Science.gov

Sample records for adenine guanine hypoxanthine

  1. Studies on the energy metabolism of opossum (Didelphis virginiana) erythrocytes: V. Utilization of hypoxanthine for the synthesis of adenine and guanine nucleotides in vitro

    SciTech Connect

    Bethlenfalvay, N.C.; White, J.C.; Chadwick, E.; Lima, J.E. )

    1990-06-01

    High pressure liquid radiochromatography was used to test the ability of opossum erythrocytes to incorporate tracer amounts of (G-{sup 3}H) hypoxanthine (Hy) into ({sup 3}H) labelled triphosphates of adenine and guanine. In the presence of supraphysiologic (30 mM) phosphate which is optimal for PRPP synthesis, both ATP and GTP are extensively labelled. When physiologic (1 mM) medium phosphate is used, red cells incubated under an atmosphere of nitrogen accumulate ({sup 3}H) ATP in a linear fashion suggesting ongoing PRPP synthesis in red cells whose hemoglobin is deoxygenated. In contrast, a lesser increase of labelled ATP is observed in cells incubated under oxygen, suggesting that conditions for purine nucleotide formation from ambient Hy are more favorable in the venous circulation.

  2. Adenine and guanine nucleotide metabolism during platelet storage at 22 degree C

    SciTech Connect

    Edenbrandt, C.M.; Murphy, S. )

    1990-11-01

    Adenine and guanine nucleotide metabolism of platelet concentrates (PCs) was studied during storage for transfusion at 22 +/- 2 degrees C over a 7-day period using high-pressure liquid chromatography. There was a steady decrease in platelet adenosine triphosphate (ATP) and adenosine diphosphate (ADP), which was balanced quantitatively by an increase in plasma hypoxanthine. As expected, ammonia accumulated along with hypoxanthine but at a far greater rate. A fall in platelet guanosine triphosphate (GTP) and guanosine diphosphate (GDP) paralleled the fall in ATP + ADP. When adenine was present in the primary anticoagulant, it was carried over into the PC and metabolized. ATP, GTP, total adenine nucleotides, and total guanine nucleotides declined more slowly in the presence of adenine than in its absence. With adenine, the increase in hypoxanthine concentration was more rapid and quantitatively balanced the decrease in adenine and platelet ATP + ADP. Plasma xanthine rose during storage but at a rate that exceeded the decline in GTP + GDP. When platelet ATP + ADP was labeled with 14C-adenine at the initiation of storage, half of the radioactivity was transferred to hypoxanthine (45%) and GTP + GDP + xanthine (5%) by the time storage was completed. The isotopic data were consistent with the presence of a radioactive (metabolic) and a nonradioactive (storage) pool of ATP + ADP at the initiation of storage with each pool contributing approximately equally to the decline in ATP + ADP during storage. The results suggested a continuing synthesis of GTP + GDP from ATP + ADP, explaining the slower rate of fall of GTP + GDP relative to the rate of rise of plasma xanthine. Throughout storage, platelets were able to incorporate 14C-hypoxanthine into both adenine and guanine nucleotides but at a rate that was only one fourth the rate of hypoxanthine accumulation.

  3. Design and synthesis of novel adenine fluorescence probe based on Eu(III) complexes with dtpa-bis(guanine) ligand.

    PubMed

    Tian, Fengyun; Jiang, Xiaoqing; Dou, Xuekai; Wu, Qiong; Wang, Jun; Song, Youtao

    2017-02-24

    A novel adenine (Ad) fluorescence probe (Eu(III)-dtpa-bis(guanine)) was designed and synthesized by improving experimental method based on the Eu(III) complex and dtpa-bis(guanine) ligand. The dtpa-bis(guanine) ligand was first synthesized by the acylation action between dtpaa and guanine (Gu), and the corresponding Eu(III) complex was successfully prepared through heat-refluxing method with dtpa-bis(guanine) ligand. As a novel fluorescence probe, the Eu(III)-dtpa-bis(guanine) complex can detect adenine (Ad) with characteristics of strong targeting, high specificity and high recognition ability. The detection mechanism of the adenine (Ad) using this probe in buffer solution was studied by ultraviolet-visible (UV-vis) and fluorescence spectroscopy. When the Eu(III)-dtpa-bis(guanine) was introduced to the adenine (Ad) solution, the fluorescence emission intensity was significantly enhanced. However, adding other bases such as guanine (Gu), xanthine (Xa), hypoxanthine (Hy) and uric acid (Ur) with similar composition and structure to that of adenine (Ad) to the Eu(III)-dtpa-bis(guanine) solution, the fluorescence emission intensities are nearly invariable. Meanwhile, the interference of guanine (Gu), xanthine (Xa), hypoxanthine (Hy) and uric acid (Ur) on the detection of the adenine using Eu(III)-dtpa-bis(guanine) probe was also studied. It was found that presence of these bases does not affect the detection of adenine (Ad). A linear response of fluorescence emission intensities of Eu(III)-dtpa-bis(guanine) at 570nm as a function of adenine (Ad) concentration in the range of 0.00-5.00×10(-5)molL(-1) was observed. The detection limit is about 4.70×10(-7)molL(-1).

  4. Cloning and expression of the hypoxanthine-guanine phosphoribosyltransferase gene from Trypanosoma brucei.

    PubMed Central

    Allen, T E; Ullman, B

    1993-01-01

    The hypoxanthine-guanine phosphoribosyltransferase (HGPRT) enzyme of Trypanosoma brucei and related parasites provides a rational target for the treatment of African sleeping sickness and several other parasitic diseases. To characterize the T. brucei HGPRT enzyme in detail, the T. brucei hgprt was isolated within a 4.2 kb SalI-KpnI genomic insert and sequenced. Nucleotide sequence analysis revealed an open reading frame of 630 bp that encoded a protein of 210 amino acids with a M(r) = 23.4 kd. After gap alignment, the T. brucei HGPRT exhibited 21-23% amino acid sequence identity, mostly in three clustered regions, with the HGPRTs from human, S. mansoni, and P falciparum, indicating that the trypanosome enzyme was the most divergent of the group. Surprisingly, the T. brucei HGPRT was more homologous to the hypoxanthine phosphoribosyltransferase (HPRT) from the prokaryote V. harveyi than to the eukaryotic HGPRTs. Northern blot analysis revealed two trypanosome transcripts of 1.4 and 1.9 kb, each expressed to equivalent degrees in insect vector and mammalian forms of the parasite. The T. brucei hgprt was inserted into an expression plasmid and transformed into S phi 606 E. coli that are deficient in both HPRT and xanthine-guanine phosphoribosyltransferase activities. Soluble, enzymatically active recombinant T. brucei HGPRT was expressed to high levels and purified to homogeneity by GTP-agarose affinity chromatography. The purified recombinant enzyme recognized hypoxanthine, guanine, and allopurinol, but not xanthine or adenine, as substrates and was inhibited by a variety of nucleotide effectors. The availability of a molecular clone encoding the T. brucei hgprt and large quantities of homogeneous recombinant HGPRT enzyme provides an experimentally manipulable molecular and biochemical system for the rational design of novel therapeutic agents for the treatment of African sleeping sickness and other diseases of parasitic origin. Images PMID:8265360

  5. Acyclic Immucillin Phosphonates. Second-Generation Inhibitors of Plasmodium falciparum Hypoxanthine- Guanine-Xanthine Phosphoribosyltransferase

    SciTech Connect

    Hazelton, Keith Z.; Ho, Meng-Chaio; Cassera, Maria B.; Clinch, Keith; Crump, Douglas R.; Rosario Jr., Irving; Merino, Emilio F.; Almo, Steve C.; Tyler, Peter C.; Schramm, Vern L.

    2012-06-22

    We found that Plasmodium falciparum is the primary cause of deaths from malaria. It is a purine auxotroph and relies on hypoxanthine salvage from the host purine pool. Purine starvation as an antimalarial target has been validated by inhibition of purine nucleoside phosphorylase. Hypoxanthine depletion kills Plasmodium falciparum in cell culture and in Aotus monkey infections. Hypoxanthine-guanine-xanthine phosphoribosyltransferase (HGXPRT) from P. falciparum is required for hypoxanthine salvage by forming inosine 5'-monophosphate, a branchpoint for all purine nucleotide synthesis in the parasite. We present a class of HGXPRT inhibitors, the acyclic immucillin phosphonates (AIPs), and cell permeable AIP prodrugs. The AIPs are simple, potent, selective, and biologically stable inhibitors. The AIP prodrugs block proliferation of cultured parasites by inhibiting the incorporation of hypoxanthine into the parasite nucleotide pool and validates HGXPRT as a target in malaria.

  6. Plasma Hypoxanthine-Guanine Phosphoribosyl Transferase Activity in Bottlenose Dolphins Contributes to Avoiding Accumulation of Non-recyclable Purines

    PubMed Central

    López-Cruz, Roberto I.; Crocker, Daniel E.; Gaxiola-Robles, Ramón; Bernal, Jaime A.; Real-Valle, Roberto A.; Lugo-Lugo, Orlando; Zenteno-Savín, Tania

    2016-01-01

    Marine mammals are exposed to ischemia/reperfusion and hypoxia/reoxygenation during diving. During oxygen deprivation, adenosine triphosphate (ATP) breakdown implies purine metabolite accumulation, which in humans is associated with pathological conditions. Purine recycling in seals increases in response to prolonged fasting and ischemia. Concentrations of metabolites and activities of key enzymes in purine metabolism were examined in plasma and red blood cells from bottlenose dolphins (Tursiops truncatus) and humans. Hypoxanthine and inosine monophosphate concentrations were higher in plasma from dolphins than humans. Plasma hypoxanthine-guanine phosphoribosyl transferase (HGPRT) activity in dolphins suggests an elevated purine recycling rate, and a mechanism for avoiding accumulation of non-recyclable purines (xanthine and uric acid). Red blood cell concentrations of hypoxanthine, adenosine diphosphate, ATP and guanosine triphosphate were lower in dolphins than in humans; adenosine monophosphate and nicotinamide adenine dinucleotide concentrations were higher in dolphins. HGPRT activity in red blood cells was higher in humans than in dolphins. The lower concentrations of purine catabolism and recycling by-products in plasma from dolphins could be beneficial in providing substrates for recovery of ATP depleted during diving or vigorous swimming. These results suggest that purine salvage in dolphins could be a mechanism for delivering nucleotide precursors to tissues with high ATP and guanosine triphosphate requirements. PMID:27375492

  7. Acyclic phosph(on)ate inhibitors of Plasmodium falciparum hypoxanthine-guanine-xanthine phosphoribosyltransferase

    PubMed Central

    Clinch, Keith; Crump, Douglas R.; Evans, Gary B.; Hazleton, Keith Z.; Mason, Jennifer M.; Schramm, Vern L.

    2013-01-01

    The pathogenic protozoa responsible for malaria lack enzymes for the de novo synthesis of purines and rely on purine salvage from the host. In Plasmodium falciparum (Pf), hypoxanthine-guanine-xanthine phosphoribosyltransferase (HGXPRT) converts hypoxanthine to inosine monophosphate and is essential for purine salvage making the enzyme an anti-malarial drug target. We have synthesized a number of simple acyclic aza-C- nucleosides and shown that some are potent inhibitors of Pf HGXPRT while showing excellent selectivity for the Pf versus the human enzyme. PMID:23810424

  8. Fragmentation mechanisms of cytosine, adenine and guanine ionized bases.

    PubMed

    Sadr-Arani, Leila; Mignon, Pierre; Chermette, Henry; Abdoul-Carime, Hassan; Farizon, Bernadette; Farizon, Michel

    2015-05-07

    The different fragmentation channels of cytosine, adenine and guanine have been studied through DFT calculations. The electronic structure of bases, their cations, and the fragments obtained by breaking bonds provides a good understanding of the fragmentation process that can complete the experimental approach. The calculations allow assigning various fragments to the given peaks. The comparison between the energy required for the formation of fragments and the peak intensity in the mass spectrum is used. For cytosine and guanine the elimination of the HNCO molecule is a major route of dissociation, while for adenine multiple loss of HCN or HNC can be followed up to small fragments. For cytosine, this corresponds to the initial bond cleavage of N3-C4/N1-C2, which represents the main dissociation route. For guanine the release of HNCO is obtained through the N1-C2/C5-C6 bond cleavage (reverse order also possible) leading to the largest peak of the spectrum. The corresponding energies of 3.5 and 3.9 eV are typically in the range available in the experiments. The loss of NH3 or HCN is also possible but requires more energy. For adenine, fragmentation consists of multiple loss of the HCN molecule and the main route corresponding to HC8N9 loss is followed by the release of HC2N1.

  9. Identification of 17 independent mutations responsible for human hypoxanthine-guanine phosphoribosyltransferase (HPRT) deficiency.

    PubMed Central

    Davidson, B L; Tarlé, S A; Van Antwerp, M; Gibbs, D A; Watts, R W; Kelley, W N; Palella, T D

    1991-01-01

    Complete hypoxanthine-guanine phosphoribosyltransferase (HPRT) deficiency causes the Lesch-Nyhan syndrome, an X-linked, purine metabolism disorder manifested by hyperuricemia, hyperuricaciduria, and neurologic dysfunction. Partial HPRT deficiency causes hyperuricemia and gout. One requirement for understanding the molecular basis of HPRT deficiency is the determination of which amino acids in this salvage enzyme are necessary for structural or catalytic competence. In this study we have used the PCR coupled with direct sequencing to determine the nucleotide and subsequent amino acid changes in 22 subjects representing 17 unrelated kindreds from the United Kingdom. These mutations were confirmed by using either RNase mapping or Southern analyses. In addition, experiments were done to determine enzyme activity and electrophoretic mobility, and predictive paradigms were used to study the impact of these amino acid substitutions on secondary structure. Images Figure 2 Figure 3 Figure 4 PMID:2018042

  10. Herpes simplex virus-mediated human hypoxanthine-guanine phosphoribosyltransferase gene transfer into neuronal cells

    SciTech Connect

    Palella, T.D.; Silverman, L.J.; Schroll, C.T.; Homa, F.L.; Levine, M.; Kelley, W.N.

    1988-01-01

    The virtually complete deficiency of the purine salvage enzyme hypoxanthine-guanine phosphoribosyltransferase (HPRT) results in a devastating neurological disease, Lesch-Nyhan syndrome. Transfer of the HPRT gene into fibroblasts and lymphoblasts in vitro and into hematopoietic cells in vivo has been accomplished by other groups with retroviral-derived vectors. It appears to be necessary, however, to transfer the HPRT gene into neuronal cells to correct the neurological dysfunction of this disorder. The neurotropic virus herpes simplex virus type 1 has features that make it suitable for use as a vector to transfer the HPRT gene into neuronal tissue. This report describes the isolation of an HPRT-deficient rat neuroma cell line, designated B103-4C, and the construction of a recombinant herpes simplex virus type 1 that contained human HPRT cDNA. These recombinant viruses were used to infect B103-4C cells. Infected cells expressed HPRT activity which was human in origin.

  11. Electron ionization of the nucleobases adenine and hypoxanthine near the threshold: a combined experimental and theoretical study.

    PubMed

    Dawley, M Michele; Tanzer, Katrin; Cantrell, William A; Plattner, Peter; Brinkmann, Nicole R; Scheier, Paul; Denifl, Stephan; Ptasińska, Sylwia

    2014-12-07

    Electron ionization of the DNA nucleobase, adenine, and the tRNA nucleobase, hypoxanthine, was investigated near the threshold region (∼5-20 eV) using a high-resolution hemispherical electron monochromator and a quadrupole mass spectrometer. Ion efficiency curves of the threshold regions and the corresponding appearance energies (AEs) are presented for the parent cations and the five most abundant fragment cations of each molecule. The experimental ionization energies (IEs) of adenine and hypoxanthine were determined to be 8.70 ± 0.3 eV and 8.88 ± 0.5 eV, respectively. Quantum chemical calculations (B3LYP/6-311+G(2d,p)) yielded a vertical IE of 8.08 eV and an adiabatic IE of 8.07 eV for adenine and a vertical IE of 8.51 eV and an adiabatic IE of 8.36 eV for hypoxanthine, and the lowest energy optimized structures of the fragment cations and their respective neutral species were calculated. The enthalpies of the possible reactions from the adenine and hypoxanthine cations were also obtained computationally, which assisted in determining the most likely electron ionization pathways leading to the major fragment cations. Our results suggest that the imidazole ring is more stable than the pyrimidine ring in several of the fragmentation reactions from both adenine and hypoxanthine. This electron ionization study contributes to the understanding of the biological effects of electrons on nucleobases and to the database of the electronic properties of biomolecules, which is necessary for modeling the damage of DNA in living cells that is induced by ionizing radiation.

  12. Crystal structures and inhibition of Trypanosoma brucei hypoxanthine-guanine phosphoribosyltransferase.

    PubMed

    Terán, David; Hocková, Dana; Česnek, Michal; Zíková, Alena; Naesens, Lieve; Keough, Dianne T; Guddat, Luke W

    2016-10-27

    Human African Trypanosomiasis (HAT) is a life-threatening infectious disease caused by the protozoan parasite, Trypanosoma brucei (Tbr). Due to the debilitating side effects of the current therapeutics and the emergence of resistance to these drugs, new medications for this disease need to be developed. One potential new drug target is 6-oxopurine phosphoribosyltransferase (PRT), an enzyme central to the purine salvage pathway and whose activity is critical for the production of the nucleotides (GMP and IMP) required for DNA/RNA synthesis within this protozoan parasite. Here, the first crystal structures of this enzyme have been determined, these in complex with GMP and IMP and with three acyclic nucleoside phosphonate (ANP) inhibitors. The Ki values for GMP and IMP are 30.5 μM and 77 μM, respectively. Two of the ANPs have Ki values considerably lower than for the nucleotides, 2.3 μM (with guanine as base) and 15.8 μM (with hypoxanthine as base). The crystal structures show that when two of the ANPs bind, they induce an unusual conformation change to the loop where the reaction product, pyrophosphate, is expected to bind. This and other structural differences between the Tbr and human enzymes suggest selective inhibitors for the Tbr enzyme can be designed.

  13. Electrochemical studies on the oxidation of guanine and adenine at cyclodextrin modified electrodes.

    PubMed

    Abbaspour, Abdolkarim; Noori, Abolhassan

    2008-12-01

    An electrochemical sensor for guanine and adenine using cyclodextrin-modified poly(N-acetylaniline) (PNAANI) on a carbon paste electrode has been developed. The oxidation mechanism of guanine and adenine on the surface of the electrode was investigated by cyclic voltammetry. It was found that the electrode processes are irreversible, pH dependent, and involve several reaction products. The electron transfer process occurs in consecutive steps with the formation of a strongly adsorbed intermediate on the electrode surface. Also, a new method for estimating the apparent formation constants of guanine and adenine with the immobilized cyclodextrins, through the change of surface coverage of studied analytes has been reported. Both guanine and adenine showed linear concentrations in the range of 0.1-10 microM by using differential pulse voltammetry, with an experimental limit of detection down to 0.05 microM. Linear concentration ranges of 2-150 microM for guanine and 6-104 microM for adenine have been found when cyclic voltammetry was used for determination of both analytes.

  14. N-Sulfomethylation of guanine, adenine and cytosine with formaldehyde-bisulfite. A selective modification of guanine in DNA.

    PubMed

    Hayatsu, H; Yamashita, Y; Yui, S; Yamagata, Y; Tomita, K; Negishi, K

    1982-10-25

    When guanine-, adenine- and cytosine-nucleosides and nucleotides were treated with formaldehyde and then with bisulfite, stable N-sulfomethyl compounds were formed. N2-Sulfomethylguanine, N6-sulfomethyladenine, N4-sulfomthylcytosine and N6-sulfomethyl-9-beta-D-arabinofuranosyladenine were isolated as crystals and characterized. A guanine-specific sulfomethylation was brought about by treatment and denatured single-stranded DNA with formaldehyde and then with bisulfite at pH 7 and 4 degrees C. Since native double-stranded DNA was not modified by this treatment, this new method of modification is expected to be useful as a conformational probe for polynucleotides.

  15. N-Sulfomethylation of guanine, adenine and cytosine with formaldehyde-bisulfite. A selective modification of guanine in DNA.

    PubMed Central

    Hayatsu, H; Yamashita, Y; Yui, S; Yamagata, Y; Tomita, K; Negishi, K

    1982-01-01

    When guanine-, adenine- and cytosine-nucleosides and nucleotides were treated with formaldehyde and then with bisulfite, stable N-sulfomethyl compounds were formed. N2-Sulfomethylguanine, N6-sulfomethyladenine, N4-sulfomthylcytosine and N6-sulfomethyl-9-beta-D-arabinofuranosyladenine were isolated as crystals and characterized. A guanine-specific sulfomethylation was brought about by treatment and denatured single-stranded DNA with formaldehyde and then with bisulfite at pH 7 and 4 degrees C. Since native double-stranded DNA was not modified by this treatment, this new method of modification is expected to be useful as a conformational probe for polynucleotides. PMID:7177848

  16. Evidence for a class of very small introns in the gene for hypoxanthine-guanine phosphoribosyltransferase in Schistosoma mansoni.

    PubMed Central

    Craig, S P; Muralidhar, M G; McKerrow, J H; Wang, C C

    1989-01-01

    The single copy gene for the hypoxanthine-guanine phosphoribosyltransferase (HGPRTase) of the parasitic trematode, Schistosoma mansoni, contains seven introns, the first four of which are only 31, 33, 42, and 32 bases in length. These are the smallest introns ever discovered in a non-viral nuclear gene coding for protein. These very small introns possess the canonical GT...AG splice site sequences but lack the branching sequence, the secondary structure, and the minimum size of approximately 50 bases believed to be required for the splicing of eucaryotic mRNA precursors. Evidently, a somewhat different splicing mechanism for the transcripts of these very small introns is necessary. Their discovery within the genes of helminths raises theoretical considerations for the evolution of introns in eucaryotes. Images PMID:2701934

  17. Analysis of cDNA encoding the hypoxanthine-guanine phosphoribosyltransferase (HGPRTase) of Schistosoma mansoni; a putative target for chemotherapy.

    PubMed Central

    Craig, S P; McKerrow, J H; Newport, G R; Wang, C C

    1988-01-01

    Because of the lack of de novo purine biosynthesis, hypoxanthine-guanine phosphoribosyltransferase (HGPRTase) is a critical enzyme in the purine metabolic pathway of the human parasite, Schistosoma mansoni. Using a cDNA clone encoding mouse HGPRTase and subsequently a synthetic oligonucleotide derived from sequencing a clone of genomic DNA, two clones were isolated from an adult schistosome cDNA library. One clone is 1.374 Kilobases (Kb) long and has an open reading frame of 693 bases. The deduced 231 amino acid sequence has 47.9% identity in a 217 amino acid overlap with human HGPRTase. Northern blot analysis indicates that the full length of mRNA for the S. mansoni HGPRTase is 1.45-1.6 Kb. Analysis of the primary structures of the putative active site for human and parasite enzymes reveal specific differences which may eventually be exploitable in the design of drugs for the treatment of schistosomiasis. Images PMID:3136439

  18. Crystal structure of a chimera of human and Plasmodium falciparum hypoxanthine guanine phosphoribosyltransferases provides insights into oligomerization.

    PubMed

    Gayathri, P; Sujay Subbayya, I N; Ashok, Chethan S; Selvi, T Senthamizh; Balaram, Hemalatha; Murthy, M R N

    2008-12-01

    The crystal structure of a chimera of Plasmodium falciparum (Pf) and human hypoxanthine guanine phosphoribosyltransferases (HGPRT), which consists of the core of the protein from the human enzyme and the hood region from the Pf enzyme, has been determined as a complex with the product guanosine monophosphate (GMP). The chimera can utilize hypoxanthine, guanine, and xanthine as substrates, similar to the Pf enzyme. It exists as a monomer-dimer mixture in solution, but shifts to a tetramer on addition of phosphoribosyl pyrophosphate (PRPP). The structural studies reveal that the asymmetric unit of the crystal consists of two monomers of the chimeric HGPRT. Surprisingly, the dimer interface of the chimera is the less extensive AC interface of the parent HGPRTs. An analysis of the crystal structures of the various human HGPRTs provides an explanation for the oligomeric characteristics of the chimera. Pro93 and Tyr197 form part of crucial interactions holding together the AB interface in the unliganded or GMP-bound forms of HGPRT, while Pro93 and His26 interact at the interface after binding of PRPP. Replacement of Tyr197 of human HGPRT by Ile207 in the chimera disrupts the interaction at the AB interface in the absence of PRPP. In the presence of PRPP, the interaction between Pro93 and His26 could restore the AB interface, shifting the chimeric enzyme to a tetrameric state. The structure provides valuable insights into the differences in the AB interface between Pf and human HGPRTs, which may be useful for designing selective inhibitors against the parasite enzyme.

  19. Structure-wise discrimination of adenine and guanine by proteins on the basis of their nonbonded interactions.

    PubMed

    Usha, S; Selvaraj, S

    2015-01-01

    We have analyzed the nonbonded interactions of the structurally similar moieties, adenine and guanine forming complexes with proteins. The results comprise (a) the amino acid-ligand atom preferences, (b) solvent accessibility of ligand atoms before and after complex formation with proteins, and (c) preferred amino acid residue atoms involved in the interactions. We have observed that the amino acid preferences involved in the hydrogen bonding interactions vary for adenine and guanine. The structural variation between the purine atoms is clearly reflected by their burial tendency in the solvent environment. Correlation of the mean amino acid preference values show the variation that exists between adenine and guanine preferences of all the amino acid residues. All our observations provide evidence for the discriminating nature of the proteins in recognizing adenine and guanine.

  20. Geometrical Characterization of Adenine And Guanine on Cu(110) By NEXAFS, XPS, And DFT Calculation

    SciTech Connect

    Furukawa, M.; Yamada, T.; Katano, S.; Kawai, M.; Ogasawara, H.; Nilsson, A.; /SLAC, SSRL /Stockholm U.

    2009-04-30

    Adsorption of purine DNA bases (guanine and adenine) on Cu(1 1 0) was studied by X-ray photoelectron spectroscopy (XPS), near-edge X-ray absorption fine-structure spectroscopy (NEXAFS), and density-functional theory (DFT) calculation. At coverages near 0.2 monolayers, Angular-resolved NEXAFS analysis revealed that adenine adsorbates lie almost flat and that guanine adsorbates are tilted up on the surface with the purine ring parallel to the atom rows of Cu(1 1 0). Referring to the previous studies on pyrimidine DNA bases [M. Furukawa, H. Fujisawa, S. Katano, H. Ogasawara, Y. Kim, T. Komeda, A. Nilsson, M. Kawai, Surf. Sci. 532-535 (2003) 261], the isomerization of DNA bases on Cu(1 1 0) was found to play an important role in the adsorption geometry. Guanine, thymine and cytosine adsorption have an amine-type nitrogen next to a carbonyl group, which is dehydrogenated into imine nitrogen on Cu(1 1 0). These bases are bonded by the inherent portion of - NH-CO - altered by conversion into enolic form and dehydrogenation. Adenine contains no CO group and is bonded to Cu(1 1 0) by participation of the inherent amine parts, resulting in nearly flatly-lying position.

  1. Major and minor groove conformations of DNA trimers modified on guanine or adenine by 4-aminobiphenyl: Adenine adducts favor the minor groove

    SciTech Connect

    Shapiro, R.; Ellis, S.; Hingerty, B.E.

    1995-01-01

    We have studied the conformational effects of 4-aminobiphenyl modification at C-8 of guanine or adenine on double-stranded DNA trimers. We used sequences with the modified purine at the central base pair and all 16 possible neighboring sequences at the outer pairs. Minimized potential energy calculations were carried out using the molecular mechanics program DUPLEX to survey the conformation space of these adducts, using a total of 1280 starting structures both in the modified guanine series and in the modified adenine series. Conformer families in which the bound 4-aminobiphenyl was located in the DNA major groove, and in the minor groove, were located for both adenine and guanine modification. In the modified guanine series, the major and minor groove families were roughly comparable in energy, and the sequence context determined which was more stable in a particular case. In the modified adenine series, however, the minor groove structure was more that 10 kcal/mol more stable than the major groove for all sequences. As a result, minor groove adducts provided most of the global minima in the adenine-modified series. This result may be relevant to a previous mutagenesis study [Lasko et al. (1988) J. Biol. Chem. 263, 15429-15435] in which the hot spot of most frequent occurrence was located at an adenine, in the sequence GAT. 25 refs., 9 figs., 4 tabs.

  2. Non-small-cell lung cancer cell lines A549 and NCI-H460 express hypoxanthine guanine phosphoribosyltransferase on the plasma membrane

    PubMed Central

    Townsend, Michelle H; Anderson, Michael D; Weagel, Evita G; Velazquez, Edwin J; Weber, K Scott; Robison, Richard A; O’Neill, Kim L

    2017-01-01

    In both males and females, lung cancer is one of the most lethal cancers worldwide and accounts for >30% of cancer-related deaths. Despite advances in biomarker analysis and tumor characterization, there remains a need to find suitable biomarker antigen targets for treatment in late-stage lung cancer. Previous research on the salvage pathway enzyme TK1 shows a unique relationship with cancer patients as serum levels are raised according to cancer grade. To expand this analysis, the other salvage pathway enzymes were evaluated for possible upregulation within lung cancer. Adenine phosphoribosyltransferase, deoxycytidine kinase, and hypoxanthine guanine phosphoribosyltransferase (HPRT) were assessed for their presentation on two non-small-cell lung cancer cell lines NCI-H460 and A549. In the present study, we show that deoxycytidine kinase and adenine phosphoribosyltransferase have no significant relationship with the membrane of NCI-H460 cells. However, we found significant localization of HPRT to the membrane of NCI-H460 and A549 cells. When treated with anti-HPRT antibodies, the average fluorescence of the cell population increased by 24.3% and 12.9% in NCI-H460 and A549 cells, respectively, in comparison with controls. To ensure that expression was not attributed to cytoplasmic HPRT, confocal microscopy was performed to visualize HPRT binding on the plasma membrane. After staining NCI-H460 cells treated with both fluorescent antibodies and a membrane-specific dye, we observed direct overlap between HPRT and the membrane of the cancer cells. Additionally, gold-conjugated antibodies were used to label and quantify the amount of HPRT on the cell surface using scanning electron microscopy and energy-dispersive analysis X-ray. Further confirming HPRT presence, the gold weight percentage of the sample increased significantly when NCI-H460 cells were exposed to HPRT antibody (P=0.012) in comparison with isotype controls. Our results show that HPRT is localized on the

  3. Molecular nature of spontaneous mutations at the hypoxanthine-guanine phosphoribosyltransferase (hprt) locus in Chinese hamster ovary cells.

    PubMed

    Xu, Z; Yu, Y; Schwartz, J L; Meltz, M L; Hsie, A W

    1995-01-01

    The hypoxanthine-guanine phosphoribosyltransferase (hprt) locus has been widely used as a selectable genetic marker for studies of mammalian cell mutagenesis. We report here the spontaneous mutation spectrum at the hprt locus in 64 independently isolated mutants of Chinese hamster ovary (CHO) cells. All nine hprt exons were simultaneously analyzed via multiplex polymerase chain reaction (PCR) for rapid detection of gene deletions or insertions. Structural point mutations were identified by direct sequence analysis of the PCR amplified cDNA. The molecular nature of RNA splicing errors and insertions was analyzed by solid-phase direct exon sequencing. Single base substitutions were found in 24 mutants (38%), of which 21 were missense and 3 were nonsense mutations. Transversions were about twice as frequent as transitions. Fifteen mutants (23%) had deletions involving either intragenic small fragments (2), single exons (9), or multiple exons (4). The majority of deletion breakpoints (71%) were located in regions surrounding exons 4, 5, and 6. RNA splicing mutations were observed in 15 mutants (23%) and affected exons 3-8; most (6/15) resulted in the loss of exon 7. Two insertion mutants, one with a 209 bp insert in exon 4 and the other with a 88 bp insert accompanied by a 24 bp deletion in exon 6, represent novel mutations reported for the first time in spontaneous mutants of the mammalian hprt gene.

  4. Fragmentation of the adenine and guanine molecules induced by electron collisions

    SciTech Connect

    Minaev, B. F. E-mail: boris@theochem.kth.se; Shafranyosh, M. I.; Svida, Yu. Yu; Sukhoviya, M. I.; Shafranyosh, I. I.; Baryshnikov, G. V.; Minaeva, V. A.

    2014-05-07

    Secondary electron emission is the most important stage in the mechanism of radiation damage to DNA biopolymers induced by primary ionizing radiation. These secondary electrons ejected by the primary electron impacts can produce further ionizations, initiating an avalanche effect, leading to genome damage through the energy transfer from the primary objects to sensitive biomolecular targets, such as nitrogenous bases, saccharides, and other DNA and peptide components. In this work, the formation of positive and negative ions of purine bases of nucleic acids (adenine and guanine molecules) under the impact of slow electrons (from 0.1 till 200 eV) is studied by the crossed electron and molecular beams technique. The method used makes it possible to measure the molecular beam intensity and determine the total cross-sections for the formation of positive and negative ions of the studied molecules, their energy dependences, and absolute values. It is found that the maximum cross section for formation of the adenine and guanine positive ions is reached at about 90 eV energy of the electron beam and their absolute values are equal to 2.8 × 10{sup −15} and 3.2 × 10{sup −15} cm{sup 2}, respectively. The total cross section for formation of the negative ions is 6.1 × 10{sup −18} and 7.6 × 10{sup −18} cm{sup 2} at the energy of 1.1 eV for adenine and guanine, respectively. The absolute cross-section values for the molecular ions are measured and the cross-sections of dissociative ionization are determined. Quantum chemical calculations are performed for the studied molecules, ions and fragments for interpretation of the crossed beams experiments.

  5. Particular behavior of the adenine and guanine ring-breathing modes upon the DNA conformational transitions.

    PubMed

    Ghomi, M; Letellier, R; Taillandier, E

    1988-06-01

    Harmonic dynamics calculations performed on the deoxyguanosine (dG) and deoxyadenosine (dA) residues, based on a reliable force field, show that the breathing motions of both guanine and adenine residues are involved in two different vibration modes (750-500 cm-1 spectral region). The calculated results reveal a strong coupling of these modes with the sugar pucker motions. This effect has been verified for the dG residue by the Raman spectra of polyd(G-C). As far as the dA residue is concerned, the particular behavior of the adenine residue breathing mode predicted by these calculations, has been confirmed by Raman spectra of polyd(A-T) undergoing a B----Z conformational transition.

  6. Pre-thymic somatic mutation leads to high mutant frequency at hypoxanthine-guanine phosphoribosyltransferase gene

    SciTech Connect

    Jett, J.

    1994-12-01

    While characterizing the background mutation spectrum of the Hypoxathine-guanine phosphoribosyltransferase (HPRT) gene in a healthy population, an outlier with a high mutant frequency of thioguanine resistant lymphocytes was found. When studied at the age of 46, this individual had been smoking 60 cigarettes per day for 38 years. His mutant frequency was calculated at 3.6 and 4.2x10{sup {minus}4} for two sampling periods eight months apart. Sequencing analysis of the HPRT gene in his mutant thioguanine resistant T lymphocytes was done to find whether the cells had a high rate of mutation, or if the mutation was due to a single occurrence of mutation and, if so, when in the T lymphocyte development the mutation occurred. By T-cell receptor analysis it has been found that out of 35 thioguanine resistant clones there was no dominant gamma T cell receptor gene rearrangement. During my appointment in the Science & Engineering Research Semester, I found that 34 of those clones have the same base substitution of G{yields}T at cDNA position 197. Due to the consistent mutant frequency from both sampling periods and the varying T cell receptors, the high mutant frequency cannot be due to recent proliferation of a mature mutant T lymphocyte. From the TCR and DNA sequence analysis we conclude that the G{yields}T mutation must have occurred in a T lymphocyte precursor before thymic differentiation so that the thioguanine resistant clones share the same base substitution but not the same gamma T cell receptor gene.

  7. Simultaneous Determination of Adenine and Guanine Using Cadmium Selenide Quantum Dots-Graphene Oxide Nanocomposite Modified Electrode.

    PubMed

    Kalaivani, Arumugam; Narayanan, Sangilimuthu Sriman

    2015-06-01

    A novel electrochemical sensor was fabricated by immobilizing Cadmium Selenide Quantum Dots (CdSe QDs)-Graphene Oxide (GO) nanocomposite on a paraffin wax impregnated graphite electrode (PIGE) and was used for the simultaneous determination of adenine and guanine. The CdSe QDs-GO nanocomposite was prepared by ultrasonication and was characterized with spectroscopic and microscopic techniques. The nanocomposite modified electrode was characterized by cyclic voltammetry (CV). The modified electrode showed excellent electrocatalytic activity towards the oxidative determination of adenine and guanine with a good peak separation of 0.31 V. This may be due to the high surface area and fast electron transfer kinetics of the nanocomposite. The modified electrode exhibited wide linear ranges from 0.167 μM to 245 μM for Guanine and 0.083 μM to 291 μM for Adenine with detection limits of 0.055 μM Guanine and 0.028 μM of Adenine (S/N = 3) respectively. Further, the modified electrode was used for the quantitative determination of adenine and guanine in herring sperm DNA with satisfactory results. The modified electrode showed acceptable selectivity, reproducibility and stability under optimal conditions.

  8. Effects of hypoxanthine substitution in peptide nucleic acids targeting KRAS2 oncogenic mRNA molecules: theory and experiment.

    PubMed

    Sanders, Jeffrey M; Wampole, Matthew E; Chen, Chang-Po; Sethi, Dalip; Singh, Amrita; Dupradeau, François-Yves; Wang, Fan; Gray, Brian D; Thakur, Mathew L; Wickstrom, Eric

    2013-10-03

    Genetic disorders can arise from single base substitutions in a single gene. A single base substitution for wild type guanine in the twelfth codon of KRAS2 mRNA occurs frequently to initiate lung, pancreatic, and colon cancer. We have observed single base mismatch specificity in radioimaging of mutant KRAS2 mRNA in tumors in mice by in vivo hybridization with radiolabeled peptide nucleic acid (PNA) dodecamers. We hypothesized that multimutant specificity could be achieved with a PNA dodecamer incorporating hypoxanthine, which can form Watson-Crick base pairs with adenine, cytosine, thymine, and uracil. Using molecular dynamics simulations and free energy calculations, we show that hypoxanthine substitutions in PNAs are tolerated in KRAS2 RNA:PNA duplexes where wild type guanine is replaced by mutant uracil or adenine in RNA. To validate our predictions, we synthesized PNA dodecamers with hypoxanthine, and then measured the thermal stability of RNA:PNA duplexes. Circular dichroism thermal melting results showed that hypoxanthine-containing PNAs are more stable in duplexes where hypoxanthine-adenine and hypoxanthine-uracil base pairs are formed than single mismatch duplexes or duplexes containing hypoxanthine-guanine opposition.

  9. A QM/QTAIM microstructural analysis of the tautomerisationviathe DPT of the hypoxanthine·adenine nucleobase pair

    NASA Astrophysics Data System (ADS)

    Brovarets', Ol'ha O.; Zhurakivsky, Roman O.; Hovorun, Dmytro M.

    2014-08-01

    We provide a pathway for the tautomerisation of the biologically important hypoxanthine.adenine (Hyp.Ade) nucleobase pair (Cs) formed by the keto tautomer of the Hyp and the amino tautomer of the Ade into the Hyp*.Ade* base pair (Cs) formed by the enol tautomer of the Hyp and the imino tautomer of the Ade by applying quantum-mechanical calculations and Bader's Quantum Theory of Atoms in Molecules analysis. It was found out that the dipole active Hyp.Ade↔Hyp*.Ade* tautomerisation occurs via the asynchronous concerted double proton transfer (DPT) through the TSHyp.Ade↔Hyp*.Ade* (Cs). Based on the sweeps of the energies of the intermolecular H-bonds along the intrinsic reaction coordinate, it was established that the N6H...O6 H-bond (5.40) is cooperative with the N1H...N1 H-bond (6.99) in the Hyp.Ade base pair, as well as the O6H...N6 H-bond (11.50) is cooperative with the N1H...N1 H-bond (7.28 kcal.mol-1) in the Hyp*.Ade* base pair, mutually strengthening each other. The Hyp*.Ade* base pair possesses an extremely short lifetime 2.68.10-14 s, which is predetermined by the negative value of the Gibbs free energy of the reverse barrier of its tautomerisation, and all of the six low-frequency intermolecular vibrations cannot develop during this period of time. Consequently, the Hyp.Ade→Hyp*.Ade* DPT tautomerisation cannot serve as a source of the rare tautomers of the bases.

  10. Adenine and guanine 8CH exchange in nucleic acids: resolution and measurement by Raman optical multichannel analysis.

    PubMed

    Lamba, O P; Becka, R; Thomas, G J

    Deuterium exchange of 8C protons of adenine and guanine in nucleic acids is conveniently monitored by laser Raman spectrophotometry, and the average exchange rate so determined [kA + kG] can be exploited as a dynamic probe of the secondary structure of DNA or RNA [J. M. Benevides and G. J. Thomas, Jr. (1985) Biopolymers 24, 667-682]. The present work describes a rapid Raman procedure, based upon optical multichannel analysis, which permits discrimination of the different 8CH exchange rates, kA of adenine and kG of guanine, in a single experimental protocol. For this procedure, simultaneous measurements are made of the intensity decay or frequency shift in separately resolved Raman bands of adenine and guanine, each of which is sensitive only to 8C deuteration of its respective purine. Resolution of the rates kA and kG is demonstrated for the mononucleotide mixtures, 5'-rAMP + 5'-rGMP and 5'-dAMP + 5'-dGMP, for the polynucleotides poly(dA-dT).poly(dA-dT) and poly(dG-dC).poly(dG-dC), for calf thymus DNA, and for the 17 base-pair operator OR3. We show that the different exchange rates of adenine and guanine, in nucleotide mixtures and in DNA, may also be calculated independently from intensity decay of the composite 1481-cm-1 band, comprising overlapped adenine and guanine components, over a time domain that encompasses two distinct regimes: (1) a relatively more rapid exchange of guanine, and (2) a concurrent slower exchange of adenine. Both methods developed here yield consistent results. We find, first, that exchange of guanine is approximately twofold more rapid than that of adenine when both purines are present in the same structure and solvent environment, presumably a consequence of the greater basicity of the 7N site of guanine. Second, we find that adenine suffers greater retardation of exchange than guanine when both purines are incorporated into a "classical" B-DNA secondary structure, such as that of calf thymus DNA. This finding suggests different

  11. Highly sensitive and synergistic detection of guanine and adenine based on poly(xanthurenic acid)-reduced graphene oxide interface.

    PubMed

    Yang, Tao; Kong, Qianqian; Li, Qianhe; Wang, Xinxing; Chen, Lihua; Jiao, Kui

    2014-07-23

    In order to achieve the large direct electrochemical signals of guanine and adenine, an urgent request to explore novel electrode materials and interfaces has been put forward. In this paper, a poly(xanthurenic acid, Xa)-reduced graphene oxide (PXa-ERGNO) interface, which has rich negatively charged active sites and accelerated electron transfer ability, was fabricated for monitoring the positively charged guanine and adenine. Scanning electron microscopy, Fourier transform infrared spectroscopy, Raman spectra, X-ray photoelectron spectroscopy, cyclic voltammetry, electrochemical impedance spectroscopy, and differential pulse voltammetry were adopted to characterize the morphology and prove the electrochemical properties of the prepared interface. The PXa-ERGNO interface with rich negative charge and large electrode surface area was an excellent sensing platform to prompt the adsorption of the positively charged guanine and adenine via strong π-π* interaction or electrostatic adsorption. The PXa-ERGNO interface exhibited prominent synergistic effect and good electrocatalytic activity for sensitive determination of guanine and adenine compared with sole PXa or ERGNO modified electrode. The sensing platform we built could be further applied in the adsorption and detection of other positively charged biomolecules or aromatic molecules.

  12. Structural and thermodynamic studies on the adenine.guanine mismatch in B-DNA.

    PubMed Central

    Leonard, G A; Booth, E D; Brown, T

    1990-01-01

    The structure of the synthetic dodecamer d(CGCAAATTGGCG) has been shown by single crystal X-ray diffraction methods to be that of a B-DNA helix containing two A(anti).G(syn) base pairs. The refinement, based on data to a resolution of 2.25 A shows that the mismatch base pairs are held together by two hydrogen bonds. The syn-conformation of the guanine base of the mismatch is stabilised by hydrogen bonding to a network of solvent molecules in both the major and minor grooves. A pH-dependent ultraviolet melting study indicates that the duplex is stabilised by protonation, suggesting that the bases of the A.G mispair are present in their most common tautomeric forms and that the N(1)-atom of adenine is protonated. The structure refinement shows that there is some disorder in the sugar-phosphate backbone. PMID:2216754

  13. Simultaneous determination of adenine and guanine in ruminant bacterial pellets by ion-pair HPLC.

    PubMed

    García del Moral, Pilar; Arín, María Jesús; Resines, José Antonio; Díez, María Teresa

    2005-11-05

    An ion-pair reversed-phase high-performance liquid chromatography with gradient elution and UV detection was used to measure adenine (A) and guanine (G) in lyophilized bacterial pellets from ruminants using allopurinol as internal standard. The separation was performed on a Symmetry C18 column and the detection was monitored at 280 nm. Calibration curves were found to be linear in the concentration range from 5 to 50 mg/l with correlation coefficients (r2)>0.999. Mean recoveries of A and G standards added to bacterial samples were 102.2 and 98.2, respectively. The method proposed yielded sharp, well-resolved peaks within 25 min and was successfully applied for the determination of A and G in bacterial pellets.

  14. Surface-Enhanced Hyper-Raman Spectra of Adenine, Guanine, Cytosine, Thymine, and Uracil

    PubMed Central

    2016-01-01

    Using picosecond excitation at 1064 nm, surface-enhanced hyper-Raman scattering (SEHRS) spectra of the nucleobases adenine, guanine, cytosine, thymine, and uracil with two different types of silver nanoparticles were obtained. Comparing the SEHRS spectra with SERS data from the identical samples excited at 532 nm and with known infrared spectra, the major bands in the spectra are assigned. Due to the different selection rules for the one- and two-photon excited Raman scattering, we observe strong variation in relative signal strengths of many molecular vibrations obtained in SEHRS and SERS spectra. The two-photon excited spectra of the nucleobases are found to be very sensitive with respect to molecule–nanoparticle interactions. Using both the SEHRS and SERS data, a comprehensive vibrational characterization of the interaction of nucleobases with silver nanostructures can be achieved. PMID:28077982

  15. Synthesis of adenine, guanine, cytosine, and other nitrogen organic compounds by a Fischer-Tropsch-like process.

    NASA Technical Reports Server (NTRS)

    Yang, C. C.; Oro, J.

    1971-01-01

    Study of the formation of purines, pyrimidines, and other bases from CO, H2, and NH3 under conditions similar to those used in the Fischer-Tropsch process. It is found that industrial nickel/iron alloy catalyzes the synthesis of adenine, guanine, cytosine, and other nitrogenous compounds from mixtures of CO, H2, and NH3 at temperatures of about 600 C. Sufficient sample was accumulated to isolate as solid products adenine, guanine, and cytosine, which were identified by infrared spectrophotometry. In the absence of nickel/iron catalyst, at 650 C, or in the presence of this catalyst, at 450 C, no purines or pyrimidines were synthesized. These results confirm and extend some of the work reported by Kayatsu et al. (1968).

  16. Overoxidized polypyrrole/graphene nanocomposite with good electrochemical performance as novel electrode material for the detection of adenine and guanine.

    PubMed

    Gao, Yan-Sha; Xu, Jing-Kun; Lu, Li-Min; Wu, Li-Ping; Zhang, Kai-Xin; Nie, Tao; Zhu, Xiao-Fei; Wu, Yao

    2014-12-15

    Most conducting polymer/graphene composites have excellent electrical conductivity. However, the background currents of these composites modified electrodes are much larger. In order to improve the sensitivities of these methods, it is necessary to decrease the background signal. In this paper, porous structure films of overoxidized polypyrrole/graphene (PPyox/GR) have been electrochemically coated onto glassy carbon electrode (GCE) and successfully utilized as an efficient electrode material for the quantitive detection of adenine and guanine, two of the most important components of DNA and RNA. The permselective polymer coatings with low background current could improve the selectivity and sensitivity of microelectrodes for the electropositive purine bases. The GRs into these polymers would further improve sensitivity by increasing the electroactive surface area. The electrochemical sensor can be applied to the quantification of adenine and guanine with a linear range covering 0.06-100 µM and 0.04-100 µM, and a low detection limit of 0.02 μM and 0.01 μM, respectively. More importantly, the proposed method was applied to quantify adenine and guanine in calf thymus DNA with satisfactory results.

  17. Electrochemical biosensor based on silver nanoparticles-polydopamine-graphene nanocomposite for sensitive determination of adenine and guanine.

    PubMed

    Huang, Ke-Jing; Wang, Lan; Wang, Hai-Bo; Gan, Tian; Wu, Ying-Ying; Li, Jing; Liu, Yan-Ming

    2013-09-30

    A multifunctional Ag nanoparticles (AgNPs)-polydopamine (Pdop)@graphene (Gr) composite was prepared by a simple and mild procedure. Gr was easily coated with Pdop at room temperature and then AgNPs was deposited by mildly stirring. The nanocomposite was characterized by scanning electron microscope (SEM) and transmission electron microscope (TEM). Guanine and adenine as model moleculars were employed to study their electrochemical responses at the Ag-Pdop@Gr composite modified electrode, which showed more favorable electron transfer kinetics than Gr modified glassy carbon and AgNPs modified glassy carbon electrodes. The Ag-Pdop@Gr modified electrode exhibited linear ranges of 0.04-50 μM and 0.02-40 μM with detection limits of 4.0 nM and 2.0 nM for guanine and adenine, respectively. The developed method was applied for simultaneous determination of trace-level adenine and guanine in fish sperm. The results demonstrated that the AgNPs-Pdop@Gr nanocomposite was a promising substrate for the development of high-performance electrocatalysts for biosensing.

