Sample records for additional subjects include

  1. Skills methods to prevent smoking.

    PubMed

    Schinke, S P; Gilchrist, L D; Schilling, R F; Snow, W H; Bobo, J K

    1986-01-01

    School health educators have devoted much attention to cigarette smoking. Recent years have seen the testing of interventions to prevent smoking. To date, controlled studies have not evaluated the added value of skills methods for preventing smoking. This article describes such an evaluation with sixth-grade students from two schools. Subjects were pretested and randomly assigned to receive conventional health education methods or to receive skills intervention. Both conditions included films, peer testimonials, discussions, and homework. Health education condition subjects additionally participated in oral quizzes, games, and debates. Skills condition subjects additionally learned problem-solving, self-instruction, and interpersonal communication methods. At postintervention, skills condition subjects, more than health education condition subjects, had better scores on measures of smoking-related knowledge, attitudes, and intentions. In addition, reported cigarette use, validated by biochemical data collection, was lower in the skills condition than in the health education condition at all postintervention measurements, including a 24-month follow-up. The article discusses the strengths, limits, and implications of the study for other smoking prevention efforts in schools.

  2. 48 CFR 1352.235-70 - Protection of human subjects.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... investigation, including research development, testing and evaluation, designed to develop or contribute to... subjects research protocol, all questionnaires, surveys, advertisements, and informed consent forms... addition, if the contractor modifies a human subjects research protocol, questionnaire, survey...

  3. 48 CFR 1352.235-70 - Protection of human subjects.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... investigation, including research development, testing and evaluation, designed to develop or contribute to... subjects research protocol, all questionnaires, surveys, advertisements, and informed consent forms... addition, if the contractor modifies a human subjects research protocol, questionnaire, survey...

  4. 48 CFR 1352.235-70 - Protection of human subjects.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... investigation, including research development, testing and evaluation, designed to develop or contribute to... subjects research protocol, all questionnaires, surveys, advertisements, and informed consent forms... addition, if the contractor modifies a human subjects research protocol, questionnaire, survey...

  5. 48 CFR 1352.235-70 - Protection of human subjects.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... investigation, including research development, testing and evaluation, designed to develop or contribute to... subjects research protocol, all questionnaires, surveys, advertisements, and informed consent forms... addition, if the contractor modifies a human subjects research protocol, questionnaire, survey...

  6. Evidence-Based Communication Practices for Children with Visual Impairments and Additional Disabilities: An Examination of Single-Subject Design Studies

    ERIC Educational Resources Information Center

    Parker, Amy T.; Grimmett, Eric S.; Summers, Sharon

    2008-01-01

    This review examines practices for building effective communication strategies for children with visual impairments, including those with additional disabilities, that have been tested by single-subject design methodology. The authors found 30 studies that met the search criteria and grouped intervention strategies to align any evidence of the…

  7. 14 CFR 382.55 - May carriers impose security screening procedures for passengers with disabilities that go beyond...

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... Accessibility of Airport Facilities § 382.55 May carriers impose security screening procedures for passengers..., including those with disabilities, are subject to TSA security screening requirements at U.S. airports. In addition, passengers at foreign airports, including those with disabilities, may be subject to security...

  8. 14 CFR 382.55 - May carriers impose security screening procedures for passengers with disabilities that go beyond...

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... Accessibility of Airport Facilities § 382.55 May carriers impose security screening procedures for passengers..., including those with disabilities, are subject to TSA security screening requirements at U.S. airports. In addition, passengers at foreign airports, including those with disabilities, may be subject to security...

  9. 14 CFR 382.55 - May carriers impose security screening procedures for passengers with disabilities that go beyond...

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... Accessibility of Airport Facilities § 382.55 May carriers impose security screening procedures for passengers..., including those with disabilities, are subject to TSA security screening requirements at U.S. airports. In addition, passengers at foreign airports, including those with disabilities, may be subject to security...

  10. The home environment and toddler physical activity: an ecological momentary assessment study.

    PubMed

    Hager, E R; Tilton, N A; Wang, Y; Kapur, N C; Arbaiza, R; Merry, B C; Black, M M

    2017-02-01

    Physical activity (PA) promotion/obesity prevention in toddlerhood should include home environments. The aim of the study was to determine social/physical home environment factors associated with toddler PA using ecological momentary assessment (EMA, real-time data collection). Low-income mother-toddler dyads were recruited and given a handheld EMA device (53 random beeps followed by social/physical environment survey over 8 d). Simultaneously, PA was assessed via accelerometry (data extracted 15 min before/after response, average activity counts per minute). Linear mixed-effects models were used, adjusting for toddler age, urban/suburban residence and time of day; covariate moderating effects were examined; within-subjects and between-subjects findings were reported. PA was hypothesized to be greater when toddlers are outside (vs. inside), children are nearby (vs. alone), toddlers are interacting with their mothers (vs. not) and TV is off (vs. on). The final count was 2454 EMA/PA responses for 160 toddlers (mean age 20 months, range 12-31; 55% male, 66% Black and 54% urban). Associations with PA include (within subjects) the following: outside location (212 additional counts min -1 ), children nearby (153 additional counts min -1 ) and interacting with mother (321 additional counts min -1 ), compared with alternatives. Age was moderated by outside location/PA association (within subjects), with 90 additional counts min -1 per 3-month age group outside vs. inside. No between-subjects or television/PA associations were found. Home environment factors were associated with PA, including outside location, children nearby and mother interaction. EMA is a novel method, allowing identification of contextual factors associated with behaviours in natural environments. © 2015 World Obesity Federation.

  11. American Journal of Physics Resource Letters - The Future of Nuclear Power

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Parks, Cecil V; Flanagan, George F; Kulynych, George E

    2010-01-01

    This Resource Letter is intended to summarize the status of nuclear power in the world today, prospects of significant expansion of nuclear power over the next several decades, the planning of and forecasts for the addition of new power reactors, and issues surrounding the addition of these new reactors. Owing to the breadth of this subject, the list of references includes journal articles, web pages, and reports to guide the reader on the subject. The subject of nuclear power and its related issues are dynamic, so the most current information is likely to be found on reputable websites.

  12. SARDA HITL Preliminary Human Factors Measures and Analyses

    NASA Technical Reports Server (NTRS)

    Hyashi, Miwa; Dulchinos, Victoria

    2012-01-01

    Human factors data collected during the SARDA HITL Simulation Experiment include a variety of subjective measures, including the NASA TLX, questionnaire questions regarding situational awareness, advisory usefulness, UI usability, and controller trust. Preliminary analysis of the TLX data indicate that workload may not be adversely affected by use of the advisories, additionally, the controller's subjective ratings of the advisories may suggest acceptance of the tool.

  13. Evidence of linkage and association on chromosome 20 for late-onset Alzheimer disease.

    PubMed

    Goddard, Katrina A B; Olson, Jane M; Payami, Haydeh; van der Voet, Monique; Kuivaniemi, Helena; Tromp, Gerard

    2004-06-01

    Recently, we reported evidence of linkage on chromosome 20 for Alzheimer disease (AD) using a novel statistical approach to incorporate covariates (e.g., age, ApoE genotype) into the analysis. These results suggest that very elderly subjects (>85 years), and individuals who carry an epsilon2 allele at the ApoE locus are more likely to be linked to this candidate region. The region on chromosome 20 includes a strong candidate gene, cystatin C (CST3), which has previously been associated with AD in case-control studies. We investigated these findings further by genotyping additional markers to narrow the candidate region, and to identify evidence of linkage disequilibrium as additional support for a susceptibility locus on chromosome 20. We selected 43 elderly sibships (89 subjects) from the NIMH AD Genetics Initiative based on current age older than 84 years, and identified 129 unrelated control subjects who were older than 84 years from the Oregon Brain Aging Study to conduct linkage and association studies in this region. Fourteen additional markers were evaluated, including 4 markers located within or near CST3. We narrowed the candidate region on chromosome 20 to an 11.8-cM region between markers D20S174 and D20S471, which includes the CST3 candidate gene. In addition, we observed evidence of association for markers located near the CST3 candidate gene, with P values between 0.002 and 0.08 for two-locus haplotypes. These results support the presence of a susceptibility locus for AD in the vicinity of CST3 for very elderly subjects with AD.

  14. 15 CFR 746.7 - Iran.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... authorization is considered authorization for purposes of the EAR as well. Transactions that are not subject to... certain reexport transactions involving Iran, including transactions dealing with items subject to the EAR... addition, BIS maintains licensing requirements on exports and reexports to Iran under the EAR as described...

  15. 15 CFR 746.7 - Iran.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... authorization for purposes of the EAR as well. Transactions that are not subject to OFAC regulatory authority... certain reexport transactions involving Iran, including transactions dealing with items subject to the EAR... addition, BIS maintains licensing requirements on exports and reexports to Iran under the EAR as described...

  16. 21 CFR 74.101 - FD&C Blue No. 1.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL LISTING OF COLOR ADDITIVES SUBJECT TO CERTIFICATION Foods § 74.101 FD&C Blue No. 1. (a) Identity. (1) The color additive FD&C...] (o-sulfobenzyl) ammonium hydroxide inner salt. (2) Color additive mixtures for food use (including...

  17. 21 CFR 74.101 - FD&C Blue No. 1.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL LISTING OF COLOR ADDITIVES SUBJECT TO CERTIFICATION Foods § 74.101 FD&C Blue No. 1. (a) Identity. (1) The color additive FD&C...] (o-sulfobenzyl) ammonium hydroxide inner salt. (2) Color additive mixtures for food use (including...

  18. 21 CFR 74.101 - FD&C Blue No. 1.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL LISTING OF COLOR ADDITIVES SUBJECT TO CERTIFICATION Foods § 74.101 FD&C Blue No. 1. (a) Identity. (1) The color additive FD&C...] (o-sulfobenzyl) ammonium hydroxide inner salt. (2) Color additive mixtures for food use (including...

  19. 14 CFR Appendix B to Part 63 - Flight Navigator Training Course Requirements

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... include additional subjects in the ground training curriculum, such as international law, flight hygiene... weather reports. Forecasting. International Morse code: Ability to receive code groups of letters and... school subjects. (3) Each instructor who conducts flight training must hold a valid flight navigator...

  20. Perceptual-Motor Attributes of Mentally Retarded Youth.

    ERIC Educational Resources Information Center

    Cratty, Bryant J.

    To evaluate six perceptual-motor attributes of trainable and educable mentally retarded children, a battery of tests was constructed which included body perception, gross agility, balance, locomotor ability, throwing, and tracking; 83 retarded subjects provided reliability data, and their scores, with those of 120 additional subjects, provided…

  1. Biomes.

    ERIC Educational Resources Information Center

    Web Feet K-8, 2001

    2001-01-01

    This annotated subject guide to Web sites and additional resources focuses on biomes. Specifies age levels for resources that include Web sites, CD-ROMs and software, videos, books, audios, and magazines; includes professional resources; and presents a relevant class activity. (LRW)

  2. 21 CFR 74.340 - FD&C Red No. 40.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL LISTING OF COLOR ADDITIVES SUBJECT TO CERTIFICATION Foods § 74.340 FD&C Red No. 40. (a) Identity. (1) The color additive FD&C...-naphthalenesulfonic acid. (2) Color additive mixtures for food use (including dietary supplements) made with FD&C Red...

  3. 21 CFR 74.340 - FD&C Red No. 40.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL LISTING OF COLOR ADDITIVES SUBJECT TO CERTIFICATION Foods § 74.340 FD&C Red No. 40. (a) Identity. (1) The color additive FD&C...-naphthalenesulfonic acid. (2) Color additive mixtures for food use (including dietary supplements) made with FD&C Red...

  4. 21 CFR 74.340 - FD&C Red No. 40.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL LISTING OF COLOR ADDITIVES SUBJECT TO CERTIFICATION Foods § 74.340 FD&C Red No. 40. (a) Identity. (1) The color additive FD&C...-naphthalenesulfonic acid. (2) Color additive mixtures for food use (including dietary supplements) made with FD&C Red...

  5. The Effects of Schooling and Environment on Memory Development.

    ERIC Educational Resources Information Center

    Wagner, Daniel A.

    This paper reports two experiments investigating the effect of schooling and urbanization on short term recall and recognition memory. Subjects were 384 male children and young adults living in Morocco representing urban and rural and schooled and nonschooled backgrounds. Additional subject groups--including Koranic school students, Moroccan rug…

  6. 77 FR 10515 - Pesticide Product Registrations; Conditional Approval

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-02-22

    ... manufacturer. Potentially affected entities may include, but are not limited to: Pesticide manufacturing (NAICS..., a product that would be used as an antimicrobial and preservative additive used to treat fibers... antimicrobial and preservative additive used to treat fibers. List of Subjects Environmental protection...

  7. Subjective Well-Being and Household Factors in South Africa

    ERIC Educational Resources Information Center

    Bookwalter, Jeffrey T.; Dalenberg, Douglas

    2004-01-01

    This paper uses a household survey from South Africa to estimate a model of subjective well-being based upon poverty and household characteristics including housing, sanitation, and transportation. Following Sen, we allow for factors in addition to income and we begin to incorporate functionings and capabilities as determinants of well-being. This…

  8. Longitudinal Associations of Alcohol Involvement with Subjective Well-Being in Adolescence and Prediction to Alcohol Problems in Early Adulthood

    ERIC Educational Resources Information Center

    Mason, W. Alex; Spoth, Richard L.

    2011-01-01

    Adolescent alcohol involvement is associated with numerous negative outcomes, but also appears to have positive correlates, including subjective well-being. Additional research is needed to understand these paradoxical findings. The current study examines alcohol use, adverse alcohol-related (and other substance-related) consequences, and…

  9. NASA thesaurus alphabetical update: Subject terms for indexing scientific and technical information

    NASA Technical Reports Server (NTRS)

    1971-01-01

    The NASA THESAURUS - ALPHABETICAL UPDATE is an alphabetical listing of all subject terms (postable and nonpostable) that are currently approved for use in the NASA scientific and technical information system. Contained in the listing are the subject terms that were listed in the Preliminary Edition of the NASA THESAURUS and the additional subject terms that were approved during the period January 1, 1967 June 30, 1971. Complete Thesaurus structuring, including scope notes, category assignments, and cross-references, is provided for each term as appropriate.

  10. Is subjective hyperhidrosis assessment sufficient enough? prevalence of hyperhidrosis among young Polish adults.

    PubMed

    Stefaniak, Tomasz; Tomaszewski, Krzysztof A; Proczko-Markuszewska, Monika; Idestal, Anette; Royton, Anders; Abi-Khalil, Christian

    2013-10-01

    The aim of this work was to assess the prevalence of palmar and axillary hyperhidrosis among young Polish adults. Additionally, this work aimed at comparing the subjective and objective (gravimetric) method of hyperhidrosis assessment. Healthy medical students, volunteering to take part in this study, were included. The participants filled out a questionnaire assessing the occurrence and subjective intensity of hyperhidrosis in different areas of the body. Additionally, the students were subjected to gravimetric assessment in four localizations: the face, palms, axillae and abdomino-lumbar area. Two hundred and fifty-three students (102 males and 151 females, mean age 24.3 ± 3.21 years) were included in the study. Forty-two (16.7%) participants declared that they suffer from hyperhidrosis. Out of the 42 students declaring any type of hyperhidrosis, only 20 (47.6%) exceeded the gravimetric reference values. From among the students that exceeded the normative values for palmar hyperhidrosis, only 10 (55.6%) were aware of their hyperhidrosis. In the group of students that exceeded the normative values for axillary hyperhidrosis, 16 (39%) were aware of their hyperhidrosis. Subjectively declared hyperhidrosis incidence may significantly exceed the real-life occurrence of this disease. Basing studies solely on data gathered from questionnaires, may lead to false results. It is imperative, when assessing patients suffering from hyperhidrosis, to use both objective and subjective methods of evaluation. © 2013 Japanese Dermatological Association.

  11. Low Hepatic Tissue Copper in Pediatric Nonalcoholic Fatty Liver Disease.

    PubMed

    Mendoza, Michael; Caltharp, Shelley; Song, Ming; Collin, Lindsay; Konomi, Juna V; McClain, Craig J; Vos, Miriam B

    2017-07-01

    Animal models and studies in adults have demonstrated that copper restriction increases severity of liver injury in nonalcoholic fatty liver disease (NAFLD). This has not been studied in children. We aimed to determine if lower tissue copper is associated with increased NAFLD severity in children. This was a retrospective study of pediatric patients who had a liver biopsy including a hepatic copper quantitation. The primary outcome compared hepatic copper concentration in NAFLD versus non-NAFLD. Secondary outcomes compared hepatic copper levels against steatosis, fibrosis, lobular inflammation, balloon degeneration, and NAFLD activity score (NAS). The study analysis included 150 pediatric subjects (102 with NAFLD and 48 non-NAFLD). After adjusting for age, body mass index z score, gamma glutamyl transferase, alanine aminotransferase, and total bilirubin, NAFLD subjects had lower levels of hepatic copper than non-NAFLD (P = 0.005). In addition, tissue copper concentration decreased as steatosis severity increased (P < 0.001). Copper levels were not associated with degree of fibrosis, lobular inflammation, portal inflammation, or balloon degeneration. In this cohort of pediatric subjects with NAFLD, we observed decreased tissue copper levels in subjects with NAFLD when compared with non-NAFLD subjects. In addition, tissue copper levels were lower in subjects with nonalcoholic steatohepatitis, a more severe form of the disease, when compared with steatosis alone. Further studies are needed to explore the relationship between copper levels and NAFLD progression.

  12. Airway Microbiota Is Associated with Up-Regulation of the PI3K Pathway in Lung Cancer.

    PubMed

    Tsay, Jun-Chieh J; Wu, Benjamin G; Badri, Michelle H; Clemente, Jose C; Shen, Nan; Meyn, Peter; Li, Yonghua; Yie, Ting-An; Lhakhang, Tenzin; Olsen, Evan; Murthy, Vivek; Michaud, Gaetane; Sulaiman, Imran; Tsirigos, Aristotelis; Heguy, Adriana; Pass, Harvey; Weiden, Michael D; Rom, William N; Sterman, Daniel H; Bonneau, Richard; Blaser, Martin J; Segal, Leopoldo N

    2018-06-04

    In lung cancer, upregulation of the PI3K pathway is an early event that contributes to cell proliferation, survival, and tissue invasion. Upregulation of this pathway was recently described as associated with enrichment of the lower airways with bacteria identified as oral commensals. We hypothesize that host-microbe interactions in the lower airways of subjects with lung cancer affect known cancer pathways. Airway brushes were collected prospectively from subjects with lung nodules at time of diagnostic bronchoscopy, including 39 subjects with final lung cancer diagnoses and 36 subjects with non-cancer diagnosis. Additionally, samples from 10 healthy control subjects were included. 16S rRNA gene amplicon sequencing and paired transcriptome sequencing (RNAseq) were performed on all airway samples. In addition, an in vitro model with airway epithelial cells exposed to bacteria/bacterial products was performed. The composition of the lower airway transcriptome in the cancer patients was significantly different from the controls, which included upregulation of ERK and PI3K signaling pathways. The lower airways of lung cancer patients were enriched for oral taxa (Streptococcus and Veillonella), which was associated with upregulation of the ERK and PI3K signaling pathways. In vitro exposure of airway epithelial cells to Veillonella, Prevotella, and Streptococcus led to upregulation of these same signaling pathways. The data presented here shows that several transcriptomic signatures previously identified as relevant to lung cancer pathogenesis are associated with enrichment of the lower airway microbiota with oral commensals.

  13. 14 CFR Appendix C to Part 63 - Flight Engineer Training Course Requirements

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... looseleaf binder to include a table of contents. If an applicant desires approval of both a ground school course and a flight school course, they must be combined in one looseleaf binder that includes a separate... include additional subjects in the ground course curriculum, such as international law, flight hygiene, or...

  14. Additional Resources - Naval Oceanography Portal

    Science.gov Websites

    section Advanced Search... Sections Home Time Earth Orientation Astronomy Meteorology Oceanography Ice You , including research and development results. Includes Astronomy and Space, as well as Earth and Ocean Sciences subject categories. Astronomy Resources Union List of Astronomy Serials (ULAS) - Bibliographic

  15. Reasons for Energy Drink Use and Reported Adverse Effects Among Adolescent Emergency Department Patients.

    PubMed

    Nordt, Sean Patrick; Claudius, Ilene; Rangan, Cyrus; Armijo, Erick; Milano, Peter; Yanger, Sheryl; Tomaszsewski, Christian

    2017-12-01

    There is concern of energy drink use by adolescents. The objective of this study was to evaluate the energy drink consumption use, frequency, age of first use, reasons for use, influences of choice of brand, and adverse events recorded in a predominant Latino adolescent population. Subjects between the ages of 13 and 19 years utilizing emergency department services for any reason at a large county hospital answered a questionnaire about energy drink usage. There were 192 subjects, of which 49% were male and 51% were female. Latino adolescents were 85% of the participants, although other ethnic groups participated including African American, white, and Asian. Reasons for use include 61% to increase energy, 32% as study aide, 29% to improve sports performance, and 9% to lose weight. Twenty-four percent reported using energy drinks with ethanol or illicit drugs including marijuana, cocaine, and methamphetamine. Adverse reactions were reported in 40% of the subjects including insomnia (19%), feeling "jittery" (19%), palpitations (16%), gastrointestinal upset (11%), headache (8%), chest pain (5%), shortness of breath (4%), and seizures (1%). Both brand name and packaging influenced the choice of energy drink in most subjects. Forty percent reported at least 1 adverse effect. While most adverse effects were not severe, a small number are serious. In addition, we showed intentional ingestion with ethanol and illicit drugs. Of additional concern is that both brand and packaging seem to directly affect choice of energy drink consumed.

  16. 40 CFR 80.614 - What are the alternative defense requirements in lieu of § 80.613(a)(1)(vi)?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... the additive package has been added, together with supporting data which includes one of the following... a MVNRLM diesel fuel additive package into MVNRLM diesel fuel subject to the 15 ppm sulfur standards... alternative to the defense element under § 80.613(a)(1)(vi): (a)(1) The blender of the additive package has a...

  17. 40 CFR 80.614 - What are the alternative defense requirements in lieu of § 80.613(a)(1)(vi)?

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... the additive package has been added, together with supporting data which includes one of the following... a MVNRLM diesel fuel additive package into MVNRLM diesel fuel subject to the 15 ppm sulfur standards... alternative to the defense element under § 80.613(a)(1)(vi): (a)(1) The blender of the additive package has a...

  18. 40 CFR 80.614 - What are the alternative defense requirements in lieu of § 80.613(a)(1)(vi)?

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... the additive package has been added, together with supporting data which includes one of the following... a MVNRLM diesel fuel additive package into MVNRLM diesel fuel subject to the 15 ppm sulfur standards... alternative to the defense element under § 80.613(a)(1)(vi): (a)(1) The blender of the additive package has a...

  19. 40 CFR 80.614 - What are the alternative defense requirements in lieu of § 80.613(a)(1)(vi)?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... the additive package has been added, together with supporting data which includes one of the following... a MVNRLM diesel fuel additive package into MVNRLM diesel fuel subject to the 15 ppm sulfur standards... alternative to the defense element under § 80.613(a)(1)(vi): (a)(1) The blender of the additive package has a...

  20. 40 CFR 80.614 - What are the alternative defense requirements in lieu of § 80.613(a)(1)(vi)?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... the additive package has been added, together with supporting data which includes one of the following... a MVNRLM diesel fuel additive package into MVNRLM diesel fuel subject to the 15 ppm sulfur standards... alternative to the defense element under § 80.613(a)(1)(vi): (a)(1) The blender of the additive package has a...

  1. How Good Is Our School? Using ICT in Learning and Teaching: Curriculum Area and Subject Appendix. Self-Evaluation Series

    ERIC Educational Resources Information Center

    Her Majesty's Inspectorate of Education, 2004

    2004-01-01

    This document contains curriculum areas where information and communications technology (ICT) can be an effective tool in learning and teaching when used by pupils and/or teachers. These include: (1) Art and design; (2) Business education subjects; (3) Biology and science; (4) Chemistry and science; (5) English, English as an additional language…

  2. The Earth Tides.

    ERIC Educational Resources Information Center

    Levine, Judah

    1982-01-01

    In addition to oceans, the earth is subjected to tidal stresses and undergoes tidal deformations. Discusses origin of tides, tidal stresses, and methods of determining tidal deformations (including gravity, tilt, and strain meters). (JN)

  3. 76 FR 13666 - Pitney Bowes, Inc., Mailing Solutions Management, Global Engineering Group, Including On-Site...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-03-14

    ...., Mailing Solutions Management, Global Engineering Group, Including On-Site Leased Workers From Guidant... workers and former workers of Pitney Bowes, Inc., Mailing Solutions Management Division, Engineering... reviewed the certification to clarify the subject worker group's identity. Additional information revealed...

  4. Theory of Planned Behavior including self-stigma and perceived barriers explain help-seeking behavior for sexual problems in Iranian women suffering from epilepsy.

    PubMed

    Lin, Chung-Ying; Oveisi, Sonia; Burri, Andrea; Pakpour, Amir H

    2017-03-01

    To apply the Theory of Planned Behavior (TPB) and the two additional concepts self-stigma and perceived barriers to the help-seeking behavior for sexual problems in women with epilepsy. In this 18-month follow-up study, TPB elements, including attitude, subjective norm, perceived behavioral control, and behavioral intention along with self-stigma and perceived barriers in seeking help for sexual problems were assessed in n=818 women with epilepsy (94.0% aged ≤40years). The basic TPB model (model 1) and the TPB model additionally including self-stigma and perceived barriers (Model 2) were analyzed using structural equation modeling (SEM). Both SEM models showed satisfactory model fits. According to model, attitude, subjective norms, perceived behavioral control, and intention explained 63.1% of the variance in help-seeking behavior. Variance was slightly higher (64.5%) when including self-stigma and perceived barriers (model 2). In addition, the fit indices of the models were better highlighting the importance of self-stigma and perceived barriers in help-seeking behavior for sexual problems. Theory of Planned Behavior is useful in explaining help-seeking behavior for sexual problems in women with epilepsy. Self-stigma and perceived barriers are additional factors that should be considered in future interventions aiming to adopt TPB to improve help-seeking behavior for sexual problems. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Serial Murder of Four Victims, of Both Genders and Different Ethnicities, by an Ordained Baptist Minister

    PubMed Central

    Reavis, James A.

    2011-01-01

    A case of a 61-year-old African-American male who sexually assaulted and murdered four individuals, of different ethnicities and both genders, is reported. The subject additionally engaged in sexual activity with each victim postmortem. Each murder is reviewed in detail, and the subjective state of the offender during the murders is commented upon. Psychological test data are reviewed. The subject met criteria for several Axis I disorders, including Bipolar I Disorder, Pedophilia, and Sexual Sadism, and met criteria for Axis II diagnoses of Narcissistic and Antisocial Personality disorder. He was additionally classified as a Psychopath, which, in combination with his Sexual Sadism, general psychiatric state, and exquisite sensitivity to humiliation, led to his decision to murder. PMID:22937398

  6. Noninvasive in vivo optical coherence tomography tracking of chronic otitis media in pediatric subjects after surgical intervention

    NASA Astrophysics Data System (ADS)

    Monroy, Guillermo L.; Pande, Paritosh; Nolan, Ryan M.; Shelton, Ryan L.; Porter, Ryan G.; Novak, Michael A.; Spillman, Darold R.; Chaney, Eric J.; McCormick, Daniel T.; Boppart, Stephen A.

    2017-12-01

    In an institutional review board-approved study, 25 pediatric subjects diagnosed with chronic or recurrent otitis media were observed over a period of six months with optical coherence tomography (OCT). Subjects were followed throughout their treatment at the initial patient evaluation and preoperative consultation, surgery (intraoperative imaging), and postoperative follow-up, followed by an additional six months of records-based observation. At each time point, the tympanic membrane (at the light reflex region) and directly adjacent middle-ear cavity were observed in vivo with a handheld OCT probe and portable system. Imaging results were compared with clinical outcomes to correlate the clearance of symptoms in relation to changes in the image-based features of infection. OCT images of most all participants showed the presence of additional infection-related biofilm structures during their initial consultation visit and similarly for subjects imaged intraoperatively before myringotomy. Subjects with successful treatment (no recurrence of infectious symptoms) had no additional structures visible in OCT images during the postoperative visit. OCT image findings suggest surgical intervention consisting of myringotomy and tympanostomy tube placement provides a means to clear the middle ear of infection-related components, including middle-ear fluid and biofilms. Furthermore, OCT was demonstrated as a rapid diagnostic tool to prospectively monitor patients in both outpatient and surgical settings.

  7. 1 CFR 18.20 - Identification of subjects in agency regulations.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... Indexing Terms. Agencies may include additional terms not contained in the Thesaurus as long as the appropriate Thesaurus terms are also used. Copies of the Federal Register Thesaurus of Indexing Terms are...

  8. 1 CFR 18.20 - Identification of subjects in agency regulations.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... Indexing Terms. Agencies may include additional terms not contained in the Thesaurus as long as the appropriate Thesaurus terms are also used. Copies of the Federal Register Thesaurus of Indexing Terms are...

  9. 1 CFR 18.20 - Identification of subjects in agency regulations.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... Indexing Terms. Agencies may include additional terms not contained in the Thesaurus as long as the appropriate Thesaurus terms are also used. Copies of the Federal Register Thesaurus of Indexing Terms are...

  10. 76 FR 81790 - Airworthiness Directives; Hawker Beechcraft Corporation Airplanes Equipped With a Certain...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-12-29

    ... modification that included installation of winglets and different engines and propellers) were installed. The... addition of winglets. (d) Subject Joint Aircraft System Component (JASC)/Air Transport Association (ATA) of...

  11. 28 CFR 16.3 - Requirements for making requests.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... request should include specific information about each record sought, such as the date, title or name, author, recipient, and subject matter of the record. In addition, if you want records about a court case...

  12. 28 CFR 16.3 - Requirements for making requests.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... request should include specific information about each record sought, such as the date, title or name, author, recipient, and subject matter of the record. In addition, if you want records about a court case...

  13. 47 CFR 5.85 - Frequencies and policy governing frequency assignment.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... (including the radio astronomy service). Stations authorized under subparts E and F are subject to additional... flux density assuming a free space characteristic impedance of 120π ohms) at the reference coordinates...

  14. 47 CFR 5.85 - Frequencies and policy governing frequency assignment.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... (including the radio astronomy service). Stations authorized under subparts E and F are subject to additional... flux density assuming a free space characteristic impedance of 120π ohms) at the reference coordinates...

  15. Solar Energy Education. Industrial arts: teacher's guide. Field test edition. [Includes glossary

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    An instructional aid is presented which integrates the subject of solar energy into the classroom study of industrial arts. This guide for teachers was produced in addition to the student activities book for industrial arts by the USDOE Solar Energy Education. A glossary of solar energy terms is included. (BCS)

  16. Perinatal factors and the risk of developing anorexia nervosa and bulimia nervosa.

    PubMed

    Favaro, Angela; Tenconi, Elena; Santonastaso, Paolo

    2006-01-01

    Few prospective studies to date have investigated the role of obstetric complications in anorexia nervosa, and no study to our knowledge exists for this in bulimia nervosa. To explore the role of obstetric complications in the development of eating disorders. A blind analysis of the obstetric records of a sample of subjects with anorexia nervosa, with bulimia nervosa, and normal subjects was performed. All of the subjects included in the study belong to the same population birth cohort and were born in the 2 obstetric wards of Padua Hospital, Padua, Italy, between January 17, 1971, and December 30, 1979. Part of the sample of subjects with eating disorders and all of the controls took part in a prevalence study carried out in 2 randomly selected areas of Padua. In addition, all of the subjects with anorexia nervosa and bulimia nervosa of the same birth cohort who were referred to an outpatient specialist unit were included. The final sample comprised 114 subjects with anorexia nervosa, 73 with bulimia nervosa, and 554 control subjects. Several complications, such as maternal anemia (P = .03), diabetes mellitus (P = .04), preeclampsia (P = .02), placental infarction (P = .001), neonatal cardiac problems (P = .007), and hyporeactivity (P = .03), were significant independent predictors of the development of anorexia nervosa. The risk of developing anorexia nervosa increased with the total number of obstetric complications. In addition, an increasing number of complications significantly anticipated the age at onset of anorexia nervosa (P = .03). The obstetric complications significantly associated with bulimia nervosa were the following: placental infarction (P = .10), neonatal hyporeactivity (P = .005), early eating difficulties (P = .02), and a low birth weight for gestational age (P = .009). Being shorter for gestational age significantly differentiated subjects with bulimia nervosa from both those with anorexia nervosa (P = .04) and control subjects (P = .05). A significantly higher risk of eating disorders was found for subjects with specific types of obstetric complications. An impairment in neurodevelopment could be implicated in the pathogenesis of eating disorders.

  17. Integrating habits and practices data for soaps, cosmetics and air care products into an existing aggregate exposure model.

    PubMed

    Comiskey, D; Api, A M; Barrett, C; Ellis, G; McNamara, C; O'Mahony, C; Robison, S H; Rose, J; Safford, B; Smith, B; Tozer, S

    2017-08-01

    In order to accurately assess aggregate exposure to a fragrance material in consumers, data are needed on consumer habits and practices, as well as the concentration of the fragrance material in those products. The present study describes the development of Phase 2 Creme RIFM model by expanding the previously developed Phase 1 model to include an additional six product types. Using subject-matching algorithms, the subjects in the Phase 1 Creme RIFM database were paired with subjects in the SUPERB and BodyCare surveys based on age and gender. Consumption of the additional products was simulated to create a seven day diary allowing full data integration in a consistent format. The inhalation route was also included for air care and other products where a fraction of product used is inhaled, derived from the RIFM 2-box model. The expansion of the Phase 1 Creme RIFM model has resulted in a more extensive and refined model, which covers a broader range of product categories and now, includes all relevant routes of exposure. An evaluation of the performance of the model has been carried out in an accompanying publication to this one. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. 78 FR 26423 - Railroad Safety Advisory Committee; Notice of Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-05-06

    ... Engineering and System Safety Task Forces. This agenda is subject to change, including the possible addition.... See the RSAC Web site for details on prior RSAC activities and pending tasks at: http://rsac.fra.dot...

  19. Mythology.

    ERIC Educational Resources Information Center

    Web Feet K-8, 2001

    2001-01-01

    This annotated subject guide to Web sites and additional resources focuses on mythology. Specific age levels are given for resources that include Web sites, CD-ROMs and software, videos, books, audios, and magazines; offers professional resources; and presents a relevant class activity. (LRW)

  20. Space.

    ERIC Educational Resources Information Center

    Web Feet K-8, 2001

    2001-01-01

    This annotated subject guide to Web sites and additional resources focuses on space and astronomy. Specifies age levels for resources that include Web sites, CD-ROMS and software, videos, books, audios, and magazines; offers professional resources; and presents a relevant class activity. (LRW)

  1. High temperature lubricants. (Latest citations from the US Patent bibliographic file with exemplary claims). Published Search

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    NONE

    1996-01-01

    The bibliography contains citations of selected patents concerning high temperature synthetic and natural lubricating compositions. Thickening agents, thermal stabilizers, polymeric additives, antioxidants, and preservatives are included relative to such lubricants as greases, oils, and soaps. Manufacturing methods and various applications are included. (Contains 50-250 citations and includes a subject term index and title list.) (Copyright NERAC, Inc. 1995)

  2. The heart field effect: Synchronization of healer-subject heart rates in energy therapy.

    PubMed

    Bair, Christine Caldwell

    2008-01-01

    Recent health research has focused on subtle energy and vibrational frequency as key components of health and healing. In particular, intentional direction of bioenergy is receiving increasing scientific attention. This study investigates the effect of the healer's electromagnetic (EM) heart field upon subjects during energy healing as measured by synchronization of heart rates and scores on a Subjective Units of Distress (SUD) scale and a Profile of Mood States (POMS) inventory. A nonequivalent pretest-posttest design was used based on heart rate comparisons between healer and subject and correlated with pre-and posttest SUD and POMS scores. Subjects included those who sat within the 3- to 4-foot "strong" range of the independent variable, the healer's heart field, while performing self-application of WHEE (the wholistic hybrid derived from EMDR [eye movement desensitization and reprocessing], and EFT [emotional freedom technique]), a meridian-based tapping technique (n=50); and those who performed the same process beyond the 15- to 18-foot range of the healer's EM heart field (n=41). The dependent variables were heart rate, SUD, and POMS inventory. All subjects completed these measures within 1 hour. Study results showed statistically significant heart-rate synchronization with the intervention population. In addition, SUD and POMS scores demonstrated considerably more improvement than in the control population, indicating additional benefit beyond the meridian-based therapies, such as WHEE, alone. Additional findings and future research recommendations are presented in this article.

  3. Eculizumab for dense deposit disease and C3 glomerulonephritis.

    PubMed

    Bomback, Andrew S; Smith, Richard J; Barile, Gaetano R; Zhang, Yuzhou; Heher, Eliot C; Herlitz, Leal; Stokes, M Barry; Markowitz, Glen S; D'Agati, Vivette D; Canetta, Pietro A; Radhakrishnan, Jai; Appel, Gerald B

    2012-05-01

    The principle defect in dense deposit disease and C3 glomerulonephritis is hyperactivity of the alternative complement pathway. Eculizumab, a monoclonal antibody that binds to C5 to prevent formation of the membrane attack complex, may prove beneficial. In this open-label, proof of concept efficacy and safety study, six subjects with dense deposit disease or C3 glomerulonephritis were treated with eculizumab every other week for 1 year. All had proteinuria >1 g/d and/or AKI at enrollment. Subjects underwent biopsy before enrollment and repeat biopsy at the 1-year mark. The subjects included three patients with dense deposit disease (including one patient with recurrent dense deposit disease in allograft) and three patients with C3 glomerulonephritis (including two patients with recurrent C3 glomerulonephritis in allograft). Genetic and complement function testing revealed a mutation in CFH and MCP in one subject each, C3 nephritic factor in three subjects, and elevated levels of serum membrane attack complex in three subjects. After 12 months, two subjects showed significantly reduced serum creatinine, one subject achieved marked reduction in proteinuria, and one subject had stable laboratory parameters but histopathologic improvements. Elevated serum membrane attack complex levels normalized on therapy and paralleled improvements in creatinine and proteinuria. Clinical and histopathologic data suggest a response to eculizumab in some but not all subjects with dense deposit disease and C3 glomerulonephritis. Elevation of serum membrane attack complex before treatment may predict response. Additional research is needed to define the subgroup of dense deposit disease/C3 glomerulonephritis patients in whom eculizumab therapy can be considered.

  4. New capacities and modifications for NASTRAN level 17.5 at DTNSRDC

    NASA Technical Reports Server (NTRS)

    Hurwitz, M. M.

    1980-01-01

    Since 1970 DTNSRDC has been modifying NASTRAN to suite various Navy requirements. These modifications include capabilities as well as user conveniences and error corrections. The new features added to NASTRAN Level 17.5 are described. The subject areas of the additions include magnetostatics, piezoelectricity, fluid structure interactions, isoparametric finite elements, and shock design for shipboard equipment.

  5. Relating binocular and monocular vision in strabismic and anisometropic amblyopia.

    PubMed

    Agrawal, Ritwick; Conner, Ian P; Odom, J V; Schwartz, Terry L; Mendola, Janine D

    2006-06-01

    To examine deficits in monocular and binocular vision in adults with amblyopia and to test the following 2 hypotheses: (1) Regardless of clinical subtype, the degree of impairment in binocular integration predicts the pattern of monocular acuity deficits. (2) Subjects who lack binocular integration exhibit the most severe interocular suppression. Seven subjects with anisometropia, 6 subjects with strabismus, and 7 control subjects were tested. Monocular tests included Snellen acuity, grating acuity, Vernier acuity, and contrast sensitivity. Binocular tests included Titmus stereo test, binocular motion integration, and dichoptic contrast masking. As expected, both groups showed deficits in monocular acuity, with subjects with strabismus showing greater deficits in Vernier acuity. Both amblyopic groups were then characterized according to the degree of residual stereoacuity and binocular motion integration ability, and 67% of subjects with strabismus compared with 29% of subjects with anisometropia were classified as having "nonbinocular" vision according to our criterion. For this nonbinocular group, Vernier acuity is most impaired. In addition, the nonbinocular group showed the most dichoptic contrast masking of the amblyopic eye and the least dichoptic contrast masking of the fellow eye. The degree of residual binocularity and interocular suppression predicts monocular acuity and may be a significant etiological mechanism of vision loss.

  6. 77 FR 26513 - Proposed Information Collection; Comment Request; Southeast Region Vessel Monitoring System (VMS...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-05-04

    ... restrictions through remote sensing methods. In addition, all fishing gears are subject to some area fishing...) ways to minimize the burden of the collection of information on respondents, including through the use...

  7. Effects of expected-value information and display format on recognition of aircraft subsystem abnormalities

    NASA Technical Reports Server (NTRS)

    Palmer, Michael T.; Abbott, Kathy H.

    1994-01-01

    This study identifies improved methods to present system parameter information for detecting abnormal conditions and to identify system status. Two workstation experiments were conducted. The first experiment determined if including expected-value-range information in traditional parameter display formats affected subject performance. The second experiment determined if using a nontraditional parameter display format, which presented relative deviation from expected value, was better than traditional formats with expected-value ranges included. The inclusion of expected-value-range information onto traditional parameter formats was found to have essentially no effect. However, subjective results indicated support for including this information. The nontraditional column deviation parameter display format resulted in significantly fewer errors compared with traditional formats with expected-value-ranges included. In addition, error rates for the column deviation parameter display format remained stable as the scenario complexity increased, whereas error rates for the traditional parameter display formats with expected-value ranges increased. Subjective results also indicated that the subjects preferred this new format and thought that their performance was better with it. The column deviation parameter display format is recommended for display applications that require rapid recognition of out-of-tolerance conditions, especially for a large number of parameters.

  8. Legal and ethical issues in neuroimaging research: human subjects protection, medical privacy, and the public communication of research results.

    PubMed

    Kulynych, Jennifer

    2002-12-01

    Humans subjects research entails significant legal and ethical obligations. Neuroimaging researchers must be familiar with the requirements of human subjects protection, including evolving standards for the protection of privacy and the disclosure of risk in "non-therapeutic" research. Techniques for creating veridical surface renderings from volumetric anatomical imaging data raise new privacy concerns, particularly under the federal medical privacy regulation. Additionally, neuroimaging researchers must consider their obligation to communicate research results responsibly. The emerging field of neuroethics should strive to raise awareness of these issues and to involve neuroimaging researchers in the legal, ethical, and policy debates that currently surround human subjects research.

  9. Experiences with three different fiber supplements in weight reduction.

    PubMed

    Birketvedt, Grethe Støa; Shimshi, Mona; Erling, Thom; Florholmen, Jon

    2005-01-01

    Fiber supplements added to a caloric diet have additional effects on weight reduction in overweight subjects. The aim of this study was to compare the effect of various commercial fiber supplements (glucomannan, guar gum and alginate) on weight reduction in healthy overweight subjects. One hundred and seventy six men and women were included to receive either active fiber substance or placebo in randomized placebo-controlled studies. The fiber supplements consisted of the viscous fibers glucomannan (Chrombalance), glucomannan and guar gum (Appe-Trim) and glucomannan, guar gum and alginat (Glucosahl). All fiber supplements plus a balanced 1200 kcal diet induced significantly weight reduction more than placebo and diet alone, during a five week observation period. However, there were no significant differences between the different fibers in their ability to induce weight reduction, which was approximately 0.8 kg/week (3.8 +/- 0.9, 4.4 +/- 2.0, 4.1 +/- 0.6 in the Chrombalance, Appe-Trim and Glucosahl group, respectively). Glucomannan induced body weight reduction in healthy overweight subjects, whereas the addition of guar gum and alginate did not seem to cause additional loss of weight.

  10. NASA Scope and Subject Category Guide

    NASA Technical Reports Server (NTRS)

    2011-01-01

    This guide provides a simple, effective tool to assist aerospace information analysts and database builders in the high-level subject classification of technical materials. Each of the 76 subject categories comprising the classification scheme is presented with a description of category scope, a listing of subtopics, cross references, and an indication of particular areas of NASA interest. The guide also includes an index of nearly 3,000 specific research topics cross referenced to the subject categories. The portable document format (PDF) version of the guide contains links in the index from each input subject to its corresponding categories. In addition to subject classification, the guide can serve as an aid to searching databases that use the classification scheme, and is also an excellent selection guide for those involved in the acquisition of aerospace literature. The CD-ROM contains both HTML and PDF versions.

  11. An anthology: Rationale for a US ballistic missile defense (1969 - 1984)

    NASA Astrophysics Data System (ADS)

    Tircuit, E. C.

    1985-04-01

    This anthology is a selection and short synopsis of representative articles on the rationale for a US ballistic missile defense (BMD). Unclassified articles and documents were reviewed and analyzed to identify and include nine representative articles in the anthology. The anthology reduces the search for quality material on the subject and documents the fundamental rationale for a BMD. The author concluded that the fundamental rationale for a US BMD is to deter nuclear war. In addition, specific rationale for a US BMD is provided in the anthology. Finally, an extensive bibliography is included in the anthology to enhance further research on the subject.

  12. 37 CFR 212.3 - Registration of claims for protection of eligible designs.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ...) Drawings must be in black ink on white 81/2″ × 11″ unruled paper. A drawing of a design should include... of the design. Solid black surface shading is not permitted except when used to represent the black... included as a separate figure, in addition to other figures which fully disclose the subject matter of the...

  13. 37 CFR 212.3 - Registration of claims for protection of eligible designs.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ...) Drawings must be in black ink on white 81/2″ × 11″ unruled paper. A drawing of a design should include... of the design. Solid black surface shading is not permitted except when used to represent the black... included as a separate figure, in addition to other figures which fully disclose the subject matter of the...

  14. 37 CFR 212.3 - Registration of claims for protection of eligible designs.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ...) Drawings must be in black ink on white 81/2″×11″ unruled paper. A drawing of a design should include... of the design. Solid black surface shading is not permitted except when used to represent the black... included as a separate figure, in addition to other figures which fully disclose the subject matter of the...

  15. 75 FR 36629 - Floor-Standing, Metal-Top Ironing Tables and Certain Parts Thereof from the People's Republic of...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-28

    ... various features, including iron rests, linen racks, and others. The subject ironing tables may be sold... top or the attachment of an included feature such as an iron rest or linen rack. The term ``complete... and cover, with or without additional features, e.g., iron rest or linen rack. The term ``incomplete...

  16. 77 FR 14499 - Floor-Standing, Metal-Top Ironing Tables and Certain Parts Thereof From the People's Republic of...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-03-12

    ... various features, including iron rests, linen racks, and others. The subject ironing tables may be sold... top or the attachment of an included feature such as an iron rest or linen rack. The term ``complete... and cover, with or without additional features, e.g., iron rest or linen rack. The term ``incomplete...

  17. Human acclimation and acclimatization to heat: A compendium of research, 1968-1978. [Bibliography

    NASA Technical Reports Server (NTRS)

    Sciaraffa, D.; Fox, S. C.; Stockmann, R.; Greenleaf, J. E.

    1980-01-01

    Abstracts and annotations of the majority of scientific works that elucidate the mechanisms of short-term acclimation to heat in men and women are presented. The compendium includes material from 1968 through 1977. Subject and author indexes are provided and additional references of preliminary research findings or work of a peripheral nature are included in a bibliography.

  18. Eculizumab for Dense Deposit Disease and C3 Glomerulonephritis

    PubMed Central

    Smith, Richard J.; Barile, Gaetano R.; Zhang, Yuzhou; Heher, Eliot C.; Herlitz, Leal; Stokes, M. Barry; Markowitz, Glen S.; D’Agati, Vivette D.; Canetta, Pietro A.; Radhakrishnan, Jai; Appel, Gerald B.

    2012-01-01

    Summary Background and objectives The principle defect in dense deposit disease and C3 glomerulonephritis is hyperactivity of the alternative complement pathway. Eculizumab, a monoclonal antibody that binds to C5 to prevent formation of the membrane attack complex, may prove beneficial. Design, setting, participants, & measurements In this open-label, proof of concept efficacy and safety study, six subjects with dense deposit disease or C3 glomerulonephritis were treated with eculizumab every other week for 1 year. All had proteinuria >1 g/d and/or AKI at enrollment. Subjects underwent biopsy before enrollment and repeat biopsy at the 1-year mark. Results The subjects included three patients with dense deposit disease (including one patient with recurrent dense deposit disease in allograft) and three patients with C3 glomerulonephritis (including two patients with recurrent C3 glomerulonephritis in allograft). Genetic and complement function testing revealed a mutation in CFH and MCP in one subject each, C3 nephritic factor in three subjects, and elevated levels of serum membrane attack complex in three subjects. After 12 months, two subjects showed significantly reduced serum creatinine, one subject achieved marked reduction in proteinuria, and one subject had stable laboratory parameters but histopathologic improvements. Elevated serum membrane attack complex levels normalized on therapy and paralleled improvements in creatinine and proteinuria. Conclusions Clinical and histopathologic data suggest a response to eculizumab in some but not all subjects with dense deposit disease and C3 glomerulonephritis. Elevation of serum membrane attack complex before treatment may predict response. Additional research is needed to define the subgroup of dense deposit disease/C3 glomerulonephritis patients in whom eculizumab therapy can be considered. PMID:22403278

  19. 78 FR 62881 - Self-Regulatory Organizations; NYSE MKT LLC; Notice of Filing and Immediate Effectiveness of...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-10-22

    ... the SROs that developed and maintain the exam. Additionally, only one $195 fee would be charged... . Please include File Number SR-NYSEMkt-2013-77 on the subject line. Paper Comments Send paper comments in...

  20. Subclinical Disease Burden as Assessed by Whole-Body MRI in Subjects With Prediabetes, Subjects With Diabetes, and Normal Control Subjects From the General Population: The KORA-MRI Study.

    PubMed

    Bamberg, Fabian; Hetterich, Holger; Rospleszcz, Susanne; Lorbeer, Roberto; Auweter, Sigrid D; Schlett, Christopher L; Schafnitzel, Anina; Bayerl, Christian; Schindler, Andreas; Saam, Tobias; Müller-Peltzer, Katharina; Sommer, Wieland; Zitzelsberger, Tanja; Machann, Jürgen; Ingrisch, Michael; Selder, Sonja; Rathmann, Wolfgang; Heier, Margit; Linkohr, Birgit; Meisinger, Christa; Weber, Christian; Ertl-Wagner, Birgit; Massberg, Steffen; Reiser, Maximilian F; Peters, Annette

    2017-01-01

    Detailed pathophysiological manifestations of early disease in the context of prediabetes are poorly understood. This study aimed to evaluate the extent of early signs of metabolic and cardio-cerebrovascular complications affecting multiple organs in individuals with prediabetes. Subjects without a history of stroke, coronary artery disease, or peripheral artery disease were enrolled in a case-control study nested within the Cooperative Health Research in the Region of Augsburg (KORA) FF4 cohort and underwent comprehensive MRI assessment to characterize cerebral parameters (white matter lesions, microbleeds), cardiovascular parameters (carotid plaque, left ventricular function, and myocardial late gadolinium enhancement [LGE]), and metabolic parameters (hepatic proton-density fat fraction [PDFF] and subcutaneous and visceral abdominal fat). Among 400 subjects who underwent MRI, 103 subjects had prediabetes and 54 had established diabetes. Subjects with prediabetes had an increased risk for carotid plaque and adverse functional cardiac parameters, including reduced early diastolic filling rates as well as a higher prevalence of LGE compared with healthy control subjects. In addition, people with prediabetes had significantly elevated levels of PDFF and total and visceral fat. Thus, subjects with prediabetes show early signs of subclinical disease that include vascular, cardiac, and metabolic changes, as measured by whole-body MRI after adjusting for cardiometabolic risk factors. © 2017 by the American Diabetes Association.

  1. The dilemma of allergy to food additives.

    PubMed

    Bahna, Sami L; Burkhardt, Joshua G

    2018-01-01

    To provide a brief summary on food additives and to outline a practical approach for evaluating subjects suspected of having reactions to food additives. Information was derived from selected reviews and original articles published in peer-reviewed journals, supplemented by the clinical experience of the authors. Priority was given to studies that used blinded, placebo controlled, oral challenges to confirm adverse reactions to food additives. In addition, selected, appropriately evaluated case reports were included. A large number of food additives are widely used in the food industry. Allergic reactions to additives seem to be rare but are very likely underdiagnosed, primarily due to a low index of suspicion. A wide variety of symptoms to food additives have been reported, but a cause-and-effect relationship has not been well documented in the majority of cases. Reactions to food additives should be suspected in patients who report symptoms related to multiple foods or to a certain food when commercially prepared but not when home made. It is also prudent to investigate food additives in subjects considered to have "idiopathic" reactions. Except for a limited number of natural additives, there is a small role for skin tests or in vitro testing. Oral challenge, in stages, with commonly used additives is the definitive procedure for detecting the offending agent. Once the specific additive is identified, management is strict avoidance, which can be difficult.

  2. Preprocessed Consortium for Neuropsychiatric Phenomics dataset.

    PubMed

    Gorgolewski, Krzysztof J; Durnez, Joke; Poldrack, Russell A

    2017-01-01

    Here we present preprocessed MRI data of 265 participants from the Consortium for Neuropsychiatric Phenomics (CNP) dataset. The preprocessed dataset includes minimally preprocessed data in the native, MNI and surface spaces accompanied with potential confound regressors, tissue probability masks, brain masks and transformations. In addition the preprocessed dataset includes unthresholded group level and single subject statistical maps from all tasks included in the original dataset. We hope that availability of this dataset will greatly accelerate research.

  3. Increasing the amount of payment to research subjects

    PubMed Central

    Resnick, DB

    2014-01-01

    This article discusses some ethical issues that can arise when researchers decide to increase the amount of payment offered to research subjects to boost enrollment. Would increasing the amount of payment be unfair to subjects who have already consented to participate in the study? This article considers how five different models of payment—the free market model, the wage payment model, the reimbursement model, the appreciation model, and the fair benefits model—would approach this issue. The article also considers several practical problems related to changing the amount of payment, including determining whether there is enough money in the budget to offer additional payments to subjects who have already enrolled, ascertaining how difficult it will be to re-contact subjects, and developing a plan of action for responding to subjects who find out they are receiving less money and demand an explanation. PMID:18757614

  4. Prosocial Behavior and Subjective Insecurity in Violent Contexts: Field Experiments.

    PubMed

    Vélez, María Alejandra; Trujillo, Carlos Andres; Moros, Lina; Forero, Clemente

    2016-01-01

    Subjective insecurity is a key determinant of different forms of prosocial behavior. In Study 1, we used field experiments with farmers in Colombian villages exposed to different levels of violence to investigate how individual perceptions of insecurity affect cooperation, trust, reciprocity and altruism. To do so, we developed a cognitive-affective measure of subjective insecurity. We found that subjective insecurity has a negative effect on cooperation but influences trust and altruism positively. In Study 2, carried out three years after Study 1, we repeated the initial design with additional measures of victimization. Our goal was to relate subjective insecurity with actual victimization. The findings of Study 2 support the initial results, and are robust and consistent for cooperative behavior and trust when including victimization as a mediator. Different indicators of victimization are positively correlated with subjective insecurity and an aggregate index of victimization has a negative effect on cooperation but exerts a positive influence on trust.

  5. The Comparative Efficacy of the Masquelet versus Titanium Mesh Cage Reconstruction Techniques for the Treatment of Large Long Bone Deficiencies

    DTIC Science & Technology

    2016-10-01

    include 9 MT, 7 TMCT. Within the last 12-month study period, 8 patients were enrolled, 2 completed the study, 1 was withdrawn, and 11 are actively ...TMCT) are being actively followed, and their study courses are uneventful. There are 3 additional potentially eligible study patients identified...Uneventfully Subjects Actively Participating Subjects Removed from Trial Continuation Masquelet 9 2 6 1 Cage 7 0 5 2 Total: 16

  6. Effect of Atropine and 2-PAM Chloride on Vision and Performance.

    DTIC Science & Technology

    1986-05-31

    occasional users of alcohol and marijuana ; one subject was a frequent user of marijuana . Our subjects were asked to refrain from all other drugs...during the experiment (including alcohol and coffee). In addition, they did not smoke any marijuana for at least 2 weeks prior to the start of the...emitting diode ( LED ) mounted on the side, moves in a fixed arc at a simulated distance of I km and a constant angular velocity of 5 mrad/sec. The

  7. 77 FR 63217 - Use of Additional Portable Oxygen Concentrators on Board Aircraft

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-10-16

    ..., organizations, and governmental jurisdictions subject to regulation. To achieve this principle, agencies are... small entities, including small businesses, not-for-profit organizations, and small governmental... manufacturer's names. In this final rule, the FAA will add those previous manufacturer's names (International...

  8. 21 CFR 73.2087 - Carmine.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... ADDITIVES EXEMPT FROM CERTIFICATION Cosmetics § 73.2087 Carmine. (a) Identity and specifications. The color...)(2). (b) Use and restrictions. Carmine may be safely used in cosmetics generally, including cosmetics... provisions of § 70.25 of this chapter. (2) Cosmetics containing carmine that are not subject to the...

  9. 21 CFR 73.2087 - Carmine.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... ADDITIVES EXEMPT FROM CERTIFICATION Cosmetics § 73.2087 Carmine. (a) Identity and specifications. The color...)(2). (b) Use and restrictions. Carmine may be safely used in cosmetics generally, including cosmetics... provisions of § 70.25 of this chapter. (2) Cosmetics containing carmine that are not subject to the...

  10. 21 CFR 73.2087 - Carmine.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... ADDITIVES EXEMPT FROM CERTIFICATION Cosmetics § 73.2087 Carmine. (a) Identity and specifications. The color...)(2). (b) Use and restrictions. Carmine may be safely used in cosmetics generally, including cosmetics... provisions of § 70.25 of this chapter. (2) Cosmetics containing carmine that are not subject to the...

  11. 21 CFR 73.2087 - Carmine.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... ADDITIVES EXEMPT FROM CERTIFICATION Cosmetics § 73.2087 Carmine. (a) Identity and specifications. The color...)(2). (b) Use and restrictions. Carmine may be safely used in cosmetics generally, including cosmetics... provisions of § 70.25 of this chapter. (2) Cosmetics containing carmine that are not subject to the...

  12. Classical Measurement Methods and Laser Scanning Usage in Shaft Hoist Assembly Inventory

    NASA Astrophysics Data System (ADS)

    Jaśkowski, Wojciech; Lipecki, Tomasz; Matwij, Wojciech; Jabłoński, Mateusz

    2018-03-01

    The shaft hoist assembly is the base of underground mining plant. Its efficiency and correct operation is subject to restrictive legal regulations and is controlled on a daily visual assessment by shaft crew and energomechanics. In addition, in the regular interval, the shaft hoist assembly is subject to a thorough inventory, which includes the determination of the geometrical relationships between the hoisting machine, the headframe and the shaft with its housing. Inventory measurements for shaft and headframe are used for years of conventional geodetic methods including mechanical or laser plumbing and tachymetric surveys. Additional precision levelling is also used for measuring shafts of hoisting machines and rope pulleys. Continuous modernization of measuring technology makes it possible to implement the further methods to the above mentioned purposes. The comparison of the accuracy and the economics of performing measurements based on many years of experience with comprehensive inventory of shaft hoist assembly using various research techniques was made and detailed in the article.

  13. Supplemental Environmental Baseline Survey for Proposed Land Use Permit Modification for Expansion of the Dynamic Explosive Test Site (DETS) 9940 Main Complex Parking Lot

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Peek, Dennis W.

    The “subject property” is comprised of a parcel of land within the Kirtland Military Reservation, Bernalillo County, New Mexico, as shown on the map in Appendix B of this document. The land requirement for the parking lot addition to the 9940 Main Complex is approximately 2.7 acres. The scope of this Supplemental Environmental Baseline Survey (SEBS) is for the parking lot addition land transfer only. For details on the original 9940 Main Complex see Environmental Baseline Survey, Land Use Permit Request for the 9940 Complex PERM/0-KI-00-0001, August 21, 2003, and for details on the 9940 Complex Expansion see Environmental Baselinemore » Survey, Proposed Land Use Permit Expansion for 9940 DETS Complex, June 24, 2009. The 2.7-acre parcel of land for the new parking lot, which is the subject of this EBS (also referred to as the “subject property”), is adjacent to the southwest boundary of the original 12.3- acre 9940 Main Complex. No testing is known to have taken place on the subject property site. The only activity known to have taken place was the burial of overhead utility lines in 2014. Adjacent to the subject property, the 9940 Main Complex was originally a 12.3-acre site used by the Department of Energy (DOE) under a land use permit from the United States Air Force (USAF). Historical use of the site, dating from 1964, included arming, fusing, and firing of explosives and testing of explosives systems components. In the late 1970s and early 1980s experiments at the 9940 Main Complex shifted toward reactor safety issues. From 1983 to 1988, fuel coolant interaction (FCI) experiments were conducted, as were experiments with conventional high explosives (HE). Today, the land is used for training of the Nuclear Emergency Response community and for research on energetic materials. In 2009, the original complex was expanded to include four additional 20-acre areas: 9940 Training South, 9940 Training East, T-Range 6, and Training West Landing Zone. The proposed use of the subject property is for the purpose of adding a parking lot to serve the increase in customer vehicles that is occurring as the 9940 Main Complex is more heavily utilized, and as the 2009 Expansion areas come online as operational training facilities. The subject property would be used only for parking, not for testing or training activities. The parking lot would have a gravel surface. Current and future work at the 9940 Main Complex involves arming, fuzing, and firing of explosives and the testing of explosive systems components in both terrestrial and aquatic settings. It also involves specialized training activities for a variety of first responder customers, both DOE and non-DOE agencies. The approach was to perform a document search, supplemented by a visual site inspection, to identify potential environmental contamination associated with the property. Factors evaluated included hazardous substances; petroleum products and derivatives; environmental restoration sites; areas of concern; storage tanks; oil/water separators; grease traps; wash racks; waste tanks; pesticides; military munitions/ordnance; medical or bio-hazardous waste; radioactive waste; solid/municipal waste; indoor air quality; groundwater; wastewater treatment, collection, and disposal/discharge; drinking water quality; utilities; asbestos; polychlorinated biphenyls (PCBs); radon; lead-based paint; cultural resources; floodplains; and natural/biological resources. Each of these factors is evaluated separately in Section 5, Findings for Subject Property. The property categorization for this subject property would be considered Category 1- “An area or real property where no storage, release, or disposal of hazardous substances or petroleum products or their derivatives has occurred into the environment or structures or disposed on the subject property (including no migration of these substances from adjacent properties).” There appears to be sufficient information to categorize the subject property and it appears that no further effort needs to be made to obtain additional information. There are no findings of an adverse nature on the subject property itself or from adjacent properties. It is recommended that the proposed transfer of the subject property from the USAF to DOE proceed.« less

  14. Meta-analysis identifies six new susceptibility loci for atrial fibrillation

    PubMed Central

    Ellinor, Patrick T; Lunetta, Kathryn L; Albert, Christine M; Glazer, Nicole L; Ritchie, Marylyn D; Smith, Albert V; Arking, Dan E; Müller-Nurasyid, Martina; Krijthe, Bouwe P; Lubitz, Steven A; Bis, Joshua C; Chung, Mina K; Dörr, Marcus; Ozaki, Kouichi; Roberts, Jason D; Smith, J Gustav; Pfeufer, Arne; Sinner, Moritz F; Lohman, Kurt; Ding, Jingzhong; Smith, Nicholas L; Smith, Jonathan D; Rienstra, Michiel; Rice, Kenneth M; Van Wagoner, David R; Magnani, Jared W; Wakili, Reza; Clauss, Sebastian; Rotter, Jerome I; Steinbeck, Gerhard; Launer, Lenore J; Davies, Robert W; Borkovich, Matthew; Harris, Tamara B; Lin, Honghuang; Völker, Uwe; Völzke, Henry; Milan, David J; Hofman, Albert; Boerwinkle, Eric; Chen, Lin Y; Soliman, Elsayed Z; Voight, Benjamin F; Li, Guo; Chakravarti, Aravinda; Kubo, Michiaki; Tedrow, Usha B; Rose, Lynda M; Ridker, Paul M; Conen, David; Tsunoda, Tatsuhiko; Furukawa, Tetsushi; Sotoodehnia, Nona; Xu, Siyan; Kamatani, Naoyuki; Levy, Daniel; Nakamura, Yusuke; Parvez, Babar; Mahida, Saagar; Furie, Karen L; Rosand, Jonathan; Muhammad, Raafia; Psaty, Bruce M; Meitinger, Thomas; Perz, Siegfried; Wichmann, H-Erich; Witteman, Jacqueline C M; Kao, W H Linda; Kathiresan, Sekar; Roden, Dan M; Uitterlinden, Andre G; Rivadeneira, Fernando; McKnight, Barbara; Sjögren, Marketa; Newman, Anne B; Liu, Yongmei; Gollob, Michael H; Melander, Olle; Tanaka, Toshihiro; Ch Stricker, Bruno H; Felix, Stephan B; Alonso, Alvaro; Darbar, Dawood; Barnard, John; Chasman, Daniel I; Heckbert, Susan R; Benjamin, Emelia J; Gudnason, Vilmundur; Kääb, Stefan

    2012-01-01

    Atrial fibrillation is a highly prevalent arrhythmia and a major risk factor for stroke, heart failure and death1. We conducted a genome-wide association study (GWAS) in individuals of European ancestry, including 6,707 with and 52,426 without atrial fibrillation. Six new atrial fibrillation susceptibility loci were identified and replicated in an additional sample of individuals of European ancestry, including 5,381 subjects with and 1 0,030 subjects without atrial fibrillation (P < 5 × 10−8). Four of the loci identified in Europeans were further replicated in silico in a GWAS of Japanese individuals, including 843 individuals with and 3,350 individuals without atrial fibrillation. The identified loci implicate candidate genes that encode transcription factors related to cardiopulmonary development, cardiac-expressed ion channels and cell signaling molecules. PMID:22544366

  15. Analysis of survival data from telemetry projects

    USGS Publications Warehouse

    Bunck, C.M.; Winterstein, S.R.; Pollock, K.H.

    1985-01-01

    Telemetry techniques can be used to study the survival rates of animal populations and are particularly suitable for species or settings for which band recovery models are not. Statistical methods for estimating survival rates and parameters of survival distributions from observations of radio-tagged animals will be described. These methods have been applied to medical and engineering studies and to the study of nest success. Estimates and tests based on discrete models, originally introduced by Mayfield, and on continuous models, both parametric and nonparametric, will be described. Generalizations, including staggered entry of subjects into the study and identification of mortality factors will be considered. Additional discussion topics will include sample size considerations, relocation frequency for subjects, and use of covariates.

  16. Progressive Failure Studies of Stiffened Panels Subjected to Shear Loading

    NASA Technical Reports Server (NTRS)

    Ambur, Damodar R.; Jaunky, Navin; Hilburger, Mark W.; Bushnell, Dennis M. (Technical Monitor)

    2002-01-01

    Experimental and analytical results are presented for progressive failure of stiffened composite panels with and without a notch and subjected to in plane shear loading well into their postbuckling regime. Initial geometric imperfections are included in the finite element models. Ply damage modes such as matrix cracking, fiber-matrix shear, and fiber failure are modeled by degrading the material properties. Experimental results from the test include strain field data from video image correlation in three dimensions in addition to other strain and displacement measurements. Results from nonlinear finite element analyses are compared with experimental data. Good agreement between experimental data and numerical results are observed for the stitched stiffened composite panels studied.

  17. The associations of indoor environment and psychosocial factors on the subjective evaluation of Indoor Air Quality among lower secondary school students: a multilevel analysis.

    PubMed

    Finell, E; Haverinen-Shaughnessy, U; Tolvanen, A; Laaksonen, S; Karvonen, S; Sund, R; Saaristo, V; Luopa, P; Ståhl, T; Putus, T; Pekkanen, J

    2017-03-01

    Subjective evaluation of Indoor Air Quality (subjective IAQ) reflects both building-related and psychosocial factors, but their associations have rarely been studied other than on the individual level in occupational settings and their interactions have not been assessed. Therefore, we studied whether schools' observed indoor air problems and psychosocial factors are associated with subjective IAQ and their potential interactions. The analysis was performed with a nationwide sample (N = 195 schools/26946 students) using multilevel modeling. Two datasets were merged: (i) survey data from students, including information on schools' psychosocial environment and subjective IAQ, and (ii) data from school principals, including information on observed indoor air problems. On the student level, school-related stress, poor teacher-student relationship, and whether the student did not easily receive help from school personnel, were significantly associated with poor subjective IAQ. On the school level, observed indoor air problem (standardized β = -0.43) and poor teacher-student relationship (standardized β = -0.22) were significant predictors of poor subjective IAQ. In addition, school-related stress was associated with poor subjective IAQ, but only in schools without observed indoor air problem (standardized β = -0.44). © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  18. Neurobiology of Addictions: Implications for Clinical Practice.

    ERIC Educational Resources Information Center

    Spence, Richard T., Ed.; DiNitto, Diana M., Ed.; Straussner, Shulamith Lala Ashenberg, Ed.

    This book offers helping professionals an introduction to the neurobiological aspects of substance abuse. It presents the basic information on the subject, including the various neurobiological theories of addiction, and places them in a psychosocial context. In addition to connecting the theoretical information with practical applications, the…

  19. The Moderating Role of Autonomous Motivation on the Relationship between Subjective Well-Being and Physical Health

    PubMed Central

    Marcinko, Ivana

    2015-01-01

    The purpose of this study was to investigate the moderator effects of autonomous motivation on the relationship between subjective well-being and physical health. Using a cluster sampling approach 486 students (403 female and 83 male students) were included in this study. Subjective well-being, physical health and autonomous motivation were determined by self-report measures. Data were analysed using hierarchical regression analysis and analysis of variance. The results show that high self-determination moderates the relationship between high subjective well-being and physical health. Accordingly, the best physical health was reported by participants who had high level of subjective well-being and whose behaviours were self-determined. Additional analyses have shown that the moderating effect of self-determination is based on the moderational impact of autonomous motives and not the controlling ones. Additionally, whether autonomous motivation moderates the relationship between components of subjective well-being and physical health was also tested. The findings have shown that autonomous motives moderate relationship between physical health and one component of well-being, positive affect. Consequently, a good physical health was found among participants with high positive affect and behaviours regulated by high degree of autonomous motives. Conclusion which can be drawn from these findings is that if an individual behaves autonomously then it can contribute to positive mind—body influences and support their own health. PMID:25942449

  20. The Moderating Role of Autonomous Motivation on the Relationship between Subjective Well-Being and Physical Health.

    PubMed

    Marcinko, Ivana

    2015-01-01

    The purpose of this study was to investigate the moderator effects of autonomous motivation on the relationship between subjective well-being and physical health. Using a cluster sampling approach 486 students (403 female and 83 male students) were included in this study. Subjective well-being, physical health and autonomous motivation were determined by self-report measures. Data were analysed using hierarchical regression analysis and analysis of variance. The results show that high self-determination moderates the relationship between high subjective well-being and physical health. Accordingly, the best physical health was reported by participants who had high level of subjective well-being and whose behaviours were self-determined. Additional analyses have shown that the moderating effect of self-determination is based on the moderational impact of autonomous motives and not the controlling ones. Additionally, whether autonomous motivation moderates the relationship between components of subjective well-being and physical health was also tested. The findings have shown that autonomous motives moderate relationship between physical health and one component of well-being, positive affect. Consequently, a good physical health was found among participants with high positive affect and behaviours regulated by high degree of autonomous motives. Conclusion which can be drawn from these findings is that if an individual behaves autonomously then it can contribute to positive mind-body influences and support their own health.

  1. Oxidative stress in hepatitis C infected end-stage renal disease subjects

    PubMed Central

    Horoz, Mehmet; Bolukbas, Cengiz; Bolukbas, Filiz F; Aslan, Mehmet; Koylu, Ahmet O; Selek, Sahbettin; Erel, Ozcan

    2006-01-01

    Background Both uremia and hepatitis C infection is associated with increased oxidative stress. In the present study, we aimed to find out whether hepatitis C infection has any impact on oxidative stress in hemodialysis subjects. Methods Sixteen hepatitis C (+) hemodialysis subjects, 24 hepatitis C negative hemodialysis subjects and 24 healthy subjects were included. Total antioxidant capacity, total peroxide level and oxidative stress index were determined in all subjects. Results Total antioxidant capacity was significantly higher in controls than hemodialysis subjects with or without hepatitis C infection (all p < 0.05/3), while total peroxide level and oxidative stress index were significantly lower (all p < 0.05/3). Hepatitis C (-) hemodialysis subjects had higher total antioxidant capacity compared to hepatitis C (+) hemodialysis subjects (all p < 0.05/3). Total peroxide level and oxidative stress index was comparable between hemodialysis subjects with or without hepatitis C infection (p > 0.05/3). Conclusion Oxidative stress is increased in both hepatitis C (+) and hepatitis C (-) hemodialysis subjects. However, hepatitis C infection seems to not cause any additional increase in oxidative stress in hemodialysis subjects and it may be partly due to protective effect of dialysis treatment on hepatitis C infection. PMID:16842626

  2. Oxidative stress in hepatitis C infected end-stage renal disease subjects.

    PubMed

    Horoz, Mehmet; Bolukbas, Cengiz; Bolukbas, Filiz F; Aslan, Mehmet; Koylu, Ahmet O; Selek, Sahbettin; Erel, Ozcan

    2006-07-14

    Both uremia and hepatitis C infection is associated with increased oxidative stress. In the present study, we aimed to find out whether hepatitis C infection has any impact on oxidative stress in hemodialysis subjects. Sixteen hepatitis C (+) hemodialysis subjects, 24 hepatitis C negative hemodialysis subjects and 24 healthy subjects were included. Total antioxidant capacity, total peroxide level and oxidative stress index were determined in all subjects. Total antioxidant capacity was significantly higher in controls than hemodialysis subjects with or without hepatitis C infection (all p < 0.05/3), while total peroxide level and oxidative stress index were significantly lower (all p < 0.05/3). Hepatitis C (-) hemodialysis subjects had higher total antioxidant capacity compared to hepatitis C (+) hemodialysis subjects (all p < 0.05/3). Total peroxide level and oxidative stress index was comparable between hemodialysis subjects with or without hepatitis C infection (p > 0.05/3). Oxidative stress is increased in both hepatitis C (+) and hepatitis C (-) hemodialysis subjects. However, hepatitis C infection seems to not cause any additional increase in oxidative stress in hemodialysis subjects and it may be partly due to protective effect of dialysis treatment on hepatitis C infection.

