of H2A-H2B gene pairs has previously shown that these belong to two different groups (groups I and II) which are characterized by specific patterns of conserved sequence elements. We have constructed a reporter gene vector that allows the simultaneous analysis of both genes regulated by the divergent promoters belonging to group I or II, respectively. Firefly-luciferase and beta-galactosidase genes were taken as reporter genes. Site directed mutagenesis performed at individual promoter elements revealed that individual sequence elements within both groups of promoters functionally depend on each other and may contribute to a coordinate expression of paired H2A and H2B genes through assembly of their joint promoter into a mutually dependent promoter complex. Group II promoters are characterized by the presence of an E2F binding site upstream of the H2A gene-proximal TATA box. Immediately upstream of the E2F element, we have identified a highly conserved octanucleotide CACAGCTT (RT-1) that exists in all human group II H2A-H2B gene promoters. Protein binding studies at the RT-1 element indicate factor binding to this sequence. Site directed mutagenesis indicates that both the E2F element and the RT-1 motif are essential for full promoter activity.

  5. Major and trace elements documented paleoenvironmental and provenance signatures as inferred from the lacustrine sequence of Orog Nuur, southern Mongolia

    NASA Astrophysics Data System (ADS)

    Yu, Kaifeng; Lehmkuhl, Frank; Diekmann, Bernhard; Nottebaum, Veit; Stauch, Georg

    2016-04-01

    In arid realm, due to scarce of continuous terrestrial archives, lacustrine sequences were more often employed as the paleoenvironmental repository. However, there exist numerous spatial and temporal heterogeneities concerning existing studied sites. In the Gobi Desert of southern Mongolia, only two records i.e., Bayan Tohomin Nuur and Ulaan Nuur, were previously reported, neither of them, however, provided records older than ~15 ka. A record that spans longer time period is therefore indispensable to better understand the thermal and hydrologic pattern and their driving mechanisms. Among the suite of the multidisciplinary studies on lacustrine archive, geochemistry appears most likely the promising tool to decipher the interplay between the environmental change, source lithotype and sediment bulk-composition. Considering the late Quaternary lacustrine sediments, the bulk-geochemistry may be controlled by source terranes, authigenic or allothigenic input, which can be altered by the past environment conditions. Knowledge of the bulk-geochemistry downcore variance along with the field investigation and carefully examined geologic mapping will thereby allow us to gain a better understanding of the climate-induced provenance changes throughout the deposition process. On the other hand, surveys considering the bulk-geochemistry and corresponding environmental interpretations in the pelagic realm have been systematically conducted and reviewed, while their counterpart explanations in the lacustrine sediments still need more investigations. Two parallel cores (ONW I, 6.00 m; ONW II, 13.36 m) was retrieved from Orog Nuur, Gobi Desert of southern Mongolia. A suite of high resolution element abundances were examined based on core ONW II in an attempt to gain a better understanding of the paleoenvironment and provenance history of the catchment system over the last ~50 ka. Due to the predominant clay or silty-clay fractions in the lacustrine sediments, Al and Si display

  6. Effects of TiO2 and Co2O3 combination additions on the elemental distribution and electromagnetic properties of Mn-Zn power ferrites

    NASA Astrophysics Data System (ADS)

    Yang, W. D.; Wang, Y. G.

    2015-06-01

    The effects of TiO2 and Co2O3 combination additions on the elemental distribution and electromagnetic properties of Mn-Zn power ferrites are investigated. TiO2 addition can promote Co2O3 transfer from grain boundaries to the bulk of the grains. The temperature at which the highest initial permeability μi and the lowest power losses PL appear shifts to low temperature range with the increase of Co2O3 content. Compared with the reference sample without TiO2 and Co2O3 addition, the microstructure and electromagnetic properties of Mn-Zn power ferrites can be considerably improved with suitable amounts of TiO2 and Co2O3 combination additions. At the peak temperature, the sample with the 0.1 wt% TiO2 and 0.08 wt% Co2O3 additions has an increase of 15.8% in μi to 3951, and a decrease of 22.9% in PL to 286 kW/m3. The saturation magnetic induction Bs and electrical resistivity ρ at 25 °C reach the highest values of 532 mT and 8.12 Ω m, respectively.

  7. Structural and functional characterization of a transcription-enhancing sequence element in the rbcL gene of the Chlamydomonas chloroplast genome.

    PubMed

    Anthonisen, Inger Lill; Kasai, Seitaro; Kato, Ko; Salvador, Maria Luisa; Klein, Uwe

    2002-08-01

    The structure and function of a transcription-enhancing sequence element in the coding region of the Chlamydomonas reinhardtii rbcL gene was analyzed in Chlamydomonas chloroplast transformants in vivo. The enhancer sequence is contained within a DNA segment extending from position +108 to position +143, relative to the start site of rbcL gene transcription. The sequence remains functional when inverted or when placed 34 bp closer to or 87 bp further downstream of the basic rbcL promoter. However, it does not function from a site about 250 bp downstream of its original location. Besides promoting transcription initiation from the rbcL promoter, the element is able to augment transcription from the promoter of the Chlamydomonas chloroplast atpB gene, but has an inhibitory effect on transcription from the promoter of the chloroplast ribosomal RNA genes. The results suggest that the enhancer-like sequence acts upon transcription initiation in a position-specific and promoter type-specific manner.

  8. High-frequency transposition of IS1373, the insertion sequence delimiting the amplifiable element AUD2 of Streptomyces lividans.

    PubMed Central

    Volff, J N; Altenbuchner, J

    1997-01-01

    IS1373 is the putative insertion sequence delimiting the amplifiable unit AUD2 of Streptomyces lividans. Two IS1373-derived thiostrepton-resistant transposons, Tn5492 and Tn5494, transposed into multiple sites of the S. lividans chromosome at frequencies as high as 0.4 and 1%, respectively. Hence, IS1373 is a functional insertion sequence and its unique open reading frame, insA, encodes the transposase. PMID:9287031

  9. Influence of pH, soil humic/fulvic acid, ionic strength, foreign ions and addition sequences on adsorption of Pb(II) onto GMZ bentonite.

    PubMed

    Wang, Suowei; Hu, Jun; Li, Jiaxing; Dong, Yunhui

    2009-08-15

    This work contributed to the adsorption of Pb(II) onto GMZ bentonite in the absence and presence of soil humic acid (HA)/fulvic acid (FA) using a batch technique. The influences of pH from 2 to 12, ionic strengths from 0.004M to 0.05M NaNO(3), soil HA/FA concentrations from 1.6 mg/L to 20mg/L, foreign cations (Li+, Na+, K+), anions (Cl(-), NO(3)(-)), and addition sequences on the adsorption of Pb(II) onto GMZ bentonite were tested. The adsorption isotherms of Pb(II) were determined at pH 3.6+/-0.1 and simulated with the Langmuir, Freundlich, and D-R adsorption models, respectively. The results demonstrated that the adsorption of Pb(II) onto GMZ bentonite increased with increasing pH from 2 to 6. HA was shown to enhance Pb(II) adsorption at low pH, but to reduce Pb(II) adsorption at high pH, whereas FA was shown to decrease Pb(II) adsorption at pH from 2 to 11. The results also demonstrated that the adsorption was strongly dependent on ionic strength and slightly dependent on the concentration of HA/FA. The adsorption of Pb(II) onto GMZ bentonite was dependent on foreign ions in solution. The addition sequences of bentonite/Pb(II)/HA had no effect on the adsorption of Pb(II).

  10. The use of additive and subtractive approaches to examine the nuclear localization sequence of the polyomavirus major capsid protein VP1

    NASA Technical Reports Server (NTRS)

    Chang, D.; Haynes, J. I. 2nd; Brady, J. N.; Consigli, R. A.; Spooner, B. S. (Principal Investigator)

    1992-01-01

    A nuclear localization signal (NLS) has been identified in the N-terminal (Ala1-Pro-Lys-Arg-Lys-Ser-Gly-Val-Ser-Lys-Cys11) amino acid sequence of the polyomavirus major capsid protein VP1. The importance of this amino acid sequence for nuclear transport of VP1 protein was demonstrated by a genetic "subtractive" study using the constructs pSG5VP1 (full-length VP1) and pSG5 delta 5'VP1 (truncated VP1, lacking amino acids Ala1-Cys11). These constructs were used to transfect COS-7 cells, and expression and intracellular localization of the VP1 protein was visualized by indirect immunofluorescence. These studies revealed that the full-length VP1 was expressed and localized in the nucleus, while the truncated VP1 protein was localized in the cytoplasm and not transported to the nucleus. These findings were substantiated by an "additive" approach using FITC-labeled conjugates of synthetic peptides homologous to the NLS of VP1 cross-linked to bovine serum albumin or immunoglobulin G. Both conjugates localized in the nucleus after microinjection into the cytoplasm of 3T6 cells. The importance of individual amino acids found in the basic sequence (Lys3-Arg-Lys5) of the NLS was also investigated. This was accomplished by synthesizing three additional peptides in which lysine-3 was substituted with threonine, arginine-4 was substituted with threonine, or lysine-5 was substituted with threonine. It was found that lysine-3 was crucial for nuclear transport, since substitution of this amino acid with threonine prevented nuclear localization of the microinjected, FITC-labeled conjugate.

  11. In Vivo Addition of Poly(A) Tail and AU-Rich Sequences to the 3′ Terminus of the Sindbis Virus RNA Genome: a Novel 3′-End Repair Pathway

    PubMed Central

    Raju, Ramaswamy; Hajjou, Mustapha; Hill, Kristie R.; Botta, Vandana; Botta, Sisir

    1999-01-01

    Alphaviruses are mosquito-transmitted RNA viruses that cause important diseases in both humans and livestock. Sindbis virus (SIN), the type species of the alphavirus genus, carries a 11.7-kb positive-sense RNA genome which is capped at its 5′ end and polyadenylated at its 3′ end. The 3′ nontranslated region (3′NTR) of the SIN genome carries many AU-rich motifs, including a 19-nucleotide (nt) conserved element (3′CSE) and a poly(A) tail. This 3′CSE and the adjoining poly(A) tail are believed to regulate the synthesis of negative-sense RNA and genome replication in vivo. We have recently demonstrated that the SIN genome lacking the poly(A) tail was infectious and that de novo polyadenylation could occur in vivo (K. R. Hill, M. Hajjou, J. Hu, and R. Raju, J. Virol. 71:2693–2704, 1997). Here, we demonstrate that the 3′-terminal 29-nt region of the SIN genome carries a signal for possible cytoplasmic polyadenylation. To further investigate the polyadenylation signals within the 3′NTR, we generated a battery of mutant genomes with mutations in the 3′NTR and tested their ability to generate infectious virus and undergo 3′ polyadenylation in vivo. Engineered SIN genomes with terminal deletions within the 19-nt 3′CSE were infectious and regained their poly(A) tail. Also, a SIN genome carrying the poly(A) tail but lacking a part or the entire 19-nt 3′CSE was also infectious. Sequence analysis of viruses generated from these engineered SIN genomes demonstrated the addition of a variety of AU-rich sequence motifs just adjacent to the poly(A) tail. The addition of AU-rich motifs to the mutant SIN genomes appears to require the presence of a significant portion of the 3′NTR. These results indicate the ability of alphavirus RNAs to undergo 3′ repair and the existence of a pathway for the addition of AU-rich sequences and a poly(A) tail to their 3′ end in the infected host cell. Most importantly, these results indicate the ability of alphavirus

  12. An AU-rich element in the 3{prime} untranslated region of the spinach chloroplast petD gene participates in sequence-specific RNA-protein complex formation

    SciTech Connect

    Chen, Qiuyun; Adams, C.C.; Usack, L.

    1995-04-01

    In chloroplasts, the 3{prime} untranslated regions of most mRNAs contain a stem-loop-forming inverted repeat (IR) sequence that is required for mRNA stability and correct 3{prime}-end formation. The IR regions of several mRNAs are also known to bind chloroplast proteins, as judged from in vitro gel mobility shift and UV cross-linking assays, and these RNA-protein interactions may be involved in the regulation of chloroplast mRNA processing and/or stability. Here we describe in detail the RNA and protein components that are involved in 3{prime} IR-containing RNA (3{prime} IR-RNA)-protein complex formation for the spinach chloroplast petD gene, which encodes subunit IV of the cytochrome b{sub 6}/f complex. We show that the complex contains 55-, 41-, and 29-kDa RNA-binding proteins (ribonucleoproteins [RNPs]). These proteins together protect a 90-nucleotide segment of RNA from RNase T{sub 1} digestion; this RNA contains the IR and downstream flanking sequences. Competition experiments using 3{prime} IR-RNAs from the psbA or rbcL gene demonstrate that the RNPs have a strong specificity for the petD sequence. Site-directed mutagenesis was carried out to define the RNA sequence elements required for complex formation. These studies identified an 8-nucleotide AU-rich sequence downstream of the IR; mutations within this sequence had moderate to severe effects on RNA-protein complex formation. Although other similar sequences are present in the petD 3{prime} untranslated region, only a single copy, which we have termed box II, appears to be essential for in vivo protein binding. In addition, the IR itself is necessary for optimal complex formation. These two sequence elements together with an RNP complex may direct correct 3{prime}-end processing and/or influence the stability of petD mRNA in chloroplasts. 48 refs., 9 figs., 2 tabs.

  13. MOLYBDENUM, RUTHENIUM, AND THE HEAVY r-PROCESS ELEMENTS IN MODERATELY METAL-POOR MAIN-SEQUENCE TURNOFF STARS

    SciTech Connect

    Peterson, Ruth C.

    2013-05-01

    The ratios of elemental abundances observed in metal-poor stars of the Galactic halo provide a unique present-day record of the nucleosynthesis products of its earliest stars. While the heaviest elements were synthesized by the r- and s-processes, dominant production mechanisms of light trans-ironic elements were obscure until recently. This work investigates further our 2011 conclusion that the low-entropy regime of a high-entropy wind (HEW) produced molybdenum and ruthenium in two moderately metal-poor turnoff stars that showed extreme overabundances of those elements with respect to iron. Only a few, rare nucleosynthesis events may have been involved. Here we determine abundances for Mo, Ru, and other trans-Fe elements for 28 similar stars by matching spectral calculations to well-exposed near-UV Keck HIRES spectra obtained for beryllium abundances. In each of the 26 turnoff stars with Mo or Ru line detections and no evidence for s-process production (therefore old), we find Mo and Ru to be three to six times overabundant. In contrast, the maximum overabundance is reduced to factors of three and two for the neighboring elements zirconium and palladium. Since the overproduction peaks sharply at Mo and Ru, a low-entropy HEW is confirmed as its origin. The overabundance level of the heavy r-process elements varies significantly, from none to a factor of four, but is uncorrelated with Mo and Ru overabundances. Despite their moderate metallicity, stars in this group trace the products of different nucleosynthetic events: possibly very few events, possibly events whose output depended on environment, metallicity, or time.

  14. Isolation and characterization of insertion sequence elements from gram-negative bacteria by using new broad-host-range, positive selection vectors.

    PubMed Central

    Simon, R; Hötte, B; Klauke, B; Kosier, B

    1991-01-01

    On the basis of an RSF1010-derived broad-host-range vector, three different systems which enable positive detection and isolation of insertion sequence (IS) elements from gram-negative bacteria were constructed. Vectors pSUP104-pheS, pSUP104-rpsL, and pSUP104-sac were used successfully in a number of Rhizobium strains and in Xanthomonas campestris. More than 20 different IS elements were isolated and characterized. The 16 IS elements from Rhizobium meliloti were further used to characterize various R. meliloti strains by hybridization. The resulting hybridization patterns were different for every strain and gave a clear and definite IS fingerprint of each strain. These IS fingerprints can be used to identify and characterize R. meliloti strains rapidly and unequivocally, as they proved to be relatively stable. Some of the IS elements were found to be identical when the IS fingerprints from a given strain were compared. This method of IS fingerprinting can also establish whether IS elements are the same, related, or different. Images PMID:1847366

  15. Influence of ternary addition of transition elements (Cr, Si and Mn) on the microstructure and magnetic properties of nano-structured CuCo alloy

    NASA Astrophysics Data System (ADS)

    Mondal, B. N.; Chabri, S.; Basumallick, A.; Chattopadhyay, P. P.

    2012-09-01

    The current state of studies presents the effect of ternary addition of transition elements such as Mn, Cr and Si (10 wt%) on the mechanically driven non-equilibrium solubility of 40 wt% Co containing Cu-Co alloy. X-ray powder diffraction analysis indicates that addition of Mn has been found to be the most effective in enhancing the solubility and formation of a complete solid solution between Co and Cu in a short duration (30 h) of ball milling. The microstructure of the ball milled CuCoMn alloy was found to be stable after the isothermal annealing up to a temperature of 450 °C for 1 h. The magnetic properties such as magnetic saturation, coercivity and remanence of ball milled CuCo alloy in the presence of Mn significantly altered after annealing in the temperature range 350-650 °C for 1 h. The best combination of magnetic properties of CuCoMn alloy has been found after annealing at 550 °C for 1 h.

  16. Negative regulation of P element excision by the somatic product and terminal sequences of P in drosophila melanogaster

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A transient in vivo P element excision assay was used to test the regulatory properties of putative repressor-encoding plasmids in Drosophila melanogaster embryos. The somatic expression of an unmodified transposase transcription unit under the control of a heat shock gene promoter (phsn) effectivel...

  17. The dependence of Ig class-switching on the nuclear export sequence of AID likely reflects interaction with factors additional to Crm1 exportin.

    PubMed

    Ellyard, Julia I; Benk, Amelie S; Taylor, Benjamin; Rada, Cristina; Neuberger, Michael S

    2011-02-01

    Activation-induced deaminase (AID) is a B lymphocyte-specific DNA deaminase that triggers Ig class-switch recombination (CSR) and somatic hypermutation. It shuttles between cytoplasm and nucleus, containing a nuclear export sequence (NES) at its carboxyterminus. Intriguingly, the precise nature of this NES is critical to AID's function in CSR, though not in somatic hypermutation. Many alterations to the NES, while preserving its nuclear export function, destroy CSR ability. We have previously speculated that AID's ability to potentiate CSR may critically depend on the affinity of interaction between its NES and Crm1 exportin. Here, however, by comparing multiple AID NES mutants, we find that - beyond a requirement for threshold Crm1 binding - there is little correlation between CSR and Crm1 binding affinity. The results suggest that CSR, as well as the stabilisation of AID, depend on an interaction between the AID C-terminal decapeptide and factor(s) additional to Crm1.

  18. Re-sequencing of the APOL1-APOL4 and MYH9 gene regions in African Americans does not identify additional risks for CKD progression

    PubMed Central

    Hawkins, Gregory A.; Friedman, David J.; Lu, Lingyi; McWilliams, David R.; Chou, Jeff W.; Sajuthi, Satria; Divers, Jasmin; Parekh, Rulan; Li, Man; Genovese, Giulio; Pollak, Martin R.; Hicks, Pamela J.; Bowden, Donald W.; Ma, Lijun; Freedman, Barry I.; Langefeld, Carl D.

    2015-01-01

    Background APOL1 G1 and G2 nephropathy risk variants are associated with non-diabetic end-stage kidney disease (ESKD) in African Americans (AAs) in an autosomal recessive pattern. Additional risk and protective genetic variants may be present near the APOL1 loci since earlier age ESKD is observed in some AAs with one APOL1 renal-risk variant and because the adjacent gene MYH9 is associated with nephropathy in populations lacking G1 and G2 variants. Methods Re-sequencing was performed across a ~275 kb region encompassing the APOL1-APOL4 and MYH9 genes in 154 AA cases with non-diabetic ESKD and 38 controls without nephropathy who were heterozygous for a single APOL1 G1 or G2 risk variant. Results Sequencing identified 3246 non-coding single nucleotide polymorphisms (SNPs), 55 coding SNPs, and 246 insertion/deletions (InDels). No new coding variations were identified. Eleven variants, including a rare APOL3 Gln58Ter null variant (rs11089781), were genotyped in a replication panel of 1571 AA ESKD cases and 1334 controls. After adjusting for APOL1 G1 and G2 risk effects, these variations were not significantly associated with ESKD. In subjects with <2 APOL1 G1 and/or G2 alleles (849 cases; 1139 controls), the APOL3 null variant was nominally associated with ESKD (recessive model, OR 1.81; p=0.026); however, analysis in 807 AA cases and 634 controls from the Family Investigation of Nephropathy and Diabetes (FIND) did not replicate this association. Conclusion Additional common variants in the APOL1-APOL4-MYH9 region do not contribute significantly to ESKD risk beyond the APOL1 G1 and G2 alleles. PMID:26343748

  19. The influence of Citrosept addition to drinking water and Scutellaria baicalensis root extract on the content of selected mineral elements in the blood plasma of turkey hens.

    PubMed

    Rusinek-Prystupa, Elżbieta; Lechowski, Jerzy; Zukiewicz-Sobczak, Wioletta; Sobczak, Paweł; Zawiślak, Kazimierz

    2014-01-01

    The aim of this research work was to indicate the influence of Citrosept preparation and Scutellaria baicalensis root extract, administered per os to growing turkey hens in 3 different dosages, on the content of selected mineral elements in blood plasma of slaughter turkey hens. An attempt was also made to specify the most effective dosage of the applied preparations with the highest efficiency as regards increased levels of examined macro- and microelements in the birds' blood. The research experiment was conducted on 315 turkey hens randomly divided into seven groups, each consisting of 45 turkey hens. Group K constituted the control group without experimental additions of the above-mentioned preparations. When it comes to turkey hens which belonged to groups II-IV, Citrosept preparation was instilled to water in the following dosages: Group II - 0.011 ml/kg of bm; Group III - 0.021 ml/kg of bm; Group IV - 0.042 ml/kg bm. For birds which belonged to groups V-VII preparation, which was Scutellaria baicalensis root extract, was instilled to water in the following dosages: Group V - 0.009 ml/kg of bm; Group VI - 0.018 ml/kg of bm, Group VII - 0.036 ml/kg bm. In the examined plant extracts and blood plasma of the birds the levels of Na, K, Ca, Mg, Cu, Zn, and Fe were identified. The use of examined extracts influenced the changes in the levels of all tested elements in slaughter turkey hens' blood plasma. An upward tendency was recorded which regarded the level of calcium and magnesium, and a downward tendency of sodium, potassium, copper, zinc, and iron in relation to the results achieved in the control group.

  20. Intercalation of XR5944 with the estrogen response element is modulated by the tri-nucleotide spacer sequence between half-sites.

    PubMed

    Sidell, Neil; Mathad, Raveendra I; Shu, Feng-jue; Zhang, Zhenjiang; Kallen, Caleb B; Yang, Danzhou

    2011-04-01

    DNA-intercalating molecules can impair DNA replication, DNA repair, and gene transcription. We previously demonstrated that XR5944, a DNA bis-intercalator, specifically blocks binding of estrogen receptor-α (ERα) to the consensus estrogen response element (ERE). The consensus ERE sequence is AGGTCAnnnTGACCT, where nnn is known as the tri-nucleotide spacer. Recent work has shown that the tri-nucleotide spacer can modulate ERα-ERE binding affinity and ligand-mediated transcriptional responses. To further understand the mechanism by which XR5944 inhibits ERα-ERE binding, we tested its ability to interact with consensus EREs with variable tri-nucleotide spacer sequences and with natural but non-consensus ERE sequences using one dimensional nuclear magnetic resonance (1D (1)H NMR) titration studies. We found that the tri-nucleotide spacer sequence significantly modulates the binding of XR5944 to EREs. Of the sequences that were tested, EREs with CGG and AGG spacers showed the best binding specificity with XR5944, while those spaced with TTT demonstrated the least specific binding. The binding stoichiometry of XR5944 with EREs was 2:1, which can explain why the spacer influences the drug-DNA interaction; each XR5944 spans four nucleotides (including portions of the spacer) when intercalating with DNA. To validate our NMR results, we conducted functional studies using reporter constructs containing consensus EREs with tri-nucleotide spacers CGG, CTG, and TTT. Results of reporter assays in MCF-7 cells indicated that XR5944 was significantly more potent in inhibiting the activity of CGG- than TTT-spaced EREs, consistent with our NMR results. Taken together, these findings predict that the anti-estrogenic effects of XR5944 will depend not only on ERE half-site composition but also on the tri-nucleotide spacer sequence of EREs located in the promoters of estrogen-responsive genes.

  1. Effects of disruption of the nucleotide pattern in CRID element and Kozak sequence of interferon β on mRNA stability and protein production.

    PubMed

    Kay, Maryam; Hojati, Zohreh; Heidari, Maryam; Bazi, Zahra; Korbekandi, Hassan

    2015-01-01

    Interferon β (IFNβ) is the most important drug that has been used frequently for multiple sclerosis treatment. This study has tried to improve the IFNβ production by introducing mutations in the coding region of IFNβ, while its amino acid sequence is intact. Two recombinant vectors IFNβ(K) and IFNβ(K+CRID )were designed by site-directed mutagenesis. The IFNβ(K) and IFNβ(K+CRID) have two substitutions in Kozak sequence and four substitutions in CRID sequence, respectively. The Chinese hamster ovary (CHO) cell codon usage optimization was also performed for both of them. They were transiently transfected to CHO-dhfr(-) cell line using Lipofectamine kit (Invitrogen, Grand Island, NY). The amount of mRNA and protein was determined by real time PCR and ELISA. The results of this study indicate that the amount of IFNβ protein produced by CHO cells containing IFNβ(K) has been elevated up to 3.5-fold. On the other hand, enormous amounts of IFNβ mRNA and protein were produced by cells containing IFNβ(K+CRID) construct; more than 4.6-fold and 6-fold, respectively. It could be concluded that disruption of AT pattern in CRID element increase RNA and protein production, improve IFNβ mRNA stability and, may also enhance mRNA half-life. In a similar way, more proteins are produced by modification of Kozak sequence.

  2. Strategies for Development of Functionally Equivalent Promoters with Minimum Sequence Homology for Transgene Expression in Plants: cis-Elements in a Novel DNA Context versus Domain Swapping1

    PubMed Central

    Bhullar, Simran; Chakravarthy, Suma; Advani, Sonia; Datta, Sudipta; Pental, Deepak; Burma, Pradeep Kumar

    2003-01-01

    The cauliflower mosaic virus 35S (35S) promoter has been extensively used for the constitutive expression of transgenes in dicotyledonous plants. The repetitive use of the same promoter is known to induce transgene inactivation due to promoter homology. As a way to circumvent this problem, we tested two different strategies for the development of synthetic promoters that are functionally equivalent but have a minimum sequence homology. Such promoters can be generated by (a) introducing known cis-elements in a novel or synthetic stretch of DNA or (b) “domain swapping,” wherein domains of one promoter can be replaced with functionally equivalent domains from other heterologous promoters. We evaluated the two strategies for promoter modifications using domain A (consisting of minimal promoter and subdomain A1) of the 35S promoter as a model. A set of modified 35S promoters were developed whose strength was compared with the 35S promoter per se using β-glucuronidase as the reporter gene. Analysis of the expression of the reporter gene in transient assay system showed that domain swapping led to a significant fall in promoter activity. In contrast, promoters developed by placing cis-elements in a novel DNA context showed levels of expression comparable with that of the 35S. Two promoter constructs Mod2A1T and Mod3A1T were then designed by placing the core sequences of minimal promoter and subdomain A1 in divergent DNA sequences. Transgenics developed in tobacco (Nicotiana tabacum) with the two constructs and with 35S as control were used to assess the promoter activity in different tissues of primary transformants. Mod2A1T and Mod3A1T were found to be active in all of the tissues tested, at levels comparable with that of 35S. Further, the expression of the Mod2A1T promoter in the seedlings of the T1 generation was also similar to that of the 35S promoter. The present strategy opens up the possibility of creating a set of synthetic promoters with minimum sequence

  3. Influencing the arc and the mechanical properties of the weld metal in GMA-welding processes by additive elements on the wire electrode surface

    NASA Astrophysics Data System (ADS)

    Wesling, V.; Schram, A.; Müller, T.; Treutler, K.

    2016-03-01

    Under the premise of an increasing scarcity of raw materials and increasing demands on construction materials, the mechanical properties of steels and its joints are gaining highly important. In particular high- and highest-strength steels are getting in the focus of the research and the manufacturing industry. To the same extent, the requirements for filler metals are increasing as well. At present, these low-alloy materials are protected by a copper coating (<1μm) against corrosion. In addition, the coating realizes a good ohmic contact and good sliding properties between the welding machine and the wire during the welding process. By exchanging the copper with other elements it should be possible to change the mechanical properties of the weld metal and the arc stability during gas metal arc welding processes and keep the basic functions of the coating nearly untouched. On a laboratory scale solid wire electrodes with coatings of various elements and compounds such as titanium oxide were made and processed with a Gas Metal Arc Welding process. During the processing a different process behavior between the wire electrodes, coated and original, could be observed. The influences ranges from greater/shorter arc-length over increasing/decreasing droplets to larger/smaller arc foot point. Furthermore, the weld metal of the coated electrodes has significantly different mechanical and technological characteristics as the weld metal from the copper coated ground wire. The yield strength and tensile strength can be increased by up to 50%. In addition, the chemical composition of the weld metal was influenced by the application of coatings with layer thicknesses to 15 microns in the lower percentage range (up to about 3%). Another effect of the coating is a modified penetration. The normally occurring “argon finger” can be suppressed or enhanced by the choice of the coating. With the help of the presented studies it will be shown that Gas Metal Arc Welding processes

  4. Grain refinement in heavy rare earth element-free sintered Nd–Fe–B magnets by addition of a small amount of molybdenum

    SciTech Connect

    Kim, Jin Woo; Lee, Won Suk; Byun, Jong Min; Kim, Young Do; Kim, Se Hoon

    2015-05-07

    We employed a modified refractory-metal-addition method to achieve higher coercivity and remanence in heavy rare earth element (HREE)-free Nd–Fe–B sintered magnets. This process involved inducing the formation of a homogeneous secondary phase at the grain boundaries during sintering, making it possible to control the intergrain diffusion by adding small amounts of Mo, a refractory metal. To control the microstructure of the secondary phase effectively, a metal organic compound of the refractory metal was coated on the surfaces of the particles of an HREE-free Nd–Fe–B powder. The average grain size after this process was 5.60 μm, which was approximately 1.8 μm smaller than that of the HREE-free sintered Nd–Fe–B magnets (7.4 μm). The coercivity of the magnets prepared through this process could be increased from 11.88 kOe to 13.91 kOe without decreasing their remanence.

  5. Additive Promotion of Viral Internal Ribosome Entry Site-Mediated Translation by Far Upstream Element-Binding Protein 1 and an Enterovirus 71-Induced Cleavage Product

    PubMed Central

    Hung, Chuan-Tien; Kung, Yu-An; Li, Mei-Ling; Lee, Kuo-Ming; Liu, Shih-Tung; Shih, Shin-Ru

    2016-01-01

    The 5' untranslated region (5' UTR) of the enterovirus 71 (EV71) RNA genome contains an internal ribosome entry site (IRES) that is indispensable for viral protein translation. Due to the limited coding capacity of their RNA genomes, EV71 and other picornaviruses typically recruit host factors, known as IRES trans-acting factors (ITAFs), to mediate IRES-dependent translation. Here, we show that EV71 viral proteinase 2A is capable of cleaving far upstream element-binding protein 1 (FBP1), a positive ITAF that directly binds to the EV71 5' UTR linker region to promote viral IRES-driven translation. The cleavage occurs at the Gly-371 residue of FBP1 during the EV71 infection process, and this generates a functional cleavage product, FBP11-371. Interestingly, the cleavage product acts to promote viral IRES activity. Footprinting analysis and gel mobility shift assay results showed that FBP11-371 similarly binds to the EV71 5' UTR linker region, but at a different site from full-length FBP1; moreover, FBP1 and FBP11-371 were found to act additively to promote IRES-mediated translation and virus yield. Our findings expand the current understanding of virus-host interactions with regard to viral recruitment and modulation of ITAFs, and provide new insights into translational control during viral infection. PMID:27780225

  6. Effects of Al Content and Addition of Third Element on Fabrication of Ti-Al Intermetallic Coatings by Heat Treatment of Warm-Sprayed Precursors

    NASA Astrophysics Data System (ADS)

    Sienkiewicz, J.; Kuroda, S.; Minagawa, K.; Murakami, H.; Araki, H.; Kurzydłowski, K. J.

    2015-06-01

    Four powder mixtures of titanium and aluminum with 50:50, 40:60, 30:70, and 20:80 atomic ratios were used as feedstock for Warm Spray process to produce composite coatings. A two-stage heat treatment at 600 and 1000 °C was applied to the deposits in order to obtain titanium aluminide intermetallic phases. The microstructure, chemical, and phase composition of the as-deposited and heat-treated coatings were investigated using SEM, EDS, and XRD. It was found that the Al content affects on the thickness expansion of the heat-treated Ti-Al coatings significantly and also has a major influence on the porosity development, which is caused by the Kirkendall effect. The effects of adding a third element Si and heat treatment with pressure to produce denser Ti-Al intermetallic coating were also examined. The investigated hot-pressed coatings with addition of Si exhibited much denser microstructure and contained Ti-Al intermetallic phases with titanium silicide precipitates.

  7. Transcriptional promoter and enhancer elements in the long terminal repeats (LTR) of endogenous murine leukemia virus (MuLV)-related proviral sequences

    SciTech Connect

    Ch'ang, L.Y.; Myer, F.E.; Yang, D.M.; Koh, C.K.; Yang, W.K.

    1987-05-01

    Mouse genome harbors 2 families of MuLV-related proviral sequences, which do not directly produce infectious virus, but may express RNA transcripts in a tissue-specific manner. The LTRS of MuLV-related sequences contain a mid-U3 inserted segment (IS) of approx. 200 bp not found in the LTR of infectious MuLVs. To test for the LTR promoter and enhancer activities, chloramphenicol acetyltransferase (CAT) gene, alone or carrying SV40 promoter, was linked to various LTR sequences of 2 MuLV and 6 representative MuLV-related DNA clones and the recombinant genes were examined for transient CAT expression in mouse NIH-3T3, mink CCL64 and human HT1080 cells by DNA transfection. While the CAT expression was high with the 2 ecotropic MuLV LTRs, very little to undetectable activities were obtained with all MuLV-related LTRs. To determine the basis for the very low activity of the MuLV-related LTRs, series of experiments were performed, which indicate that the TATA- and CCAAC-containing domain, downstream of the IS, is functionally intact as a promoter and that the IS sequences, while inactive as a promoter by itself, could provide a bi-directional enhancer-like activity to its own or MuLV LTR or SV40 promoter. Further studies suggest the presence of a cis-acting negative regulatory element in sequences upstream of the IS in both the 2 subfamilies of MuLV-related LTRs.

  8. Sphene and zircon in the Highland Range volcanic sequence (Miocene, southern Nevada, USA): Elemental partitioning, phase relations, and influence on evolution of silicic magma

    USGS Publications Warehouse

    Colombini, L.L.; Miller, C.F.; Gualda, G.A.R.; Wooden, J.L.; Miller, J.S.

    2011-01-01

    Sphene is prominent in Miocene plutonic rocks ranging from diorite to granite in southern Nevada, USA, but it is restricted to rhyolites in coeval volcanic sequences. In the Highland Range volcanic sequence, sphene appears as a phenocryst only in the most evolved rocks (72-77 mass% SiO2; matrix glass 77-78 mass% SiO2). Zr-in-sphene temperatures of crystallization are mostly restricted to 715 and 755??C, in contrast to zircon (710-920??C, Ti-in-zircon thermometry). Sphene rim/glass Kds for rare earth elements are extremely high (La 120, Sm 1200, Gd 1300, Lu 240). Rare earth elements, especially the middle REE (MREE), decrease from centers to rims of sphene phenocrysts along with Zr, demonstrating the effect of progressive sphene fractionation. Whole rocks and glasses have MREE-depleted, U-shaped REE patterns as a consequence of sphene fractionation. Within the co-genetic, sphene-rich Searchlight pluton, only evolved leucogranites show comparable MREE depletion. These results indicate that sphene saturation in intruded and extruded magmas occurred only in highly evolved melts: abundant sphene in less silicic plutonic rocks represents a late-stage 'bloom' in fractionated interstitial melt. ?? 2011 Springer-Verlag.

  9. Tectonic events, sequence stratigraphy and prediction of petroleum play elements in the Cretaceous and Tertiary of the northern Carnarvon Basin, north west shelf, Australia

    SciTech Connect

    Romine, K.K.; Durrant, J.D.

    1996-12-31

    The Carnarvon Basin is one of Australia`s most prolific oil and gas provinces. A recent Paleocene discovery has initiated a shift in exploration interest from traditional Jurassic/Triassic plays to the younger Cretaceous and Tertiary section. To improve play element prediction, a sequence stratigraphic study has been completed, utilizing newly acquired, regional high-resolution seismic data and 80 wells. The occurrence and distribution of the key play elements, reservoir, source and seal, is controlled by the interaction of tectonic subsidence, eustasy and paleogeography, with traps and migration pathways set up and modified by regional tectonic events. For example, a major rifting event commenced in the latest Kimmeridgian-Tithonian that resulted in structuring of older Jurassic sediments and initiation of seafloor spreading in the adjacent Cuvier-Gascoyne Abyssal Plain in the Valanginian. This event was accompanied by a dramatic fall in eustasy that initiated the deposition of high-quality reservoir sandstones of the Tithonian-Valanginian age Barrow Delta. The post-rift phase of thermal cooling and rapid subsidence resulted in transgression, accompanied by deposition of backstepping parasequences of the Mardie Greensand, a potential thief zone and reservoir, and culminated in maximum transgression and deposition of seal and source facies of the Muclerong Shale. The improved sequence stratigraphic framework established in this study provides a predictive tool for the development and assessment of new plays.

  10. Tectonic events, sequence stratigraphy and prediction of petroleum play elements in the Cretaceous and Tertiary of the northern Carnarvon Basin, north west shelf, Australia

    SciTech Connect

    Romine, K.K. ); Durrant, J.D. )

    1996-01-01

    The Carnarvon Basin is one of Australia's most prolific oil and gas provinces. A recent Paleocene discovery has initiated a shift in exploration interest from traditional Jurassic/Triassic plays to the younger Cretaceous and Tertiary section. To improve play element prediction, a sequence stratigraphic study has been completed, utilizing newly acquired, regional high-resolution seismic data and 80 wells. The occurrence and distribution of the key play elements, reservoir, source and seal, is controlled by the interaction of tectonic subsidence, eustasy and paleogeography, with traps and migration pathways set up and modified by regional tectonic events. For example, a major rifting event commenced in the latest Kimmeridgian-Tithonian that resulted in structuring of older Jurassic sediments and initiation of seafloor spreading in the adjacent Cuvier-Gascoyne Abyssal Plain in the Valanginian. This event was accompanied by a dramatic fall in eustasy that initiated the deposition of high-quality reservoir sandstones of the Tithonian-Valanginian age Barrow Delta. The post-rift phase of thermal cooling and rapid subsidence resulted in transgression, accompanied by deposition of backstepping parasequences of the Mardie Greensand, a potential thief zone and reservoir, and culminated in maximum transgression and deposition of seal and source facies of the Muclerong Shale. The improved sequence stratigraphic framework established in this study provides a predictive tool for the development and assessment of new plays.

  11. Cap-independent translation of poliovirus mRNA is conferred by sequence elements within the 5' noncoding region

    SciTech Connect

    Pelletier, J.; Kaplan, G.; Racaniello, V.R.; Sonenberg, N.

    1988-03-01

    Poliovirus polysomal RNA is naturally uncapped, and as such, its translation must bypass any 5' cap-dependent ribosome recognition event. To elucidate the manner by which poliovirus mRNA is translated, the authors determined the translational efficiencies of a series of deletion mutants within the 5' noncoding region of the mRNA. They found striking differences in translatability among the altered mRNAs when assayed in mock-infected and poliovirus-infected HeLa cell extracts. The results identify a functional cis-acting element within the 5' noncoding region of the poliovirus mRNA which enables it to translate in a cap-independent fashion. The major determinant of this element maps between nucleotides 320 and 631 of the 5' end of the poliovirus mRNA. They also show that this region (320 to 631), when fused to a heterologous mRNA, can function in cis to render the mRNA cap independent in translation.

  12. K-shell photoabsorption and photoionisation of trace elements. I. Isoelectronic sequences with electron number 3 ≤N ≤ 11

    NASA Astrophysics Data System (ADS)

    Palmeri, P.; Quinet, P.; Mendoza, C.; Bautista, M. A.; Witthoeft, M. C.; Kallman, T. R.

    2016-05-01

    Context. With the recent launching of the Hitomi X-ray space observatory, K lines and edges of chemical elements with low cosmic abundances, namely F, Na, P, Cl, K, Sc, Ti, V, Cr, Mn, Co, Cu and Zn, can be resolved and used to determine important properties of supernova remnants, galaxy clusters and accreting black holes and neutron stars. Aims: The second stage of the present ongoing project involves the computation of the accurate photoabsorption and photoionisation cross sections required to interpret the X-ray spectra of such trace elements. Methods: Depending on target complexity and computer tractability, ground-state cross sections are computed either with the close-coupling Breit-Pauli R-matrix method or with the autostructure atomic structure code in the isolated-resonance approximation. The intermediate-coupling scheme is used whenever possible. In order to determine a realistic K-edge behaviour for each species, both radiative and Auger dampings are taken into account, the latter being included in the R-matrix formalism by means of an optical potential. Results: Photoabsorption and total and partial photoionisation cross sections are reported for isoelectronic sequences with electron numbers 3 ≤ N ≤ 11. The Na sequence (N = 11) is used to estimate the contributions from configurations with a 2s hole (i.e. [2s]μ) and those containing 3d orbitals, which will be crucial when considering sequences with N > 11. Conclusions: It is found that the [2s]μ configurations must be included in the target representations of species with N ≥ 11 as they contribute significantly to the monotonic background of the cross section between the L and K edges. Configurations with 3d orbitals are important in rendering an accurate L edge, but they can be practically neglected in the K-edge region.