  18. Vacuum-Ultraviolet photoionization studies of the microhydrationof DNA bases (Guanine, Cytosine, Adenine and Thymine)

    SciTech Connect

    Belau, L.; Wilson, K.R.; Leone, S.R.; Musahid, Ahmed

    2007-01-22

    In this work, we report on a photoionization study of the microhydration of the four DNA bases. Gas-phase clusters of water with DNA bases [guanine (G), cytosine (C), adenine (A), and thymine (T)] are generated via thermal vaporization of the bases and expansion of the resultant vapor in a continuous supersonic jet expansion of water seeded in Ar. The resulting clusters are investigated by single-photon ionization with tunable vacuum-ultraviolet synchrotron radiation and mass analyzed using reflectron mass spectrometry. Photoionization efficiency (PIE) curves are recorded for the DNA bases and the following water (W) clusters: G, GW{sub n} (n = 1-3); C, CW{sub n} (n = 1-3); A, AW{sub n} (n = 1,2); and T, TW{sub n} (n = 1-3). Appearance energies (AE) are derived from the onset of these PIE curves (all energies in eV): G (8.1 {+-} 0.1), GW (8.0 {+-} 0.1), GW{sub 2} (8.0 {+-} 0.1), and GW{sub 3} (8.0); C (8.65 {+-} 0.05), CW (8.45 {+-} 0.05), CW{sub 2} (8.4 {+-} 0.1), and CW{sub 3} (8.3 {+-} 0.1); A (8.30 {+-} 0.05), AW (8.20 {+-} 0.05), and AW{sub 2} (8.1 {+-} 0.1); T (8.90 {+-} 0.05); and TW (8.75 {+-} 0.05), TW{sub 2} (8.6 {+-} 0.1), and TW{sub 3} (8.6 {+-} 0.1). The AEs of the DNA bases decrease slightly with the addition of water molecules (up to three) but do not converge to values found for photoinduced electron removal from DNA bases in solution.

  19. Hypoxanthine-guanine phosphoribosyltransferase and inosine 5'-monophosphate dehydrogenase activities in three mammalian species: aquatic (Mirounga angustirostris), semi-aquatic (Lontra longicaudis annectens) and terrestrial (Sus scrofa).

    PubMed

    Barjau Pérez-Milicua, Myrna; Zenteno-Savín, Tania; Crocker, Daniel E; Gallo-Reynoso, Juan P

    2015-01-01

    Aquatic and semiaquatic mammals have the capacity of breath hold (apnea) diving. Northern elephant seals (Mirounga angustirostris) have the ability to perform deep and long duration dives; during a routine dive, adults can hold their breath for 25 min. Neotropical river otters (Lontra longicaudis annectens) can hold their breath for about 30 s. Such periods of apnea may result in reduced oxygen concentration (hypoxia) and reduced blood supply (ischemia) to tissues. Production of adenosine 5'-triphosphate (ATP) requires oxygen, and most mammalian species, like the domestic pig (Sus scrofa), are not adapted to tolerate hypoxia and ischemia, conditions that result in ATP degradation. The objective of this study was to explore the differences in purine synthesis and recycling in erythrocytes and plasma of three mammalian species adapted to different environments: aquatic (northern elephant seal) (n = 11), semiaquatic (neotropical river otter) (n = 4), and terrestrial (domestic pig) (n = 11). Enzymatic activity of hypoxanthine-guanine phosphoribosyltransferase (HGPRT) was determined by spectrophotometry, and activity of inosine 5'-monophosphate dehydrogenase (IMPDH) and the concentration of hypoxanthine (HX), inosine 5'-monophosphate (IMP), adenosine 5'-monophosphate (AMP), adenosine 5'-diphosphate (ADP), ATP, guanosine 5'-diphosphate (GDP), guanosine 5'-triphosphate (GTP), and xanthosine 5'-monophosphate (XMP) were determined by high-performance liquid chromatography (HPLC). The activities of HGPRT and IMPDH and the concentration of HX, IMP, AMP, ADP, ATP, GTP, and XMP in erythrocytes of domestic pigs were higher than in erythrocytes of northern elephant seals and river otters. These results suggest that under basal conditions (no diving, sleep apnea or exercise), aquatic, and semiaquatic mammals have less purine mobilization than their terrestrial counterparts.

  20. Hydrophilic-interaction liquid chromatography-tandem mass spectrometric determination of erythrocyte 5-phosphoribosyl 1-pyrophosphate in patients with hypoxanthine-guanine phosphoribosyltransferase deficiency.

    PubMed

    Hasegawa, Hiroshi; Shinohara, Yoshihiko; Nozaki, Sayako; Nakamura, Makiko; Oh, Koei; Namiki, Osamu; Suzuki, Kiyotaka; Nakahara, Akihiko; Miyazawa, Mari; Ishikawa, Ken; Himeno, Takahiro; Yoshida, Sayaka; Ueda, Takanori; Yamada, Yasukazu; Ichida, Kimiyoshi

    2015-01-22

    Mutations in the gene encoding hypoxanthine-guanine phosphoribosyltransferase (HPRT) cause Lesch-Nyhan disease (LND) and its variants (LNV). Due to the technical problems for measuring the HPRT activity in vitro, discordances between the residual HPRT activity and the clinical severity were found. 5-Phosphoribosyl 1-pyrophosphate (PRPP) is a substrate for HPRT. Since increased PRPP concentrations were observed in erythrocytes from patients with LND and LNV, we have turned our attention to erythrocyte PRPP as a biomarker for the phenotype classification. In the present work, a method for determination of PRPP concentration in erythrocyte was developed using liquid chromatography-tandem mass spectrometry (LC-MS/MS) with multiple reaction monitoring (MRM). Packed erythrocyte samples were deproteinized by heating and the supernatants were injected into the LC-MS/MS system. All measurement results showed good precision with RSD <6%. PRPP concentrations of nine normal male subjects, four male patents with LND and six male patients with LNV were compared. The PRPP concentrations in erythrocyte from patients with LND were markedly increased compared with those from normal subjects, and those from patients with LNV were also increased but the degree was smaller than those with LND. The increase pattern of PRPP concentration in erythrocyte from patients with HPRT deficiency was consistent with the respective phenotypes and was correlated with the disease severity. PRPP concentration was suggested to give us supportive information for the diagnosis and the phenotype classification of LND and LNV.

  1. Purine salvage in the apicomplexan Sarcocystis neurona, and generation of hypoxanthine-xanthine-guanine phosphoribosyltransferase-deficient clones for positive-negative selection of transgenic parasites.

    PubMed

    Dangoudoubiyam, Sriveny; Zhang, Zijing; Howe, Daniel K

    2014-09-01

    Sarcocystis neurona is an apicomplexan parasite that causes severe neurological disease in horses and marine mammals. The Apicomplexa are all obligate intracellular parasites that lack purine biosynthesis pathways and rely on the host cell for their purine requirements. Hypoxanthine-xanthine-guanine phosphoribosyltransferase (HXGPRT) and adenosine kinase (AK) are key enzymes that function in two complementary purine salvage pathways in apicomplexans. Bioinformatic searches of the S. neurona genome revealed genes encoding HXGPRT, AK and all of the major purine salvage enzymes except purine nucleoside phosphorylase. Wild-type S. neurona were able to grow in the presence of mycophenolic acid (MPA) but were inhibited by 6-thioxanthine (6-TX), suggesting that the pathways involving either HXGPRT or AK are functional in this parasite. Prior work with Toxoplasma gondii demonstrated the utility of HXGPRT as a positive-negative selection marker. To enable the use of HXGPRT in S. neurona, the SnHXGPRT gene sequence was determined and a gene-targeting plasmid was transfected into S. neurona. SnHXGPRT-deficient mutants were selected with 6-TX, and single-cell clones were obtained. These Sn∆HXG parasites were susceptible to MPA and could be complemented using the heterologous T. gondii HXGPRT gene. In summary, S. neurona possesses both purine salvage pathways described in apicomplexans, thus allowing the use of HXGPRT as a positive-negative drug selection marker in this parasite.

  2. The electrochemical reduction of the purines guanine and adenine at platinum electrodes in several room temperature ionic liquids.

    PubMed

    Zanoni, Maria Valnice Boldrin; Rogers, Emma I; Hardacre, Christopher; Compton, Richard G

    2010-02-05

    The reduction of guanine was studied by microelectrode voltammetry in the room temperature ionic liquids (RTILs) N-hexyltriethylammonium bis (trifluoromethanesulfonyl) imide [N(6,2,2,2)][N(Tf)(2)], 1-butyl-3-methylimidazolium hexafluorosphosphate [C(4)mim][PF(6)], N-butyl-N-methyl-pyrrolidinium bis(trifluoromethanesulfonyl)imide [C(4)mpyrr][N(Tf)(2)], 1-butyl-3-methylimidazolium bis(trifluoromethanesulfonyl)imide [C(4)mim][N(Tf)(2)], N-butyl-N-methyl-pyrrolidinium dicyanamide [C(4)mpyrr][N(NC)(2)] and tris(P-hexyl)-tetradecylphosphonium trifluorotris(pentafluoroethyl)phosphate [P(14,6,6,6)][FAP] on a platinum microelectrode. In [N(6,2,2,2)][NTf(2)] and [P(14,6,6,6)][FAP], but not in the other ionic liquids studied, guanine reduction involves a one-electron, diffusion-controlled process at very negative potential to produce an unstable radical anion, which is thought to undergo a dimerization reaction, probably after proton abstraction from the cation of the ionic liquid. The rate of this subsequent reaction depends on the nature of the ionic liquid, and it is faster in the ionic liquid [P(14,6,6,6)][FAP], in which the formation of the resulting dimer can be voltammetrically monitored at less negative potentials than required for the reduction of the parent molecule. Adenine showed similar behaviour to guanine but the pyrimidines thymine and cytosine did not; thymine was not reduced at potentials less negative than required for solvent (RTIL) decomposition while only a poorly defined wave was seen for cytosine. The possibility for proton abstraction from the cation in [N(6,2,2,2)][NTf(2)] and [P(14,6,6,6)][FAP] is noted and this is thought to aid the electrochemical dimerization process. The resulting rapid reaction is thought to shift the reduction potentials for guanine and adenine to lower values than observed in RTILs where the scope for proton abstraction is not present. Such shifts are characteristic of so-called EC processes where reversible electron transfer

  3. Photoinduced Electron Transfer in DNA: Charge Shift Dynamics Between 8-Oxo-Guanine Anion and Adenine.

    PubMed

    Zhang, Yuyuan; Dood, Jordan; Beckstead, Ashley A; Li, Xi-Bo; Nguyen, Khiem V; Burrows, Cynthia J; Improta, Roberto; Kohler, Bern

    2015-06-18

    Femtosecond time-resolved IR spectroscopy is used to investigate the excited-state dynamics of a dinucleotide containing an 8-oxoguanine anion at the 5'-end and neutral adenine at the 3'-end. UV excitation of the dinucleotide transfers an electron from deprotonated 8-oxoguanine to its π-stacked neighbor adenine in less than 1 ps, generating a neutral 8-oxoguanine radical and an adenine radical anion. These species are identified by the excellent agreement between the experimental and calculated IR difference spectra. The quantum efficiency of this ultrafast charge shift reaction approaches unity. Back electron transfer from the adenine radical anion to the 8-oxguanine neutral radical occurs in 9 ps, or approximately 6 times faster than between the adenine radical anion and the 8-oxoguanine radical cation (Zhang, Y. et al. Proc. Natl. Acad. Sci. U.S.A. 2014, 111, 11612-11617). The large asymmetry in forward and back electron transfer rates is fully rationalized by semiclassical nonadiabatic electron transfer theory. Forward electron transfer is ultrafast because the driving force is nearly equal to the reorganization energy, which is estimated to lie between 1 and 2 eV. Back electron transfer is highly exergonic and takes place much more slowly in the Marcus inverted region.

  4. Metal-organic frameworks and β-cyclodextrin-based composite electrode for simultaneous quantification of guanine and adenine in a lab-on-valve manifold.

    PubMed

    Wang, Yang; Chen, Huanhuan; Wu, Yichun; Ge, Huali; Ye, Guiqin; Hu, Xiaoya

    2014-12-07

    In this work, a novel chemically modified electrode is constructed based on metal-organic frameworks and β-cyclodextrin (Cu3(BTC)2/β-CD, BTC = benzene-1,3,5-tricarboxylate) composite material. The electrode was used for simultaneous determination of guanine and adenine in a sequential injection lab-on-valve format and exhibited sensitive responses to guanine and adenine oxidation due to the π-π stacking interaction of Cu3(BTC)2 and the inclusion behavior of β-CD. The analytical performance was assessed with respect to the supporting electrolyte and its pH, accumulation time and accumulation potential, and the fluid flow rates. Under optimal conditions, linear calibration ranges for both guanine and adenine were from 1.0 × 10(-7) to 1.0 × 10(-5) mol L(-1), and detection limits (S/N = 3) were found to be 5.2 × 10(-8) and 2.8 × 10(-8) mol L(-1), respectively. The proposed sensor showed advantages of high sensitivity, simple sample preparation protocol, enhanced throughput and good reproducibility. Finally, the practical application of the proposed sensor has been performed for the determination of guanine and adenine in real samples with satisfactory results.

  5. A quantitative assay of mutation induction at the hypoxanthine-guanine phosphoribosyl transferase locus in Chinese hamster ovary cells (CHO/HGPRT system): development and definition of the system.

    PubMed

    O'Neill, J P; Brimer, P A; Machanoff, R; Hirsch, G P; Hsie, A W

    1977-10-01

    An assay is described for the measurement of mutation induction at the hypoxanthine-guanine phosphoribosyl transferase (HGPRT) locus in Chinese hamster ovary (CHO) cells utilizing resistance to 6-thioguanine (TG). Optimal selection conditions are defined for such parameters as phenotypic expression time prior to selection, and TG concentration and cell density which permits maximum mutant recovery. The nature of the TG-resistant mutants is characterized by several physiological and biochemical methods. The data demonstrate that more than 98% of the mutant clones isolated by this selection procedure contain altered HGPRTase activity. The CHO/HGPRT system thus shows the specificity necessary for a specific gene locus mutational assay.

  6. DNA-directed aniline mustards with high selectivity for adenine or guanine bases: mutagenesis in a variety of Salmonella typhimurium strains differing in DNA-repair capability.

    PubMed

    Ferguson, L R; Denny, W A; Boritzki, T J

    1994-04-01

    Two closely-related aniline monomustards (1 and 2), linked to a DNA-targeting acridine chromophore by a linker chain of different length, show high selectivity for alkylation of polymer DNA. The shorter-chain derivative (2) alkylates mainly at guanine N7 sites, while the longer-chain analogue (1) reacts almost exclusively at adenine N1. The biological effects of these compounds have been studied in standard Ames Salmonella typhimurium strains in order to determine the mutagenic consequences of such well-defined DNA lesions, and the effect of DNA-repair systems on them. Both compounds caused detectable mutations in strains TA1537, TA98 or TA100 and some related strains. Mutation rates were greatly enhanced in strains carrying either a uvrB deletion or the plasmid pKM101. Frameshift mutagenesis by both compounds was completely eliminated by recA deletion, in both the presence or absence of the plasmid. The adenine-selective compound (1) appeared more sensitive to the DNA-repair defects than the guanine-selective derivative (2). Additionally, only the adenine-selective compound (1) caused statistically significant levels of detectable mutation in the repair-proficient strains TA102, TA4001 or TA4006. The bacterial mutagenesis evidence suggests that a bulky, major groove-residing adenine lesion may be more readily recognised by DNA-repair systems, and more likely to lead to a wider range of mutagenic events, than a similar guanine lesion.

  7. Electron transfer from aromatic amino acids to guanine and adenine radical cations in pi stacked and T-shaped complexes.

    PubMed

    Butchosa, Cristina; Simon, Sílvia; Voityuk, Alexander A

    2010-04-21

    Similar redox properties of the natural nucleobases and aromatic amino acids make it possible for electron transfer (ET) to occur between these sites in protein-nucleic acid complexes. Using DFT calculations, we estimate the ET rate from aromatic amino acid X (X = Phe, His, Tyr and Trp) to radical cations of guanine (G) and adenine (A) in dimers G-X and A-X with different arrangement of the subunits. We show that irrespective of the mutual orientation of the aromatic rings, the electronic interaction in the systems is strong enough to ensure effective ET from X to G(+) or A(+). Surprisingly, relatively high ET rates are found in T-shaped dimers. This suggests that pi stacking of nucleobases and aromatic amino acids is not required for feasible ET. In most complexes [G-X](+) and [A-X](+), we find the excess charge to be confined to a single site, either the nucleobase or amino acid X. Then, conformational changes may initiate migration of the radical cation state from the nucleobase to X and back. The ET process from Trp and Tyr to G(+) is found to be faster than deprotonation of G(+). Because the last reaction may lead to the formation of highly mutagenic species, the efficient repair of G(+) may play an important role in the protection of genomic DNA from oxidative damage.

  8. New Dihydro OO'Bis(Salicylidene) 2,2' Aminobenzothiazolyl Borate Complexes: Kinetic and Voltammetric Studies of Dimethyltin Copper Complex with Guanine, Adenine, and Calf Thymus DNA.

    PubMed

    Arjmand, Farukh; Mohani, Bhawana; Parveen, Shamima

    2006-01-01

    The newly synthesized ligand, dihydro OO'bis(salicylidene) 2,2' aminobenzothiazolyl borate (2), was derived from the reaction of Schiff base of 2-aminobenzothiazole and salicylaldehyde with KBH(4). Cu(II) (3) and Zn(II) (4) complexes of (2) were synthesized and further metallated with dimethyltindichloride to yield heterobimetallic complexes (5) and (6). All complexes have been thoroughly characterized by elemental analysis, and IR, NMR, EPR, and UV-Vis spectroscopy and conductance measurements. The spectroscopic data support square planar environment around the Cu(II) atom, while the Sn(IV) atom acquires pentacoordinate geometry. The interaction of complex (5) with guanine, adenine, and calf thymus DNA was studied by spectrophotometric, electrochemical, and kinetic methods. The absorption spectra of complex (5) exhibit a remarkable "hyperchromic effect" in the presence of guanine and calf thymus DNA. Indicative of strong binding of the complex to calf thymus DNA preferentially binds through N(7) position of guanine base, while the adenine shows binding to a lesser extent. The kinetic data were obtained from the rate constants, k(obs), values under pseudo-first-order conditions. Cyclic voltammetry was employed to study the interaction of complex (5) with guanine, adenine, and calf thymus DNA. The CV of complex (5) in the absence and in the presence of guanine and calf thymus DNA altered drastically, with a positive shift in formal peak potential E(pa) and E(pc) values and a significant increase in peak current. The positive shift in formal potentials with increase in peak current favours strong interaction of complex (5) with calf thymus DNA. The net shift in E(1/2) has been used to estimate the ratio of equilibrium constants for the binding of Cu(II) and Cu(I) complexes to calf thymus DNA.

  9. Specific and nonspecific metal ion-nucleotide interactions at aqueous/solid interfaces functionalized with adenine, thymine, guanine, and cytosine oligomers.

    PubMed

    Holland, Joseph G; Malin, Jessica N; Jordan, David S; Morales, Esmeralda; Geiger, Franz M

    2011-03-02

    This article reports nonlinear optical measurements that quantify, for the first time directly and without labels, how many Mg(2+) cations are bound to DNA 21-mers covalently linked to fused silica/water interfaces maintained at pH 7 and 10 mM NaCl, and what the thermodynamics are of these interactions. The overall interaction of Mg(2+) with adenine, thymine, guanine, and cytosine is found to involve -10.0 ± 0.3, -11.2 ± 0.3, -14.0 ± 0.4, and -14.9 ± 0.4 kJ/mol, and nonspecific interactions with the phosphate and sugar backbone are found to contribute -21.0 ± 0.6 kJ/mol for each Mg(2+) ion bound. The specific and nonspecific contributions to the interaction energy of Mg(2+) with oligonucleotide single strands is found to be additive, which suggests that within the uncertainty of these surface-specific experiments, the Mg(2+) ions are evenly distributed over the oligomers and not isolated to the most strongly binding nucleobase. The nucleobases adenine and thymine are found to bind only three Mg(2+) ions per 21-mer oligonucleotide, while the bases cytosine and guanine are found to bind eleven Mg(2+) ions per 21-mer oligonucleotide.

  10. Hypoxanthine-guanine phosphoribosyltransferase and inosine 5′-monophosphate dehydrogenase activities in three mammalian species: aquatic (Mirounga angustirostris), semi-aquatic (Lontra longicaudis annectens) and terrestrial (Sus scrofa)

    PubMed Central

    Barjau Pérez-Milicua, Myrna; Zenteno-Savín, Tania; Crocker, Daniel E.; Gallo-Reynoso, Juan P.

    2015-01-01

    Aquatic and semiaquatic mammals have the capacity of breath hold (apnea) diving. Northern elephant seals (Mirounga angustirostris) have the ability to perform deep and long duration dives; during a routine dive, adults can hold their breath for 25 min. Neotropical river otters (Lontra longicaudis annectens) can hold their breath for about 30 s. Such periods of apnea may result in reduced oxygen concentration (hypoxia) and reduced blood supply (ischemia) to tissues. Production of adenosine 5′-triphosphate (ATP) requires oxygen, and most mammalian species, like the domestic pig (Sus scrofa), are not adapted to tolerate hypoxia and ischemia, conditions that result in ATP degradation. The objective of this study was to explore the differences in purine synthesis and recycling in erythrocytes and plasma of three mammalian species adapted to different environments: aquatic (northern elephant seal) (n = 11), semiaquatic (neotropical river otter) (n = 4), and terrestrial (domestic pig) (n = 11). Enzymatic activity of hypoxanthine-guanine phosphoribosyltransferase (HGPRT) was determined by spectrophotometry, and activity of inosine 5′-monophosphate dehydrogenase (IMPDH) and the concentration of hypoxanthine (HX), inosine 5′-monophosphate (IMP), adenosine 5′-monophosphate (AMP), adenosine 5′-diphosphate (ADP), ATP, guanosine 5′-diphosphate (GDP), guanosine 5′-triphosphate (GTP), and xanthosine 5′-monophosphate (XMP) were determined by high-performance liquid chromatography (HPLC). The activities of HGPRT and IMPDH and the concentration of HX, IMP, AMP, ADP, ATP, GTP, and XMP in erythrocytes of domestic pigs were higher than in erythrocytes of northern elephant seals and river otters. These results suggest that under basal conditions (no diving, sleep apnea or exercise), aquatic, and semiaquatic mammals have less purine mobilization than their terrestrial counterparts. PMID:26283971

  11. Purine salvage pathways of Bacillus subtilis and effect of guanine on growth of GMP reductase mutants.

    PubMed Central

    Endo, T; Uratani, B; Freese, E

    1983-01-01

    We have isolated numerous mutants containing mutations in the salvage pathways of purine synthesis. The mutations cause deficiencies in adenine phosphoribosyltransferase (adeF), in hypoxanthine-guanine phosphoribosyltransferase (guaF), in adenine deaminase (adeC), in inosine-guanosine phosphorylase, (guaP), and in GMP reductase (guaC). The physiological properties of mutants containing one or more of these mutations and corresponding enzyme measurements have been used to derive a metabolic chart of the purine salvage pathway of Bacillus subtilis. PMID:6408059

  12. Toward electrochemical resolution of two genes on one electrode: using 7-deaza analogues of guanine and adenine to prepare PCR products with differential redox activity.

    PubMed

    Yang, Ivana V; Ropp, Patricia A; Thorp, H Holden

    2002-01-15

    The 7-deaza analogues of guanine and adenine were incorporated into polymerase chain reaction (PCR) products by substitution of the appropriate nucleotide triphosphates into the reaction. These PCR products can be immobilized on ITO electrodes and detected by catalytic cyclic voltammetry with ruthenium polypyridyl complexes. Immobilization on indium tin oxide (ITO) electrodes of 330- and 1200-base pair (bp) PCR amplicons from the E. coli dacA gene containing one or both of the 7-deazapurines was effected by precipitation from a 9:1 DMF/acetate solution. Amplicons containing the 7-deazaguanine base were detected by observing current enhancement in the cyclic voltammogram of Ru(dmb)3(3)+/2+ (dmb = 4,4'-dimethyl-2,2'-bipyridine) due to the selective oxidation of the modified base by this mediator. Oxidation of incorporated 7-deazaadenine bases in addition to native guanines gives rise to a higher current enhancement in the cyclic voltammogram of Ru(bpy)3(3)+/2+ (bpy = 2,2'-bipyridine) compared to the enhancement observed in the presence of guanine only. This strategy was employed to simultaneously detect the 330-bp sequence containing 7-deazaadenine and the 1200-bp sequence containing 7-deazaguanine on the same ITO electrode. Such a strategy may provide a means for detecting multiple genes on a single microlocation and may thereby lead to more highly multiplexed gene assays.

  13. Analysis of peroxynitrite reactions with guanine, xanthine, and adenine nucleosides by high-pressure liquid chromatography with electrochemical detection: C8-nitration and -oxidation.

    PubMed

    Sodum, R S; Fiala, E S

    2001-04-01

    Peroxynitrite, the reaction product of nitric oxide and superoxide anion, and a powerful oxidant, was found to nitrate as well as oxidize adenine, guanine, and xanthine nucleosides. A highly sensitive reverse-phase HPLC method with a dual-mode electrochemical detector, which reduces the nitro product at the first electrode and detects the reduced product by oxidation at the second electrode, was applied to detect femtomole levels of 8-nitroguanine and 8-nitroxanthine. This method was used to separate and identify the products of nitration and oxidation from the reactions of nucleosides with peroxynitrite. Peroxynitrite nitrates deoxyguanosine at neutral pH to give the very unstable 8-nitrodeoxyguanosine, in addition to 8-nitroguanine. 8-Nitrodeoxyguanosine, with a half-life of approximately 10 min at room temperature and guanine nucleosides, adenine nucleosides undergo peroxynitrite-mediated C8 oxidation even at neutral pH to give the corresponding 8-oxoadenine nucleosides in approximately 0.3% yield. Adenine nitration, though minor compared to C8-oxidation, appears to occur at both C2 and C8 positions of the adenine ring. Lowering the

  14. Electrocatalytic activity of molybdenum disulfide nanosheets enhanced by self-doped polyaniline for highly sensitive and synergistic determination of adenine and guanine.

    PubMed

    Yang, Tao; Yang, Ruirui; Chen, Huaiyin; Nan, Fuxin; Ge, Tong; Jiao, Kui

    2015-02-04

    Recently, easy, green, and low-cost liquild exfoliation of bulk materials to obtain thin-layered nanostructure significantly emerged. In this work, thin-layered molybdenum disulfide (MoS2) nanosheets were fabricated through intercalation of self-doped polyaniline (SPAN) to layer space of bulk MoS2 by ultrasonic exfoliating method to effectively prevent reaggregation of MoS2 nanosheets. The obtained hybrid showed specific surface area, a large number of electroactive species, and open accessible space, accompanied by rich negative charged and special conjugated structure, which was applied to adopt positively charged guanine and adenine, based on their strong π-π* interactions and electrostatic adsorption. Also, the SPAN-MoS2 interface exhibited the synergistic effect and good electrocatalytic activity compared with the sole SPAN or MoS2 modified electrode.

  15. Purine metabolite and energy charge analysis of Trypanosoma brucei cells in different growth phases using an optimized ion-pair RP-HPLC/UV for the quantification of adenine and guanine pools.

    PubMed

    Graven, Patricia; Tambalo, Margherita; Scapozza, Leonardo; Perozzo, Remo

    2014-06-01

    Human African Trypanosomiasis (HAT) is caused by the protozoan parasite Trypanosoma brucei. Although trypanosomes are well-studied model organisms, only little is known about their adenine and guanine nucleotide pools. Besides being building blocks of RNA and DNA, these nucleotides are also important modulators of diverse biochemical cellular processes. Adenine nucleotides also play an important role in the regulation of metabolic energy. The energetic state of cells is evaluated by the energy charge which gives information about how much energy is available in form of high energy phosphate bonds of adenine nucleotides. A sensitive and reproducible ion-pair RP-HPLC/UV method was developed and optimized, allowing the quantification of guanine and adenine nucleosides/nucleotides in T. brucei. With this method, the purine levels and their respective ratios were investigated in trypanosomes during logarithmic, stationary and senescent growth phases. Results of this study showed that all adenine and guanine purines under investigation were in the low mM range. The energy charge was found to decrease from logarithmic to static and to senescent phase whereas AMP/ATP, ADP/ATP and GDP/GTP ratios increased in the same order. In addition, the AMP/ATP ratio varied as the square of the ADP/ATP ratio, indicating AMP to be the key energy sensor molecule in trypanosomes.

  16. Determination of guanine and adenine by high-performance liquid chromatography with a self-fabricated wall-jet/thin-layer electrochemical detector at a glassy carbon electrode.

    PubMed

    Zhou, Yaping; Yan, Hongling; Xie, Qingji; Yao, Shouzhuo

    2015-03-01

    A sensitive wall-jet/thin-layer amperometric electrochemical detector (ECD) coupled to high-performance liquid chromatography (HPLC) was developed for simultaneous determination of guanine (G) and adenine (A). The analytes were detected at a glassy carbon electrode (GCE) and the HPLC-ECD calibration curves showed good linearity (R(2)>0.997) under optimized conditions. Limits of detection for G and A are 0.6 nM and 1.4 nM (S/N=3), respectively, which are lower than those obtained with an UV-vis detector and a commercial electrochemical detector. We have successfully applied this HPLC-ECD to assess the contents of G and A in hydrochloric acid-digested calf thymus double-stranded DNA. In addition, we compared in detail the analysis of G and A by cyclic voltammetry (CV) and by the HPLC-ECD system on both bare GCE and electroreduced graphene oxide (ERGO) modified GCE. We found that the adsorption of G and A on the electrode surfaces can vary their anodic CV peaks and the competitive adsorption of G and A on the limited sites of the electrode surfaces can cause crosstalk effects on their anodic CV peak signals, but the HPLC-ECD system is insensitive to such electrode-adsorption and can give more reliable analytical results.

  17. A new microplatform based on titanium dioxide nanofibers/graphene oxide nanosheets nanocomposite modified screen printed carbon electrode for electrochemical determination of adenine in the presence of guanine.

    PubMed

    Arvand, Majid; Ghodsi, Navid; Zanjanchi, Mohammad Ali

    2016-03-15

    The current techniques for determining adenine have several shortcomings such as high cost, high time consumption, tedious pretreatment steps and the requirements for highly skilled personnel often restrict their use in routine analytical practice. This paper describes the development and utilization of a new nanocomposite consisting of titanium dioxide nanofibers (TNFs) and graphene oxide nanosheets (GONs) for screen printed carbon electrode (SPCE) modification. The synthesized GONs and TNFs were characterized by transmission electron microscopy (TEM), scanning electron microscopy (SEM), X-ray diffraction (XRD) and Fourier transform infrared spectroscopy (FT-IR). The modified electrode (TNFs/GONs/SPCE) was used for electrochemical characterization of adenine. The TNFs/GONs/SPCE exhibited an increase in peak current and the electron transfer kinetics and decrease in the overpotential for the oxidation reaction of adenine. Using differential pulse voltammetry (DPV), the prepared sensor showed good sensitivity for determining adenine in two ranges from 0.1-1 and 1-10 μM, with a detection limit (DL) of 1.71 nM. Electrochemical studies suggested that the TNFs/GONs/SPCE provided a synergistic augmentation on the voltammetric behavior of electrochemical oxidation of adenine, which was indicated by the improvement of anodic peak current and a decrease in anodic peak potential. The amount of adenine in pBudCE4.1 plasmid was determined via the proposed sensor and the result was in good compatibility with the sequence data of pBudCE4.1 plasmid.

  18. On the accessibility to conical intersections in purines: hypoxanthine and its singly protonated and deprotonated forms.

    PubMed

    Villabona-Monsalve, Juan P; Noria, Raquel; Matsika, Spiridoula; Peón, Jorge

    2012-05-09

    The dynamics following electronic excitation of hypoxanthine and its nucleoside inosine were studied by femtosecond fluorescence up-conversion. Our objective was to explore variants of the purinic DNA bases in order to determine the molecular parameters that increase or reduce the accessibility to ground state conical intersections. From experiments in water and methanol solution we conclude that both dominant neutral tautomers of hypoxanthine exhibit ultrashort excited state lifetimes (τ < 0.2 ps), which are significantly shorter than in the related nucleobase guanine. This points to a more accessible conical intersection for the fluorescent state upon removal of the amino group, present in guanine but absent in hypoxanthine. The excited state dynamics of singly protonated hypoxanthine were also studied, showing biexponential decays with a 1.1 ps component (5%) besides a sub-0.2 ps ultrafast component. On the other hand, the S(1) lifetimes of the singly deprotonated forms of hypoxanthine and inosine show drastic differences, where the latter remains ultrafast but the singly deprotonated hypoxanthine shows a much longer lifetime of 19 ps. This significant variation is related to the different deprotonation sites in hypoxanthine versus inosine, which gives rise to significantly different resonance structures. In our study we also include multireference perturbation theory (MRMP2) excited state calculations in order to determine the nature of the initial electronic excitation in our experiments and clarify the ordering of the states in the singlet manifold at the ground state geometry. In addition, we performed multireference configuration interaction calculations (MR-CIS) that identify the presence of low-lying conical intersections for both prominent neutral tautomers of hypoxanthine. In both cases, the surface crossings occur at geometries reached by out of plane opposite motions of C2 and N3. The study of this simpler purine gives several insights into how small

  19. Adenine and adenosine salvage in Leishmania donovani.

    PubMed

    Boitz, Jan M; Ullman, Buddy

    2013-08-01

    6-aminopurine metabolism in Leishmania is unique among trypanosomatid pathogens since this genus expresses two distinct routes for adenine salvage: adenine phosphoribosyltransferase (APRT) and adenine deaminase (AAH). To evaluate the relative contributions of APRT and AAH, adenine salvage was evaluated in Δaprt, Δaah, and Δaprt/Δaah null mutants of L. donovani. The data confirm that AAH plays the dominant role in adenine metabolism in L. donovani, although either enzyme alone is sufficient for salvage. Adenosine salvage was also evaluated in a cohort of null mutants. Adenosine is also primarily converted to hypoxanthine, either intracellularly or extracellularly, but can also be phosphorylated to the nucleotide level by adenosine kinase when the predominant pathways are genetically or pharmacologically blocked. These data provide genetic verification for the relative contributions of 6-aminopurine metabolizing pathways in L. donovani and demonstrate that all of the pathways can function under appropriate conditions of genetic or pharmacologic perturbation.

  20. In vitro adenine nucleotide catabolism in African catfish spermatozoa.

    PubMed

    Zietara, Marek S; Słomińska, Ewa; Rurangwa, Eugene; Ollevier, Frans; Swierczyński, Julian; Skorkowski, Edward F

    2004-08-01

    It has been shown recently that African catfish (Clarias gariepinus) spermatozoa possess relatively low ATP content and low adenylate energy charge (AEC). One of the possible explanations for this phenomenon is that the spermatozoa actively catabolize adenine nucleotides. A relatively high rate of such catabolism could then contribute to the low ATP concentration and low adenylate energy charge observed in the spermatozoa in vitro. To check this hypothesis, we investigated ATP content and adenine nucleotide catabolism in African catfish spermatozoa stored at 4 degrees C in the presence of glycine as an energetic substrate. Our results indicate that the storage of African catfish sperm at 4 degrees C in the presence of glycine causes time-dependent ATP depletion. In contrast to ATP, the AMP content increases significantly during the same period of sperm storage, while the ADP increases only slightly. Moreover, a significant increase of inosine and hypoxanthine content was also found. Hypoxanthine was accumulated in the storage medium, but xanthine was found neither in spermatozoa nor in the storage medium. It indicates that hypoxanthine is not converted to xanthine, probably due to lack of xanthine oxidase activity in catfish spermatozoa. Present results suggest that adenine nucleotides may be converted to hypoxanthine according to the following pathway: ATP-->ADP-->AMP (adenosine/IMP)-->inosine-->hypoxanthine. Moreover, hypoxanthine seems to be the end product of adenine nucleotide catabolism in African catfish spermatozoa. In conclusion, our results suggest that a relatively high rate of adenine nucleotide catabolism contributes to the low ATP concentration and low adenylate energy charge observed in African catfish spermatozoa in vitro.

  1. Is the DPT tautomerization of the long A·G Watson-Crick DNA base mispair a source of the adenine and guanine mutagenic tautomers? A QM and QTAIM response to the biologically important question.

    PubMed

    Brovarets', Ol'ha O; Zhurakivsky, Roman O; Hovorun, Dmytro M

    2014-03-05

    Herein, we first address the question posed in the title by establishing the tautomerization trajectory via the double proton transfer of the adenine·guanine (A·G) DNA base mispair formed by the canonical tautomers of the A and G bases into the A*·G* DNA base mispair, involving mutagenic tautomers, with the use of the quantum-mechanical calculations and quantum theory of atoms in molecules (QTAIM). It was detected that the A·G ↔ A*·G* tautomerization proceeds through the asynchronous concerted mechanism. It was revealed that the A·G base mispair is stabilized by the N6H···O6 (5.68) and N1H···N1 (6.51) hydrogen bonds (H-bonds) and the N2H···HC2 dihydrogen bond (DH-bond) (0.68 kcal·mol(-1) ), whereas the A*·G* base mispair-by the O6H···N6 (10.88), N1H···N1 (7.01) and C2H···N2 H-bonds (0.42 kcal·mol(-1) ). The N2H···HC2 DH-bond smoothly and without bifurcation transforms into the C2H···N2 H-bond at the IRC = -10.07 Bohr in the course of the A·G ↔ A*·G* tautomerization. Using the sweeps of the energies of the intermolecular H-bonds, it was observed that the N6H···O6 H-bond is anticooperative to the two others-N1H···N1 and N2H···HC2 in the A·G base mispair, while the latters are significantly cooperative, mutually strengthening each other. In opposite, all three O6H···N6, N1H···N1, and C2H···N2 H-bonds are cooperative in the A*·G* base mispair. All in all, we established the dynamical instability of the А*·G* base mispair with a short lifetime (4.83·10(-14) s), enabling it not to be deemed feasible source of the A* and G* mutagenic tautomers of the DNA bases. The small lifetime of the А*·G* base mispair is predetermined by the negative value of the Gibbs free energy for the A*·G* → A·G transition. Moreover, all of the six low-frequency intermolecular vibrations cannot develop during this lifetime that additionally confirms the aforementioned results. Thus, the A*·G* base mispair cannot be

  2. Trypanosoma brucei adenine-phosphoribosyltransferases mediate adenine salvage and aminopurinol susceptibility but not adenine toxicity.

    PubMed

    Lüscher, Alexandra; Lamprea-Burgunder, Estelle; Graf, Fabrice E; de Koning, Harry P; Mäser, Pascal

    2014-04-01

    African trypanosomes, like all obligate parasitic protozoa, cannot synthesize purines de novo and import purines from their hosts to build nucleic acids. The purine salvage pathways of Trypanosoma brucei being redundant, none of the involved enzymes is likely to be essential. Nevertheless they can be of pharmacological interest due to their role in activation of purine nucleobase or nucleoside analogues, which only become toxic when converted to nucleotides. Aminopurine antimetabolites, in particular, are potent trypanocides and even adenine itself is toxic to trypanosomes at elevated concentrations. Here we report on the T. brucei adenine phosphoribosyltransferases TbAPRT1 and TbAPRT2, encoded by the two genes Tb927.7.1780 and Tb927.7.1790, located in tandem on chromosome seven. The duplication is syntenic in all available Trypanosoma genomes but not in Leishmania. While TbAPRT1 is cytosolic, TbAPRT2 possesses a glycosomal targeting signal and co-localizes with the glycosomal marker aldolase. Interestingly, the distribution of glycosomal targeting signals among trypanosomatid adenine phosphoribosyltransferases is not consistent with their phylogeny, indicating that the acquisition of adenine salvage to the glycosome happened after the radiation of Trypanosoma. Double null mutant T. brucei Δtbaprt1,2 exhibited no growth phenotype but no longer incorporated exogenous adenine into the nucleotide pool. This, however, did not reduce their sensitivity to adenine. The Δtbaprt1,2 trypanosomes were resistant to the adenine isomer aminopurinol, indicating that it is activated by phosphoribosyl transfer. Aminopurinol was about 1000-fold more toxic to bloodstream-form T. brucei than the corresponding hypoxanthine isomer allopurinol. Aminopurinol uptake was not dependent on the aminopurine permease P2 that has been implicated in drug resistance.

  3. Dissociative electron attachment to the gas-phase nucleobase hypoxanthine

    SciTech Connect

    Dawley, M. Michele; Tanzer, Katrin; Denifl, Stephan E-mail: Sylwia.Ptasinska.1@nd.edu; Carmichael, Ian; Ptasińska, Sylwia E-mail: Sylwia.Ptasinska.1@nd.edu

    2015-06-07

    We present high-resolution measurements of the dissociative electron attachment (DEA) to isolated gas-phase hypoxanthine (C{sub 5}H{sub 4}N{sub 4}O, Hyp), a tRNA purine base. The anion mass spectra and individual ion efficiency curves from Hyp were measured as a function of electron energy below 9 eV. The mass spectra at 1 and 6 eV exhibit the highest anion yields, indicating possible common precursor ions that decay into the detectable anionic fragments. The (Hyp − H) anion (C{sub 5}H{sub 3}N{sub 4}O{sup −}) exhibits a sharp resonant peak at 1 eV, which we tentatively assign to a dipole-bound state of the keto-N1H,N9H tautomer in which dehydrogenation occurs at either the N1 or N9 position based upon our quantum chemical computations (B3LYP/6-311+G(d,p) and U(MP2-aug-cc-pVDZ+)) and prior studies with adenine. This closed-shell dehydrogenated anion is the dominant fragment formed upon electron attachment, as with other nucleobases. Seven other anions were also observed including (Hyp − NH){sup −}, C{sub 4}H{sub 3}N{sub 4}{sup −}/C{sub 4}HN{sub 3}O{sup −}, C{sub 4}H{sub 2}N{sub 3}{sup −}, C{sub 3}NO{sup −}/HC(HCN)CN{sup −}, OCN{sup −}, CN{sup −}, and O{sup −}. Most of these anions exhibit broad but weak resonances between 4 and 8 eV similar to many analogous anions from adenine. The DEA to Hyp involves significant fragmentation, which is relevant to understanding radiation damage of biomolecules.

  4. Adenine Aminohydrolase from Leishmania donovani

    PubMed Central

    Boitz, Jan M.; Strasser, Rona; Hartman, Charles U.; Jardim, Armando; Ullman, Buddy

    2012-01-01

    Adenine aminohydrolase (AAH) is an enzyme that is not present in mammalian cells and is found exclusively in Leishmania among the protozoan parasites that infect humans. AAH plays a paramount role in purine metabolism in this genus by steering 6-aminopurines into 6-oxypurines. Leishmania donovani AAH is 38 and 23% identical to Saccharomyces cerevisiae AAH and human adenosine deaminase enzymes, respectively, catalyzes adenine deamination to hypoxanthine with an apparent Km of 15.4 μm, and does not recognize adenosine as a substrate. Western blot analysis established that AAH is expressed in both life cycle stages of L. donovani, whereas subcellular fractionation and immunofluorescence studies confirmed that AAH is localized to the parasite cytosol. Deletion of the AAH locus in intact parasites established that AAH is not an essential gene and that Δaah cells are capable of salvaging the same range of purine nucleobases and nucleosides as wild type L. donovani. The Δaah null mutant was able to infect murine macrophages in vitro and in mice, although the parasite loads in both model systems were modestly reduced compared with wild type infections. The Δaah lesion was also introduced into a conditionally lethal Δhgprt/Δxprt mutant in which viability was dependent on pharmacologic ablation of AAH by 2′-deoxycoformycin. The Δaah/Δhgprt/Δxprt triple knock-out no longer required 2′-deoxycoformycin for growth and was avirulent in mice with no persistence after a 4-week infection. These genetic studies underscore the paramount importance of AAH to purine salvage by L. donovani. PMID:22238346

  5. Production of guanine from NH(4)CN polymerizations

    NASA Technical Reports Server (NTRS)

    Levy, M.; Miller, S. L.; Oro, J.

    1999-01-01

    The synthesis of adenine from the polymerization of concentrated ammonium cyanide solutions is well known. We show here that guanine is also produced by this reaction but at yields ranging from 10 to 40 times less than that of adenine. This synthesis is effective at both +80 and -20 degrees C. Since high concentrations of NH(4)CN are obtainable only by freezing, this prebiotic synthesis would be applicable to frozen regions of the primitive Earth, the Jovian satellite Europa and other icy satellites, and the parent body of the Murchison meteorite.

  6. A kinetic study of hypoxanthine oxidation by milk xanthine oxidase.

    PubMed Central

    Escribano, J; Garcia-Canovas, F; Garcia-Carmona, F

    1988-01-01

    The course of the reaction sequence hypoxanthine----xanthine----uric acid catalysed by xanthine:oxygen oxidoreductase from milk was investigated on the basis of u.v. spectra taken during the course of hypoxanthine and xanthine oxidations. It was found that xanthine accumulated in the reaction mixture when hypoxanthine was used as a substrate. The time course of the concentrations of hypoxanthine, xanthine intermediate and uric acid product was simulated numerically. The mathematical model takes into account the competition of substrate, intermediate and product and the accumulation of the intermediate at the enzyme. This type of analysis permits the kinetic parameters of the enzyme for hypoxanthine and xanthine to be obtained. PMID:3196295

  7. Novel Hypoxanthine Guanine Phosphoribosyltransferase Gene Mutations in Saudi Arabian Hyperuricemia Patients

    PubMed Central

    Alanazi, Mohammed; Al-Arfaj, Abdulrahman Saud; Abduljaleel, Zainularifeen; Fahad Al-Arfaj, Hussein; Reddy Parine, Narasimha; Purusottapatnam Shaik, Jilani; Khan, Zahid; Ali Khan Pathan, Akbar

    2014-01-01

    Over the past decade, a steady increase in the incidence of HPRT-related hyperuricemia (HRH) has been observed in Saudi Arabia. We examined all the nine exons of HPRT gene for mutations in ten biochemically confirmed hyperuricemia patients, including one female and three normal controls. In all, we identified 13 novel mutations in Saudi Arabian HPRT-related hyperuricemia patients manifesting different levels of uric acid. The Lys103Met alteration was highly recurrent and was observed in 50% of the cases, while Ala160Thr and Lys158Asn substitutions were found in two patients. Moreover, in 70% of the patients ≥2 mutations were detected concurrently in the HPRT gene. Interestingly, one of the patients that harbored Lys103Met substitution along with two frameshift mutations at codons 85 and 160 resulting in shortened protein demonstrated unusually high serum uric acid level of 738 μmol/L. Two of the seven point mutations that resulted in amino acid change (Lys103Met and Val160Gly) were predicted to be damaging by SIFT and Polyphen and were further analyzed for their protein stability and function by molecular dynamics simulation. The identified novel mutations in the HPRT gene may prove useful in the prenatal diagnosis and genetic counseling. PMID:25136576

  8. Comparative study of spontaneous deamination of adenine and cytosine in unbuffered aqueous solution at room temperature

    NASA Astrophysics Data System (ADS)

    Wang, Shiliang; Hu, Anguang

    2016-06-01

    Adenine in unbuffered nanopure water at a concentration of 2 mM is completely deaminated (>99%) to hypoxanthine at room temperature in ca. 10 weeks, with an estimated half-life (t1/2) less than 10 days, about six orders of magnitude faster than previously reported. Cytosine is not deaminated under the same condition, even after 3 years. This is in contrast to previous observations that cytosine deaminates 20-40 times faster than adenine free base, in nucleoside, in nucleotide and in single-stranded DNA in buffered neutral aqueous solutions.

  9. Search for interstellar adenine

    NASA Astrophysics Data System (ADS)

    Chakrabarti, Sandip K.; Majumdar, Liton; Das, Ankan; Chakrabarti, Sonali

    2015-05-01

    It is long debated if pre-biotic molecules are indeed present in the interstellar medium. Despite substantial works pointing to their existence, pre-biotic molecules are yet to be discovered with a complete confidence. In this paper, our main aim is to study the chemical evolution of interstellar adenine under various circumstances. We prepare a large gas-grain chemical network by considering various pathways for the formation of adenine. Majumdar et al. (New Astron. 20:15, 2013) proposed that in the absence of adenine detection, one could try to trace two precursors of adenine, namely, HCCN and NH2CN. Recently Merz et al. (J. Phys. Chem. A 118:3637-3644, 2014), proposed another route for the formation of adenine in interstellar condition. They proposed two more precursor molecules. But it was not verified by any accurate gas-grain chemical model. Neither was it known if the production rate would be high or low. Our paper fills this important gap. We include this new pathways to find that the contribution through this pathways for the formation of Adenine is the most dominant one in the context of interstellar medium. We propose that observers may look for the two precursors (C3NH and HNCNH) in the interstellar media which are equally important for predicting abundances of adenine. We perform quantum chemical calculations to find out spectral properties of adenine and its two new precursor molecules in infrared, ultraviolet and sub-millimeter region. Our present study would be useful for predicting abundance of adenine.

  10. The catalase activity of diiron adenine deaminase

    SciTech Connect

    Kamat S. S.; Swaminathan S.; Holmes-Hampton, G. P.; Bagaria, A.; Kumaran, D.; Tichy, S. E.; Gheyi, T.; Zheng, X.; Bain, K.; Groshong, C.; Emtage, S.; Sauder, J. M.; Burley, S. K.; Lindahl, P. A.; Raushel, F. M.

    2011-12-01

    Adenine deaminase (ADE) from the amidohydrolase superfamily (AHS) of enzymes catalyzes the conversion of adenine to hypoxanthine and ammonia. Enzyme isolated from Escherichia coli was largely inactive toward the deamination of adenine. Molecular weight determinations by mass spectrometry provided evidence that multiple histidine and methionine residues were oxygenated. When iron was sequestered with a metal chelator and the growth medium supplemented with Mn{sup 2+} before induction, the post-translational modifications disappeared. Enzyme expressed and purified under these conditions was substantially more active for adenine deamination. Apo-enzyme was prepared and reconstituted with two equivalents of FeSO{sub 4}. Inductively coupled plasma mass spectrometry and Moessbauer spectroscopy demonstrated that this protein contained two high-spin ferrous ions per monomer of ADE. In addition to the adenine deaminase activity, [Fe{sup II}/Fe{sup II}]-ADE catalyzed the conversion of H{sub 2}O{sub 2} to O{sub 2} and H{sub 2}O. The values of k{sub cat} and k{sub cat}/K{sub m} for the catalase activity are 200 s{sup -1} and 2.4 x 10{sup 4} M{sup -1} s{sup -1}, respectively. [Fe{sup II}/Fe{sup II}]-ADE underwent more than 100 turnovers with H{sub 2}O{sub 2} before the enzyme was inactivated due to oxygenation of histidine residues critical for metal binding. The iron in the inactive enzyme was high-spin ferric with g{sub ave} = 4.3 EPR signal and no evidence of anti-ferromagnetic spin-coupling. A model is proposed for the disproportionation of H{sub 2}O{sub 2} by [Fe{sup II}/Fe{sup II}]-ADE that involves the cycling of the binuclear metal center between the di-ferric and di-ferrous oxidation states. Oxygenation of active site residues occurs via release of hydroxyl radicals. These findings represent the first report of redox reaction catalysis by any member of the AHS.

  11. PA0148 from Pseudomonas aeruginosa Catalyzes the Deamination of Adenine

    SciTech Connect

    Goble, A.M.; Swaminathan, S.; Zhang, Z.; Sauder, J. M.; Burley, S. K.; Raushel, F. M.