  3. Method and System for Producing Full Motion Media to Display on a Spherical Surface

    NASA Technical Reports Server (NTRS)

    Starobin, Michael A. (Inventor)

    2015-01-01

    A method and system for producing full motion media for display on a spherical surface is described. The method may include selecting a subject of full motion media for display on a spherical surface. The method may then include capturing the selected subject as full motion media (e.g., full motion video) in a rectilinear domain. The method may then include processing the full motion media in the rectilinear domain for display on a spherical surface, such as by orienting the full motion media, adding rotation to the full motion media, processing edges of the full motion media, and/or distorting the full motion media in the rectilinear domain for instance. After processing the full motion media, the method may additionally include providing the processed full motion media to a spherical projection system, such as a Science on a Sphere system.

  4. Study of the anesthetic efficacy of inferior alveolar nerve block using articaine in irreversible pulpitis.

    PubMed

    Ahmad, Zeeshan H; Ravikumar, H; Karale, Rupali; Preethanath, R S; Sukumaran, Anil

    2014-01-01

    The purpose of this study was to determine the anesthetic efficacy of inferior alveolar nerve block (IANB) using 4% articaine and 2% lidocaine supplemented with buccal infiltration. Forty five patients, diagnosed with irreversible pulpitis of a mandibular posterior tooth were included in the study. The first group of 15 patients received 2% lidocaine with 1:200000 epinephrine, the second group 2% lidocaine with 1: 80,000 epinephrine and the third group of 15 subjects received 4% articaine with 1:100000 epinephrine. During the access cavity preparation those patients who complained of pain received an additional buccal infiltration. The percentage of subjects who got profound anesthesia and failure to achieve anesthesia were calculated and tabulated using a visual analog scale. The results revealed that 87% of subjects who received 4% Articaine with 1:100,000 epinephrine got satisfactory anesthesia with inferior alveolar nerve block alone. Only 2 (13%) subjects received an additional buccal infiltration and none of the patients failed to obtain complete anesthesia with articaine. In comparison only 40% of subjects got complete anesthesia with 2% lidocaine with 1:200000 and 60% with 2% lidocaine with 1:80,000. It can be concluded that 4% articaine can be used effectively for obtaining profound anesthesia for endodontic procedures in patients with irreversible pulpitis.

  5. Changes in physical activity and all-cause mortality in COPD.

    PubMed

    Vaes, Anouk W; Garcia-Aymerich, Judith; Marott, Jacob L; Benet, Marta; Groenen, Miriam T J; Schnohr, Peter; Franssen, Frits M E; Vestbo, Jørgen; Wouters, Emiel F M; Lange, Peter; Spruit, Martijn A

    2014-11-01

    Little is known about changes in physical activity in subjects with chronic obstructive pulmonary disease (COPD) and its impact on mortality. Therefore, we aimed to study changes in physical activity in subjects with and without COPD and the impact of physical activity on mortality risk. Subjects from the Copenhagen City Heart Study with at least two consecutive examinations were selected. Each examination included a self-administered questionnaire and clinical examination. 1270 COPD subjects and 8734 subjects without COPD (forced expiratory volume in 1 s 67±18 and 91±15% predicted, respectively) were included. COPD subjects with moderate or high baseline physical activity who reported low physical activity level at follow-up had the highest hazard ratios of mortality (1.73 and 2.35, respectively; both p<0.001). In COPD subjects with low baseline physical activity, no differences were found in survival between unchanged or increased physical activity at follow-up. In addition, subjects without COPD with low physical activity at follow-up had the highest hazard ratio of mortality, irrespective of baseline physical activity level (p≤0.05). A decline to low physical activity at follow-up was associated with an increased mortality risk in subjects with and without COPD. These observational data suggest that it is important to assess and encourage physical activity in the earliest stages of COPD in order to maintain a physical activity level that is as high as possible, as this is associated with better prognosis. ©ERS 2014.

  6. A Meta-Analysis of Single-Subject Research on Behavioral Momentum to Enhance Success in Students with Autism.

    PubMed

    Cowan, Richard J; Abel, Leah; Candel, Lindsay

    2017-05-01

    We conducted a meta-analysis of single-subject research studies investigating the effectiveness of antecedent strategies grounded in behavioral momentum for improving compliance and on-task performance for students with autism. First, we assessed the research rigor of those studies meeting our inclusionary criteria. Next, in order to apply a universal metric to help determine the effectiveness of this category of antecedent strategies investigated via single-subject research methods, we calculated effect sizes via omnibus improvement rate differences (IRDs). Outcomes provide additional support for behavioral momentum, especially interventions incorporating the high-probability command sequence. Implications for research and practice are discussed, including the consideration of how single-subject research is systematically reviewed to assess the rigor of studies and assist in determining overall intervention effectiveness .

  7. Florbetapir F 18 amyloid PET and 36-month cognitive decline: a prospective multicenter study.

    PubMed

    Doraiswamy, P M; Sperling, R A; Johnson, K; Reiman, E M; Wong, T Z; Sabbagh, M N; Sadowsky, C H; Fleisher, A S; Carpenter, A; Joshi, A D; Lu, M; Grundman, M; Mintun, M A; Skovronsky, D M; Pontecorvo, M J

    2014-09-01

    This study was designed to evaluate whether subjects with amyloid beta (Aβ) pathology, detected using florbetapir positron emission tomorgraphy (PET), demonstrated greater cognitive decline than subjects without Aβ pathology. Sixty-nine cognitively normal (CN) controls, 52 with recently diagnosed mild cognitive impairment (MCI) and 31 with probable Alzheimer's disease (AD) dementia were included in the study. PET images obtained in these subjects were visually rated as positive (Aβ+) or negative (Aβ-), blind to diagnosis. Fourteen percent (10/69) of CN, 37% (19/52) of MCI and 68% (21/31) of AD were Aβ+. The primary outcome was change in ADAS-Cog score in MCI subjects after 36 months; however, additional outcomes included change on measures of cognition, function and diagnostic status. Aβ+ MCI subjects demonstrated greater worsening compared with Aβ- subjects on the ADAS-Cog over 36 months (5.66 ± 1.47 vs -0.71 ± 1.09, P = 0.0014) as well as on the mini-mental state exam (MMSE), digit symbol substitution (DSS) test, and a verbal fluency test (P < 0.05). Similar to MCI subjects, Aβ+ CN subjects showed greater decline on the ADAS-Cog, digit-symbol-substitution test and verbal fluency (P<0.05), whereas Aβ+ AD patients showed greater declines in verbal fluency and the MMSE (P < 0.05). Aβ+ subjects in all diagnostic groups also showed greater decline on the CDR-SB (P<0.04), a global clinical assessment. Aβ+ subjects did not show significantly greater declines on the ADCS-ADL or Wechsler Memory Scale. Overall, these findings suggest that in CN, MCI and AD subjects, florbetapir PET Aβ+ subjects show greater cognitive and global deterioration over a 3-year follow-up than Aβ- subjects do.

  8. 78 FR 14288 - Privacy Act of 1974; System of Records

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-03-05

    ... Information Processing System (DCIPS) (May 3, 2011, 76 FR 24865). Additional records related to this subject....regulations.gov as they are received without change, including any personal identifiers or contact information. FOR FURTHER INFORMATION CONTACT: Mr. Charles J. Shedrick, Department of the Air Force Privacy Office...

  9. INSTRUCTIONAL TELEVISION FOR THE FOURTH GRADE. A TEACHER GUIDE SEMESTER II.

    ERIC Educational Resources Information Center

    PELIKAN, ALFRED; AND OTHERS

    PROGRAMS FOR FOURTH GRADE ARE DIVIDED INTO FOUR AREAS--ART, MUSIC PHYSICAL EDUCATION AND SCIENCE. ART LESSONS INCLUDE THE PAPER CONSTRUCTION OF ROCKETS AND SPACESHIPS, FINGER PUPPETS, SANDPAPER PRINTS AND GLASS ADDITIVE PRINTS. EACH LESSON IS PRESENTED COMPLETE WITH PURPOSES, PROCESS AND MEDIUM, SUBJECT, MATERIALS, PROPOSED SEQUENCE, AND…

  10. Additional Evidence for the Accuracy of Biographical Data: Long-Term Retest and Observer Ratings.

    ERIC Educational Resources Information Center

    Shaffer, Garnett Stokes; And Others

    1986-01-01

    Investigated accuracy of responses to biodata questionnaire using a test-retest design and informed external observers for verification. Responses from 237 subjects and 200 observers provided evidence that many responses to biodata questionnaire were accurate. Assessed sources of inaccuracy, including social desirability effects, and noted…

  11. Resources for Creative Preschool Teaching.

    ERIC Educational Resources Information Center

    Flemming, Bonnie, Ed.; And Others

    A resource book intended as a teaching aid for preschool teachers, this compilation includes those ideas that have been used with success with children three through five years of age. The curriculum material is presented in outline format under the following headings: Subject of Interest; Basic Understandings; Additional Facts the Teacher Should…

  12. Processing of Text.

    ERIC Educational Resources Information Center

    Arkansas State Dept. of Education, Little Rock.

    This curriculum guide for schools in Arkansas provides course outlines in the general subject area of text processing. Each course outline indicates grade level and prerequisites, and provides a brief description of course goals. In addition, a list of skills is included for each course, with each skill divided into three instructional levels:…

  13. 21 CFR 74.102 - FD&C Blue No. 2.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... subjected to purification procedures. The indigo (or indigo paste) used above is manufactured by the fusion... purification procedures prior to sulfonation. (2) Color additive mixtures for food use (including dietary... (calculated as sodium salts), not more than 15 percent. Water insoluble matter, not more than 0.4 percent...

  14. 21 CFR 74.102 - FD&C Blue No. 2.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... subjected to purification procedures. The indigo (or indigo paste) used above is manufactured by the fusion... purification procedures prior to sulfonation. (2) Color additive mixtures for food use (including dietary... (calculated as sodium salts), not more than 15 percent. Water insoluble matter, not more than 0.4 percent...

  15. 21 CFR 74.102 - FD&C Blue No. 2.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... subjected to purification procedures. The indigo (or indigo paste) used above is manufactured by the fusion... purification procedures prior to sulfonation. (2) Color additive mixtures for food use (including dietary... (calculated as sodium salts), not more than 15 percent. Water insoluble matter, not more than 0.4 percent...

  16. 21 CFR 74.102 - FD&C Blue No. 2.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... subjected to purification procedures. The indigo (or indigo paste) used above is manufactured by the fusion... purification procedures prior to sulfonation. (2) Color additive mixtures for food use (including dietary... (calculated as sodium salts), not more than 15 percent. Water insoluble matter, not more than 0.4 percent...

  17. 21 CFR 74.102 - FD&C Blue No. 2.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... subjected to purification procedures. The indigo (or indigo paste) used above is manufactured by the fusion... purification procedures prior to sulfonation. (2) Color additive mixtures for food use (including dietary... (calculated as sodium salts), not more than 15 percent. Water insoluble matter, not more than 0.4 percent...

  18. 15 CFR 746.7 - Iran.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... certain reexport transactions involving Iran, including transactions dealing with items subject to the EAR... addition, BIS maintains licensing requirements on exports and reexports to Iran under the EAR as described in paragraph (a)(1) of this section or elsewhere in the EAR (See, e.g., § 742.8—Anti-terrorism: Iran...

  19. Survey of State Library Agencies, 1977.

    ERIC Educational Resources Information Center

    Wilkins, Barratt

    This report is a collection of statistical tables whose data were derived from a survey of state library agencies about activities during fiscal year 1977. Subject matter of the tables includes (1) location of state library agencies within state government departments; (2) services administered; library material collections, and additions to these…

  20. Enhanced Video-Oculography System

    NASA Technical Reports Server (NTRS)

    Moore, Steven T.; MacDougall, Hamish G.

    2009-01-01

    A previously developed video-oculography system has been enhanced for use in measuring vestibulo-ocular reflexes of a human subject in a centrifuge, motor vehicle, or other setting. The system as previously developed included a lightweight digital video camera mounted on goggles. The left eye was illuminated by an infrared light-emitting diode via a dichroic mirror, and the camera captured images of the left eye in infrared light. To extract eye-movement data, the digitized video images were processed by software running in a laptop computer. Eye movements were calibrated by having the subject view a target pattern, fixed with respect to the subject s head, generated by a goggle-mounted laser with a diffraction grating. The system as enhanced includes a second camera for imaging the scene from the subject s perspective, and two inertial measurement units (IMUs) for measuring linear accelerations and rates of rotation for computing head movements. One IMU is mounted on the goggles, the other on the centrifuge or vehicle frame. All eye-movement and head-motion data are time-stamped. In addition, the subject s point of regard is superimposed on each scene image to enable analysis of patterns of gaze in real time.

  1. Subjective field study of response to impulsive helicopter noise

    NASA Technical Reports Server (NTRS)

    Powell, C. A.

    1981-01-01

    Subjects, located outdoors and indoors, judged the noisiness and other subjective noise characteristics of flyovers of two helicopters and a propeller driven airplane as part of a study of the effects of impulsiveness on the subjective response to helicopter noise. In the first experiment, the impulsive characteristics of one helicopter was controlled by varying the main rotor speed while maintaining a constant airspeed in level flight. The second experiment which utilized only the helicopters, included descent and level flight operations. The more impulsive helicopter was consistently judged less noisy than the less impulsive helicopter at equal effective perceived noise levels (EPNL). The ability of EPNL to predict noisiness was not improved by the addition of either of two proposed impulse corrections. A subjective measure of impulsiveness, however, which was not significantly related to the proposed impulse corrections, was found to improve the predictive ability of EPNL.

  2. Genetic variants associated with subjective well-being, depressive symptoms and neuroticism identified through genome-wide analyses

    PubMed Central

    Derringer, Jaime; Gratten, Jacob; Lee, James J; Liu, Jimmy Z; de Vlaming, Ronald; Ahluwalia, Tarunveer S; Buchwald, Jadwiga; Cavadino, Alana; Frazier-Wood, Alexis C; Davies, Gail; Furlotte, Nicholas A; Garfield, Victoria; Geisel, Marie Henrike; Gonzalez, Juan R; Haitjema, Saskia; Karlsson, Robert; van der Laan, Sander W; Ladwig, Karl-Heinz; Lahti, Jari; van der Lee, Sven J; Miller, Michael B; Lind, Penelope A; Liu, Tian; Matteson, Lindsay; Mihailov, Evelin; Minica, Camelia C; Nolte, Ilja M; Mook-Kanamori, Dennis O; van der Most, Peter J; Oldmeadow, Christopher; Qian, Yong; Raitakari, Olli; Rawal, Rajesh; Realo, Anu; Rueedi, Rico; Schmidt, Börge; Smith, Albert V; Stergiakouli, Evie; Tanaka, Toshiko; Taylor, Kent; Thorleifsson, Gudmar; Wedenoja, Juho; Wellmann, Juergen; Westra, Harm-Jan; Willems, Sara M; Zhao, Wei; Amin, Najaf; Bakshi, Andrew; Bergmann, Sven; Bjornsdottir, Gyda; Boyle, Patricia A; Cherney, Samantha; Cox, Simon R; Davis, Oliver S P; Ding, Jun; Direk, Nese; Eibich, Peter; Emeny, Rebecca T; Fatemifar, Ghazaleh; Faul, Jessica D; Ferrucci, Luigi; Forstner, Andreas J; Gieger, Christian; Gupta, Richa; Harris, Tamara B; Harris, Juliette M; Holliday, Elizabeth G; Hottenga, Jouke-Jan; De Jager, Philip L; Kaakinen, Marika A; Kajantie, Eero; Karhunen, Ville; Kolcic, Ivana; Kumari, Meena; Launer, Lenore J; Franke, Lude; Li-Gao, Ruifang; Liewald, David C; Koini, Marisa; Loukola, Anu; Marques-Vidal, Pedro; Montgomery, Grant W; Mosing, Miriam A; Paternoster, Lavinia; Pattie, Alison; Petrovic, Katja E; Pulkki-Råback, Laura; Quaye, Lydia; Räikkönen, Katri; Rudan, Igor; Scott, Rodney J; Smith, Jennifer A; Sutin, Angelina R; Trzaskowski, Maciej; Vinkhuyzen, Anna E; Yu, Lei; Zabaneh, Delilah; Attia, John R; Bennett, David A; Berger, Klaus; Bertram, Lars; Boomsma, Dorret I; Snieder, Harold; Chang, Shun-Chiao; Cucca, Francesco; Deary, Ian J; van Duijn, Cornelia M; Eriksson, Johan G; Bültmann, Ute; de Geus, Eco J C; Groenen, Patrick J F; Gudnason, Vilmundur; Hansen, Torben; Hartman, Catharine A; Haworth, Claire M A; Hayward, Caroline; Heath, Andrew C; Hinds, David A; Hyppönen, Elina; Iacono, William G; Järvelin, Marjo-Riitta; Jöckel, Karl-Heinz; Kaprio, Jaakko; Kardia, Sharon L R; Keltikangas-Järvinen, Liisa; Kraft, Peter; Kubzansky, Laura D; Lehtimäki, Terho; Magnusson, Patrik K E; Martin, Nicholas G; McGue, Matt; Metspalu, Andres; Mills, Melinda; de Mutsert, Renée; Oldehinkel, Albertine J; Pasterkamp, Gerard; Pedersen, Nancy L; Plomin, Robert; Polasek, Ozren; Power, Christine; Rich, Stephen S; Rosendaal, Frits R; den Ruijter, Hester M; Schlessinger, David; Schmidt, Helena; Svento, Rauli; Schmidt, Reinhold; Alizadeh, Behrooz Z; Sørensen, Thorkild I A; Spector, Tim D; Starr, John M; Stefansson, Kari; Steptoe, Andrew; Terracciano, Antonio; Thorsteinsdottir, Unnur; Thurik, A Roy; Timpson, Nicholas J; Tiemeier, Henning; Uitterlinden, André G; Vollenweider, Peter; Wagner, Gert G; Weir, David R; Yang, Jian; Conley, Dalton C; Smith, George Davey; Hofman, Albert; Johannesson, Magnus; Laibson, David I; Medland, Sarah E; Meyer, Michelle N; Pickrell, Joseph K; Esko, Tõnu; Krueger, Robert F; Beauchamp, Jonathan P; Koellinger, Philipp D; Benjamin, Daniel J; Bartels, Meike; Cesarini, David

    2016-01-01

    We conducted genome-wide association studies of three phenotypes: subjective well-being (N = 298,420), depressive symptoms (N = 161,460), and neuroticism (N = 170,910). We identified three variants associated with subjective well-being, two with depressive symptoms, and eleven with neuroticism, including two inversion polymorphisms. The two depressive symptoms loci replicate in an independent depression sample. Joint analyses that exploit the high genetic correlations between the phenotypes (|ρ^| ≈ 0.8) strengthen the overall credibility of the findings, and allow us to identify additional variants. Across our phenotypes, loci regulating expression in central nervous system and adrenal/pancreas tissues are strongly enriched for association. PMID:27089181

  3. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOEpatents

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  4. Susceptibility to Mortality in Weather Extremes: Effect Modification by Personal and Small Area Characteristics In a Multi-City Case-Only Analysis

    PubMed Central

    Zanobetti, Antonella; O’Neill, Marie S.; Gronlund, Carina J.; Schwartz, Joel D

    2015-01-01

    Background Extremes of temperature have been associated with short-term increases in daily mortality. We identified subpopulations with increased susceptibility to dying during temperature extremes, based on personal demographics, small-area characteristics and preexisting medical conditions. Methods We examined Medicare participants in 135 U.S. cities and identified preexisting conditions based on hospitalization records prior to their deaths, from 1985–2006. Personal characteristics were obtained from the Medicare records, and area characteristics were assigned based on zip-code of residence. We conducted a case-only analysis of over 11 million deaths, and evaluated modification of the risk of dying associated with extremely hot days and extremely cold days, continuous temperatures, and water-vapor pressure. Modifiers included preexisting conditions, personal characteristics, zip-code-level population characteristics, and land-cover characteristics. For each effect modifier, a city-specific logistic regression model was fitted and then an overall national estimate was calculated using meta-analysis. Results People with certain preexisting conditions were more susceptible to extreme heat, with an additional 6% (95% confidence interval= 4% – 8%) increase in the risk of dying on an extremely hot day in subjects with previous admission for atrial fibrillation, an additional 8% (4%–12%) in subjects with Alzheimer disease, and an additional 6% (3%–9%) in subjects with dementia. Zip-code level and personal characteristics were also associated with increased susceptibility to temperature. Conclusions We identified several subgroups of the population who are particularly susceptible to temperature extremes, including persons with atrial fibrillation. PMID:24045717

  5. A Comparison of the Foot and Ankle Condition between Elite Athletes and Non-athletes.

    PubMed

    Kim, Hyeyoung; Chung, Eunjung; Lee, Byoung-Hee

    2013-10-01

    [Purpose] The purpose of this study was to compare the foot and ankle condition between elite athletes and non-athletes. [Subjects] The elite athletes group included 85 subjects (28 males and 57 females) and the non-athletes group included 85 subjects (38 males and 47 females). [Methods] All subjects were evaluated for pain (visual analogue scale, VAS) and foot and ankle condition (The Foot and Ankle Disability Index, FADI, and The Foot and Ankle Outcome Score, FAOS). [Results] The elite athlete group showed significant differences from the non-athletes group in VAS, FADI (FADI, FADI-Sports), and FAOS (FAOS-symptoms, FAOS-pain, FAOS-ADL, FAOS-sports, FAOS-QoL). In addition, a meaningful difference in VAS, FADI-Sports, and FAOS-symptoms was observed between gymnasts and wrestlers. [Conclusion] The results of this study suggest the necessity prevention of injury to the foot and ankle of elite athletes, and for the development of exercise for the rehabilitation of foot and ankle injuries, because there is a difference in foot and ankle condition between elite athletes and non-athletes.

  6. A Comparison of the Foot and Ankle Condition between Elite Athletes and Non-athletes

    PubMed Central

    Kim, Hyeyoung; Chung, EunJung; Lee, Byoung-Hee

    2013-01-01

    [Purpose] The purpose of this study was to compare the foot and ankle condition between elite athletes and non-athletes. [Subjects] The elite athletes group included 85 subjects (28 males and 57 females) and the non-athletes group included 85 subjects (38 males and 47 females). [Methods] All subjects were evaluated for pain (visual analogue scale, VAS) and foot and ankle condition (The Foot and Ankle Disability Index, FADI, and The Foot and Ankle Outcome Score, FAOS). [Results] The elite athlete group showed significant differences from the non-athletes group in VAS, FADI (FADI, FADI-Sports), and FAOS (FAOS-symptoms, FAOS-pain, FAOS-ADL, FAOS-sports, FAOS-QoL). In addition, a meaningful difference in VAS, FADI-Sports, and FAOS-symptoms was observed between gymnasts and wrestlers. [Conclusion] The results of this study suggest the necessity prevention of injury to the foot and ankle of elite athletes, and for the development of exercise for the rehabilitation of foot and ankle injuries, because there is a difference in foot and ankle condition between elite athletes and non-athletes. PMID:24259773

  7. Visual consciousness and bodily self-consciousness.

    PubMed

    Faivre, Nathan; Salomon, Roy; Blanke, Olaf

    2015-02-01

    In recent years, consciousness has become a central topic in cognitive neuroscience. This review focuses on the relation between bodily self-consciousness - the feeling of being a subject in a body - and visual consciousness - the subjective experience associated with the perception of visual signals. Findings from clinical and experimental work have shown that bodily self-consciousness depends on specific brain networks and is related to the integration of signals from multiple sensory modalities including vision. In addition, recent experiments have shown that visual consciousness is shaped by the body, including vestibular, tactile, proprioceptive, and motor signals. Several lines of evidence suggest reciprocal relationships between vision and bodily signals, indicating that a comprehensive understanding of visual and bodily self-consciousness requires studying them in unison.

  8. Implementation of small group discussion as a teaching method in earth and space science subject

    NASA Astrophysics Data System (ADS)

    Aryani, N. P.; Supriyadi

    2018-03-01

    In Physics Department Universitas Negeri Semarang, Earth and Space Science subject is included in the curriculum of the third year of physics education students. There are various models of teaching earth and space science subject such as textbook method, lecturer, demonstrations, study tours, problem-solving method, etc. Lectures method is the most commonly used of teaching earth and space science subject. The disadvantage of this method is the lack of two ways interaction between lecturers and students. This research used small group discussion as a teaching method in Earth and Space science. The purpose of this study is to identify the conditions under which an efficient discussion may be initiated and maintained while students are investigating properties of earth and space science subjects. The results of this research show that there is an increase in student’s understanding of earth and space science subject proven through the evaluation results. In addition, during the learning process, student’s activeness also increase.

  9. Prosocial Behavior and Subjective Insecurity in Violent Contexts: Field Experiments

    PubMed Central

    Vélez, María Alejandra; Trujillo, Carlos Andres; Moros, Lina; Forero, Clemente

    2016-01-01

    Subjective insecurity is a key determinant of different forms of prosocial behavior. In Study 1, we used field experiments with farmers in Colombian villages exposed to different levels of violence to investigate how individual perceptions of insecurity affect cooperation, trust, reciprocity and altruism. To do so, we developed a cognitive-affective measure of subjective insecurity. We found that subjective insecurity has a negative effect on cooperation but influences trust and altruism positively. In Study 2, carried out three years after Study 1, we repeated the initial design with additional measures of victimization. Our goal was to relate subjective insecurity with actual victimization. The findings of Study 2 support the initial results, and are robust and consistent for cooperative behavior and trust when including victimization as a mediator. Different indicators of victimization are positively correlated with subjective insecurity and an aggregate index of victimization has a negative effect on cooperation but exerts a positive influence on trust. PMID:27472437

  10. Delay to Reconstruction of the Adolescent Anterior Cruciate Ligament: The Socioeconomic Impact on Treatment.

    PubMed

    Newman, Justin T; Carry, Patrick M; Terhune, Elizabeth B; Spruiell, Murray; Heare, Austin; Mayo, Meredith; Vidal, Armando F

    2014-08-01

    A delay in pediatric and adolescent anterior cruciate ligament (ACL) reconstruction is associated with an increase in the number of concomitant meniscal and chondral injuries. Factors that contribute to this delay have not been well described. Socioeconomic and demographic factors are related to ACL surgery timing. Cohort study; Level of evidence, 3. All subjects who underwent primary ACL reconstruction at a single tertiary pediatric hospital between 2005 and 2012 were retrospectively reviewed. Variables included concomitant knee injuries (cartilage or meniscus injuries requiring additional operative treatment) and chronologic, demographic, and socioeconomic factors. Multivariable Cox proportional-hazards analyses were used to identify factors related to ACL surgery timing. The mean age of the 272 subjects was 15.2 ± 2.12 years. Time to surgery was significantly different among subjects who required multiple additional surgical procedures at time of ACL reconstruction (median, 3.3 months) compared with subjects with 1 (median, 2.0 months) or no additional injuries (median, 1.6 months). Subjects underwent ACL reconstruction significantly sooner if they were older at the time of injury (hazard ratio [HR], 1.2 per 1 year; 95% CI, 1.1-1.2; P < .0001) or were covered by a commercial insurance plan (HR, 2.0; 95% CI, 1.6-2.6; P < .0001). Median time to ACL surgery was 1.5 months (95% CI, 1.3-1.7) for subjects with commercial insurance plans compared with 3.0 months (95% CI, 2.3-3.3) for subjects with noncommercial insurance coverage. The risk of delayed ACL surgery was significantly higher among pediatric and adolescent subjects who were less affluent, who were covered by a noncommercial insurance plan, and who were younger. This study also confirms previous studies that have reported an association between a delay in ACL surgery and the presence of additional knee injuries requiring operative treatment, accentuating the importance of timely care. Access to care is a current area of research interest and health policy formation. Information in this arena drives 2 important aspects of health: most immediately, care provided to patients, and over a broader scope, the policy that directs health care. The orthopaedic surgeon should be aware of the association between socioeconomic and demographic factors and ACL surgery timing to optimize outcomes.

  11. Health consequences of involuntary exposure to benzene following a flaring incident at British Petroleum refinery in Texas City.

    PubMed

    D'Andrea, Mark A; Singh, Omesh; Reddy, G Kesava

    2013-01-01

    Environmental exposure to benzene can lead to deleterious effects on many biological systems including blood-forming organs, liver, and kidneys. The authors sought to investigate the health consequences of benzene exposure following a flaring incident that occurred at the British Petroleum (BP) refinery in Texas City, TX. A cohort of subjects who were exposed to a daily sustained release of toxic chemicals including more than 7,711 kg (17,000 lb) of benzene for a total duration of 40 days due to BP's flaring incident. Not applicable to an observational study. Subjects who underwent physical and clinical evaluation between June 2010 and October 2012 were included. Demographic and clinical laboratory data were collected and analyzed. Hematologic data such as white blood cell (WBC) counts, platelet counts, hemoglobin, hematocrit, blood urea nitrogen (BUN), and creatinine levels in the serum were evaluated. In addition, data on alkaline phosphatase (ALP), aspartate amino transferase (AST), and alanine amino transferase (ALT) levels in the serum were examined. Urinary phenol was evaluated as a benzene metabolite. The outcomes were compared between exposed and unexposed patients. A total of 200 subjects (benzene exposed, n = 100 and unexposed, n = 100) were included. Benzene exposed subjects showed significantly higher levels of WBC (×10(3) per μL) count (8.6 ± 5.4 vs 6.5 ± 2.0, p = 0.0003) and platelet (×10(3) per μL) count (291.3 ± 82.7 vs 264.1 ± 74.0, p = 0.0076) compared with the unexposed subjects. ALP (IU/L) was significantly elevated in the benzene exposed subjects compared with the unexposed subjects (121.2 ± 73.7 vs 65.4 ± 23.6, p = 0.000). Similarly, benzene exposed subjects had significantly higher levels of AST (IU/L) compared with unexposed subjects (23.4 ± 11.8 vs 19.5 ± 8.9, p = 0.0089). This retrospective pilot study found that environmental benzene exposure from the BP's flaring incident appears to pose significant health risks including specific alteration of blood cells and liver enzymes, indicating that subjects exposed to benzene may be at a higher risk of developing hepatic or blood related disorders.

  12. Annihilation in Gases and Galaxies

    NASA Technical Reports Server (NTRS)

    Drachman, Richard J. (Editor)

    1990-01-01

    This publication contains most of the papers, both invited and contributed, that were presented at the Workshop of Annihilation in Gases and Galaxies. This was the fifth in a biennial series associated with the International Conference on the Physics of Electronic and Atomic Collisions. Subjects covered included the scattering and annihilation of positrons and positronium atoms in various media, including those of astrophysical interest. In addition, the topics of antimatter and dark matter were covered.

  13. Environmental Assessment for Property Transfer to Cheyenne Regional Medical Center, F.E. Warren Air Force Base, Wyoming

    DTIC Science & Technology

    2013-05-20

    density residential and agricultural. Laramie County owns most of the land between the two segments of the subject property, with the exception of a home...receptors located nearest to the Proposed Action site include residential areas and Swan Ranch and Cheyenne Logistics Hub. Additional local...generate noise; sources would include periodic emergency vehicle use and helicopter flight operations. Nearby sensitive receptors (e.g., residential

  14. Description of a multifaceted intervention programme for fatigue after acquired brain injury: a pilot study.

    PubMed

    Stubberud, Jan; Edvardsen, Espen; Schanke, Anne-Kristine; Lerdal, Anners; Kjeverud, Anita; Schillinger, Andreas; Løvstad, Marianne

    2017-07-05

    The purpose of this pilot study was to describe and explore a group-based multifaceted intervention for patients with fatigue after acquired brain injury (ABI). We hypothesised that post-intervention changes would result in reduced fatigue, in addition to improved emotional health, sleep and attentional control. Eight subjects with traumatic brain injury (n = 3) and cerebrovascular insults (n = 5) were included. Inclusion was based upon the presence of fatigue complaints. The participants received 36 hours of intervention. Changes related to fatigue, emotional health and sleep was assessed with self-rating measures. Additionally, a neuropsychological test (Conners' Continuous Performance Test II) was included as a measure of attentional control. All subjects were assessed at baseline, post-intervention, and at 3 and 9 months follow-up. Findings indicated reduced fatigue levels (post-intervention and 3 months follow-up), anxiety (9 months follow-up), and daytime sleepiness (3 and 9 months follow-up). Pilot results suggest that multifaceted group-based interventions may have the potential to alleviate symptoms of fatigue, anxiety and sleepiness after ABI. At an individual level, a low load of psychological distress, insomnia symptoms, dysexecutive symptoms, in addition to a strong sense of self-efficacy, may be central in order to reduce levels of fatigue.

  15. Community, Family, and Subjective Socioeconomic Status: Relative Status and Adolescent Health

    PubMed Central

    Quon, Elizabeth C.; McGrath, Jennifer J.

    2017-01-01

    Objective Relative socioeconomic status (SES) may be an important social determinant of health. The current study aimed to examine how relative SES, as measured by subjective SES, income inequality, and individual SES relative to others in the community, is associated with a wide range of adolescent health outcomes, after controlling for objective family SES. Method Adolescents (13–16 years; N = 2,199) from the Quebec Child and Adolescent Health and Social Survey were included. Socioeconomic measures included adolescents’ subjective SES; parental education and household income; community education/employment, income, and poverty rate; and community income inequality. Health outcomes included self-rated health, mental health problems, dietary and exercise health behaviors, substance-related health behaviors, reported physical health, and biomarkers of health. Best-fitting multilevel regression models (participants nested within schools) were used to test associations. Results Findings indicated that lower subjective SES was associated with poorer health outcomes. After accounting for family SES, lower community education/employment had an additional negative effect on health, while lower community income had a protective effect for certain health outcomes. There was less evidence for an independent effect of income inequality. Conclusions Findings highlight the importance of measures of relative SES that span across a number of levels and contexts, and provide further understanding into the socioeconomic gradient in adolescence. PMID:25222085

  16. Community, family, and subjective socioeconomic status: Relative status and adolescent health.

    PubMed

    Quon, Elizabeth C; McGrath, Jennifer J

    2015-06-01

    Relative socioeconomic status (SES) may be an important social determinant of health. The current study aimed to examine how relative SES, as measured by subjective SES, income inequality, and individual SES relative to others in the community, is associated with a wide range of adolescent health outcomes, after controlling for objective family SES. Adolescents (13-16 years; N = 2,199) from the Quebec Child and Adolescent Health and Social Survey were included. Socioeconomic measures included adolescents' subjective SES; parental education and household income; community education/employment, income, and poverty rate; and community income inequality. Health outcomes included self-rated health, mental health problems, dietary and exercise health behaviors, substance-related health behaviors, reported physical health, and biomarkers of health. Best-fitting multilevel regression models (participants nested within schools) were used to test associations. Findings indicated that lower subjective SES was associated with poorer health outcomes. After accounting for family SES, lower community education/employment had an additional negative effect on health, while lower community income had a protective effect for certain health outcomes. There was less evidence for an independent effect of income inequality. Findings highlight the importance of measures of relative SES that span across a number of levels and contexts, and provide further understanding into the socioeconomic gradient in adolescence. (c) 2015 APA, all rights reserved).

  17. Influence of headache frequency on clinical signs and symptoms of TMD in subjects with temple headache and TMD pain

    PubMed Central

    Anderson, Gary C.; John, Mike T.; Ohrbach, Richard; Nixdorf, Donald R.; Schiffman, Eric L.; Truelove, Edmond S.; List, Thomas

    2011-01-01

    The relationship of the frequency of temple headache to signs and symptoms of temporomandibular disorders (TMD) was investigated in a subset of a larger convenience sample of community TMD cases. The study sample included: 86 painful TMD, non-headache subjects; 309 painful TMD subjects with varied frequency of temple headaches; and 149 subjects without painful TMD or headache for descriptive comparison. Painful TMD included Research Diagnostic Criteria (RDC) diagnoses of myofascial pain, TMJ arthralgia and TMJ osteoarthritis. Mild to moderate intensity temple headaches were classified by frequency using criteria based on the ICHD-II classification of TTH. Outcomes included TMD signs and symptoms (pain duration, pain intensity, number of painful masticatory sites on palpation, mandibular range of motion), PPTs and temple headache resulting from masticatory provocation tests. Trend analyses across the painful TMD groups showed a substantial trend for aggravation of all of the TMD signs and symptoms associated with increased frequency of the temple headaches. In addition, increased headache frequency showed significant trends associated with reduced PPTs and reported temple headache with masticatory provocation tests. In conclusion, these findings suggest that these headaches may be TMD-related, as well as a possible role for peripheral and central sensitization in TMD patients. PMID:21196079

  18. EVA Glove Sensor Feasbility II Abstract

    NASA Technical Reports Server (NTRS)

    Melone, Kate

    2014-01-01

    The main objectives for the glove project include taking various measurements from human subjects during and after they perform different tasks in the glove box, acquiring data from these tests and determining the accuracy of these results, interpreting and analyzing this data, and using the data to better understand how hand injuries are caused during EVAs.1 Some of these measurements include force readings, temperature readings, and micro-circulatory blood flow.1 The three glove conditions tested were ungloved (a comfort glove was worn to house the sensors), Series 4000, and Phase VI. The general approach/procedure for the glove sensor feasibility project is as follows: 1. Prepare test subject for testing. This includes attaching numerous sensors (approximately 50) to the test subject, wiring, and weaving the sensors and wires in the glove which helps to keep everything together. This also includes recording baseline moisture data using the Vapometer and MoistSense. 2. Pressurizing the glove box. Once the glove box is pressurized to the desired pressure (4.3 psid), testing can begin. 3. Testing. The test subject will perform a series of tests, some of which include pinching a load cell, making a fist, pushing down on a force plate, and picking up metal pegs, rotating them 90 degrees, and placing them back in the peg board. 4. Post glove box testing data collection. After the data is collected from inside the glove box, the Vapometer and MoistSense device will be used to collect moisture data from the subject's hand. 5. Survey. At the conclusion of testing, he/she will complete a survey that asks questions pertaining to comfort/discomfort levels of the glove, glove sizing, as well as offering any additional feedback.

  19. Japanese Legacy Cohorts: The Life Span Study Atomic Bomb Survivor Cohort and Survivors’ Offspring

    PubMed Central

    Grant, Eric J; Kodama, Kazunori

    2018-01-01

    Cohorts of atomic bomb survivors—including those exposed in utero—and children conceived after parental exposure were established to investigate late health effects of atomic bomb radiation and its transgenerational effects by the Atomic Bomb Casualty Commission (ABCC) in the 1950s. ABCC was reorganized to the Radiation Effects Research Foundation (RERF) in 1975, and all work has been continued at RERF. The Life Span Study, the cohort of survivors, consists of about 120,000 subjects and has been followed since 1950. Cohorts of in utero survivors and the survivors’ children include about 3,600 and 77,000 subjects, respectively, and have been followed since 1945. Atomic bomb radiation dose was estimated for each subject based on location at the time of the bombing and shielding conditions from exposure, which were obtained through enormous efforts of investigators and cooperation of subjects. Outcomes include vital status, cause of death, and cancer incidence. In addition, sub-cohorts of these three cohorts were constructed to examine clinical features of late health effects, and the subjects have been invited to periodic health examinations at clinics of ABCC and RERF. They were also asked to donate biosamples for biomedical investigations. Epidemiological studies have observed increased radiation risks for malignant diseases among survivors, including those exposed in utero, and possible risks for some non-cancer diseases. In children of survivors, no increased risks due to parental exposure to radiation have been observed for malignancies or other diseases, but investigations are continuing, as these cohorts are still relatively young. PMID:29553058

  20. Japanese Legacy Cohorts: The Life Span Study Atomic Bomb Survivor Cohort and Survivors' Offspring.

    PubMed

    Ozasa, Kotaro; Grant, Eric J; Kodama, Kazunori

    2018-04-05

    Cohorts of atomic bomb survivors-including those exposed in utero-and children conceived after parental exposure were established to investigate late health effects of atomic bomb radiation and its transgenerational effects by the Atomic Bomb Casualty Commission (ABCC) in the 1950s. ABCC was reorganized to the Radiation Effects Research Foundation (RERF) in 1975, and all work has been continued at RERF. The Life Span Study, the cohort of survivors, consists of about 120,000 subjects and has been followed since 1950. Cohorts of in utero survivors and the survivors' children include about 3,600 and 77,000 subjects, respectively, and have been followed since 1945. Atomic bomb radiation dose was estimated for each subject based on location at the time of the bombing and shielding conditions from exposure, which were obtained through enormous efforts of investigators and cooperation of subjects. Outcomes include vital status, cause of death, and cancer incidence. In addition, sub-cohorts of these three cohorts were constructed to examine clinical features of late health effects, and the subjects have been invited to periodic health examinations at clinics of ABCC and RERF. They were also asked to donate biosamples for biomedical investigations. Epidemiological studies have observed increased radiation risks for malignant diseases among survivors, including those exposed in utero, and possible risks for some non-cancer diseases. In children of survivors, no increased risks due to parental exposure to radiation have been observed for malignancies or other diseases, but investigations are continuing, as these cohorts are still relatively young.

  1. 303 CD-ROMs To Use in Your Library: Descriptions, Evaluations, and Practical Advice.

    ERIC Educational Resources Information Center

    Dewey, Patrick R.

    This book provides descriptions of approximately 270 CD-ROM packages and series, and references to dozens of others, all which are especially suitable for libraries. Organized by subject, entries include the vendor price (when available), platform and hardware requirements, and availability of network versions. In addition, evaluative comments…

  2. Factors Affecting the Retention of Girls in Science Courses & Careers: Case Studies of Selected Secondary Schools.

    ERIC Educational Resources Information Center

    Kahle, Jane Butler

    This report describes a 9-month, nationwide project which investigated the teaching strategies and teacher attitudes which successfully encouraged girls in science. Subjects included 205 females and 147 males from seven high schools. In addition to analyzing instructional techniques, classroom climates, and teacher-student interactions, a selected…

  3. Independent Curriculum Enrichment Studies: Learning Packages for the Gifted. Table of Contents; Teachers' Sheets.

    ERIC Educational Resources Information Center

    Lafayette School District, CA.

    The looseleaf binder contains a series of 268 learning packages for gifted and talented elementary school students, divided into 13 subject area sections, including art, chess, general, health, language arts, literature, mathematics, perception, reading, science, social studies, study skills, and thinking skills. Two additional sections include…

  4. Attitudes of Community Members Toward the Schools and Consumer and Homemaking Education.

    ERIC Educational Resources Information Center

    Love, Cathleen T.

    A study measured a community's attitudes towards its school district as well as its attitudes towards the subject matter included in consumer and homemaking education. In addition, the study assessed whether alienation was a possible cause for the attitudes toward the schools and consumer and homemaking education. Using a structured questionnaire…

  5. 26 CFR 54.9802-3T - Additional requirements prohibiting discrimination based on genetic information (temporary).

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... both parents). (A) First-degree relatives include parents, spouses, siblings, and children. (B) Second... children of first cousins. (3) Genetic information means— (i) Subject to paragraphs (a)(3)(ii) and (a)(3... expertise in the field of medicine involved. For purposes of this section, a disease, disorder, or...

  6. Fatigue crack growth behavior of railroad tank car steel TC-128B subjected to various environments. Volume 1

    DOT National Transportation Integrated Search

    2006-12-01

    As part of an effort to apply damage tolerance concepts to railroad tank cars, the fatigue crack growth (FCG) behavior of two lots of TC-128B steel was investigated. In addition to the material lot difference, variables assessed include: load ratio, ...

  7. 77 FR 64327 - Privacy Act of 1974; System of Records

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-10-19

    ... entity or individual referring the inquiry or complaint; (3) records created of verbal communications by... amendment to the Rule. Additionally, this notice includes a non-substantive change to the text of the... subject to the complaint or inquiry or its employees; (6) communication with or by the entity that is...

  8. 40 CFR 80.501 - What fuel is subject to the provisions of this subpart?

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... for use as fuel in diesel motor vehicles or nonroad diesel engines or is blended with diesel fuel for use in diesel motor vehicles or nonroad diesel engines, including locomotive and marine diesel engines... (CONTINUED) AIR PROGRAMS (CONTINUED) REGULATION OF FUELS AND FUEL ADDITIVES Motor Vehicle Diesel Fuel...

  9. 40 CFR 80.501 - What fuel is subject to the provisions of this subpart?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... for use as fuel in diesel motor vehicles or nonroad diesel engines or is blended with diesel fuel for use in diesel motor vehicles or nonroad diesel engines, including locomotive and marine diesel engines... (CONTINUED) AIR PROGRAMS (CONTINUED) REGULATION OF FUELS AND FUEL ADDITIVES Motor Vehicle Diesel Fuel...

  10. 40 CFR 80.501 - What fuel is subject to the provisions of this subpart?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... for use as fuel in diesel motor vehicles or nonroad diesel engines or is blended with diesel fuel for use in diesel motor vehicles or nonroad diesel engines, including locomotive and marine diesel engines... (CONTINUED) AIR PROGRAMS (CONTINUED) REGULATION OF FUELS AND FUEL ADDITIVES Motor Vehicle Diesel Fuel...

  11. 40 CFR 80.501 - What fuel is subject to the provisions of this subpart?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... for use as fuel in diesel motor vehicles or nonroad diesel engines or is blended with diesel fuel for use in diesel motor vehicles or nonroad diesel engines, including locomotive and marine diesel engines... (CONTINUED) AIR PROGRAMS (CONTINUED) REGULATION OF FUELS AND FUEL ADDITIVES Motor Vehicle Diesel Fuel...

  12. 40 CFR 80.501 - What fuel is subject to the provisions of this subpart?

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... for use as fuel in diesel motor vehicles or nonroad diesel engines or is blended with diesel fuel for use in diesel motor vehicles or nonroad diesel engines, including locomotive and marine diesel engines... (CONTINUED) AIR PROGRAMS (CONTINUED) REGULATION OF FUELS AND FUEL ADDITIVES Motor Vehicle Diesel Fuel...

  13. Animal Rights: Selected Resources and Suggestions for Further Study.

    ERIC Educational Resources Information Center

    Davidoff, Donald J.

    1989-01-01

    Presents an annotated list of selected resources intended to serve as a guide to the growing amount of material on animal rights. Suggestions to aid in additional research include subject headings used to find books, indexes used to locate periodical articles, sources for locating organizations, and a selected list of animal rights organizations.…

  14. Doped-carbon composites, synthesizing methods and applications of the same

    DOEpatents

    Viswanathan, Tito

    2017-05-09

    A method of synthesizing a doped carbon composite includes preparing a solution having a carbon source material and a heteroatom containing additive, evaporating the solution to yield a plurality of powders, and subjecting the plurality of powders to a heat treatment for a duration of time effective to produce the doped carbon composite.

  15. Australian Institute of Aboriginal Studies; Catalogue of Tape Archive No. 7.

    ERIC Educational Resources Information Center

    Australian Inst. of Aboriginal Studies, Canberra.

    Entries in this aboriginal studies catalogue are listed under language/tribe and subject indexes, and include linguistic studies, myths and stories, songs and dances, songs and music, and speech. Language/tribe headings are from the Institute's Preliminary Tribal Index. Summaries are brief, but in most cases, additional information is available…

  16. Exploring the Core: An Examination of Required Courses in ALA-Accredited

    ERIC Educational Resources Information Center

    Hall, Russell A.

    2009-01-01

    This paper examines the required courses of ALA-accredited Library and Information Science programs as published on their websites. The study expands on previous research in this area. Findings show that the typical core curriculum has grown to include both research and information technology in addition to the more traditional subjects. The…

  17. Determinants of Fast Food Consumption among Iranian High School Students Based on Planned Behavior Theory

    PubMed Central

    Sharifirad, Gholamreza; Yarmohammadi, Parastoo; Azadbakht, Leila; Morowatisharifabad, Mohammad Ali; Hassanzadeh, Akbar

    2013-01-01

    Objective. This study was conducted to identify some factors (beliefs and norms) which are related to fast food consumption among high school students in Isfahan, Iran. We used the framework of the theory planned behavior (TPB) to predict this behavior. Subjects & Methods. Cross-sectional data were available from high school students (n = 521) who were recruited by cluster randomized sampling. All of the students completed a questionnaire assessing variables of standard TPB model including attitude, subjective norms, perceived behavior control (PBC), and the additional variables past behavior, actual behavior control (ABC). Results. The TPB variables explained 25.7% of the variance in intentions with positive attitude as the strongest (β = 0.31, P < 0.001) and subjective norms as the weakest (β = 0.29, P < 0.001) determinant. Concurrently, intentions accounted for 6% of the variance for fast food consumption. Past behavior and ABC accounted for an additional amount of 20.4% of the variance in fast food consumption. Conclusion. Overall, the present study suggests that the TPB model is useful in predicting related beliefs and norms to the fast food consumption among adolescents. Subjective norms in TPB model and past behavior in TPB model with additional variables (past behavior and actual behavior control) were the most powerful predictors of fast food consumption. Therefore, TPB model may be a useful framework for planning intervention programs to reduce fast food consumption by students. PMID:23936635

  18. Macular pigment optical density spatial distribution measured in a subject with oculocutaneous albinism.

    PubMed

    Putnam, Christopher M; Bland, Pauline J

    2014-01-01

    Previous studies of macular pigment optical density (MPOD) distribution in individuals with oculocutaneous albinism (OCA) have primarily used objective measurement techniques including fundus reflectometry and autofluorescence. We report here on a subject with OCA and their corresponding MPOD distribution assessed through heterochromatic flicker photometry (HFP). A subject with a history of OCA presented with an ocular history including strabismus surgery of the LE with persistent amblyopia and mild, latent nystagmus. Best corrected visual acuity was 20/25- RE and 20/40- LE. Spectral domain optical coherence tomography (SD-OCT) and fundus photography were also obtained. Evaluation of MPOD spatial distribution up to 8 degrees eccentricity from the fovea was performed using HFP. SD-OCT indicated a persistence of multiple inner retinal layers within the foveal region in the RE and LE including symmetric foveal thickening consistent with foveal hypoplasia. Fundus photography showed mild retinal pigmented epithelial (RPE) hypopigmentation and a poorly demarcated macula. OriginPro 9 was used to plot MPOD spatial distribution of the subject and a 33-subject sample. The OCA subject demonstrated a foveal MPOD of 0.10 with undetectable levels at 6 degrees eccentricity. The study sample showed a mean foveal MPOD of 0.34 and mean 6 degree eccentricity values of 0.03. Consistent with previous macular pigment (MP) studies of OCA, overall MPOD is reduced in our subject. Mild phenotypic expression of OCA with high functional visual acuity may represent a Henle fiber layer amenable to additional MP deposition. Further study of MP supplementation in OCA patients is warranted. Copyright © 2014 Spanish General Council of Optometry. Published by Elsevier Espana. All rights reserved.

  19. Experimental investigation of the visual field dependency in the erect and supine positions

    NASA Technical Reports Server (NTRS)

    Lichtenstein, J. H.; Saucer, R. T.

    1972-01-01

    The increasing utilization of simulators in many fields, in addition to aeronautics and space, requires the efficient use of these devices. It seemed that personnel highly influenced by the visual scene would make desirable subjects, particularly for those simulators without sufficient motion cues. In order to evaluate this concept, some measure of the degree of influence of the visual field on the subject in necessary. As part of this undertaking, 37 male and female subjects, including eight test pilots, were tested for their visual field dependency or independency. A version of Witkin's rod and frame apparatus was used for the tests. The results showed that nearly all the test subjects exhibited some degree of field dependency, the degree varying from very high field dependency to nearly zero field dependency in a normal distribution. The results for the test pilots were scattered throughout a range similar to the results for the bulk of male subjects. The few female subjects exhibited a higher field dependency than the male subjects. The male subjects exhibited a greater field dependency in the supine position than in the erect position, whereas the field dependency of the female subjects changed only slightly.

  20. Electronic cigarettes: abuse liability, topography and subjective effects.

    PubMed

    Evans, Sarah E; Hoffman, Allison C

    2014-05-01

    To review the available evidence evaluating the abuse liability, topography, subjective effects, craving and withdrawal suppression associated with e-cigarette use in order to identify information gaps and provide recommendations for future research. Literature searches were conducted between October 2012 and January 2014 using five electronic databases. Studies were included in this review if they were peer-reviewed scientific journal articles evaluating clinical laboratory studies, national surveys or content analyses. A total of 15 peer-reviewed articles regarding behavioural use and effects of e-cigarettes published between 2010 and 2014 were included in this review. Abuse liability studies are limited in their generalisability. Topography (consumption behaviour) studies found that, compared with traditional cigarettes, e-cigarette average puff duration was significantly longer, and e-cigarette use required stronger suction. Data on e-cigarette subjective effects (such as anxiety, restlessness, concentration, alertness and satisfaction) and withdrawal suppression are limited and inconsistent. In general, study data should be interpreted with caution, given limitations associated with comparisons of novel and usual products, as well as the possible effects associated with subjects' previous experience/inexperience with e-cigarettes. Currently, very limited information is available on abuse liability, topography and subjective effects of e-cigarettes. Opportunities to examine extended e-cigarette use in a variety of settings with experienced e-cigarette users would help to more fully assess topography as well as behavioural and subjective outcomes. In addition, assessment of 'real-world' use, including amount and timing of use and responses to use, would clarify behavioural profiles and potential adverse health effects.

  1. ASTRO's 2007 core physics curriculum for radiation oncology residents.

    PubMed

    Klein, Eric E; Gerbi, Bruce J; Price, Robert A; Balter, James M; Paliwal, Bhudatt; Hughes, Lesley; Huang, Eugene

    2007-08-01

    In 2004, the American Society for Therapeutic Radiology and Oncology (ASTRO) published a curriculum for physics education. The document described a 54-hour course. In 2006, the committee reconvened to update the curriculum. The committee is composed of physicists and physicians from various residency program teaching institutions. Simultaneously, members have associations with the American Association of Physicists in Medicine, ASTRO, Association of Residents in Radiation Oncology, American Board of Radiology, and American College of Radiology. Representatives from the latter two organizations are key to provide feedback between the examining organizations and ASTRO. Subjects are based on Accreditation Council for Graduate Medical Education requirements (particles and hyperthermia), whereas the majority of subjects and appropriated hours/subject were developed by consensus. The new curriculum is 55 hours, containing new subjects, redistribution of subjects with updates, and reorganization of core topics. For each subject, learning objectives are provided, and for each lecture hour, a detailed outline of material to be covered is provided. Some changes include a decrease in basic radiologic physics, addition of informatics as a subject, increase in intensity-modulated radiotherapy, and migration of some brachytherapy hours to radiopharmaceuticals. The new curriculum was approved by the ASTRO board in late 2006. It is hoped that physicists will adopt the curriculum for structuring their didactic teaching program, and simultaneously, the American Board of Radiology, for its written examination. The American College of Radiology uses the ASTRO curriculum for their training examination topics. In addition to the curriculum, the committee added suggested references, a glossary, and a condensed version of lectures for a Postgraduate Year 2 resident physics orientation. To ensure continued commitment to a current and relevant curriculum, subject matter will be updated again in 2 years.

  2. ASTRO's 2007 Core Physics Curriculum for Radiation Oncology Residents

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Klein, Eric E.; Gerbi, Bruce J.; Price, Robert A.

    2007-08-01

    In 2004, American Society for Therapeutic Radiology and Oncology (ASTRO) published a curriculum for physics education. The document described a 54-hour course. In 2006, the committee reconvened to update the curriculum. The committee is composed of physicists and physicians from various residency program teaching institutions. Simultaneously, members have associations with American Association of Physicists in Medicine, ASTRO, Association of Residents in Radiation Oncology, American Board of Radiology, and American College of Radiology. Representatives from the latter two organizations are key to provide feedback between the examining organizations and ASTRO. Subjects are based on Accreditation Council for Graduate Medical Education requirementsmore » (particles and hyperthermia), whereas the majority of subjects and appropriated hours/subject were developed by consensus. The new curriculum is 55 hours, containing new subjects, redistribution of subjects with updates, and reorganization of core topics. For each subject, learning objectives are provided, and for each lecture hour, a detailed outline of material to be covered is provided. Some changes include a decrease in basic radiologic physics, addition of informatics as a subject, increase in intensity-modulated radiotherapy, and migration of some brachytherapy hours to radiopharmaceuticals. The new curriculum was approved by the ASTRO board in late 2006. It is hoped that physicists will adopt the curriculum for structuring their didactic teaching program, and simultaneously, American Board of Radiology, for its written examination. American College of Radiology uses the ASTRO curriculum for their training examination topics. In addition to the curriculum, the committee added suggested references, a glossary, and a condensed version of lectures for a Postgraduate Year 2 resident physics orientation. To ensure continued commitment to a current and relevant curriculum, subject matter will be updated again in 2 years.« less

  3. Acetaminophen-cysteine adducts during therapeutic dosing and following overdose

    PubMed Central

    2011-01-01

    Background Acetaminophen-cysteine adducts (APAP-CYS) are a specific biomarker of acetaminophen exposure. APAP-CYS concentrations have been described in the setting of acute overdose, and a concentration >1.1 nmol/ml has been suggested as a marker of hepatic injury from acetaminophen overdose in patients with an ALT >1000 IU/L. However, the concentrations of APAP-CYS during therapeutic dosing, in cases of acetaminophen toxicity from repeated dosing and in cases of hepatic injury from non-acetaminophen hepatotoxins have not been well characterized. The objective of this study is to describe APAP-CYS concentrations in these clinical settings as well as to further characterize the concentrations observed following acetaminophen overdose. Methods Samples were collected during three clinical trials in which subjects received 4 g/day of acetaminophen and during an observational study of acetaminophen overdose patients. Trial 1 consisted of non-drinkers who received APAP for 10 days, Trial 2 consisted of moderate drinkers dosed for 10 days and Trial 3 included subjects who chronically abuse alcohol dosed for 5 days. Patients in the observational study were categorized by type of acetaminophen exposure (single or repeated). Serum APAP-CYS was measured using high pressure liquid chromatography with electrochemical detection. Results Trial 1 included 144 samples from 24 subjects; Trial 2 included 182 samples from 91 subjects and Trial 3 included 200 samples from 40 subjects. In addition, we collected samples from 19 subjects with acute acetaminophen ingestion, 7 subjects with repeated acetaminophen exposure and 4 subjects who ingested another hepatotoxin. The mean (SD) peak APAP-CYS concentrations for the Trials were: Trial 1- 0.4 (0.20) nmol/ml, Trial 2- 0.1 (0.09) nmol/ml and Trial 3- 0.3 (0.12) nmol/ml. APAP-CYS concentrations varied substantially among the patients with acetaminophen toxicity (0.10 to 27.3 nmol/ml). No subject had detectable APAP-CYS following exposure to a non-acetaminophen hepatotoxin. Conclusions Lower concentrations of APAP-CYS are detectable after exposure to therapeutic doses of acetaminophen and higher concentrations are detected after acute acetaminophen overdose and in patients with acetaminophen toxicity following repeated exposure. PMID:21401949

  4. An operational system for subject switching between controlled vocabularies

    NASA Technical Reports Server (NTRS)

    Silvester, June P.; Klingbiel, Paul H.

    1993-01-01

    The NASA system of automatically converting sets of terms assigned by Department of Defense indexers to sets of NASA's authorized terms is described. This little-touted system, which has been operating successfully since 1983, matches concepts, rather than words. Subject Switching uses a translation table, known as the Lexical Dictionary, accessed by a program that determines which rules to follow in making the transition from DTIC's to NASA's authorized terms. The authors describe the four phases of development of Subject Switching, changes that have been made, evaluating the system, and benefits. Benefits to NASA include saving indexers' time, the addition of access points for documents indexed, the utilization of other government indexing, and a contribution towards the now-operational NASA, online, interactive, machine aided indexing.

  5. Immune function of peripheral T cells in patients with venous thromboembolism or coronary artery atherosclerosis.

    PubMed

    Zhou, Lin; Song, Haoming; Xu, Wenjun; Xu, Jiahong; Jiang, Jinfa; Gong, Zhu; Liu, Yang; Yan, Wenwen; Wang, Lemin

    2014-06-01

    Recent studies have shown that the major risk factors for arterial thrombotic diseases are closely associated with venous thromboembolism (VTE). This study aimed to investigate the expression of CD3, CD4 and CD8 in T lymphocytes, the CD4/CD8 ratio and high-sensitivity C-reactive protein (hs-CRP) levels in patients with VTE, coronary artery atherosclerosis (CAA) and healthy subjects. A total of 82 healthy subjects, 51 VTE patients and 114 CAA patients were recruited, and the expression of CD3, CD4 and CD8 in T lymphocytes and the CD4/CD8 ratio were determined. Serum hs-CRP was also measured. Compared to healthy subjects, VTE patients had significantly reduced CD3 expression (p=0.019), comparable CD4 expression (p=0.868), significantly reduced CD8 expression (p<0.001) and increased CD4/CD8 ratio (p=0.044). However, VTE patients had comparable expression of CD3, CD4 and CD8 and CD4/CD8 ratio to CAA patients. In addition, among patients with VTE or CAA, the proportion of patients with reduced CD3+ and CD8+ T lymphocytes or increased CD4/CD8 ratio was significantly higher than in healthy subjects. In addition, hs-CRP in both VTE and CAA groups was significantly higher than in healthy subjects. The antigen recognition and signal transduction activation of T cells is significantly reduced in patients with VTE or CAA, and the killing effect of T cells on pathogens, including viruses, is also significantly compromised. In addition, inflammatory and immune mechanisms are involved in the occurrence and development of venous and arterial thrombosis. Copyright © 2013 Sociedade Portuguesa de Cardiologia. Published by Elsevier España. All rights reserved.

  6. Efficacy of fibre additions to flatbread flour mixes for reducing post-meal glucose and insulin responses in healthy Indian subjects.

    PubMed

    Boers, Hanny M; MacAulay, Katrina; Murray, Peter; Dobriyal, Rajendra; Mela, David J; Spreeuwenberg, Maria A M

    2017-02-01

    The incidence of type 2 diabetes mellitus (T2DM) is increasing worldwide, including in developing countries, particularly in South Asia. Intakes of foods generating a high postprandial glucose (PPG) response have been positively associated with T2DM. As part of efforts to identify effective and feasible strategies to reduce the glycaemic impact of carbohydrate-rich staples, we previously found that addition of guar gum (GG) and chickpea flour (CPF) to wheat flour could significantly reduce the PPG response to flatbread products. On the basis of the results of an exploratory study with Caucasian subjects, we have now tested the effect of additions of specific combinations of CPF with low doses of GG to a flatbread flour mix for their impacts on PPG and postprandial insulin (PPI) responses in a South-Asian population. In a randomised, placebo-controlled full-cross-over design, fifty-six healthy Indian adults consumed flatbreads made with a commercial flatbread mix (100 % wheat flour) with no further additions (control) or incorporating 15 % CPF in combination with 2, 3 or 4 % GG. The flatbreads with CPF and 3 or 4 % GG significantly reduced PPG (both ≥15 % reduction in positive incremental AUC, P<0·01) and PPI (both ≥28 % reduction in total AUC, P<0·0001) compared with flatbreads made from control flour. These results confirm the efficacy and feasibility of the addition of CPF with GG to flatbread flour mixes to achieve significant reductions in both PPG and PPI in Indian subjects.

  7. Design and Implementation of the Resuscitation Outcomes Consortium Pragmatic Airway Resuscitation Trial (PART)

    PubMed Central

    Wang, Henry E.; Prince, David; Stephens, Shannon W.; Herren, Heather; Daya, Mohamud; Richmond, Neal; Carlson, Jestin; Warden, Craig; Colella, M. Riccardo; Brienza, Ashley; Aufderheide, Tom P.; Idris, Ahamed; Schmicker, Robert; May, Susanne; Nichol, Graham

    2016-01-01

    Airway management is an important component of resuscitation from out-of-hospital cardiac arrest (OHCA). The optimal approach to advanced airway management is unknown. The Pragmatic Airway Resuscitation Trial (PART) will compare the effectiveness of endotracheal intubation (ETI) and Laryngeal Tube (LT) insertion upon 72-hour survival in adult OHCA. Encompassing United States Emergency Medical Services agencies affiliated with the Resuscitation Outcomes Consortium (ROC), PART will use a cluster-crossover randomized design. Participating subjects will include adult, non-traumatic OHCA requiring bag-valve-mask ventilation. Trial interventions will include 1) initial airway management with ETI and 2) initial airway management with LT. The primary and secondary trial outcomes are 72-hour survival and return of spontaneous circulation. Additional clinical outcomes will include airway management process and adverse events. The trial will enroll a total of 3,000 subjects. Results of PART may guide the selection of advanced airway management strategies in OHCA. PMID:26851059

  8. The problem of creating habits: establishing health-protective dental behaviors.

    PubMed

    McCaul, K D; Glasgow, R E; O'Neill, H K

    1992-01-01

    We describe three experiments testing treatments to promote the performance of health-protective dental behaviors. Subjects included 55 women from an introductory psychology course (Experiment 1), 45 men and women (Experiment 2), and 81 older-than-average students identified as at risk for gum disease (Experiment 3). The interventions, derived from social cognitive theory, included health education, skills training, and self-monitoring. In each study, we examined the contribution of additional treatment components, including social support (Experiment 1), intensive contact (Experiment 2), and flexible goal setting (Experiment 3). Across experiments, the behavioral results were remarkably similar: Subjects exhibited excellent adherence while in the study but, at follow-up, reported behavior that differed little from baseline. We discuss parallels between attempts to promote health-protective dental behaviors and other health-promotion programs, and we describe different perspectives from which to address the problem of creating healthy habits.

  9. Understanding regulations affecting pet foods.

    PubMed

    Dzanis, David A

    2008-08-01

    In the United States, pet foods are subject to regulation at both the federal and the state levels. The US Food and Drug Administration has jurisdiction over all animal feeds (including pet foods, treats, chews, supplements, and ingredients) in interstate commerce, which includes imported products. Many states adopt and enforce at least in part the Association of American Feed Control Officials Model Bill and Model Regulations for Pet Food and Specialty Pet Food. Thus, all pet foods in multi-state distribution are subject to a host of labeling requirements covering aspects such as product names, ingredient lists, nutrient content guarantees, and nutritional adequacy statements. Ingredients must be GRAS (generally recognized as safe) substances, approved food additives, or defined by Association of American Feed Control Officials for their intended use. Pet food labels may not bear claims that are false or misleading or that state or imply use for the treatment or prevention of disease. Pet foods that are found to be adulterated or misbranded may be subject to seizure or other enforcement actions.

  10. [Joint effect of birth weight and obesity measures on abnormal glucose metabolism at adulthood].

    PubMed

    Xi, Bo; Cheng, Hong; Chen, Fangfang; Zhao, Xiaoyuan; Mi, Jie

    2016-01-01

    To investigate the joint effect of birth weight and each of obesity measures (body mass index (BMI) and waist circumference (WC)) on abnormal glucose metabolism (including diabetes) at adulthood. Using the historical cohort study design and the convenience sampling method, 1 921 infants who were born in Beijing Union Medical College Hospital from June 1948 to December 1954 were selected to do the follow-up in 1995 and 2001 respectively. Through Beijing Household Registration and Management System, they were invited to participate in this study. A total of 972 subjects (627 were followed up in 1995 and 345 were followed up in 2001) with complete information on genders, age, birth weight, family history of diabetes, BMI, WC, fasting plasma glucose (FPG) and 2-hour plasma glucose (2 h PG) met the study inclusion criteria at the follow-up visits. In the data analysis, they were divided into low, normal, and high birth weight, respectively. The ANOVA and Chi-squared tests were used to compare the differences in their characteristics by birth weight group. In addition, multiple binary Logistic regression model was used to investigate the single effect of birth weight, BMI, and waist circumference on abnormal glucose metabolism at adulthood. Stratification analysis was used to investigate the joint effect of birth weight and each of obesity measures (BMI and WC) on abnormal glucose metabolism. There were 972 subjects (males: 50.7%, mean age: (46.0±2.2) years) included in the final data analysis. The 2 h PG in low birth weight group was (7.6±3.2) mmol/L , which was higher than that in normal birth weight group (6.9±2.1) mmol/L and high birth weight group (6.4±1.3) mmol/L (F=3.88, P=0.021). After adjustment for genders, age, body length, gestation age, family history of diabetes, physical activity, smoking and alcohol consumption, and duration of follow-up, subjects with overweight and obesity at adulthood had 2.73 (95% confidence interval (CI) =2.06- 3.62) times risk to develop abnormal glucose metabolism when compared with norm weight ones. Likewise, subjects with central obesity were more likely to develop abnormal glucose metabolism than ones with normal waist (odds ratio (OR)=3.35, 95%CI=2.49-4.50). In addition, compared to subjects with normal birth weight and normal BMI at adulthood, ones with normal birth weight and overweight (including obesity) at adulthood were more likely to have abnormal glucose metabolism (OR= 2.60, 95%CI=1.94-3.49); subjects with low birth weight and overweight (including obesity) at adulthood had the highest risk for abnormal glucose metabolism (OR=4.70, 95% CI=1.84- 11.99). The attributable proportion of interaction between low birth weight and overweight (including obesity) at adulthood was 48.5%. In addition, compared to subjects with normal birth weight and normal WC at adulthood, one with normal birth weight and central obesity at adulthood were more likely to have abnormal glucose metabolism (OR=3.18, 95% CI=2.33- 4.32); subjects with low birth weight and central obesity at adulthood had the highest risk for abnormal glucose metabolism (OR=4.78, 95% CI=2.01- 11.38); subjects with high birth weight and central at adulthood also had high risk for abnormal glucose metabolism (OR=4.35, 95%CI=1.38- 13.65). We found that the attributable proportion of interaction between low birth weight and central obesity at adulthood was 38.5% , and was 28.3% for interaction between high weight and central obesity. There was strong interaction effect between birth weight and overweight (especially central obesity) at adulthood on abnormal glucose metabolism at adulthood. Effective measures should be adopted to prevent and control adult obesity in order to offset the adverse effect of birth weight on long-term health risk.

  11. Better Renal Resistive Index Profile in Subjects with Beta Thalassemia Minor


    .

    PubMed

    Basut, Fahrettin; Keşkek, Şakir Özgür; Gülek, Bozkurt

    2018-05-03

    Beta thalassaemia minor is a common genetic disorder without any characteristic symptoms except mild anemia. It is found to be associated with some cardiovascular risk factors such as insulin resistance and diabetes mellitus. The renal resistive index (RRI) is a measure of renal arterial resistance to blood flow. The aim of this study was to evaluate the renal resistive index in subjects with beta thalassaemia minor (BTM). A total of 253 subjects were included in this cross-sectional study. The study group consisted of 148 subjects with BTM and the control group consisted of 105 healthy subjects. Beta thalassaemia minor was diagnosed by complete blood count and hemoglobin electrophoresis. Blood pressure measurement and biochemical tests were performed. Renal resistive index of all subjects was measured using renal Doppler ultrasonography. Subjects with beta thalassemia minor had lower renal resistive indices compared to healthy subjects (0.58 ± 0.04 vs. 0.60 ± 0.06, p = 0.0016). Additionally, the RRI levels of subjects with BTM were correlated with systolic blood pressure (p = 0.017, r = 0.194). In this study, lower renal resistive index was found in subjects with BTM. This may be associated with decreased vascular resistance and blood viscosity in these subjects. ©2018The Author(s). Published by S. Karger AG, Basel.

  12. Differences in functional connectivity between alcohol dependence and internet gaming disorder

    PubMed Central

    Han, Ji Won; Han, Doug Hyun; Bolo, Nicolas; Kim, BoAh; Kim, Boong Nyun; Renshaw, Perry F.