  13. Members of the nuclear factor 1 family and hepatocyte nuclear factor 4 bind to overlapping sequences of the L-II element on the rat pyruvate kinase L gene promoter and regulate its expression.

    PubMed

    Yamada, K; Tanaka, T; Noguchi, T

    1997-06-15

    The L-II element (-149 to -126 bp) in the enhancer unit of the rat pyruvate kinase L (PKL) gene is required for cell-type-specific transcription and induction by carbohydrates. This element was found to bind multiple nuclear proteins with different heat stabilities. A heat-labile factor was shown to be hepatocyte nuclear factor (HNF) 4 by the electrophoretic mobility-shift assay (EMSA) using various competitor DNAs and anti-HNF4 serum. A heat-stable factor was purified from rat liver nuclear extract and was resolved as two protein bands migrating at about 33 kDa on SDS/polyacrylamide gels. Peptide sequence analysis revealed that these proteins were nuclear factor (NF) 1-L and NF1/Red1. The heat-stable factor was also identified as a member of the NF1 family by using various competitor DNAs and anti-NF1 serum in an EMSA. In addition, we found that a factor bound to the accessory site of the rat S14 gene, which is necessary for carbohydrate responsiveness of this gene, was also a member of the NF1 family, raising the possibility that the NF1 family is involved in the carbohydrate regulation of gene transcription by interactions with other proteins. The NF1 family members and HNF4 interacted with overlapping sequences of the L-II element, wherein the 5' half-site was more critical for NF1 binding, and the 3' site was more important for HNF4 binding. Co-transfection of a vector expressing either NF1-L or NF1/Red1 repressed the transcription of the PKL enhancer unit-chloramphenicol acetyltransferase (CAT) fusion gene in HepG2 cells, whereas co-transfection of a vector expressing HNF4 activated the transcription of the same reporter gene. Furthermore NF1 family members antagonized the effect of HNF4 on PKL enhancer unit-CAT fusion gene expression when both expression plasmids were co-transfected. We conclude that NF1 family members and HNF4 regulate transcription of the PKL gene in an opposing manner by binding overlapping sequences of the L-II element.

  14. Sludge reduction by direct addition of chlorine dioxide into a sequencing batch reactor under operational mode of repeatedly alternating aeration/non-aeration.

    PubMed

    Peng, Hong; Liu, Weiyi; Li, Yuanmei; Xiao, Hong

    2015-01-01

    The effect of direct addition of chlorine dioxide (ClO2) into a repeatedly alternating aeration/non-aeration sequencing batch reactor (SBR) on its sludge reduction and process performance was investigated. The experimental results showed that the sludge reduction efficiency was 32.9% and the observed growth yield (Yobs) of SBR was 0.11 kg VSS (volatile suspended solids) /kg COD (chemical oxygen demand) for 80 days' operation at the optimum ClO2 dosage of 2.0 mg/g TSS (total suspended solids). It was speculated that cell lysis and cryptic growth, uncoupled metabolism and endogenous metabolism were jointly responsible for the sludge reduction in this study. COD, NH3-N, total nitrogen (TN) and total phosphorus (TP) in the effluent increased on average 29.47, 4.44, 1.97 and 0.05 mg/L, respectively. However, the effluent quality still satisfied the first-class B discharge standards for municipal wastewater treatment plants in China. In that case, the sludge maintained fine viability with the specific oxygen uptake rate (SOUR) being 14.47 mg O2/(g VSS·h) and demonstrated good settleability with the sludge volume index (SVI) being 116 mL/g. The extra cost of sludge reduction at the optimum ClO2 dosage was estimated to be 2.24 CNY (or 0.36 dollar)/kg dry sludge.

  15. Uranium hydrogeochemical and stream sediment reconnaissance of the Dalhart NTMS quadrangle, New Mexico/Texas/Oklahoma, including concentrations of forty-two additional elements

    SciTech Connect

    Morgan, T.L.

    1980-08-01

    Totals of 1583 water samples and 503 sediment samples were collected from 2028 locations within the 20 000-km/sup 2/ area of the quadrangle at an average density of one location per 9.86 km/sup 2/. Water samples were collected from wells, springs, and streams and were analyzed for uranium. Sediment samples were collected from streams and springs and were analyzed for uranium, thorium, and 41 additional elements. All field and analytical data are listed in the appendixes of this report. Discussion is limited to anomalous samples, which are considered to be those containing over 20 ppB uranium for waters and over 5 ppM uranium for sediments. Uranium concentrations in water samples range from below the detection limit of 0.2 ppB to 1457.65 ppB and average 7.41 ppB. Most of the seventy anomalous water samples (4.4% of all water samples) are grouped spatially into five clusters or areas of interest. Samples in three of the clusters were collected along the north edge of the quadrangle where Mesozoic strata are exposed. The other two clusters are from the central and southern portions where the Quaternary Ogallala formation is exposed. Sediment samples from the quadrangle have uranium concentrations that range from 0.90 ppM to 27.20 ppM and average 3.27 ppM. Fourteen samples (2.8% of all sediment samples) contain over 5 ppM uranium and are considered anomalous. The five samples with the highest concentrations occur where downcutting streams expose Cretaceous units beneath the Quaternary surficial deposits. The remaining anomalous sediment samples were collected from scattered locations and do not indicate any single formation or unit as a potential source for the anomalous concentrations.

  16. The istA gene of insertion sequence IS21 is essential for cleavage at the inner 3' ends of tandemly repeated IS21 elements in vitro.

    PubMed Central

    Reimmann, C; Haas, D

    1990-01-01

    The bacterial 2.1 kb insertion sequence IS21 occurs as a tandem repeat [=(IS21)2] on the broad host range plasmid R68.45. In (IS21)2, the two IS21 elements are separated by 3 bp termed junction sequence. Plasmids carrying (IS21)2 form cointegrates with other replicons at high frequencies. The two IS21 genes, istA and istB, were found to be necessary for cointegrate formation in vivo. Since the outer ends of (IS21)2 are dispensable for cointegrate formation, we favor a transposition model according to which a plasmid carrying (IS21)2 is cleaved at the junction sequence; the opened plasmid is then inserted into a target replicon. Here we show that Escherichia coli cell extracts, which contained over-produced IstA protein, nicked a supercoiled (IS21)2 plasmid precisely at the inner 3' termini of IS21; the resulting staggered cut generated 5' protrusions. The istA gene, but not the istB gene, was required for in vitro cleavage of an IS21-IS21 junction. Because of this cleavage and our previous findings (generation of 4 bp target duplications and loss of the junction sequence after cointegrate formation in vivo) we propose that plasmids with (IS21)2 produce cointegrates by a mechanism which involves joining of the inner 3' ends of IS21 to the 5' ends of the target. Images Fig. 3. Fig. 4. Fig. 5. PMID:2174355

  17. Next-generation sequencing detects repetitive elements expansion in giant genomes of annual killifish genus Austrolebias (Cyprinodontiformes, Rivulidae).

    PubMed

    García, G; Ríos, N; Gutiérrez, V

    2015-06-01

    Among Neotropical fish fauna, the South American killifish genus Austrolebias (Cyprinodontiformes: Rivulidae) constitutes an excellent model to study the genomic evolutionary processes underlying speciation events. Recently, unusually large genome size has been described in 16 species of this genus, with an average DNA content of about 5.95 ± 0.45 pg per diploid cell (mean C-value of about 2.98 pg). In the present paper we explore the possible origin of this unparallel genomic increase by means of comparative analysis of the repetitive components using NGS (454-Roche) technology in the lowest and highest Rivulidae genomes. Here, we provide the first annotated Rivulidae-repeated sequences composition and their relative repetitive fraction in both genomes. Remarkably, the genomic proportion of the moderately repetitive DNA in Austrolebias charrua genome represents approximately twice (45%) of the repetitive components of the highly related rivulinae taxon Cynopoecilus melanotaenia (25%). Present work provides evidence about the impact of the repeat families that could be distinctly proliferated among sublineages within Rivulidae fish group, explaining the great genome size differences encompassing the differentiation and speciation events in this family.

  18. Distinct tmRNA sequence elements facilitate RNase R engagement on rescued ribosomes for selective nonstop mRNA decay.

    PubMed

    Venkataraman, Krithika; Zafar, Hina; Karzai, A Wali

    2014-01-01

    trans-Translation, orchestrated by SmpB and tmRNA, is the principal eubacterial pathway for resolving stalled translation complexes. RNase R, the leading nonstop mRNA surveillance factor, is recruited to stalled ribosomes in a trans-translation dependent process. To elucidate the contributions of SmpB and tmRNA to RNase R recruitment, we evaluated Escherichia coli-Francisella tularensis chimeric variants of tmRNA and SmpB. This evaluation showed that while the hybrid tmRNA supported nascent polypeptide tagging and ribosome rescue, it suffered defects in facilitating RNase R recruitment to stalled ribosomes. To gain further insights, we used established tmRNA and SmpB variants that impact distinct stages of the trans-translation process. Analysis of select tmRNA variants revealed that the sequence composition and positioning of the ultimate and penultimate codons of the tmRNA ORF play a crucial role in recruiting RNase R to rescued ribosomes. Evaluation of defined SmpB C-terminal tail variants highlighted the importance of establishing the tmRNA reading frame, and provided valuable clues into the timing of RNase R recruitment to rescued ribosomes. Taken together, these studies demonstrate that productive RNase R-ribosomes engagement requires active trans-translation, and suggest that RNase R captures the emerging nonstop mRNA at an early stage after establishment of the tmRNA ORF as the surrogate mRNA template.

  19. Uranium hydrogeochemical and stream sediment reconnaissance data release for the Elk City NTMS Quadrangle, Idaho/Montana, including concentrations of forty-five additional elements

    SciTech Connect

    Broxton, D.E.; Beyth, M.

    1980-07-01

    Totals of 1580 water and 1720 sediment samples were collected from 1754 locations in the quadrangle. Elemental concentration, field measurement, weather, geologic, and geographic data for each sample location are listed for waters in Appendix I-A and for sediments in Appendix I-B. Uranium/thorium ratios for sediment samples are also included in Appendix I-B. All elemental analyses were performed at the LASL. Water samples were initially analyzed for uranium by fluorometry. All water samples containing more than 40 parts per billion (ppB) uranium were reanalyzed by delayed-neutron counting (DNC). A supplemental report containing the multielement analyses of water samples will be open filed in the near future. Sediments were analyzed for uranium and thorium as well as aluminum, antimony, arsenic, barium, beryllium, bismuth, cadmium, calcium, cerium, cesium, chlorine, chromium, cobalt, copper, dysprosium, europium, gold, hafnium, iron, lanthanum, lead, lithium, lutetium, magnesium, manganese, nickel, niobium, potassium, rubidium, samarium, selenium, scandium, silver, sodium, strontium, tantalum, terbium, tin, titanium, tungsten, vanadium, ytterbium, zinc, and zirconium. Basic statistics for 40 of these elements are presented. All sediments were analyzed for uranium by delayed-neutron counting. Other elemental concentrations in sediments were determined by neutron-activation analysis for 30 elements, by x-ray fluorescence for 12 elements, and by arc-source emission spectrography for 2 elements. Analytical results for sediments are reported as parts per million.

  20. Carbon, nitrogen and α-element abundances determine the formation sequence of the Galactic thick and thin discs

    NASA Astrophysics Data System (ADS)

    Masseron, T.; Gilmore, G.

    2015-10-01

    Using the DR12 public release of APOGEE data, we show that the thin and thick discs separate very well in the space defined by [α/Fe], [Fe/H] and [C/N]. Thick disc giants have both higher [C/N] and higher [α/Fe] than do thin disc stars with similar [Fe/H]. We deduce that the thick disc is composed of lower mass stars than the thin disc. Considering the fact that at a given metallicity there is a one-to-one relation between stellar mass and age, we are then able to infer the chronology of disc formation. Both the thick and the thin discs - defined by [α/Fe] - converge in their dependence on [C/N] and [C+N/Fe] at [Fe/H]≈-0.7. We conclude that (1) the majority of thick disc stars formed earlier than did the thin disc stars, (2) the formation histories of the thin and thick discs diverged early on, even when the [Fe/H] abundances are similar and (3) that the star formation rate in the thin disc has been lower than in the thick disc, at all metallicities. Although these general conclusions remain robust, we also show that current stellar evolution models cannot reproduce the observed C/N ratios for thick disc stars. Unexpectedly, reduced or inhibited canonical extra mixing is very common in field stars. While subject to abundance calibration zero-point uncertainties, this implies a strong dependence of non-canonical extra mixing along the red giant branch on the initial composition of the star and in particular on the α-elemental abundance.

  1. Analysis of sequences from field samples reveals the presence of the recently described pepper vein yellows virus (genus Polerovirus) in six additional countries.

    PubMed

    Knierim, Dennis; Tsai, Wen-Shi; Kenyon, Lawrence

    2013-06-01

    Polerovirus infection was detected by reverse transcription polymerase chain reaction (RT-PCR) in 29 pepper plants (Capsicum spp.) and one black nightshade plant (Solanum nigrum) sample collected from fields in India, Indonesia, Mali, Philippines, Thailand and Taiwan. At least two representative samples for each country were selected to generate a general polerovirus RT-PCR product of 1.4 kb length for sequencing. Sequence analysis of the partial genome sequences revealed the presence of pepper vein yellows virus (PeVYV) in all 13 samples. A 1990 Australian herbarium sample of pepper described by serological means as infected with capsicum yellows virus (CYV) was identified by sequence analysis of a partial CP sequence as probably infected with a potato leaf roll virus (PLRV) isolate.

  2. Heterogeneity of clinical and environmental isolates of Mycobacterium fortuitum using repetitive element sequence-based PCR: municipal water an unlikely source of community-acquired infections.

    PubMed

    Thomson, R M; Tolson, C E; Carter, R; Huygens, F; Hargreaves, M

    2014-10-01

    M. fortuitum is a rapidly growing mycobacterium associated with community-acquired and nosocomial wound, soft tissue, and pulmonary infections. It has been postulated that water has been the source of infection especially in the hospital setting. The aim of this study was to determine if municipal water may be the source of community-acquired or nosocomial infections in the Brisbane area. Between 2007 and 2009, 20 strains of M. fortuitum were recovered from municipal water and 53 patients' isolates were submitted to the reference laboratory. A wide variation in strain types was identified using repetitive element sequence-based PCR, with 13 clusters of ⩾2 indistinguishable isolates, and 28 patterns consisting of individual isolates. The clusters could be grouped into seven similar groups (>95% similarity). Municipal water and clinical isolates collected during the same time period and from the same geographical area consisted of different strain types, making municipal water an unlikely source of sporadic human infection.

  3. Sequence information signal processor

    DOEpatents

    Peterson, John C.; Chow, Edward T.; Waterman, Michael S.; Hunkapillar, Timothy J.

    1999-01-01

    An electronic circuit is used to compare two sequences, such as genetic sequences, to determine which alignment of the sequences produces the greatest similarity. The circuit includes a linear array of series-connected processors, each of which stores a single element from one of the sequences and compares that element with each successive element in the other sequence. For each comparison, the processor generates a scoring parameter that indicates which segment ending at those two elements produces the greatest degree of similarity between the sequences. The processor uses the scoring parameter to generate a similar scoring parameter for a comparison between the stored element and the next successive element from the other sequence. The processor also delivers the scoring parameter to the next processor in the array for use in generating a similar scoring parameter for another pair of elements. The electronic circuit determines which processor and alignment of the sequences produce the scoring parameter with the highest value.

  4. Relaxase DNA binding and cleavage are two distinguishable steps in conjugative DNA processing that involve different sequence elements of the nic site.

    PubMed

    Lucas, María; González-Pérez, Blanca; Cabezas, Matilde; Moncalian, Gabriel; Rivas, Germán; de la Cruz, Fernando

    2010-03-19

    TrwC, the relaxase of plasmid R388, catalyzes a series of concerted DNA cleavage and strand transfer reactions on a specific site (nic) of its origin of transfer (oriT). nic contains the cleavage site and an adjacent inverted repeat (IR(2)). Mutation analysis in the nic region indicated that recognition of the IR(2) proximal arm and the nucleotides located between IR(2) and the cleavage site were essential for supercoiled DNA processing, as judged either by in vitro nic cleavage or by mobilization of a plasmid containing oriT. Formation of the IR(2) cruciform and recognition of the distal IR(2) arm and loop were not necessary for these reactions to take place. On the other hand, IR(2) was not involved in TrwC single-stranded DNA processing in vitro. For single-stranded DNA nic cleavage, TrwC recognized a sequence embracing six nucleotides upstream of the cleavage site and two nucleotides downstream. This suggests that TrwC DNA binding and cleavage are two distinguishable steps in conjugative DNA processing and that different sequence elements are recognized by TrwC in each step. IR(2)-proximal arm recognition was crucial for the initial supercoiled DNA binding. Subsequent recognition of the adjacent single-stranded DNA binding site was required to position the cleavage site in the active center of the protein so that the nic cleavage reaction could take place.

  5. gEVE: a genome-based endogenous viral element database provides comprehensive viral protein-coding sequences in mammalian genomes

    PubMed Central

    Nakagawa, So; Takahashi, Mahoko Ueda

    2016-01-01

    In mammals, approximately 10% of genome sequences correspond to endogenous viral elements (EVEs), which are derived from ancient viral infections of germ cells. Although most EVEs have been inactivated, some open reading frames (ORFs) of EVEs obtained functions in the hosts. However, EVE ORFs usually remain unannotated in the genomes, and no databases are available for EVE ORFs. To investigate the function and evolution of EVEs in mammalian genomes, we developed EVE ORF databases for 20 genomes of 19 mammalian species. A total of 736,771 non-overlapping EVE ORFs were identified and archived in a database named gEVE (http://geve.med.u-tokai.ac.jp). The gEVE database provides nucleotide and amino acid sequences, genomic loci and functional annotations of EVE ORFs for all 20 genomes. In analyzing RNA-seq data with the gEVE database, we successfully identified the expressed EVE genes, suggesting that the gEVE database facilitates studies of the genomic analyses of various mammalian species. Database URL: http://geve.med.u-tokai.ac.jp PMID:27242033

  6. Two-dimensional distinct element modeling of the structure and growth of normal faults in multilayer sequences: 1. Model calibration, boundary conditions, and selected results

    NASA Astrophysics Data System (ADS)

    SchöPfer, Martin P. J.; Childs, Conrad; Walsh, John J.

    2007-10-01

    The distinct element method is used for modeling the growth of normal faults in layered sequences. The models consist of circular particles that can be bonded together with breakable cement. Size effects of the model mechanical properties were studied for a constant average particle size and various sample widths. The study revealed that the bulk strength of the model material decreases with increasing sample size. Consequently, numerical lab tests and the associated construction of failure envelopes were performed for the specific layer width to particle diameter ratios used in the multilayer models. The normal faulting models are composed of strong layers (bonded particles) and weak layers (nonbonded particles) that are deformed in response to movement on a predefined fault at the base of the sequence. The modeling reproduces many of the geometries observed in natural faults, including (1) changes in fault dip due to different modes of failure in the strong and weak layers, (2) fault bifurcation (splaying), (3) the flexure of strong layers and the rotation of associated blocks to form normal drag, and (4) the progressive linkage of fault segments. The model fault zone geometries and their growth are compared to natural faults from Kilve foreshore (Somerset, United Kingdom). Both the model and natural faults provide support for the well-known general trend that fault zone width increases with increasing displacement.

  7. The Human CCHC-type Zinc Finger Nucleic Acid-Binding Protein Binds G-Rich Elements in Target mRNA Coding Sequences and Promotes Translation.

    PubMed

    Benhalevy, Daniel; Gupta, Sanjay K; Danan, Charles H; Ghosal, Suman; Sun, Hong-Wei; Kazemier, Hinke G; Paeschke, Katrin; Hafner, Markus; Juranek, Stefan A

    2017-03-21

    The CCHC-type zinc finger nucleic acid-binding protein (CNBP/ZNF9) is conserved in eukaryotes and is essential for embryonic development in mammals. It has been implicated in transcriptional, as well as post-transcriptional, gene regulation; however, its nucleic acid ligands and molecular function remain elusive. Here, we use multiple systems-wide approaches to identify CNBP targets and function. We used photoactivatable ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP) to identify 8,420 CNBP binding sites on 4,178 mRNAs. CNBP preferentially bound G-rich elements in the target mRNA coding sequences, most of which were previously found to form G-quadruplex and other stable structures in vitro. Functional analyses, including RNA sequencing, ribosome profiling, and quantitative mass spectrometry, revealed that CNBP binding did not influence target mRNA abundance but rather increased their translational efficiency. Considering that CNBP binding prevented G-quadruplex structure formation in vitro, we hypothesize that CNBP is supporting translation by resolving stable structures on mRNAs.

  8. Discovery of a Katablepharis sp. in the Columbia River estuary that is abundant during the spring and bears a unique large ribosomal subunit sequence element

    PubMed Central

    Kahn, Peter; Herfort, Lydie; Peterson, Tawnya D; Zuber, Peter

    2014-01-01

    Heterotrophic protists play significant roles in pelagic food webs as bacterivorous and herbivorous consumers. However, heterotrophic protists—unlike autotrophic ones—are often difficult to track since they tend to lack features such as photosynthetic pigments that allow for remote sensing or for bulk characterization. Difficulty in the identification of heterotrophic protists has often resulted in lumping them into broad groups, but there is a strong need to develop methods that increase the spatial and temporal resolution of observations applied to particular organisms in order to discover the drivers of population structure and ecological function. In surveys of small subunit rRNA, gene (SSU) sequences of microbial eukaryotes from the Columbia River to the Pacific Ocean, the heterotrophic flagellate Katablepharis sp. were found to dominate protist assemblages (including autotrophic and heterotrophic fractions) in the spring, prior to the freshet. We discovered a 332 base pair unique sequence element (USE) insertion in the large subunit rRNA gene (28S) that is not present in other katablepharids or in any other eukaryote. Using this USE, we were able to detect Katablepharis within mixed assemblages in river, estuarine, and oceanic samples and determine spatial and temporal patterns in absolute abundance through quantitative PCR and fluorescence in situ hybridization. Given their high abundance and repeatable temporal patterns of occurrence, we hypothesize that the Columbia River Estuary Katablepharis (Katablepharis CRE) plays an important role in estuarine biogeochemical and ecosystem function. PMID:25168204

  9. gEVE: a genome-based endogenous viral element database provides comprehensive viral protein-coding sequences in mammalian genomes.

    PubMed

    Nakagawa, So; Takahashi, Mahoko Ueda

    2016-01-01

    In mammals, approximately 10% of genome sequences correspond to endogenous viral elements (EVEs), which are derived from ancient viral infections of germ cells. Although most EVEs have been inactivated, some open reading frames (ORFs) of EVEs obtained functions in the hosts. However, EVE ORFs usually remain unannotated in the genomes, and no databases are available for EVE ORFs. To investigate the function and evolution of EVEs in mammalian genomes, we developed EVE ORF databases for 20 genomes of 19 mammalian species. A total of 736,771 non-overlapping EVE ORFs were identified and archived in a database named gEVE (http://geve.med.u-tokai.ac.jp). The gEVE database provides nucleotide and amino acid sequences, genomic loci and functional annotations of EVE ORFs for all 20 genomes. In analyzing RNA-seq data with the gEVE database, we successfully identified the expressed EVE genes, suggesting that the gEVE database facilitates studies of the genomic analyses of various mammalian species.Database URL: http://geve.med.u-tokai.ac.jp.

  10. Uranium hydrogeochemical and stream sediment reconnaissance data release for the Dubois NTMS Quadrangle, Idaho/Montana, including concentrations of forty-five additional elements

    SciTech Connect

    LaDelfe, C.M.

    1980-08-01

    Totals of 1024 water samples and 1600 sediment samples were collected from 1669 locations in the Dubois quadrangle. Water samples were taken at streams, springs, and wells; sediment samples were collected from streams and springs. All field and analytical data are presented for waters in Appendix I-A and for sediments in I-B. All elemental analyses were performed at the LASL. Water samples were initially analyzed for uranium by fluorometry. All water samples containing more than the upper detection limit of uranium were reanalyzed by delayed neutron counting. Sediments were analyzed for uranium and thorium as well as aluminum, antimony, arsenic, barium, beryllium, bismuth, cadmium, calcium, cerium, cesium, chlorine, chromium, cobalt, copper, dysprosium, europium, gold, hafnium, iron, lanthanum, lead, lithium, lutetium, magnesium, manganese, nickel, niobium, potassium rubidium, samarium, scandium, selenium, silver, sodium, strontium, tantalum, terbium, tin, titanium, tungsten, vanadium, ytterbium, zinc and zirconium. All sediments were analyzed for uranium by delayed-neutron counting. Other elemental concentrations in sediments were determined by neutron-activation analysis for 30 elements, by x-ray fluorescence for 12 elements, and by arc-source emission spectrography for 2 elements. Analytical results for sediments are reported as parts per million.

  11. CONTROL OF LASER RADIATION PARAMETERS: Compensation for thermally induced aberrations in optical elements by means of additional heating by CO2 laser radiation

    NASA Astrophysics Data System (ADS)

    Soloviev, A. A.; Kozhevatov, I. E.; Palashov, O. V.; Khazanov, E. A.

    2006-10-01

    A method is proposed for compensating thermally induced phase distortions of laser radiation in absorbing optical elements. The method is based on supplementary heating of the peripheral region of the distorting element by the radiation from an auxiliary laser. A programme code has been developed for calculating the optimal parameters of supplementary radiation for minimising phase distortions. This code is based on the numerical solution of the thermal conductivity and static elasticity equations for a nonuniformly heated solid of cylindrical symmetry. Experiments reveal a high efficiency of the method for compensating distortions resulting from absorption of radiation with a Gaussian intensity profile.

  12. Changing environmental conditions during a geomagnetic reversal: Evidence from trace element and isotope variations on Pleistocene flowstone sequences from Cueva Victoria (SE Spain)

    NASA Astrophysics Data System (ADS)

    Mertz-Kraus, R.; Kocot, Y.; Gibert, L.; Scott, G. R.; Jochum, K. P.

    2011-12-01

    The weakening or non-existence of the Earth's magnetic field during a polarity transition is supposed to influence climatic conditions causing variations in, e.g., rainfall, weathering, or the amount of meteoric water infiltrating soils and rocks. Such variations can be monitored by the proxy record (stable and radiogenic isotope or elemental variations) of laminated carbonate sequences precipitated in caves (flowstones). In this study, a multiproxy approach is applied to flowstone samples from Cueva Victoria (SE Spain) recording the Brunhes-Matuyama reversal at 0.78 Ma (Marine Isotope Stage MIS 19) or less likely the lower Jaramillo polarity transition at 1.075 Ma (MIS 31). Cueva Victoria is paleontologically important because of the large number of fossilized fauna found (55 species). The flowstone forms a characteristic layer in the cave system allowing multiple sampling at different locations within the system to test the reproducablity of the analytically derived proxies. Element concentrations were determined on two flowstone samples, using laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS) along transects covering the geomagnetic change from reverse to normal. Most of the monitored elements show distinctive variations with the highest concentrations in the interval related to the polarity transition: U concentrations are up to factor of 5 higher in the interval of the transition. Increased U concentrations can be explained by (UO2)2+-enriched percolating waters enhancing the weathering during wetter conditions. About four times higher P concentrations indicate changes in vegetation and soil productivity influencing the supply of P to the cave system. Similar concentration maxima are found for the rare earth elements, but also for other elements such as Fe, Na, Al, and Si. Most of these elements are transported bound on colloids and particles. Higher particle supply to the cave environment points to higher infiltration rates caused by

  13. Uranium hydrogeochemical and stream sediment reconnaissance data release for the Lewistown NTMS Quadrangle, Montana, including concentrations of forty-two additional elements

    SciTech Connect

    Shannon, S.S. Jr.

    1980-08-01

    Totals of 758 water and 1170 sediment samples were collected from 1649 locations in the Levistown quadrangle. Water samples were collected at streams, springs, wells, ponds, and marshes; sediment samples were obtained from streams, springs, and ponds. Histograms and statistical data for uranium concentrations in water and sediment samples and thorium concentrations in sediment samples are given. All samples were collected at the nominal reconnaissance density of one sample location per 10 km/sup 2/. Elemental concentration, field measurement, weather, geologic, and geographic data for each sample location are listed for waters and for sediments. Uranium to thorium (U/Th) ratios for sediment samples are included. Water samples were initially analyzed for uranium by fluorometry. All water samples containing more than 40 ppB U were reanalyzed by delayed-neutron counting. Sediments were analyzed for U and Th as well as Al, Sb, Ba, Be, Bi, Cd, Ca, Ce, Cs, Cl, Cr, Co, Cu, Dy, Eu, Au, Hf, Fe, La, Pb, Li, Lu, Mg, Mn, Ni, Nb, K, Rb, Sa, Sc, Ag, Na, Sr, Ta, Tb, Sn, Ti, W, V, Yb, and Zn. All sediments were analyzed for U by delayed neutron counting. Other elemental concentrations in sediments were determined by neutron activation analysis for 31 elements, by x-ray fluorescence for 9 elements, and by arc-source emission spectrography for 2 elements. Analytical results are reported as parts per million. Descriptions of procedures used for analysis of water and sediments samples as well as analytical precisions and detection limits are given.

  14. Humans and chimpanzees differ in their cellular response to DNA damage and non-coding sequence elements of DNA repair-associated genes.

    PubMed

    Weis, E; Galetzka, D; Herlyn, H; Schneider, E; Haaf, T

    2008-01-01

    both species. Genetic differences in non-coding sequence elements may affect gene regulation in the DNA repair network and thus contribute to species differences in DNA repair and cancer susceptibility.

  15. Sequence-based typing of Legionella pneumophila strains isolated from hospital water distribution systems as a complementary element of risk assessment of legionellosis in Poland.

    PubMed

    Pancer, Katarzyna

    2013-01-01

    Many factors affect the risk of Legionella infection, such as the design, construction and maintenance of water distribution systems, the presence of individuals who may be exposed and their vulnerability to infection, and the degree of water system colonization and properties of Legionella strains. For epidemiological investigations, two properties of the Legionella strains are usually determined: serotyping and genotyping (sequence-based typing, SBT). In Poland, data regarding legionellosis are fragmentary, despite the fact that this has been a notifiable disease since 2002. The number of reported cases is very low; moreover, the main method of diagnosis is serological examination (delayed diagnosis and cheaper methods), and only single cases of LD were confirmed by culture of bacteria. Therefore, after 10 years of mandatory reporting of the Legionella spp. infection in Poland, the real epidemiological situation is still unknown; however, risk assessment should be carried out, especially in hospitals. In the presented study, comparison of the sequence types of 111 isolated L. pneumophila strains (from hospital water systems) with those present in the EWGLI SBT data was undertaken for complex risk analysis as a complementary element. In total, strains of L. pneumophila belonging to 12 out of 19 STs determined in the presented study were previously reported to the EWGLI SBT database (ST1, ST42, ST59, ST81, ST87, ST114, ST152, ST191, ST371, ST421, ST461, ST520). Among these strains, only 7 STs were previously reported in the amount of ≥10 (mainly ST1, ST42, ST81). Analysis of EWGLI data were carried out and, proportionally, the highest percentage of hospital-acquired strains (clinical and environmental) was found for ST 81, ST421 and ST152, but the largest number was for ST1. Based on the EWGLI data and the presented results, it was found that persistent colonization of HWS of 3 hospitals by strains belonging to ST42, ST1, ST87 indicated an increased risk of

  16. ISBst12, a novel type of insertion-sequence element causing loss of S-layer-gene expression in Bacillus stearothermophilus ATCC 12980.

    PubMed

    Egelseer, E M; Idris, R; Jarosch, M; Danhorn, T; Sleytr, U B; Sára, M

    2000-09-01

    The cell surface of the surface layer (S-layer)-carrying strain of Bacillus stearothermophilus ATCC 12980 is completely covered with an oblique lattice composed of the S-layer protein SbsC. In the S-layer-deficient strain, theS-layer gene sbsC was still present but was interrupted by a novel type of insertion sequence (IS) element designated ISBst12. The insertion site was found to be located within the coding region of the sbsC gene, 199 bp downstream from the translation start of SbsC. ISBst12 is 1612 bp long, bounded by 16 bp imperfect inverted repeats and flanked by a directly repeated 8 bp target sequence. ISBst12 contains an ORF of 1446 bp and is predicted to encode a putative transposase of 482 aa with a calculated theoretical molecular mass of 55562 Da and an isoelectric point of 9.13. The putative transposase does not exhibit a typical DDE motif but displays aHis-Arg-Tyr triad characteristic of the active site of integrases from the bacteriophage lambda Int family. Furthermore, two overlapping leucine-zipper motifs were identified at the N-terminal part of the putative transposase. As revealed by Southern blotting, ISBst12 was present in multiple copies in the S-layer-deficient strain as well as in the S-layer-carrying strain. Northern blotting indicated that S-layer gene expression is already inhibited at the transcriptional level, since no sbsC-specific transcript could be identified in the S-layer-deficient strain. By using PCR, ISBst12 was also detected in B. stearothermophilus PV72/p6, in its oxygen-induced strain variant PV72/p2 and in the S-layer-deficient strain PV72/T5.

  17. Elevated rate of fixation of endogenous retroviral elements in Haplorhini TRIM5 and TRIM22 genomic sequences: impact on transcriptional regulation.

    PubMed

    Diehl, William E; Johnson, Welkin E; Hunter, Eric

    2013-01-01

    All genes in the TRIM6/TRIM34/TRIM5/TRIM22 locus are type I interferon inducible, with TRIM5 and TRIM22 possessing antiviral properties. Evolutionary studies involving the TRIM6/34/5/22 locus have predominantly focused on the coding sequence of the genes, finding that TRIM5 and TRIM22 have undergone high rates of both non-synonymous nucleotide replacements and in-frame insertions and deletions. We sought to understand if divergent evolutionary pressures on TRIM6/34/5/22 coding regions have selected for modifications in the non-coding regions of these genes and explore whether such non-coding changes may influence the biological function of these genes. The transcribed genomic regions, including the introns, of TRIM6, TRIM34, TRIM5, and TRIM22 from ten Haplorhini primates and one prosimian species were analyzed for transposable element content. In Haplorhini species, TRIM5 displayed an exaggerated interspecies variability, predominantly resulting from changes in the composition of transposable elements in the large first and fourth introns. Multiple lineage-specific endogenous retroviral long terminal repeats (LTRs) were identified in the first intron of TRIM5 and TRIM22. In the prosimian genome, we identified a duplication of TRIM5 with a concomitant loss of TRIM22. The transposable element content of the prosimian TRIM5 genes appears to largely represent the shared Haplorhini/prosimian ancestral state for this gene. Furthermore, we demonstrated that one such differentially fixed LTR provides for species-specific transcriptional regulation of TRIM22 in response to p53 activation. Our results identify a previously unrecognized source of species-specific variation in the antiviral TRIM genes, which can lead to alterations in their transcriptional regulation. These observations suggest that there has existed long-term pressure for exaptation of retroviral LTRs in the non-coding regions of these genes. This likely resulted from serial viral challenges and provided a

  18. Staphylococcal cassette chromosome mec typing and mecA sequencing in methicillin-resistant staphylococci from Algeria: a highly diversified element with new mutations in mecA.

    PubMed

    Djoudi, Ferhat; Bonura, Celestino; Touati, Abdelaziz; Aléo, Aurora; Benallaoua, Said; Mammina, Caterina

    2016-11-01

    Genetic mechanisms of methicillin resistance are still relevant in staphylococci. The aims of this study are to assess the possible exchanges of staphylococcal cassette chromosome mec (SCCmec) among isolates of methicillin-resistant staphylococci (MRS) and to check for known or new mutations in mecA DNA. A total of 35 MRS non-repetitive isolates were recovered, including 20 Staphylococcushaemolyticus, 7 Staphylococcusaureus, 4 Staphylococcussciuri, 2 Staphylococcussaprophyticus and 1 isolate each of Staphylococcusxylosus and Staphylococcuslentus. Only 16 of the 35 strains were assigned to known SCCmec types: 7 SCCmec VII, 6 SCCmec IV and 3 SCCmec III, with possible horizontal transfer of the SCCmec VII from methicillin-resistant S. haemolyticus to methicillin-susceptible S. aureus. mecA gene sequencing in ten selected isolates allowed description of nine punctual mutations, seven of which were reported for the first time. The most frequent mutation was G246E, identified in isolates of methicillin-resistant S. aureus, S. sciuri, S. saprophyticus and S. lentus. These results emphasized the high degree of genetic diversity of SCCmec element in MRS and describe new missense mutations in mecA, which might be important in understanding the evolution of methicillin and new β-lactam resistance.

  19. Replication in the amplified dihydrofolate reductase domain in CHO cells may initiate at two distinct sites, one of which is a repetitive sequence element.

    PubMed

    Anachkova, B; Hamlin, J L

    1989-02-01

    To study initiation of DNA replication in mammalian chromosomes, we have established a methotrexate-resistant Chinese hamster ovary cell line (CHOC 400) that contains approximately 1,000 copies of the early replicating dihydrofolate reductase (DHFR) domain. We have previously shown that DNA replication in the prevalent 243-kilobase (kb) amplicon type in this cell line initiates somewhere within a 28-kb region located downstream from the DHFR gene. In an attempt to localize the origin of replication with more precision, we blocked the progress of replication forks emanating from origins at the beginning of the S phase by the introduction of trioxsalen cross-links at 1- to 5-kb intervals in the parental double-stranded DNA. The small DNA fragments synthesized under these conditions (which should be centered around replication origins) were then used as hybridization probes on digests of cosmids and plasmids from the DHFR domain. These studies suggested that in cells synchronized by this regimen, DNA replication initiates at two separate sites within the previously defined 28-kb replication initiation locus, in general agreement with results described in the accompanying paper (T.-H. Leu and J. L. Hamlin, Mol. Cell. Biol. 9:523-531, 1989). One of these sites contains a repeated DNA sequence element that is found at or near many other initiation sites in the genome, since it was also highly enriched in the early replicating DNA isolated from cross-linked CHO cells that contain only two copies of the DHFR domain.

  20. Improvement in the prediction of the translation initiation site through balancing methods, inclusion of acquired knowledge and addition of features to sequences of mRNA

    PubMed Central

    2011-01-01

    Background The accurate prediction of the initiation of translation in sequences of mRNA is an important activity for genome annotation. However, obtaining an accurate prediction is not always a simple task and can be modeled as a problem of classification between positive sequences (protein codifiers) and negative sequences (non-codifiers). The problem is highly imbalanced because each molecule of mRNA has a unique translation initiation site and various others that are not initiators. Therefore, this study focuses on the problem from the perspective of balancing classes and we present an undersampling balancing method, M-clus, which is based on clustering. The method also adds features to sequences and improves the performance of the classifier through the inclusion of knowledge obtained by the model, called InAKnow. Results Through this methodology, the measures of performance used (accuracy, sensitivity, specificity and adjusted accuracy) are greater than 93% for the Mus musculus and Rattus norvegicus organisms, and varied between 72.97% and 97.43% for the other organisms evaluated: Arabidopsis thaliana, Caenorhabditis elegans, Drosophila melanogaster, Homo sapiens, Nasonia vitripennis. The precision increases significantly by 39% and 22.9% for Mus musculus and Rattus norvegicus, respectively, when the knowledge obtained by the model is included. For the other organisms, the precision increases by between 37.10% and 59.49%. The inclusion of certain features during training, for example, the presence of ATG in the upstream region of the Translation Initiation Site, improves the rate of sensitivity by approximately 7%. Using the M-Clus balancing method generates a significant increase in the rate of sensitivity from 51.39% to 91.55% (Mus musculus) and from 47.45% to 88.09% (Rattus norvegicus). Conclusions In order to solve the problem of TIS prediction, the results indicate that the methodology proposed in this work is adequate, particularly when using the

  1. Stellar Diameters and Temperatures. III. Main-sequence A, F, G, and K Stars: Additional High-precision Measurements and Empirical Relations

    NASA Astrophysics Data System (ADS)

    Boyajian, Tabetha S.; von Braun, Kaspar; van Belle, Gerard; Farrington, Chris; Schaefer, Gail; Jones, Jeremy; White, Russel; McAlister, Harold A.; ten Brummelaar, Theo A.; Ridgway, Stephen; Gies, Douglas; Sturmann, Laszlo; Sturmann, Judit; Turner, Nils H.; Goldfinger, P. J.; Vargas, Norm

    2013-07-01

    Based on CHARA Array measurements, we present the angular diameters of 23 nearby, main-sequence stars, ranging from spectral types A7 to K0, 5 of which are exoplanet host stars. We derive linear radii, effective temperatures, and absolute luminosities of the stars using Hipparcos parallaxes and measured bolometric fluxes. The new data are combined with previously published values to create an Angular Diameter Anthology of measured angular diameters to main-sequence stars (luminosity classes V and IV). This compilation consists of 125 stars with diameter uncertainties of less than 5%, ranging in spectral types from A to M. The large quantity of empirical data is used to derive color-temperature relations to an assortment of color indices in the Johnson (BVR J I J JHK), Cousins (R C I C), Kron (R K I K), Sloan (griz), and WISE (W 3 W 4) photometric systems. These relations have an average standard deviation of ~3% and are valid for stars with spectral types A0-M4. To derive even more accurate relations for Sun-like stars, we also determined these temperature relations omitting early-type stars (T eff > 6750 K) that may have biased luminosity estimates because of rapid rotation; for this subset the dispersion is only ~2.5%. We find effective temperatures in agreement within a couple of percent for the interferometrically characterized sample of main-sequence stars compared to those derived via the infrared flux method and spectroscopic analysis.

