CODATA Fundamental Physical Constants

National Institute of Standards and Technology Data Gateway

SRD 121 NIST CODATA Fundamental Physical Constants (Web, free access)   This site, developed in the Physics Laboratory at NIST, addresses three topics: fundamental physical constants, the International System of Units (SI), which is the modern metric system, and expressing the uncertainty of measurement results.

The History of Mathematics and Mathematical Education

ERIC Educational Resources Information Center

Grattan-Guinness, I.

1977-01-01

Answers to questions which were asked after the author's various lectures in Australia are gathered here. Topics touched upon include "new" mathematics, unknown constants and free variables, propositional functions, linear algebra, arithmetic and geometry, and student assessment. (MN)

Adaptive Fuzzy Output Constrained Control Design for Multi-Input Multioutput Stochastic Nonstrict-Feedback Nonlinear Systems.

PubMed

Li, Yongming; Tong, Shaocheng

2017-12-01

In this paper, an adaptive fuzzy output constrained control design approach is addressed for multi-input multioutput uncertain stochastic nonlinear systems in nonstrict-feedback form. The nonlinear systems addressed in this paper possess unstructured uncertainties, unknown gain functions and unknown stochastic disturbances. Fuzzy logic systems are utilized to tackle the problem of unknown nonlinear uncertainties. The barrier Lyapunov function technique is employed to solve the output constrained problem. In the framework of backstepping design, an adaptive fuzzy control design scheme is constructed. All the signals in the closed-loop system are proved to be bounded in probability and the system outputs are constrained in a given compact set. Finally, the applicability of the proposed controller is well carried out by a simulation example.

Cosmological Constant as a Manifestation of the Hierarchy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Pisin; Gu, Je-An

2007-12-21

There has been the suggestion that the cosmological constant as implied by the dark energy is related to the well-known hierarchy between the Planck scale, M{sub PI}, and the Standard Model scale, M{sub SM}. Here we further propose that the same framework that addresses this hierarchy problem must also address the smallness problem of the cosmological constant. Specifically, we investigate the minimal supersymmetric (SUSY) extension of the Randall-Sundrum model where SUSY-breaking is induced on the TeV brane and transmitted into the bulk. We show that the Casimir energy density of the system indeed conforms with the observed dark energy scale.

A Study of Terrain Reductions, Density Anomalies and Geophysical Inversion Methods in Gravity Field Modelling

DTIC Science & Technology

1984-04-01

5.15) where a is a positive constant and 11 IIH the Hilbert space norm associated with the chosen covariance function K. The constant a is arbitrary...Density Anomalies 14 5. Unknown Densities - Geophysical Inversion 16 6. Density Modelling Using Rectangular Prisms 24 6.1 Space Domain 24 6.2 Frequency...theory: to calculate the gravity potential and its derivatives in space due to 6 • given density distributions. When the prime interest is in "external

Developmental cardiovascular physiology of the olive ridley sea turtle (Lepidochelys olivacea).

PubMed

Crossley, Dane Alan; Crossley, Janna Lee; Smith, Camilla; Harfush, Martha; Sánchez-Sánchez, Hermilo; Garduño-Paz, Mónica Vanessa; Méndez-Sánchez, José Fernando

2017-09-01

Our understanding of reptilian cardiovascular development and regulation has increased substantially for two species the American alligator (Alligator mississippiensis) and the common snapping turtle (Chelydra serpentina) during the past two decades. However, what we know about cardiovascular maturation in many other species remains poorly understood or unknown. Embryonic sea turtles have been studied to understand the maturation of metabolic function, but these studies have not addressed the cardiovascular system. Although prior studies have been pivotal in characterizing development, and factors that influence it, the development of cardiovascular function, which supplies metabolic function, is unknown in sea turtles. During our investigation we focused on quantifying how cardiovascular morphological and functional parameters change, to provide basic knowledge of development in the olive ridley sea turtle (Lepidochelys olivacea). Embryonic mass, as well as mass of the heart, lungs, liver, kidney, and brain increased during turtle embryo development. Although heart rate was constant during this developmental period, arterial pressure approximately doubled. Further, while embryonic olive ridley sea turtles lacked cholinergic tone on heart rate, there was a pronounced beta adrenergic tone on heart rate that decreased in strength at 90% of incubation. This beta adrenergic tone may be partially originating from the sympathetic nervous system at 90% of incubation, with the majority originating from circulating catecholamines. Data indicates that olive ridley sea turtles share traits of embryonic functional cardiovascular maturation with the American alligator (Alligator mississippiensis) but not the common snapping turtle (Chelydra serpentina). Copyright © 2017 Elsevier Inc. All rights reserved.

Discrete-time switching periodic adaptive control for time-varying parameters with unknown periodicity

NASA Astrophysics Data System (ADS)

Yu, Miao; Huang, Deqing; Yang, Wanqiu

2018-06-01

In this paper, we address the problem of unknown periodicity for a class of discrete-time nonlinear parametric systems without assuming any growth conditions on the nonlinearities. The unknown periodicity hides in the parametric uncertainties, which is difficult to estimate with existing techniques. By incorporating a logic-based switching mechanism, we identify the period and bound of unknown parameter simultaneously. Lyapunov-based analysis is given to demonstrate that a finite number of switchings can guarantee the asymptotic tracking for the nonlinear parametric systems. The simulation result also shows the efficacy of the proposed switching periodic adaptive control approach.

On Space Exploration and Human Error: A Paper on Reliability and Safety

NASA Technical Reports Server (NTRS)

Bell, David G.; Maluf, David A.; Gawdiak, Yuri

2005-01-01

NASA space exploration should largely address a problem class in reliability and risk management stemming primarily from human error, system risk and multi-objective trade-off analysis, by conducting research into system complexity, risk characterization and modeling, and system reasoning. In general, in every mission we can distinguish risk in three possible ways: a) known-known, b) known-unknown, and c) unknown-unknown. It is probably almost certain that space exploration will partially experience similar known or unknown risks embedded in the Apollo missions, Shuttle or Station unless something alters how NASA will perceive and manage safety and reliability

On the role of constant-stress surfaces in the problem of minimizing elastic stress concentration

NASA Technical Reports Server (NTRS)

Wheeler, L.

1976-01-01

Cases involving antiplane shear deformation, axisymmetric torsion, and plane strain theory, with surfaces of constant stress magnitude optimal in terms of minimizing stress, are investigated. Results for the plane theory refer to exterior doubly connected domains. Stresses generated by torsion of an elastic solid lying within a radially convex region of revolution with plane ends, body force absent, and lateral surface traction-free, are examined. The unknown portion of the boundary of such domains may involve a hole, fillet, or notch.

Analytical Dimensional Reduction of a Fuel Optimal Powered Descent Subproblem

NASA Technical Reports Server (NTRS)

Rea, Jeremy R.; Bishop, Robert H.

2010-01-01

Current renewed interest in exploration of the moon, Mars, and other planetary objects is driving technology development in many fields of space system design. In particular, there is a desire to land both robotic and human missions on the moon and elsewhere. The landing guidance system must be able to deliver the vehicle to a desired soft landing while meeting several constraints necessary for the safety of the vehicle. Due to performance limitations of current launch vehicles, it is desired to minimize the amount of fuel used. In addition, the landing site may change in real-time in order to avoid previously undetected hazards which become apparent during the landing maneuver. This complicated maneuver can be broken into simpler subproblems that bound the full problem. One such subproblem is to find a minimum-fuel landing solution that meets constraints on the initial state, final state, and bounded thrust acceleration magnitude. With the assumptions of constant gravity and negligible atmosphere, the form of the optimal steering law is known, and the equations of motion can be integrated analytically, resulting in a system of five equations in five unknowns. It is shown that this system of equations can be reduced analytically to two equations in two unknowns. With an additional assumption of constant thrust acceleration magnitude, this system can be reduced further to one equation in one unknown. It is shown that these unknowns can be bounded analytically. An algorithm is developed to quickly and reliably solve the resulting one-dimensional bounded search, and it is used as a real-time guidance applied to a lunar landing test case.

Ada Compiler Validation Summary Report: Certificate Number: 940630W1. 11360, Radional Software Corporation, VADSself for DEC Alpha AXP OSF/1, Product Number: 2100-01439, Version 6.2, DEC 3000 Model 500 AXP under OSF/1, V1.3

DTIC Science & Technology

1994-07-21

for the task’s type. The address of an ADA KRN DEFS.TASK ATTR T record is the argument of the piagma and- is passed to the underlying microkernel at...task creation. The task attributes are microkernel dependent. See ada krn defs.a in standard for the type definition of TASK ATTR T and the different...ENDIAN, BIG _4DIAN BYTE-ORDER: constant BYTE ORDER T :- LITTLEENDIAN; type L4 _ADDRESS is private; NO_ LONG_ADDR : constant 10CG_ADDRESS; function

Decentralised output feedback control of Markovian jump interconnected systems with unknown interconnections

NASA Astrophysics Data System (ADS)

Li, Li-Wei; Yang, Guang-Hong

2017-07-01

The problem of decentralised output feedback control is addressed for Markovian jump interconnected systems with unknown interconnections and general transition rates (TRs) allowed to be unknown or known with uncertainties. A class of decentralised dynamic output feedback controllers are constructed, and a cyclic-small-gain condition is exploited to dispose the unknown interconnections so that the resultant closed-loop system is stochastically stable and satisfies an H∞ performance. With slack matrices to cope with the nonlinearities incurred by unknown and uncertain TRs in control synthesis, a novel controller design condition is developed in linear matrix inequality formalism. Compared with the existing works, the proposed approach leads to less conservatism. Finally, two examples are used to illustrate the effectiveness of the new results.

On global optimization using an estimate of Lipschitz constant and simplicial partition

NASA Astrophysics Data System (ADS)

Gimbutas, Albertas; Žilinskas, Antanas

2016-10-01

A new algorithm is proposed for finding the global minimum of a multi-variate black-box Lipschitz function with an unknown Lipschitz constant. The feasible region is initially partitioned into simplices; in the subsequent iteration, the most suitable simplices are selected and bisected via the middle point of the longest edge. The suitability of a simplex for bisection is evaluated by minimizing of a surrogate function which mimics the lower bound for the considered objective function over that simplex. The surrogate function is defined using an estimate of the Lipschitz constant and the objective function values at the vertices of a simplex. The novelty of the algorithm is the sophisticated method of estimating the Lipschitz constant, and the appropriate method to minimize the surrogate function. The proposed algorithm was tested using 600 random test problems of different complexity, showing competitive results with two popular advanced algorithms which are based on similar assumptions.

Predicting DNA hybridization kinetics from sequence

NASA Astrophysics Data System (ADS)

Zhang, Jinny X.; Fang, John Z.; Duan, Wei; Wu, Lucia R.; Zhang, Angela W.; Dalchau, Neil; Yordanov, Boyan; Petersen, Rasmus; Phillips, Andrew; Zhang, David Yu

2018-01-01

Hybridization is a key molecular process in biology and biotechnology, but so far there is no predictive model for accurately determining hybridization rate constants based on sequence information. Here, we report a weighted neighbour voting (WNV) prediction algorithm, in which the hybridization rate constant of an unknown sequence is predicted based on similarity reactions with known rate constants. To construct this algorithm we first performed 210 fluorescence kinetics experiments to observe the hybridization kinetics of 100 different DNA target and probe pairs (36 nt sub-sequences of the CYCS and VEGF genes) at temperatures ranging from 28 to 55 °C. Automated feature selection and weighting optimization resulted in a final six-feature WNV model, which can predict hybridization rate constants of new sequences to within a factor of 3 with ∼91% accuracy, based on leave-one-out cross-validation. Accurate prediction of hybridization kinetics allows the design of efficient probe sequences for genomics research.

A leader's framework for decision making. A leader's framework for decision making.

PubMed

Snowden, David J; Boone, Mary E

2007-11-01

Many executives are surprised when previously successful leadership approaches fail in new situations, but different contexts call for different kinds of responses. Before addressing a situation, leaders need to recognize which context governs it -and tailor their actions accordingly. Snowden and Boone have formed a new perspective on leadership and decision making that's based on complexity science. The result is the Cynefin framework, which helps executives sort issues into five contexts: Simple contexts are characterized by stability and cause-and-effect relationships that are clear to everyone. Often, the right answer is self-evident. In this realm of "known knowns," leaders must first assess the facts of a situation -that is, "sense" it -then categorize and respond to it. Complicated contexts may contain multiple right answers, and though there is a clear relationship between cause and effect, not everyone can see it. This is the realm of "known unknowns." Here, leaders must sense, analyze, and respond. In a complex context, right answers can't be ferreted out at all; rather, instructive patterns emerge if the leader conducts experiments that can safely fail. This is the realm of "unknown unknowns," where much of contemporary business operates. Leaders in this context need to probe first, then sense, and then respond. In a chaotic context, searching for right answers is pointless. The relationships between cause and effect are impossible to determine because they shift constantly and no manageable patterns exist. This is the realm of unknowables (the events of September 11, 2001, fall into this category). In this domain, a leader must first act to establish order, sense where stability is present, and then work to transform the situation from chaos to complexity. The fifth context, disorder, applies when it is unclear which of the other four contexts is predominant. The way out is to break the situation into its constituent parts and assign each to one of the other four realms. Leaders can then make decisions and intervene in contextually appropriate ways.

Colloidal Metamaterials at Optical Frequencies

DTIC Science & Technology

2014-07-18

NUMBER 6. AUTHOR(S) 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES...8. PERFORMING ORGANIZATION REPORT NUMBER 9. SPONSORING / MONITORING AGENCY NAME(S) AND ADDRESS(ES) 10. SPONSOR...optical constants from Johnson and Christy) with a 2 nm interparticle spacing. All calculations were performed assuming an aqueous embedding medium (n

A nudging data assimilation algorithm for the identification of groundwater pumping

NASA Astrophysics Data System (ADS)

Cheng, Wei-Chen; Kendall, Donald R.; Putti, Mario; Yeh, William W.-G.

2009-08-01

This study develops a nudging data assimilation algorithm for estimating unknown pumping from private wells in an aquifer system using measured data of hydraulic head. The proposed algorithm treats the unknown pumping as an additional sink term in the governing equation of groundwater flow and provides a consistent physical interpretation for pumping rate identification. The algorithm identifies the unknown pumping and, at the same time, reduces the forecast error in hydraulic heads. We apply the proposed algorithm to the Las Posas Groundwater Basin in southern California. We consider the following three pumping scenarios: constant pumping rates, spatially varying pumping rates, and temporally varying pumping rates. We also study the impact of head measurement errors on the proposed algorithm. In the case study we seek to estimate the six unknown pumping rates from private wells using head measurements from four observation wells. The results show an excellent rate of convergence for pumping estimation. The case study demonstrates the applicability, accuracy, and efficiency of the proposed data assimilation algorithm for the identification of unknown pumping in an aquifer system.

A nudging data assimilation algorithm for the identification of groundwater pumping

NASA Astrophysics Data System (ADS)

Cheng, W.; Kendall, D. R.; Putti, M.; Yeh, W. W.

2008-12-01

This study develops a nudging data assimilation algorithm for estimating unknown pumping from private wells in an aquifer system using measurement data of hydraulic head. The proposed algorithm treats the unknown pumping as an additional sink term in the governing equation of groundwater flow and provides a consistently physical interpretation for pumping rate identification. The algorithm identifies unknown pumping and, at the same time, reduces the forecast error in hydraulic heads. We apply the proposed algorithm to the Las Posas Groundwater Basin in southern California. We consider the following three pumping scenarios: constant pumping rate, spatially varying pumping rates, and temporally varying pumping rates. We also study the impact of head measurement errors on the proposed algorithm. In the case study, we seek to estimate the six unknown pumping rates from private wells using head measurements from four observation wells. The results show excellent rate of convergence for pumping estimation. The case study demonstrates the applicability, accuracy, and efficiency of the proposed data assimilation algorithm for the identification of unknown pumping in an aquifer system.

Ecological Regional Analysis Applied to Campus Sustainability Performance

ERIC Educational Resources Information Center

Weber, Shana; Newman, Julie; Hill, Adam

2017-01-01

Purpose: Sustainability performance in higher education is often evaluated at a generalized large scale. It remains unknown to what extent campus efforts address regional sustainability needs. This study begins to address this gap by evaluating trends in performance through the lens of regional environmental characteristics.…

49 CFR 178.348-4 - Pressure relief.

Code of Federal Regulations, 2010 CFR

2010-10-01

... = The latent heat of vaporization of the lading—calories per gram (BTU/lb); Z = The compressibility... maximum loading and unloading rates must be included on the metal specification plate. (3) Cargo tanks... = A constant derived from (K), the ratio of specific heats of the vapor. If (K) is unknown, let C...

47. Photocopy of photograph (negative made from original photograph property ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

47. Photocopy of photograph (negative made from original photograph property of The Wichita Eagle newspaper, Wichita, Kansas), photographer unknown, date on photograph 1948. View of southeast, Building 8 - Veterans Administration Center, Officers Duplex Quarters, 5302 East Kellogg (Legal Address); 5500 East Kellogg (Common Address), Wichita, Sedgwick County, KS

Modeling Transit Patterns Via Mobile App Logs.

DOT National Transportation Integrated Search

2016-01-01

Transit planners need detailed information of the trips people take using public transit in : order to design more optimal routes, address new construction projects, and address the : constantly changing needs of a city and metro region. Better trans...

Absolute NMR shielding scales and nuclear spin–rotation constants in {sup 175}LuX and {sup 197}AuX (X = {sup 19}F, {sup 35}Cl, {sup 79}Br and {sup 127}I)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Demissie, Taye B., E-mail: taye.b.demissie@uit.no; Komorovsky, Stanislav; Repisky, Michal

2015-10-28

We present nuclear spin–rotation constants, absolute nuclear magnetic resonance (NMR) shielding constants, and shielding spans of all the nuclei in {sup 175}LuX and {sup 197}AuX (X = {sup 19}F, {sup 35}Cl, {sup 79}Br, {sup 127}I), calculated using coupled-cluster singles-and-doubles with a perturbative triples (CCSD(T)) correction theory, four-component relativistic density functional theory (relativistic DFT), and non-relativistic DFT. The total nuclear spin–rotation constants determined by adding the relativistic corrections obtained from DFT calculations to the CCSD(T) values are in general in agreement with available experimental data, indicating that the computational approach followed in this study allows us to predict reliable results formore » the unknown spin–rotation constants in these molecules. The total NMR absolute shielding constants are determined for all the nuclei following the same approach as that applied for the nuclear spin–rotation constants. In most of the molecules, relativistic effects significantly change the computed shielding constants, demonstrating that straightforward application of the non-relativistic formula relating the electronic contribution to the nuclear spin–rotation constants and the paramagnetic contribution to the shielding constants does not yield correct results. We also analyze the origin of the unusually large absolute shielding constant and its relativistic correction of gold in AuF compared to the other gold monohalides.« less

The vibrational dependence of dissociative recombination: Rate constants for N{sub 2}{sup +}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Guberman, Steven L., E-mail: slg@sci.org

Dissociative recombination rate constants are reported with electron temperature dependent uncertainties for the lowest 5 vibrational levels of the N{sub 2}{sup +} ground state. The rate constants are determined from ab initio calculations of potential curves, electronic widths, quantum defects, and cross sections. At 100 K electron temperature, the rate constants overlap with the exception of the third vibrational level. At and above 300 K, the rate constants for excited vibrational levels are significantly smaller than that for the ground level. It is shown that any experimentally determined total rate constant at 300 K electron temperature that is smaller thanmore » 2.0 × 10{sup −7} cm{sup 3}/s is likely to be for ions that have a substantially excited vibrational population. Using the vibrational level specific rate constants, the total rate constant is in very good agreement with that for an excited vibrational distribution found in a storage ring experiment. It is also shown that a prior analysis of a laser induced fluorescence experiment is quantitatively flawed due to the need to account for reactions with unknown rate constants. Two prior calculations of the dissociative recombination rate constant are shown to be inconsistent with the cross sections upon which they are based. The rate constants calculated here contribute to the resolution of a 30 year old disagreement between modeled and observed N{sub 2}{sup +} ionospheric densities.« less

A combined ANN-GA and experimental based technique for the estimation of the unknown heat flux for a conjugate heat transfer problem

NASA Astrophysics Data System (ADS)

M K, Harsha Kumar; P S, Vishweshwara; N, Gnanasekaran; C, Balaji

2018-05-01

The major objectives in the design of thermal systems are obtaining the information about thermophysical, transport and boundary properties. The main purpose of this paper is to estimate the unknown heat flux at the surface of a solid body. A constant area mild steel fin is considered and the base is subjected to constant heat flux. During heating, natural convection heat transfer occurs from the fin to ambient. The direct solution, which is the forward problem, is developed as a conjugate heat transfer problem from the fin and the steady state temperature distribution is recorded for any assumed heat flux. In order to model the natural convection heat transfer from the fin, an extended domain is created near the fin geometry and air is specified as a fluid medium and Navier Stokes equation is solved by incorporating the Boussinesq approximation. The computational time involved in executing the forward model is then reduced by developing a neural network (NN) between heat flux values and temperatures based on back propagation algorithm. The conjugate heat transfer NN model is now coupled with Genetic algorithm (GA) for the solution of the inverse problem. Initially, GA is applied to the pure surrogate data, the results are then used as input to the Levenberg- Marquardt method and such hybridization is proven to result in accurate estimation of the unknown heat flux. The hybrid method is then applied for the experimental temperature to estimate the unknown heat flux. A satisfactory agreement between the estimated and actual heat flux is achieved by incorporating the hybrid method.

Radical Chemistry and Structural Relationships of PPCP Degradation by UV/Chlorine Treatment in Simulated Drinking Water.

PubMed

Guo, Kaiheng; Wu, Zihao; Shang, Chii; Yao, Bo; Hou, Shaodong; Yang, Xin; Song, Weihua; Fang, Jingyun

2017-09-19

The UV/chlorine process is an emerging advanced oxidation process (AOP) used for the degradation of micropollutants. However, the radical chemistry of this AOP is largely unknown for the degradation of numerous structurally diverse micropollutants in water matrices of varying quality. These issues were addressed by grouping 34 pharmaceuticals and personal care products (PPCPs) according to the radical chemistry of their degradation in the UV/chlorine process at practical PPCP concentrations (1 μg L -1 ) and in different water matrices. The contributions of HO • and reactive chlorine species (RCS), including Cl • , Cl 2 •- , and ClO • , to the degradation of different PPCPs were compound specific. RCS showed considerable reactivity with olefins and benzene derivatives, such as phenols, anilines, and alkyl-/alkoxybenzenes. A good linear relationship was found between the RCS reactivity and negative values of the Hammett ∑σ p + constant for aromatic PPCPs, indicating that electron-donating groups promote the attack of benzene derivatives by RCS. The contribution of HO • , but not necessarily RCS, to PPCP removal decreased with increasing pH. ClO • showed high reactivity with some PPCPs, such as carbamazepine, caffeine, and gemfibrozil, with second-order rate constants of 9.2 × 10 7 , 1.03 × 10 8 , and 4.16 × 10 8 M -1 s -1 , respectively, which contributed to their degradation. Natural organic matter (NOM) induced significant scavenging of ClO • and greatly decreased the degradation of PPCPs that was attributable to ClO • , with a second-order rate constant of 4.5 × 10 4 (mg L -1 ) -1 s -1 . Alkalinity inhibited the degradation of PPCPs that was primarily attacked by HO • and Cl • but had negligible effects on the degradation of PPCPs by ClO • . This is the first study on the reactivity of RCS, particularly ClO • , with structurally diverse PPCPs under simulated drinking water condition.

All You Need to Know about Videodiscs: One Easy Lesson.

ERIC Educational Resources Information Center

Padgett, Helen L.

1993-01-01

Explains videodisc technology and its uses in education. Topics addressed include formats of videodiscs, including CAV discs (constant angular velocity) and CLV discs (constant linear velocity); the three industry-standard levels of interactivity; bar codes; bar-code readers; and finding information on a videodisc. (LRW)

The Negotiation of Lived Spaces by Unauthorized College Aged Youth

ERIC Educational Resources Information Center

Jacobo, Rodolfo

2010-01-01

Throughout the United States, undocumented students live in constant fear of their legal status being disclosed, and despite their educational success and professional objectives, face uncertainty and an unknown future. This study has put forward the question of what are the effects of the symbiotic relationship of a historical anti-Mexican…

Time-Varying Effects of Family Ethnic Socialization on Ethnic-Racial Identity Development among Latino Adolescents

ERIC Educational Resources Information Center

Douglass, Sara; Umaña-Taylor, Adriana J.

2016-01-01

Previous research has established that family ethnic socialization messages promote ethnic-racial identity (ERI) development, yet it is unknown whether these effects remain constant throughout adolescence. The current study examined the time-varying effects of family ethnic socialization on ERI exploration and resolution among Latino adolescents…

Estimation of Complex Permittivity of Composite Multilayer Material at Microwave Frequency Using Waveguide Measurements

NASA Technical Reports Server (NTRS)

Deshpande, Manohar D.; Dudley, Kenneth

2003-01-01

A simple method is presented to estimate the complex dielectric constants of individual layers of a multilayer composite material. Using the MatLab Optimization Tools simple MatLab scripts are written to search for electric properties of individual layers so as to match the measured and calculated S-parameters. A single layer composite material formed by using materials such as Bakelite, Nomex Felt, Fiber Glass, Woven Composite B and G, Nano Material #0, Cork, Garlock, of different thicknesses are tested using the present approach. Assuming the thicknesses of samples unknown, the present approach is shown to work well in estimating the dielectric constants and the thicknesses. A number of two layer composite materials formed by various combinations of above individual materials are tested using the present approach. However, the present approach could not provide estimate values close to their true values when the thicknesses of individual layers were assumed to be unknown. This is attributed to the difficulty in modelling the presence of airgaps between the layers while doing the measurement of S-parameters. A few examples of three layer composites are also presented.

46. Photocopy of photograph (negative made from original photograph property ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

46. Photocopy of photograph (negative made from original photograph property of The Wichita Eagle newspaper, Wichita, Kansas), photographer unknown, date on photograph 1943. View southeast, Building 8 is first structure on right - Veterans Administration Center, Officers Duplex Quarters, 5302 East Kellogg (Legal Address); 5500 East Kellogg (Common Address), Wichita, Sedgwick County, KS

Using Project-Based Learning to Design, Build, and Test Student-Made Photometer by Measuring the Unknown Concentration of Colored Substances

ERIC Educational Resources Information Center

Diawati, Chansyanah; Liliasari; Setiabudi, Agus; Buchari

2018-01-01

Students learned the principles and practice of photometry through project-based learning. They addressed the challenge of measuring the unknown concentration of a colored substance using a photometer they were required to design, build, and test. Then, they used that instrument to carry out the experiment and fulfill the challenge. A photometer…

An analytical approach to the external force-free motion of pendulums on surfaces of constant curvature

NASA Astrophysics Data System (ADS)

Rubio, Rafael M.; Salamanca, Juan J.

2018-07-01

The dynamics of external force free motion of pendulums on surfaces of constant Gaussian curvature is addressed when the pivot moves along a geodesic obtaining the Lagrangian of the system. As an application it is possible the study of elastic and quantum pendulums.

A deterministic global optimization using smooth diagonal auxiliary functions

NASA Astrophysics Data System (ADS)

Sergeyev, Yaroslav D.; Kvasov, Dmitri E.

2015-04-01

In many practical decision-making problems it happens that functions involved in optimization process are black-box with unknown analytical representations and hard to evaluate. In this paper, a global optimization problem is considered where both the goal function f (x) and its gradient f‧ (x) are black-box functions. It is supposed that f‧ (x) satisfies the Lipschitz condition over the search hyperinterval with an unknown Lipschitz constant K. A new deterministic 'Divide-the-Best' algorithm based on efficient diagonal partitions and smooth auxiliary functions is proposed in its basic version, its convergence conditions are studied and numerical experiments executed on eight hundred test functions are presented.

First Crewed Flight: Rationale, Considerations and Challenges from the Constellation Experience

NASA Technical Reports Server (NTRS)

Noriega, Carlos; Arceneaux, William; Williams, Jeffrey A.; Rhatigan, Jennifer L.

2011-01-01

NASA's Constellation Program has made the most progress in a generation towards building an integrated human-rated spacecraft and launch vehicle. During that development, it became clear that NASA's human-rating requirements lacked the specificity necessary to defend a program plan, particularly human-rating test flight plans, from severe budget challenges. This paper addresses the progress Constellation achieved, problems encountered in clarifying and defending a human-rating certification plan, and discusses key considerations for those who find themselves in similar straits with future human-rated spacecraft and vehicles. We assert, and support with space flight data, that NASA's current human-rating requirements do not adequately address "unknown-unknowns", or the unexpected things the hardware can reveal to the designer during test.

Parameter identification of thermophilic anaerobic degradation of valerate.

PubMed

Flotats, Xavier; Ahring, Birgitte K; Angelidaki, Irini

2003-01-01

The considered mathematical model of the decomposition of valerate presents three unknown kinetic parameters, two unknown stoichiometric coefficients, and three unknown initial concentrations for biomass. Applying a structural identifiability study, we concluded that it is necessary to perform simultaneous batch experiments with different initial conditions for estimating these parameters. Four simultaneous batch experiments were conducted at 55 degrees C, characterized by four different initial acetate concentrations. Product inhibition of valerate degradation by acetate was considered. Practical identification was done optimizing the sum of the multiple determination coefficients for all measured state variables and for all experiments simultaneously. The estimated values of kinetic parameters and stoichiometric coefficients were characterized by the parameter correlation matrix, the confidence interval, and the student's t-test at 5% significance level with positive results except for the saturation constant, for which more experiments for improving its identifiability should be conducted. In this article, we discuss kinetic parameter estimation methods.

42. Photocopy of photograph (negative made from original photograph displayed ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

42. Photocopy of photograph (negative made from original photograph displayed in office at Veterans Administration in Wichita, Kansas), photographer unknown, ca. 1935. Panoramic of campus, view of north and east, Building 8 is first structure on right - Veterans Administration Center, Officers Duplex Quarters, 5302 East Kellogg (Legal Address); 5500 East Kellogg (Common Address), Wichita, Sedgwick County, KS

The Constant Comparative Analysis Method Outside of Grounded Theory

ERIC Educational Resources Information Center

Fram, Sheila M.

2013-01-01

This commentary addresses the gap in the literature regarding discussion of the legitimate use of Constant Comparative Analysis Method (CCA) outside of Grounded Theory. The purpose is to show the strength of using CCA to maintain the emic perspective and how theoretical frameworks can maintain the etic perspective throughout the analysis. My…

A Quantitative Test of the Applicability of Independent Scattering to High Albedo Planetary Regoliths

NASA Technical Reports Server (NTRS)

Goguen, Jay D.

1993-01-01

To test the hypothesis that the independent scattering calculation widely used to model radiative transfer in atmospheres and clouds will give a useful approximation to the intensity and linear polarization of visible light scattered from an optically thick surface of transparent particles, laboratory measurements are compared to the independent scattering calculation for a surface of spherical particles with known optical constants and size distribution. Because the shape, size distribution, and optical constants of the particles are known, the independent scattering calculation is completely determined and the only remaining unknown is the net effect of the close packing of the particles in the laboratory sample surface...

A Nonlinear Spacecraft Attitude Controller and Observer with an Unknown Constant Gyro Bias and Gyro Noise

NASA Technical Reports Server (NTRS)

Deutschmann, Julie; Sanner, Robert M.

2001-01-01

A nonlinear control scheme for attitude control of a spacecraft is combined with a nonlinear gyro bias observer for the case of constant gyro bias, in the presence of gyro noise. The observer bias estimates converge exponentially to a mean square bound determined by the standard deviation of the gyro noise. The resulting coupled, closed loop dynamics are proven to be globally stable, with asymptotic tracking which is also mean square bounded. A simulation of the proposed observer-controller design is given for a rigid spacecraft tracking a specified, time-varying attitude sequence to illustrate the theoretical claims.

Alien in an Unknown World

ERIC Educational Resources Information Center

Gutierrez, M.

2011-01-01

In this article, the author describes his life experiences and how difficult it was for him as a Mexican immigrant living in the United States. His life changed when he moved to America, but his character changed when he started middle school. He had been constantly insulted by his classmates, and at the time he wanted to get revenge. The kids he…

Scare Tactics: There's Nothing Like a Good Ghost Story

ERIC Educational Resources Information Center

Mitchell, Saundra

2009-01-01

There's no doubt about it--paranormal fiction is hot right now. The author's shelves are full of vampires and werewolves, faeries and zombies. As a fan of all things supernatural, she is thrilled about this explosion of the immortal, the unknown, and the mythological. And yet, it feels like people missing the eternal constant in this renaissance:…

Production of Referring Expressions for an Unknown Audience: A Computational Model of Communal Common Ground

PubMed Central

Kutlak, Roman; van Deemter, Kees; Mellish, Chris

2016-01-01

This article presents a computational model of the production of referring expressions under uncertainty over the hearer's knowledge. Although situations where the hearer's knowledge is uncertain have seldom been addressed in the computational literature, they are common in ordinary communication, for example when a writer addresses an unknown audience, or when a speaker addresses a stranger. We propose a computational model composed of three complimentary heuristics based on, respectively, an estimation of the recipient's knowledge, an estimation of the extent to which a property is unexpected, and the question of what is the optimum number of properties in a given situation. The model was tested in an experiment with human readers, in which it was compared against the Incremental Algorithm and human-produced descriptions. The results suggest that the new model outperforms the Incremental Algorithm in terms of the proportion of correctly identified entities and in terms of the perceived quality of the generated descriptions. PMID:27630592

Cosmological Constant: A Lesson from Bose-Einstein Condensates

NASA Astrophysics Data System (ADS)

Finazzi, Stefano; Liberati, Stefano; Sindoni, Lorenzo

2012-02-01

The cosmological constant is one of the most pressing problems in modern physics. We address this issue from an emergent gravity standpoint, by using an analogue gravity model. Indeed, the dynamics of the emergent metric in a Bose-Einstein condensate can be described by a Poisson-like equation with a vacuum source term reminiscent of a cosmological constant. The direct computation of this term shows that in emergent gravity scenarios this constant may be naturally much smaller than the naive ground-state energy of the emergent effective field theory. This suggests that a proper computation of the cosmological constant would require a detailed understanding about how Einstein equations emerge from the full microscopic quantum theory. In this light, the cosmological constant appears as a decisive test bench for any quantum or emergent gravity scenario.

Cosmological constant: a lesson from Bose-Einstein condensates.

PubMed

Finazzi, Stefano; Liberati, Stefano; Sindoni, Lorenzo

2012-02-17

The cosmological constant is one of the most pressing problems in modern physics. We address this issue from an emergent gravity standpoint, by using an analogue gravity model. Indeed, the dynamics of the emergent metric in a Bose-Einstein condensate can be described by a Poisson-like equation with a vacuum source term reminiscent of a cosmological constant. The direct computation of this term shows that in emergent gravity scenarios this constant may be naturally much smaller than the naive ground-state energy of the emergent effective field theory. This suggests that a proper computation of the cosmological constant would require a detailed understanding about how Einstein equations emerge from the full microscopic quantum theory. In this light, the cosmological constant appears as a decisive test bench for any quantum or emergent gravity scenario.

Telling in-tune from out-of-tune: widespread evidence for implicit absolute intonation.

PubMed

Van Hedger, Stephen C; Heald, Shannon L M; Huang, Alex; Rutstein, Brooke; Nusbaum, Howard C

2017-04-01

Absolute pitch (AP) is the rare ability to name or produce an isolated musical note without the aid of a reference note. One skill thought to be unique to AP possessors is the ability to provide absolute intonation judgments (e.g., classifying an isolated note as "in-tune" or "out-of-tune"). Recent work has suggested that absolute intonation perception among AP possessors is not crystallized in a critical period of development, but is dynamically maintained by the listening environment, in which the vast majority of Western music is tuned to a specific cultural standard. Given that all listeners of Western music are constantly exposed to this specific cultural tuning standard, our experiments address whether absolute intonation perception extends beyond AP possessors. We demonstrate that non-AP listeners are able to accurately judge the intonation of completely isolated notes. Both musicians and nonmusicians showed evidence for absolute intonation recognition when listening to familiar timbres (piano and violin). When testing unfamiliar timbres (triangle and inverted sine waves), only musicians showed weak evidence of absolute intonation recognition (Experiment 2). Overall, these results highlight a previously unknown similarity between AP and non-AP possessors' long-term musical note representations, including evidence of sensitivity to frequency.

Explicit error bounds for the α-quasi-periodic Helmholtz problem.

PubMed

Lord, Natacha H; Mulholland, Anthony J

2013-10-01

This paper considers a finite element approach to modeling electromagnetic waves in a periodic diffraction grating. In particular, an a priori error estimate associated with the α-quasi-periodic transformation is derived. This involves the solution of the associated Helmholtz problem being written as a product of e(iαx) and an unknown function called the α-quasi-periodic solution. To begin with, the well-posedness of the continuous problem is examined using a variational formulation. The problem is then discretized, and a rigorous a priori error estimate, which guarantees the uniqueness of this approximate solution, is derived. In previous studies, the continuity of the Dirichlet-to-Neumann map has simply been assumed and the dependency of the regularity constant on the system parameters, such as the wavenumber, has not been shown. To address this deficiency, in this paper an explicit dependence on the wavenumber and the degree of the polynomial basis in the a priori error estimate is obtained. Since the finite element method is well known for dealing with any geometries, comparison of numerical results obtained using the α-quasi-periodic transformation with a lattice sum technique is then presented.

Prediction of battery storage ageing and solid electrolyte interphase property estimation using an electrochemical model

NASA Astrophysics Data System (ADS)

Ashwin, T. R.; Barai, A.; Uddin, K.; Somerville, L.; McGordon, A.; Marco, J.

2018-05-01

Ageing prediction is often complicated due to the interdependency of ageing mechanisms. Research has highlighted that storage ageing is not linear with time. Capacity loss due to storing the battery at constant temperature can shed more light on parametrising the properties of the Solid Electrolyte Interphase (SEI); the identification of which, using an electrochemical model, is systematically addressed in this work. A new methodology is proposed where any one of the available storage ageing datasets can be used to find the property of the SEI layer. A sensitivity study is performed with different molecular mass and densities which are key parameters in modelling the thickness of the SEI deposit. The conductivity is adjusted to fine tune the rate of capacity fade to match experimental results. A correlation is fitted for the side reaction variation to capture the storage ageing in the 0%-100% SoC range. The methodology presented in this paper can be used to predict the unknown properties of the SEI layer which is difficult to measure experimentally. The simulation and experimental results show that the storage ageing model shows good accuracy for the cases at 50% and 90% and an acceptable agreement at 20% SoC.

Classical Methods for Frequency-Based Equations of State

DTIC Science & Technology

2007-03-01

AH80 5e. TASK NUMBER 6. AUTHOR( S ) Steven B. Segletes 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME( S ) AND ADDRESS(ES) U.S. Army...SPONSOR/MONITOR’S ACRONYM( S ) 9. SPONSORING/MONITORING AGENCY NAME( S ) AND ADDRESS(ES) 11. SPONSOR/MONITOR’S REPORT NUMBER( S ) 12...which relates changes in pressure p and energy E at constant volume V [eqn (1)], and specific heat, which relates chang~ s in energy and temperature

Indigenous Continuance: Collaboration and Syncretism

ERIC Educational Resources Information Center

Ortiz, Simon J.

2011-01-01

In this keynote address, the author talks about Indigenous peoples who are presently in a dynamic circumstance of constant change that they are facing courageously with creative collaboration and syncretism. In the address, the author speaks "of" an Indigenous consciousness and he speaks "with" an Indigenous consciousness so that Indigenous…

Socioeconomic status and executive function: developmental trajectories and mediation.

PubMed

Hackman, Daniel A; Gallop, Robert; Evans, Gary W; Farah, Martha J

2015-09-01

Childhood socioeconomic status (SES) predicts executive function (EF), but fundamental aspects of this relation remain unknown: the developmental course of the SES disparity, its continued sensitivity to SES changes during that course, and the features of childhood experience responsible for the SES-EF relation. Regarding course, early disparities would be expected to grow during development if caused by accumulating stressors at a given constant level of SES. Alternatively, they would narrow if schooling partly compensates for the effects of earlier deprivation, allowing lower-SES children to 'catch up'. The potential for later childhood SES change to affect EF is also unknown. Regarding mediating factors, previous analyses produced mixed answers, possibly due to correlation amongst candidate mediators. We address these issues with measures of SES, working memory and planning, along with multiple candidate mediators, from the NICHD Study of Early Childcare (n = 1009). Early family income-to-needs and maternal education predicted planning by first grade, and income-to-needs predicted working memory performance at 54 months. Effects of early SES remained consistent through middle childhood, indicating that the relation between early indicators of SES and EF emerges in childhood and persists without narrowing or widening across early and middle childhood. Changes in family income-to-needs were associated with significant changes in planning and trend-level changes in working memory. Mediation analyses supported the role of early childhood home characteristics in explaining the association between SES and EF, while early childhood maternal sensitivity was specifically implicated in the association between maternal education and planning. Early emerging and persistent SES-related differences in EF, partially explained by characteristics of the home and family environment, are thus a potential source of socioeconomic disparities in achievement and health across development. © 2015 John Wiley & Sons Ltd.

The uncertainty of biodegradation rate constants of emerging organic compounds in soil and groundwater - A compilation of literature values for 82 substances.

PubMed

Greskowiak, Janek; Hamann, Enrico; Burke, Victoria; Massmann, Gudrun

2017-12-01

The present study reports on biodegradation rate constants of emerging organic compounds (EOCs) in soil and groundwater available in the literature. The major aim of this compilation was to provide an assessment of the uncertainty of hydrological models with respect to the fate of EOCs. The literature search identified a total number of 82 EOCs for which 1st-order rate constants could be derived. It was found that for the majority of compounds degradation rate constants vary over more than three orders of magnitude. Correlation to factors that are well known to affect the degradation rate, such as temperature or redox condition was weak. No correlation at all was found with results from available quantitative structure-activity relationship models. This suggests that many unknown site specific or experimentally specific factors influence the degradation behavior of EOCs in the environment. Thus, local and catchment scale predictive models to estimate EOC concentration at receptors, e.g., receiving waters or drinking water wells, need to consider the large uncertainty in 1st-order rate constants. As a consequence, applying rate constants that were derived from one experiment or field site investigation to other experiments or field sites should be done with extreme caution. Copyright © 2017 Elsevier Ltd. All rights reserved.

Complete synchronization of uncertain chaotic systems via a single proportional adaptive controller: A comparative study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ahmad, Israr, E-mail: iak-2000plus@yahoo.com; Saaban, Azizan Bin, E-mail: azizan.s@uum.edu.my; Ibrahim, Adyda Binti, E-mail: adyda@uum.edu.my

This paper addresses a comparative computational study on the synchronization quality, cost and converging speed for two pairs of identical chaotic and hyperchaotic systems with unknown time-varying parameters. It is assumed that the unknown time-varying parameters are bounded. Based on the Lyapunov stability theory and using the adaptive control method, a single proportional controller is proposed to achieve the goal of complete synchronizations. Accordingly, appropriate adaptive laws are designed to identify the unknown time-varying parameters. The designed control strategy is easy to implement in practice. Numerical simulations results are provided to verify the effectiveness of the proposed synchronization scheme.

Disturbance observer based pitch control of wind turbines for disturbance rejection

NASA Astrophysics Data System (ADS)

Yuan, Yuan; Chen, Xu; Tang, Jiong

2016-04-01

In this research, a disturbance observer based (DOB) control scheme is illustrated to reject the unknown low frequency disturbances to wind turbines. Specifically, we aim at maintaining the constant output power but achieving better generator speed regulation when the wind turbine is operated at time-varying and turbulent wind field. The disturbance observer combined with a filter is designed to asymptotically reject the persistent unknown time-varying disturbances. The proposed algorithm is tested in both linearized and nonlinear NREL offshore 5-MW baseline wind turbine. The application of this DOB pitch controller achieves improved power and speed regulation in Region 3 compared with a baseline gain scheduling PID collective controller both in linearized and nonlinear plant.

Reciprocal and Scholarly Service Learning: Emergent Theoretical Understandings of the University-Community Interface in South Africa

ERIC Educational Resources Information Center

Smith-Tolken, Antoinette; Bitzer, Eli

2017-01-01

This study addresses underlying principles to interpret scholarly-based service-related teaching and learning. Such principles include addressing specific concerns of communities, transforming theoretical knowledge into lived experiences for students, making the knowledge generated within communities meaningful and forging constant growth and…

Numerical convergence of the self-diffusion coefficient and viscosity obtained with Thomas-Fermi-Dirac molecular dynamics.

PubMed

Danel, J-F; Kazandjian, L; Zérah, G

2012-06-01

Computations of the self-diffusion coefficient and viscosity in warm dense matter are presented with an emphasis on obtaining numerical convergence and a careful evaluation of the standard deviation. The transport coefficients are computed with the Green-Kubo relation and orbital-free molecular dynamics at the Thomas-Fermi-Dirac level. The numerical parameters are varied until the Green-Kubo integral is equal to a constant in the t→+∞ limit; the transport coefficients are deduced from this constant and not by extrapolation of the Green-Kubo integral. The latter method, which gives rise to an unknown error, is tested for the computation of viscosity; it appears that it should be used with caution. In the large domain of coupling constant considered, both the self-diffusion coefficient and viscosity turn out to be well approximated by simple analytical laws using a single effective atomic number calculated in the average-atom model.

Numerical convergence of the self-diffusion coefficient and viscosity obtained with Thomas-Fermi-Dirac molecular dynamics

NASA Astrophysics Data System (ADS)

Danel, J.-F.; Kazandjian, L.; Zérah, G.

2012-06-01

Computations of the self-diffusion coefficient and viscosity in warm dense matter are presented with an emphasis on obtaining numerical convergence and a careful evaluation of the standard deviation. The transport coefficients are computed with the Green-Kubo relation and orbital-free molecular dynamics at the Thomas-Fermi-Dirac level. The numerical parameters are varied until the Green-Kubo integral is equal to a constant in the t→+∞ limit; the transport coefficients are deduced from this constant and not by extrapolation of the Green-Kubo integral. The latter method, which gives rise to an unknown error, is tested for the computation of viscosity; it appears that it should be used with caution. In the large domain of coupling constant considered, both the self-diffusion coefficient and viscosity turn out to be well approximated by simple analytical laws using a single effective atomic number calculated in the average-atom model.

Characteristic constants of 2,2',4'-trihydroxyazobenzene-5-sulfonic acid, a reagent for spectrophotometric analysis

USGS Publications Warehouse

Fletcher, Mary H.

1960-01-01

The dye 2,2',4'-trihydroxyazobenzene-5-sulfonic acid, has shown promise as a reagent for the determination of zirconium. As the literature contains very little information about this dye, basic data pertinent to its use as a reagent were determined. The sulfonic acid group and all three of the hydroxy groups show acidic characteristics. Apparent dissociation constants were determined for the three more labile protons and the approximate order of magnitude for the fourth constant was estimated. Absorption spectra for the different ionization species are given. A curve is also included which shows the fraction of dye in the different ionization forms at acidities from 10.35M hydrochloric acid to pH 11.9. A sixth dye species was found in 1.0 to 8.4M potassium hydroxide solutions, but its nature is unknown.

APPLICATION OF U.S. EPA METHODS TO THE ANALYSIS OF PHARMACEUTICALS AND PERSONAL CARE PRODUCTS IN THE ENVIRONMENT: DETERMINATION OF CLOFIBRIC ACID IN SEWAGE EFFLUENT BY GC-MS

EPA Science Inventory

An emerging area of research concerns pharmaceuticals and personal care products in the
environment and their possible impact on biota and ecosystems. The long term effects of
constant perfusion of PPCPs into the aquatic environment are presently unknown. Some
compoun...

Fusimotor control of spindle sensitivity regulates central and peripheral coding of joint angles.

PubMed

Lan, Ning; He, Xin

2012-01-01

Proprioceptive afferents from muscle spindles encode information about peripheral joint movements for the central nervous system (CNS). The sensitivity of muscle spindle is nonlinearly dependent on the activation of gamma (γ) motoneurons in the spinal cord that receives inputs from the motor cortex. How fusimotor control of spindle sensitivity affects proprioceptive coding of joint position is not clear. Furthermore, what information is carried in the fusimotor signal from the motor cortex to the muscle spindle is largely unknown. In this study, we addressed the issue of communication between the central and peripheral sensorimotor systems using a computational approach based on the virtual arm (VA) model. In simulation experiments within the operational range of joint movements, the gamma static commands (γ(s)) to the spindles of both mono-articular and bi-articular muscles were hypothesized (1) to remain constant, (2) to be modulated with joint angles linearly, and (3) to be modulated with joint angles nonlinearly. Simulation results revealed a nonlinear landscape of Ia afferent with respect to both γ(s) activation and joint angle. Among the three hypotheses, the constant and linear strategies did not yield Ia responses that matched the experimental data, and therefore, were rejected as plausible strategies of spindle sensitivity control. However, if γ(s) commands were quadratically modulated with joint angles, a robust linear relation between Ia afferents and joint angles could be obtained in both mono-articular and bi-articular muscles. With the quadratic strategy of spindle sensitivity control, γ(s) commands may serve as the CNS outputs that inform the periphery of central coding of joint angles. The results suggest that the information of joint angles may be communicated between the CNS and muscles via the descending γ(s) efferent and Ia afferent signals.

40. Photocopy of photograph (negative made from original photograph on ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

40. Photocopy of photograph (negative made from original photograph on file at Veterans Administration in Wichita, Kansas), photographer unknown, ca. 1933. Panoramic aerial view of Veterans Administration Center, view north, City of Wichita in background, Building 8 is first structure on right - Veterans Administration Center, Officers Duplex Quarters, 5302 East Kellogg (Legal Address); 5500 East Kellogg (Common Address), Wichita, Sedgwick County, KS

A coupled implicit method for chemical non-equilibrium flows at all speeds

NASA Technical Reports Server (NTRS)

Shuen, Jian-Shun; Chen, Kuo-Huey; Choi, Yunho

1993-01-01

The present time-accurate coupled-solution procedure addresses the chemical nonequilibrium Navier-Stokes equations over a wide Mach-number range uses, in conjunction with the strong conservation form of the governing equations, five unknown primitive variables. The numerical tests undertaken address steady convergent-divergent nozzle flows with air dissociation/recombination, dump combustor flows with n-pentane/air chemistry, and unsteady nonreacting cavity flows.

The Information Available to a Moving Observer on Shape with Unknown, Isotropic BRDFs.

PubMed

Chandraker, Manmohan

2016-07-01

Psychophysical studies show motion cues inform about shape even with unknown reflectance. Recent works in computer vision have considered shape recovery for an object of unknown BRDF using light source or object motions. This paper proposes a theory that addresses the remaining problem of determining shape from the (small or differential) motion of the camera, for unknown isotropic BRDFs. Our theory derives a differential stereo relation that relates camera motion to surface depth, which generalizes traditional Lambertian assumptions. Under orthographic projection, we show differential stereo may not determine shape for general BRDFs, but suffices to yield an invariant for several restricted (still unknown) BRDFs exhibited by common materials. For the perspective case, we show that differential stereo yields the surface depth for unknown isotropic BRDF and unknown directional lighting, while additional constraints are obtained with restrictions on the BRDF or lighting. The limits imposed by our theory are intrinsic to the shape recovery problem and independent of choice of reconstruction method. We also illustrate trends shared by theories on shape from differential motion of light source, object or camera, to relate the hardness of surface reconstruction to the complexity of imaging setup.

Single-Specimen Technique to Establish the J-Resistance of Linear Viscoelastic Solids with Constant Poisson's Ratio

NASA Technical Reports Server (NTRS)

Gutierrez-Lemini, Danton; McCool, Alex (Technical Monitor)

2001-01-01

A method is developed to establish the J-resistance function for an isotropic linear viscoelastic solid of constant Poisson's ratio using the single-specimen technique with constant-rate test data. The method is based on the fact that, for a test specimen of fixed crack size under constant rate, the initiation J-integral may be established from the crack size itself, the actual external load and load-point displacement at growth initiation, and the relaxation modulus of the viscoelastic solid, without knowledge of the complete test record. Since crack size alone, of the required data, would be unknown at each point of the load-vs-load-point displacement curve of a single-specimen test, an expression is derived to estimate it. With it, the physical J-integral at each point of the test record may be established. Because of its basis on single-specimen testing, not only does the method not require the use of multiple specimens with differing initial crack sizes, but avoids the need for tracking crack growth as well.

Activation of muscle nicotinic acetylcholine receptor channels by nicotinic and muscarinic agonists

PubMed Central

Akk, Gustav; Auerbach, Anthony

1999-01-01

The dose-response parameters of recombinant mouse adult neuromuscular acetylcholine receptor channels (nAChR) activated by carbamylcholine, nicotine, muscarine and oxotremorine were measured. Rate constants for agonist association and dissociation, and channel opening and closing, were estimated from single-channel kinetic analysis.The dissociation equilibrium constants were (mM): ACh (0.16)carbamylcholine (5.1)>oxotremorine M (0.6)>nicotine (0.5)>muscarine (0.15).Rat neuronal α4β2 nAChR can be activated by all of the agonists. However, detailed kinetic analysis was impossible because the recordings lacked clusters representing the activity of a single receptor complex. Thus, the number of channels in the patch was unknown and the activation rate constants could not be determined.Considering both receptor affinity and agonist efficacy, muscarine and oxotremorine are significant agonists of muscle-type nAChR. The results are discussed in terms of structure-function relationships at the nAChR transmitter binding site. PMID:10602325

Reachable set estimation for Takagi-Sugeno fuzzy systems against unknown output delays with application to tracking control of AUVs.

PubMed

Zhong, Zhixiong; Zhu, Yanzheng; Ahn, Choon Ki

2018-07-01

In this paper, we address the problem of reachable set estimation for continuous-time Takagi-Sugeno (T-S) fuzzy systems subject to unknown output delays. Based on the reachable set concept, a new controller design method is also discussed for such systems. An effective method is developed to attenuate the negative impact from the unknown output delays, which likely degrade the performance/stability of systems. First, an augmented fuzzy observer is proposed to capacitate a synchronous estimation for the system state and the disturbance term owing to the unknown output delays, which ensures that the reachable set of the estimation error is limited via the intersection operation of ellipsoids. Then, a compensation technique is employed to eliminate the influence on the system performance stemmed from the unknown output delays. Finally, the effectiveness and correctness of the obtained theories are verified by the tracking control of autonomous underwater vehicles. Copyright © 2018 ISA. Published by Elsevier Ltd. All rights reserved.

Adaptive super-twisting observer for estimation of random road excitation profile in automotive suspension systems.

PubMed

Rath, J J; Veluvolu, K C; Defoort, M

2014-01-01

The estimation of road excitation profile is important for evaluation of vehicle stability and vehicle suspension performance for autonomous vehicle control systems. In this work, the nonlinear dynamics of the active automotive system that is excited by the unknown road excitation profile are considered for modeling. To address the issue of estimation of road profile, we develop an adaptive supertwisting observer for state and unknown road profile estimation. Under Lipschitz conditions for the nonlinear functions, the convergence of the estimation error is proven. Simulation results with Ford Fiesta MK2 demonstrate the effectiveness of the proposed observer for state and unknown input estimation for nonlinear active suspension system.

Adaptive Super-Twisting Observer for Estimation of Random Road Excitation Profile in Automotive Suspension Systems

PubMed Central

Rath, J. J.; Veluvolu, K. C.; Defoort, M.

2014-01-01

The estimation of road excitation profile is important for evaluation of vehicle stability and vehicle suspension performance for autonomous vehicle control systems. In this work, the nonlinear dynamics of the active automotive system that is excited by the unknown road excitation profile are considered for modeling. To address the issue of estimation of road profile, we develop an adaptive supertwisting observer for state and unknown road profile estimation. Under Lipschitz conditions for the nonlinear functions, the convergence of the estimation error is proven. Simulation results with Ford Fiesta MK2 demonstrate the effectiveness of the proposed observer for state and unknown input estimation for nonlinear active suspension system. PMID:24683321

Assessing the 40K decay constant by intercalibration with U-Pb, Rb-Sr and K-Ca chronometers

NASA Astrophysics Data System (ADS)

Naumenko-Dèzes, M. O.; Nagler, T. F.; Mezger, K.; Villa, I. M.