    2017-01-01

    Introduction Internet gaming disorder (IGD) and alcohol dependence (AD) have been reported to share clinical characteristics including craving and over-engagement despite negative consequences. However, there are also clinical factors that differ between individuals with IGD and those with AD in terms of chemical intoxication, prevalence age, and visual and auditory stimulation. Methods We assessed brain functional connectivity within the prefrontal, striatum, and temporal lobe in 15 patients with IGD and in 16 patients with AD. Symptoms of depression, anxiety, and the attention deficit hyperactivity disorder were assessed in patients with IGD and in patients with AD. Results Both AD and IGD subjects have positive functional connectivity between the dorsolateral prefrontal cortex (DLPFC), cingulate, and cerebellum. In addition, both groups have negative functional connectivity between the DLPFC and the orbitofrontal cortex. However, the AD subjects have positive functional connectivity between the DLPFC, temporal lobe and striatal areas while IGD subjects have negative functional connectivity between the DLPFC, temporal lobe and striatal areas. Conclusions AD and IGD subjects may share deficits in executive function, including problems with self-control and adaptive responding. However, the negative connectivity between the DLPFC and the striatal areas in IGD subjects, different from the connectivity observed in AD subjects, may be due to the earlier prevalence age, different comorbid diseases as well as visual and auditory stimulation. PMID:25282597

  13. Differences in functional connectivity between alcohol dependence and internet gaming disorder.

    PubMed

    Han, Ji Won; Han, Doug Hyun; Bolo, Nicolas; Kim, BoAh; Kim, Boong Nyun; Renshaw, Perry F

    2015-02-01

    Internet gaming disorder (IGD) and alcohol dependence (AD) have been reported to share clinical characteristics including craving and over-engagement despite negative consequences. However, there are also clinical factors that differ between individuals with IGD and those with AD in terms of chemical intoxication, prevalence age, and visual and auditory stimulation. We assessed brain functional connectivity within the prefrontal, striatum, and temporal lobe in 15 patients with IGD and in 16 patients with AD. Symptoms of depression, anxiety, and the attention deficit hyperactivity disorder were assessed in patients with IGD and in patients with AD. Both AD and IGD subjects have positive functional connectivity between the dorsolateral prefrontal cortex (DLPFC), cingulate, and cerebellum. In addition, both groups have negative functional connectivity between the DLPFC and the orbitofrontal cortex. However, the AD subjects have positive functional connectivity between the DLPFC, temporal lobe and striatal areas while IGD subjects have negative functional connectivity between the DLPFC, temporal lobe and striatal areas. AD and IGD subjects may share deficits in executive function, including problems with self-control and adaptive responding. However, the negative connectivity between the DLPFC and the striatal areas in IGD subjects, different from the connectivity observed in AD subjects, may be due to the earlier prevalence age, different comorbid diseases as well as visual and auditory stimulation. Copyright © 2014 Elsevier Ltd. All rights reserved.

  14. Mirror therapy enhances upper extremity motor recovery in stroke patients.

    PubMed

    Mirela Cristina, Luca; Matei, Daniela; Ignat, Bogdan; Popescu, Cristian Dinu

    2015-12-01

    The purpose of this study was to evaluate the effects of mirror therapy program in addition with physical therapy methods on upper limb recovery in patients with subacute ischemic stroke. 15 subjects followed a comprehensive rehabilitative treatment, 8 subjects received only control therapy (CT) and 7 subjects received mirror therapy (MT) for 30 min every day, five times a week, for 6 weeks in addition to the conventional therapy. Brunnstrom stages, Fugl-Meyer Assessment (upper extremity), the Ashworth Scale, and Bhakta Test (finger flexion scale) were used to assess changes in upper limb motor recovery and motor function after intervention. After 6 weeks of treatment, patients in both groups showed significant improvements in the variables measured. Patients who received MT showed greater improvements compared to the CT group. The MT treatment results included: improvement of motor functions, manual skills and activities of daily living. The best results were obtained when the treatment was started soon after the stroke. MT is an easy and low-cost method to improve motor recovery of the upper limb.

  15. Calcium Kinetics During Long-Duration Space Flight

    NASA Technical Reports Server (NTRS)

    Smith, Scott M.; OBrien, K. O.; Wastney, M. E.; Morukov, B. V.; Larina, I.; Abrams, S. A.; Lane, H. W.; Nillen, J. L.; Davis-Street, J. E.; Oganov, V.; hide

    2001-01-01

    Bone loss represents one of the most significant effects of space flight on the human body. Understanding the mechanisms underlying this loss is critical for maintaining crew health and safety during and after flight. This investigation documents the changes in bone metabolism and calcium kinetics during and after space flight. We previously reported calcium studies on three subjects during and after a 115-d stay on the Russian space station Mir. We report here data on an additional three subjects, whose stays on Mir were approximately 4 (n=l) and 6 (n=2) mos. Previously published data are included for comparison.

  16. Bibliography, subject index, and author index of the literature examined by the Radiation Shielding Information Center (Reactor and Weapons Radiation Shielding). [1973--1976

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    1978-01-01

    An indexed bibliography is presented of literature selected by the Radiation Shielding Information Center since the previous volume was published in 1974 in the area of radiation transport and shielding against radiation from nuclear reactors, x-ray machines, radioisotopes, nuclear weapons (including fallout), and low-energy accelerators (e.g., neutron generators). In addition to lists of literature titles by subject categories (accessions 3501-4950), author and keyword indexes are given. Most of the literature selected for Vol. V was published in the years 1973 to 1976.

  17. Effectiveness of Avoidant Thinking and Redefinition in Coping with Stress.

    ERIC Educational Resources Information Center

    Burish, Thomas G.; And Others

    After receiving a sample shock, subjects in a Threat Condition were told that they would receive additional painful shocks while subjects in a Nonthreat Condition were not threatened with additional shocks. Subjects in an Avoidant Thinking Condition were then instructed to read and think about an amusing story, subjects in a Situation Redefinition…

  18. Solid State Multinuclear Magnetic Resonance Investigation of Electrolyte Decomposition Products on Lithium Ion Electrodes

    NASA Technical Reports Server (NTRS)

    DeSilva, J .H. S. R.; Udinwe, V.; Sideris, P. J.; Smart, M. C.; Krause, F. C.; Hwang, C.; Smith, K. A.; Greenbaum, S. G.

    2012-01-01

    Solid electrolyte interphase (SEI) formation in lithium ion cells prepared with advanced electrolytes is investigated by solid state multinuclear (7Li, 19F, 31P) magnetic resonance (NMR) measurements of electrode materials harvested from cycled cells subjected to an accelerated aging protocol. The electrolyte composition is varied to include the addition of fluorinated carbonates and triphenyl phosphate (TPP, a flame retardant). In addition to species associated with LiPF6 decomposition, cathode NMR spectra are characterized by the presence of compounds originating from the TPP additive. Substantial amounts of LiF are observed in the anodes as well as compounds originating from the fluorinated carbonates.

  19. Combining computerized social cognitive training with neuroplasticity-based auditory training in schizophrenia.

    PubMed

    Sacks, Stephanie; Fisher, Melissa; Garrett, Coleman; Alexander, Phillip; Holland, Christine; Rose, Demian; Hooker, Christine; Vinogradov, Sophia

    2013-01-01

    Social cognitive deficits are an important treatment target in schizophrenia, but it is unclear to what degree they require specialized interventions and which specific components of behavioral interventions are effective. In this pilot study, we explored the effects of a novel computerized neuroplasticity-based auditory training delivered in conjunction with computerized social cognition training (SCT) in patients with schizophrenia. Nineteen clinically stable schizophrenia subjects performed 50 hours of computerized exercises that place implicit, increasing demands on auditory perception, plus 12 hours of computerized training in emotion identification, social perception, and theory of mind tasks. All subjects were assessed with MATRICS-recommended measures of neurocognition and social cognition, plus a measure of self-referential source memory before and after the computerized training. Subjects showed significant improvements on multiple measures of neurocognition. Additionally, subjects showed significant gains on measures of social cognition, including the MSCEIT Perceiving Emotions, MSCEIT Managing Emotions, and self-referential source memory, plus a significant decrease in positive symptoms. Computerized training of auditory processing/verbal learning in schizophrenia results in significant basic neurocognitive gains. Further, addition of computerized social cognition training results in significant gains in several social cognitive outcome measures. Computerized cognitive training that directly targets social cognitive processes can drive improvements in these crucial functions.

  20. Dietary and hormonal interrelationships among vegetarian Seventh-Day Adventists and nonvegetarian men.

    PubMed

    Howie, B J; Shultz, T D

    1985-07-01

    The relationship between dietary nutrients and plasma testosterone, 5 alpha-dihydrotestosterone, estradiol-17 beta, luteinizing hormone, and prolactin levels was investigated in 12 Seventh-Day Adventist (SDA) vegetarian (SV), 10 SDA nonvegetarian (SNV), and 8 non-SDA nonvegetarian (NV) men. Fasting blood samples and 3-day dietary intake information were obtained from each subject. The SV subjects consumed significantly more crude and dietary fiber than the SNV and NV subjects, respectively. Plasma levels of testosterone and estradiol-17 beta were significantly lower in the SV than in the omnivores. Additionally, the plasma levels of testosterone and estradiol-17 beta of the combined groups (SV, SNV, and NV) revealed a significant negative relationship with their crude and dietary fiber intakes. These subjects hormonal milieu was related to specific dietary constituents, possibly leading to a decreased plasma concentration of androgen and estrogen in vegetarians. Implications include the possible modification of prostate cancer risk through dietary intervention.

  1. Input Device Characteristics Contribute to Performance during Training to Operate a Simulated Micro-Unmanned Aerial Vehicle

    DTIC Science & Technology

    2010-10-01

    mission, participants were given the NASA Task Load Index ( NASA TLX ) to measure subjective workload. Additional performance measures included mission...16 NASA TLX Workload Analyses...worksheet (See Appendix C), the Hidden Patterns Test (ETS, 1976), and an electronic form of the NASA Task Load Index ( TLX ; Hart & Staveland, 1988). The

  2. Operational Area Environmental Evaluations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bailey-White, Brenda Eileen; Nagy, Michael David; Wagner, Katrina Marie

    The Operational Area Environmental Evaluation update provides a description of activities that have the potential to adversely affect natural and cultural resources, including soil, air, water, biological, ecological, and historical resources. The environmental sensitivity of an area is evaluated and summarized, which may facilitate informed management decisions as to where development may be prohibited, restricted, or subject to additional requirements.

  3. Effects of Wait Time When Communicating with Children Who Have Sensory and Additional Disabilities

    ERIC Educational Resources Information Center

    Johnson, Nicole; Parker, Amy T.

    2013-01-01

    Introduction: This study utilized wait-time procedures to determine if they are effective in helping children with deafblindness or multiple disabilities that include a visual impairment communicate in their home. Methods: A single subject with an alternating treatment design was used for the study. Zero- to one-second wait time was utilized…

  4. SCHOOL LIGHTING APPLICATION DATA. EXCERPTS FROM THE IES LIGHTING HANDBOOK, 3RD EDITION.

    ERIC Educational Resources Information Center

    Illuminating Engineering Society, New York, NY.

    THIS PUBLICATION REGARDING SCHOOL LIGHTING WAS PREPARED AS A USEFUL ADDITION TO THE AMERICAN STANDARD GUIDE FOR SCHOOL LIGHTING. THE MATERIAL HAS BEEN EXTRACTED FROM THE IES LIGHTING HANDBOOK TO INCLUDE A MORE DETAILED TREATMENT OF SUBJECTS TO WHICH THE DESIGNER MUST GIVE IMPORTANT CONSIDERATION. THERE IS A MORE EXTENSIVE TREATMENT OF REFLECTED…

  5. 78 FR 21151 - G4 Products, LLC a Subsidiary of G4 Holdings, Inc. Including Workers Whose Wages are Paid Under...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-04-09

    ... certification for G4 Products. Additional information provided by the company official revealed that the subject... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-81,432] G4 Products, LLC a...-Site Leased Workers from OSW and Maine Staffing Group Lewiston, ME; Amended Certification Regarding...

  6. Guide to Special Information in Scientific and Engineering Journals.

    ERIC Educational Resources Information Center

    Harris, Mary Elizabeth

    This update of a 1983 annotated bibliography lists 298 special features or special issues of science and technology periodicals with emphasis on compilations of information that appear in periodicals on a regular basis. In addition to the 203 entries listed in the original edition, 95 new entries are included. Subjects covered in the guide include…

  7. Linkage analysis of high myopia susceptibility locus in 26 families.

    PubMed

    Paget, Sandrine; Julia, Sophie; Vitezica, Zulma G; Soler, Vincent; Malecaze, François; Calvas, Patrick

    2008-01-01

    We conducted a linkage analysis in high myopia families to replicate suggestive results from chromosome 7q36 using a model of autosomal dominant inheritance and genetic heterogeneity. We also performed a genome-wide scan to identify novel loci. Twenty-six families, with at least two high-myopic subjects (ie. refractive value in the less affected eye of -5 diopters) in each family, were included. Phenotypic examination included standard autorefractometry, ultrasonographic eye length measurement, and clinical confirmation of the non-syndromic character of the refractive disorder. Nine families were collected de novo including 136 available members of whom 34 were highly myopic subjects. Twenty new subjects were added in 5 of the 17 remaining families. A total of 233 subjects were submitted to a genome scan using ABI linkage mapping set LMSv2-MD-10, additional markers in all regions where preliminary LOD scores were greater than 1.5 were used. Multipoint parametric and non-parametric analyses were conducted with the software packages Genehunter 2.0 and Merlin 1.0.1. Two autosomal recessive, two autosomal dominant, and four autosomal additive models were used in the parametric linkage analyses. No linkage was found using the subset of nine newly collected families. Study of the entire population of 26 families with a parametric model did not yield a significant LOD score (>3), even for the previously suggestive locus on 7q36. A non-parametric model demonstrated significant linkage to chromosome 7p15 in the entire population (Z-NPL=4.07, p=0.00002). The interval is 7.81 centiMorgans (cM) between markers D7S2458 and D7S2515. The significant interval reported here needs confirmation in other cohorts. Among possible susceptibility genes in the interval, certain candidates are likely to be involved in eye growth and development.

  8. Pain in hereditary neuropathy with liability to pressure palsy: an association with fibromyalgia syndrome?

    PubMed

    Yilmaz, Ugur; Bird, Thomas T; Carter, Gregory T; Wang, Leo H; Weiss, Michael D

    2015-03-01

    This study characterizes the nature of pain in hereditary neuropathy with liability to pressure palsy (HNPP). This retrospective study was performed to assess duration, nature, location, and intensity of pain on initial presentation of subjects with HNPP, including the degree and type of analgesic medication use and electrodiagnostic characteristics. Subjects who met the American College of Rheumatology criteria for fibromyalgia syndrome (FMS) were also identified. Of 32 HNPP subjects, 24 (75%) had symptoms of pain, and 4 (12%) had pain as an initial symptom. Of subjects who described pain, 9 (28%) reported only musculoskeletal pain, 10 (31%) only neuropathic pain, and 5 (16%) both musculoskeletal and neuropathic pain. All 9 subjects with only musculoskeletal pain met criteria for FMS. Neuropathic and musculoskeletal pain occur commonly in HNPP and may be a presenting symptom. Additionally, HNPP with predominantly musculoskeletal pain may meet criteria for FMS and potentially delay the diagnosis. © 2014 Wiley Periodicals, Inc.

  9. Electrotactile Feedback Improves Performance and Facilitates Learning in the Routine Grasping Task.

    PubMed

    Isaković, Milica; Belić, Minja; Štrbac, Matija; Popović, Igor; Došen, Strahinja; Farina, Dario; Keller, Thierry

    2016-06-13

    Aim of this study was to investigate the feasibility of electrotactile feedback in closed loop training of force control during the routine grasping task. The feedback was provided using an array electrode and a simple six-level spatial coding, and the experiment was conducted in three amputee subjects. The psychometric tests confirmed that the subjects could perceive and interpret the electrotactile feedback with a high success rate. The subjects performed the routine grasping task comprising 4 blocks of 60 grasping trials. In each trial, the subjects employed feedforward control to close the hand and produce the desired grasping force (four levels). First (baseline) and the last (validation) session were performed in open loop, while the second and the third session (training) included electrotactile feedback. The obtained results confirmed that using the feedback improved the accuracy and precision of the force control. In addition, the subjects performed significantly better in the validation vs. baseline session, therefore suggesting that electrotactile feedback can be used for learning and training of myoelectric control.

  10. The Madrid Affective Database for Spanish (MADS): Ratings of Dominance, Familiarity, Subjective Age of Acquisition and Sensory Experience

    PubMed Central

    Hinojosa, José A.; Rincón-Pérez, Irene; Romero-Ferreiro, Mª Verónica; Martínez-García, Natalia; Villalba-García, Cristina; Montoro, Pedro R.; Pozo, Miguel A.

    2016-01-01

    The current study presents ratings by 540 Spanish native speakers for dominance, familiarity, subjective age of acquisition (AoA), and sensory experience (SER) for the 875 Spanish words included in the Madrid Affective Database for Spanish (MADS). The norms can be downloaded as supplementary materials for this manuscript from https://figshare.com/s/8e7b445b729527262c88 These ratings may be of potential relevance to researches who are interested in characterizing the interplay between language and emotion. Additionally, with the aim of investigating how the affective features interact with the lexicosemantic properties of words, we performed correlational analyses between norms for familiarity, subjective AoA and SER, and scores for those affective variables which are currently included in the MADs. A distinct pattern of significant correlations with affective features was found for different lexicosemantic variables. These results show that familiarity, subjective AoA and SERs may have independent effects on the processing of emotional words. They also suggest that these psycholinguistic variables should be fully considered when formulating theoretical approaches to the processing of affective language. PMID:27227521

  11. Unobtrusive measures in behavioral assessment

    PubMed Central

    Kazdin, Alan E.

    1979-01-01

    A major distinguishing characteristic of behavioral assessment is the direct assessment of overt behavior. Direct assessment is assumed to provide a sample of behavior that reflects client performance in the situation in which behavior is assessed, even if the assessment procedures were not implemented. Yet, in the majority of investigations, behavioral assessment procedures are obtrusive, i.e., subjects are aware that their behavior is being assessed. The potential problem with obtrusive assessment is that it may be reactive, i.e., affect how subjects perform. Recent research has demonstrated that obtrusive observations often are reactive and that behaviors assessed under obtrusive and unobtrusive conditions bear little relation. From methodological and applied perspectives, additional attention needs to be given to unobtrusive measures of behavior change. The present paper illustrates unobtrusive measures in behavior modification including direct observations, archival records, and physical traces of performance. In addition, validation and assessment problems, questions about the obtrusiveness of the measures, and ethical issues are discussed. PMID:16795622

  12. Refinement of Molecular Diagnostic Protocol of Auditory Neuropathy Spectrum Disorder

    PubMed Central

    Chang, Mun Young; Kim, Ah Reum; Kim, Nayoung K.D.; Lee, Chung; Park, Woong-Yang; Choi, Byung Yoon

    2015-01-01

    Abstract Auditory neuropathy spectrum disorder (ANSD) is a sensorineural hearing disorder caused by dysfunction of auditory neural conduction. ANSD has a heterogeneous etiology, including genetic factors; the response to cochlear implantation significantly varies depending on the etiology. The results of timely cochlear implantation for OTOF-related ANSD (DFNB9) have been reported to be good. Therefore, identifying the causative gene of ANSD, especially OTOF, is an important issue to rehabilitate these patients. Six sporadic ANSD subjects without anatomical abnormality of the cochlear nerve, including the 4 subjects that were previously reported to be without detectable OTOF mutation, were included. We performed targeted resequencing (TRS) of known deafness genes and multiphasic bioinformatics analyses of the data that ensured detection of capture failure and structural variations. Exclusion of SNP was also double checked. The TRS data previously obtained from 2 subjects were reanalyzed. Through this study, we detected 2 mutant alleles of OTOF from 5 (83.3%) of 6 ANSD subjects. All of the 5 subjects carried at least 1 mutant allele carrying p.R1939Q. This variant was categorized as a simple SNP (rs201326023) in the database and it resided in the exon with frequent capture failures, which previously led to exclusion of this variant from eligible candidacy mistakenly. In addition, we detected a structural variation within OTOF from a previously undiagnosed ANSD subject, which was the second structural variation reported in DFNB9 subjects to date. We identify a strong etiologic homogeneity of prelingual ANSD in case of the anatomically normal cochlear nerve in Koreans and now report DFNB9 as the single overwhelming cause. Multiphasic analysis of TRS data ensuring detection of capture failure and structural variations would be expected to reveal DFNB9 from a substantial portion of previously undiagnosed ANSD subjects in Koreans. Based on our results, we propose a novel strategy that incorporates imaging studies, prevalent mutation screening and multiphasic analysis of TRS data in a stepwise manner to correctly detect DFNB9 in Koreans. PMID:26632695

  13. A 1-year trial of repeated high-dose intravenous iron isomaltoside 1000 to maintain stable hemoglobin levels in inflammatory bowel disease.

    PubMed

    Reinisch, Walter; Altorjay, Istvan; Zsigmond, Ferenc; Primas, Christian; Vogelsang, Harald; Novacek, Gottfried; Reinisch, Sieglinde; Thomsen, Lars L

    2015-01-01

    Iron isomaltoside 1000 (Monofer®) is a high-dose intravenous (IV) iron, which in a recent 8 weeks trial in inflammatory bowel disease (IBD) subjects with iron deficiency anemia (IDA) demonstrated good tolerability and efficacy. The present trial is an extension to this trial, which evaluates the need for additional high IV iron doses to maintain a stable hemoglobin (Hb) ≥12.0 g/dl. This was a prospective, open-label, 12 months trial of European IBD subjects willing to participate after completing the lead-in trial. Subjects were allowed re-dosing with 500-2000 mg single doses of iron isomaltoside 1000 infused over ∼15 min at 3 months intervals depending on a predefined algorithm. Outcome measures included Hb, safety parameters and need for additional iron dosing. A total of 39 subjects were enrolled of which 34 subjects required re-dosing with a median cumulative 1-year dose of 1.8 g (mean cumulative dose 2.2 g). The mean (SD) Hb was 12.3 (1.5) g/dl at baseline, 12.8 (1.6) g/dl at 3 months, 12.8 (1.6) g/dl at 6 months, 12.9 (1.4) g/dl at 9 months and 12.9 (1.6) g/dl at 12 months. Seventy-four percent of subjects who had an Hb ≥12.0 g/dl at baseline were able to maintain Hb ≥12.0 g/dl till the end of the trial at 12 months. Nonserious probably related hypersensitivity reactions without significant hypotension were reported at the beginning of the infusion in two subjects, who recovered without sequelae. Repeated treatment of iron deficiency with iron isomaltoside 1000 could avoid episodes of IDA without major safety issues.

  14. DOE Office of Scientific and Technical Information (OSTI.GOV)

    West, Brian H.; Connatser, Raynella M.; Lewis, Samuel Arthur

    The Fuels, Engines, and Emissions Research Center completed analysis and testing of the CPS Powershot gasoline additive under the auspices of the Department of Energy’s Technical Assistance for US Small Businesses in Vehicle Technologies. Gas chromatography-mass spectrometry (GC-MS) was used to quantify the makeup of the additive, finding a predominance of 2,3-Ditert-Butoxypropanol, also known as Glyceryl Di-Tert-Butyl Ether (GTBE). Blends of the additive at 2 and 4 volume percent were subjected to a number of standard ASTM tests, including Research Octane Number, Motor Octane Number, distillation, and vapor pressure. Results show a high boiling range and low vapor pressure formore » the additive, and a very modest octane boosting effect in gasoline with and without ethanol.« less

  15. Effects of Levodopa on Postural Strategies in Parkinson’s disease

    PubMed Central

    Mancini, Martina; Rocchi, Laura; Horak, Fay

    2017-01-01

    Altered postural control and balance are major disabling issues of Parkinson’s disease (PD). Static and dynamic posturography have provided insight into PD’s postural deficits; however, little is known about impairments in postural coordination. We hypothesized that subjects with PD would show more ankle strategy during quiet stance than healthy control subjects, who would include some hip strategy, and this stiffer postural strategy would increase with disease progression. We quantified postural strategy and sway dispersion with inertial sensors (one placed on the shank and one on the posterior trunk at L5 level) while subjects were standing still with their eyes open. A total of 70 subjects with PD, including a mild group (H&Y≤2, N=33) and a more severe group (H&Y≥3, N=37), were assessed while OFF and while ON levodopa medication. We also included a healthy control group (N=21). Results showed an overall preference of ankle strategy in all groups while maintaining balance. Postural strategy was significantly lower ON compared to OFF medication (indicating more hip strategy), but no effect of disease stage was found. Instead, sway dispersion was significantly larger in ON compared to OFF medication, and significantly larger in the more severe PD group compared to the mild. In addition, increased hip strategy during stance was associated with poorer self-perception of balance. PMID:27131172

  16. Effects of Levodopa on Postural Strategies in Parkinson's disease.

    PubMed

    Baston, Chiara; Mancini, Martina; Rocchi, Laura; Horak, Fay

    2016-05-01

    Altered postural control and balance are major disabling issues of Parkinson's disease (PD). Static and dynamic posturography have provided insight into PD's postural deficits; however, little is known about impairments in postural coordination. We hypothesized that subjects with PD would show more ankle strategy during quiet stance than healthy control subjects, who would include some hip strategy, and this stiffer postural strategy would increase with disease progression. We quantified postural strategy and sway dispersion with inertial sensors (one placed on the shank and one on the posterior trunk at L5 level) while subjects were standing still with their eyes open. A total of 70 subjects with PD, including a mild group (H&Y≤2, N=33) and a more severe group (H&Y≥3, N=37), were assessed while OFF and while ON levodopa medication. We also included a healthy control group (N=21). Results showed an overall preference of ankle strategy in all groups while maintaining balance. Postural strategy was significantly lower ON compared to OFF medication (indicating more hip strategy), but no effect of disease stage was found. Instead, sway dispersion was significantly larger in ON compared to OFF medication, and significantly larger in the more severe PD group compared to the mild. In addition, increased hip strategy during stance was associated with poorer self-perception of balance. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Radiologists’ Training, Experience, and Attitudes About Elder Abuse Detection

    PubMed Central

    Rosen, Tony; Bloemen, Elizabeth M.; Harpe, Jasmin; Sanchez, Allen M.; Mennitt, Kevin W.; McCarthy, Thomas J.; Nicola, Refky; Murphy, Kieran; LoFaso, Veronica M.; Flomenbaum, Neal; Lachs, Mark S.

    2017-01-01

    OBJECTIVE Elder abuse is underrecognized, and identification of subtle cases requires a high index of suspicion among all health care providers. Because many geriatric injury victims undergo radiographic imaging, diagnostic radiologists may be well positioned to identify injury patterns suggestive of abuse. Little is known about radiologists’ experience with elder abuse. Our goal was to describe knowledge, attitudes, training, and practice experience in elder abuse detection among diagnostic radiologists. SUBJECTS AND METHODS We conducted 19 interviews with diagnostic radiologists at a large urban academic medical center using a semistructured format. Data from these sessions were coded and analyzed to identify themes. RESULTS Only two radiologists reported any formal or informal training in elder abuse detection. All subjects believed they had missed cases of elder abuse. Even experienced radiologists reported never having received a request from a referring physician to assess images for evidence suggestive of elder abuse. All subjects reported a desire for additional elder abuse training. Also, subjects identified radiographic findings or patterns potentially suggestive of elder abuse, including high-energy injuries such as upper rib fractures, injuries in multiple stages of healing, and injuries inconsistent with reported mechanism. CONCLUSION Radiologists are uniquely positioned to identify elder abuse. Though training in detection is currently lacking, providers expressed a desire for increased knowledge. In addition, radiologists were able to identify radiographic findings suggestive of elder abuse. On the basis of these findings, we plan to conduct additional studies to define pathognomonic injury patterns and to explore how to empower radiologists to incorporate detection into their practice. PMID:27732066

  18. Physical education, school physical activity, school sports and academic performance

    PubMed Central

    Trudeau, François; Shephard, Roy J

    2008-01-01

    Background The purpose of this paper is to review relationships of academic performance and some of its determinants to participation in school-based physical activities, including physical education (PE), free school physical activity (PA) and school sports. Methods Linkages between academic achievement and involvement in PE, school PA and sport programmes have been examined, based on a systematic review of currently available literature, including a comprehensive search of MEDLINE (1966 to 2007), PSYCHINFO (1974 to 2007), SCHOLAR.GOOGLE.COM, and ERIC databases. Results Quasi-experimental data indicate that allocating up to an additional hour per day of curricular time to PA programmes does not affect the academic performance of primary school students negatively, even though the time allocated to other subjects usually shows a corresponding reduction. An additional curricular emphasis on PE may result in small absolute gains in grade point average (GPA), and such findings strongly suggest a relative increase in performance per unit of academic teaching time. Further, the overwhelmingly majority of such programmes have demonstrated an improvement in some measures of physical fitness (PF). Cross-sectional observations show a positive association between academic performance and PA, but PF does not seem to show such an association. PA has positive influences on concentration, memory and classroom behaviour. Data from quasi-experimental studies find support in mechanistic experiments on cognitive function, pointing to a positive relationship between PA and intellectual performance. Conclusion Given competent providers, PA can be added to the school curriculum by taking time from other subjects without risk of hindering student academic achievement. On the other hand, adding time to "academic" or "curricular" subjects by taking time from physical education programmes does not enhance grades in these subjects and may be detrimental to health. PMID:18298849

  19. An Anterior-to-Posterior Shift in Midline Cortical Activity in Schizophrenia During Self-Reflection

    PubMed Central

    Holt, Daphne J.; Cassidy, Brittany S.; Andrews-Hanna, Jessica R.; Lee, Su Mei; Coombs, Garth; Goff, Donald C.; Gabrieli, John D.; Moran, Joseph M.

    2013-01-01

    Background Deficits in social cognition, including impairments in self-awareness, contribute to the overall functional disability associated with schizophrenia. Studies in healthy subjects have shown that social cognitive functions, including self-reflection, rely on the medial prefrontal cortex (mPFC) and posterior cingulate gyrus, and these regions exhibit highly correlated activity during “resting” states. In this study, we tested the hypothesis that patients with schizophrenia show dysfunction of this network during self-reflection and that this abnormal activity is associated with changes in the strength of resting-state correlations between these regions. Methods Activation during self-reflection and control tasks was measured with functional magnetic resonance imaging in 19 patients with schizophrenia and 20 demographically matched control subjects. In addition, the resting-state functional connectivity of midline cortical areas showing abnormal self-reflection-related activation in schizophrenia was measured. Results Compared with control subjects, the schizophrenia patients demonstrated lower activation of the right ventral mPFC and greater activation of the mid/posterior cingulate gyri bilaterally during self-reflection, relative to a control task. A similar pattern was seen during overall social reflection. In addition, functional connectivity between the portion of the left mid/posterior cingulate gyrus showing abnormally elevated activity during self-reflection in schizophrenia, and the dorsal anterior cingulate gyrus was lower in the schizophrenia patients compared with control subjects. Conclusions Schizophrenia is associated with an anterior-to-posterior shift in introspection-related activation, as well as changes in functional connectivity, of the midline cortex. These findings provide support for the hypothesis that aberrant midline cortical function contributes to social cognitive impairment in schizophrenia. PMID:21144498

  20. An anterior-to-posterior shift in midline cortical activity in schizophrenia during self-reflection.

    PubMed

    Holt, Daphne J; Cassidy, Brittany S; Andrews-Hanna, Jessica R; Lee, Su Mei; Coombs, Garth; Goff, Donald C; Gabrieli, John D; Moran, Joseph M

    2011-03-01

    Deficits in social cognition, including impairments in self-awareness, contribute to the overall functional disability associated with schizophrenia. Studies in healthy subjects have shown that social cognitive functions, including self-reflection, rely on the medial prefrontal cortex (mPFC) and posterior cingulate gyrus, and these regions exhibit highly correlated activity during "resting" states. In this study, we tested the hypothesis that patients with schizophrenia show dysfunction of this network during self-reflection and that this abnormal activity is associated with changes in the strength of resting-state correlations between these regions. Activation during self-reflection and control tasks was measured with functional magnetic resonance imaging in 19 patients with schizophrenia and 20 demographically matched control subjects. In addition, the resting-state functional connectivity of midline cortical areas showing abnormal self-reflection-related activation in schizophrenia was measured. Compared with control subjects, the schizophrenia patients demonstrated lower activation of the right ventral mPFC and greater activation of the mid/posterior cingulate gyri bilaterally during self-reflection, relative to a control task. A similar pattern was seen during overall social reflection. In addition, functional connectivity between the portion of the left mid/posterior cingulate gyrus showing abnormally elevated activity during self-reflection in schizophrenia, and the dorsal anterior cingulate gyrus was lower in the schizophrenia patients compared with control subjects. Schizophrenia is associated with an anterior-to-posterior shift in introspection-related activation, as well as changes in functional connectivity, of the midline cortex. These findings provide support for the hypothesis that aberrant midline cortical function contributes to social cognitive impairment in schizophrenia. Copyright © 2011 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

  1. Use of an interactive tool to assess patients' willingness-to-pay.

    PubMed

    Matthews, D; Rocchi, A; Wang, E C; Gafni, A

    2001-10-01

    Assessment of willingness to pay (WTP) has become an important issue in health care technology assessment and in providing insight into the risks and benefits of treatment options. We have accordingly explored the use of an interactive method for assessment of WTP. To illustrate our methodology, we describe the development and testing of an interactive tool to administer a WTP survey in a dental setting. The tool was developed to measure patient preference and strength of preference for three dental anesthetic options in a research setting. It delivered written and verbal formats simultaneously, including information about the risks and benefits of treatment options, insurance, and user-based WTP scenarios and questions on previous dental experience. Clinical information was presented using a modified decision aid. Subjects could request additional clinical information and review this information throughout the survey. Information and question algorithms were individualized, depending on the subject's reported clinical status and previous responses. Initial pretesting resulted in substantial modifications to the initial tool: shortening the clinical information (by making more of it optional reading) and personalizing the text to more fully engage the user. In terms of results 196 general population subjects were recruited using random-digit dialing in southwestern Ontario, Canada. Comprehension was tested to ensure the instrument clearly conveyed the clinical information; the average score was 97%. Subjects rated the instrument as easy/very easy to use (99%), interesting/very interesting (91%), and neither long nor short (72.4%). Most subjects were comfortable/very comfortable with a computer (84%). Indirect evaluation revealed most subjects completed the survey in the expected time (30 min). Additional information was requested by 50% of subjects, an average of 2.9 times each. Most subjects wanted this type of information available in the provider's office for use in clinical decision making (92%). Despite extensive pretesting, three "bugs" remained undiscovered until live use. We have demonstrated that the detailed information, complex algorithms, and cognitively challenging questions involved in a WTP survey can be successfully administered using a tailor-made, patient-based, interactive computer tool. Key lessons regarding the use of such tools include allowing the user to set the pace of information flow and tailor the content, engaging the user by personalizing the textual information, inclusion of tests of comprehension and offering opportunities for correction, and pretesting by fully mimicking the live environment.

  2. Association of Heart-Type Fatty Acid-Binding Protein with Cardiovascular Risk Factors and All-Cause Mortality in the General Population: The Takahata Study

    PubMed Central

    Otaki, Yoichiro; Watanabe, Tetsu; Takahashi, Hiroki; Hirayama, Atushi; Narumi, Taro; Kadowaki, Shinpei; Honda, Yuki; Arimoto, Takanori; Shishido, Tetsuro; Miyamoto, Takuya; Konta, Tsuneo; Shibata, Yoko; Fukao, Akira; Daimon, Makoto; Ueno, Yoshiyuki; Kato, Takeo; Kayama, Takamasa; Kubota, Isao

    2014-01-01

    Background Despite many recent advances in medicine, preventing the development of cardiovascular diseases remains a challenge. Heart-type fatty acid-binding protein (H-FABP) is a marker of ongoing myocardial damage and has been reported to be a useful indicator for future cardiovascular events. However, it remains to be determined whether H-FABP can predict all-cause and cardiovascular deaths in the general population. Methods and Results This longitudinal cohort study included 3,503 subjects who participated in a community-based health checkup with a 7-year follow-up. Serum H-FABP was measured in registered subjects. The results demonstrated that higher H-FABP levels were associated with increasing numbers of cardiovascular risk factors, including hypertension, diabetes mellitus, obesity, and metabolic syndrome. There were 158 deaths during the follow-up period, including 50 cardiovascular deaths. Deceased subjects had higher H-FABP levels compared to surviving subjects. Multivariate Cox proportional hazard regression analysis revealed that H-FABP is an independent predictor of all-cause and cardiovascular deaths after adjustments for confounding factors. Subjects were divided into four quartiles according to H-FABP level, and Kaplan-Meier analysis demonstrated that the highest H-FABP quartile was associated with the greatest risks for all-cause and cardiovascular deaths. Net reclassification index and integrated discrimination index were significantly increased by addition of H-FABP to cardiovascular risk factors. Conclusions H-FABP level was increased in association with greater numbers of cardiovascular risk factors and was an independent risk factor for all-cause and cardiovascular deaths. H-FABP could be a useful indicator for the early identification of high-risk subjects in the general population. PMID:24847804

  3. Opinion Paper: On the Diagnosis/Classification of Sexual Arousal Concerns in Women.

    PubMed

    Althof, Stanley E; Meston, Cindy M; Perelman, Michael A; Handy, Ariel B; Kilimnik, Chelsea D; Stanton, Amelia M

    2017-11-01

    In the professional literature and among our professional societies, female sexual dysfunction nomenclature and diagnostic criterion sets have been the source of considerable controversy. Recently, a consensus group, supported by the International Society for Women's Sexual Health, published its recommendations for nosology and nomenclature, which included only one type of arousal dysfunction, female genital arousal disorder, in its classification system. Subjective arousal was considered an aspect of sexual desire and not part of the arousal phase. To advocate for the importance of including subjective arousal disorder in the diagnostic nomenclature in addition to the genital arousal subtype. We reviewed how the construct of subjective arousal was included in or eliminated from the iterations of various diagnostic and statistical manuals. The Female Sexual Function Index (FSFI) was used to examine the relations among subjective arousal, genital arousal, and desire in women with and without sexual arousal concerns. Sexual arousal through a self-report Film Scale, physiologic sexual arousal through vaginal photoplethysmography in response to an erotic film, and the FSFI. The clinical literature and experience support differentiating subjective arousal from desire and genital arousal. Correlations between the FSFI domains representing desire and subjective arousal, although sufficient to suggest relatedness, share approximately 58% of the variance between constructs-a lower shared variance than FSFI domains representing subjective arousal and orgasm. Similarly, when looking at FSFI individual items best representative of sexual desire and subjective arousal, the large majority of the variance in subjective arousal was unexplained by desire. A third line of evidence showed no significant difference in levels of subjective arousal to erotic films between sexually functional women and women with desire problems. If desire and subjective arousal were the same construct, then one would expect to see evidence of low subjective arousal in women with low sexual desire. Optimized treatment efficacy requires differentiating mental and physical factors that contribute to female sexual dysfunction. Support for our conclusion is based on clinical qualitative evidence and quantitative evidence. However, the quantitative support is from only one laboratory at this time. These findings strongly support the view that female sexual arousal disorder includes a subjective arousal subtype and that subjective arousal and desire are related but not similar constructs. We advocate for the relevance of maintaining subjective arousal disorder in the diagnostic nomenclature and present several lines of evidence to support this contention. Althof SE, Meston CM, Perelman M, et al. Opinion Paper: On the Diagnosis/Classification of Sexual Arousal Concerns in Women. J Sex Med 2017;14:1365-1371. Copyright © 2017 International Society for Sexual Medicine. Published by Elsevier Inc. All rights reserved.

  4. Effect of seasonal and geographical differences on skin and effect of treatment with an osmoprotectant: Sorbitol.

    PubMed

    Muizzuddin, Neelam; Ingrassia, Michael; Marenus, Kenneth D; Maes, Daniel H; Mammone, Thomas

    2013-01-01

    Human skin maintains an optimal permeability barrier function in a terrestrial environment that varies considerably in humidity. Cells cultured under hyperosmotic stress accumulate osmolytes including sorbitol. Epidermal keratinocytes experience similar high osmolality under dry environmental conditions because of increased transepidermal water loss (TEWL) and concomitant drying of the skin. This study was designed to determine if epidermal keratinocytes, in vitro, could be protected from high osmotic stress, with the exogenous addition of sorbitol. In addition, we evaluated the effect of a formulation containing topical sorbitol on skin barrier and moisturization of subjects living in arid and humid regions in summer as well as in winter. Results from in vitro experiments showed that 50 mM sorbitol protected epidermal keratinocytes from osmotic toxicity induced by sodium chloride. Clinical studies indicated that skin chronically exposed to hot, dry environment appeared to exhibit stronger skin barrier and a lower baseline TEWL. In addition, skin barrier was stronger in summer than in winter. Sorbitol exhibited significant improvement in both barrier repair and moisturization, especially in individuals subjected to arid environmental conditions.

  5. Genome-wide association study identifies a novel locus contributing to type 2 diabetes susceptibility in Sikhs of Punjabi origin from India.

    PubMed

    Saxena, Richa; Saleheen, Danish; Been, Latonya F; Garavito, Martha L; Braun, Timothy; Bjonnes, Andrew; Young, Robin; Ho, Weang Kee; Rasheed, Asif; Frossard, Philippe; Sim, Xueling; Hassanali, Neelam; Radha, Venkatesan; Chidambaram, Manickam; Liju, Samuel; Rees, Simon D; Ng, Daniel Peng-Keat; Wong, Tien-Yin; Yamauchi, Toshimasa; Hara, Kazuo; Tanaka, Yasushi; Hirose, Hiroshi; McCarthy, Mark I; Morris, Andrew P; Basit, Abdul; Barnett, Anthony H; Katulanda, Prasad; Matthews, David; Mohan, Viswanathan; Wander, Gurpreet S; Singh, Jai Rup; Mehra, Narinder K; Ralhan, Sarju; Kamboh, M Ilyas; Mulvihill, John J; Maegawa, Hiroshi; Tobe, Kazuyuki; Maeda, Shiro; Cho, Yoon S; Tai, E Shyong; Kelly, M Ann; Chambers, John C; Kooner, Jaspal S; Kadowaki, Takashi; Deloukas, Panos; Rader, Daniel J; Danesh, John; Sanghera, Dharambir K

    2013-05-01

    We performed a genome-wide association study (GWAS) and a multistage meta-analysis of type 2 diabetes (T2D) in Punjabi Sikhs from India. Our discovery GWAS in 1,616 individuals (842 case subjects) was followed by in silico replication of the top 513 independent single nucleotide polymorphisms (SNPs) (P < 10⁻³) in Punjabi Sikhs (n = 2,819; 801 case subjects). We further replicated 66 SNPs (P < 10⁻⁴) through genotyping in a Punjabi Sikh sample (n = 2,894; 1,711 case subjects). On combined meta-analysis in Sikh populations (n = 7,329; 3,354 case subjects), we identified a novel locus in association with T2D at 13q12 represented by a directly genotyped intronic SNP (rs9552911, P = 1.82 × 10⁻⁸) in the SGCG gene. Next, we undertook in silico replication (stage 2b) of the top 513 signals (P < 10⁻³) in 29,157 non-Sikh South Asians (10,971 case subjects) and de novo genotyping of up to 31 top signals (P < 10⁻⁴) in 10,817 South Asians (5,157 case subjects) (stage 3b). In combined South Asian meta-analysis, we observed six suggestive associations (P < 10⁻⁵ to < 10⁻⁷), including SNPs at HMG1L1/CTCFL, PLXNA4, SCAP, and chr5p11. Further evaluation of 31 top SNPs in 33,707 East Asians (16,746 case subjects) (stage 3c) and 47,117 Europeans (8,130 case subjects) (stage 3d), and joint meta-analysis of 128,127 individuals (44,358 case subjects) from 27 multiethnic studies, did not reveal any additional loci nor was there any evidence of replication for the new variant. Our findings provide new evidence on the presence of a population-specific signal in relation to T2D, which may provide additional insights into T2D pathogenesis.

  6. Acute Exacerbations and Lung Function Loss in Smokers with and without Chronic Obstructive Pulmonary Disease.

    PubMed

    Dransfield, Mark T; Kunisaki, Ken M; Strand, Matthew J; Anzueto, Antonio; Bhatt, Surya P; Bowler, Russell P; Criner, Gerard J; Curtis, Jeffrey L; Hanania, Nicola A; Nath, Hrudaya; Putcha, Nirupama; Roark, Sarah E; Wan, Emily S; Washko, George R; Wells, J Michael; Wendt, Christine H; Make, Barry J

    2017-02-01

    Acute exacerbations of chronic obstructive pulmonary disease (COPD) increase the risk of death and drive healthcare costs, but whether they accelerate loss of lung function remains controversial. Whether exacerbations in subjects with mild COPD or similar acute respiratory events in smokers without airflow obstruction affect lung function decline is unknown. To determine the association between acute exacerbations of COPD (and acute respiratory events in smokers without COPD) and the change in lung function over 5 years of follow-up. We examined data on the first 2,000 subjects who returned for a second COPDGene visit 5 years after enrollment. Baseline data included demographics, smoking history, and computed tomography emphysema. We defined exacerbations (and acute respiratory events in those without established COPD) as acute respiratory symptoms requiring either antibiotics or systemic steroids, and severe events by the need for hospitalization. Throughout the 5-year follow-up period, we collected self-reported acute respiratory event data at 6-month intervals. We used linear mixed models to fit FEV 1 decline based on reported exacerbations or acute respiratory events. In subjects with COPD, exacerbations were associated with excess FEV 1 decline, with the greatest effect in Global Initiative for Chronic Obstructive Lung Disease stage 1, where each exacerbation was associated with an additional 23 ml/yr decline (95% confidence interval, 2-44; P = 0.03), and each severe exacerbation with an additional 87 ml/yr decline (95% confidence interval, 23-151; P = 0.008); statistically significant but smaller effects were observed in Global Initiative for Chronic Obstructive Lung Disease stage 2 and 3 subjects. In subjects without airflow obstruction, acute respiratory events were not associated with additional FEV 1 decline. Exacerbations are associated with accelerated lung function loss in subjects with established COPD, particularly those with mild disease. Trials are needed to test existing and novel therapies in subjects with early/mild COPD to potentially reduce the risk of progressing to more advanced lung disease. Clinical trial registered with www.clinicaltrials.gov (NCT 00608764).

  7. How do sock ply changes affect residual-limb fluid volume in people with transtibial amputation?

    PubMed

    Sanders, Joan E; Harrison, Daniel S; Allyn, Katheryn J; Myers, Timothy R; Ciol, Marcia A; Tsai, Elaine C

    2012-01-01

    The purpose of this research was to investigate the influence of sock addition and removal on residual-limb fluid volume in people using prosthetic limbs. We used bioimpedance analysis to measure residual-limb extracellular fluid volume on 28 transtibial amputee subjects during 30 min test sessions. Upon addition of a one-ply polyester sock, residual-limb fluid volume changes ranged from -4.0% to 0.8% (mean -0.9 +/- 1.3%) of the initial limb fluid volume. Changes for sock removal ranged from -1.2% to 2.8% (mean 0.5 +/- 0.8%). Subjects who reduced in fluid volume with both addition and removal of a sock and subjects with high positive ratios between the fluid-volume loss upon sock addition and gain upon sock removal (high add/remove [AR] ratios) tended to have arterial disease, were obese, and were smokers. Subjects with low positive AR ratios, subjects who increased in fluid volume both with sock addition and removal, and a single subject who increased in fluid volume with sock addition and decreased with sock removal tended to be nonsmokers and either individuals in good health without complications or individuals without arterial problems. Results are relevant for the anticipation of limb volume changes during prosthetic fitting and toward the design of adjustable-socket technologies.

  8. Prevalence and Duration of Asymptomatic Clostridium difficile Carriage among Healthy Subjects in Pittsburgh, Pennsylvania

    PubMed Central

    Galdys, Alison L.; Nelson, Jemma S.; Shutt, Kathleen A.; Schlackman, Jessica L.; Pakstis, Diana L.; Pasculle, A. William; Marsh, Jane W.; Harrison, Lee H.

    2014-01-01

    Previous studies suggested that 7 to 15% of healthy adults are colonized with toxigenic Clostridium difficile. To investigate the epidemiology, genetic diversity, and duration of C. difficile colonization in asymptomatic persons, we recruited healthy adults from the general population in Allegheny County, Pennsylvania. Participants provided epidemiological and dietary intake data and submitted stool specimens. The presence of C. difficile in stool specimens was determined by anaerobic culture. Stool specimens yielding C. difficile underwent nucleic acid testing of the tcdA gene segment with a commercial assay; tcdC genotyping was performed on C. difficile isolates. Subjects positive for C. difficile by toxigenic anaerobic culture were asked to submit additional specimens. One hundred six (81%) of 130 subjects submitted specimens, and 7 (6.6%) of those subjects were colonized with C. difficile. Seven distinct tcdC genotypes were observed among the 7 C. difficile-colonized individuals, including tcdC genotype 20, which has been found in uncooked ground pork in this region. Two (33%) out of 6 C. difficile-colonized subjects who submitted additional specimens tested positive for identical C. difficile strains on successive occasions, 1 month apart. The prevalence of C. difficile carriage in this healthy cohort is concordant with prior estimates. C. difficile-colonized individuals may be important reservoirs for C. difficile and may falsely test positive for infections due to C. difficile when evaluated for community-acquired diarrhea caused by other enteric pathogens. PMID:24759727

  9. Factors Associated With Surgery Clerkship Performance and Subsequent USMLE Step Scores.

    PubMed

    Dong, Ting; Copeland, Annesley; Gangidine, Matthew; Schreiber-Gregory, Deanna; Ritter, E Matthew; Durning, Steven J

    2018-03-12

    We conducted an in-depth empirical investigation to achieve a better understanding of the surgery clerkship from multiple perspectives, including the influence of clerkship sequence on performance, the relationship between self-logged work hours and performance, as well as the association between surgery clerkship performance with subsequent USMLE Step exams' scores. The study cohort consisted of medical students graduating between 2015 and 2018 (n = 687). The primary measures of interest were clerkship sequence (internal medicine clerkship before or after surgery clerkship), self-logged work hours during surgery clerkship, surgery NBME subject exam score, surgery clerkship overall grade, and Step 1, Step 2 CK, and Step 3 exam scores. We reported the descriptive statistics and conducted correlation analysis, stepwise linear regression analysis, and variable selection analysis of logistic regression to answer the research questions. Students who completed internal medicine clerkship prior to surgery clerkship had better performance on surgery subject exam. The subject exam score explained an additional 28% of the variance of the Step 2 CK score, and the clerkship overall score accounted for an additional 24% of the variance after the MCAT scores and undergraduate GPA were controlled. Our finding suggests that the clerkship sequence does matter when it comes to performance on the surgery NBME subject exam. Performance on the surgery subject exam is predictive of subsequent performance on future USMLE Step exams. Copyright © 2018 Association of Program Directors in Surgery. Published by Elsevier Inc. All rights reserved.

  10. Determinants of fast food consumption among Iranian high school students based on planned behavior theory.

    PubMed

    Sharifirad, Gholamreza; Yarmohammadi, Parastoo; Azadbakht, Leila; Morowatisharifabad, Mohammad Ali; Hassanzadeh, Akbar

    2013-01-01

    This study was conducted to identify some factors (beliefs and norms) which are related to fast food consumption among high school students in Isfahan, Iran. We used the framework of the theory planned behavior (TPB) to predict this behavior. Cross-sectional data were available from high school students (n = 521) who were recruited by cluster randomized sampling. All of the students completed a questionnaire assessing variables of standard TPB model including attitude, subjective norms, perceived behavior control (PBC), and the additional variables past behavior, actual behavior control (ABC). The TPB variables explained 25.7% of the variance in intentions with positive attitude as the strongest (β = 0.31, P < 0.001) and subjective norms as the weakest (β = 0.29, P < 0.001) determinant. Concurrently, intentions accounted for 6% of the variance for fast food consumption. Past behavior and ABC accounted for an additional amount of 20.4% of the variance in fast food consumption. Overall, the present study suggests that the TPB model is useful in predicting related beliefs and norms to the fast food consumption among adolescents. Subjective norms in TPB model and past behavior in TPB model with additional variables (past behavior and actual behavior control) were the most powerful predictors of fast food consumption. Therefore, TPB model may be a useful framework for planning intervention programs to reduce fast food consumption by students.

  11. Accelerated weathering of fire-retardant-treated wood for fire testing

    Treesearch

    Robert H. White

    2009-01-01

    Fire-retardant-treated products for exterior applications must be subjected to actual or accelerated weathering prior to fire testing. For fire-retardant-treated wood, the two accelerated weathering methods have been Method A and B of ASTM D 2898. The rain test is Method A of ASTM D 2898. Method B includes exposures to ultraviolet (UV) sunlamps in addition to water...

  12. Advances in Additive Manufacturing

    DTIC Science & Technology

    2016-07-14

    of 3D - printed structures. Analysis examples will include quantification of tolerance differences between the designed and manufactured parts, void...15. SUBJECT TERMS 3-D printing , validation and verification, nondestructive inspection, print -on-the-move, prototyping 16. SECURITY CLASSIFICATION...researching the formation of AM-grade metal powder from battlefield scrap and operating base waste, 2) potential of 3-D printing with sand to make

  13. Factors affecting behavioral changes in response to road fees : some analyses of the effect of attitudes, transit access and fuel efficiency on changes in miles driven, final report, February 2009.

    DOT National Transportation Integrated Search

    2009-02-01

    The Oregon Department of Transportation tested a system to collect a vehicle-based mileage fee as a replacement for the Oregon gas tax. This : project reports on additional analysis of the data from that experiment. Subjects include analysis of the c...

  14. Familial leuconychia, knuckle pads, hearing loss, and palmoplantar hyperkeratosis: an additional family with Bart-Pumphrey syndrome.

    PubMed

    Ramer, J C; Vasily, D B; Ladda, R L

    1994-01-01

    A family with five members who have variable findings of leuconychia, knuckle pads, hearing loss, and palmoplantar hyperkeratosis is described. The findings in these subjects are compared with those noted in previously reported patients with Bart-Pumphrey syndrome. The range of disorders which include knuckle pads as part of the phenotype is reviewed.

  15. "Crossing the Rubicon": Understanding Chinese EFL Students' Volitional Process Underlying In-Class Participation with the Theory of Planned Behaviour

    ERIC Educational Resources Information Center

    Girardelli, Davide; Patel, Vijay K.; Martins-Shannon, Janine

    2017-01-01

    An extended model based on the theory of planned behaviour (TPB) was used to study Chinese English as a foreign language (EFL) students' in-class participation. The model included the core TPB constructs (behavioural intentions, attitudes, subjective norms, and perceived behavioural control/self-efficacy) and 2 additional constructs (foreign…

  16. Scientific Support for NQR Explosive Detection Development

    DTIC Science & Technology

    2006-07-01

    Final 3. DATES COVERED (From - To) 8 March 2004 - 7 March 2006 4. TITLE AND SUBTITLE Scientific Support for NQR Explosive Detection Development...Laboratory (NRL) to improve explosive detection using nuclear quadrupole resonance ( NQR ) is summarized. The work includes studies of the effects...superconducting coils for explosive detection. Additional studies involving slowly rotating NQR measurements were also pursued. 15. SUBJECT TERMS Nuclear

  17. 76 FR 15295 - Floor-Standing, Metal-Top Ironing Tables and Certain Parts Thereof From the People's Republic of...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-03-21

    ... rests, linen racks, and others. The subject ironing tables may be sold with or without a pad and/or... an included feature such as an iron rest or linen rack. The term ``complete'' ironing table means... without additional features, e.g., iron rest or linen rack. The term ``incomplete'' ironing table means...

  18. 77 FR 55806 - Floor-Standing, Metal-Top Ironing Tables and Certain Parts Thereof From the People's Republic of...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-09-11

    ... rests, linen racks, and others. The subject ironing tables may be sold with or without a pad and/or... an included feature such as an iron rest or linen rack. The term ``complete'' ironing table means... without additional features, e.g., iron rest or linen rack. The term ``incomplete'' ironing table means...

  19. 76 FR 15297 - Floor-Standing, Metal-Top Ironing Tables and Certain Parts Thereof From the People's Republic of...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-03-21

    ... rests, linen racks, and others. The subject ironing tables may be sold with or without a pad and/or... an included feature such as an iron rest or linen rack. The term ``complete'' ironing table means... without additional features, e.g., iron rest or linen rack. The term ``incomplete'' ironing table means...

  20. Harvesting intensity affects forest structure and composition in an upland Amazonian forest

    Treesearch

    John A. Parrotta; John K. Francis; Oliver H. Knowles; NO-VALUE

    2002-01-01

    Forest structure and floristic composition were studied in a series of 0.5 ha natural forest plots at four sites near Porto Trombetas in Pará State, Brazil, 11–12 years after being subjected to differing levels of above-ground biomass harvest and removal. In addition to undisturbed control plots, experimental treatments included: removal of...

  1. Molecular and clinical characterization of the myopathic form of mitochondrial DNA depletion syndrome caused by mutations in the thymidine kinase (TK2) gene.

    PubMed

    Chanprasert, Sirisak; Wang, Jing; Weng, Shao-Wen; Enns, Gregory M; Boué, Daniel R; Wong, Brenda L; Mendell, Jerry R; Perry, Deborah A; Sahenk, Zarife; Craigen, William J; Alcala, Francisco J Climent; Pascual, Juan M; Melancon, Serge; Zhang, Victor Wei; Scaglia, Fernando; Wong, Lee-Jun C

    2013-01-01

    Mitochondrial DNA (mtDNA) depletion syndromes (MDSs) are a clinically and molecularly heterogeneous group of mitochondrial cytopathies characterized by severe mtDNA copy number reduction in affected tissues. Clinically, MDSs are mainly categorized as myopathic, encephalomyopathic, hepatocerebral, or multi-systemic forms. To date, the myopathic form of MDS is mainly caused by mutations in the TK2 gene, which encodes thymidine kinase 2, the first and rate limiting step enzyme in the phosphorylation of pyrimidine nucleosides. We analyzed 9 unrelated families with 11 affected subjects exhibiting the myopathic form of MDS, by sequencing the TK2 gene. Twelve mutations including 4 novel mutations were detected in 9 families. Skeletal muscle specimens were available from 7 out of 11 subjects. Respiratory chain enzymatic activities in skeletal muscle were measured in 6 subjects, and enzymatic activities were reduced in 3 subjects. Quantitative analysis of mtDNA content in skeletal muscle was performed in 5 subjects, and marked mtDNA content reduction was observed in each. In addition, we outline the molecular and clinical characteristics of this syndrome in a total of 52 patients including those previously reported, and a total of 36 TK2 mutations are summarized. Clinically, hypotonia and proximal muscle weakness are the major phenotypes present in all subjects. In summary, our study expands the molecular and clinical spectrum associated with TK2 deficiency. © 2013.

  2. Sarcopenia is associated with an increased risk of advanced colorectal neoplasia.

    PubMed

    Park, Youn Su; Kim, Ji Won; Kim, Byeong Gwan; Lee, Kook Lae; Lee, Jae Kyung; Kim, Joo Sung; Koh, Seong-Joon

    2017-04-01

    Although sarcopenia is associated with an increased risk for mortality after the curative resection of colorectal cancer, its influence on the development of advanced colonic neoplasia remains unclear. This study included 1270 subjects aged 40 years or older evaluated with first-time screening colonoscopy at Seoul National University Boramae Health Care Center from January 2010 to February 2015. Skeletal muscle mass was measured with a body composition analyzer (direct segmental multifrequency bioelectrical impedance analysis method). Multiple logistic regression analysis was performed to determine whether sarcopenia is associated with advanced colorectal neoplasia. Of 1270 subjects, 139 (10.9%) were categorized into the sarcopenia group and 1131 (89.1%) into the non-sarcopenia group. In the non-sarcopenia group, 55 subjects (4.9%) had advanced colorectal neoplasia. However, in the sarcopenia group, 19 subjects (13.7%) had advanced colorectal neoplasia, including 1 subject with invasive colorectal cancer (0.7%). In addition, subjects with sarcopenia had a higher prevalence of advanced adenoma (P < 0.001) than those without sarcopenia. According to the multiple logistic regression analysis adjusted for variable confounders, age (odds ratio 1.062, 95% confidence interval 1.032-1.093; P < 0.001), male sex (odds ratio 1.749, 95% confidence interval 1.008-3.036; P = 0.047), and sarcopenia (odds ratio 2.347, 95% confidence interval 1.311-4.202; P = 0.004) were associated with an advanced colorectal neoplasia. Sarcopenia is associated with an increased risk of advanced colorectal neoplasia.

  3. Impact of social isolation on behavioral health in elderly: Systematic review.

    PubMed

    Choi, Hanbyul; Irwin, Michael R; Cho, Hyong Jin

    2015-12-22

    To examine and compare the effects of subjective and objective social isolation on behavioral health in elderly adults. A systematic search of PubMed was performed for original research articles from peer-reviewed journals examining one of the following topics: "Social isolation and sleep disturbance", "social isolation and depression", or "social isolation and fatigue in older adults". Studies were selected following the criteria established based on the aim of this review. Data were extracted from the articles by two independent reviewers. Due to the heterogeneity in study designs and outcome measures of the included studies, qualitative and narrative analyses were conducted. The set criteria were used to select a total of 16 studies for the review. Of the 16, 13 were cross-sectional studies. The characteristics of study populations were identified as follows. A total of 12 studies randomly selected subjects irrespective of pre-existing health conditions. Consequently, an unspecified number of the study subjects had chronic diseases in the studies compared. In addition, cultural and ethnic backgrounds of studies in this review were diverse, and included subjects living in North America, South America, Asia, Europe, and Oceania. Both subjective and objective types of social isolation increased behavioral symptoms, such as sleep disturbance, depressive symptoms, and fatigue in older adults. Furthermore, a few recent studies reported stronger effects of subjective social isolation than objective social isolation on sleep disturbance and depressive symptoms. Social isolation affects behavioral health in older adults. Compared to the objective social isolation, subjective social isolation contributes more significantly to sleep disturbance and depression.

  4. Compulsory Use of the Backboard is Associated with Increased Frequency of Thoracolumbar Imaging.

    PubMed

    Clemency, Brian M; Tanski, Christopher T; Gibson Chambers, Jennifer; O'Brien, Michael; Knapp, Andrew S; Clark, Alexander J; McGoff, Patrick; Innes, Johanna; Lindstrom, Heather A; Hostler, David

    2018-02-15

    Backboards have been shown to cause pain in uninjured patients. This may alter physical exam findings, leading emergency department (ED) providers to suspect a spinal injury when none exists resulting in additional imaging of the thoracolumbar spine. New York had previously employed a "Spinal Immobilization" protocol that included compulsory backboard application for all patients with suspected spinal injuries. In 2015, New York instituted a new "Spinal Motion Restriction" protocol that made backboard use optional for these patients. The objective of this study was to determine if this protocol change was associated with decreased backboard utilization and ED thoracolumbar spine imaging. This was a retrospective before-and-after chart review of subjects transported by a single emergency medical services (EMS) agency to one of four EDs for emergency calls dispatched as motor vehicle collisions (MVC). EMS and ED data were included for all calls within a 6-month interval before and after the protocol change. The protocol change was implemented in the second half of 2015. Subject demographics, backboard use, and spine imaging were reviewed for the intervals January-June 2015 and January-June 2016. There were 818 subjects in the before period and 796 subjects in the after period. Subjects were similar in terms of gender, age and type of MVC in both periods. A backboard was utilized for 440 (54%) subjects in the before period and 92 (12%) subjects in the after period (p < 0.001). ED thoracic spine imaging was performed on 285 (35%) subjects in the before period, and 235 (30%) subjects in the after period (p = 0.02). ED lumbar spine imaging was performed for 335 (41%) subjects in the before period, and 281 (35%) subjects in the after period (p = 0.02). A shift from a spinal immobilization protocol to a spinal motion restriction protocol was associated with a decrease in backboard utilization by EMS providers and a decrease in thoracolumbar spine imaging by ED providers.

  5. Glycaemic and satiating properties of potato products.

    PubMed

    Leeman, M; Ostman, E; Björck, I

    2008-01-01

    To investigate glycaemic and satiating properties of potato products in healthy subjects using energy-equivalent or carbohydrate-equivalent test meals, respectively. Thirteen healthy subjects volunteered for the first study, and 14 for the second. The tests were performed at Applied Nutrition and Food Chemistry, Lund University, Sweden. EXPERIMENTAL DESIGN AND TEST MEALS: All meals were served as breakfast in random order after an overnight fast. Study 1 included four energy-equivalent (1000 kJ) meals of boiled potatoes, french fries, or mashed potatoes; the latter varying in portion size by use of different amounts of water. The available carbohydrate content varied between 32.5 and 50.3 g/portion. Capillary blood samples were collected during 240 min for analysis of glucose, and satiety was measured with a subjective rating scale. Study 2 included four carbohydrate-equivalent meals (50 g available carbohydrates) of french fries, boiled potatoes served with and without addition of oil, and white wheat bread (reference). The energy content varied between 963 and 1534 kJ/portion. Capillary blood samples were collected during 180 min for analysis of glucose, and satiety was measured using a subjective rating scale. Study 1: boiled potatoes induced higher subjective satiety than french fries when compared on an energy-equivalent basis. The french fries elicited the lowest early glycaemic response and was less satiating in the early postprandial phase (area under the curve (AUC) 0-45 min). No differences were found in glycaemic or satiety response between boiled or mashed potatoes. Study 2: french fries resulted in a significantly lower glycaemic response (glycaemic index (GI)=77) than boiled potatoes either with or without addition of oil (GI=131 and 111, respectively). No differences were found in subjective satiety response between the products served on carbohydrate equivalence. Boiled potatoes were more satiating than french fries on an energy-equivalent basis, the effect being most prominent in the early postprandial phase, whereas no difference in satiety could be seen on a carbohydrate-equivalent basis. The lowered GI for french fries, showing a typical prolonged low-GI profile, could not be explained by the fat content per se.

  6. Do enteric neurons make hypocretin?

    PubMed

    Baumann, Christian R; Clark, Erika L; Pedersen, Nigel P; Hecht, Jonathan L; Scammell, Thomas E

    2008-04-10

    Hypocretins (orexins) are wake-promoting neuropeptides produced by hypothalamic neurons. These hypocretin-producing cells are lost in people with narcolepsy, possibly due to an autoimmune attack. Prior studies described hypocretin neurons in the enteric nervous system, and these cells could be an additional target of an autoimmune process. We sought to determine whether enteric hypocretin neurons are lost in narcoleptic subjects. Even though we tried several methods (including whole mounts, sectioned tissue, pre-treatment of mice with colchicine, and the use of various primary antisera), we could not identify hypocretin-producing cells in enteric nervous tissue collected from mice or normal human subjects. These results raise doubts about whether enteric neurons produce hypocretin.

  7. An ESR study of the UV degradation of FEP

    NASA Technical Reports Server (NTRS)

    George, G. A.; Hill, D. J. T.; Odonnell, J. H.; Pomery, P. J.; Rasoul, F.

    1992-01-01

    Spacecraft in low earth orbit are subjected to significant levels of high energy radiation, including ultraviolet (UV) and visible ultraviolet (VUV) wavelengths. The effects of UV radiation are enhanced over those at the surface of the earth, where the only incident wavelengths are greater than 290 nm. In low earth orbit the incident UV wavelengths extend below 290 nm into the VUV region, where the Lyman alpha-emissions of atomic hydrogen occur at 121 nm. In addition to electromagnetic radiation, in low earth orbit polymer materials may also be subjected to atomic oxygen particle radiation, which will result in direct oxidation of the polymer.

  8. Frequency and outcomes of painful physical symptoms in a naturalistic population with major depressive disorder: an analysis of pooled observational studies focusing on subjects aged 65 years and over.

    PubMed

    Brnabic, A; Raskin, J; Alev, L; Serap Monkul, E; Lowry, A

    2012-12-01

    To estimate the frequency of painful physical symptoms (PPS) in elderly subjects (≥ 65 years) with major depressive disorder (MDD) in real-world clinical conditions and to establish whether PPS are associated with poor depression outcomes, including more severe depression and worse health-related quality of life (HRQoL). Observational studies of MDD that included assessment of PPS and elderly subjects were screened. Measures of PPS were based on the Somatic Symptom Inventory (SSI) or Visual Analogue Scale (VAS). Data from a variety of depressive symptom severity and HRQoL scales were used. Analysis cohorts were based on age [aged ≥ 65 years (elderly) or < 65 years (younger)] and/or PPS status (presence or absence); five subsets were used to examine specific outcomes in matched elderly subjects. Data from seven studies (representing 26 countries) were collated. Of the 11,477 subjects, 14% were aged ≥ 65 years and 71% were classified as having PPS (PPS+). PPS were more frequent in elderly subjects (74% vs. 70% of younger subjects) and were positively associated with being female and Hispanic, and negatively associated with being East Asian in the elderly. The presence of PPS was associated with more severe clinical symptomatology and comparatively poorer HRQoL in elderly subjects. PPS, although frequent in younger MDD patients, were slightly more frequent in elderly MDD patients and associated with comparatively poorer clinical and functional outcomes. As elderly patients report somatic symptoms more readily than emotional symptoms, physicians should consider depression in addition to physical causes when PPS are present. © 2012 Blackwell Publishing Ltd.

  9. Convection Weather Detection by General Aviation Pilots with Convectional and Data-Linked Graphical Weather Information Sources

    NASA Technical Reports Server (NTRS)

    Chamberlain, James P.; Latorella, Kara A.

    2001-01-01

    This study compares how well general aviation (GA) pilots detect convective weather in flight with different weather information sources. A flight test was conducted in which GA pilot test subjects were given different in-flight weather information cues and flown toward convective weather of moderate or greater intensity. The test subjects were not actually flying the aircraft, but were given pilot tasks representative of the workload and position awareness requirements of the en route portion of a cross country GA flight. On each flight, one test subject received weather cues typical of a flight in visual meteorological conditions (VMC), another received cues typical of flight in instrument meteorological conditions (IMC), and a third received cues typical of flight in IMC but augmented with a graphical weather information system (GWIS). The GWIS provided the subject with near real time data-linked weather products, including a weather radar mosaic superimposed on a moving map with a symbol depicting the aircraft's present position and direction of track. At several points during each flight, the test subjects completed short questionnaires which included items addressing their weather situation awareness and flight decisions. In particular, test subjects were asked to identify the location of the nearest convective cells. After the point of nearest approach to convective weather, the test subjects were asked to draw the location of convective weather on an aeronautical chart, along with the aircraft's present position. This paper reports preliminary results on how accurately test subjects provided with these different weather sources could identify the nearest cell of moderate or greater intensity along their route of flight. Additional flight tests are currently being conducted to complete the data set.

  10. Factors associated with the quality of life of subjects with Parkinson's disease and burden on their caregivers.

    PubMed

    Rodríguez-Violante, M; Camacho-Ordoñez, A; Cervantes-Arriaga, A; González-Latapí, P; Velázquez-Osuna, S

    2015-06-01

    Parkinson's disease affects the quality of life of the individual with the disease in addition to creating a burden on the caregiver. Factors related to these effects include motor and non-motor aspects of the disease, as well as traits inherent to the caregiver. We evaluated subjects with Parkinson's disease using the following instruments: Quality of Life Questionnaire PDQ-8, Movement Disorders Society Unified Parkinson's disease Rating Scale part i to iv (MDS-UPDRS), and Hoehn and Yahr staging. The Zarit Burden Inventory was used to assess all primary caregivers. Major demographic and clinical variables were also recorded. A total of 250 subjects with Parkinson's disease were included, of whom 201 had a primary caregiver. In the multivariate analysis, predictors of poor quality of life for a subject with Parkinson's disease were the MDS-UPDRS I score (β=.39, P<.001), MDS-UPDRS II score (β=.21, P<.001), and MDS-UPDRS III score (β=.07, P=.004). Regarding caregiver burden, the MDS-UPDRS II score (β=.54, P=.007) was the most influential factor. The present study shows a relationship between quality of life for the subject with Parkinson's disease and the caregiver's perceived burden. However, the factors that determine each situation appear to be distinct. Copyright © 2013 Sociedad Española de Neurología. Published by Elsevier España, S.L.U. All rights reserved.

  11. Perceptual benefit and functional outcomes for children using sequential bilateral cochlear implants.

    PubMed

    Galvin, Karyn Louise; Mok, Mansze; Dowell, Richard C

    2007-08-01

    To evaluate the additional perceptual benefit provided to children through the use of two cochlear implants in comparison to one after 6 to 13 mo experience with sequential bilateral implants. A second cochlear implant was received by 11 children. The principal selection criteria were being age 4 to 15 yr with a bilateral profound hearing loss and being a consistent user of a first implant with a commitment to use of a second implant. Horizontal localization was assessed by using pink noise bursts presented from a 180 degrees , eight-loudspeaker array. Speech perception was assessed by using a four-alternative forced-choice spondee test, with speech presented from in front and adaptive background noise presented from 90 degrees to the left or right. Both tests were completed in the first implant alone and bilateral conditions. A questionnaire measured the pre- to postoperative change in the parent's ratings of the child's performance in specific listening situations. Items were related to speech perception, spatial hearing, or other qualities of hearing. Regular parental reports of device use, attitude and performance were collected. Most subjects were assessed at 6 mo after surgery, with two assessed at 13 mo. The 11 subjects demonstrated a great range of outcomes. For one subject, only anecdotal data were collected. Speech perception testing indicated that when noise was presented ipsilateral to the first implant, 8 of 10 subjects showed a benefit in the bilateral condition. None of the nine subjects tested showed a benefit when noise was contralateral to the first implant. Generally, there was no benefit to localization in the bilateral condition. For eight subjects, postoperative performance ratings were generally higher than preoperative ratings, particularly in the spatial hearing section. Anecdotal reports indicated that most subjects had a negative attitude toward, and gained limited experience with, the second implant alone. The subjects developed a range of speech perception skills, from detection to conversation level. Regarding the use of bilateral implants, attitudes were more positive and device use was consistent for eight subjects, and six parents reported some evidence of improved performance in daily life. Children over age 4 yr may gain significant additional benefit from a second implant, including improved speech perception in some noise contexts and functional advantages in daily life. There is, however, no evidence from this study to suggest that binaural listening skills, including localization, will develop during the first 6 mo. Furthermore, some children who may be committed users of a first implant may not adapt to or benefit from a second implant during the first 6 mo of device use. Although the factors influencing benefit cannot be clearly identified, limited preoperative auditory experience with the second ear, a delay of years between implants, relatively advanced age, and lack of second-implant-alone experience do not preclude benefit. Continued evaluation of these and additional subjects will clarify the factors that do contribute to benefit. Such information will be vital in helping families of implanted children to make an informed decision regarding a second implant.