  2. FARME DB: a functional antibiotic resistance element database

    PubMed Central

    Wallace, James C.; Port, Jesse A.; Smith, Marissa N.; Faustman, Elaine M.

    2017-01-01

    Antibiotic resistance (AR) is a major global public health threat but few resources exist that catalog AR genes outside of a clinical context. Current AR sequence databases are assembled almost exclusively from genomic sequences derived from clinical bacterial isolates and thus do not include many microbial sequences derived from environmental samples that confer resistance in functional metagenomic studies. These environmental metagenomic sequences often show little or no similarity to AR sequences from clinical isolates using standard classification criteria. In addition, existing AR databases provide no information about flanking sequences containing regulatory or mobile genetic elements. To help address this issue, we created an annotated database of DNA and protein sequences derived exclusively from environmental metagenomic sequences showing AR in laboratory experiments. Our Functional Antibiotic Resistant Metagenomic Element (FARME) database is a compilation of publically available DNA sequences and predicted protein sequences conferring AR as well as regulatory elements, mobile genetic elements and predicted proteins flanking antibiotic resistant genes. FARME is the first database to focus on functional metagenomic AR gene elements and provides a resource to better understand AR in the 99% of bacteria which cannot be cultured and the relationship between environmental AR sequences and antibiotic resistant genes derived from cultured isolates. Database URL: http://staff.washington.edu/jwallace/farme PMID:28077567

  3. Complete Genome Sequences of Multidrug-Resistant Campylobacter jejuni Strain 14980A (Turkey Feces) and Campylobacter coli Strain 14983A (Housefly from a Turkey Farm), Harboring a Novel Gentamicin Resistance Mobile Element

    PubMed Central

    Huynh, Steven; Parker, Craig T.; Niedermeyer, Jeffrey A.; Kathariou, Sophia

    2016-01-01

    Multidrug resistance (MDR) in foodborne pathogens is a major food safety and public health issue. Here we describe whole-genome sequences of two MDR strains of Campylobacter jejuni and Campylobacter coli from turkey feces and a housefly from a turkey farm. Both strains harbor a novel chromosomal gentamicin resistance mobile element. PMID:27795285

  4. STELLAR DIAMETERS AND TEMPERATURES. III. MAIN-SEQUENCE A, F, G, AND K STARS: ADDITIONAL HIGH-PRECISION MEASUREMENTS AND EMPIRICAL RELATIONS

    SciTech Connect

    Boyajian, Tabetha S.; Jones, Jeremy; White, Russel; McAlister, Harold A.; Gies, Douglas; Von Braun, Kaspar; Van Belle, Gerard; Farrington, Chris; Schaefer, Gail; Ten Brummelaar, Theo A.; Sturmann, Laszlo; Sturmann, Judit; Turner, Nils H.; Goldfinger, P. J.; Vargas, Norm; Ridgway, Stephen

    2013-07-01

    Based on CHARA Array measurements, we present the angular diameters of 23 nearby, main-sequence stars, ranging from spectral types A7 to K0, 5 of which are exoplanet host stars. We derive linear radii, effective temperatures, and absolute luminosities of the stars using Hipparcos parallaxes and measured bolometric fluxes. The new data are combined with previously published values to create an Angular Diameter Anthology of measured angular diameters to main-sequence stars (luminosity classes V and IV). This compilation consists of 125 stars with diameter uncertainties of less than 5%, ranging in spectral types from A to M. The large quantity of empirical data is used to derive color-temperature relations to an assortment of color indices in the Johnson (BVR{sub J} I{sub J} JHK), Cousins (R{sub C} I{sub C}), Kron (R{sub K} I{sub K}), Sloan (griz), and WISE (W{sub 3} W{sub 4}) photometric systems. These relations have an average standard deviation of {approx}3% and are valid for stars with spectral types A0-M4. To derive even more accurate relations for Sun-like stars, we also determined these temperature relations omitting early-type stars (T{sub eff} > 6750 K) that may have biased luminosity estimates because of rapid rotation; for this subset the dispersion is only {approx}2.5%. We find effective temperatures in agreement within a couple of percent for the interferometrically characterized sample of main-sequence stars compared to those derived via the infrared flux method and spectroscopic analysis.

  5. Morphology and small subunit (SSU) rRNA gene sequence of the new brackish water ciliate Neobakuella flava n. g., n. sp. (Ciliophora, Spirotricha, Bakuellidae) and SSU rRNA gene sequences of six additional hypotrichs from Korea.

    PubMed

    Li, Liqiong; Khan, Sadia Nawroz; Ji, Daode; Shin, Mann Kyoon; Berger, Helmut

    2011-01-01

    The morphology and the small subunit (SSU) rRNA gene sequence of the hypotrich Neobakuella flava n. g., n. sp. from the estuary of the Taehwagang River (Ulsan, South Korea) were investigated. The three frontal cirri, the composition of the midventral complex of cirral pairs and rows, and the simple dorsal kinety pattern of three bipolar kineties assign it to the urostyloid taxon Bakuellidae. The increased number of buccal and parabuccal cirri, the presence of transverse cirri, and more than one left marginal row, as well as the lack of caudal cirri separate Neobakuella n. g. from the other bakuellids. Neobakuella flava n. sp. has many 0.3 μm sized green and/or yellow usually dark-green cortical granules and some sparsely distributed, 2 × 1 μm sized grass green with yellowish shimmer granules. The gene sequence data indicate a close relationship with Diaxonella and a distinct separation from the bakuellid Metaurostylopsis and parabirojimid Parabirojimia. The SSU rRNA gene sequences of four further urostyloids (i.e. Diaxonella pseudorubra, Anteholosticha monilata, Metaurostylopsis struederkypkeae, Pseudourostyla cristata) and two stylonychines (i.e. Sterkiella cavicola, Sterkiella histriomuscorum) from Korea were analyzed. Anteholosticha monilata, type of the genus, is clearly separated from the Holosticha clade, supporting the morphological separation from Holosticha. Sterkiella cavicola, type of Sterkiella, clusters within the stylonychines and is obviously closely related with S. histriomuscorum.

  6. Loss of Internal Backbone Carbonyls: Additional Evidence for Sequence-Scrambling in Collision-Induced Dissociation of y-Type Ions

    NASA Astrophysics Data System (ADS)

    Harper, Brett; Miladi, Mahsan; Solouki, Touradj

    2014-10-01

    It is shown that y-type ions, after losing C-terminal H2O or NH3, can lose an internal backbone carbonyl (CO) from different peptide positions and yield structurally different product fragment ions upon collision-induced dissociation (CID). Such CO losses from internal peptide backbones of y-fragment ions are not unique to a single peptide and were observed in four of five model peptides studied herein. Experimental details on examples of CO losses from y-type fragment ions for an isotopically labeled AAAAH AA-NH2 heptapeptide and des-acetylated-α-melanocyte-stimulating hormone (dα-MSH) (SYSMEHFRWGKPV-NH2) are reported. Results from isotope labeling, tandem mass spectrometry (MSn), and ion mobility-mass spectrometry (IM-MS) confirm that CO losses from different amino acids of m/ z-isolated y-type ions yield structurally different ions. It is shown that losses of internal backbone carbonyls (as CID products of m/ z-isolated y-type ions) are among intermediate steps towards formation of rearranged or permutated product fragment ions. Possible mechanisms for generation of the observed sequence-scrambled a-"like" ions, as intermediates in sequence-scrambling pathways of y-type ions, are proposed and discussed.

  7. Tuning the morphology, luminescence and magnetic properties of hexagonal-phase NaGdF4: Yb, Er nanocrystals via altering the addition sequence of the precursors

    NASA Astrophysics Data System (ADS)

    Zhao, Shuwen; Xia, Donglin; Zhao, Ruimin; Zhu, Hao; Zhu, Yiru; Xiong, Yuda; Wang, Youfa

    2017-01-01

    Hexagonal-phase NaGdF4: Yb, Er upconversion nanocrystals (UCNCs) with tunable morphology and properties were successfully prepared via a thermal decomposition method. The influences of the adding sequence of the precursors on the morphology, chemical composition, luminescence and magnetic properties were investigated by transmission electron microscopy (TEM), inductively coupled plasma-atomic emission spectrometry (ICP-AES), upconversion (UC) spectroscopy, and a vibrating sample magnetometer (VSM). It was found that the resulting nanocrystals, with different sizes ranging from 24 to 224 nm, are in the shape of spheres, hexagonal plates and flakes; moreover, the composition percentage of Yb3+-Er3+ and Gd3+ ions was found to vary in a regular pattern with the adding sequence. Furthermore, the intensity ratios of emission colors (f g/r, f g/p), and the magnetic mass susceptibility of hexagonal-phase NaGdF4: Yb, Er nanocrystals change along with the composition of the nanocrystals. A positive correlation between the susceptibility and f g/r of NaGdF4: Yb, Er was proposed. The decomposition processes of the precursors were investigated by a thermogravimetric (TG) analyzer. The result indicated that the decomposition of the resolved lanthanide trifluoroacetate is greatly different from lanthanide trifluoroacetate powder. It is of tremendous help to recognize the decomposition process of the precursors and to understand the related reaction mechanism.

  8. Uranium hydrogeochemical survey of well waters from an area around Pie Town, Catron County, West-Central New Mexico, including concentrations of twenty-three additional elements

    SciTech Connect

    Morgan, T.L.; George, W.E.; Hensley, W.K.; Thomas, G.J.; Langhorst, A.L.

    1980-10-01

    As part of the Hydrogeochemical and Stream Sediment Reconnaissance (HSSR) of the National Uranium Resource Evaluation (NURE) sponsored by the US Department of Energy (DOE), the Los Alamos Scientific Laboratory (LASL) conducted a detailed hydrogeochemical survey of well waters in a 4250-km/sup 2/ area near Pie Town in west-central New Mexico. A total of 300 well samples was collected and analyzed for uranium and 23 other elements. The results of these analyses and carbonate and bicarbonate ion concentrations are presented in the Appendixes of this report. Uranium concentrations range from below the detection limit of 0.02 parts per billion (ppB) to 293.18 ppB and average 8.71 ppB. Samples containing high levels of uranium were collected from the Largo Creek valley west of Quemado, from a small area about 6 km east of Quemado, from a small area surrounding Pie Town, and from scattered locations in the area surrounding Adams Diggings north of Pie Town. Most of the samples containing high uranium concentrations were collected from wells associated with the volcanic sedimentary facies of the Datil formation. This formation is a likely source of mobile uranium that may be precipitating in the underlying Baca formation, a known uranium host unit. Bicarbonate ion concentration, while proportional to uranium concentration in some cases, is not a strong controlling factor in the uranium concentrations in samples from this area.

  9. Tumorigenesis by Meis1 overexpression is accompanied by a change of DNA target-sequence specificity which allows binding to the AP-1 element

    PubMed Central

    Dardaei, Leila; Penkov, Dmitry; Mathiasen, Lisa; Bora, Pranami; Morelli, Marco J.; Blasi, Francesco

    2015-01-01

    Meis1 overexpression induces tumorigenicity but its activity is inhibited by Prep1 tumor suppressor. Why does overexpression of Meis1 cause cancer and how does Prep1 inhibit? Tumor profiling and ChIP-sequencing data in a genetically-defined set of cell lines show that: 1) The number of Meis1 and Prep1 DNA binding sites increases linearly with their concentration resulting in a strong increase of “extra” target genes. 2) At high concentration, Meis1 DNA target specificity changes such that the most enriched consensus becomes that of the AP-1 regulatory element, whereas the specific OCTA consensus is not enriched because diluted within the many extra binding sites. 3) Prep1 inhibits Meis1 tumorigenesis preventing the binding to many of the “extra” genes containing AP-1 sites. 4) The overexpression of Prep1, but not of Meis1, changes the functional genomic distribution of the binding sites, increasing seven fold the number of its “enhancer” and decreasing its “promoter” targets. 5) A specific Meis1 “oncogenic” and Prep1 “tumor suppressing” signature has been identified selecting from the pool of genes bound by each protein those whose expression was modified uniquely by the “tumor-inducing” Meis1 or tumor-inhibiting Prep1 overexpression. In both signatures, the enriched gene categories are the same and are involved in signal transduction. However, Meis1 targets stimulatory genes while Prep1 targets genes that inhibit the tumorigenic signaling pathways. PMID:26259236

  10. Genome-wide analysis of short interspersed nuclear elements SINES revealed high sequence conservation, gene association and retrotranspositional activity in wheat

    PubMed Central

    Ben-David, Smadar; Yaakov, Beery; Kashkush, Khalil

    2013-01-01

    Short interspersed nuclear elements (SINEs) are non-autonomous non-LTR retroelements that are present in most eukaryotic species. While SINEs have been intensively investigated in humans and other animal systems, they are poorly studied in plants, especially in wheat (Triticum aestivum). We used quantitative PCR of various wheat species to determine the copy number of a wheat SINE family, termed Au SINE, combined with computer-assisted analyses of the publicly available 454 pyrosequencing database of T. aestivum. In addition, we utilized site-specific PCR on 57 Au SINE insertions, transposon methylation display and transposon display on newly formed wheat polyploids to assess retrotranspositional activity, epigenetic status and genetic rearrangements in Au SINE, respectively. We retrieved 3706 different insertions of Au SINE from the 454 pyrosequencing database of T. aestivum, and found that most of the elements are inserted in A/T-rich regions, while approximately 38% of the insertions are associated with transcribed regions, including known wheat genes. We observed typical retrotransposition of Au SINE in the second generation of a newly formed wheat allohexaploid, and massive hypermethylation in CCGG sites surrounding Au SINE in the third generation. Finally, we observed huge differences in the copy numbers in diploid Triticum and Aegilops species, and a significant increase in the copy numbers in natural wheat polyploids, but no significant increase in the copy number of Au SINE in the first four generations for two of three newly formed allopolyploid species used in this study. Our data indicate that SINEs may play a prominent role in the genomic evolution of wheat through stress-induced activation. PMID:23855320

  11. HSP70 and modified HPV 16 E7 fusion gene without the addition of a signal peptide gene sequence as a candidate therapeutic tumor vaccine.

    PubMed

    Zong, Jinbao; Wang, Changyuan; Wang, Qingyong; Peng, Qinglin; Xu, Yufei; Xie, Xixiu; Xu, Xuemei

    2013-12-01

    Millions of women are currently infected with high-risk human papillomavirus (HPV), which is considered to be a major risk factor for cervical cancer. Thus, it is urgent to develop therapeutic vaccines to eliminate the established infections or HPV-related diseases. In the present study, using the mycobacterium tuberculosis heat shock protein 70 (MtHSP70) gene linked to the modified HPV 16 E7 (mE7) gene, we generated two potential therapeutic HPV DNA vaccines, mE7/MtHSP70 and SigmE7/MtHSP70, the latter was linked to the signal peptide gene sequence of human CD33 at the upstream of the fusion gene. We found that vaccination with the mE7/MtHSP70 DNA vaccine induced a stronger E7-specific CD8+ T cell response and resulted in a more significant therapeutic effect against E7-expressing tumor cells in mice. Our results demonstrated that HSP70 can play a more important role in mE7 and MtHSP70 fusion DNA vaccine without the help of a signal peptide. This may facilitate the use of HSP70 and serve as a significant reference for future study.

  12. The impact of nanosilver addition on element ions release form light-cured dental composite and compomer into 0.9% NaCl.

    PubMed

    Sokołowski, Krzysztof; Szynkowska, Małgorzata I; Pawlaczyk, Aleksandra; Łukomska-Szymańska, Monika; Sokołowski, Jerzy

    2014-01-01

    The aim of this paper was to identify and to assess in semi-quantified way the release of different ions from composite and compomer restorative materials subjected to 0.9% NaCl solution, which simulates the environment of the human body. In the present study, the number of ions (Al, Ag, Ba, Sr, Ti) released from dental fillings over time (one week, one month and 3 months), in different temperatures (23°C, 37°C) and depending on the materials applied (unmodified/modified with nanosilver) was investigated. The results suggest that nanosilver addition influences directly on the process of metal ion releasing into 0.9% NaCl solution. The increase in the number of counts of metal ions was observed in the solutions in which samples modified with nanosilver were kept. Higher amount of metal ion release was observed for composite samples rather than for compomer materials. The study revealed that in general the number of released metal ions increases with the time of storage (for metal ions: Ti, Ba, Sr) and at higher temperature (Ag, Ti, Ba). Reverse tendency observed for silver ion release versus incubation time may be caused by the process of silver adsorption, which takes place on the surface of analyzed material and test-tube walls, where samples were incubated.

  13. Additive roles of PthAs in bacterial growth and pathogenicity associated with nucleotide polymorphisms in effector-binding elements of citrus canker susceptibility genes.

    PubMed

    Abe, Valeria Yukari; Benedetti, Celso Eduardo

    2016-10-01

    Citrus canker, caused by Xanthomonas citri, affects most commercial citrus varieties. All X. citri strains possess at least one transcription activator-like effector of the PthA family that activates host disease susceptibility (S) genes. The X. citri strain 306 encodes four PthA effectors; nevertheless, only PthA4 is known to elicit cankers on citrus. As none of the PthAs act as avirulence factors on citrus, we hypothesized that PthAs 1-3 might also contribute to pathogenicity on certain hosts. Here, we show that, although PthA4 is indispensable for canker formation in six Brazilian citrus varieties, PthAs 1 and 3 contribute to canker development in 'Pera' sweet orange, but not in 'Tahiti' lemon. Deletions in two or more pthA genes reduce bacterial growth in planta more pronouncedly than single deletions, suggesting an additive role of PthAs in pathogenicity and bacterial fitness. The contribution of PthAs 1 and 3 in canker formation in 'Pera' plants does not correlate with the activation of the canker S gene, LOB1 (LATERAL ORGAN BOUNDARIES 1), but with the induction of other PthA targets, including LOB2 and citrus dioxygenase (DIOX). LOB1, LOB2 and DIOX show differential PthA-dependent expression between 'Pera' and 'Tahiti' plants that appears to be associated with nucleotide polymorphisms found at or near PthA-binding sites. We also present evidence that LOB1 activation alone is not sufficient to elicit cankers on citrus, and that DIOX acts as a canker S gene in 'Pera', but not 'Tahiti', plants. Our results suggest that the activation of multiple S genes, such as LOB1 and DIOX, is necessary for full canker development.

  14. A novel intronic cis element, ISE/ISS-3, regulates rat fibroblast growth factor receptor 2 splicing through activation of an upstream exon and repression of a downstream exon containing a noncanonical branch point sequence.

    PubMed

    Hovhannisyan, Ruben H; Carstens, Russ P

    2005-01-01

    Mutually exclusive splicing of fibroblast growth factor receptor 2 (FGFR2) exons IIIb and IIIc yields two receptor isoforms, FGFR2-IIIb and -IIIc, with distinctly different ligand binding properties. Several RNA cis elements in the intron (intron 8) separating these exons have been described that are required for splicing regulation. Using a heterologous splicing reporter, we have identified a new regulatory element in this intron that confers cell-type-specific inclusion of an unrelated exon that mirrors its ability to promote cell-type-specific inclusion of exon IIIb. This element promoted inclusion of exon IIIb while at the same time silencing exon IIIc inclusion in cells expressing FGFR2-IIIb; hence, we have termed this element ISE/ISS-3 (for "intronic splicing enhancer-intronic splicing silencer 3"). Silencing of exon IIIc splicing by ISE/ISS-3 was shown to require a branch point sequence (BPS) using G as the primary branch nucleotide. Replacing a consensus BPS with A as the primary branch nucleotide resulted in constitutive splicing of exon IIIc. Our results suggest that the branch point sequence constitutes an important component that can contribute to the efficiency of exon definition of alternatively spliced cassette exons. Noncanonical branch points may thus facilitate cell-type-specific silencing of regulated exons by flanking cis elements.

  15. First determination of s-process element abundances in pre-main sequence clusters. Y, Zr, La, and Ce in IC 2391, the Argus association, and IC 2602

    NASA Astrophysics Data System (ADS)

    D'Orazi, V.; De Silva, G. M.; Melo, C. F. H.

    2017-02-01

    Context. Several high-resolution spectroscopic studies have provided compelling observational evidence that open clusters display a decreasing trend of their barium abundances as a function of the cluster's age. Young clusters (ages ≲ 200 Myr) exhibit significant enhancement in the [Ba/Fe] ratios, at variance with solar-age clusters where the Ba content has been found to be [Ba/Fe] 0 dex. Different viable solutions have been suggested in the literature; nevertheless, a conclusive interpretation of such a peculiar trend has not been found. Interestingly, it is debated whether the other species produced with Ba via s-process reactions follow the same trend with age. Aims: Pre-main sequence clusters (≈10-50 Myr) show the most extreme behaviour in this respect: their [Ba/Fe] ratios can reach 0.65 dex, which is higher than the solar value by a factor of four. Crucially, there are no investigations of the other s-process species for these young stellar populations. In this paper we present the first determination of Y, Zr, La, and Ce in clusters IC 2391, IC 2602, and the Argus association. The main objective of our work is to ascertain whether these elements reveal the same enhancement as Ba. Methods: We have exploited high-resolution, high signal-to-noise spectra in order to derive abundances for Y, Zr, La, and Ce via spectral synthesis calculations. Our sample includes only stars with very similar atmospheric parameters so that internal errors due to star-to-star inhomogeneity are negligible. The chemical analysis was carried out in a strictly differential way, as done in all our previous investigations, to minimise the impact of systematic uncertainties. Results: Our results indicate that, at variance with Ba, all the other s-process species exhibit a solar scaled pattern; these clusters confirm a similar trend discovered in the slightly older local associations (e.g. AB Doradus, Carina-Near), where only Ba exhibit enhanced value with all other s-process species

  16. The Connell Sum Sequence

    NASA Astrophysics Data System (ADS)

    Bullington, Grady D.

    2007-01-01

    The Connell sum sequence refers to the partial sums of the Connell sequence. In this paper, the Connell sequence, Connell sum sequence and generalizations from Iannucci and Mills-Taylor are interpreted as sums of elements of triangles, relating them to polygonal number-stuttered arithmetic progressions. The n-th element of the Connell sum sequence is established as a sharp upper bound for the value of a gamma-labeling of a graph of size n. The limiting behavior and a explicit formula for the Connell (m,r)-sum sequence are also given.

  17. Gene sequence of mouse B-type proline-rich protein MP4. Transcriptional start point and an upstream phylogenetic footprint with ets-like and rel/NFkB-like elements.

    PubMed

    Roberts, S G; Layfield, R; Bannister, A J; McDonald, C J

    1991-12-18

    A mouse genomic B-type proline-rich protein (PRP) cosmid clone was isolated by cDNA hybridisation and mapped, the gene region was subcloned and 3770 bp were sequenced. This gene (MP4) contained three introns and encoded a 1020-nt (nt, nucleotide) mRNA for a PRP precursor 300 amino acids long arranged with 11 imperfect 18-residue proline-rich repeats. The transcriptional start point was determined by S1 nuclease mapping and primer extension to be 26 bp downstream of a TATAA sequence. Sequence comparisons revealed that only two regions from positions -650 bp - -30 bp were highly conserved in all other PRP genes, PRP boxes 1 and 2. Box 1 at positions -112 to -135 contained ets-like and rel/NFkB-like elements and was 74% conserved over 23 bp. Box 2 at positions -33 - -51 was 53% conserved over 19 bp. A search of the EMBL and GenBank sequence libraries indicated that PRP box 1 was only present upstream of the known mammalian PRP gene sequences and was absent from other genes. These conserved sequences may thus be relevant to the tissue-specific and beta-adrenergic regulation of PRP gene transcription.

  18. Multimodal sequence learning.

    PubMed

    Kemény, Ferenc; Meier, Beat

    2016-02-01

    While sequence learning research models complex phenomena, previous studies have mostly focused on unimodal sequences. The goal of the current experiment is to put implicit sequence learning into a multimodal context: to test whether it can operate across different modalities. We used the Task Sequence Learning paradigm to test whether sequence learning varies across modalities, and whether participants are able to learn multimodal sequences. Our results show that implicit sequence learning is very similar regardless of the source modality. However, the presence of correlated task and response sequences was required for learning to take place. The experiment provides new evidence for implicit sequence learning of abstract conceptual representations. In general, the results suggest that correlated sequences are necessary for implicit sequence learning to occur. Moreover, they show that elements from different modalities can be automatically integrated into one unitary multimodal sequence.

  19. A bacterial genetic screen identifies functional coding sequences of the insect mariner transposable element Famar1 amplified from the genome of the earwig, Forficula auricularia.

    PubMed Central

    Barry, Elizabeth G; Witherspoon, David J; Lampe, David J

    2004-01-01

    Transposons of the mariner family are widespread in animal genomes and have apparently infected them by horizontal transfer. Most species carry only old defective copies of particular mariner transposons that have diverged greatly from their active horizontally transferred ancestor, while a few contain young, very similar, and active copies. We report here the use of a whole-genome screen in bacteria to isolate somewhat diverged Famar1 copies from the European earwig, Forficula auricularia, that encode functional transposases. Functional and nonfunctional coding sequences of Famar1 and nonfunctional copies of Ammar1 from the European honey bee, Apis mellifera, were sequenced to examine their molecular evolution. No selection for sequence conservation was detected in any clade of a tree derived from these sequences, not even on branches leading to functional copies. This agrees with the current model for mariner transposon evolution that expects neutral evolution within particular hosts, with selection for function occurring only upon horizontal transfer to a new host. Our results further suggest that mariners are not finely tuned genetic entities and that a greater amount of sequence diversification than had previously been appreciated can occur in functional copies in a single host lineage. Finally, this method of isolating active copies can be used to isolate other novel active transposons without resorting to reconstruction of ancestral sequences. PMID:15020471

  20. In situ sulfur isotopes (δ(34)S and δ(33)S) analyses in sulfides and elemental sulfur using high sensitivity cones combined with the addition of nitrogen by laser ablation MC-ICP-MS.

    PubMed

    Fu, Jiali; Hu, Zhaochu; Zhang, Wen; Yang, Lu; Liu, Yongsheng; Li, Ming; Zong, Keqing; Gao, Shan; Hu, Shenghong

    2016-03-10

    The sulfur isotope is an important geochemical tracer in diverse fields of geosciences. In this study, the effects of three different cone combinations with the addition of N2 on the performance of in situ S isotope analyses were investigated in detail. The signal intensities of S isotopes were improved by a factor of 2.3 and 3.6 using the X skimmer cone combined with the standard sample cone or the Jet sample cone, respectively, compared with the standard arrangement (H skimmer cone combined with the standard sample cone). This signal enhancement is important for the improvement of the precision and accuracy of in situ S isotope analysis at high spatial resolution. Different cone combinations have a significant effect on the mass bias and mass bias stability for S isotopes. Poor precisions of S isotope ratios were obtained using the Jet and X cones combination at their corresponding optimum makeup gas flow when using Ar plasma only. The addition of 4-8 ml min(-1) nitrogen to the central gas flow in laser ablation MC-ICP-MS was found to significantly enlarge the mass bias stability zone at their corresponding optimum makeup gas flow in these three different cone combinations. The polyatomic interferences of OO, SH, OOH were also significantly reduced, and the interference free plateaus of sulfur isotopes became broader and flatter in the nitrogen mode (N2 = 4 ml min(-1)). However, the signal intensity of S was not increased by the addition of nitrogen in this study. The laser fluence and ablation mode had significant effects on sulfur isotope fractionation during the analysis of sulfides and elemental sulfur by laser ablation MC-ICP-MS. The matrix effect among different sulfides and elemental sulfur was observed, but could be significantly reduced by line scan ablation in preference to single spot ablation under the optimized fluence. It is recommended that the d90 values of the particles in pressed powder pellets for accurate and precise S isotope analysis

  1. Complete Genome Sequence of a Cylindrospermopsin-Producing Cyanobacterium, Cylindrospermopsis raciborskii CS505, Containing a Circular Chromosome and a Single Extrachromosomal Element

    PubMed Central

    Fuentes-Valdés, Juan J.; Plominsky, Alvaro M.; Allen, Eric E.; Tamames, Javier

    2016-01-01

    Cylindrospermopsis raciborskii is a freshwater cyanobacterium producing bloom events and toxicity in drinking water source reservoirs. We present the first genome sequence for C. raciborskii CS505 (Australia), containing one 4.1-Mbp chromosome and one 110-Kbp plasmid having G+C contents of 40.3% (3933 genes) and 39.3% (111 genes), respectively. PMID:27563040

  2. The Integrated Sequence: An Innovative Component of Four Courses in the General Education Program at Davis & Elkins College. A Digest of Program Elements, Developmental Background, and Faculty Dynamics.

    ERIC Educational Resources Information Center

    Gartmann, Will

    The Integrated Sequence Program at Davis & Elkins College, which consists of four team-taught, interdisciplinary courses, is described, along with the origins and philosophy of the program. The courses are as follows: Human Freedom and the Counterforces (freshman year); World Culture (sophomore year); Comparative Ideas (junior year); and The…

  3. CHARACTERIZATION AND NUCLEOTIDE SEQUENCE DETERMINATION OF A REPEAT ELEMENT ISOLATED FROM A 2,4,5,-T DEGRADING STRAIN OF PSEUDOMONAS CEPACIA

    EPA Science Inventory

    Pseudomonas cepacia strain AC1100, capable of growth on 2,4,5-trichlorophenoxyacetic acid (2,4,5-T), was mutated to the 2,4,5-T− strain PT88 by a ColE1 :: Tn5 chromosomal insertion. Using cloned DNA from the region flanking the insertion, a 1477-bp sequence (designated RS1100) wa...

  4. Pilot Sequencing of Onion Genomic DNA Reveals Fragments of Transposable Elements, Low Gene Densities, and Significant Gene Enrichment After Methyl Filtration

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Onion (Allium cepa) is a diploid (2n=2x=16) monocot with one of the largest nuclear genomes among cultivated plants, over 6 and 16 times that of maize and rice, respectively. In this study, we sequenced onion BACs to estimate gene densities and investigate the nature and distribution of repetitive ...

  5. Mobile DNA elements in the generation of diversity and complexity in the brain.

    PubMed

    Erwin, Jennifer A; Marchetto, Maria C; Gage, Fred H

    2014-08-01

    Mobile elements are DNA sequences that can change their position (retrotranspose) within the genome. Although its biological function is largely unappreciated, DNA derived from mobile elements comprises nearly half of the human genome. It has long been thought that neuronal genomes are invariable; however, recent studies have demonstrated that mobile elements actively retrotranspose during neurogenesis, thereby creating genomic diversity between neurons. In addition, mounting data demonstrate that mobile elements are misregulated in certain neurological disorders, including Rett syndrome and schizophrenia.

  6. Mobile DNA elements in the generation of diversity and complexity in the brain

    PubMed Central

    Erwin, Jennifer A.; Marchetto, Maria C.; Gage, Fred H.

    2015-01-01

    Mobile elements are DNA sequences that can change their position (retrotranspose) within the genome. Although its biological function is largely unappreciated, DNA derived from mobile elements comprises nearly half of the human genome. It has long been thought that neuronal genomes are invariable; however, recent studies have demonstrated that mobile elements actively retrotranspose during neurogenesis, thereby creating genomic diversity between neurons. In addition, mounting data demonstrate that mobile elements are misregulated in certain neurological disorders, including Rett syndrome and schizophrenia. PMID:25005482

  7. Insertion Sequences

    PubMed Central

    Mahillon, Jacques; Chandler, Michael

    1998-01-01

    Insertion sequences (ISs) constitute an important component of most bacterial genomes. Over 500 individual ISs have been described in the literature to date, and many more are being discovered in the ongoing prokaryotic and eukaryotic genome-sequencing projects. The last 10 years have also seen some striking advances in our understanding of the transposition process itself. Not least of these has been the development of various in vitro transposition systems for both prokaryotic and eukaryotic elements and, for several of these, a detailed understanding of the transposition process at the chemical level. This review presents a general overview of the organization and function of insertion sequences of eubacterial, archaebacterial, and eukaryotic origins with particular emphasis on bacterial elements and on different aspects of the transposition mechanism. It also attempts to provide a framework for classification of these elements by assigning them to various families or groups. A total of 443 members of the collection have been grouped in 17 families based on combinations of the following criteria: (i) similarities in genetic organization (arrangement of open reading frames); (ii) marked identities or similarities in the enzymes which mediate the transposition reactions, the recombinases/transposases (Tpases); (iii) similar features of their ends (terminal IRs); and (iv) fate of the nucleotide sequence of their target sites (generation of a direct target duplication of determined length). A brief description of the mechanism(s) involved in the mobility of individual ISs in each family and of the structure-function relationships of the individual Tpases is included where available. PMID:9729608

  8. Repetitive Elements in Mycoplasma hyopneumoniae Transcriptional Regulation

    PubMed Central

    Cattani, Amanda Malvessi; Siqueira, Franciele Maboni; Guedes, Rafael Lucas Muniz; Schrank, Irene Silveira

    2016-01-01

    Transcriptional regulation, a multiple-step process, is still poorly understood in the important pig pathogen Mycoplasma hyopneumoniae. Basic motifs like promoters and terminators have already been described, but no other cis-regulatory elements have been found. DNA repeat sequences have been shown to be an interesting potential source of cis-regulatory elements. In this work, a genome-wide search for tandem and palindromic repetitive elements was performed in the intergenic regions of all coding sequences from M. hyopneumoniae strain 7448. Computational analysis demonstrated the presence of 144 tandem repeats and 1,171 palindromic elements. The DNA repeat sequences were distributed within the 5’ upstream regions of 86% of transcriptional units of M. hyopneumoniae strain 7448. Comparative analysis between distinct repetitive sequences found in related mycoplasma genomes demonstrated different percentages of conservation among pathogenic and nonpathogenic strains. qPCR assays revealed differential expression among genes showing variable numbers of repetitive elements. In addition, repeats found in 206 genes already described to be differentially regulated under different culture conditions of M. hyopneumoniae strain 232 showed almost 80% conservation in relation to M. hyopneumoniae strain 7448 repeats. Altogether, these findings suggest a potential regulatory role of tandem and palindromic DNA repeats in the M. hyopneumoniae transcriptional profile. PMID:28005945

  9. Repetitive Elements in Mycoplasma hyopneumoniae Transcriptional Regulation.

    PubMed

    Cattani, Amanda Malvessi; Siqueira, Franciele Maboni; Guedes, Rafael Lucas Muniz; Schrank, Irene Silveira

    2016-01-01

    Transcriptional regulation, a multiple-step process, is still poorly understood in the important pig pathogen Mycoplasma hyopneumoniae. Basic motifs like promoters and terminators have already been described, but no other cis-regulatory elements have been found. DNA repeat sequences have been shown to be an interesting potential source of cis-regulatory elements. In this work, a genome-wide search for tandem and palindromic repetitive elements was performed in the intergenic regions of all coding sequences from M. hyopneumoniae strain 7448. Computational analysis demonstrated the presence of 144 tandem repeats and 1,171 palindromic elements. The DNA repeat sequences were distributed within the 5' upstream regions of 86% of transcriptional units of M. hyopneumoniae strain 7448. Comparative analysis between distinct repetitive sequences found in related mycoplasma genomes demonstrated different percentages of conservation among pathogenic and nonpathogenic strains. qPCR assays revealed differential expression among genes showing variable numbers of repetitive elements. In addition, repeats found in 206 genes already described to be differentially regulated under different culture conditions of M. hyopneumoniae strain 232 showed almost 80% conservation in relation to M. hyopneumoniae strain 7448 repeats. Altogether, these findings suggest a potential regulatory role of tandem and palindromic DNA repeats in the M. hyopneumoniae transcriptional profile.

  10. Ossification sequence heterochrony among amphibians.

    PubMed

    Harrington, Sean M; Harrison, Luke B; Sheil, Christopher A

    2013-01-01

    Heterochrony is an important mechanism in the evolution of amphibians. Although studies have centered on the relationship between size and shape and the rates of development, ossification sequence heterochrony also may have been important. Rigorous, phylogenetic methods for assessing sequence heterochrony are relatively new, and a comprehensive study of the relative timing of ossification of skeletal elements has not been used to identify instances of sequence heterochrony across Amphibia. In this study, a new version of the program Parsimov-based genetic inference (PGi) was used to identify shifts in ossification sequences across all extant orders of amphibians, for all major structural units of the skeleton. PGi identified a number of heterochronic sequence shifts in all analyses, the most interesting of which seem to be tied to differences in metamorphic patterns among major clades. Early ossification of the vomer, premaxilla, and dentary is retained by Apateon caducus and members of Gymnophiona and Urodela, which lack the strongly biphasic development seen in anurans. In contrast, bones associated with the jaws and face were identified as shifting late in the ancestor of Anura. The bones that do not shift late, and thereby occupy the earliest positions in the anuran cranial sequence, are those in regions of the skull that undergo the least restructuring throughout anuran metamorphosis. Additionally, within Anura, bones of the hind limb and pelvic girdle were also identified as shifting early in the sequence of ossification, which may be a result of functional constraints imposed by the drastic metamorphosis of most anurans.

  11. CROSS-DISCIPLINARY PHYSICS AND RELATED AREAS OF SCIENCE AND TECHNOLOGY: Simulation of SET Operation in Phase-Change Random Access Memories with Heater Addition and Ring-Type Contactor for Low-Power Consumption by Finite Element Modeling

    NASA Astrophysics Data System (ADS)

    Gong, Yue-Feng; Song, Zhi-Tang; Ling, Yun; Liu, Yan; Feng, Song-Lin

    2009-11-01

    A three-dimensional finite element model for phase change random access memory (PCRAM) is established for comprehensive electrical and thermal analysis during SET operation. The SET behaviours of the heater addition structure (HS) and the ring-type contact in bottom electrode (RIB) structure are compared with each other. There are two ways to reduce the RESET current, applying a high resistivity interfacial layer and building a new device structure. The simulation results indicate that the variation of SET current with different power reduction ways is little. This study takes the RESET and SET operation current into consideration, showing that the RIB structure PCRAM cell is suitable for future devices with high heat efficiency and high-density, due to its high heat efficiency in RESET operation.

  12. An evaluation of Comparative Genome Sequencing (CGS) by comparing two previously-sequenced bacterial genomes

    PubMed Central

    Herring, Christopher D; Palsson, Bernhard Ø

    2007-01-01

    Background With the development of new technology, it has recently become practical to resequence the genome of a bacterium after experimental manipulation. It is critical though to know the accuracy of the technique used, and to establish confidence that all of the mutations were detected. Results In order to evaluate the accuracy of genome resequencing using the microarray-based Comparative Genome Sequencing service provided by Nimblegen Systems Inc., we resequenced the E. coli strain W3110 Kohara using MG1655 as a reference, both of which have been completely sequenced using traditional sequencing methods. CGS detected 7 of 8 small sequence differences, one large deletion, and 9 of 12 IS element insertions present in W3110, but did not detect a large chromosomal inversion. In addition, we confirmed that CGS also detected 2 SNPs, one deletion and 7 IS element insertions that are not present in the genome sequence, which we attribute to changes that occurred after the creation of the W3110 lambda clone library. The false positive rate for SNPs was one per 244 Kb of genome sequence. Conclusion CGS is an effective way to detect multiple mutations present in one bacterium relative to another, and while highly cost-effective, is prone to certain errors. Mutations occurring in repeated sequences or in sequences with a high degree of secondary structure may go undetected. It is also critical to follow up on regions of interest in which SNPs were not called because they often indicate deletions or IS element insertions. PMID:17697331

  13. Identification of novel random amplified polymorphic DNAs (RAPDs) on the W chromosome of the domesticated silkworm, Bombyx mori, and the wild silkworm, B. mandarina, and their retrotransposable element-related nucleotide sequences.

    PubMed

    Abe, H; Kanehara, M; Terada, T; Ohbayashi, F; Shimada, T; Kawai, S; Suzuki, M; Sugasaki, T; Oshiki, T

    1998-08-01

    Genomic DNAs were compared between males and females of the domesticated silkworm, Bombyx mori, strains C108, C137, J137, p50, and WILD-W (constructed by crossing a wild silkworm, B. mandarina, female with a male of strain C108) by polymerase chain reaction (PCR) with 700 arbitrary 10-mer primers. Four female-specific RAPDs (W-Kabuki, W-Samurai, W-Kamikaze, and W-Yamato) were found. The sex chromosome formulas of B. mori and B. mandarina are ZW (XY) for the female and ZZ (XX) for the male. The four female-specific RAPDs are assumed to be derived from the W chromosome because the other chromosomes are shared by both sexes. A computer search for deduced amino acid sequences of these four RAPDs revealed that all of them showed homology to previously reported amino acid sequences encoded in known retrotransposable elements from various organisms.