2016-12-01

Ar-Ar is one of the most used dating systems and its accuracy plays an important role in constraining the age of planets, durations of processes and their sequence of occurrence. This system has been reported to give ages that are ca. 1% younger than U-Pb ages. The discrepancies between the two mostly used and precise geochronometers, U-Pb and K-Ar, have been a subject of critical reviewing (e.g. Renne et al. [1] and ref. therein) and were attributed to a systematic offset of the 40K decay constant. Multiple attempts to recalibrate it did not achieve consistency.We attempted to intercalibrate three dating systems: U-Pb (the main reference), Rb-Sr (the consistency check) and K-Ca (the unknown). We examined 11 natural samples, but only a phlogopite from the Phalaborwa carbonatite complex met all requirements of a geological "point-like" event [2]. The Rb-Sr age of this sample is 2058.9±5.2 Ma and agrees with the age determined by Nebel et al [3] and with published U-Pb ages. The K-Ca age for the same sample calculated with constants of Steiger&Jäger [4] is 2040±13 Ma, ca.1% younger age than U-Pb reference age of the complex. Since we improved the Ca measurements [5] the K-Ca age has a low uncertainty of 0.6%. This age constrains the decay constant of the Ca branch of the 40K decay. However, the total decay constant is given by one equation with two unknowns, the branching ratio B and the decay constant of the Ar branch.Within the range of published branching ratios (B = 0.892 to 0.896 [6]) the best total 40K decay constant lies mid-way between the values proposed by Renne et al [7] and Min et al [8] (fig. 1).Figure 1. K-Ca age of Phalaborwa phlogopite changes along sloping lines as a function of assumed branching ratio B, calculated with the total 40K decay constant of [3]. [5], [6].[1] Renne et al. (2010) Geochim. Cosmochim Acta 74, 5349-5367; [2] Begemann et al. (2001) Geochim. Cosmochim Acta 65, 111-121; [3] Nebel et al (2010) GCA 74, 5349; [4] Steiger&Jäger (1977) Earth and Plan. Sci. L. 36, 359-362; [5] Naumenko-Dèzes et al. (2015) Int. J. of Mass Spectr. 387, 60-68; [9] Bé et al (2004) Table of Radionuclides, A=1 to 150; [7] Renne et al. (2011) Geochim. et Cosmochim. Acta 75, 5097-5100; [8] Min et al. (2000) Geochim. et Cosmochim. Acta 64, 73-9.

Gastric Injury From Oral Iron Supplementation

DTIC Science & Technology

2018-02-22

1100 Willford Hall Loop , Bldg 4430 JBSA-Lackland, TX 78236-9908 17540 210-292-7141 9. SPONSORING/MONITORING AGENCY NAME(S) AND ADDRESS(ES) 10...SPONSOR/MONITOR"S ACRONYM(S) 59th Clinical Research Division 1100 Willford Hall Loop , Bldg 4430 JBSA-Lackland, TX 78236-9908 11. SPONSOR/MONITOR’S REPORT...follow up EGO that showed multiple new linear hyper -pigmented peripyloric extensions of unknown etiology. Tissue biopsy revealed pigmented foreign

Metagenomic ventures into outer sequence space.

PubMed

Dutilh, Bas E

Sequencing DNA or RNA directly from the environment often results in many sequencing reads that have no homologs in the database. These are referred to as "unknowns," and reflect the vast unexplored microbial sequence space of our biosphere, also known as "biological dark matter." However, unknowns also exist because metagenomic datasets are not optimally mined. There is a pressure on researchers to publish and move on, and the unknown sequences are often left for what they are, and conclusions drawn based on reads with annotated homologs. This can cause abundant and widespread genomes to be overlooked, such as the recently discovered human gut bacteriophage crAssphage. The unknowns may be enriched for bacteriophage sequences, the most abundant and genetically diverse component of the biosphere and of sequence space. However, it remains an open question, what is the actual size of biological sequence space? The de novo assembly of shotgun metagenomes is the most powerful tool to address this question.

Known knowns, known unknowns and unknown unknowns in prokaryotic transposition.

PubMed

Siguier, Patricia; Gourbeyre, Edith; Chandler, Michael

2017-08-01

Although the phenomenon of transposition has been known for over 60 years, its overarching importance in modifying and streamlining genomes took some time to recognize. In spite of a robust understanding of transposition of some TE, there remain a number of important TE groups with potential high genome impact and unknown transposition mechanisms and yet others, only recently identified by bioinformatics, yet to be formally confirmed as mobile. Here, we point to some areas of limited understanding concerning well established important TE groups with DDE Tpases, to address central gaps in our knowledge of characterised Tn with other types of Tpases and finally, to highlight new potentially mobile DNA species. It is not exhaustive. Examples have been chosen to provide encouragement in the continued exploration of the considerable prokaryotic mobilome especially in light of the current threat to public health posed by the spread of multiple Ab R . Copyright © 2017 Elsevier Ltd. All rights reserved.

Revised energy levels of singly ionized lanthanum

NASA Astrophysics Data System (ADS)

Güzelçimen, Feyza; Tonka, Mehdi; Uddin, Zaheer; Bhatti, Naveed Anjum; Windholz, Laurentius; Kröger, Sophie; Başar, Gönül

2018-05-01

Based on the experimental wavenumbers of 344 spectral lines from calibrated Fourier transform (FT) spectra as well as wavenumbers of 81 lines from the wavelength tables from literature, the energy of 115 fine structure levels of singly ionized lanthanum has been revised by weighted global fits. The classifications of the lines are provided by numerous previous investigations of lanthanum by different spectroscopic methods and authors. For the high accurate determination of the center of gravity wavenumbers from the experimental spectrum, the hyperfine constants of the involved levels have been taken into account, if possible. For the 94 levels with known hyperfine constants the accuracy of energy values is better than 0.01 cm-1. For 34 levels the magnetic dipole hyperfine constants A have been determined from FT spectra as part of this work. For four of these 34 levels even electric quadrupole hyperfine constants B could be estimated. For levels, which have experimentally unknown hyperfine constants and which are connected only by lines not found in the FT spectra but taken from literature, the uncertainties of energy values are about a factor of 10 higher. A list of all revised level energies together with a compilation of hyperfine structure data is given as well as a list of all lines used.

Power and Roots by Recursion.

ERIC Educational Resources Information Center

Aieta, Joseph F.

1987-01-01

This article illustrates how questions from elementary finance can serve as motivation for studying high order powers, roots, and exponential functions using Logo procedures. A second discussion addresses a relatively unknown algorithm for the trigonometric exponential and hyperbolic functions. (PK)

Liquid Nitrogen as Fast High Voltage Switching Medium

NASA Astrophysics Data System (ADS)

Dickens, J.; Neuber, A.; Haustein, M.; Krile, J.; Krompholz, H.

2002-12-01

Compact pulsed power systems require new switching technologies. For high voltages, liquid nitrogen seems to be a suitable switching medium, with high hold-off voltage, low dielectric constant, and no need for pressurized systems as in high pressure gas switches. The discharge behavior in liquid nitrogen, such as breakdown voltages, formative times, current rise as function of voltage, recovery, etc. are virtually unknown, however. The phenomenology of breakdown in liquid nitrogen is investigated with high speed (temporal resolution < 1 ns) electrical and optical diagnostics, in a coaxial system with 50-Ohm impedance. Discharge current and voltage are determined with transmission line type current sensors and capacitive voltage dividers. The discharge luminosity is measured with photomultiplier tubes. Preliminary results of self-breakdown investigations (gap 1 mm, breakdown voltage 44 kV, non-boiling supercooled nitrogen) show a fast (2 ns) transition from an unknown current level to several mA, a long-duration (100 ns) phase with constant current superimposed by ns-spikes, and a final fast transition to the impedance limited current during several nanoseconds. The optical measurements will be expanded toward spectroscopy and high speed photography with the aim of clarifying the overall breakdown mechanisms, including electronic initiation, bubble formation, bubble dynamics, and their role in breakdown, for different electrode geometries (different macroscopic field enhancements).

On the functional relevance of frontal cortex for passive and voluntarily controlled bistable vision.

PubMed

de Graaf, Tom A; de Jong, Maartje C; Goebel, Rainer; van Ee, Raymond; Sack, Alexander T

2011-10-01

In bistable vision, one constant ambiguous stimulus leads to 2 alternating conscious percepts. This perceptual switching occurs spontaneously but can also be influenced through voluntary control. Neuroimaging studies have reported that frontal regions are activated during spontaneous perceptual switches, leading some researchers to suggest that frontal regions causally induce perceptual switches. But the opposite also seems possible: frontal activations may themselves be caused by spontaneous switches. Classically implicated in attentional processes, these same regions are also candidates for the origins of voluntary control over bistable vision. Here too, it remains unknown whether frontal cortex is actually functionally relevant. It is even possible that spontaneous perceptual switches and voluntarily induced switches are mediated by the same top-down mechanisms. To directly address these issues, we here induced "virtual lesions," with transcranial magnetic stimulation, in frontal, parietal, and 2 lower level visual cortices using an established ambiguous structure-from-motion stimulus. We found that dorsolateral prefrontal cortex was causally relevant for voluntary control over perceptual switches. In contrast, we failed to find any evidence for an active role of frontal cortex in passive bistable vision. Thus, it seems the same pathway used for willed top-down modulation of bistable vision is not used during passive bistable viewing.

Fractional Steps methods for transient problems on commodity computer architectures

NASA Astrophysics Data System (ADS)

Krotkiewski, M.; Dabrowski, M.; Podladchikov, Y. Y.

2008-12-01

Fractional Steps methods are suitable for modeling transient processes that are central to many geological applications. Low memory requirements and modest computational complexity facilitates calculations on high-resolution three-dimensional models. An efficient implementation of Alternating Direction Implicit/Locally One-Dimensional schemes for an Opteron-based shared memory system is presented. The memory bandwidth usage, the main bottleneck on modern computer architectures, is specially addressed. High efficiency of above 2 GFlops per CPU is sustained for problems of 1 billion degrees of freedom. The optimized sequential implementation of all 1D sweeps is comparable in execution time to copying the used data in the memory. Scalability of the parallel implementation on up to 8 CPUs is close to perfect. Performing one timestep of the Locally One-Dimensional scheme on a system of 1000 3 unknowns on 8 CPUs takes only 11 s. We validate the LOD scheme using a computational model of an isolated inclusion subject to a constant far field flux. Next, we study numerically the evolution of a diffusion front and the effective thermal conductivity of composites consisting of multiple inclusions and compare the results with predictions based on the differential effective medium approach. Finally, application of the developed parabolic solver is suggested for a real-world problem of fluid transport and reactions inside a reservoir.

Inflaming the diseased brain: a role for tainted melanins.

PubMed

Jeitner, T M; Kalogiannis, M; Patrick, P A; Gomolin, I; Palaia, T; Ragolia, L; Brand, D; Delikatny, E J

2015-05-01

Inflammation plays a crucial role in neurodegenerative diseases, but the irritants responsible for this response remain largely unknown. This report addressed the hypothesis that hypochlorous acid reacts with dopamine to produce melanic precipitates that promote cerebral inflammation. Spectrophotometric studies demonstrated that nM amounts of HOCl and dopamine react within seconds. A second-order rate constant for the reaction of HOCl and dopamine of 2.5 × 10(4)M(-1)s(-1) was obtained by measuring loss of dopaminergic fluorescence due to HOCl. Gravimetric measurements, electron microscopy, elemental analysis, and a novel use of flow cytometry confirmed that the major product of this reaction is a precipitate with an average diameter of 1.5 μm. Flow cytometry was also used to demonstrate the preferential reaction of HOCl with dopamine rather than albumin. Engulfment of the chlorodopamine particulates by phagocytes in vitro caused these cells to release TNFα and die. Intrastriatal administration of 10(6) particles also increased the content of TNFα in the brain and led to a 50% loss of the dopaminergic neurons in the nigra. These studies indicate that HOCl and dopamine react quickly and preferentially with each other to produce particles that promote inflammation and neuronal death in the brain. Copyright © 2015 Elsevier B.V. All rights reserved.

Path Following in the Exact Penalty Method of Convex Programming.

PubMed

Zhou, Hua; Lange, Kenneth

2015-07-01

Classical penalty methods solve a sequence of unconstrained problems that put greater and greater stress on meeting the constraints. In the limit as the penalty constant tends to ∞, one recovers the constrained solution. In the exact penalty method, squared penalties are replaced by absolute value penalties, and the solution is recovered for a finite value of the penalty constant. In practice, the kinks in the penalty and the unknown magnitude of the penalty constant prevent wide application of the exact penalty method in nonlinear programming. In this article, we examine a strategy of path following consistent with the exact penalty method. Instead of performing optimization at a single penalty constant, we trace the solution as a continuous function of the penalty constant. Thus, path following starts at the unconstrained solution and follows the solution path as the penalty constant increases. In the process, the solution path hits, slides along, and exits from the various constraints. For quadratic programming, the solution path is piecewise linear and takes large jumps from constraint to constraint. For a general convex program, the solution path is piecewise smooth, and path following operates by numerically solving an ordinary differential equation segment by segment. Our diverse applications to a) projection onto a convex set, b) nonnegative least squares, c) quadratically constrained quadratic programming, d) geometric programming, and e) semidefinite programming illustrate the mechanics and potential of path following. The final detour to image denoising demonstrates the relevance of path following to regularized estimation in inverse problems. In regularized estimation, one follows the solution path as the penalty constant decreases from a large value.

Path Following in the Exact Penalty Method of Convex Programming

PubMed Central

Zhou, Hua; Lange, Kenneth

2015-01-01

Classical penalty methods solve a sequence of unconstrained problems that put greater and greater stress on meeting the constraints. In the limit as the penalty constant tends to ∞, one recovers the constrained solution. In the exact penalty method, squared penalties are replaced by absolute value penalties, and the solution is recovered for a finite value of the penalty constant. In practice, the kinks in the penalty and the unknown magnitude of the penalty constant prevent wide application of the exact penalty method in nonlinear programming. In this article, we examine a strategy of path following consistent with the exact penalty method. Instead of performing optimization at a single penalty constant, we trace the solution as a continuous function of the penalty constant. Thus, path following starts at the unconstrained solution and follows the solution path as the penalty constant increases. In the process, the solution path hits, slides along, and exits from the various constraints. For quadratic programming, the solution path is piecewise linear and takes large jumps from constraint to constraint. For a general convex program, the solution path is piecewise smooth, and path following operates by numerically solving an ordinary differential equation segment by segment. Our diverse applications to a) projection onto a convex set, b) nonnegative least squares, c) quadratically constrained quadratic programming, d) geometric programming, and e) semidefinite programming illustrate the mechanics and potential of path following. The final detour to image denoising demonstrates the relevance of path following to regularized estimation in inverse problems. In regularized estimation, one follows the solution path as the penalty constant decreases from a large value. PMID:26366044

Collisional excitation of CO by H2O - An astrophysicist's guide to obtaining rate constants from coherent anti-Stokes Raman line shape data

NASA Technical Reports Server (NTRS)

Green, Sheldon

1993-01-01

Rate constants for excitation of CO by collisions with H2O are needed to understand recent observations of comet spectra. These collision rates are closely related to spectral line shape parameters, especially those for Raman Q-branch spectra. Because such spectra have become quite important for thermometry applications, much effort has been invested in understanding this process. Although it is not generally possible to extract state-to-state rate constants directly from the data as there are too many unknowns, if the matrix of state-to-state rates can be expressed in terms of a rate-law model which depends only on rotational quantum numbers plus a few parameters, the parameters can be determined from the data; this has been done with some success for many systems, especially those relevant to combustion processes. Although such an analysis has not yet been done for CO-H2O, this system is expected to behave similarly to N2-H2O which has been well studies; modifications of parameters for the latter system are suggested which should provide a reasonable description of rate constants for the former.

Capillary pumping independent of the liquid surface energy and viscosity

NASA Astrophysics Data System (ADS)

Guo, Weijin; Hansson, Jonas; van der Wijngaart, Wouter

2018-03-01

Capillary pumping is an attractive means of liquid actuation because it is a passive mechanism, i.e., it does not rely on an external energy supply during operation. The capillary flow rate generally depends on the liquid sample viscosity and surface energy. This poses a problem for capillary-driven systems that rely on a predictable flow rate and for which the sample viscosity or surface energy are not precisely known. Here, we introduce the capillary pumping of sample liquids with a flow rate that is constant in time and independent of the sample viscosity and sample surface energy. These features are enabled by a design in which a well-characterized pump liquid is capillarily imbibed into the downstream section of the pump and thereby pulls the unknown sample liquid into the upstream pump section. The downstream pump geometry is designed to exert a Laplace pressure and fluidic resistance that are substantially larger than those exerted by the upstream pump geometry on the sample liquid. Hence, the influence of the unknown sample liquid on the flow rate is negligible. We experimentally tested pumps of the new design with a variety of sample liquids, including water, different samples of whole blood, different samples of urine, isopropanol, mineral oil, and glycerol. The capillary filling speeds of these liquids vary by more than a factor 1000 when imbibed to a standard constant cross-section glass capillary. In our new pump design, 20 filling tests involving these liquid samples with vastly different properties resulted in a constant volumetric flow rate in the range of 20.96-24.76 μL/min. We expect this novel capillary design to have immediate applications in lab-on-a-chip systems and diagnostic devices.

Using nonequilibrium capillary electrophoresis of equilibrium mixtures (NECEEM) for simultaneous determination of concentration and equilibrium constant.

PubMed

Kanoatov, Mirzo; Galievsky, Victor A; Krylova, Svetlana M; Cherney, Leonid T; Jankowski, Hanna K; Krylov, Sergey N

2015-03-03

Nonequilibrium capillary electrophoresis of equilibrium mixtures (NECEEM) is a versatile tool for studying affinity binding. Here we describe a NECEEM-based approach for simultaneous determination of both the equilibrium constant, K(d), and the unknown concentration of a binder that we call a target, T. In essence, NECEEM is used to measure the unbound equilibrium fraction, R, for the binder with a known concentration that we call a ligand, L. The first set of experiments is performed at varying concentrations of T, prepared by serial dilution of the stock solution, but at a constant concentration of L, which is as low as its reliable quantitation allows. The value of R is plotted as a function of the dilution coefficient, and dilution corresponding to R = 0.5 is determined. This dilution of T is used in the second set of experiments in which the concentration of T is fixed but the concentration of L is varied. The experimental dependence of R on the concentration of L is fitted with a function describing their theoretical dependence. Both K(d) and the concentration of T are used as fitting parameters, and their sought values are determined as the ones that generate the best fit. We have fully validated this approach in silico by using computer-simulated NECEEM electropherograms and then applied it to experimental determination of the unknown concentration of MutS protein and K(d) of its interactions with a DNA aptamer. The general approach described here is applicable not only to NECEEM but also to any other method that can determine a fraction of unbound molecules at equilibrium.

Entropy Production during Fatigue as a Criterion for Failure. A Local Theory of Fracture in Engineering Materials.

DTIC Science & Technology

1984-12-15

7] used this interpretation as the basis for a hypothesis that microplastic hysteresis energy is a constant at fatigue failure. Although they were...that microplastic strain energy dissipated is not constant at fatigue failure, but suggested that it increases with fatigue lifetime in a predictable...nonlinear thermodynamics must be addressed. The microplastic hysteresis energy is related to dislocation theory, which is directly related to

Anisotropic Effects on Constitutive Model Parameters of Aluminum Alloys

DTIC Science & Technology

2012-01-01

constants are required input to computer codes (LS-DYNA, DYNA3D or SPH ) to accurately simulate fragment impact on structural components made of high...different temperatures. These model constants are required input to computer codes (LS-DYNA, DYNA3D or SPH ) to accurately simulate fragment impact on...ADDRESS(ES) Naval Surface Warfare Center,4104Evans Way Suite 102,Indian Head,MD,20640 8. PERFORMING ORGANIZATION REPORT NUMBER 9. SPONSORING/MONITORING

41. Photocopy of photograph (negative made from original photograph on ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

41. Photocopy of photograph (negative made from original photograph on file at Veterans Administration in Wichita, Kansas), photographer unknown, ca. 1933. Aerial view of Veterans Administration Center, view north and east, in the forefront, left to right, are Building 3, Building 1, and Building 2, Buildings 10 through 14 are in background at right - Veterans Administration Center, Officers Duplex Quarters, 5302 East Kellogg (Legal Address); 5500 East Kellogg (Common Address), Wichita, Sedgwick County, KS

Intent of Study on the Use of a Dual Airborne Laser Scanner (ALS) in Conjunction with a Tactical Grade Inertial Measurement Unit (IMU) for Unmanned Aerial Vehicle (UAV) Navigation and Mapping in Unknown, Non-Global Positioning System (GPS), Environments

DTIC Science & Technology

2006-08-05

ADDRESS(ES) 10. SPONSOR/MONITOR’S ACRONYM(S) AF Office of Scientific h Researc 875 N. Randolph St. Room 3112 11. SPONSOR/MONITOR’S REPORT...the process is often time-consuming and expensive. As the IMU market is experiencing a migration trend towards Micro Electro-Mechanical System (MEMS

How Small the Number of Test Items Can Be for the Basis of Estimating the Operating Characteristics of the Discrete Responses to Unknown Test Items.

ERIC Educational Resources Information Center

Samejima, Fumiko; Changas, Paul S.

The methods and approaches for estimating the operating characteristics of the discrete item responses without assuming any mathematical form have been developed and expanded. It has been made possible that, even if the test information function of a given test is not constant for the interval of ability of interest, it is used as the Old Test.…

Entropic Lattice Boltzmann Methods

DTIC Science & Technology

2001-12-10

model of fluid dynamics in one dimension, first considered by Renda et al. in 1997 [14]. Here the geometric picture involves a four dimensional polytope...convention of including constant terms in an extra column of the matrix, using the device of appending 1 to the column vector of unknowns. In general, there...we apply the entropic lattice Boltzmann method to a simple five-velocity model of fluid dynamics in one dimension, first considered by Renda et al

Digital high speed programmable convolver

NASA Astrophysics Data System (ADS)

Rearick, T. C.

1984-12-01

A circuit module for rapidly calculating a discrete numerical convolution is described. A convolution such as finding the sum of the products of a 16 bit constant and a 16 bit variable is performed by a module which is programmable so that the constant may be changed for a new problem. In addition, the module may be programmed to find the sum of the products of 4 and 8 bit constants and variables. RAM (Random Access Memories) are loaded with partial products of the selected constant and all possible variables. Then, when the actual variable is loaded, it acts as an address to find the correct partial product in the particular RAM. The partial products from all of the RAMs are shifted to the appropriate numerical power position (if necessary) and then added in adder elements.

WHAT HAPPENS TO FLUOROTELOMER POLYMER PRODUCTS DURING WASTEWATER TREATMENT?

EPA Science Inventory

Fluorotelomer based polymers formulate numerous products relied upon by society. Despite their widespread use and high opportunity for down-the-drain disposal, the fate and stability of fluorotelomer polymer products in wastewater treatment systems remains unknown. To address thi...

Training Aids for Basic Combat Skills: A Procedure for Training-Aid Development

DTIC Science & Technology

2011-02-01

aids is a constant in training and education. Researchers in fields as varied as disability education, business, firefighting, vocal performance...the aids should (a) address tasks with which many Soldiers have difficulty mastering, (b) address tasks that are critical to basic combat training...candidates because of other practical considerations such as low cost, potential impact to critical IET tasks, etc

Survivorship analysis when cure is a possibility: a Monte Carlo study.

PubMed

Goldman, A I

1984-01-01

Parametric survivorship analyses of clinical trials commonly involves the assumption of a hazard function constant with time. When the empirical curve obviously levels off, one can modify the hazard function model by use of a Gompertz or Weibull distribution with hazard decreasing over time. Some cancer treatments are thought to cure some patients within a short time of initiation. Then, instead of all patients having the same hazard, decreasing over time, a biologically more appropriate model assumes that an unknown proportion (1 - pi) have constant high risk whereas the remaining proportion (pi) have essentially no risk. This paper discusses the maximum likelihood estimation of pi and the power curves of the likelihood ratio test. Monte Carlo studies provide results for a variety of simulated trials; empirical data illustrate the methods.

Optimal thrust level for orbit insertion

NASA Astrophysics Data System (ADS)

Cerf, Max

2017-07-01

The minimum-fuel orbital transfer is analyzed in the case of a launcher upper stage using a constantly thrusting engine. The thrust level is assumed to be constant and its value is optimized together with the thrust direction. A closed-loop solution for the thrust direction is derived from the extremal analysis for a planar orbital transfer. The optimal control problem reduces to two unknowns, namely the thrust level and the final time. Guessing and propagating the costates is no longer necessary and the optimal trajectory is easily found from a rough initialization. On the other hand the initial costates are assessed analytically from the initial conditions and they can be used as initial guess for transfers at different thrust levels. The method is exemplified on a launcher upper stage targeting a geostationary transfer orbit.

Online Solution of Two-Player Zero-Sum Games for Continuous-Time Nonlinear Systems With Completely Unknown Dynamics.

PubMed

Fu, Yue; Chai, Tianyou

2016-12-01

Regarding two-player zero-sum games of continuous-time nonlinear systems with completely unknown dynamics, this paper presents an online adaptive algorithm for learning the Nash equilibrium solution, i.e., the optimal policy pair. First, for known systems, the simultaneous policy updating algorithm (SPUA) is reviewed. A new analytical method to prove the convergence is presented. Then, based on the SPUA, without using a priori knowledge of any system dynamics, an online algorithm is proposed to simultaneously learn in real time either the minimal nonnegative solution of the Hamilton-Jacobi-Isaacs (HJI) equation or the generalized algebraic Riccati equation for linear systems as a special case, along with the optimal policy pair. The approximate solution to the HJI equation and the admissible policy pair is reexpressed by the approximation theorem. The unknown constants or weights of each are identified simultaneously by resorting to the recursive least square method. The convergence of the online algorithm to the optimal solutions is provided. A practical online algorithm is also developed. Simulation results illustrate the effectiveness of the proposed method.

Estimates and Standard Errors for Ratios of Normalizing Constants from Multiple Markov Chains via Regeneration

PubMed Central

Doss, Hani; Tan, Aixin

2017-01-01

In the classical biased sampling problem, we have k densities π1(·), …, πk(·), each known up to a normalizing constant, i.e. for l = 1, …, k, πl(·) = νl(·)/ml, where νl(·) is a known function and ml is an unknown constant. For each l, we have an iid sample from πl,·and the problem is to estimate the ratios ml/ms for all l and all s. This problem arises frequently in several situations in both frequentist and Bayesian inference. An estimate of the ratios was developed and studied by Vardi and his co-workers over two decades ago, and there has been much subsequent work on this problem from many different perspectives. In spite of this, there are no rigorous results in the literature on how to estimate the standard error of the estimate. We present a class of estimates of the ratios of normalizing constants that are appropriate for the case where the samples from the πl’s are not necessarily iid sequences, but are Markov chains. We also develop an approach based on regenerative simulation for obtaining standard errors for the estimates of ratios of normalizing constants. These standard error estimates are valid for both the iid case and the Markov chain case. PMID:28706463

Estimates and Standard Errors for Ratios of Normalizing Constants from Multiple Markov Chains via Regeneration.

PubMed

Doss, Hani; Tan, Aixin

2014-09-01

In the classical biased sampling problem, we have k densities π 1 (·), …, π k (·), each known up to a normalizing constant, i.e. for l = 1, …, k , π l (·) = ν l (·)/ m l , where ν l (·) is a known function and m l is an unknown constant. For each l , we have an iid sample from π l , · and the problem is to estimate the ratios m l /m s for all l and all s . This problem arises frequently in several situations in both frequentist and Bayesian inference. An estimate of the ratios was developed and studied by Vardi and his co-workers over two decades ago, and there has been much subsequent work on this problem from many different perspectives. In spite of this, there are no rigorous results in the literature on how to estimate the standard error of the estimate. We present a class of estimates of the ratios of normalizing constants that are appropriate for the case where the samples from the π l 's are not necessarily iid sequences, but are Markov chains. We also develop an approach based on regenerative simulation for obtaining standard errors for the estimates of ratios of normalizing constants. These standard error estimates are valid for both the iid case and the Markov chain case.

An Indirect Adaptive Control Scheme in the Presence of Actuator and Sensor Failures

NASA Technical Reports Server (NTRS)

Sun, Joy Z.; Josh, Suresh M.

2009-01-01

The problem of controlling a system in the presence of unknown actuator and sensor faults is addressed. The system is assumed to have groups of actuators, and groups of sensors, with each group consisting of multiple redundant similar actuators or sensors. The types of actuator faults considered consist of unknown actuators stuck in unknown positions, as well as reduced actuator effectiveness. The sensor faults considered include unknown biases and outages. The approach employed for fault detection and estimation consists of a bank of Kalman filters based on multiple models, and subsequent control reconfiguration to mitigate the effect of biases caused by failed components as well as to obtain stability and satisfactory performance using the remaining actuators and sensors. Conditions for fault identifiability are presented, and the adaptive scheme is applied to an aircraft flight control example in the presence of actuator failures. Simulation results demonstrate that the method can rapidly and accurately detect faults and estimate the fault values, thus enabling safe operation and acceptable performance in spite of failures.

76 FR 16796 - Pediatric Anesthesia Safety Initiative (PASI)

Federal Register 2010, 2011, 2012, 2013, 2014

2011-03-25

... children. However, the planning and performance of the numerous studies needed to address the... in children. FDA seeks under PASI to encourage and facilitate scientific collaboration among multiple... clinical studies to answer unknown questions regarding the effects of anesthetics and sedatives in the...

Macromechanics of hearing: The unknown known

NASA Astrophysics Data System (ADS)

Shera, Christopher A.

2015-12-01

The following summarizes the key points addressed during a tutorial session on the Macromechanics of Hearing that took place at the 12th International Workshop on the Mechanics of Hearing held at Cape Sounio, Greece, in June 2014. The tutorial was intended to present an overview of basic ideas and to address topics of current interest relevant to the Workshop. The session was recorded, and the audio file and accompanying visual content of the presentation can be found in the Mechanics of Hearing Digital Library (www.mechanicsofhearing.org).

A Localized Ensemble Kalman Smoother

NASA Technical Reports Server (NTRS)

Butala, Mark D.

2012-01-01

Numerous geophysical inverse problems prove difficult because the available measurements are indirectly related to the underlying unknown dynamic state and the physics governing the system may involve imperfect models or unobserved parameters. Data assimilation addresses these difficulties by combining the measurements and physical knowledge. The main challenge in such problems usually involves their high dimensionality and the standard statistical methods prove computationally intractable. This paper develops and addresses the theoretical convergence of a new high-dimensional Monte-Carlo approach called the localized ensemble Kalman smoother.

Investigating Electromagnetic Induction through a Microcomputer-Based Laboratory.

ERIC Educational Resources Information Center

Trumper, Ricardo; Gelbman, Moshe

2000-01-01

Describes a microcomputer-based laboratory experiment designed for high school students that very accurately analyzes Faraday's law of electromagnetic induction, addressing each variable separately while the others are kept constant. (Author/CCM)

Encephalocraniocutaneous lipomatosis with calvarial exostosis - Case report and review of literature

PubMed Central

Thakur, Shruti; Thakur, Vijay; Sood, Ram Gopal; Thakur, Charu Smita; Khanna, Shweta

2013-01-01

Encephalocraniocutaneous lipomatosis (ECCL), also known as Haberland syndrome, is a rare syndrome with unknown etiology. The syndrome is characterized by a triad of unique cutaneous, ocular, and central nervous system (CNS) manifestations. The cutaneous hallmark, nevus psiloliparus (NP), along with overlying alopecia is a constant feature. Choristoma of the eyelid is the most common ocular manifestation, while intracranial lipoma is the predominant CNS finding. Genetic counseling is required to emphasize that the disorder, although congenital, is not inheritable. We present a 21-year-old female with cutaneous, ocular, and CNS features satisfying the diagnostic criteria for ECCL. To our knowledge, this is the first case of ECCL having a large temporal exostosis. The objective of this article is to better understand the phenotypic spectrum of this syndrome whose molecular basis is still unknown. PMID:24604937

OpenMEEG: opensource software for quasistatic bioelectromagnetics.

PubMed

Gramfort, Alexandre; Papadopoulo, Théodore; Olivi, Emmanuel; Clerc, Maureen

2010-09-06

Interpreting and controlling bioelectromagnetic phenomena require realistic physiological models and accurate numerical solvers. A semi-realistic model often used in practise is the piecewise constant conductivity model, for which only the interfaces have to be meshed. This simplified model makes it possible to use Boundary Element Methods. Unfortunately, most Boundary Element solutions are confronted with accuracy issues when the conductivity ratio between neighboring tissues is high, as for instance the scalp/skull conductivity ratio in electro-encephalography. To overcome this difficulty, we proposed a new method called the symmetric BEM, which is implemented in the OpenMEEG software. The aim of this paper is to present OpenMEEG, both from the theoretical and the practical point of view, and to compare its performances with other competing software packages. We have run a benchmark study in the field of electro- and magneto-encephalography, in order to compare the accuracy of OpenMEEG with other freely distributed forward solvers. We considered spherical models, for which analytical solutions exist, and we designed randomized meshes to assess the variability of the accuracy. Two measures were used to characterize the accuracy. the Relative Difference Measure and the Magnitude ratio. The comparisons were run, either with a constant number of mesh nodes, or a constant number of unknowns across methods. Computing times were also compared. We observed more pronounced differences in accuracy in electroencephalography than in magnetoencephalography. The methods could be classified in three categories: the linear collocation methods, that run very fast but with low accuracy, the linear collocation methods with isolated skull approach for which the accuracy is improved, and OpenMEEG that clearly outperforms the others. As far as speed is concerned, OpenMEEG is on par with the other methods for a constant number of unknowns, and is hence faster for a prescribed accuracy level. This study clearly shows that OpenMEEG represents the state of the art for forward computations. Moreover, our software development strategies have made it handy to use and to integrate with other packages. The bioelectromagnetic research community should therefore be able to benefit from OpenMEEG with a limited development effort.

OpenMEEG: opensource software for quasistatic bioelectromagnetics

PubMed Central

2010-01-01

Background Interpreting and controlling bioelectromagnetic phenomena require realistic physiological models and accurate numerical solvers. A semi-realistic model often used in practise is the piecewise constant conductivity model, for which only the interfaces have to be meshed. This simplified model makes it possible to use Boundary Element Methods. Unfortunately, most Boundary Element solutions are confronted with accuracy issues when the conductivity ratio between neighboring tissues is high, as for instance the scalp/skull conductivity ratio in electro-encephalography. To overcome this difficulty, we proposed a new method called the symmetric BEM, which is implemented in the OpenMEEG software. The aim of this paper is to present OpenMEEG, both from the theoretical and the practical point of view, and to compare its performances with other competing software packages. Methods We have run a benchmark study in the field of electro- and magneto-encephalography, in order to compare the accuracy of OpenMEEG with other freely distributed forward solvers. We considered spherical models, for which analytical solutions exist, and we designed randomized meshes to assess the variability of the accuracy. Two measures were used to characterize the accuracy. the Relative Difference Measure and the Magnitude ratio. The comparisons were run, either with a constant number of mesh nodes, or a constant number of unknowns across methods. Computing times were also compared. Results We observed more pronounced differences in accuracy in electroencephalography than in magnetoencephalography. The methods could be classified in three categories: the linear collocation methods, that run very fast but with low accuracy, the linear collocation methods with isolated skull approach for which the accuracy is improved, and OpenMEEG that clearly outperforms the others. As far as speed is concerned, OpenMEEG is on par with the other methods for a constant number of unknowns, and is hence faster for a prescribed accuracy level. Conclusions This study clearly shows that OpenMEEG represents the state of the art for forward computations. Moreover, our software development strategies have made it handy to use and to integrate with other packages. The bioelectromagnetic research community should therefore be able to benefit from OpenMEEG with a limited development effort. PMID:20819204

Analysis of Constant Phase Contours of Evaporation Duct Mode Functions for Waveguide Mode Propagation

DTIC Science & Technology

1992-09-01

through the 10 to 11 edge (edge 1) 345 lout=l 346 if (edgeil .IL 0.dO) then 347 c Im(f)=O also runs through 00 to 01 and 01 to 11 edges. 348 c Store...Open(unit-25, file-nile, status- ’unknown’) CALL EZEROX 1ZIILI CLOSE (25) nrmode - nrne] niew0 nrmode - r Ij 63 WRITE ( nowO ) zrs(nil w) 64od DO0240

Dissolution Rate, Weathering Mechanics, and Friability of TNT, Comp B, Tritonal, and Octol

DTIC Science & Technology

2010-02-01

second conceptual model also simulates dissolution of a particle that experiences constant soil moisture such as one mixed in with the soil...or are mediated by moisture on the particle surface is not yet known. The identities of these red products are also unknown as are their health...it using the outdoor data. The model assumes that raindrops intercepted by HE particles were fully saturated in HE as they dripped off. Particle

The Coast Guard Proceedings of the Marine Safety and Security Council. Volume 72, Number 1, Spring 2015

DTIC Science & Technology

2015-01-01

vapor-tight protection). This allows the team to make continuous entries into a contaminated area for at least 72 hours, before they need to restock...to secure a contamination source or to minimize human health or environmental impact. Tailored Response All NSF hazmat technicians are procient in...to identify unknown atmo- spheres and quantify contamination . The NSF also constantly evaluates new technology and advanced instru- ments that

Quantitative Prediction of Rate Constants for Aqueous Racemization To Avoid Pointless Stereoselective Syntheses

PubMed Central

Ballard, Andrew; Ahmad, Hiwa O.; Narduolo, Stefania; Rosa, Lucy; Chand, Nikki; Cosgrove, David A.; Varkonyi, Peter; Asaad, Nabil; Tomasi, Simone

2017-01-01

Abstract Racemization has a large impact upon the biological properties of molecules but the chemical scope of compounds with known rate constants for racemization in aqueous conditions was hitherto limited. To address this remarkable blind spot, we have measured the kinetics for racemization of 28 compounds using circular dichroism and 1H NMR spectroscopy. We show that rate constants for racemization (measured by ourselves and others) correlate well with deprotonation energies from quantum mechanical (QM) and group contribution calculations. Such calculations thus provide predictions of the second‐order rate constants for general‐base‐catalyzed racemization that are usefully accurate. When applied to recent publications describing the stereoselective synthesis of compounds of purported biological value, the calculations reveal that racemization would be sufficiently fast to render these expensive syntheses pointless. PMID:29072355

Correct implementation of polarization constants in wurtzite materials and impact on III-nitrides

DOE PAGES

Dreyer, Cyrus E.; Janotti, Anderson; Van de Walle, Chris G.; ...

2016-06-20

Here, accurate values for polarization discontinuities between pyroelectric materials are critical for understanding and designing the electronic properties of heterostructures. For wurtzite materials, the zincblende structure has been used in the literature as a reference to determine the effective spontaneous polarization constants. We show that, because the zincblende structure has a nonzero formal polarization, this method results in a spurious contribution to the spontaneous polarization differences between materials. In addition, we address the correct choice of "improper" versus "proper" piezoelectric constants. For the technologically important III-nitride materials GaN, AlN, and InN, we determine polarization discontinuities using a consistent reference basedmore » on the layered hexagonal structure and the correct choice of piezoelectric constants, and discuss the results in light of available experimental data.« less

Real Problems, Real Research, Real Students: Authentic Research with Undergraduates as a Win-Win-Win Collaboration

ERIC Educational Resources Information Center

Bank, Carl-Georg; Ryan, Anne Marie

2009-01-01

Authentic research, in which students pose original questions and attempt to find the unknown answers, addresses principles of undergraduate education in an ideal way. With careful planning and reasoned considerations it will benefit students, faculty, and institutions.

Detecting Latent Heterogeneity

ERIC Educational Resources Information Center

Pearl, Judea

2017-01-01

We address the task of determining, from statistical averages alone, whether a population under study consists of several subpopulations, unknown to the investigator, each responding to a given treatment markedly differently. We show that such determination is feasible in three cases: (1) randomized trials with binary treatments, (2) models where…

Our Universe from the cosmological constant

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barrau, Aurélien; Linsefors, Linda, E-mail: Aurelien.Barrau@cern.ch, E-mail: linda.linsefors@lpsc.in2p3.fr

The issue of the origin of the Universe and of its contents is addressed in the framework of bouncing cosmologies, as described for example by loop quantum gravity. If the current acceleration is due to a true cosmological constant, this constant is naturally conserved through the bounce and the Universe should also be in a (contracting) de Sitter phase in the remote past. We investigate here the possibility that the de Sitter temperature in the contracting branch fills the Universe with radiation that causes the bounce and the subsequent inflation and reheating. We also consider the possibility that this givesmore » rise to a cyclic model of the Universe and suggest some possible tests.« less

Note: Improved calibration of atomic force microscope cantilevers using multiple reference cantilevers.

PubMed

Sader, John E; Friend, James R

2015-05-01

Overall precision of the simplified calibration method in J. E. Sader et al., Rev. Sci. Instrum. 83, 103705 (2012), Sec. III D, is dominated by the spring constant of the reference cantilever. The question arises: How does one take measurements from multiple reference cantilevers, and combine these results, to improve uncertainty of the reference cantilever's spring constant and hence the overall precision of the method? This question is addressed in this note. Its answer enables manufacturers to specify of a single set of data for the spring constant, resonant frequency, and quality factor, from measurements on multiple reference cantilevers. With this data set, users can trivially calibrate cantilevers of the same type.

Universal nonlinear small-scale dynamo.

PubMed

Beresnyak, A

2012-01-20

We consider astrophysically relevant nonlinear MHD dynamo at large Reynolds numbers (Re). We argue that it is universal in a sense that magnetic energy grows at a rate which is a constant fraction C(E) of the total turbulent dissipation rate. On the basis of locality bounds we claim that this "efficiency of the small-scale dynamo", C(E), is a true constant for large Re and is determined only by strongly nonlinear dynamics at the equipartition scale. We measured C(E) in numerical simulations and observed a value around 0.05 in the highest resolution simulations. We address the issue of C(E) being small, unlike the Kolmogorov constant which is of order unity. © 2012 American Physical Society

Global tracking for a class of uncertain nonlinear systems with unknown sign-switching control direction by output feedback

NASA Astrophysics Data System (ADS)

Roux Oliveira, Tiago; Jacoud Peixoto, Alessandro; Hsu, Liu

2015-09-01

This paper addresses the design of a sliding mode controller for a class of high-order uncertain nonlinear plants with unmatched state-dependent nonlinearities and unknown sign of the high frequency gain, i.e., the control direction is assumed unknown. Differently from most previous studies, the control direction is allowed to switch its sign. We show that it is possible to obtain global exact tracking using only output-feedback by coupling a relay periodic switching function with a norm state observer. One significant advantage of the new scheme is its robustness and improved transient response under arbitrary changes of the control direction which have been theoretically demonstrated for jump variations and successfully tested by simulations. The proposed controller is also evaluated with a DC motor control experiment.

The Equivalence Principle and the Constants of Nature

NASA Astrophysics Data System (ADS)

Damour, Thibault

2009-12-01

We briefly review the various contexts within which one might address the issue of “why” the dimensionless constants of Nature have the particular values that they are observed to have. Both the general historical trend, in physics, of replacing a-priori-given, absolute structures by dynamical entities, and anthropic considerations, suggest that coupling “constants” have a dynamical nature. This hints at the existence of observable violations of the Equivalence Principle at some level, and motivates the need for improved tests of the Equivalence Principle.

Constant diurnal temperature regime alters the impact of simulated climate warming on a tropical pseudoscorpion

NASA Astrophysics Data System (ADS)

Zeh, Jeanne A.; Bonilla, Melvin M.; Su, Eleanor J.; Padua, Michael V.; Anderson, Rachel V.; Zeh, David W.

2014-01-01

Recent theory suggests that global warming may be catastrophic for tropical ectotherms. Although most studies addressing temperature effects in ectotherms utilize constant temperatures, Jensen's inequality and thermal stress considerations predict that this approach will underestimate warming effects on species experiencing daily temperature fluctuations in nature. Here, we tested this prediction in a neotropical pseudoscorpion. Nymphs were reared in control and high-temperature treatments under a constant daily temperature regime, and results compared to a companion fluctuating-temperature study. At constant temperature, pseudoscorpions outperformed their fluctuating-temperature counterparts. Individuals were larger, developed faster, and males produced more sperm, and females more embryos. The greatest impact of temperature regime involved short-term, adult exposure, with constant temperature mitigating high-temperature effects on reproductive traits. Our findings demonstrate the importance of realistic temperature regimes in climate warming studies, and suggest that exploitation of microhabitats that dampen temperature oscillations may be critical in avoiding extinction as tropical climates warm.

Ab initio calculation of harmonic force fields and vibrational spectra for the arsine oxides and sulfides R sub 3 AsY (R = H, F; Y = O, S) and related compounds

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schneider, W.; Thiel, W.; Komornicki, A.

1990-04-05

Ab initio self-consistent-field calculations using effective core potentials and polarized double-zeta basis sets are reported for the arsenic compounds H{sub 3}As, H{sub 3}AsO, H{sub 3}AsS, F{sub 3}As, F{sub 3}AsO, F{sub 3}AsS, cis- and trans-H{sub 2}AsOH, and HAsO. The calculated geometries, rotational constants, vibrational frequencies, Coriolis coupling constants, centrifugal distortion constants, infrared band intensities, and force fields are compared with the available experimental data. Good agreement is found in the case of the known molecules, especially H{sub 3}As and F{sub 3}As, so that the predictions for the unknown molecules are expected to be realistic. The theoretical results confirm a recent spectroscopicmore » identification of H{sub 3}AsO, H{sub 2}AsOH, and HAsO and suggest reassignment of several observed frequencies.« less

In vitro and in vivo comparisons of constant resistance AC iontophoresis and DC iontophoresis.

PubMed

Li, S Kevin; Higuchi, William I; Zhu, Honggang; Kern, Steven E; Miller, David J; Hastings, Matthew S

2003-09-04

A previous in vitro constant electrical resistance alternating current (AC) iontophoresis study with human epidermal membrane (HEM) and a model neutral permeant has shown less inter- and intra-sample variability in iontophoretic transport relative to conventional constant direct current (DC) iontophoresis. The objectives of the present study were to address the following questions. (1) Can the skin electrical resistance be maintained at a constant level by AC in humans in vivo? (2) Are the in vitro data with HEM representative of those in vivo? (3) Does constant skin resistance AC iontophoresis have less inter- and intra-sample variability than conventional constant current DC iontophoresis in vivo? (4) What are the electrical and the barrier properties of skin during iontophoresis in vivo? In the present study, in vitro HEM experiments were carried out with the constant resistance AC and the conventional constant current DC methods using mannitol and glucose as the neutral model permeants. In vivo human experiments were performed using glucose as the permeant with a constant skin resistance AC only protocol and two conventional constant current DC methods (continuous constant current DC and constant current DC with its polarity alternated every 10 min with a 3:7 on:off duty cycle). Constant current DC iontophoresis was conducted with commercial constant current DC devices, and constant resistance AC iontophoresis was carried out by reducing and maintaining the skin resistance at a constant target value with AC supplied from a function generator. This study shows that (1) skin electrical resistance can be maintained at a constant level during AC iontophoresis in vivo; (2) HEM in vitro and human skin in vivo demonstrate similar electrical and barrier properties, and these properties are consistent with our previous findings; (3) there is general qualitative and semi-quantitative agreement between the HEM data in vitro and human skin data in vivo; and (4) constant skin resistance AC iontophoresis generally provides less inter- and intra-subject variability than conventional constant current DC.

Music Training and Working Memory: An ERP Study

ERIC Educational Resources Information Center

George, Elyse M.; Coch, Donna

2011-01-01

While previous research has suggested that music training is associated with improvements in various cognitive and linguistic skills, the mechanisms mediating or underlying these associations are mostly unknown. Here, we addressed the hypothesis that previous music training is related to improved working memory. Using event-related potentials…

What Is a Psychological Misconception? Moving toward an Empirical Answer

ERIC Educational Resources Information Center

Bensley, D. Alan; Lilienfeld, Scott O.

2015-01-01

Studies of psychological misconceptions have often used tests with methodological shortcomings, unknown psychometric properties, and ad hoc methods for identifying misconceptions, creating problems for estimating frequencies of specific misconceptions. To address these problems, we developed a new test, the Test of Psychological Knowledge and…

On the R-Dependence of the Spin-Orbit Coupling Constant: Potential Energy Functions of Xe2+ by High-Resolution Photoelectron Spectroscopy and ab initio Quantum Chemistry

DTIC Science & Technology

2008-01-01

ORGANIZATION NAME(S) AND ADDRESS(ES) 8. PERFORMING ORGANIZATION REPORT NUMBER Air Force Research Laboratory /RVBXR AFRL-RV-HA-TR-2008-1053 29 Randolph...the umn 2 in Table I) features a very similiar behavior of a(R) g states so that the asymptotic value of a(R) exactly coffe - although these a(R) curves

Finding My Place at the Table.

ERIC Educational Resources Information Center

O'Brien, Pat McDonald

1999-01-01

Observes that teaching today is a major challenge as teachers attempt to sift through everything that confronts them and as they constantly struggle with conflict while trying to address the complex dilemmas facing them daily in their classrooms. (SR)

The secrets of the unknown trauma patient. The hazards of undiagnosed subclavian steal syndrome in the chest trauma patient: a case report.

PubMed

Watemberg, S; Avrahami, R; Landau, O; Kott, I

1997-10-01

Chest trauma can be complicated, among others, with cardiac tamponade. This life-threatening condition should be treated promptly and adequately to assure a positive outcome. During the rapid events that take place in the emergency room with the arrival of a polytrauma patient, anamnestic data are not always available, especially if dealing with a non-cooperative, unaccompained traumatized patient. The following case report describes our experience with a chest trauma patient after a vehicle accident, who was admitted to our ward exhibiting a constellation of signs compatible with a cardiac tamponade. The only demonstrable objective signs included distended mediastinum and heart shadow on the chest X ray and muffled heart sounds. However, despite the impressive clinical picture, the patient continued to exhibit constant, though low blood pressure measurements and after a short period of observation, given the homodynamic stability, it was decided against pericardiocenthesis. The "secret" of our patient was finally discovered at angiography, when a left subclavian steal was diagnosed. The literature in this matter is discussed, stressing the importance of anamnestic data in the trauma patient. Most importantly, we address the significance of relying on hard clinical data (homodynamic stability) rather than on isolated signs (widened mediastinum/heart shadow) to reach as accurate a diagnosis as possible before pursuing invasive, usually not-innocuous procedures (pericardiocenthesis).

Efficient data assimilation algorithm for bathymetry application

NASA Astrophysics Data System (ADS)

Ghorbanidehno, H.; Lee, J. H.; Farthing, M.; Hesser, T.; Kitanidis, P. K.; Darve, E. F.

2017-12-01

Information on the evolving state of the nearshore zone bathymetry is crucial to shoreline management, recreational safety, and naval operations. The high cost and complex logistics of using ship-based surveys for bathymetry estimation have encouraged the use of remote sensing techniques. Data assimilation methods combine the remote sensing data and nearshore hydrodynamic models to estimate the unknown bathymetry and the corresponding uncertainties. In particular, several recent efforts have combined Kalman Filter-based techniques such as ensembled-based Kalman filters with indirect video-based observations to address the bathymetry inversion problem. However, these methods often suffer from ensemble collapse and uncertainty underestimation. Here, the Compressed State Kalman Filter (CSKF) method is used to estimate the bathymetry based on observed wave celerity. In order to demonstrate the accuracy and robustness of the CSKF method, we consider twin tests with synthetic observations of wave celerity, while the bathymetry profiles are chosen based on surveys taken by the U.S. Army Corps of Engineer Field Research Facility (FRF) in Duck, NC. The first test case is a bathymetry estimation problem for a spatially smooth and temporally constant bathymetry profile. The second test case is a bathymetry estimation problem for a temporally evolving bathymetry from a smooth to a non-smooth profile. For both problems, we compare the results of CSKF with those obtained by the local ensemble transform Kalman filter (LETKF), which is a popular ensemble-based Kalman filter method.

High-Frequency Vibration of the Organ of Corti in Vitro

NASA Astrophysics Data System (ADS)

Scherer, M. P.; Nowotny, M.; Dalhoff, E.; Zenner, H.-P.; Gummer, A. W.

2003-02-01

The mechanism by which the electromechanical force generated by the outer hair cells (OHC) produces the exquisite sensitivity, frequency selectivity and dynamic range of the cochlea is unknown. To address this question, we measured the electrically induced radial vibration pattern at different levels within the organ of Corti of the guinea pig. Two in vitro preparations were used: 1) a half turn including modiolar bone and cochlear partition, without tectorial membrane (TM); the basilar membrane (BM) was supported from its tympanal side. 2) A temporal bone preparation, where the bony wall was removed above and below the measurement location to permit introduction of electrodes. In the latter case, the cochlear partition was in its normal mechanical environment, with free swinging BM and with TM. Velocity of BM, reticular lamina (RL), and upper and lower sides of the TM in response to broadband electrical stimulation of the OHCs was measured with a laser Doppler vibrometer. The interferometer was sensitive enough to permit measurement without reflective beads or the like. The frequency range of the stimulation was 480 Hz - 70 kHz. Displacement amplitudes were constant up to 10 kHz, after which they dropped with -14 to -17 dB/oct. Moving across the RL in the radial direction, phase reversals characteristic of pivoting points occurred above the pillar cells and the outer tunnel. No phase reversals were observed on the BM and TM.

Translucent Procedures, Abstraction without Opacity

DTIC Science & Technology

1993-10-01

Justi1ficatilon By- Distribut •c._/ rAviiii andi or Dist Sp• ialI I ..da A Guillermo Rozas Mazo (1931-1990). c~uyo desco de dar a sus hijos la cducaci6n... que dI no pudo recibir. con este trabajo realizo. Lo proinetido es deuda. Acknowledgments There are many people to whom I owe my sanity and to whom I...constant value). This expression gives us the value of the last unknown. 4. Once the residual system is solved, compute the value of the eliminated un

A Comparison of Modeled and Observed Ocean Mixed Layer Behavior in a Sea Breeze Influenced Coastal Region

DTIC Science & Technology

1993-12-21

Latent(Lower Solid), Net Infrared (Dashed), and Net viii Heat Loss (Upper Solid - the Other 3 Surmmed) are Plotted, with Positive Values :ndicating...gained from solar insolation, Qs, and the heat lost from the surface due to latent, Qe, sensible, Qh, and net infrared radiation, Qb is positive...five empirically derived dimensionless constants in the model. With the introduction of two new unknowns, <E> and < ww2 >, the prediction of the upper

Line width determination using a biomimetic fly eye vision system.

PubMed

Benson, John B; Wright, Cameron H G; Barrett, Steven F

2007-01-01

Developing a new vision system based on the vision of the common house fly, Musca domestica, has created many interesting design challenges. One of those problems is line width determination, which is the topic of this paper. It has been discovered that line width can be determined with a single sensor as long as either the sensor, or the object in question, has a constant, known velocity. This is an important first step for determining the width of any arbitrary object, with unknown velocity.

Unaccounted source of systematic errors in measurements of the Newtonian gravitational constant G

NASA Astrophysics Data System (ADS)

DeSalvo, Riccardo

2015-06-01

Many precision measurements of G have produced a spread of results incompatible with measurement errors. Clearly an unknown source of systematic errors is at work. It is proposed here that most of the discrepancies derive from subtle deviations from Hooke's law, caused by avalanches of entangled dislocations. The idea is supported by deviations from linearity reported by experimenters measuring G, similarly to what is observed, on a larger scale, in low-frequency spring oscillators. Some mitigating experimental apparatus modifications are suggested.