  12. Analysis of thirteen predatory publishers: a trap for eager-to-publish researchers.

    PubMed

    Bolshete, Pravin

    2018-01-01

    To demonstrate a strategy employed by predatory publishers to trap eager-to-publish authors or researchers into submitting their work. This was a case study of 13 potential, possible, or probable predatory scholarly open-access publishers with similar characteristics. Eleven publishers were included from Beall's list and two additional publishers were identified from a Google web search. Each publisher's site was visited and its content analyzed. Publishers publishing biomedical journals were further explored and additional data was collected regarding their volumes, details of publications and editorial-board members. Overall, the look and feel of all 13 publishers was similar including names of publishers, website addresses, homepage content, homepage images, list of journals and subject areas, as if they were copied and pasted. There were discrepancies in article-processing charges within the publishers. None of the publishers identified names in their contact details and primarily included only email addresses. Author instructions were similar across all 13 publishers. Most publishers listed journals of varied subject areas including biomedical journals (12 publishers) covering different geographic locations. Most biomedical journals published none or very few articles. The highest number of articles published by any single biomedical journal was 28. Several editorial-board members were listed across more than one journals, with one member listed 81 times in different 69 journals (i.e. twice in 12 journals). There was a strong reason to believe that predatory publishers may have several publication houses with different names under a single roof to trap authors from different geographic locations.

  13. Objective and subjective responses in patients refitted to daily-wear silicone hydrogel contact lenses.

    PubMed

    Dumbleton, Kathryn; Keir, Nancy; Moezzi, Amir; Feng, Yunwei; Jones, Lyndon; Fonn, Desmond

    2006-10-01

    Silicone hydrogel (SiH) lenses offer many physiological advantages for daily wear (DW) in addition to the continuous-wear modality for which they were originally developed. The purpose of this study was to investigate the clinical performance and physiological responses in a group of successful long-term wearers of conventional hydrogel lenses when refitted with DW SiH contact lenses. Eighty-seven successful soft lens wearers (8.4+/-4.7 years of prior lens wear) participated in this study. Bulbar and limbal hyperemia were subjectively graded and digitally photographed for subsequent masked objective evaluation. Subjective symptoms were scored using visual analog scales. In addition, refractive error, corneal curvature, and corneal thickness were measured. All subjects were refitted with Focus Night & Day (lotrafilcon A) SiH lenses; however, to reduce the potential for bias, they were informed that they were being randomly assigned to wear either low oxygen permeability (Dk) lenses or high Dk SiH lenses and were "masked" as to their lens assignment. Subjects returned after 1 week, 1 month, and 2 months of DW, at which time all gradings, photographs, and measurements were repeated. End-of-day subjective symptoms were also graded periodically during the study. Ninety-three percent of subjects were successfully refitted. Both objective and subjective evaluations showed that bulbar and limbal hyperemia decreased significantly in all quadrants during the study (p<0.001), particularly for those subjects with greater baseline hyperemia (p<0.001). Subjects reported a concurrent reduction in end-of-day dryness and improved end-of-day comfort compared with their habitual lenses (p<0.001). No significant changes in refractive error, tarsal papillary response, corneal curvature, or corneal thickness were found during the study. Hyperemia in contact lens wearers may be attributed to a number of factors, including hypoxia. Refitting existing low Dk lens wearers with SiH lenses on a DW basis can result in a decrease in hyperemia, which may be significant for some subjects and also results in improvements in symptoms of dryness and discomfort.

  14. Effects of hip strengthening on early outcomes following anterior cruciate ligament reconstruction.

    PubMed

    Garrison, J Craig; Bothwell, Jim; Cohen, Kiley; Conway, John

    2014-04-01

    It is not clear whether the addition of hip strengthening exercises will improve outcomes during the early stages of ACL rehabilitation. The purpose of this study was to determine the effects of the addition of isolated hip strengthening exercises to traditional rehabilitation on early outcomes (within the first 3 months) after ACL reconstruction (ACLR). A total of 43 subjects (18.8±6.9, 21 females, 22 males) who were in the process of rehabilitation following ACLR participated. Subjects were randomly assigned to one of two different treatment groups (1= traditional rehabilitation [NoHip], 2= traditional plus isolated hip strengthening rehabilitation [Hip]). Assessment included the International Knee Documentation Committee (IKDC) Subjective Knee Form, Visual Analog Scale (VAS) for pain during activities of daily living, and knee extension range of motion (ROM) side to side difference taken at weeks 1, 4, 8, and 12. In addition, dynamic balance was assessed with the Y Balance Test™ at 8 and 12 weeks. A mixed model repeated measures ANOVA was performed for IKDC, VAS, and ROM. A one-way ANOVA was used to assess mean group differences for Y Balance Test - Lower Quarter (YBT-LQ) side to side difference scores at 8 and 12 weeks. There was no significant interaction for group by time across VAS (p = .463), IKDC (p = .819), or ROM (p = .513) side to side differences A significant difference was found between groups for YBT-LQ Anterior Reach (ANT) side to side difference at 12 weeks (p = .008) with the Hip group demonstrating smaller side to side reach differences than the NoHip group. No significant side to side differences were seen between groups for YBT-LQ Posteromedial (PM) or Posterolateral (PL) at 12 weeks (PM: p = .254; PL: p = .617). Rehabilitation including hip strengthening exercises appears to improve sagittal plane dynamic balance at three months post ACLR as compared to traditional rehabilitation. No differences were seen between groups for pain, ROM, and subjective function during the first 3 months following ACLR. Level 2b.

  15. OntoBrowser: a collaborative tool for curation of ontologies by subject matter experts.

    PubMed

    Ravagli, Carlo; Pognan, Francois; Marc, Philippe

    2017-01-01

    The lack of controlled terminology and ontology usage leads to incomplete search results and poor interoperability between databases. One of the major underlying challenges of data integration is curating data to adhere to controlled terminologies and/or ontologies. Finding subject matter experts with the time and skills required to perform data curation is often problematic. In addition, existing tools are not designed for continuous data integration and collaborative curation. This results in time-consuming curation workflows that often become unsustainable. The primary objective of OntoBrowser is to provide an easy-to-use online collaborative solution for subject matter experts to map reported terms to preferred ontology (or code list) terms and facilitate ontology evolution. Additional features include web service access to data, visualization of ontologies in hierarchical/graph format and a peer review/approval workflow with alerting. The source code is freely available under the Apache v2.0 license. Source code and installation instructions are available at http://opensource.nibr.com This software is designed to run on a Java EE application server and store data in a relational database. philippe.marc@novartis.com. © The Author 2016. Published by Oxford University Press.

  16. OntoBrowser: a collaborative tool for curation of ontologies by subject matter experts

    PubMed Central

    Ravagli, Carlo; Pognan, Francois

    2017-01-01

    Summary: The lack of controlled terminology and ontology usage leads to incomplete search results and poor interoperability between databases. One of the major underlying challenges of data integration is curating data to adhere to controlled terminologies and/or ontologies. Finding subject matter experts with the time and skills required to perform data curation is often problematic. In addition, existing tools are not designed for continuous data integration and collaborative curation. This results in time-consuming curation workflows that often become unsustainable. The primary objective of OntoBrowser is to provide an easy-to-use online collaborative solution for subject matter experts to map reported terms to preferred ontology (or code list) terms and facilitate ontology evolution. Additional features include web service access to data, visualization of ontologies in hierarchical/graph format and a peer review/approval workflow with alerting. Availability and implementation: The source code is freely available under the Apache v2.0 license. Source code and installation instructions are available at http://opensource.nibr.com. This software is designed to run on a Java EE application server and store data in a relational database. Contact: philippe.marc@novartis.com PMID:27605099

  17. Buckling Behavior of Long Anisotropic Plates Subjected to Fully Restrained Thermal Expansion

    NASA Technical Reports Server (NTRS)

    Nemeth, Michael P.

    2001-01-01

    An approach for synthesizing buckling results and behavior for thin balanced and unbalanced symmetric laminates that are subjected to uniform heating or cooling and fully restrained against thermal expansion or contraction is presented. This approach uses a nondimensional analysis for infinitely long, flexurally anisotropic plates that are subjected to combined mechanical loads and is based on useful nondimensional parameters. In addition, stiffness-weighted laminate thermal-expansion parameters are derived that are used to determine critical temperatures in terms of physically intuitive mechanical buckling coefficients, and the effects of membrane orthotropy and membrane anisotropy are included. Many results are presented for some common laminates that are intended to facilitate a structural designer's transition to the use of the generic buckling design curves that are presented in the paper. Several generic buckling design curves are presented that provide physical insight into the buckling response in addition to providing useful design data. Examples are presented that demonstrate the use of the generic design curves. The analysis approach and generic results indicate the effects and characteristics of laminate thermal expansion, membrane orthotropy and anisotropy, and flexural orthotropy and anisotropy in a very general and unifying manner.

  18. Public perception of the terms "cosmetic," "plastic," and "reconstructive" surgery.

    PubMed

    Hamilton, Grant S; Carrithers, Jeffrey S; Karnell, Lucy H

    2004-01-01

    To investigate potential differences in perception of the terms "cosmetic," "plastic," and "reconstructive" as descriptors for surgery. An anonymous questionnaire was offered to subjects over 18 years of age throughout the Unites States via the Internet and in person. The multiple-choice survey measured variables including permanence, risk, expense, recovery, reversibility, pain, technical difficulty, and surgeon training. The questionnaire also included several open-ended questions to capture qualitative perceptions. Semantic differential data were analyzed to measure statistical significance. For most variables--permanence, risk, recovery, reversibility, pain, and surgeon training--the 216 subjects had significantly lower mean responses for cosmetic surgery than those for plastic or reconstructive surgery (P < .002). Overall, the results of this study support the authors' hypothesis that there is a significant difference in perception of cosmetic surgery and plastic or reconstructive surgery. Cosmetic surgery is perceived to be more temporary and less technically difficult than plastic or reconstructive surgery. In addition, cosmetic surgery is believed to be associated with less risk, shorter recovery time, and less pain. Subjects also thought that cosmetic surgeons required significantly less training than plastic or reconstructive surgeons.

  19. On-line DNA analysis system with rapid thermal cycling

    DOEpatents

    Swerdlow, Harold P.; Wittwer, Carl T.

    1999-01-01

    An apparatus particularly suited for subjecting biological samples to any necessary sample preparation tasks, subjecting the sample to rapid thermal cycling, and then subjecting the sample to subsequent on-line analysis using one or more of a number of analytical techniques. The apparatus includes a chromatography device including an injection means, a chromatography pump, and a chromatography column. In addition, the apparatus also contains a capillary electrophoresis device consisting of a capillary electrophoresis column with an inlet and outlet end, a means of injection, and means of applying a high voltage to cause the differential migration of species of interest through the capillary column. Effluent from the liquid chromatography column passes over the inlet end of the capillary electrophoresis column through a tee structure and when the loading of the capillary electrophoresis column is desired, a voltage supply is activated at a precise voltage and polarity over a specific duration to cause sample species to be diverted from the flowing stream to the capillary electrophoresis column. A laser induced fluorescence detector preferably is used to analyze the products separated while in the electrophoresis column.

  20. On-line DNA analysis system with rapid thermal cycling

    DOEpatents

    Swerdlow, H.P.; Wittwer, C.T.

    1999-08-10

    This application describes an apparatus particularly suited for subjecting biological samples to any necessary sample preparation tasks, subjecting the sample to rapid thermal cycling, and then subjecting the sample to subsequent on-line analysis using one or more of a number of analytical techniques. The apparatus includes a chromatography device including an injection means, a chromatography pump, and a chromatography column. In addition, the apparatus also contains a capillary electrophoresis device consisting of a capillary electrophoresis column with an inlet and outlet end, a means of injection, and means of applying a high voltage to cause the differential migration of species of interest through the capillary column. Effluent from the liquid chromatography column passes over the inlet end of the capillary electrophoresis column through a tee structure and when the loading of the capillary electrophoresis column is desired, a voltage supply is activated at a precise voltage and polarity over a specific duration to cause sample species to be diverted from the flowing stream to the capillary electrophoresis column. A laser induced fluorescence detector preferably is used to analyze the products separated while in the electrophoresis column. 6 figs.

  1. Effect of flooring on standing comfort and fatigue.

    PubMed

    Cham, R; Redfern, M S

    2001-01-01

    This study investigated the influence of flooring on subjective discomfort and fatigue during standing and on potentially related objective measures. Participants stood for 4 h on each of 7 flooring conditions while performing computer tasks. During the 3rd and 4th h, floor type had a significant effect on a number of subjective ratings, including lower-leg and lower-back discomfort/fatigue and 2 of 4 objective variables (center of pressure weight shift and lower-extremity skin temperature). In addition, lower-leg volumetric measurements showed tendencies toward greater lower-extremity swelling on uncomfortable floors. The hard floor and 1 floor mat condition consistently had the worst discomfort/fatigue and objective ratings. Significant relationships were noted between the affected subjective ratings and objective variables. In general, floor mats characterized by increased elasticity, decreased energy absorption, and increased stiffness resulted in less discomfort and fatigue. Thus flooring properties do affect low-back and lower-leg discomfort/fatigue, but the result may be detectable only after 3 h of standing. Potential applications of this research include the reduction of work-related health problems associated with long-term standing.

  2. The interference of introversion-extraversion and depressive symptomatology with reasoning performance: a behavioural study.

    PubMed

    Papageorgiou, Charalabos; Rabavilas, Andreas D; Stachtea, Xanthy; Giannakakis, Giorgos A; Kyprianou, Miltiades; Papadimitriou, George N; Stefanis, Costas N

    2012-04-01

    The objective of this study was to investigate the link between the Eysenck Personality Questionnaire (EPQ) scores and depressive symptomatology with reasoning performance induced by a task including valid and invalid Aristotelian syllogisms. The EPQ and the Zung Depressive Scale (ZDS) were completed by 48 healthy subjects (27 male, 21 female) aged 33.5 ± 9.0 years. Additionally, the subjects engaged into two reasoning tasks (valid vs. invalid syllogisms). Analysis showed that the judgment of invalid syllogisms is a more difficult task than of valid judgments (65.1% vs. 74.6% of correct judgments respectively, p < 0.01). In both conditions, the subjects' degree of confidence is significantly higher when they make a correct judgment than when they make an incorrect judgment (83.8 ± 11.2 vs. 75.3 ± 17.3, p < 0.01). Subjects with extraversion as measured by EPQ and high sexual desire as rated by the relative ZDS subscale are more prone to make incorrect judgments in the valid syllogisms, while, at the same time, they are more confident in their responses. The effects of extraversion/introversion and sexual desire on the outcome measures of the valid condition are not commutative but additive. These findings indicate that extraversion/introversion and sexual desire variations may have a detrimental effect in the reasoning performance.

  3. Subjective burden among spousal and adult-child informal caregivers of older adults: results from a longitudinal cohort study.

    PubMed

    Oldenkamp, Marloes; Hagedoorn, Mariët; Slaets, Joris; Stolk, Ronald; Wittek, Rafael; Smidt, Nynke

    2016-12-07

    Pressures on informal caregivers are likely to increase due to increasing life expectancy and health care costs, which stresses the importance of prevention of subjective burden. The present study examined the correlates of overall subjective burden and multiple burden dimensions among spousal and adult-child caregivers of Dutch older adults, both cross-sectional and longitudinal (12-months follow-up). In 2010 and 2011 baseline and follow-up data was collected in a sample of informal caregivers and care recipients in the Northern provinces of the Netherlands. Subjective burden included 7 burden dimensions and a summary score for overall subjective burden, based on the Care-Related Quality of Life Instrument (CarerQoL-7D). Objective stressors were the time investment in caregiving (hours of household care, personal care, practical care) and the health situation of the care recipient, including multimorbidity, functional limitations (Katz Index of Independence Basic Activities of Daily Living (ADL) and Instrumental Activities of Daily Living (IADL), and cognitive functioning problems (EQ-5D + C). Correlates of subjective burden were evaluated with linear and logistic regression analyses. The sample consisted of 356 caregivers at baseline (43% spousal, 57% adult-child caregivers), and 158 caregivers at follow-up (45% spousal, 55% adult-child caregivers). At baseline and follow-up, spousal caregivers experienced a higher overall subjective burden, and reported more often mental health problems, physical health problems, and problems with combining daily activities, compared to adult-child caregivers. For spousal caregivers, a poorer health situation of the care recipient was associated with higher subjective burden, while adult-child caregivers reported higher levels of subjective burden when their time investment in caregiving was high. Subjective burden at follow-up was mainly explained by baseline subjective burden. These results indicate that for effective caregiver support, it is crucial to take the type of care relationship into account, since the level and correlates of overall subjective burden and burden dimensions varied for spousal and adult-child caregivers. In addition, reducing subjective burden will also positively impact the subjective burden over time.

  4. Effect of comorbid tics on a clinically meaningful response to 8-week open-label trial of fluoxetine in obsessive compulsive disorder.

    PubMed

    Husted, David S; Shapira, Nathan A; Murphy, Tanya K; Mann, Giselle D; Ward, Herbert E; Goodman, Wayne K

    2007-01-01

    Currently, there are limited published data evaluating the effects of tics on serotonin reuptake inhibitor (SRI) monotherapy responses in treating obsessive-compulsive disorder (OCD). One retrospective case-controlled analysis of OCD patients treated with SRI monotherapy showed lesser improvement in OCD symptoms in patients with tics than those without. However, more recently there were preliminary reports of OCD subjects treated with SRI monotherapy which did not demonstrate poorer response in subjects with tics or Tourette's Syndrome (TS). The specific aim of this study was to investigate whether the presence of comorbid chronic tics affected "clinically meaningful improvement" [McDougle, C.J., Goodman, W.K., Leckman, J.F., Barr, L.C., Heninger, G.R., Price, L.H., 1993. The efficacy of fluvoxamine in obsessive-compulsive disorder: effects of comorbid chronic tic disorder. Journal of Clinical Psychopharmacology 13, 354-358] of OCD in an 8-week open-label trial of fluoxetine monotherapy. Seventy-four adult subjects (13 patients with comorbid chronic tics and 61 patients without tics) with a primary DSM-IV OCD diagnosis were treated with up to 40mg fluoxetine for 8 weeks and had at least one post-baseline evaluation. The results indicate that there was a significant response by time in both fluoxetine-with-tic subjects and fluoxetine-without-tic subjects. Additionally, there were 3 (23.0%) OCD subjects with tics who had clinically meaningful improvement versus 16 (26.2%) OCD subjects without tics that demonstrated similar levels of improvement. These findings indicate that OCD patients with or without chronic tic disorders did not have a differential response to an 8-week open-label trial of fluoxetine. Limitations include the relatively low number of tic subjects and the open-label nature of the study. Additional data are needed on how comorbid tics may affect SRI treatment response in OCD.

  5. Relative performance of soft contact lenses having lathe-cut posterior surfaces with and without additional polishing.

    PubMed

    O'Brien, C; Charman, W N

    2006-05-01

    After a preliminary investigation of the effects of tool feed rate and spindle speed on the surface roughness of unhydrated, lathe-cut polymacon surfaces, a laboratory and clinical comparison was made between lenses with identical parameters except that the lathe-cut posterior surface was left unpolished in the "test" lenses and was polished in the "control" lenses. The lenses had moulded anterior surfaces. Laboratory comparisons included surface roughness, lens power and its uniformity across the surface. Double-blind clinical trials over 4-hour (27 subjects) and 1-month (10 subjects) periods, involved one eye of each subject wearing a "test" lens and the other, a "control" lens. No clinically significant differences were found between the results for the test and control lenses. It is concluded that today's lathing technology makes a final polishing stage unnecessary.

  6. Short-duration beta-alanine supplementation increases training volume and reduces subjective feelings of fatigue in college football players.

    PubMed

    Hoffman, Jay R; Ratamess, Nicholas A; Faigenbaum, Avery D; Ross, Ryan; Kang, Jie; Stout, Jeffrey R; Wise, John A

    2008-01-01

    The purpose of this study was to examine the effect of 30 days of beta-alanine supplementation in collegiate football players on anaerobic performance measures. Subjects were randomly divided into a supplement (beta-alanine group [BA], 4.5 g x d(-1) of beta-alanine) or placebo (placebo group [P], 4.5 g x d(-1) of maltodextrin) group. Supplementation began 3 weeks before preseason football training camp and continued for an additional 9 days during camp. Performance measures included a 60-second Wingate anaerobic power test and 3 line drills (200-yd shuttle runs with a 2-minute rest between sprints) assessed on day 1 of training camp. Training logs recorded resistance training volumes, and subjects completed questionnaires on subjective feelings of soreness, fatigue, and practice intensity. No difference was seen in fatigue rate in the line drill, but a trend (P = .07) was observed for a lower fatigue rate for BA compared with P during the Wingate anaerobic power test. A significantly higher training volume was seen for BA in the bench press exercise, and a trend (P = .09) for a greater training volume was seen for all resistance exercise sessions. In addition, subjective feelings of fatigue were significantly lower for BA than P. In conclusion, despite a trend toward lower fatigue rates during 60 seconds of maximal exercise, 3 weeks of beta-alanine supplementation did not result in significant improvements in fatigue rates during high-intensity anaerobic exercise. However, higher training volumes and lower subjective feelings of fatigue in BA indicated that as duration of supplementation continued, the efficacy of beta-alanine supplementation in highly trained athletes became apparent.

  7. Presenting rhythm in sudden deaths temporally proximate to discharge of TASER conducted electrical weapons.

    PubMed

    Swerdlow, Charles D; Fishbein, Michael C; Chaman, Linda; Lakkireddy, Dhanunjaya R; Tchou, Patrick

    2009-08-01

    Sudden deaths proximate to use of conducted electrical weapons (CEWs) have been attributed to cardiac electrical stimulation. The rhythm in death caused by rapid, cardiac electrical stimulation usually is ventricular fibrillation (VF); electrical stimulation has not been reported to cause asystole or pulseless electrical activity (PEA). The authors studied the presenting rhythms in sudden deaths temporally proximate to use of TASER CEWs to estimate the likelihood that these deaths could be caused by cardiac electrical stimulation. This was a retrospective review of CEW-associated, nontraumatic sudden deaths from 2001 to 2008. Emergency medical services (EMS), autopsy, and law enforcement reports were requested and analyzed. Subjects were included if they collapsed within 15 minutes of CEW discharge and the first cardiac arrest rhythm was reported. Records for 200 cases were received. The presenting rhythm was reported for 56 of 118 subjects who collapsed within 15 minutes (47%). The rhythm was VF in four subjects (7%; 95% confidence interval [CI] = 3% to 17%) and bradycardia-asystole or PEA in 52 subjects (93%; 95% CI = 83% to 97%). None of the eight subjects who collapsed during electrocardiogram (ECG) monitoring had VF. Only one subject (2%) collapsed immediately after CEW discharge. This was the only death typical of electrically induced VF (2%, 95% CI = 0% to 9%). An additional 4 subjects (7%) collapsed within 1 minute, and the remaining 51 subjects (91%) collapsed more than 1 minute later. The time from collapse to first recorded rhythm was 3 minutes or less in 35 subjects (62%) and 5 minutes or less in 43 subjects (77%). In sudden deaths proximate to CEW discharge, immediate collapse is unusual, and VF is an uncommon VF presenting rhythm. Within study limitations, including selection bias and the possibility that VF terminated before the presenting rhythm was recorded, these data do not support electrically induced VF as a common mechanism of these sudden deaths.

  8. Algorithms for elasto-plastic-creep postbuckling

    NASA Technical Reports Server (NTRS)

    Padovan, J.; Tovichakchaikul, S.

    1984-01-01

    This paper considers the development of an improved constrained time stepping scheme which can efficiently and stably handle the pre-post-buckling behavior of general structure subject to high temperature environments. Due to the generality of the scheme, the combined influence of elastic-plastic behavior can be handled in addition to time dependent creep effects. This includes structural problems exhibiting indefinite tangent properties. To illustrate the capability of the procedure, several benchmark problems employing finite element analyses are presented. These demonstrate the numerical efficiency and stability of the scheme. Additionally, the potential influence of complex creep histories on the buckling characteristics is considered.

  9. Exploratory Study of Dimensions of Health-related Quality of Life in the General Population of South Korea.

    PubMed

    Kim, Seon-Ha; Jo, Min-Woo; Ock, Minsu; Lee, Sang-Il

    2017-11-01

    This study aimed to explore dimensions in addition to the 5 dimensions of the 5-level EQ-5D version (EQ-5D-5L) that could satisfactorily explain variation in health-related quality of life (HRQoL) in the general population of South Korea. Domains related to HRQoL were searched through a review of existing HRQoL instruments. Among the 28 potential dimensions, the 5 dimensions of the EQ-5D-5L and 7 additional dimensions (vision, hearing, communication, cognitive function, social relationships, vitality, and sleep) were included. A representative sample of 600 subjects was selected for the survey, which was administered through face-to-face interviews. Subjects were asked to report problems in 12 health dimensions at 5 levels, as well as their self-rated health status using the EuroQol visual analogue scale (EQ-VAS) and a 5-point Likert scale. Among subjects who reported no problems for any of the parameters in the EQ-5D-5L, we analyzed the frequencies of problems in the additional dimensions. A linear regression model with the EQ-VAS as the dependent variable was performed to identify additional significant dimensions. Among respondents who reported full health on the EQ-5D-5L (n=365), 32% reported a problem for at least 1 additional dimension, and 14% reported worse than moderate self-rated health. Regression analysis revealed a R2 of 0.228 for the original EQ-5D-5L dimensions, 0.200 for the new dimensions, and 0.263 for the 12 dimensions together. Among the added dimensions, vitality and sleep were significantly associated with EQ-VAS scores. This study identified significant dimensions for assessing self-rated health among members of the general public, in addition to the 5 dimensions of the EQ-5D-5L. These dimensions could be considered for inclusion in a new preference-based instrument or for developing a country-specific HRQoL instrument.

  10. Digital data registration and differencing compression system

    NASA Technical Reports Server (NTRS)

    Ransford, Gary A. (Inventor); Cambridge, Vivien J. (Inventor)

    1990-01-01

    A process is disclosed for x ray registration and differencing which results in more efficient compression. Differencing of registered modeled subject image with a modeled reference image forms a differenced image for compression with conventional compression algorithms. Obtention of a modeled reference image includes modeling a relatively unrelated standard reference image upon a three-dimensional model, which three-dimensional model is also used to model the subject image for obtaining the modeled subject image. The registration process of the modeled subject image and modeled reference image translationally correlates such modeled images for resulting correlation thereof in spatial and spectral dimensions. Prior to compression, a portion of the image falling outside a designated area of interest may be eliminated, for subsequent replenishment with a standard reference image. The compressed differenced image may be subsequently transmitted and/or stored, for subsequent decompression and addition to a standard reference image so as to form a reconstituted or approximated subject image at either a remote location and/or at a later moment in time. Overall effective compression ratios of 100:1 are possible for thoracic x ray digital images.

  11. Digital Data Registration and Differencing Compression System

    NASA Technical Reports Server (NTRS)

    Ransford, Gary A. (Inventor); Cambridge, Vivien J. (Inventor)

    1996-01-01

    A process for X-ray registration and differencing results in more efficient compression. Differencing of registered modeled subject image with a modeled reference image forms a differenced image for compression with conventional compression algorithms. Obtention of a modeled reference image includes modeling a relatively unrelated standard reference image upon a three-dimensional model, which three-dimensional model is also used to model the subject image for obtaining the modeled subject image. The registration process of the modeled subject image and modeled reference image translationally correlates such modeled images for resulting correlation thereof in spatial and spectral dimensions. Prior to compression, a portion of the image falling outside a designated area of interest may be eliminated, for subsequent replenishment with a standard reference image. The compressed differenced image may be subsequently transmitted and/or stored, for subsequent decompression and addition to a standard reference image so as to form a reconstituted or approximated subject image at either a remote location and/or at a later moment in time. Overall effective compression ratios of 100:1 are possible for thoracic X-ray digital images.

  12. Digital data registration and differencing compression system

    NASA Technical Reports Server (NTRS)

    Ransford, Gary A. (Inventor); Cambridge, Vivien J. (Inventor)

    1992-01-01

    A process for x ray registration and differencing results in more efficient compression is discussed. Differencing of registered modeled subject image with a modeled reference image forms a differential image for compression with conventional compression algorithms. Obtention of a modeled reference image includes modeling a relatively unrelated standard reference image upon a three dimensional model, which three dimensional model is also used to model the subject image for obtaining the modeled subject image. The registration process of the modeled subject image and modeled reference image translationally correlates such modeled images for resulting correlation thereof in spatial and spectral dimensions. Prior to compression, a portion of the image falling outside a designated area of interest may be eliminated, for subsequent replenishment with a standard reference image. The compressed differenced image may be subsequently transmitted and/or stored, for subsequent decompression and addition to a standard reference image so as to form a reconstituted or approximated subject image at either remote location and/or at a later moment in time. Overall effective compression ratios of 100:1 are possible for thoracic x ray digital images.

  13. Correlates of low back pain in a general population sample: a multidisciplinary perspective.

    PubMed

    Roncarati, A; McMullen, W

    1988-06-01

    This study identifies correlates of low back pain in a general population sample and defines a profile of subjects with low back pain. A multidisciplinary approach was employed that required surveying and physically assessing 674 subjects on 105 variables in biographical, anatomical, strength and flexibility measurement categories. No attempt was made to select subjects from specific occupational, age, athletic, psychological and anatomical groups or subjects with specific biographical features, which may have resulted in a sample that was atypical of the general population. The results of this study based on a causal comparative ex post facto research design corroborated selected findings of previous research conducted on nongeneral population samples. These findings include relationships between low back pain and age, body type, sex, stress, smoking, selected types of physical activity, occupation and previous injuries to the neck, shoulders, back and upper legs, as well as previous episodes of low back pain. Additional correlates of low back pain that were identified and have little or controversial review in the back literature include: delayed low back pain syndrome caused by abrupt changes in running frequency, Q angle, pes cavus, leg length (right and left), trunk length, genu recurvatum and multiplane strength and flexibility limitations in the hip joints.

  14. Designing Oversight for Nanomedicine Research in Human Subjects: Systematic Analysis of Exceptional Oversight for Emerging Technologies

    PubMed Central

    Wolf, Susan M.; Jones, Cortney

    2012-01-01

    The basic procedures and rules for oversight of U.S. human subjects research have been in place since 1981. Certain types of human subjects research, however, have provoked creation of additional mechanisms and rules beyond the Department of Health & Human Services (DHHS) Common Rule and Food and Drug Administration (FDA) equivalent. Now another emerging domain of human subjects research—nanomedicine—is prompting calls for extra oversight. However, in 30 years of overseeing research on human beings, we have yet to specify what makes a domain of scientific research warrant extra oversight. This failure to systematically evaluate the need for extra measures, the type of extra measures appropriate for different challenges, and the usefulness of those measures hampers efforts to respond appropriately to emerging science such as nanomedicine. This article evaluates the history of extra oversight, extracting lessons for oversight of nanomedicine research in human beings. We argue that a confluence of factors supports the need for extra oversight, including heightened uncertainty regarding risks, fast-evolving science yielding complex and increasingly active materials, likelihood of research on vulnerable participants including cancer patients, and potential risks to others beyond the research participant. We suggest the essential elements of the extra oversight needed. PMID:23226969

  15. Designing oversight for nanomedicine research in human subjects: systematic analysis of exceptional oversight for emerging technologies

    NASA Astrophysics Data System (ADS)

    Wolf, Susan M.; Jones, Cortney M.

    2011-04-01

    The basic procedures and rules for oversight of U.S. human subjects research have been in place since 1981. Certain types of human subjects research, however, have provoked creation of additional mechanisms and rules beyond the Department of Health & Human Services (DHHS) Common Rule and Food and Drug Administration (FDA) equivalent. Now another emerging domain of human subjects research—nanomedicine—is prompting calls for extra oversight. However, in 30 years of overseeing research on human beings, we have yet to specify what makes a domain of scientific research warrant extra oversight. This failure to systematically evaluate the need for extra measures, the type of extra measures appropriate for different challenges, and the usefulness of those measures hampers efforts to respond appropriately to emerging science such as nanomedicine. This article evaluates the history of extra oversight, extracting lessons for oversight of nanomedicine research in human beings. We argue that a confluence of factors supports the need for extra oversight, including heightened uncertainty regarding risks, fast-evolving science yielding complex and increasingly active materials, likelihood of research on vulnerable participants including cancer patients, and potential risks to others beyond the research participant. We suggest the essential elements of the extra oversight needed.

  16. Density Deconvolution With EPI Splines

    DTIC Science & Technology

    2015-09-01

    effects of various substances on test subjects [11], [12]. Whereas in geophysics, a shot may be fired into the ground, in pharmacokinetics, a signal is...be significant, including medicine, bioinformatics, chemistry, as- tronomy, and econometrics , as well as an extensive review of kernel based methods...demonstrate the effectiveness of our model in simulations motivated by test instances in [32]. We consider an additive measurement model scenario where

  17. Familial leuconychia, knuckle pads, hearing loss, and palmoplantar hyperkeratosis: an additional family with Bart-Pumphrey syndrome.

    PubMed Central

    Ramer, J C; Vasily, D B; Ladda, R L

    1994-01-01

    A family with five members who have variable findings of leuconychia, knuckle pads, hearing loss, and palmoplantar hyperkeratosis is described. The findings in these subjects are compared with those noted in previously reported patients with Bart-Pumphrey syndrome. The range of disorders which include knuckle pads as part of the phenotype is reviewed. Images PMID:8151643

  18. Holography: A survey

    NASA Technical Reports Server (NTRS)

    Dudley, D. D.

    1973-01-01

    The development of holography and the state of the art in recording and displaying information, microscopy, motion, pictures, and television applications are discussed. In addition to optical holography, information is presented on microwave, acoustic, ultrasonic, and seismic holography. Other subjects include data processing, data storage, pattern recognition, and computer-generated holography. Diagrams of holographic installations are provided. Photographs of typical holographic applications are used to support the theoretical aspects.

  19. Introduction to geomagnetism

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Parkinson, W.D.

    1983-01-01

    This book examines a wide range of subjects in geomagnetism. It presents a brief introduction to physical principles of magnetism, and then focuses on the properties of the geomagnetic field as the sum of four interrelated phenomena: the main field, the local or crustal field, the external field, and the induced field. Additional topics, including paleomagnetism and magnetic methods in exploration, and the history of geomagnetism, are also discussed.

  20. DDC 10 Year Requirements and Planning Study. Interagency Survey Report

    DTIC Science & Technology

    1975-12-12

    RDT&E Management Information Services Traditional bibliographic information storage and retrieval techniques are insufficienL for satisfaction of...a private source. 3.3 Economics and Marketing ERDA’s tradition of absorbing costs for information 1rocessing shows no indication of changing...Libraries. Its products, in addition to traditional library services, include three prime data bases: 0 MEDLINE - journal citations and subject

  1. Report on Gang Violence in Maryland

    DTIC Science & Technology

    1994-07-01

    possession of a firearm, and drug kingpin statutes. 14 . Consider juvenile witness protection programs for youths under eighteen years of age. Scho... 14 . SUBJECT TERMS 15. NUMBER OF PAGES 16. PRICE CODE 17. SECURITY CLASSIFICATION 18. SECURITY CLASSIFICATION 19. SECURITY CLASSIFICATION 20 IIAINOF...limitations. Cite any Block 2. Report Date. Full publication date availability to the public. Enter additional including day, month, and year , if available

  2. Biobran/MGN-3, an arabinoxylan rice bran, enhances NK cell activity in geriatric subjects: A randomized, double-blind, placebo-controlled clinical trial.

    PubMed

    Elsaid, Ahmed F; Shaheen, Magda; Ghoneum, Mamdooh

    2018-03-01

    Aging is associated with a decline in natural killer (NK) and natural killer T (NKT) cell function that may contribute to increased susceptibility to malignancy and infection. A preliminary investigation was conducted examining the hypothesis that arabinoxylan rice bran (Biobran/MGN-3), a denatured hemicellulose with known immunomodulatory activity, could counteract this decline in NK/NKT cell activity in geriatrics. A total of 12 healthy geriatric subjects of both sexes and over 56 years old, participated in a randomized, double-blind, placebo-controlled clinical trial. A total of six subjects served as control and six subjects ingested Biobran/MGN-3 (500 mg/day) for 30 days. The effect of Biobran/MGN-3 supplementation on NK/NKT cell activity was assessed using the degranulation assay. All study subjects were monitored for the development of any inadvertent side effects. In addition, the pharmacological effects of Biobran/MGN-3 on blood cell components and liver and kidney functions were also assessed. Results demonstrated that Biobran/MGN-3 had no effect on the total percentage of NK cells, however it enhanced the cytotoxic activity of induced NK cell expression of cluster of differentiation 107a, when compared with baseline values and with the placebo group (P<0.05). Furthermore, there were no side effects observed, indicating that Biobran/MGN-3 supplementation was safe at the utilized dosage and for the duration of administration. Various additional beneficial effects were observed, including improved mean corpuscular volume and reduced hepatic aspartate aminotransferase enzyme levels, which suggested improved liver function. It was concluded that Biobran/MGN-3 induces a significant increase in NK activity which may increase resistance to viral infections and cancers in the geriatric population. However, additional clinical trials should be conducted in the future to verify these findings.

  3. 21 CFR 50.50 - IRB duties.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... review clinical investigations involving children as subjects covered by this subpart D and approve only... SUBJECTS Additional Safeguards for Children in Clinical Investigations § 50.50 IRB duties. In addition to...

  4. Resistance to extinction of human evaluative conditioning using a between-subjects design.

    PubMed

    Baeyens, F; Díaz, E; Ruiz, G

    2005-02-01

    Two experiments were conducted to examine whether the resistance to extinction obtained in evaluative conditioning (EC) studies implies that EC is a qualitatively distinct form of classical conditioning (Baeyens, Eelen, & Crombez, 1995 a) or whether it is the result of an nonassociative artefact ( Field & Davey, 1997 , 1998 , 1999 ). Both experiments included between-subjects control groups in addition to standard within-subjects control conditions. In Experiment 1, only verbal ratings were measured in order to evaluate the effect of postacquisition CS-only exposures on EC whereas in Experiment 2, verbal ratings and postextinction priming effects were measured. The results showed that the EC effects are demonstrable in a between-subjects design and that the extinction procedure did not have any influence on the acquired evaluative value of CSs regardless of whether the verbal ratings or the priming effects were used as dependent variables. The present results provide evidence that EC is resistant to extinction and suggest an interpretation of EC as a qualitatively distinct form of associative learning.

  5. Rhesus Macaques (Macaca mulatta) as Living Fossils of Hominoid Personality and Subjective Well-being

    PubMed Central

    Weiss, Alexander; Adams, Mark James; Widdig, Anja; Gerald, Melissa S.

    2014-01-01

    Personality dimensions capturing individual differences in behavior, cognition, and affect have been described in several species, including humans, chimpanzees, and orangutans. However, comparisons between species are limited by the use of different questionnaires. We asked raters to assess free-ranging rhesus macaques at two time points on personality and subjective well-being questionnaires used earlier to rate chimpanzees and orangutans. Principal-components analysis yielded domains we labeled Confidence, Friendliness, Dominance, Anxiety, Openness, and Activity. The presence of Openness in rhesus macaques suggests it is an ancestral characteristic. The absence of Conscientiousness suggests it is a derived characteristic in African apes. Higher Confidence and Friendliness, and lower Anxiety were prospectively related to subjective well-being, indicating that the connection between personality and subjective well-being in humans, chimpanzees, and orangutans is ancestral in catarrhine primates. As demonstrated here, each additional species studied adds another fold to the rich, historical story of primate personality evolution. PMID:21341912

  6. Bronchial reactions to exposure to welding fumes.

    PubMed Central

    Contreras, G R; Chan-Yeung, M

    1997-01-01

    OBJECTIVES: To study the airway response and its mechanism to welding fumes in six welders with respiratory symptoms. METHODS: Methacholine and welding challenge tests were carried out. The concentration of welding fumes during the exposure test was measured. On two subjects who developed bronchoconstricition to welding challenge, additional tests were carried out including prick, patch, and inhalation challenges with metal salt solutions. RESULTS: Three subjects developed immediate bronchial reaction to exposure to welding fume; one to mild steel and stainless steel welding, another to mild steel and galvanised welding, and one only to galvanised welding. They all had a moderate to pronounced degree of non-specific bronchial hyperresponsiveness. The concentration of fumes during welding tests, particularly to galvanised welding, was high. An inhalation challenge test with zinc chloride salt solution in two subjects who reacted to galvanised welding was negative. Prick and patch tests with zinc chloride were also negative. CONCLUSION: The airway response to welding in these subjects is non-specific and is due to irritation rather than to sensitisation. PMID:9538358

  7. Bronchial reactions to exposure to welding fumes.

    PubMed

    Contreras, G R; Chan-Yeung, M

    1997-11-01

    To study the airway response and its mechanism to welding fumes in six welders with respiratory symptoms. Methacholine and welding challenge tests were carried out. The concentration of welding fumes during the exposure test was measured. On two subjects who developed bronchoconstricition to welding challenge, additional tests were carried out including prick, patch, and inhalation challenges with metal salt solutions. Three subjects developed immediate bronchial reaction to exposure to welding fume; one to mild steel and stainless steel welding, another to mild steel and galvanised welding, and one only to galvanised welding. They all had a moderate to pronounced degree of non-specific bronchial hyperresponsiveness. The concentration of fumes during welding tests, particularly to galvanised welding, was high. An inhalation challenge test with zinc chloride salt solution in two subjects who reacted to galvanised welding was negative. Prick and patch tests with zinc chloride were also negative. The airway response to welding in these subjects is non-specific and is due to irritation rather than to sensitisation.

  8. Patient loyalty model.

    PubMed

    Sumaedi, Sik; Bakti, I Gede Mahatma Yuda; Rakhmawati, Tri; Astrini, Nidya Judhi; Yarmen, Medi; Widianti, Tri

    2015-07-06

    This study aims to investigate the simultaneous effect of subjective norm, perceived behavioral control and trust on patient loyalty. The empirical data were collected through survey. The respondents of the survey are 157 patients of a health-care service institution in Bogor, Indonesia. Multiple regressions analysis was performed to test the conceptual model and the proposed hypotheses. The findings showed that subjective norm and trust influence patient loyalty positively. However, this research also found that perceived behavioral control does not influence patient loyalty significantly. The survey was only conducted at one health-care service institution in Bogor, Indonesia. In addition, convenience sampling method was used. These conditions may cause that the research results can not be generalized to the other contexts. Therefore, replication research is needed to test the stability of the findings in the other contexts. Health-care service institutions need to pay attention to trust and subjective norm to establish patient loyalty. This study is believed to be the first to develop and test patient loyalty model that includes subjective norm, perceived behavioral control and trust.

  9. Template-DTW based on inertial signals: Preliminary results for step characterization.

    PubMed

    Mantilla, Juan; Oudre, Laurent; Barrois, Remi; Vienne, Alienor; Ricard, Damien

    2017-07-01

    In this paper, we present a method for the creation of a library of inertial signals based on Dynamic Time Warping (DTW) for step characterization, with preliminary results in control subjects and patients with neurological diseases. Subjects performed a protocol including a 10 m straight walking, then turn back and walking for additional 10 m. The library is constructed with inertial signals (acceleration and angular velocities recorded in three directions) aligned with the DTW. Templates in the library are obtained for a specific cohort and for the different walking phases of the protocol. They are compared to the signal of a single subject by calculating a Pearson correlation coefficient. The method has been tested on a database of 864 exercises, obtained from 71 healthy controls, 24 patients with Parkinson disease and 48 patients with Radiation Induced Leukoencephalopathy (RIL). Pearson correlation classification reports a precision of about 85% for step detection. For exercise characterization the sensitivity is about 57%, 56% and 82% for Parkinson, RIL and control subjects respectively.

  10. Total Ionizing Dose Influence on the Single Event Effect Sensitivity in Samsung 8Gb NAND Flash Memories

    NASA Astrophysics Data System (ADS)

    Edmonds, Larry D.; Irom, Farokh; Allen, Gregory R.

    2017-08-01

    A recent model provides risk estimates for the deprogramming of initially programmed floating gates via prompt charge loss produced by an ionizing radiation environment. The environment can be a mixture of electrons, protons, and heavy ions. The model requires several input parameters. This paper extends the model to include TID effects in the control circuitry by including one additional parameter. Parameters intended to produce conservative risk estimates for the Samsung 8 Gb SLC NAND flash memory are given, subject to some qualifications.

  11. Association of ABO and Rh blood groups with type 2 diabetes mellitus.

    PubMed

    Meo, S A; Rouq, F A; Suraya, F; Zaidi, S Z

    2016-01-01

    The phenotypic "ABO" blood groups are inherited antigenic substances which are found on the surface of red blood cells in addition to other tissues. Certain hypothesis advocates that genetic predisposition like "ABO" blood group would be associated with occurrence of diseases including type 2 diabetes. This study aimed to investigate the potential association between "ABO" and "Rhesus" blood groups with type 2 diabetes. We identified 47 research documents in a data based search including ISI-Web of Science, EMBASE and PubMed. Literature was explored using the key terms including "ABO blood groups" "type 2 diabetes". Studies in which "ABO" blood types and diabetes mellitus were discussed included without restrictions of research documents, types, status and language of the publications. Finally, 15 publications which matched our criteria were included, and remaining studies were excluded. Blood group "B" was associated with high incidence of type 2 diabetes and blood group "O" has a minimum association with type 2 diabetes. Blood group "A" and "AB" were almost equally distributed in both diabetic and non-diabetic population. However, we were unable to find an association between "Rh+ve" and "Rh-ve" blood groups with type 2 diabetes. Subjects with blood group "B" are at high risk while individuals with blood group "O" are at low peril of evolving type 2 diabetes. It is suggested that subjects with blood group "B" should be closely monitored by physicians as these subjects have an increased risk of type 2 diabetes.

  12. Evaluating Perceived Naturalness of Facial Expression After Fillers to the Nasolabial Folds and Lower Face With Standardized Video and Photography.

    PubMed

    Philipp-Dormston, Wolfgang G; Wong, Cindy; Schuster, Bernd; Larsson, Markus K; Podda, Maurizio

    2018-06-01

    Hyaluronic acid (HA) fillers are commonly used in treating facial wrinkles and folds but have not been studied with standardized methodology to include assessment of standard facial expressions. To assess perceived naturalness of facial expression after treatment with 2 HA fillers manufactured with XpresHAn Technology (also known as Optimal Balance Technology). Treatment was directed to the nasolabial folds (NLFs) and at least 1 additional lower face wrinkle or fold. Maintenance of naturalness, attractiveness, and age at 1 month after optimal treatment were assessed using video recordings and photographs capturing different facial animations. Global aesthetic improvement, subjects' satisfaction, and safety were also evaluated. The treatment was well tolerated. Naturalness of facial expression in motion was determined to be at least maintained in 95% of subjects. Attractiveness was enhanced in 89% of subjects and 79% of subjects were considered to look younger. Most subjects assessed their aesthetic appearance as improved and were satisfied with their treatment. Naturalness and attractiveness can be assessed using video recordings and photographs capturing different facial animations. XpresHAn Technology HA filler treatments create natural-looking results with high subject satisfaction.

  13. Do Left- and Right-Handed People Have Similar Iron Deposition in the Basal Ganglia?

    PubMed

    Wang, Dan; Li, Yue-Hua; Wang, He

    2016-01-01

    This study aimed to investigate whether right-, left-, or mixed-handed people differ in terms of iron deposition using susceptibility weighted imaging in healthy subjects. A total of 87 people (right-handed, 51 subjects; left-handed, 19 subjects; mixed-handed, 17 subjects) aged 20 to 40 years participated. All underwent magnetic resonance examination, including conventional and susceptibility weighted imaging sequences. Phase images were used to quantify iron deposition in the head of the caudate nucleus and lenticular nucleus. The radian angle value was calculated and compared between the 3 (right-, left-, or mixed-handed) groups. There was no significant difference in the radian angle values between left-, right-, or mixed-handed people for either the right or left side of the caudate nucleus head. However, the amount of iron deposition in the left lenticular nucleus was significantly higher for right-handed than for the left-handed subjects (P < 0.001) and significantly higher for mixed-handed than for left-handed subjects (P = 0.006). In addition, the amount of iron deposition in the right lenticular nucleus was significantly lower for left-handed than for right-handed subjects (P < 0.001). The results revealed no significant differences in iron deposition in the head of the caudate nucleus. However, there was a significant difference in iron deposition in the lenticular nucleus between left- and right-handed subjects and between left- and mixed-handed subjects.

  14. Haplotype frequency distribution for 7 microsatellites in chromosome 8 and 11 in relation to the metabolic syndrome in four ethnic groups: Tehran Lipid and Glucose Study.

    PubMed

    Daneshpour, Maryam Sadat; Hosseinzadeh, Nima; Zarkesh, Maryam; Azizi, Fereidoun

    2012-03-01

    Different variants of haplotype frequencies may lead to various frequencies of the same variants in individuals with drug resistance and disease susceptibility at the population level. In this study, the haplotype frequencies of 4 STR loci including the D8S1132, D8S1779, D8S514 and D8S1743, and 3 STR loci including D11S1304, D11S1998 and D11S934 were investigated in 563 individuals of four Iranian ethnic groups in the capital city of Iran, Tehran. One hundred thirty subjects had the metabolic syndrome. Haplotype frequencies of all markers were calculated. There were significant differences in the haplotype frequencies in short and long alleles between the metabolic affected subjects and controls. In addition, haplotype frequencies were significant in the four ethnic groups in both chromosomes 8 and 11. Our findings show a relation between the short allele of D8S1743 in all related haplotype frequencies of subjects with metabolic syndrome. These findings may require more studies of some candidate genes, including the lipoprotein lipase gene, in this chromosomal region. Copyright © 2011. Published by Elsevier B.V.

  15. Transdermal delivery of therapeutic agent

    NASA Technical Reports Server (NTRS)

    Kwiatkowski, Krzysztof C. (Inventor); Hayes, Ryan T. (Inventor); Magnuson, James W. (Inventor); Giletto, Anthony (Inventor)

    2008-01-01

    A device for the transdermal delivery of a therapeutic agent to a biological subject that includes a first electrode comprising a first array of electrically conductive microprojections for providing electrical communication through a skin portion of the subject to a second electrode comprising a second array of electrically conductive microprojections. Additionally, a reservoir for holding the therapeutic agent surrounding the first electrode and a pulse generator for providing an exponential decay pulse between the first and second electrodes may be provided. A method includes the steps of piercing a stratum corneum layer of skin with two arrays of conductive microprojections, encapsulating the therapeutic agent into biocompatible charged carriers, surrounding the conductive microprojections with the therapeutic agent, generating an exponential decay pulse between the two arrays of conductive microprojections to create a non-uniform electrical field and electrokinetically driving the therapeutic agent through the stratum corneum layer of skin.

  16. White matter connectivity and Internet gaming disorder

    PubMed Central

    Jeong, Bum Seok; Han, Doug Hyun; Kim, Sun Mi; Lee, Sang Won; Renshaw, Perry F.

    2017-01-01

    Internet use and on-line game play stimulate corticostriatal-limbic circuitry in both healthy subjects and subjects with Internet gaming disorder (IGD). We hypothesized that increased fractional anisotropy (FA) with decreased radial diffusivity (RD) would be observed in IGD subjects, compared with healthy control subjects, and that these white matter indices would be associated with clinical variables including duration of illness and executive function. We screened 181 male patients in order to recruit a large number (n = 58) of IGD subjects without psychiatric co-morbidity as well as 26 male healthy comparison subjects. Multiple diffusion-weighted images were acquired using a 3.0 Tesla magnetic resonance imaging scanner. Tract-based spatial statistics was applied to compare group differences in diffusion tensor imaging (DTI) metrics between IGD and healthy comparison subjects. IGD subjects had increased FA values within forceps minor, right anterior thalamic radiation, right corticospinal tract, right inferior longitudinal fasciculus, right cingulum to hippocampus and right inferior fronto-occipital fasciculus (IFOF) as well as parallel decreases in RD value within forceps minor, right anterior thalamic radiation and IFOF relative to healthy control subjects. In addition, the duration of illness in IGD subjects was positively correlated with the FA values (integrity of white matter fibers) and negatively correlated with RD scores (diffusivity of axonal density) of whole brain white matter. In IGD subjects without psychiatric co-morbidity, our DTI results suggest that increased myelination (increased FA and decreased RD values) in right-sided frontal fiber tracts may be the result of extended game play. PMID:25899390

  17. Protocol for a prospective, randomized study on neurophysiological assessment of lower urinary tract function in a healthy cohort.

    PubMed

    van der Lely, Stéphanie; Stefanovic, Martina; Schmidhalter, Melanie R; Pittavino, Marta; Furrer, Reinhard; Liechti, Martina D; Schubert, Martin; Kessler, Thomas M; Mehnert, Ulrich

    2016-11-25

    Lower urinary tract symptoms are highly prevalent and a large proportion of these symptoms are known to be associated with a dysfunction of the afferent pathways. Diagnostic tools for an objective and reproducible assessment of afferent nerve function of the lower urinary tract are missing. Previous studies showed first feasibility results of sensory evoked potential recordings following electrical stimulation of the lower urinary tract in healthy subjects and patients. Nevertheless, a refinement of the methodology is necessary. This study is a prospective, randomized trial conducted at Balgrist University Hospital, Zürich, Switzerland. Ninety healthy subjects (forty females and fifty males) without lower urinary tract symptoms are planned to be included in the study. All subjects will undergo a screening visit (including standardized questionnaires, 3-day bladder diary, urinalysis, medical history taking, vital signs, physical examination, neuro-urological examination) followed by two measurement visits separated by an interval of 3 to 4 weeks. Electrical stimulations (0.5Hz-5Hz, bipolar, square wave, pulse width 1 ms) will be applied using a custom-made transurethral catheter at different locations of the lower urinary tract including bladder dome, trigone, proximal urethra, membranous urethra and distal urethra. Every subject will be randomly stimulated at one specific site of the lower urinary tract. Sensory evoked potentials (SEP) will be recorded using a 64-channel EEG cap. For an SEP segmental work-up we will place additional electrodes on the scalp (Cpz) and above the spine (C2 and L1). Visit two and three will be conducted identically for reliability assessment. The measurement of lower urinary tract SEPs elicited by electrical stimulation at different locations of the lower urinary tract has the potential to serve as a neurophysiological biomarker for lower urinary tract afferent nerve function in patients with lower urinary tract symptoms or disorders. For implementation of such a diagnostic tool into clinical practice, an optimized setup with efficient and reliable measurements and data acquisition is crucial. In addition, normative data from a larger cohort of healthy subjects would provide information on variability, potential confounding factors and cut-off values for investigations in patients with lower urinary tract dysfunction/symptoms. Clinicaltrials.gov; Identifier: NCT02272309 .

  18. Independent and Co-morbid HIV Infection and Meth Use Disorders on Oxidative Stress Markers in the Cerebrospinal Fluid and Depressive Symptoms

    PubMed Central

    Panee, Jun; Pang, Xiaosha; Munsaka, Sody; Berry, Marla J.; Chang, Linda

    2016-01-01

    Both HIV infection and Methamphetamine (Meth) use disorders are associated with greater depressive symptoms and oxidative stress; whether the two conditions would show additive or interactive effects on the severity of depressive symptoms, and whether this is related to the level of oxidative stress in the CNS is unknown. 123 participants were evaluated, which included 41 HIV-seronegative subjects without substance use disorders (Control), 25 with recent (<6 months) moderate to severe Meth use disorders (Meth), 34 HIV-seropositive subjects without substance use disorders (HIV) and 23 HIV+Meth subjects. Depressive symptoms were assessed with the Center for Epidemiologic Studies-Depression Scale (CES-D), and oxidative stress markers were evaluated with glutathione (GSH), 4-hydroxynonenal (HNE), and activities of gamma-glutamyltransferase (GGT) and glutathione peroxidase (GPx) in the cerebrospinal fluid (CSF). Compared with Controls, HIV subjects had higher levels of HNE (+350 %) and GGT (+27 %), and lower level of GSH (−34 %), while Meth users had higher levels of GPx activity (+23 %) and GSH (+30 %). GGT correlated with GPx, and with age, across all subjects (p<0.0001). CES-D scores correlated with CSF HNE levels only in Control and HIV groups, but not in Meth and HIV+Meth groups. HIV and Meth use had an interactive effects on depressive symptoms, but did not show additive or interactive effects on oxidative stress. The differential relationship between depressive symptoms and oxidative stress response amongst the four groups suggest that depressive symptoms in these groups are mediated through different mechanisms which are not always related to oxidative stress. PMID:25575491

  19. Independent and co-morbid HIV infection and Meth use disorders on oxidative stress markers in the cerebrospinal fluid and depressive symptoms.

    PubMed

    Panee, Jun; Pang, Xiaosha; Munsaka, Sody; Berry, Marla J; Chang, Linda

    2015-03-01

    Both HIV infection and Methamphetamine (Meth) use disorders are associated with greater depressive symptoms and oxidative stress; whether the two conditions would show additive or interactive effects on the severity of depressive symptoms, and whether this is related to the level of oxidative stress in the CNS is unknown. 123 participants were evaluated, which included 41 HIV-seronegative subjects without substance use disorders (Control), 25 with recent (<6 months) moderate to severe Meth use disorders (Meth), 34 HIV-seropositive subjects without substance use disorders (HIV) and 23 HIV+Meth subjects. Depressive symptoms were assessed with the Center for Epidemiologic Studies-Depression Scale (CES-D), and oxidative stress markers were evaluated with glutathione (GSH), 4-hydroxynonenal (HNE), and activities of gamma-glutamyltransferase (GGT) and glutathione peroxidase (GPx) in the cerebrospinal fluid (CSF). Compared with Controls, HIV subjects had higher levels of HNE (+350%) and GGT (+27%), and lower level of GSH (-34%), while Meth users had higher levels of GPx activity (+23%) and GSH (+30 %). GGT correlated with GPx, and with age, across all subjects (p < 0.0001). CES-D scores correlated with CSF HNE levels only in Control and HIV groups, but not in Meth and HIV+Meth groups. HIV and Meth use had an interactive effects on depressive symptoms, but did not show additive or interactive effects on oxidative stress. The differential relationship between depressive symptoms and oxidative stress response amongst the four groups suggest that depressive symptoms in these groups are mediated through different mechanisms which are not always related to oxidative stress.

  20. EXERCISE, MANUAL THERAPY AND POSTURAL RE-EDUCATION FOR UNCONTROLLED EAR TWITCHING AND RELATED IMPAIRMENTS AFTER WHIPLASH INJURY: A CASE REPORT.

    PubMed

    Flanders, Kelsey; Feldner, Heather

    2017-10-01

    Whiplash Associated Disorders and the interventions used to remediate them are well documented in physical therapy literature. However, specific interventions for spasms of the neck musculature that also involve constant ear twitching have yet to be addressed. The purpose of this case report is twofold. First, to describe comprehensive physical therapy management and outcomes for a subject with uncontrolled ear twitching and related musculoskeletal impairments, and second, to discuss the physical therapist's approach to evidence-based care when faced with a paucity of literature addressing physical therapy interventions for subjects with uncontrolled ear twitching. The subject was a 14-year-old female who sustained a right anterolateral whiplash injury when struck in the head by a volleyball seven months prior to physical therapy. Beginning five months after that injury, she experienced uncontrolled and constant superior/inferior movement of her right ear (hereafter described in this report as a twitch) in addition to facial and cervical pain from her initial injury. She was unable to participate in high school athletics due to her pain. A multimodal treatment approach including exercise, manual therapy, and postural reeducation was utilized during the subject's episode of care. After eight treatment sessions, the subjects's cervical range of motion and upper extremity strength improved. The reported frequency of ear twitching decreased, as did reports of neck and shoulder pain. In addition, her Neck Disability Index improved from a score of 22, indicating moderate disability, to 9, indicating mild disability and she was able to return to sport activity. With limited research to direct intervention, clinical reasoning was utilized to formulate an effective therapeutic intervention. A combination of manual therapy, exercise, and postural reeducation intervention was effective for this subject and could assist in guiding interventions for similarly unique clinical presentations in the future. Further research is needed to examine the etiology of ear twitching caused by muscle spasm and to develop additional evidence-based interventions for Whiplash Associated Disorders. Level 4.

  1. An evaluation of touchscreen versus keyboard/mouse interaction for large screen process control displays.

    PubMed

    Noah, Benjamin; Li, Jingwen; Rothrock, Ling

    2017-10-01

    The objectives of this study were to test the effect of interaction device on performance in a process control task (managing a tank farm). The study compared the following two conditions: a) 4K-resolution 55" screen with a 21" touchscreen versus b) 4K-resolution 55″ screen with keyboard/mouse. The touchscreen acted both as an interaction device for data entry and navigation and as an additional source of information. A within-subject experiment was conducted among 20 college engineering students. A primary task of preventing tanks from overfilling as well as a secondary task of manual logging with situation awareness questions were designed for the study. Primary Task performance (including tank level at discharge, number of tank discharged and performance score), Secondary Task Performance (including Tank log count, performance score), system interaction times, subjective workload, situation awareness questionnaire, user experience survey regarding usability and condition comparison were used as the measures. Parametric data resulted in two metrics statistically different means between the two conditions: The 4K-keyboard condition resulted in faster Detection + Navigation time compared to the 4K-touchscreen condition, by about 2 s, while participants within the 4K-touchscreen condition were about 2 s faster in data entry than in the 4K-keyboard condition. No significant results were found for: performance on the secondary task, situation awareness, and workload. Additionally, no clear significant differences were found in the non-parametric data analysis. However, participants showed a slight preference for the 4K-touchscreen condition compared to the 4K-keyboard condition in subjective responses in comparing the conditions. Introducing the touchscreen as an additional/alternative input device showed to have an effect in interaction times, which suggests that proper design considerations need to be made. While having values shown on the interaction device provides value, a potential issue of visual distraction exists when having an additional visual display. The allocation of visual attention between primary displays and the touchscreen should be further investigated. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Increased 5S rRNA oxidation in Alzheimer's disease.

    PubMed

    Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R

    2012-01-01

    It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.

  3. Effect of polyphenol-rich grape seed extract on ambulatory blood pressure in subjects with pre- and stage I hypertension.

    PubMed

    Ras, Rouyanne T; Zock, Peter L; Zebregs, Yvonne E M P; Johnston, Neil R; Webb, David J; Draijer, Richard

    2013-12-01

    Dietary polyphenols, such as those from grape products, may exert beneficial effects on cardiovascular health, including anti-hypertensive effects. We investigated the effect of a specific grape seed extract (GSE) rich in low-molecular-weight polyphenolic compounds on ambulatory blood pressure (ABP) in untreated subjects with pre- and stage I hypertension. In addition, potential mechanisms that could underlie the hypothesised effect of GSE on blood pressure (BP), and platelet aggregation, were explored. The study was designed as a double-blind, placebo-controlled, randomised, parallel-group intervention study including seventy healthy subjects with systolic BP between 120 and 159 mmHg. A 1-week run-in period was followed by an 8-week intervention period, during which subjects consumed capsules containing either 300 mg/d of GSE or a placebo (microcrystalline cellulose). Before and after the intervention, daytime ABP readings, 24 h urine samples and fasting and non-fasting blood samples were taken. The mean baseline systolic BP was 135.8 (SE 1.3) mmHg and diastolic BP was 81.5 (SE 0.9) mmHg. BP values were modestly, but not significantly, affected by the polyphenol-rich GSE treatment v. placebo with an effect of - 3.0 mmHg for systolic BP (95% CI - 6.5, 0.5) and - 1.4 mmHg for diastolic BP (95% CI - 3.5, 0.6). Vasoactive markers including endothelin-1, NO metabolites and asymmetric dimethylarginine, plasma renin activity and platelet aggregation were not affected by the GSE intervention. Our findings show that consumption of polyphenol-rich GSE does not significantly lower ABP in untreated subjects with pre- and stage I hypertension.

  4. Additive mixed effect model for recurrent gap time data.

    PubMed

    Ding, Jieli; Sun, Liuquan

    2017-04-01

    Gap times between recurrent events are often of primary interest in medical and observational studies. The additive hazards model, focusing on risk differences rather than risk ratios, has been widely used in practice. However, the marginal additive hazards model does not take the dependence among gap times into account. In this paper, we propose an additive mixed effect model to analyze gap time data, and the proposed model includes a subject-specific random effect to account for the dependence among the gap times. Estimating equation approaches are developed for parameter estimation, and the asymptotic properties of the resulting estimators are established. In addition, some graphical and numerical procedures are presented for model checking. The finite sample behavior of the proposed methods is evaluated through simulation studies, and an application to a data set from a clinic study on chronic granulomatous disease is provided.

  5. Development of disease-specific growth charts in Turner syndrome and Noonan syndrome.

    PubMed

    Isojima, Tsuyoshi; Yokoya, Susumu

    2017-12-01

    Many congenital diseases are associated with growth failure, and patients with these diseases have specific growth patterns. As the growth patterns of affected individuals differ from those of normal populations, it is challenging to detect additional conditions that can influence growth using standard growth charts. Disease-specific growth charts are thus very useful tools and can be helpful for understanding the growth pattern and pathogenesis of congenital diseases. In addition, disease-specific growth charts allow doctors to detect deviations from the usual growth patterns for early diagnosis of an additional condition and can be used to evaluate the effects of growth-promoting treatment for patients. When developing these charts, factors that can affect the reliability of the charts should be considered. These factors include the definition of the disease with growth failure, selection bias in the measurements used to develop the charts, secular trends of the subjects, the numbers of subjects of varying ages and ethnicities, and the statistical method used to develop the charts. In this review, we summarize the development of disease-specific growth charts for Japanese individuals with Turner syndrome and Noonan syndrome and evaluate the efforts to collect unbiased measurements of subjects with these diseases. These charts were the only available disease-specific growth charts of Turner syndrome and Noonan syndrome for Asian populations and were developed using a Japanese population. Therefore, when these charts are adopted for Asian populations other than Japanese, different growth patterns should be considered.

  6. Intensive exercise reduces the fear of additional falls in elderly people: findings from the Korea falls prevention study.

    PubMed

    Oh, Dong Hyun; Park, Ji Eun; Lee, Eon Sook; Oh, Sang Woo; Cho, Sung Il; Jang, Soong Nang; Baik, Hyun Wook

    2012-12-01

    Falls among older people are a major public health problem and may result in fracture, medical complications that require hospitalization, and fear of additional falls. Given the prevalence and impact of the fear of falling again, reducing the incidence of falls is important to prevent additional falls. This study analyzed whether exercise programs decrease the fear of future falls in elderly patients who have fallen previously. A randomized controlled study was performed that included 65 elderly community-dwelling subjects who had fallen in the previous year. Subjects were randomized into two groups: an exercise group (EG, n = 36) and a control group (CG, n = 29). The EG participated in three exercise sessions per week for 12 weeks. Muscle strength, balance, agility, flexibility, and muscular endurance were measured at baseline and after 12 weeks. After the 12-week exercise program, the subjects in the EG demonstrated remarkable improvement in their walking speed, balance (p = 0.003), back strength (p = 0.08), lower extremity strength (p = 0.004), and flexibility (p < 0.001). When asked whether they were afraid of falling, more participants in the EG than in the CG responded "not at all" or "a little." The 12-week exercise program described here reduced the fear of falling (p = 0.02). It also improved the balance, flexibility, and muscle strength of the participants and was associated with improved quality of life.

  7. Radiologists' Training, Experience, and Attitudes About Elder Abuse Detection.

    PubMed

    Rosen, Tony; Bloemen, Elizabeth M; Harpe, Jasmin; Sanchez, Allen M; Mennitt, Kevin W; McCarthy, Thomas J; Nicola, Refky; Murphy, Kieran; LoFaso, Veronica M; Flomenbaum, Neal; Lachs, Mark S

    2016-12-01

    Elder abuse is underrecognized, and identification of subtle cases requires a high index of suspicion among all health care providers. Because many geriatric injury victims undergo radiographic imaging, diagnostic radiologists may be well positioned to identify injury patterns suggestive of abuse. Little is known about radiologists' experience with elder abuse. Our goal was to describe knowledge, attitudes, training, and practice experience in elder abuse detection among diagnostic radiologists. We conducted 19 interviews with diagnostic radiologists at a large urban academic medical center using a semistructured format. Data from these sessions were coded and analyzed to identify themes. Only two radiologists reported any formal or informal training in elder abuse detection. All subjects believed they had missed cases of elder abuse. Even experienced radiologists reported never having received a request from a referring physician to assess images for evidence suggestive of elder abuse. All subjects reported a desire for additional elder abuse training. Also, subjects identified radiographic findings or patterns potentially suggestive of elder abuse, including high-energy injuries such as upper rib fractures, injuries in multiple stages of healing, and injuries inconsistent with reported mechanism. Radiologists are uniquely positioned to identify elder abuse. Though training in detection is currently lacking, providers expressed a desire for increased knowledge. In addition, radiologists were able to identify radiographic findings suggestive of elder abuse. On the basis of these findings, we plan to conduct additional studies to define pathognomonic injury patterns and to explore how to empower radiologists to incorporate detection into their practice.

  8. Diagnosing Internal Herniation After Roux-en-Y Gastric Bypass Surgery: Literature Overview, Cadaver Study and the Added Value of 3D CT Angiography.

    PubMed

    Klop, Cornelis; Deden, Laura N; Aarts, Edo O; Janssen, Ignace M C; Pijl, Milan E J; van den Ende, Anneline; Witteman, Bart P L; de Jong, Gabie M; Aufenacker, Theo J; Slump, Cornelis H; Berends, Frits J

    2018-02-05

    The purposes of the study are to outline the complexity of diagnosing internal herniation after Roux-en-Y gastric bypass (RYGB) surgery and to investigate the added value of computed tomography angiography (CTA) for diagnosing internal herniation. A cadaver study was performed to investigate the manifestations of internal hernias and mesenteric vascularization. Furthermore, a prospective, ethics approved study with retrospective interpretation was conducted. Ten patients, clinically suspected for internal herniation, were prospectively included. After informed consent was obtained, these subjects underwent abdominal CT examination, including additional arterial phase CTA. All subjects underwent diagnostic laparoscopy for suspected internal herniation. The CTA was used to create a 3D reconstruction of the mesenteric arteries and surgical staples (3D CTA). The 3D CTA was interpreted, taking into account the presence and type of internal hernia that was found upon laparoscopy. Cadaveric analysis demonstrated the complexity of internal herniation. It also confirmed the expected changes in vascular structure and surgical staple arrangement in the presence of internal herniation. 3D CTA studies of the subjects with active internal hernias demonstrated remarkable differences when compared to control 3D CTA studies. The blood supply of herniated intestinal limbs in particular showed abnormal trajectories. Additionally, enteroenterostomy staple lines had migrated or altered orientation. 3D CTA is a promising technique for diagnosing active internal hernias. Our findings suggest that for diagnosing internal hernias, focus should probably shift from routine abdominal CT examination towards the 3D assessment of the mesenteric vasculature and surgical staples.

  9. Water Metabolism and Fluid Compartment Volumes in Humans at Altitude. A Compendium of Research (1914 - 1996)

    NASA Technical Reports Server (NTRS)

    Chou, J. L.; Stad, N. J.; Gay, E.; West, G. I.; Barnes, P. R.; Greenleaf, J. E.

    1997-01-01

    This compendium includes abstracts and synopses of clinical observations and of more basic studies involving physiological mechanisms concerning interaction of water metabolism and fluid compartment volumes in humans during altitude exposure. If the author's abstract or summary was appropriate, it was included. In other cases a more detailed synopsis of the paper was prepared under the subheadings Purpose, Methods, Results, and Conclusions. Author and subject indices are provided, plus an additional selected bibliography of related work of those papers received after the volume was being prepared for publication. This volume includes material published from 1914 through 1995.

  10. Flood analyses for Department of Energy Y-12, ORNL and K-25 Plants. Flood analyses in support of flood emergency planning

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    NONE

    1995-05-01

    The study involved defining the flood potential and local rainfall depth and duration data for the Department of Energy`s (DOE) Y-12, Oak Ridge National Laboratory (ORNL), and K-25 plants. All three plants are subject to flooding from the Clinch River. In addition, the Y-12 plant is subject to flooding from East Fork Poplar and Bear Creeks, the ORNL plant from Whiteoak Creek and Melton Branch, and the K-25 plant from Poplar Creek. Determination of flood levels included consideration of both rainfall events and postulated failures of Norris and Melton Hill Dams in seismic events.