  14. Complete Sequence of a F33:A-:B- Conjugative Plasmid Carrying the oqxAB, fosA3, and blaCTX-M-55 Elements from a Foodborne Escherichia coli Strain

    PubMed Central

    Xie, Miaomiao; Xie, Liqi; Lin, Dachuan; Li, Ruichao; Zhou, Yuanjie; Chan, Edward W.; Chen, Sheng

    2016-01-01

    This study reports the complete sequence of pE80, a conjugative IncFII plasmid recovered from an Escherichia coli strain isolated from chicken meat. This plasmid harbors multiple resistance determinants including oqxAB, fosA3, blaCTX-M-55, and blaTEM-1, and is a close variant of the recently reported p42-2 element, which was recovered from E. coli of veterinary source. Recovery of pE80 constitutes evidence that evolution or genetic re-arrangement of IncFII type plasmids residing in animal-borne organisms is an active event, which involves acquisition and integration of foreign resistance elements into the plasmid backbone. Dissemination of these plasmids may further compromise the effectiveness of current antimicrobial strategies. PMID:27833607

  15. Sequences of a co-existing SXT element, a chromosomal integron (CI) and an IncA/C plasmid and their roles in multidrug resistance in a Vibrio cholerae O1 El Tor strain.

    PubMed

    Wang, Ruibai; Li, Jie; Kan, Biao

    2016-09-01

    The ongoing seventh cholera pandemic is attributed to Vibrio cholerae O1 El Tor biotype strains. Although antibiotic therapy ameliorates symptoms in patients and reduces pathogen transfer to the environment, multidrug resistance remains a major clinical threat. An O1 El Tor strain isolated from a patient in 1998 was intermediate or resistant to 13 antibiotics and could potentially produce extended-spectrum β-lactamase (ESBL), which is very rare in O1 strains. Using genome sequencing, three relevant genetic elements were identified in this strain: a hybrid SXT element (ICEVchCHN1307); a new IncA/C plasmid (pVC1307); and a chromosomal integron. Twenty antibiotic resistance genes were located on them, including blaTEM-1, blaCTX-M-14 and phenotypically silenced tetRA genes. These data elucidate the role of individual genetic components in antibiotic resistance and the accumulation of drug resistance genes in V. cholerae.

  16. A large protein containing zinc finger domains binds to related sequence elements in the enhancers of the class I major histocompatibility complex and kappa immunoglobulin genes.

    PubMed Central

    Baldwin, A S; LeClair, K P; Singh, H; Sharp, P A

    1990-01-01

    A cDNA from a B-cell library was previously isolated that encodes a sequence-specific DNA-binding protein with affinities for related sites in a class I major histocompatibility complex (MHC) and kappa immunoglobulin gene enhancers. We report here approximately 6.5 kilobases of sequence of the MBP-1 (MHC enhancer binding protein 1) cDNA. MBP-1 protein has a molecular weight predicted to be greater than 200,000. A DNA-binding domain with high affinity for the MHC enhancer sequence TGGGGATTCCCCA was localized to an 118-amino-acid protein fragment containing two zinc fingers of the class Cys2-X12-His2. Analysis of expression of MBP-1 mRNA revealed relatively high expression in HeLa cells and in a human retinal cell line, with lower levels in Jurkat T cells and in two B-cell lines. Interestingly, expression of MBP-1 mRNA was inducible by mitogen and phorbol ester treatment of Jurkat T cells and by serum treatment of confluent serum-deprived human fibroblasts. Images PMID:2108316

  17. Regulation of DNA replication at the end of the mitochondrial D-loop involves the helicase TWINKLE and a conserved sequence element

    PubMed Central

    Jemt, Elisabeth; Persson, Örjan; Shi, Yonghong; Mehmedovic, Majda; Uhler, Jay P.; Dávila López, Marcela; Freyer, Christoph; Gustafsson, Claes M.; Samuelsson, Tore; Falkenberg, Maria

    2015-01-01

    The majority of mitochondrial DNA replication events are terminated prematurely. The nascent DNA remains stably associated with the template, forming a triple-stranded displacement loop (D-loop) structure. However, the function of the D-loop region of the mitochondrial genome remains poorly understood. Using a comparative genomics approach we here identify two closely related 15 nt sequence motifs of the D-loop, strongly conserved among vertebrates. One motif is at the D-loop 5′-end and is part of the conserved sequence block 1 (CSB1). The other motif, here denoted coreTAS, is at the D-loop 3′-end. Both these sequences may prevent transcription across the D-loop region, since light and heavy strand transcription is terminated at CSB1 and coreTAS, respectively. Interestingly, the replication of the nascent D-loop strand, occurring in a direction opposite to that of heavy strand transcription, is also terminated at coreTAS, suggesting that coreTAS is involved in termination of both transcription and replication. Finally, we demonstrate that the loading of the helicase TWINKLE at coreTAS is reversible, implying that this site is a crucial component of a switch between D-loop formation and full-length mitochondrial DNA replication. PMID:26253742

  18. Basal ganglia subcircuits distinctively encode the parsing and concatenation of action sequences.

    PubMed

    Jin, Xin; Tecuapetla, Fatuel; Costa, Rui M

    2014-03-01

    Chunking allows the brain to efficiently organize memories and actions. Although basal ganglia circuits have been implicated in action chunking, little is known about how individual elements are concatenated into a behavioral sequence at the neural level. Using a task in which mice learned rapid action sequences, we uncovered neuronal activity encoding entire sequences as single actions in basal ganglia circuits. In addition to neurons with activity related to the start/stop activity signaling sequence parsing, we found neurons displaying inhibited or sustained activity throughout the execution of an entire sequence. This sustained activity covaried with the rate of execution of individual sequence elements, consistent with motor concatenation. Direct and indirect pathways of basal ganglia were concomitantly active during sequence initiation, but behaved differently during sequence performance, revealing a more complex functional organization of these circuits than previously postulated. These results have important implications for understanding the functional organization of basal ganglia during the learning and execution of action sequences.

  19. Food additives

    PubMed Central

    Spencer, Michael

    1974-01-01

    Food additives are discussed from the food technology point of view. The reasons for their use are summarized: (1) to protect food from chemical and microbiological attack; (2) to even out seasonal supplies; (3) to improve their eating quality; (4) to improve their nutritional value. The various types of food additives are considered, e.g. colours, flavours, emulsifiers, bread and flour additives, preservatives, and nutritional additives. The paper concludes with consideration of those circumstances in which the use of additives is (a) justified and (b) unjustified. PMID:4467857

  20. Origins of hematite and redox-sensitive elements in a 3.46 Ga jasper-basalt sequence in ABDP #1 core from Pilbara, Western Australia

    NASA Astrophysics Data System (ADS)

    Ohmoto, H.; Bevacqua, D. C.; Watanabe, Y.

    2010-12-01

    Previous researchers suggested that the abundant hematite crystals in surface outcrops of 3.46 Ga jasper and submarine basalt in the Marble Bar area, Western Australia were modern oxidation products of siderite and pyrite. Drilling at ABDP #1 site (260 m long at ~50° angle) was carried out to obtain modern oxidation-free samples of the jasper and submarine basalt and to conduct research aimed at constraining the redox state of the Archean oceans and atmosphere. The deep drill core samples were found to contain hematite crystals as abundantly as those in surface outcrops, suggesting that the hematite crystals are not modern oxidation products. We have conducted petrological, mineralogical, and geochemical investigations on more than 100 samples of chert/jasper and basalt. Based partly on the textural relationships among minerals in SEM and TEM images, we (Hoashi et al., Nature Geosciences, 2009) have concluded that the hematite crystals in the jasper beds formed at >60°C on and/or near the deep (>200 m) ocean floor by the mixing of ferrous iron-rich hydrothermal fluids and oxygen-rich deep ocean water. Hematite crystals in basalts, which occur at below, inter bedded with, and above the jasper beds, were most likely formed by the same processes. Hematite-rich jaspers and basalts in ABDP #1 core show significant enrichments of many redox-sensitive elements (e.g., Fe3+, Mn, U, Mo, REEs), as well as some non-redox sensitive elements (e.g., Li, Ba, Sr). Negative Ce anomalies are commonly found in these samples. These characteristics are essentially identical to those in jaspers and basalts in many modern submarine hydrothermal systems. These data suggest that since at least ~3.46 Ga ago: (1) the geochemistry and mineralogy of submarine hydrothermal deposits and associated basalts have been dictated by reducing (Fe- and Mn rich) hydrothermal fluids and oxidizing deep ocean water; (2) the concentrations of many redox-senstive (and other) elements in the oceans have been

  1. AdoMet radical proteins—from structure to evolution—alignment of divergent protein sequences reveals strong secondary structure element conservation

    PubMed Central

    Nicolet, Yvain; Drennan, Catherine L.

    2004-01-01

    Eighteen subclasses of S-adenosyl-l-methionine (AdoMet) radical proteins have been aligned in the first bioinformatics study of the AdoMet radical superfamily to utilize crystallographic information. The recently resolved X-ray structure of biotin synthase (BioB) was used to guide the multiple sequence alignment, and the recently resolved X-ray structure of coproporphyrinogen III oxidase (HemN) was used as the control. Despite the low 9% sequence identity between BioB and HemN, the multiple sequence alignment correctly predicted all but one of the core helices in HemN, and correctly predicted the residues in the enzyme active site. This alignment further suggests that the AdoMet radical proteins may have evolved from half-barrel structures (αβ)4 to three-quarter-barrel structures (αβ)6 to full-barrel structures (αβ)8. It predicts that anaerobic ribonucleotide reductase (RNR) activase, an ancient enzyme that, it has been suggested, serves as a link between the RNA and DNA worlds, will have a half-barrel structure, whereas the three-quarter barrel, exemplified by HemN, will be the most common architecture for AdoMet radical enzymes, and fewer members of the superfamily will join BioB in using a complete (αβ)8 TIM-barrel fold to perform radical chemistry. These differences in barrel architecture also explain how AdoMet radical enzymes can act on substrates that range in size from 10 atoms to 608 residue proteins. PMID:15289575

  2. Senescence responsive transcriptional element

    DOEpatents

    Campisi, Judith; Testori, Alessandro

    1999-01-01

    Recombinant polynucleotides have expression control sequences that have a senescence responsive element and a minimal promoter, and which are operatively linked to a heterologous nucleotide sequence. The molecules are useful for achieving high levels of expression of genes in senescent cells. Methods of inhibiting expression of genes in senescent cells also are provided.

  3. Aryl hydrocarbon-induced interactions at multiple DNA elements of diverse sequence--a multicomponent mechanism for activation of cytochrome P4501A1 (CYP1A1) gene transcription.

    PubMed Central

    Robertson, R W; Zhang, L; Pasco, D S; Fagan, J B

    1994-01-01

    In vivo footprinting experiments, augmented with gel shift and transfection analyses suggest that activation of the CYP1A1 gene by aryl hydrocarbons may be a multicomponent process. During the first 30 minutes of exposure to aryl hydrocarbon carcinogens and environmental contaminants, in vivo footprints appear at nine distinct sites within a 281 bp region centered 950 bp upstream of the CYP1A1 transcription start site. Six of these sites are unrelated in sequence to the three xenobiotic response elements (XREs) within this region, at which the aryl hydrocarbon (AH) receptor is known to bind. These six display a variety of footprint patterns, are diverse in sequence and range in G-C content from 60 to 75%. This diversity suggests that multiple nuclear factors may be responsible for these six in vivo footprints. These observations are consistent with competition gel shift experiments showing that the nuclear factors binding at two of these sites are different from each other, as well as from the AH receptor. Gel shifts also indicate that the sequence-specific factors binding at these sites are expressed constitutively. This is consistent with a model in which in vivo footprints are induced at these six sites, not through direct activation or de novo synthesis of DNA-binding factors, but through a two phase mechanism in which binding of the nuclear AH receptor complex to XREs facilitates the binding of constitutive factors at these sites. This facilitation could be mediated either through specific protein-protein interactions or through alterations in chromatin structure that make these sites accessible to constitutive nuclear factors. A function for the sequences at which aryl hydrocarbons induce in vivo footprints is suggested by transfection experiments showing that one of these sequences cooperates with a weak XRE to confer on a reporter gene responsiveness to aryl hydrocarbons. Images PMID:8202380

  4. Estimation of long terminal repeat element content in the Helicoverpa zea genome from high-throughput sequencing of bacterial artificial chromosome pools.

    PubMed

    Coates, Brad S; Abel, Craig A; Perera, Omaththage P

    2017-04-01

    The lepidopteran pest insect Helicoverpa zea feeds on cultivated corn and cotton across the Americas where control remains challenging owing to the evolution of resistance to chemical and transgenic insecticidal toxins, yet genomic resources remain scarce for this species. A bacterial artificial chromosome (BAC) library having a mean genomic insert size of 145 ± 20 kbp was created from a laboratory strain of H. zea, which provides ∼12.9-fold coverage of a 362.8 ± 8.8 Mbp (0.37 ± 0.09 pg) flow cytometry estimated haploid genome size. Assembly of Illumina HiSeq 2000 reads generated from 14 pools that encompassed all BAC clones resulted in 165 485 genomic contigs (N50 = 3262 bp; 324.6 Mbp total). Long terminal repeat (LTR) protein coding regions annotated from 181 contigs included 30 Ty1/copia, 78 Ty3/gypsy, and 73 BEL/Pao elements, of which 60 (33.1%) encoded all five functional polyprotein (pol) domains. Approximately 14% of LTR elements are distributed non-randomly across pools of BAC clones.

  5. Activation of the major immediate early gene of human cytomegalovirus by cis-acting elements in the promoter-regulatory sequence and by virus-specific trans-acting components.

    PubMed Central

    Stinski, M F; Roehr, T J

    1985-01-01

    Upstream of the major immediate early gene of human cytomegalovirus (Towne) is a strong promoter-regulatory region that promotes the synthesis of 1.95-kilobase mRNA (D. R. Thomsen, R. M. Stenberg, W. F. Goins, and M. F. Stinski, Proc. Natl. Acad. Sci. U.S.A. 81:659-663, 1984; M. F. Stinski, D. R. Thomsen, R. M. Stenberg, and L. C. Goldstein, J. Virol. 46:1-14, 1983). The wild-type promoter-regulatory region as well as deletions within this region were ligated upstream of the thymidine kinase, chloramphenicol acetyltransferase, or ovalbumin genes. These gene chimeras were constructed to investigate the role of the regulatory sequences in enhancing downstream expression. The regulatory region extends to approximately 465 nucleotides upstream of the cap site for the initiation of transcription. The extent and type of regulatory sequences upstream of the promoter influences the level of in vitro transcription as well as the amount of in vivo expression of the downstream gene. The regulatory elements for cis-activation appear to be repeated several times within the regulatory region. A direct correlation was established between the distribution of the 19 (5' CCCCAGTTGACGTCAATGGG 3')- and 18 (5' CACTAACGGGACTTTCCAA 3')-nucleotide repeats and the level of downstream expression. In contrast, the 16 (5' CTTGGCAGTACATCAA 3')-nucleotide repeat is not necessary for the enhancement of downstream expression. In a domain associated with the 19- or 18-nucleotide repeats are elements that can be activated in trans by a human cytomegalovirus-specified component but not a herpes simplex virus-specified component. Therefore, the regulatory sequences of the major immediate early gene of human cytomegalovirus have an important role in interacting with cellular and virus-specific factors of the transcription complex to enhance downstream expression of this critical viral gene. Images PMID:2991567

  6. The E6/E7 promoter of human papillomavirus type 16 is activated in the absence of E2 proteins by a sequence-aberrant Sp1 distal element.

    PubMed Central

    Gloss, B; Bernard, H U

    1990-01-01

    The E6/E7 promoter of all genital human papillomaviruses is responsible for expression of the viral transforming genes. Centered 60 bp upstream of the transcription start, it contains a 20-bp segment with partially overlapping binding sites for the viral E2 proteins and for a cellular factor that was identified by footprint experiments. Bandshifts, bandshift competitions, and footprints revealed that protein complexes between nuclear extracts and these sequences have binding properties indistinguishable from those of the Sp1 factor that binds the simian virus 40 early promoter GC motif. Reactions of these complexes with anti-Sp1 antiserum were analyzed by superbandshifts and precipitation with protein A, and the results confirmed the identity of this transcription factor as Sp1. Sp1 binds in simian virus 40 and different human papillomavirus promoters the consensus sequence 5'-NGGNGN-3'. RNase protection analysis of in vitro or in vivo transcriptions with wild-type and mutant test vectors shows that the E6/E7 promoter of human papillomavirus type 16 is functionally dependent on the Sp1 distal promoter element. In all genital papillomaviruses, the Sp1 hexamer is invariably spaced by a single nucleotide from the distal E2 element, suggesting some precise interaction between Sp1 and E2 proteins. Published experimental evidence documents negative regulation of the E6/E7 promoter by E2 proteins through the proximal E2 element, whereas only minor quantitative differences in E6/E7 promoter function after cotransfection with E2 expression vectors were observed in this study. A detailed study of the interactions of Sp1 and E2 proteins with one another and with the corresponding three binding sites may reveal a complex modulation of this promoter. Images PMID:2170687

  7. Food additives

    MedlinePlus

    ... or natural. Natural food additives include: Herbs or spices to add flavor to foods Vinegar for pickling ... Certain colors improve the appearance of foods. Many spices, as well as natural and man-made flavors, ...

  8. Clinical Impact of Additional Cytogenetic Aberrations, cKIT and RAS Mutations, and Treatment Elements in Pediatric t(8;21)-AML: Results From an International Retrospective Study by the International Berlin-Frankfurt-Münster Study Group

    PubMed Central

    Klein, Kim; Kaspers, Gertjan; Harrison, Christine J.; Beverloo, H. Berna; Reedijk, Ardine; Bongers, Mathilda; Cloos, Jacqueline; Pession, Andrea; Reinhardt, Dirk; Zimmerman, Martin; Creutzig, Ursula; Dworzak, Michael; Alonzo, Todd; Johnston, Donna; Hirsch, Betsy; Zapotocky, Michal; De Moerloose, Barbara; Fynn, Alcira; Lee, Vincent; Taga, Takashi; Tawa, Akio; Auvrignon, Anne; Zeller, Bernward; Forestier, Erik; Salgado, Carmen; Balwierz, Walentyna; Popa, Alexander; Rubnitz, Jeffrey; Raimondi, Susana; Gibson, Brenda

    2015-01-01

    Purpose This retrospective cohort study aimed to determine the predictive relevance of clinical characteristics, additional cytogenetic aberrations, and cKIT and RAS mutations, as well as to evaluate whether specific treatment elements were associated with outcomes in pediatric t(8;21)-positive patients with acute myeloid leukemia (AML). Patients and Methods Karyotypes of 916 pediatric patients with t(8;21)-AML were reviewed for the presence of additional cytogenetic aberrations, and 228 samples were screened for presence of cKIT and RAS mutations. Multivariable regression models were used to assess the relevance of anthracyclines, cytarabine, and etoposide during induction and overall treatment. End points were the probability of achieving complete remission, cumulative incidence of relapse (CIR), probability of event-free survival, and probability of overall survival. Results Of 838 patients included in final analyses, 92% achieved complete remission. The 5-year overall survival, event-free survival, and CIR were 74%, 58%, and 26%, respectively. cKIT mutations and RAS mutations were not significantly associated with outcome. Patients with deletions of chromosome arm 9q [del(9q); n = 104] had a lower probability of complete remission (P = .01). Gain of chromosome 4 (+4; n = 21) was associated with inferior CIR and survival (P < .01). Anthracycline doses greater than 150 mg/m2 and etoposide doses greater than 500 mg/m2 in the first induction course and high-dose cytarabine 3 g/m2 during induction were associated with better outcomes on various end points. Cumulative doses of cytarabine greater than 30 g/m2 and etoposide greater than 1,500 mg/m2 were associated with lower CIR rates and better probability of event-free survival. Conclusion Pediatric patients with t(8;21)-AML and additional del(9q) or additional +4 might not be considered at good risk. Patients with t(8;21)-AML likely benefit from protocols that have high doses of anthracyclines, etoposide, and

  9. Deletion of ultraconserved elements yields viable mice

    SciTech Connect

    Ahituv, Nadav; Zhu, Yiwen; Visel, Axel; Holt, Amy; Afzal, Veena; Pennacchio, Len A.; Rubin, Edward M.

    2007-07-15

    Ultraconserved elements have been suggested to retainextended perfect sequence identity between the human, mouse, and ratgenomes due to essential functional properties. To investigate thenecessities of these elements in vivo, we removed four non-codingultraconserved elements (ranging in length from 222 to 731 base pairs)from the mouse genome. To maximize the likelihood of observing aphenotype, we chose to delete elements that function as enhancers in amouse transgenic assay and that are near genes that exhibit markedphenotypes both when completely inactivated in the mouse as well as whentheir expression is altered due to other genomic modifications.Remarkably, all four resulting lines of mice lacking these ultraconservedelements were viable and fertile, and failed to reveal any criticalabnormalities when assayed for a variety of phenotypes including growth,longevity, pathology and metabolism. In addition more targeted screens,informed by the abnormalities observed in mice where genes in proximityto the investigated elements had been altered, also failed to revealnotable abnormalities. These results, while not inclusive of all thepossible phenotypic impact of the deleted sequences, indicate thatextreme sequence constraint does not necessarily reflect crucialfunctions required for viability.

  10. Dominant short repeated sequences in bacterial genomes.

    PubMed

    Avershina, Ekaterina; Rudi, Knut

    2015-03-01

    We use a novel multidimensional searching approach to present the first exhaustive search for all possible repeated sequences in 166 genomes selected to cover the bacterial domain. We found an overrepresentation of repeated sequences in all but one of the genomes. The most prevalent repeats by far were related to interspaced short palindromic repeats (CRISPRs)—conferring bacterial adaptive immunity. We identified a deep branching clade of thermophilic Firmicutes containing the highest number of CRISPR repeats. We also identified a high prevalence of tandem repeated heptamers. In addition, we identified GC-rich repeats that could potentially be involved in recombination events. Finally, we identified repeats in a 16322 amino acid mega protein (involved in biofilm formation) and inverted repeats flanking miniature transposable elements (MITEs). In conclusion, the exhaustive search for repeated sequences identified new elements and distribution of these, which has implications for understanding both the ecology and evolution of bacteria.

  11. The distribution alloying elements in alnico 8 and 9 magnets: Site preference of ternary Ti, Fe, Co, and Ni additions in DO3 Fe3Al, Co3Al, and Ni3Al based intermetallic phases

    NASA Astrophysics Data System (ADS)

    Samolyuk, G. D.; Újfalussy, B.; Stocks, G. M.

    2014-11-01

    Recently, interest in alnico magnetic alloys has been rekindled due to their potential to substitute for rare-earth based permanent magnets provided modest improvements in their coercivity can be achieved without loss of saturation magnetization. Recent experimental studies have indicated that atomic and magnetic structure of the two phases (one AlNi-based, the other FeCo-based) that comprise these spinodally decomposed alloy is not as simple as previously thought. A key issue that arises is the distribution of Fe, Co, and Ti within the AlNi-based matrix phase. In this paper, we report the results of first-principles calculations of the site preference of ternary alloying additions in DO3 Fe3Al, Co3Al, and Ni3Al alloys, as models for the aluminide phase. For compound compositions that are Al rich, which correspond to experimental situation, Ti and Fe are found to occupy the α sites, while Co and Ni prefer the γ sites of the DO3 lattice. An important finding is that the magnetic moments of transition metals in Fe3Al and Co3Al are ordered ferromagnetically, whereas the Ni3Al were found to be nonmagnetic unless the Fe or Co is added as a ternary element.

  12. The distribution alloying elements in alnico 8 and 9 magnets: Site preference of ternary Ti, Fe, Co, and Ni additions in DO3 Fe3Al, Co3Al, and Ni3Al based intermetallic phases

    DOE PAGES

    Samolyuk, G. D.; Újfalussy, B.; Stocks, G. M.

    2014-11-07

    Recently, interest in alnico magnetic alloys has been rekindled due to their potential to substitute for rare-earth based permanent magnets provided modest improvements in their coercivity can be achieved without loss of saturation magnetization. Recent experimental studies have indicated that atomic and magnetic structure of the two phases (one AlNi-based, the other FeCo-based) that comprise these spinodally decomposed alloy is not as simple as previously thought. A key issue that arises is the distribution of Fe, Co and Ti within the AlNi-based matrix phase. In our paper we report the results of first-principles calculations of the site preference of ternarymore » alloying additions in DO3 Fe3Al, Co3Al and Ni3Al alloys, as models for the aluminide phase. For compound compositions that are Al rich, which corresponds to experimental situation, Ti and Fe are found to occupy the sites, while Co and Ni prefer the sites of the DO3 lattice. Finally, an important finding is that the magnetic moments of transition metals in Fe3Al and Co3Al are ordered ferromagnetically, whereas the Ni3Al were found to be nonmagnetic unless the Fe or Co are added as a ternary element.« less

  13. Novel Tn4371-ICE like element in Ralstonia pickettii and Genome mining for comparative elements

    PubMed Central

    2009-01-01

    Background Integrative Conjugative Elements (ICEs) are important factors in the plasticity of microbial genomes. An element related to the ICE Tn4371 was discovered during a bioinformatic search of the Ralstonia pickettii 12J genome. This element was analysed and further searches carried out for additional elements. A PCR method was designed to detect and characterise new elements of this type based on this scaffold and a culture collection of fifty-eight Ralstonia pickettii and Ralstonia insidiosa strains were analysed for the presence of the element. Results Comparative sequence analysis of bacterial genomes has revealed the presence of a number of uncharacterised Tn4371-like ICEs in the genomes of several β and γ- Proteobacteria. These elements vary in size, GC content, putative function and have a mosaic-like structure of plasmid- and phage-like sequences which is typical of Tn4371-like ICEs. These elements were found after a through search of the GenBank database. The elements, which are found in Ralstonia, Delftia, Acidovorax, Bordetella, Comamonas, Acidovorax, Congregibacter, Shewanella, Pseudomonas Stenotrophomonas, Thioalkalivibrio sp. HL-EbGR7, Polaromonas, Burkholderia and Diaphorobacter sp. share a common scaffold. A PCR method was designed (based on the Tn4371- like element detected in the Ralstonia pickettii 12J genome) to detect and characterise new elements of this type. Conclusion All elements found in this study possess a common scaffold of core genes but contain different accessory genes. A new uniform nomenclature is suggested for ICEs of the Tn4371 family. Two novel Tn4371-like ICE were discovered and characterised, using the novel PCR method described in two different isolates of Ralstonia pickettii from laboratory purified water. PMID:19941653

  14. Rapid and recent diversification of curassows, guans, and chachalacas (Galliformes: Cracidae) out of Mesoamerica: Phylogeny inferred from mitochondrial, intron, and ultraconserved element sequences.

    PubMed

    Hosner, Peter A; Braun, Edward L; Kimball, Rebecca T

    2016-09-01

    The Cracidae (curassows, guans, and chachalacas) include some of the most spectacular and endangered Neotropical bird species. They lack a comprehensive phylogenetic hypothesis, hence their geographic origin and the history of their diversification remain unclear. We present a species-level phylogeny of Cracidae inferred from a matrix of 430 ultraconserved elements (UCEs; at least one species sampled per genus) and eight more variable loci (introns and mtDNA; all available species). We use this phylogeny along with probabilistic biogeographic modeling to test whether Gondwanan vicariance, ancient dispersal to South America, ancient dispersal from South America, or massive global cooling isolated cracids in the Neotropics. Contrary to previous estimates that extant cracids diversified in the Cretaceous, our fossil-calibrated divergence time estimates instead support that crown Cracidae originated in the late Miocene. Species-rich genera Crax, Penelope, and Ortalis began diversifying as recently as 3Mya. Biogeographic reconstructions indicate that modern cracids originated in Mesoamerica and were isolated from a widespread Laurasian ancestor, consistent with the massive global cooling hypothesis. Current South American diversity is the result of multiple colonization events following uplift of the Panamanian Isthmus, coupled with rapid diversification and evolution of secondary sympatry. Of the four major cracid lineages (curassows, chachalacas, typical guans, horned guan), the only lineage that has failed to colonize and diversify South America is the unique horned guan (Oreophasis derbianus), which is sister to curassows and chachalacas rather than typical guans.

  15. Cation-dependent folding of 3' cap-independent translation elements facilitates interaction of a 17-nucleotide conserved sequence with eIF4G.

    PubMed

    Kraft, Jelena J; Treder, Krzysztof; Peterson, Mariko S; Miller, W Allen

    2013-03-01

    The 3'-untranslated regions of many plant viral RNAs contain cap-independent translation elements (CITEs) that drive translation initiation at the 5'-end of the mRNA. The barley yellow dwarf virus-like CITE (BTE) stimulates translation by binding the eIF4G subunit of translation initiation factor eIF4F with high affinity. To understand this interaction, we characterized the dynamic structural properties of the BTE, mapped the eIF4G-binding sites on the BTE and identified a region of eIF4G that is crucial for BTE binding. BTE folding involves cooperative uptake of magnesium ions and is driven primarily by charge neutralization. Footprinting experiments revealed that functional eIF4G fragments protect the highly conserved stem-loop I and a downstream bulge. The BTE forms a functional structure in the absence of protein, and the loop that base pairs the 5'-untranslated region (5'-UTR) remains solvent-accessible at high eIF4G concentrations. The region in eIF4G between the eIF4E-binding site and the MIF4G region is required for BTE binding and translation. The data support the model in which the eIF4F complex binds directly to the BTE which base pairs simultaneously to the 5'-UTR, allowing eIF4F to recruit the 40S ribosomal subunit to the 5'-end.

  16. Studying long 16S rDNA sequences with ultrafast-metagenomic sequence classification using exact alignments (Kraken).

    PubMed

    Valenzuela-González, Fabiola; Martínez-Porchas, Marcel; Villalpando-Canchola, Enrique; Vargas-Albores, Francisco

    2016-03-01

    Ultrafast-metagenomic sequence classification using exact alignments (Kraken) is a novel approach to classify 16S rDNA sequences. The classifier is based on mapping short sequences to the lowest ancestor and performing alignments to form subtrees with specific weights in each taxon node. This study aimed to evaluate the classification performance of Kraken with long 16S rDNA random environmental sequences produced by cloning and then Sanger sequenced. A total of 480 clones were isolated and expanded, and 264 of these clones formed contigs (1352 ± 153 bp). The same sequences were analyzed using the Ribosomal Database Project (RDP) classifier. Deeper classification performance was achieved by Kraken than by the RDP: 73% of the contigs were classified up to the species or variety levels, whereas 67% of these contigs were classified no further than the genus level by the RDP. The results also demonstrated that unassembled sequences analyzed by Kraken provide similar or inclusively deeper information. Moreover, sequences that did not form contigs, which are usually discarded by other programs, provided meaningful information when analyzed by Kraken. Finally, it appears that the assembly step for Sanger sequences can be eliminated when using Kraken. Kraken cumulates the information of both sequence senses, providing additional elements for the classification. In conclusion, the results demonstrate that Kraken is an excellent choice for use in the taxonomic assignment of sequences obtained by Sanger sequencing or based on third generation sequencing, of which the main goal is to generate larger sequences.

  17. Roles of repetitive sequences

    SciTech Connect

    Bell, G.I.

    1991-12-31

    The DNA of higher eukaryotes contains many repetitive sequences. The study of repetitive sequences is important, not only because many have important biological function, but also because they provide information on genome organization, evolution and dynamics. In this paper, I will first discuss some generic effects that repetitive sequences will have upon genome dynamics and evolution. In particular, it will be shown that repetitive sequences foster recombination among, and turnover of, the elements of a genome. I will then consider some examples of repetitive sequences, notably minisatellite sequences and telomere sequences as examples of tandem repeats, without and with respectively known function, and Alu sequences as an example of interspersed repeats. Some other examples will also be considered in less detail.

  18. Recognizing Sequences of Sequences

    PubMed Central

    Kiebel, Stefan J.; von Kriegstein, Katharina; Daunizeau, Jean; Friston, Karl J.

    2009-01-01

    The brain's decoding of fast sensory streams is currently impossible to emulate, even approximately, with artificial agents. For example, robust speech recognition is relatively easy for humans but exceptionally difficult for artificial speech recognition systems. In this paper, we propose that recognition can be simplified with an internal model of how sensory input is generated, when formulated in a Bayesian framework. We show that a plausible candidate for an internal or generative model is a hierarchy of ‘stable heteroclinic channels’. This model describes continuous dynamics in the environment as a hierarchy of sequences, where slower sequences cause faster sequences. Under this model, online recognition corresponds to the dynamic decoding of causal sequences, giving a representation of the environment with predictive power on several timescales. We illustrate the ensuing decoding or recognition scheme using synthetic sequences of syllables, where syllables are sequences of phonemes and phonemes are sequences of sound-wave modulations. By presenting anomalous stimuli, we find that the resulting recognition dynamics disclose inference at multiple time scales and are reminiscent of neuronal dynamics seen in the real brain. PMID:19680429

  19. Potlining Additives

    SciTech Connect

    Rudolf Keller

    2004-08-10

    In this project, a concept to improve the performance of aluminum production cells by introducing potlining additives was examined and tested. Boron oxide was added to cathode blocks, and titanium was dissolved in the metal pool; this resulted in the formation of titanium diboride and caused the molten aluminum to wet the carbonaceous cathode surface. Such wetting reportedly leads to operational improvements and extended cell life. In addition, boron oxide suppresses cyanide formation. This final report presents and discusses the results of this project. Substantial economic benefits for the practical implementation of the technology are projected, especially for modern cells with graphitized blocks. For example, with an energy savings of about 5% and an increase in pot life from 1500 to 2500 days, a cost savings of $ 0.023 per pound of aluminum produced is projected for a 200 kA pot.

  20. Phosphazene additives

    DOEpatents

    Harrup, Mason K; Rollins, Harry W

    2013-11-26

    An additive comprising a phosphazene compound that has at least two reactive functional groups and at least one capping functional group bonded to phosphorus atoms of the phosphazene compound. One of the at least two reactive functional groups is configured to react with cellulose and the other of the at least two reactive functional groups is configured to react with a resin, such as an amine resin of a polycarboxylic acid resin. The at least one capping functional group is selected from the group consisting of a short chain ether group, an alkoxy group, or an aryloxy group. Also disclosed are an additive-resin admixture, a method of treating a wood product, and a wood product.

  1. Soybean GH3 promoter contains multiple auxin-inducible elements.

    PubMed Central

    Liu, Z B; Ulmasov, T; Shi, X; Hagen, G; Guilfoyle, T J

    1994-01-01

    The soybean GH3 gene is transcriptionally induced in a wide variety of tissues and organs within minutes after auxin application. To determine the sequence elements that confer auxin inducibility to the GH3 promoter, we used gel mobility shift assays, methylation interference, deletion analysis, linker scanning, site-directed mutagenesis, and gain-of-function analysis with a minimal cauliflower mosaic virus 35S promoter. We identified at least three sequence elements within the GH3 promoter that are auxin inducible and can function independently of one another. Two of these elements are found in a 76-bp fragment, and these consist of two independent 25- and 32-bp auxin-inducible elements. Both of these 25- and 32-bp auxin-inducible elements contain the sequence TGTCTC just upstream of an AATAAG. An additional auxin-inducible element was found upstream of the 76-bp auxin-inducible fragment; this can function independently of the 76-bp fragment. Two TGA-box or Hex-like elements (TGACGTAA and TGACGTGGC) in the promoter, which are strong binding sites for proteins in plant nuclear extracts, may also elevate the level of auxin inducibility of the GH3 promoter. The multiple auxin-inducible elements within the GH3 promoter contribute incrementally to the overall level of auxin induction observed with this promoter. PMID:8038604

  2. MRO Sequence Checking Tool

    NASA Technical Reports Server (NTRS)

    Fisher, Forest; Gladden, Roy; Khanampornpan, Teerapat

    2008-01-01

    The MRO Sequence Checking Tool program, mro_check, automates significant portions of the MRO (Mars Reconnaissance Orbiter) sequence checking procedure. Though MRO has similar checks to the ODY s (Mars Odyssey) Mega Check tool, the checks needed for MRO are unique to the MRO spacecraft. The MRO sequence checking tool automates the majority of the sequence validation procedure and check lists that are used to validate the sequences generated by MRO MPST (mission planning and sequencing team). The tool performs more than 50 different checks on the sequence. The automation varies from summarizing data about the sequence needed for visual verification of the sequence, to performing automated checks on the sequence and providing a report for each step. To allow for the addition of new checks as needed, this tool is built in a modular fashion.

  3. Complete sequence of a plasmid from a bovine methicillin-resistant Staphylococcus aureus harbouring a novel ica-like gene cluster in addition to antimicrobial and heavy metal resistance genes.

    PubMed

    Feßler, Andrea T; Zhao, Qin; Schoenfelder, Sonja; Kadlec, Kristina; Brenner Michael, Geovana; Wang, Yang; Ziebuhr, Wilma; Shen, Jianzhong; Schwarz, Stefan

    2017-02-01

    The multiresistance plasmid pAFS11, obtained from a bovine methicillin-resistant Staphylococcus aureus (MRSA) isolate, was completely sequenced and analysed for its structure and organisation. Moreover, the susceptibility to the heavy metals cadmium and copper was determined by broth macrodilution. The 49,189-bp plasmid harboured the apramycin resistance gene apmA, two copies of the macrolide/lincosamide/streptogramin B resistance gene erm(B) (both located on remnants of a truncated transposon Tn917), the kanamycin/neomycin resistance gene aadD, the tetracycline resistance gene tet(L) and the trimethoprim resistance gene dfrK. The latter three genes were part of a 7,284-bp segment which was bracketed by two copies of IS431. In addition, the cadmium resistance operon cadDX as well as the copper resistance genes copA and mco were located on the plasmid and mediated a reduced susceptibility to cadmium and copper. Moreover, a complete novel ica-like gene cluster of so far unknown genetic origin was detected on this plasmid. The ica-like gene cluster comprised four different genes whose products showed 64.4-76.9% homology to the Ica proteins known to be involved in biofilm formation of the S. aureus strains Mu50, Mu3 and N315. However, 96.2-99.4% homology was seen to proteins from S. sciuri NS1 indicating an S. sciuri origin. The finding of five different antibiotic resistance genes co-located on a plasmid with heavy metal resistance genes and an ica-like gene cluster is alarming. With the acquisition of this plasmid, antimicrobial multiresistance, heavy metal resistances and potential virulence properties may be co-selected and spread via a single horizontal gene transfer event.

  4. Sequenced drive for rotary valves

    DOEpatents

    Mittell, Larry C.

    1981-01-01

    A sequenced drive for rotary valves which provides the benefits of applying rotary and linear motions to the movable sealing element of the valve. The sequenced drive provides a close approximation of linear motion while engaging or disengaging the movable element with the seat minimizing wear and damage due to scrubbing action. The rotary motion of the drive swings the movable element out of the flowpath thus eliminating obstruction to flow through the valve.

  5. p53 responsive elements in human retrotransposons.

    PubMed

    Harris, C R; Dewan, A; Zupnick, A; Normart, R; Gabriel, A; Prives, C; Levine, A J; Hoh, J

    2009-11-05

    Long interspersed nuclear elements-1 (L1s) are highly repetitive DNA elements that are capable of altering the human genome through retrotransposition. To protect against L1 retroposition, the cell downregulates the expression of L1 proteins by various mechanisms, including high-density cytosine methylation of L1 promoters and DICER-dependent destruction of L1 mRNAs. In this report, a large number of p53 responsive elements, or p53 DNA binding sites, were detected in L1 elements within the human genome. At least some of these p53 responsive elements are functional and can act to increase the levels of L1 mRNA expression. The p53 protein can directly bind to a short 15-nucleotide sequence within the L1 promoter. This p53 responsive element within L1 is a recent addition to evolution, appearing approximately 20 million years ago. This suggests an interplay between L1 elements, which have a rich history of causing changes in the genome, and the p53 protein, the function of which is to protect against genomic changes. To understand these observations, a model is proposed in which the increased expression of L1 mRNAs by p53 actually increases, rather than decreases, the genomic stability through amplification of p53-dependent processes for genomic protection.

  6. Comparative Analysis of Genome Sequences with VISTA

    DOE Data Explorer

    Dubchak, Inna

    VISTA is a comprehensive suite of programs and databases developed by and hosted at the Genomics Division of Lawrence Berkeley National Laboratory. They provide information and tools designed to facilitate comparative analysis of genomic sequences. Users have two ways to interact with the suite of applications at the VISTA portal. They can submit their own sequences and alignments for analysis (VISTA servers) or examine pre-computed whole-genome alignments of different species. A key menu option is the Enhancer Browser and Database at http://enhancer.lbl.gov/. The VISTA Enhancer Browser is a central resource for experimentally validated human noncoding fragments with gene enhancer activity as assessed in transgenic mice. Most of these noncoding elements were selected for testing based on their extreme conservation with other vertebrates. The results of this enhancer screen are provided through this publicly available website. The browser also features relevant results by external contributors and a large collection of additional genome-wide conserved noncoding elements which are candidate enhancer sequences. The LBL developers invite external groups to submit computational predictions of developmental enhancers. As of 10/19/2009 the database contains information on 1109 in vivo tested elements - 508 elements with enhancer activity.