Fluorogenic kinetic assay for high-throughput discovery of stereoselective ketoreductases relevant to pharmaceutical synthesis.

PubMed

Thai, Yen-Chi; Szekrenyi, Anna; Qi, Yuyin; Black, Gary W; Charnock, Simon J; Fessner, Wolf-Dieter

2018-04-01

Enantiomerically pure 1-(6-methoxynaphth-2-yl) and 1-(6-(dimethylamino)naphth-2-yl) carbinols are fluorogenic substrates for aldo/keto reductase (KRED) enzymes, which allow the highly sensitive and reliable determination of activity and kinetic constants of known and unknown enzymes, as well as an immediate enantioselectivity typing. Because of its simplicity in microtiter plate format, the assay qualifies for the discovery of novel KREDs of yet unknown specificity among this vast enzyme superfamily. The suitability of this approach for enzyme typing is illustrated by an exemplary screening of a large collection of short-chain dehydrogenase/reductase (SDR) enzymes arrayed from a metagenomic approach. We believe that this assay format should match well the pharmaceutical industry's demand for acetophenone-type substrates and the continuing interest in new enzymes with broad substrate promiscuity for the synthesis of chiral, non-racemic carbinols. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

The application of laser-Raman light scattering to the determination of sulfate in sea and estuarine waters

NASA Technical Reports Server (NTRS)

Bandy, A. R.

1973-01-01

Laser-Raman light scattering is a technique for determining sulfate concentrations in sea and estuarine waters with apparently none of the interferences inherent in the gravimetric and titrametric methods. The Raman measurement involved the ratioing of the peak heights of an unknown sulfate concentration and a nitrate internal standard. This ratio was used to calculate the unknown sulfate concentration from a standard curve. The standard curve was derived from the Raman data on prepared nitrate-sulfate solutions. At the 99.7% confidence level, the accuracy of the Raman technique was 7 to 8.6 percent over the concentration range of the standard curve. The sulfate analyses of water samples collected at the mouth of the James River, Hampton, Virginia, demonstrated that in most cases sulfate had a constant concentration relative to salinity in this area.

Adaptive boundary concentration control using Zakai equation

NASA Astrophysics Data System (ADS)

Tenno, R.; Mendelson, A.

2010-06-01

A mean-variance control problem is formulated with respect to a partially observed nonlinear system that includes unknown constant parameters. A physical prototype of the system is the cathode surface reaction in an electrolysis cell, where the controller aim is to keep the boundary concentration of species in the near vicinity of the cathode surface low but not zero. The boundary concentration is a diffusion-controlled process observed through the measured current density and, in practice, controlled through the applied voltage. The former incomplete data control problem is converted to complete data-to the so-called separated control problem whose solution is given by the infinite-dimensional Zakai equation. In this article, the separated control problem is solved numerically using pathwise integration of the Zakai equation. This article demonstrates precise tracking of the target trajectory with a rapid convergence of estimates to unknown parameters, which take place simultaneously with control.

A new method for determining acoustic-liner admittance in a rectangular duct with grazing flow from experimental data

NASA Technical Reports Server (NTRS)

Watson, W. R.

1984-01-01

A method is developed for determining acoustic liner admittance in a rectangular duct with grazing flow. The axial propagation constant, cross mode order, and mean flow profile is measured. These measured data are then input into an analytical program which determines the unknown admittance value. The analytical program is based upon a finite element discretization of the acoustic field and a reposing of the unknown admittance value as a linear eigenvalue problem on the admittance value. Gaussian elimination is employed to solve this eigenvalue problem. The method used is extendable to grazing flows with boundary layers in both transverse directions of an impedance tube (or duct). Predicted admittance values are compared both with exact values that can be obtained for uniform mean flow profiles and with those from a Runge Kutta integration technique for cases involving a one dimensional boundary layer.

Planar maneuvering control of underwater snake robots using virtual holonomic constraints.

PubMed

Kohl, Anna M; Kelasidi, Eleni; Mohammadi, Alireza; Maggiore, Manfredi; Pettersen, Kristin Y

2016-11-24

This paper investigates the problem of planar maneuvering control for bio-inspired underwater snake robots that are exposed to unknown ocean currents. The control objective is to make a neutrally buoyant snake robot which is subject to hydrodynamic forces and ocean currents converge to a desired planar path and traverse the path with a desired velocity. The proposed feedback control strategy enforces virtual constraints which encode biologically inspired gaits on the snake robot configuration. The virtual constraints, parametrized by states of dynamic compensators, are used to regulate the orientation and forward speed of the snake robot. A two-state ocean current observer based on relative velocity sensors is proposed. It enables the robot to follow the path in the presence of unknown constant ocean currents. The efficacy of the proposed control algorithm for several biologically inspired gaits is verified both in simulations for different path geometries and in experiments.

Into the Unknown: Aging with Autism Spectrum Disorders

ERIC Educational Resources Information Center

Perkins, Elizabeth A.; Berkman, Karen A.

2012-01-01

Research investigation of older adults with autism spectrum disorders (ASD) noticeably lags behind studies of children and younger adults with ASD. This article reviews the current literature regarding a range of quality of life outcomes of aging adults with ASD. Studies that have addressed life expectancy, comorbid physical and mental health…

Adolescents Define Sexual Orientation and Suggest Ways to Measure It

ERIC Educational Resources Information Center

Friedman, M. S. Mark S.; Silvestre, Anthony J.; Gold, Melanie A.; Markovic, Nina; Savin-Williams, Ritch C.; Huggins, James; Sell, Randal L.

2004-01-01

Researchers disagree on how to assess adolescent sexual orientation. The relative importance of various dimensions (e.g. attraction, relationships, behavior, self-labeling) is unknown, which calls into question the validity of studies assessing adolescent sexual orientation. To address this issue, 50 male and female adolescents of varied sexual…

Complex Sentence Profiles in Children with Specific Language Impairment: Are They Really Atypical?

ERIC Educational Resources Information Center

Riches, Nick G.

2017-01-01

Children with Specific Language Impairment (SLI) have language difficulties of unknown origin. Syntactic profiles are atypical, with poor performance on non-canonical structures, e.g. object relatives, suggesting a localized deficit. However, existing analyses using ANOVAs are problematic because they do not systematically address unequal…

LAB ANALYSIS OF EMERGENCY WATER SAMPLES CONTAINING UNKNOWN CONTAMINANTS: CONSIDERATIONS FROM THE USEPA RESPONSE PROTOCOL TOOLBOX

EPA Science Inventory

EPA's Office of Research and Development and Office of Water/Water Security Division have jointly developed a Response Protocol Toolbox (RPTB) to address the complex, multi-faceted challenges of a water utility's planning and response to intentional contamination of drinking wate...

"ZEAL": An Aesthetic Revolution for Education

ERIC Educational Resources Information Center

Clark, Barbara A.; French, James Joss

2012-01-01

Educators are hesitant to venture into the unknown landscape within a child's heart and mind because they have throughout their education experienced the same non-compassionate teachers. This research proposes an awakening, making a wave for a new revolution of compassionate teachers that institutes aesthetic methodology to address relevant…

Dietary rice protein isolate attenuates atherosclerosis in apoE-deficient mice by upregulating antioxidant enzymes

USDA-ARS?s Scientific Manuscript database

Rice-based diets may have been reported to protect against the development of atherosclerosis; however, the underlying mechanism(s) for this protection remains unknown. In this report, the mechanism(s) contributing to the atheroprotective effects of rice-based diet was addressed using the apolipopro...

Biosystematics and evolutionary relationships of perennial Triticeae species revealed by genomic analyses

USDA-ARS?s Scientific Manuscript database

Literature published after 1984 were reviewed to address: (1) genome relationships among monogenomic diploid species, (2) progenitors of the unknown Y genome in Elymus polyploids, X in Thinopyrum intermedium, and Xm in Leymus, and (3) genome constitutions of some perennial Triticeae species that wer...

Regolith thermal property inversion in the LUNAR-A heat-flow experiment

NASA Astrophysics Data System (ADS)

Hagermann, A.; Tanaka, S.; Yoshida, S.; Fujimura, A.; Mizutani, H.

2001-11-01

In 2003, two penetrators of the LUNAR--A mission of ISAS will investigate the internal structure of the Moon by conducting seismic and heat--flow experiments. Heat-flow is the product of thermal gradient tial T / tial z, and thermal conductivity λ of the lunar regolith. For measuring the thermal conductivity (or dissusivity), each penetrator will carry five thermal property sensors, consisting of small disc heaters. The thermal response Ts(t) of the heater itself to the constant known power supply of approx. 50 mW serves as the data for the subsequent data interpretation. Horai et al. (1991) found a forward analytical solution to the problem of determining the thermal inertia λ ρ c of the regolith for constant thermal properties and a simplyfied geometry. In the inversion, the problem of deriving the unknown thermal properties of a medium from known heat sources and temperatures is an Identification Heat Conduction Problem (IDHCP), an ill--posed inverse problem. Assuming that thermal conductivity λ and heat capacity ρ c are linear functions of temperature (which is reasonable in most cases), one can apply a Kirchhoff transformation to linearize the heat conduction equation, which minimizes computing time. Then the error functional, i.e. the difference between the measured temperature response of the heater and the predicted temperature response, can be minimized, thus solving for thermal dissusivity κ = λ / (ρ c), wich will complete the set of parameters needed for a detailed description of thermal properties of the lunar regolith. Results of model calculations will be presented, in which synthetic data and calibration data are used to invert the unknown thermal diffusivity of the unknown medium by means of a modified Newton Method. Due to the ill-posedness of the problem, the number of parameters to be solved for should be limited. As the model calculations reveal, a homogeneous regolith allows for a fast and accurate inversion.

Power maximization of variable-speed variable-pitch wind turbines using passive adaptive neural fault tolerant control

NASA Astrophysics Data System (ADS)

Habibi, Hamed; Rahimi Nohooji, Hamed; Howard, Ian

2017-09-01

Power maximization has always been a practical consideration in wind turbines. The question of how to address optimal power capture, especially when the system dynamics are nonlinear and the actuators are subject to unknown faults, is significant. This paper studies the control methodology for variable-speed variable-pitch wind turbines including the effects of uncertain nonlinear dynamics, system fault uncertainties, and unknown external disturbances. The nonlinear model of the wind turbine is presented, and the problem of maximizing extracted energy is formulated by designing the optimal desired states. With the known system, a model-based nonlinear controller is designed; then, to handle uncertainties, the unknown nonlinearities of the wind turbine are estimated by utilizing radial basis function neural networks. The adaptive neural fault tolerant control is designed passively to be robust on model uncertainties, disturbances including wind speed and model noises, and completely unknown actuator faults including generator torque and pitch actuator torque. The Lyapunov direct method is employed to prove that the closed-loop system is uniformly bounded. Simulation studies are performed to verify the effectiveness of the proposed method.

A learning-based semi-autonomous controller for robotic exploration of unknown disaster scenes while searching for victims.

PubMed

Doroodgar, Barzin; Liu, Yugang; Nejat, Goldie

2014-12-01

Semi-autonomous control schemes can address the limitations of both teleoperation and fully autonomous robotic control of rescue robots in disaster environments by allowing a human operator to cooperate and share such tasks with a rescue robot as navigation, exploration, and victim identification. In this paper, we present a unique hierarchical reinforcement learning-based semi-autonomous control architecture for rescue robots operating in cluttered and unknown urban search and rescue (USAR) environments. The aim of the controller is to enable a rescue robot to continuously learn from its own experiences in an environment in order to improve its overall performance in exploration of unknown disaster scenes. A direction-based exploration technique is integrated in the controller to expand the search area of the robot via the classification of regions and the rubble piles within these regions. Both simulations and physical experiments in USAR-like environments verify the robustness of the proposed HRL-based semi-autonomous controller to unknown cluttered scenes with different sizes and varying types of configurations.

Market-Based Coordination of Thermostatically Controlled Loads—Part II: Unknown Parameters and Case Studies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Sen; Zhang, Wei; Lian, Jianming

This two-part paper considers the coordination of a population of Thermostatically Controlled Loads (TCLs) with unknown parameters to achieve group objectives. The problem involves designing the bidding and market clearing strategy to motivate self-interested users to realize efficient energy allocation subject to a peak power constraint. The companion paper (Part I) formulates the problem and proposes a load coordination framework using the mechanism design approach. To address the unknown parameters, Part II of this paper presents a joint state and parameter estimation framework based on the expectation maximization algorithm. The overall framework is then validated using real-world weather data andmore » price data, and is compared with other approaches in terms of aggregated power response. Simulation results indicate that our coordination framework can effectively improve the efficiency of the power grid operations and reduce power congestion at key times.« less

Neuro-adaptive backstepping control of SISO non-affine systems with unknown gain sign.

PubMed

Ramezani, Zahra; Arefi, Mohammad Mehdi; Zargarzadeh, Hassan; Jahed-Motlagh, Mohammad Reza

2016-11-01

This paper presents two neuro-adaptive controllers for a class of uncertain single-input, single-output (SISO) nonlinear non-affine systems with unknown gain sign. The first approach is state feedback controller, so that a neuro-adaptive state-feedback controller is constructed based on the backstepping technique. The second approach is an observer-based controller and K-filters are designed to estimate the system states. The proposed method relaxes a priori knowledge of control gain sign and therefore by utilizing the Nussbaum-type functions this problem is addressed. In these methods, neural networks are employed to approximate the unknown nonlinear functions. The proposed adaptive control schemes guarantee that all the closed-loop signals are semi-globally uniformly ultimately bounded (SGUUB). Finally, the theoretical results are numerically verified through simulation examples. Simulation results show the effectiveness of the proposed methods. Copyright © 2016 ISA. All rights reserved.

Effects of memory colour on colour constancy for unknown coloured objects

PubMed Central

Granzier, Jeroen J M; Gegenfurtner, Karl R

2012-01-01

The perception of an object's colour remains constant despite large variations in the chromaticity of the illumination—colour constancy. Hering suggested that memory colours, the typical colours of objects, could help in estimating the illuminant's colour and therefore be an important factor in establishing colour constancy. Here we test whether the presence of objects with diagnostical colours (fruits, vegetables, etc) within a scene influence colour constancy for unknown coloured objects in the scene. Subjects matched one of four Munsell papers placed in a scene illuminated under either a reddish or a greenish lamp with the Munsell book of colour illuminated by a neutral lamp. The Munsell papers were embedded in four different scenes—one scene containing diagnostically coloured objects, one scene containing incongruent coloured objects, a third scene with geometrical objects of the same colour as the diagnostically coloured objects, and one scene containing non-diagnostically coloured objects (eg, a yellow coffee mug). All objects were placed against a black background. Colour constancy was on average significantly higher for the scene containing the diagnostically coloured objects compared with the other scenes tested. We conclude that the colours of familiar objects help in obtaining colour constancy for unknown objects. PMID:23145282

Effects of memory colour on colour constancy for unknown coloured objects.

PubMed

Granzier, Jeroen J M; Gegenfurtner, Karl R

2012-01-01

The perception of an object's colour remains constant despite large variations in the chromaticity of the illumination-colour constancy. Hering suggested that memory colours, the typical colours of objects, could help in estimating the illuminant's colour and therefore be an important factor in establishing colour constancy. Here we test whether the presence of objects with diagnostical colours (fruits, vegetables, etc) within a scene influence colour constancy for unknown coloured objects in the scene. Subjects matched one of four Munsell papers placed in a scene illuminated under either a reddish or a greenish lamp with the Munsell book of colour illuminated by a neutral lamp. The Munsell papers were embedded in four different scenes-one scene containing diagnostically coloured objects, one scene containing incongruent coloured objects, a third scene with geometrical objects of the same colour as the diagnostically coloured objects, and one scene containing non-diagnostically coloured objects (eg, a yellow coffee mug). All objects were placed against a black background. Colour constancy was on average significantly higher for the scene containing the diagnostically coloured objects compared with the other scenes tested. We conclude that the colours of familiar objects help in obtaining colour constancy for unknown objects.

Note: Improved calibration of atomic force microscope cantilevers using multiple reference cantilevers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sader, John E., E-mail: jsader@unimelb.edu.au; Friend, James R.

2015-05-15

Overall precision of the simplified calibration method in J. E. Sader et al., Rev. Sci. Instrum. 83, 103705 (2012), Sec. III D, is dominated by the spring constant of the reference cantilever. The question arises: How does one take measurements from multiple reference cantilevers, and combine these results, to improve uncertainty of the reference cantilever’s spring constant and hence the overall precision of the method? This question is addressed in this note. Its answer enables manufacturers to specify of a single set of data for the spring constant, resonant frequency, and quality factor, from measurements on multiple reference cantilevers. Withmore » this data set, users can trivially calibrate cantilevers of the same type.« less

The Adsorption of Bromide Ion at Mercury from Propylene Carbonate Solutions of Constant Ionic Strength

DTIC Science & Technology

1991-05-20

Chemistry University of California Davis, CA 95616 * To whom correspondence should be addressed. t Permanent address: Instituto de Fisica e Quimica ...I]. In the case of Br- ion adsorption at Hg, studies have been carried out in water [2-4] and N- methylformamide solutions [5,6] of both varying and...discussed with respect to current theoretical developments. 4 Experimental Differential capacity against potential data were obtained for the mercury

Allocating monitoring effort in the face of unknown unknowns

USGS Publications Warehouse

Wintle, B.A.; Runge, M.C.; Bekessy, S.A.

2010-01-01

There is a growing view that to make efficient use of resources, ecological monitoring should be hypothesis-driven and targeted to address specific management questions. 'Targeted' monitoring has been contrasted with other approaches in which a range of quantities are monitored in case they exhibit an alarming trend or provide ad hoc ecological insights. The second form of monitoring, described as surveillance, has been criticized because it does not usually aim to discern between competing hypotheses, and its benefits are harder to identify a priori. The alternative view is that the existence of surveillance data may enable rapid corroboration of emerging hypotheses or help to detect important 'unknown unknowns' that, if undetected, could lead to catastrophic outcomes or missed opportunities. We derive a model to evaluate and compare the efficiency of investments in surveillance and targeted monitoring. We find that a decision to invest in surveillance monitoring may be defensible if: (1) the surveillance design is more likely to discover or corroborate previously unknown phenomena than a targeted design and (2) the expected benefits (or avoided costs) arising from discovery are substantially higher than those arising from a well-planned targeted design. Our examination highlights the importance of being explicit about the objectives, costs and expected benefits of monitoring in a decision analytic framework. ?? 2010 Blackwell Publishing Ltd/CNRS.

The free fall of an apple: conceptual subtleties and implications for physics teaching

NASA Astrophysics Data System (ADS)

Assis, A. K. T.; Karam, R. A. S.

2018-05-01

The study of free fall is thoroughly present in physics teaching at all levels. From the point of view of Newtonian dynamics it appears to be extremely simple, as it consists of a two-body problem with a constant force generating a constant acceleration. However, there are several important conceptual subtleties and hidden assumptions involved in this problem, which are rarely discussed in educational settings. In this work we present some of these subtleties and argue that explicitly addressing them has significant pedagogical benefits.

Systems with a constant heat flux with applications to radiative heat transport across nanoscale gaps and layers

NASA Astrophysics Data System (ADS)

Budaev, Bair V.; Bogy, David B.

2018-06-01

We extend the statistical analysis of equilibrium systems to systems with a constant heat flux. This extension leads to natural generalizations of Maxwell-Boltzmann's and Planck's equilibrium energy distributions to energy distributions of systems with a net heat flux. This development provides a long needed foundation for addressing problems of nanoscale heat transport by a systematic method based on a few fundamental principles. As an example, we consider the computation of the radiative heat flux between narrowly spaced half-spaces maintained at different temperatures.

Accurate determination of lattice parameters based on Niggli reduced cell theory by using digitized electron diffraction micrograph.

PubMed

Yang, Yi; Cai, Canying; Lin, Jianguo; Gong, Lunjun; Yang, Qibin

2017-05-01

In this paper, we used Niggli reduced cell theory to determine lattice constants of a micro/nano crystal by using electron diffraction patterns. The Niggli reduced cell method enhanced the accuracy of lattice constant measurement obviously, because the lengths and the angles of lattice vectors of a primitive cell can be measured directly on the electron micrographs instead of a double tilt holder. With the aid of digitized algorithm and least square optimization by using three digitized micrographs, a valid reciprocal Niggli reduced cell number can be obtained. Thus a reciprocal and real Bravais lattices are acquired. The results of three examples, i.e., Mg 4 Zn 7 , an unknown phase (Precipitate phase in nickel-base superalloy) and Ba 4 Ti 13 O 30 showed that the maximum errors are 1.6% for lengths and are 0.3% for angles. Copyright © 2017 Elsevier Ltd. All rights reserved.

Decreased shoulder function and pain common in recreational badminton players.

PubMed

Fahlström, M; Söderman, K

2007-06-01

The aim of this study was to describe the prevalence and consequences of painful conditions in the shoulder region in recreational badminton players. A questionnaire study was performed on 99 players, of whom 57 were also assessed with Constant score. Previous or present pain in the dominant shoulder was reported by 52% of the players. Sixteen percent of the players had on-going shoulder pain associated with badminton play. A majority of these players reported that their training habits were affected by the pain. Total Constant score was lower in the painful shoulders. Furthermore, range of active pain-free shoulder abduction was decreased. However, isometric shoulder strength test showed no differences when compared with pain-free shoulders. Even though the pain caused functional problems, the players were still playing with on-going symptoms. The diagnoses were mostly unknown, although history and clinical tests indicate problems resembling subacromial impingement.

Contamination assessment for OSSA space station IOC payloads

NASA Technical Reports Server (NTRS)

Chinn, S.; Gordon, T.; Rantanen, R.

1987-01-01

The results are presented from a study for the Space Station Planners Group of the Office of Space Sciences and Applications. The objectives of the study are: (1) the development of contamination protection requirements for protection of Space Station attached payloads, serviced payloads and platforms; and (2) the determination of unknowns or major impacts requiring further assessment. The nature, sources, and quantitative properties of the external contaminants to be encountered on the Station are summarized. The OSSA payload contamination protection requirements provided by the payload program managers are reviewed and the level of contamination awareness among them is discussed. Preparation of revisions to the contamination protection requirements are detailed. The comparative impact of flying the Station at constant atmospheric density rather than constant altitude is assessed. The impact of the transverse boom configuration of the Station on contamination is also assessed. The contamination protection guidelines which OSSA should enforce during their development of payloads are summarized.

Fine- and hyperfine structure investigations of the even-parity configuration system of the atomic holmium

NASA Astrophysics Data System (ADS)

Stefanska, D.; Ruczkowski, J.; Elantkowska, M.; Furmann, B.

2018-04-01

In this work new experimental results concerning the hyperfine structure (hfs) for the even-parity level system of the holmium atom (Ho I) were obtained; additionally, hfs data obtained recently as a by-product in investigations of the odd-parity level system were summarized. In the present work the values of the magnetic dipole and the electric quadrupole hfs constants A and B were determined for 24 even-parity levels, for 14 of them for the first time. On the basis of these results, as well as on available literature data, a parametric study of the fine structure and the hyperfine structure for the even-parity configurations of atomic holmium was performed. A multi-configuration fit of 7 configurations was carried out, taking into account second-order of the perturbation theory. For unknown electronic levels predicted values of the level energies and hfs constants are given, which can facilitate further experimental investigations.

Method and apparatus for transmutation of atomic nuclei

DOEpatents

Maenchen, John Eric; Ruiz, Carlos Leon

1998-01-01

Insuring a constant supply of radioisotopes is of great importance to medicine and industry. This invention addresses this problem, and helps to solve it by introducing a new apparatus for transmutation of isotopes which enables swift and flexible production on demand.

Symbiotic Chlorella variabilis incubated under constant dark conditions for 24 hours loses the ability to avoid digestion by host lysosomal enzymes in digestive vacuoles of host ciliate Paramecium bursaria.

PubMed

Kodama, Yuuki; Fujishima, Masahiro

2014-12-01

Endosymbiosis between symbiotic Chlorella and alga-free Paramecium bursaria cells can be induced by mixing them. To establish the endosymbiosis, algae must acquire temporary resistance to the host lysosomal enzymes in the digestive vacuoles (DVs). When symbiotic algae isolated from the alga-bearing paramecia are kept under a constant dark conditions for 24 h before mixing with the alga-free paramecia, almost all algae are digested in the host DVs. To examine the cause of algal acquisition to the host lysosomal enzymes, the isolated algae were kept under a constant light conditions with or without a photosynthesis inhibitor 3-(3,4-dichlorophenyl)-1,1-dimethylurea for 24 h, and were mixed with alga-free paramecia. Unexpectedly, most of the algae were not digested in the DVs irrespective of the presence of the inhibitor. Addition of 1 mM maltose, a main photosynthetic product of the symbiotic algae or of a supernatant of the isolated algae kept for 24 h under a constant light conditions, did not rescue the algal digestion in the DVs. These observations reveal that unknown factors induced by light are a prerequisite for algal resistance to the host lysosomal enzymes. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

Determination of the sonic properties of a Nigerian quartz for ultrasonic transducer.

PubMed

Nwadike, Uchechukwu I; Agwu, Kenneth K; Eze, Charles U; Kani, Duke; Agu, Gregory; Enwereuzo, Emmanuel; Obika, Mike; Umoh, Effiong; Ufomba, Emmanuel

2018-03-15

There is abundant quartz deposit in Nigeria which has been used for export and building purposes. However, its electrical and piezoelectric properties have not been studied. Thus, whether it can be used as raw material for the indigenous electric industries is unknown to date. This study aims to characterize the piezoelectric properties of smoky quartz for ultrasonic transducer and determine its sonic properties. In the research approach, the raw quartz was cut into six crystals of rectangular shape using a universal cutter. The crystals were purified with a 100 ml hydrofluoric and hydrochloric acid solution under a temperature of 250°C in a furnace. The sizes, weights, and capacitance of crystals were determined using the standard measuring instruments. The resonance method was used for the determination of the frequency of minimum and maximum impedance of the crystals. The piezoelectric constants of the crystals were derived using the standard formula for determination of piezoelectric constants. The results show that the sonic properties represented by the piezoelectric charge constant (d31) and the piezoelectric voltage constant (g31) values are 2.52 (±1.075) ×10-8c/m2 and 1030.6114 ± 250.89v/m2 respectively. The present study has characterized Nigerian quartz for its piezoelectric properties and found that it was suitable for use in the construction of ultrasonic transducers.

Seedling defoliation and drought stress: variation in intensity and frequency affect performance and survival

USDA-ARS?s Scientific Manuscript database

Our ability to restore rangelands is limited, and it is unknown if seedling herbivory on its own, or in interaction with other stressors, is a major contributor to restoration failure. To address this, we conducted two experiments: a No Defoliation experiment [ND] (n=48) where seedlings from three p...

Outsourcing in Higher Education: The Known and Unknown about the Practice

ERIC Educational Resources Information Center

Wekullo, Caroline Sabina

2017-01-01

Outsourcing or privatising services in higher education is a common practice, but what do we really know about it? Is outsourcing effective? It is imperative that these questions be addressed since outsourcing is becoming a norm in higher education institutions. Scholars, institutional administrators and policymakers need to understand the…

Tsunesaburo Makiguchi and Mikhail Bakhtin in Dialogue: Pedagogy for a Spatial Literacy of Ecological Selfhood

ERIC Educational Resources Information Center

Goulah, Jason

2009-01-01

This article considers the philosophies of unknown Japanese educator Tsunesaburo Makiguchi (1871-1944) and his Russian contemporary Mikhail Bakhtin (1895-1975) as an Asian-Pacific pedagogical foundation for addressing the fierce urgency of human-induced environmental destruction and global climate shock. Specifically, the author compares…

Factors Predicting Online Graduate Students' Responsiveness to Feedback from Their Professors

ERIC Educational Resources Information Center

Breslin, Mary R.

2012-01-01

College students act on their professors' feedback less often and less completely than their professors would like. The problem this study addressed is that the relative predictive value of factors concerning graduate students in online courses acting on their professors' feedback is unknown. By focusing on graduate students in…

Asbestos in Schools: A Dilemma.

ERIC Educational Resources Information Center

General Accounting Office, Washington, DC.

Asbestos, a mineral known to cause cancer in humans, is present in an unknown number of schools where it may be hazardous to the health of students and employees. Although the Federal Government has programs designed to address the asbestos situation, it has not determined in what specific circumstances asbestos is a hazard. Therefore, State and…

Expression, Purification, and Analysis of Unknown Translation Factors from "Escherichia Coli": A Synthesis Approach

ERIC Educational Resources Information Center

Walter, Justin D.; Littlefield, Peter; Delbecq, Scott; Prody, Gerry; Spiegel, P. Clint

2010-01-01

New approaches are currently being developed to expose biochemistry and molecular biology undergraduates to a more interactive learning environment. Here, we propose a unique project-based laboratory module, which incorporates exposure to biophysical chemistry approaches to address problems in protein chemistry. Each of the experiments described…

The Infralimbic Cortex Regulates the Consolidation of Extinction after Cocaine Self-Administration

ERIC Educational Resources Information Center

LaLumiere, Ryan T.; Niehoff, Kate E.; Kalivas, Peter W.

2010-01-01

The infralimbic cortex (IL) regulates the consolidation of extinction learning for fear conditioning. Whether the IL influences the consolidation of extinction learning for cocaine self-administration is unknown. To address this issue, male Sprague-Dawley rats underwent 2 wk of cocaine self-administration followed by extinction training. On the…

Exploring the Unknown: The Autonomy of Saudi EFL Learners

ERIC Educational Resources Information Center

Alrabai, Fakieh

2017-01-01

This study addresses a new area of research in Saudi Arabia. Using a sample of 630 Saudi students, it investigates learners' level of autonomy and its relationship to academic achievement in English as a foreign language (EFL). Learners' level of autonomy was measured by a survey, whereas their achievement was evaluated using standardized…

Dietary Soy Protein Isolate Ameliorates Atherosclerotic Lesions in Apolipoprotein E-Deficient Mice Potentially by Inhibiting Monocyte Chemoattractant Protein-1 Expression

USDA-ARS?s Scientific Manuscript database

Soy-based diets reportedly protect against the development of atherosclerosis; however, the underlying mechanism(s) for this protection remains unknown. In this report, the mechanism(s) contributing to the atheroprotective effects of a soy-based diet was addressed using the apolipoprotein E knockout...

Exploration. It's What We Do.

NASA Image and Video Library

2018-02-12

Exploration is a tradition at NASA. We reach for new heights and reveal the unknown for the benefit of humankind. On February, 12, 2018, Acting Administrator Robert Lightfoot gave a State of NASA address to roll out the Fiscal Year 2019 Budget proposal. This video highlights the future-facing vision of those plans. #StateofNASA

Investigating Chinese Preschool Teachers' Beliefs in Mathematics Teaching from a Cross-Cultural Perspective

ERIC Educational Resources Information Center

Li, Xia; Liu, Song; DeBey, Mary; McFadden, Karen; Pan, Yue-Juan

2018-01-01

In China, preschool curriculum has undergone reform and profound changes. Much remains unknown, however, regarding preschool teachers' teaching beliefs after 30 years of curriculum reform and adaptation. This study aimed to address the issue and investigate teachers' beliefs concerning teaching mathematics. Twelve preschool teachers in China…

‘Hass’ avocado quality as influenced by temperature and ethylene prior to and during final ripening

USDA-ARS?s Scientific Manuscript database

Avocados (Persea americana Mill.) are often held for short periods after harvest at relatively high temperatures both in the field and in storage during preconditioning and prior to ripening with unknown effects on subsequent quality. To address this question, avocados were harvested at five differ...

Teachers' Capacities to Meet Students' Additional Support Needs in Mainstream Primary Education

ERIC Educational Resources Information Center

Bruggink, M.; Goei, S. L.; Koot, H. M.

2016-01-01

Mainstream primary school teachers generally acknowledge the need to implement adaptive teaching; however, meeting a variety of students' needs is a challenge. Studies have addressed the conditions under which teachers attribute their (in)capacities, but these have mainly involved vignettes. Therefore, it remains unknown whether teachers are…

Bringing metabolic networks to life: convenience rate law and thermodynamic constraints

PubMed Central

Liebermeister, Wolfram; Klipp, Edda

2006-01-01

Background Translating a known metabolic network into a dynamic model requires rate laws for all chemical reactions. The mathematical expressions depend on the underlying enzymatic mechanism; they can become quite involved and may contain a large number of parameters. Rate laws and enzyme parameters are still unknown for most enzymes. Results We introduce a simple and general rate law called "convenience kinetics". It can be derived from a simple random-order enzyme mechanism. Thermodynamic laws can impose dependencies on the kinetic parameters. Hence, to facilitate model fitting and parameter optimisation for large networks, we introduce thermodynamically independent system parameters: their values can be varied independently, without violating thermodynamical constraints. We achieve this by expressing the equilibrium constants either by Gibbs free energies of formation or by a set of independent equilibrium constants. The remaining system parameters are mean turnover rates, generalised Michaelis-Menten constants, and constants for inhibition and activation. All parameters correspond to molecular energies, for instance, binding energies between reactants and enzyme. Conclusion Convenience kinetics can be used to translate a biochemical network – manually or automatically - into a dynamical model with plausible biological properties. It implements enzyme saturation and regulation by activators and inhibitors, covers all possible reaction stoichiometries, and can be specified by a small number of parameters. Its mathematical form makes it especially suitable for parameter estimation and optimisation. Parameter estimates can be easily computed from a least-squares fit to Michaelis-Menten values, turnover rates, equilibrium constants, and other quantities that are routinely measured in enzyme assays and stored in kinetic databases. PMID:17173669

Method and apparatus for transmutation of atomic nuclei

DOEpatents

Maenchen, J.E.; Ruiz, C.L.

1998-12-08

Insuring a constant supply of radioisotopes is of great importance to medicine and industry. This invention addresses this problem, and helps to solve it by introducing a new apparatus for transmutation of isotopes which enables swift and flexible production on demand. 9 figs.

Method and apparatus for transmutation of atomic nuclei

DOEpatents

Maenchen, J.E.; Ruiz, C.L.

1998-06-09

Insuring a constant supply of radioisotopes is of great importance to medicine and industry. This invention addresses this problem, and helps to solve it by introducing a new apparatus for transmutation of isotopes which enables swift and flexible production on demand. 9 figs.

Building Digital Libraries: Running to Stand Still?

ERIC Educational Resources Information Center

Huwe, Terence K.

2005-01-01

Technostress--the challenge of keeping up with changing technology--has been one of the few constants in professional lives for the past 30 or more years. In this paper, the author addresses what constitutes "best practices" for keeping up with rapidly changing technology.

Guidance and control strategies for aerospace vehicles

NASA Technical Reports Server (NTRS)

Hibey, Joseph L.; Naidu, Desineni S.

1990-01-01

The first part of the report concerns broadly the summary of the work done in the areas of singular perturbations and time scales (SPaTS), aerobraking technology, guidance and aerocruise. The synergistic plane change problem connected with orbital transfer employing aeroassist technology, is addressed. The mission involves transfer from high Earth orbit to low Earth orbit with plane change being performed within the atmosphere. The complete mission consists of a deorbit phase, atmospheric phase, and finally reorbit phase. The atmospheric maneuver is composed of an entry mode, a cruise mode, and finally an exit mode. During the cruise mode, constant altitude and velocity are maintained by means of bank angle control with constant thrust or thrust control with constant bank angle. Comparisons between these two control strategies bring out some interesting features.

Assimilation efficiency and toxicokinetics of 14C-lindane in the terrestrial isopod Porcellionides pruinosus: the role of isopods in degradation of persistent soil pollutants.

PubMed

Loureiro, Susana; Sousa, J P; Nogueira, A J A; Soares, A M V M

2002-12-01

An achievable way to evaluate the bioavailability of a certain toxic in the environment is to measure the concentration inside soil organisms. Non-target saprotrophic organisms like isopods are often exposed to agrochemicals or other kind of persistent chemicals. In this study the isopod Porcellionides pruinosus was exposed to a constant concentration of Lindane (gamma-HCH) via food. Using toxicokinetic models the bioaccumulation and fate of the pesticide by isopods was assessed and compared with previous studies, where an unexpected decrease in gamma-HCH concentration was observed. Animal body burdens showed higher values, and a lower assimilation rate constant, although the elimination rate constant was twice the value previously observed. It was also observed that a significant amount of gamma-HCH had an unknown fate. To discover its possible destiny, a factorial experiment was carried out using two types of CO2 traps and contaminated leaves in the presence and absence of isopods. It was concluded that isopod activity might have been responsible for a more rapid biotransformation of gamma-HCH in leaves, since the amount of the pesticide is reduced in their presence.

Study of Randomness in AES Ciphertexts Produced by Randomly Generated S-Boxes and S-Boxes with Various Modulus and Additive Constant Polynomials

NASA Astrophysics Data System (ADS)

Das, Suman; Sadique Uz Zaman, J. K. M.; Ghosh, Ranjan

2016-06-01

In Advanced Encryption Standard (AES), the standard S-Box is conventionally generated by using a particular irreducible polynomial {11B} in GF(28) as the modulus and a particular additive constant polynomial {63} in GF(2), though it can be generated by many other polynomials. In this paper, it has been shown that it is possible to generate secured AES S-Boxes by using some other selected modulus and additive polynomials and also can be generated randomly, using a PRNG like BBS. A comparative study has been made on the randomness of corresponding AES ciphertexts generated, using these S-Boxes, by the NIST Test Suite coded for this paper. It has been found that besides using the standard one, other moduli and additive constants are also able to generate equally or better random ciphertexts; the same is true for random S-Boxes also. As these new types of S-Boxes are user-defined, hence unknown, they are able to prevent linear and differential cryptanalysis. Moreover, they act as additional key-inputs to AES, thus increasing the key-space.

Theoretical study on elastic properties of Si2N2O by ab initio calculation

NASA Astrophysics Data System (ADS)

Tsuboi, Seiya; Adachi, Kanta; Nagakubo, Akira; Ogi, Hirotsugu

2018-07-01

The elastic constants of crystalline Si2N2O remain unknown since it was discovered in the 1960s. We determine the nine independent elastic constants of orthorhombic Si2N2O by ab initio calculations. We applied various deformation modes with strains up to ±0.01 to a unit cell, calculated the energy-strain relationships, and deduced all the elastic constants by fitting the harmonic-oscillation function. Our results are as follows: C 11 = 311.1, C 22 = 238.5, C 33 = 317.9, C 44 = 136.1, C 55 = 57.6, C 66 = 73.9, C 12 = 79.6, C 13 = 52.2, and C 23 = 33.6 GPa. Despite the different crystal structures and symmetries, the direction-over-averaged Young’s modulus of Si2N2O is well explained by the nitrogen content and Young’s moduli of α-SiO2 and β-Si3N4. The anisotropy of sound-wave velocity was investigated, and its origin was examined on the basis of the crystallographic structure. The quasi-isotropic plane for the longitudinal-wave propagation was identified.

The Full Breadth of Mendel's Genetics.

PubMed

van Dijk, Peter J; Ellis, T H Noel

2016-12-01

Gregor Mendel's "Experiments on Plant Hybrids" (1865/1866), published 150 years ago, is without doubt one of the most brilliant works in biology. Curiously, Mendel's later studies on Hieracium (hawkweed) are usually seen as a frustrating failure, because it is assumed that they were intended to confirm the segregation ratios he found in Pisum Had this been his intention, such a confirmation would have failed, since, unknown to Mendel, Hieracium species mostly reproduce by means of clonal seeds (apomixis). Here we show that this assumption arises from a misunderstanding that could be explained by a missing page in Mendel's first letter to Carl Nägeli. Mendel's writings clearly indicate his interest in "constant hybrids," hybrids which do not segregate, and which were "essentially different" from "variable hybrids" such as in Pisum After the Pisum studies, Mendel worked mainly on Hieracium for 7 years where he found constant hybrids and some great surprises. He also continued to explore variable hybrids; both variable and constant hybrids were of interest to Mendel with respect to inheritance and to species evolution. Mendel considered that their similarities and differences might provide deep insights and that their differing behaviors were "individual manifestations of a higher more fundamental law." Copyright © 2016 van Dijk and Ellis.

Thermodynamic Analysis of Chemically Reacting Mixtures-Comparison of First and Second Order Models.

PubMed

Pekař, Miloslav

2018-01-01

Recently, a method based on non-equilibrium continuum thermodynamics which derives thermodynamically consistent reaction rate models together with thermodynamic constraints on their parameters was analyzed using a triangular reaction scheme. The scheme was kinetically of the first order. Here, the analysis is further developed for several first and second order schemes to gain a deeper insight into the thermodynamic consistency of rate equations and relationships between chemical thermodynamic and kinetics. It is shown that the thermodynamic constraints on the so-called proper rate coefficient are usually simple sign restrictions consistent with the supposed reaction directions. Constraints on the so-called coupling rate coefficients are more complex and weaker. This means more freedom in kinetic coupling between reaction steps in a scheme, i.e., in the kinetic effects of other reactions on the rate of some reaction in a reacting system. When compared with traditional mass-action rate equations, the method allows a reduction in the number of traditional rate constants to be evaluated from data, i.e., a reduction in the dimensionality of the parameter estimation problem. This is due to identifying relationships between mass-action rate constants (relationships which also include thermodynamic equilibrium constants) which have so far been unknown.

Adaptive Flight Control for Aircraft Safety Enhancements

NASA Technical Reports Server (NTRS)

Nguyen, Nhan T.; Gregory, Irene M.; Joshi, Suresh M.

2008-01-01

This poster presents the current adaptive control research being conducted at NASA ARC and LaRC in support of the Integrated Resilient Aircraft Control (IRAC) project. The technique "Approximate Stability Margin Analysis of Hybrid Direct-Indirect Adaptive Control" has been developed at NASA ARC to address the needs for stability margin metrics for adaptive control that potentially enables future V&V of adaptive systems. The technique "Direct Adaptive Control With Unknown Actuator Failures" is developed at NASA LaRC to deal with unknown actuator failures. The technique "Adaptive Control with Adaptive Pilot Element" is being researched at NASA LaRC to investigate the effects of pilot interactions with adaptive flight control that can have implications of stability and performance.

Interdisciplinary team communication among forensic nurses and rape victim advocates.

PubMed

Patterson, Debra

2014-01-01

Victim advocates and forensic nurses provide integrated care to address the complex legal, medical, and mental health needs of rape survivors. Research suggests that conflict exists between nurses and advocates, but it remains unknown how their communication patterns contribute to or resolve these conflicts. Utilizing a qualitative case study approach, the current study interviewed 24 nurses and advocates from a Midwest organization to better understand team communication patterns when addressing conflicts. The findings suggest that most nurses communicate concerns directly while advocates avoid direct communication. Factors that influenced direct and indirect communication and their implications for practice will be discussed.

A simple finite element method for the Stokes equations

DOE PAGES

Mu, Lin; Ye, Xiu

2017-03-21

The goal of this paper is to introduce a simple finite element method to solve the Stokes equations. This method is in primal velocity-pressure formulation and is so simple such that both velocity and pressure are approximated by piecewise constant functions. Implementation issues as well as error analysis are investigated. A basis for a divergence free subspace of the velocity field is constructed so that the original saddle point problem can be reduced to a symmetric and positive definite system with much fewer unknowns. The numerical experiments indicate that the method is accurate.

A simple finite element method for the Stokes equations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mu, Lin; Ye, Xiu

The goal of this paper is to introduce a simple finite element method to solve the Stokes equations. This method is in primal velocity-pressure formulation and is so simple such that both velocity and pressure are approximated by piecewise constant functions. Implementation issues as well as error analysis are investigated. A basis for a divergence free subspace of the velocity field is constructed so that the original saddle point problem can be reduced to a symmetric and positive definite system with much fewer unknowns. The numerical experiments indicate that the method is accurate.

An approximate analytical solution for interlaminar stresses in angle-ply laminates

NASA Technical Reports Server (NTRS)

Rose, Cheryl A.; Herakovich, Carl T.

1991-01-01

An improved approximate analytical solution for interlaminar stresses in finite width, symmetric, angle-ply laminated coupons subjected to axial loading is presented. The solution is based upon statically admissible stress fields which take into consideration local property mismatch effects and global equilibrium requirements. Unknown constants in the admissible stress states are determined through minimization of the complementary energy. Typical results are presented for through-the-thickness and interlaminar stress distributions for angle-ply laminates. It is shown that the results represent an improved approximate analytical solution for interlaminar stresses.

The Availability and Utility of Services to Address Risk Factors for Recidivism among Justice-Involved Veterans

PubMed Central

Blonigen, Daniel M.; Rodriguez, Allison L.; Manfredi, Luisa; Britt, Jessica; Nevedal, Andrea; Finlay, Andrea K.; Rosenthal, Joel; Smelson, David; Timko, Christine

2016-01-01

The availability and utility of services to address recidivism risk factors among justice-involved veterans is unknown. We explored these issues through qualitative interviews with 63 Specialists from the Department of Veterans Affairs’ (VA) Veterans Justice Programs. To guide the interviews, we utilized the Risk-Need-Responsivity (RNR) model of offender rehabilitation. Specialists reported that justice-involved veterans generally have access to services to address most RNR-based risk factors (substance abuse; lack of positive school/work involvement; family/marital dysfunction; lack of prosocial activities/interests), but have less access to services targeting risk factors of antisocial tendencies and associates and empirically-based treatments for recidivism in VA. Peer-based services, motivational interviewing/cognitive-behavioral therapy, and Veterans Treatment Courts were perceived as useful to address multiple risk factors. These findings highlight potential gaps in provision of evidence-based care to address recidivism among justice-involved veterans, as well as promising policy-based solutions that may have widespread impact on reducing recidivism in this population. PMID:26924887

Practical Considerations for Using Constant Force Springs in Space-Based Mechanisms

NASA Technical Reports Server (NTRS)

Williams, R. Brett; Fisher, Charles D.; Gallon, John C.

2013-01-01

Mechanical springs are a common element in mechanism from all walks of life; cars, watches, appliances, and many others. These springs generally exhibit a linear relationship between force and deflection. In small mechanisms, deflections are small so the variation in spring force between one position and another are generally small and do not influence the design or functionality of the device. However, as the spacecraft industry drives towards larger, deployable satellites, the distances a spring or springs must function over can become considerable so much so that the structural integrity of the device may be impacted. As such, an increasingly common mechanism element is the constant force spring- one that provides a constant force regardless of deflection. These elements are commonly in the conceptual design phase to deal with system-level large deflections, but in the detailed design or integration test phase they can pose significant implementation issues. This article addresses some of the detailed issues in order for these constant force springs to be properly designed into space systems.

Alternatives to an extended Kalman Filter for target image tracking

NASA Astrophysics Data System (ADS)

Leuthauser, P. R.

1981-12-01

Four alternative filters are compared to an extended Kalman filter (EKF) algorithm for tracking a distributed (elliptical) source target in a closed loop tracking problem, using outputs from a forward looking (FLIR) sensor as measurements. These were (1) an EKF with (second order) bias correction term, (2) a constant gain EKF, (3) a constant gain EKF with bias correction term, and (4) a statistically linearized filter. Estimates are made of both actual target motion and of apparent motion due to atmospheric jitter. These alternative designs are considered specifically to address some of the significant biases exhibited by an EKF due to initial acquisition difficulties, unmodelled maneuvering by the target, low signal-to-noise ratio, and real world conditions varying significantly from those assumed in the filter design (robustness). Filter performance was determined with a Monte Carlo study under both ideal and non ideal conditions for tracking targets on a constant velocity cross range path, and during constant acceleration turns of 5G, 10G, and 20G.

Peer Learning in an Introductory Programming Course.

ERIC Educational Resources Information Center

Lippert, Susan K.; Granger, Mary J.

The role of Information Systems within organizations is constantly changing. Undergraduates concentrating in Information Systems need to acquire the knowledge and skills to compete in this dynamic arena. The undergraduate curriculum must not only address technical knowledge, but also communications and collaborative skills necessary for…

EHealth: self-management in inflammatory bowel disease and in irritable bowel syndrome using novel constant-care web applications. EHealth by constant-care in IBD and IBS.

PubMed

Pedersen, Natalia

2015-12-01

Inflammatory bowel disease (IBD) and irritable bowel syndrome (IBS) are chronic gastrointestinal disorders of unknown aetiology of increasing incidence and changing disease activity or severity. Approximately 60-80% of IBD patients suffer from IBS. Monitoring and treatment goals of IBD are to optimise the disease course by prolonging remission periods and preventing or shortening periods of active disease. Constant-care web-monitoring and treatment approaches with active patient involvement have been proven effective in UC, increasing patients' adherence and improving the disease outcomes.   To assess the feasibility and efficacy of the novel constant-care eHealth applications in: i) CD patients treated with infliximab (IFX), ii) UC patients with active disease on mesalazine, iii) IBS patients and iv) IBD patients with IBS on a low FODMAP diet (LFD).   New constant-care web applications www.cd.constant-care.dk, www.meza.constant-care.dk and www.ibs.constant-care.dk in IBD patients were developed and assessed in this thesis. An integrated inflammatory burden measure of disease activity, consisting of a subjective (clinical indices) and of an objective (faecal calprotectin) part and a treatment guide to drug doses and intervals, was incorporated into the web applications and used by patients. Web-guided IFX treatment in CD demonstrated patients' inter- and intra-individual variability in infusion intervals and provided patients with individualised treatment according to their needs. Web-guided treatment with multimatrix mesalazine was efficacious in a majority of UC patients with mild-to-moderate disease activity. Web-guided IBS-monitoring in IBD and in IBS patients on LFD was shown to be a feasible method that actively involved patients in their disease management and had a positive short-term impact on the disease. Moreover, the new constant-care concepts were demonstrated to be safe and to have a positive impact on quality of life and adherence to treatment and helped to reduce the costs.   The novel constant-care web applications have proven feasible in improving the disease outcomes in CD patients on IFX, in UC patients on mesalazine, and in monitoring IBS. These applications are expected to be implemented in the clinical practice of gastroenterology in Denmark in the coming years. Future studies will help to assess whether the natural disease course can be improved in the long-term.

Chapter 18: Variable Frequency Drive Evaluation Protocol. The Uniform Methods Project: Methods for Determining Energy Efficiency Savings for Specific Measures

DOE Office of Scientific and Technical Information (OSTI.GOV)

Romberger, Jeff

An adjustable-speed drive (ASD) includes all devices that vary the speed of a rotating load, including those that vary the motor speed and linkage devices that allow constant motor speed while varying the load speed. The Variable Frequency Drive Evaluation Protocol presented here addresses evaluation issues for variable-frequency drives (VFDs) installed on commercial and industrial motor-driven centrifugal fans and pumps for which torque varies with speed. Constant torque load applications, such as those for positive displacement pumps, are not covered by this protocol.

Measuring the Density of a Sugar Solution: A General Chemistry Experiment Using a Student-Prepared Unknown

ERIC Educational Resources Information Center

Peterson, Karen I.

2008-01-01

The experiment developed in this article addresses the concept of equipment calibration for reducing systematic error. It also suggests simple student-prepared sucrose solutions for which accurate densities are known, but not readily available to students. Densities are measured with simple glassware that has been calibrated using the density of…

Harry Potter Casts His Spell in the Classroom

ERIC Educational Resources Information Center

Witschonke, Christopher

2006-01-01

This article deals with the use of alternative texts, such as the Harry Potter book series in classroom teaching. In this article, the author discusses a wide range of themes that could be addressed in the classroom. Harry Potter and the Sorcerer's Stone deals with issues of greed, self-sacrifice, fear of the unknown, and self-confidence. Harry…

Neural Circuits via Which Single Prolonged Stress Exposure Leads to Fear Extinction Retention Deficits

ERIC Educational Resources Information Center

Knox, Dayan; Stanfield, Briana R.; Staib, Jennifer M.; David, Nina P.; Keller, Samantha M.; DePietro, Thomas

2016-01-01

Single prolonged stress (SPS) has been used to examine mechanisms via which stress exposure leads to post-traumatic stress disorder symptoms. SPS induces fear extinction retention deficits, but neural circuits critical for mediating these deficits are unknown. To address this gap, we examined the effect of SPS on neural activity in brain regions…

Residue distribution and biomass recovery following biomass harvest of plantation pine

Treesearch

Johnny Grace III; John Klepac; S. Taylor; Dana Mitchell

2016-01-01

Forest biomass is anticipated to play a significant role in addressing an alternative energy supply. However, the efficiencies of current state-of-the-art recovery systems operating in forest biomass harvests are still relatively unknown. Forest biomass harvest stands typically have higher stand densities and smaller diameter trees than conventional stands which may...

The Use of a Modified Semantic Features Analysis Approach in Aphasia

ERIC Educational Resources Information Center

Hashimoto, Naomi; Frome, Amber

2011-01-01

Several studies have reported improved naming using the semantic feature analysis (SFA) approach in individuals with aphasia. Whether the SFA can be modified and still produce naming improvements in aphasia is unknown. The present study was designed to address this question by using a modified version of the SFA approach. Three, rather than the…

Communicating to Learn: Infants' Pointing Gestures Result in Optimal Learning

ERIC Educational Resources Information Center

Lucca, Kelsey; Wilbourn, Makeba Parramore

2018-01-01

Infants' pointing gestures are a critical predictor of early vocabulary size. However, it remains unknown precisely how pointing relates to word learning. The current study addressed this question in a sample of 108 infants, testing one mechanism by which infants' pointing may influence their learning. In Study 1, 18-month-olds, but not…

Family Background, Parental Involvement, and Parent Child Interactions as Predictors of Fifth-Graders Behavior Problems

ERIC Educational Resources Information Center

Brown, Tamala P.

2012-01-01

Many studies have been conducted to address childhood behavior problems, but much remains unknown regarding the causes and factors that affect internalizing and externalizing problems in children. The purpose of the current research study was to examine the relationships between children's internalizing and externalizing behavior problems and (a)…

Guidelines for the identification of unknown samples for laboratories performing forensic analyses for chemical terrorism.

PubMed

Magnuson, Matthew L; Satzger, R Duane; Alcaraz, Armando; Brewer, Jason; Fetterolf, Dean; Harper, Martin; Hrynchuk, Ronald; McNally, Mary F; Montgomery, Madeline; Nottingham, Eric; Peterson, James; Rickenbach, Michael; Seidel, Jimmy L; Wolnik, Karen

2012-05-01

Since the early 1990s, the FBI Laboratory has sponsored Scientific Working Groups to improve discipline practices and build consensus among the forensic community. The Scientific Working Group on the Forensic Analysis of Chemical, Biological, Radiological and Nuclear Terrorism developed guidance, contained in this document, on issues forensic laboratories encounter when accepting and analyzing unknown samples associated with chemical terrorism, including laboratory capabilities and analytical testing plans. In the context of forensic analysis of chemical terrorism, this guidance defines an unknown sample and addresses what constitutes definitive and tentative identification. Laboratory safety, reporting issues, and postreporting considerations are also discussed. Utilization of these guidelines, as part of planning for forensic analysis related to a chemical terrorism incident, may help avoid unfortunate consequences not only to the public but also to the laboratory personnel. 2011 American Academy of Forensic Sciences. Published 2011. This article is a U.S. Government work and is in the public domain in the U.S.A.

Joint deconvolution and classification with applications to passive acoustic underwater multipath.

PubMed

Anderson, Hyrum S; Gupta, Maya R

2008-11-01

This paper addresses the problem of classifying signals that have been corrupted by noise and unknown linear time-invariant (LTI) filtering such as multipath, given labeled uncorrupted training signals. A maximum a posteriori approach to the deconvolution and classification is considered, which produces estimates of the desired signal, the unknown channel, and the class label. For cases in which only a class label is needed, the classification accuracy can be improved by not committing to an estimate of the channel or signal. A variant of the quadratic discriminant analysis (QDA) classifier is proposed that probabilistically accounts for the unknown LTI filtering, and which avoids deconvolution. The proposed QDA classifier can work either directly on the signal or on features whose transformation by LTI filtering can be analyzed; as an example a classifier for subband-power features is derived. Results on simulated data and real Bowhead whale vocalizations show that jointly considering deconvolution with classification can dramatically improve classification performance over traditional methods over a range of signal-to-noise ratios.