  11. Interidentity amnesia for neutral, episodic information in dissociative identity disorder.

    PubMed

    Huntjens, Rafaële J C; Postma, Albert; Peters, Madelon L; Woertman, Liesbeth; van der Hart, Onno

    2003-05-01

    Interidentity amnesia is considered a hallmark of dissociative identity disorder (DID) in clinical practice. In this study, objective methods of testing episodic memory transfer between identities were used. Tests of both recall (interference paradigm) and recognition were used. A sample of 31 DID patients was included. Additionally, 50 control subjects participated, half functioning as normal controls and the other half simulating interidentity amnesia. Twenty-one patients subjectively reported complete one-way amnesia for the learning episode. However, objectively, neither recall nor recognition scores of patients were different from those of normal controls. It is suggested that clinical models of amnesia in DID may be specified to exclude episodic memory impairments for emotionally neutral material.

  12. Do enteric neurons make hypocretin? ☆

    PubMed Central

    Baumann, Christian R.; Clark, Erika L.; Pedersen, Nigel P.; Hecht, Jonathan L.; Scammell, Thomas E.

    2008-01-01

    Hypocretins (orexins) are wake-promoting neuropeptides produced by hypothalamic neurons. These hypocretin-producing cells are lost in people with narcolepsy, possibly due to an autoimmune attack. Prior studies described hypocretin neurons in the enteric nervous system, and these cells could be an additional target of an autoimmune process. We sought to determine whether enteric hypocretin neurons are lost in narcoleptic subjects. Even though we tried several methods (including whole mounts, sectioned tissue, pre-treatment of mice with colchicine, and the use of various primary antisera), we could not identify hypocretin-producing cells in enteric nervous tissue collected from mice or normal human subjects. These results raise doubts about whether enteric neurons produce hypocretin. PMID:18191238

  13. On the subjective acceptance during cardiovascular magnetic resonance imaging at 7.0 Tesla.

    PubMed

    Klix, Sabrina; Els, Antje; Paul, Katharina; Graessl, Andreas; Oezerdem, Celal; Weinberger, Oliver; Winter, Lukas; Thalhammer, Christof; Huelnhagen, Till; Rieger, Jan; Mehling, Heidrun; Schulz-Menger, Jeanette; Niendorf, Thoralf

    2015-01-01

    This study examines the subjective acceptance during UHF-CMR in a cohort of healthy volunteers who underwent a cardiac MR examination at 7.0T. Within a period of two-and-a-half years (January 2012 to June 2014) a total of 165 healthy volunteers (41 female, 124 male) without any known history of cardiac disease underwent UHF-CMR. For the assessment of the subjective acceptance a questionnaire was used to examine the participants experience prior, during and after the UHF-CMR examination. For this purpose, subjects were asked to respond to the questionnaire in an exit interview held immediately after the completion of the UHF-CMR examination under supervision of a study nurse to ensure accurate understanding of the questions. All questions were answered with "yes" or "no" including space for additional comments. Transient muscular contraction was documented in 12.7% of the questionnaires. Muscular contraction was reported to occur only during periods of scanning with the magnetic field gradients being rapidly switched. Dizziness during the study was reported by 12.7% of the subjects. Taste of metal was reported by 10.1% of the study population. Light flashes were reported by 3.6% of the entire cohort. 13% of the subjects reported side effects/observations which were not explicitly listed in the questionnaire but covered by the question about other side effects. No severe side effects as vomiting or syncope after scanning occurred. No increase in heart rate was observed during the UHF-CMR exam versus the baseline clinical examination. This study adds to the literature by detailing the subjective acceptance of cardiovascular magnetic resonance imaging examinations at a magnetic field strength of 7.0T. Cardiac MR examinations at 7.0T are well tolerated by healthy subjects. Broader observational and multi-center studies including patient cohorts with cardiac diseases are required to gain further insights into the subjective acceptance of UHF-CMR examinations.

  14. What is the relationship between mental workload factors and cognitive load types?

    PubMed

    Galy, Edith; Cariou, Magali; Mélan, Claudine

    2012-03-01

    The present study tested the hypothesis of an additive interaction between intrinsic, extraneous and germane cognitive load, by manipulating factors of mental workload assumed to have a specific effect on either type of cognitive load. The study of cognitive load factors and their interaction is essential if we are to improve workers' wellbeing and safety at work. High cognitive load requires the individual to allocate extra resources to entering information. It is thought that this demand for extra resources may reduce processing efficiency and performance. The present study tested the effects of three factors thought to act on either cognitive load type, i.e. task difficulty, time pressure and alertness in a working memory task. Results revealed additive effects of task difficulty and time pressure, and a modulation by alertness on behavioral, subjective and psychophysiological workload measures. Mental overload can be the result of a combination of task-related components, but its occurrence may also depend on subject-related characteristics, including alertness. Solutions designed to reduce incidents and accidents at work should consider work organization in addition to task constraints in so far that both these factors may interfere with mental workload. Copyright © 2011 Elsevier B.V. All rights reserved.

  15. Performance of a neuro-fuzzy model in predicting weight changes of chronic schizophrenic patients exposed to antipsychotics.

    PubMed

    Lan, T H; Loh, E W; Wu, M S; Hu, T M; Chou, P; Lan, T Y; Chiu, H-J

    2008-12-01

    Artificial intelligence has become a possible solution to resolve the problem of loss of information when complexity of a disease increases. Obesity phenotypes are observable clinical features of drug-naive schizophrenic patients. In addition, atypical antipsychotic medications may cause these unwanted effects. Here we examined the performance of neuro-fuzzy modeling (NFM) in predicting weight changes in chronic schizophrenic patients exposed to antipsychotics. Two hundred and twenty inpatients meeting DSMIV diagnosis of schizophrenia, treated with antipsychotics, either typical or atypical, for more than 2 years, were recruited. All subjects were assessed in the same study period between mid-November 2003 and mid-April 2004. The baseline and first visit's physical data including weight, height and circumference were used in this study. Clinical information (Clinical Global Impression and Life Style Survey) and genotype data of five single nucleotide polymorphisms were also included as predictors. The subjects were randomly assigned into the first group (105 subjects) and second group (115 subjects), and NFM was performed by using the FuzzyTECH 5.54 software package, with a network-type structure constructed in the rule block. A complete learned model trained from merged data of the first and second groups demonstrates that, at a prediction error of 5, 93% subjects with weight gain were identified. Our study suggests that NFM is a feasible prediction tool for obesity in schizophrenic patients exposed to antipsychotics, with further improvements required.

  16. Micro electro-mechanical heater

    DOEpatents

    Oh, Yunje; Asif, Syed Amanulla Syed; Cyrankowski, Edward; Warren, Oden Lee

    2016-04-19

    A sub-micron scale property testing apparatus including a test subject holder and heating assembly. The assembly includes a holder base configured to couple with a sub-micron mechanical testing instrument and electro-mechanical transducer assembly. The assembly further includes a test subject stage coupled with the holder base. The test subject stage is thermally isolated from the holder base. The test subject stage includes a stage subject surface configured to receive a test subject, and a stage plate bracing the stage subject surface. The stage plate is under the stage subject surface. The test subject stage further includes a heating element adjacent to the stage subject surface, the heating element is configured to generate heat at the stage subject surface.

  17. Micro electro-mechanical heater

    DOEpatents

    Oh, Yunje; Asif, Syed Amanulla Syed; Cyrankowski, Edward; Warren, Oden Lee

    2017-09-12

    A sub-micron scale property testing apparatus including a test subject holder and heating assembly. The assembly includes a holder base configured to couple with a sub-micron mechanical testing instrument and electro-mechanical transducer assembly. The assembly further includes a test subject stage coupled with the holder base. The test subject stage is thermally isolated from the holder base. The test subject stage includes a stage subject surface configured to receive a test subject, and a stage plate bracing the stage subject surface. The stage plate is under the stage subject surface. The test subject stage further includes a heating element adjacent to the stage subject surface, the heating element is configured to generate heat at the stage subject surface.

  18. They Know I Saw It: Evaluation Apprehension and Diffusion of Responsibility in Bystander Reactions to a Violent Crime.

    ERIC Educational Resources Information Center

    Gottlieb, Avi; Schwartz, Shalom H.

    Male and female bystanders witnessed a violent theft in the course of a bogus "ESP Experiment." In addition to the subjects' sex, two experimental manipulations were orthogonally crossed. The subject was either the only one to witness the emergency, or witnessed it with an additional participant (diffusion of responsibility), and the subject's…

  19. Five year global dataset: NMC operational analyses (1978 to 1982)

    NASA Technical Reports Server (NTRS)

    Straus, David; Ardizzone, Joseph

    1987-01-01

    This document describes procedures used in assembling a five year dataset (1978 to 1982) using NMC Operational Analysis data. These procedures entailed replacing missing and unacceptable data in order to arrive at a complete dataset that is continuous in time. In addition, a subjective assessment on the integrity of all data (both preliminary and final) is presented. Documentation on tapes comprising the Five Year Global Dataset is also included.

  20. Meteor Beliefs Project: Spears of GodSpears of God

    NASA Astrophysics Data System (ADS)

    Hendrix, Howard V.; McBeath, Alastair; Gheorghe, Andrei Dorian

    2012-04-01

    A selection of genuine or supposedly sky-fallen objects from real-world sources, a mixture of weapons, tools and "magical" objects of heavenly provenance, are drawn from their re-use in the near-future science-fiction novel Spears of God by author Howard V Hendrix, with additional discussion. The book includes other meteoric and meteoritic items too, some of which have been the subject of previous Meteor Beliefs Project examinations.

  1. Frequent Extreme Cold Exposure and Brown Fat and Cold-Induced Thermogenesis: A Study in a Monozygotic Twin

    PubMed Central

    Vosselman, Maarten J.; Vijgen, Guy H. E. J.; Kingma, Boris R. M.; Brans, Boudewijn; van Marken Lichtenbelt, Wouter D.

    2014-01-01

    Introduction Mild cold acclimation is known to increase brown adipose tissue (BAT) activity and cold-induced thermogenesis (CIT) in humans. We here tested the effect of a lifestyle with frequent exposure to extreme cold on BAT and CIT in a Dutch man known as ‘the Iceman’, who has multiple world records in withstanding extreme cold challenges. Furthermore, his monozygotic twin brother who has a ‘normal’ sedentary lifestyle without extreme cold exposures was measured. Methods The Iceman (subject A) and his brother (subject B) were studied during mild cold (13°C) and thermoneutral conditions (31°C). Measurements included BAT activity and respiratory muscle activity by [18F]FDG-PET/CT imaging and energy expenditure through indirect calorimetry. In addition, body temperatures, cardiovascular parameters, skin perfusion, and thermal sensation and comfort were measured. Finally, we determined polymorphisms for uncoupling protein-1 and β3-adrenergic receptor. Results Subjects had comparable BAT activity (A: 1144 SUVtotal and B: 1325 SUVtotal), within the range previously observed in young adult men. They were genotyped with the polymorphism for uncoupling protein-1 (G/G). CIT was relatively high (A: 40.1% and B: 41.9%), but unlike during our previous cold exposure tests in young adult men, here both subjects practiced a g-Tummo like breathing technique, which involves vigorous respiratory muscle activity. This was confirmed by high [18F]FDG-uptake in respiratory muscle. Conclusion No significant differences were found between the two subjects, indicating that a lifestyle with frequent exposures to extreme cold does not seem to affect BAT activity and CIT. In both subjects, BAT was not higher compared to earlier observations, whereas CIT was very high, suggesting that g-Tummo like breathing during cold exposure may cause additional heat production by vigorous isometric respiratory muscle contraction. The results must be interpreted with caution given the low subject number and the fact that both participants practised the g-Tummo like breathing technique. PMID:25014028

  2. A 1-year trial of repeated high-dose intravenous iron isomaltoside 1000 to maintain stable hemoglobin levels in inflammatory bowel disease

    PubMed Central

    Reinisch, Walter; Altorjay, Istvan; Zsigmond, Ferenc; Primas, Christian; Vogelsang, Harald; Novacek, Gottfried; Reinisch, Sieglinde; Thomsen, Lars L.

    2015-01-01

    Abstract Objective. Iron isomaltoside 1000 (Monofer®) is a high-dose intravenous (IV) iron, which in a recent 8 weeks trial in inflammatory bowel disease (IBD) subjects with iron deficiency anemia (IDA) demonstrated good tolerability and efficacy. The present trial is an extension to this trial, which evaluates the need for additional high IV iron doses to maintain a stable hemoglobin (Hb) ≥12.0 g/dl. Material and methods. This was a prospective, open-label, 12 months trial of European IBD subjects willing to participate after completing the lead-in trial. Subjects were allowed re-dosing with 500–2000 mg single doses of iron isomaltoside 1000 infused over ∼15 min at 3 months intervals depending on a predefined algorithm. Outcome measures included Hb, safety parameters and need for additional iron dosing. Results. A total of 39 subjects were enrolled of which 34 subjects required re-dosing with a median cumulative 1-year dose of 1.8 g (mean cumulative dose 2.2 g). The mean (SD) Hb was 12.3 (1.5) g/dl at baseline, 12.8 (1.6) g/dl at 3 months, 12.8 (1.6) g/dl at 6 months, 12.9 (1.4) g/dl at 9 months and 12.9 (1.6) g/dl at 12 months. Seventy-four percent of subjects who had an Hb ≥12.0 g/dl at baseline were able to maintain Hb ≥12.0 g/dl till the end of the trial at 12 months. Nonserious probably related hypersensitivity reactions without significant hypotension were reported at the beginning of the infusion in two subjects, who recovered without sequelae. Conclusion. Repeated treatment of iron deficiency with iron isomaltoside 1000 could avoid episodes of IDA without major safety issues. PMID:25900645

  3. Using Electrophysiological Measures to Assess the Consumer Acceptability of Smokeless Tobacco Products.

    PubMed

    Buzzell, George A; Das, Babita; Cruz-Cano, Raul; Nkongho, Lizette E; Kidanu, Azieb W; Kim, Hyoshin; Clark, Pamela I; McDonald, Craig G

    2016-09-01

    Adequate evaluation of novel tobacco products must include investigation of consumers' psychological response to such products. Traditionally, subjective scales of product liking have been used to assess consumer acceptability of tobacco products. However, subjective scales may miss cognitive changes that can only be captured by direct neurophysiological assessment. The present investigation explored the viability of using electroencephalography (EEG), in combination with traditional subjective measures, to assess consumer acceptability of five smokeless tobacco products. Given previous work linking product liking to arousal/attentional (executive function) enhancement, we focused on EEG measures of attention/arousal to objectively characterize cognitive changes associated with tobacco product use. During five separate laboratory visits, smokeless tobacco users used Verve discs, Ariva dissolvables, Skoal snuff, Camel snus, or Nicorette lozenges. The N2 and P3b event-related potential components elicited by an oddball task were used to index attentional changes before/after product usage. Additionally, resting state alpha band EEG activity was analyzed before/after product usage to index cortical arousal. Although analyses of the subjective results provided limited inference, analyses of the electrophysiological measures, particularly the alpha suppression measure, revealed robust differences between products. Skoal elicited significantly enhanced alpha suppression compared to all four other products tested. Additionally, alpha suppression was found to correlate positively with subjective measures of satisfaction and psychological reward, but was unrelated to perceived aversion. The present results provide evidence that electrophysiological measures can yield important insights into consumer acceptability of novel tobacco products and are a valuable complement to subjective measures. This study is the first to employ a combination of electrophysiological measures and traditional subjective assays in order to assess the consumer acceptability of smokeless tobacco products. The results highlight the importance of adopting a multidimensional/multi-method approach to studying the consumer acceptability of tobacco products. © The Author 2016. Published by Oxford University Press on behalf of the Society for Research on Nicotine and Tobacco. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  4. A Comparative Study of Randomized Constraint Solvers for Random-Symbolic Testing

    NASA Technical Reports Server (NTRS)

    Takaki, Mitsuo; Cavalcanti, Diego; Gheyi, Rohit; Iyoda, Juliano; dAmorim, Marcelo; Prudencio, Ricardo

    2009-01-01

    The complexity of constraints is a major obstacle for constraint-based software verification. Automatic constraint solvers are fundamentally incomplete: input constraints often build on some undecidable theory or some theory the solver does not support. This paper proposes and evaluates several randomized solvers to address this issue. We compare the effectiveness of a symbolic solver (CVC3), a random solver, three hybrid solvers (i.e., mix of random and symbolic), and two heuristic search solvers. We evaluate the solvers on two benchmarks: one consisting of manually generated constraints and another generated with a concolic execution of 8 subjects. In addition to fully decidable constraints, the benchmarks include constraints with non-linear integer arithmetic, integer modulo and division, bitwise arithmetic, and floating-point arithmetic. As expected symbolic solving (in particular, CVC3) subsumes the other solvers for the concolic execution of subjects that only generate decidable constraints. For the remaining subjects the solvers are complementary.

  5. Qualitative and quantitative aspects of information processing in first psychosis: latent class analyses in patients, at-risk subjects, and controls.

    PubMed

    van Tricht, Mirjam J; Bour, Lo J; Koelman, Johannes H T M; Derks, Eske M; Braff, David L; de Wilde, Odette M; Boerée, Thijs; Linszen, Don H; de Haan, Lieuwe; Nieman, Dorien H

    2015-04-01

    We aimed to determine profiles of information processing deficits in the pathway to first psychosis. Sixty-one subjects at ultrahigh risk (UHR) for psychosis were assessed, of whom 18 converted to a first episode of psychosis (FEP) within the follow-up period. Additionally, 47 FEP and 30 control subjects were included. Using 10 neurophysiological parameters associated with information processing, latent class analyses yielded three classes at baseline. Class membership was related to group status. Within the UHR sample, two classes were found. Transition to psychosis was nominally associated with class membership. Neurophysiological profiles were unstable over time, but associations between specific neurophysiological components at baseline and follow-up were found. We conclude that certain constellations of neurophysiological variables aid in the differentiation between controls and patients in the prodrome and after first psychosis. Copyright © 2014 Society for Psychophysiological Research.

  6. Improving subject recruitment, retention, and participation in research through Peplau's theory of interpersonal relations.

    PubMed

    Penckofer, Sue; Byrn, Mary; Mumby, Patricia; Ferrans, Carol Estwing

    2011-04-01

    Recruitment and retention of persons participating in research is one of the most significant challenges faced by investigators. Although incentives are often used to improve recruitment and retention, evidence suggests that the relationship of the patient to study personnel may be the single, most important factor in subject accrual and continued participation. Peplau's theory of interpersonal relations provides a framework to study the nurse-patient relationship during the research process. In this paper the authors provide a brief summary of research strategies that have been used for the recruitment and retention of subjects and an overview of Peplau's theory of interpersonal relations including its use in research studies. In addition, a discussion of how this theory was used for the successful recruitment and retention of women with type 2 diabetes who participated in a clinical trial using a nurse-delivered psychoeducational intervention for depression is addressed.

  7. One Session of Autogenic Training Increases Acute Subjective Sexual Arousal in Premenopausal Women Reporting Sexual Arousal Problems.

    PubMed

    Stanton, Amelia M; Hixon, J Gregory; Nichols, Lindsey M; Meston, Cindy M

    2018-01-01

    Below average heart rate variability (HRV) has been associated with sexual arousal dysfunction and overall sexual dysfunction in women. Autogenic training, a psychophysiologic relaxation technique, has been shown to increase HRV. In a recent study, sexually healthy women experienced acute increases in physiologic (ie, genital) and subjective sexual arousal after 1 brief session of autogenic training. To build on these findings by testing the effects of a single session of autogenic training on sexual arousal in a sample of women who reported decreased or absent sexual arousal for at least 6 months. Genital sexual arousal, subjective sexual arousal, and perceived genital sensations were assessed in 25 women 20 to 44 years old before and after listening to a 22-minute autogenic training recording. HRV was assessed with electrocardiography. Change in genital sexual arousal, subjective sexual arousal, and perceived genital sensations from the pre-manipulation erotic film to the post-manipulation erotic film. Marginally significant increases in discrete subjective sexual arousal (P = .051) and significant increases in perceived genital sensations (P = .018) were observed. In addition, degree of change in HRV significantly moderated increases in subjective arousal measured continuously over time (P < .0001). There were no significant increases in genital arousal after the manipulation. The results of this study suggest that autogenic training, and other interventions that aim to increase HRV, could be a useful addition to treatment protocols for women who are reporting a lack of subjective arousal or decreased genital sensations. There are few treatment options for women with arousal problems. We report on a new psychosocial intervention that could improve arousal. Limitations include a relatively small sample and the lack of a control group. Our findings indicate that autogenic training significantly improves acute subjective arousal and increases perceived genital sensations in premenopausal women with self-reported arousal concerns. Stanton AM, Hixon JG, Nichols LM, Meston CM. One Session of Autogenic Training Increases Acute Subjective Sexual Arousal in Premenopausal Women Reporting Sexual Arousal Problems. J Sex Med 2018;15:64-76. Copyright © 2017 International Society for Sexual Medicine. Published by Elsevier Inc. All rights reserved.

  8. Subjective Age and Changes in Memory in Older Adults.

    PubMed

    Stephan, Yannick; Sutin, Angelina R; Caudroit, Johan; Terracciano, Antonio

    2016-07-01

    The subjective experience of aging, indexed by how old or young an individual feels, has been related to well-being and health-related outcomes among older adults. The present study examined whether subjective age is associated with memory level and changes, as indexed by measures of immediate and delayed recall. A complementary purpose was to test the mediating role of depressive symptoms and physical activity in the relation between subjective age and memory changes. Participants were drawn from three waves of the Health and Retirement Study. Subjective age, baseline memory measures, and covariates were assessed during the 2008 wave (N = 5809), depressive symptoms and physical activity were assessed again in the 2010 wave, and the follow-up memory measures were assessed in the 2012 wave. Regression analyses that included demographic, metabolic, and vascular covariates revealed that a younger subjective age at baseline was associated with better concurrent performance and with slower decline in immediate and delayed recall. Bootstrap procedures indicated that fewer depressive symptoms mediated these associations. Additional analyses revealed that memory level and change were unrelated to changes in subjective age. Beyond chronological age, the subjective experience of age is associated with cognitive aging. © The Author 2015. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  9. Association of DPP4 Gene Polymorphisms with Type 2 Diabetes Mellitus in Malaysian Subjects

    PubMed Central

    Ahmed, Radwan H.; Huri, Hasniza Zaman; Al-Hamodi, Zaid; Salem, Sameer D.; Al-absi, Boshra; Muniandy, Sekaran

    2016-01-01

    Background Genetic polymorphisms of the Dipeptidyl Peptidase 4 (DPP4) gene may play a role in the etiology of type 2 diabetes mellitus (T2DM). This study aimed to investigate the possible association of single nucleotide polymorphisms (SNPs) of the DPP4 gene in Malaysian subjects with T2DM and evaluated whether they had an effect on the serum levels of soluble dipeptidyl peptidase 4 (sDPP-IV). Method Ten DPP4 SNPs were genotyped by TaqMan genotyping assays in 314 subjects with T2DM and 235 controls. Of these, 71 metabolic syndrome (MetS) subjects were excluded from subsequent analysis. The odds ratios (ORs) and their 95% confidence interval (CIs) were calculated using multiple logistic regression for the association between the SNPs of DPP4 and T2DM. In addition, the serum levels of sDPP-IV were investigated to evaluate the association of the SNPs of DPP4 with the sDPP-IV levels. Results Dominant, recessive, and additive genetic models were employed to test the association of DPP4 polymorphisms with T2DM, after adjusting for age, race, gender and BMI. The rs12617656 was associated with T2DM in Malaysian subjects in the recessive genetic model (OR = 1.98, p = 0.006), dominant model (OR = 1.95, p = 0.008), and additive model (OR = 1.63, p = 0.001). This association was more pronounced among Malaysian Indians, recessive (OR = 3.21, p = 0.019), dominant OR = 3.72, p = 0.003) and additive model (OR = 2.29, p = 0.0009). The additive genetic model showed that DPP4 rs4664443 and rs7633162 polymorphisms were associated with T2DM (OR = 1.53, p = 0.039), and (OR = 1.42, p = 0.020), respectively. In addition, the rs4664443 G>A polymorphism was associated with increased sDPP-IV levels (p = 0.042) in T2DM subjects. Conclusions DPP4 polymorphisms were associated with T2DM in Malaysian subjects, and linked to variations in sDPP-IV levels. In addition, these associations were more pronounced among Malaysian Indian subjects. PMID:27111895

  10. Association of DPP4 Gene Polymorphisms with Type 2 Diabetes Mellitus in Malaysian Subjects.

    PubMed

    Ahmed, Radwan H; Huri, Hasniza Zaman; Al-Hamodi, Zaid; Salem, Sameer D; Al-Absi, Boshra; Muniandy, Sekaran

    2016-01-01

    Genetic polymorphisms of the Dipeptidyl Peptidase 4 (DPP4) gene may play a role in the etiology of type 2 diabetes mellitus (T2DM). This study aimed to investigate the possible association of single nucleotide polymorphisms (SNPs) of the DPP4 gene in Malaysian subjects with T2DM and evaluated whether they had an effect on the serum levels of soluble dipeptidyl peptidase 4 (sDPP-IV). Ten DPP4 SNPs were genotyped by TaqMan genotyping assays in 314 subjects with T2DM and 235 controls. Of these, 71 metabolic syndrome (MetS) subjects were excluded from subsequent analysis. The odds ratios (ORs) and their 95% confidence interval (CIs) were calculated using multiple logistic regression for the association between the SNPs of DPP4 and T2DM. In addition, the serum levels of sDPP-IV were investigated to evaluate the association of the SNPs of DPP4 with the sDPP-IV levels. Dominant, recessive, and additive genetic models were employed to test the association of DPP4 polymorphisms with T2DM, after adjusting for age, race, gender and BMI. The rs12617656 was associated with T2DM in Malaysian subjects in the recessive genetic model (OR = 1.98, p = 0.006), dominant model (OR = 1.95, p = 0.008), and additive model (OR = 1.63, p = 0.001). This association was more pronounced among Malaysian Indians, recessive (OR = 3.21, p = 0.019), dominant OR = 3.72, p = 0.003) and additive model (OR = 2.29, p = 0.0009). The additive genetic model showed that DPP4 rs4664443 and rs7633162 polymorphisms were associated with T2DM (OR = 1.53, p = 0.039), and (OR = 1.42, p = 0.020), respectively. In addition, the rs4664443 G>A polymorphism was associated with increased sDPP-IV levels (p = 0.042) in T2DM subjects. DPP4 polymorphisms were associated with T2DM in Malaysian subjects, and linked to variations in sDPP-IV levels. In addition, these associations were more pronounced among Malaysian Indian subjects.

  11. Urinary Metabolite Profiles May be Predictive of Cognitive Performance Under Conditions of Acute Sleep Deprivation

    DTIC Science & Technology

    2016-01-01

    temporal changes in urinary metabolite profiles mirrored cognitive performance during continuous wakefulness. Additionally , subjects identified by...profiles mirrored cognitive performance during continuous wakefulness. Additionally , subjects identified by cognitive assessments as having a high...field studies and would have little useful application in occupational or military operational environments. Addition - ally, their usefulness is

  12. European Population Genetic Substructure: Further Definition of Ancestry Informative Markers for Distinguishing Among Diverse European Ethnic Groups

    PubMed Central

    Tian, Chao; Kosoy, Roman; Nassir, Rami; Lee, Annette; Villoslada, Pablo; Klareskog, Lars; Hammarström, Lennart; Garchon, Henri-Jean; Pulver, Ann E.; Ransom, Michael; Gregersen, Peter K.; Seldin, Michael F.

    2009-01-01

    The definition of European population genetic substructure and its application to understanding complex phenotypes is becoming increasingly important. In the current study using over 4000 subjects genotyped for 300 thousand SNPs we provide further insight into relationships among European population groups and identify sets of SNP ancestry informative markers (AIMs) for application in genetic studies. In general, the graphical description of these principal components analyses (PCA) of diverse European subjects showed a strong correspondence to the geographical relationships of specific countries or regions of origin. Clearer separation of different ethnic and regional populations was observed when northern and southern European groups were considered separately and the PCA results were influenced by the inclusion or exclusion of different self-identified population groups including Ashkenazi Jewish, Sardinian and Orcadian ethnic groups. SNP AIM sets were identified that could distinguish the regional and ethnic population groups. Moreover, the studies demonstrated that most allele frequency differences between different European groups could be effectively controlled in analyses using these AIM sets. The European substructure AIMs should be widely applicable to ongoing studies to confirm and delineate specific disease susceptibility candidate regions without the necessity to perform additional genome-wide SNP studies in additional subject sets. PMID:19707526

  13. European population genetic substructure: further definition of ancestry informative markers for distinguishing among diverse European ethnic groups.

    PubMed

    Tian, Chao; Kosoy, Roman; Nassir, Rami; Lee, Annette; Villoslada, Pablo; Klareskog, Lars; Hammarström, Lennart; Garchon, Henri-Jean; Pulver, Ann E; Ransom, Michael; Gregersen, Peter K; Seldin, Michael F

    2009-01-01

    The definition of European population genetic substructure and its application to understanding complex phenotypes is becoming increasingly important. In the current study using over 4,000 subjects genotyped for 300,000 single-nucleotide polymorphisms (SNPs), we provide further insight into relationships among European population groups and identify sets of SNP ancestry informative markers (AIMs) for application in genetic studies. In general, the graphical description of these principal components analyses (PCA) of diverse European subjects showed a strong correspondence to the geographical relationships of specific countries or regions of origin. Clearer separation of different ethnic and regional populations was observed when northern and southern European groups were considered separately and the PCA results were influenced by the inclusion or exclusion of different self-identified population groups including Ashkenazi Jewish, Sardinian, and Orcadian ethnic groups. SNP AIM sets were identified that could distinguish the regional and ethnic population groups. Moreover, the studies demonstrated that most allele frequency differences between different European groups could be controlled effectively in analyses using these AIM sets. The European substructure AIMs should be widely applicable to ongoing studies to confirm and delineate specific disease susceptibility candidate regions without the necessity of performing additional genome-wide SNP studies in additional subject sets.

  14. Auditory evoked potentials: predicting speech therapy outcomes in children with phonological disorders.

    PubMed

    Leite, Renata Aparecida; Wertzner, Haydée Fiszbein; Gonçalves, Isabela Crivellaro; Magliaro, Fernanda Cristina Leite; Matas, Carla Gentile

    2014-03-01

    This study investigated whether neurophysiologic responses (auditory evoked potentials) differ between typically developed children and children with phonological disorders and whether these responses are modified in children with phonological disorders after speech therapy. The participants included 24 typically developing children (Control Group, mean age: eight years and ten months) and 23 children clinically diagnosed with phonological disorders (Study Group, mean age: eight years and eleven months). Additionally, 12 study group children were enrolled in speech therapy (Study Group 1), and 11 were not enrolled in speech therapy (Study Group 2). The subjects were submitted to the following procedures: conventional audiological, auditory brainstem response, auditory middle-latency response, and P300 assessments. All participants presented with normal hearing thresholds. The study group 1 subjects were reassessed after 12 speech therapy sessions, and the study group 2 subjects were reassessed 3 months after the initial assessment. Electrophysiological results were compared between the groups. Latency differences were observed between the groups (the control and study groups) regarding the auditory brainstem response and the P300 tests. Additionally, the P300 responses improved in the study group 1 children after speech therapy. The findings suggest that children with phonological disorders have impaired auditory brainstem and cortical region pathways that may benefit from speech therapy.

  15. Management of bone mineral density in HIV-infected patients.

    PubMed

    Negredo, Eugenia; Bonjoch, Anna; Clotet, Bonaventura

    2016-01-01

    Loss of bone mineral density is an emerging problem in persons living with HIV infection. Earlier and more rapid bone demineralization has been attributed not only to the high prevalence of traditional risk factors, but also to specific HIV-related factors. The aim of this guidance is to stimulate an appropriate management of osteoporosis in this population, to identify patients at risk and to better manage them. Appropriate screening of HIV-infected subjects to identify those at risk for bone fractures is described, as well as the recommended interventions. American and European recommendations in HIV-infected and non-infected populations were considered. As the etiology of bone loss is multifactorial, many factors have to be addressed. Overall, recommendations on traditional risk factors are the same for HIV-infected and non-HIV-infected subjects. However, we should consider some specific factors in the HIV-infected population, including an appropriate antiretroviral therapy in patients with low bone mineral density, and probably novel strategies that could provide an additional benefit, such as anti-inflammatory drugs, although data supporting this approach are scant. Some personal opinions are highlighted on the management of bone health in HIV-infected subjects, mainly on the use of FRAX(®) score and DXA scans. In addition, the need to implement new strategies to delay demineralization is remarked upon.

  16. Buckling Behavior of Long Anisotropic Plates Subjected to Elastically Restrained Thermal Expansion

    NASA Technical Reports Server (NTRS)

    Nemeth, Michael P.

    2002-01-01

    An approach for synthesizing buckling results for, and behavior of, thin balanced and unbalanced symmetric laminates that are subjected to uniform heating or cooling and elastically restrained against thermal expansion or contraction is presented. This approach uses a nondimensional analysis for infinitely long, flexurally anisotropic plates that are subjected to combined mechanical loads and is based on useful nondimensional parameters. In addition, stiffness-weighted laminate thermal-expansion parameters and compliance coefficients are derived that are used to determine critical temperatures in terms of physically intuitive mechanical-buckling coefficients. The effects of membrane orthotropy and membrane anisotropy are included in the general formulation. Many results are presented for some common laminates that are intended to facilitate a structural designer's transition to the use of generic buckling design curves. Several curves that illustrate the fundamental parameters used in the analysis are presented, for nine contemporary material systems, that provide physical insight into the buckling response in addition to providing useful design data. Examples are presented that demonstrate the use of generic design curves. The analysis approach and generic results indicate the effects and characteristics of elastically restrained laminate thermal expansion or contraction, membrane orthotropy and anisotropy, and flexural orthotropy and anisotropy in a very general and unifying manner.

  17. Health factors in the everyday life and work of public sector employees in Sweden.

    PubMed

    Erlandsson, Lena-Karin; Carlsson, Gunilla; Horstmann, Vibeke; Gard, Gunvor; Holmström, Eva

    2012-01-01

    The aim was to explore aspects of everyday life in addition to established risk factors and their relationship to subjective health and well-being among public sector employees in Sweden. Gainful employment impact on employees' health and well-being, but work is only one part of everyday life and a broader perspective is essential in order to identify health-related factors. Data were obtained from employees at six Social Insurance Offices in Sweden, 250 women and 50 men. A questionnaire based on established instruments and questions specifically designed for this study was used. Relationships between five factors of everyday life, subjective health and well-being were investigated by means of multivariate logistic regression analysis. The final model revealed a limited importance of certain work-related factors. A general satisfaction with everyday activities, a stress-free environment and general control in addition to not having monotonous movements at work were found to be factors explaining 46.3% of subjective good health and well-being. A person's entire activity pattern, including work, is important, and strategies for promoting health should take into account the person's situation as a whole. The interplay between risk and health factors is not clear and further research is warranted.

  18. A randomized, double-blinded, controlled trial of the effects of fluid rate and/or presence of dextrose in intravenous fluids on the labor course of nulliparas.

    PubMed

    Fong, Alex; Serra, Allison E; Caballero, Deysi; Garite, Thomas J; Shrivastava, Vineet K

    2017-08-01

    Prolonged labor has been demonstrated to increase adverse maternal and neonatal outcome. A practice that may decrease the risk of prolonged labor is the modification of fluid intake during labor. Several studies demonstrated that increased hydration in labor as well as addition of dextrose-containing fluids may be associated with a decrease in length of labor. The purpose of our study was to characterize whether high-dose intravenous fluids, standard-dose fluids with dextrose, or high-dose fluids with dextrose show a difference in the duration of labor in nulliparas. Nulliparous subjects with singletons who presented in active labor were randomized to 1 of 3 groups of intravenous fluids: 250 mL/h of normal saline, 125 mL/h of 5% dextrose in normal saline, or 250 mL/h of 2.5% dextrose in normal saline. The primary outcome was total length of labor from initiation of intravenous fluid in vaginally delivered subjects. Secondary outcomes included cesarean delivery rate and length of second stage of labor, among other maternal and neonatal outcomes. In all, 274 subjects who met inclusion criteria were enrolled. There were no differences in baseline characteristics among the 3 groups. There was no difference in the primary outcome of total length of labor in vaginally delivered subjects among the 3 groups. First stage of labor duration, second stage of labor duration, and cesarean delivery rates were also equivalent. There were no differences identified in other secondary outcomes including clinical chorioamnionitis, postpartum hemorrhage, blood loss, Apgar scores, or neonatal intensive care admission. There is no difference in length of labor or delivery outcomes when comparing high-dose intravenous fluids, addition of dextrose, or use of high-dose intravenous fluids with dextrose in nulliparous women who present in active labor. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Identification of Cardiometabolic Vulnerabilities Caused by Effects of Synergistic Stressors that are Commonly Encountered During Space Missions

    NASA Technical Reports Server (NTRS)

    Ruger, M.; Scheer, F. A. J.; Barger, L. K.; Lockley, S. W.; Wang, W.; Johnston, S. L. III; Crucian, B.; Shea, A. S.

    2011-01-01

    Microgravity is a physiologically challenging state even when at rest. Astronauts experience additional physical and mental stresses, such as prolonged exertion, sleep loss and circadian misalignment, that could impact cardiovascular function. The main goals of this four year NASA project are to characterize the independent and synergistic effects on cardiovascular and immune function of: (1) circadian misalignment; (2) sleep loss; and (3) varied physical and mental stressors, mimicking some of the synergistic stressors experienced by astronauts. Sixteen healthy volunteers, aged 35-55 years, will be studied with standardized behavioral stressors occurring across all circadian phases, both with and without accruing sleep loss, achieved via two 11-day "forced desynchrony" protocols performed in each subject (randomized, within-subject design), where wake periods are advanced 4-h each "day" (i.e. recurring 20-h "days"). One protocol permits 8.33 h sleep opportunity per 20-h "day" (=10 h sleep per 24-h), and the other permits 5 h sleep per 20-h "day" (=6 h sleep per 24-h; matching the reported sleep duration of astronauts). In both protocols, subjects will perform a standardized stress battery including a cognitively challenging task; bicycle exercise, and passive 60deg head up tilt. Outcome variables include blood pressure, heart rate, arrhythmia frequency, cardiac vagal tone (from heart rate variability), sympathetic activity (catecholamines), and endothelial function. Additional measures of cardiac function (echocardiography), responses to a passive 80deg head up tilt, maximal oxygen uptake, and immune function will be assessed at the beginning and at the end of each protocol (i.e., without and with sleep loss, and before and after circadian misalignment). We hope to identify the relative impact on cardiovascular risk markers of varied behavioural stressors while subjects experience circadian misalignment and sleep loss, mimicking some of the synergistic stressors experienced by astronauts. Supported by NASANNX1 OAR 1 OG.

  20. Health in Elite Sports from a Salutogenetic Perspective: Athletes' Sense of Coherence

    PubMed Central

    Mayer, Jochen; Thiel, Ansgar

    2014-01-01

    Objective Considering the high number of stressors encountered in the context of elite sports, a high sense of coherence (SOC) is crucial to allow athletes to maintain their health from both short- and long-term perspectives. The aim of this cross-sectional study was to investigate SOC in a population of elite athletes, focusing on identification of subsets of athletes with particularly high and low SOC scores, and any related predictors. The elite athletes' SOC scores were also evaluated for differences with those of the general population of Germany; whether a correlation between SOC and subjective health existed was additionally examined. Method In total, 698 male and female elite athletes, drawn from Germany's highest-level national track and field squads, and first and second division handball teams, completed a survey that included the SOC-L9 Scale and measures of subjective health, sociodemographic information, and the number of injury lay-offs experienced during the athletes' careers to date. Results Classification tree analysis reveals six contrast groups with varying SOC scores. Several interacting factors determine the group to which an athlete belongs. Together with overuse injuries, additional factors are age, gender, and completed/not completed apprenticeship/degree. Female athletes aged between 19 and 25, who had already been subject to lay-offs due to overuse injuries, comprise the group with the lowest SOC scores. Overall, the SOC of elite athletes is slightly lower than in the general population. In accordance with other studies, a stronger SOC is also correlated significantly with better global subjective health. Conclusion The identification of contrast groups with varying SOC scores contributes to the development of more targeted salutogenetic health promotion programs. Such programs would ideally include learning modules pertaining to coping with overuse injuries, as well as social support systems aiming to effectively combine education and elite sport. PMID:25014085

  1. TREATMENT OF SUBACUTE POSTERIOR KNEE PAIN IN AN ADOLESCENT BALLET DANCER UTILIZING TRIGGER POINT DRY NEEDLING: A CASE REPORT

    PubMed Central

    Tansey, Kimberly A.; Westrick, Richard B.

    2014-01-01

    Study Design: Case Report. Background and Purpose: Dry needling (DN) is an increasingly popular intervention used by clinicians as a treatment of regional neuromusculoskeletal pain. DN is an invasive procedure that involves insertion of a thin monofilament needle directly into a muscle trigger point (MTP) with the intent of stimulating a local twitch response. Current evidence is somewhat limited, but recent literature supports the use of this intervention in specific neuromusculoskeletal conditions. The purpose of this case report is to present the outcomes of DN as a primary treatment intervention in an adolescent subject with subacute posterior knee pain. Case Description: The subject was a 16‐year‐old female competitive ballet dancer referred to physical therapy with a two month history of right posterior knee pain. Palpation identified MTPs which reproduced the patient’s primary symptoms. In addition to an exercise program promoting lower extremity flexibility and hip stability, the subject was treated with DN to the right gastrocnemius, soleus, and popliteus muscles. Outcomes: The subject reported being pain free on the Numerical Pain Scale and a +7 improvement in perceived change in recovery on the Global Rating of Change at final follow‐up. Physical examination demonstrated no observed impairments or functional limitations, including normal mobility, full strength, and unrestricted execution of dance maneuvers. Discussion: The patient was able to return to high level dance training and competition without physical limitations and resumed pre‐injury dynamic movement activities including dancing, running, jumping, and pivoting without pain. DN can be an effective and efficient intervention to assist patients in decreasing pain and returning to high intensity physical activity. Additional research is needed to determine if DN is effective for other body regions and has long‐term positive outcomes. Level of Evidence: Level 4 PMID:24567862

  2. Detection of Early lung Cancer Among Military Personnel (DECAMP)

    DTIC Science & Technology

    2017-10-01

    addition of two new recruitment sites. We have recruited ~75% of the 500 total subjects in the indeterminate pulmonary nodule study (Protocol 1), and...60% of the 800 total subjects in the longitudinal screening study (Protocol 2). We have also added a junior faculty pulmonary physician and scientific...supplement infrastructure support within DECAMP and pursue additional biomarker studies . 15. SUBJECT TERMS 16. SECURITY CLASSIFICATION OF: 17

  3. The health burden of breast hypertrophy.

    PubMed

    Kerrigan, C L; Collins, E D; Striplin, D; Kim, H M; Wilkins, E; Cunningham, B; Lowery, J

    2001-11-01

    Women seeking consultation for the surgical relief of symptoms associated with breast hypertrophy have been the focus of many studies. In contrast, little is known about those women with breast hypertrophy who do not seek symptomatic relief. The purpose of this study was to describe the health burden of breast hypertrophy by using a set of validated questionnaires and to compare women with breast hypertrophy who seek surgical treatment with those who do not. In addition, this latter group was compared with a group of control women without breast hypertrophy. Women seeking consultation for surgery were recruited from 14 plastic-surgery practices. Control subjects were recruited by advertisements in primary-care offices and newspapers. Women were asked to complete a self-report questionnaire that included the European Quality of Life (EuroQol) questionnaire, McGill Pain Questionnaire, Multidimensional Body Self Relations Questionnaire (MBSRQ), the Short Form-36 (SF-36) questionnaire, and questions regarding breast-related symptoms, comorbidities, and bra size. Descriptive statistics were compiled for three groups of women: (1) hypertrophy patients seeking surgical care, (2) hypertrophy control subjects (those whose reported bra-cup size was a D or larger), and (3) normal control subjects (those whose reported bra-cup size was an A, B, or C). The multiple linear regression method was used to compare the health burdens across groups while adjusting for other variables. Two hundred ninety-one women seeking surgical care and 195 control subjects were enrolled in the study. The 184 control subjects with bra-cup information available were further separated into 88 hypertrophy control subjects and 96 normal control subjects. In the control group, bra-cup size was correlated with health-burden measures, whereas in the surgical candidates, it was not. When scores were compared across the three groups, significant differences were found in all health-burden measures. The surgical candidates scored more poorly on the EuroQol utility, McGill pain rating index, MBSRQ appearance evaluation, physical component scale of the SF-36, and on breast symptoms than did the two control groups. In addition, the hypertrophy control subjects scored more poorly than the normal control subjects. With multiple linear regression analysis incorporating important potential confounders, the poorer scores in the surgical candidates remained statistically significant. It was concluded that breast hypertrophy in those seeking surgical care and those not seeking surgery has a significant impact on women's quality of life as measured by validated and widely used self-report instruments including the EuroQol, MBSRQ, McGill Pain Questionnaire, and the SF-36. Likewise, a new assessment instrument for breast-related symptoms also demonstrated greater symptomatology in women with breast hypertrophy.

  4. Crisis in Cataloging Revisited: The Year's Work in Subject Analysis, 1990.

    ERIC Educational Resources Information Center

    Young, James Bradford

    1991-01-01

    Reviews the 1990 literature that concerns subject analysis. Issues addressed include subject cataloging, including Library of Congress Subject Headings (LCSH); classification, including Dewey Decimal Classification (DDC), Library of Congress Classification, and classification in online systems; subject access, including the online use of…

  5. FBXL4 defects are common in patients with congenital lactic acidemia and encephalomyopathic mitochondrial DNA depletion syndrome.

    PubMed

    Dai, H; Zhang, V W; El-Hattab, A W; Ficicioglu, C; Shinawi, M; Lines, M; Schulze, A; McNutt, M; Gotway, G; Tian, X; Chen, S; Wang, J; Craigen, W J; Wong, L-J

    2017-04-01

    Mutations in FBXL4 have recently been recognized to cause a mitochondrial disorder, with clinical features including early onset lactic acidosis, hypotonia, and developmental delay. FBXL4 sequence analysis was performed in 808 subjects suspected to have a mitochondrial disorder. In addition, 28 samples from patients with early onset of lactic acidosis, but without identifiable mutations in 192 genes known to cause mitochondrial diseases, were examined for FBXL4 mutations. Definitive diagnosis was made in 10 new subjects with a total of 7 novel deleterious variants; 5 null and 2 missense substitutions. All patients exhibited congenital lactic acidemia, most of them with severe encephalopathic presentation, and global developmental delay. Overall, FBXL4 defects account for at least 0.7% (6 out of 808) of subjects suspected to have a mitochondrial disorder, and as high as 14.3% (4 out of 28) in young children with congenital lactic acidosis and clinical features of mitochondrial disease. Including FBLX4 in the mitochondrial diseases panel should be particularly important for patients with congenital lactic acidosis. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  6. In vivo antiplaque efficacy of combined antimicrobial dentifrice and rinse hygiene regimens.

    PubMed

    White, Donald J; Barker, Matthew L; Klukowska, Malgorzata

    2008-06-01

    To evaluate using digital plaque image analysis the antiplaque efficacy of oral care regimens including use of antimicrobial toothpaste in combination with antimicrobial mouthrinse. 16 subjects completed the study protocol including: (1) initial treatment phase, all subjects used a standard sodium fluoride dentifrice with 2x/day brushing, (2) second treatment phase, subjects were randomized to two treatment groups: stannous fluoride/sodium hexametaphosphate dentifrice or sodium fluoride triclosan/copolymer dentifrice; (3) third treatment phase, the group using stannous fluoride dentifrice rinsed with alcohol-free cetylpyridinium chloride mouthrinse and the group using triclosan dentifrice rinsed with essential oil mouthrinse. During each phase, plaque levels were assessed in the morning before toothbrushing (AM), post-brushing in the morning (PB) and in the afternoon (PM). Stannous fluoride dentifrice was superior to triclosan dentifrice in plaque growth inhibition between toothbrushing. Both mouthrinses provided additional plaque prevention benefits when used with antimicrobial dentifrices. The cetylpyridinium chloride mouthrinse and stannous fluoride dentifrice regimen was particularly effective, building accretive efficacy over time. Average plaque reductions exceeded 50% vs. sodium fluoride dentifrice alone. Chemotherapeutic dentifrices and rinses increase plaque control used alone and particularly in combination. The stannous fluoride-cetylpyridinium chloride regimen showed the greatest benefits.

  7. A Four-Dimensional Probabilistic Atlas of the Human Brain

    PubMed Central

    Mazziotta, John; Toga, Arthur; Evans, Alan; Fox, Peter; Lancaster, Jack; Zilles, Karl; Woods, Roger; Paus, Tomas; Simpson, Gregory; Pike, Bruce; Holmes, Colin; Collins, Louis; Thompson, Paul; MacDonald, David; Iacoboni, Marco; Schormann, Thorsten; Amunts, Katrin; Palomero-Gallagher, Nicola; Geyer, Stefan; Parsons, Larry; Narr, Katherine; Kabani, Noor; Le Goualher, Georges; Feidler, Jordan; Smith, Kenneth; Boomsma, Dorret; Pol, Hilleke Hulshoff; Cannon, Tyrone; Kawashima, Ryuta; Mazoyer, Bernard

    2001-01-01

    The authors describe the development of a four-dimensional atlas and reference system that includes both macroscopic and microscopic information on structure and function of the human brain in persons between the ages of 18 and 90 years. Given the presumed large but previously unquantified degree of structural and functional variance among normal persons in the human population, the basis for this atlas and reference system is probabilistic. Through the efforts of the International Consortium for Brain Mapping (ICBM), 7,000 subjects will be included in the initial phase of database and atlas development. For each subject, detailed demographic, clinical, behavioral, and imaging information is being collected. In addition, 5,800 subjects will contribute DNA for the purpose of determining genotype– phenotype–behavioral correlations. The process of developing the strategies, algorithms, data collection methods, validation approaches, database structures, and distribution of results is described in this report. Examples of applications of the approach are described for the normal brain in both adults and children as well as in patients with schizophrenia. This project should provide new insights into the relationship between microscopic and macroscopic structure and function in the human brain and should have important implications in basic neuroscience, clinical diagnostics, and cerebral disorders. PMID:11522763

  8. Association of gastro-oesophageal reflux and chronic rhinosinusitis: systematic review and meta-analysis.

    PubMed

    Leason, S R; Barham, H P; Oakley, G; Rimmer, J; DelGaudio, J M; Christensen, J M; Sacks, R; Harvey, R J

    2017-03-01

    Gastro-oesophageal reflux disease (GORD) has been implicated in the development of chronic rhinosinusitis (CRS). The association of GORD with CRS is systematically assessed from the medical literature. Embase and MEDLINE were searched using a comprehensive strategy limited to English language and Human subjects. Any study with original data on the experimental, diagnostic, treatment or prognostic association of CRS with GORD was included. Studies without a control group, case reports and review articles were excluded. The search returned 958 records, with an additional 10 found from bibliographic lists; this produced 32 studies. The included studies (n=32) consisted of studies reporting pathogenic factors (n=20), epidemiological association (n=8), prognostic interactions (n=3), and a combination of these outcomes (n=1). Potential pathogenic roles for GORD in CRS were supported; CRS subjects had greater prevalence of intranasal Helicobacter pylori and acid reflux than subjects without CRS. CRS is more prevalent in GORD sufferers than those without GORD. Evidence is conflicting for GORD as a factor in CRS treatment failure. The results support a significant association of GORD with CRS. Physicians should be cognizant of the potential for acid and non-acid reflux as a driving factor in CRS.

  9. [Evaluation of nutrition instruction in a group of Senegalese students at the secondary level].

    PubMed

    Sakiliba, H; Turgeon-O'brien, H; Vallières, A; Plante, J

    2001-04-01

    In Senegal, nutrition instruction was implanted in 1981 in the national curriculum of biology and has never been evaluated since. The purpose of this study, was to evaluate the effect of a six weeks nutrition instruction program on improving nutrition knowledge and nutrition attitudes in an experimental group including 81 subjects aged 16.7+/-1.2 years and a control group including 80 subjects aged 15.7+/-1.3 years. These subjects came respectively from third and fourth grade. A questionnaire on knowledge and one on attitudes were administered to the experimental group, before and after the nutrition instruction, while the control group, who did not received any nutrition instruction, also answered the questionnaires. Results indicate that the adjusted mean knowledge posttest scores did not significantly increase in the experimental group compared to the control group. In addition, the adjusted mean attitude postscores of the boys and girls of the experimental group on the attitude scale "Nutrition affects health" were significantly higher from that of the control group. An evaluation of the nutrition curriculum and the teaching methods is suggested in order to improve the effectiveness of this nutrition program.

  10. No differences in subjective knee function between surgical techniques of anterior cruciate ligament reconstruction at 2-year follow-up: a cohort study from the Swedish National Knee Ligament Register.

    PubMed

    Hamrin Senorski, Eric; Sundemo, David; Murawski, Christopher D; Alentorn-Geli, Eduard; Musahl, Volker; Fu, Freddie; Desai, Neel; Stålman, Anders; Samuelsson, Kristian

    2017-12-01

    The purpose of this study was to investigate how different techniques of single-bundle anterior cruciate ligament (ACL) reconstruction affect subjective knee function via the Knee injury and Osteoarthritis Outcome Score (KOOS) evaluation 2 years after surgery. It was hypothesized that the surgical techniques of single-bundle ACL reconstruction would result in equivalent results with respect to subjective knee function 2 years after surgery. This cohort study was based on data from the Swedish National Knee Ligament Register during the 10-year period of 1 January 2005 through 31 December 2014. Patients who underwent primary single-bundle ACL reconstruction with hamstrings tendon autograft were included. Details on surgical technique were collected using a web-based questionnaire comprised of essential AARSC items, including utilization of accessory medial portal drilling, anatomic tunnel placement, and visualization of insertion sites and landmarks. A repeated measures ANOVA and an additional linear mixed model analysis were used to investigate the effect of surgical technique on the KOOS 4 from the pre-operative period to 2-year follow-up. A total of 13,636 patients who had undergone single-bundle ACL reconstruction comprised the study group for this analysis. A repeated measures ANOVA determined that mean subjective knee function differed between the pre-operative time period and at 2-year follow-up (p < 0.001). No differences were found with respect to the interaction between KOOS 4 and surgical technique or gender. Additionally, the linear mixed model adjusted for age at reconstruction, gender, and concomitant injuries showed no difference between surgical techniques in KOOS 4 improvement from baseline to 2-year follow-up. However, KOOS 4 improved significantly in patients for all surgical techniques of single-bundle ACL reconstruction (p < 0.001); the largest improvement was seen between the pre-operative time period and at 1-year follow-up. Surgical techniques of primary single-bundle ACL reconstruction did not demonstrate differences in the improvement in baseline subjective knee function as measured with the KOOS 4 during the first 2 years after surgery. However, subjective knee function improved from pre-operative baseline to 2-year follow-up independently of surgical technique.

  11. Unraveling of Enigmatic Hearing-Impaired GJB2 Single Heterozygotes by Massive Parallel Sequencing: DFNB1 or Not?

    PubMed Central

    Kim, So Young; Kim, Ah Reum; Kim, Nayoung K. D.; Lee, Chung; Kim, Min Young; Jeon, Eun-Hee; Park, Woong-Yang; Choi, Byung Yoon

    2016-01-01

    Abstract The molecular etiology of nonsyndromic sensorineural hearing loss (SNHL) in subjects with only one detectable autosomal recessive GJB2 mutation is unclear. Here, we report GJB2 single heterozygotes with various final genetic diagnoses and suggest appropriate diagnostic strategies. A total of 160 subjects with SNHL without phenotypic markers were screened for GJB2 mutations. Single-nucleotide variants or structural variations within the DFNB1 locus or in other deafness genes were examined by Sanger sequencing, breakpoint PCR, and targeted exome sequencing (TES) of 129 deafness genes. We identified 27 subjects with two mutations and 10 subjects with only one detectable mutation in GJB2. The detection rate of the single GJB2 mutation among the 160 SNHL subjects in the present study (6.25%) was higher than 2.58% in normal hearing controls in Korean. The DFNB1 was clearly excluded as a molecular etiology in four (40%) subjects: other recessive deafness genes (N = 3) accounted for SNHL and the causative gene for the other non-DFNB1 subject (N = 1) was not identified. The etiology of additional two subjects was potentially explained by digenic etiology (N = 2) of GJB2 with MITF and GJB3, respectively. The contribution of the single GJB2 mutation in the four remaining subjects is unclear. Comprehensive diagnostic testing including TES is prerequisite for understanding GJB2 single heterozygotes. PMID:27057829

  12. Are Scores From NBME Subject Examinations Valid Measures of Knowledge Acquired During Clinical Clerkships?

    PubMed

    Ryan, Michael S; Bishop, Steven; Browning, Joel; Anand, Rahul J; Waterhouse, Elizabeth; Rigby, Fidelma; Al-Mateen, Cheryl S; Lee, Clifton; Bradner, Melissa; Colbert-Getz, Jorie M

    2017-06-01

    The National Board of Medical Examiners' Clinical Science Subject Examinations are a component used by most U.S. medical schools to determine clerkship grades. The purpose of this study was to examine the validity of this practice. This was a retrospective cohort study of medical students at the Virginia Commonwealth University School of Medicine who completed clerkships in 2012 through 2014. Linear regression was used to determine how well United States Medical Licensing Examination Step 1 scores predicted Subject Examination scores in seven clerkships. The authors then substituted each student's Subject Examination standard scores with his or her Step 1 standard score. Clerkship grades based on the Step 1 substitution were compared with actual grades with the Wilcoxon rank test. A total of 2,777 Subject Examination scores from 432 students were included in the analysis. Step 1 scores significantly predicted between 23% and 44% of the variance in Subject Examination scores, P < .001 for all clerkship regression equations. Mean differences between expected and actual Subject Examination scores were small (≤ 0.2 points). There was a match between 73% of Step 1 substituted final clerkship grades and actual final clerkship grades. The results of this study suggest that performance on Step 1 can be used to identify and counsel students at risk for poor performance on the Subject Examinations. In addition, these findings call into the question the validity of using scores from Subject Examinations as a high-stakes assessment of learning in individual clerkships.

  13. Factors Influencing Cognitive Function in Subjects With COPD.

    PubMed

    Dag, Ersel; Bulcun, Emel; Turkel, Yakup; Ekici, Aydanur; Ekici, Mehmet

    2016-08-01

    The aim of this study was to assess the association between cognitive function and age, pulmonary function, comorbidity index, and the 6-min walk distance in subjects with COPD as well as to compare the Mini Mental State Examination (MMSE) and Montreal Cognitive Assessment (MoCA) in terms of their ability to identify cognitive dysfunction in subjects with COPD. A total of 52 individuals with stable COPD were included in this study. Cognitive function was assessed using MMSE and MoCA. Age, body mass index, the Modified Cumulative Illness Rating Scale, 6-min walk distance, arterial blood gases, and pulmonary function tests were assessed and recorded. The range and SD of scores in subjects with COPD were larger with MoCA than with MMSE. MMSE and MoCA scores are associated with 6-min walk distance and comorbidity index in subjects with COPD. General cognitive function measured by MoCA was negatively correlated with the comorbidity index but was positively associated with 6-min walk distance in subjects with COPD after controlling for possible confounding factors in the multivariate model. However, general cognitive function measured by MMSE was not correlated with the comorbidity index and 6-min walk distance in subjects with COPD, after controlling for possible confounding factors in the multivariate model. MoCA may be a more reliable screening test than MMSE in detecting cognitive impairment in subjects with COPD. The addition of cognitive tests on assessment of subjects with COPD can provide further benefit. Copyright © 2016 by Daedalus Enterprises.

  14. Differential dietary habits among 570 young underweight Japanese women with and without a desire for thinness: a comparison with normal weight counterparts.

    PubMed

    Mori, Nagisa; Asakura, Keiko; Sasaki, Satoshi

    2016-01-01

    The strong social pressure for thinness in Japanese society has produced a dramatic increase in underweight (body mass index: <18.5 kg/m2) among young women. Being underweight is associated with several negative health outcomes, including nutritional deficiency, osteoporosis, and unfavourable pregnancy outcomes. However, evidence which would help deal with this problem from a public health perspective is scarce. Here, we aimed to identify the dietary characteristics of underweight female university students, particularly those with a desire for thinness. Data on dietary habits and other lifestyle variables, including the desire for thinness, were obtained through a self-administered questionnaire survey conducted at 54 academic institutions in Japan, from which we selected 3634 female students for analysis. The subjects were divided into three groups of normal weight (84.3%), and underweight with (6.4%) or without (9.3%) a desire for thinness. After adjusting for potential confounders, the underweight subjects with a desire for thinness consumed less cereal and rice, whereas those without a desire for thinness consumed more cereal and rice than the normal weight subjects. In addition, those without a desire for thinness consumed less confectionaries, including candies and ice cream, and less fats and oils than the normal weight subjects. These results suggest that dietary habits differ between underweight women with and without a desire for thinness. Although both groups require nutritional education to maintain appropriate body weight, underweight women with a desire for thinness require particular attention to improve recognition of their constitution and dietary habits.

  15. Management of Patient Experience With ATX-101 (Deoxycholic Acid Injection) for Reduction of Submental Fat.

    PubMed

    Dover, Jeffrey S; Kenkel, Jeffrey M; Carruthers, Alastair; Lizzul, Paul F; Gross, Todd M; Subramanian, Meenakshi; Beddingfield, Frederick C

    2016-11-01

    ATX-101 (deoxycholic acid injection; Kythera Biopharmaceuticals, Inc., Westlake Village, CA [an affiliate of Allergan plc, Dublin, Ireland]) was recently approved for submental fat (SMF) reduction in the United States (Kybella) and Canada (Belkyra). The pivotal trials supporting these approvals revealed that ATX-101 is associated with common injection-site treatment reactions consistent with its mechanism of action and administration procedure. The purpose of this study was to evaluate 4 patient experience management paradigms targeting the common injection-site adverse events of pain, swelling/edema, and bruising after a single treatment session with ATX-101. In this double-blind, parallel-group, exploratory Phase 3b study (ClinicalTrials.gov identifier: NCT02007434), subjects with moderate to severe SMF were randomized 4:1 within each paradigm to receive ATX-101 2 mg/cm or placebo. In Paradigm 1, subjects received a cold pack application to the treatment area. In Paradigm 2, in addition to cold pack application, subjects were treated with topical lidocaine and injectable lidocaine containing epinephrine. In Paradigm 3, in addition to the interventions of Paradigm 2, subjects received loratadine and ibuprofen. Subjects in Paradigm 4 received the same interventions in Paradigm 3, plus application of a chin strap. Eighty-three subjects were treated. In ATX-101-treated subjects, peak pain occurred within 1 to 5 minutes of treatment, with median values at these time points ranging from 21.4 to 35.7 mm on a 100-mm pain visual analog scale ("mild"). Pain ratings reduced substantially by 15 minutes; at 4 hours after injection, pain was characterized as mild tenderness or mild achiness. Compared with cold alone, treatment with topical and injectable lidocaine reduced median peak pain by 17%. Addition of ibuprofen and loratadine resulted in a total reduction in pain by 40%. Peak swelling/edema in ATX-101-treated subjects was "modest," with mean values ≤1.7 (on a 0-5 scale) across all paradigms. Swelling/edema was not substantially mitigated by the interventions, including ibuprofen, loratidine, and the use of a chin strap. Bruising associated with ATX-101 treatment was confined to the treatment area, with mean values between 1.0 and 1.4 on a 0-to-5 scale. Bruising was modestly reduced by injectable lidocaine with epinephrine. Results from this study support the safety of ATX-101 for SMF reduction, and demonstrate that pain and bruising associated with ATX-101 treatment can be mitigated by a series of simple measures.

  16. Inappropriate usage of dietary supplements in patients by miscommunication with physicians in Japan.

    PubMed

    Chiba, Tsuyoshi; Sato, Yoko; Nakanishi, Tomoko; Yokotani, Kaori; Suzuki, Sachina; Umegaki, Keizo

    2014-11-26

    Recently, people have used dietary supplements not only for nutritional supplementation, but also for treatment of their diseases. However, use of dietary supplements to treat diseases, especially with medications, may cause health problems in patients. In this study, we investigated use of dietary supplements in patients in Japan. This survey was conducted from January to December 2012, and was completed by 2732 people, including 599 admitted patients, 1154 ambulatory patients, and 979 healthy subjects who attended a seminar about dietary supplements. At the time of the questionnaire, 20.4% of admitted patients, 39.1% of ambulatory patients, and 30.7% of healthy subjects were using dietary supplements, which including vitamin/mineral supplements, herbal extracts, its ingredients, or food for specified health uses. The primary purpose for use in all groups was health maintenance, whereas 3.7% of healthy subjects, 10.0% of ambulatory patients, and 13.2% of admitted patients used dietary supplements to treat diseases. In addition, 17.7% of admitted patients and 36.8% of ambulatory patients were using dietary supplements concomitantly with their medications. However, among both admitted patients and ambulatory patients, almost 70% did not mention dietary supplement use to their physicians. Overall, 3.3% of all subjects realized adverse effects associated with dietary supplements. Communication between patients and physicians is important to avoid health problems associated with the use of dietary supplements.

  17. Analysis of physiological impact while reading stereoscopic radiographs

    NASA Astrophysics Data System (ADS)

    Unno, Yasuko Y.; Tajima, Takashi; Kuwabara, Takao; Hasegawa, Akira; Natsui, Nobutaka; Ishikawa, Kazuo; Hatada, Toyohiko

    2011-03-01

    A stereoscopic viewing technology is expected to improve diagnostic performance in terms of reading efficiency by adding one more dimension to the conventional 2D images. Although a stereoscopic technology has been applied to many different field including TV, movies and medical applications, physiological fatigue through reading stereoscopic radiographs has been concerned although no established physiological fatigue data have been provided. In this study, we measured the α-amylase concentration in saliva, heart rates and normalized tissue hemoglobin index (nTHI) in blood of frontal area to estimate physiological fatigue through reading both stereoscopic radiographs and the conventional 2D radiographs. In addition, subjective assessments were also performed. As a result, the pupil contraction occurred just after the reading of the stereoscopic images, but the subjective assessments regarding visual fatigue were nearly identical for the reading the conventional 2D and stereoscopic radiographs. The α-amylase concentration and the nTHI continued to decline while examinees read both 2D and stereoscopic images, which reflected the result of subjective assessment that almost half of the examinees reported to feel sleepy after reading. The subjective assessments regarding brain fatigue showed that there were little differences between 2D and stereoscopic reading. In summary, this study shows that the physiological fatigue caused by stereoscopic reading is equivalent to the conventional 2D reading including ocular fatigue and burden imposed on brain.

  18. Neuropsychiatric effects of anabolic steroids in male normal volunteers.

    PubMed

    Su, T P; Pagliaro, M; Schmidt, P J; Pickar, D; Wolkowitz, O; Rubinow, D R

    1993-06-02

    To evaluate the acute effects of anabolic steroids on mood and behavior in male normal volunteers. A 2-week, double-blind (subject and rater), fixed-order, placebo-controlled crossover trial of methyltestosterone. An inpatient research unit at the National Institutes of Health. A volunteer sample of 20 men who were medication free, free of medical and psychiatric illness, not involved in athletic training, and had no prior history of anabolic steroid use. A sequential trial for 3 days each of the following four drug conditions: placebo baseline, low-dose methyltestosterone (40 mg/d), high-dose methyltestosterone (240 mg/d), and placebo withdrawal. Mood and behavioral ratings were completed during each drug condition and included both subjective and objective measures. Significant (P < .05) albeit subtle increases in symptom scores were observed during high-dose methyltestosterone administration compared with baseline in positive mood (euphoria, energy, and sexual arousal), negative mood (irritability, mood swings, violent feelings, and hostility), and cognitive impairment (distractibility, forgetfulness, and confusion). An acute manic episode was observed in one of the 20 subjects, representing a 5% incidence, even under these conservative conditions. An additional subject became hypomanic. Baseline characteristics including family psychiatric history or previous drug abuse did not predict symptom changes. This is the first placebo-controlled prospective study demonstrating the adverse and activating mood and behavioral effects of anabolic steroids.

  19. Orbitofrontal cortical activity during repeated free choice.

    PubMed

    Campos, Michael; Koppitch, Kari; Andersen, Richard A; Shimojo, Shinsuke

    2012-06-01

    Neurons in the orbitofrontal cortex (OFC) have been shown to encode subjective values, suggesting a role in preference-based decision-making, although the precise relation to choice behavior is unclear. In a repeated two-choice task, subjective values of each choice can account for aggregate choice behavior, which is the overall likelihood of choosing one option over the other. Individual choices, however, are impossible to predict with knowledge of relative subjective values alone. In this study we investigated the role of internal factors in choice behavior with a simple but novel free-choice task and simultaneous recording from individual neurons in nonhuman primate OFC. We found that, first, the observed sequences of choice behavior included periods of exceptionally long runs of each of two available options and periods of frequent switching. Neither a satiety-based mechanism nor a random selection process could explain the observed choice behavior. Second, OFC neurons encode important features of the choice behavior. These features include activity selective for exceptionally long runs of a given choice (stay selectivity) as well as activity selective for switches between choices (switch selectivity). These results suggest that OFC neural activity, in addition to encoding subjective values on a long timescale that is sensitive to satiety, also encodes a signal that fluctuates on a shorter timescale and thereby reflects some of the statistically improbable aspects of free-choice behavior.

  20. Inappropriate Usage of Dietary Supplements in Patients by Miscommunication with Physicians in Japan

    PubMed Central

    Chiba, Tsuyoshi; Sato, Yoko; Nakanishi, Tomoko; Yokotani, Kaori; Suzuki, Sachina; Umegaki, Keizo

    2014-01-01

    Recently, people have used dietary supplements not only for nutritional supplementation, but also for treatment of their diseases. However, use of dietary supplements to treat diseases, especially with medications, may cause health problems in patients. In this study, we investigated use of dietary supplements in patients in Japan. This survey was conducted from January to December 2012, and was completed by 2732 people, including 599 admitted patients, 1154 ambulatory patients, and 979 healthy subjects who attended a seminar about dietary supplements. At the time of the questionnaire, 20.4% of admitted patients, 39.1% of ambulatory patients, and 30.7% of healthy subjects were using dietary supplements, which including vitamin/mineral supplements, herbal extracts, its ingredients, or food for specified health uses. The primary purpose for use in all groups was health maintenance, whereas 3.7% of healthy subjects, 10.0% of ambulatory patients, and 13.2% of admitted patients used dietary supplements to treat diseases. In addition, 17.7% of admitted patients and 36.8% of ambulatory patients were using dietary supplements concomitantly with their medications. However, among both admitted patients and ambulatory patients, almost 70% did not mention dietary supplement use to their physicians. Overall, 3.3% of all subjects realized adverse effects associated with dietary supplements. Communication between patients and physicians is important to avoid health problems associated with the use of dietary supplements. PMID:25431879

  1. Orbitofrontal cortical activity during repeated free choice

    PubMed Central

    Koppitch, Kari; Andersen, Richard A.; Shimojo, Shinsuke

    2012-01-01

    Neurons in the orbitofrontal cortex (OFC) have been shown to encode subjective values, suggesting a role in preference-based decision-making, although the precise relation to choice behavior is unclear. In a repeated two-choice task, subjective values of each choice can account for aggregate choice behavior, which is the overall likelihood of choosing one option over the other. Individual choices, however, are impossible to predict with knowledge of relative subjective values alone. In this study we investigated the role of internal factors in choice behavior with a simple but novel free-choice task and simultaneous recording from individual neurons in nonhuman primate OFC. We found that, first, the observed sequences of choice behavior included periods of exceptionally long runs of each of two available options and periods of frequent switching. Neither a satiety-based mechanism nor a random selection process could explain the observed choice behavior. Second, OFC neurons encode important features of the choice behavior. These features include activity selective for exceptionally long runs of a given choice (stay selectivity) as well as activity selective for switches between choices (switch selectivity). These results suggest that OFC neural activity, in addition to encoding subjective values on a long timescale that is sensitive to satiety, also encodes a signal that fluctuates on a shorter timescale and thereby reflects some of the statistically improbable aspects of free-choice behavior. PMID:22423007

  2. Cannabinoid CB1 receptor immunoreactivity in the prefrontal cortex: Comparison of schizophrenia and major depressive disorder.