    2011-08-02

    Four proteins from NCBI cog1816, previously annotated as adenosine deaminases, have been subjected to structural and functional characterization. Pa0148 (Pseudomonas aeruginosa PAO1), AAur1117 (Arthrobacter aurescens TC1), Sgx9403e, and Sgx9403g have been purified and their substrate profiles determined. Adenosine is not a substrate for any of these enzymes. All of these proteins will deaminate adenine to produce hypoxanthine with k{sub cat}/K{sub m} values that exceed 10{sup 5} M{sup -1} s{sup -1}. These enzymes will also accept 6-chloropurine, 6-methoxypurine, N-6-methyladenine, and 2,6-diaminopurine as alternate substrates. X-ray structures of Pa0148 and AAur1117 have been determined and reveal nearly identical distorted ({beta}/{alpha}){sub 8} barrels with a single zinc ion that is characteristic of members of the amidohydrolase superfamily. Structures of Pa0148 with adenine, 6-chloropurine, and hypoxanthine were also determined, thereby permitting identification of the residues responsible for coordinating the substrate and product.

  12. Pa0148 from Pseudomonas aeruginosa Catalyzes the Deamination of Adenine

    SciTech Connect

    A Goble; Z Zhang; J Sauder; S Burley; S Swaminathan; F Raushel

    2011-12-31

    Four proteins from NCBI cog1816, previously annotated as adenosine deaminases, have been subjected to structural and functional characterization. Pa0148 (Pseudomonas aeruginosa PAO1), AAur1117 (Arthrobacter aurescens TC1), Sgx9403e, and Sgx9403g have been purified and their substrate profiles determined. Adenosine is not a substrate for any of these enzymes. All of these proteins will deaminate adenine to produce hypoxanthine with k{sub cat}/K{sub m} values that exceed 10{sup 5} M{sup -1} s{sup -1}. These enzymes will also accept 6-chloropurine, 6-methoxypurine, N-6-methyladenine, and 2,6-diaminopurine as alternate substrates. X-ray structures of Pa0148 and AAur1117 have been determined and reveal nearly identical distorted ({beta}/{alpha}){sub 8} barrels with a single zinc ion that is characteristic of members of the amidohydrolase superfamily. Structures of Pa0148 with adenine, 6-chloropurine, and hypoxanthine were also determined, thereby permitting identification of the residues responsible for coordinating the substrate and product.

  13. Effect of ethanol on metabolism of purine bases (hypoxanthine, xanthine, and uric acid).

    PubMed

    Yamamoto, Tetsuya; Moriwaki, Yuji; Takahashi, Sumio

    2005-06-01

    There are many factors that contribute to hyperuricemia, including obesity, insulin resistance, alcohol consumption, diuretic use, hypertension, renal insufficiency, genetic makeup, etc. Of these, alcohol (ethanol) is the most important. Ethanol enhances adenine nucleotide degradation and increases lactic acid level in blood, leading to hyperuricemia. In beer, purines also contribute to an increase in plasma uric acid. Although rare, dehydration and ketoacidosis (due to ethanol ingestion) are associated with the ethanol-induced increase in serum uric acid levels. Ethanol also increases the plasma concentrations and urinary excretion of hypoxanthine and xanthine via the acceleration of adenine nucleotide degradation and a possible weak inhibition of xanthine dehydrogenase activity. Since many factors such as the ALDH2*1 gene and ADH2*2 gene, daily drinking habits, exercise, and dehydration enhance the increase in plasma concentration of uric acid induced by ethanol, it is important to pay attention to these factors, as well as ingested ethanol volume, type of alcoholic beverage, and the administration of anti-hyperuricemic agents, to prevent and treat ethanol-induced hyperuricemia.

  14. Hypoxanthine enhances the cured meat taste.

    PubMed

    Ichimura, Sayaka; Nakamura, Yukinobu; Yoshida, Yuka; Hattori, Akihito

    2017-02-01

    We evaluated the enhancement of cured meat taste during maturation by sensory analysis. We focused on the heat-stable sarcoplasmic fraction (HSSF) to identify the factors related to cured meat taste. Because the dry matter of HSSF contained more than 30% nitrogen, nitrogen compounds such as free amino acids, small peptides and adenosine triphosphate-related compounds seemed to be the important components of HSSF. The samples cured with HSSF for 2 h exhibited the same taste profile as ones cured without HSSF for 168 h. Therefore, the changes in the amount and fractions of nitrogen compounds were examined in HSSF during incubation from 0 to 168 h. The concentration of hypoxanthine (Hx) gradually increased, while inosine-5'-monophosphate decreased during the incubation. The samples cured with pickles containing various concentrations of Hx were subjected to sensory analysis. The addition of Hx, in a dose-dependent fashion, enhanced cured meat taste by maturation for 2 h. It was concluded that Hx is essential for the enhancement of cured meat taste.

  15. Hypoxanthine enhances the cured meat taste

    PubMed Central

    Nakamura, Yukinobu; Yoshida, Yuka; Hattori, Akihito

    2016-01-01

    Abstract We evaluated the enhancement of cured meat taste during maturation by sensory analysis. We focused on the heat‐stable sarcoplasmic fraction (HSSF) to identify the factors related to cured meat taste. Because the dry matter of HSSF contained more than 30% nitrogen, nitrogen compounds such as free amino acids, small peptides and adenosine triphosphate‐related compounds seemed to be the important components of HSSF. The samples cured with HSSF for 2 h exhibited the same taste profile as ones cured without HSSF for 168 h. Therefore, the changes in the amount and fractions of nitrogen compounds were examined in HSSF during incubation from 0 to 168 h. The concentration of hypoxanthine (Hx) gradually increased, while inosine‐5′‐monophosphate decreased during the incubation. The samples cured with pickles containing various concentrations of Hx were subjected to sensory analysis. The addition of Hx, in a dose‐dependent fashion, enhanced cured meat taste by maturation for 2 h. It was concluded that Hx is essential for the enhancement of cured meat taste. PMID:27169902

  16. Adenine formation without HCN.

    PubMed

    Merz, Kenneth M; Aguiar, Eduardo C; da Silva, Joao Bosco P

    2014-05-22

    From a historic point of view adenine was always presumed to be the product of HCN pentamerization. In this work a new mechanism for adenine synthesis in the gas phase without HCN is proposed. The concept of retrosynthetic analysis was employed to create a tautomer of adenine, which can be reached from previously observed interstellar molecules C3NH and HNCNH and its isomer H2NCN. MP2/6-311++G(2d,2p) calculations were performed to calculate the Gibbs free energy of the minimum and the transition state (TS) structures involved in the six step mechanism. This new mechanism requires a smaller number of steps, the reaction energy is twice as exergonic, and the rate determining TS is lower in energy than the corresponding ones proposed elsewhere in the literature.

  17. Butyrate influences intracellular levels of adenine and adenine derivatives in the fungus Penicillium restrictum.

    PubMed

    Zutz, Christoph; Chiang, Yi Ming; Faehnrich, Bettina; Bacher, Markus; Hellinger, Roland; Kluger, Bernhard; Wagner, Martin; Strauss, Joseph; Rychli, Kathrin

    2017-04-01

    Butyrate, a small fatty acid, has an important role in the colon of ruminants and mammalians including the inhibition of inflammation and the regulation of cell proliferation. There is also growing evidence that butyrate is influencing the histone structure in mammalian cells by inhibition of histone deacetylation. Butyrate shows furthermore an antimicrobial activity against fungi, yeast and bacteria, which is linked to its toxicity at a high concentration. In fungi there are indications that butyrate induces the production of secondary metabolites potentially via inhibition of histone deacetylases. However, information about the influence of butyrate on growth, primary metabolite production and metabolism, besides lipid catabolism, in fungi is scarce. We have identified the filamentous fungus Penicillium (P.) restrictum as a susceptible target for butyrate treatment in an antimicrobial activity screen. The antimicrobial activity was detected only in the mycelium of the butyrate treated culture. We investigated the effect of butyrate ranging from low (0.001mM) to high (30mM), potentially toxic, concentrations on biomass and antimicrobial activity. Butyrate at high concentrations (3 and 30mM) significantly reduced the fungal biomass. In contrast P. restrictum treated with 0.03mM of butyrate showed the highest antimicrobial activity. We isolated three antimicrobial active compounds, active against Staphylococcus aureus, from P. restrictum cellular extracts treated with butyrate: adenine, its derivate hypoxanthine and the nucleoside derivate adenosine. Production of all three compounds was increased at low butyrate concentrations. Furthermore we found that butyrate influences the intracellular level of the adenine nucleoside derivate cAMP, an important signalling molecule in fungi and various organisms. In conclusion butyrate treatment increases the intracellular levels of adenine and its respective derivatives.

  18. Catalytic Mechanism and Three-Dimensional Structure of Adenine Deaminase

    SciTech Connect

    S Kamat; A Bagaria; D Kumaran; G Holmes-Hampton; H Fan; A Sali; J Sauder; S Burley; P Lindahl; et. al.

    2011-12-31

    Adenine deaminase (ADE) catalyzes the conversion of adenine to hypoxanthine and ammonia. The enzyme isolated from Escherichia coli using standard expression conditions was low for the deamination of adenine (k{sub cat} = 2.0 s{sup -1}; k{sub cat}/K{sub m} = 2.5 x 10{sup 3} M{sup -1} s{sup -1}). However, when iron was sequestered with a metal chelator and the growth medium was supplemented with Mn{sup 2+} prior to induction, the purified enzyme was substantially more active for the deamination of adenine with k{sub cat} and k{sub cat}/K{sub m} values of 200 s{sup -1} and 5 x 10{sup 5} M{sup -1} s{sup -1}, respectively. The apoenzyme was prepared and reconstituted with Fe{sup 2+}, Zn{sup 2+}, or Mn{sup 2+}. In each case, two enzyme equivalents of metal were necessary for reconstitution of the deaminase activity. This work provides the first example of any member of the deaminase subfamily of the amidohydrolase superfamily to utilize a binuclear metal center for the catalysis of a deamination reaction. [Fe{sup II}/Fe{sup II}]-ADE was oxidized to [Fe{sup III}/Fe{sup III}]-ADE with ferricyanide with inactivation of the deaminase activity. Reducing [Fe{sup III}/Fe{sup III}]-ADE with dithionite restored the deaminase activity, and thus, the diferrous form of the enzyme is essential for catalytic activity. No evidence of spin coupling between metal ions was evident by electron paramagnetic resonance or Moessbauer spectroscopy. The three-dimensional structure of adenine deaminase from Agrobacterium tumefaciens (Atu4426) was determined by X-ray crystallography at 2.2 {angstrom} resolution, and adenine was modeled into the active site on the basis of homology to other members of the amidohydrolase superfamily. On the basis of the model of the adenine-ADE complex and subsequent mutagenesis experiments, the roles for each of the highly conserved residues were proposed. Solvent isotope effects, pH-rate profiles, and solvent viscosity were utilized to propose a chemical reaction

  19. Catalytic Mechanism and Three-Dimensional Structure of Adenine Deaminase

    SciTech Connect

    Kamat, S.S.; Swaminathan, S.; Bagaria, A.; Kumaran, D.; Holmes-Hampton, G. P.; Fan, H.; Sali, A.; Sauder, J. M.; Burley, S. K.; Lindahl, P. A.; Raushel, F. M.

    2011-03-22

    Adenine deaminase (ADE) catalyzes the conversion of adenine to hypoxanthine and ammonia. The enzyme isolated from Escherichia coli using standard expression conditions was low for the deamination of adenine (k{sub cat} = 2.0 s{sup -1}; k{sub cat}/K{sub m} = 2.5 x 10{sup 3} M{sup -1} s{sup -1}). However, when iron was sequestered with a metal chelator and the growth medium was supplemented with Mn{sup 2+} prior to induction, the purified enzyme was substantially more active for the deamination of adenine with kcat and kcat/Km values of 200 s{sup -1} and 5 x 10{sup 5} M{sup -1} s{sup -1}, respectively. The apoenzyme was prepared and reconstituted with Fe{sup 2+}, Zn{sup 2+}, or Mn{sup 2+}. In each case, two enzyme equivalents of metal were necessary for reconstitution of the deaminase activity. This work provides the first example of any member of the deaminase subfamily of the amidohydrolase superfamily to utilize a binuclear metal center for the catalysis of a deamination reaction. [Fe{sup II}/Fe{sup II}]-ADE was oxidized to [Fe{sup III}/Fe{sup III}]-ADE with ferricyanide with inactivation of the deaminase activity. Reducing [Fe{sup III}/Fe{sup III}]-ADE with dithionite restored the deaminase activity, and thus, the diferrous form of the enzyme is essential for catalytic activity. No evidence of spin coupling between metal ions was evident by electron paramagnetic resonance or Moessbauer spectroscopy. The three-dimensional structure of adenine deaminase from Agrobacterium tumefaciens (Atu4426) was determined by X-ray crystallography at 2.2 {angstrom} resolution, and adenine was modeled into the active site on the basis of homology to other members of the amidohydrolase superfamily. On the basis of the model of the adenine-ADE complex and subsequent mutagenesis experiments, the roles for each of the highly conserved residues were proposed. Solvent isotope effects, pH-rate profiles, and solvent viscosity were utilized to propose a chemical reaction mechanism and the

  20. Camptothecins guanine interactions: mechanism of charge transfer reaction upon photoactivation

    NASA Astrophysics Data System (ADS)

    Steenkeste, K.; Guiot, E.; Tfibel, F.; Pernot, P.; Mérola, F.; Georges, P.; Fontaine-Aupart, M. P.

    2002-01-01

    The potent activity exhibited by the antitumoral camptothecin (CPT) and its analog irinotecan (CPT-11) is known to be related to a close contact between the drug and the nucleic acid base guanine. This specificity of interaction between these two chromophores was examined by following changes in the photophysical properties of the drug using steady-state as well as time-resolved absorption and fluorescence methods. The observed effects on absorption, fluorescence emission and singlet excited state lifetimes give evidence for the occurrence of a stacking complex formation restricted to the quinoline part of CPT or CPT-11 and the guanine base but also with the adenine base. The triplet excited state properties of the drugs have been also characterized in absence and in presence of guanosine monophosphate and reveal the occurrence of an electron transfer from the guanine base to the drug. Support for this conclusion was obtained from the studies of a set of biological targets of various oxido-reduction potentials, adenosine monophosphate, cytidine, cytosine, tryptophan, tyrosine and phenylalanine. This finding gives an interpretation of the CPT-induced guanine photolesions previously reported in the literature. These data taken together are discussed in connection with the drug activity. The stacking complex CPT/guanine is necessary but not sufficient to explain the role of the chirality and of the lactone structure in the function of the drug. A stereospecific interaction with the enzyme topoisomerase I seems necessary to stabilize the stacking complex. The first experiments using time-resolved fluorescence by two-photon excitation confirms that CPT does not bind to the isolated enzyme.

  1. A three-state model for the photophysics of guanine.

    PubMed

    Serrano-Andrés, Luis; Merchán, Manuela; Borin, Antonio Carlos

    2008-02-27

    The nonadiabatic photochemistry of the guanine molecule (2-amino-6-oxopurine) and some of its tautomers has been studied by means of the high-level theoretical ab initio quantum chemistry methods CASSCF and CASPT2. Accurate computations, based by the first time on minimum energy reaction paths, states minima, transition states, reaction barriers, and conical intersections on the potential energy hypersurfaces of the molecules lead to interpret the photochemistry of guanine and derivatives within a three-state model. As in the other purine DNA nucleobase, adenine, the ultrafast subpicosecond fluorescence decay measured in guanine is attributed to the barrierless character of the path leading from the initially populated 1(pi pi* L(a)) spectroscopic state of the molecule toward the low-lying methanamine-like conical intersection (gs/pi pi* L(a))CI. On the contrary, other tautomers are shown to have a reaction energy barrier along the main relaxation profile. A second, slower decay is attributed to a path involving switches toward two other states, 1(pi pi* L(b)) and, in particular, 1(n(O) pi*), ultimately leading to conical intersections with the ground state. A common framework for the ultrafast relaxation of the natural nucleobases is obtained in which the predominant role of a pi pi*-type state is confirmed.

  2. Mechanisms involved in the antinociception induced by spinal administration of inosine or guanine in mice.

    PubMed

    de Oliveira, Enderson D; Schallenberger, Cristhine; Böhmer, Ana Elisa; Hansel, Gisele; Fagundes, Aécio C; Milman, Michael; Silva, Marcos D P; Oses, Jean P; Porciúncula, Lisiane O; Portela, Luís V; Elisabetsky, Elaine; Souza, Diogo O; Schmidt, André P

    2016-02-05

    It is well known that adenine-based purines exert multiple effects on pain transmission. Recently, we have demonstrated that guanine-based purines may produce some antinociceptive effects against chemical and thermal pain in mice. The present study was designed to investigate the antinociceptive effects of intrathecal (i.t.) administration of inosine or guanine in mice. Additionally, investigation into the mechanisms of action of these purines, their general toxicity and measurements of CSF purine levels were performed. Animals received an i.t. injection of vehicle (30mN NaOH), inosine or guanine (up to 600nmol) and submitted to several pain models and behavioural paradigms. Guanine and inosine produced dose-dependent antinociceptive effects in the tail-flick, hot-plate, intraplantar (i.pl.) glutamate, i.pl. capsaicin and acetic acid pain models. Additionally, i.t. inosine inhibited the biting behaviour induced by spinal injection of capsaicin and i.t. guanine reduced the biting behaviour induced by spinal injection of glutamate or AMPA. Intrathecal administration of inosine (200nmol) induced an approximately 115-fold increase on CSF inosine levels. This study provides new evidence on the mechanism of action of extracellular guanine and inosine presenting antinociceptive effects following spinal administration. These effects seem to be related, at least partially, to the modulation of A1 adenosine receptors.

  3. Photoirradiation products of flavin derivatives, and the effects of photooxidation on guanine.

    PubMed

    Kino, Katsuhito; Kobayashi, Teruhiko; Arima, Eiji; Komori, Rie; Kobayashi, Takanobu; Miyazawa, Hiroshi

    2009-04-01

    Photoirradiation in the presence of riboflavin led to guanine oxidation and the formation of imidazolone. Meanwhile, riboflavin itself was degraded by ultraviolet light A (UV-A) and visible light (VIS) radiation, and the end product was lumichrome. VIS radiation in the presence of riboflavin oxidized guanine similarly to UV-A radiation. Although UV-A radiation with lumichrome oxidized guanine, VIS radiation with lumichrome did not. Thus, UV-A radiation with riboflavin can oxidize guanine even if riboflavin is degraded to lumichrome. In contrast, following VIS radiation degradation of riboflavin to lumichrome, VIS radiation with riboflavin is hardly capable of oxidizing guanine. The consequences of riboflavin degradation and guanine photooxidation can be extended to flavin mononucleotide and flavin adenine dinucleotide. In addition, we report advanced synthesis; carboxymethylflavin was obtained by oxidation of formylmethylflavin with chlorite and hydrogen peroxide; lumichrome was obtained by heating of formylmethylflavin in 50% AcOH; lumiflavin was obtained by incubation of formylmethylflavin in 2 M NaOH, followed by isolation by step-by-step concentration.

  4. Adenine phosphoribosyltransferase deficiency.

    PubMed

    Bollée, Guillaume; Harambat, Jérôme; Bensman, Albert; Knebelmann, Bertrand; Daudon, Michel; Ceballos-Picot, Irène

    2012-09-01

    Complete adenine phosphoribosyltransferase (APRT) deficiency is a rare inherited metabolic disorder that leads to the formation and hyperexcretion of 2,8-dihydroxyadenine (DHA) into urine. The low solubility of DHA results in precipitation of this compound and the formation of urinary crystals and stones. The disease can present as recurrent urolithiasis or nephropathy secondary to crystal precipitation into renal parenchyma (DHA nephropathy). The diagnostic tools available-including stone analysis, crystalluria, and APRT activity measurement-make the diagnosis easy to confirm when APRT deficiency is suspected. However, the disease can present at any age, and the variability of symptoms can present a diagnostic challenge to many physicians. The early recognition and treatment of APRT deficiency are of crucial importance for preventing irreversible loss of renal function, which still occurs in a non-negligible proportion of cases. This review summarizes the genetic and metabolic mechanisms underlying stone formation and renal disease, along with the diagnosis and management of APRT deficiency.

  5. An amperometric hypoxanthine biosensor based on Au@FeNPs for determination of hypoxanthine in meat samples.

    PubMed

    Devi, Rooma; Yadav, Sujata; Nehra, Renuka; Pundir, C S

    2013-11-01

    A xanthine oxidase (XOD) from buttermilk was immobilized covalently onto boronic acid functionalized gold coated iron nanoparticles (Au@FeNPs) electrodeposited on pencil graphite (PG) electrode, via the boroester linkages, between free hydroxyl groups of boronic acid, α-COOH and -NH2 groups of enzyme. The surface functionalization of Fe/Au nanoparticles with boronic acid (Au@FeNPs) on pencil graphite (PG) electrode was characterized by Fourier transform infrared (FTIR), cyclic voltammetry (CV), scanning electron microscopy (SEM), atomic force microscopy (AFM) and Electrochemical impedance spectroscopy (EIS) before and after immobilization of XOD. The biosensor exhibited optimum response within 3s at pH 7.2 and 30 °C and linearity in the range, 0.05 μM to 150 μM for hypoxanthine with a detection limit of 0.05 μM (S/N=3). Apparent Michaelis Menten constant (Km(app)) for hypoxanthine was 40 μM and Imax 0.125 mA. The biosensor was employed to determine hypoxanthine in fish, chicken, pork, beef meat and lost 50% of its initial activity after its 200 uses over 100 days, when stored at 4 °C.

  6. Extracellular conversion of guanine-based purines to guanosine specifically enhances astrocyte glutamate uptake.

    PubMed

    Frizzo, Marcos Emílio dos Santos; Antunes Soares, Félix Alexandre; Dall'Onder, Leonara Patrícia; Lara, Diogo Rizzato; Swanson, Raymond A; Souza, Diogo Onofre

    2003-05-16

    Guanosine (GUO) has been shown to stimulate glutamate uptake in primary astrocyte cultures. The purpose of this study was to determine the effect and specificity of guanine- or adenine-based purines on glutamate and GABA uptake in cultured astrocytes. Stimulatory effect on glutamate uptake was observed with GUO, GMP or GTP. Simultaneous exposure with these guanine-based purines did not show an additive effect. We also investigated a possible interconversion of guanine-based purines during incubation time. Action by GTP was excluded since the hydrolysis resistant GTP analog, GMP-PNP did not stimulate glutamate uptake. Addition of an ecto-5'-nucleotidase inhibitor abolished GMP-stimulatory effect on glutamate uptake, without affecting GUO action. Taken together, these results suggest that GUO is the guanine-based purines responsible for glutamate uptake activation. In addition, the stimulatory effect on glutamate uptake was not observed with adenine-based purines. Moreover, GABA uptake was not activated by GUO. These results point to specificity in the interaction between GUO and the astrocyte glutamate uptake system.

  7. 21 CFR 73.1329 - Guanine.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 1 2013-04-01 2013-04-01 false Guanine. 73.1329 Section 73.1329 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL LISTING OF COLOR ADDITIVES EXEMPT FROM CERTIFICATION Drugs § 73.1329 Guanine. (a) Identity. (1) The color additive guanine...

  8. 21 CFR 73.1329 - Guanine.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 1 2014-04-01 2014-04-01 false Guanine. 73.1329 Section 73.1329 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL LISTING OF COLOR ADDITIVES EXEMPT FROM CERTIFICATION Drugs § 73.1329 Guanine. (a) Identity. (1) The color additive guanine...

  9. 21 CFR 73.1329 - Guanine.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 1 2012-04-01 2012-04-01 false Guanine. 73.1329 Section 73.1329 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL LISTING OF COLOR ADDITIVES EXEMPT FROM CERTIFICATION Drugs § 73.1329 Guanine. (a) Identity. (1) The color additive guanine...

  10. 21 CFR 73.1329 - Guanine.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 1 2010-04-01 2010-04-01 false Guanine. 73.1329 Section 73.1329 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL LISTING OF COLOR ADDITIVES EXEMPT FROM CERTIFICATION Drugs § 73.1329 Guanine. (a) Identity. (1) The color additive guanine...

  11. 21 CFR 73.2329 - Guanine.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... ADDITIVES EXEMPT FROM CERTIFICATION Cosmetics § 73.2329 Guanine. (a) Identity and specifications. (1) The color additive guanine shall conform in identity and specifications to the requirements of § 73.1329 (a)(1) and (b). (2) Color additive mixtures of guanine may contain the following diluents: (i)...

  12. 21 CFR 73.1329 - Guanine.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... eye, in amounts consistent with good manufacturing practice. (d) Labeling. The color additive and any... ADDITIVES EXEMPT FROM CERTIFICATION Drugs § 73.1329 Guanine. (a) Identity. (1) The color additive guanine is... derived. (2) Color additive mixtures for drug use made with guanine may contain only those diluents...

  13. Protein modification by adenine propenal.

    PubMed

    Shuck, Sarah C; Wauchope, Orrette R; Rose, Kristie L; Kingsley, Philip J; Rouzer, Carol A; Shell, Steven M; Sugitani, Norie; Chazin, Walter J; Zagol-Ikapitte, Irene; Boutaud, Olivier; Oates, John A; Galligan, James J; Beavers, William N; Marnett, Lawrence J

    2014-10-20

    Base propenals are products of the reaction of DNA with oxidants such as peroxynitrite and bleomycin. The most reactive base propenal, adenine propenal, is mutagenic in Escherichia coli and reacts with DNA to form covalent adducts; however, the reaction of adenine propenal with protein has not yet been investigated. A survey of the reaction of adenine propenal with amino acids revealed that lysine and cysteine form adducts, whereas histidine and arginine do not. N(ε)-Oxopropenyllysine, a lysine-lysine cross-link, and S-oxopropenyl cysteine are the major products. Comprehensive profiling of the reaction of adenine propenal with human serum albumin and the DNA repair protein, XPA, revealed that the only stable adduct is N(ε)-oxopropenyllysine. The most reactive sites for modification in human albumin are K190 and K351. Three sites of modification of XPA are in the DNA-binding domain, and two sites are subject to regulatory acetylation. Modification by adenine propenal dramatically reduces XPA's ability to bind to a DNA substrate.

  14. A DNA-templated silver nanocluster probe for label-free, turn-on fluorescence-based screening of homo-adenine binding molecules.

    PubMed

    Park, Ki Soo; Park, Hyun Gyu

    2015-02-15

    A novel, label-free, turn-on fluorescence strategy to detect molecules that bind to adenine-rich DNA sequences has been developed. The probe employs DNA-templated silver nanoclusters (DNA-AgNCs) as the key detection component. The new strategy relies on the formation of non-Watson-Crick homo-adenine DNA duplex, triggered by strong interactions with homo-adenine binding molecules, which brings a guanine-rich sequence in one strand close to DNA-AgNCs located on the opposite strand. This phenomenon transforms weakly fluorescent AgNCs into highly emissive species that display bright red fluorescence. Finally, we have shown that the new fluorescence turn-on strategy can be employed to detect coralyne, the most representative homo-adenine binding molecule that triggers formation of a non-Watson-Crick homo-adenine DNA duplex.

  15. Supramolecular polymeric chemosensor for biomedical applications: design and synthesis of a luminescent zinc metallopolymer as a chemosensor for adenine detection.

    PubMed

    Chow, Cheuk-Fai

    2012-11-01

    Adenine is an important bio-molecule that plays many crucial roles in food safety and biomedical diagnostics. Differentiating adenine from a mixture of adenosine and other nucleic bases (guanine, thymine, cytosine, and uracil) is particularly important for both biological and clinical applications. A neutral Zn(II) metallosupramolecular polymer based on acyl hydrazone derived coordination centres (P1) were generated through self-assembly polymerization. It is a linear coordination polymer that behaves like self-standing film. The synthesis, (1)H-NMR characterization, and spectroscopic properties of this supramolecular material are reported. P1 was found to be a chemosensor specific to adenine, with a luminescent enhancement. The binding properties of P1 with common nucleic bases and nucleosides reveal that this supramolecular polymer is very selective to adenine molecules (~20 to 420 times more selectivity than other nucleic bases). The formation constant (K) of P1 to adenine was found to be log K = 4.10 ± 0.02. This polymeric chemosensor produces a specific response to adenine down to 90 ppb. Spectrofluorimetric and (1)H-NMR titration studies showed that the P1 polymer allows each Zn(II) coordination centre to bind to two adenine molecules through hydrogen bonding with their imine and hydrazone protons.

  16. Alkylation by propylene oxide of deoxyribonucleic acid, adenine, guanosine and deoxyguanylic acid

    PubMed Central

    Lawley, P. D.; Jarman, M.

    1972-01-01

    1. Propylene oxide reacts with DNA in aqueous buffer solution at about neutral pH to yield two principal products, identified as 7-(2-hydroxypropyl)guanine and 3-(2-hydroxypropyl)adenine, which hydrolyse out of the alkylated DNA at neutral pH values at 37°C. 2. These products were obtained in quantity by reactions between propylene oxide and guanosine or adenine respectively. 3. The reactions between propylene oxide and adenine in acetic acid were parallel to those between dimethyl sulphate and adenine in neutral aqueous solution; the alkylated positions in adenine in order of decreasing reactivity were N-3, N-1 and N-9. A method for separating these alkyladenines is described. 4. Deoxyguanylic acid sodium salt was alkylated at N-7 by propylene oxide in neutral aqueous solution. 5. The nature of the side chain in the principal alkylation products was established by mass spectrometry, and the nature of the products is consistent with their formation by the bimolecular reaction mechanism. PMID:5073240

  17. Was adenine the first purine?

    NASA Technical Reports Server (NTRS)

    Schwartz, Alan W.; Bakker, C. G.

    1989-01-01

    Oligomerization of HCN (1 molar) in the presence of added formaldehyde (0.5 molar) produced an order of magnitude more 8-hydroxymethyladenine than adenine or any other biologically significant purine. This result suggests that on the prebiotic earth, nucleoside analogs may have been synthesized directly in more complex mixtures of HCN with other aldehydes.

  18. Adenine deaminase is encoded by Tad1 and participates in copper accumulation in Trichoderma reesei.

    PubMed

    Fu, Kehe; Fan, Lili; Yu, Chuangjing; Li, Yingying; Gao, Shigang; Li, Yaqian; Chen, Jie

    2014-02-01

    We cloned a novel Tad1 gene and demonstrated that this gene is closely involved in copper bioaccumulation in Trichoderma reesei. Tad1 gene encodes a 510 amino acids protein of the amidohydrolase superfamily which belongs to COG0402. We found that adenine was the most efficient substrate of Tad1 protein among the substrates used in this study. Gene function was also investigated by overexpression and RNA interference. Results showed that copper accumulation increased in mutant cells when Tad1 was overexpressed; by contrast, copper accumulation significantly decreased when Tad1 was inhibited. To investigate the function of Tad1 in copper bioaccumulation, we determined adenine, hypoxanthine, and xanthine concentrations by reversed phase HPLC. Tad1 overexpression induced a substantial production of xanthine, which functions in binding numerous copper ions and reducing copper concentration. We further compared the gene expression profile of AT01 with that of a wild-type T. reesei strain grown in a medium containing 1.0mM Cu(2+) by performing DNA microarray. Several upregulated genes in the mutant were associated with adenine or copper metabolism.

  19. Onset of chiral adenine surface growth.

    PubMed

    Capitán, María Jose; Álvarez, Jesús; Wang, Yang; Otero, Roberto; Alcamí, Manuel; Martín, Fernando; Miranda, Rodolfo

    2013-10-07

    The structure and stability of adenine crystals and thin layers has been studied by using scanning tunneling microscopy, X-ray diffraction, and density functional theory calculations. We have found that adenine crystals can be grown in two phases that are energetically quasi-degenerate, the structure of which can be described as a pile-up of 2D adenine planes. In each plane, the structure can be described as an aggregation of adenine dimers. Under certain conditions, kinetic effects can favor the growth of the less stable phase. These results have been used to understand the growth of adenine thin films on gold under ultra-high vacuum conditions. We have found that the grown phase corresponds to the α-phase, which is composed of stacked prochiral planes. In this way, the adenine nanocrystals exhibit a surface that is enantiopure. These results could open new insight into the applications of adenine in biological, medical, and enantioselective or pharmaceutical fields.

  20. Bacterial Ammeline Metabolism via Guanine Deaminase ▿

    PubMed Central

    Seffernick, Jennifer L.; Dodge, Anthony G.; Sadowsky, Michael J.; Bumpus, John A.; Wackett, Lawrence P.

    2010-01-01

    Melamine toxicity in mammals has been attributed to the blockage of kidney tubules by insoluble complexes of melamine with cyanuric acid or uric acid. Bacteria metabolize melamine via three consecutive deamination reactions to generate cyanuric acid. The second deamination reaction, in which ammeline is the substrate, is common to many bacteria, but the genes and enzymes responsible have not been previously identified. Here, we combined bioinformatics and experimental data to identify guanine deaminase as the enzyme responsible for this biotransformation. The ammeline degradation phenotype was demonstrated in wild-type Escherichia coli and Pseudomonas strains, including E. coli K12 and Pseudomonas putida KT2440. Bioinformatics analysis of these and other genomes led to the hypothesis that the ammeline deaminating enzyme was guanine deaminase. An E. coli guanine deaminase deletion mutant was deficient in ammeline deaminase activity, supporting the role of guanine deaminase in this reaction. Two guanine deaminases from disparate sources (Bradyrhizobium japonicum USDA 110 and Homo sapiens) that had available X-ray structures were purified to homogeneity and shown to catalyze ammeline deamination at rates sufficient to support bacterial growth on ammeline as a sole nitrogen source. In silico models of guanine deaminase active sites showed that ammeline could bind to guanine deaminase in a similar orientation to guanine, with a favorable docking score. Other members of the amidohydrolase superfamily that are not guanine deaminases were assayed in vitro, and none had substantial ammeline deaminase activity. The present study indicated that widespread guanine deaminases have a promiscuous activity allowing them to catalyze a key reaction in the bacterial transformation of melamine to cyanuric acid and potentially contribute to the toxicity of melamine. PMID:20023034

  1. BII stability and base step flexibility of N6-adenine methylated GATC motifs.

    PubMed

    Karolak, Aleksandra; van der Vaart, Arjan

    2015-01-01

    The effect of N6-adenine methylation on the flexibility and shape of palindromic GATC sequences has been investigated by molecular dynamics simulations. Variations in DNA backbone geometry were observed, which were dependent on the degree of methylation and the identity of the bases. While the effect was small, more frequent BI to BII conversions were observed in the GA step of hemimethylated DNA. The increased BII population of the hemimethylated system positively correlated with increased stacking interactions between methylated adenine and guanine, while stacking interactions decreased at the TC step for the fully methylated strand. The flexibility of the AT and TC steps was marginally affected by methylation, in a fashion that was correlated with stacking interactions. The facilitated BI to BII conversion in hemimethylated strands might be of importance for SeqA selectivity and binding.

  2. Identification of the major lesion from the reaction of an acridine-targeted aniline mustard with DNA as an adenine N1 adduct.

    PubMed

    Boritzki, T J; Palmer, B D; Coddington, J M; Denny, W A

    1994-01-01

    DNA adducts of two acridine-linked aniline half-mustards have been isolated and identified. The compound where the half-mustard is attached to the DNA-targeting acridine moiety by a short linker chain alkylates both double- and single-stranded DNA exclusively at guanine N7, as do the majority of known aromatic and aliphatic nitrogen mustards. The longer-chain analogue, also containing a more reactive half-mustard, shows a strikingly different pattern, alkylating double-stranded DNA to yield primarily (> 90%) the adenine N1 adduct, together with < 10% of the adenine N3 adduct and only trace amounts of the guanine N7 adduct. In the presence of MgCl2 (which is known not to inhibit the interaction of drugs at minor groove sites), the adenine N3 adduct is the major product. The latter compound is the first known aniline mustard (and apparently the first known alkylating agent of any type) to preferentially alkylate adenine at the N1 position in duplex DNA. These results are consistent with previous work [Prakash et al. (1990) Biochemistry 29, 9799-9807], which showed that the preferred site of DNA alkylation by the corresponding long-chain acridine-linked aniline bis-mustards in general was at major groove sites of adenines and identifies the major site of alkylation as adenine N1 and not N7. This selectivity for adenine N1 alkylation is suggested to result from a preference for the acridine mustard side chain of these compounds to project into the major groove following intercalation of the acridine, coupled with structural distortion of the DNA helix to make the N1 positions of adenines adjacent to the intercalation sites more accessible.

  3. Restoration of Hypoxanthine Phosphoribosyl Transferase Activity in Mouse 1R Cells After Fusion with Chick-Embryo Fibroblasts

    PubMed Central

    Bakay, Bohdan; Croce, Carlo M.; Koprowski, Hilary; Nyhan, William L.

    1973-01-01

    Fusion of the 1R mouse cell, which lacks activity of hypoxanthine phosphoribosyl transferase (EC 2.4.2.8), with chick-embryo fibroblasts yielded progeny cells that survived in hypoxanthine-aminopterin-thymidine selective medium. This property and the failure of the progeny to survive in 8-azaguanine indicated that hypoxanthine phosphoribosyl transferase activity was present. Electrophoretic analysis revealed that the enzyme was of mouse, not chick, origin. These observations are consistent with the operation of a regulator gene responsible for the absence of hypoxanthine phosphoribosyl-transferase activity in the 1R cell and its presence in the progeny. Images PMID:4516198

  4. Plasma hypoxanthine: a marker for hypoxic-ischaemic induced periventricular leucomalacia?

    PubMed Central

    Russell, G A; Jeffers, G; Cooke, R W

    1992-01-01

    Cerebral ischaemia of the immature brain may result in cavitating periventricular leucomalacia (PVL), an important association of cerebral palsy. Hypoxanthine measured by high performance liquid chromatography was used as a marker of peripartum hypoxia and ischaemia in 116 infants at risk of PVL. PVL was detected by ultrasound. The 81 infants who were unaffected had median (range) gestation of 30 weeks (24-32), weight of 1336 g (724-3790), and a plasma hypoxanthine concentration of 7.8 mumol/l (2.4-48.9). The seven infants who had cavitating PVL had a median gestation of 28 weeks (26-30), weight of 1165 g (682-1860), and a hypoxanthine concentration of 31.9 mumol/l (7.1-149). Cavitating PVL was significantly dependent only on hypoxanthine when controlling for the effects of weight and gestation. This suggests that peripartum hypoxia-ischaemia may be one of the aetiological factors in cavitating PVL. Oxidation of hypoxanthine during reperfusion generates free radicals which may contribute to the tissue destruction of PVL. The association of hypoxia-ischaemia with PVL suggests that PVL may be modified by reducing free radical activity. PMID:1586176

  5. Bound Anionic States of Adenine

    SciTech Connect

    Haranczyk, Maciej; Gutowski, Maciej S.; Li, Xiang; Bowen, Kit H.

    2007-03-20

    The research described in this product was performed in part in the Environmental Molecular Sciences Laboratory, a national scientific user facility sponsored by the Department of Energy's Office of Biological and Environmental Research and located at Pacific Northwest National Laboratory. Anionic states of nucleic acid bases are involved in DNA damage by low-energy electrons and in charge transfer through DNA. Previous gas phase studies of free, unsolvated nucleic acid base parent anions probed only dipole-bound states, which are not present in condensed phase environments, but did not observe valence anionic states, which for purine bases are thought to be adiabatically unbound. Contrary to this expectation, we have demonstrated that some thus far ignored tautomers of adenine, which result from enamine-imine transformations, support valence anionic states with electron vertical detachment energies as large as 2.2 eV, and at least one of these anionic tautomers is adiabatically bound. Moreover, we predict that the new anionic tautomers should also dominate in solutions and should be characterized by larger values of electron vertical detachment energy than the canonical valence anion. All of the newfound anionic tautomers might be formed in the course of dissociative electron attachment followed by a hydrogen atom attachment to a carbon atom, and they might affect the structure and properties of DNA and RNA exposed to low-energy electrons. The new valence states observed here, unlike the dipole-bound state, could exist in condensed phases and might be relevant to radiobiological damage. The discovery of these valence anionic states of adenine was facilitated by the development of (i) an experimental method for preparing parent anions of nucleic acid bases for photoelectron experiments, and (it) a combinatorial/quantum chemical approach for identification of the most stable tautomers of organic molecules.

  6. Hypoxanthine: A Universal Metabolic Indicator of Training Status in Competitive Sports.

    PubMed

    Zieliński, Jacek; Kusy, Krzysztof

    2015-10-01

    Cardiorespiratory and biochemical indicators typically used by contemporary elite athletes seem to have limited applicability. According to some recent studies, purine metabolism better reflects exercise response and muscle adaptation in this group. We propose using purine derivatives, especially plasma hypoxanthine concentration, as indicators of training status in consecutive training phases in highly trained athletes.

  7. Hypoxanthine phosphoribosyltransferase: radiochemical assay procedures for the forward and reverse reactions

    SciTech Connect

    Smithers, G.W.; O'Sullivan, W.J.

    1985-02-15

    Simple and rapid radiochemical assay procedures for the forward (IMP synthesis) and reverse (IMP pyrophosphorolysis) reactions catalyzed by hypoxanthine phosphoribosyltransferase have been developed. Enzyme activity in the forward direction was assessed by measuring the amount of (8-/sup 14/C)IMP formed from (8-/sup 14/C)hypoxanthine following their separation by polyethyleneimine-cellulose TLC in methanol:water (1:1, v/v). (8-/sup 14/C)IMP has been synthesized from (8-/sup 14/C)hypoxanthine, using hypoxanthine phosphoribosyltransferase derived from human brain, with subsequent purification by elution from phenyl boronate-agarose. Enzyme activity in the reverse direction was assessed by measuring the amount of (8-/sup 14/C)uric acid formed from the labeled IMP following their separation by polyethyleneimine-cellulose TLC in 0.2 M LiCl saturated with boric acid (pH 4.5):95% ethanol (1:1, v/v), the transferase reaction being coupled with excess xanthine oxidase and catalase to overcome the unfavorable equilibrium.

  8. Draft Genome Sequence of the Soil Isolate Lysinibacillus fusiformis M5, a Potential Hypoxanthine Producer

    PubMed Central

    Maróti, Gergely; Bálint, Balázs

    2016-01-01

    Lysinibacillus fusiformis strain M5 is a potential hypoxanthine producer that was isolated from clay soil. Here, we present the draft genome sequence that was annotated in order to facilitate future studies of L. fusiformis M5. PMID:27834716

  9. Bound anionic states of adenine

    SciTech Connect

    Haranczyk, Maciej; Gutowski, Maciej S; Li, Xiang; Bowen, Kit H

    2007-03-20

    Anionic states of nucleic acid bases are involved in DNA damage by low-energy electrons and in charge transfer through DNA. Previous gas phase studies of free, unsolvated nucleic acid base parent anions probed only dipole-bound states, which are not present in condensed phase environments, but did not observe valence anionic states, which for purine bases, are thought to be adiabatically unbound. Contrary to this expectation, we have demonstrated that some thus far ignored tautomers of adenine, which result from enamine-imine transformations, support valence anionic states with electron vertical detachment energies as large as 2.2 eV, and at least one of these anionic tautomers is adiabatically bound. Moreover, we predict that the new anionic tautomers should also dominate in solutions and should be characterized by larger values of electron vertical detachment energy than the canonical valence anion. All of the new-found anionic tautomers might be formed in the course of dissociative electron attachment followed by a hydrogen atom attachment to a carbon atom, and they might affect the structure and properties of DNA and RNA exposed to low-energy electrons. The discovery of these valence anionic states of adenine was facilitated by the development of: (i) a new experimental method for preparing parent anions of nucleic acid bases for photoelectron experiments, and (ii) a new combinatorial/ quantum chemical approach for identification of the most stable tautomers of organic molecules. The computational portion of this work was supported by the: (i) Polish State Committee for Scientific Research (KBN) Grants: DS/8000-4-0140-7 (M.G.) and N204 127 31/2963 (M.H.), (ii) European Social Funds (EFS) ZPORR/2.22/II/2.6/ARP/U/2/05 (M.H.), and (iii) US DOE Office of Biological and Environmental Research, Low Dose Radiation Research Program (M.G.). M.H. holds the Foundation for Polish Science (FNP) award for young scientists. The calculations were performed at the Academic

  10. Double proton transfer mechanism in the adenine-uracil base pair and spontaneous mutation in RNA duplex

    NASA Astrophysics Data System (ADS)

    Cerón-Carrasco, José P.; Requena, Alberto; Perpète, Eric A.; Michaux, Catherine; Jacquemin, Denis

    2009-12-01

    We study the mechanism of double proton transfer (DPT) in the adenine-uracil (AU) base pair, both in gas phase and under the influence of surrounding water molecules. According to our ab initio calculations, no stable proton transfer product exists in gas phase, while in solution, the DPT process may occur only through the catalysis of water molecules. Nevertheless, a thermodynamic analysis confirms that AU does not contribute to spontaneous mutation in RNA duplex, and thus guanine-cytosine (GC) would be the only base pair contributing to spontaneous mutation.

  11. 21 CFR 73.2329 - Guanine.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... ADDITIVES EXEMPT FROM CERTIFICATION Cosmetics § 73.2329 Guanine. (a) Identity and specifications. (1) The... coloring cosmetics generally, only those diluents listed under § 73.1001(a)(1); (ii) For coloring externally applied cosmetics, only those diluents listed in § 73.1001(b) and, in addition, nitrocellulose....

  12. 21 CFR 73.2329 - Guanine.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... ADDITIVES EXEMPT FROM CERTIFICATION Cosmetics § 73.2329 Guanine. (a) Identity and specifications. (1) The... coloring cosmetics generally, only those diluents listed under § 73.1001(a)(1); (ii) For coloring externally applied cosmetics, only those diluents listed in § 73.1001(b) and, in addition, nitrocellulose....

  13. 21 CFR 73.2329 - Guanine.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... ADDITIVES EXEMPT FROM CERTIFICATION Cosmetics § 73.2329 Guanine. (a) Identity and specifications. (1) The... coloring cosmetics generally, only those diluents listed under § 73.1001(a)(1); (ii) For coloring externally applied cosmetics, only those diluents listed in § 73.1001(b) and, in addition, nitrocellulose....

  14. 21 CFR 73.2329 - Guanine.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... ADDITIVES EXEMPT FROM CERTIFICATION Cosmetics § 73.2329 Guanine. (a) Identity and specifications. (1) The... coloring cosmetics generally, only those diluents listed under § 73.1001(a)(1); (ii) For coloring externally applied cosmetics, only those diluents listed in § 73.1001(b) and, in addition, nitrocellulose....

  15. Crystal structures and inhibition of Trypanosoma brucei hypoxanthine–guanine phosphoribosyltransferase

    PubMed Central

    Terán, David; Hocková, Dana; Česnek, Michal; Zíková, Alena; Naesens, Lieve; Keough, Dianne T.; Guddat, Luke W.

    2016-01-01

    Human African Trypanosomiasis (HAT) is a life-threatening infectious disease caused by the protozoan parasite, Trypanosoma brucei (Tbr). Due to the debilitating side effects of the current therapeutics and the emergence of resistance to these drugs, new medications for this disease need to be developed. One potential new drug target is 6-oxopurine phosphoribosyltransferase (PRT), an enzyme central to the purine salvage pathway and whose activity is critical for the production of the nucleotides (GMP and IMP) required for DNA/RNA synthesis within this protozoan parasite. Here, the first crystal structures of this enzyme have been determined, these in complex with GMP and IMP and with three acyclic nucleoside phosphonate (ANP) inhibitors. The Ki values for GMP and IMP are 30.5 μM and 77 μM, respectively. Two of the ANPs have Ki values considerably lower than for the nucleotides, 2.3 μM (with guanine as base) and 15.8 μM (with hypoxanthine as base). The crystal structures show that when two of the ANPs bind, they induce an unusual conformation change to the loop where the reaction product, pyrophosphate, is expected to bind. This and other structural differences between the Tbr and human enzymes suggest selective inhibitors for the Tbr enzyme can be designed. PMID:27786284

  16. Photophysical deactivation pathways in adenine oligonucleotides.

    PubMed

    Spata, Vincent A; Matsika, Spiridoula

    2015-12-14

    In this work we study deactivation processes in adenine oligomers after absorption of UV radiation using Quantum Mechanics combined with Molecular Mechanics (QM/MM). Correlated electronic structure methods appropriate for describing the excited states are used to describe a π-stacked dimer of adenine bases incorporated into (dA)20(dT)20. The results of these calculations reveal three different types of excited state minima which play a role in deactivation processes. Within this set of minima there are minima where the excited state is localized on one adenine (monomer-like) as well as minima where the excited state is delocalized on two adenines, forming different types of excimers and bonded excimers of varying but inter-related character. The proximity of their energies reveals that the minima can decay into one another along a flat potential energy surface dependent on the interbase separation. Additionally, analysis of the emissive energies and other physical properties, including theoretical anisotropy calculations, and comparison with fluorescence experiments, provides evidence that excimers play an important role in long-lived signals in adenine oligonucleotides while the subpicosecond decay is attributed to monomer-like minima. The necessity for a close approach of the nucleobases reveals that the deactivation mechanism is tied to macro-molecular motion.

  17. Prebiotic synthesis of adenine and amino acids under Europa-like conditions

    NASA Technical Reports Server (NTRS)

    Levy, M.; Miller, S. L.; Brinton, K.; Bada, J. L.

    2000-01-01

    In order to simulate prebiotic synthetic processes on Europa and other ice-covered planets and satellites, we have investigated the prebiotic synthesis of organic compounds from dilute solutions of NH4CN frozen for 25 years at -20 and -78 degrees C. In addition, the aqueous products of spark discharge reactions from a reducing atmosphere were frozen for 5 years at -20 degrees C. We find that both adenine and guanine, as well as a simple set of amino acids dominated by glycine, are produced in substantial yields under these conditions. These results indicate that some of the key components necessary for the origin of life may have been available on Europa throughout its history and suggest that the circumstellar zone where life might arise may be wider than previously thought.

  18. Prebiotic Synthesis of Adenine and Amino Acids Under Europa-like Conditions

    NASA Technical Reports Server (NTRS)

    Levy, Matthew; Miller, Stanley L.; Brinton, Karen; Bada, Jeffrey L.

    2003-01-01

    In order to simulate prebiotic synthetic processes on Europa and other ice-covered planets and satellites. we have investigated the prebiotic synthesis of organic compounds from dilute solutions of NH4CN frozen for 25 year at -20 and -78 C. In addition the aqueous products of spark discharge reactions from a reducing atmosphere were frozen for 5 years at -20%. We find that both adenine and guanine, as well as a simple set of amino acids dominated by glycine, are produced in substantial yields under these conditions. These results indicate that some of the key components necessary for the origin of life may have been available on Europa throughout its history and suggest that the circumstellar zone where life might arise may be m der than previously thought.

  19. Prototropic tautomerism and basic molecular principles of hypoxanthine mutagenicity: an exhaustive quantum-chemical analysis.