Plasma Theory and Simulation.

DTIC Science & Technology

1986-06-30

energy are conserved, and the entropy of the plasma either in- creases or remains constant. Furthermore, the collision kinematics are relativistic...addresses within that array. c* Note that in PDW1 the suboutine MOVE must be renamed. imove = nloc(2) - nadd do 10 isp=nsp,2,-l moveto = nloc(isp) + 1

Mosquitoes of the Caatinga: 1. Adults stage survey and the emerge of seven news species endemic of a dry tropical forest in Brazil.

PubMed

Marteis, Letícia Silva; Natal, Delsio; Sallum, Maria Anice Mureb; Medeiros-Sousa, Antônio Ralph; Oliveira, Tatiane Marques Porangaba; La Corte, Roseli

2017-02-01

The Caatinga is the least known Brazilian biome in terms of the diversity of Culicidae. No systematic study of the diversity or ecology of the mosquitoes of this biome is available, despite the importance of vector diseases in Brazil. The present study addressed the mosquito biodiversity in the Caatinga biome by sampling adult populations. Specimens were sampled monthly from March 2013 to September 2014 in a Caatinga conservation unit located in the Brazilian semiarid zone. Mosquito collections were carried out in Shannon traps from late afternoon to early evening, and manual aspiration was used to capture diurnal species as well. A total of 4,692 mosquitoes were collected. The most dominant and constant species were all undescribed species belonging to the genera Wyeomyia and Runchomyia, which together represented 80% of the specimens. The most abundant species of epidemiological importance was Haemagogus (Con.) leucocelaenus. The abundance of mosquitoes was positively associated with the relative humidity and temperature recorded during the month preceding the collection date. In the Caatinga, the diversity of adult mosquitoes was associated with the availability (quantity and diversity) of natural larval habitats found in the different phytophysiognomies of the biome, which vary according to temperature and humidity. The number of species unknown to science reflects the levels of endemism that exist in the study area, and reinforces the need to further taxonomic investigation in the biome. Copyright © 2016 Elsevier B.V. All rights reserved.

Cuticular lipid composition, surface structure, and gene expression in Arabidopsis stem epidermis.

PubMed

Suh, Mi Chung; Samuels, A Lacey; Jetter, Reinhard; Kunst, Ljerka; Pollard, Mike; Ohlrogge, John; Beisson, Fred

2005-12-01

All vascular plants are protected from the environment by a cuticle, a lipophilic layer synthesized by epidermal cells and composed of a cutin polymer matrix and waxes. The mechanism by which epidermal cells accumulate and assemble cuticle components in rapidly expanding organs is largely unknown. We have begun to address this question by analyzing the lipid compositional variance, the surface micromorphology, and the transcriptome of epidermal cells in elongating Arabidopsis (Arabidopsis thaliana) stems. The rate of cell elongation is maximal near the apical meristem and decreases steeply toward the middle of the stem, where it is 10 times slower. During and after this elongation, the cuticular wax load and composition remain remarkably constant (32 microg/cm2), indicating that the biosynthetic flux into waxes is closely matched to surface area expansion. By contrast, the load of polyester monomers per unit surface area decreases more than 2-fold from the upper (8 microg/cm2) to the lower (3 microg/cm2) portion of the stem, although the compositional variance is minor. To aid identification of proteins involved in the biosynthesis of waxes and cutin, we have isolated epidermal peels from Arabidopsis stems and determined transcript profiles in both rapidly expanding and nonexpanding cells. This transcriptome analysis was validated by the correct classification of known epidermis-specific genes. The 15% transcripts preferentially expressed in the epidermis were enriched in genes encoding proteins predicted to be membrane associated and involved in lipid metabolism. An analysis of the lipid-related subset is presented.

Interstate vibronic coupling constants between electronic excited states for complex molecules

NASA Astrophysics Data System (ADS)

Fumanal, Maria; Plasser, Felix; Mai, Sebastian; Daniel, Chantal; Gindensperger, Etienne

2018-03-01

In the construction of diabatic vibronic Hamiltonians for quantum dynamics in the excited-state manifold of molecules, the coupling constants are often extracted solely from information on the excited-state energies. Here, a new protocol is applied to get access to the interstate vibronic coupling constants at the time-dependent density functional theory level through the overlap integrals between excited-state adiabatic auxiliary wavefunctions. We discuss the advantages of such method and its potential for future applications to address complex systems, in particular, those where multiple electronic states are energetically closely lying and interact. We apply the protocol to the study of prototype rhenium carbonyl complexes [Re(CO)3(N,N)(L)]n+ for which non-adiabatic quantum dynamics within the linear vibronic coupling model and including spin-orbit coupling have been reported recently.

Parameterizations for ensemble Kalman inversion

NASA Astrophysics Data System (ADS)

Chada, Neil K.; Iglesias, Marco A.; Roininen, Lassi; Stuart, Andrew M.

2018-05-01

The use of ensemble methods to solve inverse problems is attractive because it is a derivative-free methodology which is also well-adapted to parallelization. In its basic iterative form the method produces an ensemble of solutions which lie in the linear span of the initial ensemble. Choice of the parameterization of the unknown field is thus a key component of the success of the method. We demonstrate how both geometric ideas and hierarchical ideas can be used to design effective parameterizations for a number of applied inverse problems arising in electrical impedance tomography, groundwater flow and source inversion. In particular we show how geometric ideas, including the level set method, can be used to reconstruct piecewise continuous fields, and we show how hierarchical methods can be used to learn key parameters in continuous fields, such as length-scales, resulting in improved reconstructions. Geometric and hierarchical ideas are combined in the level set method to find piecewise constant reconstructions with interfaces of unknown topology.

A new problem in mathematical physics associated with the problem of coherent phase transformation

NASA Astrophysics Data System (ADS)

Grinfeld, M. A.

1985-06-01

The description of heterogeneous coherent phase equilibria in an elastic single component system is shown to lead, in the approximation of small intrinsic deformation, to a new problem in mathematical physics with an unknown bound. The low order terms of the resulting system of equilibrium equations coincide with the equations of the classical linear theory of elasticity (generally speaking, anisotropic); however, the problem remains strongly nonlinear overall, inasmuch as it contains an unknown bound and a boundary condition on it which is quadratic with respect to translation. The formulas obtained are used to find certain explicit solutions to the boundary problems. As an example, the problem of heterogeneous equilibria in an infinite rectangular isotropic beam with free faces and constant loading on the surfaces x squared = const can be examined. A modeling problem for the asymptote of small intrinsic deformation during coherent phase transformation is presented as a scalar analog of the vector problem considered initially.

Extremum seeking with bounded update rates

DOE PAGES

Scheinker, Alexander; Krstić, Miroslav

2013-11-16

In this work, we present a form of extremum seeking (ES) in which the unknown function being minimized enters the system’s dynamics as the argument of a cosine or sine term, thereby guaranteeing known bounds on update rates and control efforts. We present general n-dimensional optimization and stabilization results as well as 2D vehicle control, with bounded velocity and control efforts. For application to autonomous vehicles, tracking a source in a GPS denied environment with unknown orientation, this ES approach allows for smooth heading angle actuation, with constant velocity, and in application to a unicycle-type vehicle results in control abilitymore » as if the vehicle is fully actuated. Our stability analysis is made possible by the classic results of Kurzweil, Jarnik, Sussmann, and Liu, regarding systems with highly oscillatory terms. In our stability analysis, we combine the averaging results with a semi-global practical stability result under small parametric perturbations developed by Moreau and Aeyels.« less

Model risk for European-style stock index options.

PubMed

Gençay, Ramazan; Gibson, Rajna

2007-01-01

In empirical modeling, there have been two strands for pricing in the options literature, namely the parametric and nonparametric models. Often, the support for the nonparametric methods is based on a benchmark such as the Black-Scholes (BS) model with constant volatility. In this paper, we study the stochastic volatility (SV) and stochastic volatility random jump (SVJ) models as parametric benchmarks against feedforward neural network (FNN) models, a class of neural network models. Our choice for FNN models is due to their well-studied universal approximation properties of an unknown function and its partial derivatives. Since the partial derivatives of an option pricing formula are risk pricing tools, an accurate estimation of the unknown option pricing function is essential for pricing and hedging. Our findings indicate that FNN models offer themselves as robust option pricing tools, over their sophisticated parametric counterparts in predictive settings. There are two routes to explain the superiority of FNN models over the parametric models in forecast settings. These are nonnormality of return distributions and adaptive learning.

Approximation algorithm for the problem of partitioning a sequence into clusters

NASA Astrophysics Data System (ADS)

Kel'manov, A. V.; Mikhailova, L. V.; Khamidullin, S. A.; Khandeev, V. I.

2017-08-01

We consider the problem of partitioning a finite sequence of Euclidean points into a given number of clusters (subsequences) using the criterion of the minimal sum (over all clusters) of intercluster sums of squared distances from the elements of the clusters to their centers. It is assumed that the center of one of the desired clusters is at the origin, while the center of each of the other clusters is unknown and determined as the mean value over all elements in this cluster. Additionally, the partition obeys two structural constraints on the indices of sequence elements contained in the clusters with unknown centers: (1) the concatenation of the indices of elements in these clusters is an increasing sequence, and (2) the difference between an index and the preceding one is bounded above and below by prescribed constants. It is shown that this problem is strongly NP-hard. A 2-approximation algorithm is constructed that is polynomial-time for a fixed number of clusters.

Λ(t) CDM and the present accelerating expansion of the universe from 5D scalar vacuum

NASA Astrophysics Data System (ADS)

Madriz Aguilar, José Edgar; Zamarripa, J.; Peraza, A.; Licea, J. A.

2017-12-01

In this letter we investigate some consequences of considering our 4D observable universe as locally and isometrically embedded in a 5D spacetime, where gravity is described by a Brans-Dicke theory in vacuum. Once we impose the embedding conditions we obtain that gravity on the 4D spacetime is governed by the Einstein field equations modified by an extra term that can play the role of a dynamical cosmological constant. Two examples were studied. In the first we derive a cosmological model of a universe filled only with a cosmological constant. In the second we obtain a cosmological solution describing a universe filled with matter, radiation and a dynamical cosmological constant. We constrain the model by using the current observational data combination Planck + WP + BAO + SN. The present acceleration in the expansion of the universe is explained by the geometrically induced dynamical cosmological constant avoiding the introduction of a dark energy component and without addressing the underlying cosmological constant problem. Moreover, all 4D matter sources are geometrically induced in the same manner as it is usually done in the Wesson's induced matter theory.

Directly patching high-level exchange-correlation potential based on fully determined optimized effective potentials

NASA Astrophysics Data System (ADS)

Huang, Chen; Chi, Yu-Chieh

2017-12-01

The key element in Kohn-Sham (KS) density functional theory is the exchange-correlation (XC) potential. We recently proposed the exchange-correlation potential patching (XCPP) method with the aim of directly constructing high-level XC potential in a large system by patching the locally computed, high-level XC potentials throughout the system. In this work, we investigate the patching of the exact exchange (EXX) and the random phase approximation (RPA) correlation potentials. A major challenge of XCPP is that a cluster's XC potential, obtained by solving the optimized effective potential equation, is only determined up to an unknown constant. Without fully determining the clusters' XC potentials, the patched system's XC potential is "uneven" in the real space and may cause non-physical results. Here, we developed a simple method to determine this unknown constant. The performance of XCPP-RPA is investigated on three one-dimensional systems: H20, H10Li8, and the stretching of the H19-H bond. We investigated two definitions of EXX: (i) the definition based on the adiabatic connection and fluctuation dissipation theorem (ACFDT) and (ii) the Hartree-Fock (HF) definition. With ACFDT-type EXX, effective error cancellations were observed between the patched EXX and the patched RPA correlation potentials. Such error cancellations were absent for the HF-type EXX, which was attributed to the fact that for systems with fractional occupation numbers, the integral of the HF-type EXX hole is not -1. The KS spectra and band gaps from XCPP agree reasonably well with the benchmarks as we make the clusters large.

Determination of variations of the solar radius from solar eclipse observations

NASA Technical Reports Server (NTRS)

Sofia, S.; Dunham, D. W.; Fiala, A. D.

1980-01-01

This paper describes the method to determine the solar radius and its variations from observations made during total solar eclipses. In particular, the procedure to correct the spherical moon predictions for the effects of lunar mountains and valleys on the width and location of the path of totality is addressed in detail. The errors affecting this technique are addressed, a summary of the results of its application to three solar eclipses are presented, and the implications of the results on the constancy of the solar constant are described.

Effect of Hollow Sphere Size and Distribution on the Quasi-Static and High Strain Rate Compressive Properties of Al-A380-Al2O3 Syntactic Foams

DTIC Science & Technology

2012-01-01

TASK NUMBER 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS( ES ) University Of Wisconsin,Milwaukee Materials Department,P.O. Box...784,Milwaukee,WI,53201 8. PERFORMING ORGANIZATION REPORT NUMBER 9. SPONSORING/MONITORING AGENCY NAME(S) AND ADDRESS( ES ) 10. SPONSOR/MONITOR’S...diameter = 14.3 mm length = 12.7 mm). Testing was carried out using a SATEC Model 50Ud Universal Testing Machine at constant crosshead speed with an

Content-addressable read/write memories for image analysis

NASA Technical Reports Server (NTRS)

Snyder, W. E.; Savage, C. D.

1982-01-01

The commonly encountered image analysis problems of region labeling and clustering are found to be cases of search-and-rename problem which can be solved in parallel by a system architecture that is inherently suitable for VLSI implementation. This architecture is a novel form of content-addressable memory (CAM) which provides parallel search and update functions, allowing speed reductions down to constant time per operation. It has been proposed in related investigations by Hall (1981) that, with VLSI, CAM-based structures with enhanced instruction sets for general purpose processing will be feasible.

Pulse charging of lead-acid traction cells

NASA Technical Reports Server (NTRS)

Smithrick, J. J.

1980-01-01

Pulse charging, as a method of rapidly and efficiently charging 300 amp-hour lead-acid traction cells for an electric vehicle application was investigated. A wide range of charge pulse current square waveforms were investigated and the results were compared to constant current charging at the time averaged pulse current values. Representative pulse current waveforms were: (1) positive waveform-peak charge pulse current of 300 amperes (amps), discharge pulse-current of zero amps, and a duty cycle of about 50%; (2) Romanov waveform-peak charge pulse current of 300 amps, peak discharge pulse current of 15 amps, and a duty of 50%; and (3) McCulloch waveform peak charge pulse current of 193 amps, peak discharge pulse current of about 575 amps, and a duty cycle of 94%. Experimental results indicate that on the basis of amp-hour efficiency, pulse charging offered no significant advantage as a method of rapidly charging 300 amp-hour lead-acid traction cells when compared to constant current charging at the time average pulse current value. There were, however, some disadvantages of pulse charging in particular a decrease in charge amp-hour and energy efficiencies and an increase in cell electrolyte temperature. The constant current charge method resulted in the best energy efficiency with no significant sacrifice of charge time or amp-hour output. Whether or not pulse charging offers an advantage over constant current charging with regard to the cell charge/discharge cycle life is unknown at this time.

Resolving Ethical Issues at School

ERIC Educational Resources Information Center

Benninga, Jacques S.

2013-01-01

Although ethical dilemmas are a constant in teachers' lives, the profession has offered little in the way of training to help teachers address such issues. This paper presents a framework, based on developmental theory, for resolving professional ethical dilemmas. The Four-Component Model of Moral Maturity, when used in conjunction with a…

Rx for a Healthy School Nutrition Program

ERIC Educational Resources Information Center

Boettger, Julie

2009-01-01

School nutrition directors face challenges on many fronts, from changing nutrition standards to addressing community interest in sustainability and local food sourcing. Programs are constantly changing to meet these new demands. How does a school business administrator know which changes will affect his/her school nutrition program positively? The…

Continuous Improvement in State Funded Preschool Programs

ERIC Educational Resources Information Center

Jackson, Sarah L.

2012-01-01

State funded preschool programs were constantly faced with the need to change in order to address internal and external demands. As programs engaged in efforts towards change, minimal research was available on how to support continuous improvement efforts within the context unique to state funded preschool programs. Guidance available had…

Spatial Context Learning Survives Interference from Working Memory Load

ERIC Educational Resources Information Center

Vickery, Timothy J.; Sussman, Rachel S.; Jiang, Yuhong V.

2010-01-01

The human visual system is constantly confronted with an overwhelming amount of information, only a subset of which can be processed in complete detail. Attention and implicit learning are two important mechanisms that optimize vision. This study addressed the relationship between these two mechanisms. Specifically we asked, Is implicit learning…

Real-time tree foliage density estimation with laser scanning sensor for variable-rate tree sprayer development

USDA-ARS?s Scientific Manuscript database

Trees, even in the same orchard or nursery, can have considerably different structures and foliage densities. Conventional chemical applications often spray the entire field at a constant rate without considering field variations, resulting in excessive chemical waste and spray drift. To address thi...

The Practice of Writing.

ERIC Educational Resources Information Center

Lodge, David

With the constant theme of the mysterious process of creativity running through its essays, this book discusses the work of some much admired 20th-century writers--Graham Greene, James Joyce, D.H. Lawrence, Henry Green, Kingsley Amis, Vladimir Nabokov, and Anthony Burgess. The book addresses the situation of the contemporary novelist, both…

Helping Your Child Learn Self-Care.

ERIC Educational Resources Information Center

Murphy, Linda; Corte, Suzanne Della

1987-01-01

Practical advice for parents of handicapped children is the focus of this issue on self-care skills including self-feeding, dressing, and personal hygiene. Ten initial tips for teaching skills to children include constant repetition, modeling, and keeping verbal instruction to a minimum. The section on self-feeding addresses the topics of…

Authentic Language Opportunities: An Alternative Dual Language Model (ADLM)

ERIC Educational Resources Information Center

Winstead, Lisa

2006-01-01

This paper addresses an important topic--the isolation and or lack of inclusion of immigrant children in U.S. schools. Immigrant children constantly pour into U.S. schools and, especially as newcomers, their opportunities for authentic interaction with mainstream peers are limited. How can schools provide authentic language opportunities for…

Addressing the Problem of Service Teaching Introductory Economics Subjects

ERIC Educational Resources Information Center

Barrett, Steven

2005-01-01

Enrolments in undergraduate economics programs have been falling constantly since the early 1990s. This trend coincides with the increasing popularity of business and management degrees. Consequently, the major activity of many, if not most economics departments and schools in Australia is service teaching of introductory economics to first year…

EMC Enhanced Constant ’Z’ Modulator.

DTIC Science & Technology

1984-06-01

TUTHILL, Colonel, USAF Chief, Relilability & Compatibility Division FOR THE COMMANDER: JOHN A. RITZ Acting Chief, Plans Office 0 * - If your address...supply bypasses. 3.2.6 System Testing Breadboard system tests resulted in the replacement of the HP5082-3340 shunt mounted PIN diodes due to a carrer life

Adaptive output-feedback control for switched stochastic uncertain nonlinear systems with time-varying delay.

PubMed

Song, Zhibao; Zhai, Junyong

2018-04-01

This paper addresses the problem of adaptive output-feedback control for a class of switched stochastic time-delay nonlinear systems with uncertain output function, where both the control coefficients and time-varying delay are unknown. The drift and diffusion terms are subject to unknown homogeneous growth condition. By virtue of adding a power integrator technique, an adaptive output-feedback controller is designed to render that the closed-loop system is bounded in probability, and the state of switched stochastic nonlinear system can be globally regulated to the origin almost surely. A numerical example is provided to demonstrate the validity of the proposed control method. Copyright © 2018 ISA. Published by Elsevier Ltd. All rights reserved.

Integrative metabolomics for characterizing unknown low-abundance metabolites by capillary electrophoresis-mass spectrometry with computer simulations.

PubMed

Lee, Richard; Ptolemy, Adam S; Niewczas, Liliana; Britz-McKibbin, Philip

2007-01-15

Characterization of unknown low-abundance metabolites in biological samples is one the most significant challenges in metabolomic research. In this report, an integrative strategy based on capillary electrophoresis-electrospray ionization-ion trap mass spectrometry (CE-ESI-ITMS) with computer simulations is examined as a multiplexed approach for studying the selective nutrient uptake behavior of E. coli within a complex broth medium. On-line sample preconcentration with desalting by CE-ESI-ITMS was performed directly without off-line sample pretreatment in order to improve detector sensitivity over 50-fold for cationic metabolites with nanomolar detection limits. The migration behavior of charged metabolites were also modeled in CE as a qualitative tool to support MS characterization based on two fundamental analyte physicochemical properties, namely, absolute mobility (muo) and acid dissociation constant (pKa). Computer simulations using Simul 5.0 were used to better understand the dynamics of analyte electromigration, as well as aiding de novo identification of unknown nutrients. There was excellent agreement between computer-simulated and experimental electropherograms for several classes of cationic metabolites as reflected by their relative migration times with an average error of <2.0%. Our studies revealed differential uptake of specific amino acids and nucleoside nutrients associated with distinct stages of bacterial growth. Herein, we demonstrate that CE can serve as an effective preconcentrator, desalter, and separator prior to ESI-MS, while providing additional qualitative information for unambiguous identification among isobaric and isomeric metabolites. The proposed strategy is particularly relevant for characterizing unknown yet biologically relevant metabolites that are not readily synthesized or commercially available.

Attitudes, Perceptions, and Behavioral Intentions of Engineering Workers toward Web 2.0 Tools in the Workplace

ERIC Educational Resources Information Center

Krause, Jaclyn A.

2010-01-01

As Web 2.0 tools and technologies increase in popularity in consumer markets, enterprises are seeking ways to take advantage of the rich social knowledge exchanges that these tools offer. The problem this study addresses is that it remains unknown whether employees perceive that these tools offer value to the organization and therefore will be…

Developmental Trajectory of Rule Detection in Four- to Six-Year-Old Children

ERIC Educational Resources Information Center

Li, Wei; Cao, Bihua; Hu, Lijuan; Li, Fuhong

2017-01-01

Children younger than three years old are able to detect hidden rules in numerical sequences, and this ability matches that of adults by age seven. However, the developmental trajectory of this ability during the ages of four to six remains unknown. The present study adopted a modified Brixton task to address this issue. In this task, children…

Measuring the entanglement of bipartite pure states

NASA Astrophysics Data System (ADS)

Sancho, J. M.; Huelga, S. F.

2000-04-01

The problem of the experimental determination of the amount of entanglement of a bipartite pure state is addressed. We show that measuring a single observable does not suffice to determine the entanglement of a given unknown pure state of two particles. Possible minimal local measuring strategies are discussed, and a comparison is made on the basis of their best achievable precision.

An Analysis of the Neighborhood Impacts of a Mortgage Assistance Program: A Spatial Hedonic Model

ERIC Educational Resources Information Center

Di, Wenhua; Ma, Jielai; Murdoch, James C.

2010-01-01

Down payment or closing cost assistance is an effective program in addressing the wealth constraints of low-and moderate-income homebuyers. However, the spillover effect of such programs on the neighborhood is unknown. This paper estimates the impact of the City of Dallas Mortgage Assistance Program (MAP) on nearby home values using a hedonic…

Hammondia hammondi harbors functional orthologs of the host-modulating effectors GRA15 and ROP16 but is distinguished from toxoplasma gondii by a unique transcriptional profile

USDA-ARS?s Scientific Manuscript database

The mechanisms underlying the phenotypic differences between the human pathogen Toxoplasma gondii and its nearest extant relative, Hammondia hammondi are unknown, but they are likely to be due to both gene content and gene expression differences. To address thisfurther we tested whether two known ho...

Session on coupled atmospheric/chemistry coupled models

NASA Technical Reports Server (NTRS)

Thompson, Anne

1993-01-01

The session on coupled atmospheric/chemistry coupled models is reviewed. Current model limitations, current issues and critical unknowns, and modeling activity are addressed. Specific recommendations and experimental strategies on the following are given: multiscale surface layer - planetary boundary layer - chemical flux measurements; Eulerian budget study; and Langrangian experiment. Nonprecipitating cloud studies, organized convective systems, and aerosols - heterogenous chemistry are also discussed.

Stress Tuning of Laser Crystals

NASA Technical Reports Server (NTRS)

Carty, Atherton A.

1995-01-01

The topic of stress tunable laser crystals is addressed in this study with the purpose of determining the piezo-optic coefficients of a new laser material. This data was collected using a quadruple pass birefringence technique because of its high degree of sensitivity relative to the other methods examined including fringe shift analysis using a Mach-Zender interferometer. A green He-Ne laser was passed through a light chopper and Glan-Thompson prism before entering a crystal of Erbium doped Yttrium Aluminum Garnet (Er:YAG) (used in order to validate the experimental technique). The Er:YAG crystal is mounted in a press mechanism and the laser is quadruple passed through test specimen before being returned through the prism and the orthogonally polarized portion of the beam measured with a optical sensor. At a later stage, the Er:YAG crystal was replaced with a new crystal in order to determine the piezo-optic coefficients of this uncharacterized material. The applied load was monitored with the use of a 50 lb. load cell placed in line with the press. Light transmission readings were taken using a lock-in amplifier while load cell measurements were taken with a voltmeter from a 5 volt, 0.5 amp power supply. Despite the fact that an effective crystal press damping system was developed, size limitations precluded the use of the complete system. For this reason, data points were taken only once per full turn so as to minimize the effect of non uniform load application on the collected data. Good correlation was found in the transmission data between the experimentally determined Er:YAG and the previously known peizo-optic constants of non-doped crystal with which it was compared. The variation which was found between the two could be accounted for by the aforementioned presence of Erbium in the experimental sample (for which exact empirical data was not known). The same test procedure was then carried out on a Yttrium Gallium Aluminum garnet (YGAG) for the purpose of establishing values of its unknown piezo-optic constant tensor using experimentally collected transmission data. Significant variation between the piezo-optic constants of YAG and YGAG crystals was found however, the excellent data correlation of separate experimental runs carried out on the YGAG sample demonstrates the validity of these results. The data collected during the stressing of the YGAG was of high quality, however the amount of data collected was somewhat limited by a fracture of YGAG specimen which undoubted altered the crystalline lattice structure and hence precluded any further testing.

Multi-target QSPR modeling for simultaneous prediction of multiple gas-phase kinetic rate constants of diverse chemicals

NASA Astrophysics Data System (ADS)

Basant, Nikita; Gupta, Shikha

2018-03-01

The reactions of molecular ozone (O3), hydroxyl (•OH) and nitrate (NO3) radicals are among the major pathways of removal of volatile organic compounds (VOCs) in the atmospheric environment. The gas-phase kinetic rate constants (kO3, kOH, kNO3) are thus, important in assessing the ultimate fate and exposure risk of atmospheric VOCs. Experimental data for rate constants are not available for many emerging VOCs and the computational methods reported so far address a single target modeling only. In this study, we have developed a multi-target (mt) QSPR model for simultaneous prediction of multiple kinetic rate constants (kO3, kOH, kNO3) of diverse organic chemicals considering an experimental data set of VOCs for which values of all the three rate constants are available. The mt-QSPR model identified and used five descriptors related to the molecular size, degree of saturation and electron density in a molecule, which were mechanistically interpretable. These descriptors successfully predicted three rate constants simultaneously. The model yielded high correlations (R2 = 0.874-0.924) between the experimental and simultaneously predicted endpoint rate constant (kO3, kOH, kNO3) values in test arrays for all the three systems. The model also passed all the stringent statistical validation tests for external predictivity. The proposed multi-target QSPR model can be successfully used for predicting reactivity of new VOCs simultaneously for their exposure risk assessment.

Some remarks on the attractor behaviour in ELKO cosmology

NASA Astrophysics Data System (ADS)

Pereira, S. H.; A. Pinho S., S.; Hoff da Silva, J. M.

2014-08-01

Recent results on the dynamical stability of a system involving the interaction of the ELKO spinor field with standard matter in the universe have been reanalysed, and the conclusion is that such system does not exhibit isolated stable points that could alleviate the cosmic coincidence problem. When a constant parameter δ related to the potential of the ELKO field is introduced in the system however, stable fixed points are found for some specific types of interaction between the ELKO field and matter. Although the parameter δ is related to an unknown potential, in order to satisfy the stability conditions and also that the fixed points are real, the range of the constant parameter δ can be constrained for the present time and the coincidence problem can be alleviated for some specific interactions. Such restriction on the ELKO potential opens possibility to apply the ELKO field as a candidate to dark energy in the universe, and so explain the present phase of acceleration of the universe through the decay of the ELKO field into matter.

Evaluation of effects of long term exposure on lethal toxicity with mammals.

PubMed

Verma, Vibha; Yu, Qiming J; Connell, Des W

2014-02-01

The relationship between exposure time (LT50) and lethal exposure concentration (LC50) has been evaluated over relatively long exposure times using a novel parameter, Normal Life Expectancy (NLT), as a long term toxicity point. The model equation, ln(LT50) = aLC50(ν) + b, where a, b and ν are constants, was evaluated by plotting lnLT50 against LC50 using available toxicity data based on inhalation exposure from 7 species of mammals. With each specific toxicant a single consistent relationship was observed for all mammals with ν always <1. Use of NLT as a long term toxicity point provided a valuable limiting point for long exposure times. With organic compounds, the Kow can be used to calculate the model constants a and v where these are unknown. The model can be used to characterise toxicity to specific mammals and then be extended to estimate toxicity at any exposure time with other mammals. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

Stability of Schmallenberg virus during long-term storage.

PubMed

Wernike, Kerstin; Beer, Martin

2016-01-01

Schmallenberg virus (SBV), a novel insect-transmitted orthobunyavirus that infects ruminants, caused a large epidemic in European livestock since its emergence in 2011. For the in vitro characterization of this hitherto unknown virus as well as for antibody detection tests like indirect immunofluorescence and neutralization test infectious virus is necessary. To determine the most suitable storage temperature, culture-grown SBV was kept at 37°C, 28°C, 4°C, -20°C and -70°C for up to one year. A storage at 37°C led to a complete loss of infectivity within days and at 28°C within a few weeks. When stored at 4°C the infectious titer decreased dependent on the starting quantity, whereas the viral titer was almost constant for a month at -20°C and remained constant for the study period when stored at -70°C. Consequently, SBV should be kept at -70°C, if retention of infectivity is required.

Imaginary-frequency polarizability and van der Waals force constants of two-electron atoms, with rigorous bounds

NASA Technical Reports Server (NTRS)

Glover, R. M.; Weinhold, F.

1977-01-01

Variational functionals of Braunn and Rebane (1972) for the imagery-frequency polarizability (IFP) have been generalized by the method of Gramian inequalities to give rigorous upper and lower bounds, valid even when the true (but unknown) unperturbed wavefunction must be represented by a variational approximation. Using these formulas in conjunction with flexible variational trial functions, tight error bounds are computed for the IFP and the associated two- and three-body van der Waals interaction constants of the ground 1(1S) and metastable 2(1,3S) states of He and Li(+). These bounds generally establish the ground-state properties to within a fraction of a per cent and metastable properties to within a few per cent, permitting a comparative assessment of competing theoretical methods at this level of accuracy. Unlike previous 'error bounds' for these properties, the present results have a completely a priori theoretical character, with no empirical input data.

A Probabilistic Model of Local Sequence Alignment That Simplifies Statistical Significance Estimation

PubMed Central

Eddy, Sean R.

2008-01-01

Sequence database searches require accurate estimation of the statistical significance of scores. Optimal local sequence alignment scores follow Gumbel distributions, but determining an important parameter of the distribution (λ) requires time-consuming computational simulation. Moreover, optimal alignment scores are less powerful than probabilistic scores that integrate over alignment uncertainty (“Forward” scores), but the expected distribution of Forward scores remains unknown. Here, I conjecture that both expected score distributions have simple, predictable forms when full probabilistic modeling methods are used. For a probabilistic model of local sequence alignment, optimal alignment bit scores (“Viterbi” scores) are Gumbel-distributed with constant λ = log 2, and the high scoring tail of Forward scores is exponential with the same constant λ. Simulation studies support these conjectures over a wide range of profile/sequence comparisons, using 9,318 profile-hidden Markov models from the Pfam database. This enables efficient and accurate determination of expectation values (E-values) for both Viterbi and Forward scores for probabilistic local alignments. PMID:18516236

Ultra-high Speed Optical Imaging of Ultrasound-activated Microbubbles in Mesenteric Microvessels

NASA Astrophysics Data System (ADS)

Chen, Hong

Ultrasound contrast agent microbubbles have gained widespread applications in diagnostic and therapeutic ultrasound. Animal studies of bioeffects induced by ultrasound-activated microbubbles have demonstrated that microbubbles can cause microvessel damage. Much scientific attention has been attracted to such microvascular bioeffects, not only because of the related safety concerns, but also because of the potential useful applications of microbubbles in the intravascular delivery of drugs and genetic materials into target tissues. A significant challenge in using microbubbles in medical ultrasound is the lack of knowledge about how the microbubbles behave in blood vessels when exposed to ultrasound and how their interactions with ultrasound cause vascular damage. Although extensive studies were performed in the past to study the dynamics of microbubbles, most of those studies were performed in vitro and did not directly address the clinical environment in which microbubbles are injected into blood vessels. In this thesis work, a synchronized optical-acoustic system was set up for ultrahigh speed imaging of insonated microbubbles in microvessels. The recorded images revealed the formation of microjets penetrating the microbubbles, as well as vessel distention (motion outward against the surrounding tissue) and vessel invagination (motion inward toward the lumen) caused by the expansion and collapse of the microbubbles, respectively. Contrary to current paradigms which propose that microbubbles damage vessels either by distending them or by forming liquid jets impinging on them, microbubbles translation and jetting were in the direction away from the nearest vessel wall; furthermore, invagination typically exceeded distention in arterioles and venules. Vessel invagination was found to be associated with vascular damage. These studies suggest that vessel invagination may be a newly discovered potential mechanism for vascular damage by ultrasound-activated microbubbles. The dynamics of bubble-vessel interactions are coupled intimately with the viscoelastic properties of the microvessels. To probe these properties, a method based on the relaxation times of the invaginated microvessels was used to estimate the relaxation time constants of the microvessels. It was found that the time constants were on microsecond time scales, which provided insight into the unique and unknown viscoelastic properties of the microvessels.

The Full Breadth of Mendel’s Genetics

PubMed Central

van Dijk, Peter J.; Ellis, T. H. Noel

2016-01-01

Gregor Mendel’s “Experiments on Plant Hybrids” (1865/1866), published 150 years ago, is without doubt one of the most brilliant works in biology. Curiously, Mendel’s later studies on Hieracium (hawkweed) are usually seen as a frustrating failure, because it is assumed that they were intended to confirm the segregation ratios he found in Pisum. Had this been his intention, such a confirmation would have failed, since, unknown to Mendel, Hieracium species mostly reproduce by means of clonal seeds (apomixis). Here we show that this assumption arises from a misunderstanding that could be explained by a missing page in Mendel’s first letter to Carl Nägeli. Mendel’s writings clearly indicate his interest in “constant hybrids,” hybrids which do not segregate, and which were “essentially different” from “variable hybrids” such as in Pisum. After the Pisum studies, Mendel worked mainly on Hieracium for 7 years where he found constant hybrids and some great surprises. He also continued to explore variable hybrids; both variable and constant hybrids were of interest to Mendel with respect to inheritance and to species evolution. Mendel considered that their similarities and differences might provide deep insights and that their differing behaviors were “individual manifestations of a higher more fundamental law.” PMID:27927898

Absolute protein-protein association rate constants from flexible, coarse-grained Brownian dynamics simulations: the role of intermolecular hydrodynamic interactions in barnase-barstar association.

PubMed

Frembgen-Kesner, Tamara; Elcock, Adrian H

2010-11-03

Theory and computation have long been used to rationalize the experimental association rate constants of protein-protein complexes, and Brownian dynamics (BD) simulations, in particular, have been successful in reproducing the relative rate constants of wild-type and mutant protein pairs. Missing from previous BD studies of association kinetics, however, has been the description of hydrodynamic interactions (HIs) between, and within, the diffusing proteins. Here we address this issue by rigorously including HIs in BD simulations of the barnase-barstar association reaction. We first show that even very simplified representations of the proteins--involving approximately one pseudoatom for every three residues in the protein--can provide excellent reproduction of the absolute association rate constants of wild-type and mutant protein pairs. We then show that simulations that include intermolecular HIs also produce excellent estimates of association rate constants, but, for a given reaction criterion, yield values that are decreased by ∼35-80% relative to those obtained in the absence of intermolecular HIs. The neglect of intermolecular HIs in previous BD simulation studies, therefore, is likely to have contributed to the somewhat overestimated absolute rate constants previously obtained. Consequently, intermolecular HIs could be an important component to include in accurate modeling of the kinetics of macromolecular association events. Copyright © 2010 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Biodegradation testing of chemicals with high Henry's constants - Separating mass and effective concentration reveals higher rate constants.

PubMed

Birch, Heidi; Andersen, Henrik R; Comber, Mike; Mayer, Philipp

2017-05-01

During simulation-type biodegradation tests, volatile chemicals will continuously partition between water phase and headspace. This study addressed how (1) this partitioning affects test results and (2) can be accounted for by combining equilibrium partition and dynamic biodegradation models. An aqueous mixture of 9 (semi)volatile chemicals was first generated using passive dosing and then diluted with environmental surface water producing concentrations in the ng/L to μg/L range. After incubation for 2 h to 4 weeks, automated Headspace Solid Phase Microextraction (HS-SPME) was applied directly on the test systems to measure substrate depletion by biodegradation relatively to abiotic controls. HS-SPME was also applied to determine air to water partitioning ratios. Biodegradation rate constants relating to the chemical in the water phase, k water , were generally a factor 1 to 11 times higher than biodegradation rate constants relating to the total mass of chemical in the test system, k system , with one exceptional factor of 72 times for a long chain alkane. True water phase degradation rate constants were found (i) more appropriate for risk assessment than test system rate constants, (ii) to facilitate extrapolation to other air-water systems and (iii) to be better defined input parameters for aquatic exposure and fate models. Copyright © 2017 Elsevier Ltd. All rights reserved.

A proposed atom interferometry determination of G at 10-5 using a cold atomic fountain

NASA Astrophysics Data System (ADS)

Rosi, G.

2018-02-01

In precision metrology, the determination of the Newtonian gravity constant G represents a real problem, since its history is plagued by huge unknown discrepancies between a large number of independent experiments. In this paper, we propose a novel experimental setup for measuring G with a relative accuracy of 10-5 , using a standard cold atomic fountain and matter wave interferometry. We discuss in detail the major sources of systematic errors, and provide the expected statistical uncertainty. The feasibility of determining G at the 10-6 level is also discussed.

Determining the Intensity of a Point-Like Source Observed on the Background of AN Extended Source

NASA Astrophysics Data System (ADS)

Kornienko, Y. V.; Skuratovskiy, S. I.

2014-12-01

The problem of determining the time dependence of intensity of a point-like source in case of atmospheric blur is formulated and solved by using the Bayesian statistical approach. A pointlike source is supposed to be observed on the background of an extended source with constant in time though unknown brightness. The equation system for optimal statistical estimation of the sequence of intensity values in observation moments is obtained. The problem is particularly relevant for studying gravitational mirages which appear while observing a quasar through the gravitational field of a far galaxy.

Compatibility check of measured aircraft responses using kinematic equations and extended Kalman filter

NASA Technical Reports Server (NTRS)

Klein, V.; Schiess, J. R.

1977-01-01

An extended Kalman filter smoother and a fixed point smoother were used for estimation of the state variables in the six degree of freedom kinematic equations relating measured aircraft responses and for estimation of unknown constant bias and scale factor errors in measured data. The computing algorithm includes an analysis of residuals which can improve the filter performance and provide estimates of measurement noise characteristics for some aircraft output variables. The technique developed was demonstrated using simulated and real flight test data. Improved accuracy of measured data was obtained when the data were corrected for estimated bias errors.

Identifying chemicals that are planetary boundary threats.

PubMed

MacLeod, Matthew; Breitholtz, Magnus; Cousins, Ian T; de Wit, Cynthia A; Persson, Linn M; Rudén, Christina; McLachlan, Michael S

2014-10-07

Rockström et al. proposed a set of planetary boundaries that delimit a "safe operating space for humanity". Many of the planetary boundaries that have so far been identified are determined by chemical agents. Other chemical pollution-related planetary boundaries likely exist, but are currently unknown. A chemical poses an unknown planetary boundary threat if it simultaneously fulfills three conditions: (1) it has an unknown disruptive effect on a vital Earth system process; (2) the disruptive effect is not discovered until it is a problem at the global scale, and (3) the effect is not readily reversible. In this paper, we outline scenarios in which chemicals could fulfill each of the three conditions, then use the scenarios as the basis to define chemical profiles that fit each scenario. The chemical profiles are defined in terms of the nature of the effect of the chemical and the nature of exposure of the environment to the chemical. Prioritization of chemicals in commerce against some of the profiles appears feasible, but there are considerable uncertainties and scientific challenges that must be addressed. Most challenging is prioritizing chemicals for their potential to have a currently unknown effect on a vital Earth system process. We conclude that the most effective strategy currently available to identify chemicals that are planetary boundary threats is prioritization against profiles defined in terms of environmental exposure combined with monitoring and study of the biogeochemical processes that underlie vital Earth system processes to identify currently unknown disruptive effects.

Exacerbating the Cosmological Constant Problem with Interacting Dark Energy Models.

PubMed

Marsh, M C David

2017-01-06

Future cosmological surveys will probe the expansion history of the Universe and constrain phenomenological models of dark energy. Such models do not address the fine-tuning problem of the vacuum energy, i.e., the cosmological constant problem (CCP), but can make it spectacularly worse. We show that this is the case for "interacting dark energy" models in which the masses of the dark matter states depend on the dark energy sector. If realized in nature, these models have far-reaching implications for proposed solutions to the CCP that require the number of vacua to exceed the fine-tuning of the vacuum energy density. We show that current estimates of the number of flux vacua in string theory, N_{vac}∼O(10^{272 000}), are far too small to realize certain simple models of interacting dark energy and solve the cosmological constant problem anthropically. These models admit distinctive observational signatures that can be targeted by future gamma-ray observatories, hence making it possible to observationally rule out the anthropic solution to the cosmological constant problem in theories with a finite number of vacua.

Parallel Elemental and Molecular Mass Spectrometry (PEMMS) for Speciation of Metals in Complex Matrices

NASA Astrophysics Data System (ADS)

Derry, L. A.; Sacks, G. L.; Brenna, J. T.

2006-12-01

The mobility, bioavailability, and toxicity of many metals are strongly influenced by their molecular form, or speciation. Many metals (M) in the environment are complexed with organic ligands (L); in some cases such complexed forms comprise virtually all of the dissolved metal. When available, stability constants can be used to model speciation, but only when the identities of species can be known or assumed. In other cases, coupling a separation tool such as HPLC to a metal detection system like ICP-MS can provide information on speciation. But because ICP-MS destroys molecular information the complexing L must be identified by retention time matching of standards. The assumptions inherent in these approaches preclude investigation of unknown compounds. Electrochemical methods can determine conditional stability constants for unknown L but do not provide information on their molecular structure or composition. Molecular MS allows characterization of molecular mass and structure and is a powerful tool for identifying unknown organic compounds. However, sensitivity for M and precision for isotope ratios are often low. We combined HPLC separation with simultaneous parallel detection of metals (M) and ligands (L) by ICP-MS and API-QTOF-MS-MS. The basis of our approach is that the shape of a chromatographic peak is essentially set by interactions with the LC column. The signal of a metal M determined by the ICP-MS in chromatographic mode is fit using an exponentially modified Gaussian function. Peak parameters including retention time, peak width and skew are determined for the M peak. The parallel QTOF signal in full scan mode may show hundreds of peaks in the same time window. The acquired peak library is searched for L peaks that match the parameters determined for the M peak on the ICP-MS. We have found that our system can correctly identify M-L pairs and L in complex samples and generates few false positives. Unknown L can be further interrogated by using the MS-MS product ion scan mode of the QTOF, in which candidate peaks are fragmented in a collision cell after MS1 and the fragments analyzed by MS2. The combination of precise mass determinations, recognition of isotopomers, and product ion scans can often identify unknown M-L in complex natural mixtures without prior knowledge of the sample composition. Data from seleno-compounds illustrate the PEMMS concept. An artificially noisy sample was generated by spiking 30 ppb Se-methionine (SeMet) and 5 ppb Se-methylselenocysteine (SeMSC) with unselenized yeast extract and run by PEMMS. The PEMMS software was able to detect four molecular MS peaks associated with SeMet and two for SeMSC, while filtering out more than 40 co-eluting spectral peaks associated with chemical noise in each sample. Additional data from Cu-thiols produced by marine plankton and soil chelates of Al demonstrate the utility of the PEMMS approach in the study of natural environmental systems.

A Thermal Paradox: Which Gets Warmer?

ERIC Educational Resources Information Center

Salazar, Agustin; Apinaniz, Estibaliz; Mendioroz, Arantza; Oleaga, Alberto

2010-01-01

In this paper we address a common misconception concerning the thermal behaviour of matter, namely that the front surface of a very thin plate, uniformly illuminated by a constant light beam, reaches a higher temperature than the front surface of a very thick slab made out of the same material. We present analytical solutions for the temperature…

Toward Achievement in the "Knowledge Economy" of the 21st Century: Preparing Students through T-STEM Academies

ERIC Educational Resources Information Center

Gonzales, Alberto

2010-01-01

Schools are constantly engaged in implementing reform strategies to prepare students for post-secondary education leading to their career choices. Challenges here involve education initiatives addressing programs not strategically planned, educators not prepared for transition, and no follow-up support beyond initial implementation stages. This…

Toward Achievement in the "Knowledge Economy" of the 21st Century: Preparing Students through T-STEM Academies

ERIC Educational Resources Information Center

Gonzales, Alberto; Jones, Don; Ruiz, Alberto

2014-01-01

Schools are constantly engaged in implementing reform strategies to prepare students for postsecondary education leading to their career choices. Challenges here involve education initiatives addressing programs not strategically planned, educators not prepared for transition, and no follow-up support beyond initial implementation stages. This…

Who We Are: A Case Study on the Institutional Identity of One Public Institution

ERIC Educational Resources Information Center

Driggers, Mallory C.

2016-01-01

This research examined the formation, change and sustainment of institutional identity over a period of almost three decades under one leader at a public research institution in the southwest. This qualitative case study used constant comparative analysis with interview transcripts and convocation address transcripts to examine the change in…

Examining the Relationship between Congruency of Perceived Principal Leadership Style and Leadership Effectiveness

ERIC Educational Resources Information Center

Iwuanyanwu-Biemkpa, Catherine Chinedum

2017-01-01

Despite the constant interest in the theory and practice of leadership as it relates to leadership styles and leadership effectiveness, ongoing debate continues regarding the importance of leadership style and its effectiveness in the administration of underperforming schools. The problem addressed by this study was, despite frequent changes of…

Professional Doctoral Scholarship in Ghana: A Case Study of the CDT-BEPS Framework

ERIC Educational Resources Information Center

Owusu-Manu, D.; Edwards, D. J.; Afrane, S. K.; Dontwi, I. K.; Laycock, P.

2015-01-01

The constantly evolving paradigm of 21st century educational offerings and the growing demand for "professional practice" research degrees have raised concerns about the relevance of the traditional "theoretical" PhD award. To meet this growing demand, and address these concerns, alternative routes to achieving the doctoral…

A Holistic Approach to Develop IS Curricula: Focusing on Accreditation and IT Certification

ERIC Educational Resources Information Center

Al-Rawi, Akram; Lansari, Azzedine; Bouslama, Faouzi

2005-01-01

Academic institutions worldwide are constantly trying to refine or even reinvent their Information Systems (IS) curricula to address the needs of industry and government. As many IS curricula emerge, a number of them do not satisfy well recognized standards and even lack critical components. Furthermore, a highly competitive Information Technology…

The School Technology Primer: A Non-Technical Guide to Understanding School Technology.

ERIC Educational Resources Information Center

Little Inst. for School Facilities Research, Charlotte, NC.

This booklet is designed to provide educational administrators and planners with an easy guide to understanding the constantly evolving elements of school technology. The booklet presents a comprehensive overview of modern information systems in schools and how they can enhance the students' learning environment. Seven sections address a variety…

Teaching Presence in Online Courses: Practical Applications, Co-Facilitation, and Technology Integration

ERIC Educational Resources Information Center

Budhai, Stephanie Smith; Williams, Maureen

2016-01-01

The number of online courses being offered at the postsecondary level has constantly increased. However, online instructors are still investigating ways to translate their pedagogical instruction into the online forum, while maintaining a strong presence instructionally. This paper aims to address how to build teaching presence in online courses.…

Teacher Motivation: Definition, Research Development and Implications for Teachers

ERIC Educational Resources Information Center

Han, Jiying; Yin, Hongbiao

2016-01-01

The past decade has witnessed an increase in research on teacher motivation which has been proved a crucial factor closely related to a number of variables in education such as student motivation, educational reform, teaching practice and teachers' psychological fulfilment and well-being. To address the constant calls for teacher motivation…

Agility in Business School Education through Richness and Reach: A Conceptual Model

ERIC Educational Resources Information Center

Gupta, Nakul; Bharadwaj, Sangeeta Shah

2013-01-01

Purpose: Pedagogy today has become a function of technology and this relationship becomes all the more promising when used to address the educational needs of the constantly changing and fast evolving business school education. Business schools today are responsible for empowering future managers and leaders with not only the knowledge and…

Dairy-Based Emulsions: Viscosity Affects Fat Difference Thresholds and Sweetness Perception.

PubMed

Zahn, Susann; Hoppert, Karin; Ullrich, Franziska; Rohm, Harald

2013-11-27

In complex emulsions, viscosity or viscosity-associated sensory attributes such as creaminess are important for quality assessment and product differentiation. Two sets of emulsions with fat or locust bean gum content being varied at seven levels were developed; the two emulsions at each level had similar apparent viscosity. Additionally, sugar concentration was kept constant either with respect to total emulsion, or with respect to the aqueous phase. Series of two-alternative forced choice tests were performed with one constant stimulus, and just noticeable differences were calculated using probability regression. The results show that, when viscosity was not compensated, it was easy for the subjects to (a) distinguish emulsions with different fat content when the fat content was addressed in the question, and to (b) distinguish emulsions with different fat or locust bean gum content when creaminess was addressed. For the latter descriptor, it is of minor importance whether viscosity is altered by fat content or a thickener. Weber fractions that were calculated for viscosity were approximately 0.20. The quantitative effects of viscosity on sweetness, however, depend on how product rheology was modified.

Ongoing Progress in Spacecraft Controls

NASA Technical Reports Server (NTRS)

Ghosh, Dave (Editor)

1992-01-01

This publication is a collection of papers presented at the Mars Mission Research Center workshop on Ongoing Progress in Spacecraft Controls. The technical program addressed additional Mars mission control problems that currently exist in robotic missions in addition to human missions. Topics include control systems design in the presence of large time delays, fuel-optimal propulsive control, and adaptive control to handle a variety of unknown conditions.

Francisco de Castro: Localizationism, intelligence and the frontal lobe

PubMed Central

Oliveira, Pedro Sudbrack; Engelhardt, Eliasz; Gomes, Marleide da Mota

2017-01-01

ABSTRACT This article addresses the largely unknown legacy of Francisco de Castro regarding the neurological sciences. His essay "Psychogenic Cortical Centers", written in 1881 for his admission to the Imperial Academy of Medicine in Rio de Janeiro, is a refined appreciation of the theory of localized cortical functions that was in evidence in Europe in the second half of the nineteenth century. PMID:29213528

Spacecraft Stabilization and Control for Capture of Non-Cooperative Space Objects

NASA Technical Reports Server (NTRS)

Joshi, Suresh; Kelkar, Atul G.

2014-01-01

This paper addresses stabilization and control issues in autonomous capture and manipulation of non-cooperative space objects such as asteroids, space debris, and orbital spacecraft in need of servicing. Such objects are characterized by unknown mass-inertia properties, unknown rotational motion, and irregular shapes, which makes it a challenging control problem. The problem is further compounded by the presence of inherent nonlinearities, signi cant elastic modes with low damping, and parameter uncertainties in the spacecraft. Robust dissipativity-based control laws are presented and are shown to provide global asymptotic stability in spite of model uncertainties and nonlinearities. It is shown that robust stabilization can be accomplished via model-independent dissipativity-based controllers using thrusters alone, while stabilization with attitude and position control can be accomplished using thrusters and torque actuators.

Group prioritisation with unknown expert weights in incomplete linguistic context

NASA Astrophysics Data System (ADS)

Cheng, Dong; Cheng, Faxin; Zhou, Zhili; Wang, Juan

2017-09-01

In this paper, we study a group prioritisation problem in situations when the expert weights are completely unknown and their judgement preferences are linguistic and incomplete. Starting from the theory of relative entropy (RE) and multiplicative consistency, an optimisation model is provided for deriving an individual priority vector without estimating the missing value(s) of an incomplete linguistic preference relation. In order to address the unknown expert weights in the group aggregating process, we define two new kinds of expert weight indicators based on RE: proximity entropy weight and similarity entropy weight. Furthermore, a dynamic-adjusting algorithm (DAA) is proposed to obtain an objective expert weight vector and capture the dynamic properties involved in it. Unlike the extant literature of group prioritisation, the proposed RE approach does not require pre-allocation of expert weights and can solve incomplete preference relations. An interesting finding is that once all the experts express their preference relations, the final expert weight vector derived from the DAA is fixed irrespective of the initial settings of expert weights. Finally, an application example is conducted to validate the effectiveness and robustness of the RE approach.

Novel Calibration Algorithm for a Three-Axis Strapdown Magnetometer

PubMed Central

Liu, Yan Xia; Li, Xi Sheng; Zhang, Xiao Juan; Feng, Yi Bo

2014-01-01

A complete error calibration model with 12 independent parameters is established by analyzing the three-axis magnetometer error mechanism. The said model conforms to an ellipsoid restriction, the parameters of the ellipsoid equation are estimated, and the ellipsoid coefficient matrix is derived. However, the calibration matrix cannot be determined completely, as there are fewer ellipsoid parameters than calibration model parameters. Mathematically, the calibration matrix derived from the ellipsoid coefficient matrix by a different matrix decomposition method is not unique, and there exists an unknown rotation matrix R between them. This paper puts forward a constant intersection angle method (angles between the geomagnetic field and gravitational field are fixed) to estimate R. The Tikhonov method is adopted to solve the problem that rounding errors or other errors may seriously affect the calculation results of R when the condition number of the matrix is very large. The geomagnetic field vector and heading error are further corrected by R. The constant intersection angle method is convenient and practical, as it is free from any additional calibration procedure or coordinate transformation. In addition, the simulation experiment indicates that the heading error declines from ±1° calibrated by classical ellipsoid fitting to ±0.2° calibrated by a constant intersection angle method, and the signal-to-noise ratio is 50 dB. The actual experiment exhibits that the heading error is further corrected from ±0.8° calibrated by the classical ellipsoid fitting to ±0.3° calibrated by a constant intersection angle method. PMID:24831110

Policy Concerns Raised by the Growing U.S. Population Aging with Disability

PubMed Central

Iezzoni, Lisa I.

2014-01-01

Narrative Summary The number of Americans aging with disabilities will grow substantially in coming decades. Promulgating policies and practices to improve their independent functioning within communities and participation in daily life is therefore imperative, but the most effective approaches for meeting various needs are generally unknown. Historically, research addressing approaches targeting elderly individuals have differed in important ways (e.g., underlying models of disability) from studies involving younger persons aging with disabilities. Participants in a conference addressing this discordance identified six major areas requiring study: (1) resources to support independent living; (2) improving quality of life and participation in daily activities; (3) performing activities of daily living (ADL) and instrumental ADLs; (4) role of families; (5) medical care; and (6) concerns transcending sectors. As these investigations move forward, bridging the divide between approaches addressing elderly individuals versus persons with disabilities will be critical. PMID:24456688

LANDSAT-4 to ground station interface description

NASA Technical Reports Server (NTRS)

1983-01-01

The LANDSAT 4 to ground station interface is described in detail. The radiometric specifications, internal calibration, sensor output format, and data processing constants for the multispectral scanner and the thematic mapper are discussed. The mission payload telemetry, onboard computer telemetry, and engineering telemetry formats are described. In addition, the telemetry time signals and the onboard clock resetting procedure are addressed.