  7. Whistle sequences in wild killer whales (Orcinus orca).

    PubMed

    Riesch, Rüdiger; Ford, John K B; Thomsen, Frank

    2008-09-01

    Combining different stereotyped vocal signals into specific sequences increases the range of information that can be transferred between individuals. The temporal emission pattern and the behavioral context of vocal sequences have been described in detail for a variety of birds and mammals. Yet, in cetaceans, the study of vocal sequences is just in its infancy. Here, we provide a detailed analysis of sequences of stereotyped whistles in killer whales off Vancouver Island, British Columbia. A total of 1140 whistle transitions in 192 whistle sequences recorded from resident killer whales were analyzed using common spectrographic analysis techniques. In addition to the stereotyped whistles described by Riesch et al., [(2006). "Stability and group specificity of stereotyped whistles in resident killer whales, Orcinus orca, off British Columbia," Anim. Behav. 71, 79-91.] We found a new and rare stereotyped whistle (W7) as well as two whistle elements, which are closely linked to whistle sequences: (1) stammers and (2) bridge elements. Furthermore, the frequency of occurrence of 12 different stereotyped whistle types within the sequences was not randomly distributed and the transition patterns between whistles were also nonrandom. Finally, whistle sequences were closely tied to close-range behavioral interactions (in particular among males). Hence, we conclude that whistle sequences in wild killer whales are complex signal series and propose that they are most likely emitted by single individuals.

  8. Insertion sequences enrichment in extreme Red sea brine pool vent.

    PubMed

    Elbehery, Ali H A; Aziz, Ramy K; Siam, Rania

    2017-03-01

    Mobile genetic elements are major agents of genome diversification and evolution. Limited studies addressed their characteristics, including abundance, and role in extreme habitats. One of the rare natural habitats exposed to multiple-extreme conditions, including high temperature, salinity and concentration of heavy metals, are the Red Sea brine pools. We assessed the abundance and distribution of different mobile genetic elements in four Red Sea brine pools including the world's largest known multiple-extreme deep-sea environment, the Red Sea Atlantis II Deep. We report a gradient in the abundance of mobile genetic elements, dramatically increasing in the harshest environment of the pool. Additionally, we identified a strong association between the abundance of insertion sequences and extreme conditions, being highest in the harshest and deepest layer of the Red Sea Atlantis II Deep. Our comparative analyses of mobile genetic elements in secluded, extreme and relatively non-extreme environments, suggest that insertion sequences predominantly contribute to polyextremophiles genome plasticity.

  9. Expression of the human granulocyte-macrophage colony stimulating factor (hGM-CSF) gene under control of the 5'-regulatory sequence of the goat alpha-S1-casein gene with and without a MAR element in transgenic mice.

    PubMed

    Burkov, I A; Serova, I A; Battulin, N R; Smirnov, A V; Babkin, I V; Andreeva, L E; Dvoryanchikov, G A; Serov, O L

    2013-10-01

    Expression of the human granulocyte-macrophage colony-stimulating factor (hGM-CSF) gene under the control of the 5'-regulatory sequence of the goat alpha-S1-casein gene with and without a matrix attachment region (MAR) element from the Drosophila histone 1 gene was studied in four and eight transgenic mouse lines, respectively. Of the four transgenic lines carrying the transgene without MAR, three had correct tissues-specific expression of the hGM-CSF gene in the mammary gland only and no signs of cell mosaicism. The concentration of hGM-CSF in the milk of transgenic females varied from 1.9 to 14 μg/ml. One line presented hGM-CSF in the blood serum, indicating ectopic expression. The values of secretion of hGM-CSF in milk of 6 transgenic lines carrying the transgene with MAR varied from 0.05 to 0.7 μg/ml, and two of these did not express hGM-CSF. Three of the four examined animals from lines of this group showed ectopic expression of the hGM-CSF gene, as determined by RT-PCR and immunofluorescence analyses, as well as the presence of hGM-CSF in the blood serum. Mosaic expression of the hGM-CSF gene in mammary epithelial cells was specific to all examined transgenic mice carrying the transgene with MAR but was never observed in the transgenic mice without MAR. The mosaic expression was not dependent on transgene copy number. Thus, the expected "protective or enhancer effect" from the MAR element on the hGM-CSF gene expression was not observed.

  10. Sequence information signal processor for local and global string comparisons

    DOEpatents

    Peterson, John C.; Chow, Edward T.; Waterman, Michael S.; Hunkapillar, Timothy J.

    1997-01-01

    A sequence information signal processing integrated circuit chip designed to perform high speed calculation of a dynamic programming algorithm based upon the algorithm defined by Waterman and Smith. The signal processing chip of the present invention is designed to be a building block of a linear systolic array, the performance of which can be increased by connecting additional sequence information signal processing chips to the array. The chip provides a high speed, low cost linear array processor that can locate highly similar global sequences or segments thereof such as contiguous subsequences from two different DNA or protein sequences. The chip is implemented in a preferred embodiment using CMOS VLSI technology to provide the equivalent of about 400,000 transistors or 100,000 gates. Each chip provides 16 processing elements, and is designed to provide 16 bit, two's compliment operation for maximum score precision of between -32,768 and +32,767. It is designed to provide a comparison between sequences as long as 4,194,304 elements without external software and between sequences of unlimited numbers of elements with the aid of external software. Each sequence can be assigned different deletion and insertion weight functions. Each processor is provided with a similarity measure device which is independently variable. Thus, each processor can contribute to maximum value score calculation using a different similarity measure.

  11. Transposable elements belonging to the Tc1-Mariner superfamily are heavily mutated in Colletotrichum graminicola.

    PubMed

    Braga, Raíssa Mesquita; Santana, Mateus Ferreira; Veras da Costa, Rodrigo; Brommonschenkel, Sergio Herminio; de Araújo, Elza Fernandes; de Queiroz, Marisa Vieira

    2014-01-01

    Transposable elements are ubiquitous and constitute an important source of genetic variation in addition to generating deleterious mutations. Several filamentous fungi are able to defend against transposable elements using RIP(repeat-induced point mutation)-like mechanisms, which induce mutations in duplicated sequences. The sequenced Colletotrichum graminicola genome and the availability of transposable element databases provide an efficient approach for identifying and characterizing transposable elements in this fungus, which was the subject of this study. We identified 132 full-sized Tc1-Mariner transposable elements in the sequenced C. graminicola genome, which were divided into six families. Several putative transposases that have been found in these elements have conserved DDE motifs, but all are interrupted by stop codons. An in silico analysis showed evidence for RIP-generated mutations. The TCg1 element, which was cloned from the Brazilian 2908 m isolate, has a putative transposase sequence with three characteristic conserved motifs. However, this sequence is interrupted by five stop codons. Genomic DNA from various isolates was analyzed by hybridization with an internal region of TCg1. All of the isolates featured transposable elements that were similar to TCg1, and several hybridization profiles were identified. C. graminicola has many Tc1-Mariner transposable elements that have been degenerated by characteristic RIP mutations. It is unlikely that any of the characterized elements are autonomous in the sequenced isolate. The possible existence of active copies in field isolates from Brazil was shown. The TCg1 element is present in several C. graminicola isolates and is a potentially useful molecular marker for population studies of this phytopathogen.

  12. Entropy and long-range memory in random symbolic additive Markov chains

    NASA Astrophysics Data System (ADS)

    Melnik, S. S.; Usatenko, O. V.

    2016-06-01

    The goal of this paper is to develop an estimate for the entropy of random symbolic sequences with elements belonging to a finite alphabet. As a plausible model, we use the high-order additive stationary ergodic Markov chain with long-range memory. Supposing that the correlations between random elements of the chain are weak, we express the conditional entropy of the sequence by means of the symbolic pair correlation function. We also examine an algorithm for estimating the conditional entropy of finite symbolic sequences. We show that the entropy contains two contributions, i.e., the correlation and the fluctuation. The obtained analytical results are used for numerical evaluation of the entropy of written English texts and DNA nucleotide sequences. The developed theory opens the way for constructing a more consistent and sophisticated approach to describe the systems with strong short-range and weak long-range memory.

  13. Human DNA polymerase alpha gene: sequences controlling expression in cycling and serum-stimulated cells.

    PubMed Central

    Pearson, B E; Nasheuer, H P; Wang, T S

    1991-01-01

    We have investigated the DNA polymerase alpha promoter sequence requirements for the expression of a heterologous gene in actively cycling cells and following serum addition to serum-deprived cells. An 11.4-kb genomic clone that spans the 5' end of this gene and includes 1.62 kb of sequence upstream from the translation start site was isolated. The transcription start site was mapped at 46 +/- 1 nucleotides upstream from the translation start site. The upstream sequence is GC rich and lacks a TATA sequence but has a CCAAT sequence on the opposite strand. Analysis of a set of deletion constructs in transient transfection assays demonstrated that efficient expression of the reporter in cycling cells requires 248 bp of sequence upstream from the cap site. Clustered within these 248 nucleotides are sequences similar to consensus sequences for Sp1-, Ap1-, Ap2-, and E2F-binding sites. The CCAAT sequence and the potential E2F- and Ap1-binding sites are shown to be protected from DNase I digestion by partially purified nuclear proteins. The DNA polymerase alpha promoter can confer upon the reporter an appropriate, late response to serum addition. No single sequence element could be shown to confer serum inducibility. Rather, multiple sequence elements appear to mediate the full serum response. Images PMID:2005899

  14. Towards “bionic” proteins: replacement of continuous sequences from HIF-1α with proteomimetics to create functional p300 binding HIF-1α mimics† †Electronic supplementary information (ESI) available: Detailed experimental procedures and characterisation; additional biophysical data. See DOI: 10.1039/c6cc01812b Click here for additional data file.

    PubMed Central

    Burslem, George M.; Kyle, Hannah F.; Breeze, Alexander L.; Edwards, Thomas A.; Nelson, Adam; Warriner, Stuart L.

    2016-01-01

    Using the HIF-1α transcription factor as a model, this manuscript illustrates how an extended sequence of α-amino acids in a polypeptide can be replaced with a non-natural topographical mimic of an α-helix comprised from an aromatic oligoamide. The resultant hybrid is capable of reproducing the molecular recognition profile of the p300 binding sequence of HIF-1α from which it is derived. PMID:27009828

  15. Elemental ZOO

    NASA Astrophysics Data System (ADS)

    Helser, Terry L.

    2003-04-01

    This puzzle uses the symbols of 39 elements to spell the names of 25 animals found in zoos. Underlined spaces and the names of the elements serve as clues. To solve the puzzle, students must find the symbols that correspond to the elemental names and rearrange them into the animals' names.

  16. Genome Sequencing.

    PubMed

    Verma, Mansi; Kulshrestha, Samarth; Puri, Ayush

    2017-01-01

    Genome sequencing is an important step toward correlating genotypes with phenotypic characters. Sequencing technologies are important in many fields in the life sciences, including functional genomics, transcriptomics, oncology, evolutionary biology, forensic sciences, and many more. The era of sequencing has been divided into three generations. First generation sequencing involved sequencing by synthesis (Sanger sequencing) and sequencing by cleavage (Maxam-Gilbert sequencing). Sanger sequencing led to the completion of various genome sequences (including human) and provided the foundation for development of other sequencing technologies. Since then, various techniques have been developed which can overcome some of the limitations of Sanger sequencing. These techniques are collectively known as "Next-generation sequencing" (NGS), and are further classified into second and third generation technologies. Although NGS methods have many advantages in terms of speed, cost, and parallelism, the accuracy and read length of Sanger sequencing is still superior and has confined the use of NGS mainly to resequencing genomes. Consequently, there is a continuing need to develop improved real time sequencing techniques. This chapter reviews some of the options currently available and provides a generic workflow for sequencing a genome.

  17. Enhanced mRNA-protein fusion efficiency of a single-domain antibody by selection of mRNA display with additional random sequences in the terminal translated regions

    PubMed Central

    Takahashi, Kazuki; Sunohara, Masato; Terai, Takuya; Kumachi, Shigefumi; Nemoto, Naoto

    2017-01-01

    In vitro display technologies such as mRNA and cDNA display are powerful tools to create and select functional peptides. However, in some cases, efficiency of mRNA-protein fusion is very low, which results in decreased library size and lower chance of successful selection. In this study, to improve mRNA-protein fusion efficiency, we prepared an mRNA display library of a protein with random N- and C-terminal coding regions consisting of 12 nucleotides (i.e. four amino acids), and performed an electrophoresis mobility shift assay (EMSA)-based selection of successfully formed mRNA display molecules. A single-domain antibody (Nanobody, or VHH) was used as a model protein, and as a result, a pair of sequences was identified that increased mRNA-protein fusion efficiency of this protein by approximately 20%. Interestingly, enhancement of the fusion efficiency induced by the identified sequences was protein-specific, and different results were obtained for other proteins including VHHs with different CDRs. The results suggested that conformation of mRNA as a whole, rather than the amino acid sequence of the translated peptide, is an important factor to determine mRNA-protein fusion efficiency. PMID:28275529

  18. Enhanced mRNA-protein fusion efficiency of a single-domain antibody by selection of mRNA display with additional random sequences in the terminal translated regions.

    PubMed

    Takahashi, Kazuki; Sunohara, Masato; Terai, Takuya; Kumachi, Shigefumi; Nemoto, Naoto

    2017-01-01

    In vitro display technologies such as mRNA and cDNA display are powerful tools to create and select functional peptides. However, in some cases, efficiency of mRNA-protein fusion is very low, which results in decreased library size and lower chance of successful selection. In this study, to improve mRNA-protein fusion efficiency, we prepared an mRNA display library of a protein with random N- and C-terminal coding regions consisting of 12 nucleotides (i.e. four amino acids), and performed an electrophoresis mobility shift assay (EMSA)-based selection of successfully formed mRNA display molecules. A single-domain antibody (Nanobody, or VHH) was used as a model protein, and as a result, a pair of sequences was identified that increased mRNA-protein fusion efficiency of this protein by approximately 20%. Interestingly, enhancement of the fusion efficiency induced by the identified sequences was protein-specific, and different results were obtained for other proteins including VHHs with different CDRs. The results suggested that conformation of mRNA as a whole, rather than the amino acid sequence of the translated peptide, is an important factor to determine mRNA-protein fusion efficiency.

  19. Identification of plant promoter constituents by analysis of local distribution of short sequences

    PubMed Central

    Yamamoto, Yoshiharu Y; Ichida, Hiroyuki; Matsui, Minami; Obokata, Junichi; Sakurai, Tetsuya; Satou, Masakazu; Seki, Motoaki; Shinozaki, Kazuo; Abe, Tomoko

    2007-01-01

    Background Plant promoter architecture is important for understanding regulation and evolution of the promoters, but our current knowledge about plant promoter structure, especially with respect to the core promoter, is insufficient. Several promoter elements including TATA box, and several types of transcriptional regulatory elements have been found to show local distribution within promoters, and this feature has been successfully utilized for extraction of promoter constituents from human genome. Results LDSS (Local Distribution of Short Sequences) profiles of short sequences along the plant promoter have been analyzed in silico, and hundreds of hexamer and octamer sequences have been identified as having localized distributions within promoters of Arabidopsis thaliana and rice. Based on their localization patterns, the identified sequences could be classified into three groups, pyrimidine patch (Y Patch), TATA box, and REG (Regulatory Element Group). Sequences of the TATA box group are consistent with the ones reported in previous studies. The REG group includes more than 200 sequences, and half of them correspond to known cis-elements. The other REG subgroups, together with about a hundred uncategorized sequences, are suggested to be novel cis-regulatory elements. Comparison of LDSS-positive sequences between Arabidopsis and rice has revealed moderate conservation of elements and common promoter architecture. In addition, a dimer motif named the YR Rule (C/T A/G) has been identified at the transcription start site (-1/+1). This rule also fits both Arabidopsis and rice promoters. Conclusion LDSS was successfully applied to plant genomes and hundreds of putative promoter elements have been extracted as LDSS-positive octamers. Identified promoter architecture of monocot and dicot are well conserved, but there are moderate variations in the utilized sequences. PMID:17346352

  20. Cohabitation of insulators and silencing elements in yeast subtelomeric regions.

    PubMed Central

    Fourel, G; Revardel, E; Koering, C E; Gilson, E

    1999-01-01

    In budding yeast, the telomeric DNA is flanked by a combination of two subtelomeric repetitive sequences, the X and Y' elements. We have investigated the influence of these sequences on telomeric silencing. The telomere-proximal portion of either X or Y' dampened silencing when located between the telomere and the reporter gene. These elements were named STARs, for subtelomeric anti-silencing regions. STARs can also counteract silencer-driven repression at the mating-type HML locus. When two STARs bracket a reporter gene, its expression is no longer influenced by surrounding silencing elements, although these are still active on a second reporter gene. In addition, an intervening STAR uncouples the silencing of neighboring genes. STARs thus display the hallmarks of insulators. Protection from silencing is recapitulated by multimerized oligonucleotides representing Tbf1p- and Reb1p-binding sites, as found in STARs. In contrast, sequences located more centromere proximal in X and Y' elements reinforce silencing. They can promote silencing downstream of an insulated expressed domain. Overall, our results suggest that the silencing emanating from telomeres can be propagated in a discontinuous manner via a series of subtelomeric relay elements. PMID:10228166

  1. Regulation of glutathione S-transferase Ya subunit gene expression: Identification of a unique xenobiotic-responsive element controlling inducible expression by planar aromatic compounds

    SciTech Connect

    Rushmore, T.H.; King, R.G.; Pickett, C.B. ); Paulson, K.E. )

    1990-05-01

    The authors have identified a region in the 5{prime} flanking sequence of the glutathione S-transferase Ya subunit gene that contains a unique xenobiotic-responsive element (XRE). The regulatory region spans nucleotides {minus}722 to {minus}682 of the 5{prime} flanking sequence and is responsible for part of the basal level as well as inducible expression of the Ya subunit gene by planar aromatic compounds such as {beta}-naphthoflavone ({beta}-NF) and 3-methylcholanthrene. The DNA sequence of this region ({beta}-NF-responsive element) is distinct from the DNA sequence of the XRE found in the cytochrome P-450 IA1 gene. In addition to the region containing the {beta}-NF-responsive element, two other regulatory regions of the Ya subunit gene have been identified. The data suggest that regulation of gene expression by planar aromatic compounds can be mediated by a DNA sequence this is distinct from the XRE sequence.

  2. Elemental health

    SciTech Connect

    Tonneson, L.C.

    1997-01-01

    Trace elements used in nutritional supplements and vitamins are discussed in the article. Relevant studies are briefly cited regarding the health effects of selenium, chromium, germanium, silicon, zinc, magnesium, silver, manganese, ruthenium, lithium, and vanadium. The toxicity and food sources are listed for some of the elements. A brief summary is also provided of the nutritional supplements market.

  3. Pegasus, a small terminal inverted repeat transposable element found in the white gene of Anopheles gambiae.

    PubMed

    Besansky, N J; Mukabayire, O; Bedell, J A; Lusz, H

    1996-10-01

    Pegasus, a novel transposable element, was discovered as a length polymorphism in the white gene of Anopheles gambiae. Sequence analysis revealed that this 535 bp element was flanked by 8 bp target site duplications and 8 bp perfect terminal inverted repeats similar to those found in many members of the Tc1 family. Its small size and lack of long open reading frames preclude protein coding capacity. Southern analysis and in situ hybridization to polytene chromosomes demonstrated that Pegasus occurs in approximately 30 copies in the genomes of An. gambiae and its sibling species and is homogenous in structure but polymorphic in chromosomal location. Characterization of five additional elements by sequencing revealed nucleotide identities of 95% to 99%. Of 30 Pegasus-containing phage clones examined by PCR, only one contained an element exceeding 535 bp in length, due to the insertion of another transposable element-like sequence. Thus, the majority, if not all, extant Pegasus elements may be defective copies of a complete element whose contemporary existence in An. gambiae is uncertain. No Pegasus-hybridizing sequences were detected in nine other anophelines and three culicines examined, suggesting a very limited taxonomic distribution.

  4. Impact of small repeat sequences on bacterial genome evolution.

    PubMed

    Delihas, Nicholas

    2011-01-01

    Intergenic regions of prokaryotic genomes carry multiple copies of terminal inverted repeat (TIR) sequences, the nonautonomous miniature inverted-repeat transposable element (MITE). In addition, there are the repetitive extragenic palindromic (REP) sequences that fold into a small stem loop rich in G-C bonding. And the clustered regularly interspaced short palindromic repeats (CRISPRs) display similar small stem loops but are an integral part of a complex genetic element. Other classes of repeats such as the REP2 element do not have TIRs but show other signatures. With the current availability of a large number of whole-genome sequences, many new repeat elements have been discovered. These sequences display diverse properties. Some show an intimate linkage to integrons, and at least one encodes a small RNA. Many repeats are found fused with chromosomal open reading frames, and some are located within protein coding sequences. Small repeat units appear to work hand in hand with the transcriptional and/or post-transcriptional apparatus of the cell. Functionally, they are multifaceted, and this can range from the control of gene expression, the facilitation of host/pathogen interactions, or stimulation of the mammalian immune system. The CRISPR complex displays dramatic functions such as an acquired immune system that defends against invading viruses and plasmids. Evolutionarily, mobile repeat elements may have influenced a cycle of active versus inactive genes in ancestral organisms, and some repeats are concentrated in regions of the chromosome where there is significant genomic plasticity. Changes in the abundance of genomic repeats during the evolution of an organism may have resulted in a benefit to the cell or posed a disadvantage, and some present day species may reflect a purification process. The diverse structure, eclectic functions, and evolutionary aspects of repeat elements are described.

  5. Evolutionarily conserved sequences on human chromosome 21

    SciTech Connect

    Frazer, Kelly A.; Sheehan, John B.; Stokowski, Renee P.; Chen, Xiyin; Hosseini, Roya; Cheng, Jan-Fang; Fodor, Stephen P.A.; Cox, David R.; Patil, Nila

    2001-09-01

    Comparison of human sequences with the DNA of other mammals is an excellent means of identifying functional elements in the human genome. Here we describe the utility of high-density oligonucleotide arrays as a rapid approach for comparing human sequences with the DNA of multiple species whose sequences are not presently available. High-density arrays representing approximately 22.5 Mb of nonrepetitive human chromosome 21 sequence were synthesized and then hybridized with mouse and dog DNA to identify sequences conserved between humans and mice (human-mouse elements) and between humans and dogs (human-dog elements). Our data show that sequence comparison of multiple species provides a powerful empiric method for identifying actively conserved elements in the human genome. A large fraction of these evolutionarily conserved elements are present in regions on chromosome 21 that do not encode known genes.

  6. Genome Sequence Databases (Overview): Sequencing and Assembly

    SciTech Connect

    Lapidus, Alla L.

    2009-01-01

    From the date its role in heredity was discovered, DNA has been generating interest among scientists from different fields of knowledge: physicists have studied the three dimensional structure of the DNA molecule, biologists tried to decode the secrets of life hidden within these long molecules, and technologists invent and improve methods of DNA analysis. The analysis of the nucleotide sequence of DNA occupies a special place among the methods developed. Thanks to the variety of sequencing technologies available, the process of decoding the sequence of genomic DNA (or whole genome sequencing) has become robust and inexpensive. Meanwhile the assembly of whole genome sequences remains a challenging task. In addition to the need to assemble millions of DNA fragments of different length (from 35 bp (Solexa) to 800 bp (Sanger)), great interest in analysis of microbial communities (metagenomes) of different complexities raises new problems and pushes some new requirements for sequence assembly tools to the forefront. The genome assembly process can be divided into two steps: draft assembly and assembly improvement (finishing). Despite the fact that automatically performed assembly (or draft assembly) is capable of covering up to 98% of the genome, in most cases, it still contains incorrectly assembled reads. The error rate of the consensus sequence produced at this stage is about 1/2000 bp. A finished genome represents the genome assembly of much higher accuracy (with no gaps or incorrectly assembled areas) and quality ({approx}1 error/10,000 bp), validated through a number of computer and laboratory experiments.

  7. The Evolution of Insertion Sequences within Enteric Bacteria

    PubMed Central

    Lawrence, J. G.; Ochman, H.; Hartl, D. L.

    1992-01-01

    To identify mechanisms that influence the evolution of bacterial transposons, DNA sequence variation was evaluated among homologs of insertion sequences IS1, IS3 and IS30 from natural strains of Escherichia coli and related enteric bacteria. The nucleotide sequences within each class of IS were highly conserved among E. coli strains, over 99.7% similar to a consensus sequence. When compared to the range of nucleotide divergence among chromosomal genes, these data indicate high turnover and rapid movement of the transposons among clonal lineages of E. coli. In addition, length polymorphism among IS appears to be far less frequent than in eukaryotic transposons, indicating that nonfunctional elements comprise a smaller fraction of bacterial transposon populations than found in eukaryotes. IS present in other species of enteric bacteria are substantially divergent from E. coli elements, indicating that IS are mobilized among bacterial species at a reduced rate. However, homologs of IS1 and IS3 from diverse species provide evidence that recombination events and horizontal transfer of IS among species have both played major roles in the evolution of these elements. IS3 elements from E. coli and Shigella show multiple, nested, intragenic recombinations with a distantly related transposon, and IS1 homologs from diverse taxa reveal a mosaic structure indicative of multiple recombination and horizontal transfer events. PMID:1317318

  8. JACKETED FUEL ELEMENT

    DOEpatents

    Wigner, E.P.; Szilard, L.; Creutz, E.C.

    1959-02-01

    These fuel elements are comprised of a homogeneous metallic uranium body completely enclosed and sealed in an aluminum cover. The uranium body and aluminum cover are bonded together by a layer of zinc located between them. The bonding layer serves to improve transfer of heat, provides an additional protection against corrosion of the uranium by the coolant, and also localizes any possible corrosion by preventing travel of corrosive material along the surface of the fuel element.

  9. Event sequence detector

    NASA Technical Reports Server (NTRS)

    Hanna, M. F. (Inventor)

    1973-01-01

    An event sequence detector is described with input units, each associated with a row of bistable elements arranged in an array of rows and columns. The detector also includes a shift register which is responsive to clock pulses from any of the units to sequentially provide signals on its output lines each of which is connected to the bistable elements in a corresponding column. When the event-indicating signal is received by an input unit it provides a clock pulse to the shift register to provide the signal on one of its output lines. The input unit also enables all its bistable elements so that the particular element in the column supplied with the signal from the register is driven to an event-indicating state.

  10. Conjugal mobilization of the mega element carrying mef(E) from Streptococcus salivarius to Streptococcus pneumoniae.

    PubMed

    Santagati, Maria; Lupo, Agnese; Scillato, Marina; Di Martino, Andrea; Stefani, Stefania

    2009-01-01

    We report the isolation and characterization of an unusual strain of Streptococcus salivarius, 3C30, displaying both the macrolide-lincosamide-streptogramin B and the tetracycline resistance phenotypes. It harbours the mef(E), erm(B), and tet(M) genes carried by different genetic elements. The genetic element carrying mef(E), named mega, was investigated by long PCR and sequencing, while the presence of the Tn3872-like element, carrying tet(M) and erm(B), was demonstrated by sequencing of both the int-xis-Tn and the fragment between the two resistance genes. In strain 3C30 the mega element is 5388 bp in size and its nucleotide sequence is identical to that of the element described previously in S. salivarius, with the exception of a 912 bp deletion at the left end. The composite Tn3872-like element appeared to be nonconjugative while the mega element was transferred by conjugation to Streptococcus pneumoniae. It was, however, impossible to transfer it again from these transconjugants to other strains. In addition, only in the 3C30 strain did mega form circular structures, as identified by real-time PCR. In conclusion, we found a clinical strain of S. salivarius carrying both mega and Tn3872-like genetic elements. Mega is transferable by conjugation to S. pneumoniae but it is not transferable again from the transconjugants, suggesting a possible mobilization by recombinases of the coresident Tn3872-like transposon.

  11. Elemental Education.

    ERIC Educational Resources Information Center

    Daniel, Esther Gnanamalar Sarojini; Saat, Rohaida Mohd.

    2001-01-01

    Introduces a learning module integrating three disciplines--physics, chemistry, and biology--and based on four elements: carbon, oxygen, hydrogen, and silicon. Includes atomic model and silicon-based life activities. (YDS)

  12. Superheavy Elements

    ERIC Educational Resources Information Center

    Tsang, Chin Fu

    1975-01-01

    Discusses the possibility of creating elements with an atomic number of around 114. Describes the underlying physics responsible for the limited extent of the periodic table and enumerates problems that must be overcome in creating a superheavy nucleus. (GS)

  13. Element 117

    ScienceCinema

    None

    2016-09-30

    An international team of scientists from Russia and the United States, including two Department of Energy national laboratories and two universities, has discovered the newest superheavy element, element 117. The team included scientists from the Joint Institute of Nuclear Research (Dubna, Russia), the Research Institute for Advanced Reactors (Dimitrovgrad), Lawrence Livermore National Laboratory, Oak Ridge National Laboratory, Vanderbilt University, and the University of Nevada, Las Vegas.

  14. Element 117

    SciTech Connect

    2010-04-08

    An international team of scientists from Russia and the United States, including two Department of Energy national laboratories and two universities, has discovered the newest superheavy element, element 117. The team included scientists from the Joint Institute of Nuclear Research (Dubna, Russia), the Research Institute for Advanced Reactors (Dimitrovgrad), Lawrence Livermore National Laboratory, Oak Ridge National Laboratory, Vanderbilt University, and the University of Nevada, Las Vegas.

  15. Sequencing technologies and genome sequencing.

    PubMed

    Pareek, Chandra Shekhar; Smoczynski, Rafal; Tretyn, Andrzej

    2011-11-01

    The high-throughput - next generation sequencing (HT-NGS) technologies are currently the hottest topic in the field of human and animals genomics researches, which can produce over 100 times more data compared to the most sophisticated capillary sequencers based on the Sanger method. With the ongoing developments of high throughput sequencing machines and advancement of modern bioinformatics tools at unprecedented pace, the target goal of sequencing individual genomes of living organism at a cost of $1,000 each is seemed to be realistically feasible in the near future. In the relatively short time frame since 2005, the HT-NGS technologies are revolutionizing the human and animal genome researches by analysis of chromatin immunoprecipitation coupled to DNA microarray (ChIP-chip) or sequencing (ChIP-seq), RNA sequencing (RNA-seq), whole genome genotyping, genome wide structural variation, de novo assembling and re-assembling of genome, mutation detection and carrier screening, detection of inherited disorders and complex human diseases, DNA library preparation, paired ends and genomic captures, sequencing of mitochondrial genome and personal genomics. In this review, we addressed the important features of HT-NGS like, first generation DNA sequencers, birth of HT-NGS, second generation HT-NGS platforms, third generation HT-NGS platforms: including single molecule Heliscope™, SMRT™ and RNAP sequencers, Nanopore, Archon Genomics X PRIZE foundation, comparison of second and third HT-NGS platforms, applications, advances and future perspectives of sequencing technologies on human and animal genome research.

  16. Molecular characterization and chromosomal distribution of Galileo, Kepler and Newton, three foldback transposable elements of the Drosophila buzzatii species complex.

    PubMed

    Casals, Ferran; Cáceres, Mario; Manfrin, Maura Helena; González, Josefa; Ruiz, Alfredo

    2005-04-01

    Galileo is a foldback transposable element that has been implicated in the generation of two polymorphic chromosomal inversions in Drosophila buzzatii. Analysis of the inversion breakpoints led to the discovery of two additional elements, called Kepler and Newton, sharing sequence and structural similarities with Galileo. Here, we describe in detail the molecular structure of these three elements, on the basis of the 13 copies found at the inversion breakpoints plus 10 additional copies isolated during this work. Similarly to the foldback elements described in other organisms, these elements have long inverted terminal repeats, which in the case of Galileo possess a complex structure and display a high degree of internal variability between copies. A phylogenetic tree built with their shared sequences shows that the three elements are closely related and diverged approximately 10 million years ago. We have also analyzed the abundance and chromosomal distribution of these elements in D. buzzatii and other species of the repleta group by Southern analysis and in situ hybridization. Overall, the results suggest that these foldback elements are present in all the buzzatti complex species and may have played an important role in shaping their genomes. In addition, we show that recombination rate is the main factor determining the chromosomal distribution of these elements.

  17. Whole Genome Resequencing Reveals Natural Target Site Preferences of Transposable Elements in Drosophila melanogaster

    PubMed Central

    Linheiro, Raquel S.; Bergman, Casey M.

    2012-01-01

    Transposable elements are mobile DNA sequences that integrate into host genomes using diverse mechanisms with varying degrees of target site specificity. While the target site preferences of some engineered transposable elements are well studied, the natural target preferences of most transposable elements are poorly characterized. Using population genomic resequencing data from 166 strains of Drosophila melanogaster, we identified over 8,000 new insertion sites not present in the reference genome sequence that we used to decode the natural target preferences of 22 families of transposable element in this species. We found that terminal inverted repeat transposon and long terminal repeat retrotransposon families present clade-specific target site duplications and target site sequence motifs. Additionally, we found that the sequence motifs at transposable element target sites are always palindromes that extend beyond the target site duplication. Our results demonstrate the utility of population genomics data for high-throughput inference of transposable element targeting preferences in the wild and establish general rules for terminal inverted repeat transposon and long terminal repeat retrotransposon target site selection in eukaryotic genomes. PMID:22347367

  18. Phylogenetic Trees From Sequences

    NASA Astrophysics Data System (ADS)

    Ryvkin, Paul; Wang, Li-San

    In this chapter, we review important concepts and approaches for phylogeny reconstruction from sequence data.We first cover some basic definitions and properties of phylogenetics, and briefly explain how scientists model sequence evolution and measure sequence divergence. We then discuss three major approaches for phylogenetic reconstruction: distance-based phylogenetic reconstruction, maximum parsimony, and maximum likelihood. In the third part of the chapter, we review how multiple phylogenies are compared by consensus methods and how to assess confidence using bootstrapping. At the end of the chapter are two sections that list popular software packages and additional reading.

  19. Guidelines for the nomenclature of genetic elements in tunicate genomes.

    PubMed

    Stolfi, Alberto; Sasakura, Yasunori; Chalopin, Domitille; Satou, Yutaka; Christiaen, Lionel; Dantec, Christelle; Endo, Toshinori; Naville, Magali; Nishida, Hiroki; Swalla, Billie J; Volff, Jean-Nicolas; Voskoboynik, Ayelet; Dauga, Delphine; Lemaire, Patrick

    2015-01-01

    Tunicates are invertebrate members of the chordate phylum, and are considered to be the sister group of vertebrates. Tunicates are composed of ascidians, thaliaceans, and appendicularians. With the advent of inexpensive high-throughput sequencing, the number of sequenced tunicate genomes is expected to rise sharply within the coming years. To facilitate comparative genomics within the tunicates, and between tunicates and vertebrates, standardized rules for the nomenclature of tunicate genetic elements need to be established. Here we propose a set of nomenclature rules, consensual within the community, for predicted genes, pseudogenes, transcripts, operons, transcriptional cis-regulatory regions, transposable elements, and transgenic constructs. In addition, the document proposes guidelines for naming transgenic and mutant lines.

  20. Guidelines for the Nomenclature of Genetic Elements in Tunicate Genomes

    PubMed Central

    Stolfi, Alberto; Sasakura, Yasunori; Chalopin, Domitille; Satou, Yutaka; Christiaen, Lionel; Dantec, Christelle; Endo, Toshinori; Naville, Magali; Nishida, Hiroki; Swalla, Billie J.; Volff, Jean-Nicolas; Voskoboynik, Ayelet; Dauga, Delphine; Lemaire, Patrick

    2014-01-01

    Summary Tunicates are invertebrate members of the chordate phylum, and are considered to be the sister group of vertebrates. Tunicates are composed of ascidians, thaliaceans, and appendicularians. With the advent of inexpensive high-throughput sequencing, the number of sequenced tunicate genomes is expected to rise sharply within the coming years. To facilitate comparative genomics within the tunicates, and between tunicates and vertebrates, standardized rules for the nomenclature of tunicate genetic elements need to be established. Here we propose a set of nomenclature rules, consensual within the community, for predicted genes, pseudogenes, transcripts, operons, transcriptional cis-regulatory regions, transposable elements, and transgenic constructs. In addition, the document proposes guidelines for naming transgenic and mutant lines. PMID:25220678

  1. Elemental Chem Lab

    ERIC Educational Resources Information Center

    Franco Mariscal, Antonio Joaquin

    2008-01-01

    This educative material uses the symbols of 45 elements to spell the names of 32 types of laboratory equipment usually found in chemical labs. This teaching material has been divided into three puzzles according to the type of the laboratory equipment: (i) glassware as reaction vessels or containers; (ii) glassware for measuring, addition or…

  2. Mercury, elemental

    Integrated Risk Information System (IRIS)

    Mercury , elemental ; CASRN 7439 - 97 - 6 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Noncarcinoge

  3. Element Research.

    ERIC Educational Resources Information Center

    Herald, Christine

    2001-01-01

    Describes a research assignment for 8th grade students on the elements of the periodic table. Students use web-based resources and a chemistry handbook to gather information, construct concept maps, and present the findings to the full class using the mode of their choice: a humorous story, a slideshow or gameboard, a brochure, a song, or skit.…

  4. Dna Sequencing

    DOEpatents

    Tabor, Stanley; Richardson, Charles C.

    1995-04-25

    A method for sequencing a strand of DNA, including the steps off: providing the strand of DNA; annealing the strand with a primer able to hybridize to the strand to give an annealed mixture; incubating the mixture with four deoxyribonucleoside triphosphates, a DNA polymerase, and at least three deoxyribonucleoside triphosphates in different amounts, under conditions in favoring primer extension to form nucleic acid fragments complementory to the DNA to be sequenced; labelling the nucleic and fragments; separating them and determining the position of the deoxyribonucleoside triphosphates by differences in the intensity of the labels, thereby to determine the DNA sequence.

  5. Encoding of sequence boundaries in the subthalamic nucleus of patients with Parkinson's disease.

    PubMed

    Herrojo Ruiz, María; Rusconi, Marco; Brücke, Christof; Haynes, John-Dylan; Schönecker, Thomas; Kühn, Andrea A

    2014-10-01

    Sequential behaviour is widespread not only in humans but also in animals, ranging in different degrees of complexity from locomotion to birdsong or music performance. The capacity to learn new motor sequences relies on the integrity of basal ganglia-cortical loops. In Parkinson's disease the execution of habitual action sequences as well as the acquisition of novel sequences is impaired partly due to a deficiency in being able to generate internal cues to trigger movement sequences. In addition, patients suffering from Parkinson's disease have difficulty initiating or terminating a self-paced sequence of actions. Direct recordings from the basal ganglia in these patients show an increased level of beta (14-30 Hz) band oscillatory activity associated with impairment in movement initiation. In this framework, the current study aims to evaluate in patients with Parkinson's disease the neuronal activity in the subthalamic nucleus related to the encoding of sequence boundaries during the explicit learning of sensorimotor sequences. We recorded local field potential activity from the subthalamic nucleus of 12 patients who underwent deep brain stimulation for the treatment of advanced Parkinson's disease, while the patients in their usual medicated state practiced sequences of finger movements on a digital piano with corresponding auditory feedback. Our results demonstrate that variability in performance during an early phase of sequence acquisition correlates across patients with changes in the pattern of subthalamic beta-band oscillations; specifically, an anticipatory suppression of beta-band activity at sequence boundaries is linked to better performance. By contrast, a more compromised performance is related to attenuation of beta-band activity before within-sequence elements. Moreover, multivariate pattern classification analysis reveals that differential information about boundaries and within-sequence elements can be decoded at least 100 ms before the keystroke

  6. The identity of the discriminator base has an impact on CCA addition

    PubMed Central

    Wende, Sandra; Bonin, Sonja; Götze, Oskar; Betat, Heike; Mörl, Mario

    2015-01-01

    CCA-adding enzymes synthesize and maintain the C-C-A sequence at the tRNA 3′-end, generating the attachment site for amino acids. While tRNAs are the most prominent substrates for this polymerase, CCA additions on non-tRNA transcripts are described as well. To identify general features for substrate requirement, a pool of randomized transcripts was incubated with the human CCA-adding enzyme. Most of the RNAs accepted for CCA addition carry an acceptor stem-like terminal structure, consistent with tRNA as the main substrate group for this enzyme. While these RNAs show no sequence conservation, the position upstream of the CCA end was in most cases represented by an adenosine residue. In tRNA, this position is described as discriminator base, an important identity element for correct aminoacylation. Mutational analysis of the impact of the discriminator identity on CCA addition revealed that purine bases (with a preference for adenosine) are strongly favoured over pyrimidines. Furthermore, depending on the tRNA context, a cytosine discriminator can cause a dramatic number of misincorporations during CCA addition. The data correlate with a high frequency of adenosine residues at the discriminator position observed in vivo. Originally identified as a prominent identity element for aminoacylation, this position represents a likewise important element for efficient and accurate CCA addition. PMID:25958396

  7. The identity of the discriminator base has an impact on CCA addition.

    PubMed

    Wende, Sandra; Bonin, Sonja; Götze, Oskar; Betat, Heike; Mörl, Mario

    2015-06-23

    CCA-adding enzymes synthesize and maintain the C-C-A sequence at the tRNA 3'-end, generating the attachment site for amino acids. While tRNAs are the most prominent substrates for this polymerase, CCA additions on non-tRNA transcripts are described as well. To identify general features for substrate requirement, a pool of randomized transcripts was incubated with the human CCA-adding enzyme. Most of the RNAs accepted for CCA addition carry an acceptor stem-like terminal structure, consistent with tRNA as the main substrate group for this enzyme. While these RNAs show no sequence conservation, the position upstream of the CCA end was in most cases represented by an adenosine residue. In tRNA, this position is described as discriminator base, an important identity element for correct aminoacylation. Mutational analysis of the impact of the discriminator identity on CCA addition revealed that purine bases (with a preference for adenosine) are strongly favoured over pyrimidines. Furthermore, depending on the tRNA context, a cytosine discriminator can cause a dramatic number of misincorporations during CCA addition. The data correlate with a high frequency of adenosine residues at the discriminator position observed in vivo. Originally identified as a prominent identity element for aminoacylation, this position represents a likewise important element for efficient and accurate CCA addition.