    PubMed

    Eggan, Stephen M; Stoyak, Samuel R; Verrico, Christopher D; Lewis, David A

    2010-09-01

    We recently showed that measures of cannabinoid 1 receptor (CB1R) mRNA and protein were significantly reduced in dorsolateral prefrontal cortex (DLPFC) area 9 in schizophrenia subjects relative to matched normal comparison subjects. However, other studies have reported unaltered or higher measures of CB1R levels in schizophrenia. To determine whether these discrepancies reflect differences across brain regions or across subject groups (eg, presence of depression, cannabis exposure, etc), we used immunocytochemical techniques to determine whether lower levels of CB1R immunoreactivity are (1) present in another DLPFC region, area 46, in the same subjects with schizophrenia, (2) present in area 46 in a new cohort of schizophrenia subjects, (3) present in major depressive disorder (MDD) subjects, or (4) attributable to factors other than a diagnosis of schizophrenia, including prior cannabis use. CB1R immunoreactivity levels in area 46 were significantly 19% lower in schizophrenia subjects relative to matched normal comparison subjects, a deficit similar to that observed in area 9 in the same subjects. In a new cohort of subjects, CB1R immunoreactivity levels were significantly 20 and 23% lower in schizophrenia subjects relative to matched comparison and MDD subjects, respectively. The lower levels of CB1R immunoreactivity in schizophrenia subjects were not explained by other factors such as cannabis use, suicide, or pharmacological treatment. In addition, CB1R immunoreactivity levels were not altered in monkeys chronically exposed to haloperidol. Thus, the lower levels of CB1R immunoreactivity may be common in schizophrenia, conserved across DLPFC regions, not present in MDD, and not attributable to other factors, and thus a reflection of the underlying disease process.

  3. nmsBuilder: Freeware to create subject-specific musculoskeletal models for OpenSim.

    PubMed

    Valente, Giordano; Crimi, Gianluigi; Vanella, Nicola; Schileo, Enrico; Taddei, Fulvia

    2017-12-01

    Musculoskeletal modeling and simulations of movement have been increasingly used in orthopedic and neurological scenarios, with increased attention to subject-specific applications. In general, musculoskeletal modeling applications have been facilitated by the development of dedicated software tools; however, subject-specific studies have been limited also by time-consuming modeling workflows and high skilled expertise required. In addition, no reference tools exist to standardize the process of musculoskeletal model creation and make it more efficient. Here we present a freely available software application, nmsBuilder 2.0, to create musculoskeletal models in the file format of OpenSim, a widely-used open-source platform for musculoskeletal modeling and simulation. nmsBuilder 2.0 is the result of a major refactoring of a previous implementation that moved a first step toward an efficient workflow for subject-specific model creation. nmsBuilder includes a graphical user interface that provides access to all functionalities, based on a framework for computer-aided medicine written in C++. The operations implemented can be used in a workflow to create OpenSim musculoskeletal models from 3D surfaces. A first step includes data processing to create supporting objects necessary to create models, e.g. surfaces, anatomical landmarks, reference systems; and a second step includes the creation of OpenSim objects, e.g. bodies, joints, muscles, and the corresponding model. We present a case study using nmsBuilder 2.0: the creation of an MRI-based musculoskeletal model of the lower limb. The model included four rigid bodies, five degrees of freedom and 43 musculotendon actuators, and was created from 3D surfaces of the segmented images of a healthy subject through the modeling workflow implemented in the software application. We have presented nmsBuilder 2.0 for the creation of musculoskeletal OpenSim models from image-based data, and made it freely available via nmsbuilder.org. This application provides an efficient workflow for model creation and helps standardize the process. We hope this would help promote personalized applications in musculoskeletal biomechanics, including larger sample size studies, and might also represent a basis for future developments for specific applications. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Personality characteristics as predictors of underreporting of energy intake on 24-hour dietary recall interviews.

    PubMed

    Novotny, Janet A; Rumpler, William V; Riddick, Howard; Hebert, James R; Rhodes, Donna; Judd, Joseph T; Baer, David J; McDowell, Margaret; Briefel, Ronette

    2003-09-01

    To identify characteristics associated with misreporting of energy intake during 24-hour dietary recalls (24 HR). Ninety-eight subjects were administered two 24 HRs. Energy expenditure was determined by doubly labeled water (44 subjects) or intake balance (54 subjects). Data on subjects' physical, lifestyle, and psychosocial characteristics were also collected. Subjects/setting At the Beltsville Human Nutrition Research Center 52 women and 46 men were administered 24HR and completed lifestyle and personality questionnaires and a memory test. Physical characteristics such as weight, percent body fat, and total energy expenditure were measured. Statistical analysis The influences of subject parameters on energy misreporting were assessed by linear regression and Pearson product-moment correlation analysis for continuous variables and by ANOVA for discrete variables. Stepwise regression was used to identify key factors in underreporting. Factors particularly important in predicting underreporting of energy intake include factors indicating dissatisfaction with body image; for example, a 398 kcal/day underreport in subjects attempting weight loss during the past year with a nearly 500 kcal/day underreport in women. Overall, women underreported by 393 kcal/day relative to men and women evinced a social desirability bias amounting to a 26 kcal underreport for each point on the social desirability scale. Gender differences also were evident in the effect of percent body fat (with men underreporting about 16 kcal/day/percent body fat) and in departure from self-reported ideal body weight (with women underreporting about 21 kcal/day/kg). Body image and fatness are key factors on which health professionals should focus when seeking predictors of underreporting of dietary intake. Dietary interviews must be conducted to minimize bias related to subjects' tendencies to win approval and avoid censure by the interviewer. In addition, dissatisfaction with body image may lead to underestimation of food intake, therefore reducing likelihood of success in weight loss. Thus, health care professionals involved in weight loss counseling may achieve better success if treatment includes generating a more positive body image.

  5. Proteomic Signatures of Human Oral Epithelial Cells in HIV-Infected Subjects

    PubMed Central

    Yohannes, Elizabeth; Ghosh, Santosh K.; Jiang, Bin; McCormick, Thomas S.; Weinberg, Aaron; Hill, Edward; Faddoul, Faddy; Chance, Mark R.

    2011-01-01

    The oral epithelium, the most abundant structural tissue lining the oral mucosa, is an important line of defense against infectious microorganisms. HIV infected subjects on highly active antiretroviral therapy (HAART) are susceptible to comorbid viral, bacterial and fungal infections in the oral cavity. To provide an assessment of the molecular alterations of oral epithelia potentially associated with susceptibility to comorbid infections in such subjects, we performed various proteomic studies on over twenty HIV infected and healthy subjects. In a discovery phase two Dimensional Difference Gel Electrophoresis (2-D DIGE) analyses of human oral gingival epithelial cell (HOEC) lysates were carried out; this identified 61 differentially expressed proteins between HIV-infected on HAART subjects and healthy controls. Down regulated proteins in HIV-infected subjects include proteins associated with maintenance of protein folding and pro- and anti-inflammatory responses (e.g., heat-shock proteins, Cryab, Calr, IL-1RA, and Galectin-3-binding protein) as well as proteins involved in redox homeostasis and detoxification (e.g., Gstp1, Prdx1, and Ero1). Up regulated proteins include: protein disulfide isomerases, proteins whose expression is negatively regulated by Hsp90 (e.g., Ndrg1), and proteins that maintain cellular integrity (e.g., Vimentin). In a verification phase, proteins identified in the protein profiling experiments and those inferred from Ingenuity Pathway Analysis were analyzed using Western blotting analysis on separate HOEC lysate samples, confirming many of the discovery findings. Additionally in HIV-infected patient samples Heat Shock Factor 1 is down regulated, which explains the reduced heat shock responses, while activation of the MAPK signal transduction cascade is observed. Overall, HAART therapy provides an incomplete immune recovery of the oral epithelial cells of the oral cavity for HIV-infected subjects, and the toxic side effects of HAART and/or HIV chronicity silence expression of multiple proteins that in healthy subjects function to provide robust innate immune responses and combat cellular stress. PMID:22114700

  6. Effect of diquafosol tetrasodium eye drop for persistent dry eye after laser in situ keratomileusis.

    PubMed

    Mori, Yosai; Nejima, Ryohei; Masuda, Ayami; Maruyama, Yoko; Minami, Keiichiro; Miyata, Kazunori; Amano, Shiro

    2014-07-01

    To evaluate the effect of diquafosol tetrasodium (DQS) for the treatment of persistent dry eye after laser in situ keratomileusis (LASIK). Miyata Eye Hospital, Miyazaki, Japan. Noncomparative case series. This prospective study included 30 eyes of 15 patients in whom dry eye had persisted for over 12 months after LASIK, and the symptoms had not improved with artificial tears and sodium hyaluronate treatment. In addition, treatment with DQS 3% eye drops, 6 times a day, was performed for 12 weeks. Best-corrected visual acuity, tear secretion with the Schirmer test, tear break-up time, and fluorescein and lissamine green staining scores on the cornea and conjunctiva were examined before and at 1, 4, and 12 weeks after the addition. A subjective questionnaire of 14 symptoms was also assessed before and 12 weeks after treatment. The fluorescein and lissamine green staining scores significantly improved over 12 weeks; however, the best-corrected visual acuity and tear secretion did not change. The symptoms of fatigue, dryness, grittiness, discomfort, difficulty in reading, and discomfort within the area of dryness improved after the additional DQS treatment. The DQS treatment improved the subjective and objective symptoms of persistent dry eye after LASIK. Increased mucin production because of the addition of DQS probably improved the tear film stability and reduced the symptoms of dry eye in patients who had persistent dry eye after LASIK.

  7. Orthodontic treatment in periodontitis‐susceptible subjects: a systematic literature review

    PubMed Central

    Lindsten, Rune; Slotte, Christer; Bjerklin, Krister

    2016-01-01

    Abstract The aim is to evaluate the literature for clinical scientific data on possible effects of orthodontic treatment on periodontal status in periodontitis‐susceptible subjects. A systematic literature review was performed on studies in English using PubMed, MEDLINE, and Cochrane Library central databases (1965‐2014). By manually searching reference lists of selected studies, we identified additional articles; then we searched these publications: Journal of Periodontology, Periodontology 2000, Journal of Clinical Periodontology, American Journal of Orthodontics and Dentofacial Orthopedics, Angle Orthodontist, International Journal of Periodontics & Restorative Dentistry, and European Journal of Orthodontics. Search terms included randomized clinical trials, controlled clinical trials, prospective and retrospective clinical studies, case series >5 patients, periodontitis, orthodontics, alveolar bone loss, tooth migration, tooth movement, orthodontic extrusion, and orthodontic intrusion. Only studies on orthodontic treatment in periodontally compromised dentitions were included. One randomized controlled clinical trial, one controlled clinical trial, and 12 clinical studies were included. No evidence currently exists from controlled studies and randomized controlled clinical trials, which shows that orthodontic treatment improves or aggravates the status of periodontally compromised dentitions. PMID:29744163

  8. Full-motion video analysis for improved gender classification

    NASA Astrophysics Data System (ADS)

    Flora, Jeffrey B.; Lochtefeld, Darrell F.; Iftekharuddin, Khan M.

    2014-06-01

    The ability of computer systems to perform gender classification using the dynamic motion of the human subject has important applications in medicine, human factors, and human-computer interface systems. Previous works in motion analysis have used data from sensors (including gyroscopes, accelerometers, and force plates), radar signatures, and video. However, full-motion video, motion capture, range data provides a higher resolution time and spatial dataset for the analysis of dynamic motion. Works using motion capture data have been limited by small datasets in a controlled environment. In this paper, we explore machine learning techniques to a new dataset that has a larger number of subjects. Additionally, these subjects move unrestricted through a capture volume, representing a more realistic, less controlled environment. We conclude that existing linear classification methods are insufficient for the gender classification for larger dataset captured in relatively uncontrolled environment. A method based on a nonlinear support vector machine classifier is proposed to obtain gender classification for the larger dataset. In experimental testing with a dataset consisting of 98 trials (49 subjects, 2 trials per subject), classification rates using leave-one-out cross-validation are improved from 73% using linear discriminant analysis to 88% using the nonlinear support vector machine classifier.

  9. Clinical progression and metachronous paragangliomas in a large cohort of SDHD germline variant carriers.

    PubMed

    Heesterman, Berdine L; de Pont, Lisa M H; van der Mey, Andel Gl; Bayley, Jean-Pierre; Corssmit, Eleonora Pm; Hes, Frederik J; Verbist, Berit M; van Benthem, Peter Paul G; Jansen, Jeroen C

    2018-05-18

    Although it is well established that paternally transmitted germline variants in SDHD are associated with multifocal paragangliomas and lifelong follow-up is generally advised, the risk of metachronous lesions is presently unknown. In a large Dutch cohort of SDHD variant carriers, we studied the development of new paragangliomas, and the evolution of symptoms and cranial nerve impairment. Recurrent event analysis and the Kaplan-Meier product limit estimator were used to study the risk of new lesions. The relation between several predictors and development of new symptoms was assessed using logistic regression. Of the 222 SDHD variant carriers included, 65% presented with symptoms and 11% with cranial nerve dysfunction. Over a median period of 8 years, 42% reported new symptoms, and new cranial nerve impairment was observed in 11% of subjects. The estimated fraction of subjects that developed new HNPGL increased to 73% (95% CI: 52-85%) after 22 years of follow-up. Males were more likely to develop new HNPGL compared to females (HR: 1.63, 95% CI: 1.10-2.40), as were subjects that presented with symptoms, compared to subjects that were asymptomatic at baseline (HR: 1.61, 95% CI: 1.01-2.55). In addition, the risk of new lesions decreased with number of HNPGL present at first diagnosis (HR: 0.68 and 95% CI: 0.56-0.82). Carriers of a paternally inherited SDHD variant face a considerable risk for new HNPGL. In addition, nearly 50% of subjects reported new symptoms. However, new cranial nerve deficits were observed in only 11%, which is less than reported in surgical series. These risks should be taken into account when considering treatment strategies and counseling.

  10. The relationship of periaortic fat thickness and cardiovascular risk factors in children with Turner syndrome.

    PubMed

    Akyürek, Nesibe; Atabek, Mehmet Emre; Eklioglu, Beray Selver; Alp, Hayrullah

    2015-06-01

    Children with Turner syndrome (TS) have a broad range of later health problems, including an increased risk of cardiovascular morbidity and mortality. The aim of this study was to evaluate the relationship between periaortic fat thickness (PAFT) and metabolic and cardiovascular profiles in children with TS. Twenty-nine TS and 29 healthy children and adolescents were enrolled in the study. Anthropometric measurements, pubertal staging, and blood pressure measurements were performed. Fasting serum glucose, insulin, and lipid profile were measured. Periaortic fat thickness was measured using an echocardiography method, which has not previously been applied in children with TS. No difference was found between TS and control subject (CS) in age, weight, waist/hip ratio, HDL cholesterol and LDL cholesterol levels. However, in TS subjects, total cholesterol (p = 0.045) was greater than that in controls. It was determined that 13.7 % (N: 4) of TS subjects had dyslipidemia. Mean fasting glucose, fasting insulin, QUICK-I, HOMA, and FGIR index were similar in TS and in CS, whereas 17.2 % (N: 5) of TS subjects had insulin resistance (IR) and 13.7 % (N: 4) had impaired glucose tolerance. Six subjects (20.6 %) were diagnosed as hypertensive. Periaortic fat thickness was significantly higher in the TS group (p < 0.001) (0.1694 ± 0.025 mm in the TS group and 0.1416 ± 0.014 mm in the CS group) In children with TS, PAFT was positively correlated with fasting insulin, body mass index, and diastolic blood pressure. Our results provide additional evidence for the presence of subclinical cardiovascular disease in TS. In addition to existing methods, we recommend the measurement of periaortic fat thickness in children with TS to reveal the presence of early atherosclerosis.

  11. Associations between psychological factors and the effect of home-based physical exercise in women with chronic neck and shoulder pain

    PubMed Central

    Karlsson, Linn; Gerdle, Björn; Takala, Esa-Pekka; Andersson, Gerhard; Larsson, Britt

    2016-01-01

    Background: Exercise is often used in the treatment of chronic neck and shoulder muscle pain. It is likely that psychological aspects have an impact on the results of exercise-based treatments. Objectives: (1) To examine the associations between psychological factors and the effect of a home-based physical exercise intervention. (2) To examine differences in psychological factors at baseline between (a) subjects who continued in the trial and those who did not and (b) subjects who completed the intervention and those who did not. Method: A total of 57 women with chronic neck and shoulder pain were included in a home-based exercise intervention trial. Pain intensity, disability, and psychological factors (anxiety and depression symptoms, catastrophizing, fear-avoidance beliefs, self-efficacy, and pain acceptance) were measured at baseline, after 4–6 months, and after 1 year of exercise. Associations between the psychological factors and changes in pain intensity and disability were analysed, as well as differences in psychological factors at baseline between subjects who continued in and completed the intervention, and those who did not. Results: Associations between positive changes in pain intensity and disability were found for low fear-avoidance beliefs and low-pain self-efficacy at baseline. In addition, fear-avoidance beliefs at baseline were higher in the subjects who dropped out of the intervention than in those who continued. Pain acceptance at baseline was higher in the subjects who completed the intervention at the end of the trial. Conclusion: Particularly, fear-avoidance beliefs and pain self-efficacy should be taken into consideration when implementing home-based physical exercise as treatment for chronic neck pain. In addition, high pain acceptance might improve the adherence to prescribed exercise. PMID:27688880

  12. Test–Retest Reproducibility of the Microperimeter MP3 With Fundus Image Tracking in Healthy Subjects and Patients With Macular Disease

    PubMed Central

    Palkovits, Stefan; Hirnschall, Nino; Georgiev, Stefan; Leisser, Christoph

    2018-01-01

    Purpose To evaluate the test–retest reproducibility of a novel microperimeter with fundus image tracking (MP3, Nidek Co, Japan) in healthy subjects and patients with macular disease. Methods Ten healthy subjects and 20 patients suffering from range of macular diseases were included. After training measurements, two additional microperimetry measurements were scheduled. Test–retest reproducibility was assessed for mean retinal sensitivity, pointwise sensitivity, and deep scotoma size using the coefficient of repeatability and Bland-Altman diagrams. In addition, in a subgroup of patients microperimetry was compared with conventional perimetry. Results Average differences in mean retinal sensitivity between the two study measurements were 0.26 ± 1.7 dB (median 0 dB; interquartile range [IQR] −1 to 1) for the healthy and 0.36 ± 2.5 dB (median 0 dB; IQR −1 to 2) for the macular patient group. Coefficients of repeatability for mean retinal sensitivity and pointwise retinal sensitivity were 1.2 and 3.3 dB for the healthy subjects and 1.6 and 5.0 dB for the macular disease patients, respectively. Absolute agreement in deep scotoma size between both study days was found in 79.9% of the test loci. Conclusion The microperimeter MP3 shows an adequate test–retest reproducibility for mean retinal sensitivity, pointwise retinal sensitivity, and deep scotoma size in healthy subjects and patients suffering from macular disease. Furthermore, reproducibility of microperimetry is higher than conventional perimetry. Translational Relevance Reproducibility is an important measure for each diagnostic device. Especially in a clinical setting high reproducibility set the basis to achieve reliable results using the specific device. Therefore, assessment of the reproducibility is of eminent importance to interpret the findings of future studies. PMID:29430338

  13. Test-Retest Reproducibility of the Microperimeter MP3 With Fundus Image Tracking in Healthy Subjects and Patients With Macular Disease.

    PubMed

    Palkovits, Stefan; Hirnschall, Nino; Georgiev, Stefan; Leisser, Christoph; Findl, Oliver

    2018-02-01

    To evaluate the test-retest reproducibility of a novel microperimeter with fundus image tracking (MP3, Nidek Co, Japan) in healthy subjects and patients with macular disease. Ten healthy subjects and 20 patients suffering from range of macular diseases were included. After training measurements, two additional microperimetry measurements were scheduled. Test-retest reproducibility was assessed for mean retinal sensitivity, pointwise sensitivity, and deep scotoma size using the coefficient of repeatability and Bland-Altman diagrams. In addition, in a subgroup of patients microperimetry was compared with conventional perimetry. Average differences in mean retinal sensitivity between the two study measurements were 0.26 ± 1.7 dB (median 0 dB; interquartile range [IQR] -1 to 1) for the healthy and 0.36 ± 2.5 dB (median 0 dB; IQR -1 to 2) for the macular patient group. Coefficients of repeatability for mean retinal sensitivity and pointwise retinal sensitivity were 1.2 and 3.3 dB for the healthy subjects and 1.6 and 5.0 dB for the macular disease patients, respectively. Absolute agreement in deep scotoma size between both study days was found in 79.9% of the test loci. The microperimeter MP3 shows an adequate test-retest reproducibility for mean retinal sensitivity, pointwise retinal sensitivity, and deep scotoma size in healthy subjects and patients suffering from macular disease. Furthermore, reproducibility of microperimetry is higher than conventional perimetry. Reproducibility is an important measure for each diagnostic device. Especially in a clinical setting high reproducibility set the basis to achieve reliable results using the specific device. Therefore, assessment of the reproducibility is of eminent importance to interpret the findings of future studies.

  14. The American Society for Radiation Oncology's 2010 Core Physics Curriculum for Radiation Oncology Residents

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xiao Ying, E-mail: ying.xiao@jefferson.edu; De Amorim Bernstein, Karen; Chetty, Indrin J.

    Purpose: In 2004, the American Society for Radiation Oncology (ASTRO) published its first physics education curriculum for residents, which was updated in 2007. A committee composed of physicists and physicians from various residency program teaching institutions was reconvened again to update the curriculum in 2009. Methods and Materials: Members of this committee have associations with ASTRO, the American Association of Physicists in Medicine, the Association of Residents in Radiation Oncology, the American Board of Radiology (ABR), and the American College of Radiology. Members reviewed and updated assigned subjects from the last curriculum. The updated curriculum was carefully reviewed by amore » representative from the ABR and other physics and clinical experts. Results: The new curriculum resulted in a recommended 56-h course, excluding initial orientation. Learning objectives are provided for each subject area, and a detailed outline of material to be covered is given for each lecture hour. Some recent changes in the curriculum include the addition of Radiation Incidents and Bioterrorism Response Training as a subject and updates that reflect new treatment techniques and modalities in a number of core subjects. The new curriculum was approved by the ASTRO board in April 2010. We anticipate that physicists will use this curriculum for structuring their teaching programs, and subsequently the ABR will adopt this educational program for its written examination. Currently, the American College of Radiology uses the ASTRO curriculum for their training examination topics. In addition to the curriculum, the committee updated suggested references and the glossary. Conclusions: The ASTRO physics education curriculum for radiation oncology residents has been updated. To ensure continued commitment to a current and relevant curriculum, the subject matter will be updated again in 2 years.« less

  15. Depression and suicidal behavior in adolescent inpatients with obsessive compulsive disorder.

    PubMed

    Apter, Alan; Horesh, Netta; Gothelf, Doron; Zalsman, Gil; Erlich, Zippy; Soreni, Noam; Weizman, Abraham

    2003-07-01

    To investigate the prevalence and correlations of suicidal behavior in obsessive compulsive disorder (OCD) among adolescent psychiatric inpatients. A total of 348 adolescents, representing consecutive admissions to an adolescent inpatient unit, were assessed. Of these, 40 patients had OCD, 118 had schizophrenia, 59 had an affective disorder, 81 had a conduct disorder and 50 had an eating disorder. In addition, 87 normal community controls were assessed. All subjects were assessed for suicidal behavior by the Childhood Suicide Potential Scale (CSPS), for depression by the Beck Depression Inventory, for impulsiveness by the Impulse Control Scale, for anxiety by the State-Trait Anxiety Scale and for aggression by the Yudowsky Overt Aggression Scale. All the psychiatrically ill subjects, including those with OCD, had high levels of depression, anxiety and impulsiveness, which were far higher than those of the controls. The rate of attempted suicide was, however, much lower in the OCD subjects. In addition, there was a significant inverse correlation between suicidal behavior levels on the CSPS and depression in the OCD subjects, while all other subjects showed the expected significant positive correlation between level of suicidal behavior and depression. This study looked at a referred population and generalization to outpatient and community samples cannot be made. Distinguishing between the primary and the comorbid diagnosis is difficult and some findings are based on small sample size and therefore may be vulnerable to type I error. Although suicidal ideation and depressive symptoms are common in OCD adolescent inpatients, they seem to be protected against suicide attempts. The inverse relationship between suicidal behavior and depression may mean that suicidal behavior is, in some ways, qualitatively different from that seen in other psychiatrically ill adolescents.

  16. Application of the Transtheoretical Model to Exercise Behavior and Physical Activity in Patients after Open Heart Surgery.

    PubMed

    Huang, Hsin-Yi; Lin, Yu-Shan; Chuang, Yi-Cheng; Lin, Wei-Hsuan; Kuo, Li Ying; Chen, Jui Chun; Hsu, Ching Ling; Chen, Bo Yan; Tsai, Hui Yu; Cheng, Fei Hsin; Tsai, Mei-Wun

    2015-05-01

    To assess exercise behavior and physical activity levels after open heart surgery. This prospective cohort study included 130 patients (70.8% male, aged 61.0 ± 12.2 years, 53.8% coronary bypass grafting) who underwent open heart surgery. The exercise behavior and physical activity of these patients were assessed at the 3- and 6-month follow-up appointments. Additional interviews were also conducted to further assess exercise behavior. Physical activity duration and metabolic equivalents were calculated from self-reported questionnaire responses. Moreover, possible related demographic factors, clinical features, participation in cardiac rehabilitation programs, and physical activity levels were additionally evaluated. Six months after hospital discharge, most patients were in the action (39.2%) and maintenance (37.7%) stages. Other subjects were in the precontemplation (11.5%), contemplation (5.4%), and preparation (6.2%) stages. The average physical activity level was 332.6 ± 377.1 min/week and 1198.1 ± 1396.9 KJ/week. Subjects in the action and maintenance stages exercised an average of 399.4 ± 397.6 min/week, significantly longer than those in other stages (116.2 ± 176.2 min/week, p = 0.02). Subjects that participated in outpatient cardiac rehabilitation programs after discharge may have the better exercise habit. Gender had no significant effect on exercise behavior 6 months after hospital discharge. Most subjects following open heart surgery may maintain regular exercise behavior at 6 months after hospital discharge. Physical activity levels sufficient for cardiac health were achieved by subjects in the active and maintenance stages. Outpatient cardiac rehabilitation programs are valuable for encouraging exercise behavior after heart surgery. Exercise behavior; Open heart surgery; Physical activity; Transtheoretical model.

  17. The American Society for Radiation Oncology's 2010 core physics curriculum for radiation oncology residents.

    PubMed

    Xiao, Ying; Bernstein, Karen De Amorim; Chetty, Indrin J; Eifel, Patricia; Hughes, Lesley; Klein, Eric E; McDermott, Patrick; Prisciandaro, Joann; Paliwal, Bhudatt; Price, Robert A; Werner-Wasik, Maria; Palta, Jatinder R

    2011-11-15

    In 2004, the American Society for Radiation Oncology (ASTRO) published its first physics education curriculum for residents, which was updated in 2007. A committee composed of physicists and physicians from various residency program teaching institutions was reconvened again to update the curriculum in 2009. Members of this committee have associations with ASTRO, the American Association of Physicists in Medicine, the Association of Residents in Radiation Oncology, the American Board of Radiology (ABR), and the American College of Radiology. Members reviewed and updated assigned subjects from the last curriculum. The updated curriculum was carefully reviewed by a representative from the ABR and other physics and clinical experts. The new curriculum resulted in a recommended 56-h course, excluding initial orientation. Learning objectives are provided for each subject area, and a detailed outline of material to be covered is given for each lecture hour. Some recent changes in the curriculum include the addition of Radiation Incidents and Bioterrorism Response Training as a subject and updates that reflect new treatment techniques and modalities in a number of core subjects. The new curriculum was approved by the ASTRO board in April 2010. We anticipate that physicists will use this curriculum for structuring their teaching programs, and subsequently the ABR will adopt this educational program for its written examination. Currently, the American College of Radiology uses the ASTRO curriculum for their training examination topics. In addition to the curriculum, the committee updated suggested references and the glossary. The ASTRO physics education curriculum for radiation oncology residents has been updated. To ensure continued commitment to a current and relevant curriculum, the subject matter will be updated again in 2 years. Copyright © 2011 Elsevier Inc. All rights reserved.

  18. Global Assessment of the Impact of Type 2 Diabetes on Sleep through Specific Questionnaires. A Case-Control Study.

    PubMed

    Lecube, Albert; Sánchez, Enric; Gómez-Peralta, Fernando; Abreu, Cristina; Valls, Joan; Mestre, Olga; Romero, Odile; Martínez, María Dolores; Sampol, Gabriel; Ciudin, Andreea; Hernández, Cristina; Simó, Rafael

    2016-01-01

    Type 2 diabetes (T2D) is an independent risk factor for sleep breathing disorders. However, it is unknown whether T2D affects daily somnolence and quality of sleep independently of the impairment of polysomnographic parameters. A case-control study including 413 patients with T2D and 413 non-diabetic subjects, matched by age, gender, BMI, and waist and neck circumferences. A polysomnography was performed and daytime sleepiness was evaluated using the Epworth Sleepiness Scale (ESS). In addition, 135 subjects with T2D and 45 controls matched by the same previous parameters were also evaluated through the Pittsburgh Sleep Quality Index (PSQI) to calculate sleep quality. Daytime sleepiness was higher in T2D than in control subjects (p = 0.003), with 23.9% of subjects presenting an excessive daytime sleepiness (ESS>10). Patients with fasting plasma glucose (FPG ≥13.1 mmol/l) were identified as the group with a higher risk associated with an ESS>10 (OR 3.9, 95% CI 1.8-7.9, p = 0.0003). A stepwise regression analyses showed that the presence of T2D, baseline glucose levels and gender but not polysomnographic parameters (i.e apnea-hyoapnea index or sleeping time spent with oxigen saturation lower than 90%) independently predicted the ESS score. In addition, subjects with T2D showed higher sleep disturbances [PSQI: 7.0 (1.0-18.0) vs. 4 (0.0-12.0), p<0.001]. The presence of T2D and high levels of FPG are independent risk factors for daytime sleepiness and adversely affect sleep quality. Prospective studies addressed to demonstrate whether glycemia optimization could improve the sleep quality in T2D patients seem warranted.

  19. Networks of blood proteins in the neuroimmunology of schizophrenia.

    PubMed

    Jeffries, Clark D; Perkins, Diana O; Fournier, Margot; Do, Kim Q; Cuenod, Michel; Khadimallah, Ines; Domenici, Enrico; Addington, Jean; Bearden, Carrie E; Cadenhead, Kristin S; Cannon, Tyrone D; Cornblatt, Barbara A; Mathalon, Daniel H; McGlashan, Thomas H; Seidman, Larry J; Tsuang, Ming; Walker, Elaine F; Woods, Scott W

    2018-06-06

    Levels of certain circulating cytokines and related immune system molecules are consistently altered in schizophrenia and related disorders. In addition to absolute analyte levels, we sought analytes in correlation networks that could be prognostic. We analyzed baseline blood plasma samples with a Luminex platform from 72 subjects meeting criteria for a psychosis clinical high-risk syndrome; 32 subjects converted to a diagnosis of psychotic disorder within two years while 40 other subjects did not. Another comparison group included 35 unaffected subjects. Assays of 141 analytes passed early quality control. We then used an unweighted co-expression network analysis to identify highly correlated modules in each group. Overall, there was a striking loss of network complexity going from unaffected subjects to nonconverters and thence to converters (applying standard, graph-theoretic metrics). Graph differences were largely driven by proteins regulating tissue remodeling (e.g. blood-brain barrier). In more detail, certain sets of antithetical proteins were highly correlated in unaffected subjects (e.g. SERPINE1 vs MMP9), as expected in homeostasis. However, for particular protein pairs this trend was reversed in converters (e.g. SERPINE1 vs TIMP1, being synthetical inhibitors of remodeling of extracellular matrix and vasculature). Thus, some correlation signals strongly predict impending conversion to a psychotic disorder and directly suggest pharmaceutical targets.

  20. Molcas 8: New capabilities for multiconfigurational quantum chemical calculations across the periodic table.

    PubMed

    Aquilante, Francesco; Autschbach, Jochen; Carlson, Rebecca K; Chibotaru, Liviu F; Delcey, Mickaël G; De Vico, Luca; Fdez Galván, Ignacio; Ferré, Nicolas; Frutos, Luis Manuel; Gagliardi, Laura; Garavelli, Marco; Giussani, Angelo; Hoyer, Chad E; Li Manni, Giovanni; Lischka, Hans; Ma, Dongxia; Malmqvist, Per Åke; Müller, Thomas; Nenov, Artur; Olivucci, Massimo; Pedersen, Thomas Bondo; Peng, Daoling; Plasser, Felix; Pritchard, Ben; Reiher, Markus; Rivalta, Ivan; Schapiro, Igor; Segarra-Martí, Javier; Stenrup, Michael; Truhlar, Donald G; Ungur, Liviu; Valentini, Alessio; Vancoillie, Steven; Veryazov, Valera; Vysotskiy, Victor P; Weingart, Oliver; Zapata, Felipe; Lindh, Roland

    2016-02-15

    In this report, we summarize and describe the recent unique updates and additions to the Molcas quantum chemistry program suite as contained in release version 8. These updates include natural and spin orbitals for studies of magnetic properties, local and linear scaling methods for the Douglas-Kroll-Hess transformation, the generalized active space concept in MCSCF methods, a combination of multiconfigurational wave functions with density functional theory in the MC-PDFT method, additional methods for computation of magnetic properties, methods for diabatization, analytical gradients of state average complete active space SCF in association with density fitting, methods for constrained fragment optimization, large-scale parallel multireference configuration interaction including analytic gradients via the interface to the Columbus package, and approximations of the CASPT2 method to be used for computations of large systems. In addition, the report includes the description of a computational machinery for nonlinear optical spectroscopy through an interface to the QM/MM package Cobramm. Further, a module to run molecular dynamics simulations is added, two surface hopping algorithms are included to enable nonadiabatic calculations, and the DQ method for diabatization is added. Finally, we report on the subject of improvements with respects to alternative file options and parallelization. © 2015 Wiley Periodicals, Inc.

  1. Moderate peripheral neuropathy impairs weight transfer and unipedal balance in the elderly.

    PubMed

    Richardson, J K; Ashton-Miller, J A; Lee, S G; Jacobs, K

    1996-11-01

    To quantitatively assess the performance of elderly with and without moderate, electrodiagnostically confirmed peripheral neuropathy (PN) on tasks of weight shifting and maintenance of unipedal balance. A case control study with PN subjects selected from a computerized data bank of all patients who had undergone electrodiagnostic studies at a university-based referral center. Control subjects of similar age and same gender were selected from the same source. Clinical examination included neurological and gross motor components. Quantitative evaluation included testing while the subjects stood with a force plate under each foot. Center of reaction (CR) excursions and ground reaction forces were quantified in: (1) six trials as subjects transferred their weight from bipedal stance to unipedal stance, on command, and attempted to maintain it for at least 3 seconds; and (2) in two additional trials in which subjects held unipedal stance for as long as possible. No subjects in either group had difficulty with level gait, a 180-degree turn, or required examiner assistance during an eyes-closed Romberg test. Biomechanical testing revealed that although the PN group used the same time to transfer their weight onto one foot as the C group, they achieved a significantly (1) lower rate of success in reliably maintaining 3 seconds of unipedal stance (.12 vs .58, p = .021), and (2) shorter mean maximum unipedal stance time (3.8 vs 32.3sec, p < .001). Furthermore, the PN group experienced greater difficulty in maintaining unipedal stance, as evidenced by significantly greater fluctuations in their ground reaction forces. The demonstrated impairment in reliability of unipedal stance in elderly with PN likely contributes to their known high rate of falls. Furthermore, unipedal stance testing serves to sharpen the physical examination by verifying the functional significance of impaired distal sensation-a common finding in the elderly.

  2. The COPD Assessment Test: Can It Discriminate Across COPD Subpopulations?

    PubMed

    Gupta, Nisha; Pinto, Lancelot; Benedetti, Andrea; Li, Pei Zhi; Tan, Wan C; Aaron, Shawn D; Chapman, Kenneth R; FitzGerald, J Mark; Hernandez, Paul; Marciniuk, Darcy D; Maltais, François; O'Donnell, Denis E; Sin, Don; Walker, Brandie L; Bourbeau, Jean

    2016-11-01

    The COPD Assessment Test (CAT) is a valid disease-specific questionnaire measuring health status. However, knowledge concerning its use regarding patient and disease characteristics remains limited. Our main objective was to assess the degree to which the CAT score varies and can discriminate between specific patient population groups. The Canadian Cohort Obstructive Lung Disease (CanCOLD) is a random-sampled, population-based, multicenter, prospective cohort that includes subjects with COPD (Global Initiative for Chronic Obstructive Lung Disease [GOLD] classifications 1 to 3). The CAT questionnaire was administered at three visits (baseline, 1.5 years, and 3 years). The CAT total score was determined for sex, age groups, smoking status, GOLD classification, exacerbations, and comorbidities. A total of 716 subjects with COPD were included in the analysis. The majority of subjects (72.5%) were not previously diagnosed with COPD. The mean FEV 1 /FVC ratio was 61.1 ± 8.1%, with a mean FEV 1 % predicted of 82.3 ± 19.3%. The mean CAT scores were 5.8 ± 5.0, 9.6 ± 6.7, and 16.1 ± 10.0 for GOLD 1, 2, and 3+ classifications, respectively. Higher CAT scores were observed in women, current smokers, ever-smokers, and subjects with a previous diagnosis of COPD. The CAT was also able to distinguish between subjects who experience exacerbations vs those who had no exacerbation. These results suggest that the CAT, originally designed for use in clinically symptomatic patients with COPD, can also be used in individuals with mild airflow obstruction and newly diagnosed COPD. In addition, the CAT was able to discriminate between sexes and subjects who experience frequent and infrequent exacerbations. ClinicalTrials.gov; No.: NCT00920348; Study ID No.: IRO-93326. Crown Copyright © 2016. Published by Elsevier Inc. All rights reserved.

  3. High hydrostatic pressure processing reduces the glycemic index of fresh mango puree in healthy subjects.

    PubMed

    Elizondo-Montemayor, Leticia; Hernández-Brenes, Carmen; Ramos-Parra, Perla A; Moreno-Sánchez, Diana; Nieblas, Bianca; Rosas-Pérez, Aratza M; Lamadrid-Zertuche, Ana C

    2015-04-01

    Dietary guidelines recommend the daily consumption of fruits; however, healthy and type 2 diabetes mellitus (T2DM) subjects receive conflicting messages regarding ingestion of fruits, such as mango, because of its sugar content. We investigated the effects of high hydrostatic pressure (HHP) processing of fresh mango puree (MP) on the glycemic indexes (GIs) and postprandial glycemic responses of 38 healthy Mexican subjects in a randomized cross-over clinical trial. Physicochemical characterization of MP included sugar profiles by HPLC-ELSD, starch, fibers, moisture, viscosity, swelling capacity and solubility properties of alcohol insoluble residue (AIR). The mean GI for HHP-MP was significantly lower (32.7 ± 13.4) than that of unprocessed-MP (42.7 ± 19.5). A significantly higher proportion of subjects showed a low GI following the consumption of HHP-MP compared to unprocessed-MP and none of them showed a high GI for the HHP-MP, compared to a significantly higher proportion for the unprocessed-MP. The viscosity and AIR solubility values of HHP-MP samples were significantly higher, which influenced glucose peaking later (Tmax) at 45 minutes and induced 20% lower AUC values than unprocessed-MP, corresponding to greater retardation indexes. The study findings support data stating that low GI fruits are appropriate for glycemic control and that mango may be included as part of healthy subjects' diets and potentially T2DM subjects' diets. Furthermore, HHP processing of mango may offer additional benefits for glycemic control, as its performance regarding GI, AUC and Tmax was significantly better than that of the unprocessed-MP. To our knowledge, this is the first report on the impact of this commercial non-thermal pasteurization technology on glucose metabolism.

  4. Genome-Wide Association Study of d-Amphetamine Response in Healthy Volunteers Identifies Putative Associations, Including Cadherin 13 (CDH13)

    PubMed Central

    Wardle, Margaret C.; Sokoloff, Greta; Stephens, Matthew; de Wit, Harriet; Palmer, Abraham A.

    2012-01-01

    Both the subjective response to d-amphetamine and the risk for amphetamine addiction are known to be heritable traits. Because subjective responses to drugs may predict drug addiction, identifying alleles that influence acute response may also provide insight into the genetic risk factors for drug abuse. We performed a Genome Wide Association Study (GWAS) for the subjective responses to amphetamine in 381 non-drug abusing healthy volunteers. Responses to amphetamine were measured using a double-blind, placebo-controlled, within-subjects design. We used sparse factor analysis to reduce the dimensionality of the data to ten factors. We identified several putative associations; the strongest was between a positive subjective drug-response factor and a SNP (rs3784943) in the 8th intron of cadherin 13 (CDH13; P = 4.58×10−8), a gene previously associated with a number of psychiatric traits including methamphetamine dependence. Additionally, we observed a putative association between a factor representing the degree of positive affect at baseline and a SNP (rs472402) in the 1st intron of steroid-5-alpha-reductase-α-polypeptide-1 (SRD5A1; P = 2.53×10−7), a gene whose protein product catalyzes the rate-limiting step in synthesis of the neurosteroid allopregnanolone. This SNP belongs to an LD-block that has been previously associated with the expression of SRD5A1 and differences in SRD5A1 enzymatic activity. The purpose of this study was to begin to explore the genetic basis of subjective responses to stimulant drugs using a GWAS approach in a modestly sized sample. Our approach provides a case study for analysis of high-dimensional intermediate pharmacogenomic phenotypes, which may be more tractable than clinical diagnoses. PMID:22952603

  5. Genome-wide association study of d-amphetamine response in healthy volunteers identifies putative associations, including cadherin 13 (CDH13).

    PubMed

    Hart, Amy B; Engelhardt, Barbara E; Wardle, Margaret C; Sokoloff, Greta; Stephens, Matthew; de Wit, Harriet; Palmer, Abraham A

    2012-01-01

    Both the subjective response to d-amphetamine and the risk for amphetamine addiction are known to be heritable traits. Because subjective responses to drugs may predict drug addiction, identifying alleles that influence acute response may also provide insight into the genetic risk factors for drug abuse. We performed a Genome Wide Association Study (GWAS) for the subjective responses to amphetamine in 381 non-drug abusing healthy volunteers. Responses to amphetamine were measured using a double-blind, placebo-controlled, within-subjects design. We used sparse factor analysis to reduce the dimensionality of the data to ten factors. We identified several putative associations; the strongest was between a positive subjective drug-response factor and a SNP (rs3784943) in the 8(th) intron of cadherin 13 (CDH13; P = 4.58×10(-8)), a gene previously associated with a number of psychiatric traits including methamphetamine dependence. Additionally, we observed a putative association between a factor representing the degree of positive affect at baseline and a SNP (rs472402) in the 1(st) intron of steroid-5-alpha-reductase-α-polypeptide-1 (SRD5A1; P = 2.53×10(-7)), a gene whose protein product catalyzes the rate-limiting step in synthesis of the neurosteroid allopregnanolone. This SNP belongs to an LD-block that has been previously associated with the expression of SRD5A1 and differences in SRD5A1 enzymatic activity. The purpose of this study was to begin to explore the genetic basis of subjective responses to stimulant drugs using a GWAS approach in a modestly sized sample. Our approach provides a case study for analysis of high-dimensional intermediate pharmacogenomic phenotypes, which may be more tractable than clinical diagnoses.

  6. Self-reported allergic reactions to peanut on commercial airliners.

    PubMed

    Sicherer, S H; Furlong, T J; DeSimone, J; Sampson, H A

    1999-07-01

    Allergic reactions to food occurring on commercial airlines have not been systematically characterized. We sought to describe the clinical characteristics of allergic reactions to peanuts on airplanes. Participants in the National Registry of Peanut and Tree Nut Allergy who indicated an allergic reaction while on a commercial airliner were interviewed by telephone. Sixty-two of 3704 National Registry of Peanut and Tree Nut Allergy participants indicated a reaction on an airplane; 42 of 48 patients or parental surrogates contacted confirmed the reaction began on the airplane (median age of affected subject, 2 years; range, 6 months to 50 years). Of these, 35 reacted to peanuts (4 were uncertain of exposure) and 7 to tree nuts, although 3 of these 7 reacted to substances that may have also contained peanut. Exposures occurred by ingestion (20 subjects), skin contact (8 subjects), and inhalation (14 subjects). Reactions generally occurred within 10 minutes of exposure (32 of 42 subjects), and reaction severity correlated with exposure route (ingestion > inhalation > skin). The causal food was generally served by the airline (37 of 42 subjects). Medications were given in flight to 19 patients (epinephrine to 5) and to an additional 14 at landing/gate return (including epinephrine to 1 and intravenous medication to 2), totaling 79% treated. Flight crews were notified in 33% of reactions. During inhalation reactions as a result of peanut allergy, greater than 25 passengers were estimated to be eating peanuts at the time of the reaction. Initial symptoms generally involved the upper airway, with progression to the skin or further lower respiratory reactions (no gastrointestinal symptoms). Allergic reactions to peanuts and tree nuts caused by accidental ingestion, skin contact, or inhalation occur during commercial flights, but airline personnel are usually not notified. Reactions can be severe, requiring medications, including epinephrine.

  7. US Medical Student Performance on the NBME Subject Examination in Internal Medicine: Do Clerkship Sequence and Clerkship Length Matter?

    PubMed

    Ouyang, Wenli; Cuddy, Monica M; Swanson, David B

    2015-09-01

    Prior to graduation, US medical students are required to complete clinical clerkship rotations, most commonly in the specialty areas of family medicine, internal medicine, obstetrics and gynecology (ob/gyn), pediatrics, psychiatry, and surgery. Within a school, the sequence in which students complete these clerkships varies. In addition, the length of these rotations varies, both within a school for different clerkships and between schools for the same clerkship. The present study investigated the effects of clerkship sequence and length on performance on the National Board of Medical Examiner's subject examination in internal medicine. The study sample included 16,091 students from 67 US Liaison Committee on Medical Education (LCME)-accredited medical schools who graduated in 2012 or 2013. Student-level measures included first-attempt internal medicine subject examination scores, first-attempt USMLE Step 1 scores, and five dichotomous variables capturing whether or not students completed rotations in family medicine, ob/gyn, pediatrics, psychiatry, and surgery prior to taking the internal medicine rotation. School-level measures included clerkship length and average Step 1 score. Multilevel models with students nested in schools were estimated with internal medicine subject examination scores as the dependent measure. Step 1 scores and the five dichotomous variables were treated as student-level predictors. Internal medicine clerkship length and average Step 1 score were used to predict school-to-school variation in average internal medicine subject examination scores. Completion of rotations in surgery, pediatrics and family medicine prior to taking the internal medicine examination significantly improved scores, with the largest benefit observed for surgery (coefficient = 1.58 points; p value < 0.01); completion of rotations in ob/gyn and psychiatry were unrelated to internal medicine subject examination performance. At the school level, longer internal medicine clerkships were associated with higher scores on the internal medicine examination (coefficient = 0.23 points/week; p value < 0.01). The order in which students complete clinical clerkships and the length of the internal medicine clerkship are associated with their internal medicine subject examination scores. Findings may have implications for curriculum re-design.

  8. The effect of unabsorbable carbohydrate on gut hormones. Modification of post-prandial GIP secretion by guar.

    PubMed

    Morgan, L M; Goulder, T J; Tsiolakis, D; Marks, V; Alberti, K G

    1979-08-01

    Five healthy volunteers and 6 diabetics were given a mixed test meal on two occasions--once with and once without 10 g guar flour. Addition of guar caused a 47% decrease in maximum post-prandial GIP levels, a 48% decrease in blood glucose and a 48% decrease in plasma insulin in normal subjects. In diabetics, addition of guar caused a 30% reduction in maximum post-prandial GIP and 58% decrease in blood glucose. Four normal and 6 diabetic subjects were given a predominantly carbohydrate meal, again with and without 10 g guar. Addition of guar caused a 78% decrease in blood glucose and a 59% decrease in plasma insulin in normal subjects. In diabetics addition of guar caused a 71% decrease in maximum post-prandial plasma GIP and a 68% decrease in blood glucose. Lowering of post-prandial blood glucose, plasma insulin and GIP levels by guar was statistically significant in every case. Addition of guar to the predominantly carbohydrate meal caused a decrease in total plasma GLI in both normal and diabetic subjects but reached statistical significance only in the normal subjects. There was a highly significant correlation (r = 0.83; p less than 0.0005) between peak post-prandial insulin levels in normal subjects and the corresponding plasma GIP concentration. The reduction of GIP or GLI secretion may, therefore, be partly responsible for the smaller rise in plasma insulin observed in normal volunteers when guar is added to meals.

  9. Association between physical exercise and quality of erection in men with ischaemic heart disease and erectile dysfunction subjected to physical training.

    PubMed

    Kałka, Dariusz; Domagała, Zygmunt; Dworak, Jacek; Womperski, Krzysztof; Rusiecki, Lesław; Marciniak, Wojciech; Adamus, Jerzy; Pilecki, Witold

    2013-01-01

    In addition to a beneficial effect on exercise tolerance and an associated reduction of global cardiovascular risk, modification of physical activity has a positive effect on the quality of life, reducing, among other things, the severity of erectile dysfunction (ED). The specific nature of sexual activity, which combines the need to maintain appropriate exercise tolerance and good erection quality, prompted us to evaluate the association between exercise tolerance and severity of ED in an intervention group of subjects with ischaemic heart disease (IHD) and ED in the context of cardiac rehabilitation (CR). A total of 138 men treated invasively for IHD (including 99 treated with percutaneous coronary intervention and 39 treated with coronary artery bypass grafting) who scored 21 or less in the initial IIEF-5 test were investigated. Subjects were randomised into two groups. The study group included 103 subjects (mean age 62.07 ± 8.59 years) who were subjected to a CR cycle. The control group included 35 subjects (mean age 61.43 ± 8.81 years) who were not subjected to any CR. All subjects filled out an initial and final IIEF-5 questionnaire and were evaluated twice with a treadmill exercise test. The CR cycle was carried out for a period of 6 months and included interval endurance training on a cycle ergometer (three times a week) and general fitness exercises and resistance training (twice a week). The CR cycle in the study group resulted in a statistically significant increase in exercise tolerance (7.15 ± 1.69 vs. 9.16 ± 1.84 METs,p < 0.05) and an increase in erection quality (12.51 ± 5.98 vs. 14.39 ± 6.82, p < 0.05) which was not observed in the control group. A significant effect of age on a progressive decrease in exercise tolerance and erection quality was found in the study group. Exercise tolerance and erection quality were also negatively affected by hypertension and smoking. A significant correlation between exercise tolerance and erection quality prior to the rehabilitation cycle indicates better erection quality in patients with better effort tolerance. The improvement in exercise tolerance did not correlate significantly with initial exercise tolerance or age of the subjects. In contrast, a significantly higher increase in erection quality was observed in younger subjects with the lowest baseline severity of ED.The relative increase in exercise tolerance in the group subjected to CR was significantly higher than the relative increase in erection quality but these two effects were not significantly correlated with each other. 1. In subjects with IHD and ED, erection quality is significantly correlated with exercise tolerance. 2. Exercise training had a positive effect on both exercise tolerance and erection quality but the size of these two effects was different and they ran independently of each other.

  10. A multicenter study of topical azelaic acid 15% gel in combination with oral doxycycline as initial therapy and azelaic acid 15% gel as maintenance monotherapy.

    PubMed

    Thiboutot, Diane M; Fleischer, Alan B; Del Rosso, James Q; Rich, Phoebe

    2009-07-01

    This two-phase, multicenter study was undertaken to examine the safety and efficacy of combination therapy with oral doxycycline and topical azelaic acid (AzA) 15% gel in moderate-to-severe papulopustular rosacea and to determine the effect of subsequent maintenance monotherapy with AzA 15% gel alone. In the initial open-label, non-randomized phase of the study, subjects (n=172) received topical AzA 15% gel and oral doxycycline (100 mg), both twice daily, for < or = 12 weeks. In the second, double-blind study phase, subjects who had initially undergone at least four weeks of combination treatment in phase 1 and who achieved > or = 75% inflammatory lesion count reduction (n=136) were randomized to receive either AzA 15% gel or its vehicle twice daily for an additional 24 weeks. Assessments of efficacy were obtained at four-week intervals throughout both phases of the study and included change in inflammatory lesion count, investigator global assessment (IGA) of rosacea severity, and separate assessments of erythema and telangiectasia severity. At the last visit for each phase of the study, the investigator and participant each rated overall improvement, with the participant rating cosmetic acceptability and the investigator rating treatment as "success" or "failure" based on IGA score. During the second phase of the trial, the rate of relapse -- defined as either a 50% deterioration in the lesion count improvement from phase 1, an increase in erythema intolerable to the subject or maintenance therapy failure as judged by the investigator and/or the subject -- was obtained. Safety assessments were conducted for both phases of the study and included analysis of adverse events (AEs) and a rating of cutaneous tolerability by the subject. By week 12 of the open-label phase of the study, 81.4% of subjects had reached a 75% or greater reduction in inflammatory lesion count, and 64% of patients achieved treatment success. During the second study phase (maintenance phase), AzA 15% gel consistently provided a better maintenance response than vehicle, with maintenance of remission in 75% of patients over the six-month duration of the maintenance phase. Additionally AzA 15% gel showed a statistically significantly lower deterioration in absolute inflammatory lesion counts than did vehicle after 8, 16, 20 and 24 weeks of maintenance therapy. No serious treatment-related AEs were encountered in the study, and 98.5% of subjects were satisfied with the local tolerability of both AzA gel and vehicle.

  11. The effects of deuterium on static posture control

    NASA Technical Reports Server (NTRS)

    Layne, Charles S.

    1990-01-01

    A significant operational problem impacting upon the Space Shuttle program involves the astronaut's ability to safely egress from the Orbiter during an emergency situation. Following space flight, astronauts display significant movement problems. One variable which may contribute to increased movement ataxia is deuterium (D2O). Deuterium is present in low levels within the Orbiter's water supply but may accumulate to significant physiological levels during lengthy missions. Deuterium was linked to a number of negative physiological responses, including motion sickness, decreased metabolism, and slowing of neural conduction velocity. The effects of D2O on static postural control in response to a range of dosage levels were investigated. Nine sugjects were divided into three groups of three subjects each. The groups were divided into a low, medium, and a high D2O dosage group. The subjects static posture was assessed with the use of the EquiTest systems, a commercially available postural control evaluation system featuring movable force plates and a visual surround that can be servoed to the subject's sway. In addition to the force plate information, data about the degree of subject sway about the hips and shoulders was obtained. Additionally, surface electromyographic (EMG) data from the selected lower limb muscles were collected along with saliva samples used to determine the amount of deuterium enrichment following D2O ingestion. Two baseline testing sessions were performed using the EquiTest testing protocol prior to ingestion of the D2O. Thirty minutes after dosing, subjects again performed the tests. Two more post-dosing tests were run with an interest interval of one hour. Preliminary data anlaysis indicates that only subjects in the igh dose group displayed any significant static postural problems. Future analyses of the sway and EMG is expected to reveal significant variations in the subject's postural control strategy following D2O dosing. While functionally significant static postural problems were not commonly observed, subjects in both the medium and high dosage groups displayed significant, and in some cases, severe voluntary movement problems.

  12. Assessing the Risk of Prehospital Administration of Naloxone with Subsequent Refusal of Care.

    PubMed

    Levine, Michael; Sanko, Stephen; Eckstein, Marc

    2016-01-01

    EMS providers frequently encounter opioid-toxic patients who receive naloxone and then refuse further medical care. Older studies revealed this practice to be safe. In light of the evolving patterns of opioid abuse, this study attempted to determine the safety of this practice. This is a retrospective review of all patient encounters by the Los Angeles Fire Department (LAFD) between July 1, 2011-December 31, 2013. All LAFD patient encounters are stored electronically. These electronic records were reviewed for subjects who received naloxone had a documented respiratory rate (RR) less than 12, and subsequently refused transport. Data abstracted included name, social security number (SSN), date of birth (DOB), date of EMS encounter, age, and treatment rendered. The names, SSN, and DOB, as available, were supplied to the coroner's office. The Coroner's records were reviewed to determine if a patient with the same or similar name (e.g., Jon vs. Jonathan) had died within 24 hours, 30 days, or 6 months of the initial EMS encounter. The abstractor was blinded to the study hypothesis. 205 subjects were identified; the median (IQR) age was 41 (29-53) years. 27 (13%) were female. One subject (0.49%) died within 24 hours of the initial EMS encounter. The cause of death (COD) was coronary artery disease and heroin use. Two additional subjects (1. %) died within 30 days. One of these subjects died 6 days later; the COD is unknown. The other subject died 20 days after the EMS encounter; the COD was cardiovascular disease and liver cirrhosis. No additional subjects were identified at the 6 month follow up. A third subject died of a heroin overdose 16 months after the initial EMS encounter, but was beyond the pre-defined follow up period. The practice of receiving pre-hospital naloxone by paramedics and subsequently refusing care is associated with an extremely low short- and intermediate-term mortality. Despite an evolving pattern of opioid abuse, the results of this study are consistent with previously reported studies.

  13. Patentability of Stem Cells in the United States.

    PubMed

    Fendrick, Sarah E; Zuhn, Donald L

    2015-08-20

    Until recently, the patentability of stem cells was well established within the judicial and statutory framework in the United States. However, the shifting landscape of patent law, particularly with regard to patent-eligible subject matter under 35 U.S.C. §101, presents new challenges to the patentability of stem cells. In this paper, we discuss the legal precedent that paved the way for stem cell patents, including Diamond v. Chakrabarty and In re Bergy. Additionally, we review recent Supreme Court cases and recent guidance issued by the U.S. Patent and Trademark Office that impose new limitations on patent-eligible subject matter and thereby threaten the patentability of stem cells in the United States. Copyright © 2015 Cold Spring Harbor Laboratory Press; all rights reserved.

  14. A stimulation method using odors suitable for PET and fMRI studies with recording of physiological and behavioral signals.

    PubMed

    Vigouroux, M; Bertrand, B; Farget, V; Plailly, J; Royet, J P

    2005-03-15

    A design for a semi-automatic olfactometric system is described for PET and fMRI experiments. The olfactometer presents several advantages because it enables the use of an 'infinite' number of odorants and the synchronization of stimuli with breathing. These advantages mean that the subject is recorded while breathing normally during olfactory judgment tasks. In addition, the design includes a system for recording the behavioral (rating scale) and physiological (breathing, electrodermal reaction (ED), plethysmography (PL)) signals given by the subject. Both systems present the advantage of being compatible with fMRI magnetic fields since no ferrous material is used in the Faraday cage and signals are transmitted via an optical transmission interface to an acquisition system.

  15. Data catalog series for space science and applications flight missions. Volume 4A: Descriptions of meteorological and terrestrial applications spacecraft and investigations

    NASA Technical Reports Server (NTRS)

    Ng, C. Y. (Editor); Sheu, Y. T. P. (Editor)

    1985-01-01

    The National Space Science Data Center (NSSDC) provides data from and information about space science and applications flight investigations in support of additional studies beyond those performed as the principal part of any flight mission. The Earth-orbiting spacecraft for investigations of the earth and its atmosphere is discussed. Geodetic tracking data are included in this category. The principal subject areas presented are meteorology and earth resources survey, and the spacecraft selection is made according to those subjects. All experiments on board the spacecraft are described. No attempt is made to reference investigations that are related to the above disciplines, but that are described in other volumes of this series.

  16. Skylab experiments. Volume 1: Physical science, solar astronomy

    NASA Technical Reports Server (NTRS)

    1973-01-01

    The basic subject of this volume is the solar astronomy program conducted on Skylab. In addition to descriptions of the individual experiments and the principles involved in their performance, a brief description is included of the sun and the energy characteristics associated with each zone. Wherever possible, related classroom activities have been identified and discussed in some detail. It will be apparent that the relationships rest not only in the field of solar astronomy, but also in the following subjects: (1) physics - optics, electromagnetic spectrum, atomic structure, etc.; (2) chemistry - emission spectra, kinetic theory, X-ray absorption, etc.; (3) biology - radiation and dependence on the sun; (4) electronics - cathode ray tubes, detectors, photomultipliers, etc.; (5) photography; (6) astronomy; and (7) industrial arts.

  17. Gender differences in recreational sports participation among Taiwanese adults.

    PubMed

    Tsai, Liang-Ting; Lo, Feng-En; Yang, Chih-Chien; Keller, Joseph Jordan; Lyu, Shu-Yu

    2015-01-15

    This study examines the gender differences in the enjoyment of recreational sports participation among Taiwanese adults. Data were obtained using the 2007 Taiwan Social Change Survey. The questionnaire included a topical module of the International Social Survey Program regarding leisure time and sports. Results showed that male subjects were more likely to participate in recreational sports to improve their appearance and on account of their personal interest. In addition to these factors, female subjects also experienced greater motivation to participate when Taiwanese athletes performed well in international sporting competitions. This study confirmed that the factors influencing enjoyment of recreational sports participation differ among men and women. These results can be used to better inform public health professionals and other regulatory organizations formulating physical activity intervention strategies.

  18. Relationship of hyposalivation and xerostomia in Mexican elderly with socioeconomic, sociodemographic and dental factors

    PubMed Central

    Islas-Granillo, Horacio; Borges-Yáñez, Aida; Fernández-Barrera, Miguel Ángel; Ávila-Burgos, Leticia; Patiño-Marín, Nuria; Márquez-Corona, María de Lourdes; Mendoza-Rodríguez, Martha; Medina-Solís, Carlo Eduardo

    2017-01-01

    We determined the prevalence of hyposalivation and xerostomia in older Mexicans (≥60 years), and its relationship with diverse factors. A cross-sectional study was realized in elderly subjects from Pachuca, Mexico. Chewing-stimulated saliva was collected under standardized conditions and salivary flow was measured; subjects were considered to have hyposalivation if their stimulated salivary flow was less than 0.7 mL per minute. Xerostomia was evaluated by asking subjects ‘Does your mouth feel dry?’. Hyposalivation was present in 59.7%, and xerostomia in 25.2% of subjects. 16.5% of subjects had both conditions. Xerostomia was present in 27.7% of subjects with hyposalivation and 21.4% of subjects without hyposalivation, but the difference was not significant (p > 0.05). Thus, 68.3% of older Mexicans had xerostomia and/or hyposalivation. Factors associated with hyposalivation were: using fewer devices in oral hygiene, lacking social benefits for retirement/pension, living in a public retirement home, brushing teeth less than twice a day and lacking teeth without dentures. None of the factors included in this study were associated with xerostomia. We concluded that several variables studied were associated with hyposalivation, but none for xerostomia. Additional research should examine the amount of hyposalivation and factors associated with hyposalivation especially in elderly with increased risk for hyposalivation. PMID:28094800

  19. The NASA scientific and technical information system: Its scope and coverage

    NASA Technical Reports Server (NTRS)

    1988-01-01

    A general description of the subject areas covered in the NASA scientific and technical information system is presented. In addition, it establishes subject-based selection criteria for guiding decisions related to the addition of new documents to the NASA collection.

  20. Comparison of subfoveal choroidal thickness in healthy pregnancy and pre-eclampsia

    PubMed Central

    Kim, J W; Park, M H; Kim, Y J; Kim, Y T

    2016-01-01

    Purpose Pregnancy is a known predisposing factor for central serous chorioretinopathy (CSC). Choroidal thickness (CT) increases in patients with CSC. This study was designed to evaluate CT in pregnant women. Patients and methods This was a prospective study. Fourteen healthy pregnant women and seven patients with pre-eclampsia were included. Twenty-one normal subjects were also recruited. CT was measured using enhanced-depth imaging optical coherence tomography. Results The mean CT of normal subjects, healthy pregnant women and patients with pre-eclampsia were 264.95±21.03, 274.23±29.30 and 389.79±25.13 μm, respectively (normal subjects vs healthy gravidas: P>0.05; normal subjects vs pre-eclampsia: P<0.001; healthy gravidas vs pre-eclampsia: P<0.001). CT decreased from 381.05±22.96 μm to 335.17±9.97 μm 1 week after delivery in patients with pre-eclampsia. Conclusions Pregnancy itself did not increase CT, whereas pre-eclampsia did appear to result in increased CT. This suggests that additional unknown factors induce hyperpermeability in pregnant women. PMID:26541086

  1. The effect of dilute baby shampoo on nasal mucociliary clearance in healthy subjects.

    PubMed

    Isaacs, Seth; Fakhri, Samer; Luong, Amber; Whited, Chad; Citardi, Martin J

    2011-01-01

    Biofilm formation has been implicated as an etiologic factor in the development of chronic rhinosinusitis (CRS). Nasal irrigation with surfactants including dilute baby shampoo have been proposed as an antibiofilm treatment for CRS patients. The effect of dilute baby shampoo on normal sinonasal mucosal function is unknown. Mucociliary clearance time (MCT), as measured by the time in minutes for a subject to detect a sweet taste after the application of a saccharin granules at the anterior part of the inferior turbinate, was performed before and shortly after nasal irrigation with 50 ml of 1% baby shampoo (Johnson & Johnson, New Brunswick, NJ) in 27 healthy volunteers. Mean MCTs before and after irrigation were 12.09 (±4.83 minutes) and 15.45 (±7.71 minutes) minutes, respectively. The mean difference, 3.37 minutes, was statistically significant (p = 0.031). Pre- and post-MCTs for each subject were not correlated (r = 0.324; p = 0.100). Nasal irrigations with dilute baby shampoo increase MCTs in healthy subjects. The impact of such interventions in CRS patients warrants additional investigation.

  2. Believing Is Doing: Emotion Regulation Beliefs Are Associated With Emotion Regulation Behavioral Choices and Subjective Well-Being

    PubMed Central

    Ortner, Catherine Nicole Marie; Briner, Esther Lydia; Marjanovic, Zdravko

    2017-01-01

    Research in emotion regulation has begun to examine various predictors of emotion regulation choices, including individual differences and contextual variables. However, scant attention has been paid to the extent to which people’s beliefs about the specific consequences of emotion regulation strategies for the components of an emotional response and long-term well-being predict their behavioral regulatory choices and, in turn, their subjective well-being. Participants completed measures to assess their beliefs about the consequences of functional and dysfunctional strategies, behavioral choices of emotion regulation strategies in negative scenarios, and subjective well-being. The model that fit the data indicated partial mediation whereby beliefs were associated with approximately 9% of the variance in choices. Emotion regulation choices were related to subjective well-being, with an additional direct effect between beliefs and well-being. This suggests beliefs play a role in people’s regulatory choices. Future research should explore how beliefs interact with individual differences and contextual variables to better understand why people regulate their emotions in different ways and, ultimately, to help individuals make healthy emotion regulation choices. PMID:28344675

  3. Believing Is Doing: Emotion Regulation Beliefs Are Associated With Emotion Regulation Behavioral Choices and Subjective Well-Being.

    PubMed

    Ortner, Catherine Nicole Marie; Briner, Esther Lydia; Marjanovic, Zdravko

    2017-03-01

    Research in emotion regulation has begun to examine various predictors of emotion regulation choices, including individual differences and contextual variables. However, scant attention has been paid to the extent to which people's beliefs about the specific consequences of emotion regulation strategies for the components of an emotional response and long-term well-being predict their behavioral regulatory choices and, in turn, their subjective well-being. Participants completed measures to assess their beliefs about the consequences of functional and dysfunctional strategies, behavioral choices of emotion regulation strategies in negative scenarios, and subjective well-being. The model that fit the data indicated partial mediation whereby beliefs were associated with approximately 9% of the variance in choices. Emotion regulation choices were related to subjective well-being, with an additional direct effect between beliefs and well-being. This suggests beliefs play a role in people's regulatory choices. Future research should explore how beliefs interact with individual differences and contextual variables to better understand why people regulate their emotions in different ways and, ultimately, to help individuals make healthy emotion regulation choices.

  4. Subjective memory complaints are associated with brain activation supporting successful memory encoding.

    PubMed

    Hayes, Jessica M; Tang, Lingfei; Viviano, Raymond P; van Rooden, Sanneke; Ofen, Noa; Damoiseaux, Jessica S

    2017-12-01

    Subjective memory complaints, the perceived decline in cognitive abilities in the absence of clinical deficits, may precede Alzheimer's disease. Individuals with subjective memory complaints show differential brain activation during memory encoding; however, whether such differences contribute to successful memory formation remains unclear. Here, we investigated how subsequent memory effects, activation which is greater for hits than misses during an encoding task, differed between healthy older adults aged 50 to 85 years with (n = 23) and without (n = 41) memory complaints. Older adults with memory complaints, compared to those without, showed lower subsequent memory effects in the occipital lobe, superior parietal lobe, and posterior cingulate cortex. In addition, older adults with more memory complaints showed a more negative subsequent memory effects in areas of the default mode network, including the posterior cingulate cortex, precuneus, and ventromedial prefrontal cortex. Our findings suggest that for successful memory formation, older adults with subjective memory complaints rely on distinct neural mechanisms which may reflect an overall decreased task-directed attention. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Influencing factors on CPAP adherence and anatomic characteristics of upper airway in OSA subjects.

    PubMed

    Park, Pona; Kim, Jinil; Song, Yoon Jae; Lim, Jae Hyun; Cho, Sung Woo; Won, Tae-Bin; Han, Doo Hee; Kim, Dong-Young; Rhee, Chae Seo; Kim, Hyun Jik

    2017-12-01

    Although continuous positive airway pressure (CPAP) is the most effective treatment modality, poor adherence still remains a problem for obstructive sleep apnea (OSA) treatment and there is little evidence regarding how this might be improved. This study aims to analyze the anatomic and clinical factors of OSA subjects who failed to comply with CPAP therapy.The medical records of 47 OSA subjects who received CPAP therapy as a first-line treatment modality were retrospectively reviewed. The medical records were reviewed for demographic and polysomnographic data and anatomic findings of the nasal cavity and oropharynx.24 patients who adhered to CPAP therapy and 23 patients who were nonadherent were enrolled in the study. There were no statistically significant differences in sleep parameters between CPAP-adherent patients and CPAP nonadherent subjects. Mean body mass index of CPAP nonadherent group was significantly higher than CPAP adherent group. Higher grades of septal deviation and hypertrophic change of the inferior turbinate were observed more in the CPAP nonadherent group. In addition, CPAP nonadherent subjects showed considerably bigger tonsils and higher grade palatal position comparing with the CPAP adherent subjects. Subjective discomfort including inconvenience, mouth dryness, and chest discomfort were the main problems for OSA subjects who did not comply with CPAP therapy.Excessive upper airway blockage in the nasal cavity and oropharynx was predominant in CPAP nonadherent subjects, which might cause the reported subjective discomfort that reduces CPAP compliance. Therefore, resolution of these issues is needed to enhance CPAP compliance for control of OSA. Copyright © 2017 The Authors. Published by Wolters Kluwer Health, Inc. All rights reserved.

  6. Influencing factors on CPAP adherence and anatomic characteristics of upper airway in OSA subjects

    PubMed Central

    Park, Pona; Kim, Jinil; Song, Yoon Jae; Lim, Jae Hyun; Cho, Sung Woo; Won, Tae-Bin; Han, Doo Hee; Kim, Dong-Young; Rhee, Chae Seo; Kim, Hyun Jik

    2017-01-01

    Abstract Although continuous positive airway pressure (CPAP) is the most effective treatment modality, poor adherence still remains a problem for obstructive sleep apnea (OSA) treatment and there is little evidence regarding how this might be improved. This study aims to analyze the anatomic and clinical factors of OSA subjects who failed to comply with CPAP therapy. The medical records of 47 OSA subjects who received CPAP therapy as a first-line treatment modality were retrospectively reviewed. The medical records were reviewed for demographic and polysomnographic data and anatomic findings of the nasal cavity and oropharynx. 24 patients who adhered to CPAP therapy and 23 patients who were nonadherent were enrolled in the study. There were no statistically significant differences in sleep parameters between CPAP-adherent patients and CPAP nonadherent subjects. Mean body mass index of CPAP nonadherent group was significantly higher than CPAP adherent group. Higher grades of septal deviation and hypertrophic change of the inferior turbinate were observed more in the CPAP nonadherent group. In addition, CPAP nonadherent subjects showed considerably bigger tonsils and higher grade palatal position comparing with the CPAP adherent subjects. Subjective discomfort including inconvenience, mouth dryness, and chest discomfort were the main problems for OSA subjects who did not comply with CPAP therapy. Excessive upper airway blockage in the nasal cavity and oropharynx was predominant in CPAP nonadherent subjects, which might cause the reported subjective discomfort that reduces CPAP compliance. Therefore, resolution of these issues is needed to enhance CPAP compliance for control of OSA. PMID:29390419

  7. The Perceived Socioeconomic Status Is an Important Factor of Health Recovery for Victims of Occupational Accidents in Korea.

    PubMed

    Seok, Hongdeok; Yoon, Jin-Ha; Lee, Wanhyung; Lee, June-Hee; Jung, Pil Kyun; Roh, Jaehoon; Won, Jong-Uk

    2016-02-01

    We aimed to examine whether there is a correlation between the health recovery of industrial accident victims and their perceived socioeconomic status. Data were obtained from the first Panel Study of Worker's Compensation Insurance, which included 2,000 participants. We performed multivariate regression analysis and determined the odds ratios for participants with a subjectively lower socioeconomic status and for those with a subjectively lower middle socioeconomic status using 95% confidence intervals. An additional multivariate regression analysis yielded the odds ratios for participants with a subjectively lower socioeconomic status and those with a subjectively upper middle socioeconomic class using 95% confidence intervals. Of all participants, 299 reported a full recovery, whereas 1,701 did not. We examined the odds ratio (95% confidence intervals) for participants' health recovery according to their subjective socioeconomic status while controlling for sex, age, education, tobacco use, alcohol use, subjective state of health prior to the accident, chronic disease, employment duration, recovery period, accident type, disability status, disability rating, and economic participation. The odds of recovery in participants with a subjectively lower middle socioeconomic status were 1.707 times greater (1.264-2.305) than that of those with a subjectively lower socioeconomic status. Similarly, the odds of recovery in participants with a subjectively upper middle socioeconomic status were 3.124 times greater (1.795-5.438) than that of those with a subjectively lower socioeconomic status. Our findings indicate that participants' perceived socioeconomic disparities extend to disparities in their health status. The reinforcement of welfare measures is greatly needed to temper these disparities.