From Complex Data to Actionable Information: Institutional Research Supporting Enrollment Management

ERIC Educational Resources Information Center

Anderson, Douglas K.; Milner, Bridgett J.; Foley, Chris J.

2008-01-01

Producing analyses that are accurate, timely, and simple is a constant challenge for institutional researchers. The stakes are high: when the analysis is incomplete, arrives too late, does not adequately address the question, or is simply too much to comprehend, decision makers fall back on anecdotal thinking or gut-level reactions that can lead…

Developing a Curriculum for On-Line International Business Degree: An Integrated Approach Using Systems and ERP Concepts

ERIC Educational Resources Information Center

Desai, Mayur S.; Pitre, Richard

2009-01-01

The world today can be characterized by constant change. One such change is globalization: the integration of world economies into a single economy. Because of globalization, it is necessary for colleges and universities to respond with appropriate curriculum changes that addresses this new world phenomenon. Several institutions of higher…

Spacecraft detumbling through energy dissipation

NASA Technical Reports Server (NTRS)

Fitz-Coy, Norman; Chatterjee, Anindya

1993-01-01

The attitude motion of a tumbling, rigid, axisymmetric spacecraft is considered. A methodology for detumbling the spacecraft through energy dissipation is presented. The differential equations governing this motion are stiff, and therefore an approximate solution, based on the variation of constants method, is developed and utilized in the analysis of the detumbling strategy. Stability of the detumbling process is also addressed.

Changing Past Student Discipline Practices to Create a District-Wide Discipline Plan

ERIC Educational Resources Information Center

Green, Judith A.

2009-01-01

Improving student discipline is a constant challenge in the field of P-12 education. The challenge is especially great for district-level administrators who must address the educational and social needs of all students. As a district-level administrator, the author participates in a study of a midwestern district of elementary (preschool-8)…

Effectively Adapting the Sport Management Curricula: Harnessing Internal and External Resources to Address Industry-Specific Needs

ERIC Educational Resources Information Center

Braunstein-Minkove, Jessica R.; DeLuca, Jaime R.

2015-01-01

Academic programs must constantly evolve in order to ensure that students are best prepared for success in internships and subsequent post-collegiate endeavors within the dynamic, rapidly changing sport industry. Based upon qualitative research, this work assesses and recommends areas of development in sport management curricula using internal and…

Non-Zero Net Force and Constant Velocity: A Study in Mazur's Peer Instruction

ERIC Educational Resources Information Center

Newburgh, Ronald

2009-01-01

A problem addressed infrequently in beginning physics courses is that of a moving body with changing mass. Elementary texts often have footnotes referring to jet planes and rockets but rarely do they go further. This omission is understandable because calculations with variable mass generally require the tools of calculus. This paper presents a…

Addressing Digital Inequalities amongst Young People: Conflicting Discourses and Complex Outcomes

ERIC Educational Resources Information Center

Wilkin, Sarah; Davies, Huw; Eynon, Rebecca

2017-01-01

Despite the ongoing discourse about the constantly connected and digitally savvy youth in the UK, a growing evidence base demonstrates that there are still significant inequalities in young people's ability to access and use the internet. There is a small, but significant, proportion of young people who do not have internet access at home, nor…

Strategies and challenges for nursery production: Perspectives on where we're going and where we've been

Treesearch

Diane L. Haase

2010-01-01

During the past century, seedling production has changed in accordance with technology and new knowledge. Many strategies have been developed to address challenges associated with pests, environmental conditions, and customer demands. Although the underlying concepts for growing seedlings have remained relatively constant, technological advances have enabled nurseries...

The Atomic Mass Unit, the Avogadro Constant, and the Mole: A Way to Understanding

ERIC Educational Resources Information Center

Baranski, Andrzej

2012-01-01

Numerous articles have been published that address problems encountered in teaching basic concepts of chemistry such as the atomic mass unit, Avogadro's number, and the mole. The origin of these problems is found in the concept definitions. If these definitions are adjusted for teaching purposes, understanding could be improved. In the present…

The Routine Fitting of Kinetic Data to Models

PubMed Central

Berman, Mones; Shahn, Ezra; Weiss, Marjory F.

1962-01-01

A mathematical formalism is presented for use with digital computers to permit the routine fitting of data to physical and mathematical models. Given a set of data, the mathematical equations describing a model, initial conditions for an experiment, and initial estimates for the values of model parameters, the computer program automatically proceeds to obtain a least squares fit of the data by an iterative adjustment of the values of the parameters. When the experimental measures are linear combinations of functions, the linear coefficients for a least squares fit may also be calculated. The values of both the parameters of the model and the coefficients for the sum of functions may be unknown independent variables, unknown dependent variables, or known constants. In the case of dependence, only linear dependencies are provided for in routine use. The computer program includes a number of subroutines, each one of which performs a special task. This permits flexibility in choosing various types of solutions and procedures. One subroutine, for example, handles linear differential equations, another, special non-linear functions, etc. The use of analytic or numerical solutions of equations is possible. PMID:13867975

The CASTOR proteins are arginine sensors for the mTORC1 pathway

PubMed Central

Chantranupong, Lynne; Scaria, Sonia M.; Saxton, Robert A.; Gygi, Melanie P.; Shen, Kuang; Wyant, Gregory A.; Wang, Tim; Harper, J. Wade; Gygi, Steven P.; Sabatini, David M.

2016-01-01

Amino acids signal to the mTOR complex I (mTORC1) growth pathway through the Rag GTPases. Multiple distinct complexes regulate the Rags, including GATOR1, a GTPase activating protein (GAP), and GATOR2, a positive regulator of unknown molecular function. Arginine stimulation of cells activates mTORC1, but how it is sensed is not well understood. Recently, SLC38A9 was identified as a putative lysosomal arginine sensor required for arginine to activate mTORC1 but how arginine deprivation represses mTORC1 is unknown. Here, we show that CASTOR1, a previously uncharacterized protein, interacts with GATOR2 and is required for arginine deprivation to inhibit mTORC1. CASTOR1 homodimerizes and can also heterodimerize with the related protein, CASTOR2. Arginine disrupts the CASTOR1-GATOR2 complex by binding to CASTOR1 with a dissociation constant of ~30 μM, and its arginine-binding capacity is required for arginine to activate mTORC1 in cells. Collectively, these results establish CASTOR1 as an arginine sensor for the mTORC1 pathway. PMID:26972053

Uncertainty contribution on the density of liquids due to unknown sinker temperature in hydrostatic weighing apparatus

NASA Astrophysics Data System (ADS)

Schiebl, M.; Zelenka, Z.; Buchner, C.; Pohl, R.; Steindl, D.

2018-02-01

In this study, the influence of the unknown sinker temperature on the measured density of liquids is evaluated. Generally, due to the intrinsic temperature instability of the heat bath temperature controller, the system will never reach thermal equilibrium but instead will oscillate around a mean temperature. The sinker temperature follows this temperature oscillation with a certain time lag. Since the sinker temperature is not measured directly in a hydrostatic weighing apparatus, the temperature of the sinker, and thus in turn the volume of the sinker, is not known exactly. As a consequence, this leads to uncertainty in the value of the density of the liquid. From an analysis of the volume relaxation of the sinker immersed into a heat bath with time-dependent temperature characteristics, the heat transfer coefficient can be estimated, and thus a characteristic time constant for achieving quasi thermal equilibrium for a hydrostatic weighing apparatus is proposed. Additionally, from a theoretical analysis of the transient behavior of the sinker volume, the systematic deviation of the theoretical to the actual measured liquid density is calculated.

Rhelogical constraints on ridge formation on Icy Satellites

NASA Astrophysics Data System (ADS)

Rudolph, M. L.; Manga, M.

2010-12-01

The processes responsible for forming ridges on Europa remain poorly understood. We use a continuum damage mechanics approach to model ridge formation. The main objectives of this contribution are to constrain (1) choice of rheological parameters and (2) maximum ridge size and rate of formation. The key rheological parameters to constrain appear in the evolution equation for a damage variable (D): ˙ {D} = B <<σ >>r}(1-D){-k-α D (p)/(μ ) and in the equation relating damage accumulation to volumetric changes, Jρ 0 = δ (1-D). Similar damage evolution laws have been applied to terrestrial glaciers and to the analysis of rock mechanics experiments. However, it is reasonable to expect that, like viscosity, the rheological constants B, α , and δ depend strongly on temperature, composition, and ice grain size. In order to determine whether the damage model is appropriate for Europa’s ridges, we must find values of the unknown damage parameters that reproduce ridge topography. We perform a suite of numerical experiments to identify the region of parameter space conducive to ridge production and show the sensitivity to changes in each unknown parameter.

Achieving high confidence protein annotations in a sea of unknowns

NASA Astrophysics Data System (ADS)

Timmins-Schiffman, E.; May, D. H.; Noble, W. S.; Nunn, B. L.; Mikan, M.; Harvey, H. R.

2016-02-01

Increased sensitivity of mass spectrometry (MS) technology allows deep and broad insight into community functional analyses. Metaproteomics holds the promise to reveal functional responses of natural microbial communities, whereas metagenomics alone can only hint at potential functions. The complex datasets resulting from ocean MS have the potential to inform diverse realms of the biological, chemical, and physical ocean sciences, yet the extent of bacterial functional diversity and redundancy has not been fully explored. To take advantage of these impressive datasets, we need a clear bioinformatics pipeline for metaproteomics peptide identification and annotation with a database that can provide confident identifications. Researchers must consider whether it is sufficient to leverage the vast quantities of available ocean sequence data or if they must invest in site-specific metagenomic sequencing. We have sequenced, to our knowledge, the first western arctic metagenomes from the Bering Strait and the Chukchi Sea. We have addressed the long standing question: Is a metagenome required to accurately complete metaproteomics and assess the biological distribution of metabolic functions controlling nutrient acquisition in the ocean? Two different protein databases were constructed from 1) a site-specific metagenome and 2) subarctic/arctic groups available in NCBI's non-redundant database. Multiple proteomic search strategies were employed, against each individual database and against both databases combined, to determine the algorithm and approach that yielded the balance of high sensitivity and confident identification. Results yielded over 8200 confidently identified proteins. Our comparison of these results allows us to quantify the utility of investing resources in a metagenome versus using the constantly expanding and immediately available public databases for metaproteomic studies.

Long-term monitoring of sudden oak death in Marin County and the East Bay Hills

Treesearch

Brice A. McPherson; Greg Biging; Maggi Kelly; David L. Wood

2017-01-01

Prior to 2000 the etiology, effects on host trees, and possible consequences for northern California’s forests of the syndrome known as sudden oak death were unknown. We designed a plot-based study to address these issues and to set a baseline for future evaluations.In March-April 2000 we established a total of 20 plots in two forested...

Using a Problem Solving-Cooperative Learning Approach to Improve Students' Skills for Interpreting [Superscript 1]H NMR Spectra of Unknown Compounds in an Organic Spectroscopy Course

ERIC Educational Resources Information Center

Angawi, Rihab F.

2014-01-01

To address third- and fourth-year chemistry students' difficulties with the challenge of interpreting [superscript 1]H NMR spectra, a problem solving-cooperative learning technique was incorporated in a Spectra of Organic Compounds course. Using this approach helped students deepen their understanding of the basics of [superscript 1]H NMR…

Treating Anxiety Disorders in Inner City Schools: Results from a Pilot Randomized Controlled Trial Comparing CBT and Usual Care

ERIC Educational Resources Information Center

Ginsburg, Golda S.; Becker, Kimberly D.; Drazdowski, Tess K.; Tein, Jenn-Yun

2012-01-01

Background: The effectiveness of cognitive-behavioral treatment (CBT) in inner city schools, when delivered by novice CBT clinicians, and compared to usual care (UC), is unknown. Objective: This pilot study addressed this issue by comparing a modular CBT for anxiety disorders to UC in a sample of 32 volunteer youth (mean age 10.28 years, 63%…

The Role of Auditory and Visual Speech in Word Learning at 18 Months and in Adulthood

ERIC Educational Resources Information Center

Havy, Mélanie; Foroud, Afra; Fais, Laurel; Werker, Janet F.

2017-01-01

Visual information influences speech perception in both infants and adults. It is still unknown whether lexical representations are multisensory. To address this question, we exposed 18-month-old infants (n = 32) and adults (n = 32) to new word-object pairings: Participants either heard the acoustic form of the words or saw the talking face in…

Examining the Fundamental Obstructs of Adopting Cloud Computing for 9-1-1 Dispatch Centers in the USA

ERIC Educational Resources Information Center

Osman, Abdulaziz

2016-01-01

The purpose of this research study was to examine the unknown fears of embracing cloud computing which stretches across measurements like fear of change from leaders and the complexity of the technology in 9-1-1 dispatch centers in USA. The problem that was addressed in the study was that many 9-1-1 dispatch centers in USA are still using old…

Contrast enhancement of mail piece images

NASA Astrophysics Data System (ADS)

Shin, Yong-Chul; Sridhar, Ramalingam; Demjanenko, Victor; Palumbo, Paul W.; Hull, Jonathan J.

1992-08-01

A New approach to contrast enhancement of mail piece images is presented. The contrast enhancement is used as a preprocessing step in the real-time address block location (RT-ABL) system. The RT-ABL system processes a stream of mail piece images and locates destination address blocks. Most of the mail pieces (classified into letters) show high contrast between background and foreground. As an extreme case, however, the seasonal greeting cards usually use colored envelopes which results in reduced contrast osured by an error rate by using a linear distributed associative memory (DAM). The DAM is trained to recognize the spectra of three classes of images: with high, medium, and low OCR error rates. The DAM is not forced to make a classification every time. It is allowed to reject as unknown a spectrum presented that does not closely resemble any that has been stored in the DAM. The DAM was fairly accurate with noisy images but conservative (i.e., rejected several text images as unknowns) when there was little ground and foreground degradations without affecting the nondegraded images. This approach provides local enhancement which adapts to local features. In order to simplify the computation of A and (sigma) , dynamic programming technique is used. Implementation details, performance, and the results on test images are presented in this paper.

Clustering Millions of Faces by Identity.

PubMed

Otto, Charles; Wang, Dayong; Jain, Anil K

2018-02-01

Given a large collection of unlabeled face images, we address the problem of clustering faces into an unknown number of identities. This problem is of interest in social media, law enforcement, and other applications, where the number of faces can be of the order of hundreds of million, while the number of identities (clusters) can range from a few thousand to millions. To address the challenges of run-time complexity and cluster quality, we present an approximate Rank-Order clustering algorithm that performs better than popular clustering algorithms (k-Means and Spectral). Our experiments include clustering up to 123 million face images into over 10 million clusters. Clustering results are analyzed in terms of external (known face labels) and internal (unknown face labels) quality measures, and run-time. Our algorithm achieves an F-measure of 0.87 on the LFW benchmark (13 K faces of 5,749 individuals), which drops to 0.27 on the largest dataset considered (13 K faces in LFW + 123M distractor images). Additionally, we show that frames in the YouTube benchmark can be clustered with an F-measure of 0.71. An internal per-cluster quality measure is developed to rank individual clusters for manual exploration of high quality clusters that are compact and isolated.

Viral Diseases in Zebrafish: What Is Known and Unknown

PubMed Central

Crim, Marcus J.; Riley, Lela K.

2013-01-01

Naturally occurring viral infections have the potential to introduce confounding variability that leads to invalid and misinterpreted data. Whereas the viral diseases of research rodents are well characterized and closely monitored, no naturally occurring viral infections have been characterized for the laboratory zebrafish (Danio rerio), an increasingly important biomedical research model. Despite the ignorance about naturally occurring zebrafish viruses, zebrafish models are rapidly expanding in areas of biomedical research where the confounding effects of unknown infectious agents present a serious concern. In addition, many zebrafish research colonies remain linked to the ornamental (pet) zebrafish trade, which can contribute to the introduction of new pathogens into research colonies, whereas mice used for research are purpose bred, with no introduction of new mice from the pet industry. Identification, characterization, and monitoring of naturally occurring viruses in zebrafish are crucial to the improvement of zebrafish health, the reduction of unwanted variability, and the continued development of the zebrafish as a model organism. This article addresses the importance of identifying and characterizing the viral diseases of zebrafish as the scope of zebrafish models expands into new research areas and also briefly addresses zebrafish susceptibility to experimental viral infection and the utility of the zebrafish as an infection and immunology model. PMID:23382345

Jupiter's Great Red Spot as a shallow water system

NASA Technical Reports Server (NTRS)

Dowling, Timothy E.; Ingersoll, Andrew P.

1989-01-01

Voyager cloud-top velocity data for Jupiter's Great Red Spot (GRS) is used to derive the bottom topography up to a constant that depends on the unknown radius of deformation. The bottom topography is inferred from the Bernoulli streamfunction, kinetic energy per unit mass, and absolute vorticity values derived from the velocity data. The results are used to calculate potential vorticity versus latitude far from the vortex. It is found that the deep atmosphere is in differential motion and that the far-field potential vorticity gradient changes sign at several latitudes. Numerical experiments are conducted to study the time-dependent behavior of the shallow water analog of Jupiter's analog.

Optimal estimation of parameters and states in stochastic time-varying systems with time delay

NASA Astrophysics Data System (ADS)

Torkamani, Shahab; Butcher, Eric A.

2013-08-01

In this study estimation of parameters and states in stochastic linear and nonlinear delay differential systems with time-varying coefficients and constant delay is explored. The approach consists of first employing a continuous time approximation to approximate the stochastic delay differential equation with a set of stochastic ordinary differential equations. Then the problem of parameter estimation in the resulting stochastic differential system is represented as an optimal filtering problem using a state augmentation technique. By adapting the extended Kalman-Bucy filter to the resulting system, the unknown parameters of the time-delayed system are estimated from noise-corrupted, possibly incomplete measurements of the states.

Strain Coupling of a Nitrogen-Vacancy Center Spin to a Diamond Mechanical Oscillator

NASA Astrophysics Data System (ADS)

Teissier, J.; Barfuss, A.; Appel, P.; Neu, E.; Maletinsky, P.

2014-07-01

We report on single electronic spins coupled to the motion of mechanical resonators by a novel mechanism based on crystal strain. Our device consists of single-crystal diamond cantilevers with embedded nitrogen-vacancy center spins. Using optically detected electron spin resonance, we determine the unknown spin-strain coupling constants and demonstrate that our system resides well within the resolved sideband regime. We realize coupling strengths exceeding 10 MHz under mechanical driving and show that our system has the potential to reach strong coupling. Our novel hybrid system forms a resource for future experiments on spin-based cantilever cooling and coherent spin-oscillator coupling.

Isentropic compression of argon

DOE Office of Scientific and Technical Information (OSTI.GOV)

Veeser, L.R.; Ekdahl, C.A.; Oona, H.

1997-06-01

The compression was done in an MC-1 flux compression (explosive) generator, in order to study the transition from an insulator to a conductor. Since conductivity signals were observed in all the experiments (except when the probe is removed), both the Teflon and the argon are becoming conductive. The conductivity could not be determined (Teflon insulation properties unknown), but it could be bounded as being {sigma}=1/{rho}{le}8({Omega}cm){sub -1}, because when the Teflon breaks down, the dielectric constant is reduced. The Teflon insulator problem remains, and other ways to better insulate the probe or to measure the conductivity without a probe is beingmore » sought.« less

Direct Adaptive Control of Systems with Actuator Failures: State of the Art and Continuing Challenges

NASA Technical Reports Server (NTRS)

Tao, Gang; Joshi, Suresh M.

2008-01-01

In this paper, the problem of controlling systems with failures and faults is introduced, and an overview of recent work on direct adaptive control for compensation of uncertain actuator failures is presented. Actuator failures may be characterized by some unknown system inputs being stuck at some unknown (fixed or varying) values at unknown time instants, that cannot be influenced by the control signals. The key task of adaptive compensation is to design the control signals in such a manner that the remaining actuators can automatically and seamlessly take over for the failed ones, and achieve desired stability and asymptotic tracking. A certain degree of redundancy is necessary to accomplish failure compensation. The objective of adaptive control design is to effectively use the available actuation redundancy to handle failures without the knowledge of the failure patterns, parameters, and time of occurrence. This is a challenging problem because failures introduce large uncertainties in the dynamic structure of the system, in addition to parametric uncertainties and unknown disturbances. The paper addresses some theoretical issues in adaptive actuator failure compensation: actuator failure modeling, redundant actuation requirements, plant-model matching, error system dynamics, adaptation laws, and stability, tracking, and performance analysis. Adaptive control designs can be shown to effectively handle uncertain actuator failures without explicit failure detection. Some open technical challenges and research problems in this important research area are discussed.

Prolonged Perceptual Learning of Positional Acuity in Adult Amblyopia

PubMed Central

Li, Roger W; Klein, Stanley A; Levi, Dennis M

2009-01-01

Amblyopia is a developmental abnormality that results in physiological alterations in the visual cortex and impairs form vision. It is often successfully treated by patching the sound eye in infants and young children, but is generally considered to be untreatable in adults. However, a number of recent studies suggest that repetitive practice of a visual task using the amblyopic eye results in improved performance in both children and adults with amblyopia. These perceptual learning studies have used relatively brief periods of practice; however, clinical studies have shown that the time-constant for successful patching is long. The time-constant for perceptual learning in amblyopia is still unknown. Here we show that the time-constant for perceptual learning depends on the degree of amblyopia. Severe amblyopia requires more than 50 hours (≈35,000 trials) to reach plateau, yielding as much as a five-fold improvement in performance at a rate of ≈1.5% per hour. There is significant transfer of learning from the amblyopic to the dominant eye, suggesting that the learning reflects alterations in higher decision stages of processing. Using a reverse correlation technique, we document, for the first time, a dynamic retuning of the amblyopic perceptual decision template and a substantial reduction in internal spatial distortion. These results show that the mature amblyopic brain is surprisingly malleable, and point to more intensive treatment methods for amblyopia. PMID:19109504

Impact of dissolved oxygen concentration on some key parameters and production of rhG-CSF in batch fermentation.

PubMed

Krishna Rao, Dasari V; Ramu, Chatadi T; Rao, Joginapally V; Narasu, Mangamoori L; Bhujanga Rao, Adibhatla Kali S

2008-09-01

The impact of different levels of agitation speed, carbondioxide and dissolved oxygen concentration on the key parameters and production of rhG-CSF in Escherichia coli BL21(DE3)PLysS were studied. Lower carbondioxide concentrations as well as higher agitation speeds and dissolved oxygen concentrations led to reduction in the acetate concentrations, and enhanced the cell growth, but inhibited plasmid stability and rhG-CSF expression. Similarly, higher carbondioxide concentrations and lower agitation speeds as well as dissolved oxygen concentrations led to enhanced acetate concentrations, but inhibited the cell growth and protein expression. To address the bottlenecks, a two-stage agitation control strategy (strategy-1) and two-stage dissolved oxygen control strategy (strategy-2) were employed to establish the physiological and metabolic conditions, so as to improve the expression of rhG-CSF. By adopting strategy-1 the yields were improved 1.4-fold over constant speed of 550 rpm, 1.1-fold over constant dissolved oxygen of 45%, respectively. Similarly, using strategy-2 the yields were improved 1.6-fold over constant speed of 550 rpm, 1.3-fold over constant dissolved oxygen of 45%, respectively.

Bromamine Decomposition Revisited: A Holistic Approach for Analyzing Acid and Base Catalysis Kinetics.

PubMed

Wahman, David G; Speitel, Gerald E; Katz, Lynn E

2017-11-21

Chloramine chemistry is complex, with a variety of reactions occurring in series and parallel and many that are acid or base catalyzed, resulting in numerous rate constants. Bromide presence increases system complexity even further with possible bromamine and bromochloramine formation. Therefore, techniques for parameter estimation must address this complexity through thoughtful experimental design and robust data analysis approaches. The current research outlines a rational basis for constrained data fitting using Brønsted theory, application of the microscopic reversibility principle to reversible acid or base catalyzed reactions, and characterization of the relative significance of parallel reactions using fictive product tracking. This holistic approach was used on a comprehensive and well-documented data set for bromamine decomposition, allowing new interpretations of existing data by revealing that a previously published reaction scheme was not robust; it was not able to describe monobromamine or dibromamine decay outside of the conditions for which it was calibrated. The current research's simplified model (3 reactions, 17 constants) represented the experimental data better than the previously published model (4 reactions, 28 constants). A final model evaluation was conducted based on representative drinking water conditions to determine a minimal model (3 reactions, 8 constants) applicable for drinking water conditions.

ASN reputation system model

NASA Astrophysics Data System (ADS)

Hutchinson, Steve; Erbacher, Robert F.

2015-05-01

Network security monitoring is currently challenged by its reliance on human analysts and the inability for tools to generate indications and warnings for previously unknown attacks. We propose a reputation system based on IP address set membership within the Autonomous System Number (ASN) system. Essentially, a metric generated based on the historic behavior, or misbehavior, of nodes within a given ASN can be used to predict future behavior and provide a mechanism to locate network activity requiring inspection. This will provide reinforcement of notifications and warnings and lead to inspection for ASNs known to be problematic even if initial inspection leads to interpretation of the event as innocuous. We developed proof of concept capabilities to generate the IP address to ASN set membership and analyze the impact of the results. These results clearly show that while some ASNs are one-offs with individual or small numbers of misbehaving IP addresses, there are definitive ASNs with a history of long term and wide spread misbehaving IP addresses. These ASNs with long histories are what we are especially interested in and will provide an additional correlation metric for the human analyst and lead to new tools to aid remediation of these IP address blocks.

Degravitation, inflation and the cosmological constant as an afterglow

NASA Astrophysics Data System (ADS)

Patil, Subodh P.

2009-01-01

In this report, we adopt the phenomenological approach of taking the degravitation paradigm seriously as a consistent modification of gravity in the IR, and investigate its consequences for various cosmological situations. We motivate degravitation — where Netwon's constant is promoted to a scale dependent filter function — as arising from either a small (resonant) mass for the graviton, or as an effect in semi-classical gravity. After addressing how the Bianchi identities are to be satisfied in such a set up, we turn our attention towards the cosmological consequences of degravitation. By considering the example filter function corresponding to a resonantly massive graviton (with a filter scale larger than the present horizon scale), we show that slow roll inflation, hybrid inflation and old inflation remain quantitatively unchanged. We also find that the degravitation mechanism inherits a memory of past energy densities in the present epoch in such a way that is likely significant for present cosmological evolution. For example, if the universe underwent inflation in the past due to it having tunneled out of some false vacuum, we find that degravitation implies a remnant `afterglow' cosmological constant, whose scale immediately afterwards is parametrically suppressed by the filter scale (L) in Planck units Λ ~ l2pl/L2. We discuss circumstances through which this scenario reasonably yields the presently observed value for Λ ~ O(10-120). We also find that in a universe still currently trapped in some false vacuum state, resonance graviton models of degravitation only degravitate initially Planck or GUT scale energy densities down to the presently observed value over timescales comparable to the filter scale. We argue that different functional forms for the filter function will yield similar conclusions. In this way, we argue that although the degravitation models we study have the potential to explain why the cosmological constant is not large in addition to why it is not zero, it does not satisfactorily address the co-incidence problem without additional tuning.

Unimodular Einstein-Cartan gravity: Dynamics and conservation laws

NASA Astrophysics Data System (ADS)

Bonder, Yuri; Corral, Cristóbal

2018-04-01

Unimodular gravity is an interesting approach to address the cosmological constant problem, since the vacuum energy density of quantum fields does not gravitate in this framework, and the cosmological constant appears as an integration constant. These features arise as a consequence of considering a constrained volume element 4-form that breaks the diffeomorphisms invariance down to volume preserving diffeomorphisms. In this work, the first-order formulation of unimodular gravity is presented by considering the spin density of matter fields as a source of spacetime torsion. Even though the most general matter Lagrangian allowed by the symmetries is considered, dynamical restrictions arise on their functional dependence. The field equations are obtained and the conservation laws associated with the symmetries are derived. It is found that, analogous to torsion-free unimodular gravity, the field equation for the vierbein is traceless; nevertheless, torsion is algebraically related to the spin density as in standard Einstein-Cartan theory. The particular example of massless Dirac spinors is studied, and comparisons with standard Einstein-Cartan theory are shown.

Can compactifications solve the cosmological constant problem?

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hertzberg, Mark P.; Center for Theoretical Physics, Department of Physics,Massachusetts Institute of Technology,77 Massachusetts Ave, Cambridge, MA 02139; Masoumi, Ali

2016-06-30

Recently, there have been claims in the literature that the cosmological constant problem can be dynamically solved by specific compactifications of gravity from higher-dimensional toy models. These models have the novel feature that in the four-dimensional theory, the cosmological constant Λ is much smaller than the Planck density and in fact accumulates at Λ=0. Here we show that while these are very interesting models, they do not properly address the real cosmological constant problem. As we explain, the real problem is not simply to obtain Λ that is small in Planck units in a toy model, but to explain whymore » Λ is much smaller than other mass scales (and combinations of scales) in the theory. Instead, in these toy models, all other particle mass scales have been either removed or sent to zero, thus ignoring the real problem. To this end, we provide a general argument that the included moduli masses are generically of order Hubble, so sending them to zero trivially sends the cosmological constant to zero. We also show that the fundamental Planck mass is being sent to zero, and so the central problem is trivially avoided by removing high energy physics altogether. On the other hand, by including various large mass scales from particle physics with a high fundamental Planck mass, one is faced with a real problem, whose only known solution involves accidental cancellations in a landscape.« less

Age-Related Phasic Patterns of Mitochondrial Maintenance in Adult Caenorhabditis elegans Neurons

PubMed Central

Morsci, Natalia S.; Hall, David H.

2016-01-01

Aging is associated with cognitive decline and increasing risk of neurodegeneration. Perturbation of mitochondrial function, dynamics, and trafficking are implicated in the pathogenesis of several age-associated neurodegenerative diseases. Despite this fundamental importance, the critical understanding of how organismal aging affects lifetime neuronal mitochondrial maintenance remains unknown, particularly in a physiologically relevant context. To address this issue, we performed a comprehensive in vivo analysis of age-associated changes in mitochondrial morphology, density, trafficking, and stress resistance in individual Caenorhabditis elegans neurons throughout adult life. Adult neurons display three distinct stages of increase, maintenance, and decrease in mitochondrial size and density during adulthood. Mitochondrial trafficking in the distal neuronal processes declines progressively with age starting from early adulthood. In contrast, long-lived daf-2 mutants exhibit delayed age-associated changes in mitochondrial morphology, constant mitochondrial density, and maintained trafficking rates during adulthood. Reduced mitochondrial load at late adulthood correlates with decreased mitochondrial resistance to oxidative stress. Revealing aging-associated changes in neuronal mitochondria in vivo is an essential precedent that will allow future elucidation of the mechanistic causes of mitochondrial aging. Thus, our study establishes the critical foundation for the future analysis of cellular pathways and genetic and pharmacological factors regulating mitochondrial maintenance in aging- and disease-relevant conditions. SIGNIFICANCE STATEMENT Using Caenorhabditis elegans as a model, we address long-standing questions: How does aging affect neuronal mitochondrial morphology, density, trafficking, and oxidative stress resistance? Are these age-related changes amenable to genetic manipulations that slow down the aging process? Our study illustrates that mitochondrial trafficking declines progressively from the first day of adulthood, whereas mitochondrial size, density, and resistance to oxidative stress undergo three distinct stages: increase in early adulthood, maintenance at high levels during mid-adulthood, and decline during late adulthood. Thus, our study characterizes mitochondrial aging profile at the level of a single neuron in its native environment and establishes the critical foundation for the future genetic and pharmacological dissection of factors that influence long-term mitochondrial maintenance in neurons. PMID:26818523

Constraining the 40K decay constant with 87Rb-87Sr - 40K-40Ca chronometer intercomparison

NASA Astrophysics Data System (ADS)

Naumenko-Dèzes, Maria O.; Nägler, Thomas F.; Mezger, Klaus; Villa, Igor M.

2018-01-01

A literature survey reveals that the K-Ar chronometer gives ages that are ca. 1% younger than U-Pb ages. This offset is generally attributed to an inaccurate 40K decay constant. Three geological samples selected from a shortlist of eight with known U-Pb ages were investigated using detailed petrological methods and subsequently the Rb-Sr and K-Ca chronometers in order (a) to evaluate if they meet the requirement of a geological history reflecting a ;point-like; event (i.e. isochronous formation and subsequent ideal closure of chronometers) and (b) to narrow down the systematic uncertainty on the 40K decay constant by investigating the metrologically traceable K-Ca decay branch. Lepidolite of the Rubikon pegmatite, Namibia, was dated with Rb-Sr at 504.7 ± 4.2 Ma and the phlogopite and apatite from the Phalaborwa carbonatite complex, South Africa, yielded a Rb-Sr age of 2058.9 ± 5.2 Ma. Both Rb-Sr ages agree with published U-Pb ages. The Rb-Sr age of the late Archean Siilinjärvi carbonatite, Finland, records a later regional metamorphic event at 1869 ± 10 Ma. Only the samples from the Phalaborwa complex represent a ;point-like; magmatic event and meet all the criteria to make them suitable for the 40K decay constant intercalibration. The Phalaborwa K-Ca isochron has a slope of 1.878 ± 0.012. Forcing the K-Ca isochron to coincide with the U-Pb and Rb-Sr ages gives one equation with two unknowns. Assuming that the branching ratio of the K-Ca branch, BCa, lies in the interval (k = 2) of all published references, 0.8925 < BCa < 0.8963, then the most reliable uncertainty interval (k = 2) for the total 40K decay constant, λtot, is calculated as 5.484 × 10-10 a-1 < λtot < 5.498 × 10-10 a-1. This confirms that the currently used IUGS recommendation is inaccurate.

KSC-01pp1551

NASA Image and Video Library

2001-08-31

JOHNSON SPACE CENTER, HOUSTON, TEXAS -- EXPEDITION FOUR INSIGNIA -- The International Space Station (ISS) Expedition Four crew patch has an overall diamond shape, showing the "diamond in the rough" configuration of the Station during expedition four. The red hexagonal shape with stylized American and Russian flags represents the cross-sectional view of the S0 truss segment, which the crew will attach to the U.S. Lab Destiny. The persistent Sun shining on the Earth and Station represents the constant challenges that the crew and ground support team will face every day while operating the International Space Station, while shedding new light through daily research. The green portion of the Earth represents the fourth color in the visible spectrum and the black void of space represents humankind's constant quest to explore the unknown. The NASA insignia design for Shuttle flights ts is reserved for use by the astronauts and for other official use as the NASA Administrator may authorize. Public availability has been approved only in the forms of illustrations by the various news media. When and if there is any change in this policy, which we do not anticipate, it will be publicly announced

Expedition 4 crew insignia

NASA Image and Video Library

2001-08-01

ISS004-S-001 (August 2001) --- The International Space Station (ISS) Expedition 4 crew patch has an overall diamond shape, showing the “diamond in the rough” configuration of the Station during expedition 4. The red hexagonal shape with stylized American and Russian flags represents the cross-sectional view of the S0 truss segment, which the crew will attach to the U.S. Lab Destiny. The persistent Sun shining on the Earth and Station represents the constant challenges that the crew and ground support team will face every day while operating the International Space Station, while shedding new light through daily research. The green portion of the Earth represents the fourth color in the visible spectrum and the black void of space represents humankind’s constant quest to explore the unknown. The NASA insignia design for Shuttle flights is reserved for use by the astronauts and for other official use as the NASA Administrator may authorize. Public availability has been approved only in the forms of illustrations by the various news media. When and if there is any change in this policy, which is not anticipated, the change will be publicly announced.

O-ribosyl-phosphate purine as a constant modified nucleotide located at position 64 in cytoplasmic initiator tRNAs(Met) of yeasts.

PubMed Central

Glasser, A L; Desgres, J; Heitzler, J; Gehrke, C W; Keith, G

1991-01-01

The unknown modified nucleotide G*, isolated from both Schizosaccharomyces pombe and Torulopsis utilis initiator tRNAs(Met), has been identified as an O-ribosyl-(1"----2')-guanosine-5"-phosphate, called Gr(p), by means of HPLC, UV-absorption, mass spectrometry and periodate oxidation procedures. By comparison with the previously published structure of Ar(p) isolated from Saccharomyces cerevisiae initiator tRNA(Met), the (1"----2')-glycosidic bond in Gr(p) has been postulated to have a beta-spatial conformation. The modified nucleotide Gr(p) is located at position 64 in the tRNA(Met) molecules, i.e. at the same position as Ar(p). Since we have also characterized Gr(p) in Candida albicans initiator tRNA(Met), the phosphoribosylation of purine 64 can be considered as a constant nucleotide modification in the cytoplasmic initiator tRNAs(Met) of all yeast species so far sequenced. Precise evidence for the presence of Gr(p) in initiator tRNAs(Met) of several plants is also reported. PMID:1656390

Release of enzymes from cells: transport and distribution within the extracellular space.

PubMed

Mattenheimer, H; Friedel, R

1977-01-01

The distribution in the extracellular space of enzymes released from organ cells was investigated using three models: (1) comparison of enzyme activities in blood plasma and lymph of the ductus thoracicus (dog) and plasma and intestinal lymph (rat); (2) i.v. injection of heterologous, homologous and autologous enzymes in order to increase acutely the activities and to measure the rate constants for the distribution and elimination of the enzymes (rat); or (3) plasmapheresis in order to create an enzyme activity gradient from the interstitial space and to determine the rate constants for the reestablishment of the equilibrium between the extra and intravascular compartments (rat). The results suggest that the enzymes are mainly released into the interstitial fluid and transported via the lymph into the intravascular compartment. From there the enzymes diffuse back into the interstitial compartment and are eliminated by a yet unknown mechanism. Transport of enzymes across the capillary membranes in both directions depends on (1) the permeability of the capillary membranes, which varies from region to region and (2) the molecular seizes of the enzymes.

The 1985 central chile earthquake: a repeat of previous great earthquakes in the region?

PubMed

Comte, D; Eisenberg, A; Lorca, E; Pardo, M; Ponce, L; Saragoni, R; Singh, S K; Suárez, G

1986-07-25

A great earthquake (surface-wave magnitude, 7.8) occurred along the coast of central Chile on 3 March 1985, causing heavy damage to coastal towns. Intense foreshock activity near the epicenter of the main shock occurred for 11 days before the earthquake. The aftershocks of the 1985 earthquake define a rupture area of 170 by 110 square kilometers. The earthquake was forecast on the basis of the nearly constant repeat time (83 +/- 9 years) of great earthquakes in this region. An analysis of previous earthquakes suggests that the rupture lengths of great shocks in the region vary by a factor of about 3. The nearly constant repeat time and variable rupture lengths cannot be reconciled with time- or slip-predictable models of earthquake recurrence. The great earthquakes in the region seem to involve a variable rupture mode and yet, for unknown reasons, remain periodic. Historical data suggest that the region south of the 1985 rupture zone should now be considered a gap of high seismic potential that may rupture in a great earthquake in the next few tens of years.

Connecting Time and Frequency in the RC Circuit

NASA Astrophysics Data System (ADS)

Moya, A. A.

2017-04-01

Charging and discharging processes of a capacitor through a resistor, as well as the concept of impedance in alternating current circuits, are topics covered in introductory physics courses. The experimental study of the charge and discharge of a capacitor through a resistor is a well-established lab exercise that is used to introduce concepts such as exponential increase or decrease and time constant. Determining the time constant of the RC circuit has important practical applications because, for example, it can be used to measure unknown values of resistance or capacitance. The transient experiment can be done by using a voltmeter and stopwatch, signal generator and oscilloscope, or even low-cost data acquisition systems such as Arduino. An equivalent topic when studying alternating current circuits arises from the characterization of the impedance of the series or parallel combination of the capacitor and the resistor as a function of frequency. Determining the time constant of the RC circuit by means of impedance measurements for different frequencies is a known experimental technique that can be done using not only LCR meters but also basic instrumentation in the physics lab such as a signal generator, frequency counter, and multimeter. However, lab exercises dealing with RC circuits in alternating current usually focus on their use as filters, and the potential applications in the field of the electrical characterization of material systems are ignored. In this work, we describe a simple exercise showing how the time constant of the RC circuit can easily be determined in the introductory physics lab by means of impedance measurements as a function of frequency. This exercise allows students to learn experimental techniques that find application to characterize the time constants of the charge transport processes in material systems. Moreover, comparison of the time constants obtained from transient and frequency analysis allows us to relate the time and frequency domains, which plays a central role in the advanced analysis of electric circuits, once the concept of Laplace transform has been introduced in order to simplify the problem of dealing with differential equations in the time domain by converting them into algebraic equations within the frequency domain.

NOMINAL VALUES FOR SELECTED SOLAR AND PLANETARY QUANTITIES: IAU 2015 RESOLUTION B3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Prša, Andrej; Harmanec, Petr; Torres, Guillermo

In this brief communication we provide the rationale for and the outcome of the International Astronomical Union (IAU) resolution vote at the XXIXth General Assembly in Honolulu, Hawaii, in 2015, on recommended nominal conversion constants for selected solar and planetary properties. The problem addressed by the resolution is a lack of established conversion constants between solar and planetary values and SI units: a missing standard has caused a proliferation of solar values (e.g., solar radius, solar irradiance, solar luminosity, solar effective temperature, and solar mass parameter) in the literature, with cited solar values typically based on best estimates at the timemore » of paper writing. As precision of observations increases, a set of consistent values becomes increasingly important. To address this, an IAU Working Group on Nominal Units for Stellar and Planetary Astronomy formed in 2011, uniting experts from the solar, stellar, planetary, exoplanetary, and fundamental astronomy, as well as from general standards fields to converge on optimal values for nominal conversion constants. The effort resulted in the IAU 2015 Resolution B3, passed at the IAU General Assembly by a large majority. The resolution recommends the use of nominal solar and planetary values, which are by definition exact and are expressed in SI units. These nominal values should be understood as conversion factors only, not as the true solar/planetary properties or current best estimates. Authors and journal editors are urged to join in using the standard values set forth by this resolution in future work and publications to help minimize further confusion.« less

Nominal Values for Selected Solar and Planetary Quantities: IAU 2015 Resolution B3

NASA Astrophysics Data System (ADS)

Prša, Andrej; Harmanec, Petr; Torres, Guillermo; Mamajek, Eric; Asplund, Martin; Capitaine, Nicole; Christensen-Dalsgaard, Jørgen; Depagne, Éric; Haberreiter, Margit; Hekker, Saskia; Hilton, James; Kopp, Greg; Kostov, Veselin; Kurtz, Donald W.; Laskar, Jacques; Mason, Brian D.; Milone, Eugene F.; Montgomery, Michele; Richards, Mercedes; Schmutz, Werner; Schou, Jesper; Stewart, Susan G.

2016-08-01

In this brief communication we provide the rationale for and the outcome of the International Astronomical Union (IAU) resolution vote at the XXIXth General Assembly in Honolulu, Hawaii, in 2015, on recommended nominal conversion constants for selected solar and planetary properties. The problem addressed by the resolution is a lack of established conversion constants between solar and planetary values and SI units: a missing standard has caused a proliferation of solar values (e.g., solar radius, solar irradiance, solar luminosity, solar effective temperature, and solar mass parameter) in the literature, with cited solar values typically based on best estimates at the time of paper writing. As precision of observations increases, a set of consistent values becomes increasingly important. To address this, an IAU Working Group on Nominal Units for Stellar and Planetary Astronomy formed in 2011, uniting experts from the solar, stellar, planetary, exoplanetary, and fundamental astronomy, as well as from general standards fields to converge on optimal values for nominal conversion constants. The effort resulted in the IAU 2015 Resolution B3, passed at the IAU General Assembly by a large majority. The resolution recommends the use of nominal solar and planetary values, which are by definition exact and are expressed in SI units. These nominal values should be understood as conversion factors only, not as the true solar/planetary properties or current best estimates. Authors and journal editors are urged to join in using the standard values set forth by this resolution in future work and publications to help minimize further confusion.

Student Worker Free Speech on the Public Campus: A New Twist to a Constant Issue

ERIC Educational Resources Information Center

Letzring, Timothy D.; Wolff, Lori A.

2009-01-01

Rather than anticipating an issue or proactively addressing it, college and university administrators often find themselves in the position of reacting to recent laws or court decisions. This paper examines an issue ripe for proactive thought; an issue not yet directly considered in court cases: free speech and the student employee. In the…

A computational algorithm addressing how vessel length might depend on vessel diameter

Treesearch

Jing Cai; Shuoxin Zhang; Melvin T. Tyree

2010-01-01

The objective of this method paper was to examine a computational algorithm that may reveal how vessel length might depend on vessel diameter within any given stem or species. The computational method requires the assumption that vessels remain approximately constant in diameter over their entire length. When this method is applied to three species or hybrids in the...

Trying to Get Ahead of the Curve: Raising and Understanding Current Themes in New Literacies Practices

ERIC Educational Resources Information Center

Wilber, Dana

2012-01-01

This article addresses the following questions: What impact does using the theoretical framework of new literacies have on understanding language, literacy, and learning practices today as technologies are constantly being developed and used? What is the state of research in this area? What are some new directions the field might take in order to…

A Structural Equation Modeling Approach to the Study of Stress and Psychological Adjustment in Emerging Adults

ERIC Educational Resources Information Center

Asberg, Kia K.; Bowers, Clint; Renk, Kimberly; McKinney, Cliff

2008-01-01

Today's society puts constant demands on the time and resources of all individuals, with the resulting stress promoting a decline in psychological adjustment. Emerging adults are not exempt from this experience, with an alarming number reporting excessive levels of stress and stress-related problems. As a result, the present study addresses the…

Natural environment design criteria for the space station program definition phase

NASA Technical Reports Server (NTRS)

Vaughan, W. W.

1984-01-01

The natural environment design criteria requirements for use in the Space Station and its Elements (SSPE) definition phase studies are presented. The atmospheric dynamic and thermodynamic environments, meteoroids, radiation, physical constants are addressed. It is intended to enable all groups involved in the definition phase studies to proceed with a common and consistent set of natural environment criteria requirements.

Ontario Community Colleges and Change: Is There an Essence That Has Remained Constant? Does It Matter?

ERIC Educational Resources Information Center

Skolnik, Michael L.

This address, given at the Association of Colleges of Applied Arts and Technology of Ontario (ACAATO) Conference in February 2002, focuses on the identity of the Ontario Community Colleges and if that identity has changed over time. The author concludes that community orientation has never been part of the Colleges of Applied Arts and Technology…

Testing the Domain-Specificity of a Theory of Mind Deficit in Brain-Injured Patients: Evidence for Consistent Performance on Non-Verbal, ''Reality-Unknown'' False Belief and False Photograph Tasks

ERIC Educational Resources Information Center

Apperly, Ian A.; Samson, Dana; Chiavarino, Claudia; Bickerton, Wai-Ling; Humphreys, Glyn W.

2007-01-01

To test the domain-specificity of ''theory of mind'' abilities we compared the performance of a case-series of 11 brain-lesioned patients on a recently developed test of false belief reasoning (Apperly, Samson, Chiavarino, & Humphreys, 2004) and on a matched false photograph task, which did not require belief reasoning and which addressed problems…

Numerical determination of visible/NIR optical constants from laboratory spectra of HED meteorites

NASA Astrophysics Data System (ADS)

Davalos, Jorge A. G.; Carvano, Jorge Márcio; Blanco, Julio

2017-03-01

Radiative transfer models in particulate media (Hapke, 1981, 1993, 2012b; Shkuratov et al., 1999) are the most versatile tool that can be used to retrieve both composition and surface physical properties from observation of asteroids and other atmosphereless bodies of the Solar System. One caveat is that these methods require as input a sufficiently comprehensive set of optical constants of suitable template materials. These optical constants are the real and imaginary parts of the refractive indexes of the material as function of wavelength, and have to be derived from laboratory measurements of samples of minerals and meteorites. Optical constants can be calculated from a variety of types of measurements, and each has its problems and limitations. In particular, a problem with the determination of optical constants from measurement of reflectance is that the measurements need to be themselves interpreted using radiative transfer models. This is an issue because the number of parameters used in the most accurate versions of the radiative transfer models is large, and for most of the samples many of these parameters were not measured independently. As a result, attempts in the literature to retrieve optical constants from reflectance measurements tend to assume values for the unknown parameters, which can lead to uncertainties in the retrieved optical constants that can be difficult to quantify. In this work we propose a numerical method that allows the simultaneous inversion of the optical constant and the model parameters. This model is then applied to a set of reflectance spectra of 5 HED meteorites from the RELAB database that were measured with the same setup for samples with several particle size intervals. Our results indicate that our method is able to retrieve optical constants which are able to reproduce the measured reflectance of the samples over a large range (25-500 μm) of particle diameters. It is also found that the solutions obtained in this way are non-unique, in the sense that many combination of the model parameters can yield different sets of optical constants that fit equally well the reflectance spectra. Thus, in the absence of the independent determination of at least some of the model parameter the method is unable to decide which solution correspond to the physical optical constants of the materials. Even so, the dispersion of the model parameters (in particular effective particle diameter and porosity) for acceptable solutions (defined as the ones that reproduce the measured reflectance spectra at all size range with residues smaller than 10%) is within a radius of around 30% of the value of the best fit solution for each parameter. Given the ability of the optical constants derived with this method to reproduce the sample spectra over a large range of particle sizes, they can be used without other restriction to assess if a given meteorite assemblage is contributing to the observed spectra of asteroids. However, quantitative informations that can also be derived using these optical constants, like particle sizes, porosity and volumetric fractions of each end-member in a mixture should be regarded only as rough estimates.

Multi-color incomplete Cholesky conjugate gradient methods for vector computers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Poole, E.L.

1986-01-01

This research is concerned with the solution on vector computers of linear systems of equations. Ax = b, where A is a large, sparse symmetric positive definite matrix with non-zero elements lying only along a few diagonals of the matrix. The system is solved using the incomplete Cholesky conjugate gradient method (ICCG). Multi-color orderings are used of the unknowns in the linear system to obtain p-color matrices for which a no-fill block ICCG method is implemented on the CYBER 205 with O(N/p) length vector operations in both the decomposition of A and, more importantly, in the forward and back solvesmore » necessary at each iteration of the method. (N is the number of unknowns and p is a small constant). A p-colored matrix is a matrix that can be partitioned into a p x p block matrix where the diagonal blocks are diagonal matrices. The matrix is stored by diagonals and matrix multiplication by diagonals is used to carry out the decomposition of A and the forward and back solves. Additionally, if the vectors across adjacent blocks line up, then some of the overhead associated with vector startups can be eliminated in the matrix vector multiplication necessary at each conjugate gradient iteration. Necessary and sufficient conditions are given to determine which multi-color orderings of the unknowns correspond to p-color matrices, and a process is indicated for choosing multi-color orderings.« less

Semi-empirical proton binding constants for natural organic matter

NASA Astrophysics Data System (ADS)

Matynia, Anthony; Lenoir, Thomas; Causse, Benjamin; Spadini, Lorenzo; Jacquet, Thierry; Manceau, Alain

2010-03-01

Average proton binding constants ( KH,i) for structure models of humic (HA) and fulvic (FA) acids were estimated semi-empirically by breaking down the macromolecules into reactive structural units (RSUs), and calculating KH,i values of the RSUs using linear free energy relationships (LFER) of Hammett. Predicted log KH,COOH and log KH,Ph-OH are 3.73 ± 0.13 and 9.83 ± 0.23 for HA, and 3.80 ± 0.20 and 9.87 ± 0.31 for FA. The predicted constants for phenolic-type sites (Ph-OH) are generally higher than those derived from potentiometric titrations, but the difference may not be significant in view of the considerable uncertainty of the acidity constants determined from acid-base measurements at high pH. The predicted constants for carboxylic-type sites agree well with titration data analyzed with Model VI (4.10 ± 0.16 for HA, 3.20 ± 0.13 for FA; Tipping, 1998), the Impermeable Sphere model (3.50-4.50 for HA; Avena et al., 1999), and the Stockholm Humic Model (4.10 ± 0.20 for HA, 3.50 ± 0.40 for FA; Gustafsson, 2001), but differ by about one log unit from those obtained by Milne et al. (2001) with the NICA-Donnan model (3.09 ± 0.51 for HA, 2.65 ± 0.43 for FA), and used to derive recommended generic values. To clarify this ambiguity, 10 high-quality titration data from Milne et al. (2001) were re-analyzed with the new predicted equilibrium constants. The data are described equally well with the previous and new sets of values ( R2 ⩾ 0.98), not necessarily because the NICA-Donnan model is overparametrized, but because titration lacks the sensitivity needed to quantify the full binding properties of humic substances. Correlations between NICA-Donnan parameters are discussed, but general progress is impeded by the unknown number of independent parameters that can be varied during regression of a model fit to titration data. The high consistency between predicted and experimental KH,COOH values, excluding those of Milne et al. (2001), gives faith in the proposed semi-empirical structural approach, and its usefulness to assess the plausibility of proton stability constants derived from simulations of titration data.

Electrostimulation improves muscle perfusion but does not affect either muscle deoxygenation or pulmonary oxygen consumption kinetics during a heavy constant-load exercise.

PubMed

Layec, Gwenael; Millet, Grégoire P; Jougla, Aurélie; Micallef, Jean-Paul; Bendahan, David

2008-02-01

Electromyostimulation (EMS) is commonly used as part of training programs. However, the exact effects at the muscle level are largely unknown and it has been recently hypothesized that the beneficial effect of EMS could be mediated by an improved muscle perfusion. In the present study, we investigated rates of changes in pulmonary oxygen consumption (VO(2p)) and muscle deoxygenation during a standardized exercise performed after an EMS warm-up session. We aimed at determining whether EMS could modify pulmonary O(2) uptake and muscle deoxygenation as a result of improved oxygen delivery. Nine subjects performed a 6-min heavy constant load cycling exercise bout preceded either by an EMS session (EMS) or under control conditions (CONT). VO(2p) and heart rate (HR) were measured while deoxy-(HHb), oxy-(HbO(2)) and total haemoglobin/myoglobin (Hb(tot)) relative contents were measured using near infrared spectroscopy. EMS significantly increased (P < 0.05) the Hb(tot) resting level illustrating a residual hyperaemia. The EMS priming exercise did not affect either the HHb time constant (17.7 +/- 14.2 s vs. 13.1 +/- 2.3 s under control conditions) or the VO(2p) kinetics (time-constant = 18.2 +/- 5.2 s vs. 15.4 +/- 4.6 s under control conditions). Likewise, the other VO(2p) parameters were unchanged. Our results further indicated that EMS warm-up improved muscle perfusion through a residual hyperaemia. However, neither VO(2p) nor [HHb] kinetics were modified accordingly. These results suggest that improved O(2) delivery by residual hyperaemia induced by EMS does not accelerate the rate of aerobic metabolism during heavy exercise at least in trained subjects.

Polarized pressure dependence of the anisotropic dielectric functions of highly oriented poly(p-phenylene vinylene)

NASA Astrophysics Data System (ADS)

Morandi, V.; Galli, M.; Marabelli, F.; Comoretto, D.

2010-04-01

In this work, we combined an experimental technique and a detailed data analysis to investigate the influence of an applied pressure on the anisotropic dielectric functions of highly oriented poly(p-phenylene vinylene) (PPV). The dielectric constants were derived from polarized reflectance spectra recorded through a diamond anvil cell up to 50 kbar. The presence of the diamond anvils strongly affects measured spectra requiring the development in an optical model able to take all spurious effects into account. A parametric procedure was then applied to derive the complex dielectric constants for both polarizations as a function of pressure. A detailed analysis of their pressure dependence allows addressing the role of intermolecular interactions and electron-phonon coupling in highly oriented PPV.

Magnetically modified bioсells in constant magnetic field

NASA Astrophysics Data System (ADS)

Abramov, E. G.; Panina, L. K.; Kolikov, V. A.; Bogomolova, E. V.; Snetov, V. N.; Cherepkova, I. A.; Kiselev, A. A.