    PubMed

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2013-01-01

    The molecular structures, relative stability order, and dipole moments of a complete family of 21 planar hypoxanthine (Hyp) prototropic molecular-zwitterionic tautomers including ylidic forms were computationally investigated at the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory in vacuum and in three different surrounding environments: continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interface of protein-nucleic acid interactions, dimethylsulfoxide (DMSO), and water. The keto-N1HN7H tautomer was established to be the global minimum in vacuum and in continuum with ϵ = 4, while Hyp molecule exists as a mixture of the keto-N1HN9H and keto-N1HN7H tautomers in approximately equal amounts in DMSO and in water at T = 298.15 K. We found out that neither intramolecular tautomerization by single proton transfer in the Hyp base, nor intermolecular tautomerization by double proton transfer in the most energetically favorable Hyp·Hyp homodimer (symmetry C(2h)), stabilized by two equivalent N1H…O6 H-bonds, induces the formation of the enol tautomer (marked with an asterisk) of Hyp with cis-oriented O6H hydroxyl group relative to neighboring N1C6 bond. We first discovered a new scenario of the keto-enol tautomerization of Hyp · Hyp homodimer (C(2h)) via zwitterionic near-orthogonal transition state (TS), stabilized by N1⁺H…N1⁻ and O6⁺H…N1⁻ H-bonds, to heterodimer Hyp∗ · Hyp (C(s)), stabilized by O6H…O6 and N1H…N1 H-bonds. We first showed that Hyp∗ · Thy mispair (C(s)), stabilized by O6H…O4, N3H…N1, and C2H…O2 H-bonds, mimicking Watson-Crick base pairing, converts to the wobble Hyp · Thy base pair (C(s)), stabilized by N3H…O6 and N1H…O2 H-bonds, via high- and low-energy TSs and intermediate Hyp · Thy∗, stabilized by O4H…O6, N1H…N3, and C2H…O2 H-bonds. The most energetically favorable TS is the zwitterionic pair Hyp⁺ · Thy⁻ (C(s)), stabilized by O6

  20. Guanine nucleotide regulation of receptor binding of thyrotropin-releasing hormone (TRH) in rat brain regions, retina and pituitary.

    PubMed

    Sharif, N A; Burt, D R

    1987-10-29

    Guanine nucleotides inhibited the specific binding of [3H](3-Me-His2)thyrotropin-releasing hormone ([3H]MeTRH) to receptors for TRH in washed homogenates of rat anterior pituitary gland in a dose-related manner. The order of potency (at 100 and 500 microM final) was Gpp(NH)p (a stable analog of GTP) greater than GTP much greater than GDP much greater than cGMP (with the adenine nucleotides being inactive) in the pituitary and various brain regions. Gpp(NH)p at 1 mM caused 17-35% inhibition of [3H]MeTRH binding to different tissues including the pituitary, hypothalamus, retina and nucleus accumbens. A statistically significant nucleotide effect was not observed, however, in the olfactory bulb and medulla/pons membranes. Gpp(NH)p (1 mM) increased the dissociation constants for [3H]MeTRH binding by 1.9- to 2.4-fold in the pituitary, n. accumbens and retinal preparations without altering the apparent binding capacity. These data suggest that TRH receptor binding can be allosterically regulated by guanine nucleotides and provide further evidence for the existence of guanine nucleotide binding protein(s) coupled to the TRH receptor.

  1. Adenine auxotrophy--be aware: some effects of adenine auxotrophy in Saccharomyces cerevisiae strain W303-1A.

    PubMed

    Kokina, Agnese; Kibilds, Juris; Liepins, Janis

    2014-08-01

    Adenine auxotrophy is a commonly used genetic marker in haploid yeast strains. Strain W303-1A, which carries the ade2-1 mutation, is widely used in physiological and genetic research. Yeast extract-based rich medium contains a low level of adenine, so that adenine is often depleted before glucose. This could affect the cell physiology of adenine auxotrophs grown in rich medium. The aim of our study was to assess the effects of adenine auxotrophy on cell morphology and stress physiology. Our results show that adenine depletion halts cell division, but that culture optical density continues to increase due to cell swelling. Accumulation of trehalose and a coincident 10-fold increase in desiccation stress tolerance is observed in adenine auxotrophs after adenine depletion, when compared to prototrophs. Under adenine starvation, long-term survival of W303-1A is lower than during carbon starvation, but higher than during leucine starvation. We observed drastic adenine-dependent changes in cell stress physiology, suggesting that results may be biased when adenine auxotrophs are grown in rich media without adenine supplementation.

  2. The metabolic relation between hypoxanthine and uric acid in man following maximal short-distance running.

    PubMed

    Westing, Y H; Ekblom, B; Sjödin, B

    1989-11-01

    This study was performed to assess the metabolic relation between hypoxanthine and uric acid following short-distance maximal running. Eleven trained males, mean age 22 years (16-31), were instructed to run 800 m in the shortest time possible. Blood samples were collected before warm-up, before the run, immediately after the run and periodically up to 24 h following the run. Blood lactate was determined after warm-up, and at 5, 10, and 30 min following the run. Mean VO2 max for the subjects was 65.8 (4.7) (SD) ml kg-1 min-1 and mean oxygen demand for the running was 118 (8)% of VO2 max. Plasma hypoxanthine levels rose from 3.3 (1.4) to a peak of 48.2 (19.0) mumol l-1 at 20 min following the run and at 180 min had almost returned to pre-run levels. Plasma uric acid levels rose from a pre-run value of 267 (34) to a peak value of 431 (87) mumol l-1 at 45 min following the run. Uric acid concentrations had not returned to normal at 10 h following the run. The blood lactate level peaked at 5 min with 13.7 (2.0) mmol l-1. The results obtained in this study indicate a metabolic relationship between the formation of hypoxanthine and the formation of uric acid. The data also indicate that xanthine oxidase is active following short-distance intensive running.

  3. Calculation of the stabilization energies of oxidatively damaged guanine base pairs with guanine.

    PubMed

    Suzuki, Masayo; Kino, Katsuhito; Morikawa, Masayuki; Kobayashi, Takanobu; Komori, Rie; Miyazawa, Hiroshi

    2012-06-01

    DNA is constantly exposed to endogenous and exogenous oxidative stresses. Damaged DNA can cause mutations, which may increase the risk of developing cancer and other diseases. G:C-C:G transversions are caused by various oxidative stresses. 2,2,4-Triamino-5(2H)-oxazolone (Oz), guanidinohydantoin (Gh)/iminoallantoin (Ia) and spiro-imino-dihydantoin (Sp) are known products of oxidative guanine damage. These damaged bases can base pair with guanine and cause G:C-C:G transversions. In this study, the stabilization energies of these bases paired with guanine were calculated in vacuo and in water. The calculated stabilization energies of the Ia:G base pairs were similar to that of the native C:G base pair, and both bases pairs have three hydrogen bonds. By contrast, the calculated stabilization energies of Gh:G, which form two hydrogen bonds, were lower than the Ia:G base pairs, suggesting that the stabilization energy depends on the number of hydrogen bonds. In addition, the Sp:G base pairs were less stable than the Ia:G base pairs. Furthermore, calculations showed that the Oz:G base pairs were less stable than the Ia:G, Gh:G and Sp:G base pairs, even though experimental results showed that incorporation of guanine opposite Oz is more efficient than that opposite Gh/Ia and Sp.

  4. Quantum-chemical study of interactions of trans-resveratrol with guanine-thymine dinucleotide and DNA-nucleobases.

    PubMed

    Mikulski, Damian; Szeląg, Małgorzata; Molski, Marcin

    2011-12-01

    Trans-resveratrol, a natural phytoalexin present in red wine and grapes, has gained considerable attention because of its antiproliferative, chemopreventive and proapoptotic activity against human cancer cells. The accurate quantum-chemical computations based on the density functional theory (DFT) and ab initio second-order Møller-Plesset perturbation method (MP2) have been performed for the first time to study interactions of trans-resveratrol with guanine-thymine dinucleotide and DNA-derived nitrogenous bases: adenine, guanine, cytosine and thymine in vacuum and water medium. This compound is found to show high affinity to nitrogenous bases and guanine-thymine dinucleotide. The electrostatic interactions from intermolecular hydrogen bonding increase the stability of complexes studied. In particular, significantly strong hydrogen bonds between 4'-H atom of trans-resveratrol and imidazole nitrogen as well as carbonyl oxygen atoms of nucleobases studied stabilize these systems. The stabilization energies computed reveal that the negatively charged trans-resveratrol-dinucleotide complex is more energetically stable in water medium than in vacuum. MP2 method gives more reliable and significantly high values of stabilization energy of trans-resveratrol-dinucleotide, trans-resveratrol-guanine and trans-resveratrol-thymine complexes than B3LYP exchange-correlation functional because it takes into account London dispersion energy. According to the results, in the presence of trans-resveratrol the 3'-5' phosphodiester bond in dinucleotide can be cleaved and the proton from 4'-OH group of trans-resveratrol migrates to the 3'-O atom of dinucleotide. It is concluded that trans-resveratrol is able to break the DNA strand. Hence, the findings obtained help understand antiproliferative and anticancer properties of this polyphenol.

  5. Graphene-Enhanced Raman Scattering from the Adenine Molecules

    NASA Astrophysics Data System (ADS)

    Dolgov, Leonid; Pidhirnyi, Denys; Dovbeshko, Galyna; Lebedieva, Tetiana; Kiisk, Valter; Heinsalu, Siim; Lange, Sven; Jaaniso, Raivo; Sildos, Ilmo

    2016-04-01

    An enhanced Raman scattering from a thin layer of adenine molecules deposited on graphene substrate was detected. The value of enhancement depends on the photon energy of the exciting light. The benzene ring in the structure of adenine molecule suggests π-stacking of adenine molecule on top of graphene. So, it is proposed that the enhancement in the adenine Raman signal is explained by the resonance electron transfer from the Fermi level of graphene to the lowest unoccupied molecular orbital (LUMO) level of adenine.

  6. Atomic substitution reveals the structural basis for substrate adenine recognition and removal by adenine DNA glycosylase

    SciTech Connect

    Lee, Seongmin; Verdine, Gregory L.

    2010-01-14

    Adenine DNA glycosylase catalyzes the glycolytic removal of adenine from the promutagenic A {center_dot} oxoG base pair in DNA. The general features of DNA recognition by an adenine DNA glycosylase, Bacillus stearothermophilus MutY, have previously been revealed via the X-ray structure of a catalytically inactive mutant protein bound to an A:oxoG-containing DNA duplex. Although the structure revealed the substrate adenine to be, as expected, extruded from the DNA helix and inserted into an extrahelical active site pocket on the enzyme, the substrate adenine engaged in no direct contacts with active site residues. This feature was paradoxical, because other glycosylases have been observed to engage their substrates primarily through direct contacts. The lack of direct contacts in the case of MutY suggested that either MutY uses a distinctive logic for substrate recognition or that the X-ray structure had captured a noncatalytically competent state in lesion recognition. To gain further insight into this issue, we crystallized wild-type MutY bound to DNA containing a catalytically inactive analog of 2'-deoxyadenosine in which a single 2'-H atom was replaced by fluorine. The structure of this fluorinated lesion-recognition complex (FLRC) reveals the substrate adenine buried more deeply into the active site pocket than in the prior structure and now engaged in multiple direct hydrogen bonding and hydrophobic interactions. This structure appears to capture the catalytically competent state of adenine DNA glycosylases, and it suggests a catalytic mechanism for this class of enzymes, one in which general acid-catalyzed protonation of the nucleobase promotes glycosidic bond cleavage.

  7. Trichomonas vaginalis NTPDase and ecto-5'-nucleotidase hydrolyze guanine nucleotides and increase extracellular guanosine levels under serum restriction.

    PubMed

    Menezes, Camila Braz; Durgante, Juliano; de Oliveira, Rafael Rodrigues; Dos Santos, Victor Hugo Jacks Mendes; Rodrigues, Luiz Frederico; Garcia, Solange Cristina; Dos Santos, Odelta; Tasca, Tiana

    2016-05-01

    Trichomonas vaginalis is the aethiologic agent of trichomoniasis, the most common non-viral sexually transmitted disease in the world. The purinergic signaling pathway is mediated by extracellular nucleotides and nucleosides that are involved in many biological effects as neurotransmission, immunomodulation and inflammation. Extracellular nucleotides can be hydrolyzed by a family of enzymes known as ectonucleotidases including the ecto-nucleoside triphosphate diphosphohydrolases (E-NTPDases) family which hydrolyses nucleosides triphosphate and diphosphate as preferential substrates and ecto-5'-nucleotidase which catalyzes the conversion of monophosphates into nucleosides. In T. vaginalis the E-NTPDase and ecto-5'-nucleotidase activities upon adenine nucleotides have already been characterized in intact trophozoites but little is known concerning guanine nucleotides and nucleoside. These enzymes may exert a crucial role on nucleoside generation, providing the purine sources for the synthesis de novo of these essential nutrients, sustaining parasite growth and survival. In this study, we investigated the hydrolysis profile of guanine-related nucleotides and nucleoside in intact trophozoites from long-term-grown and fresh clinical isolates of T. vaginalis. Knowing that guanine nucleotides are also substrates for T. vaginalis ectoenzymes, we evaluated the profile of nucleotides consumption and guanosine uptake in trophozoites submitted to a serum limitation condition. Results show that guanine nucleotides (GTP, GDP, GMP) were substrates for T. vaginalis ectonucleotidases, with expected kinetic parameters for this enzyme family. Different T. vaginalis isolates (two from the ATCC and nine fresh clinical isolates) presented a heterogeneous hydrolysis profile. The serum culture condition increased E-NTPDase and ecto-5'-nucleotidase activities with high consumption of extracellular GTP generating enhanced GDP, GMP and guanosine levels as demonstrated by HPLC, with final

  8. Chlorophyll fluorescence control in microalgae by biogenic guanine crystals

    NASA Astrophysics Data System (ADS)

    Miyashita, Yuito; Iwasaka, Masakazu; Endo, Hirotoshi

    2015-05-01

    Magnetic fields were applied to water suspensions of guanine crystals to induce changes in light scattering as a possible way to control photosynthesis in microalgae. The effect of guanine microcrystals with and without an applied magnetic field on the photosynthesis of a unicellular microalgae (plant), Pleurochrysis. carterae (P. carterae), was investigated by examining chlorophyll fluorescence. The fluorescence intensity at 600-700 nm of the photosynthetic cells increased remarkably when the concentration ratio of guanine microcrystals was 10 times larger than that of the cells. This increase in fluorescence occurred reproducibly and was proportional to the amount of guanine microcrystals added. It is speculated that the guanine microcrystals enhance the intensity of the excitation light on the cells by concentrating the excitation light or prolonging the time of light exposure to the cells. Moreover, applying a 500-mT magnetic field allowed modulation of the fluorescence intensity, depending on the direction of the fluorescence light.

  9. Identification, expression, and characterization of Escherichia coli guanine deaminase.

    PubMed

    Maynes, J T; Yuan, R G; Snyder, F F

    2000-08-01

    Using the human cDNA sequence corresponding to guanine deaminase, the Escherichia coli genome was scanned using the Basic Local Alignment Search Tool (BLAST), and a corresponding 439-residue open reading frame of unknown function was identified as having 36% identity to the human protein. The putative gene was amplified, subcloned into the pMAL-c2 vector, expressed, purified, and characterized enzymatically. The 50.2-kDa protein catalyzed the conversion of guanine to xanthine, having a K(m) of 15 microM with guanine and a k(cat) of 3.2 s(-1). The bacterial enzyme shares a nine-residue heavy metal binding site with human guanine deaminase, PG[FL]VDTHIH, and was found to contain approximately 1 mol of zinc per mol of subunit of protein. The E. coli guanine deaminase locus is 3' from an open reading frame which shows homology to a bacterial purine base permease.

  10. Identification, Expression, and Characterization of Escherichia coli Guanine Deaminase

    PubMed Central

    Maynes, Jason T.; Yuan, Richard G.; Snyder, Floyd F.

    2000-01-01

    Using the human cDNA sequence corresponding to guanine deaminase, the Escherichia coli genome was scanned using the Basic Local Alignment Search Tool (BLAST), and a corresponding 439-residue open reading frame of unknown function was identified as having 36% identity to the human protein. The putative gene was amplified, subcloned into the pMAL-c2 vector, expressed, purified, and characterized enzymatically. The 50.2-kDa protein catalyzed the conversion of guanine to xanthine, having a Km of 15 μM with guanine and a kcat of 3.2 s−1. The bacterial enzyme shares a nine-residue heavy metal binding site with human guanine deaminase, PG[FL]VDTHIH, and was found to contain approximately 1 mol of zinc per mol of subunit of protein. The E. coli guanine deaminase locus is 3′ from an open reading frame which shows homology to a bacterial purine base permease. PMID:10913105

  11. Kinetics of the proton-deuteron exchange at position H8 of adenine and guanine in DNA.

    PubMed Central

    Brandes, R; Ehrenberg, A

    1986-01-01

    Proton-NMR has been used to determine the activation energies and pre-exponential factors for the deuterium exchange of AH8 in poly(dA-dT).poly(dA-dT), and for GH8 in poly(dG-dC).poly(dG-dC). No simple relationship between the kinetic parameters and molecular conformation was found. By addition of 4.5 M NaCl a transition from the B to the Z conformation was induced for poly(dG-dC).poly(dG-dC), and an increased exchange rate was observed. The exchange rate for poly(dA-dT).poly(dA-dT) also increased below 64 degrees C, and a significant decrease in activation energy on addition of 4.5 M NaCl was observed. The exchange rates at T = 55.8 degrees C were also measured for the AH8 and GH8 in random sequence calf thymus DNA. From the difference in exchange rates, a method of preferential labeling of either the AH8 or the GH8 in high molecular weight DNA is evaluated. PMID:3025816

  12. 2-Thiouracil deprived of thiocarbonyl function preferentially base pairs with guanine rather than adenine in RNA and DNA duplexes

    PubMed Central

    Sochacka, Elzbieta; Szczepanowski, Roman H.; Cypryk, Marek; Sobczak, Milena; Janicka, Magdalena; Kraszewska, Karina; Bartos, Paulina; Chwialkowska, Anna; Nawrot, Barbara

    2015-01-01

    2-Thiouracil-containing nucleosides are essential modified units of natural and synthetic nucleic acids. In particular, the 5-substituted-2-thiouridines (S2Us) present in tRNA play an important role in tuning the translation process through codon–anticodon interactions. The enhanced thermodynamic stability of S2U-containing RNA duplexes and the preferred S2U-A versus S2U-G base pairing are appreciated characteristics of S2U-modified molecular probes. Recently, we have demonstrated that 2-thiouridine (alone or within an RNA chain) is predominantly transformed under oxidative stress conditions to 4-pyrimidinone riboside (H2U) and not to uridine. Due to the important biological functions and various biotechnological applications for sulfur-containing nucleic acids, we compared the thermodynamic stabilities of duplexes containing desulfured products with those of 2-thiouracil-modified RNA and DNA duplexes. Differential scanning calorimetry experiments and theoretical calculations demonstrate that upon 2-thiouracil desulfuration to 4-pyrimidinone, the preferred base pairing of S2U with adenosine is lost, with preferred base pairing with guanosine observed instead. Therefore, biological processes and in vitro assays in which oxidative desulfuration of 2-thiouracil-containing components occurs may be altered. Moreover, we propose that the H2U-G base pair is a suitable model for investigation of the preferred recognition of 3′-G-ending versus A-ending codons by tRNA wobble nucleosides, which may adopt a 4-pyrimidinone-type structural motif. PMID:25690900

  13. New ribose-modified fluorescent analogs of adenine and guanine nucleotides available as substrates for various enzymes.

    PubMed

    Hiratsuka, T

    1983-02-15

    The synthesis of fluorescent derivatives of nucleosides and nucleotides, by reaction with isatoic anhydride in aqueous solution at mild pH and temperature, yielding their 3'-O-anthraniloyl derivatives, is here described. The N-methylanthraniloyl derivatives were also synthesized by reaction with N-methylisatoic anhydride. Upon excitation at 330-350 nm these derivatives exhibited maximum fluorescence emission at 430-445 nm in aqueous solution with quantum yields of 0.12-0.24. Their fluorescence was sensitive to the polarity of the solvent; in N,N-dimethylformamide the quantum yields were 0.83-0.93. The major differences between the two fluorophores were the longer wavelength of the emission maximum of the N-methylanthraniloyl group and its greater quantum yield in water. All anthraniloyl derivatives, as well as the N-methylanthraniloyl ones, had virtually identical fluorescent properties, regardless of their base structures. The ATP derivatives showed considerable substrate activity as a replacement of ATP with adenylate kinase, guanylate kinase, glutamine synthetase, myosin ATPase and sodium-potassium transport ATPase. The ADP derivatives were good substrates for creatine kinase and glutamine synthetase (gamma-glutamyl transfer activity). The GMP and adenosine derivatives were substrates for guanylate kinase and adenosine deaminase, respectively. All derivatives had only slightly altered Km values for these enzymes. While more fluorescent in water, the N-methylanthraniloyl derivatives were found to show relatively low substrate activities against some of these enzymes. The results indicate that these ribose-modified nucleosides and nucleotides can be versatile fluorescent substrate analogs for various enzymes.

  14. 2-Thiouracil deprived of thiocarbonyl function preferentially base pairs with guanine rather than adenine in RNA and DNA duplexes.

    PubMed

    Sochacka, Elzbieta; Szczepanowski, Roman H; Cypryk, Marek; Sobczak, Milena; Janicka, Magdalena; Kraszewska, Karina; Bartos, Paulina; Chwialkowska, Anna; Nawrot, Barbara

    2015-03-11

    2-Thiouracil-containing nucleosides are essential modified units of natural and synthetic nucleic acids. In particular, the 5-substituted-2-thiouridines (S2Us) present in tRNA play an important role in tuning the translation process through codon-anticodon interactions. The enhanced thermodynamic stability of S2U-containing RNA duplexes and the preferred S2U-A versus S2U-G base pairing are appreciated characteristics of S2U-modified molecular probes. Recently, we have demonstrated that 2-thiouridine (alone or within an RNA chain) is predominantly transformed under oxidative stress conditions to 4-pyrimidinone riboside (H2U) and not to uridine. Due to the important biological functions and various biotechnological applications for sulfur-containing nucleic acids, we compared the thermodynamic stabilities of duplexes containing desulfured products with those of 2-thiouracil-modified RNA and DNA duplexes. Differential scanning calorimetry experiments and theoretical calculations demonstrate that upon 2-thiouracil desulfuration to 4-pyrimidinone, the preferred base pairing of S2U with adenosine is lost, with preferred base pairing with guanosine observed instead. Therefore, biological processes and in vitro assays in which oxidative desulfuration of 2-thiouracil-containing components occurs may be altered. Moreover, we propose that the H2U-G base pair is a suitable model for investigation of the preferred recognition of 3'-G-ending versus A-ending codons by tRNA wobble nucleosides, which may adopt a 4-pyrimidinone-type structural motif.

  15. Developmental changes in purine phosphoribosyltransferases in human and rat tissues.

    PubMed Central

    Adams, A; Harkness, R A

    1976-01-01

    1. The hypoxanthine/guanine and adenine phosphoribosyltransferase activities in a wide variety of human tissues were studied during their growth and development from foetal life onward. A wide range of activities develop after birth, with especially high values in the central nervous system and testes. 2. Postnatal development of hypoxanthine/guanine phosphoribosyltransferase was also defined in the rat. Although there were increases in the central nervous system and testes, there was also a rise in activity in the liver, which was less marked in man. 3. A sensitive radiochemical assay method, using dTTP to inhibit 5'-nucleotidase activity, suitable for tissue extracts, was developed. 4. No definite evidence of the existence of tissue-specific isoenzymes of hypoxanthine/guanine or adenine phosphoribosyltransferase was found. Hypoxanthine/guanine phosphoribosyltransferase in testes, however, had a significantly different thermal-denaturation rate constant. 5. The findings are discussed in an attempt to relate activity of hypoxanthine/guanine phosphoribosyltransferase to biological function. Growth as well as some developmental changes appear to be related to increase in the activity of this enzyme. PMID:1016239

  16. Substrate orientation and specificity in xanthine oxidase: crystal structures of the enzyme in complex with indole-3-acetaldehyde and guanine.

    PubMed

    Cao, Hongnan; Hall, James; Hille, Russ

    2014-01-28

    Xanthine oxidase is a molybdenum-containing hydroxylase that catalyzes the hydroxylation of sp(2)-hybridized carbon centers in a variety of aromatic heterocycles as well as aldehydes. Crystal structures of the oxidase form of the bovine enzyme in complex with a poor substrate indole-3-acetaldehyde and the nonsubstrate guanine have been determined, both at a resolution of 1.6 Å. In each structure, a specific and unambiguous orientation of the substrate in the active site is observed in which the hydroxylatable site is oriented away from the active site molybdenum center. The orientation seen with indole-3-acetaldehyde has the substrate positioned with the indole ring rather than the exocyclic aldehyde nearest the molybdenum center, indicating that the substrate must rotate some 30° in the enzyme active site to permit hydroxylation of the aldehyde group (as observed experimentally), accounting for the reduced reactivity of the enzyme toward this substrate. The principal product of hydroxylation of indole-3-acetaldehyde by the bovine enzyme is confirmed to be indole-3-carboxylic acid based on its characteristic UV-vis spectrum, and the kinetics of enzyme reduction are reported. With guanine, the dominant orientation seen crystallographically has the C-8 position that might be hydroxylated pointed away from the active site molybdenum center, in a configuration resembling that seen previously with hypoxanthine (a substrate that is effectively hydroxylated at position 2). The ∼180° reorientation required to permit reaction is sterically prohibited, indicating that substrate (mis)orientation in the active site is a major factor precluding formation of the highly mutagenic 8-hydroxyguanine.

  17. A New HPLC Purine Assay for Quantifying Microbial Flow

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A HPLC method was developed to quantify the purines adenine and guanine and their metabolites xanthine and hypoxanthine in hydrolysates of isolated bacteria and omasal digesta and to assess the effect of using either purines only, or purines plus metabolites, as microbial markers for estimating micr...

  18. PRESENCE OF PURINE METABOLITES IN OMASAL DIGESTA AND BACTERIA: NEW ANALYTICAL METHOD AND EFFECTS ON MICROBIAL FLOWS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A new HPLC method was developed to determine concentrations of purines [adenine (A) and guanine (G)], and their metabolites [xanthine (X) and hypoxanthine (HX)] in omasal digesta and bacterial samples and to assess the effect of using either purines (TP) or purines plus their metabolites (PM) as mic...

  19. Dispensability of the [4Fe-4S] cluster in novel homologues of adenine glycosylase MutY.

    PubMed

    Trasviña-Arenas, Carlos H; Lopez-Castillo, Laura M; Sanchez-Sandoval, Eugenia; Brieba, Luis G

    2016-02-01

    7,8-Dihydro-8-deoxyguanine (8oG) is one of the most common oxidative lesions in DNA. DNA polymerases misincorporate an adenine across from this lesion. Thus, 8oG is a highly mutagenic lesion responsible for G:C→T:A transversions. MutY is an adenine glycosylase, part of the base excision repair pathway that removes adenines, when mispaired with 8oG or guanine. Its catalytic domain includes a [4Fe-4S] cluster motif coordinated by cysteinyl ligands. When this cluster is absent, MutY activity is depleted and several studies concluded that the [4Fe-4S] cluster motif is an indispensable component for DNA binding, substrate recognition and enzymatic activity. In the present study, we identified 46 MutY homologues that lack the canonical cysteinyl ligands, suggesting an absence of the [4Fe-4S] cluster. A phylogenetic analysis groups these novel MutYs into two different clades. One clade is exclusive of the order Lactobacillales and another clade has a mixed composition of anaerobic and microaerophilic bacteria and species from the protozoan genus Entamoeba. Structural modeling and sequence analysis suggests that the loss of the [4Fe-4S] cluster is compensated by a convergent solution in which bulky amino acids substitute the [4Fe-4S] cluster. We functionally characterized MutYs from Lactobacillus brevis and Entamoeba histolytica as representative members from each clade and found that both enzymes are active adenine glycosylases. Furthermore, chimeric glycosylases, in which the [4Fe-4S] cluster of Escherichia coli MutY is replaced by the corresponding amino acids of LbY and EhY, are also active. Our data indicates that the [4Fe-4S] cluster plays a structural role in MutYs and evidences the existence of alternative functional solutions in nature.

  20. Exploration of Excited State Deactivation Pathways of Adenine Monohydrates.

    PubMed

    Chaiwongwattana, Sermsiri; Sapunar, Marin; Ponzi, Aurora; Decleva, Piero; Došlić, Nađa

    2015-10-29

    Binding of a single water molecule has a dramatic effect on the excited state lifetime of adenine. Here we report a joint nonadiabatic dynamics and reaction paths study aimed at understanding the sub-100 fs lifetime of adenine in the monohydrates. Our nonadiabatic dynamics simulations, performed using the ADC(2) electronic structure method, show a shortening of the excited state lifetime in the monohydrates with respect to bare adenine. However, the computed lifetimes were found to be significantly longer that the observed one. By comparing the reaction pathways of several excited state deactivation processes in adenine and adenine monohydrates, we show that electron-driven proton transfer from water to nitrogen atom N3 of the adenine ring may be the process responsible for the observed ultrafast decay. The inaccessibility of the electron-driven proton transfer pathway to trajectory-based nonadiabatic dynamics simulation is discussed.

  1. Lactobacillus gasseri PA-3 Uses the Purines IMP, Inosine and Hypoxanthine and Reduces Their Absorption in Rats

    PubMed Central

    Yamada, Naruomi; Saito-Iwamoto, Chizuru; Nakamura, Marie; Soeda, Misato; Chiba, Yoshika; Kano, Hiroshi; Asami, Yukio

    2017-01-01

    Excessive intake of purine-rich foods elevates serum levels of uric acid. Animal and fish meats contain high amounts of inosine and its related purines, and the reduction of taking those purines is crucial for the improvement of serum uric acid levels. We previously showed that Lactobacillus gasseri PA-3 (PA-3) incorporates adenosine and its related purines and that oral treatment with PA-3 reduced adenosine absorption in rats. This study investigated whether PA-3 also incorporates IMP (inosine 5′-monophosphate), inosine, and hypoxanthine, and whether it reduces their absorption in rats. PA-3 was incubated in vitro with radioisotope (RI)-labeled IMP, inosine, and hypoxanthine, and the incorporation of these compounds by PA-3 was evaluated. In addition, rats were orally administered PA-3 along with RI-labeled inosine 5′-monophosphate, inosine, or hypoxanthine, and the ability of PA-3 to attenuate the absorption of these purines was determined. PA-3 incorporated all three purines and displayed greater proliferation in the presence than in the absence of these purines. Oral administration of PA-3 to rats reduced the absorption of IMP, inosine, and hypoxanthine. These results indicate that PA-3 reduces the absorption of purines contained in foods and it is expected that PA-3 contributes attenuation of the excessive intake of dietary purines. PMID:28282902

  2. Experimental observation of guanine tautomers with VUV photoionization.

    PubMed

    Zhou, Jia; Kostko, Oleg; Nicolas, Christophe; Tang, Xiaonan; Belau, Leonid; de Vries, Mattanjah S; Ahmed, Musahid

    2009-04-30

    Two methods of preparing guanine in the gas phase, thermal vaporization and laser desorption, have been investigated. The guanine generated by each method is entrained in a molecular beam, single-photon ionized with tunable VUV synchrotron radiation, and analyzed using reflectron mass spectrometry. The recorded photoionization efficiency (PIE) curves show a dramatic difference for experiments performed via thermal vaporization compared to that with laser desorption. The calculated vertical and adiabatic ionization energies for the eight lowest-lying tautomers of guanine suggest that the experimental observations arise from different tautomers being populated in the two different experimental methods.

  3. Guanine oxidation: one- and two-electron reactions.

    PubMed

    Pratviel, Geneviève; Meunier, Bernard

    2006-08-07

    Guanine bases in DNA are the most sensitive to oxidation. A lot of effort has been devoted to the understanding of the chemical modifications of guanine under different oxidizing conditions, the final goal being to know which lesions in DNA can be expected in vivo and their biological consequences. This article analyses the mechanisms underlying guanine oxidation by the comparison between one- and two-electron transfer processes. The different oxidants used in vitro give complementary answers. This overview presents a choice of some key intermediates and the predictive description of G-oxidation products that can be generated from these intermediates depending on the reaction conditions.

  4. Experimental observation of guanine tautomers with VUV photoionization

    SciTech Connect

    Zhou, Jia; Kostko, Oleg; Nicolas, Christophe; Tang, Xiaonan; Belau, Leonid; de Vries, Mattanjah S.; Ahmed, Musahid

    2008-12-01

    Two methods of preparing guanine in the gas phase, thermal vaporization and laser desorption, have been investigated. The guanine generated by each method is entrained in a molecular beam, single photon ionized with tunable VUV synchrotron radiation, and analyzed using reflectron mass spectrometry. The recorded photoionization efficiency (PIE) curves show a dramatic difference for experiments performed via thermal vaporization compared to laser desorption. The calculated vertical and adiabatic ionization energies for the eight lowest lying tautomers of guanine suggest the experimental observations arise from different tautomers being populated in the two different experimental methods.

  5. Purine metabolism in Toxoplasma gondii

    SciTech Connect

    Krug, E.C.; Marr, J.J.; Berens, R.L.

    1989-06-25

    We have studied the incorporation and interconversion of purines into nucleotides by freshly isolated Toxoplasma gondii. They did not synthesize nucleotides from formate, glycine, or serine. The purine bases hypoxanthine, xanthine, guanine, and adenine were incorporated at 9.2, 6.2, 5.1, and 4.3 pmol/10(7) cells/h, respectively. The purine nucleosides adenosine, inosine, guanosine, and xanthosine were incorporated at 110, 9.0, 2.7, and 0.3 pmol/10(7) cells/h, respectively. Guanine, xanthine, and their respective nucleosides labeled only guanine nucleotides. Inosine, hypoxanthine, and adenine labeled both adenine and guanine nucleotide pools at nearly equal ratios. Adenosine kinase was greater than 10-fold more active than the next most active enzyme in vitro. This is consistent with the metabolic data in vivo. No other nucleoside kinase or phosphotransferase activities were found. Phosphorylase activities were detected for guanosine and inosine; no other cleavage activities were detected. Deaminases were found for adenine and guanine. Phosphoribosyltransferase activities were detected for all four purine nucleobases. Interconversion occurs only in the direction of adenine to guanine nucleotides.

  6. Guanine- Formation During the Thermal Polymerization of Amino Acids

    NASA Technical Reports Server (NTRS)

    Mc Caw, B. K.; Munoz, E. F.; Ponnamperuma, C.; Young, R. S.

    1964-01-01

    The action of heat on a mixture of amino acids was studied as a possible abiological pathway for the synthesis of purines and pyrimidines. Guanine was detected. This result is significant in the context of chemical evolution.

  7. Crystal Structure of a Replicative DNA Polymerase Bound to the Oxidized Guanine Lesion Guanidinohydantoin

    SciTech Connect

    Aller, Pierre; Ye, Yu; Wallace, Susan S.; Burrows, Cynthia J.; Doubli, Sylvie

    2010-04-12

    The oxidation of guanine generates one of the most common DNA lesions, 8-oxo-7,8-dihydroguanine (8-oxoG). The further oxidation of 8-oxoG can produce either guanidinohydantoin (Gh) in duplex DNA or spiroiminodihydantoin (Sp) in nucleosides and ssDNA. Although Gh can be a strong block for replicative DNA polymerases such as RB69 DNA polymerase, this lesion is also mutagenic: DNA polymerases bypass Gh by preferentially incorporating a purine with a slight preference for adenine, which results in G {center_dot} C {yields} T {center_dot} A or G {center_dot} C {yields} C {center_dot} G transversions. The 2.15 {angstrom} crystal structure of the replicative RB69 DNA polymerase in complex with DNA containing Gh reveals that Gh is extrahelical and rotated toward the major groove. In this conformation Gh is no longer in position to serve as a templating base for the incorporation of an incoming nucleotide. This work also constitutes the first crystallographic structure of Gh, which is stabilized in the R configuration in the two polymerase/DNA complexes present in the crystal asymmetric unit. In contrast to 8-oxoG, Gh is found in a high syn conformation in the DNA duplex and therefore presents the same hydrogen bond donor and acceptor pattern as thymine, which explains the propensity of DNA polymerases to incorporate a purine opposite Gh when bypass occurs.

  8. Adenine suppresses IgE-mediated mast cell activation.

    PubMed

    Silwal, Prashanta; Shin, Keuna; Choi, Seulgi; Kang, Seong Wook; Park, Jin Bong; Lee, Hyang-Joo; Koo, Suk-Jin; Chung, Kun-Hoe; Namgung, Uk; Lim, Kyu; Heo, Jun-Young; Park, Jong Il; Park, Seung-Kiel

    2015-06-01

    Nucleobase adenine is produced by dividing human lymphoblasts mainly from polyamine synthesis and inhibits immunological functions of lymphocytes. We investigated the anti-allergic effect of adenine on IgE-mediated mast cell activation in vitro and passive cutaneous anaphylaxis (PCA) in mice. Intraperitoneal injection of adenine to IgE-sensitized mice attenuated IgE-mediated PCA reaction in a dose dependent manner, resulting in a median effective concentration of 4.21 mg/kg. In mast cell cultures, only adenine among cytosine, adenine, adenosine, ADP and ATP dose-dependently suppressed FcɛRI (a high affinity receptor for IgE)-mediated degranulation with a median inhibitory concentration of 1.6mM. It also blocked the production of LTB4, an inflammatory lipid mediator, and inflammatory cytokines TNF-α and IL-4. In addition, adenine blocked thapsigargin-induced degranulation which is FcɛRI-independent but shares FcɛRI-dependent signaling events. Adenine inhibited the phosphorylation of signaling molecules important to FcɛRI-mediated allergic reactions such as Syk, PLCγ2, Gab2, Akt, and mitogen activated protein kinases ERK and JNK. From this result, we report for the first time that adenine inhibits PCA in mice and allergic reaction by inhibiting FcɛRI-mediated signaling events in mast cells. Therefore, adenine may be useful for the treatment of mast cell-mediated allergic diseases. Also, the upregulation of adenine production may provide another mechanism for suppressing mast cell activity especially at inflammatory sites.

  9. Radiation and thermal stabilities of adenine nucleotides.

    PubMed

    Demidov, V V; Potaman, V N; Solyanina, I P; Trofimov, V I

    1995-03-01

    We have investigated in detail radiation and thermal stabilities and transformations of adenosine mono- and triphosphates in liquid and frozen solid aqueous solutions within a wide range of absorbed radiation dose (up to 75 kGy) and temperature (up to 160 degrees C). Dephosphorylation is the main pathway of high temperature hydrolysis of adenine nucleotides. Basic thermodynamic and kinetic parameters of this process have been determined. Radiolysis of investigated compounds at room temperature results in scission of N-glycosidic bond with a radiation yield about of 1 mol/100 eV. Solution freezing significantly enhances radiation stability of nucleotides as well as other biomolecules. This circumstance is essential in the discussion of panspermia concepts.

  10. Studies on guanine deaminase and its inhibitors in rat tissue

    PubMed Central

    Kumar, S.; Josan, V.; Sanger, K. C. S.; Tewari, K. K.; Krishnan, P. S.

    1967-01-01

    1. In kidney, but not in rat whole brain and liver, guanine-deaminase activity was localized almost exclusively in the 15000g supernatant fraction of iso-osmotic sucrose homogenates. However, as in brain and liver, the enzymic activity recovered in the supernatant was higher than that in the whole homogenate. The particulate fractions of kidney, especially the heavy mitochondria, brought about powerful inhibition of the supernatant guanine-deaminase activity. 2. In spleen, as in kidney, guanine-deaminase activity was localized in the 15000g supernatant fraction of iso-osmotic sucrose homogenates. However, the particulate fractions did not inhibit the activity of the supernatant. 3. Guanine-deaminase activity in rat brain was absent from the cerebellum and present only in the cerebral hemispheres. The inhibitor of guanine deaminase was located exclusively in the cerebellum, where it was associated with the particles sedimenting at 5000g from sucrose homogenates. 4. Homogenates of cerebral hemispheres, the separated cortex or the remaining portion of the hemispheres had significantly higher guanine-deaminase activity than homogenates of whole brain. The enzymic activity of the subcellular particulate fractions was nearly the same. 5. Guanine deaminase was purified from the 15000g supernatant of sucrose homogenates of whole brain. The enzyme separated as two distinct fractions, A and B, on DEAE-cellulose columns. 6. The guanine-deaminase activity of the light-mitochondrial fraction of whole brain was fully exposed and solubilized by treatment with Triton X-100, and partially purified. 7. Tested in the form of crude preparations, the inhibitor from kidney did not act on the brain and liver supernatant enzymes and the inhibitor from cerebellum did not act on kidney enzyme, but the inhibitor from liver acted on both brain and kidney enzyme. 8. The inhibitor of guanine deaminase was purified from the heavy mitochondria of whole brain and liver and the 5000g residue of

  11. Design and synthesis of novel, potent and selective hypoxanthine analogs as adenosine A1 receptor antagonists and their biological evaluation.

    PubMed

    Koul, Summon; Ramdas, Vidya; Barawkar, Dinesh A; Waman, Yogesh B; Prasad, Neela; Madadi, Santosh Kumar; Shejul, Yogesh D; Bonagiri, Rajesh; Basu, Sujay; Menon, Suraj; Reddy, Srinivasa B; Chaturvedi, Sandhya; Chennamaneni, Srinivas Rao; Bedse, Gaurav; Thakare, Rhishikesh; Gundu, Jayasagar; Chaudhary, Sumit; De, Siddhartha; Meru, Ashwinkumar V; Palle, Venkata; Chugh, Anita; Mookhtiar, Kasim A

    2017-03-15

    Multipronged approach was used to synthesize a library of diverse C-8 cyclopentyl hypoxanthine analogs from a common intermediate III. Several potent and selective compounds were identified and evaluated for pharmacokinetic (PK) properties in Wistar rats. One of the compounds 14 with acceptable PK parameters was selected for testing in in vivo primary acute diuresis model. The compound demonstrated significant diuretic activity in this model.

  12. Substrate Orientation and Catalytic Specificity in the Action of Xanthine Oxidase: The Sequential Hydroxylation of Hypoxanthine to Uric Acid

    SciTech Connect

    Cao, Hongnan; Pauff, James M.; Hille, Russ

    2010-11-29

    Xanthine oxidase is a molybdenum-containing enzyme catalyzing the hydroxylation of a sp{sup 2}-hybridized carbon in a broad range of aromatic heterocycles and aldehydes. Crystal structures of the bovine enzyme in complex with the physiological substrate hypoxanthine at 1.8 {angstrom} resolution and the chemotherapeutic agent 6-mercaptopurine at 2.6 {angstrom} resolution have been determined, showing in each case two alternate orientations of substrate in the two active sites of the crystallographic asymmetric unit. One orientation is such that it is expected to yield hydroxylation at C-2 of substrate, yielding xanthine. The other suggests hydroxylation at C-8 to give 6,8-dihydroxypurine, a putative product not previously thought to be generated by the enzyme. Kinetic experiments demonstrate that >98% of hypoxanthine is hydroxylated at C-2 rather than C-8, indicating that the second crystallographically observed orientation is significantly less catalytically effective than the former. Theoretical calculations suggest that enzyme selectivity for the C-2 over C-8 of hypoxanthine is largely due to differences in the intrinsic reactivity of the two sites. For the orientation of hypoxanthine with C-2 proximal to the molybdenum center, the disposition of substrate in the active site is such that Arg880 and Glu802, previous shown to be catalytically important for the conversion of xanthine to uric acid, play similar roles in hydroxylation at C-2 as at C-8. Contrary to the literature, we find that 6,8-dihydroxypurine is effectively converted to uric acid by xanthine oxidase.

  13. Development of a Novel High-Density [3H]Hypoxanthine Scintillation Proximity Assay To Assess Plasmodium falciparum Growth

    PubMed Central

    Caballero, Iván; Colmenarejo, Gonzalo; Sanz, Laura M.; Álvarez-Ruiz, Emilio; Gamo, Francisco-Javier; Cid, Concepción

    2016-01-01

    The discovery and development of new antimalarial drugs are becoming imperative because of the spread of resistance to current clinical treatments. The lack of robustly validated antimalarial targets and the difficulties with the building in of whole-cell activity in screening hits are hampering target-based approaches. However, phenotypic screens of structurally diverse molecule libraries are offering new opportunities for the identification of novel antimalarials. Several methodologies can be used to determine the whole-cell in vitro potencies of antimalarial hits. The [3H]hypoxanthine incorporation assay is considered the “gold standard” assay for measurement of the activity of antimalarial compounds against intraerythrocytic forms of Plasmodium falciparum. However, the method has important limitations, as the assay is not amenable for high-throughput screening since it remains associated with the 96-well plate format. We have overcome this drawback by adapting the [3H]hypoxanthine incorporation method to a 384-well high-density format by coupling a homogeneous scintillation proximity assay (SPA) and thus eliminating the limiting filtration step. This SPA has been validated using a diverse set of 1,000 molecules, including both a representative set from the Tres Cantos Antimalarial Set (TCAMS) of compounds and molecules inactive against whole cells. The results were compared with those from the P. falciparum lactate dehydrogenase whole-cell assay, another method that is well established as a surrogate for parasite growth and is amenable for high-throughput screening. The results obtained demonstrate that the SPA-based [3H]hypoxanthine incorporation assay is a suitable design that is adaptable to high-throughput antimalarial drug screening and that maintains the features, robustness, and reliability of the standard filtration hypoxanthine incorporation method. PMID:27458216

  14. Adenine oxidation by pyrite-generated hydroxyl radicals.

    PubMed

    Cohn, Corey A; Fisher, Shawn C; Brownawell, Bruce J; Schoonen, Martin Aa

    2010-04-26

    Cellular exposure to particulate matter with concomitant formation of reactive oxygen species (ROS) and oxidization of biomolecules may lead to negative health outcomes. Evaluating the particle-induced formation of ROS and the oxidation products from reaction of ROS with biomolecules is useful for gaining a mechanistic understanding of particle-induced oxidative stress. Aqueous suspensions of pyrite particles have been shown to form hydroxyl radicals and degrade nucleic acids. Reactions between pyrite-induced hydroxyl radicals and nucleic acid bases, however, remain to be determined. Here, we compared the oxidation of adenine by Fenton-generated (i.e., ferrous iron and hydrogen peroxide) hydroxyl radicals to adenine oxidation by hydroxyl radicals generated in pyrite aqueous suspensions. Results show that adenine oxidizes in the presence of pyrite (without the addition of hydrogen peroxide) and that the rate of oxidation is dependent on the pyrite loading. Adenine oxidation was prevented by addition of either catalase or ethanol to the pyrite/adenine suspensions, which implies that hydrogen peroxide and hydroxyl radicals are causing the adenine oxidation. The adenine oxidation products, 8-oxoadenine and 2-hydroxyadenine, were the same whether hydroxyl radicals were generated by Fenton or pyrite-initiated reactions. Although nucleic acid bases are unlikely to be directly exposed to pyrite particles, the formation of ROS in the vicinity of cells may lead to oxidative stress.

  15. Determination of Xanthine in the Presence of Hypoxanthine by Adsorptive Stripping Voltammetry at the Mercury Film Electrode

    PubMed Central

    Farias, Percio Augusto Mardini; Castro, Arnaldo Aguiar

    2014-01-01

    A stripping method for the determination of xanthine in the presence of hypoxanthine at the submicromolar concentration levels is described. The method is based on controlled adsorptive accumulation at the thin-film mercury electrode followed by a fast linear scan voltammetric measurement of the surface species. Optimum experimental conditions were found to be the use of 1.0 × 10−3 mol L−1 NaOH solution as supporting electrolyte, an accumulation potential of 0.00 V for xanthine and −0.50 V for hypoxanthine–copper, and a linear scan rate of 200 mV second−1. The response of xanthine is linear over the concentration ranges of 20–140 ppb. For an accumulation time of 30 minutes, the detection limit was found to be 36 ppt (2.3 × 10−10 mol L−1). Adequate conditions for measuring the xanthine in the presence of hypoxanthine, copper and other metals, uric acid, and other nitrogenated bases were also investigated. The utility of the method is demonstrated by the presence of xanthine associated with hypoxanthine, uric acid, nitrogenated bases, ATP, and ssDNA. PMID:24940040

  16. Graphene-titanium dioxide nanocomposite based hypoxanthine sensor for assessment of meat freshness.

    PubMed

    Albelda, Jasmine A V; Uzunoglu, Aytekin; Santos, Gil Nonato C; Stanciu, Lia A

    2017-03-15

    We report on the fabrication of a graphene/titanium dioxide nanocomposite (TiO2-G) and its use as an effective electrode material in an amperometric hypoxanthine (Hx) sensor for meat freshness evaluation. The nanocomposite was characterized by TEM, XRD, FTIR, XPS, TGA, BET, and CV using the redox couples [Fe(CN)6](-3/-4) and [Ru(NH3)6](+3/+2) respectively. The TiO2/G nanocomposite offered a favorable microenvironment for direct electrochemistry of xanthine oxidase (XOD). The fabricated Nafion/XOD/TiO2-G/GCE sensor exhibited excellent electro catalytic activity towards Hx with linear range of 20μM to 512μM, limit of detection of 9.5μM, and sensitivity of 4.1nA/μM. In addition, the biosensor also demonstrated strong anti-interference properties in the presence of uric acid (UA), ascorbic acid (AA) and glucose. Minimal interference of xanthine (Xn) was observed at ~7%. Moreover, the biosensor showed good repeatability (4.3% RSD) and reproducibility (3.8% RSD). The reported biosensor was tested towards the detection of Hx in pork tenderloins stored at room temperature for seven days. There was a good correlation (r=0.9795) between biosensor response and measurements obtained by a standard enzymatic colorimetric method. The TiO2-G nanocomposite is therefore an effective electrode material to be used in electrochemical biosensors to assess the freshness of meat.

  17. A 2-iminohydantoin from the oxidation of guanine.

    PubMed

    Ye, Wenjie; Sangaiah, R; Degen, Diana E; Gold, Avram; Jayaraj, K; Koshlap, Karl M; Boysen, Gunnar; Williams, Jason; Tomer, Kenneth B; Ball, Louise M

    2006-04-01

    The nucleobase guanine was oxidized with dimethyldioxirane (DMDO) to explore the role of epoxidizing agents in oxidative DNA damage. Treatment of guanine with 10% molar excess DMDO in aqueous solution at 0 degrees C and pH 7.5 followed by workup under mild conditions gave 5-carboxamido-5-formamido-2-iminohydantoin (1) as the sole isolable product in 71% yield. The structure of 1 was established on the basis of mass spectrometry and NMR studies on 1 and its isotopomers generated by the oxidation of [4-(13)C] and [7-(15)N]guanine, which yield [5-(13)C]1 and [7-(15)N]1. The distribution of 13C and 15N labels in the isotopomeric products supports initial epoxidation of the C4-C5 bond of guanine followed by a 1,2-acyl migration of guanine C6. Compound 1 is suggested as a possible primary DNA lesion from putative epoxidizing agents, including hydroperoxides present during biological processes such as lipid peroxidation.