  8. Distinguishing medication-free subjects with unipolar disorder from subjects with bipolar disorder: state matters.

    PubMed

    Rive, Maria M; Redlich, Ronny; Schmaal, Lianne; Marquand, André F; Dannlowski, Udo; Grotegerd, Dominik; Veltman, Dick J; Schene, Aart H; Ruhé, Henricus G

    2016-11-01

    Recent studies have indicated that pattern recognition techniques of functional magnetic resonance imaging (fMRI) data for individual classification may be valuable for distinguishing between major depressive disorder (MDD) and bipolar disorder (BD). Importantly, medication may have affected previous classification results as subjects with MDD and BD use different classes of medication. Furthermore, almost all studies have investigated only depressed subjects. Therefore, we focused on medication-free subjects. We additionally investigated whether classification would be mood state independent by including depressed and remitted subjects alike. We applied Gaussian process classifiers to investigate the discriminatory power of structural MRI (gray matter volumes of emotion regulation areas) and resting-state fMRI (resting-state networks implicated in mood disorders: default mode network [DMN], salience network [SN], and lateralized frontoparietal networks [FPNs]) in depressed (n=42) and remitted (n=49) medication-free subjects with MDD and BD. Depressed subjects with MDD and BD could be classified based on the gray matter volumes of emotion regulation areas as well as DMN functional connectivity with 69.1% prediction accuracy. Prediction accuracy using the FPNs and SN did not exceed chance level. It was not possible to discriminate between remitted subjects with MDD and BD. For the first time, we showed that medication-free subjects with MDD and BD can be differentiated based on structural MRI as well as resting-state functional connectivity. Importantly, the results indicated that research concerning diagnostic neuroimaging tools distinguishing between MDD and BD should consider mood state as only depressed subjects with MDD and BD could be correctly classified. Future studies, in larger samples are needed to investigate whether the results can be generalized to medication-naïve or first-episode subjects. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  9. Subclinical Inflammation and Endothelial Dysfunction in Patients with Chronic Pancreatitis and Newly Diagnosed Pancreatic Cancer.

    PubMed

    Gasiorowska, A; Talar-Wojnarowska, R; Kaczka, A; Borkowska, A; Czupryniak, L; Małecka-Panas, E

    2016-04-01

    Recent studies have suggested that various cytokines may be important players in the development and progression of chronic pancreatitis (CP) and pancreatic adenocarcinoma (PC). We studied endothelial dysfunction and subclinical inflammation in patients with newly diagnosed pancreatic adenocarcinoma and CP. A total of 45 patients were included in the present investigation, 27 with CP and 18 with PC. In addition, the study included 13 age- and body weight-matched healthy subjects served as controls. In all subjects, plasma adiponectin, TNF-alfa, interleukin 6 (IL-6), interleukin 1beta (IL-1β), E-selectin, thrombomodulin, adhesion molecules ICAM and VCAM, and endothelin-1 were assessed. PC and CP patients as compared with controls had significantly greater plasma adiponectin (13,292 and 12,227 vs 5408 ng/ml; p < 0.0003), TNF-alfa (22.1 and 23.1 vs 13 pg/ml; p < 0.0002), and IL-6 (6.6 and 7.3 vs 3.3 pg/ml; p < 0.0001). Moreover, there was significantly higher concentration of ICAM (931 and 492 vs 290 ng/ml; p < 0.005) and VCAM (1511 and 1080 vs 840 ng/ml; p < 0.01) in PC and CP patients. When PC and CP patients with and without diabetes were considered separately, there was no difference in adiponectin, cytokines, and parameters of endothelial dysfunction. In summary, our data indicate that patients with CP and PC express high levels of several cytokines compared with healthy individuals, especially adiponectin, TNF-α and IL-6. Serum TNF-α and ICAM concentrations coordinately increase in advanced CP. Furthermore, especially in PC subjects, elevated markers of endothelial dysfunction are present. This study provides additional evidence that changes in inflammatory cytokine and adhesion molecules in PC and CP are not likely related to endocrine disorders.

  10. Exploratory Study of Dimensions of Health-related Quality of Life in the General Population of South Korea

    PubMed Central

    2017-01-01

    Objectives This study aimed to explore dimensions in addition to the 5 dimensions of the 5-level EQ-5D version (EQ-5D-5L) that could satisfactorily explain variation in health-related quality of life (HRQoL) in the general population of South Korea. Methods Domains related to HRQoL were searched through a review of existing HRQoL instruments. Among the 28 potential dimensions, the 5 dimensions of the EQ-5D-5L and 7 additional dimensions (vision, hearing, communication, cognitive function, social relationships, vitality, and sleep) were included. A representative sample of 600 subjects was selected for the survey, which was administered through face-to-face interviews. Subjects were asked to report problems in 12 health dimensions at 5 levels, as well as their self-rated health status using the EuroQol visual analogue scale (EQ-VAS) and a 5-point Likert scale. Among subjects who reported no problems for any of the parameters in the EQ-5D-5L, we analyzed the frequencies of problems in the additional dimensions. A linear regression model with the EQ-VAS as the dependent variable was performed to identify additional significant dimensions. Results Among respondents who reported full health on the EQ-5D-5L (n=365), 32% reported a problem for at least 1 additional dimension, and 14% reported worse than moderate self-rated health. Regression analysis revealed a R2 of 0.228 for the original EQ-5D-5L dimensions, 0.200 for the new dimensions, and 0.263 for the 12 dimensions together. Among the added dimensions, vitality and sleep were significantly associated with EQ-VAS scores. Conclusions This study identified significant dimensions for assessing self-rated health among members of the general public, in addition to the 5 dimensions of the EQ-5D-5L. These dimensions could be considered for inclusion in a new preference-based instrument or for developing a country-specific HRQoL instrument. PMID:29207449

  11. Effect of bromocriptine-QR (a quick-release formulation of bromocriptine mesylate) on major adverse cardiovascular events in type 2 diabetes subjects.

    PubMed

    Gaziano, J Michael; Cincotta, Anthony H; Vinik, Aaron; Blonde, Lawrence; Bohannon, Nancy; Scranton, Richard

    2012-10-01

    Bromocriptine-QR (a quick-release formulation of bromocriptine mesylate), a dopamine D2 receptor agonist, is a US Food and Drug Administrration-approved treatment for type 2 diabetes mellitus (T2DM). A 3070-subject randomized trial demonstrated a significant, 40% reduction in relative risk among bromocriptine-QR-treated subjects in a prespecified composite cardiovascular (CV) end point that included ischemic-related (myocardial infarction and stroke) and nonischemic-related (hospitalization for unstable angina, congestive heart failure [CHF], or revascularization surgery) end points, but did not include cardiovascular death as a component of this composite. The present investigation was undertaken to more critically evaluate the impact of bromocriptine-QR on cardiovascular outcomes in this study subject population by (1) including CV death in the above-described original composite analysis and then stratifying this new analysis on the basis of multiple demographic subgroups and (2) analyzing the influence of this intervention on only the "hard" CV end points of myocardial infarction, stroke, and CV death (major adverse cardiovascular events [MACEs]). Three thousand seventy T2DM subjects on stable doses of ≤2 antidiabetes medications (including insulin) with HbA1c ≤10.0 (average baseline HbA1c=7.0) were randomized 2:1 to bromocriptine-QR (1.6 to 4.8 mg/day) or placebo for a 52-week treatment period. Subjects with heart failure (New York Heart Classes I and II) and precedent myocardial infarction or revascularization surgery were allowed to participate in the trial. Study outcomes included time to first event for each of the 2 CV composite end points described above. The relative risk comparing bromocriptine-QR with the control for the cardiovascular outcomes was estimated as a hazard ratio with 95% confidence interval on the basis of Cox proportional hazards regression. The statistical significance of any between-group difference in the cumulative percentage of CV events over time (derived from a Kaplan-Meier curve) was determined by a log-rank test on the intention-to-treat population. Study subjects were in reasonable metabolic control, with an average baseline HbA1c of 7.0±1.1, blood pressure of 128/76±14/9, and total and LDL cholesterol of 179±42 and 98±32, respectively, with 88%, 77%, and 69% of subjects being treated with antidiabetic, antihypertensive, and antihyperlipidemic agents, respectively. Ninety-one percent of the expected person-year outcome ascertainment was obtained in this study. Respecting the CV-inclusive composite cardiovascular end point, there were 39 events (1.9%) among 2054 bromocriptine-QR-treated subjects versus 33 events (3.2%) among 1016 placebo subjects, yielding a significant, 39% reduction in relative risk in this end point with bromocriptine-QR exposure (P=0.0346; log-rank test) that was not influenced by age, sex, race, body mass index, duration of diabetes, or preexisting cardiovascular disease. In addition, regarding the MACE end point, there were 14 events (0.7%) among 2054 bromocriptine-QR-treated subjects and 15 events (1.5%) among 1016 placebo-treated subjects, yielding a significant, 52% reduction in relative risk in this end point with bromocriptine-QR exposure (P<0.05; log-rank test). These findings reaffirm and extend the original observation of relative risk reduction in cardiovascular adverse events among type 2 diabetes subjects treated with bromocriptine-QR and suggest that further investigation into this impact of bromocriptine-QR is warranted. URL: http://clinicaltrials.gov. Unique Identifier: NCT00377676.

  12. Effect of physical activity on pulse wave velocity in elderly subjects with normal glucose, prediabetes or Type 2 Diabetes.

    PubMed

    Metsämarttila, Erja; Rodilla, Enrique; Jokelainen, Jari; Herrala, Sauli; Leppäluoto, Juhani; Keinänen-Kiukaanniemi, Sirkka; Herzig, Karl-Heinz

    2018-05-23

    Carotid-femoral pulse wave velocity ((cf)PWV) is a measure of arterial stiffness, predicting cardiovascular disease. We hypothesized that the amount of physical activity (PA) is correlated with reduced arterial stiffness in Type 2 diabetic (T2D) subjects. 570 subjects from the 1945 Oulu birth cohort were included in the analysis. (cf)PWV was determined by a non-invasive applanation tonometry. Oral glucose tolerance test was performed and LDL and HDL cholesterol analyzed. PA was registered daily with a wrist-worn acceleration meter for two weeks. (cf)PWV values in subjects with impaired glucose metabolism (IGM) and T2D were higher than in normal glycemic subjects (P < 0.001). PA, fasting and 2 h glucose and HbA1c correlated significantly with (cf)PWV, but HDL or LDL cholesterol did not. The 2 h glucose, heart rate and alcohol consumption in T2D subjects had independent effects on (cf)PWV in multiple regression analysis. T2D and IGM were significantly associated to (cf)PWV. Interestingly, lipids did not have an additional effect on (cf)PWV. Subjects walking more than 10 000 steps/day had 0.2 m/s lower (cf)PWV than those walking less than 6000 steps/day. Presence of T2D, elevated heart rate and alcohol consumption in males were associated with increased aortic stiffening in elderly subjects.

  13. The Shigella human challenge model.

    PubMed

    Porter, C K; Thura, N; Ranallo, R T; Riddle, M S

    2013-02-01

    Shigella is an important bacterial cause of infectious diarrhoea globally. The Shigella human challenge model has been used since 1946 for a variety of objectives including understanding disease pathogenesis, human immune responses and allowing for an early assessment of vaccine efficacy. A systematic review of the literature regarding experimental shigellosis in human subjects was conducted. Summative estimates were calculated by strain and dose. While a total of 19 studies evaluating nine strains at doses ranging from 10 to 1 × 1010 colony-forming units were identified, most studies utilized the S. sonnei strain 53G and the S. flexneri strain 2457T. Inoculum solution and pre-inoculation buffering has varied over time although diarrhoea attack rates do not appear to increase above 75-80%, and dysentery rates remain fairly constant, highlighting the need for additional dose-ranging studies. Expansion of the model to include additional strains from different serotypes will elucidate serotype and strain-specific outcome variability.

  14. Diagnostic potential of serum N-terminal pro-B-type brain natriuretic peptide level in detection of cardiac wall stress in women with polycystic ovary syndrome: a cross-sectional comparison study.

    PubMed

    Celik, Onder; Sahin, Ibrahim; Celik, Nilufer; Hascalik, Seyma; Keskin, Lezzan; Ozcan, Hamdi; Uckan, Ahmet; Kosar, Feridun

    2007-11-01

    In addition to the negative effect on fertility, polycystic ovary syndrome (PCOS) has been associated with cardiac pathology. Brain natriuretic peptide (BNP) is a possible marker for cardiac risk, therefore we investigated whether N-terminal pro-B-type BNP (NT-proBNP) increases in women with PCOS compared with healthy women of comparable age and body mass index. Thirty women with PCOS and 30 healthy women not suffering from overt cardiac disease were involved in the study. Fasting insulin and serum NT-proBNP levels were measured, and M-Mode echocardiography was performed. Insulin resistance was calculated using the homeostasis model assessment insulin resistance index (HOMA-IR). PCOS subjects had higher NT-proBNP levels than the control subjects (P < 0.001). Abnormal echocardiography indices were detected in 14 of the PCOS subjects (but none of the controls), including valvular heart disease in nine, diastolic dysfunction in two, right ventricular enlargement in one, right atrial enlargement in one and pulmonary hypertension in one. PCOS subjects (n = 30) showed an increased left ventricular mass (LVM) (P < 0.001) and left ventricular posterior wall thickness (LVPWT) (P = 0.006). In addition, NT-proBNP concentration was positively correlated with LVM (r = 0.587, P = 0.001) and negatively correlated with sex-hormone-binding globulin (r = -0.528, P = 0.003). There was a positive correlation between LVM and HOMA-IR (r = 0.295, P = 0.03) while LVPWT was positively correlated with fasting insulin and HOMA-IR (r = 0.335, P = 0.031 and r = 0.346, P = 0.045, respectively) in PCOS subjects (n = 30). The present study demonstrated that the level of NT-proBNP was increased in PCOS subjects with asymptomatic heart disease.

  15. Reduction of facial redness with resveratrol added to topical product containing green tea polyphenols and caffeine.

    PubMed

    Ferzli, Georgina; Patel, Mital; Phrsai, Natasha; Brody, Neil

    2013-07-01

    Many topical formulations include antioxidants to improve the antioxidant capability of the skin. This study evaluated the ability of a unique combination of antioxidants including resveratrol, green tea polyphenols, and caffeine to reduce facial redness. Subjects (n=16) presenting with facial redness applied the resveratrol-enriched product twice daily to the entire face. Reduction in redness was evaluated by trained staff members and dermatology house staff officers. Evaluators compared clinical photographs and spectrally enhanced images taken before treatment and at 2-week intervals for up to 12 weeks. 16 of 16 clinical images showed improvement and 13 of 16 spectrally enhanced images were improved. Reduction in facial redness continued to evolve over the duration of the study period but was generally detectable by 6 weeks of treatment. Adverse effects were not observed in any subject. The skin product combination of resveratrol, green tea polyphenols, and caffeine safely reduces facial redness in most patients by 6 weeks of continuous treatment and may provide further improvement with additional treatment.

  16. Clinical Manifestations of an Anti-Drug Antibody Response: Autoimmune Reactions.

    PubMed

    Swanson, Steven J

    2014-12-01

    Antibodies can be generated against a therapeutic protein upon administration to human subjects. When the therapeutic protein closely mimics one of the subject's endogenous proteins, those antibodies might bind to the endogenous protein in addition to the therapeutic protein. This scenario results when tolerance to the endogenous protein is broken. The consequences of breaking tolerance include an autoimmune response where antibodies are generated against the endogenous protein. These autoantibodies could have significant clinical relevance depending on several factors, including the redundancy of action of the endogenous protein as well as the concentration, binding affinity, and neutralizing potential of the antibodies. The consequences of a therapeutic-protein-induced autoimmune reaction can be challenging to manage as the stimulus for further perpetuation of the immune response can shift from the therapeutic protein to the endogenous protein. The potential for inducing an autoimmune response is one of the reasons that the immune response to a therapeutic protein should be monitored if it persists through the end of the study.

  17. Medical Subspecialty Textbooks in the 21st Century. Essential or Headed for Extinction?

    PubMed

    Broaddus, V Courtney; Grippi, Michael A

    2015-08-01

    In recent years, the role of medical subspecialty textbooks as sources of information for students, trainees, and practicing clinicians has been challenged. Although the structure of textbooks continues to evolve from standard, printed versions to digital formats, including e-books and online texts, we maintain that the authoritative compilation of clinical and scientific material by experts in the field (i.e., a modern-day textbook) remains central to the education, training, and practice of subspecialists. Regardless of format, an effective medical subspecialty textbook is authoritative, comprehensive, and integrated in its coverage of the subject. Textbook content represents a unique synthesis of clinical and scientific material of real educational and clinical value. Incorporation of illustrations, including figures, tables, videos, and audios, bolsters the presentation and further solidifies the reader's understanding of the subject. The textbook, both printed and digital, reinforces the many widely available online resources and serves as a platform from which to evaluate other sources of information and to launch additional scientific and clinical inquiry.

  18. Probabilistic Material Strength Degradation Model for Inconel 718 Components Subjected to High Temperature, High-Cycle and Low-Cycle Mechanical Fatigue, Creep and Thermal Fatigue Effects

    NASA Technical Reports Server (NTRS)

    Bast, Callie C.; Boyce, Lola

    1995-01-01

    The development of methodology for a probabilistic material strength degradation is described. The probabilistic model, in the form of a postulated randomized multifactor equation, provides for quantification of uncertainty in the lifetime material strength of aerospace propulsion system components subjected to a number of diverse random effects. This model is embodied in the computer program entitled PROMISS, which can include up to eighteen different effects. Presently, the model includes five effects that typically reduce lifetime strength: high temperature, high-cycle mechanical fatigue, low-cycle mechanical fatigue, creep and thermal fatigue. Results, in the form of cumulative distribution functions, illustrated the sensitivity of lifetime strength to any current value of an effect. In addition, verification studies comparing predictions of high-cycle mechanical fatigue and high temperature effects with experiments are presented. Results from this limited verification study strongly supported that material degradation can be represented by randomized multifactor interaction models.

  19. Urban Renewal Mega Projects and Residents' Quality of Life: Evidence from Historical Religious Center of Mashhad Metropolis.

    PubMed

    Forouhar, Amir; Hasankhani, Mahnoosh

    2018-04-01

    Urban decay is the process by which a historical city center, or an old part of a city, falls into decrepitude and faces serious problems. Urban management, therefore, implements renewal mega projects with the goal of physical and functional revitalization, retrieval of socioeconomic capacities, and improving of quality of life of residents. Ignoring the complexities of these large-scale interventions in the old and historical urban fabrics may lead to undesirable consequences, including an additional decline of quality of life. Thus, the present paper aims to assess the impact of renewal mega projects on residents' subjective quality of life, in the historical religious district of the holy city of Mashhad (Samen District). A combination of quantitative and qualitative methods of impact assessment, including questionnaires, semi-structured personal interviews, and direct observation, is used in this paper. The results yield that the Samen Renewal Project has significantly reduced the resident's subjective quality of life, due to its undesirable impacts on physical, socio-cultural, and economic environments.

  20. Combining facial dynamics with appearance for age estimation.

    PubMed

    Dibeklioglu, Hamdi; Alnajar, Fares; Ali Salah, Albert; Gevers, Theo

    2015-06-01

    Estimating the age of a human from the captured images of his/her face is a challenging problem. In general, the existing approaches to this problem use appearance features only. In this paper, we show that in addition to appearance information, facial dynamics can be leveraged in age estimation. We propose a method to extract and use dynamic features for age estimation, using a person's smile. Our approach is tested on a large, gender-balanced database with 400 subjects, with an age range between 8 and 76. In addition, we introduce a new database on posed disgust expressions with 324 subjects in the same age range, and evaluate the reliability of the proposed approach when used with another expression. State-of-the-art appearance-based age estimation methods from the literature are implemented as baseline. We demonstrate that for each of these methods, the addition of the proposed dynamic features results in statistically significant improvement. We further propose a novel hierarchical age estimation architecture based on adaptive age grouping. We test our approach extensively, including an exploration of spontaneous versus posed smile dynamics, and gender-specific age estimation. We show that using spontaneity information reduces the mean absolute error by up to 21%, advancing the state of the art for facial age estimation.

  1. The synergistic effects of saxagliptin and metformin on CD34+ endothelial progenitor cells in early type 2 diabetes patients: a randomized clinical trial.

    PubMed

    Dore, Fiona J; Domingues, Cleyton C; Ahmadi, Neeki; Kundu, Nabanita; Kropotova, Yana; Houston, Sara; Rouphael, Carol; Mammadova, Aytan; Witkin, Linda; Khiyami, Anamil; Amdur, Richard L; Sen, Sabyasachi

    2018-05-03

    Type 2 diabetes is associated with endothelial dysfunction leading to cardiovascular disease. CD34+ endothelial Progenitor Cells (EPCs) are responsible for endothelial repair and neo-angiogenesis and can be used as a cardiovascular disease risk biomarker. This study investigated whether the addition of saxagliptin, a DPP-IV inhibitor, to metformin, may reduce cardiovascular disease risk in addition to improving glycemic control in Type 2 diabetes patients. In 12 week, double-blind, randomized placebo-controlled trial, 42 subjects already taking metformin 1-2 grams/day were randomized to placebo or saxagliptin 5 mg. Subjects aged 40-70 years with diabetes for < 10 years, with no known cardiovascular disease, BMI 25-39.9, HbA1C 6-9% were included. We evaluated EPCs number, function, surface markers and gene expression, in addition to arterial stiffness, blood biochemistries, resting energy expenditure, and body composition parameters. A mixed model regression to examine saxagliptin vs placebo, accounting for within-subject autocorrelation, was done with SAS (p < 0.05). Although there was no significant increase in CD34+ cell number, CD31+ cells percentage increased. Saxagliptin increased migration (in response to SDF1α) with a trend of higher colony formation count. MNCs cytometry showed higher percentage of CXCR4 double positivity for both CD34 and CD31 positive cells, indicating a functional improvement. Gene expression analysis showed an upregulation in CD34+ cells for antioxidant SOD1 (p < 0.05) and a downregulation in CD34- cells for IL-6 (p < 0.01). For arterial stiffness, both augmentation index and systolic blood pressure measures went down in saxagliptin subjects (p < 0.05). Saxagliptin, in combination with metformin, can help improve endothelial dysfunction in early diabetes before macrovascular complications appear. Trial registration Trial is registered under clinicaltrials.gov, NCT02024477.

  2. Clinical outcomes of lung transplant recipients with telomerase mutations.

    PubMed

    Tokman, Sofya; Singer, Jonathan P; Devine, Megan S; Westall, Glen P; Aubert, John-David; Tamm, Michael; Snell, Gregory I; Lee, Joyce S; Goldberg, Hilary J; Kukreja, Jasleen; Golden, Jeffrey A; Leard, Lorriana E; Garcia, Christine K; Hays, Steven R

    2015-10-01

    Successful lung transplantation for patients with pulmonary fibrosis from telomerase mutations may be limited by systemic complications of telomerase dysfunction, including myelosuppression, cirrhosis, and malignancy. We describe clinical outcomes in 14 lung transplant recipients with telomerase mutations. Subjects underwent lung transplantation between February 2005 and April 2014 at 5 transplant centers. Data were abstracted from medical records, focusing on outcomes reflecting post-transplant treatment effects likely to be complicated by telomerase mutations. The median age of subjects was 60.5 years (interquartile range = 52.0-62.0), 64.3% were male, and the mean post-transplant observation time was 3.2 years (SD ± 2.9). A mutation in telomerase reverse transcriptase was present in 11 subjects, a telomerase RNA component mutation was present in 2 subjects, and an uncharacterized mutation was present in 1 subject. After lung transplantation, 10 subjects were leukopenic and 5 did not tolerate lymphocyte anti-proliferative agents. Six subjects developed recurrent lower respiratory tract infections, 7 developed acute cellular rejection (A1), and 4 developed chronic lung allograft dysfunction. Eight subjects developed at least 1 episode of acute renal failure and 10 developed chronic renal insufficiency. In addition, 3 subjects developed cancer. No subjects had cirrhosis. At data censorship, 13 subjects were alive. The clinical course for lung transplant recipients with telomerase mutations is complicated by renal disease, leukopenia with intolerance of lymphocyte anti-proliferative agents, and recurrent lower respiratory tract infections. In contrast, cirrhosis was absent, acute cellular rejection was mild, and development of chronic lung allograft dysfunction was comparable to other lung transplant recipients. Although it poses challenges, lung transplantation may be feasible for patients with pulmonary fibrosis from telomerase mutations. Copyright © 2015 International Society for Heart and Lung Transplantation. Published by Elsevier Inc. All rights reserved.

  3. Prosody impairment and associated affective and behavioral disturbances in Alzheimer's disease.

    PubMed

    Roberts, V J; Ingram, S M; Lamar, M; Green, R C

    1996-12-01

    We examined the ability to produce, repeat, and comprehend emotional prosody in 20 patients with Alzheimer's disease (AD) and in 11 elderly normal control subjects. In addition, caregivers of AD patients completed affective and behavioral measures with reference to the patient. Relative to control subjects, comprehension of emotional prosody was marginally impaired in mildly demented AD patients, whereas production, comprehension, and repetition of emotional prosody were significantly impaired in moderately demented AD patients. The moderately demented patients performed significantly poorer than the mildly demented patients on the production and repetition tasks. In contrast, there was no significance difference between the two groups on the prosody comprehension task. Additional analyses revealed an inverse relationship between the ability to correctly produce and repeat emotional prosody and the frequency of agitated behaviors and depressive symptomatology in moderately demented patients. This latter findings suggests that the inability to communicate emotional message is associated with disturbances in mood and behavior in AD patients. Implications for the management of disruptive behavior in agitated and aprosodic AD patients include the development of caregiver sensitivity to unexpressed emotion and caregiver assistance with emotional expression.

  4. Crew/Robot Coordinated Planetary EVA Operations at a Lunar Base Analog Site

    NASA Technical Reports Server (NTRS)

    Diftler, M. A.; Ambrose, R. O.; Bluethmann, W. J.; Delgado, F. J.; Herrera, E.; Kosmo, J. J.; Janoiko, B. A.; Wilcox, B. H.; Townsend, J. A.; Matthews, J. B.; hide

    2007-01-01

    Under the direction of NASA's Exploration Technology Development Program, robots and space suited subjects from several NASA centers recently completed a very successful demonstration of coordinated activities indicative of base camp operations on the lunar surface. For these activities, NASA chose a site near Meteor Crater, Arizona close to where Apollo Astronauts previously trained. The main scenario demonstrated crew returning from a planetary EVA (extra-vehicular activity) to a temporary base camp and entering a pressurized rover compartment while robots performed tasks in preparation for the next EVA. Scenario tasks included: rover operations under direct human control and autonomous modes, crew ingress and egress activities, autonomous robotic payload removal and stowage operations under both local control and remote control from Houston, and autonomous robotic navigation and inspection. In addition to the main scenario, participants had an opportunity to explore additional robotic operations: hill climbing, maneuvering heaving loads, gathering geo-logical samples, drilling, and tether operations. In this analog environment, the suited subjects and robots experienced high levels of dust, rough terrain, and harsh lighting.

  5. Study to develop improved fire resistant aircraft passenger seat materials, phase 1

    NASA Technical Reports Server (NTRS)

    Trabold, E. L.

    1977-01-01

    The procurement and testing of a wide range of candidate materials is reported. Improved fire resistant nonmetallic materials were subjected to tests to evaluate their thermal characteristics, such as burn, smoke generation, heat release rate and toxicity. In addition, candidate materials were evaluated for mechanical, physical and aesthetic properties. Other properties considered included safety, comfort, durability and maintainability. The fiscal year 1977 and the projected 1980 cost data were obtained for aircraft seat materials.

  6. Ballistic Evaluation of 2060 Aluminum

    DTIC Science & Technology

    2016-05-24

    thicknesses subjected to impacts from various munitions including armor-piercing (AP) and fragment-simulating projectiles (FSPs). Additionally, Table 2...Experimental Procedure The V50 is defined as the impact velocity at which the projectile is equally as likely to penetrate the target as it is to arrest. A...0.51-mm (0.020-inch) 2024 T3 Al witness plate was positioned 152 mm (6 inches) behind the target to determine the outcome of each shot. An impact is

  7. Considerations for preparing collaborative international research: a Ugandan experience.

    PubMed

    Musil, Carol M; Mutabaazi, Jemimah; Walusimbi, Mariam; Okonsky, Jennifer G; Biribonwa, Yedidah; Eagan, Sabrina; Dimarco, Marguerite A; Mbaballi, Speciosa; Fitzpatrick, Joyce J

    2004-08-01

    This article describes issues to consider when planning and conducting international research projects. Key considerations include building collaboration, developing a comprehensive and feasible research plan, funding and budgets, addressing human subjects concerns, and analyzing and disseminating project findings. These considerations and related methodological issues are discussed in the context of a replication pilot project conducted outside Kampala, Uganda. Ongoing dialog, flexibility, and collaboration, in addition to good science, are critical to developing successful international research projects.

  8. Hydrogen energy. A bibliography with abstracts

    NASA Technical Reports Server (NTRS)

    1978-01-01

    Hydrogen Energy is a continuing bibliographic summary with abstracts of research and projections on the subject of hydrogen as a secondary fuel and as an energy carrier. This update to Hydrogen Energy cites additional references identified during the fourth quarter of 1978. It is the fourth in a 1978 quarterly series intended to provide current awareness to those interested in hydrogen energy. A series of cross indexes are included which track directly with those of the cumulative volume.

  9. Physiologic responses to water immersion in man: A compendium of research

    NASA Technical Reports Server (NTRS)

    Kollias, J.; Vanderveer, D.; Dorchak, K. J.; Greenleaf, J. E.

    1976-01-01

    A total of 221 reports published through December 1973 in the area of physiologic responses to water immersion in man were summarized. The author's abstract or summary was used whenever possible. Otherwise, a detailed annotation was provided under the subheadings: (1) purpose, (2) procedures and methods, (3) results, and (4) conclusions. The annotations are in alphabetical order by first author; author and subject indexes are included. Additional references are provided in the selected bibliography.

  10. Consciousness in humans and non-human animals: recent advances and future directions

    PubMed Central

    Boly, Melanie; Seth, Anil K.; Wilke, Melanie; Ingmundson, Paul; Baars, Bernard; Laureys, Steven; Edelman, David B.; Tsuchiya, Naotsugu

    2013-01-01

    This joint article reflects the authors' personal views regarding noteworthy advances in the neuroscience of consciousness in the last 10 years, and suggests what we feel may be promising future directions. It is based on a small conference at the Samoset Resort in Rockport, Maine, USA, in July of 2012, organized by the Mind Science Foundation of San Antonio, Texas. Here, we summarize recent advances in our understanding of subjectivity in humans and other animals, including empirical, applied, technical, and conceptual insights. These include the evidence for the importance of fronto-parietal connectivity and of “top-down” processes, both of which enable information to travel across distant cortical areas effectively, as well as numerous dissociations between consciousness and cognitive functions, such as attention, in humans. In addition, we describe the development of mental imagery paradigms, which made it possible to identify covert awareness in non-responsive subjects. Non-human animal consciousness research has also witnessed substantial advances on the specific role of cortical areas and higher order thalamus for consciousness, thanks to important technological enhancements. In addition, much progress has been made in the understanding of non-vertebrate cognition relevant to possible conscious states. Finally, major advances have been made in theories of consciousness, and also in their comparison with the available evidence. Along with reviewing these findings, each author suggests future avenues for research in their field of investigation. PMID:24198791

  11. Characterization of doctor-patient communication using heartbeat nonlinear dynamics: A preliminary study using Lagged Poincaré Plots.

    PubMed

    Nardelli, M; Del Piccolo, L; Danzi, Op; Perlini, C; Tedeschi, F; Greco, A; Scilingo, Ep; Valenza, G

    2017-07-01

    Emphatic doctor-patient communication has been associated with an improved psycho-physiological well-being involving cardiovascular and neuroendocrine responses. Nevertheless, a comprehensive assessment of heartbeat linear and nonlinear/complex dynamics throughout the communication of a life-threatening disease has not been performed yet. To this extent, we here study heart rate variability (HRV) series gathered from 17 subjects while watching a video where an oncologist discloses the diagnosis of a cancer metastasis to a patient. Further 17 subjects watched the same video including additional affective emphatic contents. For the assessment of the two groups, linear heartbeat dynamics was quantified through measures defined in the time and frequency domains, whereas nonlinear/complex dynamics referred to measures of entropy, and combined Lagged Poincare Plots (LPP) and symbolic analyses. Considering differences between the beginning and the end of the video, results from non-parametric statistical tests demonstrated that the group watching emphatic contents showed HRV changes in the LF/HF ratio exclusively. Conversely, the group watching the purely informative video showed changes in vagal activity (i.e., HF power), LF/HF ratio, as well as LPP measures. Additionally, a Support Vector Machine algorithm including HRV nonlinear/complex information was able to automatically discern between groups with an accuracy of 76.47%. We therefore propose the use of heartbeat nonlinear/complex dynamics to objectively assess the empathy level of healthy women.

  12. Exogenous regucalcin suppresses the growth of human liver cancer HepG2 cells in vitro.

    PubMed

    Yamaguchi, Masayoshi; Murata, Tomiyasu

    2018-04-05

    Regucalcin, which its gene is localized on the X chromosome, plays a pivotal role as a suppressor protein in signal transduction in various types of cells and tissues. Regucalcin gene expression has been demonstrated to be suppressed in various tumor tissues of animal and human subjects, suggesting a potential role of regucalcin in carcinogenesis. Regucalcin, which is produced from the tissues including liver, is found to be present in the serum of human subjects and animals. This study was undertaken to determine the effects of exogenous regucalcin on the proliferation in cloned human hepatoma HepG2 cells in vitro. Proliferation of HepG2 cells was suppressed after culture with addition of regucalcin (0.01 – 10 nM) into culture medium. Exogenous regucalcin did not reveal apoptotic cell death in HepG2 cells in vitro. Suppressive effects of regucalcin on cell proliferation were not enhanced in the presence of various signaling inhibitors including tumor necrosis factor-α (TNF-α), Bay K 8644, PD98059, staurosporine, worthomannin, 5,6-dichloro-1-β-D-ribofuranosylbenzimidazole (DRB) or gemcitabine, which were found to suppress the proliferation. In addition, exogenous regucalcin suppressed the formation of colonies of cultured hepatoma cells in vitro. These findings demonstrated that exogenous regucalcin exhibits a suppressive effect on the growth of human hepatoma HepG2 cells, proposing a strategy with the gene therapy for cancer treatment.

  13. Green tea polyphenol epigallocatechin-3-gallate (EGCG) as adjuvant in cancer therapy.

    PubMed

    Lecumberri, Elena; Dupertuis, Yves Marc; Miralbell, Raymond; Pichard, Claude

    2013-12-01

    Green tea catechins, especially epigallocatechin-3-gallate (EGCG), have been associated with cancer prevention and treatment. This has resulted in an increased number of studies evaluating the effects derived from the use of this compound in combination with chemo/radiotherapy. This review aims at compiling latest literature on this subject. Keywords including EGCG, cancer, chemotherapy, radiotherapy and side effects, were searched using PubMed and ScienceDirect databases to identify, analyze, and summarize the research literature on this topic. Most of the studies on this subject up to date are preclinical. Relevance of the findings, impact factor, and date of publication were critical parameters for the studies to be included in the review. Additive and synergistic effects of EGCG when combined with conventional cancer therapies have been proposed, and its anti-inflammatory and antioxidant activities have been related to amelioration of cancer therapy side effects. However, antagonistic interactions with certain anticancer drugs might limit its clinical use. The use of EGCG could enhance the effect of conventional cancer therapies through additive or synergistic effects as well as through amelioration of deleterious side effects. Further research, especially at the clinical level, is needed to ascertain the potential role of EGCG as adjuvant in cancer therapy. Copyright © 2013 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.

  14. Description of data on the Nimbus 7 LIMS map archive tape: Water vapor and nitrogen dioxide

    NASA Technical Reports Server (NTRS)

    Haggard, Kenneth V.; Marshall, B. T.; Kurzeja, Robert J.; Remsberg, Ellis E.; Russell, James M., III

    1988-01-01

    Described is the process by which the analysis of the Limb Infrared Monitor of the Stratosphere (LIMS) experiment data were used to produce estimates of synoptic maps of water vapor and nitrogen dioxide. In addition to a detailed description of the analysis procedure, also discussed are several interesting features in the data which are used to demonstrate how the analysis procedure produced the final maps and how one can estimate the uncertainties in the maps. In addition, features in the analysis are noted that would influence how one might use, or interpret, the results. These include subjects such as smoothing and the interpretation of wave components.

  15. The financial impact of heparin-induced thrombocytopenia.

    PubMed

    Smythe, Maureen A; Koerber, John M; Fitzgerald, Maureen; Mattson, Joan C

    2008-09-01

    Heparin-induced thrombocytopenia (HIT) is an adverse drug reaction that increases patient morbidity and mortality. The financial impact of HIT to an institution is thought to be significant. The objective of this study was to evaluate the financial impact of HIT. A case-control study was employed. Case patients were identified as newly diagnosed HIT patients. Control subjects were matched by diagnosis-related group, primary diagnosis code, primary procedure code, and hospital admission date. The financial/decision support database of the hospital was queried to identify the matched control subjects, total cost, and reimbursement. The determination of financial impact included the total profit or (total loss) and the backfill effect (ie, the lost operating margin resulting from increased length of stay). Length of stay and mortality were compared. Data from 22 case patients and 255 control subjects were analyzed. On average, HIT case patients incurred a financial loss of $14,387 per patient and an increase in length of stay of 14.5 days. When confining the analysis to only Medicare case patients (n = 17) and Medicare control subjects, case patients incurred a financial loss of $20,170 per case and an increase in length of stay of 15.8 days. Depending on the occupancy rate of the institution, additional financial loss could result from the backfill effect. Mortality was not significantly affected. For an institution that sees 50 new cases of HIT per year, the projected annual financial impact ranges from approximately $700,000 to $1 million. Institutions with high bed occupancy rates may see an additional loss from the backfill effect.

  16. Normal postural responses preceding shoulder flexion: co-activation or asymmetric activation of transverse abdominis?

    PubMed

    Davarian, Sanaz; Maroufi, Nader; Ebrahimi, Esmaeil; Parnianpour, Mohammad; Farahmand, Farzam

    2014-01-01

    It is suggested that activation of the transverse abdominis muscle has a stabilizing effect on the lumbar spine by raising intra-abdominal pressure without added disc compression. However, its feedforward activity has remained a controversial issue. In addition, research regarding bilateral activation of trunk muscles during a unilateral arm movement is limited. The aim of this study was to evaluate bilateral anticipatory activity of trunk muscles during unilateral arm flexion. Eighteen healthy subjects (aged 25 ± 3.96 years) participated in this study and performed 10 trials of rapid arm flexion in response to a visual stimulus. The electromyographic activity of the right anterior deltoid (AD) and bilateral trunk muscles including the transverse abdominis/internal oblique (TA/IO), superficial lumbar multifidus (SLM) and lumbar erector spine (LES) was recorded. The onset latency and anticipatory activity of the recorded trunk muscles were calculated. The first muscle activated in anticipation of the right arm flexion was the left TA/IO. The right TA/IO activated significantly later than all other trunk muscles (P < 0.0005). In addition, anticipatory activity of the right TA/IO was significantly lower than all other trunk muscles (P < 0.0005). There was no significant difference in either onset latency or anticipatory activity among other trunk muscles (P > 0.05). Healthy subjects showed no bilateral anticipatory co-activation of TA/IO in unilateral arm elevation. Further investigations are required to delineate normal muscle activation pattern in healthy subjects prior to prescribing bilateral activation training of transverse abdominis for subjects with chronic low back pain.

  17. Assessment of the effects of lacosamide on sleep parameters in healthy subjects.

    PubMed

    Hudson, J Douglas; Guptill, Jeffrey T; Byrnes, William; Yates, Stephen L; Williams, Paulette; D'Cruz, O'Neill

    2015-02-01

    Seizures and antiepileptic drugs (AED) may disrupt sleep patterns in patients with epilepsy, thus evaluation of lacosamide effects on objective and subjective sleep measures is warranted. A multicenter, interventional, open-label study (NCT01530386) was conducted in healthy subjects without confounding effects of concomitant AED use, co-morbidities, or disease state to determine whether lacosamide impacts sleep parameters after 22 days of lacosamide exposure. After overnight polysomnography (PSG) to assess baseline parameters, lacosamide was initiated at 100mg/day (50mg twice daily) and increased by 100mg/day weekly to 300 mg/day (the mid-range maintenance dose for adjunctive therapy). The primary variable was change from baseline to post-treatment in wake after sleep onset (WASO). Secondary variables included additional objective sleep measures, subject-reported measures of sleep quality, daytime sleepiness, and tolerability. Change from baseline in WASO was analyzed using the Wilcoxon rank-sum test. A total of 27 subjects received ≥1 dose of lacosamide and 25 subjects completed the study. For WASO, median change from baseline was a 6-min reduction (95% confidence interval: -38, 77.5; p=0.1074) after lacosamide treatment; this was considered not clinically relevant. No clinically relevant changes were observed in any secondary variables. Thirteen subjects (48%) reported a treatment-emergent adverse event, none of which was severe or led to study discontinuation. Lacosamide 300 mg/day had no effect on objective or subjective sleep parameters in healthy subjects and was generally well tolerated. Copyright © 2014 British Epilepsy Association. Published by Elsevier Ltd. All rights reserved.

  18. Dissociation between history and challenge in patients with physical urticaria.

    PubMed

    Komarow, Hirsh D; Arceo, Sarah; Young, Michael; Nelson, Celeste; Metcalfe, Dean D

    2014-01-01

    Physical urticaria is a subtype of chronic urticaria induced by a physical stimulus. To evaluate the consistency between a history of physical urticaria and results of challenge testing. Seventy-six subjects, ages 3 to 77 years old, were referred with the diagnosis of a physical urticaria and were evaluated by using challenge testing directed toward the presenting diagnosis, yet included other stimuli based on history. The majority of subjects were tested to 3 or more stimuli, thus 294 provocation tests were performed. Fifty-seven subjects were surveyed for the status of their physical urticaria at least 1 year after initial evaluation. Of the 76 subjects with a positive history of a physical urticaria, 38% (n = 29) were challenge negative to the presenting diagnosis. Eight subjects within the challenge negative group reacted positively to additional testing, thus 28% (n = 21) remained negative to all challenge testing, which allowed discontinuation of medications and avoidance behavior. A negative challenge result was less likely with subjects who presented with cold-induced urticaria (25%), delayed pressure urticaria (25%), and dermatographism (29%), yet more common with cholinergic (65%) and solar urticaria (67%). A 1-year follow-up survey of 57 subjects was consistent with initial results. Nineteen of this subgroup were rechallenged for the presenting diagnosis, and the outcome was unchanged in 17 subjects and, in 2 subjects the urticaria had resolved. The diagnosis by history of a physical urticaria should be verified by testing whenever possible and particularly if the condition is judged as severe and thus requires both significant life-style changes and pharmacologic intervention. Published by Elsevier Inc.

  19. Space Suit Portable Life Support System (PLSS) 2.0 Human-in-the-Loop (HITL) Testing

    NASA Technical Reports Server (NTRS)

    Watts, Carly; Vogel, Matthew

    2016-01-01

    The space suit Portable Life Support System (PLSS) 2.0 represents the second integrated prototype developed and tested to mature a design that uses advanced technologies to reduce consumables, improve robustness, and provide additional capabilities over the current state of the art. PLSS 2.0 was developed in 2012, with extensive functional evaluations and system performance testing through mid-2014. In late 2014, PLSS 2.0 was integrated with the Mark III space suit in an ambient laboratory environment to facilitate manned testing, designated PLSS 2.0 Human-in-the-Loop (HITL) testing, in which the PLSS prototype performed the primary life support functions, including suit pressure regulation, ventilation, carbon dioxide control, and cooling of the test subject and PLSS avionics. The intent of this testing was to obtain subjective test subject feedback regarding qualitative aspects of PLSS 2.0 performance such as thermal comfort, sounds, smells, and suit pressure fluctuations due to the cycling carbon dioxide removal system, as well as to collect PLSS performance data over a range of human metabolic rates from 500-3000 Btu/hr. Between October 27 and December 18, 2014, nineteen two-hour simulated EVA test points were conducted in which suited test subjects walked on a treadmill to achieve a target metabolic rate. Six test subjects simulated nominal and emergency EVA conditions with varied test parameters including metabolic rate profile, carbon dioxide removal control mode, cooling water temperature, and Liquid Cooling and Ventilation Garment (state of the art or prototype). The nineteen test points achieved more than 60 hours of test time, with 36 hours accounting for simulated EVA time. The PLSS 2.0 test article performed nominally throughout the test series, confirming design intentions for the advanced PLSS. Test subjects' subjective feedback provided valuable insight into thermal comfort and perceptions of suit pressure fluctuations that will influence future advanced PLSS design and testing strategies.

  20. Blocking carbohydrate absorption and weight loss: a clinical trial using a proprietary fractionated white bean extract.

    PubMed

    Udani, Jay; Singh, Betsy B

    2007-01-01

    A proprietary fractionated white bean extract of Phaseolus vulgaris has been shown in vitro to inhibit the digestive enzyme alpha-amylase. This may prevent or delay the digestion of complex carbohydrates, potentially resulting in weight loss. A 4-week randomized, double-blind, placebo-controlled study of 25 healthy subjects consuming 1000 mg of a proprietary fractioned white bean extract or an identical placebo twice a day before meals in conjunction with a multi-component weight-loss program, including diet, exercise, and behavioral intervention, was conducted. Both groups reduced their weight and waist size significantly from baseline. The active group lost 6.0 lbs (P=.0002) and 2.2 in (P=.0050), and the placebo group lost 4.7 lbs (P=.0016) and 2.1 in (P=.0001). The differences between groups were not significant (weight P=.4235, waist size P=.8654). Through subsequent exploratory analysis to investigate group findings further, subjects were stratified by total dietary carbohydrate intake. This probative analysis revealed that the tertile of subjects who had consumed the most carbohydrates demonstrated significant reductions in both weight (8.7 lbs vs 1.7 lbs, P=.0412) and waist size (3.3 in vs 1.3 in P=.0100) compared with placebo subjects in the same tertile of carbohydrate intake. Subjects who adhere to a program including dietary modification, exercise, and behavioral intervention can significantly reduce their weight and waist size in a short period of time. In an exploratory analysis of data, the tertile of subjects who ate the most carbohydrates experienced a significant reduction in both weight and waist size with the addition of the white bean extract compared to the placebo group of the same tertile of carbohydrate consumption. Longer studies with a larger pool of subjects are required to validate these findings.

  1. Weight change with liraglutide and comparator therapies: an analysis of seven phase 3 trials from the liraglutide diabetes development programme.

    PubMed

    Niswender, K; Pi-Sunyer, X; Buse, J; Jensen, K H; Toft, A D; Russell-Jones, D; Zinman, B

    2013-01-01

    We investigated the relationship between weight change and related factors in subjects with type 2 diabetes mellitus (T2DM) treated with liraglutide versus comparator diabetes therapies. Twenty-six-week data from seven phase 3, randomized trials in the liraglutide T2DM development programme were analysed by trial and treatment group: liraglutide (1.2 and 1.8 mg), active comparator and placebo. Outcome measures included proportions of subjects in various weight change categories and their percentage weight change from baseline; impact of body mass index (BMI) and gastrointestinal (GI) adverse events (AEs) on weight change and correlation of weight change with change in glycosylated haemoglobin (HbA1c). A number of subjects experienced >5% weight loss during the trials (24.4% liraglutide 1.8 mg and 17.7% liraglutide 1.2 mg; 17.7% exenatide, 10.0% sitagliptin, 3.6-7.0% sulphonylurea, 2.6% thiazolidinedione and 2.6% glargine; 9.9% placebo). More weight loss was seen with liraglutide 1.2 and 1.8 mg than with active comparators except exenatide. Across trials, higher initial BMI was associated with slightly greater weight loss with liraglutide. Mean weight loss increased slightly the longer GI AEs persisted. Although HbA1c reduction was slightly larger in higher weight loss categories across treatments (including placebo), sample sizes were small and no clear correlation could be determined. Liraglutide-treated subjects experienced additional HbA1c reduction beyond that which appeared weight induced; thus, not all HbA1c-lowering effect appears weight mediated. The majority of liraglutide-treated T2DM subjects experienced weight loss in this analysis. Weight loss was greater and occurred more in glucagon-like peptide-1 receptor agonist-treated subjects than in active comparator-treated subjects. © 2012 Blackwell Publishing Ltd.

  2. Plasma amino acid profiles are associated with insulin, C-peptide and adiponectin levels in type 2 diabetic patients

    PubMed Central

    Nakamura, H; Jinzu, H; Nagao, K; Noguchi, Y; Shimba, N; Miyano, H; Watanabe, T; Iseki, K

    2014-01-01

    Objectives: Plasma-free amino acid (PFAA) profiles have been associated with a future risk of developing diabetes or cardiovascular disease in nondiabetic subjects. These PFAA alterations might predominantly result from the metabolic shift caused by insulin resistance and visceral fat deposition. The variety of PFAA profiles within diabetic subjects is not well researched. In this study, we focused on type 2 diabetic subjects and examined the association between PFAA profiles and insulin- and glucose-related variables. Methods: Fifty-one Japanese subjects diagnosed with type 2 diabetes were recruited from an outpatient clinic. The plasma concentrations of 21 amino acids; glucose-related markers including glucose, hemoglobin A1c (HbA1c), glycoalbumin and 1,5-anhydroglucitol; insulin-related markers including insulin, C-peptide, and the homeostasis model assessment of insulin resistance; and adipocytokines including adiponectin and leptin were determined. The association of PFAA and other metabolic profiles were analyzed, and stratified analyses of the PFAAs and clinical characteristics were performed according to the fasting plasma insulin and HbA1c levels. In addition, the PFAA indices that correlate to visceral fat obesity were evaluated. Results: Although strong correlations between PFAAs and glucose-related markers were not observed, several amino acids (branched-chain amino acids, tryptophan, alanine, tyrosine, glutamate and proline) and PFAA indices that evaluate visceral obesity were highly correlated with insulin-related markers and adiponectin (P<0.001). In the group of diabetic patients with hyperinsulinemia, the amino acid levels were significantly increased, which generally demonstrated good concordance with insulin-related markers and adiponectin levels. Conclusions: The PFAA profiles in diabetic patients were strongly associated with hyperinsulinemia and hypoadiponectinemia, which might become risk evaluation factors for the development of cardiovascular diseases. PMID:25177913

  3. Psychosocial correlates, outcome, and stability of abnormal adolescent eating behavior in community samples of young people.

    PubMed

    Steinhausen, Hans-Christoph; Gavez, Silvia; Winkler Metzke, Christa

    2005-03-01

    The current study investigated psychosocial correlates of abnormal adolescent eating behavior at three times during adolescence and young adulthood and its association with psychiatric diagnosis in young adulthood in a community sample. Sixty-four (10.5%) high-risk subjects (mean age 15 years) with abnormal eating behavior were identified at Time 1, another 252 (16.9%) were identified at Time 2 (mean age 16.2 years), and 164 (16.9%) were identified at Time 3 (mean age 19.7 years) and compared with three control groups matched for age and gender. Dependent measures included emotional and behavioral problems, life events, coping capacities, self-related cognition, social network, and family functions. Outcome was measured additionally by structured psychiatric interviews, and stability of abnormal eating behavior was studied in a longitudinal sample of 330 subjects. Few subjects showed more than one of five criteria of abnormal eating behavior. High-risk subjects shared a very similar pattern at all three times. They were characterized by higher scores for emotional and behavioral problems, more life events including more negative impact, less active coping, lower self-esteem, and less family cohesion. Among 10 major psychiatric disorders, only clinical eating disorders at Time 3 shared a significant association with abnormal eating disorder at the same time whereas high-risk status at Times 1 and 2 did not predict any psychiatric disorder at Time 3. Stability of abnormal eating behavior across time was very low. Stability of abnormal eating behavior across time was very low. Abnormal eating behavior in adolescence and young adulthood is clearly associated with various indicators of psychosocial maladaption. In adolescence, it does not significantly predict any psychiatric disorder including eating disorder in young adulthood and it is predominantly a transient feature. (c) 2005 by Wiley Periodicals, Inc.

  4. Populations and outcome measures used in ongoing research in sarcopenia.

    PubMed

    Peña Ordóñez, Gloria Gabriela; Bustamante Montes, Lilia Patricia; Ramírez Duran, Ninfa; Sánchez Castellano, Carmen; Cruz-Jentoft, Alfonso J

    2017-08-01

    Sarcopenia research may be hampered by the heterogeneity of populations and outcome measures used in clinical studies. The aim of this study was to describe the inclusion/exclusion criteria and outcome measures used in ongoing research in sarcopenia. All active intervention studies registered in the World Health Organization with the keyword sarcopenia were included. Study design, type of intervention, inclusion/exclusion criteria and outcome measures were registered and classified. In April 2014, 151 studies on sarcopenia were registered in the WHO database. One hundred twenty-three were intervention studies. Most trials (94.3 %) were single centre and randomized (93.5 %), 51.2 % were double blind. Nutritional interventions (36.6 %), physical exercise (12.2 %) or both (19.5 %) were the most common interventions tested. Only 54.4 % included subjects of both genders, and 46.3 % had an upper age limit. Definition of the target populations was heterogeneous, with 57.7 % including healthy subjects and none using recent definitions of sarcopenia. Lifestyle and the degree of physical activity of subjects were not described or considered in most cases (79.7 %). Subjects with cardiovascular, neuropsychiatric or metabolic disorders and those with physical disability were usually excluded. Muscle mass and muscle strength were the primary outcome variables in 28.5 and 29.5 % of studies and physical performance in 19.5 %, but only 4.1 % used the three variables used the three of them. An additional 26.8 % used biological outcome variables. Little information and agreement existed in the way muscle and physical performance parameters were measured. We found a large heterogeneity in trial design, definition of populations and outcome measures in present research.

  5. Does dietary fluid intake affect skin hydration in healthy humans? A systematic literature review.

    PubMed

    Akdeniz, M; Tomova-Simitchieva, T; Dobos, G; Blume-Peytavi, U; Kottner, J

    2018-02-02

    Associations between daily amounts of drinking water and skin hydration and skin physiology receive increasingly attention in the daily life and in clinical practice. However, there is a lack of evidence of dermatological benefits from drinking increased amounts of water. Pubmed and Web of Science were searched without any restrictions of publication dates. References of included papers and related reviews were checked. Eligibility criteria were primary intervention and observational studies investigating the effects of fluid intake on skin properties in English, German, Spanish or Portuguese language, including subjects being healthy and 18+ years. Searches resulted in 216 records, 23 articles were read in full text, and six were included. The mean age of the samples ranged from 24 to 56 years. Overall the evidence is weak in terms of quantity and methodological quality. Disregarding the methodological limitations a slight increase in stratum corneum and "deep" skin hydration was observed after additional water intake, particularly in individuals with lower prior water consumption. Reductions of clinical signs of dryness and roughness were observed. The extensibility and elasticity of the skin increased slightly. Unclear associations were shown between water intake and transepidermal water loss, sebum content, and skin surface pH. Additional dietary water intake may increase stratum corneum hydration. The underlying biological mechanism for this possible relationship is unknown. Whether this association also exists in aged subjects is unclear. Research is needed to answer the question whether increased fluid intake decreases signs of dry skin. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  6. A cone-beam computed tomography study of maxillary first permanent molar root and canal morphology in a Chinese population.

    PubMed

    Zheng, Qing-hua; Wang, Yao; Zhou, Xue-dong; Wang, Qian; Zheng, Guang-ning; Huang, Ding-ming

    2010-09-01

    This study evaluated root and canal morphology of permanent maxillary first molars in a Chinese population using cone-beam computed tomography scanning. The sample included 775 cone-beam computed tomography images of maxillary first molars; 627 of the subjects had unilateral qualifying molars and 74 had bilateral qualifying molars. The following observations were made: (1) frequency of root and canal numbers, (2) frequency of additional canals in the mesiobuccal root by sex, age, and tooth position, and (3) unilateral and bilateral occurrence of additional canals in the mesiobuccal root. Fused roots were present in 2.71% of unilateral qualifying molars. Multiple canals were present in the following frequencies: two canals in 0.31%, three canals in 47.21%, four canals in 50.40%, five canals in 1.75%, and six canals in 0.31% of teeth. Additional canals were detected in 52.24% of mesiobuccal roots, 1.12% of distobuccal roots, and 1.76% of palatal roots. Patients aged 20 to 30 years showed a higher prevalence of additional mesiobuccal root canals. This prevalence did not differ with sex and tooth position. Most (71.11%) of the additional mesiobuccal root canals in subjects with bilateral qualifying molars were symmetric. Cone-beam computed tomography scanning is an effective method for studying external and internal dental morphology. The root and canal configurations of maxillary first molars in this Chinese population were consistent with previously reported data. More attention should be given to the detection of additional canals in patients between 20 and 30 years of age. These data may facilitate successful endodontic treatment. Copyright 2010 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  7. 40 CFR 26.301 - To what does this subpart apply?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... SUBJECTS Observational Research: Additional Protections for Pregnant Women and Fetuses Involved as Subjects... involving human subjects who are pregnant women (and therefore their fetuses) conducted or supported by the...

  8. 40 CFR 26.301 - To what does this subpart apply?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... SUBJECTS Observational Research: Additional Protections for Pregnant Women and Fetuses Involved as Subjects... involving human subjects who are pregnant women (and therefore their fetuses) conducted or supported by the...

  9. 40 CFR 26.301 - To what does this subpart apply?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... SUBJECTS Observational Research: Additional Protections for Pregnant Women and Fetuses Involved as Subjects... involving human subjects who are pregnant women (and therefore their fetuses) conducted or supported by the...

  10. 40 CFR 26.301 - To what does this subpart apply?

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... SUBJECTS Observational Research: Additional Protections for Pregnant Women and Fetuses Involved as Subjects... involving human subjects who are pregnant women (and therefore their fetuses) conducted or supported by the...

  11. 40 CFR 26.301 - To what does this subpart apply?

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... SUBJECTS Observational Research: Additional Protections for Pregnant Women and Fetuses Involved as Subjects... involving human subjects who are pregnant women (and therefore their fetuses) conducted or supported by the...

  12. Measures of outdoor play and independent mobility in children and youth: A methodological review.

    PubMed

    Bates, Bree; Stone, Michelle R

    2015-09-01

    Declines in children's outdoor play have been documented globally, which are partly due to heightened restrictions around children's independent mobility. Literature on outdoor play and children's independent mobility is increasing, yet no paper has summarized the various methodological approaches used. A methodological review could highlight most commonly used measures and comprehensive research designs that could result in more standardized methodological approaches. Methodological review. A standardized protocol guided a methodological review of published research on measures of outdoor play and children's independent mobility in children and youth (0-18 years). Online searches of 8 electronic databases were conducted and studies included if they contained a subjective/objective measure of outdoor play or children's independent mobility. References of included articles were scanned to identify additional articles. Twenty-four studies were included on outdoor play, and twenty-three on children's independent mobility. Study designs were diverse. Common objective measures included accelerometry, global positioning systems and direct observation; questionnaires, surveys and interviews were common subjective measures. Focus groups, activity logs, monitoring sheets, travel/activity diaries, behavioral maps and guided tours were also utilized. Questionnaires were used most frequently, yet few studies used the same questionnaire. Five studies employed comprehensive, mixed-methods designs. Outdoor play and children's independent mobility have been measured using a wide variety of techniques, with only a few studies using similar methodologies. A standardized methodological approach does not exist. Future researchers should consider including both objective measures (accelerometry and global positioning systems) and subjective measures (questionnaires, activity logs, interviews), as more comprehensive designs will enhance understanding of each multidimensional construct. Creating a standardized methodological approach would improve study comparisons. Copyright © 2014 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.

  13. The diffusion tensor imaging (DTI) component of the NIH MRI study of normal brain development (PedsDTI).

    PubMed

    Walker, Lindsay; Chang, Lin-Ching; Nayak, Amritha; Irfanoglu, M Okan; Botteron, Kelly N; McCracken, James; McKinstry, Robert C; Rivkin, Michael J; Wang, Dah-Jyuu; Rumsey, Judith; Pierpaoli, Carlo

    2016-01-01

    The NIH MRI Study of normal brain development sought to characterize typical brain development in a population of infants, toddlers, children and adolescents/young adults, covering the socio-economic and ethnic diversity of the population of the United States. The study began in 1999 with data collection commencing in 2001 and concluding in 2007. The study was designed with the final goal of providing a controlled-access database; open to qualified researchers and clinicians, which could serve as a powerful tool for elucidating typical brain development and identifying deviations associated with brain-based disorders and diseases, and as a resource for developing computational methods and image processing tools. This paper focuses on the DTI component of the NIH MRI study of normal brain development. In this work, we describe the DTI data acquisition protocols, data processing steps, quality assessment procedures, and data included in the database, along with database access requirements. For more details, visit http://www.pediatricmri.nih.gov. This longitudinal DTI dataset includes raw and processed diffusion data from 498 low resolution (3 mm) DTI datasets from 274 unique subjects, and 193 high resolution (2.5 mm) DTI datasets from 152 unique subjects. Subjects range in age from 10 days (from date of birth) through 22 years. Additionally, a set of age-specific DTI templates are included. This forms one component of the larger NIH MRI study of normal brain development which also includes T1-, T2-, proton density-weighted, and proton magnetic resonance spectroscopy (MRS) imaging data, and demographic, clinical and behavioral data. Published by Elsevier Inc.

  14. Biofeedback treatment of constipation: a critical review.

    PubMed

    Heymen, Steve; Jones, Kenneth R; Scarlett, Yolanda; Whitehead, William E

    2003-09-01

    This review was designed to 1) critically examine the research design used in investigations of biofeedback for pelvic floor dyssynergia, 2) compare the various biofeedback treatment protocols for pelvic floor dyssynergia-type constipation used in this research, 3) identify factors that influence treatment outcome, and 4) identify goals for future biofeedback research for pelvic floor dyssynergia. A comprehensive review of both the pediatric and adult research from 1970 to 2002 on "biofeedback for constipation" was conducted using a Medline search in all languages. Only prospective studies including five or more subjects that described the treatment protocol were included. In addition, a meta-analysis of these studies was performed to compare the outcome of different biofeedback protocols for treating constipation. Thirty-eight studies were reviewed, and sample size, treatment protocol, outcome rates, number of sessions, and etiology are shown in a table. Ten studies using a parallel treatment design were reviewed in detail, including seven that randomized subjects to treatment groups. A meta-analysis (weighted by subjects) was performed to compare the results of two treatment protocols prevalent in the literature. The mean success rate of studies using pressure biofeedback (78 percent) was superior (P = 0.018) to the mean success rate for studies using electromyography biofeedback (70 percent). However, the mean success rates comparing studies using intra-anal electromyography sensors to studies using perianal electromyography sensors were 69 and 72 percent, respectively, indicating no advantages for one type of electromyography protocol over the other (P = 0.428). In addition to the varied protocols and instrumentation used, there also are inconsistencies in the literature regarding the severity and etiology of symptoms, patient selection criteria, and the definition of a successful outcome. Finally, no anatomic, physiologic, or demographic variables were identified that would assist in predicting successful outcome. Having significant psychological symptoms was identified as a factor that may influence treatment outcome, but this requires further study. Although most studies report positive results using biofeedback to treat constipation, quality research is lacking. Specific recommendations are made for future investigations to 1) improve experimental design, 2) clearly define outcome measures, 3) identify the etiology and severity of symptoms, 4) determine which treatment protocol and which component of treatment is most effective for different types of subjects, 5) systematically explore the role of psychopathology in this population, 6) use an adequate sample size that allows for meaningful analysis, and 7) include long-term follow-up data.

  15. Increasing passive energy expenditure during clerical work.

    PubMed

    Beers, Erik A; Roemmich, James N; Epstein, Leonard H; Horvath, Peter J

    2008-06-01

    Sitting on a therapy ball or standing may be a passive means of increasing energy expenditure throughout the workday. The purpose of this study was to determine the energy expenditure and liking of performing clerical work in various postures. Subjects included 24 men and women employed in sedentary clerical occupations. Energy expenditure was measured while word processing in three standardized postures; sitting in an office chair, sitting on a therapy ball, and standing. Adults ranked their comfort, fatigue, and liking of each posture and were asked to perform their choice of 20 min of additional clerical work in one of the postures. Energy expenditure was 4.1 kcal/h greater (p or= 0.48). Subjects also liked sitting on a therapy ball as much as sitting in an office chair and liked sitting on a therapy ball more than standing (p

  16. Auditory display as feedback for a novel eye-tracking system for sterile operating room interaction.

    PubMed

    Black, David; Unger, Michael; Fischer, Nele; Kikinis, Ron; Hahn, Horst; Neumuth, Thomas; Glaser, Bernhard

    2018-01-01

    The growing number of technical systems in the operating room has increased attention on developing touchless interaction methods for sterile conditions. However, touchless interaction paradigms lack the tactile feedback found in common input devices such as mice and keyboards. We propose a novel touchless eye-tracking interaction system with auditory display as a feedback method for completing typical operating room tasks. Auditory display provides feedback concerning the selected input into the eye-tracking system as well as a confirmation of the system response. An eye-tracking system with a novel auditory display using both earcons and parameter-mapping sonification was developed to allow touchless interaction for six typical scrub nurse tasks. An evaluation with novice participants compared auditory display with visual display with respect to reaction time and a series of subjective measures. When using auditory display to substitute for the lost tactile feedback during eye-tracking interaction, participants exhibit reduced reaction time compared to using visual-only display. In addition, the auditory feedback led to lower subjective workload and higher usefulness and system acceptance ratings. Due to the absence of tactile feedback for eye-tracking and other touchless interaction methods, auditory display is shown to be a useful and necessary addition to new interaction concepts for the sterile operating room, reducing reaction times while improving subjective measures, including usefulness, user satisfaction, and cognitive workload.

  17. An Open Label Clinical Trial of a Peptide Treatment Serum and Supporting Regimen Designed to Improve the Appearance of Aging Facial Skin.

    PubMed

    Draelos, Zoe Diana; Kononov, Tatiana; Fox, Theresa

    2016-09-01

    A 14-week single-center clinical usage study was conducted to test the efficacy of a peptide treatment serum and supporting skincare regimen in 29 women with mild to moderately photodamaged facial skin. The peptide treatment serum contained gamma-aminobutyric acid (GABA) and various peptides with neurotransmitter inhibiting and cell signaling properties. It was hypothesized that the peptide treatment serum would ameliorate eye and facial expression lines including crow's feet and forehead lines. The efficacy of the supporting skincare regimen was also evaluated. An expert investigator examined the subjects at rest and at maximum smile. Additionally, the subjects completed self-assessment questionnaires. At week 14, the expert investigator found a statistically significant improvement in facial lines, facial wrinkles, eye lines, and eye wrinkles at rest when compared to baseline results. The expert investigator also found statistically significant improvement at week 14 in facial lines, eye lines, and eye wrinkles when compared to baseline results at maximum smile. In addition, there was continued highly statistically significant improvement in smoothness, softness, firmness, radiance, luminosity, and overall appearance at rest when compared to baseline results at the 14-week time point. The test regimen was well perceived by the subjects for efficacy and product attributes. The products were well tolerated with no adverse events.

    J Drugs Dermatol. 2016;15(9):1100-1106.

  18. Physiological Evaluation of Personal Protective Ensembles Recommended for Use in West Africa.

    PubMed

    Coca, Aitor; Quinn, Tyler; Kim, Jung-Hyun; Wu, Tianzhou; Powell, Jeff; Roberge, Raymond; Shaffer, Ronald

    2017-10-01

    Personal protective equipment (PPE) provides health care workers with a barrier to prevent human contact with viruses like Ebola and potential transmission of the disease. However, PPE can also introduce an additional physiological burden from potentially increased heat stress. This study evaluated the human physiological and subjective responses to continuous light exercise within environmental conditions similar to those in West Africa while wearing 3 different, commonly used PPE ensembles (E1, E2, and E3). Six healthy individuals were tested in an environmental chamber (32°C, 92% relative humidity) while walking (3 METs, 2.5 mph, 0% incline) on a treadmill for 60 minutes. All subjects wore medical scrubs and PPE items. E1 also had a face shield and fluid-resistant surgical gown; E2 additionally included goggles, coverall, and separate hood; and E3 also contained a highly impermeable coverall, separate hood, and surgical mask cover over the N95 respirator. Heart rate and core temperature at the end of the exercise were significantly higher for E2 and E3 than for E1. Subjective perceptions of heat and exertion were significantly higher for E2 and E3 than for E1. Heat stress and PPE training, as well as the implementation of a work-to-rest ratio that avoids dehydration and possible heat stress issues, are recommended. (Disaster Med Public Health Preparedness. 2017;11:580-586).

  19. Vehicle automation: a remedy for driver stress?

    PubMed

    Funke, G; Matthews, G; Warm, J S; Emo, A K

    2007-08-01

    The present study addressed the effects of stress, vehicle automation and subjective state on driver performance and mood in a simulated driving task. A total of 168 college students participated. Participants in the stress-induction condition completed a 'winter' drive, which included periodic loss of control episodes. Participants in the no-stress-induction condition were not exposed to loss of control. An additional, independent manipulation of vehicle speed was also conducted, consisting of two control conditions requiring manual speed regulation and a third in which vehicle speed was automatically regulated by the simulation. Stress and automation both influenced subjective distress, but the two factors did not interact. Driver performance data indicated that vehicle automation impacted performance similarly in the stress and no-stress conditions. Individual differences in subjective stress response and performance were also investigated. Resource theory provides a framework that partially but not completely explains the relationship between vehicle automation and driver stress. Implications for driver workload, safety and training are discussed.

  20. Data collection and preparation of authoritative reviews on space food and nutrition research

    NASA Technical Reports Server (NTRS)

    1972-01-01

    The collection and classification of information for a manually operated information retrieval system on the subject of space food and nutrition research are described. The system as it currently exists is designed for retrieval of documents, either in hard copy or on microfiche, from the technical files of the MSC Food and Nutrition Section by accession number, author, and/or subject. The system could readily be extended to include retrieval by affiliation, report and contract number, and sponsoring agency should the need arise. It can also be easily converted to computerized retrieval. At present the information retrieval system contains nearly 3000 documents which consist of technical papers, contractors' reports, and reprints obtained from the food and nutrition files at MSC, Technical Library, the library at the Texas Medical Center in Houston, the BMI Technical Libraries, Dr. E. B. Truitt at MBI, and the OSU Medical Libraries. Additional work was done to compile 18 selected bibliographies on subjects of immediate interest on the MSC Food and Nutrition Section.

  1. Experimental evaluation of sensorimotor patterning used with mentally retarded children.

    PubMed

    Neman, R; Roos, P; McCann, R M; Menolascino, F J; Heal, L W

    1975-01-01

    In the present study, a sensorimotor "patterning" program used with 66 institutionalized, mentally retarded children and adolescents was evaluated. The subjects were randomly assigned to one of three groups: (a) Experimental 1 group, which received a program of mobility exercises including patterning, creeping, and crawling; visual-motor training; and sensory stimulation exercises; (b) Experimental 2 group, which received a program of physical activity, personal attention, and the same sensory stimulation program given to the first group; or (c) Passive Control group, which provided baseline measures but which received no additional programming as part of the study. Experimental 1 group subjects improved more than subjects in the other groups in visual perception, program-related measures of mobility, and language ability. Intellectual functioning did not appear to be enhanced by the procedures, at least during the active phase of the project. The results were discussed with reference to other researchers who have failed to support the patterning approach, and some reasons were suggested for the differences between the present and past investigations.

  2. The relationship between personality and the response to acute psychological stress.

    PubMed

    Xin, Yuanyuan; Wu, Jianhui; Yao, Zhuxi; Guan, Qing; Aleman, André; Luo, Yuejia

    2017-12-04

    The present study examined the relationship between personality traits and the response to acute psychological stress induced by a standardized laboratory stress induction procedure (the Trier Social Stress Test, TSST). The stress response was measured with a combination of cardiovascular reactivity, hypothalamic-pituitary-adrenal axis reactivity, and subjective affect (including positive affect, negative affect and subjective controllability) in healthy individuals. The Generalized Estimating Equations (GEE) approach was applied to account for the relationship between personality traits and stress responses. Results suggested that higher neuroticism predicted lower heart rate stress reactivity, lower cortisol stress response, more decline of positive affect and lower subjective controllability. Individuals higher in extraversion showed smaller cortisol activation to stress and less increase of negative affect. In addition, higher openness score was associated with lower cortisol stress response. These findings elucidate that neuroticism, extraversion and openness are important variables associated with the stress response and different dimensions of personality trait are associated with different aspects of the stress response.