2017-02-01

Paper addresses the inverse problem in determining the area, where the external constant magnetic field captures the biological cells modified by the magnetic nanoparticles. Zero velocity isolines, in area where the modified cells are captured by the magnetic field were determined by numerical method for two locations of the magnet. The problem was solved taking into account the gravitational field, magnetic induction, density of medium, concentration and size of cells, and size and magnetization of nanoparticles attached to the cell. Increase in the number of the nanoparticles attached to the cell and decrease in the cell' size, enlarges the area, where the modified cells are captured and concentrated by the magnet. Solution is confirmed by the visible pattern formation of the modified cells Saccharomyces cerevisiae.

VPLS: an effective technology for building scalable transparent LAN services

NASA Astrophysics Data System (ADS)

Dong, Ximing; Yu, Shaohua

2005-02-01

Virtual Private LAN Service (VPLS) is generating considerable interest with enterprises and service providers as it offers multipoint transparent LAN service (TLS) over MPLS networks. This paper describes an effective technology - VPLS, which links virtual switch instances (VSIs) through MPLS to form an emulated Ethernet switch and build Scalable Transparent Lan Services. It first focuses on the architecture of VPLS with Ethernet bridging technique at the edge and MPLS at the core, then it tries to elucidate the data forwarding mechanism within VPLS domain, including learning and aging MAC addresses on a per LSP basis, flooding of unknown frames and replication for unknown, multicast, and broadcast frames. The loop-avoidance mechanism, known as split horizon forwarding, is also analyzed. Another important aspect of VPLS service is its basic operation, including autodiscovery and signaling, is discussed. From the perspective of efficiency and scalability the paper compares two important signaling mechanism, BGP and LDP, which are used to set up a PW between the PEs and bind the PWs to a particular VSI. With the extension of VPLS and the increase of full mesh of PWs between PE devices (n*(n-1)/2 PWs in all, a n2 complete problem), VPLS instance could have a large number of remote PE associations, resulting in an inefficient use of network bandwidth and system resources as the ingress PE has to replicate each frame and append MPLS labels for remote PE. So the latter part of this paper focuses on the scalability issue: the Hierarchical VPLS. Within the architecture of HVPLS, this paper addresses two ways to cope with a possibly large number of MAC addresses, which make VPLS operate more efficiently.

Reheating and the asymmetric production of matter

NASA Astrophysics Data System (ADS)

Adshead, Peter

The early thermal history of the universe, from the end of inflation until the light elements are produced at big-bang nucleosynthesis, remains one of the most poorly understood periods of our cosmic history. We do not understand how inflation ends, and the connection between the physics that drives inflation and the standard model is poorly constrained. Consequently, the mechanism by which the Universe is reheated from its super-cooled post-inflationary state into a thermalized plasma is unknown. Furthermore, the precise mechanism responsible for the matter-antimatter asymmetry and the detailed particle origin of dark matter are, as yet, unknown. However, it is precisely during this epoch that abundant phenomenology from fundamental physics beyond the standard model is anticipated. The objective of the proposed research is to address this gap in our understanding of the history of the Universe by exploring the connection between the physics that drives the inflationary epoch, and the physics that ignites the hot big-bang. This will be achieved by two detailed studies of the physics of reheating. The first study examines the cosmic history of dark sectors, and addresses the cosmological question of how these sectors are populated in the early universe. The second study examines detailed particle physics models of reheating where the inflaton couples to gauge fields. NASA's strategic objectives in astrophysics are to discover how the universe works and to explore how it began and evolved. The primary goal of this proposal is to address these questions by developing a deeper understanding of the history of the post-inflationary universe through cosmological observations and fundamental theory. Specifically, this proposal will advance NASA's science goal to probe the origin and destiny of our universe, including the nature of black holes, dark energy, dark matter and gravity

Robust Adaptive Synchronization of Ring Configured Uncertain Chaotic FitzHugh–Nagumo Neurons under Direction-Dependent Coupling

PubMed Central

Iqbal, Muhammad; Rehan, Muhammad; Hong, Keum-Shik

2018-01-01

This paper exploits the dynamical modeling, behavior analysis, and synchronization of a network of four different FitzHugh–Nagumo (FHN) neurons with unknown parameters linked in a ring configuration under direction-dependent coupling. The main purpose is to investigate a robust adaptive control law for the synchronization of uncertain and perturbed neurons, communicating in a medium of bidirectional coupling. The neurons are assumed to be different and interconnected in a ring structure. The strength of the gap junctions is taken to be different for each link in the network, owing to the inter-neuronal coupling medium properties. Robust adaptive control mechanism based on Lyapunov stability analysis is employed and theoretical criteria are derived to realize the synchronization of the network of four FHN neurons in a ring form with unknown parameters under direction-dependent coupling and disturbances. The proposed scheme for synchronization of dissimilar neurons, under external electrical stimuli, coupled in a ring communication topology, having all parameters unknown, and subject to directional coupling medium and perturbations, is addressed for the first time as per our knowledge. To demonstrate the efficacy of the proposed strategy, simulation results are provided. PMID:29535622

Geodynamic Effects of Ocean Tides: Progress and Problems

NASA Technical Reports Server (NTRS)

Richard, Ray

1999-01-01

Satellite altimetry, particularly Topex/Poseidon, has markedly improved our knowledge of global tides, thereby allowing significant progress on some longstanding problems in geodynamics. This paper reviews some of that progress. Emphasis is given to global-scale problems, particularly those falling within the mandate of the new IERS Special Bureau for Tides: angular momentum, gravitational field, geocenter motion. For this discussion I use primarily the new ocean tide solutions GOT99.2, CSR4.0, and TPXO.4 (for which G. Egbert has computed inverse-theoretic error estimates), and I concentrate on new results in angular momentum and gravity and their solid-earth implications. One example is a new estimate of the effective tidal Q at the M_2 frequency, based on combining these ocean models with tidal estimates from satellite laser ranging. Three especially intractable problems are also addressed: (1) determining long-period tides in the Arctic [large unknown effect on the inertia tensor, particularly for Mf]; (2) determining the global psi_l tide [large unknown effect on interpretations of gravimetry for the near-diurnal free wobble]; and (3) determining radiational tides [large unknown temporal variations at important frequencies]. Problems (2) and (3) are related.

Switched-Observer-Based Adaptive Neural Control of MIMO Switched Nonlinear Systems With Unknown Control Gains.

PubMed

Long, Lijun; Zhao, Jun

2017-07-01

In this paper, the problem of adaptive neural output-feedback control is addressed for a class of multi-input multioutput (MIMO) switched uncertain nonlinear systems with unknown control gains. Neural networks (NNs) are used to approximate unknown nonlinear functions. In order to avoid the conservativeness caused by adoption of a common observer for all subsystems, an MIMO NN switched observer is designed to estimate unmeasurable states. A new switched observer-based adaptive neural control technique for the problem studied is then provided by exploiting the classical average dwell time (ADT) method and the backstepping method and the Nussbaum gain technique. It effectively handles the obstacle about the coexistence of multiple Nussbaum-type function terms, and improves the classical ADT method, since the exponential decline property of Lyapunov functions for individual subsystems is no longer satisfied. It is shown that the technique proposed is able to guarantee semiglobal uniformly ultimately boundedness of all the signals in the closed-loop system under a class of switching signals with ADT, and the tracking errors converge to a small neighborhood of the origin. The effectiveness of the approach proposed is illustrated by its application to a two inverted pendulum system.

Robust adaptive precision motion control of hydraulic actuators with valve dead-zone compensation.

PubMed

Deng, Wenxiang; Yao, Jianyong; Ma, Dawei

2017-09-01

This paper addresses the high performance motion control of hydraulic actuators with parametric uncertainties, unmodeled disturbances and unknown valve dead-zone. By constructing a smooth dead-zone inverse, a robust adaptive controller is proposed via backstepping method, in which adaptive law is synthesized to deal with parametric uncertainties and a continuous nonlinear robust control law to suppress unmodeled disturbances. Since the unknown dead-zone parameters can be estimated by adaptive law and then the effect of dead-zone can be compensated effectively via inverse operation, improved tracking performance can be expected. In addition, the disturbance upper bounds can also be updated online by adaptive laws, which increases the controller operability in practice. The Lyapunov based stability analysis shows that excellent asymptotic output tracking with zero steady-state error can be achieved by the developed controller even in the presence of unmodeled disturbance and unknown valve dead-zone. Finally, the proposed control strategy is experimentally tested on a servovalve controlled hydraulic actuation system subjected to an artificial valve dead-zone. Comparative experimental results are obtained to illustrate the effectiveness of the proposed control scheme. Copyright © 2017 ISA. Published by Elsevier Ltd. All rights reserved.

Nonnegative Matrix Factorization for identification of unknown number of sources emitting delayed signals

PubMed Central

Iliev, Filip L.; Stanev, Valentin G.; Vesselinov, Velimir V.

2018-01-01

Factor analysis is broadly used as a powerful unsupervised machine learning tool for reconstruction of hidden features in recorded mixtures of signals. In the case of a linear approximation, the mixtures can be decomposed by a variety of model-free Blind Source Separation (BSS) algorithms. Most of the available BSS algorithms consider an instantaneous mixing of signals, while the case when the mixtures are linear combinations of signals with delays is less explored. Especially difficult is the case when the number of sources of the signals with delays is unknown and has to be determined from the data as well. To address this problem, in this paper, we present a new method based on Nonnegative Matrix Factorization (NMF) that is capable of identifying: (a) the unknown number of the sources, (b) the delays and speed of propagation of the signals, and (c) the locations of the sources. Our method can be used to decompose records of mixtures of signals with delays emitted by an unknown number of sources in a nondispersive medium, based only on recorded data. This is the case, for example, when electromagnetic signals from multiple antennas are received asynchronously; or mixtures of acoustic or seismic signals recorded by sensors located at different positions; or when a shift in frequency is induced by the Doppler effect. By applying our method to synthetic datasets, we demonstrate its ability to identify the unknown number of sources as well as the waveforms, the delays, and the strengths of the signals. Using Bayesian analysis, we also evaluate estimation uncertainties and identify the region of likelihood where the positions of the sources can be found. PMID:29518126

Adaptive neural output-feedback control for nonstrict-feedback time-delay fractional-order systems with output constraints and actuator nonlinearities.

PubMed

Zouari, Farouk; Ibeas, Asier; Boulkroune, Abdesselem; Cao, Jinde; Mehdi Arefi, Mohammad

2018-06-01

This study addresses the issue of the adaptive output tracking control for a category of uncertain nonstrict-feedback delayed incommensurate fractional-order systems in the presence of nonaffine structures, unmeasured pseudo-states, unknown control directions, unknown actuator nonlinearities and output constraints. Firstly, the mean value theorem and the Gaussian error function are introduced to eliminate the difficulties that arise from the nonaffine structures and the unknown actuator nonlinearities, respectively. Secondly, the immeasurable tracking error variables are suitably estimated by constructing a fractional-order linear observer. Thirdly, the neural network, the Razumikhin Lemma, the variable separation approach, and the smooth Nussbaum-type function are used to deal with the uncertain nonlinear dynamics, the unknown time-varying delays, the nonstrict feedback and the unknown control directions, respectively. Fourthly, asymmetric barrier Lyapunov functions are employed to overcome the violation of the output constraints and to tune online the parameters of the adaptive neural controller. Through rigorous analysis, it is proved that the boundedness of all variables in the closed-loop system and the semi global asymptotic tracking are ensured without transgression of the constraints. The principal contributions of this study can be summarized as follows: (1) based on Caputo's definitions and new lemmas, methods concerning the controllability, observability and stability analysis of integer-order systems are extended to fractional-order ones, (2) the output tracking objective for a relatively large class of uncertain systems is achieved with a simple controller and less tuning parameters. Finally, computer-simulation studies from the robotic field are given to demonstrate the effectiveness of the proposed controller. Copyright © 2018 Elsevier Ltd. All rights reserved.

Nonnegative Matrix Factorization for identification of unknown number of sources emitting delayed signals.

PubMed

Iliev, Filip L; Stanev, Valentin G; Vesselinov, Velimir V; Alexandrov, Boian S

2018-01-01

Factor analysis is broadly used as a powerful unsupervised machine learning tool for reconstruction of hidden features in recorded mixtures of signals. In the case of a linear approximation, the mixtures can be decomposed by a variety of model-free Blind Source Separation (BSS) algorithms. Most of the available BSS algorithms consider an instantaneous mixing of signals, while the case when the mixtures are linear combinations of signals with delays is less explored. Especially difficult is the case when the number of sources of the signals with delays is unknown and has to be determined from the data as well. To address this problem, in this paper, we present a new method based on Nonnegative Matrix Factorization (NMF) that is capable of identifying: (a) the unknown number of the sources, (b) the delays and speed of propagation of the signals, and (c) the locations of the sources. Our method can be used to decompose records of mixtures of signals with delays emitted by an unknown number of sources in a nondispersive medium, based only on recorded data. This is the case, for example, when electromagnetic signals from multiple antennas are received asynchronously; or mixtures of acoustic or seismic signals recorded by sensors located at different positions; or when a shift in frequency is induced by the Doppler effect. By applying our method to synthetic datasets, we demonstrate its ability to identify the unknown number of sources as well as the waveforms, the delays, and the strengths of the signals. Using Bayesian analysis, we also evaluate estimation uncertainties and identify the region of likelihood where the positions of the sources can be found.

Figureheads, ghost-writers and pseudonymous quant bloggers: the recent evolution of authorship in science publishing.

PubMed

Charlton, Bruce G

2008-10-01

Traditionally, science has been published only under the proper names and postal addresses of the scientists who did the work. This is no longer the case, and over recent decades science authorship has fundamentally changed its character. At one extreme, prestigious scientists writing from high status institutions are used as mere figureheads to publish research that has been performed, analyzed and 'ghost-written' by commercial organizations. At the other extreme 'quant bloggers' are publishing real science with their personal identity shielded by pseudonyms and writing from internet addresses that give no indication of their location or professional affiliation. Yet the paradox is that while named high status scientists from famous institutions are operating with suspect integrity (e.g. covertly acting as figureheads) and minimal accountability (i.e. failing to respond to substantive criticism); pseudonymous bloggers - of mostly unknown identity, unknown education or training, and unknown address - are publishing interesting work and interacting with their critics on the internet. And at the same time as 'official' and professional science is increasingly timid careerist and dull; the self-organized, amateur realm of science blogs displays curiosity, scientific motivation, accountability, responsibility - and often considerable flair and skill. Quant bloggers and other internet scientists are, however, usually dependent on professional scientists to generate databases. But professional science has become highly constrained by non-scientific influences: increasingly sluggish, rigid, bureaucratic, managerial, and enmeshed with issues of pseudo-ethics, political correctness, public relations, politics and marketing. So it seems that professional science needs the quant bloggers. One possible scenario is that professional scientists may in future continue to be paid to do the plodding business of generating raw data (dull work that no one would do unless they were paid); but these same professional scientists (functioning essentially as either project managers or technicians) may be found to lack the boldness, flair, sheer 'smarts' or genuine interest in the subject to make sense of what they have discovered. Some branches of future science may then come to depend on a swarm of gifted 'amateurs' somewhat like the current quant bloggers; for analysis and integration of their data, for understanding its implications, and for speculating freely about the potential applications.

Novel prescribed performance neural control of a flexible air-breathing hypersonic vehicle with unknown initial errors.

PubMed

Bu, Xiangwei; Wu, Xiaoyan; Zhu, Fujing; Huang, Jiaqi; Ma, Zhen; Zhang, Rui

2015-11-01

A novel prescribed performance neural controller with unknown initial errors is addressed for the longitudinal dynamic model of a flexible air-breathing hypersonic vehicle (FAHV) subject to parametric uncertainties. Different from traditional prescribed performance control (PPC) requiring that the initial errors have to be known accurately, this paper investigates the tracking control without accurate initial errors via exploiting a new performance function. A combined neural back-stepping and minimal learning parameter (MLP) technology is employed for exploring a prescribed performance controller that provides robust tracking of velocity and altitude reference trajectories. The highlight is that the transient performance of velocity and altitude tracking errors is satisfactory and the computational load of neural approximation is low. Finally, numerical simulation results from a nonlinear FAHV model demonstrate the efficacy of the proposed strategy. Copyright © 2015 ISA. Published by Elsevier Ltd. All rights reserved.

Genotoxicity of metal nanoparticles.

PubMed

Xie, Hong; Mason, Michael M; Wise, John Pierce

2011-01-01

Nanotechnology is currently used in industry, medicine, and military applications, as well as in more than 300 commercial products. Yet, the same properties that make these particles exciting for technology also make them daunting public health concerns because their toxicity is unknown and relatively unexplored. Increased attention is being placed on the study of metal particle genotoxicity; however, a lot of unknowns remain about their effects and the mechanisms. In this article, we highlight some metal and metal oxide nanoparticles of interest and discuss the current in vivo and in vitro studies of genotoxic effects. Many metal nanoparticles were found to cause chromosomal aberrations, DNA strand breaks, oxidative DNA damage, and mutations. Inconsistencies are found in the literature, however, thus drawing conclusions is difficult due to a variety of factors. Therefore, the areas requiring further attention are highlighted and recommendations to improve our understanding of the genotoxic potential are addressed.

75 FR 81498 - Fisheries of the Northeastern United States; Summer Flounder, Scup, and Black Sea Bass Fisheries...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-12-28

... period will be addressed in July 2011, prior to the start of the 2011 Winter II fishery. Per the quota... inappropriate years of very low harvest as the foundation of the constant catch starting point. The commenters... summer flounder quota at the start of the fishing year that begins January 1, 2011, is required by the...

Mid-infrared plasmonic resonances exploiting heavily-doped Ge on Si

NASA Astrophysics Data System (ADS)

Biagioni, P.; Sakat, E.; Baldassarre, L.; Calandrini, E.; Samarelli, A.; Gallacher, K.; Frigerio, J.; Isella, G.; Paul, D. J.; Ortolani, M.

2015-03-01

We address the behavior of mid-infrared localized plasmon resonances in elongated germanium antennas integrated on silicon substrates. Calculations based on Mie theory and on the experimentally retrieved dielectric constant allow us to study the tunability and the figures of merit of plasmon resonances in heavily-doped germanium and to preliminarily compare them with those of the most established plasmonic material, gold.

Navigation through unknown and dynamic open spaces using topological notions

NASA Astrophysics Data System (ADS)

Miguel-Tomé, Sergio

2018-04-01

Until now, most algorithms used for navigation have had the purpose of directing system towards one point in space. However, humans communicate tasks by specifying spatial relations among elements or places. In addition, the environments in which humans develop their activities are extremely dynamic. The only option that allows for successful navigation in dynamic and unknown environments is making real-time decisions. Therefore, robots capable of collaborating closely with human beings must be able to make decisions based on the local information registered by the sensors and interpret and express spatial relations. Furthermore, when one person is asked to perform a task in an environment, this task is communicated given a category of goals so the person does not need to be supervised. Thus, two problems appear when one wants to create multifunctional robots: how to navigate in dynamic and unknown environments using spatial relations and how to accomplish this without supervision. In this article, a new architecture to address the two cited problems is presented, called the topological qualitative navigation architecture. In previous works, a qualitative heuristic called the heuristic of topological qualitative semantics (HTQS) has been developed to establish and identify spatial relations. However, that heuristic only allows for establishing one spatial relation with a specific object. In contrast, navigation requires a temporal sequence of goals with different objects. The new architecture attains continuous generation of goals and resolves them using HTQS. Thus, the new architecture achieves autonomous navigation in dynamic or unknown open environments.

Is There a Cosmological Constant?

NASA Technical Reports Server (NTRS)

Kochanek, Christopher; Oliversen, Ronald J. (Technical Monitor)

2002-01-01

The grant contributed to the publication of 18 refereed papers and 5 conference proceedings. The primary uses of the funding have been for page charges, travel for invited talks related to the grant research, and the support of a graduate student, Charles Keeton. The refereed papers address four of the primary goals of the proposal: (1) the statistics of radio lenses as a probe of the cosmological model (#1), (2) the role of spiral galaxies as lenses (#3), (3) the effects of dust on statistics of lenses (#7, #8), and (4) the role of groups and clusters as lenses (#2, #6, #10, #13, #15, #16). Four papers (#4, #5, #11, #12) address general issues of lens models, calibrations, and the relationship between lens galaxies and nearby galaxies. One considered cosmological effects in lensing X-ray sources (#9), and two addressed issues related to the overall power spectrum and theories of gravity (#17, #18). Our theoretical studies combined with the explosion in the number of lenses and the quality of the data obtained for them is greatly increasing our ability to characterize and understand the lens population. We can now firmly conclude both from our study of the statistics of radio lenses and our survey of extinctions in individual lenses that the statistics of optically selected quasars were significantly affected by extinction. However, the limits on the cosmological constant remain at lambda < 0.65 at a 2-sigma confidence level, which is in mild conflict with the results of the Type la supernova surveys. We continue to find that neither spiral galaxies nor groups and clusters contribute significantly to the production of gravitational lenses. The lack of group and cluster lenses is strong evidence for the role of baryonic cooling in increasing the efficiency of galaxies as lenses compared to groups and clusters of higher mass but lower central density. Unfortunately for the ultimate objective of the proposal, improved constraints on the cosmological constant, the next large survey for gravitational lenses did not release its results during the term of the proposal. The research supported the career development. of six graduate students (polar, Fletcher, Herold, Keeton, Deng and Rusin) and two post-docs (Labor and Munoz).

Toxic Substances: The Extent of Lead Hazards in Child Care Facilities and Schools Is Unknown. Report to the Chairman, Subcommittee on Health and the Environment, Committee on Energy and Commerce, House of Representatives.

ERIC Educational Resources Information Center

General Accounting Office, Washington, DC. Resources, Community, and Economic Development Div.

This report by the United States General Accounting Office discusses federal, state, and local programs and activities to inspect for and address lead hazards in the nation's child care facilities and schools, and existing information on the extent and treatment of lead hazards in these facilities and schools. Federal agencies conduct numerous…

Sensorless Load Torque Estimation and Passivity Based Control of Buck Converter Fed DC Motor

PubMed Central

Kumar, S. Ganesh; Thilagar, S. Hosimin

2015-01-01

Passivity based control of DC motor in sensorless configuration is proposed in this paper. Exact tracking error dynamics passive output feedback control is used for stabilizing the speed of Buck converter fed DC motor under various load torques such as constant type, fan type, propeller type, and unknown load torques. Under load conditions, sensorless online algebraic approach is proposed, and it is compared with sensorless reduced order observer approach. The former produces better response in estimating the load torque. Sensitivity analysis is also performed to select the appropriate control variables. Simulation and experimental results fully confirm the superiority of the proposed approach suggested in this paper. PMID:25893208

Purification and substrate specificity of polymorphic forms of esterase D from human erythrocytes.

PubMed Central

Scott, E M; Wright, R C

1978-01-01

Esterase D (EsD), purified from human erythrocytes and tested with a variety of substrates, hydrolyzed only triacetin, tributyrin, and certain soluble aryl esters of aliphatic acids. Esters of 4-methylumbelliferone were easily the best substrates. When the three genetically different isozymes were compared, the less common forms, EsD 2 and EsD 2-1, were less stable than EsD 1. With some substrates, the Michaelis constant of the EsD 2 form differed from that of the EsD 1 form. The EsD 2-1 hybrid form was usually, but not invariably, intermediate in properties. The physiologic significance of the genetic variability of this enzyme is unknown. PMID:623100

Finite-error metrological bounds on multiparameter Hamiltonian estimation

NASA Astrophysics Data System (ADS)

Kura, Naoto; Ueda, Masahito

2018-01-01

Estimation of multiple parameters in an unknown Hamiltonian is investigated. We present upper and lower bounds on the time required to complete the estimation within a prescribed error tolerance δ . The lower bound is given on the basis of the Cramér-Rao inequality, where the quantum Fisher information is bounded by the squared evolution time. The upper bound is obtained by an explicit construction of estimation procedures. By comparing the cases with different numbers of Hamiltonian channels, we also find that the few-channel procedure with adaptive feedback and the many-channel procedure with entanglement are equivalent in the sense that they require the same amount of time resource up to a constant factor.

An inverse finance problem for estimation of the volatility

NASA Astrophysics Data System (ADS)

Neisy, A.; Salmani, K.

2013-01-01

Black-Scholes model, as a base model for pricing in derivatives markets has some deficiencies, such as ignoring market jumps, and considering market volatility as a constant factor. In this article, we introduce a pricing model for European-Options under jump-diffusion underlying asset. Then, using some appropriate numerical methods we try to solve this model with integral term, and terms including derivative. Finally, considering volatility as an unknown parameter, we try to estimate it by using our proposed model. For the purpose of estimating volatility, in this article, we utilize inverse problem, in which inverse problem model is first defined, and then volatility is estimated using minimization function with Tikhonov regularization.

Radioactive source localization in urban environments with sensor networks and the Internet of Things

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sullivan, Clair J.

The use of radiation detectors as an element in the so-called “Internet of Things” has recently become viable with the available of low-cost, mobile radiation sensors capable of streaming geo-referenced data. New methods for fusing the data from multiple sensors on such a network is presented. The traditional simple and ordinary Kriging methods present a challenge for such a network since the assumption of a constant mean is not valid in this application. In conclusion, a variety of Kalman filters are introduced in an attempt to solve the problem associated with this variable and unknown mean. Results are presented onmore » a deployed sensor network.« less

On determining absolute entropy without quantum theory or the third law of thermodynamics

NASA Astrophysics Data System (ADS)

Steane, Andrew M.

2016-04-01

We employ classical thermodynamics to gain information about absolute entropy, without recourse to statistical methods, quantum mechanics or the third law of thermodynamics. The Gibbs-Duhem equation yields various simple methods to determine the absolute entropy of a fluid. We also study the entropy of an ideal gas and the ionization of a plasma in thermal equilibrium. A single measurement of the degree of ionization can be used to determine an unknown constant in the entropy equation, and thus determine the absolute entropy of a gas. It follows from all these examples that the value of entropy at absolute zero temperature does not need to be assigned by postulate, but can be deduced empirically.

Radioactive source localization in urban environments with sensor networks and the Internet of Things

DOE PAGES

Sullivan, Clair J.

2016-01-01

The use of radiation detectors as an element in the so-called “Internet of Things” has recently become viable with the available of low-cost, mobile radiation sensors capable of streaming geo-referenced data. New methods for fusing the data from multiple sensors on such a network is presented. The traditional simple and ordinary Kriging methods present a challenge for such a network since the assumption of a constant mean is not valid in this application. In conclusion, a variety of Kalman filters are introduced in an attempt to solve the problem associated with this variable and unknown mean. Results are presented onmore » a deployed sensor network.« less

Pre-hospital policies for the care of patients with acute coronary syndromes in India: A policy document analysis.

PubMed

Patel, Amisha; Prabhakaran, Dorairaj; Berendsen, Mark; Mohanan, P P; Huffman, Mark D

2017-04-01

Ischemic heart disease is the leading cause of death in India. In high-income countries, pre-hospital systems of care have been developed to manage acute manifestations of ischemic heart disease, such as acute coronary syndrome (ACS). However, it is unknown whether guidelines, policies, regulations, or laws exist to guide pre-hospital ACS care in India. We undertook a nation-wide document analysis to address this gap in knowledge. From November 2014 to May 2016, we searched for publicly available emergency care guidelines and legislation addressing pre-hospital ACS care in all 29 Indian states and 7 Union Territories via Internet search and direct correspondence. We found two documents addressing pre-hospital ACS care. Though India has legislation mandating acute care for emergencies such as trauma, regulations or laws to guide pre-hospital ACS care are largely absent. Policy makers urgently need to develop comprehensive, multi-stakeholder policies for pre-hospital emergency cardiovascular care in India. Copyright © 2016. Published by Elsevier B.V.

Thermal time constant: optimising the skin temperature predictive modelling in lower limb prostheses using Gaussian processes

PubMed Central

Buis, Arjan

2016-01-01

Elevated skin temperature at the body/device interface of lower-limb prostheses is one of the major factors that affect tissue health. The heat dissipation in prosthetic sockets is greatly influenced by the thermal conductive properties of the hard socket and liner material employed. However, monitoring of the interface temperature at skin level in lower-limb prosthesis is notoriously complicated. This is due to the flexible nature of the interface liners used which requires consistent positioning of sensors during donning and doffing. Predicting the residual limb temperature by monitoring the temperature between socket and liner rather than skin and liner could be an important step in alleviating complaints on increased temperature and perspiration in prosthetic sockets. To predict the residual limb temperature, a machine learning algorithm – Gaussian processes is employed, which utilizes the thermal time constant values of commonly used socket and liner materials. This Letter highlights the relevance of thermal time constant of prosthetic materials in Gaussian processes technique which would be useful in addressing the challenge of non-invasively monitoring the residual limb skin temperature. With the introduction of thermal time constant, the model can be optimised and generalised for a given prosthetic setup, thereby making the predictions more reliable. PMID:27695626

Electric Machine with Boosted Inductance to Stabilize Current Control

NASA Technical Reports Server (NTRS)

Abel, Steve

2013-01-01

High-powered motors typically have very low resistance and inductance (R and L) in their windings. This makes the pulse-width modulated (PWM) control of the current very difficult, especially when the bus voltage (V) is high. These R and L values are dictated by the motor size, torque (Kt), and back-emf (Kb) constants. These constants are in turn set by the voltage and the actuation torque-speed requirements. This problem is often addressed by placing inductive chokes within the controller. This approach is undesirable in that space is taken and heat is added to the controller. By keeping the same motor frame, reducing the wire size, and placing a correspondingly larger number of turns in each slot, the resistance, inductance, torque constant, and back-emf constant are all increased. The increased inductance aids the current control but ruins the Kt and Kb selections. If, however, a fraction of the turns is moved from their "correct slot" to an "incorrect slot," the increased R and L values are retained, but the Kt and Kb values are restored to the desired values. This approach assumes that increased resistance is acceptable to a degree. In effect, the heat allocated to the added inductance has been moved from the controller to the motor body, which in some cases is preferred.

Thermal time constant: optimising the skin temperature predictive modelling in lower limb prostheses using Gaussian processes.

PubMed

Mathur, Neha; Glesk, Ivan; Buis, Arjan

2016-06-01

Elevated skin temperature at the body/device interface of lower-limb prostheses is one of the major factors that affect tissue health. The heat dissipation in prosthetic sockets is greatly influenced by the thermal conductive properties of the hard socket and liner material employed. However, monitoring of the interface temperature at skin level in lower-limb prosthesis is notoriously complicated. This is due to the flexible nature of the interface liners used which requires consistent positioning of sensors during donning and doffing. Predicting the residual limb temperature by monitoring the temperature between socket and liner rather than skin and liner could be an important step in alleviating complaints on increased temperature and perspiration in prosthetic sockets. To predict the residual limb temperature, a machine learning algorithm - Gaussian processes is employed, which utilizes the thermal time constant values of commonly used socket and liner materials. This Letter highlights the relevance of thermal time constant of prosthetic materials in Gaussian processes technique which would be useful in addressing the challenge of non-invasively monitoring the residual limb skin temperature. With the introduction of thermal time constant, the model can be optimised and generalised for a given prosthetic setup, thereby making the predictions more reliable.

Effects of system net charge and electrostatic truncation on all-atom constant pH molecular dynamics.

PubMed

Chen, Wei; Shen, Jana K

2014-10-15

Constant pH molecular dynamics offers a means to rigorously study the effects of solution pH on dynamical processes. Here, we address two critical questions arising from the most recent developments of the all-atom continuous constant pH molecular dynamics (CpHMD) method: (1) What is the effect of spatial electrostatic truncation on the sampling of protonation states? (2) Is the enforcement of electrical neutrality necessary for constant pH simulations? We first examined how the generalized reaction field and force-shifting schemes modify the electrostatic forces on the titration coordinates. Free energy simulations of model compounds were then carried out to delineate the errors in the deprotonation free energy and salt-bridge stability due to electrostatic truncation and system net charge. Finally, CpHMD titration of a mini-protein HP36 was used to understand the manifestation of the two types of errors in the calculated pK(a) values. The major finding is that enforcing charge neutrality under all pH conditions and at all time via cotitrating ions significantly improves the accuracy of protonation-state sampling. We suggest that such finding is also relevant for simulations with particle mesh Ewald, considering the known artifacts due to charge-compensating background plasma. Copyright © 2014 Wiley Periodicals, Inc.

Effects of system net charge and electrostatic truncation on all-atom constant pH molecular dynamics †

PubMed Central

Chen, Wei; Shen, Jana K.

2014-01-01

Constant pH molecular dynamics offers a means to rigorously study the effects of solution pH on dynamical processes. Here we address two critical questions arising from the most recent developments of the all-atom continuous constant pH molecular dynamics (CpHMD) method: 1) What is the effect of spatial electrostatic truncation on the sampling of protonation states? 2) Is the enforcement of electrical neutrality necessary for constant pH simulations? We first examined how the generalized reaction field and force shifting schemes modify the electrostatic forces on the titration coordinates. Free energy simulations of model compounds were then carried out to delineate the errors in the deprotonation free energy and salt-bridge stability due to electrostatic truncation and system net charge. Finally, CpHMD titration of a mini-protein HP36 was used to understand the manifestation of the two types of errors in the calculated pK a values. The major finding is that enforcing charge neutrality under all pH conditions and at all time via co-titrating ions significantly improves the accuracy of protonation-state sampling. We suggest that such finding is also relevant for simulations with particle-mesh Ewald, considering the known artifacts due to charge-compensating background plasma. PMID:25142416

Other ways of measuring `Big G'

NASA Astrophysics Data System (ADS)

Rothleitner, Christian

2016-03-01

In 1798, the British scientist Henry Cavendish performed the first laboratory experiment to determine the gravitational force between two massive bodies. From his result, Newton's gravitational constant, G, was calculated. Cavendish's measurement principle was the torsion balance invented by John Michell some 15 years before. During the following two centuries, more than 300 new measurements followed. Although technology - and physics - developed rapidly during this time, surprisingly, most experiments were still based on the same principle. In fact, the most accurate determination of G to date is a measurement based on the torsion balance principle. Despite the fact that G was one of the first fundamental physical constants ever measured, and despite the huge number of experiments performed on it to this day, its CODATA recommended value still has the highest standard measurement uncertainty when compared to other fundamental physical constants. Even more serious is the fact that even measurements based on the same principle often do not overlap within their attributed standard uncertainties. It must be assumed that various experiments are subject to one or more unknown biases. In this talk I will present some alternative experimental setups to the torsion balance which have been performed or proposed to measure G. Although their estimated uncertainties are often higher than most torsion balance experiments, revisiting such ideas is worthwhile. Advances in technology could offer solutions to problems which were previously insurmountable, these solutions could result in lower measurement uncertainties. New measurement principles could also help to uncover hidden systematic effects.

Monitoring bruise age using visible diffuse reflectance spectroscopy

NASA Astrophysics Data System (ADS)

McMurdy, John W.; Duffy, Susan; Crawford, Gregory P.

2007-02-01

The ability to determine the age of a bruise of unknown age mechanism is important in matters of domestic and child abuse and forensics. While physicians are asked to make clinical judgment on the age of a bruise using color and tenderness, studies have shown that a physicians estimate is highly inaccurate and in cases no better than chance alone. We present here the temporal progression of reflection spectrum collected from accidentally inflicted contusions in adult and child study participants with a synopsis of the observed phenomena. Reflection spectra collected using a portable fiber optic reflection spectrometer can track the increase in extravasated hemoglobin from trauma caused blood vessel rupture and subsequent removal of this hemoglobin occurring concurrent with an increase in the absorption attributed to the breakdown product bilirubin. We hypothesize that this time dependent pattern can be used to determine the age of an unknown bruise in an individual provided rate constant information for the patient can be determined in a controlled calibration bruise. Using reflection spectra to estimate bruise age can provide a rapid and noninvasive method to improve the ability of physicians in dating the age of a contusion.

Disturbance rejection control for vibration suppression of piezoelectric laminated thin-walled structures

NASA Astrophysics Data System (ADS)

Zhang, S. Q.; Li, H. N.; Schmidt, R.; Müller, P. C.

2014-02-01

Thin-walled piezoelectric integrated smart structures are easily excited to vibrate by unknown disturbances. In order to design and simulate a control strategy, firstly, an electro-mechanically coupled dynamic finite element (FE) model of smart structures is developed based on first-order shear deformation (FOSD) hypothesis. Linear piezoelectric constitutive equations and the assumption of constant electric field through the thickness are considered. Based on the dynamic FE model, a disturbance rejection (DR) control with proportional-integral (PI) observer using step functions as the fictitious model of disturbances is developed for vibration suppression of smart structures. In order to achieve a better dynamic behavior of the fictitious model of disturbances, the PI observer is extended to generalized proportional-integral (GPI) observer, in which sine or polynomial functions can be used to represent disturbances resulting in better dynamics. Therefore the disturbances can be estimated either by PI or GPI observer, and then the estimated signals are fed back to the controller. The DR control is validated by various kinds of unknown disturbances, and compared with linear-quadratic regulator (LQR) control. The results illustrate that the vibrations are better suppressed by the proposed DR control.

A Potential Proxy of the Second Integral of Motion (I2) in a Rotating Barred Potential

NASA Astrophysics Data System (ADS)

Shen, Juntai; Qin, Yujing

2017-06-01

The only analytically known integral of motion in a 2-D rotating barred potential is the Jacobi constant (EJ). In addition to EJ, regular orbits also obey a second integral of motion (I2) whose analytical form is unknown. We show that the time-averaged characteristics of angular momentum in a rotating bar potential resemble the behavior of the analytically-unknown I2. For a given EJ, regular orbits of various families follow a continuous sequence in the space of net angular momentum and its dispersion ("angular momentum space"). In the limiting case where regular orbits of the well-known x1/x4 orbital families dominate the phase space, the orbital sequence can be monotonically traced by a single parameter, namely the ratio of mean angular momentum to its dispersion. This ratio behaves well even in the 3-D case, and thus may be used as a proxy of I2. The potential proxy of I2 may be used as an efficient way to probe the phase space structure, and a convenient new scheme of orbit classification in addition to the frequency mapping technique.

Polarimetric subspace target detector for SAR data based on the Huynen dihedral model

NASA Astrophysics Data System (ADS)

Larson, Victor J.; Novak, Leslie M.

1995-06-01

Two new polarimetric subspace target detectors are developed based on a dihedral signal model for bright peaks within a spatially extended target signature. The first is a coherent dihedral target detector based on the exact Huynen model for a dihedral. The second is a noncoherent dihedral target detector based on the Huynen model with an extra unknown phase term. Expressions for these polarimetric subspace target detectors are developed for both additive Gaussian clutter and more general additive spherically invariant random vector clutter including the K-distribution. For the case of Gaussian clutter with unknown clutter parameters, constant false alarm rate implementations of these polarimetric subspace target detectors are developed. The performance of these dihedral detectors is demonstrated with real millimeter-wave fully polarimetric SAR data. The coherent dihedral detector which is developed with a more accurate description of a dihedral offers no performance advantage over the noncoherent dihedral detector which is computationally more attractive. The dihedral detectors do a better job of separating a set of tactical military targets from natural clutter compared to a detector that assumes no knowledge about the polarimetric structure of the target signal.

Hypothesis testing of a change point during cognitive decline among Alzheimer's disease patients.

PubMed

Ji, Ming; Xiong, Chengjie; Grundman, Michael

2003-10-01

In this paper, we present a statistical hypothesis test for detecting a change point over the course of cognitive decline among Alzheimer's disease patients. The model under the null hypothesis assumes a constant rate of cognitive decline over time and the model under the alternative hypothesis is a general bilinear model with an unknown change point. When the change point is unknown, however, the null distribution of the test statistics is not analytically tractable and has to be simulated by parametric bootstrap. When the alternative hypothesis that a change point exists is accepted, we propose an estimate of its location based on the Akaike's Information Criterion. We applied our method to a data set from the Neuropsychological Database Initiative by implementing our hypothesis testing method to analyze Mini Mental Status Exam scores based on a random-slope and random-intercept model with a bilinear fixed effect. Our result shows that despite large amount of missing data, accelerated decline did occur for MMSE among AD patients. Our finding supports the clinical belief of the existence of a change point during cognitive decline among AD patients and suggests the use of change point models for the longitudinal modeling of cognitive decline in AD research.

Optimal estimates of the diffusion coefficient of a single Brownian trajectory.

PubMed

Boyer, Denis; Dean, David S; Mejía-Monasterio, Carlos; Oshanin, Gleb

2012-03-01

Modern developments in microscopy and image processing are revolutionizing areas of physics, chemistry, and biology as nanoscale objects can be tracked with unprecedented accuracy. The goal of single-particle tracking is to determine the interaction between the particle and its environment. The price paid for having a direct visualization of a single particle is a consequent lack of statistics. Here we address the optimal way to extract diffusion constants from single trajectories for pure Brownian motion. It is shown that the maximum likelihood estimator is much more efficient than the commonly used least-squares estimate. Furthermore, we investigate the effect of disorder on the distribution of estimated diffusion constants and show that it increases the probability of observing estimates much smaller than the true (average) value.

Receptor-mediated endocytosis generates nanomechanical force reflective of ligand identity and cellular property.

PubMed

Zhang, Xiao; Ren, Juan; Wang, Jingren; Li, Shixie; Zou, Qingze; Gao, Nan

2018-08-01

Whether environmental (thermal, chemical, and nutrient) signals generate quantifiable, nanoscale, mechanophysical changes in the cellular plasma membrane has not been well elucidated. Assessment of such mechanophysical properties of plasma membrane may shed lights on fundamental cellular process. Atomic force microscopic (AFM) measurement of the mechanical properties of live cells was hampered by the difficulty in accounting for the effects of the cantilever motion and the associated hydrodynamic force on the mechanical measurement. These challenges have been addressed in our recently developed control-based AFM nanomechanical measurement protocol, which enables a fast, noninvasive, broadband measurement of the real-time changes in plasma membrane elasticity in live cells. Here we show using this newly developed AFM platform that the plasma membrane of live mammalian cells exhibits a constant and quantifiable nanomechanical property, the membrane elasticity. This mechanical property sensitively changes in response to environmental factors, such as the thermal, chemical, and growth factor stimuli. We demonstrate that different chemical inhibitors of endocytosis elicit distinct changes in plasma membrane elastic modulus reflecting their specific molecular actions on the lipid configuration or the endocytic machinery. Interestingly, two different growth factors, EGF and Wnt3a, elicited distinct elastic force profiles revealed by AFM at the plasma membrane during receptor-mediated endocytosis. By applying this platform to genetically modified cells, we uncovered a previously unknown contribution of Cdc42, a key component of the cellular trafficking network, to EGF-stimulated endocytosis at plasma membrane. Together, this nanomechanical AFM study establishes an important foundation that is expandable and adaptable for investigation of cellular membrane evolution in response to various key extracellular signals. © 2017 Wiley Periodicals, Inc.

Circadian rhythmicity and light sensitivity of the zebrafish brain.

PubMed

Moore, Helen A; Whitmore, David

2014-01-01

Traditionally, circadian clocks have been thought of as a neurobiological phenomenon. This view changed somewhat over recent years with the discovery of peripheral tissue circadian oscillators. In mammals, however, the suprachiasmatic nucleus (SCN) in the hypothalamus still retains the critical role of a central synchronizer of biological timing. Zebrafish, in contrast, have always reflected a more highly decentralized level of clock organization, as individual cells and tissues contain directly light responsive circadian pacemakers. As a consequence, clock function in the zebrafish brain has remained largely unexplored, and the precise organization of rhythmic and light-sensitive neurons within the brain is unknown. To address this issue, we used the period3 (per3)-luciferase transgenic zebrafish to confirm that multiple brain regions contain endogenous circadian oscillators that are directly light responsive. In addition, in situ hybridization revealed localised neural expression of several rhythmic and light responsive clock genes, including per3, cryptochrome1a (cry1a) and per2. Adult brain nuclei showing significant clock gene expression include the teleost equivalent of the SCN, as well as numerous hypothalamic nuclei, the periventricular grey zone (PGZ) of the optic tectum, and granular cells of the rhombencephalon. To further investigate the light sensitive properties of neurons, expression of c-fos, a marker for neuronal activity, was examined. c-fos mRNA was upregulated in response to changing light conditions in different nuclei within the zebrafish brain. Furthermore, under constant dark (DD) conditions, c-fos shows a significant circadian oscillation. Taken together, these results show that there are numerous areas of the zebrafish central nervous system, which contain deep brain photoreceptors and directly light-entrainable circadian pacemakers. However, there are also multiple brain nuclei, which possess neither, demonstrating a degree of pacemaker complexity that was not previously appreciated.

Circadian Rhythmicity and Light Sensitivity of the Zebrafish Brain

PubMed Central

Moore, Helen A.; Whitmore, David

2014-01-01

Traditionally, circadian clocks have been thought of as a neurobiological phenomenon. This view changed somewhat over recent years with the discovery of peripheral tissue circadian oscillators. In mammals, however, the suprachiasmatic nucleus (SCN) in the hypothalamus still retains the critical role of a central synchronizer of biological timing. Zebrafish, in contrast, have always reflected a more highly decentralized level of clock organization, as individual cells and tissues contain directly light responsive circadian pacemakers. As a consequence, clock function in the zebrafish brain has remained largely unexplored, and the precise organization of rhythmic and light-sensitive neurons within the brain is unknown. To address this issue, we used the period3 (per3)-luciferase transgenic zebrafish to confirm that multiple brain regions contain endogenous circadian oscillators that are directly light responsive. In addition, in situ hybridization revealed localised neural expression of several rhythmic and light responsive clock genes, including per3, cryptochrome1a (cry1a) and per2. Adult brain nuclei showing significant clock gene expression include the teleost equivalent of the SCN, as well as numerous hypothalamic nuclei, the periventricular grey zone (PGZ) of the optic tectum, and granular cells of the rhombencephalon. To further investigate the light sensitive properties of neurons, expression of c-fos, a marker for neuronal activity, was examined. c-fos mRNA was upregulated in response to changing light conditions in different nuclei within the zebrafish brain. Furthermore, under constant dark (DD) conditions, c-fos shows a significant circadian oscillation. Taken together, these results show that there are numerous areas of the zebrafish central nervous system, which contain deep brain photoreceptors and directly light-entrainable circadian pacemakers. However, there are also multiple brain nuclei, which possess neither, demonstrating a degree of pacemaker complexity that was not previously appreciated. PMID:24465943

Direct access: factors that affect physical therapist practice in the state of Ohio.

PubMed

McCallum, Christine A; DiAngelis, Tom

2012-05-01

Direct access to physical therapist services is permitted by law in the majority of states and across all practice settings. Ohio enacted such legislation in 2004; however, it was unknown how direct access had affected actual clinical practice. The purpose of this study was to describe physical therapist and physical therapist practice environment factors that affect direct access practice. A 2-phase, mixed-method descriptive study was conducted. In the first phase, focus group interviews with 32 purposively selected physical therapists were completed, which resulted in 8 themes for an electronically distributed questionnaire. In the second phase, survey questionnaires were distributed to physical therapists with an e-mail address on file with the Ohio licensing board. An adjusted return rate of 23% was achieved. Data were analyzed for descriptive statistics. A constant comparative method assessed open-ended questions for common themes and patterns. Thirty-one percent of the respondents reported using direct access in physical therapist practice; however, 80% reported they would practice direct access if provided the opportunity. Physical therapists who practiced direct access were more likely to be in practice 6 years or more and hold advanced degrees beyond the entry level, were American Physical Therapy Association members, and had supportive management and organizational practice policies. The direct access physical therapist practice was generally a locally owned suburban private practice or a school-based clinic that saw approximately 6% to 10% of its patients by direct access. The majority of patients treated were adults with musculoskeletal or neuromuscular impairments. Nonresponse from e-mail may be associated with sample frame bias. Implementation of a direct access physical therapist practice model is evident in Ohio. Factors related to reimbursement and organizational policy appear to impede the process.

Estimating fish exploitation and aquatic habitat loss across diffuse inland recreational fisheries.

PubMed

de Kerckhove, Derrick Tupper; Minns, Charles Kenneth; Chu, Cindy

2015-01-01

The current state of many freshwater fish stocks worldwide is largely unknown but suspected to be vulnerable to exploitation from recreational fisheries and habitat degradation. Both these factors, combined with complex ecological dynamics and the diffuse nature of inland fisheries could lead to an invisible collapse: the drastic decline in fish stocks without great public or management awareness. In this study we provide a method to address the pervasive knowledge gaps in regional rates of exploitation and habitat degradation, and demonstrate its use in one of North America's largest and most diffuse recreational freshwater fisheries (Ontario, Canada). We estimated that (1) fish stocks were highly exploited and in apparent danger of collapse in management zones close to large population centres, and (2) fish habitat was under a low but constant threat of degradation at rates comparable to deforestation in Ontario and throughout Canada. These findings confirm some commonly held, but difficult to quantify, beliefs in inland fisheries management but also provide some further insights including (1) large anthropogenic projects greater than one hectare could contribute much more to fish habitat loss on an area basis than the cumulative effect of smaller projects within one year, (2) hooking mortality from catch-and-release fisheries is likely a greater source of mortality than the harvest itself, and (3) in most northern management zones over 50% of the fisheries resources are not yet accessible to anglers. While this model primarily provides a framework to prioritize management decisions and further targeted stock assessments, we note that our regional estimates of fisheries productivity and exploitation were similar to broadscale monitoring efforts by the Province of Ontario. We discuss the policy implications from our results and extending the model to other jurisdictions and countries.

Muscles innervated by a single motor neuron exhibit divergent synaptic properties on multiple time scales.

PubMed

Blitz, Dawn M; Pritchard, Amy E; Latimer, John K; Wakefield, Andrew T

2017-04-01

Adaptive changes in the output of neural circuits underlying rhythmic behaviors are relayed to muscles via motor neuron activity. Presynaptic and postsynaptic properties of neuromuscular junctions can impact the transformation from motor neuron activity to muscle response. Further, synaptic plasticity occurring on the time scale of inter-spike intervals can differ between multiple muscles innervated by the same motor neuron. In rhythmic behaviors, motor neuron bursts can elicit additional synaptic plasticity. However, it is unknown whether plasticity regulated by the longer time scale of inter-burst intervals also differs between synapses from the same neuron, and whether any such distinctions occur across a physiological activity range. To address these issues, we measured electrical responses in muscles innervated by a chewing circuit neuron, the lateral gastric (LG) motor neuron, in a well-characterized small motor system, the stomatogastric nervous system (STNS) of the Jonah crab, Cancer borealis In vitro and in vivo , sensory, hormonal and modulatory inputs elicit LG bursting consisting of inter-spike intervals of 50-250 ms and inter-burst intervals of 2-24 s. Muscles expressed similar facilitation measured with paired stimuli except at the shortest inter-spike interval. However, distinct decay time constants resulted in differences in temporal summation. In response to bursting activity, augmentation occurred to different extents and saturated at different inter-burst intervals. Further, augmentation interacted with facilitation, resulting in distinct intra-burst facilitation between muscles. Thus, responses of multiple target muscles diverge across a physiological activity range as a result of distinct synaptic properties sensitive to multiple time scales. © 2017. Published by The Company of Biologists Ltd.

In search for an optimal methodology to calculate the valence electron affinities of temporary anions.

PubMed

Puiatti, Marcelo; Vera, D Mariano A; Pierini, Adriana B

2009-10-28

Recently, we have proposed an approach for finding the valence anion ground state, based on the stabilization exerted by a polar solvent; the methodology used standard DFT methods and relatively inexpensive basis sets and yielded correct electron affinity (EA) values by gradually decreasing the dielectric constant of the medium. In order to address the overall performance of the new methodology, to find the best conditions for stabilizing the valence state and to evaluate its scope and limitations, we gathered a pool of 60 molecules, 25 of them bearing the conventional valence state as the ground anion and 35 for which the lowest anion state found holds the extra electron in a diffuse orbital around the molecule (non valence state). The results obtained by testing this representative set suggest a very good performance for most species having an experimental EA less negative than -3.0 eV; the correlation at the B3LYP/6-311+G(2df,p) level being y = 1.01x + 0.06, with a correlation index of 0.985. As an alternative, the time dependent DFT (TD-DFT) approach was also tested with both B3LYP and PBE0 functionals. The methodology we proposed shows a comparable or better accuracy with respect to TD-DFT, although the TD-DFT approach with the PBE0 functional is suggested as a suitable estimate for species with the most negative EAs (ca.-2.5 to -3.5 eV), for which stabilization strategies can hardly reach the valence state. As an application, a pool of 8 compounds of key biological interest with EAs which remain unknown or unclear were predicted using the new methodology.

The Neuropeptide Oxytocin Induces a Social Altruism Bias.

PubMed

Marsh, Nina; Scheele, Dirk; Gerhardt, Holger; Strang, Sabrina; Enax, Laura; Weber, Bernd; Maier, Wolfgang; Hurlemann, René

2015-11-25

Current psychological concepts of social and ecological responsibility emphasize the relevance of altruism, suggesting that more altruistic individuals are more likely to engage in sustainable behaviors. Emerging evidence indicates a central role of the neuropeptide oxytocin in promoting altruism. Whether this influence extends to ecological responsibility or is limited to the social domain remains unknown. In two independent experiments involving 172 human participants, we addressed this question by exposing subjects to a sustainability-related monetary donation task, with the option to support either socially or ecologically framed charities. We found that oxytocin induced a context-dependent change in altruistic behavior away from pro-environmental toward pro-social donations, while keeping constant the overall proportion of donated money. This pro-social bias transcended to the domain of sustainable consumption. Collectively, our findings demonstrate that altruistic priorities vary as a function of oxytocin system activity, which has implications for the promotion of pro-environmental attitudes and eco-friendly behaviors. Individual responses to ecological and social sustainability require a shift in personal priorities away from selfish to more altruistic behaviors. Emerging evidence indicates a central role of the hypothalamic peptide oxytocin in promoting altruism, but whether the influence of oxytocin benefits altruistic decision-making in the context of ecological and social sustainability is unclear. In two independent behavioral experiments involving 172 human subjects, we show that heightened oxytocin system activity induces a social altruism bias at the cost of ecological responsibility. Our results have fundamental implications for policy interventions and business strategies designed to sustain ecological resources by suggesting that a social framing may attract more individuals to engage in pro-environmental and eco-friendly behaviors. Copyright © 2015 the authors 0270-6474/15/3515696-06$15.00/0.

Methylmercury production and accumulation in urban stormwater ponds and habitat wetlands.

PubMed

Strickman, R J; Mitchell, C P J

2017-02-01

Stormwater management ponds and created habitat wetlands effectively manage erosion, flooding, and pollutant loadings while providing biodiversity and aesthetic benefits, but these structures are also potential sources of methylmercury (MeHg), a bioaccumulative neurotoxin. While MeHg accumulation has been confirmed in habitat wetlands, the extent of MeHg production and accumulation in stormwater ponds is unknown. Additionally, the fine-scale spatial variation in MeHg in these wetlands has never been explored despite the possibility that cycles of wetting and drying, and the presence of aquatic plants may stimulate methylation at their margins. To address these knowledge gaps, we compared MeHg and inorganic mercury concentrations, the percent of total mercury present as MeHg (%MeHg), and potential mercury methylation rate constants (K meth ) in the sediments of terrestrial-aquatic transects through several stormwater and habitat wetlands. We present novel evidence confirming the in situ production of MeHg in both stormwater ponds and habitat wetlands, but observe no systematic differences across the terrestrial-aquatic gradient, suggesting that routine variations in water level do not alter MeHg production and accumulation. Stormwater ponds effectively trap mercury while converting relatively little to MeHg, as evidenced by lower MeHg concentrations, %-MeHg, and K meth values than habitat wetlands, but often greater inorganic Hg concentrations. The relationship of aquatic vegetation to MeHg accumulation is weak and ambiguous, suggesting plants are not strong drivers of MeHg biogeochemistry in these systems. Although the MeHg hazard associated with individual artificial wetlands is low, they may be important sources of MeHg at the landscape level. Copyright © 2016 Elsevier Ltd. All rights reserved.