  18. Nicotinamide adenine dinucleotide biosynthesis promotes liver regeneration.

    PubMed

    Mukherjee, Sarmistha; Chellappa, Karthikeyani; Moffitt, Andrea; Ndungu, Joan; Dellinger, Ryan W; Davis, James G; Agarwal, Beamon; Baur, Joseph A

    2017-02-01

    The regenerative capacity of the liver is essential for recovery from surgical resection or injuries induced by trauma or toxins. During liver regeneration, the concentration of nicotinamide adenine dinucleotide (NAD) falls, at least in part due to metabolic competition for precursors. To test whether NAD availability restricts the rate of liver regeneration, we supplied nicotinamide riboside (NR), an NAD precursor, in the drinking water of mice subjected to partial hepatectomy. NR increased DNA synthesis, mitotic index, and mass restoration in the regenerating livers. Intriguingly, NR also ameliorated the steatosis that normally accompanies liver regeneration. To distinguish the role of hepatocyte NAD levels from any systemic effects of NR, we generated mice overexpressing nicotinamide phosphoribosyltransferase, a rate-limiting enzyme for NAD synthesis, specifically in the liver. Nicotinamide phosphoribosyltransferase overexpressing mice were mildly hyperglycemic at baseline and, similar to mice treated with NR, exhibited enhanced liver regeneration and reduced steatosis following partial hepatectomy. Conversely, mice lacking nicotinamide phosphoribosyltransferase in hepatocytes exhibited impaired regenerative capacity that was completely rescued by administering NR.

  19. Adenine adlayers on Cu(111): XPS and NEXAFS study.

    PubMed

    Tsud, Nataliya; Bercha, Sofiia; Ševčíková, Klára; Acres, Robert G; Prince, Kevin C; Matolín, Vladimír

    2015-11-07

    The adsorption of adenine on Cu(111) was studied by photoelectron and near edge x-ray absorption fine structure spectroscopy. Disordered molecular films were deposited by means of physical vapor deposition on the substrate at room temperature. Adenine chemisorbs on the Cu(111) surface with strong rehybridization of the molecular orbitals and the Cu 3d states. Annealing at 150 °C caused the desorption of weakly bonded molecules accompanied by formation of a short-range ordered molecular adlayer. The interface is characterized by the formation of new states in the valence band at 1.5, 7, and 9 eV. The present work complements and refines existing knowledge of adenine interaction with this surface. The coverage is not the main parameter that defines the adenine geometry and adsorption properties on Cu(111). Excess thermal energy can further rearrange the molecular adlayer and, independent of the initial coverage, the flat lying stable molecular adlayer is formed.

  20. Adenine adlayers on Cu(111): XPS and NEXAFS study

    SciTech Connect

    Tsud, Nataliya; Bercha, Sofiia; Ševčíková, Klára; Matolín, Vladimír; Acres, Robert G.; Prince, Kevin C.

    2015-11-07

    The adsorption of adenine on Cu(111) was studied by photoelectron and near edge x-ray absorption fine structure spectroscopy. Disordered molecular films were deposited by means of physical vapor deposition on the substrate at room temperature. Adenine chemisorbs on the Cu(111) surface with strong rehybridization of the molecular orbitals and the Cu 3d states. Annealing at 150 °C caused the desorption of weakly bonded molecules accompanied by formation of a short-range ordered molecular adlayer. The interface is characterized by the formation of new states in the valence band at 1.5, 7, and 9 eV. The present work complements and refines existing knowledge of adenine interaction with this surface. The coverage is not the main parameter that defines the adenine geometry and adsorption properties on Cu(111). Excess thermal energy can further rearrange the molecular adlayer and, independent of the initial coverage, the flat lying stable molecular adlayer is formed.

  1. Intermolecular band dispersion in quasi-one-dimensional adenine assemblies.

    PubMed

    Wang, Ying; Fleurence, Antoine; Yamada-Takamura, Yukiko; Friedlein, Rainer

    2011-12-07

    Highly-ordered, hydrated adenine multilayer films grown on the surface of highly-oriented pyrolytic graphite, HOPG(0001), display extended electronic states, affording anisotropic band-like charge transport along the π-π stacking direction.

  2. A three-state model for the photophysics of adenine.

    PubMed

    Serrano-Andrés, Luis; Merchán, Manuela; Borin, Antonio Carlos

    2006-08-25

    An ab initio theoretical study at the CASPT2 level is reported on minimum energy reaction paths, state minima, transition states, reaction barriers, and conical intersections on the potential energy hypersurfaces of two tautomers of adenine: 9H- and 7H-adenine. The obtained results led to a complete interpretation of the photophysics of adenine and derivatives, both under jet-cooled conditions and in solution, within a three-state model. The ultrafast subpicosecond fluorescence decay measured in adenine is attributed to the low-lying conical intersection (gs/pipi* La)(CI), reached from the initially populated 1(pipi* La) state along a path which is found to be barrierless only in 9H-adenine, while for the 7H tautomer the presence of an intermediate plateau corresponding to an NH2-twisted conformation may explain the absence of ultrafast decay in 7-substituted compounds. A secondary picosecond decay is assigned to a path involving switches towards two other states, 1(pipi* Lb) and 1(npi*), ultimately leading to another conical intersection with the ground state, (gs/npi*), with a perpendicular disposition of the amino group. The topology of the hypersurfaces and the state properties explain the absence of secondary decay in 9-substituted adenines in water in terms of the higher position of the 1(npi*) state and also that the 1(pipi* Lb) state of 7H-adenine is responsible for the observed fluorescence in water. A detailed discussion comparing recent experimental and theoretical findings is given. As for other nucleobases, the predominant role of a pipi*-type state in the ultrafast deactivation of adenine is confirmed.

  3. Characterization of in vivo somatic mutations at the hypoxanthine phosphoribosyltransferase gene of a human control population.

    PubMed Central

    Burkhart-Schultz, K; Thomas, C B; Thompson, C L; Strout, C L; Brinson, E; Jones, I M

    1993-01-01

    The ability to recognize a change in mutation spectrum after an exposure to a toxic substance and then relate that exposure to health risk depends on the knowledge of mutations that occur in the absence of exposure. Toward this end, we have been studying both the frequency and molecular nature of mutations of the hypoxanthine phosphoribosyltransferase (hprt) gene in peripheral blood lymphocytes as surrogate reporters of genetic damage. We have analyzed mutants, one per donor to ensure independence, from a control population in which the quantitative effects of smoking and age on mutant frequency have been well defined. Analyses of cDNA and genomic DNA by polymerase chain reaction and sequencing have identified the mutations in 63 mutants, 45 from males and 18 from females, of which 34 were smokers and 29 were nonsmokers. Slightly less than half of the mutations were base substitutions; they were predominantly at GC base pairs. Different mutations at the same site indicated that there are features of the hprt polypeptide that affect the mutation spectrum. Two pairs of identical mutations indicated that there may also be hot spots. Mutations not previously reported have been detected, indicating that the mutation spectrum is only partly defined. The remainder of the mutations were deletions or insertions/duplications; deletions ranged from one base pair to complete loss of the locus. Despite a small average increase in mutant frequency for smokers, an increased proportion of base substitutions at AT base pairs in smokers (p = 0.2) hinted at a smoking-associated shift in the mutation spectrum.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8513767

  4. The Shizosaccharomyces pombe homolog (SpMYH) of the Escherichia coli MutY is required for removal of guanine from 8-oxoguanine/guanine mispairs to prevent G:C to C:G transversions.

    PubMed

    Doi, Takashi; Yonekura, Shin-Ichiro; Tano, Keizo; Yasuhira, Shinji; Yonei, Shuji; Zhang, Qiu-Mei

    2005-06-01

    The frequency of G:C-->C:G transversions significantly increases upon exposure of cells to ionizing radiation or reactive oxygen species. Transversions can be prevented by base excision repair, which removes the causative modified bases from DNA. Our previous studies revealed that MutY is responsible for removing guanine from 7,8-dihydro-8-oxoguanine/guanine mispairs (8-oxoG/G) and prevents the generation of G:C-->C:G transversions in E. coli. SpMYH, a homolog of E. coli MutY, had been identified and characterized in the fission yeast S. pombe. Purified SpMYH has adenine DNA glycosylase activity on A/8-oxoG and A/G mismatch-containing oligonucleotides. In this study, we examined whether SpMYH has a similar activity allowing it to remove G from 8-oxoG/G in DNA. The purified SpMYH tightly bound to duplex oligonucleotides containing 8-oxoG/G and removed the unmodified G from 8-oxoG/G as efficiently as A from 8-oxoG/A. The activity was absent in the cell extract prepared from an SpMYH-knockout strain of S. pombe. The expression of SpMYH markedly reduced the frequency of spontaneous G:C-->C:G transversions in the E. coli mutY mutant. These results demonstrate that SpMYH is involved in the repair of 8-oxoG/G, by which it prevents mutations induced by oxidative stress in S. pombe.

  5. Global deformation facilitates flipping of damaged 8-oxo-guanine and guanine in DNA

    PubMed Central

    La Rosa, Giuseppe; Zacharias, Martin

    2016-01-01

    Oxidation of guanine (Gua) to form 7,8-dihydro-8-oxoguanine (8oxoG) is a frequent mutagenic DNA lesion. DNA repair glycosylases such as the bacterial MutM can effciently recognize and eliminate the 8oxoG damage by base excision. The base excision requires a 8oxoG looping out (flipping) from an intrahelical base paired to an extrahelical state where the damaged base is in the enzyme active site. It is still unclear how the damage is identified and flipped from an energetically stable stacked and paired state without any external energy source. Free energy simulations have been employed to study the flipping process for globally deformed DNA conformational states. DNA deformations were generated by systematically untwisting the DNA to mimic its conformation in repair enzyme encounter complex. The simulations indicate that global DNA untwisting deformation toward the enzyme bound form alone (without protein) significantly reduces the penalty for damage flipping to about half of the penalty observed in regular DNA. The finding offers a mechanistic explanation how binding free energy that is transformed to binding induced DNA deformation facilitates flipping and helps to rapidly detect a damaged base. It is likely of general relevance since repair enzyme binding frequently results in significant deformation of the target DNA. PMID:27651459

  6. Progress and recent advances in fabrication and utilization of hypoxanthine biosensors for meat and fish quality assessment: a review.

    PubMed

    Lawal, Abdulazeez T; Adeloju, Samuel B

    2012-10-15

    This review provides an update on the research conducted on the fabrication and utilization of hypoxanthine (Hx) biosensors published over the past four decades. In particular, the review focuses on progress made in the development and use of Hx biosensors for the assessment of fish and meat quality which has dominated research in this area. The various fish and meat freshness indexes that have been proposed over this period are highlighted. Furthermore, recent developments and future advances in the use of screen-printed electrodes and nanomaterials for achieving improved performances for the reliable determination of Hx in fish and meat are discussed.

  7. Elimination and utilization of oxidized guanine nucleotides in the synthesis of RNA and its precursors.

    PubMed

    Sekiguchi, Takeshi; Ito, Riyoko; Hayakawa, Hiroshi; Sekiguchi, Mutsuo

    2013-03-22

    Reactive oxygen species are produced as side products of oxygen utilization and can lead to the oxidation of nucleic acids and their precursor nucleotides. Among the various oxidized bases, 8-oxo-7,8-dihydroguanine seems to be the most critical during the transfer of genetic information because it can pair with both cytosine and adenine. During the de novo synthesis of guanine nucleotides, GMP is formed first, and it is converted to GDP by guanylate kinase. This enzyme hardly acts on an oxidized form of GMP (8-oxo-GMP) formed by the oxidation of GMP or by the cleavage of 8-oxo-GDP and 8-oxo-GTP by MutT protein. Although the formation of 8-oxo-GDP from 8-oxo-GMP is thus prevented, 8-oxo-GDP itself may be produced by the oxidation of GDP by reactive oxygen species. The 8-oxo-GDP thus formed can be converted to 8-oxo-GTP because nucleoside-diphosphate kinase and adenylate kinase, both of which catalyze the conversion of GDP to GTP, do not discriminate 8-oxo-GDP from normal GDP. The 8-oxo-GTP produced in this way and by the oxidation of GTP can be used for RNA synthesis. This misincorporation is prevented by MutT protein, which has the potential to cleave 8-oxo-GTP as well as 8-oxo-GDP to 8-oxo-GMP. When (14)C-labeled 8-oxo-GTP was applied to CaCl2-permeabilized cells of a mutT(-) mutant strain, it could be incorporated into RNA at 4% of the rate for GTP. Escherichia coli cells appear to possess mechanisms to prevent misincorporation of 8-oxo-7,8-dihydroguanine into RNA.

  8. Kidney Disease in Adenine Phosphoribosyltransferase Deficiency

    PubMed Central

    Runolfsdottir, Hrafnhildur Linnet; Palsson, Runolfur; Sch. Agustsdottir, Inger M.; Indridason, Olafur S.; Edvardsson, Vidar O.

    2015-01-01

    Background Adenine phosphoribosyltransferase (APRT) deficiency is a purine metabolism disorder causing kidney stones and chronic kidney disease (CKD). The course of nephrolithiasis and CKD has not been well characterized. The objective of this study was to examine long-term kidney outcomes in patients with APRT deficiency. Study Design An observational cohort study. Setting & Participants All patients enrolled in the APRT Deficiency Registry of the Rare Kidney Stone Consortium. Outcomes Kidney stones, acute kidney injury (AKI), stage of CKD and kidney failure, estimated glomerular filtration rate (eGFR) and changes in eGFR. Measurements Serum creatinine and eGFR calculated using creatinine-based equations. Results Of 53 patients, 30 (57%) were female and median age at diagnosis was 37.0 (range, 0.6–67.9) years. The median duration of follow-up was 10.3 (range, 0.0–31.5) years. At diagnosis, kidney stones had developed in 29 patients (55%) and 20 (38%) had CKD stages 3–5, including 11 patients (21%) with stage 5. At latest follow-up, 33 patients (62%) had had kidney stones; 18 (34%), AKI; and 22 (42%), CKD stage 3–5. Of the 14 (26%) patients with CKD stage 5, 12 had initiated renal replacement therapy. Kidney stones recurred in 18 of 33 patients (55%). The median eGFR slope was −0.38 (range, −21.99 to 1.42) mL/min/1.73 m2 per year in patients receiving treatment with xanthine dehydrogenase inhibitor and −5.74 (range, −75.8 to −0.10) mL/min/1.73 m2 per year in those not treated prior to the development of stage 5 CKD (p=0.001). Limitations Use of observational registry data. Conclusions Progressive CKD and AKI episodes are major features of APRT deficiency, while nephrolithiasis is the most common presentation. Advanced CKD without history of kidney stones is more prevalent than previously reported. Our data suggest that timely therapy may retard CKD progression. PMID:26724837

  9. The use of primary rat hepatocytes to achieve metabolic activation of promutagens in the Chinese hamster ovary/hypoxantine-guanine phosphoribosyl transferase mutational assay

    SciTech Connect

    Bermudez, E.; Couch, D.B.; Tillery, D.

    1982-01-01

    A method is described in which primary rat hepatocytes have been cocultured with chinese hamster ovary (CHO) cells to provide metabolic activation of promutgens in the Chinese hamster ovary/hypoxanthine-guanine phosphoribosyl transferase (CHO/HGPRT) mutational assay. Single cell hepatocyte suspensions were prepared from male Fisher-344 rats using the in situ collagenase perfusion technique. Hepatocytes were allowed to attach for 1.5 hours in tissue culture dishes containing an approximately equal number of CHO cells in log growth. The cocultures were exposed to promutagens for up to 20 hours in serum-free medium. The survival and 6-thioguanine-resistant fraction of treated CHO cells were then determined as in the standard CHO/HGPRT assay. Aflatoxin B/sub 1/ (AFB/sub 1/) 7,12-dimethylbenz(a)anthracene (DMBA) and benzo(a)pyrene (B(a)P) were found to produce increases in the mutant fractions of treated CHO cells as a function of concentration. The time required for optimum expression of the mutant phenotype following exposure to DMBA and AFB/sub 1/ was approximately 8 days. Primary cell-mediated mutagenesis may be useful in elucidating methobolic pathways important in the production and detoxification of genotoxic products in vivo.

  10. [Study of some pharmacological properties of a new adenine derivative].

    PubMed

    Iasnetsov; Ozerov, A A; Motin, V G; Iasnetsov, Vik V; Karsanova, S K; Ivanov, Iu V; Chel'naia, N A

    2014-01-01

    It is established that the new compound, 9-[2-(4-isopropylphenoxy)ethyl]adenine (9-IPE-adenine) in a dose of 10 mg/kg per day produces neuroprotective effect in rats with brain ischemia model. 9-IPE-adenine decreased the neurologic deficiency 1.2 times more effectively (p < 0.05) than the reference drug mexidol in analogous dose, and had equal effect with this drug at 25 mg/kg per day on the neurologic deficiency and survival of animals. Electrophysiological studies in hippocampal slices in rats showed that 9-IPE-adenine depressed orthodromic population spikes in CA1 area by 42 ± 4%. Non-competitive antagonist of NMDA receptor complex MK-801, in contrast to D-AP5 (competitive NMDA receptor antagonist) and CNQX (competitive AMPA receptor antagonist), enhanced the depressive effect of the new drug more than two times. These ese results are indicative of the ability of 9-IPE-adenine to modulate the ion channel of NMDA receptor complex.

  11. DNA adenine hypomethylation leads to metabolic rewiring in Deinococcus radiodurans.

    PubMed

    Shaiwale, Nayana S; Basu, Bhakti; Deobagkar, Deepti D; Deobagkar, Dileep N; Apte, Shree K

    2015-08-03

    The protein encoded by DR_0643 gene from Deinococcus radiodurans was shown to be an active N-6 adenine-specific DNA methyltransferase (Dam). Deletion of corresponding protein reduced adenine methylation in the genome by 60% and resulted in slow-growth phenotype. Proteomic changes induced by DNA adenine hypomethylation were mapped by two-dimensional protein electrophoresis coupled with mass spectrometry. As compared to wild type D. radiodurans cells, at least 54 proteins were differentially expressed in Δdam mutant. Among these, 39 metabolic enzymes were differentially expressed in Δdam mutant. The most prominent change was DNA adenine hypomethylation induced de-repression of pyruvate dehydrogenase complex, E1 component (aceE) gene resulting in 10 fold increase in the abundance of corresponding protein. The observed differential expression profile of metabolic enzymes included increased abundance of enzymes involved in fatty acid and amino acid degradation to replenish acetyl Co-A and TCA cycle intermediates and diversion of phosphoenolpyruvate and pyruvate into amino acid biosynthesis, a metabolic rewiring attempt by Δdam mutant to restore energy generation via glycolysis-TCA cycle axis. This is the first report of DNA adenine hypomethylation mediated rewiring of metabolic pathways in prokaryotes.

  12. Theoretical study on absorption and emission spectra of adenine analogues.

    PubMed

    Liu, Hongxia; Song, Qixia; Yang, Yan; Li, Yan; Wang, Haijun

    2014-04-01

    Fluorescent nucleoside analogues have attracted much attention in studying the structure and dynamics of nucleic acids in recent years. In the present work, we use theoretical calculations to investigate the structural and optical properties of four adenine analogues (termed as A1, A2, A3, and A4), and also consider the effects of aqueous solution and base pairing. The results show that the fluorescent adenine analogues can pair with thymine to form stable H-bonded WC base pairs. The excited geometries of both adenine analogues and WC base pairs are similar to the ground geometries. The absorption and emission maxima of adenine analogues are greatly red shifted compared with nature adenine, the oscillator strengths of A1 and A2 are stronger than A3 and A4 in both absorption and emission spectra. The calculated low-energy peaks in the absorption spectra are in good agreement with the experimental data. In general, the aqueous solution and base pairing can slightly red-shift both the absorption and emission maxima, and can increase the oscillator strengths of absorption spectra, but significantly decrease the oscillator strengths of A3 in emission spectra.

  13. Cerulenin-mediated apoptosis is involved in adenine metabolic pathway

    SciTech Connect

    Chung, Kyung-Sook; Sun, Nam-Kyu; Lee, Seung-Hee; Lee, Hyun-Jee; Choi, Shin-Jung; Kim, Sun-Kyung; Song, Ju-Hyun; Jang, Young-Joo; Song, Kyung-Bin; Yoo, Hyang-Sook; Simon, Julian . E-mail: jsimon@fhcrc.org; Won, Misun . E-mail: misun@kribb.re.kr

    2006-10-27

    Cerulenin, a fatty acid synthase (FAS) inhibitor, induces apoptosis of variety of tumor cells. To elucidate mode of action by cerulenin, we employed the proteomics approach using Schizosaccharomyces pombe. The differential protein expression profile of S. pombe revealed that cerulenin modulated the expressions of proteins involved in stresses and metabolism, including both ade10 and adk1 proteins. The nutrient supplementation assay demonstrated that cerulenin affected enzymatic steps transferring a phosphoribosyl group. This result suggests that cerulenin accumulates AMP and p-ribosyl-s-amino-imidazole carboxamide (AICAR) and reduces other necessary nucleotides, which induces feedback inhibition of enzymes and the transcriptional regulation of related genes in de novo and salvage adenine metabolic pathway. Furthermore, the deregulation of adenine nucleotide synthesis may interfere ribonucleotide reductase and cause defects in cell cycle progression and chromosome segregation. In conclusion, cerulenin induces apoptosis through deregulation of adenine nucleotide biosynthesis resulting in nuclear division defects in S. pombe.

  14. Adenine and 2-aminopurine: paradigms of modern theoretical photochemistry.

    PubMed

    Serrano-Andrés, Luis; Merchán, Manuela; Borin, Antonio C

    2006-06-06

    Distinct photophysical behavior of nucleobase adenine and its constitutional isomer, 2-aminopurine, has been studied by using quantum chemical methods, in particular an accurate ab initio multiconfigurational second-order perturbation theory. After light irradiation, the efficient, ultrafast energy dissipation observed for nonfluorescent 9H-adenine is explained here by the nonradiative internal conversion process taking place along a barrierless reaction path from the initially populated 1(pipi* La) excited state toward a low-lying conical intersection (CI) connected with the ground state. In contrast, the strong fluorescence recorded for 2-aminopurine at 4.0 eV with large decay lifetime is interpreted by the presence of a minimum in the 1(pipi* La) hypersurface lying below the lowest CI and the subsequent potential energy barrier required to reach the funnel to the ground state. Secondary deactivation channels were found in the two systems related to additional CIs involving the 1(pipi* Lb) and 1(npi*) states. Although in 9H-adenine a population switch between both states is proposed, in 7H-adenine this may be perturbed by a relatively larger barrier to access the 1(npi*) state, and, therefore, the 1(pipi* Lb) state becomes responsible for the weak fluorescence measured in aqueous adenine at approximately 4.5 eV. In contrast to previous models that explained fluorescence quenching in adenine, unlike in 2-aminopurine, on the basis of the vibronic coupling of the nearby 1(pipi*) and 1(npi*) states, the present results indicate that the 1(npi*) state does not contribute to the leading photophysical event and establish the prevalence of a model based on the CI concept in modern photochemistry.

  15. Selective inhibitory effect of (S)-9-(3-hydroxy-2-phosphonylmethoxypropyl)adenine and 2'-nor-cyclic GMP on adenovirus replication in vitro.

    PubMed

    Baba, M; Mori, S; Shigeta, S; De Clercq, E

    1987-02-01

    The inhibitory effects of 20 selected antiviral compounds on the replication of adenoviruses (types 1 to 8) in vitro were investigated. While 18 compounds were ineffective, 2 compounds, namely (S)-9-(3-hydroxy-2-phosphonylmethoxypropyl)adenine [(S)-HPMPA] and 9-[(2-hydroxy-1,3,2-dioxaphosphorinan-5-yl)oxymethyl]guanine P-oxide (2'-nor-cyclic GMP), were highly effective against all adenovirus types assayed in human embryonic fibroblast cultures. Their 50% inhibitory doses were 1.1 microgram/ml for (S)-HPMPA and 4.1 micrograms/ml for 2'-nor-cyclic GMP. They were nontoxic for the host cells at the effective antiviral doses.

  16. Selective inhibitory effect of (S)-9-(3-hydroxy-2-phosphonylmethoxypropyl)adenine and 2'-nor-cyclic GMP on adenovirus replication in vitro.

    PubMed Central

    Baba, M; Mori, S; Shigeta, S; De Clercq, E

    1987-01-01

    The inhibitory effects of 20 selected antiviral compounds on the replication of adenoviruses (types 1 to 8) in vitro were investigated. While 18 compounds were ineffective, 2 compounds, namely (S)-9-(3-hydroxy-2-phosphonylmethoxypropyl)adenine [(S)-HPMPA] and 9-[(2-hydroxy-1,3,2-dioxaphosphorinan-5-yl)oxymethyl]guanine P-oxide (2'-nor-cyclic GMP), were highly effective against all adenovirus types assayed in human embryonic fibroblast cultures. Their 50% inhibitory doses were 1.1 microgram/ml for (S)-HPMPA and 4.1 micrograms/ml for 2'-nor-cyclic GMP. They were nontoxic for the host cells at the effective antiviral doses. PMID:3566256

  17. Negative ion formation in potassium-adenine collisions

    NASA Astrophysics Data System (ADS)

    Chunha, T.; Mendes, M.; Ferreira da Silva, F.; García, G.; Limáo Vieira, P.

    2016-09-01

    We have devoted experimental studies to time-of-flight negative ion formation in electron transfer experiments from neutral potassium atoms with neutral adenine molecules1. Total partial cross sections have been obtained as a function of the collision energy, together with branching ratios for the most relevant fragment anions. Additional set of measurements in adenine derivatives have been performed in order to probe the role of negative ions as well as to probe whether site- and bond-selective excision is also a prevalent mechanism within electron transfer in atom-molecule collision experiments.

  18. Impedimetric investigation of gold nanoparticles - guanine modified electrode

    SciTech Connect

    Vulcu, A.; Pruneanu, S.; Berghian-Grosan, C.; Olenic, L.; Muresan, L. M.; Barbu-Tudoran, L.

    2013-11-13

    In this paper we report the preparation of a modified electrode with gold nanoparticles and guanine. The colloidal suspension of gold nanoparticles was obtained by Turkevich method and was next analyzed by UV-Vis spectroscopy and Transmission Electron Microscopy (TEM). The gold electrode was modified by self-assembling the gold nanoparticles with guanine, the organic molecule playing also the role of linker. The electrochemical characteristics of the bare and modified electrode were investigated by Electrochemical Impedance Spectroscopy (EIS). A theoretical model was developed based on an electrical equivalent circuit which contain solution resistance (R{sub s}), charge transfer resistance (R{sub ct}), Warburg impedance (Z{sub W}) and double layer capacitance (C{sub dl})

  19. Guanine is a growth factor for Legionella species.

    PubMed Central

    Pine, L; Franzus, M J; Malcolm, G B

    1986-01-01

    Evaluation of previously described chemically defined media for the growth of Legionella pneumophila showed that these media supported poor growth of several strains of L. pneumophila and did not support growth of certain of the Legionella species described later. Growth was stimulated by the dialysate from yeast extract but not by the nondialyzable fraction. Further investigations indicated that the active factors from the yeast extract dialysate were purine or pyrimidine derivatives, and certain known purines and pyrimidines were found to stimulate growth. Of these, guanine universally stimulated growth of all Legionella strains and was a growth requirement for several of the species tested. A balanced, N-(2-acetamido)-2-aminoethanesulfonic acid-buffered, chemically defined medium having guanine or a purine-pyrimidine mix is presented for the general growth of Legionella species. PMID:3700600

  20. Hole wave functions and transport with deazaadenines replacing adenines in DNA.

    PubMed

    Breindel, Alexander J; Stuart, Rachel E; Bock, William J; Stelter, David N; Kravec, Shane M; Conwell, Esther M

    2013-03-21

    Transport of a hole along the base stack of DNA is relatively facile for a series of adenines (As) paired with thymines (Ts) or for a series of guanines (Gs) paired with cytosines (Cs). However, the speed at which a hole was found to travel was much too small to make useful semiconductor-type devices. Quite recently it was found that replacing one of the electronegative nitrogens (N3 or N7) with a carbon and a hydrogen, thus turning A into deazaadenine, increased the hole speed in what was A/T by a factor 30. To study the effect of the substitution we have carried out simulations for the wave function of a hole on an A/T oligomer with As modified by replacing N3 or N7, or both, with C-H's. The simulations were carried out using QM/MM and the code CP2K. We find, for either N, or both, replaced, the wave function of the hole behaves similarly to that of a hole on A/T in being delocalized immediately after hole insertion for up to ∼20 fs, and then becoming localized on one of the modified As. The time for localization could be decreased by placing additional water within ∼1.8 Å of N3 or N7, encouraging the formation of hydrogen bonds with these nitrogens. Because of their positive charge the hydrogen bonds tend to repel holes. However, these bonds were found to decay on a femtosecond time scale, thus unlikely to affect the hole hopping, which occurs on approximately a nanosecond scale in A/T. Replacement with a C-H of one or both of the electronegative Ns, along with the structural changes that result, is expected to decrease the activation energy and thus account for the larger hole hopping rate in the deaza-modified DNA.

  1. Guanine base stacking in G-quadruplex nucleic acids

    PubMed Central

    Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân

    2013-01-01

    G-quadruplexes constitute a class of nucleic acid structures defined by stacked guanine tetrads (or G-tetrads) with guanine bases from neighboring tetrads stacking with one another within the G-tetrad core. Individual G-quadruplexes can also stack with one another at their G-tetrad interface leading to higher-order structures as observed in telomeric repeat-containing DNA and RNA. In this study, we investigate how guanine base stacking influences the stability of G-quadruplexes and their stacked higher-order structures. A structural survey of the Protein Data Bank is conducted to characterize experimentally observed guanine base stacking geometries within the core of G-quadruplexes and at the interface between stacked G-quadruplex structures. We couple this survey with a systematic computational examination of stacked G-tetrad energy landscapes using quantum mechanical computations. Energy calculations of stacked G-tetrads reveal large energy differences of up to 12 kcal/mol between experimentally observed geometries at the interface of stacked G-quadruplexes. Energy landscapes are also computed using an AMBER molecular mechanics description of stacking energy and are shown to agree quite well with quantum mechanical calculated landscapes. Molecular dynamics simulations provide a structural explanation for the experimentally observed preference of parallel G-quadruplexes to stack in a 5′–5′ manner based on different accessible tetrad stacking modes at the stacking interfaces of 5′–5′ and 3′–3′ stacked G-quadruplexes. PMID:23268444

  2. `Guanigma': the revised structure of biogenic anhydrous guanine

    NASA Astrophysics Data System (ADS)

    Hirsch, Anna; Gur, Dvir; Polishchuk, Iryna; Levy, Davide; Pokroy, Boaz; Cruz-Cabeza, Aurora J.; Addadi, Lia; Kronik, Leeor; Leiserowitz, Leslie

    Living organisms display a spectrum of colors, produced by pigmentation, structural coloration, or both. A relatively well-studied system, which produces colors via an array of alternating anhydrous guanine crystals and cytoplasm, is responsible for the metallic luster of many fish. The structure of biogenic anhydrous guanine was believed to be the same as that of the synthetic one - a monoclinic polymorph. Here we re-examine the structure of biogenic guanine, using experimental X-ray and electron diffraction (ED) data exposing troublesome inconsistencies - namely, a 'guanigma'. To address this, we sought alternative candidate polymorphs using symmetry and packing considerations, then used first principles calculations to determine whether the selected candidates could be energetically stable. We identified theoretically a different monoclinic polymorph, were able to synthesize it, and to confirm using X-ray diffraction that it is this polymorph that occurs in biogenic samples. However, the ED data were still not consistent with this polymorph, but rather with a theoretically generated orthorhombic polymorph. This apparent inconsistency was resolved by showing how the ED pattern could be affected by crystal structural faults composed of offset molecular layers.

  3. Some aspects of adenosine triphosphate synthesis from adenine and adenosine in human red blood cells

    PubMed Central

    Whittam, R.; Wiley, J. S.

    1968-01-01

    1. The synthesis of ATP has been studied in human erythrocytes. Fresh cells showed no net synthesis of ATP when incubated with adenine or adenosine, although labelled adenine was incorporated into ATP in small amounts. 2. Cold-stored cells (3-6 weeks old) became progressively depleted of adenine nucleotides but incubation with adenosine or adenine plus inosine restored the ATP concentration to normal within 4 hr. Incorporation of labelled adenine or adenosine into the ATP of incubated stored cells corresponded to net ATP synthesis by these cells. 3. Synthesis of ATP from adenosine plus adenine together was 75% derived from adenine and only 25% from adenosine, indicating that nucleotide synthesis from adenine inhibits the simultaneous synthesis of nucleotide from adenosine. PMID:5723519

  4. Detection of electronically equivalent tautomers of adenine base: DFT study

    SciTech Connect

    Siddiqui, Shamoon Ahmad; Bouarissa, Nadir; Rasheed, Tabish; Al-Assiri, M.S.; Al-Hajry, A.

    2014-03-01

    Graphical abstract: - Highlights: • DFT calculations have been performed on adenine and its rare tautomer Cu{sup 2+} complexes. • Interaction of A-Cu{sup 2+} and rA-Cu{sup 2+} complexes with AlN modified fullerene (C{sub 60}) have been studied briefly. • It is found that AlN modified C{sub 60} could be used as a nanoscale sensor to detect these two A-Cu{sup 2+} and rA-Cu{sup 2+} complexes. - Abstract: In the present study, quantum chemical calculations were carried out to investigate the electronic structures and stabilities of adenine and its rare tautomer along with their Cu{sup 2+} complexes. Density Functional Theory (B3LYP method) was used in all calculations. The two Cu{sup 2+} complexes of adenine have almost similar energies and electronic structures; hence, their chemical differentiation is very difficult. For this purpose, interactions of these complexes with AlN modified fullerene (C{sub 60}) have been studied. Theoretical investigations reveal that AlN-doped C{sub 60} may serve as a potentially viable nanoscale sensor for detection of the two Cu{sup 2+} complexes of adenine.

  5. Arterial endothelial barrier dysfunction: actions of homocysteine and the hypoxanthine-xanthine oxidase free radical generating system.

    PubMed

    Berman, R S; Martin, W

    1993-04-01

    1. Endothelial barrier function was assessed by use of an in vitro model in which transfer of trypan blue-labelled albumin was measured across monolayers of bovine aortic endothelial cells grown on polycarbonate membranes. 2. Addition of either hypoxanthine (0.2 mM) or xanthine oxidase (20 mu ml-1) alone during a 90 min incubation did not affect albumin transfer across endothelial cell monolayers, but a combination of both increased transfer. 3. The increase in albumin transfer induced by hypoxanthine and xanthine oxidase was abolished by catalase (3 u ml-1), reduced by allopurinol (4 mM), but unaffected by superoxide dismutase (6000 u ml-1), the hydroxyl radical scavengers, mannitol (15 mM), dimethylthiourea (10 mM) and N-(2-mercaptopropionyl)-glycine (1 mM), the iron chelator, deferoxamine (0.5 mM), ferric chloride (50 microM), an inhibitor of nitric oxide synthase, NG-nitro-L-arginine (30 microM), or the antioxidant, dithiothreitol (3 mM). 4. Hydrogen peroxide (0.1-30 mM) itself increased albumin transfer across endothelial cell monolayers, exhibiting a biphasic concentration-response curve. The increase induced by 0.1 mM hydrogen peroxide was abolished in the presence of 0.3 u ml-1 catalase whilst that induced by 10 mM hydrogen peroxide was abolished by 3000 u ml-1 catalase. 5. Homocysteine (0.5-1.5 mM) did not affect albumin transfer across endothelial monolayers when added alone, but when added in combination with copper sulphate (50 microM), which catalyses its oxidation, a significant increase in albumin transfer was observed. 6. The increase in albumin transfer induced by the combination of homocysteine (1.5 mM) and copper sulphate was abolished by catalase (1 u ml-1), but was unaffected by superoxide dismutase (6000 u ml-1), mannitol (15 mM), dimethylthiourea (1 mM) or deferoxamine (0.5 mM).7. The data suggest that the endothelial barrier dysfunction induced by the combination of hypoxanthine and xanthine oxidase is mediated solely by the action of

  6. Generation of hypoxanthine phosphoribosyltransferase gene knockout rabbits by homologous recombination and gene trapping through somatic cell nuclear transfer.

    PubMed

    Yin, Mingru; Jiang, Weihua; Fang, Zhenfu; Kong, Pengcheng; Xing, Fengying; Li, Yao; Chen, Xuejin; Li, Shangang

    2015-11-02

    The rabbit is a common animal model that has been employed in studies on various human disorders, and the generation of genetically modified rabbit lines is highly desirable. Female rabbits have been successfully cloned from cumulus cells, and the somatic cell nuclear transfer (SCNT) technology is well established. The present study generated hypoxanthine phosphoribosyltransferase (HPRT) gene knockout rabbits using recombinant adeno-associated virus-mediated homologous recombination and SCNT. Gene trap strategies were employed to enhance the gene targeting rates. The male and female gene knockout fibroblast cell lines were derived by different strategies. When male HPRT knockout cells were used for SCNT, no live rabbits were obtained. However, when female HPRT(+/-) cells were used for SCNT, live, healthy rabbits were generated. The cloned HPRT(+/-) rabbits were fertile at maturity. We demonstrate a new technique to produce gene-targeted rabbits. This approach may also be used in the genetic manipulation of different genes or in other species.

  7. Kinetic mechanism for the excision of hypoxanthine by Escherichia coli AlkA and evidence for binding to DNA ends.

    PubMed

    Zhao, Boyang; O'Brien, Patrick J

    2011-05-24

    The Escherichia coli 3-methyladenine DNA glycosylase II protein (AlkA) recognizes a broad range of oxidized and alkylated base lesions and catalyzes the hydrolysis of the N-glycosidic bond to initiate the base excision repair pathway. Although the enzyme was one of the first DNA repair glycosylases to be discovered more than 25 years ago and there are multiple crystal structures, the mechanism is poorly understood. Therefore, we have characterized the kinetic mechanism for the AlkA-catalyzed excision of the deaminated purine, hypoxanthine. The multiple-turnover glycosylase assays are consistent with Michaelis-Menten kinetics. However, under single-turnover conditions that are commonly employed for studying other DNA glycosylases, we observe an unusual biphasic protein saturation curve. Initially, the observed rate constant for excision increases with an increasing level of AlkA protein, but at higher protein concentrations, the rate constant decreases. This behavior can be most easily explained by tight binding to DNA ends and by crowding of multiple AlkA protamers on the DNA. Consistent with this model, crystal structures have shown the preferential binding of AlkA to DNA ends. By varying the position of the lesion, we identified an asymmetric substrate that does not show inhibition at higher concentrations of AlkA, and we performed pre-steady state and steady state kinetic analysis. Unlike the situation in other glycosylases, release of the abasic product is faster than N-glycosidic bond cleavage. Nevertheless, AlkA exhibits significant product inhibition under multiple-turnover conditions, and it binds approximately 10-fold more tightly to an abasic site than to a hypoxanthine lesion site. This tight binding could help protect abasic sites when the adaptive response to DNA alkylation is activated and very high levels of AlkA protein are present.

  8. Guanine oxidation by electron transfer: one- versus two-electron oxidation mechanism.

    PubMed

    Kupan, Adam; Saulière, Aude; Broussy, Sylvain; Seguy, Christel; Pratviel, Geneviève; Meunier, Bernard

    2006-01-01

    The degeneracy of the guanine radical cation, which is formed in DNA by oxidation of guanine by electron transfer, was studied by a detailed analysis of the oxidation products of guanine on oligonucleotide duplexes and by labeling experiments. It was shown that imidazolone, the major product of guanine oxidation, is formed through a one-electron oxidation process and incorporates one oxygen atom from O2. The formation of 8-oxo-7,8-dihydroguanine by a two-electron oxidation process was a minor pathway. The two-electron oxidation mechanism was also evidenced by the formation of a tris(hydroxymethyl)aminomethane adduct.

  9. Study on the oxidation form of adenine in phosphate buffer solution.

    PubMed

    Song, Yuan-Zhi; Zhou, Jian-Feng; Zhu, Feng-Xia; Ye, Yong; Xie, Ji-Min

    2010-07-01

    The oxidation of adenine in phosphate buffer solution is investigated using square-wave voltammetry and in situ UV spectroelectrochemistry. The geometry of adenine and the derivatives optimized at DFTB3LYP-6-31G (d, p)-PCM level is in agreement with the crystal structure, and the imitated UV spectra of adenine and the product at electrode are consistent with the in situ UV spectra. The relationship between the electrochemical property and the molecular structure is also discussed. The experimental and theoretical results show that the adenine oxidation origins from the neutral adenine.

  10. Structure-Based Design of Trna-Guanine Transglycosylase Inhibitors

    NASA Astrophysics Data System (ADS)

    Klebe, Gerhard

    Taking the development of inhibitors for the tRNA-modifying enzyme tRNA-guanine transglycosylase (TGT) as an example, the scope of a structure-based drug development project will be demonstrated, performed via several cycles of iterative design. The described example is based on studies, performed at ETH-Zurich and University of Marburg in joint collaboration. As these studies have been executed in an academic environment, different tools of structure-based design have been applied and several issues of more fundamental interest to the methodological background of the project could be addressed.

  11. Excited State Pathways Leading to Formation of Adenine Dimers.

    PubMed

    Banyasz, Akos; Martinez-Fernandez, Lara; Ketola, Tiia-Maaria; Muñoz-Losa, Aurora; Esposito, Luciana; Markovitsi, Dimitra; Improta, Roberto

    2016-06-02

    The reaction intermediate in the path leading to UV-induced formation of adenine dimers A═A and AA* is identified for the first time quantum mechanically, using PCM/TD-DFT calculations on (dA)2 (dA: 2'deoxyadenosine). In parallel, its fingerprint is detected in the absorption spectra recorded on the millisecond time-scale for the single strand (dA)20 (dA: 2'deoxyadenosine).

  12. High resolution dissociative electron attachment to gas phase adenine

    SciTech Connect

    Huber, D.; Beikircher, M.; Denifl, S.; Zappa, F.; Matejcik, S.; Bacher, A.; Grill, V.; Maerk, T. D.; Scheier, P.

    2006-08-28

    The dissociative electron attachment to the gas phase nucleobase adenine is studied using two different experiments. A double focusing sector field mass spectrometer is utilized for measurements requiring high mass resolution, high sensitivity, and relative ion yields for all the fragment anions and a hemispherical electron monochromator instrument for high electron energy resolution. The negative ion mass spectra are discussed at two different electron energies of 2 and 6 eV. In contrast to previous gas phase studies a number of new negative ions are discovered in the mass spectra. The ion efficiency curves for the negative ions of adenine are measured for the electron energy range from about 0 to 15 eV with an electron energy resolution of about 100 meV. The total anion yield derived via the summation of all measured fragment anions is compared with the total cross section for negative ion formation measured recently without mass spectrometry. For adenine the shape of the two cross section curves agrees well, taking into account the different electron energy resolutions; however, for thymine some peculiar differences are observed.

  13. The nucleobase adenine as a signalling molecule in the kidney.

    PubMed

    Thimm, D; Schiedel, A C; Peti-Peterdi, J; Kishore, B K; Müller, C E

    2015-04-01

    In 2002, the first receptor activated by the nucleobase adenine was discovered in rats. In the past years, two adenine receptors (AdeRs) in mice and one in Chinese hamsters, all of which belong to the family of G protein-coupled receptors (GPCRs), were cloned and pharmacologically characterized. Based on the nomenclature for other purinergic receptor families (P1 for adenosine receptors and P2 for nucleotide, e.g. ATP, receptors), AdeRs were designated P0 receptors. Pharmacological data indicate the existence of G protein-coupled AdeRs in pigs and humans as well; however, those have not been cloned so far. Current data suggest a role for adenine and AdeRs in renal proximal tubules. Furthermore, AdeRs are suggested to be functional counterplayers of vasopressin in the collecting duct system, thus exerting diuretic effects. We are only at the beginning of understanding the significance of this new class of purinergic receptors, which might become future drug targets.

  14. Guanine binding to gold nanoparticles through nonbonding interactions.

    PubMed

    Zhang, Xi; Sun, Chang Q; Hirao, Hajime

    2013-11-28

    Gold nanoparticles have been widely used as nanocarriers in gene delivery. However, the binding mechanism between gold nanoparticles and DNA bases remains a puzzle. We performed density functional theory calculations with and without dispersion correction on Au(N)( (N = 13, 55, or 147) nanoparticles in high-symmetry cuboctahedral structures to understand the mechanism of their binding with guanine at the under-coordinated sites. Our study verified that: (i) negative charges transfer from the inner area to the surface of a nanoparticle as a result of the surface quantum trapping effect; and (ii) the valence states shift up toward the Fermi level, and thereby participate more actively in the binding to guanine. These effects are more prominent in a smaller nanoparticle, which has a larger surface-to-volume ratio. Additional fragment orbital analysis revealed that: (i) electron donation from the lone-pair orbital of N to the unoccupied orbital of the Au cluster occurs in all complexes; (ii) π back-donation occurs from the polarized Au d(yz) orbital to the N p(y)-π* orbital when there is no Au···H-N hydrogen bond, and, (iii) depending on the configuration, Au···H-N hydrogen bonding can also exist, to which the Au occupied orbital and the H-N unoccupied orbital contribute.

  15. Regulation of the Nicotinamide Adenine Dinucleotide- and Nicotinamide Adenine Dinucleotide Phosphate-Dependent Glutamate Dehydrogenases of Saccharomyces cerevisiae

    PubMed Central

    Roon, Robert J.; Even, Harvey L.

    1973-01-01

    Saccharomyces cerevisiae contains two distinct l-glutamate dehydrogenases. These enzymes are affected in a reciprocal fashion by growth on ammonia or dicarboxylic amino acids as the nitrogen source. The specific activity of the nicotinamide adenine dinucleotide phosphate (NADP) (anabolic) enzyme is highest in ammonia-grown cells and is reduced in cells grown on glutamate or aspartate. Conversely, the specific activity of the nicotinamide adenine dinucleotide (NAD) (catabolic) glutamate dehydrogenase is highest in cells grown on glutamate or aspartate and is much lower in cells grown on ammonia. The specific activity of both enzymes is very low in nitrogen-starved yeast. Addition of the ammonia analogue methylamine to the growth medium reduces the specific activity of the NAD-dependent enzyme and increases the specific activity of the NADP-dependent enzyme. PMID:4147647

  16. Translesion synthesis by human DNA polymerase eta across oxidative products of guanine.

    PubMed

    Kino, Katuhito; Ito, Nobutoshi; Sugasawa, Kaoru; Sugiyama, Hiroshi; Hanaoka, Fumio

    2004-01-01

    Guanine is the most oxidizable base among natural bases. 8-Oxoguanine (8-oxoG) is the typical oxidative product, but the amount of 8-oxoG does not directly reflect the strength of oxidative stress. Imidazolone, oxazolone and guanidinohydantoin are oxidative products of guanine and 8-oxoG. Here, we investigated enzymatic reactions with human DNA polymerase eta on these lesions.

  17. Adenine versus guanine DNA adducts of aristolochic acids: role of the carcinogen-purine linkage in the differential global genomic repair propensity.

    PubMed

    Kathuria, Preetleen; Sharma, Purshotam; Wetmore, Stacey D

    2015-09-03

    Computational modeling is employed to provide a plausible structural explanation for the experimentally-observed differential global genome repair (GGR) propensity of the ALII-N(2)-dG and ALII-N(6)-dA DNA adducts of aristolochic acid II. Our modeling studies suggest that an intrinsic twist at the carcinogen-purine linkage of ALII-N(2)-dG induces lesion site structural perturbations and conformational heterogeneity of damaged DNA. These structural characteristics correlate with the relative repair propensities of AA-adducts, where GGR recognition occurs for ALII-N(2)-dG, but is evaded for intrinsically planar ALII-N(6)-dA that minimally distorts DNA and restricts the conformational flexibility of the damaged duplex. The present analysis on the ALII adduct model systems will inspire future experimental studies on these adducts, and thereby may extend the list of structural factors that directly correlate with the propensity for GGR recognition.

  18. Mutation from guanine to adenine in 25S rRNA at the position equivalent to E. coli A2058 does not confer erythromycin sensitivity in Sacchromyces cerevisae

    PubMed Central

    Bommakanti, Ananth S.; Lindahl, Lasse; Zengel, Janice M.

    2008-01-01

    The macrolide erythromycin binds to the large subunit of the prokaryotic ribosome near the peptidyltransferase center (PTC) and inhibits elongation of new peptide chains beyond a few amino acids. Nucleotides A2058 and A2059 (E. coli numbering) in 23S rRNA play a crucial role in the binding of erythromycin, and mutation of nucleotide A2058 confers erythromycin resistance in both Gram-positive and Gram-negative bacteria. There are high levels of sequence and structural similarity in the PTC of prokaryotic and eukaryotic ribosomes. However, eukaryotic ribosomes are resistant to erythromycin and the presence of a G at the position equivalent to E. coli nucleotide A2058 is believed to be the reason. To test this hypothesis, we introduced a G to A mutation at this position of the yeast Saccharomyces cerevisiae 25S rRNA and analyzed sensitivity toward erythromycin. Neither growth studies nor erythromycin binding assays on mutated yeast ribosomes indicated any erythromycin sensitivity in mutated yeast strains. These results suggest that the identity of nucleotide 2058 is not the only determinant responsible for the difference in erythromycin sensitivity between yeast and prokaryotes. PMID:18218702

  19. Mobility enhancement of organic field-effect transistor based on guanine trap-neutralizing layer

    NASA Astrophysics Data System (ADS)

    Shi, Wei; Zheng, Yifan; Yu, Junsheng; Taylor, André D.; Katz, Howard E.

    2016-10-01

    We introduced a nucleic acid component guanine as a trap-neutralizing layer between silicon dioxide gate dielectric and a pentacene semiconducting layer to obtain increased field-effect mobility in organic field-effect transistors (OFETs). A tripling of the field-effect mobility, from 0.13 to 0.42 cm2/V s, was achieved by introducing a 2 nm guanine layer. By characterizing the surface morphology of pentacene films grown on guanine, we found that the effect of guanine layer on the topography of pentacene film was not responsible for the mobility enhancement of the OFETs. The increased field-effect mobility was mainly attributed to the hydrogen bonding capacity of otherwise unassociated guanine molecules, which enabled them to neutralize trapping sites on the silicon dioxide surface.

  20. The synergism of nucleoside antibiotics combined with guanine 7-N-oxide against a rhabdovirus, infectious hematopoietic necrosis virus (IHNV).