  8. Using a biomimetic membrane surface experiment to investigate the activity of the magnetite biomineralisation protein Mms6† †Electronic supplementary information (ESI) available: Including Mms6 protein and peptide sequences, additional QCM-D and SEM data and protein modelling. See DOI: 10.1039/c5ra16469a Click here for additional data file.

    PubMed Central

    Bird, Scott M.; Rawlings, Andrea E.; Galloway, Johanna M.

    2016-01-01

    Magnetotactic bacteria are able to synthesise precise nanoparticles of the iron oxide magnetite within their cells. These particles are formed in dedicated organelles termed magnetosomes. These lipid membrane compartments use a range of biomineralisation proteins to nucleate and regulate the magnetite crystallisation process. A key component is the membrane protein Mms6, which binds to iron ions and helps to control the formation of the inorganic core. We have previously used Mms6 on gold surfaces patterned with a self-assembled monolayer to successfully produce arrays of magnetic nanoparticles. Here we use this surface system as a mimic of the interior face of the magnetosome membrane to study differences between intact Mms6 and the acid-rich C-terminal peptide subregion of the Mms6 protein. When immobilised on surfaces, the peptide is unable to reproduce the particle size or homogeneity control exhibited by the full Mms6 protein in our experimental setup. Moreover, the peptide is unable to support anchoring of a dense array of nanoparticles to the surface. This system also allows us to deconvolute particle binding from particle nucleation, and shows that Mms6 particle binding is less efficient when supplied with preformed magnetite nanoparticles when compared to particles precipitated from solution in the presence of the surface immobilised Mms6. This suggests that Mms6 binds to iron ions rather than to magnetite surfaces in our system, and is perhaps a nucleating agent rather than a controller of magnetite crystal growth. The comparison between the peptide and the protein under identical experimental conditions indicates that the full length sequence is required to support the full function of Mms6 on surfaces. PMID:27019707

  9. Trace and antitrace maps for aperiodic sequences: Extensions and applications

    NASA Astrophysics Data System (ADS)

    Wang, Xiaoguang; Grimm, Uwe; Schreiber, Michael

    2000-12-01

    We study aperiodic systems based on substitution rules by means of a transfer-matrix approach. In addition to the well-known trace map, we investigate the so-called ``antitrace'' map, which is the corresponding map for the difference of the off-diagonal elements of the 2×2 transfer matrix. The antitrace maps are obtained for various binary, ternary, and quaternary aperiodic sequences, such as the Fibonacci, Thue-Morse, period-doubling, Rudin-Shapiro sequences, and certain generalizations. For arbitrary substitution rules, we show that not only trace maps, but also antitrace maps exist. The dimension of our antitrace map is r(r+1)/2, where r denotes the number of basic letters in the aperiodic sequence. Analogous maps for specific matrix elements of the transfer matrix can also be constructed, but the maps for the off-diagonal elements and for the difference of the diagonal elements coincide with the antitrace map. Thus, from the trace and antitrace map, we can determine any physical quantity related to the global transfer matrix of the system. As examples, we employ these dynamical maps to compute the transmission coefficients for optical multilayers, harmonic chains, and electronic systems.

  10. Promoter sequences required for transcription of Xenopus laevis histone genes in injected frog oocyte nuclei.

    PubMed Central

    Heindl, L M; Weil, T S; Perry, M

    1988-01-01

    Amphibian oogenesis is accompanied by the accumulation of histone mRNA and proteins in the absence of ongoing DNA replication. To begin an analysis of the mechanisms by which histone gene expression is regulated during frog oogenesis and embryogenesis, we used oocyte injection to examine the upstream sequences required for transcription of genes encoding each of the five histone classes. We found that sequences necessary for maximal levels of transcription are located 100 to 200 base pairs upstream of the corresponding start sites. In this region, each promoter examined contains conserved sequence elements, several of which seem to be histone gene class specific, in addition to other, more common sequence elements believed to be used by general transcription factors. Images PMID:3221862

  11. A versatile element for gene addition in bacterial chromosomes

    PubMed Central

    Sibley, Marion H.; Raleigh, Elisabeth A.

    2012-01-01

    The increasing interest in genetic manipulation of bacterial host metabolic pathways for protein or small molecule production has led to a need to add new genes to a chromosome quickly and easily without leaving behind a selectable marker. The present report describes a vector and four-day procedure that enable site-specific chromosomal insertion of cloned genes in a context insulated from external transcription, usable once in a construction series. The use of rhamnose-inducible transcription from rhaBp allows regulation of the inserted genes independently of the commonly used IPTG and arabinose strategies. Using lacZ as a reporter, we first show that expression from the rhamnose promoter is tightly regulatable, exhibiting very low leakage of background expression compared with background, and moderate rhamnose-induced expression compared with IPTG-induced expression from lacp. Second, the expression of a DNA methyltransferase was used to show that rhamnose regulation yielded on-off expression of this enzyme, such that a resident high-copy plasmid was either fully sensitive or fully resistant to isoschizomer restriction enzyme cleavage. In both cases, growth medium manipulation allows intermediate levels of expression. The vehicle can also be adapted as an ORF-cloning vector. PMID:22123741

  12. The ENCODE (ENCyclopedia Of DNA Elements) Project.

    PubMed

    2004-10-22

    The ENCyclopedia Of DNA Elements (ENCODE) Project aims to identify all functional elements in the human genome sequence. The pilot phase of the Project is focused on a specified 30 megabases (approximately 1%) of the human genome sequence and is organized as an international consortium of computational and laboratory-based scientists working to develop and apply high-throughput approaches for detecting all sequence elements that confer biological function. The results of this pilot phase will guide future efforts to analyze the entire human genome.

  13. FUEL ELEMENT

    DOEpatents

    Fortescue, P.; Zumwalt, L.R.

    1961-11-28

    A fuel element was developed for a gas cooled nuclear reactor. The element is constructed in the form of a compacted fuel slug including carbides of fissionable material in some cases with a breeder material carbide and a moderator which slug is disposed in a canning jacket of relatively impermeable moderator material. Such canned fuel slugs are disposed in an elongated shell of moderator having greater gas permeability than the canning material wherefore application of reduced pressure to the space therebetween causes gas diffusing through the exterior shell to sweep fission products from the system. Integral fission product traps and/or exterior traps as well as a fission product monitoring system may be employed therewith. (AEC)

  14. Turtle Graphics of Morphic Sequences

    NASA Astrophysics Data System (ADS)

    Zantema, Hans

    2016-02-01

    The simplest infinite sequences that are not ultimately periodic are pure morphic sequences: fixed points of particular morphisms mapping single symbols to strings of symbols. A basic way to visualize a sequence is by a turtle curve: for every alphabet symbol fix an angle, and then consecutively for all sequence elements draw a unit segment and turn the drawing direction by the corresponding angle. This paper investigates turtle curves of pure morphic sequences. In particular, criteria are given for turtle curves being finite (consisting of finitely many segments), and for being fractal or self-similar: it contains an up-scaled copy of itself. Also space-filling turtle curves are considered, and a turtle curve that is dense in the plane. As a particular result we give an exact relationship between the Koch curve and a turtle curve for the Thue-Morse sequence, where until now for such a result only approximations were known.

  15. Complete genome sequences of multidrug-resistant Campylobacter jejuni 14980A (turkey feces) and Campylobacter coli 14983A (housefly from turkey farm), harboring a novel gentamicin resistance mobile element.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Multidrug resistance (MDR) in foodborne pathogens is a major food safety and public health issue. Here we describe whole-genome sequences of two MDR strains of Campylobacter jejuni and Campylobacter coli from turkey feces and a housefly in a turkey farm. Both strains harbor a novel chromosomal genta...

  16. Explicit knowledge enhances motor vigor and performance: motivation versus practice in sequence tasks

    PubMed Central

    Lindquist, Martin A.; Haith, Adrian M.; Krakauer, John W.

    2015-01-01

    Motor skill learning involves a practice-induced improvement in the speed and/or accuracy of a discrete movement. It is often thought that paradigms involving repetitive practice of discrete movements performed in a fixed sequence result in a further enhancement of skill beyond practice of the individual movements in a random order. Sequence-specific performance improvements could, however, arise without practice as a result of knowledge of the sequence order; knowledge could operate by either enabling advanced motor planning of the known sequence elements or by increasing overall motivation. Here, we examined how knowledge and practice contribute to performance of a sequence of movements. We found that explicit knowledge provided through instruction produced practice-independent improvements in reaction time and execution quality. These performance improvements occurred even for random elements within a partially known sequence, indicative of a general motivational effect rather than a sequence-specific effect of advanced planning. This motivational effect suggests that knowledge influences performance in a manner analogous to reward. Additionally, practice led to similar improvements in execution quality for both known and random sequences. The lack of interaction between knowledge and practice suggests that any skill acquisition occurring during discrete sequence tasks arises solely from practice of the individual movement elements, independent of their order. We conclude that performance improvements in discrete sequence tasks arise from the combination of knowledge-based motivation and sequence-independent practice; investigating this interplay between cognition and movement may facilitate a greater understanding of the acquisition of skilled behavior. PMID:25904709

  17. Long terminal repeat of murine retroviral DNAs: sequence analysis, host-proviral junctions, and preintegration site.

    PubMed Central

    Van Beveren, C; Rands, E; Chattopadhyay, S K; Lowy, D R; Verma, I M

    1982-01-01

    The nucleotide sequence of the long terminal repeat (LTR) of three murine retroviral DNAs has been determined. The data indicate that the U5 region (sequences originating from the 5' end of the genome) of various LTRs is more conserved than the U3 region (sequences from the 3' end of the genome). The location and sequence of the control elements such as the 5' cap, "TATA-like" sequences, "CCAAT-box," and presumptive polyadenylic acid addition signal AATAAA in the various LTRs are nearly identical. Some murine retroviral DNAs contain a duplication of sequences within the LTR ranging in size from 58 to 100 base pairs. A variant of molecularly cloned Moloney murine sarcoma virus DNA in which one of the two LTRs integrated into the viral DNA was also analyzed. A 4-base-pair duplication was generated at the site of integration of LTR in the viral DNA. The host-viral junction of two molecularly cloned AKR-murine leukemia virus DNAs (clones 623 and 614) was determined. In the case of AKR-623 DNA, a 3- or 4-base-pair direct repeat of cellular sequences flanking the viral DNA was observed. However, AKR-614 DNA contained a 5-base-pair repeat of cellular sequences. The nucleotide sequence of the preintegration site of AKR-623 DNA revealed that the cellular sequences duplicated during integration are present only once. Finally, a striking homology between the sequences flanking the preintegration site and viral LTRs was observed. Images PMID:6281466

  18. Rural Schools Facilities: Additions & Renovations As an Integrated Sequence.

    ERIC Educational Resources Information Center

    Swedberg, Dan

    The community/school relationship is considered vital in helping rural school districts adapt to changing needs through renovation and/or expansion of its school facilities. How these needs are met involves choices that include consolidation with another district, new school construction, or renovation and adding on to an existing school. This…

  19. FUEL ELEMENT

    DOEpatents

    Howard, R.C.; Bokros, J.C.

    1962-03-01

    A fueled matrlx eontnwinlng uncomblned carbon is deslgned for use in graphlte-moderated gas-cooled reactors designed for operatlon at temperatures (about 1500 deg F) at which conventional metallic cladding would ordlnarily undergo undesired carburization or physical degeneratlon. - The invention comprlses, broadly a fuel body containlng uncombined earbon, clad with a nickel alloy contalning over about 28 percent by' weight copper in the preferred embodlment. Thls element ls supporirted in the passageways in close tolerance with the walls of unclad graphite moderator materlal. (AEC)

  20. A novel vacuum spectrometer for total reflection x-ray fluorescence analysis with two exchangeable low power x-ray sources for the analysis of low, medium, and high Z elements in sequence

    SciTech Connect

    Wobrauschek, P. Prost, J.; Ingerle, D.; Kregsamer, P.; Streli, C.; Misra, N. L.

    2015-08-15

    The extension of the detectable elemental range with Total Reflection X-ray Fluorescence (TXRF) analysis is a challenging task. In this paper, it is demonstrated how a TXRF spectrometer is modified to analyze elements from carbon to uranium. Based on the existing design of a vacuum TXRF spectrometer with a 12 specimen sample changer, the following components were renewed: the silicon drift detector with 20 mm{sup 2} active area and having a special ultra-thin polymer window allowing the detection of elements from carbon upwards. Two exchangeable X-ray sources guarantee the efficient excitation of both low and high Z elements. These X-ray sources were two light-weighted easily mountable 35 W air-cooled low-power tubes with Cr and Rh anodes, respectively. The air cooled tubes and the Peltier-cooled detector allowed to construct a transportable tabletop spectrometer with compact dimensions, as neither liquid nitrogen cooling for the detector nor a water cooling circuit and a bulky high voltage generator for the X-ray tubes are required. Due to the excellent background conditions as a result of the TXRF geometry, detection limits of 150 ng for C, 12 ng for F, and 3.3 ng for Na have been obtained using Cr excitation in vacuum. For Rh excitation, the detection limits of 90 pg could be achieved for Sr. Taking 10 to 20 μl of sample volume, extrapolated detection limits in the ng/g (ppb) range are resulting in terms of concentration.

  1. A novel vacuum spectrometer for total reflection x-ray fluorescence analysis with two exchangeable low power x-ray sources for the analysis of low, medium, and high Z elements in sequence

    NASA Astrophysics Data System (ADS)

    Wobrauschek, P.; Prost, J.; Ingerle, D.; Kregsamer, P.; Misra, N. L.; Streli, C.

    2015-08-01

    The extension of the detectable elemental range with Total Reflection X-ray Fluorescence (TXRF) analysis is a challenging task. In this paper, it is demonstrated how a TXRF spectrometer is modified to analyze elements from carbon to uranium. Based on the existing design of a vacuum TXRF spectrometer with a 12 specimen sample changer, the following components were renewed: the silicon drift detector with 20 mm2 active area and having a special ultra-thin polymer window allowing the detection of elements from carbon upwards. Two exchangeable X-ray sources guarantee the efficient excitation of both low and high Z elements. These X-ray sources were two light-weighted easily mountable 35 W air-cooled low-power tubes with Cr and Rh anodes, respectively. The air cooled tubes and the Peltier-cooled detector allowed to construct a transportable tabletop spectrometer with compact dimensions, as neither liquid nitrogen cooling for the detector nor a water cooling circuit and a bulky high voltage generator for the X-ray tubes are required. Due to the excellent background conditions as a result of the TXRF geometry, detection limits of 150 ng for C, 12 ng for F, and 3.3 ng for Na have been obtained using Cr excitation in vacuum. For Rh excitation, the detection limits of 90 pg could be achieved for Sr. Taking 10 to 20 μl of sample volume, extrapolated detection limits in the ng/g (ppb) range are resulting in terms of concentration.

  2. DPTEdb, an integrative database of transposable elements in dioecious plants.

    PubMed

    Li, Shu-Fen; Zhang, Guo-Jun; Zhang, Xue-Jin; Yuan, Jin-Hong; Deng, Chuan-Liang; Gu, Lian-Feng; Gao, Wu-Jun

    2016-01-01

    Dioecious plants usually harbor 'young' sex chromosomes, providing an opportunity to study the early stages of sex chromosome evolution. Transposable elements (TEs) are mobile DNA elements frequently found in plants and are suggested to play important roles in plant sex chromosome evolution. The genomes of several dioecious plants have been sequenced, offering an opportunity to annotate and mine the TE data. However, comprehensive and unified annotation of TEs in these dioecious plants is still lacking. In this study, we constructed a dioecious plant transposable element database (DPTEdb). DPTEdb is a specific, comprehensive and unified relational database and web interface. We used a combination of de novo, structure-based and homology-based approaches to identify TEs from the genome assemblies of previously published data, as well as our own. The database currently integrates eight dioecious plant species and a total of 31 340 TEs along with classification information. DPTEdb provides user-friendly web interfaces to browse, search and download the TE sequences in the database. Users can also use tools, including BLAST, GetORF, HMMER, Cut sequence and JBrowse, to analyze TE data. Given the role of TEs in plant sex chromosome evolution, the database will contribute to the investigation of TEs in structural, functional and evolutionary dynamics of the genome of dioecious plants. In addition, the database will supplement the research of sex diversification and sex chromosome evolution of dioecious plants.Database URL: http://genedenovoweb.ticp.net:81/DPTEdb/index.php.

  3. DPTEdb, an integrative database of transposable elements in dioecious plants

    PubMed Central

    Li, Shu-Fen; Zhang, Guo-Jun; Zhang, Xue-Jin; Yuan, Jin-Hong; Deng, Chuan-Liang; Gu, Lian-Feng; Gao, Wu-Jun

    2016-01-01

    Dioecious plants usually harbor ‘young’ sex chromosomes, providing an opportunity to study the early stages of sex chromosome evolution. Transposable elements (TEs) are mobile DNA elements frequently found in plants and are suggested to play important roles in plant sex chromosome evolution. The genomes of several dioecious plants have been sequenced, offering an opportunity to annotate and mine the TE data. However, comprehensive and unified annotation of TEs in these dioecious plants is still lacking. In this study, we constructed a dioecious plant transposable element database (DPTEdb). DPTEdb is a specific, comprehensive and unified relational database and web interface. We used a combination of de novo, structure-based and homology-based approaches to identify TEs from the genome assemblies of previously published data, as well as our own. The database currently integrates eight dioecious plant species and a total of 31 340 TEs along with classification information. DPTEdb provides user-friendly web interfaces to browse, search and download the TE sequences in the database. Users can also use tools, including BLAST, GetORF, HMMER, Cut sequence and JBrowse, to analyze TE data. Given the role of TEs in plant sex chromosome evolution, the database will contribute to the investigation of TEs in structural, functional and evolutionary dynamics of the genome of dioecious plants. In addition, the database will supplement the research of sex diversification and sex chromosome evolution of dioecious plants. Database URL: http://genedenovoweb.ticp.net:81/DPTEdb/index.php PMID:27173524

  4. Sequencing Voyager II for the Uranus encounter

    NASA Technical Reports Server (NTRS)

    Morris, R. B.

    1986-01-01

    The process of developing the programmed sequence of events necessary for the Voyager 2 spacecraft to return desired data from its Uranus encounter is discussed. The major steps in the sequence process are reviewed, and the elements of the Mission Sequence Software are described. The design phase and the implementation phase of the sequence process are discussed, and the Computer Command Subsystem architecture is examined in detail. The software's role in constructing the sequences and converting them into onboard programs is elucidated, and the problems unique to the Uranus encounter sequences are considered.

  5. Developmental contributions to motor sequence learning.

    PubMed

    Savion-Lemieux, Tal; Bailey, Jennifer A; Penhune, Virginia B

    2009-05-01

    Little is known about how children acquire new motor sequences. In particular, it is not clear if the same learning progression observed in adults is also present in childhood nor whether motor skills are acquired in a similar fashion across development. In the present study we used the multi-finger sequencing task (MFST), a variant of the serial reaction time (SRT) task, to study motor sequence learning, across two consecutive days, in three cross-sectional samples of children aged 6, 8, and 10 years, and a control sample of adults. In the MFST, participants reproduced 10-element sequences of key presses on an electronic keyboard, using four fingers of the right hand. Each block of practice included 10 intermixed trials of a Repeated (REP) sequence and four trials of Random (RAN) sequences. Performance was assessed by examining changes in accuracy, a component of the task that requires the association of the visual stimulus with the motor response, and response synchronization, a component that requires fine-grained sensorimotor integration and timing. Additionally, participants completed Recognition and Recall tests, to assess explicit knowledge of the repeated sequence. Overall, results showed a developmental progression in motor sequence learning within and across days of practice. Interestingly, the two behavioral measures showed different developmental trajectories. For accuracy, differences were greatest for the two youngest groups early in learning, and these groups also showed the greatest rate of improvement. However, by the end of Day 2, only the 6-year-olds still lagged behind all other groups. For response synchronization, all child groups differed from adults early in learning, but both child and adult groups showed similar rates of improvement across blocks of practice. By the end of Day 2, 10-year-olds reached adult levels of performance, whereas 6- and 8-year-olds did not. Taken together, the dissociation observed with our two behavioral measures

  6. Orbital-Maneuver-Sequence Optimization

    DTIC Science & Technology

    1985-12-01

    optimization computer program and applied it to the generation of optimal cog-brbital attack4ianeuver sequences * and to the generation of optimal evasions...maneuver-sequence- optimization computer programs can be improved by a general restructuring and streamlining and the addition of various features. It is...believed that with further development and systematic testing the programs have potential for real-time generation of optimal maneuver sequences in an

  7. Transposon facilitated DNA sequencing

    SciTech Connect

    Berg, D.E.; Berg, C.M.; Huang, H.V.

    1990-01-01

    The purpose of this research is to investigate and develop methods that exploit the power of bacterial transposable elements for large scale DNA sequencing: Our premise is that the use of transposons to put primer binding sites randomly in target DNAs should provide access to all portions of large DNA fragments, without the inefficiencies of methods involving random subcloning and attendant repetitive sequencing, or of sequential synthesis of many oligonucleotide primers that are used to match systematically along a DNA molecule. Two unrelated bacterial transposons, Tn5 and {gamma}{delta}, are being used because they have both proven useful for molecular analyses, and because they differ sufficiently in mechanism and specificity of transposition to merit parallel development.

  8. An Effective Approach for Analyzing “Prefinished” Genomic Sequence Data

    PubMed Central

    Kuehl, Peter M.; Weisemann, Jane M.; Touchman, Jeffrey W.; Green, Eric D.; Boguski, Mark S.

    1999-01-01

    Ongoing efforts to sequence the human genome are already generating large amounts of data, with substantial increases anticipated over the next few years. In most cases, a shotgun sequencing strategy is being used, which rapidly yields most of the primary sequence in incompletely assembled sequence contigs (“prefinished” sequence) and more slowly produces the final, completely assembled sequence (“finished” sequence). Thus, in general, prefinished sequence is produced in excess of finished sequence, and this trend is certain to continue and even accelerate over the next few years. Even at a prefinished stage, genomic sequence represents a rich source of important biological information that is of great interest to many investigators. However, analyzing such data is a challenging and daunting task, both because of its sheer volume and because it can change on a day-by-day basis. To facilitate the discovery and characterization of genes and other important elements within prefinished sequence, we have developed an analytical strategy and system that uses readily available software tools in new combinations. Implementation of this strategy for the analysis of prefinished sequence data from human chromosome 7 has demonstrated that this is a convenient, inexpensive, and extensible solution to the problem of analyzing the large amounts of preliminary data being produced by large-scale sequencing efforts. Our approach is accessible to any investigator who wishes to assimilate additional information about particular sequence data en route to developing richer annotations of a finished sequence. [Our software system is available via an extensive web supplement to this article at http://www.ncbi.nlm.nih.gov/Kuehl/prefinished.] PMID:10022984

  9. Sequence-Modified Antibiotic Resistance Genes Provide Sustained Plasmid-Mediated Transgene Expression in Mammals.

    PubMed

    Lu, Jiamiao; Zhang, Feijie; Fire, Andrew Z; Kay, Mark A

    2017-03-30

    Conventional plasmid vectors are incapable of achieving sustained levels of transgene expression in vivo even in quiescent mammalian tissues because the transgene expression cassette is silenced. Transcriptional silencing results from the presence of the bacterial plasmid backbone or virtually any DNA sequence of >1 kb in length placed outside of the expression cassette. Here, we show that transcriptional silencing can be substantially forestalled by increasing the An/Tn sequence composition in the plasmid bacterial backbone. Increasing numbers of An/Tn sequences increased sustained transcription of both backbone sequences and adjacent expression cassettes. In order to recapitulate these expression profiles in compact and portable plasmid DNA backbones, we engineered the standard kanamycin or ampicillin antibiotic resistance genes, optimizing the number of An/Tn sequence without altering the encoded amino acids. The resulting vector backbones yield sustained transgene expression from mouse liver, providing generic DNA vectors capable of sustained transgene expression without additional genes or mammalian regulatory elements.

  10. Gene Slider: sequence logo interactive data-visualization for education and research.

    PubMed

    Waese, Jamie; Pasha, Asher; Wang, Ting Ting; van Weringh, Anna; Guttman, David S; Provart, Nicholas J

    2016-12-01

    Gene Slider helps visualize the conservation and entropy of orthologous DNA and protein sequences by presenting them as one long sequence logo that can be zoomed in and out of, from an overview of the entire sequence down to just a few residues at a time. A search function enables users to find motifs such as cis-elements in promoter regions by simply 'drawing' a sequence logo representation of the desired motif as a query. In addition to displaying user-supplied FASTA files, our demonstration version of Gene Slider loads and displays a rich database of 90 000+ conserved non-coding regions across the Brassicaceae indexed to the TAIR10 Col-0 Arabidopsis thaliana sequence. It also displays transcription factor binding sites, enabling easy identification of regions that are both conserved across multiple species and may contain transcription factor binding sites.

  11. MSLICE Sequencing

    NASA Technical Reports Server (NTRS)

    Crockett, Thomas M.; Joswig, Joseph C.; Shams, Khawaja S.; Norris, Jeffrey S.; Morris, John R.

    2011-01-01

    MSLICE Sequencing is a graphical tool for writing sequences and integrating them into RML files, as well as for producing SCMF files for uplink. When operated in a testbed environment, it also supports uplinking these SCMF files to the testbed via Chill. This software features a free-form textural sequence editor featuring syntax coloring, automatic content assistance (including command and argument completion proposals), complete with types, value ranges, unites, and descriptions from the command dictionary that appear as they are typed. The sequence editor also has a "field mode" that allows tabbing between arguments and displays type/range/units/description for each argument as it is edited. Color-coded error and warning annotations on problematic tokens are included, as well as indications of problems that are not visible in the current scroll range. "Quick Fix" suggestions are made for resolving problems, and all the features afforded by modern source editors are also included such as copy/cut/paste, undo/redo, and a sophisticated find-and-replace system optionally using regular expressions. The software offers a full XML editor for RML files, which features syntax coloring, content assistance and problem annotations as above. There is a form-based, "detail view" that allows structured editing of command arguments and sequence parameters when preferred. The "project view" shows the user s "workspace" as a tree of "resources" (projects, folders, and files) that can subsequently be opened in editors by double-clicking. Files can be added, deleted, dragged-dropped/copied-pasted between folders or projects, and these operations are undoable and redoable. A "problems view" contains a tabular list of all problems in the current workspace. Double-clicking on any row in the table opens an editor for the appropriate sequence, scrolling to the specific line with the problem, and highlighting the problematic characters. From there, one can invoke "quick fix" as described

  12. Striatal and hippocampal involvement in motor sequence chunking depends on the learning strategy.

    PubMed

    Lungu, Ovidiu; Monchi, Oury; Albouy, Geneviève; Jubault, Thomas; Ballarin, Emanuelle; Burnod, Yves; Doyon, Julien

    2014-01-01

    Motor sequences can be learned using an incremental approach by starting with a few elements and then adding more as training evolves (e.g., learning a piano piece); conversely, one can use a global approach and practice the whole sequence in every training session (e.g., shifting gears in an automobile). Yet, the neural correlates associated with such learning strategies in motor sequence learning remain largely unexplored to date. Here we used functional magnetic resonance imaging to measure the cerebral activity of individuals executing the same 8-element sequence after they completed a 4-days training regimen (2 sessions each day) following either a global or incremental strategy. A network comprised of striatal and fronto-parietal regions was engaged significantly regardless of the learning strategy, whereas the global training regimen led to additional cerebellar and temporal lobe recruitment. Analysis of chunking/grouping of sequence elements revealed a common prefrontal network in both conditions during the chunk initiation phase, whereas execution of chunk cores led to higher mediotemporal activity (involving the hippocampus) after global than incremental training. The novelty of our results relate to the recruitment of mediotemporal regions conditional of the learning strategy. Thus, the present findings may have clinical implications suggesting that the ability of patients with lesions to the medial temporal lobe to learn and consolidate new motor sequences may benefit from using an incremental strategy.

  13. Form drag in rivers due to small-scale natural topographic features: 2. Irregular sequences

    USGS Publications Warehouse

    Kean, J.W.; Smith, J.D.

    2006-01-01

    The size, shape, and spacing of small-scale topographic features found on the boundaries of natural streams, rivers, and floodplains can be quite variable. Consequently, a procedure for determining the form drag on irregular sequences of different-sized topographic features is essential for calculating near-boundary flows and sediment transport. A method for carrying out such calculations is developed in this paper. This method builds on the work of Kean and Smith (2006), which describes the flow field for the simpler case of a regular sequence of identical topographic features. Both approaches model topographic features as two-dimensional elements with Gaussian-shaped cross sections defined in terms of three parameters. Field measurements of bank topography are used to show that (1) the magnitude of these shape parameters can vary greatly between adjacent topographic features and (2) the variability of these shape parameters follows a lognormal distribution. Simulations using an irregular set of topographic roughness elements show that the drag on an individual element is primarily controlled by the size and shape of the feature immediately upstream and that the spatial average of the boundary shear stress over a large set of randomly ordered elements is relatively insensitive to the sequence of the elements. In addition, a method to transform the topography of irregular surfaces into an equivalently rough surface of regularly spaced, identical topographic elements also is given. The methods described in this paper can be used to improve predictions of flow resistance in rivers as well as quantify bank roughness.

  14. Functionally conserved cis-regulatory elements of COL18A1 identified through zebrafish transgenesis.

    PubMed

    Kague, Erika; Bessling, Seneca L; Lee, Josephine; Hu, Gui; Passos-Bueno, Maria Rita; Fisher, Shannon

    2010-01-15

    Type XVIII collagen is a component of basement membranes, and expressed prominently in the eye, blood vessels, liver, and the central nervous system. Homozygous mutations in COL18A1 lead to Knobloch Syndrome, characterized by ocular defects and occipital encephalocele. However, relatively little has been described on the role of type XVIII collagen in development, and nothing is known about the regulation of its tissue-specific expression pattern. We have used zebrafish transgenesis to identify and characterize cis-regulatory sequences controlling expression of the human gene. Candidate enhancers were selected from non-coding sequence associated with COL18A1 based on sequence conservation among mammals. Although these displayed no overt conservation with orthologous zebrafish sequences, four regions nonetheless acted as tissue-specific transcriptional enhancers in the zebrafish embryo, and together recapitulated the major aspects of col18a1 expression. Additional post-hoc computational analysis on positive enhancer sequences revealed alignments between mammalian and teleost sequences, which we hypothesize predict the corresponding zebrafish enhancers; for one of these, we demonstrate functional overlap with the orthologous human enhancer sequence. Our results provide important insight into the biological function and regulation of COL18A1, and point to additional sequences that may contribute to complex diseases involving COL18A1. More generally, we show that combining functional data with targeted analyses for phylogenetic conservation can reveal conserved cis-regulatory elements in the large number of cases where computational alignment alone falls short.

  15. [Gene and gene sequence patenting].

    PubMed

    Bergel, S D

    1998-01-01

    According to the author, the patenting of elements isolated or copied from the human body boils down to the issue of genes and gene sequences. He describes the current situation from the comparative law standpoint (U.S. and Spanish law mainly) and then esamines the biotechnology industry's position.

  16. Identification of two factors which bind to the upstream sequences of a number of nuclear genes coding for mitochondrial proteins and to genetic elements important for cell division in yeast.

    PubMed Central

    Dorsman, J C; van Heeswijk, W C; Grivell, L A

    1988-01-01

    Two abundant factors, GFI and GFII which interact with the 5' flanking regions of nuclear genes coding for proteins of the mitochondrial respiratory chain have been identified. In one case (subunit VIII of QH2: cytochrome c oxidoreductase) the binding sites for both factors overlap completely and their binding is mutually exclusive. For the other 5' regions tested the GFI and GFII binding sites do not coincide. Interestingly, binding sites for GFI and GFII are also present in or at the 3' ends of the coding regions of two genes of the PHO gene family and in DNA elements important for optimal ARS and CEN function respectively. The sites recognized by GFI conform to the consensus RTCRNNNNNNACGNR, while those recognized by GFII contain the element RTCACGTG. We speculate that GFI and GFII may play a role in different cellular processes, dependent on the context of their binding sites and that one of these processes may be the coordination of the expression of genes involved in mitochondrial biogenesis with the progress of the cell cycle. Images PMID:3045755

  17. Presence of env-like sequences in Quercus suber retrotransposons.

    PubMed

    Carvalho, M; Ribeiro, T; Viegas, W; Morais-Cecilio, L; Rocheta, M

    2010-01-01

    The main difference between LTR retrotransposons and retroviruses is the presence of the envelope (env) gene in the latter, downstream of the pol gene. The env gene is involved in their infectious capacity. Here we report the presence of env-like sequences in the genome of Quercus suber (cork oak), one of the most economically important Portuguese species. These gene sequences were isolated through DNA amplification between RNaseH conserved motifs and 3' LTR, based on the structure of copia retrotransposons. Phylogenetic analysis revealed that almost all the clones isolated are clustered with Cyclops-2, a Ty3-gypsy element identified in Pisum sativum, except one clustered with gypsy and copia retroelements found in different species. This suggests the existence of a potential ancestral sequence of the env gene, prior to the separation of Ty3-gypsy and Ty1-copia retrotransposons. Additionally, the isolated env-like sequences showed 26-39% of homology with env-like sequences characterized in viruses. The origin of env-like sequences in retrotransposons from host plant taxa is discussed.

  18. Damper mechanism for nuclear reactor control elements

    DOEpatents

    Taft, William Elwood

    1976-01-01

    A damper mechanism which provides a nuclear reactor control element decelerating function at the end of the scram stroke. The total damping function is produced by the combination of two assemblies, which operate in sequence. First, a tapered dashram assembly decelerates the control element to a lower velocity, after which a spring hydraulic damper assembly takes over to complete the final damping.

  19. Evolution of P Elements in Natural Populations of Drosophila willistoni and D. sturtevanti

    PubMed Central

    Silva, Joana C.; Kidwell, Margaret G.

    2004-01-01

    To determine how population structure of the host species affects the spread of transposable elements and to assess the strength of selection acting on different structural regions, we sequenced P elements from strains of Drosophila willistoni and Drosophila sturtevanti sampled from across the distributions of these species. Elements from D. sturtevanti exhibited considerable sequence variation, and similarity among them was correlated to geographic distance between collection sites. By contrast, all D. willistoni elements sampled were essentially identical (π < 0.2%) and exhibited patterns typical of a recent population expansion. While the canonical P elements sampled from D. sturtevanti appear to be long-time residents in that species, a rapid expansion of a very young canonical P-element lineage is suggested in D. willistoni, overcoming barriers such as large geographical distances and moderate levels of population subdivision. Between-species comparisons reveal selective constraints on P-element evolution, as indicated by significantly different substitution rates in noncoding, silent, and replacement sites. Most remarkably, in addition to replacement sites, selection pressure appears to be strong in the first and third introns and in the 3′ and 5′ flanking regions. PMID:15579688

  20. Chemistry of the superheavy elements.

    PubMed

    Schädel, Matthias

    2015-03-13

    The quest for superheavy elements (SHEs) is driven by the desire to find and explore one of the extreme limits of existence of matter. These elements exist solely due to their nuclear shell stabilization. All 15 presently 'known' SHEs (11 are officially 'discovered' and named) up to element 118 are short-lived and are man-made atom-at-a-time in heavy ion induced nuclear reactions. They are identical to the transactinide elements located in the seventh period of the periodic table beginning with rutherfordium (element 104), dubnium (element 105) and seaborgium (element 106) in groups 4, 5 and 6, respectively. Their chemical properties are often surprising and unexpected from simple extrapolations. After hassium (element 108), chemistry has now reached copernicium (element 112) and flerovium (element 114). For the later ones, the focus is on questions of their metallic or possibly noble gas-like character originating from interplay of most pronounced relativistic effects and electron-shell effects. SHEs provide unique opportunities to get insights into the influence of strong relativistic effects on the atomic electrons and to probe 'relativistically' influenced chemical properties and the architecture of the periodic table at its farthest reach. In addition, they establish a test bench to challenge the validity and predictive power of modern fully relativistic quantum chemical models.

  1. Genomic distribution of copia-like transposable elements in somatic tissues and during development of Drosophila melanogaster.

    PubMed

    Di Franco, C; Pisano, C; Dimitri, P; Gigliotti, S; Junakovic, N

    1989-12-01

    The genomic distribution of elements of the copia, 412, B 104, mdg 1, mdg 4 and 1731 transposon families was compared by the Southern technique in DNA preparations extracted from brains, salivary glands and adult flies of two related Drosophila lines. The copia, 412 and mdg 1 sequences were also probed in DNA from sperm, embryos, and 1st and 2nd instar larvae. The homogeneity of the patterns observed shows that somatic transposition is unlikely to occur frequently. A correlation between mobility and the euchromatic or heterochromatic location of transposable elements is discussed. In addition, an explanation of the variable band intensities of transposable elements in Southern autoradiographs is proposed.

  2. Identification of Genetic Elements Associated with EPSPS Gene Amplification

    PubMed Central

    Gaines, Todd A.; Wright, Alice A.; Molin, William T.; Lorentz, Lothar; Riggins, Chance W.; Tranel, Patrick J.; Beffa, Roland; Westra, Philip; Powles, Stephen B.

    2013-01-01

    Weed populations can have high genetic plasticity and rapid responses to environmental selection pressures. For example, 100-fold amplification of the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene evolved in the weed species Amaranthus palmeri to confer resistance to glyphosate, the world’s most important herbicide. However, the gene amplification mechanism is unknown. We sequenced the EPSPS gene and genomic regions flanking EPSPS loci in A. palmeri, and searched for mobile genetic elements or repetitive sequences. The EPSPS gene was 10,229 bp, containing 8 exons and 7 introns. The gene amplification likely proceeded through a DNA-mediated mechanism, as introns exist in the amplified gene copies and the entire amplified sequence is at least 30 kb in length. Our data support the presence of two EPSPS loci in susceptible (S) A. palmeri, and that only one of these was amplified in glyphosate-resistant (R) A. palmeri. The EPSPS gene amplification event likely occurred recently, as no sequence polymorphisms were found within introns of amplified EPSPS copies from R individuals. Sequences with homology to miniature inverted-repeat transposable elements (MITEs) were identified next to EPSPS gene copies only in R individuals. Additionally, a putative Activator (Ac) transposase and a repetitive sequence region were associated with amplified EPSPS genes. The mechanism controlling this DNA-mediated amplification remains unknown. Further investigation is necessary to determine if the gene amplification may have proceeded via DNA transposon-mediated replication, and/or unequal recombination between different genomic regions resulting in replication of the EPSPS gene. PMID:23762434

  3. Terminological aspects of data elements

    SciTech Connect

    Strehlow, R.A. ); Kenworthey, W.H. Jr. ); Schuldt, R.E. )

    1991-01-01

    The creation and display of data comprise a process that involves a sequence of steps requiring both semantic and systems analysis. An essential early step in this process is the choice, definition, and naming of data element concepts and is followed by the specification of other needed data element concept attributes. The attributes and the values of data element concept remain associated with them from their birth as a concept to a generic data element that serves as a template for final application. Terminology is, therefore, centrally important to the entire data creation process. Smooth mapping from natural language to a database is a critical aspect of database, and consequently, it requires terminology standardization from the outset of database work. In this paper the semantic aspects of data elements are analyzed and discussed. Seven kinds of data element concept information are considered and those that require terminological development and standardization are identified. The four terminological components of a data element are the hierarchical type of a concept, functional dependencies, schematas showing conceptual structures, and definition statements. These constitute the conventional role of terminology in database design. 12 refs., 8 figs., 1 tab.

  4. Transposable elements and circular DNAs

    PubMed Central

    2016-01-01

    ABSTRACT Circular DNAs are extra-chromosomal fragments that become circularized by genomic recombination events. We have recently shown that yeast LTR elements generate circular DNAs through recombination events between their flanking long terminal repeats (LTRs). Similarly, circular DNAs can be generated by recombination between LTRs residing at different genomic loci, in which case the circular DNA will contain the intervening sequence. In yeast, this can result in gene copy number variations when circles contain genes and origins of replication. Here, I speculate on the potential and implications of circular DNAs generated through recombination between human transposable elements. PMID:28090380

  5. The structure of the human peripherin gene (PRPH) and identification of potential regulatory elements

    SciTech Connect

    Foley, J.; Ley, C.A.; Parysek, L.M.