Bright flash response recovery of mammalian rods in vivo is rate limited by RGS9

PubMed Central

Peinado Allina, Gabriel; Fortenbach, Christopher; Gross, Owen P.; Pugh, Edward N.

2017-01-01

The temporal resolution of scotopic vision is thought to be constrained by the signaling kinetics of retinal rods, which use a highly amplified G-protein cascade to transduce absorbed photons into changes in membrane potential. Much is known about the biochemical mechanisms that determine the kinetics of rod responses ex vivo, but the rate-limiting mechanisms in vivo are unknown. Using paired flash electroretinograms with improved signal-to-noise, we have recorded the amplitude and kinetics of rod responses to a wide range of flash strengths from living mice. Bright rod responses in vivo recovered nearly twice as fast as all previous recordings, although the kinetic consequences of genetic perturbations previously studied ex vivo were qualitatively similar. In vivo, the dominant time constant of recovery from bright flashes was dramatically reduced by overexpression of the RGS9 complex, revealing G-protein deactivation to be rate limiting for recovery. However, unlike previous ex vivo recordings, dim flash responses in vivo were relatively unaffected by RGS9 overexpression, suggesting that other mechanisms, such as calcium feedback dynamics that are strongly regulated by the restricted subretinal microenvironment, act to determine rod dim flash kinetics. To assess the consequences for scotopic vision, we used a nocturnal wheel-running assay to measure the ability of wild-type and RGS9-overexpressing mice to detect dim flickering stimuli and found no improvement when rod recovery was speeded by RGS9 overexpression. These results are important for understanding retinal circuitry, in particular as modeled in the large literature that addresses the relationship between the kinetics and sensitivity of retinal responses and visual perception. PMID:28302678

Evolution of the Selfing Syndrome in Arabis alpina (Brassicaceae).

PubMed

Tedder, Andrew; Carleial, Samuel; Gołębiewska, Martyna; Kappel, Christian; Shimizu, Kentaro K; Stift, Marc

2015-01-01

The transition from cross-fertilisation (outcrossing) to self-fertilisation (selfing) frequently coincides with changes towards a floral morphology that optimises self-pollination, the selfing syndrome. Population genetic studies have reported the existence of both outcrossing and selfing populations in Arabis alpina (Brassicaceae), which is an emerging model species for studying the molecular basis of perenniality and local adaptation. It is unknown whether its selfing populations have evolved a selfing syndrome. Using macro-photography, microscopy and automated cell counting, we compared floral syndromes (size, herkogamy, pollen and ovule numbers) between three outcrossing populations from the Apuan Alps and three selfing populations from the Western and Central Alps (Maritime Alps and Dolomites). In addition, we genotyped the plants for 12 microsatellite loci to confirm previous measures of diversity and inbreeding coefficients based on allozymes, and performed Bayesian clustering. Plants from the three selfing populations had markedly smaller flowers, less herkogamy and lower pollen production than plants from the three outcrossing populations, whereas pistil length and ovule number have remained constant. Compared to allozymes, microsatellite variation was higher, but revealed similar patterns of low diversity and high Fis in selfing populations. Bayesian clustering revealed two clusters. The first cluster contained the three outcrossing populations from the Apuan Alps, the second contained the three selfing populations from the Maritime Alps and Dolomites. We conclude that in comparison to three outcrossing populations, three populations with high selfing rates are characterised by a flower morphology that is closer to the selfing syndrome. The presence of outcrossing and selfing floral syndromes within a single species will facilitate unravelling the genetic basis of the selfing syndrome, and addressing which selective forces drive its evolution.

Attention-Deficit/Hyperactivity Disorder-Related Impulsivity and Cyberbullying in Social Media.

PubMed

Reilly, Marie; Fogler, Jason; Selkie, Ellen; Augustyn, Marilyn

2016-01-01

Sarah is a 13-year-old eighth grader who was recently diagnosed for the first time with attention-deficit/hyperactivity disorder (ADHD)-inattentive type, and the family elected to treat her with behavioral interventions to help her organization and attention. She had struggled with distractibility and disorganization since the fourth grade. At home, Sarah's mother described her as "spacey" and unable to complete the morning routine without constant supervision. Over time, her mother observed that it seemed as if Sarah had given up on school.As Sarah became an adolescent, her self-esteem suffered because of her academic struggles, and she placed increasing emphasis on her appearance, including focus on remaining thin and refusing to leave the house without makeup. It was in this context that Sarah recently posted photographs of herself in various stages of undress and/or drinking alcohol on Snapchat, a photograph-sharing application in which users can send "snaps"-photographs that disappear soon after opening. However, snap recipients can take a screenshot or photograph of the snap, thereby saving the image. For unknown reasons, Sarah's close female friend took screenshots of these provocative photographs and sent them to their classmates and Sarah's older brother.Sarah's family contacted the police and has been working with her school to address this incident. This experience resulted in significant family stress and distrust of Sarah. For example, her mother took away her cell phone and laptop and has "grounded her" for a month from all out of school activities.Sarah's family seeks guidance regarding teaching Sarah about using social media responsibly and preventing this from happening again. Sarah's mom comes to your urgent care session asking for help because she does not feel that Sarah has "learned her lesson." What would you do next?

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ben-Dov, Nadav; Korenstein, Rafi, E-mail: korens@post.tau.ac.il

Recently it has been shown that elevating proton concentration at the cell surface stimulates the formation of membrane invaginations and vesicles accompanied by an enhanced uptake of macromolecules. While the initial induction of inward membrane curvature was rationalized in terms of proton-based increase of charge asymmetry across the membrane, the mechanisms underlying vesicle formation and its scission are still unknown. In light of the critical role of actin in vesicle formation during endocytosis, the present study addresses the involvement of cytoskeletal actin in proton-induced uptake (PIU). The uptake of dextran-FITC is used as a measure for the factual fraction ofmore » inward invaginations that undergo scission from the cell's plasma membrane. Our findings show that the rate of PIU in suspended cells is constant, whereas the rate of PIU in adherent cells is gradually increased in time, saturating at the level possessed by suspended cells. This is consistent with pH induced gradual degradation of stress-fibers in adherent cells. Wortmannin and calyculin-A are able to elevate PIU by 25% in adherent cells but not in suspended cells, while cytochalasin-D, rapamycin and latrunculin-A elevate PIU both in adherent and suspended cells. However, extensive actin depolymerization by high concentrations of latrunculin-A is able to inhibit PIU. We conclude that proton-induced membrane vesiculation is restricted by the actin structural resistance to the plasma membrane bending. Nevertheless, a certain degree of cortical actin restructuring is required for the completion of the scission process. - Highlights: ► Acidification of cells' exterior enhances uptake of macromolecules by the cells. ► Disruption of actin stress fibers leads to enhancement of proton induced uptake. ► Extensive depolymerization of cellular actin attenuates proton-induced uptake.« less

Estimating Fish Exploitation and Aquatic Habitat Loss across Diffuse Inland Recreational Fisheries

PubMed Central

de Kerckhove, Derrick Tupper; Minns, Charles Kenneth; Chu, Cindy

2015-01-01

The current state of many freshwater fish stocks worldwide is largely unknown but suspected to be vulnerable to exploitation from recreational fisheries and habitat degradation. Both these factors, combined with complex ecological dynamics and the diffuse nature of inland fisheries could lead to an invisible collapse: the drastic decline in fish stocks without great public or management awareness. In this study we provide a method to address the pervasive knowledge gaps in regional rates of exploitation and habitat degradation, and demonstrate its use in one of North America’s largest and most diffuse recreational freshwater fisheries (Ontario, Canada). We estimated that 1) fish stocks were highly exploited and in apparent danger of collapse in management zones close to large population centres, and 2) fish habitat was under a low but constant threat of degradation at rates comparable to deforestation in Ontario and throughout Canada. These findings confirm some commonly held, but difficult to quantify, beliefs in inland fisheries management but also provide some further insights including 1) large anthropogenic projects greater than one hectare could contribute much more to fish habitat loss on an area basis than the cumulative effect of smaller projects within one year, 2) hooking mortality from catch-and-release fisheries is likely a greater source of mortality than the harvest itself, and 3) in most northern management zones over 50% of the fisheries resources are not yet accessible to anglers. While this model primarily provides a framework to prioritize management decisions and further targeted stock assessments, we note that our regional estimates of fisheries productivity and exploitation were similar to broadscale monitoring efforts by the Province of Ontario. We discuss the policy implications from our results and extending the model to other jurisdictions and countries. PMID:25875790

One hundred years of the cosmological constant: from "superfluous stunt" to dark energy

NASA Astrophysics Data System (ADS)

O'Raifeartaigh, Cormac; O'Keeffe, Michael; Nahm, Werner; Mitton, Simon

2018-05-01

We present a centennial review of the history of the term known as the cosmological constant. First introduced to the general theory of relativity by Einstein in 1917 in order to describe a universe that was assumed to be static, the term fell from favour in the wake of the discovery of the expanding universe, only to make a dramatic return in recent times. We consider historical and philosophical aspects of the cosmological constant over four main epochs; (i) the use of the term in static cosmologies (both Newtonian and relativistic): (ii) the marginalization of the term following the discovery of cosmic expansion: (iii) the use of the term to address specific cosmic puzzles such as the timespan of expansion, the formation of galaxies and the redshifts of the quasars: (iv) the re-emergence of the term in today's Λ-CDM cosmology. We find that the cosmological constant was never truly banished from theoretical models of the universe, but was marginalized by astronomers for reasons of convenience. We also find that the return of the term to the forefront of modern cosmology did not occur as an abrupt paradigm shift due to one particular set of observations, but as the result of a number of empirical advances such as the measurement of present cosmic expansion using the Hubble Space Telescope, the measurement of past expansion using type SN Ia supernovae as standard candles, and the measurement of perturbations in the cosmic microwave background by balloon and satellite. We give a brief overview of contemporary interpretations of the physics underlying the cosmic constant and conclude with a synopsis of the famous cosmological constant problem.

One hundred years of the cosmological constant: from "superfluous stunt" to dark energy

NASA Astrophysics Data System (ADS)

O'Raifeartaigh, Cormac; O'Keeffe, Michael; Nahm, Werner; Mitton, Simon

2018-03-01

We present a centennial review of the history of the term known as the cosmological constant. First introduced to the general theory of relativity by Einstein in 1917 in order to describe a universe that was assumed to be static, the term fell from favour in the wake of the discovery of the expanding universe, only to make a dramatic return in recent times. We consider historical and philosophical aspects of the cosmological constant over four main epochs; (i) the use of the term in static cosmologies (both Newtonian and relativistic): (ii) the marginalization of the term following the discovery of cosmic expansion: (iii) the use of the term to address specific cosmic puzzles such as the timespan of expansion, the formation of galaxies and the redshifts of the quasars: (iv) the re-emergence of the term in today's Λ-CDM cosmology. We find that the cosmological constant was never truly banished from theoretical models of the universe, but was marginalized by astronomers for reasons of convenience. We also find that the return of the term to the forefront of modern cosmology did not occur as an abrupt paradigm shift due to one particular set of observations, but as the result of a number of empirical advances such as the measurement of present cosmic expansion using the Hubble Space Telescope, the measurement of past expansion using type SN Ia supernovae as standard candles, and the measurement of perturbations in the cosmic microwave background by balloon and satellite. We give a brief overview of contemporary interpretations of the physics underlying the cosmic constant and conclude with a synopsis of the famous cosmological constant problem.

Generalization of the event-based Carnevale-Hines integration scheme for integrate-and-fire models.

PubMed

van Elburg, Ronald A J; van Ooyen, Arjen

2009-07-01

An event-based integration scheme for an integrate-and-fire neuron model with exponentially decaying excitatory synaptic currents and double exponential inhibitory synaptic currents has been introduced by Carnevale and Hines. However, the integration scheme imposes nonphysiological constraints on the time constants of the synaptic currents, which hamper its general applicability. This letter addresses this problem in two ways. First, we provide physical arguments demonstrating why these constraints on the time constants can be relaxed. Second, we give a formal proof showing which constraints can be abolished. As part of our formal proof, we introduce the generalized Carnevale-Hines lemma, a new tool for comparing double exponentials as they naturally occur in many cascaded decay systems, including receptor-neurotransmitter dissociation followed by channel closing. Through repeated application of the generalized lemma, we lift most of the original constraints on the time constants. Thus, we show that the Carnevale-Hines integration scheme for the integrate-and-fire model can be employed for simulating a much wider range of neuron and synapse types than was previously thought.

Modified expression for bulb-tracer depletion—Effect on argon dating standards

USGS Publications Warehouse

Fleck, Robert J.; Calvert, Andrew T.

2014-01-01

40Ar/39Ar geochronology depends critically on well-calibrated standards, often traceable to first-principles K-Ar age calibrations using bulb-tracer systems. Tracer systems also provide precise standards for noble-gas studies and interlaboratory calibration. The exponential expression long used for calculating isotope tracer concentrations in K-Ar age dating and calibration of 40Ar/39Ar age standards may provide a close approximation of those values, but is not correct. Appropriate equations are derived that accurately describe the depletion of tracer reservoirs and concentrations of sequential tracers. In the modified expression the depletion constant is not in the exponent, which only varies as integers by tracer-number. Evaluation of the expressions demonstrates that systematic error introduced through use of the original expression may be substantial where reservoir volumes are small and resulting depletion constants are large. Traditional use of large reservoir to tracer volumes and the resulting small depletion constants have kept errors well less than experimental uncertainties in most previous K-Ar and calibration studies. Use of the proper expression, however, permits use of volumes appropriate to the problems addressed.

Sustained Zero-Order Release of Intact Ultra-Stable Drug-Loaded Liposomes from an Implantable Nanochannel Delivery System

PubMed Central

Celia, Christian; Ferrati, Silvia; Bansal, Shyam; van de Ven, Anne L.; Ruozi, Barbara; Zabre, Erika; Hosali, Sharath; Paolino, Donatella; Sarpietro, Maria Grazia; Fine, Daniel; Fresta, Massimo; Ferrari, Mauro

2014-01-01

Metronomic chemotherapy supports the idea that long-term, sustained, constant administration of chemotherapeutics, currently not achievable, could be effective against numerous cancers. Particularly appealing are liposomal formulations, used to solubilize hydrophobic therapeutics and minimize side effects, while extending drug circulation time and enabling passive targeting. As liposome alone cannot survive in circulation beyond 48 hrs, sustaining their constant plasma level for many days is a challenge. To address this, we developed, as a proof of concept, an implantable nanochannel delivery system and ultra-stable PEGylated lapatinib loaded-liposomes, and we demonstrate the release of intact vesicles for over 18 days. Further, we investigate intravasation kinetics of subcutaneously delivered liposomes and verify their biological activity post nanochannel release on BT474 breast cancer cells. The key innovation of this work is the combination of two nanotechnologies to exploit the synergistic effect of liposomes, demonstrated as passive-targeting vectors and nanofluidics to maintain therapeutic constant plasma levels. In principle, this approach could maximize efficacy of metronomic treatments. PMID:23881575

Analysis of the Impact of Realistic Wind Size Parameter on the Delft3D Model

NASA Astrophysics Data System (ADS)

Washington, M. H.; Kumar, S.

2017-12-01

The wind size parameter, which is the distance from the center of the storm to the location of the maximum winds, is currently a constant in the Delft3D model. As a result, the Delft3D model's output prediction of the water levels during a storm surge are inaccurate compared to the observed data. To address these issues, an algorithm to calculate a realistic wind size parameter for a given hurricane was designed and implemented using the observed water-level data for Hurricane Matthew. A performance evaluation experiment was conducted to demonstrate the accuracy of the model's prediction of water levels using the realistic wind size input parameter compared to the default constant wind size parameter for Hurricane Matthew, with the water level data observed from October 4th, 2016 to October 9th, 2016 from National Oceanic and Atmospheric Administration (NOAA) as a baseline. The experimental results demonstrate that the Delft3D water level output for the realistic wind size parameter, compared to the default constant size parameter, matches more accurately with the NOAA reference water level data.

The ϱ-ππ coupling constant in lattice gauge theory

NASA Astrophysics Data System (ADS)

Gottlieb, Steven; MacKenzie, Paul B.; Thacker, H. B.; Weingarten, Don

1984-01-01

We present a method for studying hadronic transitions in lattice gauge theory which requires computer time comparable to that required by recent hadron spectrum calculations. This method is applied to a calculation of the decay ϱ-->ππ. On leave from the Department of Physics, Indiana University, Bloomington, IN 47405, USA. Address after September 1, 1983: IBM, T.J. Watson Research Center, Yorktown Heights, NY 10598, USA.

The development of solar systems - Physical and cosmological considerations

NASA Astrophysics Data System (ADS)

Treder, H.-J.

Present knowledge of the evolution of the universe is addressed in terms of various philosophies, in particular Kantian philosophy. The formation of the solar system according to the theories of Kant and Laplace is reviewed and evaluated in terms of the time necessary to accomplish it. The significance of the Mach-Einstein ideas concerning inertia and Dirac's (1927) notion of a changing gravitational constant in this context is also considered.

Getting to No (Nuclear Weapons) with Iran: Will Coercive Diplomacy Work?

DTIC Science & Technology

2013-12-10

elucidates additional options to better address strategic ends, but with greater risk. Unless a grand bargain is attainable, the U.S. must likely accept...strategic ends, but likely with a substantial increase in risk. Unless an unspoken grand bargain is attainable, the U.S. must likely accept...adroit and vigilant application of counter- force at a series of constantly shifting geographical and political points, corresponding to the shifts

Identifying How Patient Portals May Be Effectively Used Among Mental Health Populations to Support Digital Inclusion: A Study Protocol.

PubMed

Strudwick, Gillian; Booth, Richard; Strauss, John

2018-01-01

Patient portals are secure online websites that allow patients access to their medical information from a particular healthcare organization. Currently, it is unknown how this technology can best be used to support patients with mental illness, and what types of indicators of portal adoption are meaningful to these patients. This study addresses this gap in our knowledge by obtaining the perspectives on this topic from patients, family members and Peer Support Workers.

Orthogonal Gaussian process models

DOE PAGES

Plumlee, Matthew; Joseph, V. Roshan

2017-01-01

Gaussian processes models are widely adopted for nonparameteric/semi-parametric modeling. Identifiability issues occur when the mean model contains polynomials with unknown coefficients. Though resulting prediction is unaffected, this leads to poor estimation of the coefficients in the mean model, and thus the estimated mean model loses interpretability. This paper introduces a new Gaussian process model whose stochastic part is orthogonal to the mean part to address this issue. As a result, this paper also discusses applications to multi-fidelity simulations using data examples.

Orthogonal Gaussian process models

DOE Office of Scientific and Technical Information (OSTI.GOV)

Plumlee, Matthew; Joseph, V. Roshan

Gaussian processes models are widely adopted for nonparameteric/semi-parametric modeling. Identifiability issues occur when the mean model contains polynomials with unknown coefficients. Though resulting prediction is unaffected, this leads to poor estimation of the coefficients in the mean model, and thus the estimated mean model loses interpretability. This paper introduces a new Gaussian process model whose stochastic part is orthogonal to the mean part to address this issue. As a result, this paper also discusses applications to multi-fidelity simulations using data examples.

Plasma filtering techniques for nuclear waste remediation

DOE PAGES

Gueroult, Renaud; Hobbs, David T.; Fisch, Nathaniel J.

2015-04-24

Nuclear waste cleanup is challenged by the handling of feed stocks that are both unknown and complex. Plasma filtering, operating on dissociated elements, offers advantages over chemical methods in processing such wastes. The costs incurred by plasma mass filtering for nuclear waste pretreatment, before ultimate disposal, are similar to those for chemical pretreatment. However, significant savings might be achieved in minimizing the waste mass. As a result, this advantage may be realized over a large range of chemical waste compositions, thereby addressing the heterogeneity of legacy nuclear waste.

Elder physical abuse.

PubMed

Young, Lisa M

2014-11-01

Physical abuse of the elderly is a significant public health concern. The true prevalence of all types is unknown, and under-reporting is known to be significant. The geriatric population is projected to increase dramatically over the next 10 years, and the number of abused individuals is projected to increase also. It is critical that health care providers feel competent in addressing physical elder abuse. This article presents cases illustrating the variety of presenting symptoms that may be attributed to physical elder abuse. Copyright © 2014 Elsevier Inc. All rights reserved.

Reclaiming Hope in Extinction Storytelling.

PubMed

Kohl, Patrice

2017-07-01

Critics often take conservationists to task for delivering a constant barrage of bad news without offering a compelling vision of the future. Could recent advances in synthetic biology-an optimistic, forward-looking field with a can-do attitude-let conservationists develop a new vision and generate some better news? Synthetic biology and related gene-editing applications could be used to address threats to species. Genetic interventions might also be used in plants to better protect biodiversity in U.S. rangelands and forests. One possibility has stood out in its ability to capture media attention and the public imagination-recreating extinct species. And perhaps a de-extinction story could counter the seemingly relentless negativity in biodiversity talk. De-extinction proponent Stewart Brand writes that resurrecting species could shift the "conservation story … from negative to positive, from constant whining and guilt-tripping to high fives and new excitement." So, why do many people in conservation oppose the de-extinction narrative? This essay is an inquiry into whether there are intrinsic social reactions to these types of conservation solutions that might offset their potential benefits. If genetic tools are to be applied to address conservation issues in a realistic and responsible way, their broader social-cultural implications deserve far more attention than they have so far received. © 2017 The Hastings Center.

The effects of task difficulty, novelty and the size of the search space on intrinsically motivated exploration.

PubMed

Baranes, Adrien F; Oudeyer, Pierre-Yves; Gottlieb, Jacqueline

2014-01-01

Devising efficient strategies for exploration in large open-ended spaces is one of the most difficult computational problems of intelligent organisms. Because the available rewards are ambiguous or unknown during the exploratory phase, subjects must act in intrinsically motivated fashion. However, a vast majority of behavioral and neural studies to date have focused on decision making in reward-based tasks, and the rules guiding intrinsically motivated exploration remain largely unknown. To examine this question we developed a paradigm for systematically testing the choices of human observers in a free play context. Adult subjects played a series of short computer games of variable difficulty, and freely choose which game they wished to sample without external guidance or physical rewards. Subjects performed the task in three distinct conditions where they sampled from a small or a large choice set (7 vs. 64 possible levels of difficulty), and where they did or did not have the possibility to sample new games at a constant level of difficulty. We show that despite the absence of external constraints, the subjects spontaneously adopted a structured exploration strategy whereby they (1) started with easier games and progressed to more difficult games, (2) sampled the entire choice set including extremely difficult games that could not be learnt, (3) repeated moderately and high difficulty games much more frequently than was predicted by chance, and (4) had higher repetition rates and chose higher speeds if they could generate new sequences at a constant level of difficulty. The results suggest that intrinsically motivated exploration is shaped by several factors including task difficulty, novelty and the size of the choice set, and these come into play to serve two internal goals-maximize the subjects' knowledge of the available tasks (exploring the limits of the task set), and maximize their competence (performance and skills) across the task set.

Causality Analysis: Identifying the Leading Element in a Coupled Dynamical System

PubMed Central

BozorgMagham, Amir E.; Motesharrei, Safa; Penny, Stephen G.; Kalnay, Eugenia

2015-01-01

Physical systems with time-varying internal couplings are abundant in nature. While the full governing equations of these systems are typically unknown due to insufficient understanding of their internal mechanisms, there is often interest in determining the leading element. Here, the leading element is defined as the sub-system with the largest coupling coefficient averaged over a selected time span. Previously, the Convergent Cross Mapping (CCM) method has been employed to determine causality and dominant component in weakly coupled systems with constant coupling coefficients. In this study, CCM is applied to a pair of coupled Lorenz systems with time-varying coupling coefficients, exhibiting switching between dominant sub-systems in different periods. Four sets of numerical experiments are carried out. The first three cases consist of different coupling coefficient schemes: I) Periodic–constant, II) Normal, and III) Mixed Normal/Non-normal. In case IV, numerical experiment of cases II and III are repeated with imposed temporal uncertainties as well as additive normal noise. Our results show that, through detecting directional interactions, CCM identifies the leading sub-system in all cases except when the average coupling coefficients are approximately equal, i.e., when the dominant sub-system is not well defined. PMID:26125157

The biological significance of storage granules in rat parathyroid cells.

PubMed

Setoguti, T; Inoue, Y; Wild, P

1995-10-01

Both prosecretory and storage granules are concomitantly formed at the trans Golgi network including the innermost Golgi cisterna. Prosecretory granules develop into small secretory granules that release their contents by exocytosis finely regulated by a complex mechanism for maintaining calcium homeostasis. In the rat parathyroid cells, storage granules are large secretory granules storing parathyroid hormone for an emergency supply. The hormone is rapidly discharged by exocytosis when serum calcium concentration is decreased. The granules are constantly produced even under conditions of low serum calcium concentration in the regions of 8 mg/dl. The granule content is constantly hydrolyzed when not discharged, leading to a decreased core and finally to the formation of vacuolar bodies. The fate of the vacuolar bodies is unknown. Hypercalcemic conditions accelerate hydrolysis. The threshold value of calcium concentration required for the release of storage granule contents is between 8.0 and 7.5 mg/dl and that of calcium concentration for accelerating degradation of storage granules is about 11.5 mg/dl. Sympathetic stimulation causes storage granules to be discharged regardless of hypercalcemia or hypocalcemia. Parasympathetic stimulation accelerates hydrolysis. The degradation of storage granules seems to be closely associated with an intracellular regulatory mechanism for parathyroid hormone secretion.

A Fourier method for the analysis of exponential decay curves.

PubMed

Provencher, S W

1976-01-01

A method based on the Fourier convolution theorem is developed for the analysis of data composed of random noise, plus an unknown constant "base line," plus a sum of (or an integral over a continuous spectrum of) exponential decay functions. The Fourier method's usual serious practical limitation of needing high accuracy data over a very wide range is eliminated by the introduction of convergence parameters and a Gaussian taper window. A computer program is described for the analysis of discrete spectra, where the data involves only a sum of exponentials. The program is completely automatic in that the only necessary inputs are the raw data (not necessarily in equal intervals of time); no potentially biased initial guesses concerning either the number or the values of the components are needed. The outputs include the number of components, the amplitudes and time constants together with their estimated errors, and a spectral plot of the solution. The limiting resolving power of the method is studied by analyzing a wide range of simulated two-, three-, and four-component data. The results seem to indicate that the method is applicable over a considerably wider range of conditions than nonlinear least squares or the method of moments.

Misuse of thermodynamics in the interpretation of isothermal titration calorimetry data for ligand binding to proteins.

PubMed

Pethica, Brian A

2015-03-01

Isothermal titration calorimetry (ITC) has given a mass of data on the binding of small molecules to proteins and other biopolymers, with particular interest in drug binding to proteins chosen as therapeutic indicators. Interpretation of the enthalpy data usually follows an unsound protocol that uses thermodynamic relations in circumstances where they do not apply. Errors of interpretation include incomplete definitions of ligand binding and equilibrium constants and neglect of the non-ideality of the solutions under study, leading to unreliable estimates of standard free energies and entropies of binding. The mass of reported thermodynamic functions for ligand binding to proteins estimated from ITC enthalpies alone is consequently of uncertain thermodynamic significance and utility. ITC and related experiments to test the protocol assumptions are indicated. A thermodynamic procedure avoiding equilibrium constants or other reaction models and not requiring protein activities is given. The discussion draws attention to the fundamental but neglected relation between the thermodynamic activity and bioactivity of drugs and to the generally unknown thermodynamic status of ligand solutions, which for drugs relates directly to effective therapeutic dosimetry. Copyright © 2014 Elsevier Inc. All rights reserved.

An effective medium approach to modelling the pressure-dependent electrical properties of porous rocks

NASA Astrophysics Data System (ADS)

Han, Tongcheng

2018-07-01

Understanding the electrical properties of rocks under varying pressure is important for a variety of geophysical applications. This study proposes an approach to modelling the pressure-dependent electrical properties of porous rocks based on an effective medium model. The so-named Textural model uses the aspect ratios and pressure-dependent volume fractions of the pores and the aspect ratio and electrical conductivity of the matrix grains. The pores were represented by randomly oriented stiff and compliant spheroidal shapes with constant aspect ratios, and their pressure-dependent volume fractions were inverted from the measured variation of total porosity with differential pressure using a dual porosity model. The unknown constant stiff and compliant pore aspect ratios and the aspect ratio and electrical conductivity of the matrix grains were inverted by best fitting the modelled electrical formation factor to the measured data. Application of the approach to three sandstone samples covering a broad porosity range showed that the pressure-dependent electrical properties can be satisfactorily modelled by the proposed approach. The results demonstrate that the dual porosity concept is sufficient to explain the electrical properties of porous rocks under pressure through the effective medium model scheme.

Dust grain characterization — Direct measurement of light scattering

NASA Astrophysics Data System (ADS)

BartoÅ, P.; Pavlů, J.

2018-01-01

Dust grains play a key role in dusty plasma since they interact with the plasma we can use them to study plasma itself. The grains are illuminated by visible light (e.g., a laser sheet) and the situation is captured with camera. Despite of simplicity, light scattering on similar-to-wavelength sized grains is complex phenomenon. Interaction of the electromagnetic wave with material has to be computed with respect to Maxwell equations — analytic solution is nowadays available only for several selected shapes like sphere, coated sphere, or infinite cylinder. Moreover, material constants needed for computations are usually unknown. For computation result verification and material constant determination, we designed and developed a device directly measur­ing light scattering profiles. Single dust grains are trapped in the ultrasonic field (so called "acoustic levitation") and illuminated by the laser beam. Scattered light is then measured by a photodiode mounted on rotating platform. Synchronous detection is employed for a noise reduction. This setup brings several benefits against conventional methods: (1) it works in the free air, (2) the measured grain is captured for a long time, and (3) the grain could be of arbitrary shape.

Use of the augmented Young-Laplace equation to model equilibrium and evaporating extended menisci

DOE Office of Scientific and Technical Information (OSTI.GOV)

DasGupta, S.; Schonberg, J.A.; Kim, I.Y.

1993-05-01

The generic importance of fluid flow and change-of-phase heat transfer in the contact line region of an extended meniscus has led to theoretical and experimental research on the details of these transport processes. Numerical solutions of equilibrium and nonequilibrium models based on the augmented Young-Laplace equation were successfully used to evaluate experimental data for an extended meniscus. The data for the equilibrium and nonequilibrium meniscus profiles were obtained optically using ellipsometry and image processing interferometry. A Taylor series expansion of the fourth-order nonlinear transport model was used to obtain the extremely sensitive initial conditions at the interline. The solid-liquid-vapor Hamakermore » constants for the systems were obtained from the experimental data. The consistency of the data was demonstrated by using the combining rules to calculate the unknown value of the Hamaker constant for the experimental substrate. The sensitivity of the meniscus profile to small changes in the environment was demonstrated. Both temperature and intermolecular forces need to be included in modeling transport processes in the contact line region because the chemical potential is a function of both temperature and pressure.« less

Sonneberg Plate Photometry for Boyajian’s Star in Two Passbands

NASA Astrophysics Data System (ADS)

Hippke, Michael; Kroll, Peter; Matthai, Frank; Angerhausen, Daniel; Tuvikene, Taavi; Stassun, Keivan G.; Roshchina, Elena; Vasileva, Tatyana; Izmailov, Igor; Samus, Nikolay N.; Pastukhova, Elena N.; Bryukhanov, Ivan; Lund, Michael B.

2017-03-01

The F3 main-sequence star KIC 8462852 (Boyajian’s Star) showed deep (up to 20%) day-long brightness dips of unknown cause during the four years of the Kepler mission. A 0.164 mag (16%) dimming between 1890 and 1990 was claimed, based on the analysis of photographic plates from the Harvard Observatory. We have gathered an independent set of historic plates from Sonneberg Observatory, Germany, covering the years of 1934-1995. With 861 mag in B, and 397 mag in V, we find the star to be of constant brightness within 0.03 mag per century (3%). Consistent outcomes are found using by-eye estimates of the best 119 plates. Results are supported by data from Sternberg Observatory, Moscow, which show the star as constant between 1895 and 1995. The previously claimed century-long dimming is inconsistent with our results at the 5σ -level, however, the recently reported modest dimming of 3% in the Kepler data is not inconsistent with our data. We find no periodicities or shorter trends within our limits of 5% per five year bin, but note a possible dimming event on 1978 October 24.

Algebraic solution for the forward displacement analysis of the general 6-6 stewart mechanism

NASA Astrophysics Data System (ADS)

Wei, Feng; Wei, Shimin; Zhang, Ying; Liao, Qizheng

2016-01-01

The solution for the forward displacement analysis(FDA) of the general 6-6 Stewart mechanism(i.e., the connection points of the moving and fixed platforms are not restricted to lying in a plane) has been extensively studied, but the efficiency of the solution remains to be effectively addressed. To this end, an algebraic elimination method is proposed for the FDA of the general 6-6 Stewart mechanism. The kinematic constraint equations are built using conformal geometric algebra(CGA). The kinematic constraint equations are transformed by a substitution of variables into seven equations with seven unknown variables. According to the characteristic of anti-symmetric matrices, the aforementioned seven equations can be further transformed into seven equations with four unknown variables by a substitution of variables using the Gröbner basis. Its elimination weight is increased through changing the degree of one variable, and sixteen equations with four unknown variables can be obtained using the Gröbner basis. A 40th-degree univariate polynomial equation is derived by constructing a relatively small-sized 9´9 Sylvester resultant matrix. Finally, two numerical examples are employed to verify the proposed method. The results indicate that the proposed method can effectively improve the efficiency of solution and reduce the computational burden because of the small-sized resultant matrix.

Early signs of recovery of Acropora palmata in St. John, US Virgin Islands

USGS Publications Warehouse

Muller, E.M.; Rogers, Caroline S.; van Woesik, R.

2014-01-01

Since the 1980s, diseases have caused significant declines in the population of the threatened Caribbean coral Acropora palmata. Yet it is largely unknown whether the population densities have recovered from these declines and whether there have been any recent shifts in size-frequency distributions toward large colonies. It is also unknown whether colony size influences the risk of disease infection, the most common stressor affecting this species. To address these unknowns, we examined A. palmata colonies at ten sites around St. John, US Virgin Islands, in 2004 and 2010. The prevalence of white-pox disease was highly variable among sites, ranging from 0 to 53 %, and this disease preferentially targeted large colonies. We found that colony density did not significantly change over the 6-year period, although six out of ten sites showed higher densities through time. The size-frequency distributions of coral colonies at all sites were positively skewed in both 2004 and 2010, however, most sites showed a temporal shift toward more large-sized colonies. This increase in large-sized colonies occurred despite the presence of white-pox disease, a severe bleaching event, and several storms. This study provides evidence of slow recovery of the A. palmata population around St. John despite the persistence of several stressors.

Evolved stars as complex chemical laboratories - the quest for gaseous chemistry

NASA Astrophysics Data System (ADS)

Katrien Els Decin, Leen

2015-08-01

At the end of their life, most stars lose a large fraction of their mass through a stellar wind. The stellar winds of evolved (super)giant stars are the dominant suppliers for the pristine building blocks of the interstellar medium (ISM). Crucial to the understanding of the chemical life cycle of the ISM is hence a profound insight in the chemical and physical structure governing these stellar winds.These winds are really unique chemical laboratories in which currently more than 70 different molecules and 15 different dust species are detected. Several chemical processes such as neutral-neutral and ion-molecule gas-phase reactions, dust nucleation and growth, and photo-processes determine the chemical content of these winds. However, gas-phase and dust-nucleation chemistry for astronomical environments still faces many challenges. One should realize that only ˜15% of the rate coefficients for gas-phase reactions considered to occur in (inter/circum)stellar regions at temperatures (T) below 300K have been subject to direct laboratory determinations and that the temperature dependence of the rate constants is often not known; only ˜2% have rate constants at T<200K and less than 0.5% at T<100 K. For stellar wind models, an important bottleneck occurs among the reactions involving silicon- and sulfur-bearing species, for which only a few have documented reaction rates. Often, researchers are implementing ‘educated guesses’ for these unknown rates, sometimes forcing the network to yield predictions concurring with (astronomical) observations. Large uncertainties are inherent in this type of ‘optimized’ chemical schemes.Thanks to an ERC-CoG grant, we are now in the position to solve some riddles involved in understanding the gas-phase chemistry in evolved stars. In this presentation, I will demonstrate the need for accurate temperature-dependent gas-phase reaction rate constants and will present our new laboratory equipment built to measure the rate constants for species key in stellar wind chemistry. Specifically, we aim to obtain the rate constants of reactions involving silicon- and sulphur bearing species and HCCO for 30

Different Amounts of DNA in Newborn Cells of Escherichia coli Preclude a Role for the Chromosome in Size Control According to the "Adder" Model.

PubMed

Huls, Peter G; Vischer, Norbert O E; Woldringh, Conrad L

2018-01-01

According to the recently-revived adder model for cell size control, newborn cells of Escherichia coli will grow and divide after having added a constant size or length, ΔL , irrespective of their size at birth. Assuming exponential elongation, this implies that large newborns will divide earlier than small ones. The molecular basis for the constant size increment is still unknown. As DNA replication and cell growth are coordinated, the constant ΔL could be based on duplication of an equal amount of DNA, ΔG , present in newborn cells. To test this idea, we measured amounts of DNA and lengths of nucleoids in DAPI-stained cells growing in batch culture at slow and fast rates. Deeply-constricted cells were divided in two subpopulations of longer and shorter lengths than average; these were considered to represent large and small prospective daughter cells, respectively. While at slow growth, large and small prospective daughter cells contained similar amounts of DNA, fast growing cells with multiforked replicating chromosomes, showed a significantly higher amount of DNA (20%) in the larger cells. This observation precludes the hypothesis that Δ L is based on the synthesis of a constant ΔG . Growth curves were constructed for siblings generated by asymmetric division and growing according to the adder model. Under the assumption that all cells at the same growth rate exhibit the same time between initiation of DNA replication and cell division (i.e., constant C+D -period), the constructions predict that initiation occurs at different sizes ( Li ) and that, at fast growth, large newborn cells transiently contain more DNA than small newborns, in accordance with the observations. Because the state of segregation, measured as the distance between separated nucleoids, was found to be more advanced in larger deeply-constricted cells, we propose that in larger newborns nucleoid separation occurs faster and at a shorter length, allowing them to divide earlier. We propose a composite model in which both differential initiation and segregation leads to an adder-like behavior of large and small newborn cells.

Distance measurements from supernovae and dark energy constraints

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang Yun

2009-12-15

Constraints on dark energy from current observational data are sensitive to how distances are measured from Type Ia supernova (SN Ia) data. We find that flux averaging of SNe Ia can be used to test the presence of unknown systematic uncertainties, and yield more robust distance measurements from SNe Ia. We have applied this approach to the nearby+SDSS+ESSENCE+SNLS+HST set of 288 SNe Ia, and the 'Constitution' set of 397 SNe Ia. Combining the SN Ia data with cosmic microwave background anisotropy data from Wilkinson Microwave Anisotropy Probe 5 yr observations, the Sloan Digital Sky Survey baryon acoustic oscillation measurements, themore » data of 69 gamma-ray bursts (GRBs) , and the Hubble constant measurement from the Hubble Space Telescope project SHOES, we measure the dark energy density function X(z){identical_to}{rho}{sub X}(z)/{rho}{sub X}(0) as a free function of redshift (assumed to be a constant at z>1 or z>1.5). Without the flux averaging of SNe Ia, the combined data using the Constitution set of SNe Ia seem to indicate a deviation from a cosmological constant at {approx}95% confidence level at 0 < or apporx. z < or approx. 0.8; they are consistent with a cosmological constant at {approx}68% confidence level when SNe Ia are flux averaged. The combined data using the nearby+SDSS+ESSENCE+SNLS+HST data set of SNe Ia are consistent with a cosmological constant at 68% confidence level with or without flux averaging of SNe Ia, and give dark energy constraints that are significantly more stringent than that using the Constitution set of SNe Ia. Assuming a flat Universe, dark energy is detected at >98% confidence level for z{<=}0.75 using the combined data with 288 SNe Ia from nearby+SDSS+ESSENCE+SNLS+HST, independent of the assumptions about X(z{>=}1). We quantify dark energy constraints without assuming a flat Universe using the dark energy figure of merit for both X(z) and a dark energy equation-of-state linear in the cosmic scale factor.« less

Photopic visual input is necessary for emmetropization in mice

PubMed Central

Tkatchenko, Tatiana V.; Shen, Yimin; Braun, Rod D.; Bawa, Gurinder; Kumar, Pradeep; Avrutsky, Ivan; Tkatchenko, Andrei V.

2013-01-01

It was recently demonstrated that refractive errors in mice stabilize around emmetropic values during early postnatal development, and that they develop experimental myopia in response to both visual form deprivation and imposed optical defocus similar to other vertebrate species. Animal studies also suggest that photopic vision plays critical role in emmetropization in diurnal species; however, it is unknown whether refractive eye development is guided by photopic vision in the mouse, which is a nocturnal species. We used an infrared mouse photorefractor and a high-resolution MRI to clarify the role of photopic visual input in refractive eye development in the mouse. Refractive eye development and form-deprivation myopia in P21-P89 C57BL/6J mice were analyzed under 12:12 h light-dark cycle, constant light and constant darkness regimens. Animals in all experimental groups were myopic at P21 (-13.2 ± 1.6 D, light-dark cycle; -12.5 ± 0.9 D, constant light; -12.5 ± 2.0 D, constant dark). The mean refractive error in the light-dark-cycle-reared animals was -0.5 ± 1.3 D at P32 and, and did not change significantly until P40 (+0.3 ± 0.6 D, P40). Animals in this group became progressively hyperopic between P40 and P89 (+2.2 ± 0.6, P67; +3.7 ± 2.0, P89). The mean refractive error in the constant-light-reared mice was -1.0 ± 0.7 D at P32 and remained stable until P89 (+0.1 ± 0.6, P40; +0.3 ± 0.6, P67; 0.0 ± 0.4, P89). Dark-reared animals exhibited highly hyperopic refractive errors at P32 (+5.2 ± 1.8) and became progressively more hyperopic with age (+8.7 ± 1.9, P40; +11.2 ± 1.4, P67). MRI analysis revealed that emmetropization in the P40-P89 constant-light-reared animals was associated with larger eyes, a longer axial length and a larger vitreous chamber compared to the light-dark-cycle-reared mice. Constant-light-reared mice also developed 4 times higher degrees of form-deprivation myopia on average compared to light-dark-cycle-reared animals (-12.0 ± 1.4, constant light; -2.7 ± 0.7, light-dark cycle). Dark-rearing completely prevented the development of form-deprivation myopia (-0.3 ± 0.5). Thus, photopic vision plays important role in normal refractive eye development and ocular response to visual form deprivation in the mouse. PMID:23838522

Quality of Prostate Cancer Treatment Information on Cancer Center Websites.

PubMed

Dulaney, Caleb; Barrett, Olivia Claire; Rais-Bahrami, Soroush; Wakefield, Daniel; Fiveash, John; Dobelbower, Michael

2016-04-20

Cancer center websites are trusted sources of internet information about treatment options for prostate cancer. The quality of information on these websites is unknown. The objective of this study was to evaluate the quality of information on cancer center websites addressing prostate cancer treatment options, outcomes, and toxicity. We evaluated the websites of all National Cancer Institute-designated cancer centers to determine if sufficient information was provided to address eleven decision-specific knowledge questions from the validated Early Prostate Cancer Treatment Decision Quality Instrument. We recorded the number of questions addressed, the number of clicks to reach the prostate cancer-specific webpage, evaluation time, and Spanish and mobile accessibility. Correlation between evaluation time and questions addressed were calculated using the Pearson coefficient. Sixty-three websites were reviewed. Eighty percent had a prostate cancer-specific webpage reached in a median of three clicks. The average evaluation time was 6.5 minutes. Information was available in Spanish on 24% of sites and 59% were mobile friendly. Websites provided sufficient information to address, on average, 19% of questions. No website addressed all questions. Evaluation time correlated with the number of questions addressed (R(2) = 0.42, p < 0.001). Cancer center websites provide insufficient information for men with localized prostate cancer due to a lack of information about and direct comparison of specific treatment outcomes and toxicities. Information is also less accessible in Spanish and on mobile devices. These data can be used to improve the quality and accessibility of prostate cancer treatment information on cancer center websites.

Recovering a full dimensional quantum rate constant from a reduced dimensionality calculation: Application to the OH+CO{r_arrow}H+CO{sub 2} reaction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dzegilenko, F.N.; Bowman, J.M.

1996-08-01

Two reduced dimensionality theories are used to calculate the thermal rate constant for the OH+CO{r_arrow}H+CO{sub 2} reaction. The standard theory employs energy-shift approximations to extract the full six degree-of-freedom quantum rate constant for this reaction from the previous two degree-of-freedom (2-DOF) quantum calculations of Hernandez and Clary [M.I. Hernandez and D.C. Clary, J. Chem. Phys. {bold 101}, 2779 (1994)]. Three extra bending modes and one extra {open_quote}{open_quote}spectator{close_quote}{close_quote} CO stretch mode are treated adiabatically in the harmonic fashion. The parameters of the exit channel transition state are used to evaluate the frequencies of those additional modes. A new reduced dimensionality theorymore » is also applied to this reaction. This theory explicitly addresses the finding from the 2-DOF calculations that the reaction proceeds mainly via complex formation. A J-shifting approximation has been used to take into account the initial states with non-zero values of total angular momentum in both reduced dimensionality theories. Cumulative reaction probabilities and thermal rate constants are calculated and compared with the previous quasiclassical and reduced dimensionality quantum calculations and with experiment. The rate constant from the new reduced dimensionality theory is between a factor of 5 and 100 times smaller than the statistical transition state theory result, and is in much better agreement with experiment. {copyright} {ital 1996 American Institute of Physics.}« less

Neglected parasitic infections in the United States: toxocariasis.

PubMed

Woodhall, Dana M; Eberhard, Mark L; Parise, Monica E

2014-05-01

Toxocariasis is a preventable parasitic disease that is caused by the dog and cat roundworms Toxocara cani and T. cati, respectively. Humans become infected when they accidently ingest infectious Toxocara eggs commonly found in contaminated soil; children are most often affected. Clinical manifestations of Toxocara infection in humans include ocular toxocariasis and visceral toxocariasis. Although infection with Toxocara can cause devastating disease, the burden of toxocariasis in the United States population remains unknown. In addition, risk factors for acquiring infection need to be better defined, and research needs to be conducted to better understand the pathophysiology and clinical course of toxocariasis. Development of diagnostic tests would enable clinicians to detect active infection, and determination of optimal drug regiments would ensure patients were appropriately treated. Addressing these public health gaps is necessary to understand and address the impact of toxocariasis in the United States.

Measuring public opinion on alcohol policy: a factor analytic study of a US probability sample.

PubMed

Latimer, William W; Harwood, Eileen M; Newcomb, Michael D; Wagenaar, Alexander C

2003-03-01

Public opinion has been one factor affecting change in policies designed to reduce underage alcohol use. Extant research, however, has been criticized for using single survey items of unknown reliability to define adult attitudes on alcohol policy issues. The present investigation addresses a critical gap in the literature by deriving scales on public attitudes, knowledge, and concerns pertinent to alcohol policies designed to reduce underage drinking using a US probability sample survey of 7021 adults. Five attitudinal scales were derived from exploratory and confirmatory factor analyses addressing policies to: (1) regulate alcohol marketing, (2) regulate alcohol consumption in public places, (3) regulate alcohol distribution, (4) increase alcohol taxes, and (5) regulate youth access. The scales exhibited acceptable psychometric properties and were largely consistent with a rational framework which guided the survey construction.

Global finite-time attitude stabilization for rigid spacecraft in the exponential coordinates

NASA Astrophysics Data System (ADS)

Shi, Xiao-Ning; Zhou, Zhi-Gang; Zhou, Di

2018-06-01

This paper addresses the global finite-time attitude stabilisation problem on the special orthogonal group (SO(3)) for a rigid spacecraft via homogeneous feedback approach. Considering the topological and geometric properties of SO(3), the logarithm map is utilised to transform the stabilisation problem on SO(3) into the one on its associated Lie algebra (?). A model-independent discontinuous state feedback plus dynamics compensation scheme is constructed to achieve the global finite-time attitude stabilisation in a coordinate-invariant way. In addition, to address the absence of angular velocity measurements, a sliding mode observer is proposed to reconstruct the unknown angular velocity information within finite time. Then, an observer-based finite-time output feedback control strategy is obtained. Numerical simulations are finally performed to demonstrate the effectiveness of the proposed finite-time controllers.

The optimal modified variational iteration method for the Lane-Emden equations with Neumann and Robin boundary conditions

NASA Astrophysics Data System (ADS)

Singh, Randhir; Das, Nilima; Kumar, Jitendra

2017-06-01

An effective analytical technique is proposed for the solution of the Lane-Emden equations. The proposed technique is based on the variational iteration method (VIM) and the convergence control parameter h . In order to avoid solving a sequence of nonlinear algebraic or complicated integrals for the derivation of unknown constant, the boundary conditions are used before designing the recursive scheme for solution. The series solutions are found which converges rapidly to the exact solution. Convergence analysis and error bounds are discussed. Accuracy, applicability of the method is examined by solving three singular problems: i) nonlinear Poisson-Boltzmann equation, ii) distribution of heat sources in the human head, iii) second-kind Lane-Emden equation.

Self-Stabilizing Measurement of Phase

NASA Astrophysics Data System (ADS)

Vinjanampathy, Sai

2014-05-01

Measuring phase accurately constitutes one of the most important task in precision measurement science. Such measurements can be deployed to measure everything from fundamental constants to measuring detuning and tunneling rates of atoms more precisely. Quantum mechanics enhances the ultimate bounds on the precision of such measurements possible, and exploit coherence and entanglement to reduce the phase uncertainty. In this work, we will describe a method to stabilize a decohering two-level atom and use the stabilizing measurements to learn the unknown phase acquired by the atom. Such measurements will employ a Bayesian learner to do active feedback control on the atom. We will discuss some ultimate bounds employed in precision metrology and an experimental proposal for the implementation of this scheme. Financial support from Ministry of Education, Singapore.

Self-Evaluation of PANDA-FBG Based Sensing System for Dynamic Distributed Strain and Temperature Measurement.

PubMed

Zhu, Mengshi; Murayama, Hideaki; Wada, Daichi

2017-10-12

A novel method is introduced in this work for effectively evaluating the performance of the PANDA type polarization-maintaining fiber Bragg grating (PANDA-FBG) distributed dynamic strain and temperature sensing system. Conventionally, the errors during the measurement are unknown or evaluated by using other sensors such as strain gauge and thermocouples. This will make the sensing system complicated and decrease the efficiency since more than one kind of sensor is applied for the same measurand. In this study, we used the approximately constant ratio of primary errors in strain and temperature measurement and realized the self-evaluation of the sensing system, which can significantly enhance the applicability, as well as the reliability in strategy making.

The degradation of bioactive peptides and proteins by dipeptidyl peptidase IV from human placenta.

PubMed

Nausch, I; Mentlein, R; Heymann, E

1990-11-01

The degradation of several bioactive peptides and proteins by purified human dipeptidyl peptidase IV is reported. It was hitherto unknown that human gastrin-releasing peptide, human chorionic gonadotropin, human pancreatic polypeptide, sheep prolactin, aprotinin, corticotropin-like intermediate lobe peptide and (Tyr-)melanostatin are substrates of this peptidase. Kinetic constants were determined for the degradation of a number of other natural peptides, including substance P, the degradation of which has been described earlier in a qualitative manner. Generally, small peptides are degraded much more rapidly than proteins. However, the Km-values seem to be independent of the peptide chain length. The influence of the action of dipeptidyl peptidase IV on the biological function of peptides and proteins is discussed.

Relational symplectic groupoid quantization for constant poisson structures

NASA Astrophysics Data System (ADS)

Cattaneo, Alberto S.; Moshayedi, Nima; Wernli, Konstantin

2017-09-01

As a detailed application of the BV-BFV formalism for the quantization of field theories on manifolds with boundary, this note describes a quantization of the relational symplectic groupoid for a constant Poisson structure. The presence of mixed boundary conditions and the globalization of results are also addressed. In particular, the paper includes an extension to space-times with boundary of some formal geometry considerations in the BV-BFV formalism, and specifically introduces into the BV-BFV framework a "differential" version of the classical and quantum master equations. The quantization constructed in this paper induces Kontsevich's deformation quantization on the underlying Poisson manifold, i.e., the Moyal product, which is known in full details. This allows focussing on the BV-BFV technology and testing it. For the inexperienced reader, this is also a practical and reasonably simple way to learn it.

Use of smartphone technology in cardiology.

PubMed

Nguyen, Hoang H; Silva, Jennifer N A

2016-05-01

Smartphone-based technologies along with broadband connectivity are changing the way modern cardiology is practiced. The ever broadening connectivity and increasing capabilities of smartphone-based technologies can better monitor, diagnose, and prevent cardiovascular diseases. Researchers can leverage the ubiquitous use of smartphone-based technologies and their constant stream of biometric data to establish large community-based clinical research studies. Patient engagement is enhanced with constant and on-demand access to physicians, daily self-monitoring, and expanding social networks. On the other hand, the exponential growth of smartphone-based technologies invariably disrupts the traditional healthcare model and leaves a vacuum in the infrastructure, medico-legal apparatus, and reimbursement systems that need to be addressed. In this review, we present a comprehensive discussion of the various applications utilizing smartphone-based technologies in cardiology. Copyright © 2016 Elsevier Inc. All rights reserved.

Stability of Dirac Liquids with Strong Coulomb Interaction.

PubMed

Tupitsyn, Igor S; Prokof'ev, Nikolay V

2017-01-13

We develop and apply the diagrammatic Monte Carlo technique to address the problem of the stability of the Dirac liquid state (in a graphene-type system) against the strong long-range part of the Coulomb interaction. So far, all attempts to deal with this problem in the field-theoretical framework were limited either to perturbative or random phase approximation and functional renormalization group treatments, with diametrically opposite conclusions. Our calculations aim at the approximation-free solution with controlled accuracy by computing vertex corrections from higher-order skeleton diagrams and establishing the renormalization group flow of the effective Coulomb coupling constant. We unambiguously show that with increasing the system size L (up to ln(L)∼40), the coupling constant always flows towards zero; i.e., the two-dimensional Dirac liquid is an asymptotically free T=0 state with divergent Fermi velocity.

Adjusted Analyses in Studies Addressing Therapy and Harm: Users' Guides to the Medical Literature.

PubMed

Agoritsas, Thomas; Merglen, Arnaud; Shah, Nilay D; O'Donnell, Martin; Guyatt, Gordon H

2017-02-21

Observational studies almost always have bias because prognostic factors are unequally distributed between patients exposed or not exposed to an intervention. The standard approach to dealing with this problem is adjusted or stratified analysis. Its principle is to use measurement of risk factors to create prognostically homogeneous groups and to combine effect estimates across groups.The purpose of this Users' Guide is to introduce readers to fundamental concepts underlying adjustment as a way of dealing with prognostic imbalance and to the basic principles and relative trustworthiness of various adjustment strategies.One alternative to the standard approach is propensity analysis, in which groups are matched according to the likelihood of membership in exposed or unexposed groups. Propensity methods can deal with multiple prognostic factors, even if there are relatively few patients having outcome events. However, propensity methods do not address other limitations of traditional adjustment: investigators may not have measured all relevant prognostic factors (or not accurately), and unknown factors may bias the results.A second approach, instrumental variable analysis, relies on identifying a variable associated with the likelihood of receiving the intervention but not associated with any prognostic factor or with the outcome (other than through the intervention); this could mimic randomization. However, as with assumptions of other adjustment approaches, it is never certain if an instrumental variable analysis eliminates bias.Although all these approaches can reduce the risk of bias in observational studies, none replace the balance of both known and unknown prognostic factors offered by randomization.