    PubMed

    Hasobe, M; Saneyoshi, M; Isono, K

    1986-09-01

    Guanine 7-N-oxide was shown to have synergistic activity in combination with neplanocin A against a rhabdovirus, infectious hematopoietic necrosis virus (IHNV), as reported previously. We examined further the antiviral activity of guanine 7-N-oxide in combination with other nucleoside antibiotics against IHNV. Synergism was seen between guanine 7-N-oxide and D-eritadenine or cordycepin. It is considered that compounds inhibiting RNA methylation show synergism with guanine 7-N-oxide.

  1. Deficiency of the purine metabolic gene HPRT dysregulates microRNA-17 family cluster and guanine-based cellular functions: a role for EPAC in Lesch-Nyhan syndrome

    PubMed Central

    Guibinga, Ghiabe-Henri; Murray, Fiona; Barron, Nikki; Pandori, William; Hrustanovic, Gorjan

    2013-01-01

    Lesch-Nyhan syndrome (LNS) is a neurodevelopmental disorder caused by mutations in the gene encoding the purine metabolic enzyme hypoxanthine-guanine phosphoribosyltransferase (HPRT). A series of motor, cognitive and neurobehavioral anomalies characterize this disease phenotype, which is still poorly understood. The clinical manifestations of this syndrome are believed to be the consequences of deficiencies in neurodevelopmental pathways that lead to disordered brain function. We have used microRNA array and gene ontology analysis to evaluate the gene expression of differentiating HPRT-deficient human neuron-like cell lines. We set out to identify dysregulated genes implicated in purine-based cellular functions. Our approach was based on the premise that HPRT deficiency affects preeminently the expression and the function of purine-based molecular complexes, such as guanine nucleotide exchange factors (GEFs) and small GTPases. We found that several microRNAs from the miR-17 family cluster and genes encoding GEF are dysregulated in HPRT deficiency. Most notably, our data show that the expression of the exchange protein activated by cAMP (EPAC) is blunted in HPRT-deficient human neuron-like cell lines and fibroblast cells from LNS patients, and is altered in the cortex, striatum and midbrain of HPRT knockout mouse. We also show a marked impairment in the activation of small GTPase RAP1 in the HPRT-deficient cells, as well as differences in cytoskeleton dynamics that lead to increased motility for HPRT-deficient neuron-like cell lines relative to control. We propose that the alterations in EPAC/RAP1 signaling and cell migration in HPRT deficiency are crucial for neuro-developmental events that may contribute to the neurological dysfunctions in LNS. PMID:23804752

  2. Guanine- 5-carboxylcytosine base pairs mimic mismatches during DNA replication.

    PubMed

    Shibutani, Toshihiro; Ito, Shinsuke; Toda, Mariko; Kanao, Rie; Collins, Leonard B; Shibata, Marika; Urabe, Miho; Koseki, Haruhiko; Masuda, Yuji; Swenberg, James A; Masutani, Chikahide; Hanaoka, Fumio; Iwai, Shigenori; Kuraoka, Isao

    2014-06-09

    The genetic information encoded in genomes must be faithfully replicated and transmitted to daughter cells. The recent discovery of consecutive DNA conversions by TET family proteins of 5-methylcytosine into 5-hydroxymethylcytosine, 5-formylcytosine, and 5-carboxylcytosine (5caC) suggests these modified cytosines act as DNA lesions, which could threaten genome integrity. Here, we have shown that although 5caC pairs with guanine during DNA replication in vitro, G·5caC pairs stimulated DNA polymerase exonuclease activity and were recognized by the mismatch repair (MMR) proteins. Knockdown of thymine DNA glycosylase increased 5caC in genome, affected cell proliferation via MMR, indicating MMR is a novel reader for 5caC. These results suggest the epigenetic modification products of 5caC behave as DNA lesions.

  3. In vivo methylation of guanine by the organophosphorus insecticide tetrachlorvinphos.

    PubMed

    Zayed, S M; Mostafa, I Y; Adam, Y; Hegazi, B

    1983-12-01

    The in vivo methylating capability of the organophosphorus insecticide tetrachlorvinphos, assayed by the formation of 7-methyl-guanine in mouse liver, was investigated. Following intraperitoneal injection of male mice with different doses of the 14C-insecticide, labelled at the OCH3 groups, the total and specific radioactivity of nucleic acids and protein were determined. The 14C-labelling in the isolated macromolecules reached its maximum 24 hours following administration of the insecticide. Analysis of the acid hydrolysate of DNA and of RNA on Dowex-50 WX-12 revealed the presence of (7-14C) methylguanine. At maximum 14C-labelling, the amount of radioactive 7-MeGu, calculated as fraction of total dose, was around 9 X 10(-5) and 39 X 10(-5) for DNA and RNA, respectively.

  4. Effects of spinally administered adenine on dorsal horn neuronal responses in a rat model of inflammation.

    PubMed

    Matthews, Elizabeth A; Dickenson, Anthony H

    2004-02-19

    A novel G-protein-coupled receptor with adenine identified as the endogenous ligand has recently been described. In vivo electrophysiological techniques in the rat were used to record the response of dorsal horn neurones in response to transcutaneous electrical stimulation to the hindpaw receptive field. Spinal adenine (1-1000 microg) exerted facilitatory effects on the electrically-evoked neuronal responses, in a mildly dose-related manner. After establishment of carrageenan-induced inflammation to the hindpaw this excitatory effect of adenine was still apparent, yet reduced. C-fibre-evoked responses and other nociceptive related measures were most susceptible to the effects of adenine, whereas non-nociceptive Abeta-fibre evoked activity remained unaffected. Thus, activation of the adenine receptor site, via spinally applied adenine, suggests a pronociceptive role in nociceptive sensory transmission.

  5. Influence of hydrogen bonding on the geometry of the adenine fragment

    NASA Astrophysics Data System (ADS)

    Słowikowska, Joanna Maria; Woźniak, Krzysztof

    1996-01-01

    The crystal structures of two adenine derivatives, N(6),9-dimethyl-8-butyladenine (I) and its hydrate (1 : 1) (II), have been determined by single-crystal X-ray diffraction. The geometrical features of both structures are discussed. The influence of protonation, substitution and hydrogen bond formation on the geometry of the adenine fragment was studied, based on data retrieved from the Cambridge Structural Database. Total correlation analysis showed mutual correlation between the structural parameters in the adenine ring system; partial correlation calculations for the adenine nucleoside fragments suggest intercorrelation between the parameters of the hydrogen bonding involved in base pairing and the N(adenine)-C(sugar) bond through the adenine fragment; few such correlations were found for fragments without the sugar substituent.

  6. Sulfur and adenine metabolisms are linked, and both modulate sulfite resistance in wine yeast.

    PubMed

    Aranda, Agustín; Jiménez-Martí, Elena; Orozco, Helena; Matallana, Emilia; Del Olmo, Marcellí

    2006-08-09

    Sulfite treatment is the most common way to prevent grape must spoilage in winemaking because the yeast Saccharomyces cerevisiae is particularly resistant to this chemical. In this paper we report that sulfite resistance depends on sulfur and adenine metabolism. The amount of adenine and methionine in a chemically defined growth medium modulates sulfite resistance of wine yeasts. Mutations in the adenine biosynthetic pathway or the presence of adenine in a synthetic minimal culture medium increase sulfite resistance. The presence of methionine has the opposite effect, inducing a higher sensitivity to SO(2). The concentration of methionine, adenine, and sulfite in a synthetic grape must influences the progress of fermentation and at the transcriptional level the expression of genes involved in sulfur (MET16), adenine (ADE4), and acetaldehyde (ALD6) metabolism. Sulfite alters the pattern of expression of all these genes. This fact indicates that the response to this stress is complex and involves several metabolic pathways.

  7. ESR studies on reaction of saccharide with the free radicals generated from the xanthine oxidase/hypoxanthine system containing iron.

    PubMed

    Luo, G M; Qi, D H; Zheng, Y G; Mu, Y; Yan, G L; Yang, T S; Shen, J C

    2001-03-09

    The free radicals generated from the iron containing system of xanthine oxidase and hypoxanthine (Fe-XO/HX) were directly detected by using spin trapping. It was found that not only superoxide anion (O(2)*-) and hydroxyl radical (OH*), but also alkyl or alkoxyl radicals (R*) were formed when saccharides such as glucose, fructose and sucrose were added into the Fe-XO/HX system. The generated amount of R* was dependent on the kind and concentration of saccharides added into the Fe-XO/HX system and no R* were detected in the absence of saccharides, indicating that there is an interaction between the saccharide molecules and the free radicals generated from the Fe-XO/HX system and saccharide molecules are essential for generating R* in the Fe-XO/HX system. It is expected that the toxicity of R* would be greater than of hydrophilic O(2)*- and OH* because they are liposoluble and their lives are longer and the active sites of biomolecules are closely related with lipophilic phase, thus they can damage cells more seriously than O(2)*- and OH*. The R* generated from the saccharide containing Fe-XO/HX can be effectively scavenged by selenium containing abzyme (Se-abzyme), indicating Se-abzyme is a promising antioxidant.

  8. Eighteen-year follow-up of a patient with partial hypoxanthine phosphoribosyltransferase deficiency and a new mutation.

    PubMed

    Gregoric, Alojz; Rabelink, Gwenda M; Kokalj Vokac, Nadja; Varda, Natasa Marcun; Zagradisnik, Boris

    2005-09-01

    Hypoxanthine phosphoribosyltransferase (HPRT) deficiency is an inherited disorder. Complete deficiency of HPRT activity is phenotypically expressed as the devastating Lesch-Nyhan syndrome. Partial HPRT deficiency usually causes hyperuricemia, precocious gout, and uric acid nephrolithiasis. We describe an 18-year follow-up of a 5-year old boy with partial HPRT deficiency and report a novel mutation in his HPRT gene. He presented with overproduction of uric acid and passage of uric acid renal stones, and without gout or neurological and behavioral abnormalities. Treatment with allopurinol, adequate hydration, urinary alkalization, and a low-purine diet was started. No subsequent nephrolithiasis has occurred. After 18-year of this therapy his physical and neuropsychological status were normal, merely his glomerular filtration rate (GFR, normal 97-137 mL min(-1)/1.73 m(2)) fell from normal to 65.1 mL min(-1). The most likely cause of initial renal impairment in our patient is uric and/or xanthine crystalluria. A missense and transition mutation 169A>G (57ATG>GTG, 57met>val) in exon 3 of the patient's HPRT gene was identified and the mother was the carrier of the mutation. As far as we are aware, the identified mutation has not previously been reported. We named the mutant HPRT Maribor.

  9. Generation of hypoxanthine phosphoribosyltransferase gene knockout rabbits by homologous recombination and gene trapping through somatic cell nuclear transfer

    PubMed Central

    Yin, Mingru; Jiang, Weihua; Fang, Zhenfu; Kong, Pengcheng; Xing, Fengying; Li, Yao; Chen, Xuejin; Li, Shangang

    2015-01-01

    The rabbit is a common animal model that has been employed in studies on various human disorders, and the generation of genetically modified rabbit lines is highly desirable. Female rabbits have been successfully cloned from cumulus cells, and the somatic cell nuclear transfer (SCNT) technology is well established. The present study generated hypoxanthine phosphoribosyltransferase (HPRT) gene knockout rabbits using recombinant adeno-associated virus-mediated homologous recombination and SCNT. Gene trap strategies were employed to enhance the gene targeting rates. The male and female gene knockout fibroblast cell lines were derived by different strategies. When male HPRT knockout cells were used for SCNT, no live rabbits were obtained. However, when female HPRT+/− cells were used for SCNT, live, healthy rabbits were generated. The cloned HPRT+/− rabbits were fertile at maturity. We demonstrate a new technique to produce gene-targeted rabbits. This approach may also be used in the genetic manipulation of different genes or in other species. PMID:26522387

  10. Expression of Maternally and Embryonically Derived Hypoxanthine Phosphoribosyl Transferase (Hprt) Activity in Mouse Eggs and Early Embryos

    PubMed Central

    Kratzer, Paul G.

    1983-01-01

    X-chromosome activity in early mouse development has been studied by a gene dosage method that involves measuring the activity level of the X-linked enzyme hypoxanthine phosphoribosyl transferase (HPRT) in single eggs and embryos from XO females and from females heterozygous for In(X)1H, a paracentric inversion of the X chromosome. The HPRT activity in oocytes increased threefold over a 24-hr period beginning after ovulation. Afterward, the activity plateaued in unfertilized eggs but continued to increase for at least 66 hr in presumed OY embryos. Both before and after ovulation, the level of activity in unfertilized eggs from In(X)/X females was twice that from XO females, and the distributions of activity in eggs for both sets of females remained unimodal. Beginning with the two-cell stage, distributions of activity for embryos from In(X)/X females were trimodal, which is evidence for embryonic activity. It is proposed that activation of a maternal mRNA or proenzyme is responsible for the HPRT activity increase in oocytes and early embryos and is supplemented by dosage-dependent activity of the embryonic Hprt gene as early as the two-cell stage. PMID:6618165

  11. Lifetimes and reaction pathways of guanine radical cations and neutral guanine radicals in an oligonucleotide in aqueous solutions.

    PubMed

    Rokhlenko, Yekaterina; Geacintov, Nicholas E; Shafirovich, Vladimir

    2012-03-14

    The exposure of guanine in the oligonucleotide 5'-d(TCGCT) to one-electron oxidants leads initially to the formation of the guanine radical cation G(•+), its deptotonation product G(-H)(•), and, ultimately, various two- and four-electron oxidation products via pathways that depend on the oxidants and reaction conditions. We utilized single or successive multiple laser pulses (308 nm, 1 Hz rate) to generate the oxidants CO(3)(•-) and SO(4)(•-) (via the photolysis of S(2)O(8)(2-) in aqueous solutions in the presence and absence of bicarbonate, respectively) at concentrations/pulse that were ∼20-fold lower than the concentration of 5'-d(TCGCT). Time-resolved absorption spectroscopy measurements following single-pulse excitation show that the G(•+) radical (pK(a) = 3.9) can be observed only at low pH and is hydrated within 3 ms at pH 2.5, thus forming the two-electron oxidation product 8-oxo-7,8-dihydroguanosine (8-oxoG). At neutral pH, and single pulse excitation, the principal reactive intermediate is G(-H)(•), which, at best, reacts only slowly with H(2)O and lives for ∼70 ms in the absence of oxidants/other radicals to form base sequence-dependent intrastrand cross-links via the nucleophilic addition of N3-thymidine to C8-guanine (5'-G*CT* and 5'-T*CG*). Alternatively, G(-H)(•) can be oxidized further by reaction with CO(3)(•-), generating the two-electron oxidation products 8-oxoG (C8 addition) and 5-carboxamido-5-formamido-2-iminohydantoin (2Ih, by C5 addition). The four-electron oxidation products, guanidinohydantoin (Gh) and spiroiminodihydantoin (Sp), appear only after a second (or more) laser pulse. The levels of all products, except 8-oxoG, which remains at a low constant value, increase with the number of laser pulses.

  12. HYDROGEN-BONDED DIMERS OF ADENINE AND URACIL DERIVATIVES.

    PubMed

    HAMLIN, R M; LORD, R C; RICH, A

    1965-06-25

    In concentrated solutions of either 9-ethyladenine or 1-cyclohexyluracil in deuterochloroform, absorption bands in the infrared spectrum demonstrate hydrogen bonding of the adenine and uracil derivatives with themselves. In dilute solutions, there is very little hydrogen bonding. However, when dilute solutions of 9-ethyladenine and 1-cyclohexyluracil are mixed, a series of bands appear which show that these molecules are hydrogen-bonding with each other much more strongly than with themselves. A study of the stoichiometry of this association indicates formation of 1:1 hydrogen-bonded pairs in solution.

  13. Purines 2010: Adenine Nucleosides and Nucleotides in Biomedicine.

    PubMed

    Sereda, Michal J

    2010-08-01

    The Purines 2010: Adenine Nucleosides and Nucleotides in Biomedicine meeting, held in Tarragona, Spain, included topics covering new findings in the field of purinergic signaling and the development of purine-based drugs. This conference report highlights selected presentations on developments in purinerigic signaling, medicinal chemistry, the therapeutic potential of purine-based drugs, and the role of purines and adenosine receptors in neurodegenerative disorders, sickle cell disease, bone homeostasis, pulmonary fibrosis and pain. Investigational drugs discussed include CF-101 (Can-Fite BioPharma Ltd/NIH/Kwang Dong Pharmaceutical Co Ltd/Seikagaku Corp) and denufosol tetrasodium (Cystic Fibrosis Foundation Therapeutics Inc/Inspire Pharmaceuticals Inc).

  14. Investigation of coordination properties of isolated adenine to copper metal: a systematic spectroscopic and DFT study.

    PubMed

    Prakash, Om; Singh, Sachin Kumar; Singh, Bachcha; Singh, Ranjan K

    2013-08-01

    The coordination properties of copper with adenine have been studied by the analyzing the changes in Fourier Transform Infra-red (FTIR) and Raman spectra of adenine and adenine-copper complex. The geometry of adenine and adenine copper complex were optimized and theoretical Infra-red and Raman spectra of the optimized structures were calculated using Density Functional Theory (DFT). During synthesis of adenine-copper complex specific procedure was adopted to attach the Cu atom with particular N-atom of adenine (N9). The results of Raman and DFT confirmed the attachment. The Raman bands at 625, 330 and 230 cm(-1) of adenine-copper complex contain significant contribution of the vibrational motions of Cu metal coordinated to N9 and Cl atoms. The DFT calculations give additional vibrational modes containing the Cu, N9 and N9* atoms, which are not observed in FTIR and Raman spectra. The Raman, IR and DFT study confirm that Cu metal has good binding affinity to the isolated adenine base.

  15. Guanine and 7,8-dihydro-8-oxo-guanine-specific oxidation in DNA by chromium(V).

    PubMed

    Sugden, Kent D; Martin, Brooke D

    2002-10-01

    The hexavalent oxidation state of chromium [Cr(VI)] is a well-established human carcinogen, although the mechanism of cancer induction is currently unknown. Intracellular reduction of Cr(VI) forms Cr(V), which is thought to play a fundamental role in the mechanism of DNA damage by this carcinogen. Two separate pathways of DNA damage, an oxidative pathway and a metal-binding pathway, have been proposed to account for the lesions observed in cell systems. We have used a model Cr(V) complex, N,N-ethylenebis(salicylidene-animato)oxochromium(V) [Cr(V)-Salen], to investigate the oxidative pathway of DNA damage and to elucidate the lesions generated from this oxidation process. Reaction of Cr(V)-Salen with synthetic oligonucleotides produced guanine-specific lesions that were not 8-oxo-2'-deoxyguanosine, based on the inability of iridium(IV) to further oxidize these sites. Oxidation products were identified using a 7,8-dihydro-8-oxo-2'-deoxyguanosine (8-oxo-G) containing oligonucleotide to increase the yields of product for identification by electrospray ionization mass spectrometry. The guanine-based lesions observed by mass spectrometry corresponded to the lesions guanidinohydantoin and spiroiminodihydantoin. The effects of these Cr(V)-Salen-induced lesions on DNA replication fidelity was assayed using a polymerase-based misincorporation assay. These lesions produced G --> T transversion mutations and polymerase stops at levels greater than those observed for 8-oxo-G. These data suggest a model by which chromate can cause DNA damage leading to mutations and cancer.

  16. Guanine Oxidation in Double-stranded DNA by MnTMPyP/KHSO(5): At Least Three Independent Reaction Pathways.

    PubMed

    Lapi, A; Pratviel, G; Meunier, B

    2001-01-01

    In order to better define the mechanism and the products of guanine oxidation within DNA, we investigated the details of the mechanism of guanine oxidation by a metalloporphyrin, Mn-TMPyP, associated to KHSO(5) on oligonucleotides. We found that the three major products of guanine oxidation are formed by independent reaction routes. The oxidized guanidinohydantoin (1) and the proposed spiro compound 3 derivatives are not precursors of imidazolone lesion (Iz). These guanine lesions as well as their degradation products, may account for non-detected guanine oxidation products on oxidatively damaged DNA.

  17. Density Functional Study of the Influence of C5 Cytosine Substitution in Base Pairs with Guanine

    PubMed Central

    Moser, Adam; Guza, Rebecca; Tretyakova, Natalia; York, Darrin M.

    2009-01-01

    The present study employs density-functional electronic structure methods to investigate the effect of chemical modification at the C5 position of cytosine. A series of experimentally motivated chemical modifications are considered, including alkyl, halogen, aromatic, fused ring, and strong σ and π withdrawing functional groups. The effect of these modifications on cytosine geometry, electronic structure, proton affinities, gas phase basicities, cytosine-guanine base-pair hydrogen bond network and corresponding nucleophilicity at guanine are examined. Ultimately, these results play a part in dissecting the effect of endogenous cytosine methylation on the reactivity of neighboring guanine toward carcinogens and DNA alkylating agents. PMID:19890472

  18. Theoretical Study of Oxidation of Guanine by Singlet Oxygen (¹Δg) and Formation of Guanine:Lysine Cross-Links.

    PubMed

    Thapa, Bishnu; Munk, Barbara H; Burrows, Cynthia J; Schlegel, H Bernhard

    2017-03-01

    Oxidation of guanine in the presence of lysine can lead to guanine-lysine cross-links. The ratio of the C-4, C-5 and C-8 crosslinks depends on the manner of oxidation. Type II photosensitizers such as Rose Bengal and methylene blue can generate singlet oxygen, which leads to a different ratio of products than oxidation by type I photosensitizers or by one electron oxidants. Modeling reactions of singlet oxygen can be quite challenging. Reactions have been explored using CASSCF, NEVPT2, DFT, CCSD(T), BD(T) calculations with SMD implicit solvation. The spin contaminations in open-shell calculations were corrected by Yamaguchi's approximate spin projection method. The addition of singlet oxygen to guanine to form guanine endoperoxide proceeds step-wise via a zwitterionic peroxyl intermediate. The subsequent barrier for ring closure is smaller than the initial barrier for singlet oxygen addition. Ring opening of the endoperoxide by protonation at C4-O is followed by loss of a proton from C-8 and dehydration to produce 8-oxoGox. The addition of lysine (modelled by methylamine) or water across the C5-N7 double bond of 8-oxoGox is followed by acyl migration to form the final spiro products. The barrier for methylamine addition is significantly lower than for water addition and should be the dominant reaction channel. These results are in good agreement with the experimental results for the formation of guanine-lysine cross-links via oxidation by type II photosensitizers.

  19. A9145, a New Adenine-Containing Antifungal Antibiotic: Fermentation

    PubMed Central

    Boeck, L. D.; Clem, G. M.; Wilson, M. M.; Westhead, J. E.

    1973-01-01

    A9145 is a basic, water-soluble, antifungal antibiotic which is produced in a complex organic medium by Streptomyces griseolus. The metabolite has a molecular weight of 510, and contains adenine as well as sugar hydroxyl and amino groups. Although glucose, fructose, glucose polymers, and some long-chain fatty acid methyl esters supported biosynthesis, oils were superior, with cottonseed oil being preferred. Several ions and salts, especially Co2+, PO43−, and CaCO3, were stimulatory. Adenine, nucleosides, and some amino acids increased the accumulation of A9145 in shaken-flask fermentors. Enrichment of the culture medium with tyrosine afforded maximal enhancement of antibiotic production in both flask and tank fermentors. Control of the dissolved O2 level was also critical, the optimal concentration being 3 × 10−2 to 4.5 × 10−2 μmole of O2/ml. Optimization of various fermentation parameters increased antibiotic titers approximately 135-fold in shaken flask fermentors and 225-fold in stirred vessels. PMID:4208279

  20. A9145, a new adenine-containing antifungal antibiotic: fermentation.

    PubMed

    Boeck, L D; Clem, G M; Wilson, M M; Westhead, J E

    1973-01-01

    A9145 is a basic, water-soluble, antifungal antibiotic which is produced in a complex organic medium by Streptomyces griseolus. The metabolite has a molecular weight of 510, and contains adenine as well as sugar hydroxyl and amino groups. Although glucose, fructose, glucose polymers, and some long-chain fatty acid methyl esters supported biosynthesis, oils were superior, with cottonseed oil being preferred. Several ions and salts, especially Co(2+), PO(4) (3-), and CaCO(3), were stimulatory. Adenine, nucleosides, and some amino acids increased the accumulation of A9145 in shaken-flask fermentors. Enrichment of the culture medium with tyrosine afforded maximal enhancement of antibiotic production in both flask and tank fermentors. Control of the dissolved O(2) level was also critical, the optimal concentration being 3 x 10(-2) to 4.5 x 10(-2) mumole of O(2)/ml. Optimization of various fermentation parameters increased antibiotic titers approximately 135-fold in shaken flask fermentors and 225-fold in stirred vessels.

  1. On the deactivation mechanisms of adenine-thymine base pair.

    PubMed

    Gobbo, João Paulo; Saurí, Vicenta; Roca-Sanjuán, Daniel; Serrano-Andrés, Luis; Merchán, Manuela; Borin, Antonio Carlos

    2012-04-05

    In this contribution, the multiconfigurational second-order perturbation theory method based on a complete active space reference wave function (CASSCF/CASPT2) is applied to study all possible single and double proton/hydrogen transfers between the nucleobases in the adenine-thymine (AT) base pair, analyzing the role of excited states with different nature [localized (LE) and charge transfer (CT)], and considering concerted as well as step-wise mechanisms. According to the findings, once the lowest excited states, localized in adenine, are populated during UV irradiation of the Watson-Crick base pair, the proton transfer in the N-O bridge does not require high energy in order to populate a CT state. The latter state will immediately relax toward a crossing with the ground state, which will funnel the system to either the canonical structure or the imino-enol tautomer. The base pair is also capable of repairing itself easily since the imino-enol species is unstable to thermal conversion.

  2. Nonselective enrichment for yeast adenine mutants by flow cytometry

    NASA Technical Reports Server (NTRS)

    Bruschi, C. V.; Chuba, P. J.

    1988-01-01

    The expression of certain adenine biosynthetic mutations in the yeast Saccharomyces cerevisiae results in a red colony color. This phenomenon has historically provided an ideal genetic marker for the study of mutation, recombination, and aneuploidy in lower eukaryotes by classical genetic analysis. In this paper, it is reported that cells carrying ade1 and/or ade2 mutations exhibit primary fluorescence. Based on this observation, the nonselective enrichment of yeast cultures for viable adenine mutants by using the fluorescence-activated cell sorter has been achieved. The advantages of this approach over conventional genetic analysis of mutation, recombination, and mitotic chromosomal stability include speed and accuracy in acquiring data for large numbers of clones. By using appropriate strains, the cell sorter has been used for the isolation of both forward mutations and chromosomal loss events in S. cerevisiae. The resolving power of this system and its noninvasiveness can easily be extended to more complex organisms, including mammalian cells, in which analogous metabolic mutants are available.

  3. Direct oxidation of guanine and 7,8-dihydro-8-oxoguanine in DNA by a high-valent chromium complex: a possible mechanism for chromate genotoxicity.

    PubMed

    Sugden, K D; Campo, C K; Martin, B D

    2001-09-01

    Intracellular reductive activation of the human carcinogen chromate, Cr(VI), is a necessary step in the formation of DNA lesions that lead to cancer. Reductive activation forms the transient metastable high-valent oxidation state of Cr(V) as a precursor to the final intracellularly stable oxidation state, Cr(III). In this study, we have used a model high-valent Cr(V) complex, N,N'-ethylenebis(salicylideneanimato)oxochromium(V), Cr(V)-Salen, to probe the mechanism of interaction between this oxidation state of chromium and DNA. This interaction was found to be specific toward the oxidation of the nucleic acid base guanine in unmodified single- and double-stranded oligonucleotides as measured by an increased level of DNA strand cleavage at these sites following piperidine treatment. Replacement of a single guanine residue in DNA with a more readily oxidized 7,8-dihydro-8-oxoguanine (8-oxo-G) base allowed for site-specific oxidation at this modified site within the DNA strand by the Cr(V)-Salen complex. HPLC and ESI-mass spectrometry were used to identify the modified guanine base lesions formed in the reaction of this high-valent chromium complex with the 8-oxo-G-containing DNA substrate. Two of these modified base lesions, identified as guanidinohydantoin and spiroiminodihydantoin, were found in the reaction of the Cr(V)-Salen complex with 8-oxo-G-modified DNA, while only one, spiroiminodihydantoin, was formed from oxidation of the 8-oxo-G nucleoside. A primer extension assay using the exo(-) Klenow fragment demonstrated polymerase arrest at the site of these base modifications as well as a high degree of misincorporation of adenine opposite the site of modification. These results suggest that mutations arising from G --> T transversions would predominate with these lesions. The mechanism of damage and base oxidation products for the interaction between high-valent chromium and DNA described herein may be relevant to the in vivo formation of DNA damage leading to

  4. Mechanistic aspects of hydration of guanine radical cations in DNA.

    PubMed

    Rokhlenko, Yekaterina; Cadet, Jean; Geacintov, Nicholas E; Shafirovich, Vladimir

    2014-04-23

    The mechanistic aspects of hydration of guanine radical cations, G(•+) in double- and single-stranded oligonucleotides were investigated by direct time-resolved spectroscopic monitoring methods. The G(•+) radical one-electron oxidation products were generated by SO4(•-) radical anions derived from the photolysis of S2O8(2-) anions by 308 nm laser pulses. In neutral aqueous solutions (pH 7.0), after the complete decay of SO4(•-) radicals (∼5 μs after the actinic laser flash) the transient absorbance of neutral guanine radicals, G(-H)(•) with maximum at 312 nm, is dominant. The kinetics of decay of G(-H)(•) radicals depend strongly on the DNA secondary structure. In double-stranded DNA, the G(-H)(•) decay is biphasic with one component decaying with a lifetime of ∼2.2 ms and the other with a lifetime of ∼0.18 s. By contrast, in single-stranded DNA the G(-H)(•) radicals decay monophasically with a ∼ 0.28 s lifetime. The ms decay component in double-stranded DNA is correlated with the enhancement of 8-oxo-7,8-dihydroguanine (8-oxoG) yields which are ∼7 greater than in single-stranded DNA. In double-stranded DNA, it is proposed that the G(-H)(•) radicals retain radical cation character by sharing the N1-proton with the N3-site of C in the [G(•+):C] base pair. This [G(-H)(•):H(+)C ⇆ G(•+):C] equilibrium allows for the hydration of G(•+) followed by formation of 8-oxoG. By contrast, in single-stranded DNA, deprotonation of G(•+) and the irreversible escape of the proton into the aqueous phase competes more effectively with the hydration mechanism, thus diminishing the yield of 8-oxoG, as observed experimentally.

  5. Inhibition of calcineurin by FK506 stimulates germinal vesicle breakdown of mouse oocytes in hypoxanthine-supplemented medium

    PubMed Central

    Wang, Li; Zhen, Yan-Hong; Liu, Xiao-Ming; Cao, Jing; Wang, Yan-Ling

    2017-01-01

    Calcineurin (CN) is a serine/threonine phosphatase which plays important roles in meiosis maturation in invertebrate oocytes; however, the role of CN in mouse oocytes is relatively unexplored. In this study, we examined the expression, localization and functional roles of CN in mouse oocytes and granulosa cells. The RT-PCR results showed that the β isoform of calcineurin A subunit (Cn A) expressed significantly higher than α and γ isoforms, and the expression of Cn Aβ mRNA obviously decreased in oocytes in which germinal vesicle breakdown (GVBD) occurred, while only B1 of calcineurin B subunit (Cn B) was detected in oocytes and stably expressed during oocytes maturation. The following fluorescence experiment showed that Cn A was mainly located in the nucleus of germinal vesicle (GV) stage oocytes and gruanlosa cells, and subsequently dispersed into the entire cytoplasm after GVBD. The decline of Cn A in oocytes suggested that it may play an important role in GVBD. To further clarify the role of calcineurin during meiotic maturation, FK506 (a calcineurin inhibitor) was used in the culture medium contained hypoxanthine (HX) which could keep mouse oocytes staying at GV stage. As expected, FK506 could induce a significant elevation of GVBD rate and increase the MPF level of denuded oocytes (DOs). Furthermore, FK506 could also play an induction role of GVBD of oocytes in COCs and follicles, and the process could be counteracted by MAPK kinase inhibitor (U0126). Above all, the results implied that calcineurin might play a crucial role in development of mouse oocytes and MPF and MAPK pathways are involved in this process. PMID:28243539

  6. Altered Turnover of Hypoxanthine Phosphoribosyltransferase in Erythroid Cells of Mice Expressing Hprt a and Hprt b Alleles

    PubMed Central

    Johnson, Gerald G.; Chapman, Verne M.

    1987-01-01

    We have previously shown that mice expressing Hprt a allele(s) have erythrocyte hypoxanthine phosphoribosyltransferase (HPRT) levels that are approximately 25-fold (Mus musculus castaneus) and 70-fold ( Mus spretus) higher than in mice that express the Hprt b allele (Mus musculus domesticus; C57BI/6J; C3H/HeHa), and that these differences in erythrocyte HPRT levels are due to differences in the turnover rates of the HPRT A and B proteins as reticulocytes mature to erythrocytes. We show here that: (1) the taxonomic subgroups of the genus Mus are essentially monomorphic for the occurrence of either the Hprt a or the Hprt b allele, with Hprt a being common in the aboriginal species (M. spretus, Mus hortulanus and Mus abbotti) and in several commensal species (Mus musculus musculus, M. m. castaneus, Mus musculus molossinus), while Hprt b is common in feral M. m. domesticus populations as well as in all inbred strains of mice tested; (2) in all these diverse Mus subgroups there is a strict association of Hprt a with high and Hprt b with low levels of erythrocyte HPRT; and, (3) the association between the occurrence of the Hprt a allele and elevated erythrocyte HPRT levels is retained following repeated backcrosses of wild-derived Hprt a allele(s) into the genetic background of inbred strains of mice with the Hprt b allele. Collectively, these observations indicate that the elevated and low levels of erythrocyte HPRT are specified by differences in the Hprt a and b structural genes. Since evidence indicates that Hprt a and b encode HPRT proteins which differ in primary structure, we infer that the structure of HPRT is an important factor in determining its sensitivity to turnover in mouse erythroid cells. Hprt a and b may provide a useful system of "normal" allelic gene products for identifying factors that participate in protein turnover during mouse reticulocyte maturation. PMID:3609725

  7. Adenine attenuates the Ca(2+) contraction-signaling pathway via adenine receptor-mediated signaling in rat vascular smooth muscle cells.

    PubMed

    Fukuda, Toshihiko; Kuroda, Takahiro; Kono, Miki; Hyoguchi, Mai; Tajiri, Satoshi; Tanaka, Mitsuru; Mine, Yoshinori; Matsui, Toshiro

    2016-09-01

    Our previous study demonstrated that adenine (6-amino-6H-purine) relaxed contracted rat aorta rings in an endothelial-independent manner. Although adenine receptors (AdeRs) are expressed in diverse tissues, aortic AdeR expression has not been ascertained. Thus, the aims of this study were to clarify the expression of AdeR in rat vascular smooth muscle cells (VSMCs) and to investigate the adenine-induced vasorelaxation mechanism(s). VSMCs were isolated from 8-week-old male Wistar-Kyoto rats and used in this study. Phosphorylation of myosin light chain (p-MLC) was measured by western blot. AdeR mRNA was detected by RT-PCR. Intracellular Ca(2+) concentration ([Ca(2+)]i) was measured by using Fura-2/AM. Vasorelaxant adenine (10-100 μM) significantly reduced p-MLC by angiotensin II (Ang II, 10 μM) in VSMCs (P < 0.05). We confirmed the expression of aortic AdeR mRNA and the activation of PKA in VSMCs through stimulation of AdeR by adenine by ELISA. Intracellular Ca(2+) concentration ([Ca(2+)]i) measurement demonstrated that adenine inhibits Ang II- and m-3M3FBS (PLC agonist)-induced [Ca(2+)]i elevation. In AdeR-knockdown VSMCs, PKA activation and p-MLC reduction by adenine were completely abolished. These results firstly demonstrated that vasorelaxant adenine can suppress Ca(2+) contraction signaling pathways via aortic AdeR/PKA activation in VSMCs.

  8. G-quartet type self-assembly of guanine functionalized single-walled carbon nanotubes

    NASA Astrophysics Data System (ADS)

    Singh, Prabhpreet; Venkatesh, V.; Nagapradeep, N.; Verma, Sandeep; Bianco, Alberto

    2012-03-01

    The simple strategy of linking guanine to single-walled carbon nanotubes (CNTs) through covalent functionalization permitted generation of the alignment of the nanotubes into lozenges reminiscent of guanine quartets (G-quartets) in the presence of potassium ions as observed by atomic force microscopy.The simple strategy of linking guanine to single-walled carbon nanotubes (CNTs) through covalent functionalization permitted generation of the alignment of the nanotubes into lozenges reminiscent of guanine quartets (G-quartets) in the presence of potassium ions as observed by atomic force microscopy. Electronic supplementary information (ESI) available: Experimental procedures for the synthesis and characterization of the precursors and MWCNT conjugates. See DOI: 10.1039/c2nr11849a

  9. The intrinsic stabilities and structures of alkali metal cationized guanine quadruplexes.

    PubMed

    Azargun, M; Jami-Alahmadi, Y; Fridgen, T D

    2017-01-04

    The structures and stabilities of self-assembled guanine quadruplexes, M(9eG)8(+) (M = Na, K, Rb, Cs; 9eG = 9-ethylguanine), have been studied in the gas phase by blackbody infrared radiative dissociation to determine the difference in the stabilizing effect of the alkali metal cations. The order of stabilities to decomposition was determined to be K(+) > Rb(+) > Cs(+) ≫ Na(+), which is consistent with the observation of K(+) being the ion of choice in guanine quadruplexes in nucleic acids. In the gas phase, the sodiated quadruplex was found to lose one 9eG at a time, whereas the quadruplexes of the heavier cations lost a neutral guanine tetrad. Vibrational spectroscopy on the gas-phase quadruplex ions was consistent with the structures in which the metal cations were sandwiched between two guanine tetrads. Electronic structure calculations are also used to compare with the observed stabilities and vibrational spectra.

  10. Analysis of guanine oxidation products in double-stranded DNA and proposed guanine oxidation pathways in single-stranded, double-stranded or quadruplex DNA.

    PubMed

    Morikawa, Masayuki; Kino, Katsuhito; Oyoshi, Takanori; Suzuki, Masayo; Kobayashi, Takanobu; Miyazawa, Hiroshi

    2014-02-10

    Guanine is the most easily oxidized among the four DNA bases, and some guanine-rich sequences can form quadruplex structures. In a previous study using 6-mer DNA d(TGGGGT), which is the shortest oligomer capable of forming quadruplex structures, we demonstrated that guanine oxidation products of quadruplex DNA differ from those of single-stranded DNA. Therefore, the hotooxidation products of double-stranded DNA (dsDNA) may also differ from that of quadruplex or single-stranded DNA, with the difference likely explaining the influence of DNA structures on guanine oxidation pathways. In this study, the guanine oxidation products of the dsDNA d(TGGGGT)/d(ACCCCA) were analyzed using HPLC and electrospray ionization-mass spectrometry (ESI-MS). As a result, the oxidation products in this dsDNA were identified as 2,5-diamino-4H-imidazol-4-one (Iz), 8-oxo-7,8-dihydroguanine (8oxoG), dehydroguanidinohydantoin (Ghox), and guanidinohydantoin (Gh). The major oxidation products in dsDNA were consistent with a combination of each major oxidation product observed in single-stranded and quadruplex DNA. We previously reported that the kinds of the oxidation products in single-stranded or quadruplex DNA depend on the ease of deprotonation of the guanine radical cation (G•+) at the N1 proton. Similarly, this mechanism was also involved in dsDNA. Deprotonation in dsDNA is easier than in quadruplex DNA and more difficult in single-stranded DNA, which can explain the formation of the four oxidation products in dsDNA.

  11. Renoprotective effects of aliskiren on adenine-induced tubulointerstitial nephropathy: possible underlying mechanisms.

    PubMed

    Hussein, Abdelaziz M; Malek, Hala Abdel; Saad, Mohamed-Ahdy

    2016-08-01

    The present study investigated the possible renoprotective effect of direct renin inhibitor (aliskiren) on renal dysfunctions, as well as its underlying mechanisms in rat model of adenine-induced tubulointerstitial nephropathy. Forty male Sprague-Dawley rats were randomized into 4 groups; normal group, aliskiren group (normal rats received 10 mg/kg aliskiren), adenine group (animals received high-adenine diet for 4 weeks and saline for 12 weeks), and adenine + aliskiren group (animals received adenine for 4 weeks and aliskiren 10 mg/kg for 12 weeks). It was found that adenine caused significant decrease in body mass, Hb, HR, serum Ca(2+), eNOS and nrf2 expression, GSH, and catalase in kidney tissues with significant increase in arterial blood pressure (ABP), serum creatinine, BUN, plasma renin activity (PRA), K(+) and P, urinary albumin excretion (UAE), caspase-3, and MDA (lipid peroxidation marker) in kidney tissues compared to normal group (p < 0.05). Administration of aliskiren caused significant improvement in all studied parameters compared to adenine group (p < 0.05). We concluded that aliskiren has renoprotective effect against adenine-induced nephropathy. This might be due to inhibition of PRA, attenuation of oxidative stress, activation of Nrf2 and eNOS genes, and suppression of caspase-3.

  12. Guanine nucleotides stimulate hydrolysis of phosphatidyl inositol bis phosphate in human myelin membranes

    SciTech Connect

    Boulias, C.; Moscarello, M.A. )

    1989-07-14

    Phosphodiesterase activity was stimulated in myelin membranes in the presence of guanine nucleotide analogues. This activity was reduced in myelin membranes which had been adenosine diphosphate ribosylated in the presence of cholera toxin which ADP-ribosylated three proteins of Mr 46,000, 43,000 and 18,500. Aluminum fluoride treatment of myelin had the same stimulatory effects on phosphodiesterase activity as did the guanine nucleotides.

  13. Chlamydial entry involves TARP binding of guanine nucleotide exchange factors.

    PubMed

    Lane, B Josh; Mutchler, Charla; Al Khodor, Souhaila; Grieshaber, Scott S; Carabeo, Rey A

    2008-03-01

    Chlamydia trachomatis attachment to cells induces the secretion of the elementary body-associated protein TARP (Translocated Actin Recruiting Protein). TARP crosses the plasma membrane where it is immediately phosphorylated at tyrosine residues by unknown host kinases. The Rac GTPase is also activated, resulting in WAVE2 and Arp2/3-dependent recruitment of actin to the sites of chlamydia attachment. We show that TARP participates directly in chlamydial invasion activating the Rac-dependent signaling cascade to recruit actin. TARP functions by binding two distinct Rac guanine nucleotide exchange factors (GEFs), Sos1 and Vav2, in a phosphotyrosine-dependent manner. The tyrosine phosphorylation profile of the sequence YEPISTENIYESI within TARP, as well as the transient activation of the phosphatidylinositol 3-kinase (PI3-K), appears to determine which GEF is utilized to activate Rac. The first and second tyrosine residues, when phosphorylated, are utilized by the Sos1/Abi1/Eps8 and Vav2, respectively, with the latter requiring the lipid phosphatidylinositol 3,4,5-triphosphate. Depletion of these critical signaling molecules by siRNA resulted in inhibition of chlamydial invasion to varying degrees, owing to a possible functional redundancy of the two pathways. Collectively, these data implicate TARP in signaling to the actin cytoskeleton remodeling machinery, demonstrating a mechanism by which C.trachomatis invades non-phagocytic cells.

  14. Fluorescence enhancement of DNA-silver nanoclusters from guanine proximity

    SciTech Connect

    Yeh, Hsin-chih; Sharma, Jaswinder; Yoo, Hyojong; Martinez, Jennifer S

    2010-01-01

    Oligonucleotide-templated, silver nanoclusters (DNA/Ag NCs) are a versatile set of fluorophores and have already been used for live cell imaging, detection of specific metal ions, and single-nucleotide variation identification. Compared to commonly used organic dyes, these fluorescent nanoclusters have much better photostability and are often a few times brighter. Owing to their small size, simple preparation, and biocompatibility (i.e. made of nontoxic metals), DNA/Ag NCs should find more applications in biological imaging and chemical detection in the years to come. While clearly promising as new fluorophores, DNA/Ag NCs possess a unique and poorly understood dynamic process not shared by organic dyes or photoluminescent nanocrystals - the conversion among different NC species due to silver oxidation/reduction or NC regrouping. While this environmental sensitivity can be viewed as a drawback, in the appropriate context, it can be used as a sensor or reporter. Often reversible, conversions among different NC species have been found to depend upon a number of factors, including time, temperature, oxygen and salt content. In this communication, we report significant fluorescence enhancement of DNA/Ag NCs via interactions with guanine-rich DNA sequences. Moreover, we demonstrated this property can be used for sensitive detection of specific target DNA from a human oncogene (i.e. Braf gene).

  15. Interaction of sulfanilamide and sulfamethoxazole with bovine serum albumin and adenine: Spectroscopic and molecular docking investigations

    NASA Astrophysics Data System (ADS)

    Rajendiran, N.; Thulasidhasan, J.

    2015-06-01

    Interaction between sulfanilamide (SAM) and sulfamethoxazole (SMO) with BSA and DNA base (adenine) was investigated by UV-visible, fluorescence, cyclic voltammetry and molecular docking studies. Stern-Volmer fluorescence quenching constant (Ka) suggests SMO is more quenched with BSA/adenine than that of SAM. The distance r between donor (BSA/adenine) and acceptor (SAM and SMO) was obtained according to fluorescence resonance energy transfer (FRET). The results showed that hydrophobic forces, electrostatic interactions, and hydrogen bonds played vital roles in the SAM and SMO with BSA/adenine binding interaction. During the interaction, sulfa drugs could insert into the hydrophobic pocket, where the non-radioactive energy transfer from BSA/adenine to sulfa drugs occurred with high possibility. Cyclic voltammetry results suggested that when the drug concentration is increased, the anodic electrode potential deceased. The docking method indicates aniline group is interacted with the BSA molecules.

  16. Electrochemical characterization of redox polymer modified electrode developed for monitoring of adenine.

    PubMed

    Kuralay, Filiz; Erdem, Arzum; Abacı, Serdar; Ozyörük, Haluk

    2013-05-01

    Electrochemical characterization of redox polymer for monitoring of adenine was described in this study using poly(vinylferrocenium) (PVF(+)) modified platinum (Pt) electrode. Scanning electron microscope (SEM) was used for the surface characterization. The electrochemical behaviors of polymer modified and adenine immobilized polymer modified electrodes were investigated by using cyclic voltammetry (CV) and differential pulse voltammetry (DPV). In order to obtain more sensitive and improved electrochemical signals, analytical parameters such as the effects of polymeric film thickness, immobilization time of adenine, pH and adenine concentration were examined on the response of the polymer modified electrode. Alternating current (AC) impedance spectroscopy was used for the characterization of polymer modified and adenine immobilized polymer modified electrodes. The effect of possible interferents on the response of the electrode was examined.

  17. Interaction of sulfanilamide and sulfamethoxazole with bovine serum albumin and adenine: spectroscopic and molecular docking investigations.

    PubMed

    Rajendiran, N; Thulasidhasan, J

    2015-06-05

    Interaction between sulfanilamide (SAM) and sulfamethoxazole (SMO) with BSA and DNA base (adenine) was investigated by UV-visible, fluorescence, cyclic voltammetry and molecular docking studies. Stern-Volmer fluorescence quenching constant (Ka) suggests SMO is more quenched with BSA/adenine than that of SAM. The distance r between donor (BSA/adenine) and acceptor (SAM and SMO) was obtained according to fluorescence resonance energy transfer (FRET). The results showed that hydrophobic forces, electrostatic interactions, and hydrogen bonds played vital roles in the SAM and SMO with BSA/adenine binding interaction. During the interaction, sulfa drugs could insert into the hydrophobic pocket, where the non-radioactive energy transfer from BSA/adenine to sulfa drugs occurred with high possibility. Cyclic voltammetry results suggested that when the drug concentration is increased, the anodic electrode potential deceased. The docking method indicates aniline group is interacted with the BSA molecules.

  18. Gender differences in adenine-induced chronic kidney disease and cardiovascular complications in rats.

    PubMed

    Diwan, Vishal; Small, David; Kauter, Kate; Gobe, Glenda C; Brown, Lindsay

    2014-12-01

    Gender contributes to differences in incidence and progression of chronic kidney disease (CKD) and associated cardiovascular disease. To induce kidney damage in male and female Wistar rats (n = 12/group), a 0.25% adenine diet for 16 wk was used. Kidney function (blood urea nitrogen, plasma creatinine, proteinuria) and structure (glomerular damage, tubulointerstitial atrophy, fibrosis, inflammation); cardiovascular function (blood pressure, ventricular stiffness, vascular responses, echocardiography) and structure (cardiac fibrosis); plasma testosterone and estrogen concentrations; and protein expression for oxidative stress [heme oxygenase-1, inflammation (TNF-α), fibrosis (transforming growth factor-β), ERK1/2, and estrogen receptor-α (ER-α)] were compared in males and females. Adenine-fed females had less decline in kidney function than adenine-fed males, although kidney atrophy, inflammation, and fibrosis were similar. Plasma estrogen concentrations increased and plasma testosterone concentrations decreased in adenine-fed males, with smaller changes in females. CKD-associated molecular changes in kidneys were more pronounced in males than females except for expression of ER-α in the kidney, which was completely suppressed in adenine-fed males but unchanged in adenine-fed females. Both genders showed increased blood pressure, ventricular stiffness, and cardiac fibrosis with the adenine diet. Cardiovascular changes with adenine were similar in males and females, except males developed concentric, and females eccentric cardiac hypertrophy. In hearts from adenine-fed male and female rats, expression of ER-α and activation of the ERK1/2 pathway were increased, in part explaining changes in cardiac hypertrophy. In summary, adenine-induced kidney damage may be increased in males due to the suppression of ER-α.

  19. Ultraviolet absorption and luminescence of matrix-isolated adenine

    SciTech Connect

    Polewski, K.; Sutherland, J.; Zinger, D.; Trunk, J.

    2011-10-01

    We have investigated the absorption, the fluorescence and phosphorescence emission and the fluorescence lifetimes of adenine in low-temperature argon and nitrogen matrices at 15 K. Compared to other environments the absorption spectrum shows higher intensity at the shortest wavelengths, and a weak apparent absorption peak is observed at 280 nm. The resolved fluorescence excitation spectrum has five peaks at positions corresponding to those observed in the absorption spectrum. The position of the fluorescence maximum depends on the excitation wavelength. Excitation below 220 nm displays a fluorescence maximum at 305 nm, while for excitations at higher wavelengths the maximum occurs at 335 nm. The results suggest that multiple-emission excited electronic states are populated in low-temperature gas matrices. Excitation at 265 nm produces a phosphorescence spectrum with a well-resolved vibrational structure and a maximum at 415 nm. The fluorescence decays corresponding to excitation at increasing energy of each resolved band could be fit with a double exponential, with the shorter and longer lifetimes ranging from 1.7 to 3.3 ns and from 12 to 23 ns, respectively. Only for the excitation at 180 nm one exponential is required, with the calculated lifetimes of 3.3 ns. The presented results provide an experimental evidence of the existence of multiple site-selected excited electronic states, and may help elucidate the possible deexcitation pathways of adenine. The additional application of synchrotron radiation proved to result in a significant enhancement of the resolution and spectral range of the phenomena under investigation.