    1994-07-15

    The authors determined the complete nucleotide sequence of the coding region of the human peripherin gene (PRPH), as well as 742 bp 5{prime} to the cap site and 584 bp 3{prime} to the stop codon, and compared its structure and sequence to the rat and mouse genes. The overall structure of 9 exons separated by 8 introns is conserved among these three mammalian species. The nucleotide sequences of the human peripherin gene exons were 90% identical to the rat gene sequences, and the predicted human peripherin protein differed from rat peripherin at only 18 of 475 amino acid residues. Comparison of the 5{prime} flanking regions of the human peripherin gene and rodent genes revealed extensive areas of high homology. Additional conserved segments were found in introns 1 and 2. Within the 5{prime} region, potential regulatory sequences, including a nerve growth factor negative regulatory element, a Hox protein binding site, and a heat shock element, were identified in all peripherin genes. The positional conservation of each element suggests that they may be important in the tissue-specific, developmental-specific, and injury-specific expression of the peripherin gene. 24 refs., 2 figs., 1 tab.

  6. Functional mapping of the translation-dependent instability element of yeast MATalpha1 mRNA.

    PubMed Central

    Hennigan, A N; Jacobson, A

    1996-01-01

    The determinants of mRNA stability include specific cis-acting destabilizing sequences located within mRNA coding and noncoding regions. We have developed an approach for mapping coding-region instability sequences in unstable yeast mRNAs that exploits the link between mRNA translation and turnover and the dependence of nonsense-mediated mRNA decay on the activity of the UPF1 gene product. This approach, which involves the systematic insertion of in-frame translational termination codons into the coding sequence of a gene of interest in a upf1delta strain, differs significantly from conventional methods for mapping cis-acting elements in that it causes minimal perturbations to overall mRNA structure. Using the previously characterized MATalpha1 mRNA as a model, we have accurately localized its 65-nucleotide instability element (IE) within the protein coding region. Termination of translation 5' to this element stabilized the MATalpha1 mRNA two- to threefold relative to wild-type transcripts. Translation through the element was sufficient to restore an unstable decay phenotype, while internal termination resulted in different extents of mRNA stabilization dependent on the precise location of ribosome stalling. Detailed mutagenesis of the element's rare-codon/AU-rich sequence boundary revealed that the destabilizing activity of the MATalpha1 IE is observed when the terminal codon of the element's rare-codon interval is translated. This region of stability transition corresponds precisely to a MATalpha1 IE sequence previously shown to be complementary to 18S rRNA. Deletion of three nucleotides 3' to this sequence shifted the stability boundary one codon 5' to its wild-type location. Conversely, constructs containing an additional three nucleotides at this same location shifted the transition downstream by an equivalent sequence distance. Our results suggest a model in which the triggering of MATalpha1 mRNA destabilization results from establishment of an interaction

  7. Additive Similarity Trees

    ERIC Educational Resources Information Center

    Sattath, Shmuel; Tversky, Amos

    1977-01-01

    Tree representations of similarity data are investigated. Hierarchical clustering is critically examined, and a more general procedure, called the additive tree, is presented. The additive tree representation is then compared to multidimensional scaling. (Author/JKS)

  8. Expression of Transposable Elements in Neural Tissues during Xenopus Development

    PubMed Central

    Faunes, Fernando; Sanchez, Natalia; Moreno, Mauricio; Olivares, Gonzalo H.; Lee-Liu, Dasfne; Almonacid, Leonardo; Slater, Alex W.; Norambuena, Tomas; Taft, Ryan J.; Mattick, John S.; Melo, Francisco; Larrain, Juan

    2011-01-01

    Transposable elements comprise a large proportion of animal genomes. Transposons can have detrimental effects on genome stability but also offer positive roles for genome evolution and gene expression regulation. Proper balance of the positive and deleterious effects of transposons is crucial for cell homeostasis and requires a mechanism that tightly regulates their expression. Herein we describe the expression of DNA transposons of the Tc1/mariner superfamily during Xenopus development. Sense and antisense transcripts containing complete Tc1-2_Xt were detected in Xenopus embryos. Both transcripts were found in zygotic stages and were mainly localized in Spemann's organizer and neural tissues. In addition, the Tc1-like elements Eagle, Froggy, Jumpy, Maya, Xeminos and TXr were also expressed in zygotic stages but not oocytes in X. tropicalis. Interestingly, although Tc1-2_Xt transcripts were not detected in Xenopus laevis embryos, transcripts from other two Tc1-like elements (TXr and TXz) presented a similar temporal and spatial pattern during X. laevis development. Deep sequencing analysis of Xenopus tropicalis gastrulae showed that PIWI-interacting RNAs (piRNAs) are specifically derived from several Tc1-like elements. The localized expression of Tc1-like elements in neural tissues suggests that they could play a role during the development of the Xenopus nervous system. PMID:21818339

  9. The contribution of AAUAAA and the upstream element UUUGUA to the efficiency of mRNA 3'-end formation in plants.

    PubMed Central

    Rothnie, H M; Reid, J; Hohn, T

    1994-01-01

    The requirement for sequence specificity in the AAUAAA motif of the cauliflower mosaic virus (CaMV) polyadenylation signal was examined by saturation mutagenesis. While deletion of AAUAAA almost abolished processing at the CaMV polyadenylation site, none of the 18 possible single base mutations had a dramatic effect on processing efficiency. The effect of replacing all six nucleotides simultaneously varied depending on the sequence used, but some replacements were as detrimental as the deletion mutant. Taken together, these results confirm that AAUAAA is an essential component of the CaMV polyadenylation signal, but indicate that a high degree of sequence variation can be tolerated. A repeated UUUGUA motif was identified as an important upstream accessory element of the CaMV polyadenylation signal. This sequence was able to induce processing at a heterologous polyadenylation site in a sequence-specific and additive manner. The effect of altering the spacing between this upstream element and the AAUAAA was examined; moving these two elements closer together or further apart reduces the processing efficiency. The upstream element does not function to signal processing at the CaMV polyadenylation site if placed downstream of the cleavage site. Analysis of further upstream sequences revealed that almost all of the 200 nt fragment required for maximal processing contributes positively to processing efficiency. Furthermore, isolated far upstream sequences distinct from UUUGUA were also able to induce processing at a heterologous polyadenylation site. Images PMID:8187773

  10. Elements of Regolith Simulant's Cost Structure

    NASA Technical Reports Server (NTRS)

    Rickman, Douglas L.

    2009-01-01

    The cost of lunar regolith simulants is much higher than many users anticipate. After all, it is nothing more than broken rock. This class will discuss the elements which make up the cost structure for simulants. It will also consider which elements can be avoided under certain circumstances and which elements might be altered by the application of additional research and development.

  11. Identification of Bari Transposons in 23 Sequenced Drosophila Genomes Reveals Novel Structural Variants, MITEs and Horizontal Transfer.

    PubMed

    Palazzo, Antonio; Lovero, Domenica; D'Addabbo, Pietro; Caizzi, Ruggiero; Marsano, René Massimiliano

    2016-01-01

    Bari elements are members of the Tc1-mariner superfamily of DNA transposons, originally discovered in Drosophila melanogaster, and subsequently identified in silico in 11 sequenced Drosophila genomes and as experimentally isolated in four non-sequenced Drosophila species. Bari-like elements have been also studied for their mobility both in vivo and in vitro. We analyzed 23 Drosophila genomes and carried out a detailed characterization of the Bari elements identified, including those from the heterochromatic Bari1 cluster in D. melanogaster. We have annotated 401 copies of Bari elements classified either as putatively autonomous or inactive according to the structure of the terminal sequences and the presence of a complete transposase-coding region. Analyses of the integration sites revealed that Bari transposase prefers AT-rich sequences in which the TA target is cleaved and duplicated. Furthermore evaluation of transposon's co-occurrence near the integration sites of Bari elements showed a non-random distribution of other transposable elements. We also unveil the existence of a putatively autonomous Bari1 variant characterized by two identical long Terminal Inverted Repeats, in D. rhopaloa. In addition, we detected MITEs related to Bari transposons in 9 species. Phylogenetic analyses based on transposase gene and the terminal sequences confirmed that Bari-like elements are distributed into three subfamilies. A few inconsistencies in Bari phylogenetic tree with respect to the Drosophila species tree could be explained by the occurrence of horizontal transfer events as also suggested by the results of dS analyses. This study further clarifies the Bari transposon's evolutionary dynamics and increases our understanding on the Tc1-mariner elements' biology.

  12. Paucity of moderately repetitive sequences

    SciTech Connect

    Schmid, C.W.

    1991-01-01

    We examined clones of renatured repetitive human DNA to find novel repetitive DNAs. After eliminating known repeats, the remaining clones were subjected to sequence analysis. These clones also corresponded to known repeats, but with greater sequence diversity. This indicates that either these libraries were depleted of short interspersed repeats in construction, or these repeats are much less prevalent in the human genome than is indicated by data from {und Xenopus} or sea urchin studies. We directly investigated the sequence composition of human DNA through traditional renaturation techniques with the goal of estimating the limits of abundance of repetitive sequence classes in human DNA. Our results sharply limit the maximum possible abundance to 1--2% of the human genome. Our estimate, minus the known repeats in this fraction, leaves about 1% (3 {times} 10{sup 7} nucleotides) of the human genome for novel repetitive elements. 2 refs. (MHB)

  13. Polyimide processing additives

    NASA Technical Reports Server (NTRS)

    Pratt, J. R.; St. Clair, T. L.; Burks, H. D.; Stoakley, D. M.

    1987-01-01

    A method has been found for enhancing the melt flow of thermoplastic polyimides during processing. A high molecular weight 422 copoly(amic acid) or copolyimide was fused with approximately 0.05 to 5 pct by weight of a low molecular weight amic acid or imide additive, and this melt was studied by capillary rheometry. Excellent flow and improved composite properties on graphite resulted from the addition of a PMDA-aniline additive to LARC-TPI. Solution viscosity studies imply that amic acid additives temporarily lower molecular weight and, hence, enlarge the processing window. Thus, compositions containing the additive have a lower melt viscosity for a longer time than those unmodified.

  14. [Food additives and healthiness].

    PubMed

    Heinonen, Marina

    2014-01-01

    Additives are used for improving food structure or preventing its spoilage, for example. Many substances used as additives are also naturally present in food. The safety of additives is evaluated according to commonly agreed principles. If high concentrations of an additive cause adverse health effects for humans, a limit of acceptable daily intake (ADI) is set for it. An additive is a risk only when ADI is exceeded. The healthiness of food is measured on the basis of nutrient density and scientifically proven effects.

  15. Type I Repressors of P Element Mobility

    PubMed Central

    Gloor, G. B.; Preston, C. R.; Johnson-Schlitz, D. M.; Nassif, N. A.; Phillis, R. W.; Benz, W. K.; Robertson, H. M.; Engels, W. R.

    1993-01-01

    We describe here a family of P elements that we refer to as type I repressors. These elements are identified by their repressor functions and their lack of any deletion within the first two-thirds of the canonical P sequence. Elements belonging to this repressor class were isolated from P strains and were made in vitro. We found that type I repressor elements could strongly repress both a cytotype-dependent allele and P element mobility in somatic and germline tissues. These effects wer very dependent on genomic position. Moreover, we observed that an element's ability to repress in one assay positively correlated with its ability to repress in either of the other two assays. The type I family of repressor elements includes both autonomous P elements and those lacking exon 3 of the P element. Fine structure deletion mapping showed that the minimal 3' boundary of a functional type I element lies between nucleotide position 1950 and 1956. None of 12 elements examined with more extreme deletions extending into exon 2 made repressor. We conclude that the type I repressors form a structurally distinct group that does not include more extensively deleted repressor elements such as the KP element described previously. PMID:8224830

  16. Diversity of SCCmec Elements in Staphylococcus aureus as Observed in South-Eastern Germany.

    PubMed

    Monecke, Stefan; Jatzwauk, Lutz; Müller, Elke; Nitschke, Hedda; Pfohl, Katharina; Slickers, Peter; Reissig, Annett; Ruppelt-Lorz, Antje; Ehricht, Ralf

    2016-01-01

    SCCmec elements are very important mobile genetic elements in Staphylococci that carry beta-lactam resistance genes mecA/mecC, recombinase genes and a variety of accessory genes. Twelve main types and a couple of variants have yet been described. In addition, there are also other SCC elements harbouring other markers. In order to subtype strains of methicillin-resistant S. aureus (MRSA) based on variations within their SCCmec elements, 86 markers were selected from published SCC sequences for an assay based on multiplexed primer extension reactions followed by hybridisation to the specific probes. These included mecA/mecC, fusC, regulatory genes, recombinase genes, genes from ACME and heavy metal resistance loci as well as several genes of unknown function. Hybridisation patterns for published genome or SCC sequences were theoretically predicted. For validation of the microarray based assay and for stringent hybridisation protocol optimization, real hybridization experiments with fully sequenced reference strains were performed modifying protocols until yielded the results were in concordance to the theoretical predictions. Subsequently, 226 clinical isolates from two hospitals in the city of Dresden, Germany, were characterised in detail. Beside previously described types and subtypes, a wide variety of additional SCC types or subtypes and pseudoSCC elements were observed as well as numerous composite elements. Within the study collection, 61 different such elements have been identified. Since hybridisation cannot recognise the localisation of target genes, gene duplications or inversions, this is a rather conservative estimate. Interestingly, some widespread epidemic strains engulf distinct variants with different SCCmec subtypes. Notable examples are ST239-MRSA-III, CC5-, CC22-, CC30-, and CC45-MRSA-IV or CC398-MRSA-V. Conversely, identical SCC elements were observed in different strains with SCCmec IVa being spread among the highest number of Clonal Complexes

  17. Diversity of SCCmec Elements in Staphylococcus aureus as Observed in South-Eastern Germany

    PubMed Central

    Monecke, Stefan; Jatzwauk, Lutz; Müller, Elke; Nitschke, Hedda; Pfohl, Katharina; Slickers, Peter; Reissig, Annett; Ruppelt-Lorz, Antje; Ehricht, Ralf

    2016-01-01

    SCCmec elements are very important mobile genetic elements in Staphylococci that carry beta-lactam resistance genes mecA/mecC, recombinase genes and a variety of accessory genes. Twelve main types and a couple of variants have yet been described. In addition, there are also other SCC elements harbouring other markers. In order to subtype strains of methicillin-resistant S. aureus (MRSA) based on variations within their SCCmec elements, 86 markers were selected from published SCC sequences for an assay based on multiplexed primer extension reactions followed by hybridisation to the specific probes. These included mecA/mecC, fusC, regulatory genes, recombinase genes, genes from ACME and heavy metal resistance loci as well as several genes of unknown function. Hybridisation patterns for published genome or SCC sequences were theoretically predicted. For validation of the microarray based assay and for stringent hybridisation protocol optimization, real hybridization experiments with fully sequenced reference strains were performed modifying protocols until yielded the results were in concordance to the theoretical predictions. Subsequently, 226 clinical isolates from two hospitals in the city of Dresden, Germany, were characterised in detail. Beside previously described types and subtypes, a wide variety of additional SCC types or subtypes and pseudoSCC elements were observed as well as numerous composite elements. Within the study collection, 61 different such elements have been identified. Since hybridisation cannot recognise the localisation of target genes, gene duplications or inversions, this is a rather conservative estimate. Interestingly, some widespread epidemic strains engulf distinct variants with different SCCmec subtypes. Notable examples are ST239-MRSA-III, CC5-, CC22-, CC30-, and CC45-MRSA-IV or CC398-MRSA-V. Conversely, identical SCC elements were observed in different strains with SCCmec IVa being spread among the highest number of Clonal Complexes

  18. Dataset for distribution of SIDER2 elements in the Leishmania major genome and transcriptome.

    PubMed

    Requena, Jose M; Rastrojo, Alberto; Garde, Esther; López, Manuel C; Thomas, M Carmen; Aguado, Begoña

    2017-04-01

    This paper contains data related to the research article entitled "Genomic cartography and proposal of nomenclature for the repeated, interspersed elements of the Leishmania major SIDER2 family and identification of SIDER2-containing transcripts" [1]. SIDER2 elements are repeated sequences, derived from, nowadays, extinct retrotransposons, that populate the genomes of protist of the genera Leishmania. This dataset (Supplementary file 1), an inventory of 1100 SIDER2 elements, was generated by surveying the L. major complete genome using bioinformatics tools with further manual refinements. In addition to the genomic distribution of these elements (summarized in Fig. 1), this dataset contains information regarding their association with specific transcripts, based on the recently established transcriptome for L. major[2].

  19. Periodic power spectrum with applications in detection of latent periodicities in DNA sequences.

    PubMed

    Yin, Changchuan; Wang, Jiasong

    2016-11-01

    Periodic elements play important roles in genomic structures and functions, yet some complex periodic elements in genomes are difficult to detect by conventional methods such as digital signal processing and statistical analysis. We propose a periodic power spectrum (PPS) method for analyzing periodicities of DNA sequences. The PPS method employs periodic nucleotide distributions of DNA sequences and directly calculates power spectra at specific periodicities. The magnitude of a PPS reflects the strength of a signal on periodic positions. In comparison with Fourier transform, the PPS method avoids spectral leakage, and reduces background noise that appears high in Fourier power spectrum. Thus, the PPS method can effectively capture hidden periodicities in DNA sequences. Using a sliding window approach, the PPS method can precisely locate periodic regions in DNA sequences. We apply the PPS method for detection of hidden periodicities in different genome elements, including exons, microsatellite DNA sequences, and whole genomes. The results show that the PPS method can minimize the impact of spectral leakage and thus capture true hidden periodicities in genomes. In addition, performance tests indicate that the PPS method is more effective and efficient than a fast Fourier transform. The computational complexity of the PPS algorithm is [Formula: see text]. Therefore, the PPS method may have a broad range of applications in genomic analysis. The MATLAB programs for implementing the PPS method are available from MATLAB Central ( http://www.mathworks.com/matlabcentral/fileexchange/55298 ).

  20. Complete Genome Sequences of Pseudomonas monteilii SB3078 and SB3101, Two Benzene-, Toluene-, and Ethylbenzene-Degrading Bacteria Used for Bioaugmentation.

    PubMed

    Dueholm, Morten S; Albertsen, Mads; D'Imperio, Seth; Tale, Vaibhav P; Lewis, Derrick; Nielsen, Per Halkjær; Nielsen, Jeppe Lund

    2014-05-29

    Pseudomonas monteilii SB3078 and SB3101 are benzene-, toluene-, and ethylbenzene-degrading strains used for bioaugmentation in relation to treatment of wastewater contaminated with petrochemical hydrocarbons. Complete genome sequencing of the bioaugmentation strains confirms that they are very closely related (100.0% average nucleotide identity). Both strains contain extensive integration of phage elements, with the main difference being insertion of additional phage elements in the SB3078 genome.

  1. Complete Genome Sequences of Pseudomonas monteilii SB3078 and SB3101, Two Benzene-, Toluene-, and Ethylbenzene-Degrading Bacteria Used for Bioaugmentation

    PubMed Central

    Albertsen, Mads; D’Imperio, Seth; Tale, Vaibhav P.; Lewis, Derrick; Nielsen, Per Halkjær; Nielsen, Jeppe Lund

    2014-01-01

    Pseudomonas monteilii SB3078 and SB3101 are benzene-, toluene-, and ethylbenzene-degrading strains used for bioaugmentation in relation to treatment of wastewater contaminated with petrochemical hydrocarbons. Complete genome sequencing of the bioaugmentation strains confirms that they are very closely related (100.0% average nucleotide identity). Both strains contain extensive integration of phage elements, with the main difference being insertion of additional phage elements in the SB3078 genome. PMID:24874689

  2. The impact of transposable elements on mammalian development.

    PubMed

    Garcia-Perez, Jose L; Widmann, Thomas J; Adams, Ian R

    2016-11-15

    Despite often being classified as selfish or junk DNA, transposable elements (TEs) are a group of abundant genetic sequences that have a significant impact on mammalian development and genome regulation. In recent years, our understanding of how pre-existing TEs affect genome architecture, gene regulatory networks and protein function during mammalian embryogenesis has dramatically expanded. In addition, the mobilization of active TEs in selected cell types has been shown to generate genetic variation during development and in fully differentiated tissues. Importantly, the ongoing domestication and evolution of TEs appears to provide a rich source of regulatory elements, functional modules and genetic variation that fuels the evolution of mammalian developmental processes. Here, we review the functional impact that TEs exert on mammalian developmental processes and discuss how the somatic activity of TEs can influence gene regulatory networks.

  3. The Regulatory Properties of Autonomous Subtelomeric P Elements Are Sensitive to a Suppressor of Variegation in Drosophila Melanogaster

    PubMed Central

    Ronsseray, S.; Lehmann, M.; Nouaud, D.; Anxolabehere, D.

    1996-01-01

    Genetic recombination was used in Drosophila melanogaster to isolate P elements, inserted at the telomeres of X chromosomes (cytological site 1A) from natural populations, in a genetic background devoid of other P elements. We show that complete maternally inherited P repression in the germline (P cytotype) can be elicited by only two autonomous P elements at 1A and that a single element at this site has partial regulatory properties. The analysis of the surrounding chromosomal regions of the P elements at 1A shows that in all cases these elements are flanked by Telomeric Associated Sequences, tandemly repetitive noncoding sequences that have properties of heterochromatin. In addition, we show that the regulatory properties of P elements at 1A can be inhibited by some of the mutant alleles of the Su(var)205 gene and by a deficiency of this gene. However, the regulatory properties of reference P strains (Harwich and Texas 007) are not impaired by Su(var)205 mutations. Su(var)205 encodes Heterochromatin Protein 1 (HP1). These results suggest that the HP1 dosage effect on the P element properties is site-dependent and could involve the structure of the chromatin. PMID:8844154

  4. Identification of a retroviroid-like element from plants.

    PubMed

    Daròs, J A; Flores, R

    1995-07-18

    The biological nature of carnation small viroid-like RNA (CarSV RNA), a 275-nt circular molecule with self-cleaving hammerhead structures in its strands of both polarities, was investigated. The lack of infectivity observed in a series of transmission assays in carnation indicates that CarSV RNA, in spite of sharing structural similarities with viroid and viroid-like satellite RNAs from plants, does not belong to either of these two groups. Additional evidence in this direction comes from the observation that CarSV RNA also exists in carnation plants as DNA tandem repeats. In this respect, CarSV RNA is similar to a small transcript of a tandemly repeated DNA sequence of the newt genome. Moreover, CarSV and newt RNAs have similarities in their sequences as well as in some characteristics of their corresponding hammerhead structures. Further analyses have revealed that CarSV DNA is found directly fused to DNA sequences of carnation etched ring caulimovirus, a pararetrovirus, most likely in the form of an extrachromosomal element. The properties of the CarSV RNA/DNA system are those of a retroviroid-like element having some features in common with viroid and viroid-like satellite RNAs from plants and others with the newt transcript.

  5. Transposable Element Dynamics among Asymbiotic and Ectomycorrhizal Amanita Fungi

    PubMed Central

    Hess, Jaqueline; Skrede, Inger; Wolfe, Benjamin E.; LaButti, Kurt; Ohm, Robin A.; Grigoriev, Igor V.; Pringle, Anne

    2014-01-01

    Transposable elements (TEs) are ubiquitous inhabitants of eukaryotic genomes and their proliferation and dispersal shape genome architectures and diversity. Nevertheless, TE dynamics are often explored for one species at a time and are rarely considered in ecological contexts. Recent work with plant pathogens suggests a link between symbiosis and TE abundance. The genomes of pathogenic fungi appear to house an increased abundance of TEs, and TEs are frequently associated with the genes involved in symbiosis. To investigate whether this pattern is general, and relevant to mutualistic plant-fungal symbioses, we sequenced the genomes of related asymbiotic (AS) and ectomycorrhizal (ECM) Amanita fungi. Using methods developed to interrogate both assembled and unassembled sequences, we characterized and quantified TEs across three AS and three ECM species, including the AS outgroup Volvariella volvacea. The ECM genomes are characterized by abundant numbers of TEs, an especially prominent feature of unassembled sequencing libraries. Increased TE activity in ECM species is also supported by phylogenetic analysis of the three most abundant TE superfamilies; phylogenies revealed many radiations within contemporary ECM species. However, the AS species Amanita thiersii also houses extensive amplifications of elements, highlighting the influence of additional evolutionary parameters on TE abundance. Our analyses provide further evidence for a link between symbiotic associations among plants and fungi, and increased TE activity, while highlighting the importance individual species’ natural histories may have in shaping genome architecture. PMID:24923322

  6. Genome-wide BAC-end sequencing of Cucumis melo using two BAC libraries

    PubMed Central

    2010-01-01

    Background Although melon (Cucumis melo L.) is an economically important fruit crop, no genome-wide sequence information is openly available at the current time. We therefore sequenced BAC-ends representing a total of 33,024 clones, half of them from a previously described melon BAC library generated with restriction endonucleases and the remainder from a new random-shear BAC library. Results We generated a total of 47,140 high-quality BAC-end sequences (BES), 91.7% of which were paired-BES. Both libraries were assembled independently and then cross-assembled to obtain a final set of 33,372 non-redundant, high-quality sequences. These were grouped into 6,411 contigs (4.5 Mb) and 26,961 non-assembled BES (14.4 Mb), representing ~4.2% of the melon genome. The sequences were used to screen genomic databases, identifying 7,198 simple sequence repeats (corresponding to one microsatellite every 2.6 kb) and 2,484 additional repeats of which 95.9% represented transposable elements. The sequences were also used to screen expressed sequence tag (EST) databases, revealing 11,372 BES that were homologous to ESTs. This suggests that ~30% of the melon genome consists of coding DNA. We observed regions of microsynteny between melon paired-BES and six other dicotyledonous plant genomes. Conclusion The analysis of nearly 50,000 BES from two complementary genomic libraries covered ~4.2% of the melon genome, providing insight into properties such as microsatellite and transposable element distribution, and the percentage of coding DNA. The observed synteny between melon paired-BES and six other plant genomes showed that useful comparative genomic data can be derived through large scale BAC-end sequencing by anchoring a small proportion of the melon genome to other sequenced genomes. PMID:21054843

  7. Optically intraconnected computer employing dynamically reconfigurable holographic optical element

    NASA Technical Reports Server (NTRS)

    Bergman, Larry A. (Inventor)

    1992-01-01

    An optically intraconnected computer and a reconfigurable holographic optical element employed therein. The basic computer comprises a memory for holding a sequence of instructions to be executed; logic for accessing the instructions in sequence; logic for determining for each the instruction the function to be performed and the effective address thereof; a plurality of individual elements on a common support substrate optimized to perform certain logical sequences employed in executing the instructions; and, element selection logic connected to the logic determining the function to be performed for each the instruction for determining the class of each function and for causing the instruction to be executed by those the elements which perform those associated the logical sequences affecting the instruction execution in an optimum manner. In the optically intraconnected version, the element selection logic is adapted for transmitting and switching signals to the elements optically.

  8. Chemical experiments with superheavy elements.

    PubMed

    Türler, Andreas

    2010-01-01

    Unnoticed by many chemists, the Periodic Table of the Elements has been extended significantly in the last couple of years and the 7th period has very recently been completed with eka-Rn (element 118) currently being the heaviest element whose synthesis has been reported. These 'superheavy' elements (also called transactinides with atomic number > or = 104 (Rf)) have been artificially synthesized in fusion reactions at accelerators in minute quantities of a few single atoms. In addition, all isotopes of the transactinide elements are radioactive and decay with rather short half-lives. Nevertheless, it has been possible in some cases to investigate experimentally chemical properties of transactinide elements and even synthesize simple compounds. The experimental investigation of superheavy elements is especially intriguing, since theoretical calculations predict significant deviations from periodic trends due to the influence of strong relativistic effects. In this contribution first experiments with hassium (Hs, atomic number 108), copernicium (Cn, atomic number 112) and element 114 (eka-Pb) are reviewed.

  9. The distribution alloying elements in alnico 8 and 9 magnets: Site preference of ternary Ti, Fe, Co, and Ni additions in DO{sub 3} Fe{sub 3}Al, Co{sub 3}Al, and Ni{sub 3}Al based intermetallic phases

    SciTech Connect

    Samolyuk, G. D.; Stocks, G. M.; Újfalussy, B.

    2014-11-07

    Recently, interest in alnico magnetic alloys has been rekindled due to their potential to substitute for rare-earth based permanent magnets provided modest improvements in their coercivity can be achieved without loss of saturation magnetization. Recent experimental studies have indicated that atomic and magnetic structure of the two phases (one AlNi-based, the other FeCo-based) that comprise these spinodally decomposed alloy is not as simple as previously thought. A key issue that arises is the distribution of Fe, Co, and Ti within the AlNi-based matrix phase. In this paper, we report the results of first-principles calculations of the site preference of ternary alloying additions in DO{sub 3} Fe{sub 3}Al, Co{sub 3}Al, and Ni{sub 3}Al alloys, as models for the aluminide phase. For compound compositions that are Al rich, which correspond to experimental situation, Ti and Fe are found to occupy the α sites, while Co and Ni prefer the γ sites of the DO{sub 3} lattice. An important finding is that the magnetic moments of transition metals in Fe{sub 3}Al and Co{sub 3}Al are ordered ferromagnetically, whereas the Ni{sub 3}Al were found to be nonmagnetic unless the Fe or Co is added as a ternary element.

  10. The distribution alloying elements in alnico 8 and 9 magnets: Site preference of ternary Ti, Fe, Co, and Ni additions in DO3 Fe3Al, Co3Al, and Ni3Al based intermetallic phases

    SciTech Connect

    Samolyuk, G. D.; Újfalussy, B.; Stocks, G. M.

    2014-11-07

    Recently, interest in alnico magnetic alloys has been rekindled due to their potential to substitute for rare-earth based permanent magnets provided modest improvements in their coercivity can be achieved without loss of saturation magnetization. Recent experimental studies have indicated that atomic and magnetic structure of the two phases (one AlNi-based, the other FeCo-based) that comprise these spinodally decomposed alloy is not as simple as previously thought. A key issue that arises is the distribution of Fe, Co and Ti within the AlNi-based matrix phase. In our paper we report the results of first-principles calculations of the site preference of ternary alloying additions in DO3 Fe3Al, Co3Al and Ni3Al alloys, as models for the aluminide phase. For compound compositions that are Al rich, which corresponds to experimental situation, Ti and Fe are found to occupy the sites, while Co and Ni prefer the sites of the DO3 lattice. Finally, an important finding is that the magnetic moments of transition metals in Fe3Al and Co3Al are ordered ferromagnetically, whereas the Ni3Al were found to be nonmagnetic unless the Fe or Co are added as a ternary element.

  11. Characterization and distribution of repetitive elements in association with genes in the human genome.

    PubMed

    Liang, Kai-Chiang; Tseng, Joseph T; Tsai, Shaw-Jenq; Sun, H Sunny

    2015-08-01

    Repetitive elements constitute more than 50% of the human genome. Recent studies implied that the complexity of living organisms is not just a direct outcome of a number of coding sequences; the repetitive elements, which do not encode proteins, may also play a significant role. Though scattered studies showed that repetitive elements in the regulatory regions of a gene control gene expression, no systematic survey has been done to report the characterization and distribution of various types of these repetitive elements in the human genome. Sequences from 5' and 3' untranslated regions and upstream and downstream of a gene were downloaded from the Ensembl database. The repetitive elements in the neighboring of each gene were identified and classified using cross-matching implemented in the RepeatMasker. The annotation and distribution of distinct classes of repetitive elements associated with individual gene were collected to characterize genes in association with different types of repetitive elements using systems biology program. We identified a total of 1,068,400 repetitive elements which belong to 37-class families and 1235 subclasses that are associated with 33,761 genes and 57,365 transcripts. In addition, we found that the tandem repeats preferentially locate proximal to the transcription start site (TSS) of genes and the major function of these genes are involved in developmental processes. On the other hand, interspersed repetitive elements showed a tendency to be accumulated at distal region from the TSS and the function of interspersed repeat-containing genes took part in the catabolic/metabolic processes. Results from the distribution analysis were collected and used to construct a gene-based repetitive element database (GBRED; http://www.binfo.ncku.edu.tw/GBRED/index.html). A user-friendly web interface was designed to provide the information of repetitive elements associated with any particular gene(s). This is the first study focusing on the gene

  12. Polylactides in additive biomanufacturing.

    PubMed

    Poh, Patrina S P; Chhaya, Mohit P; Wunner, Felix M; De-Juan-Pardo, Elena M; Schilling, Arndt F; Schantz, Jan-Thorsten; van Griensven, Martijn; Hutmacher, Dietmar W

    2016-12-15

    New advanced manufacturing technologies under the alias of additive biomanufacturing allow the design and fabrication of a range of products from pre-operative models, cutting guides and medical devices to scaffolds. The process of printing in 3 dimensions of cells, extracellular matrix (ECM) and biomaterials (bioinks, powders, etc.) to generate in vitro and/or in vivo tissue analogue structures has been termed bioprinting. To further advance in additive biomanufacturing, there are many aspects that we can learn from the wider additive manufacturing (AM) industry, which have progressed tremendously since its introduction into the manufacturing sector. First, this review gives an overview of additive manufacturing and both industry and academia efforts in addressing specific challenges in the AM technologies to drive toward AM-enabled industrial revolution. After which, considerations of poly(lactides) as a biomaterial in additive biomanufacturing are discussed. Challenges in wider additive biomanufacturing field are discussed in terms of (a) biomaterials; (b) computer-aided design, engineering and manufacturing; (c) AM and additive biomanufacturing printers hardware; and (d) system integration. Finally, the outlook for additive biomanufacturing was discussed.

  13. Additive Manufactured Product Integrity

    NASA Technical Reports Server (NTRS)

    Waller, Jess; Wells, Doug; James, Steve; Nichols, Charles

    2017-01-01

    NASA is providing key leadership in an international effort linking NASA and non-NASA resources to speed adoption of additive manufacturing (AM) to meet NASA's mission goals. Participants include industry, NASA's space partners, other government agencies, standards organizations and academia. Nondestructive Evaluation (NDE) is identified as a universal need for all aspects of additive manufacturing.

  14. NICER elements: a family of nerve growth factor-inducible cAMP-extinguishable retrovirus-like elements.

    PubMed Central

    Cho, K O; Minsk, B; Wagner, J A

    1990-01-01

    We have shown previously that the transcription of the gene designated d5 is induced by nerve growth factor (NGF) in rat adrenal pheochromocytoma PC-12 cells and that this NGF induction is repressed by cAMP. In this paper we demonstrate that d5 is a member of a gene family that contains several hundred members, which is closely related to retroviruses and retrotransposons, as demonstrated by the following observations: (i) the original d5 cDNA hybridized to numerous restriction fragments in genomic DNA; (ii) d5 cDNA hybridized to genomic clones with various intensities, and genomic clones can be isolated with a frequency suggesting that this family includes several hundred members; and (iii) there were minor sequence variations in four independently isolated cDNA clones that were homologous to d5 cDNA. Primer extension studies show that initiation of the 5.7-kilobase d5 mRNA(s) occurs at a unique site relative to a synthetic primer. The 5' end of the cDNA sequence was homologous to Rasheed rat sarcoma virus; and a genomic clone contained several elements that are typical of a long terminal repeat (LTR), including a CCAAT box, a TATA box, a primer binding site, a poly(A) addition signal, and a poly(A) addition site. Furthermore, there is a LTR at the 3' end of at least one of the genes in this family, and there appeared to be a four-base duplication at the probable site of integration into host DNA. Since several members of this family retain responses to NGF and cAMP, we conclude that the regulatory elements present in the LTR have been conserved in many members of this family. We have named this family of genes the NICER elements because they are a family of NGF-inducible cAMP-extinguishable retrovirus-like elements. Images PMID:2160077

  15. The sequence of sequencers: The history of sequencing DNA.

    PubMed

    Heather, James M; Chain, Benjamin

    2016-01-01

    Determining the order of nucleic acid residues in biological samples is an integral component of a wide variety of research applications. Over the last fifty years large numbers of researchers have applied themselves to the production of techniques and technologies to facilitate this feat, sequencing DNA and RNA molecules. This time-scale has witnessed tremendous changes, moving from sequencing short oligonucleotides to millions of bases, from struggling towards the deduction of the coding sequence of a single gene to rapid and widely available whole genome sequencing. This article traverses those years, iterating through the different generations of sequencing technology, highlighting some of the key discoveries, researchers, and sequences along the way.

  16. Integration of Experiments across Diverse Environments Identifies the Genetic Determinants of Variation in Sorghum bicolor Seed Element Composition1[OPEN

    PubMed Central

    Connolly, Erin L.

    2016-01-01

    Seedling establishment and seed nutritional quality require the sequestration of sufficient element nutrients. The identification of genes and alleles that modify element content in the grains of cereals, including sorghum (Sorghum bicolor), is fundamental to developing breeding and selection methods aimed at increasing bioavailable element content and improving crop growth. We have developed a high-throughput work flow for the simultaneous measurement of multiple elements in sorghum seeds. We measured seed element levels in the genotyped Sorghum Association Panel, representing all major cultivated sorghum races from diverse geographic and climatic regions, and mapped alleles contributing to seed element variation across three environments by genome-wide association. We observed significant phenotypic and genetic correlation between several elements across multiple years and diverse environments. The power of combining high-precision measurements with genome-wide association was demonstrated by implementing rank transformation and a multilocus mixed model to map alleles controlling 20 element traits, identifying 255 loci affecting the sorghum seed ionome. Sequence similarity to genes characterized in previous studies identified likely causative genes for the accumulation of zinc, manganese, nickel, calcium, and cadmium in sorghum seeds. In addition to strong candidates for these five elements, we provide a list of candidate loci for several other elements. Our approach enabled the identification of single-nucleotide polymorphisms in strong linkage disequilibrium with causative polymorphisms that can be evaluated in targeted selection strategies for plant breeding and improvement. PMID:26896393

  17. Abundance, distribution and potential impact of transposable elements in the genome of Mycosphaerella fijiensis

    PubMed Central

    2012-01-01

    Background Mycosphaerella fijiensis is a ascomycete that causes Black Sigatoka in bananas. Recently, the M. fijiensis genome was sequenced. Repetitive sequences are ubiquitous components of fungal genomes. In most genomic analyses, repetitive sequences are associated with transposable elements (TEs). TEs are dispersed repetitive DNA sequences found in a host genome. These elements have the ability to move from one location to another within the genome, and their insertion can cause a wide spectrum of mutations in their hosts. Some of the deleterious effects of TEs may be due to ectopic recombination among TEs of the same family. In addition, some transposons are physically linked to genes and can control their expression. To prevent possible damage caused by the presence of TEs in the genome, some fungi possess TE-silencing mechanisms, such as RIP (Repeat Induced Point mutation). In this study, the abundance, distribution and potential impact of TEs in the genome of M. fijiensis were investigated. Results A total of 613 LTR-Gypsy and 27 LTR-Copia complete elements of the class I were detected. Among the class II elements, a total of 28 Mariner, five Mutator and one Harbinger complete elements were identified. The results of this study indicate that transposons were and are important ectopic recombination sites. A distribution analysis of a transposable element from each class of the M. fijiensis isolates revealed variable hybridization profiles, indicating the activity of these elements. Several genes encoding proteins involved in important metabolic pathways and with potential correlation to pathogenicity systems were identified upstream and downstream of transposable elements. A comparison of the sequences from different transposon groups suggested the action of the RIP silencing mechanism in the genome of this microorganism. Conclusions The analysis of TEs in M. fijiensis suggests that TEs play an important role in the evolution of this organism because the

  18. Identification of Bari Transposons in 23 Sequenced Drosophila Genomes Reveals Novel Structural Variants, MITEs and Horizontal Transfer

    PubMed Central

    D’Addabbo, Pietro; Caizzi, Ruggiero

    2016-01-01

    Bari elements are members of the Tc1-mariner superfamily of DNA transposons, originally discovered in Drosophila melanogaster, and subsequently identified in silico in 11 sequenced Drosophila genomes and as experimentally isolated in four non-sequenced Drosophila species. Bari-like elements have been also studied for their mobility both in vivo and in vitro. We analyzed 23 Drosophila genomes and carried out a detailed characterization of the Bari elements identified, including those from the heterochromatic Bari1 cluster in D. melanogaster. We have annotated 401 copies of Bari elements classified either as putatively autonomous or inactive according to the structure of the terminal sequences and the presence of a complete transposase-coding region. Analyses of the integration sites revealed that Bari transposase prefers AT-rich sequences in which the TA target is cleaved and duplicated. Furthermore evaluation of transposon’s co-occurrence near the integration sites of Bari elements showed a non-random distribution of other transposable elements. We also unveil the existence of a putatively autonomous Bari1 variant characterized by two identical long Terminal Inverted Repeats, in D. rhopaloa. In addition, we detected MITEs related to Bari transposons in 9 species. Phylogenetic analyses based on transposase gene and the terminal sequences confirmed that Bari-like elements are distributed into three subfamilies. A few inconsistencies in Bari phylogenetic tree with respect to the Drosophila species tree could be explained by the occurrence of horizontal transfer events as also suggested by the results of dS analyses. This study further clarifies the Bari transposon’s evolutionary dynamics and increases our understanding on the Tc1-mariner elements’ biology. PMID:27213270

  19. 37 CFR 1.77 - Arrangement of application elements.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... elements. 1.77 Section 1.77 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE... § 1.77 Arrangement of application elements. (a) The elements of the application, if applicable, should... research agreement. (5) Reference to a “Sequence Listing,” a table, or a computer program listing...