RecutClub.com: An Open Source, Whole Slide Image-based Pathology Education System

PubMed Central

Christensen, Paul A.; Lee, Nathan E.; Thrall, Michael J.; Powell, Suzanne Z.; Chevez-Barrios, Patricia; Long, S. Wesley

2017-01-01

Background: Our institution's pathology unknown conferences provide educational cases for our residents. However, the cases have not been previously available digitally, have not been collated for postconference review, and were not accessible to a wider audience. Our objective was to create an inexpensive whole slide image (WSI) education suite to address these limitations and improve the education of pathology trainees. Materials and Methods: We surveyed residents regarding their preference between four unique WSI systems. We then scanned weekly unknown conference cases and study set cases and uploaded them to our custom built WSI viewer located at RecutClub.com. We measured site utilization and conference participation. Results: Residents preferred our OpenLayers WSI implementation to Ventana Virtuoso, Google Maps API, and OpenSlide. Over 16 months, we uploaded 1366 cases from 77 conferences and ten study sets, occupying 793.5 GB of cloud storage. Based on resident evaluations, the interface was easy to use and demonstrated minimal latency. Residents are able to review cases from home and from their mobile devices. Worldwide, 955 unique IP addresses from 52 countries have viewed cases in our site. Conclusions: We implemented a low-cost, publicly available repository of WSI slides for resident education. Our trainees are very satisfied with the freedom to preview either the glass slides or WSI and review the WSI postconference. Both local users and worldwide users actively and repeatedly view cases in our study set. PMID:28382224

Understanding the kinetics of the ClO dimer cycle

NASA Astrophysics Data System (ADS)

von Hobe, M.; Salawitch, R. J.; Canty, T.; Keller-Rudek, H.; Moortgat, G. K.; Grooß, J.-U.; Müller, R.; Stroh, F.

2006-08-01

Among the major factors controlling ozone loss in the polar winter is the kinetics of the ClO dimer catalytic cycle. The most important issues are the thermal equilibrium between ClO and Cl2O2, the rate of Cl2O2 formation, and the Cl2O2 photolysis rate. All these issues have been addressed in a large number of laboratory, field and theoretical studies, but large discrepancies between individual results exist and a self-consistent set of parameters compatible with field observations of ClO and Cl2O2 has not been identified. Here, we use thermodynamic calculations and unimolecular rate theory to constrain the ClO/Cl2O2 equilibrium constant and the rate constants for Cl2O2 formation and dissociation. This information is used together with available atmospheric data to examine Cl2O2 photolysis rates based on different Cl2O2 absorption cross sections. Good overall consistency is achieved using a ClO/Cl2O2 equilibrium constant recently suggested by Plenge et al. (2005), the Cl2O2 recombination rate constant reported by Nickolaisen et al. (1994) and Cl2O2 photolysis rates based on averaged absorption cross sections that are roughly intermediate between the JPL 2002 assessment and a laboratory study by Burkholder et al. (1990).

Accelerating Sequential Gaussian Simulation with a constant path

NASA Astrophysics Data System (ADS)

Nussbaumer, Raphaël; Mariethoz, Grégoire; Gravey, Mathieu; Gloaguen, Erwan; Holliger, Klaus

2018-03-01

Sequential Gaussian Simulation (SGS) is a stochastic simulation technique commonly employed for generating realizations of Gaussian random fields. Arguably, the main limitation of this technique is the high computational cost associated with determining the kriging weights. This problem is compounded by the fact that often many realizations are required to allow for an adequate uncertainty assessment. A seemingly simple way to address this problem is to keep the same simulation path for all realizations. This results in identical neighbourhood configurations and hence the kriging weights only need to be determined once and can then be re-used in all subsequent realizations. This approach is generally not recommended because it is expected to result in correlation between the realizations. Here, we challenge this common preconception and make the case for the use of a constant path approach in SGS by systematically evaluating the associated benefits and limitations. We present a detailed implementation, particularly regarding parallelization and memory requirements. Extensive numerical tests demonstrate that using a constant path allows for substantial computational gains with very limited loss of simulation accuracy. This is especially the case for a constant multi-grid path. The computational savings can be used to increase the neighbourhood size, thus allowing for a better reproduction of the spatial statistics. The outcome of this study is a recommendation for an optimal implementation of SGS that maximizes accurate reproduction of the covariance structure as well as computational efficiency.

Assessing the New Literacies of Online Reading Comprehension: An Informative Interview with W. Ian O'Byrne, Lisa Zawilinski, J. Greg McVerry, and Donald J. Leu at the University of Connecticut

ERIC Educational Resources Information Center

Mokhtari, Kouider; Kymes, Angel; Edwards, Patricia

2008-01-01

The constantly changing nature of literacy, brought about by the Internet and other forms of information and communication technologies (ICTs), has pressed researchers and practitioners to seek new ways of addressing the complexities of reading comprehension and writing on and with the Internet. In this brief interview, members of the New…

Achieving Interoperability Through Base Registries for Governmental Services and Document Management

NASA Astrophysics Data System (ADS)

Charalabidis, Yannis; Lampathaki, Fenareti; Askounis, Dimitris

As digital infrastructures increase their presence worldwide, following the efforts of governments to provide citizens and businesses with high-quality one-stop services, there is a growing need for the systematic management of those newly defined and constantly transforming processes and electronic documents. E-government Interoperability Frameworks usually cater to the technical standards of e-government systems interconnection, but do not address service composition and use by citizens, businesses, or other administrations.

China Report: Science and Technology, No. 209. China Addresses Environmental Issues -- 1/83

DTIC Science & Technology

1983-10-12

determines suc- cess or failure of a plan. The steps in planning can be divided into two stages , preparation and planning. The preparation stage ...Noise Control Legislation Requirements Surveyed (Wen Bobing; FAXUE YANJIU, No 6, 1982)........... 21 System of Two -Fines in...with constant improvement in economic results, it is necessary to adopt the two phase strategic plan of laying a good foundation in the first 10 years

Infrared Chemiluminescence Studies of Ion-Molecule Reactions in a Flowing Afterglow.

DTIC Science & Technology

1982-01-01

reaction rate constants and branching ratios have been addressed in drift tubes and flow drift systems, and the translational energy distribution of atomic...composed of about 40 thin cylindrical sections of flow tube , separated by mylar spacers and connected by precision resistors. In the region of LIF... tube radius (Albritton, 1967). For proper operation of a drift tube , ionic species of only one polarity can be present. Efficient separation of

Mobile Interactive Training: Tablets, Readers, and Phones - Oh, My!

DTIC Science & Technology

2011-12-01

the interactive PDF, it was not possible to devise a one-size- fits -all solution. Instead, each type of interaction had to be addressed...determined they could automate this process by using Flash to export the individual frames of the slideshow and to produce a text file with the appropriate...now to create Web-enabled HUDs that can be integrated into eyeglasses and contact lenses. Only one thing remains constant with every new Web

Parameter Identification

DTIC Science & Technology

1979-11-01

Science Aeronautique, Vol. 6, pp. 38-49, 1950. 9. Anon.: "Methods of testing at constant attitude", ICAO Circular 16-AN/13, 1951. 10. H.L. Jonkers...spectral density analysis, it was determined that a notch filter at 17.7 hertz and a third-order Butterworth low-pass filter with a break frequency of 20...of the effects of specific errors, they are circular in nature and do not address the basic theoretical problem. Therefore, the Cramer-Rao bound

Health Extension in New Mexico: An Academic Health Center and the Social Determinants of Disease

PubMed Central

Kaufman, Arthur; Powell, Wayne; Alfero, Charles; Pacheco, Mario; Silverblatt, Helene; Anastasoff, Juliana; Ronquillo, Francisco; Lucero, Ken; Corriveau, Erin; Vanleit, Betsy; Alverson, Dale; Scott, Amy

2010-01-01

The Agricultural Cooperative Extension Service model offers academic health centers methodologies for community engagement that can address the social determinants of disease. The University of New Mexico Health Sciences Center developed Health Extension Rural Offices (HEROs) as a vehicle for its model of health extension. Health extension agents are located in rural communities across the state and are supported by regional coordinators and the Office of the Vice President for Community Health at the Health Sciences Center. The role of agents is to work with different sectors of the community in identifying high-priority health needs and linking those needs with university resources in education, clinical service and research. Community needs, interventions, and outcomes are monitored by county health report cards. The Health Sciences Center is a large and varied resource, the breadth and accessibility of which are mostly unknown to communities. Community health needs vary, and agents are able to tap into an array of existing health center resources to address those needs. Agents serve a broader purpose beyond immediate, strictly medical needs by addressing underlying social determinants of disease, such as school retention, food insecurity, and local economic development. Developing local capacity to address local needs has become an overriding concern. Community-based health extension agents can effectively bridge those needs with academic health center resources and extend those resources to address the underlying social determinants of disease. PMID:20065282

Potassium conductance dynamics confer robust spike-time precision in a neuromorphic model of the auditory brain stem

PubMed Central

Boahen, Kwabena

2013-01-01

A fundamental question in neuroscience is how neurons perform precise operations despite inherent variability. This question also applies to neuromorphic engineering, where low-power microchips emulate the brain using large populations of diverse silicon neurons. Biological neurons in the auditory pathway display precise spike timing, critical for sound localization and interpretation of complex waveforms such as speech, even though they are a heterogeneous population. Silicon neurons are also heterogeneous, due to a key design constraint in neuromorphic engineering: smaller transistors offer lower power consumption and more neurons per unit area of silicon, but also more variability between transistors and thus between silicon neurons. Utilizing this variability in a neuromorphic model of the auditory brain stem with 1,080 silicon neurons, we found that a low-voltage-activated potassium conductance (gKL) enables precise spike timing via two mechanisms: statically reducing the resting membrane time constant and dynamically suppressing late synaptic inputs. The relative contribution of these two mechanisms is unknown because blocking gKL in vitro eliminates dynamic adaptation but also lengthens the membrane time constant. We replaced gKL with a static leak in silico to recover the short membrane time constant and found that silicon neurons could mimic the spike-time precision of their biological counterparts, but only over a narrow range of stimulus intensities and biophysical parameters. The dynamics of gKL were required for precise spike timing robust to stimulus variation across a heterogeneous population of silicon neurons, thus explaining how neural and neuromorphic systems may perform precise operations despite inherent variability. PMID:23554436

Motoneuron membrane potentials follow a time inhomogeneous jump diffusion process.

PubMed

Jahn, Patrick; Berg, Rune W; Hounsgaard, Jørn; Ditlevsen, Susanne

2011-11-01

Stochastic leaky integrate-and-fire models are popular due to their simplicity and statistical tractability. They have been widely applied to gain understanding of the underlying mechanisms for spike timing in neurons, and have served as building blocks for more elaborate models. Especially the Ornstein-Uhlenbeck process is popular to describe the stochastic fluctuations in the membrane potential of a neuron, but also other models like the square-root model or models with a non-linear drift are sometimes applied. Data that can be described by such models have to be stationary and thus, the simple models can only be applied over short time windows. However, experimental data show varying time constants, state dependent noise, a graded firing threshold and time-inhomogeneous input. In the present study we build a jump diffusion model that incorporates these features, and introduce a firing mechanism with a state dependent intensity. In addition, we suggest statistical methods to estimate all unknown quantities and apply these to analyze turtle motoneuron membrane potentials. Finally, simulated and real data are compared and discussed. We find that a square-root diffusion describes the data much better than an Ornstein-Uhlenbeck process with constant diffusion coefficient. Further, the membrane time constant decreases with increasing depolarization, as expected from the increase in synaptic conductance. The network activity, which the neuron is exposed to, can be reasonably estimated to be a threshold version of the nerve output from the network. Moreover, the spiking characteristics are well described by a Poisson spike train with an intensity depending exponentially on the membrane potential.

Pupil size tracks perceptual content and surprise.

PubMed

Kloosterman, Niels A; Meindertsma, Thomas; van Loon, Anouk M; Lamme, Victor A F; Bonneh, Yoram S; Donner, Tobias H

2015-04-01

Changes in pupil size at constant light levels reflect the activity of neuromodulatory brainstem centers that control global brain state. These endogenously driven pupil dynamics can be synchronized with cognitive acts. For example, the pupil dilates during the spontaneous switches of perception of a constant sensory input in bistable perceptual illusions. It is unknown whether this pupil dilation only indicates the occurrence of perceptual switches, or also their content. Here, we measured pupil diameter in human subjects reporting the subjective disappearance and re-appearance of a physically constant visual target surrounded by a moving pattern ('motion-induced blindness' illusion). We show that the pupil dilates during the perceptual switches in the illusion and a stimulus-evoked 'replay' of that illusion. Critically, the switch-related pupil dilation encodes perceptual content, with larger amplitude for disappearance than re-appearance. This difference in pupil response amplitude enables prediction of the type of report (disappearance vs. re-appearance) on individual switches (receiver-operating characteristic: 61%). The amplitude difference is independent of the relative durations of target-visible and target-invisible intervals and subjects' overt behavioral report of the perceptual switches. Further, we show that pupil dilation during the replay also scales with the level of surprise about the timing of switches, but there is no evidence for an interaction between the effects of surprise and perceptual content on the pupil response. Taken together, our results suggest that pupil-linked brain systems track both the content of, and surprise about, perceptual events. © 2015 Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

Appetite course over time and the risk of death in patients on chronic hemodialysis.

PubMed

Bossola, Maurizio; Di Stasio, Enrico; Rosa, Fausto; Dominici, Loredana; Antocicco, Manuela; Pazzaglia, Costanza; Aprile, Irene; Tazza, Luigi

2013-08-01

Appetite in patients on chronic hemodialysis (HD) may be constantly very good/good or fair/poor or may fluctuate up and down over time. When constantly fair/poor, appetite has been shown to be associated with older age, more comorbidities, and more hospitalizations; however, it is unknown if it predicts survival. The aim of the present study was to assess appetite monthly for 6 months in patients on chronic HD and to determine if the course of appetite over time predicts mortality. Ninety-two HD patients were evaluated at baseline for appetite, nutritional and inflammatory markers, comorbid conditions, and Charlson's comorbidity index. Appetite assessment was repeated monthly for 6 consecutive months. Survival in relation with the course of appetite over time was determined. Appetite was constantly very good/good in 45 patients (Group 1), fair/poor/very poor in 30 (Group 2), and fluctuated in 17 (Group 3). Twenty-seven (29.3 %) patients died after a mean period of 28 ± 13 months. Overall, the mean survival time was 42.1 ± 1.2 months. For Groups 1, 2, and 3, the mean survival time was 46.1 ± 0.92, 37.9 ± 2.5, and 39.1 ± 3.7 months, respectively (p < 0.0001). After multivariate logistic regression analysis, the course of appetite over time was not found to be an independent risk factor for mortality. The course of appetite over time does not seem to predict mortality in patients on chronic hemodialysis. Considering that the study included a relatively small number of patients, larger similar studies are desirable.

Pre-steady-state kinetic analysis of the three Escherichia coli pseudouridine synthases TruB, TruA, and RluA reveals uniformly slow catalysis

PubMed Central

Wright, Jaden R.; Keffer-Wilkes, Laura C.; Dobing, Selina R.; Kothe, Ute

2011-01-01

Pseudouridine synthases catalyze formation of the most abundant modification of functional RNAs by site-specifically isomerizing uridines to pseudouridines. While the structure and substrate specificity of these enzymes have been studied in detail, the kinetic and the catalytic mechanism of pseudouridine synthases remain unknown. Here, the first pre-steady-state kinetic analysis of three Escherichia coli pseudouridine synthases is presented. A novel stopped-flow absorbance assay revealed that substrate tRNA binding by TruB takes place in two steps with an overall rate of 6 sec−1. In order to observe catalysis of pseudouridine formation directly, the traditional tritium release assay was adapted for the quench-flow technique, allowing, for the first time, observation of a single round of pseudouridine formation. Thereby, the single-round rate constant of pseudouridylation (kΨ) by TruB was determined to be 0.5 sec−1. This rate constant is similar to the kcat obtained under multiple-turnover conditions in steady-state experiments, indicating that catalysis is the rate-limiting step for TruB. In order to investigate if pseudouridine synthases are characterized by slow catalysis in general, the rapid kinetic quench-flow analysis was also performed with two other E. coli enzymes, RluA and TruA, which displayed rate constants of pseudouridine formation of 0.7 and 0.35 sec−1, respectively. Hence, uniformly slow catalysis might be a general feature of pseudouridine synthases that share a conserved catalytic domain and supposedly use the same catalytic mechanism. PMID:21998096

Quantitative ultrasonic testing of acoustically anisotropic materials with verification on austenitic and dissimilar weld joints

NASA Astrophysics Data System (ADS)

Boller, C.; Pudovikov, S.; Bulavinov, A.

2012-05-01

Austenitic stainless steel materials are widely used in a variety of industry sectors. In particular, the material is qualified to meet the design criteria of high quality in safety related applications. For example, the primary loop of the most of the nuclear power plants in the world, due to high durability and corrosion resistance, is made of this material. Certain operating conditions may cause a range of changes in the integrity of the component, and therefore require nondestructive testing at reasonable intervals. These in-service inspections are often performed using ultrasonic techniques, in particular when cracking is of specific concern. However, the coarse, dendritic grain structure of the weld material, formed during the welding process, is extreme and unpredictably anisotropic. Such structure is no longer direction-independent to the ultrasonic wave propagation; therefore, the ultrasonic beam deflects and redirects and the wave front becomes distorted. Thus, the use of conventional ultrasonic testing techniques using fixed beam angles is very limited and the application of ultrasonic Phased Array techniques becomes desirable. The "Sampling Phased Array" technique, invented and developed by Fraunhofer IZFP, allows the acquisition of time signals (A-scans) for each individual transducer element of the array along with fast image reconstruction techniques based on synthetic focusing algorithms. The reconstruction considers the sound propagation from each image pixel to the individual sensor element. For anisotropic media, where the sound beam is deflected and the sound path is not known a-priori, a novel phase adjustment technique called "Reverse Phase Matching" is implemented. By taking into account the anisotropy and inhomogeneity of the weld structure, a ray tracing algorithm for modeling the acoustic wave propagation and calculating the sound propagation time is applied. This technique can be utilized for 2D and 3D real time image reconstruction. The "Gradient Constant Descent Method" (GECDM), an iterative algorithm, is implemented, which is essential for examination of inhomogeneous anisotropic media having unknown properties (elastic constants). The Sampling Phased Array technique with Reverse Phase Matching extended by GECDM-technique determines unknown elastic constants and provides reliable and efficient quantitative flaw detection in the austenitic welds. The validation of ray-tracing algorithm and GECDM-method is performed by number of experiments on test specimens with artificial as well as natural material flaws. A mechanized system for ultrasonic testing of stainless steel and dissimilar welds is developed. The system works on both conventional and Sampling Phased Array techniques. The new frontend ultrasonic unit with optical data link allows the 3D visualization of the inspection results in real time.

Revealing a circadian clock in captive arctic-breeding songbirds, lapland longspurs (Calcarius lapponicus), under constant illumination.

PubMed

Ashley, Noah T; Ubuka, Takayoshi; Schwabl, Ingrid; Goymann, Wolfgang; Salli, Brady M; Bentley, George E; Buck, C Loren

2014-12-01

Most organisms in temperate or tropic regions employ the light-dark (LD) cycle as the primary Zeitgeber to synchronize circadian rhythms. At higher latitudes (>66°33'), continuous illumination during the summer presents a significant time-keeping dilemma for polar-adapted species. Lapland longspurs (Calcarius lapponicus), arctic-breeding migratory songbirds, are one of the few recorded species maintaining an intact diel rhythm in activity and plasma melatonin titers during polar summer. However, it is unknown whether rhythms are endogenous and entrain to low-amplitude polar Zeitgeber signals, such as daily variations in light intensity and the spectral composition of the sun (as measured by color temperature). Wild-caught male and female longspurs were brought into captivity, and locomotor activity was assessed using infrared detection. To examine if rhythms were endogenous, birds were exposed to constant bright light (LL; 1300 lux) or constant darkness (DD; 0.1 lux). All birds exhibited free-running activity rhythms in LL and DD, suggesting the presence of a functional circadian clock. Mean periods in LL (22.86 h) were significantly shorter than those in DD (23.5 h), in accordance with Aschoff's rule. No birds entrained to diel changes in light intensity, color temperature, or both. To examine endogenous molecular clock function, the Per2 gene was partially cloned in longspurs (llPer2) and transcripts were measured in hypothalamic tissue punches, eye, and liver using competitive polymerase chain reaction. Ocular llPer2 gene expression was periodic in LL and elevated at ZT24 (CT24) for LD or constant conditions (LL and DD), but llPer2 rhythmicity was not detected in hypothalamus or liver. Plasma melatonin was significantly lower in LL compared with LD or DD. In conclusion, rhythmic ocular Per2 expression and melatonin secretion may maintain the circadian activity rhythm across the polar day. © 2014 The Author(s).

A flowing partially penetrating well in a finite-thickness aquifer: a mixed-type initial boundary value problem

NASA Astrophysics Data System (ADS)

Chang, Chien-Chieh; Chen, Chia-Shyun

2003-02-01

An analytical approach using integral transform techniques is developed to deal with a well hydraulics model involving a mixed boundary of a flowing partially penetrating well, where constant drawdown is stipulated along the well screen and no-flux condition along the remaining unscreened part. The aquifer is confined of finite thickness. First, the mixed boundary is changed into a homogeneous Neumann boundary by discretizing the well screen into a finite number of segments, each of which at constant drawdown is subject to unknown a priori well bore flux. Then, the Laplace and the finite Fourier transforms are used to solve this modified model. Finally, the prescribed constant drawdown condition is reinstated to uniquely determine the well bore flux function, and to restore the relation between the solution and the original model. The transient and the steady-state solutions for infinite aquifer thickness can be derived from the semi-analytical solution, complementing the currently available dual integral solution. If the distance from the edge of the well screen to the bottom/top of the aquifer is 100 times greater than the well screen length, aquifer thickness can be assumed infinite for times of practical significance, and groundwater flow can reach a steady-state condition, where the well will continuously supply water under a constant discharge. However, if aquifer thickness is smaller, the well discharge decreases with time. The partial penetration effect is most pronounced in the vicinity of the flowing well, decreases with increasing horizontal distance, and vanishes at distances larger than 1-2 times the aquifer thickness divided by the square root of aquifer anisotropy. The horizontal hydraulic conductivity and the specific storage coefficient can be determined from vertically averaged drawdown as measured by fully penetrating observation wells. The vertical hydraulic conductivity can be determined from the well discharge under two particular partial penetration conditions.

The contribution of local features to familiarity judgments in music.

PubMed

Bigand, Emmanuel; Gérard, Yannick; Molin, Paul

2009-07-01

The contributions of local and global features to object identification depend upon the context. For example, while local features play an essential role in identification of words and objects, the global features are more influential in face recognition. In order to evaluate the respective strengths of local and global features for face recognition, researchers usually ask participants to recognize human faces (famous or learned) in normal and scrambled pictures. In this paper, we address a similar issue in music. We present the results of an experiment in which musically untrained participants were asked to differentiate famous from unknown musical excerpts that were presented in normal or scrambled ways. Manipulating the size of the temporal window on which the scrambling procedure was applied allowed us to evaluate the minimal length of time necessary for participants to make a familiarity judgment. Quite surprisingly, the minimum duration for differentiation of famous from unknown pieces is extremely short. This finding highlights the contribution of very local features to music memory.

Robust approximation-free prescribed performance control for nonlinear systems and its application

NASA Astrophysics Data System (ADS)

Sun, Ruisheng; Na, Jing; Zhu, Bin

2018-02-01

This paper presents a robust prescribed performance control approach and its application to nonlinear tail-controlled missile systems with unknown dynamics and uncertainties. The idea of prescribed performance function (PPF) is incorporated into the control design, such that both the steady-state and transient control performance can be strictly guaranteed. Unlike conventional PPF-based control methods, we further tailor a recently proposed systematic control design procedure (i.e. approximation-free control) using the transformed tracking error dynamics, which provides a proportional-like control action. Hence, the function approximators (e.g. neural networks, fuzzy systems) that are widely used to address the unknown nonlinearities in the nonlinear control designs are not needed. The proposed control design leads to a robust yet simplified function approximation-free control for nonlinear systems. The closed-loop system stability and the control error convergence are all rigorously proved. Finally, comparative simulations are conducted based on nonlinear missile systems to validate the improved response and the robustness of the proposed control method.

Precision medicine based on epigenomics: the paradigm of carcinoma of unknown primary.

PubMed

Moran, Sebastián; Martinez-Cardús, Anna; Boussios, Stergios; Esteller, Manel

2017-11-01

Epigenetic alterations are a common hallmark of human cancer. Single epigenetic markers are starting to be incorporated into clinical practice; however, the translational use of these biomarkers has not been validated at the 'omics' level. The identification of the tissue of origin in patients with cancer of unknown primary (CUP) is an example of how epigenomics can be incorporated in clinical settings, addressing an unmet need in the diagnostic and clinical management of these patients. Despite the great diagnostic advances made in the past decade, the use of traditional diagnostic procedures only enables the tissue of origin to be determined in ∼30% of patients with CUP. Thus, development of molecularly guided diagnostic strategies has emerged to complement traditional procedures, thereby improving the clinical management of patients with CUP. In this Review, we present the latest data on strategies using epigenetics and other molecular biomarkers to guide therapeutic decisions involving patients with CUP, and we highlight areas warranting further research to engage the medical community in this unmet need.

On the Traceability of Commercial Saffron Samples Using ¹H-NMR and FT-IR Metabolomics.

PubMed

Consonni, Roberto; Ordoudi, Stella A; Cagliani, Laura R; Tsiangali, Maria; Tsimidou, Maria Z

2016-02-29

In previous works on authentic samples of saffron of known history (harvest and processing year, storage conditions, and length of time) some biomarkers were proposed using both FT-IR and NMR metabolomics regarding the shelf life of the product. This work addresses the difficulties to trace back the "age" of commercial saffron samples of unknown history, sets a limit value above which these products can be considered substandard, and offers a useful tool to combat saffron mislabeling and fraud with low-quality saffron material. Investigations of authentic and commercial saffron samples of different origin and harvest year, which had been stored under controlled conditions for different lengths of time, allowed a clear-cut clustering of samples in two groups according to the storage period irrespectively of the provenience. In this respect, the four-year cut off point proposed in our previous work assisted to trace back the "age" of unknown samples and to check for possible mislabeling practices.

zBEAMS: a unified solution for supernova cosmology with redshift uncertainties

DOE Office of Scientific and Technical Information (OSTI.GOV)

Roberts, Ethan; Lochner, Michelle; Bassett, Bruce A.

Supernova cosmology without spectra will be an important component of future surveys such as LSST. This lack of supernova spectra results in uncertainty in the redshifts which, if ignored, leads to significantly biased estimates of cosmological parameters. Here we present a hierarchical Bayesian formalism— zBEAMS—that addresses this problem by marginalising over the unknown or uncertain supernova redshifts to produce unbiased cosmological estimates that are competitive with supernova data with spectroscopically confirmed redshifts. zBEAMS provides a unified treatment of both photometric redshifts and host galaxy misidentification (occurring due to chance galaxy alignments or faint hosts), effectively correcting the inevitable contamination inmore » the Hubble diagram. Like its predecessor BEAMS, our formalism also takes care of non-Ia supernova contamination by marginalising over the unknown supernova type. We illustrate this technique with simulations of supernovae with photometric redshifts and host galaxy misidentification. A novel feature of the photometric redshift case is the important role played by the redshift distribution of the supernovae.« less

HIV transmission risk behavior among HIV-positive patients receiving antiretroviral therapy in KwaZulu-Natal, South Africa.

PubMed

Shuper, Paul A; Kiene, Susan M; Mahlase, Gethwana; MacDonald, Susan; Christie, Sarah; Cornman, Deborah H; Fisher, William A; Greener, Ross; Lalloo, Umesh G; Pillay, Sandy; van Loggerenberg, Francois; Fisher, Jeffrey D

2014-08-01

The aim of this investigation was to identify factors associated with HIV transmission risk behavior among HIV-positive women and men receiving antiretroviral therapy (ART) in KwaZulu-Natal, South Africa. Across 16 clinics, 1,890 HIV+ patients on ART completed a risk-focused audio computer-assisted self-interview upon enrolling in a prevention-with-positives intervention trial. Results demonstrated that 62 % of HIV-positive patients' recent unprotected sexual acts involved HIV-negative or HIV status unknown partners. For HIV-positive women, multivariable correlates of unprotected sex with HIV-negative or HIV status unknown partners were indicative of poor HIV prevention-related information and of sexual partnership-associated behavioral skills barriers. For HIV-positive men, multivariable correlates represented motivational barriers, characterized by negative condom attitudes and the experience of depressive symptomatology, as well as possible underlying information deficits. Findings suggest that interventions addressing gender-specific and culturally-relevant information, motivation, and behavioral skills barriers could help reduce HIV transmission risk behavior among HIV-positive South Africans.

Hybridizable discontinuous Galerkin method for the 2-D frequency-domain elastic wave equations

NASA Astrophysics Data System (ADS)

Bonnasse-Gahot, Marie; Calandra, Henri; Diaz, Julien; Lanteri, Stéphane

2018-04-01

Discontinuous Galerkin (DG) methods are nowadays actively studied and increasingly exploited for the simulation of large-scale time-domain (i.e. unsteady) seismic wave propagation problems. Although theoretically applicable to frequency-domain problems as well, their use in this context has been hampered by the potentially large number of coupled unknowns they incur, especially in the 3-D case, as compared to classical continuous finite element methods. In this paper, we address this issue in the framework of the so-called hybridizable discontinuous Galerkin (HDG) formulations. As a first step, we study an HDG method for the resolution of the frequency-domain elastic wave equations in the 2-D case. We describe the weak formulation of the method and provide some implementation details. The proposed HDG method is assessed numerically including a comparison with a classical upwind flux-based DG method, showing better overall computational efficiency as a result of the drastic reduction of the number of globally coupled unknowns in the resulting discrete HDG system.

Perfect blind restoration of images blurred by multiple filters: theory and efficient algorithms.

PubMed

Harikumar, G; Bresler, Y

1999-01-01

We address the problem of restoring an image from its noisy convolutions with two or more unknown finite impulse response (FIR) filters. We develop theoretical results about the existence and uniqueness of solutions, and show that under some generically true assumptions, both the filters and the image can be determined exactly in the absence of noise, and stably estimated in its presence. We present efficient algorithms to estimate the blur functions and their sizes. These algorithms are of two types, subspace-based and likelihood-based, and are extensions of techniques proposed for the solution of the multichannel blind deconvolution problem in one dimension. We present memory and computation-efficient techniques to handle the very large matrices arising in the two-dimensional (2-D) case. Once the blur functions are determined, they are used in a multichannel deconvolution step to reconstruct the unknown image. The theoretical and practical implications of edge effects, and "weakly exciting" images are examined. Finally, the algorithms are demonstrated on synthetic and real data.

Work-related social skills: Definitions and interventions in public vocational rehabilitation.

PubMed

Phillips, Brian N; Kaseroff, Ashley A; Fleming, Allison R; Huck, Garrett E

2014-11-01

Social skills play an important role in employment. This study provides a qualitative analysis of salient work related social skills and interventions for addressing social skills in public vocational rehabilitation (VR). A modified consensual qualitative research (CQR) approach was taken to understand the elements and influence of work related social skills in public VR. Thirty-five counselors, supervisors, and administrators participated in semistructured interviews to provide their perspectives of work related social skills and the interventions they use for addressing these skills. Multiple aspects of work-related social skills were described as being important for VR consumer success. The most common work related social skills across all participants were nonverbal communication and the ability to connect with others. Primary social interventions included informal social skills training (SST), systems collaboration, and creating an appropriate job match. Public rehabilitation agency staff, constantly faced with addressing work related social skills, possess many insights about salient skills and interventions that can benefit future research and practice. Agencies currently address social skills deficits by providing interventions to both person and environment. The research provides directions for future research related to identification of social skills and interventions to address related deficits. (PsycINFO Database Record (c) 2014 APA, all rights reserved).

Efficacy of levetiracetam in primary hemifacial spasm.

PubMed

Kuroda, Takeshi; Saito, Yu; Fujita, Kazuhisa; Yano, Satoshi; Ishigaki, Seiichiro; Kato, Hirotaka; Murakami, Hidetomo; Ono, Kenjiro

2016-12-01

Hemifacial spasm (HFS) is a peripherally-induced movement disorder characterized by the involuntary, unilateral, intermittent, irregular, tonic or clonic contractions of muscles innervated by the ipsilateral facial nerve. Kindling-like hyperactivity of the facial nucleus induced by constant stimulation of compressing artery is considered as the predominant mechanism underlying the pathogenesis of HFS. As a treatment for HFS, microsurgical decompression and botulinum toxin injection have been shown to be highly successful. Anticonvulsant drugs relieve HFS in some patients; however, the use of such drugs is limited owing to their side effects, predominantly in elderly patients. We experienced two elderly HFS patients who exhibited a marked response to levetiracetam (LEV) without side effects. Although the exact underlying pharmacological mechanism remains unknown, we assume anti-kindling effect as one of the important pharmacological mechanism underlying the effect of LEV against HFS. Moreover, LEV is considered to be suitable for use in elderly patients because of its good tolerability. In addition, the lack of hepatic induction or inhibition makes it an easy and safe drug when used in addition to other anticonvulsants. Although the long-term benefit remains unknown, LEV may represent an alternative treatment for elderly HFS patients who are unable to undergo or decline surgical intervention and/or botulinum toxin injections or are intolerant to other anticonvulsants. Copyright © 2016 Elsevier Ltd. All rights reserved.

On the centenary of Charcot: hysteria, suggestibility and hypnosis.

PubMed

Chertok, L

1984-06-01

In studying hysteria by means of hypnosis, Charcot placed emphasis on the psychological aetiology of the neuroses. Among his pupils, Freud alone grasped this epistemological turning-point, from which he made his great discoveries. But hysteria and hypnosis still remain today largely unknown. We have not yet elucidated the 'mysterious leap' between the psychological and the somatic for the former, and between the relational and the instrumental for the latter. While psychoanalysts have constantly concerned themselves with hysteria, they have shown a lack of interest in hypnosis after Freud abandoned its practice. According to Freud, thanks to transference, affect would be controlled by cognition, a viewpoint eminently suited to satisfy his rationalistic outlook. Affect, however, remains an unknown realm. The affective relationship has, at all events, acquired an ever-increasing importance in psychoanalysis during the last few years, with the emphasis on the early mother-child relationship. The 'affective locus' remains the basic, as well as the most obscure, element in the hypno-suggestive relationship. The behaviourist approach, which quantifies the 'vertical' dimension in depth, is a limited one. The study of the 'horizontal' dimension of subjective experience represents a new line of research, which may make it possible to distinguish different forms of hypnosis. The understanding of hypno-suggestion may throw light on psychoanalysis, psychotherapy, and the human sciences in general.

Human Effectiveness and Risk Characterization of the Electromuscular Incapacitation Device - A Limited Analysis of the TASER. Part 1. Technical Report

DTIC Science & Technology

2005-03-01

factors such as wind, temperature, and precipitation do not affect the dose of electricity delivered since the electricity flows through insulated wires...additional (and perhaps lethal) force. It is unknown if these mechanisms for success will also occur in DoD use. If they do not, and if the complete or...information if it does not display s currently valid OMB control number. PLEASE DO NOT RETURN YOUR FORM TO THE ABOVE ADDRESS. 1. REPORT DATE (DD-MM-YYYY

A Randomized, Crossover Clinical Trial of Exoskeletal-Assisted Walking to Improve Mobility, Bowel Function, and Cardiometabolic Profiles in Persons with SCI

DTIC Science & Technology

2015-10-01

comply with a collection of information if it does not display a currently valid OMB control number. PLEASE DO NOT RETURN YOUR FORM TO THE ABOVE ADDRESS...participants and at three study sites. It is also designed to determine if the body composition and bowel function benefits that were observed with as few...demonstrated that ten participants were able to use the device to successfully walk for four to six hours per week for three months. It is unknown if a

Rationale for Further Medical and Health Research on High-Potency Sweeteners

PubMed Central

2012-01-01

High-potency or artificial sweeteners have historically been considered inert compounds without physiological consequences other than taste sensations. However, recent data suggest that some of these sweeteners have biological effects that may impact human health. Furthermore, there are significant gaps in our current knowledge of the pharmacokinetics of these sweeteners, their potential for “sweetener–drug interactions” and their impact on appetite and body weight regulation. Nine research needs are described that address some of the major unknown issues associated with ingestion of high-potency sweeteners. PMID:22539626

Rationale for further medical and health research on high-potency sweeteners.

PubMed

Schiffman, Susan S

2012-10-01

High-potency or artificial sweeteners have historically been considered inert compounds without physiological consequences other than taste sensations. However, recent data suggest that some of these sweeteners have biological effects that may impact human health. Furthermore, there are significant gaps in our current knowledge of the pharmacokinetics of these sweeteners, their potential for "sweetener-drug interactions" and their impact on appetite and body weight regulation. Nine research needs are described that address some of the major unknown issues associated with ingestion of high-potency sweeteners.

Exploring the Unknown: Selected Documents in the History of the U.S. Civilian Space Program. Volume 2; External Relationships

NASA Technical Reports Server (NTRS)

Logsdon, John M. (Editor); Day, Dwayne A. (Editor); Launius, Roger D. (Editor)

1996-01-01

The documents selected for inclusion in this volume are presented in three chapters, each covering a particular aspect of the evolution of U.S. space exploration. These chapters address (1) the relations between the civilian space program of the United States and the space activities of other countries, (2) the relations between the U.S. civilian space program and the space efforts of national security organizations and the military, and (3) NASA's relations with industry and academic institutions.

A black box optimization approach to parameter estimation in a model for long/short term variations dynamics of commodity prices

NASA Astrophysics Data System (ADS)

De Santis, Alberto; Dellepiane, Umberto; Lucidi, Stefano

2012-11-01

In this paper we investigate the estimation problem for a model of the commodity prices. This model is a stochastic state space dynamical model and the problem unknowns are the state variables and the system parameters. Data are represented by the commodity spot prices, very seldom time series of Futures contracts are available for free. Both the system joint likelihood function (state variables and parameters) and the system marginal likelihood (the state variables are eliminated) function are addressed.

Road less traveled vital to operational success

DOE Office of Scientific and Technical Information (OSTI.GOV)

Madison, Alison L.

2012-01-08

PNNL's Monthly Economic Diversity column for the Tri-City Herald Business section. Excerpt follows: Things aren't always what they seem. Sometimes the path less traveled--although it can be exhausting if not scary to think about navigating its unknowns--really is the best way to go. And not just because Robert Frost said so. Patric Sazama, Regional Project Director for Impact Washington, would agree as well. He recently spoke to the Three Rivers Entrepreneur Network about achieving operational success by addressing the less tangible elements of an organization, the company's own less traveled path.

Toward a New Chemotherapy for Breast Cancer: Structural and Functional Mechanism of the Retinoid Receptors Addressed by a Novel Computer Approach

DTIC Science & Technology

2002-01-01

the surface of the receptor. This pocket is the target for several known and unknown coactivator proteins, which bind the LBD through a conserved LxxLL...was and to Not se FLKAILN) and the LBDs of several receptors (TRo was used as an example in prisingly, the LBD of TR13 was also found to interact with...receptors. 541 ATTCCTTAAAGCCATTTTAAACTGAGGCATTAAGAAGAAATGCACTCACCATGAGCACCA The LBDs of several nuclear receptors were examined for FL. K. A • 1,...N

DOE Office of Scientific and Technical Information (OSTI.GOV)

MacMartin, Douglas G.; Kravitz, Ben; Long, Jane C. S.

Any well-informed future decision on whether and how to deploy solar geoengineering requires balancing the impacts (both intended and unintended) of intervening in the climate against the impacts of not doing so. In spite of the tremendous progress in the last decade, the current state of knowledge remains insufficient to support an assessment of this balance, even for stratospheric aerosol geoengineering (SAG), arguably the best understood (practical) geoengineering method. We then articulate key unknowns associated with SAG, including both climate-science and design questions, as an essential step toward developing a future strategic research program that could address outstanding uncertainties.

Plasma filtering techniques for nuclear waste remediation.

PubMed

Gueroult, Renaud; Hobbs, David T; Fisch, Nathaniel J

2015-10-30

Nuclear waste cleanup is challenged by the handling of feed stocks that are both unknown and complex. Plasma filtering, operating on dissociated elements, offers advantages over chemical methods in processing such wastes. The costs incurred by plasma mass filtering for nuclear waste pretreatment, before ultimate disposal, are similar to those for chemical pretreatment. However, significant savings might be achieved in minimizing the waste mass. This advantage may be realized over a large range of chemical waste compositions, thereby addressing the heterogeneity of legacy nuclear waste. Copyright © 2015 Elsevier B.V. All rights reserved.

Titanium Pyrophosphate for Removal of Trivalent Heavy Metals and Actinides Simulated by Retention of Europium

PubMed Central

Flores-Espinosa, Rosa María; Ordoñez-Regil, Eduardo; Fernández-Valverde, Suilma Marisela

2017-01-01

This work addresses the synthesis of titanium pyrophosphate, as well as the characterization and evaluation of the sorption process of europium, for removal of trivalent heavy metals and actinides simulate. The evaluation of the surface properties of titanium pyrophosphate was carried out determining the surface roughness and surface acidity constants. The values obtained from the determination of the surface roughness of the synthesized solid indicate that the surface of the material presents itself as slightly smooth. The FITEQL program was used to fit the experimental titration curves to obtain the surface acidity constants: log⁡K+ = 3.59 ± 0.06 and log⁡K− = −3.90 ± 0.05. The results of sorption kinetics evidenced that the pseudo-order model explains the retention process of europium, in which the initial sorption velocity was 8.3 × 10−4 mg g−1 min−1 and kinetic constant was 1.8 × 10−3 g mg min−1. The maximum sorption capacity was 0.6 mg g−1. The results obtained from sorption edge showed the existence of two bidentate complexes on the surface. PMID:28785720

Laser flash photolysis and CIDNP studies of steric effects on coupling rate constants of imidazolidine nitroxide with carbon-centered radicals, methyl isobutyrate-2-yl and tert-butyl propionate-2-yl.

PubMed

Zubenko, Dmitry; Tsentalovich, Yuri; Lebedeva, Nataly; Kirilyuk, Igor; Roshchupkina, Galina; Zhurko, Irina; Reznikov, Vladimir; Marque, Sylvain R A; Bagryanskaya, Elena

2006-08-04

Time-resolved chemically induced dynamic nuclear polarization (TR-CIDNP) and laser flash photolysis (LFP) techniques have been used to measure rate constants for coupling between acrylate-type radicals and a series of newly synthesized stable imidazolidine N-oxyl radicals. The carbon-centered radicals under investigation were generated by photolysis of their corresponding ketone precursors RC(O)R (R = C(CH3)2-C(O)OCH3 and CH(CH3)-C(O)-OtBu) in the presence of stable nitroxides. The coupling rate constants kc for modeling studies of nitroxide-mediated polymerization (NMP) experiments were determined, and the influence of steric and electronic factors on kc values was addressed by using a Hammett linear free energy relationship. The systematic changes in kc due to the varied steric (Es,n) and electronic (sigmaL,n) characters of the substituents are well-described by the biparameter equation log(kc/M- 1s(-1)) = 3.52sigmaL,n + 0.47Es,n + 10.62. Hence, kc decreases with the increasing steric demand and increases with the increasing electron-withdrawing character of the substituents on the nitroxide.

Uniform function constants of motion and their first-order perturbation

NASA Astrophysics Data System (ADS)

Prato, Domingo; Hamity, Victor H.

2005-05-01

The main purpose of this work is to present some uniform function constants of motion rather than the well-known quantities arising from spacetime symmetries. These constants are usually associated with the intrinsic characteristics of the trajectories of a particle in a central potential field. We treat two cases. The first is the Lenz vector which sometimes is found in the literature [1, 2]; the other is associated with the isotropic harmonic oscillator, of relative importance in some simple models of the classical molecular interaction. The first example is applied to describe the perturbation of the trajectories in the Rutherford scattering and the precession of the Keplerian orbit of a planet. In the other case the conserved quantity is a symmetric tensor. We find the eigenvectors and eigenvalues of that tensor while at the same time we obtain the solution to the problem of calculating the rotation rate of the orbits in first order of a perturbation parameter in the potential energy, by performing a simple coordinate transformation in the Cartesian plane. We think that the present work addresses many aspects of mechanics with a didactical interest in other physics or mathematics courses.

Accelerating semantic graph databases on commodity clusters

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morari, Alessandro; Castellana, Vito G.; Haglin, David J.

We are developing a full software system for accelerating semantic graph databases on commodity cluster that scales to hundreds of nodes while maintaining constant query throughput. Our framework comprises a SPARQL to C++ compiler, a library of parallel graph methods and a custom multithreaded runtime layer, which provides a Partitioned Global Address Space (PGAS) programming model with fork/join parallelism and automatic load balancing over a commodity clusters. We present preliminary results for the compiler and for the runtime.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chandrasekhar, S.

In 1991 the Charles Greely Abbot Award of the American Solar Energy Society was awarded to Dr. Subrahmanyan Chandrasekhar, in recognition of his well-known work on the internal operation and life cycle of stars such as the sun, and for his development of the new radiation heat transfer and fluid flow analysis techniques he had found to be necessary to do this work. His acceptance address is presented here, which explains the relationship between Abbot's work on the solar constant and Dr. Chandrasekhar's research.

Stochastic processes in cosmology

NASA Astrophysics Data System (ADS)

Cáceres, Manuel O.; Diaz, Mario C.; Pullin, Jorge A.

1987-08-01

The behavior of a radiation filled de Sitter universe in which the equation of state is perturbed by a stochastic term is studied. The corresponding two-dimensional Fokker-Planck equation is solved. The finiteness of the cosmological constant appears to be a necessary condition for the stability of the model which undergoes an exponentially expanding state. Present address: Facultad de Matemática Astronomía y Física, Universidad Nacional de Córdoba, Laprida 854, 5000 Códoba, Argentina.

Task-oriented situation recognition

NASA Astrophysics Data System (ADS)

Bauer, Alexander; Fischer, Yvonne

2010-04-01

From the advances in computer vision methods for the detection, tracking and recognition of objects in video streams, new opportunities for video surveillance arise: In the future, automated video surveillance systems will be able to detect critical situations early enough to enable an operator to take preventive actions, instead of using video material merely for forensic investigations. However, problems such as limited computational resources, privacy regulations and a constant change in potential threads have to be addressed by a practical automated video surveillance system. In this paper, we show how these problems can be addressed using a task-oriented approach. The system architecture of the task-oriented video surveillance system NEST and an algorithm for the detection of abnormal behavior as part of the system are presented and illustrated for the surveillance of guests inside a video-monitored building.

Utilization of FEP energetics

NASA Technical Reports Server (NTRS)

Frederking, T. H. K.; Abbassi, P.; Afifi, F.; Khandhar, P. K.; Ono, D. Y.; Chen, W. E. W.

1987-01-01

The research and development work on Fountain Effect Pump Systems (FEP systems) has been of interest in the competition between mechanical pumps for He II and FEP units. The latter do not have moving parts. In the course of the work, the energetics have been addressed using one part of a simple four-changes-of-state cycle. One option is the FEP ideal change of state at constant chemical potential (mu). The other option is the two-state sequence mu-P with a d mu=0 state change followed by an isobar. Questions of pump behavior, of flow rate response to temperature difference at the hot end, and related questions of thermodynamic cycle completion and heat transfer have been addressed. Porous media data obtained elucidate differences between vapor-liquid phase separation (VLPS) and Zero Net Mass Transfer (ZNMF).

Integrating Address Geocoding, Land Use Regression, and Spatiotemporal Geostatistical Estimation for Groundwater Tetrachloroethylene

PubMed Central

Messier, Kyle P.; Akita, Yasuyuki; Serre, Marc L.

2012-01-01

Geographic Information Systems (GIS) based techniques are cost-effective and efficient methods used by state agencies and epidemiology researchers for estimating concentration and exposure. However, budget limitations have made statewide assessments of contamination difficult, especially in groundwater media. Many studies have implemented address geocoding, land use regression, and geostatistics independently, but this is the first to examine the benefits of integrating these GIS techniques to address the need of statewide exposure assessments. A novel framework for concentration exposure is introduced that integrates address geocoding, land use regression (LUR), below detect data modeling, and Bayesian Maximum Entropy (BME). A LUR model was developed for Tetrachloroethylene that accounts for point sources and flow direction. We then integrate the LUR model into the BME method as a mean trend while also modeling below detects data as a truncated Gaussian probability distribution function. We increase available PCE data 4.7 times from previously available databases through multistage geocoding. The LUR model shows significant influence of dry cleaners at short ranges. The integration of the LUR model as mean trend in BME results in a 7.5% decrease in cross validation mean square error compared to BME with a constant mean trend. PMID:22264162

Nursing curriculum and bullying: An integrative literature review.

PubMed

Sidhu, Sharan; Park, Tanya

2018-06-01

The purpose of this integrative review was to identify and synthesize key concepts that inform curriculum which increase nursing students' competence, skills and strategies when addressing bullying. Specifically, the authors sought to examine the concepts informing educational interventions, skills, and strategies, which addressed the bullying of nursing students. Integrative literature review. A search of the electronic databases CINAHL, MEDLINE, ERIC, PsycINFO, Proquest, and PubMed was conducted in January 2016 using search terms such as 'bully' 'nursing student' 'education' and 'curriculum'. Articles were screened for relevance and eligibility and extracted onto a table. Critical appraisal was conducted using multiple tools. Papers were analysed using constant comparison and concept mapping. 61 articles were included in the synthesis. Concepts identified included: empowerment, socialization, support, self-awareness, awareness about bullying, collaboration, communication, and self-efficacy. All concepts linked to empowerment. Social Cognitive Theory was used by many studies. Active teaching methods which gave students opportunities to practice skills were the most effective. Empowered nursing students have the potential to address bullying more effectively and competently. Empowerment of nursing students is a powerful concept that educators must consider when developing curriculum and educational interventions to address bullying. Copyright © 2018 Elsevier Ltd. All rights reserved.

Integrating address geocoding, land use regression, and spatiotemporal geostatistical estimation for groundwater tetrachloroethylene.

PubMed

Messier, Kyle P; Akita, Yasuyuki; Serre, Marc L

2012-03-06

Geographic information systems (GIS) based techniques are cost-effective and efficient methods used by state agencies and epidemiology researchers for estimating concentration and exposure. However, budget limitations have made statewide assessments of contamination difficult, especially in groundwater media. Many studies have implemented address geocoding, land use regression, and geostatistics independently, but this is the first to examine the benefits of integrating these GIS techniques to address the need of statewide exposure assessments. A novel framework for concentration exposure is introduced that integrates address geocoding, land use regression (LUR), below detect data modeling, and Bayesian Maximum Entropy (BME). A LUR model was developed for tetrachloroethylene that accounts for point sources and flow direction. We then integrate the LUR model into the BME method as a mean trend while also modeling below detects data as a truncated Gaussian probability distribution function. We increase available PCE data 4.7 times from previously available databases through multistage geocoding. The LUR model shows significant influence of dry cleaners at short ranges. The integration of the LUR model as mean trend in BME results in a 7.5% decrease in cross validation mean square error compared to BME with a constant mean trend.

Solar Cell Calibration and Measurement Techniques

NASA Technical Reports Server (NTRS)

Bailey, Sheila; Brinker, Dave; Curtis, Henry; Jenkins, Phillip; Scheiman, Dave

1997-01-01

The increasing complexity of space solar cells and the increasing international markets for both cells and arrays has resulted in workshops jointly sponsored by NASDA, ESA and NASA. These workshops are designed to obtain international agreement on standardized values for the AMO spectrum and constant, recommend laboratory measurement practices and establish a set of protocols for international comparison of laboratory measurements. A working draft of an ISO standard, WDI 5387, 'Requirements for Measurement and Calibration Procedures for Space Solar Cells' was discussed with a focus on the scope of the document, a definition of primary standard cell, and required error analysis for all measurement techniques. Working groups addressed the issues of Air Mass Zero (AMO) solar constant and spectrum, laboratory measurement techniques, and the international round robin methodology. A summary is presented of the current state of each area and the formulation of the ISO document.

Solar Cell Calibration and Measurement Techniques

NASA Technical Reports Server (NTRS)

Bailey, Sheila; Brinker, Dave; Curtis, Henry; Jenkins, Phillip; Scheiman, Dave

2004-01-01

The increasing complexity of space solar cells and the increasing international markets for both cells and arrays has resulted in workshops jointly sponsored by NASDA, ESA and NASA. These workshops are designed to obtain international agreement on standardized values for the AMO spectrum and constant, recommend laboratory measurement practices and establish a set of protocols for international comparison of laboratory measurements. A working draft of an ISO standard, WD15387, "Requirements for Measurement and Calibration Procedures for Space Solar Cells" was discussed with a focus on the scope of the document, a definition of primary standard cell, and required error analysis for all measurement techniques. Working groups addressed the issues of Air Mass Zero (AMO) solar constant and spectrum, laboratory measurement techniques, and te international round robin methodology. A summary is presented of the current state of each area and the formulation of the ISO document.

The Implications of Encoder/Modulator/ Phased Array Designs for Future Broadband LEO Communications

NASA Technical Reports Server (NTRS)

Vanderaar, Mark; Jensen, Chris A.; Terry, John D.

1997-01-01

In this paper we summarize the effects of modulation and channel coding on the design of wide angle scan, broadband, phased army antennas. In the paper we perform several trade studies. First, we investigate the amplifier back-off requirement as a function of variability of modulation envelope. Specifically, we contrast constant and non-constant envelope modulations, as well as single and multiple carrier schemes. Additionally, we address the issues an(f concerns of using pulse shaping filters with the above modulation types. Second, we quantify the effects of beam steering on the quality of data, recovery using selected modulation techniques. In particular, we show that the frequency response of the array introduces intersymbol interference for broadband signals and that the mode of operation for the beam steering controller may introduce additional burst or random errors. Finally, we show that the encoder/modulator design must be performed in conjunction with the phased array antenna design.

Current-Sensitive Path Planning for an Underactuated Free-Floating Ocean Sensorweb

NASA Technical Reports Server (NTRS)

Dahl, Kristen P.; Thompson, David R.; McLaren, David; Chao, Yi; Chien, Steve

2011-01-01

This work investigates multi-agent path planning in strong, dynamic currents using thousands of highly under-actuated vehicles. We address the specific task of path planning for a global network of ocean-observing floats. These submersibles are typified by the Argo global network consisting of over 3000 sensor platforms. They can control their buoyancy to float at depth for data collection or rise to the surface for satellite communications. Currently, floats drift at a constant depth regardless of the local currents. However, accurate current forecasts have become available which present the possibility of intentionally controlling floats' motion by dynamically commanding them to linger at different depths. This project explores the use of these current predictions to direct float networks to some desired final formation or position. It presents multiple algorithms for such path optimization and demonstrates their advantage over the standard approach of constant-depth drifting.

Critique of Macro Flow/Damage Surface Representations for Metal Matrix Composites Using Micromechanics

NASA Technical Reports Server (NTRS)

Lissenden, Cliff J.; Arnold, Steven M.

1996-01-01

Guidance for the formulation of robust, multiaxial, constitutive models for advanced materials is provided by addressing theoretical and experimental issues using micromechanics. The multiaxial response of metal matrix composites, depicted in terms of macro flow/damage surfaces, is predicted at room and elevated temperatures using an analytical micromechanical model that includes viscoplastic matrix response as well as fiber-matrix debonding. Macro flow/damage surfaces (i.e., debonding envelopes, matrix threshold surfaces, macro 'yield' surfaces, surfaces of constant inelastic strain rate, and surfaces of constant dissipation rate) are determined for silicon carbide/titanium in three stress spaces. Residual stresses are shown to offset the centers of the flow/damage surfaces from the origin and their shape is significantly altered by debonding. The results indicate which type of flow/damage surfaces should be characterized and what loadings applied to provide the most meaningful experimental data for guiding theoretical model development and verification.