  20. Flavin Adenine Dinucleotide Structural Motifs: From Solution to Gas Phase

    PubMed Central

    2015-01-01

    Flavin adenine dinucleotide (FAD) is involved in important metabolic reactions where the biological function is intrinsically related to changes in conformation. In the present work, FAD conformational changes were studied in solution and in gas phase by measuring the fluorescence decay time and ion-neutral collision cross sections (CCS, in a trapped ion mobility spectrometer, TIMS) as a function of the solvent conditions (i.e., organic content) and gas-phase collisional partner (i.e., N2 doped with organic molecules). Changes in the fluorescence decay suggest that FAD can exist in four conformations in solution, where the abundance of the extended conformations increases with the organic content. TIMS-MS experiments showed that FAD can exist in the gas phase as deprotonated (M = C27H31N9O15P2) and protonated forms (M = C27H33N9O15P2) and that multiple conformations (up to 12) can be observed as a function of the starting solution for the [M + H]+ and [M + Na]+molecular ions. In addition, changes in the relative abundances of the gas-phase structures were observed from a “stack” to a “close” conformation when organic molecules were introduced in the TIMS cell as collision partners. Candidate structures optimized at the DFT/B3LYP/6-31G(d,p) were proposed for each IMS band, and results showed that the most abundant IMS band corresponds to the most stable candidate structure. Solution and gas-phase experiments suggest that the driving force that stabilizes the different conformations is based on the interaction of the adenine and isoalloxazine rings that can be tailored by the “solvation” effect created with the organic molecules. PMID:25222439

  1. Identification of N2-(1-carboxyethyl)guanine (CEG) as a guanine advanced glycosylation end product.

    PubMed

    Papoulis, A; al-Abed, Y; Bucala, R

    1995-01-17

    Reducing sugars such as glucose react nonenzymatically with protein amino groups to initiate a posttranslational modification process known as advanced glycosylation. Nucleotide bases also participate in advanced glycosylation reactions, producing DNA-linked advanced glycosylation endproducts (AGEs) that cause mutations and DNA transposition. Although several protein-derived AGEs have been isolated and structurally characterized, AGE-modified nucleotides have not yet been reported. We systematically examined the reactivities of the model nucleotide bases 9-methylguanine (9-mG), 9-methyladenine (9-mA), and 1-methylcytosine (1-mC) toward glucose and several glucose-derived reactants. In "fast" reactions performed at refluxing temperature and physiological pH, 1 equiv of nucleotide base was reacted with 10 equiv of D-glucose, D-glucose 6-phosphate (G-6-P), D-glucose 6-phosphate/lysine (G-6-P/Lys), the Schiff base 1-n-propylamino-N-D-glucoside (SB), or the Amadori product 1-n-propylamino-N-D-fructose (AP). In every reaction involving 9-mG, N2-(1-carboxyethyl)-9-methylguanine (CEmG) was a major product which was produced. N2-(1-carboxyethyl)-9-methylguanine also formed from 9-mG and AP in long-term incubations performed at 37 degrees C. Direct treatment of 9-mG with methylglyoxal (MG), a Maillard reaction propagator that forms from the decomposition of AP, also produced CEmG in high yield. N2-(1-Carboxyethyl)-9-methylguanine appears to result from the nucleophilic addition of the primary amino group of guanine to the ketone group of MG followed by an intramolecular rearrangement. Methylglyoxal is a known prokaryotic mutagen and was shown additionally to be mutagenic in a eukaryotic shuttle vector assay system.(ABSTRACT TRUNCATED AT 250 WORDS)

  2. An HPLC method for determination of inosine and hypoxanthine in human plasma from healthy volunteers and patients presenting with potential acute cardiac ischemia.

    PubMed

    Farthing, Don; Sica, Domenic; Gehr, Todd; Wilson, Bill; Fakhry, Itaf; Larus, Terri; Farthing, Christine; Karnes, H Thomas

    2007-07-01

    A simple and sensitive high-performance liquid chromatography (HPLC) method utilizing ultraviolet (UV) detection was developed for the determination of inosine and hypoxanthine in human plasma. For component separation, a monolithic C(18) column at a flow rate of 1.0 mL/min with an aqueous mobile phase of trifluoroacetic acid (0.1% TFA in deionized water pH 2.2, v/v) and methanol gradient was used. The method employed a one-step sample preparation utilizing centrifugal filtration with high component recoveries (approximately 98%) from plasma, which eliminated the need of an internal standard. The method demonstrated excellent linearity (0.25-5 microg/mL, R>0.9990) for both inosine and hypoxanthine with detection limits of 100 ng/mL. This simple and cost effective method was utilized to evaluate potential endogenous plasma biomarker(s), which may aid hospital emergency personnel in the early detection of acute cardiac ischemia in patients presenting with non-traumatic chest pain.

  3. Slow deactivation channels in UV-photoexcited adenine DNA.

    PubMed

    Chen, Xuebo; Fang, Weihai; Wang, Haobin

    2014-03-07

    The molecular mechanism for removing the excess energy in DNA bases is responsible for the high photostability of DNA and is thus the subject of intense theoretical/computational investigation. To understand why the excited state decay of the stacked bases is significantly longer than that of the monomers, we carried out electronic structure calculations on an adenine monomer and an aqueous (dA)5 oligonucleotide employing the CASPT2//CASSCF and CASPT2//CASSCF/AMBER levels of theory. The newly-found bright excited state pair Sstack1((1)ππ*) and Sstack2((1)ππ*) of d(A)5, originated from base stacking, is of intra-base charge transfer nature and occurs in different stacked bases with charge transfer along opposite directions. Two slow deactivation channels of d(A)5 were proposed as a result of the sizable barriers along the relaxation paths starting from the FC point of the Sstack1((1)ππ*) state. The SN1P((1)nπ*) state of d(A)5 serves as an intermediate state in one relaxation channel, to which a nonadiabatic decay from the Sstack1((1)ππ*) state occurs in an energy degeneracy region. A relatively high barrier in this state is found and attributed to the steric hindrance of the DNA environment due to the large NH2 group twisting, which gives a weak and red-shifted fluorescence. Another direct relaxation channel, induced by the C2-H2 bond twisting motion, is found to go through a conical intersection between the Sstack1((1)ππ*) and the ground state. The barrier found here enables fluorescence from the Sstack1((1)ππ*) state and may explain the bright state emission observed in the fluorescence upconversion measurements. The inter-molecular SCT((1)ππ*) state may be involved in the slow relaxation process of the photoexcited adenine oligomers through efficient internal conversion to the intra-base Sstack1((1)ππ*) state.

  4. Regulation of IMP dehydrogenase gene expression by its end products, guanine nucleotides.

    PubMed Central

    Glesne, D A; Collart, F R; Huberman, E

    1991-01-01

    To study the regulation of IMP dehydrogenase (IMPDH), the rate-limiting enzyme of guanine nucleotide biosynthesis, we examined the effects of nucleosides, nucleotides, nucleotide analogs, or the IMPDH inhibitor mycophenolic acid (MPA) on the steady-state levels of IMPDH mRNA. The results indicated that IMPDH gene expression is regulated inversely by the intracellular level of guanine ribonucleotides. We have shown that treatment with guanosine increased the level of cellular guanine ribonucleotides and subsequently reduced IMPDH steady-state mRNA levels in a time- and dose-dependent manner. Conversely, MPA treatment diminished the level of guanine ribonucleotides and increased IMPDH mRNA levels. Both of these effects on the steady-state level of IMPDH mRNA could be negated by cotreatment with guanosine and MPA. The down regulation of IMPDH gene expression by guanosine or its up regulation by MPA was not due to major changes in transcriptional initiation and elongation or mRNA stability in the cytoplasm but rather was due to alterations in the levels of the IMPDH mRNA in the nucleus. These results suggest that IMPDH gene expression is regulated by a posttranscriptional, nuclear event in response to fluctuations in the intracellular level of guanine ribonucleotides. Images PMID:1717828

  5. Theoretical Study of the Photophysics of 8-Vinylguanine, an Isomorphic Fluorescent Analogue of Guanine.

    PubMed

    Kochman, Michał A; Pola, Martina; Miller, R J Dwayne

    2016-08-11

    Paving the way for the application of the algebraic-diagrammatic construction scheme of second-order (ADC(2)) to systems based on the guanine chromophore, we demonstrate the this excited-state electronic structure method provides a realistic description of the photochemistry of 9H-guanine, in close agreement with the benchmark provided by the CASPT2 method. We then proceed to apply the ADC(2) method to the photochemistry of 8-vinylguanine (8vG), a minimally modified analogue of guanine which, unlike the naturally occurring nucleobase, displays intense fluorescence, indicative of a much longer-lived excited electronic state. The emissive electronic state of 8vG is identified as an ππ*-type intramolecular charge transfer (ICT) state, in which a charge of roughly -0.2 e is transferred from the guanine moiety onto the vinyl substituent. The main radiationless deactivation pathway competing with fluorescence is predicted to involve the molecule leaving the minimum on the ICT ππ* state, and reaching a region of the S1 adiabatic state where it resembles the La ππ* state of unmodified 9H-guanine. The topology of the La ππ* region of the S1 state favors subsequent internal conversion at a crossing seam with the ground electronic state. The sensitivity of this process to environment polarity may explain the experimentally observed fluorescence quenching of 8vG upon incorporation in single- and double-stranded DNA.

  6. Control of self-assembled 2D nanostructures by methylation of guanine.

    PubMed

    Bald, Ilko; Wang, Yao-guang; Dong, Mingdong; Rosen, Christian B; Ravnsbaek, Jens B; Zhuang, Gui-lin; Gothelf, Kurt V; Wang, Jian-guo; Besenbacher, Flemming

    2011-04-04

    Methylation of DNA nucleobases is an important control mechanism in biology applied, for example, in the regulation of gene expression. The effect of methylation on the intermolecular interactions between guanine molecules is studied through an interplay between scanning tunneling microscopy (STM) and density functional theory with empirical dispersion correction (DFT-D). The present STM and DFT-D results show that methylation of guanine can have subtle effects on the hydrogen-bond strength with a strong dependence on the position of methylation. It is demonstrated that the methylation of DNA nucleobases is a precise means to tune intermolecular interactions and consequently enables very specific recognition of DNA methylation by enzymes. This scheme is used to generate four different types of artificial 2D nanostructures from methylated guanine. For instance, a 2D guanine windmill motif that is stabilized by cooperative hydrogen bonding is revealed. It forms by self-assembly on a graphite surface under ambient conditions at the liquid-solid interface when the hydrogen-bonding donor at the N1 site of guanine is blocked by a methyl group.

  7. Guanine-based structural coloration as an indicator of oxidative stress in a cichlid fish.

    PubMed

    Cahn, Matthew D; Brown, Alexandria C; Clotfelter, Ethan D

    2015-07-01

    Vertebrate pigmentation is known to be influenced by oxidative stress, but few studies have tested the hypothesis that structural coloration can be similarly affected. We tested whether fish iridophores, which produce structural color using guanine stacks, might be affected by the prooxidant-antioxidant balance of the animal. Specifically, we hypothesized that convict cichlids (Amatitlania nigrofasciata) metabolize guanine present in iridophores to uric acid, an antioxidant, in response to oxidative damage. We used Hunter's contrast gloss and high performance liquid chromatography to determine whether dietary guanine supplementation allows fish to maintain their structural coloration despite oxidative stress induced via ultraviolet-B (UV-B) radiation. We found that dietary guanine was associated with greater skin gloss, and that exposure to UV-B light reduced glossiness. UV-B exposure did not increase oxidative damage (acrolein) or total antioxidant capacity in the skin or liver. Our experiment did not detect effects of dietary guanine or UV-B light on uric acid, but uric acid was positively related to antioxidant capacity. Our results support the hypothesis that structural color in fish may be altered by environmental stressors such as exposure to UV light, and highlight the need for future studies to consider the role of iridophores in condition-dependent visual signaling.

  8. Label-free detection of telomerase activity using guanine electrochemical oxidation signal.

    PubMed

    Eskiocak, Ugur; Ozkan-Ariksoysal, Dilsat; Ozsoz, Mehmet; Oktem, Huseyin Avni

    2007-11-15

    Telomerase is an important biomarker for cancer cells and its activation in 85% of all cancer types confers a clinical diagnostic value. A label-free electrochemical assay based on guanine oxidation signal to measure telomerase activity is described. This developed technology combined with a disposable sensor, carbon graphite electrode (CGE), and differential pulse voltammetry (DPV) was performed by using PCR amplicons with/without telomeric repeats as the guanine oxidation signal observed at +1.0 V measured after the immobilization of PCR products. Guanine oxidation signal was chosen as a measure of telomerase activity because a substantial increase in the number of guanines was introduced by the action of telomerase which adds hexameric repeats (TTAGGG)n that contain 50% guanine. The developed assay was shown to specifically measure telomerase activity from cell extracts, and elongation rates increased linearly in a concentration dependent manner. Telomerase activity could be detected in cell extracts containing as low as 100 ng/microL of protein. All of the electrochemical measurements were also confirmed with the conventional TRAP-silver staining assay. Rapidity, simplicity, and the label-free nature of the developed assay make it suitable for practical use in quantitative determination of telomerase activity from clinical samples for diagnosis of cancer.

  9. Reduction of electron deficient guanine radical species in plasmid DNA by tyrosine derivatives.

    PubMed

    Tsoi, Mandi; Do, Trinh T; Tang, Vicky J; Aguilera, Joseph A; Milligan, Jamie R

    2010-06-07

    Guanine bases are the most easily oxidized sites in DNA and therefore electron deficient guanine radical species are major intermediates in the direct effect of ionizing radiation (ionization of the DNA itself) on DNA as a consequence of hole migration to guanine. As a model for this process we have used gamma-irradiation in the presence of thiocyanate ions to generate single electron oxidized guanine radicals in a plasmid target in aqueous solution. The stable species formed from these radicals can be detected and quantified by the formation of strand breaks in the plasmid after a post-irradiation incubation using a suitable enzyme. If a tyrosine derivative is also present during irradiation, the production of guanine oxidation products is decreased by electron transfer from tyrosine to the intermediate guanyl radical species. By using cationic tyrosine containing ligands we are able to observe this process when the tyrosine is electrostatically bound to the plasmid. The driving force dependence of this reaction was determined by comparing the reactivity of tyrosine with its 3-nitro analog. The results imply that the electron transfer reaction is coupled to a proton transfer. The experimental conditions used in this model system provide a reasonable approximation to those involved in the radioprotection of DNA by tightly bound proteins in chromatin.

  10. Guanine derivatives modulate L-glutamate uptake into rat brain synaptic vesicles.

    PubMed

    Tasca, Carla I; Santos, Tiago G; Tavares, Rejane G; Battastini, Ana M O; Rocha, João B T; Souza, Diogo O

    2004-05-01

    Glutamate uptake into synaptic vesicles is driven by a proton electrochemical gradient generated by a vacuolar H(+)-ATPase and stimulated by physiological concentrations of chloride. This uptake plays an important role in glutamatergic transmission. We show here that vesicular glutamate uptake is selectively inhibited by guanine derivatives, in a time- and concentration-dependent manner. Guanosine, GMP, GDP, guanosine-5'-O-2-thiodiphosphate, GTP, or 5'-guanylylimidodiphosphate (GppNHp) inhibited glutamate uptake in 1.5 and 3 min incubations, however, when incubating for 10 min, only GTP or GppNHp displayed such inhibition. By increasing ATP concentrations, the inhibitory effect of GTP was no longer observed, but GppNHp still inhibited glutamate uptake. In the absence of ATP, vesicular ATPase can hydrolyze GTP in order to drive glutamate uptake. However, 5mM GppNHp inhibited ATP hydrolysis by synaptic vesicle preparations. GTP or GppNHp decreased the proton electrochemical gradient, whereas the other guanine derivatives did not. Glutamate saturation curves were assayed in order to evaluate the specificity of inhibition of the vesicular glutamate carrier by the guanine derivatives. The maximum velocity of the initial rate of glutamate uptake was decreased by all guanine derivatives. These results indicate that, although GppNHp can inhibit ATPase activity, guanine derivatives are more likely to be acting through interaction with vesicular glutamate carrier.

  11. Design of laser pulses for selective vibrational excitation of the N6-H bond of adenine and adenine-thymine base pair using optimal control theory.

    PubMed

    Sharma, Sitansh; Sharma, Purshotam; Singh, Harjinder; Balint-Kurti, Gabriel G

    2009-06-01

    Time dependent quantum dynamics and optimal control theory are used for selective vibrational excitation of the N6-H (amino N-H) bond in free adenine and in the adenine-thymine (A-T) base pair. For the N6-H bond in free adenine we have used a one dimensional model while for the hydrogen bond, N6-H(A)...O4(T), present in the A-T base pair, a two mathematical dimensional model is employed. The conjugate gradient method is used for the optimization of the field dependent cost functional. Optimal laser fields are obtained for selective population transfer in both the model systems, which give virtually 100% excitation probability to preselected vibrational levels. The effect of the optimized laser field on the other hydrogen bond, N1(A)...H-N3(T), present in A-T base pair is also investigated.

  12. DNA methylation on N6-adenine in C. elegans

    PubMed Central

    Greer, Eric Lieberman; Blanco, Mario Andres; Gu, Lei; Sendinc, Erdem; Liu, Jianzhao; Aristizábal-Corrales, David; Hsu, Chih-Hung; Aravind, L.; He, Chuan; Shi, Yang

    2015-01-01

    Summary In mammalian cells, DNA methylation on the 5th position of cytosine (5mC) plays an important role as an epigenetic mark. However, DNA methylation was considered to be absent in C. elegans because of the lack of detectable 5mC as well as homologs of the cytosine DNA methyltransferases. Here, using multiple approaches, we demonstrate the presence of adenine N6-methylation (6mA) in C. elegans DNA. We further demonstrate that this modification increases trans-generationally in a paradigm of epigenetic inheritance. Importantly, we identify a DNA demethylase, NMAD-1, and a potential DNA methyltransferase, DAMT-1, which regulate 6mA levels and crosstalk between methylation of histone H3K4me2 and 6mA, and control the epigenetic inheritance of phenotypes associated with the loss of the H3K4me2 demethylase spr-5. Together, these data identify a DNA modification in C. elegans and raise the exciting possibility that 6mA may be a carrier of heritable epigenetic information in eukaryotes. PMID:25936839

  13. Radiolysis of aqueous adenine (vitamin B4) and 8-hydroxyadenine

    NASA Astrophysics Data System (ADS)

    Hartmann, J.; Quint, R. M.; Getoff, N.

    2007-05-01

    The radiolysis of adenine (vitamin B4) was studied in aqueous solution (pH˜7.4) saturated either with argon (operating radicals: 44% e -aq, 46% OH, 10% H) or with air (46% OH, 54% O 2rad - ) and with N 2O (90% OH, 10% H), respectively. The obtained initial Gi-values are: 0.88, 1.16 and 1.45. As main radiolytic product was determined 8-hydroxyadenine (8-HOA), whose yield depends on the OH concentration in the reacting media. Hence, under the same experimental conditions the Gi-values are in media saturated with argon: 0.1, in air: 0.15 and in N 2O: 0.29. In aerated solution also a mixture of aldehydes as well as of carboxylic acids were formed, but they were not identified. 8-HOA is of some biological interest; therefore, its radiolysis was also investigated under the same conditions. The determined Gi(-8HOA)-values were in airfree solution negligible, in aerated solutions: 3.1 and in the presence of N 2O: 4.0. For explanation of the product formation some probable reaction mechanisms were given.

  14. The solute specificity profiles of nucleobase cation symporter 1 (NCS1) from Zea mays and Setaria viridis illustrate functional flexibility.

    PubMed

    Rapp, Micah; Schein, Jessica; Hunt, Kevin A; Nalam, Vamsi; Mourad, George S; Schultes, Neil P

    2016-03-01

    The solute specificity profiles (transport and binding) for the nucleobase cation symporter 1 (NCS1) proteins, from the closely related C4 grasses Zea mays and Setaria viridis, differ from that of Arabidopsis thaliana and Chlamydomonas reinhardtii NCS1. Solute specificity profiles for NCS1 from Z. mays (ZmNCS1) and S. viridis (SvNCS1) were determined through heterologous complementation studies in NCS1-deficient Saccharomyces cerevisiae strains. The four Viridiplantae NCS1 proteins transport the purines adenine and guanine, but unlike the dicot and algal NCS1, grass NCS1 proteins fail to transport the pyrimidine uracil. Despite the high level of amino acid sequence similarity, ZmNCS1 and SvNCS1 display distinct solute transport and recognition profiles. SvNCS1 transports adenine, guanine, hypoxanthine, cytosine, and allantoin and competitively binds xanthine and uric acid. ZmNCS1 transports adenine, guanine, and cytosine and competitively binds, 5-fluorocytosine, hypoxanthine, xanthine, and uric acid. The differences in grass NCS1 profiles are due to a limited number of amino acid alterations. These amino acid residues do not correspond to amino acids essential for overall solute and cation binding or solute transport, as previously identified in bacterial and fungal NCS1, but rather may represent residues involved in subtle solute discrimination. The data presented here reveal that within Viridiplantae, NCS1 proteins transport a broad range of nucleobase compounds and that the solute specificity profile varies with species.

  15. Spin-dependent electron transport in zinc- and manganese-doped adenine molecules

    SciTech Connect

    Simchi, Hamidreza; Esmaeilzadeh, Mahdi Mazidabadi, Hossein

    2014-01-28

    The spin-dependent electron transport properties of zinc- and manganese-doped adenine molecules connected to zigzag graphene leads are studied in the zero bias regime using the non-equilibrium Green's function method. The conductance of the adenine molecule increased and became spin-dependent when a zinc or manganese atom was doped into the molecules. The effects of a transverse electric field on the spin-polarization of the transmitted electrons were investigated and the spin-polarization was controlled by changing the transverse electric field. Under the presence of a transverse electric field, both the zinc- and manganese-doped adenine molecules acted as spin-filters. The maximum spin-polarization of the manganese-doped adenine molecule was greater than the molecule doped with zinc.

  16. Effect of intense magnetic fields on the convection of biogenic guanine crystals in aqueous solution

    NASA Astrophysics Data System (ADS)

    Iwasaka, M.; Mizukawa, Y.

    2015-05-01

    In this study, the basic magneto-optic properties of biogenic microcrystals in aqueous media were investigated. Microcrystals, mica plates, silica, and microcrystals from a diatom cell and biogenic guanine crystals from goldfish showed light scattering inhibition when the crystals were observed in water under a 5 T magnetic field and dark-field illumination. In particular, in 50% ethanol/water medium, convection of the biogenic guanine particle aggregates was reversibly inhibited when the microcrystal suspension was exposed to a 5 T magnetic field. Microscopic observation comparing the biogenic guanine crystals in water with 95% ethanol or 99% acetone revealed that light flickering on the surface of the crystals was affected by the surface interaction of the crystal with the surrounding medium. By considering both the magnetic orientation of the microcrystals and the possible interactions of crystals with the surrounding medium, a magnetically controllable fluidic tracer was suggested.

  17. Formation of the carboxamidine precursor of cyanuric acid from guanine oxidative lesion dehydro-guanidinohydantoin.

    PubMed

    Irvoas, Joris; Trzcionka, Jérôme; Pratviel, Geneviève

    2014-09-01

    DNA damage under oxidative stress leads to oxidation of guanine base. The identification of the resulting guanine lesions in cellular DNA is difficult due to the sensitivity of the primary oxidation products to hydrolysis and/or further oxidation. We isolated dehydroguanidino-hydantoin (DGh) (or oxidized guanidinohydantoin), a secondary oxidation product of guanine, and showed that this lesion reacts readily with nucleophiles such as asymmetric peroxides and transforms to 2,4,6-trioxo-1,3,5-triazinane-1-carboxamidine residue. Further hydrolysis of this intermediate leads to cyanuric acid and finally to urea residue. This work demonstrates a new possible pathway for the formation of the well-known carboxamidine precursor of cyanuric acid lesion.

  18. Rapid and simple G-quadruplex DNA aptasensor with guanine chemiluminescence detection.

    PubMed

    Cho, Sandy; Park, Lucienne; Chong, Richard; Kim, Young Teck; Lee, Ji Hoon

    2014-02-15

    Cost-effective and sensitive aptasensor with guanine chemiluminescence detection capable of simply quantifying thrombin in human serum was developed using thrombin aptamer (TBA), one of the G-quadruplex DNA aptamers, without expensive nanoparticles and complicated procedures. Guanines of G-quadruplex TBA-conjugated carboxyfluorescein (6-FAM) bound with thrombin do not react with 3,4,5-trimethoxylphenylglyoxal (TMPG) in the presence of tetra-n-propylammonium hydroxide (TPA), whereas guanines of free TBA- and TBA-conjugated 6-FAM immobilized on the surface of graphene oxide rapidly react with TMPG to emit light. Thus, guanine chemiluminescence in 5% human serum with thrombin was lower than that without thrombin when TBA-conjugated 6-FAM was added in two samples and incubated for 20 min. In other words, the brightness of guanine chemiluminescence was quenched due to the formation of G-quadruplex TBA-conjugated 6-FAM bound with thrombin in a sample. High-energy intermediate, capable of emitting dim light by itself, formed from the reaction between guanines of TBA and TMPG in the presence of TPA, transfers energy to 6-FAM to emit bright light based on the principle of chemiluminescence energy transfer (CRET). G-quadruplex TBA aptasensor devised using the rapid interaction between TBA-conjugated 6-FAM and thrombin quantified trace levels of thrombin without complicated procedures. The limit of detection (LOD = background + 3 × standard deviation) of G-quadruplex TBA aptasensor with good linear calibration curve, accuracy, precision, and recovery was as low as 12.3 nM in 5% human serum. Using the technology reported in this research, we expect that various types of G-quadruplex DNA aptasensors capable of specifically sensing a target molecule such as ATP, HIV, ochratoxin, potassium ions, and thrombin can be developed.

  19. Neutrophil gelatinase-associated lipocalin in a triphasic rat model of adenine-induced kidney injury.

    PubMed

    Gil, Amnon; Brod, Vera; Awad, Hoda; Heyman, Samuel N; Abassi, Zaid; Frajewicki, Victor

    2016-10-01

    The aim of this study is to investigate whether NGAL, given its advantages over traditional biomarkers, can be used to describe the dynamic characteristics of the renal tubulointerstitial insult caused by adenine. Subsequently, it will be possible to assess NGAL as a biomarker of any acute kidney injury, on top of chronic interstitial disease, if NGAL levels are stable through the chronic phase of our adenine model. Study group rats were fed an adenine diet, and control group rats were fed a regular diet only. Blood and urine samples for urea, creatinine and NGAL were drawn from each rat at the beginning of the study and after 1, 3, 4, 5, 6, 7 and 8 weeks. Kidney slices from these rats were stained with Hematoxylin-eosin (HE) and β-actin stainings. Serum urea, creatinine and NGAL levels and urinary NGAL/creatinine ratio in the study group were higher than baseline and than in the control group; these differences were statistically significant in some of the intervals. Tubulointerstitial changes and adenine crystals were evident in the study group rats. In the rats fed adenine, serum urea, creatinine and NGAL levels and urinary NGAL/creatinine ratio followed a triphasic pattern of kidney injury: an acute phase while on the adenine diet, a partial recovery phase after switching to the regular diet and a chronic kidney disease phase after stabilization of renal function. NGAL can serve a biomarker for acute kidney injury and possibly for chronic kidney disease in the tubulointerstitial rat model.

  20. Improved growth and stress tolerance in the Arabidopsis oxt1 mutant triggered by altered adenine metabolism.

    PubMed

    Sukrong, Suchada; Yun, Kil-Young; Stadler, Patrizia; Kumar, Charan; Facciuolo, Tony; Moffatt, Barbara A; Falcone, Deane L

    2012-11-01

    Plants perceive and respond to environmental stresses with complex mechanisms that are often associated with the activation of antioxidant defenses. A genetic screen aimed at isolating oxidative stress-tolerant lines of Arabidopsis thaliana has identified oxt1, a line that exhibits improved tolerance to oxidative stress and elevated temperature but displays no apparent deleterious growth effects under non-stress conditions. Oxt1 harbors a mutation that arises from the altered expression of a gene encoding adenine phosphoribosyltransferase (APT1), an enzyme that converts adenine to adenosine monophosphate (AMP), indicating a link between purine metabolism, whole-plant growth responses, and stress acclimation. The oxt1 mutation results in decreased APT1 expression that leads to reduced enzymatic activity. Correspondingly, oxt1 plants possess elevated levels of adenine. Decreased APT enzyme activity directly correlates with stress resistance in transgenic lines that ectopically express APT1. The metabolic alteration in oxt1 plants also alters the expression of several antioxidant defense genes and the response of these genes to oxidative challenge. Finally, it is shown that manipulation of adenine levels can induce stress tolerance to wild-type plants. Collectively, these results show that alterations in cellular adenine levels can trigger stress tolerance and improve growth, leading to increases in plant biomass. The results also suggest that adenine might play a part in the signals that modulate responses to abiotic stress and plant growth.

  1. Benchmark Thermochemistry for Biologically Relevant Adenine and Cytosine. A Combined Experimental and Theoretical Study.

    PubMed

    Emel'yanenko, Vladimir N; Zaitsau, Dzmitry H; Shoifet, Evgeni; Meurer, Florian; Verevkin, Sergey P; Schick, Christoph; Held, Christoph

    2015-09-17

    The thermochemical properties available in the literature for adenine and cytosine are in disarray. A new condensed phase standard (p° = 0.1 MPa) molar enthalpy of formation at T = 298.15 K was measured by using combustion calorimetry. New molar enthalpies of sublimation were derived from the temperature dependence of vapor pressure measured by transpiration and by the quarz-crystal microbalance technique. The heat capacities of crystalline adenine and cytosine were measured by temperature-modulated DSC. Thermodynamic data on adenine and cytosine available in the literature were collected, evaluated, and combined with our experimental results. Thus, the evaluated collection of data together with the new experimental results reported here has helped to resolve contradictions in the available enthalpies of formation. A set of reliable thermochemical data is recommended for adenine and cytosine for further thermochemical calculations. Quantum-chemical calculations of the gas phase molar enthalpies of formation of adenine and cytosine have been performed by using the G4 method and results were in excellent agreement with the recommended experimental data. The standard molar entropies of formation and the standard molar Gibbs functions of formation in crystal and gas state have been calculated. Experimental vapor-pressure data measured in this work were used to estimate pure-component PC-SAFT parameters. This allowed modeling solubility of adenine and cytosine in water over the temperature interval 278-310 K.

  2. Mechanisms of oxidation of guanine in DNA by carbonate radical anion, a decomposition product of nitrosoperoxycarbonate.

    PubMed

    Lee, Young Ae; Yun, Byeong Hwa; Kim, Seog K; Margolin, Yelena; Dedon, Peter C; Geacintov, Nicholas E; Shafirovich, Vladimir

    2007-01-01

    Peroxynitrite is produced during inflammation and combines rapidly with carbon dioxide to yield the unstable nitrosoperoxycarbonate, which decomposes (in part) to CO(3) (.-) and (.)NO(2) radicals. The CO(3) (.-) radicals oxidize guanine bases in DNA through a one-electron transfer reaction process that ultimately results in the formation of stable guanine oxidation products. Here we have explored these mechanisms, starting with a spectroscopic study of the kinetics of electron transfer from 20-22mer double-stranded oligonucleotides to CO(3) (.-) radicals, together with the effects of base sequence on the formation of the end-products in runs of one, two, or three contiguous guanines. The distributions of these alkali-labile lesions were determined by gel electrophoresis methods. The cascade of events was initiated through the use of 308 nm XeCl excimer laser pulses to generate CO(3) (.-) radicals by an established method based on the photodissociation of persulfate to sulfate radicals and the oxidation of bicarbonate. Although the Saito model (Saito et al., J. Am. Chem. Soc. 1995, 117, 6406-6407) predicts relative ease of one-electron oxidations in DNA, following the trend 5'-GGG > 5'-GG > 5'-G, we found that the rate constants for CO(3) (.-)-mediated oxidation of guanines in these sequence contexts (k(5)) showed only small variation within a narrow range [(1.5-3.0)x10(7) M(-1) s(-1)]. In contrast, the distributions of the end-products are dependent on the base sequence context and are higher at the 5'-G in 5'-GG sequences and at the first two 5'-guanines in the 5'-GGG sequences. These effects are attributed to a combination of initial hole distributions among the contiguous guanines and the subsequent differences in chemical reaction yields at each guanine. The lack of dependence of k(5) on sequence context indicates that the one-electron oxidation of guanine in DNA by CO(3) (.-) radicals occurs by an inner-sphere mechanism.

  3. Alkylation of urinary guanine in mice by the organophosphorus insecticide tetrachlorvinphos.

    PubMed

    Zayed, S M; Mostafa, I Y; Hegazi, B

    1984-06-01

    The methylating capability of tetrachlorvinphos on urinary guanine in mice has been investigated using an insecticide labeled at both O-CH3 groups. Following intraperitoneal administration of the 14C-labeled insecticide to mice, about 0.57% of the radioactivity in the O- to 24-hr samples was associated with the purine fraction. The amount of [7-14C]methylguanine in 0- to 48-hr urine samples, estimated as fraction of applied dose, was 26-31 X 10(-5). The results obtained indicate possible chemical alkylation of urinary guanine. On the other hand, a considerable portion of radioactivity is probably incorporated via the C-1 pool.

  4. Transcription profiling of guanine nucleotide binding proteins during developmental regulation, and pesticide response in Solenopsis invicta (Hymenoptera: Formicidae)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Guanine nucleotide binding proteins (GNBP or G-protein) are glycoproteins anchored on the cytoplasmic cell membrane, and are mediators for many cellular processes. Complete cDNA of guanine nucleotide-binding protein gene ß-subunit (SiGNBP) was cloned and sequenced from S. invicta workers. To detect ...

  5. Thiaminylated adenine nucleotides. Chemical synthesis, structural characterization and natural occurrence.

    PubMed

    Frédérich, Michel; Delvaux, David; Gigliobianco, Tiziana; Gangolf, Marjorie; Dive, Georges; Mazzucchelli, Gabriel; Elias, Benjamin; De Pauw, Edwin; Angenot, Luc; Wins, Pierre; Bettendorff, Lucien

    2009-06-01

    Thiamine and its three phosphorylated derivatives (mono-, di- and triphosphate) occur naturally in most cells. Recently, we reported the presence of a fourth thiamine derivative, adenosine thiamine triphosphate, produced in Escherichia coli in response to carbon starvation. Here, we show that the chemical synthesis of adenosine thiamine triphosphate leads to another new compound, adenosine thiamine diphosphate, as a side product. The structure of both compounds was confirmed by MS analysis and 1H-, 13C- and 31P-NMR, and some of their chemical properties were determined. Our results show an upfield shifting of the C-2 proton of the thiazolium ring in adenosine thiamine derivatives compared with conventional thiamine phosphate derivatives. This modification of the electronic environment of the C-2 proton might be explained by a through-space interaction with the adenosine moiety, suggesting U-shaped folding of adenosine thiamine derivatives. Such a structure in which the C-2 proton is embedded in a closed conformation can be located using molecular modeling as an energy minimum. In E. coli, adenosine thiamine triphosphate may account for 15% of the total thiamine under energy stress. It is less abundant in eukaryotic organisms, but is consistently found in mammalian tissues and some cell lines. Using HPLC, we show for the first time that adenosine thiamine diphosphate may also occur in small amounts in E. coli and in vertebrate liver. The discovery of two natural thiamine adenine compounds further highlights the complexity and diversity of thiamine biochemistry, which is not restricted to the cofactor role of thiamine diphosphate.

  6. Labeling of mitochondrial adenine nucleotides of bovine sperm

    SciTech Connect

    Cheetham, J.; Lardy, H.A.

    1986-05-01

    Incorporation of /sup 32/P/sub i/ into the adenine nucleotide pool of intact bovine spermatozoa utilizing endogenous substrates results in a specific activity (S.A.) ratio ATP/ADP of 0.3 to 0.5, suggesting compartmentation of nucleotide pools or a pathway for phosphorylation of AMP in addition to the myokinase reaction. Incubation of filipin-permeabilized cells with pyruvate, acetylcarnitine, or ..cap alpha..-ketoglutarate (..cap alpha..KG) resulted in ATP-ADP S.A. ratios of 0.5, 0.8, and 1.6, respectively, for mitochondrial nucleotides. However, when malate was included with pyruvate or acetylcarnitine, the ATP/ADP S.A. ratio increased by 400% to 2.0 for pyruvate/malate and by 290% to 2.8 for acetylcarnitine/malate, while the ATP/ADP ratio increased by less than 100% in both cases. These results may indicate that under conditions of limited flux through the citric acid cycle a pathway for phosphorylation of AMP from a precursor other than ATP exists or that ATP is compartmented within the mitochondrion. In the presence of uncoupler and oligomycin with ..cap alpha..KG, pyruvate/malate, or acetylcarnitine/malate, /sup 32/P/sub i/ is incorporated primarily into ATP, resulting in an ATP/ADP S.A. ratio of 4.0 for ..cap alpha..KG, 2.7 for pyruvate/malate, and 2.8 for acetylcarnitine/malate. These data are consistent with phosphorylation of ADP during substrate level phosphorylation in the citric acid cycle.

  7. Phenotype and Genotype Characterization of Adenine Phosphoribosyltransferase Deficiency

    PubMed Central

    Bollée, Guillaume; Dollinger, Cécile; Boutaud, Lucile; Guillemot, Delphine; Bensman, Albert; Harambat, Jérôme; Deteix, Patrice; Daudon, Michel; Knebelmann, Bertrand

    2010-01-01

    Adenine phosphoribosyltransferase (APRT) deficiency is a rare autosomal recessive disorder causing 2,8-dihydroxyadenine stones and renal failure secondary to intratubular crystalline precipitation. Little is known regarding the clinical presentation of APRT deficiency, especially in the white population. We retrospectively reviewed all 53 cases of APRT deficiency (from 43 families) identified at a single institution between 1978 and 2009. The median age at diagnosis was 36.3 years (range 0.5 to 78.0 years). In many patients, a several-year delay separated the onset of symptoms and diagnosis. Of the 40 patients from 33 families with full clinical data available, 14 (35%) had decreased renal function at diagnosis. Diagnosis occurred in six (15%) patients after reaching ESRD, with five diagnoses made at the time of disease recurrence in a renal allograft. Eight (20%) patients reached ESRD during a median follow-up of 74 months. Thirty-one families underwent APRT sequencing, which identified 54 (87%) mutant alleles on the 62 chromosomes analyzed. We identified 18 distinct mutations. A single T insertion in a splice donor site in intron 4 (IVS4 + 2insT), which produces a truncated protein, accounted for 40.3% of the mutations. We detected the IVS4 + 2insT mutation in two (0.98%) of 204 chromosomes of healthy newborns. This report, which is the largest published series of APRT deficiency to date, highlights the underdiagnosis and potential severity of this disease. Early diagnosis is crucial for initiation of effective treatment with allopurinol and for prevention of renal complications. PMID:20150536

  8. Analysis of HeLa cell hypoxanthine phosphoribosyltransferase mutants and revertants by two-dimensional polyacrylamide gel electrophoresis: evidence for silent gene activation.

    PubMed Central

    Milman, G; Lee, E; Ghangas, G S; McLaughlin, J R; George, M

    1976-01-01

    The spot corresponding to hypoxanthine phosphoribosyltransferase (HPRT; IMP:pyrophosphate phosphoribosyltransferase, EC 2.4.2.8) has been identified in two-dimensional polyacrylamide gels of HeLa cell extracts. This spot is absent in gels of 24 HPRT dificient mutants. A missense mutant displays a new HPRT spot at the same molecular weight but different isoelectric focusing position. Five independently isolated revertants of the missense mutant display spots corresponding to both the wild-type and mutant proteins indicating that they synthesize HPRT from two separate genes. If the missense protein is synthesized from a mutated form of the initially active HPRT gene, then wild-type HPRT protein in the revertants must be snythesized from a newly activated but prevously silent wild-type gene. The newly activated gene in the revertants of the missense mutation appears unstable producing a high frequency of spontaneous HPRT mutants. Images PMID:63948

  9. Chemical probing of adenine residues within the secondary structure of rabbit /sup 18/S ribosomal RNA

    SciTech Connect

    Rairkar, A.; Rubino, H.M.; Lockard, R.E.

    1988-01-26

    The location of unpaired adenine residues within the secondary structure of rabbit /sup 18/S ribosomal RNA was determined by chemical probing. Naked /sup 18/S rRNA was first prepared by digestion of purified 40S subunits with matrix-bound proteinase K in sodium dodecyl sulfate, thereby omitting the use of nucleic acid denaturants. Adenines within naked /sup 18/S rRNA were chemically probed by using either diethyl pyrocarbonate or dimethyl sulfate, which specifically react with unpaired nucleotides. Adenine modification sites were identified by polyacrylamide sequencing gel electrophoresis either upon aniline-induced strand scission of /sup 32/P-end-labeled intact and fragmented rRNA or by primer extension using sequence-specific DNA oligomers with reverse transcriptase. The data indicate good agreement between the general pattern of adenine reactivity and the location of unpaired regions in /sup 18/S rRNA determined by comparative sequence analysis. The overall reactivity of adenine residues toward single-strand-specific chemical probes was, also, similar for both rabbit and Escherichia coli small rRNA. The number of strongly reactive adenines appearing within phylogenetically determined helical segments, however, was greater in rabbit /sup 18/S rRNA than for E. coli /sup 16/S rRNA. Some of these adenines were found clustered in specific helices. Such differences suggest a greater irregularity of many of the helical elements within mammalian /sup 18/S rRNA, as compared with prokaryotic /sup 16/S rRNA. These helical irregularities could be important for protein association and also may represent biologically relevant flexible regions of the molecule.

  10. Dissection of the PHO pathway in Schizosaccharomyces pombe using epistasis and the alternate repressor adenine.

    PubMed

    Estill, Molly; Kerwin-Iosue, Christine L; Wykoff, Dennis D

    2015-05-01

    In Saccharomyces cerevisiae, intracellular phosphate levels are maintained by the PHO pathway, activation of which is assayed by increased phosphatase activity. The PHO pathway of Schizosaccharomyces pombe upregulates phosphatase activity (encoded by pho1 (+)) during low extracellular phosphate levels, but the underlying mechanism is poorly understood. We utilized an alternate repressor of pho1 (+) expression (adenine supplementation) along with epistasis analysis to develop a model of how S. pombe PHO pathway components interact. Analyzing Pho1 activity in S. pombe PHO pathway deletion mutants during adenine starvation, we observed most mutants with a phosphatase defect in phosphate starvation also had a defect in adenine starvation. Pho7, a transcription factor in the PHO pathway, is necessary for an adenine starvation-mediated increase in Pho1 activity. Comparing adenine starvation to phosphate starvation, there are differences in the degree to which individual mutants regulate the two responses. Through epistasis studies, we identified two positive regulatory arms and one repressive arm of the PHO pathway. PKA activation is a positive regulator of Pho1 activity under both environmental conditions and is critical for transducing adenine concentrations in the cell. The synthesis of IP7 also appears critical for the induction of Pho1 activity during adenine starvation, but IP7 is not critical during phosphate starvation, which differs from S. cerevisiae. Finally, Csk1 is critical for repression of pho1 (+) expression during phosphate starvation. We believe all of these regulatory arms converge to increase transcription of pho1 (+) and some of the regulation acts through pho7 (+).

  11. Exploring the Use of a Guanine-Rich Catalytic DNA for Sulfoxide Preparation.

    PubMed

    Dellafiore, María A; Montserrat, Javier M; Iribarren, Adolfo M

    2015-01-01

    A guanine-rich DNA oligonucleotide complexed with hemin was used to catalyze controlled oxygen transfer reactions to different sulfides for sulfoxide preparation in the presence of H2O2. Comparable activities were obtained when using fully modified L-DNA. In addition, oligonucleotide immobilization led to an active catalyst which could be successfully recovered and reused without loss of activity.

  12. Vibrational investigations of guanine, thioguanine and their singly charged cations and anions

    NASA Astrophysics Data System (ADS)

    Singh, R.; Yadav, R. A.

    2017-01-01

    The complete vibrational studies have been done with help of quantum mechanics for the neutral Guanine (Gua) and Thioguanine (TGua) molecules and their singly charged cations and anions employing the B3LYP/6-311++G** method. Neutral Thioguanine and cations of Guanine and Thioguanine show planar structures and belong to Cs point group symmetry while the neutral Guanine and anions of Guanine and Thioguanine possess non-planar structure with C1 point group symmetry. Vibrational studies of ionic radicals of Gua and its thio- derivative are not available in literatures. Such extensive studies have been attempted for the first time. The normal modes of all the species have been assigned on the basis using potential energy distributions (PEDs) using GAR2PED software. The PEDs have also been calculated to make a conspicuous assignment as animation available in GaussView is not a guarantee for correct normal mode assignment. Charge transfer occurs in the molecule have been shown by the calculated highest occupied molecular orbital—lowest unoccupied molecular orbital (HOMO-LUMO) energies. The mapping of electron density iso-surface with electrostatic potential, has been carried out to get the information about the size, shape, charge density distribution and site of chemical reactivity of the molecule. The electronic properties HOMO and LUMO energies have been measured. The energy gap from HOMO to LUMO of the Gua is 5.0547 eV and TGua 4.0743 eV.

  13. Human Sos1: a guanine nucleotide exchange factor for Ras that binds to GRB2.

    PubMed

    Chardin, P; Camonis, J H; Gale, N W; van Aelst, L; Schlessinger, J; Wigler, M H; Bar-Sagi, D

    1993-05-28

    A human complementary DNA was isolated that encodes a widely expressed protein, hSos1, that is closely related to Sos, the product of the Drosophila son of sevenless gene. The hSos1 protein contains a region of significant sequence similarity to CDC25, a guanine nucleotide exchange factor for Ras from yeast. A fragment of hSos1 encoding the CDC25-related domain complemented loss of CDC25 function in yeast. This hSos1 domain specifically stimulated guanine nucleotide exchange on mammalian Ras proteins in vitro. Mammalian cells overexpressing full-length hSos1 had increased guanine nucleotide exchange activity. Thus hSos1 is a guanine nucleotide exchange factor for Ras. The hSos1 interacted with growth factor receptor-bound protein 2 (GRB2) in vivo and in vitro. This interaction was mediated by the carboxyl-terminal domain of hSos1 and the Src homology 3 (SH3) domains of GRB2. These results suggest that the coupling of receptor tyrosine kinases to Ras signaling is mediated by a molecular complex consisting of GRB2 and hSos1.

  14. Theoretical and Experimental Study of Valence-Shell Ionization Spectra of Guanine

    NASA Astrophysics Data System (ADS)

    Zaytseva, Irina L.; Trofimov, Alexander B.; Schirmer, Jochen; Plekan, Oksana; Feyer, Vitaliy; Richter, Robert; Coreno, Marcello; Prince, Kevin C.

    2009-10-01

    The full valence-shell ionization spectra of the four most stable guanine tautomers were studied theoretically. The third-order algebraic-diagrammatic construction (ADC(3)) method for the one-particle Green's function was used to calculate the energies and relative intensities of the vertical ionization transitions. For low-lying transitions, the influence of planar and nonplanar guanine configurations on the ionization energies, as well as the convergence of the results with respect to basis set was studied at the level of the outer-valence Green's function (OVGF) approximation scheme. The results of the calculations were used to interpret recent synchrotron radiation valence-shell photoionization spectra of guanine in the gas phase under thermal equilibrium conditions. The photoelectron spectrum was modeled by summing individual tautomer spectra weighted by Boltzmann population ratios (BPR) of tautomers from our previous high-level ab initio thermochemical calculations. The theoretical spectra are in good agreement with the experimental results, providing assignments of most observed structures and offering insight into tautomerism of guanine in the gas phase. The first six molecular orbitals give rise to single-hole states with a binding energy of about 7-12 eV. At higher binding energy the spectral features are mainly due to satellite states.

  15. Coupling of guanine nucleotide inhibitory protein to somatostatin receptors on pancreatic acinar membranes

    SciTech Connect

    Sakamoto, C.; Matozaki, T.; Nagao, M.; Baba, S.

    1987-09-01

    Guanine nucleotides and pertussis toxin were used to investigate whether somatostatin receptors interact with the guanine nucleotide inhibitory protein (NI) on pancreatic acinar membranes in the rat. Guanine nucleotides reduced /sup 125/I-(Tyr/sup 1/)somatostatin binding to acinar membranes up to 80%, with rank order of potency being 5'-guanylyl imidodiphosphate (Gpp(NH)p)>GTP>TDP>GMP. Scatchard analysis revealed that the decrease in somatostatin binding caused by Gpp(NH)p was due to the decrease in the maximum binding capacity without a significant change in the binding affinity. The inhibitory effect of Gpp(NH)p was partially abolished in the absence of Mg/sup 2 +/. When pancreatic acini were treated with 1 ..mu..g/ml pertussis toxin for 4 h, subsequent /sup 125/I-(Tyr/sup 1/)somatostatin binding to acinar membranes was reduced. Pertussis toxin treatment also abolished the inhibitory effect of somatostatin on vasoactive intestinal peptide-stimulated increase in cellular content of adenosine 3',5'-cyclic monophosphate (cAMP) in the acini. The present results suggest that 1) somatostatin probably functions in the pancreas to regulate adenylate cyclase enzyme system via Ni, 2) the extent of modification of Ni is correlated with the ability of somatostatin to inhibit cAMP accumulation in acini, and 3) guanine nucleotides also inhibit somatostatin binding to its receptor.

  16. Successive attachment of electrons to protonated Guanine: (G+H)* radicals and (G+H)- anions.

    PubMed

    Zhang, Jun D; Xie, Yaoming; Schaefer, Henry F

    2006-11-02

    The structures, energetics, and vibrational frequencies of nine hydrogenated 9H-keto-guanine radicals (G+H)(*) and closed-shell anions (G+H)(-) are predicted using the carefully calibrated (Chem. Rev. 2002, 102, 231) B3LYP density functional method in conjunction with a DZP++ basis set. These radical and anionic species come from consecutive electron attachment to the corresponding protonated (G+H)(+) cations in low pH environments. The (G+H)(+) cations are studied using the same level of theory. The proton affinity (PA) of guanine computed in this research (228.1 kcal/mol) is within 0.7 kcal/mol of the latest experiment value. The radicals range over 41 kcal/mol in relative energy, with radical r1, in which H is attached at the C8 site of guanine, having the lowest energy. The lowest energy anion is a2, derived by hydride ion attachment at the C2 site of guanine. No stable N2-site hydride should exist in the gas phase. Structure a9 was predicted to be dissociative in this research. The theoretical adiabatic electron affinities (AEA), vertical electron affinities, and vertical detachment energies were computed, with AEAs ranging from 0.07 to 3.12 eV for the nine radicals.