  20. Polyimide processing additives

    NASA Technical Reports Server (NTRS)

    Fletcher, James C. (Inventor); Pratt, J. Richard (Inventor); St.clair, Terry L. (Inventor); Stoakley, Diane M. (Inventor); Burks, Harold D. (Inventor)

    1992-01-01

    A process for preparing polyimides having enhanced melt flow properties is described. The process consists of heating a mixture of a high molecular weight poly-(amic acid) or polyimide with a low molecular weight amic acid or imide additive in the range of 0.05 to 15 percent by weight of additive. The polyimide powders so obtained show improved processability, as evidenced by lower melt viscosity by capillary rheometry. Likewise, films prepared from mixtures of polymers with additives show improved processability with earlier onset of stretching by TMA.

  1. Polyimide processing additives

    NASA Technical Reports Server (NTRS)

    Pratt, J. Richard (Inventor); St.clair, Terry L. (Inventor); Stoakley, Diane M. (Inventor); Burks, Harold D. (Inventor)

    1993-01-01

    A process for preparing polyimides having enhanced melt flow properties is described. The process consists of heating a mixture of a high molecular weight poly-(amic acid) or polyimide with a low molecular weight amic acid or imide additive in the range of 0.05 to 15 percent by weight of the additive. The polyimide powders so obtained show improved processability, as evidenced by lower melt viscosity by capillary rheometry. Likewise, films prepared from mixtures of polymers with additives show improved processability with earlier onset of stretching by TMA.

  2. Detection of a novel active transposable element in Caldicellulosiruptor hydrothermalis and a new search for elements in this genus.

    PubMed

    Chung, Daehwan; Farkas, Joel; Westpheling, Janet

    2013-05-01

    We show that a previously annotated hypothetical protein is the transposase of a new and active IS element, ISCahy1, widespread in Caldicellulosiruptor species. Transposition generated an 11-bp direct repeat at the insertion site in Caldicellulosiruptor hydrothermalis, suggesting a cut-and-paste mechanism. The discovery of an active insertion sequence in Caldicellulosiruptor species led to a survey of potential IS elements in the genome sequences of eight Caldicellulosiruptor species that identified several new elements, including one novel to this genus.

  3. Assessing the impact of comparative genomic sequence data on the functional annotation of the Drosophila genome

    PubMed Central

    Bergman, Casey M; Pfeiffer, Barret D; Rincón-Limas, Diego E; Hoskins, Roger A; Gnirke, Andreas; Mungall, Chris J; Wang, Adrienne M; Kronmiller, Brent; Pacleb, Joanne; Park, Soo; Stapleton, Mark; Wan, Kenneth; George, Reed A; de Jong, Pieter J; Botas, Juan; Rubin, Gerald M; Celniker, Susan E

    2002-01-01

    Background It is widely accepted that comparative sequence data can aid the functional annotation of genome sequences; however, the most informative species and features of genome evolution for comparison remain to be determined. Results We analyzed conservation in eight genomic regions (apterous, even-skipped, fushi tarazu, twist, and Rhodopsins 1, 2, 3 and 4) from four Drosophila species (D. erecta, D. pseudoobscura, D. willistoni, and D. littoralis) covering more than 500 kb of the D. melanogaster genome. All D. melanogaster genes (and 78-82% of coding exons) identified in divergent species such as D. pseudoobscura show evidence of functional constraint. Addition of a third species can reveal functional constraint in otherwise non-significant pairwise exon comparisons. Microsynteny is largely conserved, with rearrangement breakpoints, novel transposable element insertions, and gene transpositions occurring in similar numbers. Rates of amino-acid substitution are higher in uncharacterized genes relative to genes that have previously been studied. Conserved non-coding sequences (CNCSs) tend to be spatially clustered with conserved spacing between CNCSs, and clusters of CNCSs can be used to predict enhancer sequences. Conclusions Our results provide the basis for choosing species whose genome sequences would be most useful in aiding the functional annotation of coding and cis-regulatory sequences in Drosophila. Furthermore, this work shows how decoding the spatial organization of conserved sequences, such as the clustering of CNCSs, can complement efforts to annotate eukaryotic genomes on the basis of sequence conservation alone. PMID:12537575

  4. Splicing of COB intron 5 requires pairing between the internal guide sequence and both flanking exons.

    PubMed

    Partono, S; Lewin, A S

    1990-11-01

    Group I introns are characterized by a set of conserved sequence elements and secondary structures. Evidence supporting the pairing of certain of these sequences has come from the comparison of intron sequences and from the analysis of mutations that disrupt splicing by interfering with pairing. One of the structures proposed for all group I introns is an internal guide sequence that base pairs with the upstream and the downstream exons, bringing them into alignment for ligation. We made specific mutations in the internal guide sequence and the flanking exons of the fifth intron in the yeast mitochondrial gene for apocytochrome b (COB). Mutations that disrupted the pairing between the internal guide sequence and the upstream exon (the P1 pairing) blocked addition of guanosine to the 5' end of the intron during autocatalytic reactions and prevented formation of the full-length circular intron. In contrast, transcripts containing mutations that disrupted the pairing between the guide sequence and the downstream exon (the P10 helix) initiated splicing but failed to ligate exons. Compensatory mutations that restored helices of normal stability mitigated the effects of the original mutations. These data provide direct evidence for the importance of the base pairing between the internal guide sequence and the downstream exon in the splicing of a wild-type group I intron.

  5. Food Additives and Hyperkinesis

    ERIC Educational Resources Information Center

    Wender, Ester H.

    1977-01-01

    The hypothesis that food additives are causally associated with hyperkinesis and learning disabilities in children is reviewed, and available data are summarized. Available from: American Medical Association 535 North Dearborn Street Chicago, Illinois 60610. (JG)

  6. Smog control fuel additives

    SciTech Connect

    Lundby, W.

    1993-06-29

    A method is described of controlling, reducing or eliminating, ozone and related smog resulting from photochemical reactions between ozone and automotive or industrial gases comprising the addition of iodine or compounds of iodine to hydrocarbon-base fuels prior to or during combustion in an amount of about 1 part iodine per 240 to 10,000,000 parts fuel, by weight, to be accomplished by: (a) the addition of these inhibitors during or after the refining or manufacturing process of liquid fuels; (b) the production of these inhibitors for addition into fuel tanks, such as automotive or industrial tanks; or (c) the addition of these inhibitors into combustion chambers of equipment utilizing solid fuels for the purpose of reducing ozone.

  7. Integrative Conjugative Elements and Related Elements Are Major Contributors to the Genome Diversity of Streptococcus agalactiae▿ §

    PubMed Central

    Brochet, Mathieu; Couvé, Elisabeth; Glaser, Philippe; Guédon, Gérard; Payot, Sophie

    2008-01-01

    Thirty-five putative integrative conjugative elements and related elements were identified at 15 locations in the eight sequenced genomes of Streptococcus agalactiae. Twelve are composite, likely resulting from site-specific accretions. Circular forms were detected for five elements. Macroarray analysis confirmed their high plasticity and wide distribution in S. agalactiae. PMID:18708498

  8. Biobased extreme pressure additives: Structure-property considerations

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Extreme pressure additives are widely used in lubricant formulations for engine oils, hydraulic fluids, gear oils, metalworking fluids, and many others. Extreme pressure additives contain selected elements such as sulfur, phosphorus, and halogens in their structures. These elements, under extreme tr...

  9. Engineering fluid flow using sequenced microstructures

    NASA Astrophysics Data System (ADS)

    Amini, Hamed; Sollier, Elodie; Masaeli, Mahdokht; Xie, Yu; Ganapathysubramanian, Baskar; Stone, Howard A.; di Carlo, Dino

    2013-05-01

    Controlling the shape of fluid streams is important across scales: from industrial processing to control of biomolecular interactions. Previous approaches to control fluid streams have focused mainly on creating chaotic flows to enhance mixing. Here we develop an approach to apply order using sequences of fluid transformations rather than enhancing chaos. We investigate the inertial flow deformations around a library of single cylindrical pillars within a microfluidic channel and assemble these net fluid transformations to engineer fluid streams. As these transformations provide a deterministic mapping of fluid elements from upstream to downstream of a pillar, we can sequentially arrange pillars to apply the associated nested maps and, therefore, create complex fluid structures without additional numerical simulation. To show the range of capabilities, we present sequences that sculpt the cross-sectional shape of a stream into complex geometries, move and split a fluid stream, perform solution exchange and achieve particle separation. A general strategy to engineer fluid streams into a broad class of defined configurations in which the complexity of the nonlinear equations of fluid motion are abstracted from the user is a first step to programming streams of any desired shape, which would be useful for biological, chemical and materials automation.

  10. Structure analysis of two Toxoplasma gondii and Neospora caninum satellite DNA families and evolution of their common monomeric sequence.

    PubMed

    Clemente, Marina; de Miguel, Natalia; Lia, Veronica V; Matrajt, Mariana; Angel, Sergio O

    2004-05-01

    A family of repetitive DNA elements of approximately 350 bp-Sat350-that are members of Toxoplasma gondii satellite DNA was further analyzed. Sequence analysis identified at least three distinct repeat types within this family, called types A, B, and C. B repeats were divided into the subtypes B1 and B2. A search for internal repetitions within this family permitted the identification of conserved regions and the design of PCR primers that amplify almost all these repetitive elements. These primers amplified the expected 350-bp repeats and a novel 680-bp repetitive element (Sat680) related to this family. Two additional tandemly repeated high-order structures corresponding to this satellite DNA family were found by searching the Toxoplasma genome database with these sequences. These studies were confirmed by sequence analysis and identified: (1). an arrangement of AB1CB2 350-bp repeats and (2). an arrangement of two 350-bp-like repeats, resulting in a 680-bp monomer. Sequence comparison and phylogenetic analysis indicated that both high-order structures may have originated from the same ancestral 350-bp repeat. PCR amplification, sequence analysis and Southern blot showed that similar high-order structures were also found in the Toxoplasma-sister taxon Neospora caninum. The Toxoplasma genome database (http://ToxoDB.org ) permitted the assembly of a contig harboring Sat350 elements at one end and a long nonrepetitive DNA sequence flanking this satellite DNA. The region bordering the Sat350 repeats contained two differentially expressed sequence-related regions and interstitial telomeric sequences.

  11. RNA sequence analysis using covariance models.

    PubMed Central

    Eddy, S R; Durbin, R

    1994-01-01

    We describe a general approach to several RNA sequence analysis problems using probabilistic models that flexibly describe the secondary structure and primary sequence consensus of an RNA sequence family. We call these models 'covariance models'. A covariance model of tRNA sequences is an extremely sensitive and discriminative tool for searching for additional tRNAs and tRNA-related sequences in sequence databases. A model can be built automatically from an existing sequence alignment. We also describe an algorithm for learning a model and hence a consensus secondary structure from initially unaligned example sequences and no prior structural information. Models trained on unaligned tRNA examples correctly predict tRNA secondary structure and produce high-quality multiple alignments. The approach may be applied to any family of small RNA sequences. Images PMID:8029015

  12. Cell-specific activity of cis-acting regulatory elements in the promoter of the mouse multidrug resistance gene mdr1.

    PubMed

    Raymond, M; Gros, P

    1990-11-01

    To define cis-acting elements implicated in transcriptional regulation of the mouse multidrug resistance gene mdr1, we have cloned and characterized the 5' end of the gene. Nucleotide sequence analysis identified TATA, GGGCGG, and CCAAT consensus sequence elements at positions -27, -47, and -83, respectively. The transcriptional activities of 5' deletion fragments from the promoter linked to a reporter gene were tested in mouse cell lines of different tissue origins shown to express different levels of endogenous mdr1 RNA. Sequences located between nucleotides -93 and +84 were able to confer basal promoter activity and cell specificity to the reporter gene. The addition to the basal promoter of sequences upstream of position -141 was found to up or down regulate the basal level of expression of the reporter gene in a cell-specific manner.

  13. Refinement of the Diatom Episome Maintenance Sequence and Improvement of Conjugation-Based DNA Delivery Methods

    PubMed Central

    Diner, Rachel E.; Bielinski, Vincent A.; Dupont, Christopher L.; Allen, Andrew E.; Weyman, Philip D.

    2016-01-01

    Conjugation of episomal plasmids from bacteria to diatoms advances diatom genetic manipulation by simplifying transgene delivery and providing a stable and consistent gene expression platform. To reach its full potential, this nascent technology requires new optimized expression vectors and a deeper understanding of episome maintenance. Here, we present the development of an additional diatom vector (pPtPBR1), based on the parent plasmid pBR322, to add a plasmid maintained at medium copy number in Escherichia coli to the diatom genetic toolkit. Using this new vector, we evaluated the contribution of individual yeast DNA elements comprising the 1.4-kb tripartite CEN6-ARSH4-HIS3 sequence that enables episome maintenance in Phaeodactylum tricornutum. While various combinations of these individual elements enable efficient conjugation and high exconjugant yield in P. tricornutum, individual elements alone do not. Conjugation of episomes containing CEN6-ARSH4 and a small sequence from the low GC content 3′ end of HIS3 produced the highest number of diatom exconjugant colonies, resulting in a smaller and more efficient vector design. Our findings suggest that the CEN6 and ARSH4 sequences function differently in yeast and diatoms, and that low GC content regions of greater than ~500 bp are a potential indicator of a functional diatom episome maintenance sequence. Additionally, we have developed improvements to the conjugation protocol including a high-throughput option utilizing 12-well plates and plating methods that improve exconjugant yield and reduce time and materials required for the conjugation protocol. The data presented offer additional information regarding the mechanism by which the yeast-derived sequence enables diatom episome maintenance and demonstrate options for flexible vector design. PMID:27551676

  14. An AU-Rich Sequence Element (UUUN[A/U]U) Downstream of the Edited C in Apolipoprotein B mRNA Is a High-Affinity Binding Site for Apobec-1: Binding of Apobec-1 to This Motif in the 3′ Untranslated Region of c-myc Increases mRNA Stability

    PubMed Central

    Anant, Shrikant; Davidson, Nicholas O.

    2000-01-01

    Apobec-1, the catalytic subunit of the mammalian apolipoprotein B (apoB) mRNA-editing enzyme, is a cytidine deaminase with RNA binding activity for AU-rich sequences. This RNA binding activity is required for Apobec-1 to mediate C-to-U RNA editing. Filter binding assays, using immobilized Apobec-1, demonstrate saturable binding to a 105-nt apoB RNA with a Kd of ∼435 nM. A series of AU-rich templates was used to identify a high-affinity (∼50 nM) binding site of consensus sequence UUUN[A/U]U, with multiple copies of this sequence constituting the high-affinity binding site. In order to determine whether this consensus site could be functionally demonstrated from within an apoB RNA, circular-permutation analysis was performed, revealing one major (UUUGAU) and one minor (UU) site located 3 and 16 nucleotides, respectively, downstream of the edited base. Secondary-structure predictions reveal a stem-loop flanking the edited base with Apobec-1 binding to the consensus site(s) at an open loop. A similar consensus (AUUUA) is present in the 3′ untranslated regions of several mRNAs, including that of c-myc, that are known to undergo rapid degradation. In this context, it is presumed that the consensus motif acts as a destabilizing element. As an independent test of the ability of Apobec-1 to bind to this sequence, F442A cells were transfected with Apobec-1 and the half-life of c-myc mRNA was determined following actinomycin D treatment. These studies demonstrated an increase in the half-life of c-myc mRNA from 90 to 240 min in control versus Apobec-1-expressing cells. Apobec-1 expression mutants, in which RNA binding activity is eliminated, failed to alter c-myc mRNA turnover. Taken together, the data establish a consensus binding site for Apobec-1 embedded in proximity to the edited base in apoB RNA. Binding to this site in other target RNAs raises the possibility that Apobec-1 may be involved in other aspects of RNA metabolism, independent of its role as an apoB RNA

  15. The Extrapolation of Elementary Sequences

    NASA Technical Reports Server (NTRS)

    Laird, Philip; Saul, Ronald

    1992-01-01

    We study sequence extrapolation as a stream-learning problem. Input examples are a stream of data elements of the same type (integers, strings, etc.), and the problem is to construct a hypothesis that both explains the observed sequence of examples and extrapolates the rest of the stream. A primary objective -- and one that distinguishes this work from previous extrapolation algorithms -- is that the same algorithm be able to extrapolate sequences over a variety of different types, including integers, strings, and trees. We define a generous family of constructive data types, and define as our learning bias a stream language called elementary stream descriptions. We then give an algorithm that extrapolates elementary descriptions over constructive datatypes and prove that it learns correctly. For freely-generated types, we prove a polynomial time bound on descriptions of bounded complexity. An especially interesting feature of this work is the ability to provide quantitative measures of confidence in competing hypotheses, using a Bayesian model of prediction.

  16. New Drosophila P-like elements and reclassification of Drosophila P-elements subfamilies.

    PubMed

    Loreto, Elgion L S; Zambra, Francis M B; Ortiz, Mauro F; Robe, Lizandra J

    2012-07-01

    Genomic searches for P-like transposable elements were performed (1) in silico in the 12 available Drosophila genomes and (2) by PCR using degenerate primers in 21 Neotropical Drosophila species. In silico searches revealed P-like sequences only in Drosophila persimilis and Drosophila willistoni. Sixteen new P-like elements were obtained by PCR. These sequences were added to sequences of previously described P-like elements, and a phylogenetic analysis was performed. The subfamilies of P-elements described in the literature (Canonical, M, O, T, and K) were included in the reconstructed tree, and all were monophyletic. However, we suggest that some subfamilies can be enlarged, other subdivided, and some new subfamilies may be proposed, totalizing eleven subfamilies, most of which contain new P-like sequences. Our analyses support the monophyly of P-like elements in Drosophilidae. We suggest that, once these elements need host-specific factors to be mobilizable, the horizontal transfer (HT) of P-like elements may be inhibited among more distant taxa. Nevertheless, HT among Drosophilidae species appears to be a common phenomenon.

  17. Group Sparse Additive Models

    PubMed Central

    Yin, Junming; Chen, Xi; Xing, Eric P.

    2016-01-01

    We consider the problem of sparse variable selection in nonparametric additive models, with the prior knowledge of the structure among the covariates to encourage those variables within a group to be selected jointly. Previous works either study the group sparsity in the parametric setting (e.g., group lasso), or address the problem in the nonparametric setting without exploiting the structural information (e.g., sparse additive models). In this paper, we present a new method, called group sparse additive models (GroupSpAM), which can handle group sparsity in additive models. We generalize the ℓ1/ℓ2 norm to Hilbert spaces as the sparsity-inducing penalty in GroupSpAM. Moreover, we derive a novel thresholding condition for identifying the functional sparsity at the group level, and propose an efficient block coordinate descent algorithm for constructing the estimate. We demonstrate by simulation that GroupSpAM substantially outperforms the competing methods in terms of support recovery and prediction accuracy in additive models, and also conduct a comparative experiment on a real breast cancer dataset.

  18. Additive Manufacturing Infrared Inspection

    NASA Technical Reports Server (NTRS)

    Gaddy, Darrell

    2014-01-01

    Additive manufacturing is a rapid prototyping technology that allows parts to be built in a series of thin layers from plastic, ceramics, and metallics. Metallic additive manufacturing is an emerging form of rapid prototyping that allows complex structures to be built using various metallic powders. Significant time and cost savings have also been observed using the metallic additive manufacturing compared with traditional techniques. Development of the metallic additive manufacturing technology has advanced significantly over the last decade, although many of the techniques to inspect parts made from these processes have not advanced significantly or have limitations. Several external geometry inspection techniques exist such as Coordinate Measurement Machines (CMM), Laser Scanners, Structured Light Scanning Systems, or even traditional calipers and gages. All of the aforementioned techniques are limited to external geometry and contours or must use a contact probe to inspect limited internal dimensions. This presentation will document the development of a process for real-time dimensional inspection technique and digital quality record of the additive manufacturing process using Infrared camera imaging and processing techniques.

  19. Archaeal Extrachromosomal Genetic Elements

    PubMed Central

    Wang, Haina; Peng, Nan; Shah, Shiraz A.

    2015-01-01

    SUMMARY Research on archaeal extrachromosomal genetic elements (ECEs) has progressed rapidly in the past decade. To date, over 60 archaeal viruses and 60 plasmids have been isolated. These archaeal viruses exhibit an exceptional diversity in morphology, with a wide array of shapes, such as spindles, rods, filaments, spheres, head-tails, bottles, and droplets, and some of these new viruses have been classified into one order, 10 families, and 16 genera. Investigation of model archaeal viruses has yielded important insights into mechanisms underlining various steps in the viral life cycle, including infection, DNA replication and transcription, and virion egression. Many of these mechanisms are unprecedented for any known bacterial or eukaryal viruses. Studies of plasmids isolated from different archaeal hosts have also revealed a striking diversity in gene content and innovation in replication strategies. Highly divergent replication proteins are identified in both viral and plasmid genomes. Genomic studies of archaeal ECEs have revealed a modular sequence structure in which modules of DNA sequence are exchangeable within, as well as among, plasmid families and probably also between viruses and plasmids. In particular, it has been suggested that ECE-host interactions have shaped the coevolution of ECEs and their archaeal hosts. Furthermore, archaeal hosts have developed defense systems, including the innate restriction-modification (R-M) system and the adaptive CRISPR (clustered regularly interspaced short palindromic repeats) system, to restrict invasive plasmids and viruses. Together, these interactions permit a delicate balance between ECEs and their hosts, which is vitally important for maintaining an innovative gene reservoir carried by ECEs. In conclusion, while research on archaeal ECEs has just started to unravel the molecular biology of these genetic entities and their interactions with archaeal hosts, it is expected to accelerate in the next decade. PMID

  20. Rolling-Element Bearings

    NASA Technical Reports Server (NTRS)

    Hamrock, B. J.; Anderson, W. J.

    1983-01-01

    Rolling element bearings are a precision, yet simple, machine element of great utility. A brief history of rolling element bearings is reviewed and the type of rolling element bearings, their geometry and kinematics, as well as the materials they are made from and the manufacturing processes they involve are described. Unloaded and unlubricated rolling element bearings, loaded but unlubricated rolling element bearings and loaded and lubricated rolling element bearings are considered. The recognition and understanding of elastohydrodynamic lubrication covered, represents one of the major development in rolling element bearings.

  1. Phenylethynyl Containing Reactive Additives

    NASA Technical Reports Server (NTRS)

    Connell, John W. (Inventor); Smith, Joseph G., Jr. (Inventor); Hergenrother, Paul M. (Inventor)

    2002-01-01

    Phenylethynyl containing reactive additives were prepared from aromatic diamine, containing phenylethvnvl groups and various ratios of phthalic anhydride and 4-phenylethynviphthalic anhydride in glacial acetic acid to form the imide in one step or in N-methyl-2-pvrrolidinone to form the amide acid intermediate. The reactive additives were mixed in various amounts (10% to 90%) with oligomers containing either terminal or pendent phenylethynyl groups (or both) to reduce the melt viscosity and thereby enhance processability. Upon thermal cure, the additives react and become chemically incorporated into the matrix and effect an increase in crosslink density relative to that of the host resin. This resultant increase in crosslink density has advantageous consequences on the cured resin properties such as higher glass transition temperature and higher modulus as compared to that of the host resin.

  2. Fused Lasso Additive Model

    PubMed Central

    Petersen, Ashley; Witten, Daniela; Simon, Noah

    2016-01-01

    We consider the problem of predicting an outcome variable using p covariates that are measured on n independent observations, in a setting in which additive, flexible, and interpretable fits are desired. We propose the fused lasso additive model (FLAM), in which each additive function is estimated to be piecewise constant with a small number of adaptively-chosen knots. FLAM is the solution to a convex optimization problem, for which a simple algorithm with guaranteed convergence to a global optimum is provided. FLAM is shown to be consistent in high dimensions, and an unbiased estimator of its degrees of freedom is proposed. We evaluate the performance of FLAM in a simulation study and on two data sets. Supplemental materials are available online, and the R package flam is available on CRAN. PMID:28239246

  3. Phenylethynyl Containing Reactive Additives

    NASA Technical Reports Server (NTRS)

    Connell, John W. (Inventor); Smith, Joseph G., Jr. (Inventor); Hergenrother, Paul M. (Inventor)

    2002-01-01

    Phenylethynyl containing reactive additives were prepared from aromatic diamines containing phenylethynyl groups and various ratios of phthalic anhydride and 4-phenylethynylphthalic anhydride in glacial acetic acid to form the imide in one step or in N-methyl-2-pyrrolidi none to form the amide acid intermediate. The reactive additives were mixed in various amounts (10% to 90%) with oligomers containing either terminal or pendent phenylethynyl groups (or both) to reduce the melt viscosity and thereby enhance processability. Upon thermal cure, the additives react and become chemically incorporated into the matrix and effect an increase in crosslink density relative to that of the host resin. This resultant increase in crosslink density has advantageous consequences on the cured resin properties such as higher glass transition temperature and higher modulus as compared to that of the host resin.

  4. The abundance and relative volatility of refractory trace elements in Allende Ca,Al-rich inclusions - Implications for chemical and physical processes in the solar nebula

    NASA Technical Reports Server (NTRS)

    Kornacki, Alan S.; Fegley, Bruce, Jr.

    1986-01-01

    The relative volatilities of lithophile refractory trace elements (LRTE) were determined using calculated 50-percent condensation temperatures. Then, the refractory trace-element abundances were measured in about 100 Allende inclusions. The abundance patterns found in Allende Ca,Al-rich inclusions (CAIs) and ultrarefractory inclusions were used to empirically modify the calculated LRTE volatility sequence. In addition, the importance of crystal-chemical effects, diffusion constraints, and grain transport for the origin of the trace-element chemistry of Allende CAIs (which have important implications for chemical and physical processes in the solar nebula) is discussed.

  5. Additives in plastics.

    PubMed Central

    Deanin, R D

    1975-01-01

    The polymers used in plastics are generally harmless. However, they are rarely used in pure form. In almost all commercial plastics, they are "compounded" with monomeric ingredients to improve their processing and end-use performance. In order of total volume used, these monomeric additives may be classified as follows: reinforcing fibers, fillers, and coupling agents; plasticizers; colorants; stabilizers (halogen stabilizers, antioxidants, ultraviolet absorbers, and biological preservatives); processing aids (lubricants, others, and flow controls); flame retardants, peroxides; and antistats. Some information is already available, and much more is needed, on potential toxicity and safe handling of these additives during processing and manufacture of plastics products. PMID:1175566

  6. Additives in plastics.

    PubMed

    Deanin, R D

    1975-06-01

    The polymers used in plastics are generally harmless. However, they are rarely used in pure form. In almost all commercial plastics, they are "compounded" with monomeric ingredients to improve their processing and end-use performance. In order of total volume used, these monomeric additives may be classified as follows: reinforcing fibers, fillers, and coupling agents; plasticizers; colorants; stabilizers (halogen stabilizers, antioxidants, ultraviolet absorbers, and biological preservatives); processing aids (lubricants, others, and flow controls); flame retardants, peroxides; and antistats. Some information is already available, and much more is needed, on potential toxicity and safe handling of these additives during processing and manufacture of plastics products.

  7. An Evolutionary Machine Learning Framework for Big Data Sequence Mining

    ERIC Educational Resources Information Center

    Kamath, Uday Krishna

    2014-01-01

    Sequence classification is an important problem in many real-world applications. Unlike other machine learning data, there are no "explicit" features or signals in sequence data that can help traditional machine learning algorithms learn and predict from the data. Sequence data exhibits inter-relationships in the elements that are…

  8. The Effect of Content Sequence on Student Learning.

    ERIC Educational Resources Information Center

    Rudnitsky, Alan N.; Posner, George J.

    This study investigates the effects of content sequence on student learning. The treatments, a spatial and conceptual instructional sequence each consisting of identical content elements, were administered to students in a two-year college Botany course. Hypotheses tested were that sequence would have an effect on student perceptions of the…

  9. Implementation of mixed formulation elements in PC/NASTRAN

    NASA Technical Reports Server (NTRS)

    Schaeffer, Harry G.

    1993-01-01

    The purpose of this paper is to describe the implementation and use of a consistent family of two and three dimensional elements in NASTRAN. The elements which are based on a mixed formulation include a replacement of the original NASTRAN shear element and the addition of triangular quadrilateral shell elements and tetrahedral, pentahedral and hexahedral solid elements. These elements support all static loads including temperature gradient and pressure load. The mass matrix is also generated to support all dynamic rigid formats.

  10. Discrete Element Modeling

    SciTech Connect

    Morris, J; Johnson, S

    2007-12-03

    The Distinct Element Method (also frequently referred to as the Discrete Element Method) (DEM) is a Lagrangian numerical technique where the computational domain consists of discrete solid elements which interact via compliant contacts. This can be contrasted with Finite Element Methods where the computational domain is assumed to represent a continuum (although many modern implementations of the FEM can accommodate some Distinct Element capabilities). Often the terms Discrete Element Method and Distinct Element Method are used interchangeably in the literature, although Cundall and Hart (1992) suggested that Discrete Element Methods should be a more inclusive term covering Distinct Element Methods, Displacement Discontinuity Analysis and Modal Methods. In this work, DEM specifically refers to the Distinct Element Method, where the discrete elements interact via compliant contacts, in contrast with Displacement Discontinuity Analysis where the contacts are rigid and all compliance is taken up by the adjacent intact material.

  11. A systematic identification of Kolobok superfamily transposons in Trichomonas vaginalis and sequence analysis on related transposases.

    PubMed

    Meng, Qingshu; Chen, Kaifu; Ma, Lina; Hu, Songnian; Yu, Jun

    2011-02-01

    Transposons are sequence elements widely distributed among genomes of all three kingdoms of life, providing genomic changes and playing significant roles in genome evolution. Trichomonas vaginalis is an excellent model system for transposon study since its genome (~160 Mb) has been sequenced and is composed of ~65% transposons and other repetitive elements. In this study, we primarily report the identification of Kolobok-type transposons (termed tvBac) in T. vaginalis and the results of transposase sequence analysis. We categorized 24 novel subfamilies of the Kolobok element, including one autonomous subfamily and 23 non-autonomous subfamilies. We also identified a novel H2CH motif in tvBac transposases based on multiple sequence alignment. In addition, we supposed that tvBac and Mutator transposons may have evolved independently from a common ancestor according to our phylogenetic analysis. Our results provide basic information for the understanding of the function and evolution of tvBac transposons in particular and other related transposon families in general.

  12. Actinomycete integrative and conjugative elements

    PubMed Central

    te Poele, Evelien M.; Bolhuis, Henk

    2008-01-01

    This paper reviews current knowledge on actinomycete integrative and conjugative elements (AICEs). The best characterised AICEs, pSAM2 of Streptomyces ambofaciens (10.9 kb), SLP1 (17.3 kb) of Streptomyces coelicolor and pMEA300 of Amycolatopsis methanolica (13.3 kb), are present as integrative elements in specific tRNA genes, and are capable of conjugative transfer. These AICEs have a highly conserved structural organisation, with functional modules for excision/integration, replication, conjugative transfer, and regulation. Recently, it has been shown that pMEA300 and the related elements pMEA100 of Amycolatopsis mediterranei and pSE211 of Saccharopolyspora erythraea form a novel group of AICEs, the pMEA-elements, based on the unique characteristics of their replication initiator protein RepAM. Evaluation of a large collection of Amycolatopsis isolates has allowed identification of multiple pMEA-like elements. Our data show that, as AICEs, they mainly coevolved with their natural host in an integrated form, rather than being dispersed via horizontal gene transfer. The pMEA-like elements could be separated into two distinct populations from different geographical origins. One group was most closely related to pMEA300 and was found in isolates from Australia and Asia and pMEA100-related sequences were present in European isolates. Genome sequence data have enormously contributed to the recent insight that AICEs are present in many actinomycete genera. The sequence data also provide more insight into their evolutionary relationships, revealing their modular composition and their likely combined descent from bacterial plasmids and bacteriophages. Evidence is accumulating that AICEs act as modulators of host genome diversity and are also involved in the acquisition of secondary metabolite clusters and foreign DNA via horizontal gene transfer. Although still speculative, these AICEs may play a role in the spread of antibiotic resistance factors into pathogenic bacteria

  13. Trace elements affect methanogenic activity and diversity in enrichments from subsurface coal bed produced water.

    PubMed

    Unal, Burcu; Perry, Verlin Ryan; Sheth, Mili; Gomez-Alvarez, Vicente; Chin, Kuk-Jeong; Nüsslein, Klaus

    2012-01-01

    Microbial methane from coal beds accounts for a significant and growing percentage of natural gas worldwide. Our knowledge of physical and geochemical factors regulating methanogenesis is still in its infancy. We hypothesized that in these closed systems, trace elements (as micronutrients) are a limiting factor for methanogenic growth and activity. Trace elements are essential components of enzymes or cofactors of metabolic pathways associated with methanogenesis. This study examined the effects of eight trace elements (iron, nickel, cobalt, molybdenum, zinc, manganese, boron, and copper) on methane production, on mcrA transcript levels, and on methanogenic community structure in enrichment cultures obtained from coal bed methane (CBM) well produced water samples from the Powder River Basin, Wyoming. Methane production was shown to be limited both by a lack of additional trace elements as well as by the addition of an overly concentrated trace element mixture. Addition of trace elements at concentrations optimized for standard media enhanced methane production by 37%. After 7 days of incubation, the levels of mcrA transcripts in enrichment cultures with trace element amendment were much higher than in cultures without amendment. Transcript levels of mcrA correlated positively with elevated rates of methane production in supplemented enrichments (R(2) = 0.95). Metabolically active methanogens, identified by clone sequences of mcrA mRNA retrieved from enrichment cultures, were closely related to Methanobacterium subterraneum and Methanobacterium formicicum. Enrichment cultures were dominated by M. subterraneum and had slightly higher predicted methanogenic richness, but less diversity than enrichment cultures without amendments. These results suggest that varying concentrations of trace elements in produced water from different subsurface coal wells may cause changing levels of CBM production and alter the composition of the active methanogenic community.

  14. Trace Elements Affect Methanogenic Activity and Diversity in Enrichments from Subsurface Coal Bed Produced Water

    PubMed Central

    Ünal, Burcu; Perry, Verlin Ryan; Sheth, Mili; Gomez-Alvarez, Vicente; Chin, Kuk-Jeong; Nüsslein, Klaus

    2012-01-01

    Microbial methane from coal beds accounts for a significant and growing percentage of natural gas worldwide. Our knowledge of physical and geochemical factors regulating methanogenesis is still in its infancy. We hypothesized that in these closed systems, trace elements (as micronutrients) are a limiting factor for methanogenic growth and activity. Trace elements are essential components of enzymes or cofactors of metabolic pathways associated with methanogenesis. This study examined the effects of eight trace elements (iron, nickel, cobalt, molybdenum, zinc, manganese, boron, and copper) on methane production, on mcrA transcript levels, and on methanogenic community structure in enrichment cultures obtained from coal bed methane (CBM) well produced water samples from the Powder River Basin, Wyoming. Methane production was shown to be limited both by a lack of additional trace elements as well as by the addition of an overly concentrated trace element mixture. Addition of trace elements at concentrations optimized for standard media enhanced methane production by 37%. After 7 days of incubation, the levels of mcrA transcripts in enrichment cultures with trace element amendment were much higher than in cultures without amendment. Transcript levels of mcrA correlated positively with elevated rates of methane production in supplemented enrichments (R2 = 0.95). Metabolically active methanogens, identified by clone sequences of mcrA mRNA retrieved from enrichment cultures, were closely related to Methanobacterium subterraneum and Methanobacterium formicicum. Enrichment cultures were dominated by M. subterraneum and had slightly higher predicted methanogenic richness, but less diversity than enrichment cultures without amendments. These results suggest that varying concentrations of trace elements in produced water from different subsurface coal wells may cause changing levels of CBM production and alter the composition of the active methanogenic community. PMID

  15. Chromatin domain boundary element search tool for Drosophila

    PubMed Central

    Srinivasan, Arumugam; Mishra, Rakesh K.

    2012-01-01

    Chromatin domain boundary elements prevent inappropriate interaction between distant or closely spaced regulatory elements and restrict enhancers and silencers to correct target promoters. In spite of having such a general role and expected frequent occurrence genome wide, there is no DNA sequence analysis based tool to identify boundary elements. Here, we report chromatin domain Boundary Element Search Tool (cdBEST), to identify boundary elements. cdBEST uses known recognition sequences of boundary interacting proteins and looks for ‘motif clusters’. Using cdBEST, we identified boundary sequences across 12 Drosophila species. Of the 4576 boundary sequences identified in Drosophila melanogaster genome, >170 sequences are repetitive in nature and have sequence homology to transposable elements. Analysis of such sequences across 12 Drosophila genomes showed that the occurrence of repetitive sequences in the context of boundaries is a common feature of drosophilids. We use a variety of genome organization criteria and also experimental test on a subset of the cdBEST boundaries in an enhancer-blocking assay and show that 80% of them indeed function as boundaries in vivo. These observations highlight the role of cdBEST in better understanding of chromatin domain boundaries in Drosophila and setting the stage for comparative analysis of boundaries across closely related species. PMID:22287636

  16. Biobased lubricant additives

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Fully biobased lubricants are those formulated using all biobased ingredients, i.e. biobased base oils and biobased additives. Such formulations provide the maximum environmental, safety, and economic benefits expected from a biobased product. Currently, there are a number of biobased base oils that...

  17. More Than Additional Space...

    ERIC Educational Resources Information Center

    CEFP Journal, 1973

    1973-01-01

    A much needed addition to the Jamestown Elementary School turned out to be more than an expansion of walls for more space. A new educational program, a limited budget, and a short time line were tackled on a team approach basis and were successfully resolved. (Author)

  18. BLSSpeller: exhaustive comparative discovery of conserved cis-regulatory elements

    PubMed Central

    De Witte, Dieter; Van de Velde, Jan; Decap, Dries; Van Bel, Michiel; Audenaert, Pieter; Demeester, Piet; Dhoedt, Bart; Vandepoele, Klaas; Fostier, Jan

    2015-01-01

    Motivation: The accurate discovery and annotation of regulatory elements remains a challenging problem. The growing number of sequenced genomes creates new opportunities for comparative approaches to motif discovery. Putative binding sites are then considered to be functional if they are conserved in orthologous promoter sequences of multiple related species. Existing methods for comparative motif discovery usually rely on pregenerated multiple sequence alignments, which are difficult to obtain for more diverged species such as plants. As a consequence, misaligned regulatory elements often remain undetected. Results: We present a novel algorithm that supports both alignment-free and alignment-based motif discovery in the promoter sequences of related species. Putative motifs are exhaustively enumerated as words over the IUPAC alphabet and screened for conservation using the branch length score. Additionally, a confidence score is established in a genome-wide fashion. In order to take advantage of a cloud computing infrastructure, the MapReduce programming model is adopted. The method is applied to four monocotyledon plant species and it is shown that high-scoring motifs are significantly enriched for open chromatin regions in Oryza sativa and for transcription factor binding sites inferred through protein-binding microarrays in O.sativa and Zea mays. Furthermore, the method is shown to recover experimentally profiled ga2ox1-like KN1 binding sites in Z.mays. Availability and implementation: BLSSpeller was written in Java. Source code and manual are available at http://bioinformatics.intec.ugent.be/blsspeller Contact: Klaas.Vandepoele@psb.vib-ugent.be or jan.fostier@intec.ugent.be Supplementary information: Supplementary data are available at Bioinformatics online. PMID:26254488

  19. Contrasting Sequence Groups by Emerging Sequences

    NASA Astrophysics Data System (ADS)

    Deng, Kang; Zaïane, Osmar R.

    Group comparison per se is a fundamental task in many scientific endeavours but is also the basis of any classifier. Contrast sets and emerging patterns contrast between groups of categorical data. Comparing groups of sequence data is a relevant task in many applications. We define Emerging Sequences (ESs) as subsequences that are frequent in sequences of one group and less frequent in the sequences of another, and thus distinguishing or contrasting sequences of different classes. There are two challenges to distinguish sequence classes: the extraction of ESs is not trivially efficient and only exact matches of sequences are considered. In our work we address those problems by a suffix tree-based framework and a similar matching mechanism. We propose a classifier based on Emerging Sequences. Evaluating against two learning algorithms based on frequent subsequences and exact matching subsequences, the experiments on two datasets show that our model outperforms the baseline approaches by up to 20% in prediction accuracy.

  20. Precision Measurement of Transition Matrix Elements via Light Shift Cancellation

    DTIC Science & Technology

    2012-12-14

    vanishes, provide precise constraints on the matrix elements. We make the fhstmeasurement of the 5s-6p matrix elements in rubidium by measuring the...We make the first measurement of the 5s-6p matrix elements in rubidium by measuring the light shift around the 421 and 423 nm zeros through...elements in rubidium by measuring the light shift around the 421 and 423 nm zeros through diffraction of a condensate off a sequence of standing wave

  1. Shotgun protein sequencing.

    SciTech Connect

    Faulon, Jean-Loup Michel; Heffelfinger, Grant S.

    2009-06-01

    A novel experimental and computational technique based on multiple enzymatic digestion of a protein or protein mixture that reconstructs protein sequences from sequences of overlapping peptides is described in this SAND report. This approach, analogous to shotgun sequencing of DNA, is to be used to sequence alternative spliced proteins, to identify post-translational modifications, and to sequence genetically engineered proteins.

  2. Repetitive DNA sequences in Mycoplasma pneumoniae.

    PubMed Central

    Wenzel, R; Herrmann, R

    1988-01-01