  3. A methodology using in-chair movements as an objective measure of discomfort for the purpose of statistically distinguishing between similar seat surfaces.

    PubMed

    Cascioli, Vincenzo; Liu, Zhuofu; Heusch, Andrew; McCarthy, Peter W

    2016-05-01

    This study presents a method for objectively measuring in-chair movement (ICM) that shows correlation with subjective ratings of comfort and discomfort. Employing a cross-over controlled, single blind design, healthy young subjects (n = 21) sat for 18 min on each of the following surfaces: contoured foam, straight foam and wood. Force sensitive resistors attached to the sitting interface measured the relative movements of the subjects during sitting. The purpose of this study was to determine whether ICM could statistically distinguish between each seat material, including two with subtle design differences. In addition, this study investigated methodological considerations, in particular appropriate threshold selection and sitting duration, when analysing objective movement data. ICM appears to be able to statistically distinguish between similar foam surfaces, as long as appropriate ICM thresholds and sufficient sitting durations are present. A relationship between greater ICM and increased discomfort, and lesser ICM and increased comfort was also found. Copyright © 2016. Published by Elsevier Ltd.

  4. Establishing pan-European clinical trials: regulatory compliance and other practical considerations.

    PubMed

    Grienenberger, Aurelie

    2004-01-01

    There are currently many concerns in the pharmaceutical and scientific community working in or around clinical research on the EU Directive 2001/20/EC or Clinical Trials Directive. The Directive introduces regulatory requirements for all phases of study in human subjects, drawing no distinction between commercially funded drug trials and non-commercial/academic research. The Directive makes Good Clinical Practice (GCP) a legal requirement in Europe and all clinical research will be subjected to the same rigorous standards including GCP and Good Manufacturing Practice (GMP) application even at the early clinical phases as well as exhaustive pharmacovigilance and protection of trial subjects. Some of these requirements may be seen as additional burden and a brake to clinical research in Europe. However, the application of the directive should provide a single and highly regulated market of 25 European countries for investigational medicinal products. This article reviews the main aspects and areas of concern of the Directive and provide US sponsor with useful references.

  5. Bed rest and immunity

    NASA Astrophysics Data System (ADS)

    Sonnenfeld, Gerald; Aviles, Hernan; Butel, Janet S.; Shearer, William T.; Niesel, David; Pandya, Utpal; Allen, Christopher; Ochs, Hans D.; Blancher, Antoine; Abbal, Michel

    2007-02-01

    Space flight has been shown to result in altered immune responses. The current study was designed to investigate this possibility by using the bed rest model of some space flight conditions. A large number of women are included as subjects in the study. The hypothesis being tested is: 60 days head-down tilt bed rest of humans will affect the immune system and resistance to infection. Blood, urine and saliva samples will be obtained from bed rest subjects prior to, at intervals during, and after completion of 60 days of head-down tilt bed rest. Leukocyte blastogenesis, cytokine production and virus reactivation will be assessed. The ability of the subjects to respond appropriately to immunization with the neoantigen bacteriophage φX-174 will also be determined. Bed rest is being carried out at MEDES, Toulouse France, and the University of Texas Medical Branch, Galveston, TX. The studies to be carried out in France will also allow assessment of the effects of muscle/bone exercise and nutritional countermeasures on the immune system in addition to the effects of bed rest.

  6. Acute comparison of clovoxamine and mianserin, alone and in combination with ethanol, on human psychomotor performance.

    PubMed

    Strömberg, C; Mattila, M J

    1987-05-01

    Objective and subjective effects on human performance of clovoxamine and mianserin were measured in 12 student volunteers who participated in 12 test sessions and received single doses of clovoxamine 50 mg, 100 mg and 150 mg, mianserin 20 mg, and placebo in a double-blind and cross-over manner. Each test drug was given twice, both in combination with alcohol 0.8 g/kg and with a non-alcoholic drink. The tests included tracking, body balance, flicker fusion, horizontal nystagmus, digit symbol substitution, recall memory, and subjective assessments on visual analogue scales. Mianserin and alcohol impaired objective performance in most tests, and their combination showed at least an additive effect. Alcohol counteracted rather than increased mianserin-induced subjective sedation. Clovoxamine neither differed significantly from placebo nor increased alcohol effects. On the contrary, clovoxamine 150 mg reduced significantly alcohol-induced body sway. No evidence of pharmacokinetic interactions were found between the study drugs and alcohol.

  7. The case for Mars III: Strategies for exploration - General interest and overview

    NASA Technical Reports Server (NTRS)

    Stoker, Carol R. (Editor)

    1989-01-01

    Papers on the possibilities for manned Mars missions are presented, covering topics such as space policy, space education and Mars exploration, economic issues, international cooperation, life support, biomedical factors, human factors, the Mars Rover Sample Return Mission, and possible unmanned precursor missions to Mars. Other topics include the scientific objectives for human exploration of Mars, mission strategies, possible transportation systems for manned Mars flight, advanced propulsion techniques, and the utilization of Mars resources. Additional subjects include the construction and maintenance of a Martian base, possible systems for mobility on the Martian surface, space power systems, and the use of the Space Station for a Mars mission.

  8. Photosynthesis and the web: 2001.

    PubMed

    Orr, L

    2001-01-01

    First, a brief history of the Internet and the World Wide Web is presented. This is followed by relevant information on photosynthesis-related web sites grouped into several categories: (1) large group sites, (2) comprehensive overview sites, (3) specific subject sites, (4) individual researcher sites, (5) kindergarten through high school (K-12) educational sites, (6) books and journals, and, 7) other useful sites. A section on searching the Web is also included. Finally, we have included an appendix with all of the web sites discussed herein as well as other web sites that space did not allow. Readers are requested to send comments, corrections and additions to gov@uiuc.edu.

  9. [The influence of perceived discrimination on health in migrants].

    PubMed

    Igel, Ulrike; Brähler, Elmar; Grande, Gesine

    2010-05-01

    The aim of the study was to investigate the influence of racial discrimination on subjective health in migrants. The sample included 1.844 migrants from the SOEP. Discrimination was assessed by two items. Socioeconomic status, country of origin, and health behavior were included in multivariate regression models to control for effects on health. Differential models with regard to gender and origin were analysed. Migrants who experienced discrimination report a worse health status. Discrimination determines mental and physical health of migrants. There are differences in models due to gender and origin. In addition to socioeconomic factors experienced discrimination should be taken into account as a psycho-social stressor of migrants.

  10. Data on German farmers risk preference, perception and management strategies.

    PubMed

    Meraner, Manuela; Finger, Robert

    2017-12-01

    The extent to which people are willing to take on risk, i.e. their risk preferences as well as subjective risk perception plays a major role in explaining their behavior. This is of particular relevance in agricultural production, which is inherently risky. The data presented here was collected amongst a total of 64 German farmers in 2015. It includes results of three different risk preference elicitation methods (multiple price list, business statements in four relevant domains and general self-assessment) as well as risk perception. Additionally, farm business characteristics (e.g. size, farm-level workforce, succession) and personal farmer characteristics (e.g. age, gender, risk literacy) are included.

  11. Associations of Salivary BPIFA1 Protein in Chronic Periodontitis Patients with Type 2 Diabetes Mellitus

    PubMed Central

    Tang, Chen-Yi

    2017-01-01

    Aims To explore the differences in salivary BPI fold containing family A, member 1 (BPIFA1) concentration among type 2 diabetes mellitus (T2DM) subjects with various severities of chronic periodontitis and to determine whether BPIFA1 in saliva can be used as a potential biomarker of T2DM. Methods Unstimulated saliva samples were collected from 44 subjects with T2DM and 44 without T2DM (NDM). Additionally, demographic data and general health parameters, including fasting blood glucose (FBG) and body mass index (BMI), were collected. We also detected full-mouth clinical periodontal parameters including probing pocket depth (PPD), clinical attachment level (CAL), bleeding index (BI), and plaque index (PLI). Salivary BPIFA1, tumor necrosis factor-α (TNF-α), and interleukin-6 (IL-6) concentrations were also detected. Results BPIFA1 in saliva was detected at relatively high levels. T2DM subjects had decreased salivary BPIFA1 concentrations (P = 0.031). In T2DM subjects with nonperiodontitis or severe periodontitis, the level of BPIFA1 was significantly lower compared with that of NDM. Salivary TNF-α concentration displayed a similar trend to BPIFA1 in the NDM group. Conclusions BPIFA1 protein is rich in saliva and might be used as a potential predictive biomarker of T2DM, especially in patients with severe periodontitis and nonperiodontitis. This trial is registered with ChiCTR-ROC-17010310. PMID:29109737

  12. Responses to Overdiagnosis in Thyroid Cancer Screening among Korean Women.

    PubMed

    Lee, Sangeun; Lee, Yoon Young; Yoon, Hyo Joong; Choi, Eunji; Suh, Mina; Park, Boyoung; Jun, Jae Kwan; Kim, Yeol; Choi, Kui Son

    2016-07-01

    Communicating the harms and benefits of thyroid screening is necessary to help individuals decide on whether or not to undergo thyroid cancer screening. This study was conducted to assess changes in thyroid cancer screening intention in response to receiving information about overdiagnosis and to determine factors with the greatest influence thereon. Data were acquired from subjects included in the 2013 Korean National Cancer Screening Survey (KNCSS), a nationwide, population-based, cross-sectional survey. Of the 4,100 respondents in the 2013 KNCSS, women were randomly subsampled and an additional face-to-face interview was conducted. Finally, a total of 586 female subjects were included in this study. Intention to undergo thyroid cancer screening was assessed before and after receiving information on overdiagnosis. Prior awareness of overdiagnosis in thyroid cancer screening was 27.8%. The majority of subjects intended to undergo thyroid cancer screening before and after receiving information on overdiagnosis (87% and 74%, respectively). Only a small number of subjects changed their intention to undergo thyroid cancer screening from positive to negative after receiving information on overdiagnosis. Women of higher education level and Medical Aid Program recipients reported being significantly more likely to change their intention to undergo thyroid cancer screening afterreceiving information on overdiagnosis,whilewomen with stronger beliefs on the efficacy of cancer screening were less likely to change their intention. Women in Korea appeared to be less concerned about overdiagnosis when deciding whether or not to undergo thyroid cancer screening.

  13. Spatial Disorientation in Gondola Centrifuges Predicted by the Form of Motion as a Whole in 3-D

    PubMed Central

    Holly, Jan E.; Harmon, Katharine J.

    2009-01-01

    INTRODUCTION During a coordinated turn, subjects can misperceive tilts. Subjects accelerating in tilting-gondola centrifuges without external visual reference underestimate the roll angle, and underestimate more when backward-facing than when forward-facing. In addition, during centrifuge deceleration, the perception of pitch can include tumble while paradoxically maintaining a fixed perceived pitch angle. The goal of the present research was to test two competing hypotheses: (1) that components of motion are perceived relatively independently and then combined to form a three-dimensional perception, and (2) that perception is governed by familiarity of motions as a whole in three dimensions, with components depending more strongly on the overall shape of the motion. METHODS Published experimental data were used from existing tilting-gondola centrifuge studies. The two hypotheses were implemented formally in computer models, and centrifuge acceleration and deceleration were simulated. RESULTS The second, whole-motion oriented, hypothesis better predicted subjects' perceptions, including the forward-backward asymmetry and the paradoxical tumble upon deceleration. Important was the predominant stimulus at the beginning of the motion as well as the familiarity of centripetal acceleration. CONCLUSION Three-dimensional perception is better predicted by taking into account familiarity with the form of three-dimensional motion. PMID:19198199

  14. Global topological dominance in the left hemisphere.

    PubMed

    Wang, Bo; Zhou, Tian Gang; Zhuo, Yan; Chen, Lin

    2007-12-26

    A series of experiments with right-handers demonstrated that the left hemisphere (LH) is reliably and consistently superior to the right hemisphere (RH) for global topological perception. These experiments generalized the topological account of lateralization to different kinds of topological properties (including holes, inside/outside relation, and "presence vs. absence") in comparison with a broad spectrum of geometric properties, including orientation, distance, size, mirror-symmetry, parallelism, collinearity, etc. The stimuli and paradigms used were also designed to prevent subjects from using various nontopological properties in performing the tasks of topological discrimination. Furthermore, task factors commonly considered in the study of hemispheric asymmetry, such as response latency vs. accuracy, vertical vs. horizontal presentation, detection vs. recognition, and simultaneous vs. sequential judgment, were manipulated to not be confounding factors. Moreover, left-handed subjects were tested and showed the right lateralization of topological perception, in the opposite direction of lateralization compared with right-handers. In addition, the functional magnetic resonance imaging measure revealed that only a region in the left temporal gyrus was consistently more activated across subjects in the task of topological discrimination, consistent with the behavioral results. In summary, the global topological dominance in the LH is well supported by the converging evidence from the variety of paradigms and techniques, and it suggests a unified solution to the current major controversies on visual lateralization.

  15. Comparative evaluation of anchorage reinforcement between orthodontic implants and conventional anchorage in orthodontic management of bimaxillary dentoalveolar protrusion.

    PubMed

    Chopra, S S; Mukherjee, Manish; Mitra, Rajat; Kochar, Gagan Deep; Kadu, Abhijeet

    2017-04-01

    Increased upper lip procumbency is commonly associated with maxillary dentoalveolar protrusion with the major goal of reducing maxillary dentoalveolar protrusion. The treatment plan usually includes extraction of the maxillary first premolars, followed by retraction of anterior teeth with maximum anchorage. Dental implants have been widely accepted as successful adjuncts for obtaining maximum anchorage in orthodontic treatment. 50 subjects between the ages of 13 and 17 years having bimaxillary dentoalveolar protrusion were included in the study. The patients were divided into two groups. Both groups received treatment with 0.022″ MBT prescription preadjusted edgewise appliance system. In addition, subjects of Group 'I' received the Nance button and lingual arch as anchorage reinforcement in the upper and lower arches, respectively. Subjects of Group 'II' received self-drilling titanium OI for anchorage reinforcement. Significant retraction was achieved in all cases with good vertical control. Anchor loss was observed in both groups. Anchor loss was much higher in Group I compared to Group II, and an intergroup comparison for anchor loss was highly significant. Implants as anchorage, for en masse retraction, can be incorporated into orthodontic practice. The use of orthodontic implants for anchorage is a viable alternative to conventional molar anchorage.

  16. Association of Salivary Helicobacter pylori Infection with Oral Diseases: a Cross-sectional Study in a Chinese Population.

    PubMed

    Ding, Yi-Jian; Yan, Tian-Lian; Hu, Xin-Lan; Liu, Jian-Hua; Yu, Chao-Hui; Li, You-Ming; Wang, Qun-Yan

    2015-01-01

    The aim of this study was to detect the prevalence of oral H.pylori among adults and to investigate the correlation between H.pylori infection and common oral diseases. A cross-sectional study was performed among adults Chinese who took their annual oral healthy examination at The First Affiliated Hospital, Zhejiang University School of Medicine, China. The study included 1050 subjects in total and oral H.pylori infection occurred in 60.29% of the subjects. The prevalence rates of oral H.pylori in patients with periodontal diseases (63.42%) and caries (66.91%) were significantly increased than those without oral diseases (54.07%), respectively (P < 0.05), while the difference between subjects with recurrent aphthous stomatitis and controls was not significant. In addition, the differences of positive rates of H.pylori with or without history of gastric ulcer were statistically significant (69.47% vs 58.26%, P<0.05). Presenting with periodontal diseases (OR 1.473;95% CI 1.021 to 2.124), caries (OR 1.717; 1.127 to 2.618), and having history of gastric ulcer (OR 1.631; 1.164 to 2.285) increased the risk of H.pylori infection. Oral H.pylori infection is common in adult Chinese, which is significantly associated with oral diseases including periodontal diseases and caries.

  17. Microwave and millimeter-wave Doppler radar heart sensing

    NASA Astrophysics Data System (ADS)

    Boric-Lubecke, Olga; Lin, Jenshan; Lubecke, Victor M.; Host-Madsen, Anders; Sizer, Tod

    2007-04-01

    Technology that can be used to unobtrusively detect and monitor the presence of human subjects from a distance and through barriers can be a powerful tool for meeting new security challenges, including asymmetric battlefield threats abroad and defense infrastructure needs back home. Our team is developing mobile remote sensing technology for battle-space awareness and warfighter protection, based on microwave and millimeter-wave Doppler radar motion sensing devices that detect human presence. This technology will help overcome a shortfall of current see-through-thewall (STTW) systems, which is, the poor detection of stationary personnel. By detecting the minute Doppler shifts induced by a subject's cardiopulmonary related chest motion, the technology will allow users to detect personnel that are completely stationary more effectively. This personnel detection technique can also have an extremely low probability of intercept since the signals used can be those from everyday communications. The software and hardware developments and challenges for personnel detection and count at a distance will be discussed, including a 2.4 GHz quadrature radar single-chip silicon CMOS implementation, a low-power double side-band Ka-band transmission radar, and phase demodulation and heart rate extraction algorithms. In addition, the application of MIMO techniques for determining the number of subjects will be discussed.

  18. The relationship between sense of coherence and attribution of responsibility for problems and their solutions, and cessation of substance abuse over time.

    PubMed

    Feigin, Rena; Sapir, Yaffa

    2005-03-01

    The present study deals with personal and psychological characteristics of addicts coping with abstinence from drugs in various stages of recovery. The study focuses primarily on two personal variables: attribution of responsibility for the problem and its solution, and the sense of coherence. Additional factors that were examined in the study are demographic variables, which include those related to drug addiction. The sample included 128 short-term abstinent patients in the early stages of recovery after detoxification, and 40 long-term abstinent former addicts, who have abstained from the use of drugs for two to eight years. The results indicate a higher level of sense of coherence among the long-term abstinent subjects relating to their inner resources. On the other hand, much similarity was found between the groups in relation to the attribution of responsibility variable. In both groups, the majority reports that they attribute responsibility for the solution of the problem to themselves. The findings underscored the significant link between personality variables and coping with the processes of recovery, while an analysis of demographic and addiction variables did not show a significant distinction between the group of long-term abstinent subjects and the short-term abstinent subjects.

  19. Metabolomic Fingerprinting in Various Body Fluids of a Diet-Controlled Clinical Smoking Cessation Study Using a Validated GC-TOF-MS Metabolomics Platform.

    PubMed

    Goettel, Michael; Niessner, Reinhard; Mueller, Daniel; Scherer, Max; Scherer, Gerhard; Pluym, Nikola

    2017-10-06

    Untargeted GC-TOF-MS analysis proved to be a suitable analytical platform to determine alterations in the metabolic profile. Several metabolic pathways were found to be altered in a first clinical study comparing smokers against nonsmokers. Subsequently, we conducted a clinical diet-controlled study to investigate alterations in the metabolic profile during the course of 3 months of smoking cessation. Sixty male subjects were included in the study, and plasma, saliva, and urine samples were collected during four 24 h stationary visits: at baseline, while still smoking, after 1 week, after 1 month, and after 3 months of cessation. Additionally, subjects were monitored for their compliance by measurements of CO in exhaled breath and salivary cotinine throughout the study. GC-TOF-MS fingerprinting was applied to plasma, saliva, and urine samples derived from 39 compliant subjects. In total, 52 metabolites were found to be significantly altered including 26 in plasma, 20 in saliva, and 12 in urine, respectively. In agreement with a previous study comparing smokers and nonsmokers, the fatty acid and amino acid metabolism showed significant alterations upon 3 months of smoking cessation. Thus these results may indicate a partial recovery of metabolic pathway perturbations, even after a relatively short period of smoking cessation.

  20. ALS Multicenter Cohort Study of Oxidative Stress (ALS COSMOS): study methodology, recruitment, and baseline demographic and disease characteristics.

    PubMed

    Mitsumoto, Hiroshi; Factor-Litvak, Pam; Andrews, Howard; Goetz, Raymond R; Andrews, Leslie; Rabkin, Judith G; McElhiney, Martin; Nieves, Jeri; Santella, Regina M; Murphy, Jennifer; Hupf, Jonathan; Singleton, Jess; Merle, David; Kilty, Mary; Heitzman, Daragh; Bedlack, Richard S; Miller, Robert G; Katz, Jonathan S; Forshew, Dallas; Barohn, Richard J; Sorenson, Eric J; Oskarsson, Bjorn; Fernandes Filho, J Americo M; Kasarskis, Edward J; Lomen-Hoerth, Catherine; Mozaffar, Tahseen; Rollins, Yvonne D; Nations, Sharon P; Swenson, Andrea J; Shefner, Jeremy M; Andrews, Jinsy A; Koczon-Jaremko, Boguslawa A

    2014-06-01

    Abstract In a multicenter study of newly diagnosed ALS patients without a reported family history of ALS, we are prospectively investigating whether markers of oxidative stress (OS) are associated with disease progression. Methods utilize an extensive structured telephone interview ascertaining environmental, lifestyle, dietary and psychological risk factors associated with OS. Detailed assessments were performed at baseline and at 3-6 month intervals during the ensuing 30 months. Our biorepository includes DNA, plasma, urine, and skin. Three hundred and fifty-five patients were recruited. Subjects were enrolled over a 36-month period at 16 sites. To meet the target number of subjects, the recruitment period was prolonged and additional sites were included. Results showed that demographic and disease characteristics were similar between 477 eligible/non-enrolled and enrolled patients, the only difference being type of health insurance among enrolled patients. Sites were divided into three groups by the number of enrolled subjects. Comparing these three groups, the Columbia site had fewer 'definite ALS' diagnoses. This is the first prospective, interdisciplinary, in-depth, multicenter epidemiological investigation of OS related to ALS progression and has been accomplished by an aggressive recruitment process. The baseline demographic and disease features of the study sample are now fully characterized.

  1. Serial Metabolome Changes in a Prospective Cohort of Subjects with Influenza Viral Infection and Comparison with Dengue Fever.

    PubMed

    Cui, Liang; Fang, Jinling; Ooi, Eng Eong; Lee, Yie Hou

    2017-07-07

    Influenza virus infection (IVI) and dengue virus infection (DVI) are major public health threats. Between IVI and DVI, clinical symptoms can be overlapping yet infection-specific, but host metabolome changes are not well-described. Untargeted metabolomics and targeted oxylipinomic analyses were performed on sera serially collected at three phases of infection from a prospective cohort study of adult subjects with either H3N2 influenza infection or dengue fever. Untargeted metabolomics identified 26 differential metabolites, and major perturbed pathways included purine metabolism, fatty acid biosynthesis and β-oxidation, tryptophan metabolism, phospholipid catabolism, and steroid hormone pathway. Alterations in eight oxylipins were associated with the early symptomatic phase of H3N2 flu infection, were mostly arachidonic acid-derived, and were enriched in the lipoxygenase pathway. There was significant overlap in metabolome profiles in both infections. However, differences specific to IVI and DVI were observed. DVI specifically attenuated metabolites including serotonin, bile acids and biliverdin. Additionally, metabolome changes were more persistent in IVI in which metabolites such as hypoxanthine, inosine, and xanthine of the purine metabolism pathway remained significantly elevated at 21-27 days after fever onset. This study revealed the dynamic metabolome changes in IVI subjects and provided biochemical insights on host physiological similarities and differences between IVI and DVI.

  2. A binary method for simple and accurate two-dimensional cursor control from EEG with minimal subject training.

    PubMed

    Kayagil, Turan A; Bai, Ou; Henriquez, Craig S; Lin, Peter; Furlani, Stephen J; Vorbach, Sherry; Hallett, Mark

    2009-05-06

    Brain-computer interfaces (BCI) use electroencephalography (EEG) to interpret user intention and control an output device accordingly. We describe a novel BCI method to use a signal from five EEG channels (comprising one primary channel with four additional channels used to calculate its Laplacian derivation) to provide two-dimensional (2-D) control of a cursor on a computer screen, with simple threshold-based binary classification of band power readings taken over pre-defined time windows during subject hand movement. We tested the paradigm with four healthy subjects, none of whom had prior BCI experience. Each subject played a game wherein he or she attempted to move a cursor to a target within a grid while avoiding a trap. We also present supplementary results including one healthy subject using motor imagery, one primary lateral sclerosis (PLS) patient, and one healthy subject using a single EEG channel without Laplacian derivation. For the four healthy subjects using real hand movement, the system provided accurate cursor control with little or no required user training. The average accuracy of the cursor movement was 86.1% (SD 9.8%), which is significantly better than chance (p = 0.0015). The best subject achieved a control accuracy of 96%, with only one incorrect bit classification out of 47. The supplementary results showed that control can be achieved under the respective experimental conditions, but with reduced accuracy. The binary method provides naïve subjects with real-time control of a cursor in 2-D using dichotomous classification of synchronous EEG band power readings from a small number of channels during hand movement. The primary strengths of our method are simplicity of hardware and software, and high accuracy when used by untrained subjects.

  3. Clinicomanometric factors associated with clinically relevant esophagogastric junction outflow obstruction from the Sandhill high-resolution manometry system.

    PubMed

    Song, B G; Min, Y W; Lee, H; Min, B-H; Lee, J H; Rhee, P-L; Kim, J J

    2018-03-01

    Integrated relaxation pressure (IRP) is a key metric for diagnosing esophagogastric junction outflow obstruction (EGJOO). However, its normal value might be different according to the manufacturer of high-resolution manometry (HRM). This study aimed to investigate optimal value of IRP for diagnosing EGJOO in Sandhill HRM and to find clinicomanometric variables to segregate clinically relevant EGJOO. We analyzed 262 consecutive subjects who underwent HRM between June 2011 and December 2016 showing elevated median IRP (> 15 mm Hg) but did not satisfy criteria for achalasia. Clinically relevant subjects were defined as follows: (i) subsequent HRM met achalasia criteria during follow-up (early achalasia); (ii) Eckardt score was decreased at least two points without exceeding a score of 3 after pneumatic dilatation (variant achalasia); and (iii) significant passage disturbance on esophagogram without structural abnormality (possible achalasia). Seven subjects were clinically relevant, including two subjects with early achalasia, four subjects with variant achalasia, and one subject with possible achalasia. All clinically relevant subjects had IRP 20 mm Hg or above. Among subjects (n = 122) with IRP 20 mm Hg or more, clinically relevant group (n = 7) had significantly higher rate of dysphagia (100% vs 24.3%, P < .001) and compartmentalized pressurization (85.7% vs 21.7%, P = .001) compared to clinically non-relevant group (n = 115). Our results suggest that IRP of 20 mm Hg or higher could segregate clinically relevant subjects showing EGJOO in Sandhill HRM. Additionally, if subjects have both dysphagia and compartmentalized pressurization, careful follow-up is essential. © 2017 John Wiley & Sons Ltd.

  4. The Muscle Metabolome Differs between Healthy and Frail Older Adults.

    PubMed

    Fazelzadeh, Parastoo; Hangelbroek, Roland W J; Tieland, Michael; de Groot, Lisette C P G M; Verdijk, Lex B; van Loon, Luc J C; Smilde, Age K; Alves, Rodrigo D A M; Vervoort, Jacques; Müller, Michael; van Duynhoven, John P M; Boekschoten, Mark V

    2016-02-05

    Populations around the world are aging rapidly. Age-related loss of physiological functions negatively affects quality of life. A major contributor to the frailty syndrome of aging is loss of skeletal muscle. In this study we assessed the skeletal muscle biopsy metabolome of healthy young, healthy older and frail older subjects to determine the effect of age and frailty on the metabolic signature of skeletal muscle tissue. In addition, the effects of prolonged whole-body resistance-type exercise training on the muscle metabolome of older subjects were examined. The baseline metabolome was measured in muscle biopsies collected from 30 young, 66 healthy older subjects, and 43 frail older subjects. Follow-up samples from frail older (24 samples) and healthy older subjects (38 samples) were collected after 6 months of prolonged resistance-type exercise training. Young subjects were included as a reference group. Primary differences in skeletal muscle metabolite levels between young and healthy older subjects were related to mitochondrial function, muscle fiber type, and tissue turnover. Similar differences were observed when comparing frail older subjects with healthy older subjects at baseline. Prolonged resistance-type exercise training resulted in an adaptive response of amino acid metabolism, especially reflected in branched chain amino acids and genes related to tissue remodeling. The effect of exercise training on branched-chain amino acid-derived acylcarnitines in older subjects points to a downward shift in branched-chain amino acid catabolism upon training. We observed only modest correlations between muscle and plasma metabolite levels, which pleads against the use of plasma metabolites as a direct read-out of muscle metabolism and stresses the need for direct assessment of metabolites in muscle tissue biopsies.

  5. In adults with Prader-Willi syndrome, elevated ghrelin levels are more consistent with hyperphagia than high PYY and GLP-1 levels.

    PubMed

    Purtell, Louise; Sze, Lisa; Loughnan, Georgina; Smith, Ellie; Herzog, Herbert; Sainsbury, Amanda; Steinbeck, Katharine; Campbell, Lesley V; Viardot, Alexander

    2011-08-01

    Prader-Willi syndrome (PWS) is a leading genetic cause of obesity, characterized by hyperphagia, endocrine and developmental disorders. It is suggested that the intense hyperphagia could stem, in part, from impaired gut hormone signaling. Previous studies produced conflicting results, being confounded by differences in body composition between PWS and control subjects. Fasting and postprandial gut hormone responses were investigated in a cross-sectional cohort study including 10 adult PWS, 12 obese subjects matched for percentage body fat and central abdominal fat, and 10 healthy normal weight subjects. PYY[total], PYY[3-36], GLP-1[active] and ghrelin[total] were measured by ELISA or radioimmunoassay. Body composition was assessed by dual energy X-ray absorptiometry. Visual analog scales were used to assess hunger and satiety. In contrast to lean subjects (p<0.05), PWS and obese subjects were similarly insulin resistant and had similar insulin levels. Ghrelin[total] levels were significantly higher in PWS compared to obese subjects before and during the meal (p<0.05). PYY[3-36] meal responses were higher in PWS than in lean subjects (p=0.01), but not significantly different to obese (p=0.08), with an additional non-significant trend in PYY[total] levels. There were no significant differences in self-reported satiety between groups, however PWS subjects reported more hunger throughout (p=0.003), and exhibited a markedly reduced meal-induced suppression of hunger (p=0.01) compared to lean or obese subjects. Compared to adiposity-matched control subjects, hyperphagia in PWS is not related to a lower postprandial GLP-1 or PYY response. Elevated ghrelin levels in PWS are consistent with increased hunger and are unrelated to insulin levels. Copyright © 2011 Elsevier Ltd. All rights reserved.

  6. The Effects of Magnesium Supplementation on Subjective Anxiety and Stress—A Systematic Review

    PubMed Central

    Boyle, Neil Bernard; Lawton, Clare; Dye, Louise

    2017-01-01

    Background: Anxiety related conditions are the most common affective disorders present in the general population with a lifetime prevalence of over 15%. Magnesium (Mg) status is associated with subjective anxiety, leading to the proposition that Mg supplementation may attenuate anxiety symptoms. This systematic review examines the available evidence for the efficacy of Mg supplementation in the alleviation of subjective measures of anxiety and stress. Methods: A systematic search of interventions with Mg alone or in combination (up to 5 additional ingredients) was performed in May 2016. Ovid Medline, PsychInfo, Embase, CINAHL and Cochrane databases were searched using equivalent search terms. A grey literature review of relevant sources was also undertaken. Results: 18 studies were included in the review. All reviewed studies recruited samples based upon an existing vulnerability to anxiety: mildly anxious, premenstrual syndrome (PMS), postpartum status, and hypertension. Four/eight studies in anxious samples, four/seven studies in PMS samples, and one/two studies in hypertensive samples reported positive effects of Mg on subjective anxiety outcomes. Mg had no effect on postpartum anxiety. No study administered a validated measure of subjective stress as an outcome. Conclusions: Existing evidence is suggestive of a beneficial effect of Mg on subjective anxiety in anxiety vulnerable samples. However, the quality of the existing evidence is poor. Well-designed randomised controlled trials are required to further confirm the efficacy of Mg supplementation. PMID:28445426

  7. Subjective cognitive complaints, psychosocial factors and nursing work function in nurses providing direct patient care.

    PubMed

    Barbe, Tammy; Kimble, Laura P; Rubenstein, Cynthia

    2018-04-01

    The aim of this study was to examine relationships among subjective cognitive complaints, psychosocial factors and nursing work function in nurses providing direct patient care. Cognitive functioning is a critical component for nurses in the assurance of error prevention, identification and correction when caring for patients. Negative changes in nurses' cognitive and psychosocial functioning can adversely affect nursing care and patient outcomes. A descriptive correlational design with stratified random sampling. The sample included 96 nurses from the major geographic regions of the United States. Over 9 months in 2016-2017, data were collected using a web-based survey. Stepwise multiple linear regression analyses were used to examine relationships among subjective cognitive complaints, psychosocial factors and nursing work function. Overall, participants reported minimal work function impairment and low levels of subjective cognitive complaints, depression and stress. In multivariate analyses, depression was not associated with nurses' work function. However, perceived stress and subjective concerns about cognitive function were associated with greater impairment of work function. Nurses experiencing subjective cognitive complaints should be encouraged to address personal and environmental factors that are associated with their cognitive status. Additionally, stress reduction in nurses should be a high priority as a potential intervention to promote optimal functioning of nurses providing direct patient care. Healthcare institutions should integrate individual and institutional strategies to reduce factors contributing to workplace stress. © 2017 John Wiley & Sons Ltd.

  8. Complex and Simple Clinical Reaction Times Are Associated with Gait, Balance, and Major Fall Injury in Older Subjects with Diabetic Peripheral Neuropathy

    PubMed Central

    Richardson, James K.; Eckner, James T.; Allet, Lara; Kim, Hogene; Ashton-Miller, James

    2016-01-01

    Objective To identify relationships between complex and simple clinical measures of reaction time (RTclin), and indicators of balance in older subjects with and without diabetic peripheral neuropathy (DPN). Design Prospective cohort design. Complex RTclin Accuracy, Simple RTclin Latency, and their ratio were determined using a novel device in 42 subjects (age = 69.1 ± 8.3 yrs), 26 with DPN and 16 without. Dependent variables included unipedal stance time (UST), step width variability and range on an uneven surface, and major fall-related injury over 12 months. Results In the DPN subjects the ratio of Complex RTclin Accuracy:Simple RTclin Latency was strongly associated with longer UST (r/p = .653/.004), and decreased step width variability and range (r/p = −.696/.001 and −.782/<.001, respectively) on an uneven surface. Additionally, the two DPN subjects sustaining major injuries had lower Complex RTclin Accuracy:Simple: RTclin Latency than those without. Conclusions The ratio of Complex RTclin Accuracy:Simple RTclin Latency is a potent predictor of UST and frontal plane gait variability in response to perturbations, and may predict major fall injury in older subjects with DPN. These short latency neurocognitive measures may compensate for lower limb neuromuscular impairments, and provide a more comprehensive understanding of balance and fall risk. PMID:27552354

  9. The Effects of Magnesium Supplementation on Subjective Anxiety and Stress-A Systematic Review.

    PubMed

    Boyle, Neil Bernard; Lawton, Clare; Dye, Louise

    2017-04-26

    Anxiety related conditions are the most common affective disorders present in the general population with a lifetime prevalence of over 15%. Magnesium (Mg) status is associated with subjective anxiety, leading to the proposition that Mg supplementation may attenuate anxiety symptoms. This systematic review examines the available evidence for the efficacy of Mg supplementation in the alleviation of subjective measures of anxiety and stress. A systematic search of interventions with Mg alone or in combination (up to 5 additional ingredients) was performed in May 2016. Ovid Medline, PsychInfo, Embase, CINAHL and Cochrane databases were searched using equivalent search terms. A grey literature review of relevant sources was also undertaken. 18 studies were included in the review. All reviewed studies recruited samples based upon an existing vulnerability to anxiety: mildly anxious, premenstrual syndrome (PMS), postpartum status, and hypertension. Four/eight studies in anxious samples, four/seven studies in PMS samples, and one/two studies in hypertensive samples reported positive effects of Mg on subjective anxiety outcomes. Mg had no effect on postpartum anxiety. No study administered a validated measure of subjective stress as an outcome. Existing evidence is suggestive of a beneficial effect of Mg on subjective anxiety in anxiety vulnerable samples. However, the quality of the existing evidence is poor. Well-designed randomised controlled trials are required to further confirm the efficacy of Mg supplementation.

  10. Gender Differences in Recreational Sports Participation among Taiwanese Adults

    PubMed Central

    Tsai, Liang-Ting; Lo, Feng-En; Yang, Chih-Chien; Keller, Joseph Jordan; Lyu, Shu-Yu

    2015-01-01

    This study examines the gender differences in the enjoyment of recreational sports participation among Taiwanese adults. Data were obtained using the 2007 Taiwan Social Change Survey. The questionnaire included a topical module of the International Social Survey Program regarding leisure time and sports. Results showed that male subjects were more likely to participate in recreational sports to improve their appearance and on account of their personal interest. In addition to these factors, female subjects also experienced greater motivation to participate when Taiwanese athletes performed well in international sporting competitions. This study confirmed that the factors influencing enjoyment of recreational sports participation differ among men and women. These results can be used to better inform public health professionals and other regulatory organizations formulating physical activity intervention strategies. PMID:25599374

  11. A study of the thermoregulatory characteristics of a liquid-cooled garment with automatic temperature control based on sweat rate: Experimental investigation and biothermal man-model development

    NASA Technical Reports Server (NTRS)

    Chambers, A. B.; Blackaby, J. R.; Miles, J. B.

    1973-01-01

    Experimental results for three subjects walking on a treadmill at exercise rates of up to 590 watts showed that thermal comfort could be maintained in a liquid cooled garment by using an automatic temperature controller based on sweat rate. The addition of head- and neck-cooling to an Apollo type liquid cooled garment increased its effectiveness and resulted in greater subjective comfort. The biothermal model of man developed in the second portion of the study utilized heat rates and exchange coefficients based on the experimental data, and included the cooling provisions of a liquid-cooled garment with automatic temperature control based on sweat rate. Simulation results were good approximations of the experimental results.

  12. Planetary protection implementation on future Mars lander missions

    NASA Astrophysics Data System (ADS)

    Howell, Robert; Devincenzi, Donald L.

    1993-06-01

    A workshop was convened to discuss the subject of planetary protection implementation for Mars lander missions. It was sponsored and organized by the Exobiology Implementation Team of the U.S./Russian Joint Working Group on Space Biomedical and Life Support Systems. The objective of the workshop was to discuss planetary protection issues for the Russian Mars '94 mission, which is currently under development, as well as for additional future Mars lander missions including the planned Mars '96 and U.S. MESUR Pathfinder and Network missions. A series of invited presentations was made to ensure that workshop participants had access to information relevant to the planned discussions. The topics summarized in this report include exobiology science objectives for Mars exploration, current international policy on planetary protection, planetary protection requirements developed for earlier missions, mission plans and designs for future U.S. and Russian Mars landers, biological contamination of spacecraft components, and techniques for spacecraft bioload reduction. In addition, the recent recommendations of the U.S. Space Studies Board (SSB) on this subject were also summarized. Much of the discussion focused on the recommendations of the SSB. The SSB proposed relaxing the planetary protection requirements for those Mars lander missions that do not contain life detection experiments, but maintaining Viking-like requirements for those missions that do contain life detection experiments. The SSB recommendations were found to be acceptable as a guide for future missions, although many questions and concerns about interpretation were raised and are summarized. Significant among the concerns was the need for more quantitative guidelines to prevent misinterpretation by project offices and better access to and use of the Viking data base of bio-assays to specify microbial burden targets. Among the questions raised were how will the SSB recommendations be integrated with existing Committee on Space Research (COSPAR) policy and how will they apply to and affect Mars '94, Mars '96, MESUR Pathfinder, and MESUR Network missions? One additional topic briefly considered at the workshop was the identification of some issues related to planetary protection considerations for Mars sample return missions. These issues will form the basis for a follow-on joint U.S./Russian workshop on that subject.

  13. Planetary protection implementation on future Mars lander missions

    NASA Technical Reports Server (NTRS)

    Howell, Robert; Devincenzi, Donald L.

    1993-01-01

    A workshop was convened to discuss the subject of planetary protection implementation for Mars lander missions. It was sponsored and organized by the Exobiology Implementation Team of the U.S./Russian Joint Working Group on Space Biomedical and Life Support Systems. The objective of the workshop was to discuss planetary protection issues for the Russian Mars '94 mission, which is currently under development, as well as for additional future Mars lander missions including the planned Mars '96 and U.S. MESUR Pathfinder and Network missions. A series of invited presentations was made to ensure that workshop participants had access to information relevant to the planned discussions. The topics summarized in this report include exobiology science objectives for Mars exploration, current international policy on planetary protection, planetary protection requirements developed for earlier missions, mission plans and designs for future U.S. and Russian Mars landers, biological contamination of spacecraft components, and techniques for spacecraft bioload reduction. In addition, the recent recommendations of the U.S. Space Studies Board (SSB) on this subject were also summarized. Much of the discussion focused on the recommendations of the SSB. The SSB proposed relaxing the planetary protection requirements for those Mars lander missions that do not contain life detection experiments, but maintaining Viking-like requirements for those missions that do contain life detection experiments. The SSB recommendations were found to be acceptable as a guide for future missions, although many questions and concerns about interpretation were raised and are summarized. Significant among the concerns was the need for more quantitative guidelines to prevent misinterpretation by project offices and better access to and use of the Viking data base of bioassays to specify microbial burden targets. Among the questions raised were how will the SSB recommendations be integrated with existing Committee on Space Research (COSPAR) policy and how will they apply to and affect Mars '94, Mars '96, MESUR Pathfinder, and MESUR Network missions? One additional topic briefly considered at the workshop was the identification of some issues related to planetary protection considerations for Mars sample return missions. These issues will form the basis for a follow-on joint U.S./Russian workshop on that subject.

  14. Spacecraft Fire Detection and Extinguishment: A Bibliography

    NASA Technical Reports Server (NTRS)

    Jason, Nora H.

    1988-01-01

    Pertinent fire detection and extinguishment references have been identified to further the knowledge of spacecraft fire safety. To broaden the scope of the bibliography, other unusual environments, e.g., aircraft, submarine, ship, have been included. In addition, for a more comprehensive view of the spacecraft fire safety problem, selected subjects are included, e.g., materials flammability, smoke, human behavior. The references will provide the researcher with access to state-of-the-art and historic works. Selected references from the 1960's have been included, but the emphasis is on references published from 1975 to 1987. The references are arranged by very broad categories. Often a paper will cover more than one topic, but for the purposes of this bibliography it will be cited only once.

  15. Layered Deposits and Pitted Terrain in the Circum Hellas Region

    NASA Technical Reports Server (NTRS)

    Moore, J. M.; Howard, A. D.

    2005-01-01

    Much of the southern highlands has been mantled since the Noachian, including a general blanket of possibly airfall-derived sediment that softens the landscape, the Electris mantle including knobby chaos in several basins, and a variety of deposits that are the subject of this study that share the common characteristics of being generally confined to basins and crater floors and that manifest irregular interior depressions. Many of these features occur in a zone surrounding Hellas. These deposits share the general characteristics of having fairly smooth, nearly planar surfaces and abrupt scarps bordering interior and marginal depressions. Despite these common characteristics, a wide range of morphologies occurs. Several end-members are discussed below. Additional information is included in the original extended abstract.

  16. Carbon Dioxide Washout Testing Using Various Inlet Vent Configurations in the Mark-III Space Suit

    NASA Technical Reports Server (NTRS)

    Korona, F. Adam; Norcross, Jason; Conger, Bruce; Navarro, Moses

    2014-01-01

    Requirements for using a space suit during ground testing include providing adequate carbon dioxide (CO2) washout for the suited subject. Acute CO2 exposure can lead to symptoms including headache, dyspnea, lethargy, and eventually unconsciousness or even death. Symptoms depend on several factors including inspired partial pressure of CO2 (ppCO2), duration of exposure, metabolic rate of the subject, and physiological differences between subjects. Computational Fluid Dynamics (CFD) analysis has predicted that the configuration of the suit inlet vent has a significant effect on oronasal CO2 concentrations. The main objective of this test was to characterize inspired oronasal ppCO2 for a variety of inlet vent configurations in the Mark-III suit across a range of workload and flow rates. Data and trends observed during testing along with refined CFD models will be used to help design an inlet vent configuration for the Z-2 space suit. The testing methodology used in this test builds upon past CO2 washout testing performed on the Z-1 suit, Rear Entry I-Suit, and the Enhanced Mobility Advanced Crew Escape Suit. Three subjects performed two test sessions each in the Mark-III suit to allow for comparison between tests. Six different helmet inlet vent configurations were evaluated during each test session. Suit pressure was maintained at 4.3 psid. Suited test subjects walked on a treadmill to generate metabolic workloads of approximately 2000 and 3000 BTU/hr. Supply airflow rates of 6 and 4 actual cubic feet per minute were tested at each workload. Subjects wore an oronasal mask with an open port in front of the mouth and were allowed to breathe freely. Oronasal ppCO2 was monitored real-time via gas analyzers with sampling tubes connected to the oronasal mask. Metabolic rate was calculated from the CO2 production measured by an additional gas analyzer at the air outlet from the suit. Real-time metabolic rate measurements were used to adjust the treadmill workload to meet target metabolic rates. This paper provides detailed descriptions of the test hardware, methodology and results, as well as implications for future inlet vent designs and ground testing.

  17. A laboratory study of the perceived benefit of additional noise attenuation by houses

    NASA Technical Reports Server (NTRS)

    Flindell, I. H.

    1983-01-01

    Two Experiments were conducted to investigate the perceived benefit of additional house attenuation against aircraft flyover noise. First, subjects made annoyance judgments in a simulated living room while an operative window with real and dummy storm windows was manipulated in full view of those subjects. Second, subjects made annoyance judgments in an anechoic audiometric test chamber of frequency shaped noise signals having spectra closely matched to those of the aircraft flyover noises reproduced in the first experiment. These stimuli represented the aircraft flyover noises in levels and spectra but without the situational and visual cues present in the simulated living room. Perceptual constancy theory implies that annoyance tends to remain constant despite reductions in noise level caused by additional attenuation of which the subjects are fully aware. This theory was supported when account was taken for a reported annoyance overestimation for certain spectra and for a simulated condition cue overreaction.

  18. Subjective versus objective measures of tic severity in Tourette syndrome - The influence of environment.

    PubMed

    Barnea, Meirav; Benaroya-Milshtein, Noa; Gilboa-Sechtman, Eva; Woods, Douglas W; Piacentini, John; Fennig, Silvana; Apter, Alan; Steinberg, Tamar

    2016-08-30

    The objective of this study was to examine the influence of environmental challenges on tic expression by subjective and objective measures. The study group consisted of 41 children aged 6-18 years (M=10.15, SD=2.73) with a primary diagnosis of Tourette syndrome. Subjective measures included the Functional Assessment Interview developed for this study and three standard validated instruments. The objective measure was a video-recording of the patients in five daily-life situations: watching television, doing homework, being alone, receiving attention when ticcing, and talking to a stranger. In addition, the effect of premonitory urges on assessment of tic expression was evaluated. The associations between the subjective and objective measures of tic expression were moderate to low. A significantly higher number of tics were observed in the television situation, and a significantly lower number in the alone situation, compared to the other situations. Higher levels of premonitory urge were associated with greater awareness of objectively measured tic expression. In conclusion, tic expression is significantly influenced by the environment. Subjective measures of tic expression may be misleading. These results have implications for refining the clinical assessment of tics, improving research methodology, and developing new therapeutic strategies. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  19. It matters how old you feel: Antecedents and performance consequences of average relative subjective age in organizations.

    PubMed

    Kunze, Florian; Raes, Anneloes M L; Bruch, Heike

    2015-09-01

    This article extends the conceptual knowledge of average relative subjective age in organizations by exploring organizational-level antecedents and consequences of employees, on average, feeling younger than their chronological age. We draw from the theories of selection-optimization-compensation and socioemotional selectivity to build a theoretical framework for relative subjective age in organizations. We hypothesize that companies in which employees, on average, perceive themselves to be younger than they actually are have a higher average individual goal accomplishment and, in turn, experience higher company performance. We further hypothesize that employees' average experience of high work-related meaning relates to a lower subjective age in organizations. In addition, we assess the role of environmental dynamism and age-inclusive human resource management as moderators in this theoretical model. Through empirically testing this model in a multisource dataset, including 107 companies with 15,164 participating employees, we received support for the hypothesized relationships. Our results contribute to current debates in the scientific literature on age and have important practical implications in light of the demographic changes faced by many companies. This research indicates to both researchers and practitioners that it is not employees' chronological age but their subjective age, a factor that can be influenced, which drives organizational performance outcomes. (c) 2015 APA, all rights reserved).

  20. Short-term Internet search using makes people rely on search engines when facing unknown issues.

    PubMed

    Wang, Yifan; Wu, Lingdan; Luo, Liang; Zhang, Yifen; Dong, Guangheng

    2017-01-01

    The Internet search engines, which have powerful search/sort functions and ease of use features, have become an indispensable tool for many individuals. The current study is to test whether the short-term Internet search training can make people more dependent on it. Thirty-one subjects out of forty subjects completed the search training study which included a pre-test, a six-day's training of Internet search, and a post-test. During the pre- and post- tests, subjects were asked to search online the answers to 40 unusual questions, remember the answers and recall them in the scanner. Un-learned questions were randomly presented at the recalling stage in order to elicited search impulse. Comparing to the pre-test, subjects in the post-test reported higher impulse to use search engines to answer un-learned questions. Consistently, subjects showed higher brain activations in dorsolateral prefrontal cortex and anterior cingulate cortex in the post-test than in the pre-test. In addition, there were significant positive correlations self-reported search impulse and brain responses in the frontal areas. The results suggest that a simple six-day's Internet search training can make people dependent on the search tools when facing unknown issues. People are easily dependent on the Internet search engines.

  1. Short-term Internet search using makes people rely on search engines when facing unknown issues

    PubMed Central

    Wang, Yifan; Wu, Lingdan; Luo, Liang; Zhang, Yifen

    2017-01-01

    The Internet search engines, which have powerful search/sort functions and ease of use features, have become an indispensable tool for many individuals. The current study is to test whether the short-term Internet search training can make people more dependent on it. Thirty-one subjects out of forty subjects completed the search training study which included a pre-test, a six-day’s training of Internet search, and a post-test. During the pre- and post- tests, subjects were asked to search online the answers to 40 unusual questions, remember the answers and recall them in the scanner. Un-learned questions were randomly presented at the recalling stage in order to elicited search impulse. Comparing to the pre-test, subjects in the post-test reported higher impulse to use search engines to answer un-learned questions. Consistently, subjects showed higher brain activations in dorsolateral prefrontal cortex and anterior cingulate cortex in the post-test than in the pre-test. In addition, there were significant positive correlations self-reported search impulse and brain responses in the frontal areas. The results suggest that a simple six-day’s Internet search training can make people dependent on the search tools when facing unknown issues. People are easily dependent on the Internet search engines. PMID:28441408

  2. Effects of aging on pointing movements under restricted visual feedback conditions.

    PubMed

    Zhang, Liancun; Yang, Jiajia; Inai, Yoshinobu; Huang, Qiang; Wu, Jinglong

    2015-04-01

    The goal of this study was to investigate the effects of aging on pointing movements under restricted visual feedback of hand movement and target location. Fifteen young subjects and fifteen elderly subjects performed pointing movements under four restricted visual feedback conditions that included full visual feedback of hand movement and target location (FV), no visual feedback of hand movement and target location condition (NV), no visual feedback of hand movement (NM) and no visual feedback of target location (NT). This study suggested that Fitts' law applied for pointing movements of the elderly adults under different visual restriction conditions. Moreover, significant main effect of aging on movement times has been found in all four tasks. The peripheral and central changes may be the key factors for these different characteristics. Furthermore, no significant main effects of age on the mean accuracy rate under condition of restricted visual feedback were found. The present study suggested that the elderly subjects made a very similar use of the available sensory information as young subjects under restricted visual feedback conditions. In addition, during the pointing movement, information about the hand's movement was more useful than information about the target location for young and elderly subjects. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Bacterial biofilm composition in caries and caries-free subjects.

    PubMed

    Wolff, D; Frese, C; Maier-Kraus, T; Krueger, T; Wolff, B

    2013-01-01

    Certain major pathogens such as Streptococcus mutans, Lactobacillus spp. and others have been reported to be involved in caries initiation and progression. Yet, in addition to those leading pathogens, microbial communities seem to be much more diverse and individually differing. The aim of this study, therefore, was to analyze the bacterial composition of carious dentin and the plaque of caries-free patients by using a custom-made, real-time quantitative polymerase chain reaction assay (RQ-PCR). The study included 26 patients with caries and 28 caries-free controls. Decayed tooth substance and plaque samples were harvested. Bacterial DNA was extracted and tested for the presence of 43 bacterial species or species groups using RQ-PCR. Relative quantification revealed that Propionibacterium acidifaciens was significantly more abundant in caries samples than were other microorganisms (fold change 169.12, p = 0.023). In the caries-free samples, typical health-associated species were significantly more prevalent. Unsupervised hierarchical cluster analysis showed a high abundance of P. acidifaciens in caries subjects and distinct but individually differing bacterial clusters in the caries-free subjects. The distribution of 11 bacteria allowed full discrimination between caries and caries-free subjects. Within the investigated cohort, P. acidifaciens was the only pathogen significantly more abundant in caries subjects. Cluster analysis yielded a diverse flora in caries-free subjects, whereas it was narrowed down to a small range of a few outcompeting members in caries subjects. Copyright © 2012 S. Karger AG, Basel.

  4. Virtual Reality Therapy for the Treatment of Alcohol Dependence: A Preliminary Investigation With Positron Emission Tomography/Computerized Tomography.

    PubMed

    Son, Ji Hyun; Lee, Sang Hoon; Seok, Ju Won; Kee, Baik Seok; Lee, Hyun Woong; Kim, Hyung Joon; Lee, Tae Kyung; Han, Doug Hyun

    2015-07-01

    Virtual reality therapy (VRT) uses multimodal stimulation that includes visual, auditory, olfactory, and gustatory stimuli. The aim of this study was to assess the effectiveness of VRT in treating subjects with alcohol dependence (AD) by evaluating changes in brain metabolism. The VRT protocol consisted of three steps: relaxation, presentation of a high-risk situation, and presentation of an aversive situation. Twelve alcohol-dependent subjects underwent 10 sessions of VRT. The alcohol-dependent subjects were assessed with 18F-fluorodeoxyglucose positron emission tomography images before and after VRT, whereas the control group underwent imaging according to the same protocol only at baseline. Compared with the healthy control group, AD subjects showed higher metabolism in the right lentiform nucleus and right temporal lobe (BA20) at baseline (P(FDR < .05) = .026). In addition, the metabolism in the left anterior cingulate was lower in subjects with AD (P(uncorr) = .001). After VRT, alcohol-dependent subjects showed decreased brain metabolism in the right lentiform nucleus (P(FDR < .05) = .026) and right temporal lobe (BA38, P(FDR < .05) = .032) relative to that at baseline. Our results suggest a neurobiological imbalance, notably, a high sensitivity to stimuli, in the limbic system in subjects with AD. Furthermore, we determined that metabolism decreased in the basal ganglia after VRT, which may explain the limbic-regulated responses of reward and regulation. Therefore, we tentatively recommend VRT to treat AD through its regulating effect on limbic circuits.

  5. Elevated homocysteine levels in human immunodeficiency virus-infected patients under antiretroviral therapy: A meta-analysis

    PubMed Central

    Deminice, Rafael; Silva, Talita Capoani Vieira; de Oliveira, Vitor Hugo Fernando

    2015-01-01

    AIM: To evaluate the association between the levels of homocysteine (Hcy), folate, vitamin B12 in human immunodeficiency virus (HIV)-infected patients who were treated with antiretroviral therapy (ART) or not treated with ART. METHODS: The PubMed and Scielo databases were searched. Eligible studies regarding plasma Hcy level in HIV-infected patients were firstly identified. After careful analysis by two independent researches, the identified articles were included in the review according to two outcomes (1) Hcy, folate and vitamin B12 blood concentration in HIV-infected subjects vs health controls and; (2) Hcy blood concentration in HIV-infected subjects under ART vs not treated with ART. RevMan (version 5.2) was employed for data synthesis. RESULTS: A total of 12 studies were included in outcome 1 (1649 participants, 932 cases and 717 controls). Outcome 1 meta-analysis demonstrated higher plasma Hcy (2.05 µmol/L; 95%CI: 0.10 to 4.00, P < 0.01) and decreased plasma folate concentrations (-2.74 ng/mL; 95%CI: -5.18 to -0.29, P < 0.01) in HIV-infected patients compared to healthy controls. No changes in vitamin B12 plasma concentration were observed between groups. All studies included in the outcome 2 meta-analysis (1167 participants; 404 HIV-infected exposed to ART and 757 HIV-infected non-ART patients) demonstrated higher mean Hcy concentration in subjects HIV-infected under ART compared to non-ART HIV subjects (4.13 µmol/L; 95%CI: 1.34 to 6.92, P < 0.01). CONCLUSION: This meta-analysis demonstrated that the levels of Hcy and folate, but not vitamin B12, were associated with HIV infection. In addition, Hcy levels were higher in HIV-infected patients who were under ART compared to HIV-infected patients who were not exposed to ART. Our results suggest that hyperhomocysteinemia should be included among the several important metabolic disturbances that are associated with ART in patients with HIV infection. PMID:25964880

  6. Packaging interventions to increase medication adherence: systematic review and meta-analysis

    PubMed Central

    Conn, Vicki S.; Ruppar, Todd M.; Chan, Keith C.; Dunbar-Jacob, Jacqueline; Pepper, Ginette A.; De Geest, Sabina

    2015-01-01

    Objective Inadequate medication adherence is a widespread problem that contributes to increase chronic disease complications and health care expenditures. Packaging interventions using pill boxes and blister packs have been widely recommended to address the medication adherence issue. This meta-analysis review determined the overall effect of packaging interventions on medication adherence and health outcomes. In addition, we tested whether effects vary depending on intervention, sample, and design characteristics. Research design and methods Extensive literature search strategies included examination of 13 computerized databases and 19 research registries, hand searches of 57 journal, and author and ancestry searches. Eligible studies included either pill-boxes or blister packaging interventions to increase medication adherence. Primary study characteristics and outcomes were reliably coded. Random-effects analyses were used to calculate overall effect sizes and conduct moderator analyses. Results Data were synthesized across 22,858 subjects from 52 reports. The overall mean weighted standardized difference effect size for two-group comparisons was 0.593 (favoring treatment over control), which is consistent with the mean of 71% adherence for treatment subjects compared to 63% among control subjects. We found using moderator analyses that interventions were most effective when they used blister packs and were delivered in pharmacies, while interventions were less effective when studies included older subjects and those with cognitive impairment. Methodological moderator analyses revealed significantly larger effect sizes in studies reporting continuous data outcomes instead of dichotomous results and in studies using pharmacy refill medication adherence measures as compared to studies with self-report measures. Conclusions Overall, meta-analysis findings support the use of packaging interventions to effectively increase medication adherence. Limitations of the study include the exclusion of packaging interventions other than pill boxes and blister packs, evidence of publication bias, and primary study sparse reporting of health outcomes and potentially interesting moderating variables such as the number of prescribed medications. PMID:25333709

  7. RISK FACTORS FOR CONTACT LENS INDUCED PAPILLARY CONJUNCTIVITIS ASSOCIATED WITH SILICONE HYDROGEL CONTACT LENS WEAR

    PubMed Central

    Tagliaferri, Angela; Love, Thomas E.; Szczotka-Flynn, Loretta

    2014-01-01

    BACKGROUND Contact lens induced papillary conjunctivitis (CLPC) continues to be a major cause of dropout during contact lens extended wear. This retrospective study explores risk factors for the development of CLPC during silicone hydrogel lens extended wear. METHODS Data from 205 subjects enrolled in the Longitudinal Analysis of Silicone Hydrogel Contact Lens (LASH) study wearing lotrafilcon A silicone hydrogel lenses for up to 30 days of continuous wear were used to determine risk factors for CLPC in this secondary analysis of the main cohort. The main covariates of interest included substantial lens-associated bacterial bioburden, and topographically determined lens base curve-to-cornea fitting relationships. Additional covariates of interest included history of prior adverse events, time of year, race, education level, gender and other subject demographics. Statistical analyses included univariate logistic regression to assess the impact of potential risk factors on the binary CLPC outcome, and Cox proportional hazards regression to describe the impact of those factors on time-to-CLPC diagnosis. RESULTS Across 12 months of follow-up, 52 subjects (25%) experienced CLPC. No associations were found between CLPC development and the presence of bacterial bioburden, lens-to-cornea fitting relationships, history of prior adverse events, gender or race. CLPC development followed the same seasonal trends as the local peaks in environmental allergans. CONCLUSIONS Lens fit and biodeposits, in the form of lens associated bacterial bioburden, were not associated with the development of CLPC during extended wear with lotrafilcon A silicone hydrogel lenses. PMID:24681609

  8. Objective speech quality assessment and the RPE-LTP coding algorithm in different noise and language conditions.

    PubMed

    Hansen, J H; Nandkumar, S

    1995-01-01

    The formulation of reliable signal processing algorithms for speech coding and synthesis require the selection of a prior criterion of performance. Though coding efficiency (bits/second) or computational requirements can be used, a final performance measure must always include speech quality. In this paper, three objective speech quality measures are considered with respect to quality assessment for American English, noisy American English, and noise-free versions of seven languages. The purpose is to determine whether objective quality measures can be used to quantify changes in quality for a given voice coding method, with a known subjective performance level, as background noise or language conditions are changed. The speech coding algorithm chosen is regular-pulse excitation with long-term prediction (RPE-LTP), which has been chosen as the standard voice compression algorithm for the European Digital Mobile Radio system. Three areas are considered for objective quality assessment which include: (i) vocoder performance for American English in a noise-free environment, (ii) speech quality variation for three additive background noise sources, and (iii) noise-free performance for seven languages which include English, Japanese, Finnish, German, Hindi, Spanish, and French. It is suggested that although existing objective quality measures will never replace subjective testing, they can be a useful means of assessing changes in performance, identifying areas for improvement in algorithm design, and augmenting subjective quality tests for voice coding/compression algorithms in noise-free, noisy, and/or non-English applications.

  9. 40 CFR 80.161 - Detergent additive certification program.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... the subject detergent additive in each test fuel, and the corresponding test results (percent flow... penalties in §§ 80.169 and 80.172. (iii) If both parties submit the required information, EPA will evaluate... customers who use the disqualified detergent. Failure to do so may subject the certifier to liabilities for...

  10. The relationship between clinical characteristics, metacognitive appraisals, and cognitive insight in patients with obsessive-compulsive disorder.

    PubMed

    Ekinci, Okan; Ekinci, Asli

    2016-11-01

    Cognitive insight, a recently developed insight measure, refers to metacognitive processes of the re-evaluation and correction of distorted beliefs and misinterpretations. However, to the best of the authors' knowledge, no study has specifically examined cognitive insight, demographics, psychopathological variables, and distorted beliefs in OCD. The aim of this research was to examine links between cognitive insight and demographics, clinical factors, and distorted beliefs among patients with OCD. Eighty-four consecutive outpatients with a diagnosis of OCD underwent a detailed clinical assessment for OCD, including the Yale-Brown Obsessive-Compulsive Scale (Y-BOCS), Beck Cognitive Insight Scale (BCIS), Thought-Action Fusion Scale (TAFS), White Bear Thought Suppression Inventory, Metacognition Questioniarre-30 (MCQ-30), and a sociodemographic questionnaire. In addition, 82 control subjects matched for age, education, and gender were tested. BCIS-self-certainty scores were all substantially higher in subjects with remitted and unremitted OCD than in healthy comparison subjects, while BCIS-composite scores were significantly lower in both patient groups than controls. Obsession and compulsion severity had significant effects on BCIS scores. In addition, it was found that the specific symptoms were linked to self-certainty scores. Self-reflectiveness and composite scores had positive correlations with the sub-scale scores of the MCQ-30, while the TAF-morality score was positively correlated with self-certainty scores. The results demonstrated poor cognitive insight among remitted and unremitted OCD patients. In addition, the present study suggested significant associations between sociodemographic and clinical features and dysfunctional appraisals. Cognitive-behavioural techniques aimed at enhancing cognitive insight may be beneficial for patients with OCD, particularly patients who have prominent dysfunctional beliefs.

  11. Thresholds for thermal damage to normal tissues: an update.

    PubMed

    Yarmolenko, Pavel S; Moon, Eui Jung; Landon, Chelsea; Manzoor, Ashley; Hochman, Daryl W; Viglianti, Benjamin L; Dewhirst, Mark W

    2011-01-01

    The purpose of this review is to summarise a literature survey on thermal thresholds for tissue damage. This review covers published literature for the consecutive years from 2002-2009. The first review on this subject was published in 2003. It included an extensive discussion of how to use thermal dosimetric principles to normalise all time-temperature data histories to a common format. This review utilises those same principles to address sensitivity of a variety of tissues, but with particular emphasis on brain and testis. The review includes new data on tissues that were not included in the original review. Several important observations have come from this review. First, a large proportion of the papers examined for this review were discarded because time-temperature history at the site of thermal damage assessment was not recorded. It is strongly recommended that future research on this subject include such data. Second, very little data is available examining chronic consequences of thermal exposure. On a related point, the time of assessment of damage after exposure is critically important for assessing whether damage is transient or permanent. Additionally, virtually no data are available for repeated thermal exposures which may occur in certain recreational or occupational activities. For purposes of regulatory guidelines, both acute and lasting effects of thermal damage should be considered.

  12. Evaluating signal-to-noise ratios, loudness, and related measures as indicators of airborne sound insulation.

    PubMed

    Park, H K; Bradley, J S

    2009-09-01

    Subjective ratings of the audibility, annoyance, and loudness of music and speech sounds transmitted through 20 different simulated walls were used to identify better single number ratings of airborne sound insulation. The first part of this research considered standard measures such as the sound transmission class the weighted sound reduction index (R(w)) and variations of these measures [H. K. Park and J. S. Bradley, J. Acoust. Soc. Am. 126, 208-219 (2009)]. This paper considers a number of other measures including signal-to-noise ratios related to the intelligibility of speech and measures related to the loudness of sounds. An exploration of the importance of the included frequencies showed that the optimum ranges of included frequencies were different for speech and music sounds. Measures related to speech intelligibility were useful indicators of responses to speech sounds but were not as successful for music sounds. A-weighted level differences, signal-to-noise ratios and an A-weighted sound transmission loss measure were good predictors of responses when the included frequencies were optimized for each type of sound. The addition of new spectrum adaptation terms to R(w) values were found to be the most practical approach for achieving more accurate predictions of subjective ratings of transmitted speech and music sounds.

  13. Open-label observation of addition of etanercept versus a conventional disease-modifying antirheumatic drug in subjects with active rheumatoid arthritis despite methotrexate therapy in the Latin American region.

    PubMed

    Machado, Daniel A; Guzman, Renato M; Xavier, Ricardo M; Simon, J Abraham; Mele, Linda; Pedersen, Ronald; Ferdousi, Tahmina; Koenig, Andrew S; Kotak, Sameer; Vlahos, Bonnie

    2014-01-01

    Previous global studies examined etanercept (ETN) + methotrexate (MTX) for treatment of rheumatoid arthritis (RA), but included few subjects from Latin America. The objective of this study was to compare the safety and efficacy of ETN + MTX versus a standard-of-care disease-modifying antirheumatic drug (DMARD) + MTX in Latin American subjects with moderate to severe active RA despite MTX therapy. This open-label, active-comparator study (NCT00848354) randomized subjects 2:1 to ETN 50 mg/wk + MTX or investigator-selected DMARD (sulfasalazine or hydroxychloroquine) + MTX (ETN + MTX, n = 281; DMARD + MTX, n = 142). The primary end point was the proportion achieving American College of Rheumatology (ACR) 50 at week 24. Secondary end points included ACR20/70, disease activity score (DAS) 28 measures, and mean change in modified total Sharp score. Patient-reported outcomes were the Health Assessment Questionnaire, 36-item Short-Form, Hospital Anxiety and Depression Scale, Work Productivity and Activity Impairment: RA (WPAI:RA), and Caregiver Burden and Resource Utilization. Statistical analyses were stratified by country; χ test and analysis of covariance were used. Adverse events were monitored. More subjects achieved ACR50 at week 24 with ETN + MTX versus DMARD + MTX (62% vs 23%, respectively), in addition to secondary end points (P < 0.0001 for all); mean change in modified total Sharp score was lower for the ETN + MTX group (0.4 vs 1.4, respectively; P = 0.0270). Improvements in patient-reported outcomes favored ETN + MTX for Health Assessment Questionnaire, 36-item Short-Form, Hospital Anxiety and Depression Scale for depression, WPAI:RA, and Caregiver Burden and Resource Utilization emergency department visits for RA (P < 0.01). Overall, adverse events were similar between the groups (69% vs 68%,); serious adverse events were also similar (4% vs 1%). The rate of overall infections was higher with ETN + MTX (38%) than DMARD + MTX (22%, P ≤ 0.001). Consistent with published global data among RA patients with inadequate response to MTX, adding ETN to MTX demonstrated better efficacy than adding one other conventional DMARD to MTX. No new safety issues were observed. ETN + MTX provided favorable benefit-risk profile among RA patients from LA region.

  14. Fifth Summit of the Americas, Port of Spain, Trinidad and Tobago, April 2009: Background, Agenda, and Expectations

    DTIC Science & Technology

    2009-01-21

    taken the leads.26 Additionally, the first Latin America and Caribbean Integration and Development Summit, held in Salvador de Bahia Brazil on December...of law, no person shall be subject to a penalty for failing to comply with a collection of information if it does not display a currently valid OMB...failure because of its divisiveness, it too produced a number of important initiatives, including support for Haiti’s democracy, improved infrastructure

  15. Multi-Agent Software Design and Engineering for Human Centered Collaborative Autonomous Space Systems: NASA Intelligent Systems

    NASA Technical Reports Server (NTRS)

    Bradshaw, Jeffrey M.

    2005-01-01

    Detailed results of this three-year project are available in 37 publications, including 7 book chapters, 3 journal articles, and 27 refereed conference proceedings. In addition, various aspects of the project were the subject of 31 invited presentations and 6 tutorials at international conferences and workshops. Good descriptions of prior and ongoing work on foundational technologies in Brahms, KAoS, NOMADS, and the PSA project can be found in numerous publications not listed here.

  16. A numerical solution of Duffing's equations including the prediction of jump phenomena

    NASA Technical Reports Server (NTRS)

    Moyer, E. T., Jr.; Ghasghai-Abdi, E.

    1987-01-01

    Numerical methodology for the solution of Duffing's differential equation is presented. Algorithms for the prediction of multiple equilibrium solutions and jump phenomena are developed. In addition, a filtering algorithm for producing steady state solutions is presented. The problem of a rigidly clamped circular plate subjected to cosinusoidal pressure loading is solved using the developed algorithms (the plate is assumed to be in the geometrically nonlinear range). The results accurately predict regions of solution multiplicity and jump phenomena.

  17. GMSEC Interface Specification Document 2016 March

    NASA Technical Reports Server (NTRS)

    Handy, Matthew

    2016-01-01

    The GMSEC Interface Specification Document contains the standard set of defined messages. Each GMSEC standard message contains a GMSEC Information Bus Header section and a Message Contents section. Each message section identifies required fields, optional fields, data type and recommended use of the fields. Additionally, this document includes the message subjects associated with the standard messages. The system design of the operations center should ensure the components that are selected use both the API and the defined standard messages in order to achieve full interoperability from component to component.

  18. DOD Civilian and Contractor Workforces: Additional Cost Savings Data and Efficiencies Plan are Needed

    DTIC Science & Technology

    2016-10-01

    reductions reported in average strength bNumber of reductions reported in full-time equivalents Note: DOD costs savings provided for the prior FY are...comparing costs from FY 2012 to FY 2017, and not each year in between. Further, officials stated that DOD did not include full- time equivalents ...Application FTE Full-time Equivalent NDAA National Defense Authorization Act This is a work of the U.S. government and is not subject to copyright

  19. Beer Drinking Games: Categories, Level of Risk, and their Correlation with Sensation Seeking

    DTIC Science & Technology

    1994-07-01

    Maximum 200 words) moo, AU 1F2 1994 . . F 14 . SUBJECT TERMS 15. NUMBER OF PAGES 16. PRICE CODE 17. SECURITY CLASSIFICATION 18. SECURITY CLASSIFICATION ig...availability or limitations. Cite any Block 2. Report Date. Full publication date availability to the public. Enter additional including day, month, and year ...if available (e.g. 1 limitations or special markings in all capitals (e.g. Jan 88). Must cite at least the year . NOFORN, REL, ITAR). Block 3. Type of

  20. Group typicality, group loyalty and cognitive development.

    PubMed

    Patterson, Meagan M

    2014-09-01

    Over the course of childhood, children's thinking about social groups changes in a variety of ways. Developmental Subjective Group Dynamics (DSGD) theory emphasizes children's understanding of the importance of conforming to group norms. Abrams et al.'s study, which uses DSGD theory as a framework, demonstrates the social cognitive skills underlying young elementary school children's thinking about group norms. Future research on children's thinking about groups and group norms should explore additional elements of this topic, including aspects of typicality beyond loyalty. © 2014 The British Psychological Society.

Top