  17. Glibenclamide improves kidney and heart structure and function in the adenine-diet model of chronic kidney disease.

    PubMed

    Diwan, Vishal; Gobe, Glenda; Brown, Lindsay

    2014-01-01

    The development of chronic kidney disease (CKD) and associated cardiovascular disease involves free radical damage and inflammation. Addition of adenine to the diet induces inflammation followed by CKD and cardiovascular disease. NOD-like receptor protein-3 (NLRP-3) is pro-inflammatory in the kidney; glibenclamide inhibits production of NLRP-3. Male Wistar rats were fed either control rat food or adenine (0.25%) in this food for 16 weeks. Glibenclamide (10 mg/kg/day) was administered to two groups with and without adenine for the final 8 weeks. Kidney function (blood urea nitrogen/BUN, plasma creatinine/PCr, plasma uric acid, proteinuria), kidney structure (fibrosis, inflammation), cardiovascular parameters (blood pressure, left ventricular stiffness, vascular responses and echocardiography) and protein expression of markers for oxidative stress (HO-1), and inflammation (TNF-α, NLRP-3) were assessed. In adenine-fed rats, glibenclamide decreased BUN (controls: 6±0.6; adenine: 56.6±5.4; adenine+glibenclamide: 19.4±2.7 mmol/L), PCr (controls: 42±2.8; adenine: 268±23; adenine+glibenclamide: 81±10 μmol/L), proteinuria (controls: 150±7.4; adenine: 303±19; adenine+glibenclamide: 220±13 μmol/L) (all p<0.05). Glibenclamide decreased infiltration of chronic inflammatory cells, fibrosis, tubular damage and expression of HO-1, TNF-α and NLRP-3 in the kidney. Glibenclamide did not alter plasma uric acid concentrations (controls: 38±1; adenine: 63±4; adenine+glibenclamide: 69±14 μmol/L). Cardiovascular changes included decreased systolic blood pressure and improved vascular responses although cardiac fibrosis, left ventricular stiffness and hypertrophy were not reduced. Glibenclamide improved kidney structure and function in CKD and decreased some cardiovascular parameters. Inflammatory markers and cell populations were attenuated by glibenclamide in kidneys.

  18. DNA Adenine Methyltransferase Influences the Virulence of Aeromonas hydrophila

    PubMed Central

    Erova, Tatiana E.; Pillai, Lakshmi; Fadl, Amin A.; Sha, Jian; Wang, Shaofei; Galindo, Cristi L.; Chopra, Ashok K.

    2006-01-01

    Among the various virulence factors produced by Aeromonas hydrophila, a type II secretion system (T2SS)-secreted cytotoxic enterotoxin (Act) and the T3SS are crucial in the pathogenesis of Aeromonas-associated infections. Our laboratory molecularly characterized both Act and the T3SS from a diarrheal isolate, SSU of A. hydrophila, and defined the role of some regulatory genes in modulating the biological effects of Act. In this study, we cloned, sequenced, and expressed the DNA adenine methyltransferase gene of A. hydrophila SSU (damAhSSU) in a T7 promoter-based vector system using Escherichia coli ER2566 as a host strain, which could alter the virulence potential of A. hydrophila. Recombinant Dam, designated as M.AhySSUDam, was produced as a histidine-tagged fusion protein and purified from an E. coli cell lysate using nickel affinity chromatography. The purified Dam had methyltransferase activity, based on its ability to transfer a methyl group from S-adenosyl-l-methionine to N6-methyladenine-free lambda DNA and to protect methylated lambda DNA from digestion with DpnII but not against the DpnI restriction enzyme. The dam gene was essential for the viability of the bacterium, and overproduction of Dam in A. hydrophila SSU, using an arabinose-inducible, PBAD promoter-based system, reduced the virulence of this pathogen. Specifically, overproduction of M.AhySSUDam decreased the motility of the bacterium by 58%. Likewise, the T3SS-associated cytotoxicity, as measured by the release of lactate dehydrogenase enzyme in murine macrophages infected with the Dam-overproducing strain, was diminished by 55% compared to that of a control A. hydrophila SSU strain harboring the pBAD vector alone. On the contrary, cytotoxic and hemolytic activities associated with Act as well as the protease activity in the culture supernatant of a Dam-overproducing strain were increased by 10-, 3-, and 2.4-fold, respectively, compared to those of the control A. hydrophila SSU strain. The Dam

  19. Total purine and purine base content of common foodstuffs for facilitating nutritional therapy for gout and hyperuricemia.

    PubMed

    Kaneko, Kiyoko; Aoyagi, Yasuo; Fukuuchi, Tomoko; Inazawa, Katsunori; Yamaoka, Noriko

    2014-01-01

    Purines are natural substances found in all of the body's cells and in virtually all foods. In humans, purines are metabolized to uric acid, which serves as an antioxidant and helps to prevent damage caused by active oxygen species. A continuous supply of uric acid is important for protecting human blood vessels. However, frequent and high intake of purine-rich foods reportedly enhances serum uric acid levels, which results in gout and could be a risk factor for cardiovascular disease, kidney disease, and metabolic syndrome. In Japan, the daily intake of dietary purines is recommended to be less than 400 mg to prevent gout and hyperuricemia. We have established an HPLC method for purine analysis and determined purines in a total of 270 foodstuffs. A relatively small number of foods contained concentrated amounts of purines. For the most part, purine-rich foods are also energy-rich foods, and include animal meats, fish meats, organs such as the liver and fish milt, and yeast. When the ratio of the four purine bases (adenine, guanine, hypoxanthine, and xanthine) was compared, two groups of foods were identified: one that contained mainly adenine and guanine and one that contained mainly hypoxanthine. For patients with gout and hyperuricemia, the amount of total purines and the types of purines consumed, particularly hypoxanthine, are important considerations. In this context, the data from our analysis provide a purine content reference, and thereby clinicians and patients could utilize that reference in nutritional therapy for gout and hyperuricemia.

  20. One-pot synthesis of fluorescent polysaccharides: adenine grafted agarose and carrageenan.

    PubMed

    Oza, Mihir D; Prasad, Kamalesh; Siddhanta, A K

    2012-08-01

    New fluorescent polysaccharides were synthesized by grafting the nucleobase adenine on to the backbones of agarose and κ-carrageenan, which were characterized by FT-IR, (13)C NMR, TGA, XRD, UV, and fluorescence properties. The synthesis involved a rapid water based potassium persulfate (KPS) initiated method under microwave irradiation. The emission spectra of adenine grafted agarose and κ-carrageenan were recorded in aqueous (5×10(-5) M) solution, exhibiting λ(em,max) 347 nm by excitation at 261 nm, affording ca. 30% and 40% enhanced emission intensities, respectively compared to that of pure adenine solution in the same concentration. Similar emission intensity was recorded in the pure adenine solution at its molar equivalent concentrations present in the 5×10(-5) M solution of the agarose and carrageenan grafted products, that is, 3.28×10(-5) M and 4.5×10(-5) M respectively. These fluorescent adenine grafted products may have potential utility in various sensor applications.

  1. Determination of adenine based on the fluorescence recovery of the L-Tryptophan-Cu2+ complex

    NASA Astrophysics Data System (ADS)

    Duan, Ruilin; Li, Chunyan; Liu, Shaopu; Liu, Zhongfang; Li, Yuanfang; Yuan, Yusheng; Hu, Xiaoli

    2016-01-01

    A simple and sensitive method for determination of adenine was developed based on fluorescence quenching and recovery of L-Tryptophan (L-Trp). The fluorescence of L-Trp could efficiently quenched by copper ion compared with other common metal ions. Upon addition of adenine (Ade) in L-Trp-Cu(II) system, the fluorescence was reoccurred. Under the optimum conditions, the recovery fluorescence intensity was linearly correlated with the concentration of adenine in the range from 0.34 to 25.0 μmol L-1, with a correlation coefficient (R2) of 0.9994. The detection limit (3σ/k) was 0.046 μmol L-1, indicating that this method could applied to detect trace adenine. In this study, amino acids including L-Trp, D-Trp, L-Tyr, D-Tyr, L-Phe, D-Phe were investigated and only L-Trp could well chelated copper ion. Additionally, the mechanism of quench and recovery also were discussed and the method was successfully applied to detect the adenine in DNA with satisfactory results.

  2. Spectroscopic investigation on cocrystal formation between adenine and fumaric acid based on infrared and Raman techniques.

    PubMed

    Du, Yong; Fang, Hong Xia; Zhang, Qi; Zhang, Hui Li; Hong, Zhi

    2016-01-15

    As an important component of double-stranded DNA, adenine has powerful hydrogen-bond capability, due to rich hydrogen bond donors and acceptors existing within its molecular structure. Therefore, it is easy to form cocrystal between adenine and other small molecules with intermolecular hydrogen-bond effect. In this work, cocrystal of adenine and fumaric acid has been characterized as model system by FT-IR and FT-Raman spectral techniques. The experimental results show that the cocrystal formed between adenine and fumaric acid possesses unique spectroscopical characteristic compared with that of starting materials. Density functional theory (DFT) calculation has been performed to optimize the molecular structures and simulate vibrational modes of adenine, fumaric acid and the corresponding cocrystal. Combining the theoretical and experimental vibrational results, the characteristic bands corresponding to bending and stretching vibrations of amino and carbonyl groups within cocrystal are shifted into lower frequencies upon cocrystal formation, and the corresponding bond lengths show some increase due to the effect of intermolecular hydrogen bonding. Different vibrational modes shown in the experimental spectra have been assigned based on the simulation DFT results. The study could provide experimental and theoretical benchmarks to characterize cocrystal formed between active ingredients and cocrystal formers and also the intermolecular hydrogen-bond effect within cocrystal formation process by vibrational spectroscopic techniques.

  3. Determination of adenine based on the fluorescence recovery of the L-Tryptophan-Cu(2+) complex.

    PubMed

    Duan, Ruilin; Li, Chunyan; Liu, Shaopu; Liu, Zhongfang; Li, Yuanfang; Yuan, Yusheng; Hu, Xiaoli

    2016-01-05

    A simple and sensitive method for determination of adenine was developed based on fluorescence quenching and recovery of L-Tryptophan (L-Trp). The fluorescence of L-Trp could efficiently quenched by copper ion compared with other common metal ions. Upon addition of adenine (Ade) in L-Trp-Cu(II) system, the fluorescence was reoccurred. Under the optimum conditions, the recovery fluorescence intensity was linearly correlated with the concentration of adenine in the range from 0.34 to 25.0μmolL(-1), with a correlation coefficient (R(2)) of 0.9994. The detection limit (3σ/k) was 0.046μmolL(-1), indicating that this method could applied to detect trace adenine. In this study, amino acids including L-Trp, D-Trp, L-Tyr, D-Tyr, L-Phe, D-Phe were investigated and only L-Trp could well chelated copper ion. Additionally, the mechanism of quench and recovery also were discussed and the method was successfully applied to detect the adenine in DNA with satisfactory results.

  4. Binding of adenine to Stx2, the protein toxin from Escherichia coli O157:H7

    SciTech Connect

    Fraser, Marie E.; Cherney, Maia M.; Marcato, Paola; Mulvey, George L.; Armstrong, Glen D.; James, Michael N. G.

    2006-07-01

    Crystals of Stx2 were grown in the presence of adenosine and adenine. In both cases, the resulting electron density showed only adenine bound at the active site of the A subunit, proving that the holotoxin is an active N-glycosidase. Stx2 is a protein toxin whose catalytic subunit acts as an N-glycosidase to depurinate a specific adenine base from 28S rRNA. In the holotoxin, the catalytic portion, A1, is linked to the rest of the A subunit, A2, and A2 interacts with the pentameric ring formed by the five B subunits. In order to test whether the holotoxin is active as an N-glycosidase, Stx2 was crystallized in the presence of adenosine and adenine. The crystals diffracted to ∼1.8 Å and showed clear electron density for adenine in the active site. Adenosine had been cleaved, proving that Stx2 is an active N-glycosidase. While the holotoxin is active against small substrates, it would be expected that the B subunits would interfere with the binding of the 28S rRNA.

  5. Spectroscopic investigation on cocrystal formation between adenine and fumaric acid based on infrared and Raman techniques

    NASA Astrophysics Data System (ADS)

    Du, Yong; Fang, Hong Xia; Zhang, Qi; Zhang, Hui Li; Hong, Zhi

    2016-01-01

    As an important component of double-stranded DNA, adenine has powerful hydrogen-bond capability, due to rich hydrogen bond donors and acceptors existing within its molecular structure. Therefore, it is easy to form cocrystal between adenine and other small molecules with intermolecular hydrogen-bond effect. In this work, cocrystal of adenine and fumaric acid has been characterized as model system by FT-IR and FT-Raman spectral techniques. The experimental results show that the cocrystal formed between adenine and fumaric acid possesses unique spectroscopical characteristic compared with that of starting materials. Density functional theory (DFT) calculation has been performed to optimize the molecular structures and simulate vibrational modes of adenine, fumaric acid and the corresponding cocrystal. Combining the theoretical and experimental vibrational results, the characteristic bands corresponding to bending and stretching vibrations of amino and carbonyl groups within cocrystal are shifted into lower frequencies upon cocrystal formation, and the corresponding bond lengths show some increase due to the effect of intermolecular hydrogen bonding. Different vibrational modes shown in the experimental spectra have been assigned based on the simulation DFT results. The study could provide experimental and theoretical benchmarks to characterize cocrystal formed between active ingredients and cocrystal formers and also the intermolecular hydrogen-bond effect within cocrystal formation process by vibrational spectroscopic techniques.

  6. Excited-state lifetime of adenine near the first electronic band origin

    NASA Astrophysics Data System (ADS)

    Kang, Hyuk; Chang, Jinyoung; Lee, Sang Hak; Ahn, Tae Kyu; Kim, Nam Joon; Kim, Seong Keun

    2010-10-01

    The excited-state lifetime of supersonically cooled adenine was measured in the gas phase by femtosecond pump-probe transient ionization as a function of excitation energy between 36 100 and 37 500 cm-1. The excited-state lifetime of adenine is ˜2 ps around the 0-0 band of the L1b ππ ∗ state (36 105 cm-1). The lifetime drops to ˜1 ps when adenine is excited to the L1a ππ ∗ state with the pump energy at 36 800 cm-1 and above. The excited-state lifetimes of L1a and L1b ππ∗ states are differentiated in accordance with previous frequency-resolved and computational studies.

  7. Adenine phosphoribosyltransferase deficiency as a rare cause of renal allograft dysfunction.

    PubMed

    Kaartinen, Kati; Hemmilä, Ulla; Salmela, Kaija; Räisänen-Sokolowski, Anne; Kouri, Timo; Mäkelä, Satu

    2014-04-01

    Adenine phosphoribosyltransferase deficiency is a rare autosomal recessive disorder manifesting as urolithiasis or crystalline nephropathy. It leads to the generation of large amounts of poorly soluble 2,8-dihydroxyadenine excreted in urine, yielding kidney injury and in some patients, kidney failure. Early recognition of the disease, institution of xanthine analog therapy to block the formation of 2,8-dihydroxyadenine, high fluid intake, and low purine diet prevent CKD. Because of symptom variability and lack of awareness, however, the diagnosis is sometimes extremely deferred. We describe a patient with adenine phosphoribosyltransferase deficiency who was diagnosed during evaluation of a poorly functioning second kidney allograft. This report highlights the risk of renal allograft loss in patients with undiagnosed adenine phosphoribosyltransferase deficiency and the need for improved early detection of this disease.

  8. Cleavage of nicotinamide adenine dinucleotide by the ribosome-inactivating protein from Momordica charantia.

    PubMed

    Vinkovic, M; Dunn, G; Wood, G E; Husain, J; Wood, S P; Gill, R

    2015-09-01

    The interaction of momordin, a type 1 ribosome-inactivating protein from Momordica charantia, with NADP(+) and NADPH has been investigated by X-ray diffraction analysis of complexes generated by co-crystallization and crystal soaking. It is known that the proteins of this family readily cleave the adenine-ribose bond of adenosine and related nucleotides in the crystal, leaving the product, adenine, bound to the enzyme active site. Surprisingly, the nicotinamide-ribose bond of oxidized NADP(+) is cleaved, leaving nicotinamide bound in the active site in the same position but in a slightly different orientation to that of the five-membered ring of adenine. No binding or cleavage of NADPH was observed at pH 7.4 in these experiments. These observations are in accord with current views of the enzyme mechanism and may contribute to ongoing searches for effective inhibitors.

  9. The basal proton conductance of mitochondria depends on adenine nucleotide translocase content

    PubMed Central

    2005-01-01

    The basal proton conductance of mitochondria causes mild uncoupling and may be an important contributor to metabolic rate. The molecular nature of the proton-conductance pathway is unknown. We show that the proton conductance of muscle mitochondria from mice in which isoform 1 of the adenine nucleotide translocase has been ablated is half that of wild-type controls. Overexpression of the adenine nucleotide translocase encoded by the stress-sensitive B gene in Drosophila mitochondria increases proton conductance, and underexpression decreases it, even when the carrier is fully inhibited using carboxyatractylate. We conclude that half to two-thirds of the basal proton conductance of mitochondria is catalysed by the adenine nucleotide carrier, independently of its ATP/ADP exchange or fatty-acid-dependent proton-leak functions. PMID:16076285

  10. Unique modification of adenine in genomic DNA of the marine cyanobacterium Trichodesmium sp. strain NIBB 1067.

    PubMed Central

    Zehr, J P; Ohki, K; Fujita, Y; Landry, D

    1991-01-01

    The genomic DNA of the marine nonheterocystous nitrogen-fixing cyanobacterium Trichodesmium sp. strain NIBB 1067 was found to be highly resistant to DNA restriction endonucleases. The DNA was digested extensively by the restriction enzyme DpnI, which requires adenine methylation for activity. The DNA composition, determined by high-performance liquid chromatography (HPLC), was found to be 69% AT. Surprisingly, it was found that a modified adenine which was not methylated at the usual N6 position was present and made up 4.7 mol% of the nucleosides in Trichodesmium DNA (15 mol% of deoxyadenosine). In order for adenine residues to be modified at this many positions, there must be many modifying enzymes or at least one of the modifying enzymes must have a degenerate recognition site. The reason(s) for this extensive methylation has not yet been determined but may have implications for the ecological success of this microorganism in nature. Images FIG. 1 FIG. 2 PMID:1657876

  11. De novo synthesis of adenine nucleotides in different skeletal muscle fiber types

    SciTech Connect

    Tullson, P.C.; John-Alder, H.B.; Hood, D.A.; Terjung, R.L.

    1988-09-01

    Management of adenine nucleotide catabolism differs among skeletal muscle fiber types. This study evaluated whether there are corresponding differences in the rates of de novo synthesis of adenine nucleotide among fiber type sections of skeletal muscle using an isolated perfused rat hindquarter preparation. Label incorporation into adenine nucleotides from the (1-14C)glycine precursor was determined and used to calculate synthesis rates based on the intracellular glycine specific radioactivity. Results show that intracellular glycine is closely related to the direct precursor pool. Rates of de novo synthesis were highest in fast-twitch red muscle (57.0 +/- 4.0, 58.2 +/- 4.4 nmol.h-1.g-1; deep red gastrocnemius and vastus lateralis), relatively high in slow-twitch red muscle (47.0 +/- 3.1; soleus), and low in fast-twitch white muscle (26.1 +/- 2.0 and 21.6 +/- 2.3; superficial white gastrocnemius and vastus lateralis). Rates for four mixed muscles were intermediate, ranging between 32.3 and 37.3. Specific de novo synthesis rates exhibited a strong correlation (r = 0.986) with muscle section citrate synthase activity. Turnover rates (de novo synthesis rate/adenine nucleotide pool size) were highest in high oxidative muscle (0.82-1.06%/h), lowest in low oxidative muscle (0.30-0.35%/h), and intermediate in mixed muscle (0.44-0.55%/h). Our results demonstrate that differences in adenine nucleotide management among fiber types extends to the process of de novo adenine nucleotide synthesis.

  12. Efficacy of the acyclic nucleoside phosphonates (S)-9-(3-fluoro-2-phosphonylmethoxypropyl)adenine (FPMPA) and 9-(2-phosphonylmethoxyethyl)adenine (PMEA) against feline immunodeficiency virus.

    PubMed

    Hartmann, K; Kuffer, M; Balzarini, J; Naesens, L; Goldberg, M; Erfle, V; Goebel, F D; De Clercq, E; Jindrich, J; Holy, A; Bischofberger, N; Kraft, W

    1998-02-01

    The acyclic nucleoside phosphonates (S)-9-(3-fluoro-2-phosphonylmethoxypropyl)adenine (FPMPA) and 9-(2-phosphonylmethoxyethyl)adenine (PMEA) were evaluated for their efficacy and side effects in a double-blind placebo-controlled trial using naturally occurring feline immunodeficiency virus (FIV)-infected cats. This natural retrovirus animal model is considered highly relevant for the pathogenesis and chemotherapy of HIV in humans. Both PMEA and FPMPA proved effective in ameliorating the clinical symptoms of FIV-infected cats, as measured by several clinical parameters including the incidence and severity of stomatitis, Karnofsky's score, immunologic parameters such as relative and absolute CD4+ lymphocyte counts, and virologic parameters including proviral DNA levels in peripheral blood mononuclear cells (PBMC) of drug-treated animals. In contrast with PMEA, FPMPA showed no hematologic side effects at a dose that was 2.5-fold higher than PMEA.

  13. Ricin Activity Assay by Direct Analysis in Real Time Mass Spectrometry Detection of Adenine Release

    DTIC Science & Technology

    2010-02-01

    direct analysis in real time mass spectrometry. The release of adenine from the inhomo- geneous substrate herring sperm DNA by ricin was determined to...chain catalyzes cleavage at adenosine 4324 (in rat RNA) of 28S rRNA to release adenine.10 This action inhibits protein synthesis, leading to cell...death. In addition to RNA, herring sperm DNA (hsDNA) is a substrate for ricin.11 We chose to employ hsDNA for this assay because it is relatively stable

  14. Nuclear magnetic resonance solution structure of an N(2)-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: intercalation from the minor groove with ruptured Watson-Crick base pairing.

    PubMed

    Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H; Cai, Yuqin; Rodriguez, Fabian A; Sayer, Jane M; Jerina, Donald M; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E

    2012-12-04

    The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the nonplanar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14 position with the exocyclic amino group of guanine. Here, we present the first nuclear magnetic resonance solution structure of a DB[a,l]P-derived adduct, the 14R-(+)-trans-anti-DB[a,l]P-N(2)-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N(2)-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3'-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3'-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE-DNA adduct conformation differs from (1) the classical intercalation motif in which Watson-Crick base pairing is intact at the lesion site and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix. The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed.

  15. Affinity of a galactose-specific legume lectin from Dolichos lablab to adenine revealed by X-ray cystallography.

    PubMed

    Shetty, Kartika N; Latha, Vakada Lavanya; Rao, Rameshwaram Nagender; Nadimpalli, Siva Kumar; Suguna, Kaza

    2013-07-01

    Crystal structure analysis of a galactose-specific lectin from a leguminous food crop Dolichos lablab (Indian lablab beans) has been carried out to obtain insights into its quaternary association and lectin-carbohydrate interactions. The analysis led to the identification of adenine binding sites at the dimeric interfaces of the heterotetrameric lectin. Structural details of similar adenine binding were reported in only one legume lectin, Dolichos biflorus, before this study. Here, we present the structure of the galactose-binding D. lablab lectin at different pH values in the native form and in complex with galactose and adenine. This first structure report on this lectin also provides a high resolution atomic view of legume lectin-adenine interactions. The tetramer has two canonical and two DB58-like interfaces. The binding of adenine, a non-carbohydrate ligand, is found to occur at four hydrophobic sites at the core of the tetramer at the DB58-like dimeric interfaces and does not interfere with the carbohydrate-binding site. To support the crystallographic observations, the adenine binding was further quantified by carrying out isothermal calorimetric titration. By this method, we not only estimated the affinity of the lectin to adenine but also showed that adenine binds with negative cooperativity in solution.

  16. Finding Adiabatically Bound Anions of Guanine through a Combinatorial Computational Approach

    SciTech Connect

    Haranczyk, Maciej; Gutowski, Maciej S.

    2005-09-15

    In summary, guanine supports many adiabatically bound valence anions, which result from enamine-imine transformations of the most stable neutral tautomers. These stable anionic tautomers have been found using combinatorial-computational prescreening at the B3LYP level of theory followed by CCSD(T)/aug-cc-pVDZ calculations. The new anionic tautomers contradict a common opinion that guanine has the lowest electron affinity among nucleobases. The new anionic tautomers might be formed in the course of dissociative electron attachment followed by a hydrogen atom attachment to a carbon atom. They might affect the structure and properties of DNA and RNA exposed to low-energy electrons. Chemical transformations of DNA triggered by the new anionic tautomers will be explored in our future studies.

  17. Guanine nucleotide binding to the Bateman domain mediates the allosteric inhibition of eukaryotic IMP dehydrogenases

    NASA Astrophysics Data System (ADS)

    Buey, Rubén M.; Ledesma-Amaro, Rodrigo; Velázquez-Campoy, Adrián; Balsera, Mónica; Chagoyen, Mónica; de Pereda, José M.; Revuelta, José L.

    2015-11-01

    Inosine-5'-monophosphate dehydrogenase (IMPDH) plays key roles in purine nucleotide metabolism and cell proliferation. Although IMPDH is a widely studied therapeutic target, there is limited information about its physiological regulation. Using Ashbya gossypii as a model, we describe the molecular mechanism and the structural basis for the allosteric regulation of IMPDH by guanine nucleotides. We report that GTP and GDP bind to the regulatory Bateman domain, inducing octamers with compromised catalytic activity. Our data suggest that eukaryotic and prokaryotic IMPDHs might have developed different regulatory mechanisms, with GTP/GDP inhibiting only eukaryotic IMPDHs. Interestingly, mutations associated with human retinopathies map into the guanine nucleotide-binding sites including a previously undescribed non-canonical site and disrupt allosteric inhibition. Together, our results shed light on the mechanisms of the allosteric regulation of enzymes mediated by Bateman domains and provide a molecular basis for certain retinopathies, opening the door to new therapeutic approaches.

  18. Guanine-based amphiphiles: synthesis, ion transport properties and biological activity.

    PubMed

    Musumeci, Domenica; Irace, Carlo; Santamaria, Rita; Milano, Domenico; Tecilla, Paolo; Montesarchio, Daniela

    2015-03-01

    Novel amphiphilic guanine derivatives, here named Gua1 and Gua2, have been prepared through few, simple and efficient synthetic steps. In ion transport experiments through phospholipid bilayers, carried out to evaluate their ability to mediate H(+) transport, Gua2 showed high activity. When this compound was investigated for ion-selective transport activities, no major differences were observed in the behaviour with cations while, in the case of anions, selective activity was observed in the series I(-)>Br(-)>Cl(-)>F(-). The bioactivity of these guanine analogues has been evaluated on a panel of human tumour and non-tumour cell lines in preliminary in vitro cytotoxicity assays, showing a relevant antiproliferative profile for Gua2.

  19. Guanine nucleotide binding to the Bateman domain mediates the allosteric inhibition of eukaryotic IMP dehydrogenases

    PubMed Central

    Buey, Rubén M.; Ledesma-Amaro, Rodrigo; Velázquez-Campoy, Adrián; Balsera, Mónica; Chagoyen, Mónica; de Pereda, José M.; Revuelta, José L.

    2015-01-01

    Inosine-5′-monophosphate dehydrogenase (IMPDH) plays key roles in purine nucleotide metabolism and cell proliferation. Although IMPDH is a widely studied therapeutic target, there is limited information about its physiological regulation. Using Ashbya gossypii as a model, we describe the molecular mechanism and the structural basis for the allosteric regulation of IMPDH by guanine nucleotides. We report that GTP and GDP bind to the regulatory Bateman domain, inducing octamers with compromised catalytic activity. Our data suggest that eukaryotic and prokaryotic IMPDHs might have developed different regulatory mechanisms, with GTP/GDP inhibiting only eukaryotic IMPDHs. Interestingly, mutations associated with human retinopathies map into the guanine nucleotide-binding sites including a previously undescribed non-canonical site and disrupt allosteric inhibition. Together, our results shed light on the mechanisms of the allosteric regulation of enzymes mediated by Bateman domains and provide a molecular basis for certain retinopathies, opening the door to new therapeutic approaches. PMID:26558346

  20. Synthesis, cyclopolymerization and cyclo-copolymerization of 9-(2-diallylaminoethyl)adenine and its hydrochloride salt.

    PubMed

    Bouhadir, Kamal H; Abramian, Lara; Ezzeddine, Alaa; Usher, Karyn; Vladimirov, Nikolay

    2012-11-08

    We report herein the synthesis and characterization of 9-(2-diallylaminoethyl) adenine. We evaluated two different synthetic routes starting with adenine where the optimal route was achieved through coupling of 9-(2-chloroethyl)adenine with diallylamine. The cyclopolymerization and cyclo-copolymerization of 9-(2-diallylaminoethyl)adenine hydrochloride salt resulted in low molecular weight oligomers in low yields. In contrast, 9-(2-diallylaminoethyl)adenine failed to cyclopolymerize, however, it formed a copolymer with SO₂ in relatively good yields. The molecular weights of the cyclopolymers were around 1,700-6,000 g/mol, as estimated by SEC. The cyclo-copolymer was stable up to 226 °C. To the best of our knowledge, this is the first example of a free-radical cyclo-copolymerization of a neutral alkyldiallylamine derivative with SO₂. These polymers represent a novel class of carbocyclic polynucleotides.

  1. Caffeine biosynthesis and adenine metabolism in transgenic Coffea canephora plants with reduced expression of N-methyltransferase genes.

    PubMed

    Ashihara, Hiroshi; Zheng, Xin-Qiang; Katahira, Riko; Morimoto, Masayuki; Ogita, Shinjiro; Sano, Hiroshi

    2006-05-01

    In anti-sense and RNA interference transgenic plants of Coffea canephora in which the expression of CaMXMT1 was suppressed, caffeine biosynthesis from [8-(14)C]adenine was investigated, together with the overall metabolism of [8-(14)C]adenine. Compared with wild type control plants, total purine alkaloid biosynthesis from adenine and conversion of theobromine to caffeine were both reduced in the transgenic plants. As found previously, [8-(14)C]adenine was metabolised to salvage products (nucleotides and RNA), to degradation products (ureides and CO(2)) and to purine alkaloids (theobromine and caffeine). In the transgenic plants, metabolism of [8-(14)C]adenine shifted from purine alkaloid synthesis to purine catabolism or salvage for nucleotides. HPLC analysis revealed a significantly reduced caffeine content in the transgenic plants. A small quantity (less than 20 nmol g(-1) fresh weight) of xanthosine had accumulated in at least one of the transgenic plants.

  2. Solubilization and reconstitution of the formylmethionylleucylphenylalanine receptor coupled to guanine nucleotide regulatory protein

    SciTech Connect

    Williamson, K.; Dickey, B.F.; Pyun, H.Y.; Navarro, J.

    1988-07-12

    The authors describe the solubilization, resolution, and reconstitution of the formylmethionylleucylphenylalanine (fMet-Leu-Phe) receptor and guanine nucleotide regulatory proteins (G-proteins). The receptor was solubilized with 3-((3-cholamidopropyl)dimethylammonio)-1-propanesulfonate. Guanine nucleotides decreased the number of high-affinity binding sites and accelerated the rate of dissociation of the receptor-ligand complex, suggesting that the solubilized receptor remained coupled to endogenous G-proteins. The solubilized receptor was resolved from endogenous G-proteins by fractionation on a wheat germ agglutinin (WGA)-Sepharose 4B column. High-affinity (/sup 3/H)fMet-Leu-Phe binding to the WGA-purified receptor was diminished and exhibited reduced guanine nucleotide sensitivity. High-affinity (/sup 3/H)fMET-Leu-Phe binding and guanine nucleotide sensitivity were reconstituted upon the addition of purified brain G-proteins. Similar results were obtained when the receptor was reconstituted with brain G-proteins into phospholipid vesicles by gel filtration chromatography. In addition, they also demonstrated fMET-Leu-Phe-dependent GTP hydrolysis in the reconstituted vesicles. The results of this work indicate that coupling of the fMet-Leu-Phe receptor to G-proteins converts the receptor to a high-affinity binding state and that agonist produces activation of G-proteins. The resolution and functional reconstitution of this receptor should provide an important step toward the elucidation of the molecular mechanism of the fMet-Leu-Phe transduction system in neutrophils.

  3. Mutations in the guanine nucleotide exchange factor gene IQSEC2 cause nonsyndromic intellectual disability

    PubMed Central

    Shoubridge, Cheryl; Tarpey, Patrick S; Abidi, Fatima; Ramsden, Sarah L; Rujirabanjerd, Sinitdhorn; Murphy, Jessica A; Boyle, Jackie; Shaw, Marie; Gardner, Alison; Proos, Anne; Puusepp, Helen; Raymond, F Lucy; Schwartz, Charles E; Stevenson, Roger E; Turner, Gill; Field, Michael; Walikonis, Randall S; Harvey, Robert J; Hackett, Anna; Futreal, P Andrew; Stratton, Michael R; Gécz, Jozef

    2013-01-01

    The first family identified as having a nonsyndromic intellectual disability was mapped in 1988. Here we show that a mutation of IQSEC2, encoding a guanine nucleotide exchange factor for the ADP-ribosylation factor family of small GTPases, caused this disorder. In addition to MRX1, IQSEC2 mutations were identified in three other families with X-linked intellectual disability. This discovery was made possible by systematic and unbiased X chromosome exome resequencing. PMID:20473311

  4. Protein–DNA charge transport: Redox activation of a DNA repair protein by guanine radical

    PubMed Central

    Yavin, Eylon; Boal, Amie K.; Stemp, Eric D. A.; Boon, Elizabeth M.; Livingston, Alison L.; O'Shea, Valerie L.; David, Sheila S.; Barton, Jacqueline K.

    2005-01-01

    DNA charge transport (CT) chemistry provides a route to carry out oxidative DNA damage from a distance in a reaction that is sensitive to DNA mismatches and lesions. Here, DNA-mediated CT also leads to oxidation of a DNA-bound base excision repair enzyme, MutY. DNA-bound Ru(III), generated through a flash/quench technique, is found to promote oxidation of the [4Fe-4S]2+ cluster of MutY to [4Fe-4S]3+ and its decomposition product [3Fe-4S]1+. Flash/quench experiments monitored by EPR spectroscopy reveal spectra with g = 2.08, 2.06, and 2.02, characteristic of the oxidized clusters. Transient absorption spectra of poly(dGC) and [Ru(phen)2dppz]3+ (dppz = dipyridophenazine), generated in situ, show an absorption characteristic of the guanine radical that is depleted in the presence of MutY with formation instead of a long-lived species with an absorption at 405 nm; we attribute this absorption also to formation of the oxidized [4Fe-4S]3+ and [3Fe-4S]1+ clusters. In ruthenium-tethered DNA assemblies, oxidative damage to the 5′-G of a 5′-GG-3′ doublet is generated from a distance but this irreversible damage is inhibited by MutY and instead EPR experiments reveal cluster oxidation. With ruthenium-tethered assemblies containing duplex versus single-stranded regions, MutY oxidation is found to be mediated by the DNA duplex, with guanine radical as an intermediate oxidant; guanine radical formation facilitates MutY oxidation. A model is proposed for the redox activation of DNA repair proteins through DNA CT, with guanine radicals, the first product under oxidative stress, in oxidizing the DNA-bound repair proteins, providing the signal to stimulate DNA repair. PMID:15738421

  5. Guanine nucleotide-induced polymerization of actin in electropermeabilized human neutrophils

    PubMed Central

    1989-01-01

    The effects of exogenous guanine nucleotides on the polymerization of actin in human neutrophils were tested in an electropermeabilized cell preparation. Close to 40% permeabilization was achieved with a single electric discharge as measured by nucleic acid staining with ethidium bromide or propidium iodide with minimal (less than 2%) release of the cytoplasmic marker lactate dehydrogenase. In addition, electropermeabilized neutrophils retained their capacity to produce superoxide anions and to sustain a polymerization of actin in response to surface-receptor dependent stimuli such as chemotactic factors. Electropermeabilization produced a rapid and transient permeabilization that allowed the entry of guanine nucleotides into the cells. GTP and, to a larger extent, its nonhydrolyzable analog guanosine 5'-O-2- thiotriphosphate (GTP[S]), induced a time- and concentration-dependent polymerization of actin, as determined by increased staining with 7- nitrobenz-2-oxa-1,3-diazolylphallacidin. The effects of the aforementioned guanine nucleotides were antagonized by GDP[S], but were insensitive to pertussis toxin. Cholera toxin potentiated to a small degree the amount of actin polymerization induced by GTP[S]. These results provided direct evidence for the involvement of GTP-binding proteins in the regulation of the organization of the cytoskeleton of neutrophils, an event that is of crucial importance to the performance of the defense-oriented functions of these cells. PMID:2768336

  6. Non-covalent functionalization of hexagonal boron nitride nanosheets with guanine.

    PubMed

    Anota, E Chigo; Tlapale, Y; Villanueva, M Salazar; Márquez, J A Rivera

    2015-08-01

    Density functional theory (DFT) calculations were performed to analyze changes in the structural and electronic properties generated by the interaction of a single nucleobase group (guanine) with the surface of boron nitride nanosheets with hexagonal symmetry (hBNNs). Nanosheets in two contexts were tested: pristine sheets and with point defects (doped with carbon atoms). The criterion of energy minimum was used to find the ground state of the nine possible isomers generated by the hBNNs-guanine interaction. The phenomenon of physisorption is known to occur at values less than 1.0 eV; the adsorption energy results revealed that the preferential geometry was a parallel arrangement between the two partners, with van der Waals-type bonds generated for the hBNNs doped with two carbon atoms. This was the only energetically stable configuration, thus revealing a vibrational mode rather than imaginaries. Furthermore, the hBNNs/C-guanine system has a low value for work function, and therefore could be used in health applications such drug transport and delivery. The increased polarity values suggest that these nanosheets could be solubilized in common solvents used in experimental processes.

  7. Thiol-modifying phenylarsine oxide inhibits guanine nucleotide binding of Rho but not of Rac GTPases.

    PubMed

    Gerhard, Ralf; John, Harald; Aktories, Klaus; Just, Ingo

    2003-06-01

    Phenylarsine oxide (PAO) is a phosphotyrosine phosphatase inhibitor that cross-links vicinal thiol groups, thereby inactivating phosphatases possessing XCysXXCysX motifs. The RhoA-GTPase, but not the Rac1-GTPase, also possesses vicinal cysteines within the guanine nucleotide-binding region (aa 13-20) and the phosphohydrolase activity site. Treatment of Caco-2 cells with PAO showed a dose-dependent reorganization of the actin cytoskeleton, indicating involvement of Rho GTPases. As tested by pull-down experiments, RhoA, but not Rac1, from cell lysates was inactivated by PAO in a concentration-dependent manner. Modification of RhoA by PAO resulted in altered mobility on SDS-polyacrylamide gel electrophoresis, and PAO-modified RhoA was no longer substrate for C3-catalyzed ADP-ribosylation. Furthermore, RhoA treated with PAO, but not Rac1 treated with PAO, lost its property to bind to guanine nucleotides. Matrix-assisted laser desorption ionization-mass analysis of PAO-modified RhoA showed a mass shift according to an adduction of a single PAO molecule per molecule RhoA. Further analysis of Glu-C-generated RhoA peptides confirmed binding of PAO to a peptide harboring the guanine nucleotide binding region. Thus, PAO does not exclusively inhibit phosphotyrosine phosphatases but also inactivates RhoA by alteration of nucleotide binding.

  8. Oxidative modification of guanine bases initiated by oxyl radicals derived from photolysis of azo compounds.

    PubMed

    Shao, Jie; Geacintov, Nicholas E; Shafirovich, Vladimir

    2010-05-20

    Oxidative damage to guanine bases initiated by photolysis of the water-soluble radical generator 2,2'-azobis(2-amidinopropane) dihydrochloride (AAPH) has been investigated by laser kinetic spectroscopy. In the neutral oxygenated aqueous solutions, 355 nm laser flash photolysis of AAPH generates a whole spectrum of free radicals including 2-amidinoprop-2-peroxyl (ROO(*)), 2-amidinoprop-2-oxyl (RO(*)), and superoxide (O(2)(*-)) radicals. These oxyl radicals with negligible absorption in a near UV-visible range were monitored in the reactions leading to the products with characteristic absorption spectra. This approach reveals that RO(*) radicals induce fast one-electron oxidation of 2'-deoxyguanosine (dG) to form guanine neutral radicals, dG(-H)(*). In contrast, ROO(*) radicals do not react at observable rates with dG. The O(2)(*-) radicals were detected using a classical test reaction with tetranitromethane to form nitroform. The major pathway for formation of the end-products of guanine oxidation is the combination of the G(-H)(*) and O(2)(*-) radicals to form 2,5-diamino-4H-imidazolone (Iz). This mechanism was confirmed by analysis of the end-products produced by oxidation of two substrates: (1) the guanosine derivative 2',3',5'-tri-O-acetylguanosine (tri-O-Ac-G) and (2) the 5'-d(CCATCGCTACC) sequence. The major products isolated by HPLC and identified by mass spectrometry methods were the tri-O-Ac-Iz and 5'-d(CCATC[Iz]CTACC products.

  9. DNA polymerase V allows bypass of toxic guanine oxidation products in vivo.

    PubMed

    Neeley, William L; Delaney, Sarah; Alekseyev, Yuriy O; Jarosz, Daniel F; Delaney, James C; Walker, Graham C; Essigmann, John M

    2007-04-27

    Reactive oxygen and nitrogen radicals produced during metabolic processes, such as respiration and inflammation, combine with DNA to form many lesions primarily at guanine sites. Understanding the roles of the polymerases responsible for the processing of these products to mutations could illuminate molecular mechanisms that correlate oxidative stress with cancer. Using M13 viral genomes engineered to contain single DNA lesions and Escherichia coli strains with specific polymerase (pol) knockouts, we show that pol V is required for efficient bypass of structurally diverse, highly mutagenic guanine oxidation products in vivo. We also find that pol IV participates in the bypass of two spiroiminodihydantoin lesions. Furthermore, we report that one lesion, 5-guanidino-4-nitroimidazole, is a substrate for multiple SOS polymerases, whereby pol II is necessary for error-free replication and pol V for error-prone replication past this lesion. The results spotlight a major role for pol V and minor roles for pol II and pol IV in the mechanism of guanine oxidation mutagenesis.

  10. Rates of chemical cleavage of DNA and RNA oligomers containing guanine oxidation products.

    PubMed

    Fleming, Aaron M; Alshykhly, Omar; Zhu, Judy; Muller, James G; Burrows, Cynthia J

    2015-06-15

    The nucleobase guanine in DNA (dG) and RNA (rG) has the lowest standard reduction potential of the bases, rendering it a major site of oxidative damage in these polymers. Mapping the sites at which oxidation occurs in an oligomer via chemical reagents utilizes hot piperidine for cleaving oxidized DNA and aniline (pH 4.5) for cleaving oxidized RNA. In the present studies, a series of time-dependent cleavages of DNA and RNA strands containing various guanine lesions were examined to determine the strand scission rate constants. The guanine base lesions 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), 5-guanidinohydantoin (Gh), 2,2,4-triamino-2H-oxazol-5-one (Z), and 5-carboxamido-5-formamido-2-iminohydantoin (2Ih) were evaluated in piperidine-treated DNA and aniline-treated RNA. These data identified wide variability in the chemical lability of the lesions studied in both DNA and RNA. Further, the rate constants for cleaving lesions in RNA were generally found to be significantly smaller than for lesions in DNA. The OG nucleotides were poorly cleaved in DNA and RNA; Sp nucleotides were slowly cleaved in DNA and did not cleave significantly in RNA; Gh and Z nucleotides cleaved in both DNA and RNA at intermediate rates; and 2Ih oligonucleotides cleaved relatively quickly in both DNA and RNA. The data are compared and contrasted with respect to future experimental design.

  11. Formation of ring-opened and rearranged products of guanine: mechanisms and biological significance.

    PubMed

    Jena, N R; Mishra, P C

    2012-07-01

    DNA damage by endogenous and exogenous agents is a serious concern, as the damaged products can affect genome integrity severely. Damage to DNA may arise from various factors such as DNA base modifications, strand break, inter- and intrastrand crosslinks, and DNA-protein crosslinks. Among these factors, DNA base modification is a common and important form of DNA damage that has been implicated in mutagenesis, carcinogenesis, and many other pathological conditions. Among the four DNA bases, guanine (G) has the smallest oxidation potential, because of which it is frequently modified by reactive species, giving rise to a plethora of lethal lesions. Similarly, 8-oxo-7,8-dihydroguanine (8-oxoG), an oxidatively damaged guanine lesion, also undergoes various degradation reactions giving rise to several mutagenic species. The various products formed from reactions of G or 8-oxoG with different reactive species are mainly 2,6-diamino-4-oxo-5-formamidopyrimidine, 2,5-diamino-4H-imidazolone, 2,2,4-triamino-5-(2H)-oxazolone, 5-guanidino-4-nitroimidazole, guanidinohydantoin, spiroiminodihydantoin, cyanuric acid, parabanic acid, oxaluric acid, and urea, among others. These products are formed from either ring opening or ring opening and subsequent rearrangement. The main aim of this review is to provide a comprehensive overview of various possible reactions and the mechanisms involved, after which these ring-opened and rearranged products of guanine would be formed in DNA. The biological significance of oxidatively damaged products of G is also discussed.

  12. Magnetic Control of the Light Reflection Anisotropy in a Biogenic Guanine Microcrystal Platelet.

    PubMed

    Iwasaka, Masakazu; Mizukawa, Yuri; Roberts, Nicholas W

    2016-01-12

    Bioinspired but static optical devices such as lenses, retarders, and reflectors have had a significant impact on the designs of many man-made optical technologies. However, while numerous adaptive and flexible optical mechanisms are found throughout the animal kingdom, highly desirable biomimetic copies of these remarkable smart systems remain, in many cases, a distant dream. Many aquatic animals have evolved highly efficient reflectors based on multilayer stacks of the crystallized nucleic acid base guanine. With exceptional levels of spectral and intensity control, these reflectors represent an interesting design pathway towards controllable micromirror structures. Here we show that individual guanine crystals, with dimensions of 5 μm × 20 μm × 70 nm, can be magnetically controlled to act as individual micromirrors. By applying magnetic fields of 500 mT, the reflectivity of these crystals can be switched off and on for the change in reflectivity. Overall, the use of guanine represents a novel design scheme for a highly efficient and controllable synthetic organic micromirror array.

  13. Activation of G Proteins by Guanine Nucleotide Exchange Factors Relies on GTPase Activity

    PubMed Central

    Stanley, Rob J.; Thomas, Geraint M. H.

    2016-01-01

    G proteins are an important family of signalling molecules controlled by guanine nucleotide exchange and GTPase activity in what is commonly called an ‘activation/inactivation cycle’. The molecular mechanism by which guanine nucleotide exchange factors (GEFs) catalyse the activation of monomeric G proteins is well-established, however the complete reversibility of this mechanism is often overlooked. Here, we use a theoretical approach to prove that GEFs are unable to positively control G protein systems at steady-state in the absence of GTPase activity. Instead, positive regulation of G proteins must be seen as a product of the competition between guanine nucleotide exchange and GTPase activity—emphasising a central role for GTPase activity beyond merely signal termination. We conclude that a more accurate description of the regulation of G proteins via these processes is as a ‘balance/imbalance’ mechanism. This result has implications for the understanding of intracellular signalling processes, and for experimental strategies that rely on modulating G protein systems. PMID:26986850

  14. N7-(carboxymethyl)guanine-Lithium Crystalline Complex: A Bioinspired Solid Electrolyte

    NASA Astrophysics Data System (ADS)

    Dutta, Dipak; Nagapradeep, N.; Zhu, Haijin; Forsyth, Maria; Verma, Sandeep; Bhattacharyya, Aninda J.

    2016-04-01

    Electrochemical device with components having direct significance to biological life processes is a potent futuristic strategy for the realization of all-round green and sustainable development. We present here synthesis design, structural analysis and ion transport of a novel solid organic electrolyte (G7Li), a compound reminiscent of ion channels, derived from regioisomeric N7-guanine-carboxylate conjugate and Li-ions. G7Li, with it’s in-built supply of Li+-ions, exhibited remarkably high lithium-ion transference number (= 0.75) and tunable room temperature ionic conductivity spanning three decades (≈10‑7 to 10‑3 Ω‑1 cm‑1) as a function of moisture content. The ionic conductivity show a distinct reversible transition around 80–100 °C, from a dual Li+ and H+ (<100 °C) to a pure Li+ conductor (>100 °C). Systematic studies reveal a transition from water-assisted Li-ion transport to Li hopping-like mechanism involving guanine-Li coordination. While as-synthesized G7Li has potential in humidity sensors, the anhydrous G7Li is attractive for rechargeable batteries.

  15. N7-(carboxymethyl)guanine-Lithium Crystalline Complex: A Bioinspired Solid Electrolyte

    PubMed Central

    Dutta, Dipak; Nagapradeep, N.; Zhu, Haijin; Forsyth, Maria; Verma, Sandeep; Bhattacharyya, Aninda J.

    2016-01-01

    Electrochemical device with components having direct significance to biological life processes is a potent futuristic strategy for the realization of all-round green and sustainable development. We present here synthesis design, structural analysis and ion transport of a novel solid organic electrolyte (G7Li), a compound reminiscent of ion channels, derived from regioisomeric N7-guanine-carboxylate conjugate and Li-ions. G7Li, with it’s in-built supply of Li+-ions, exhibited remarkably high lithium-ion transference number (= 0.75) and tunable room temperature ionic conductivity spanning three decades (≈10−7 to 10−3 Ω−1 cm−1) as a function of moisture content. The ionic conductivity show a distinct reversible transition around 80–100 °C, from a dual Li+ and H+ (<100 °C) to a pure Li+ conductor (>100 °C). Systematic studies reveal a transition from water-assisted Li-ion transport to Li hopping-like mechanism involving guanine-Li coordination. While as-synthesized G7Li has potential in humidity sensors, the anhydrous G7Li is attractive for rechargeable batteries. PMID:27091631

  16. ESI-MS Characterization of a Novel Pyrrole-Inosine Nucleoside that Interacts with Guanine Bases

    PubMed Central

    Pierce, Sarah E.; Sherman, Courtney L.; Jayawickramarajah, Janarthanan; Lawrence, Candace M.; Sessler, Jonathan L.; Brodbelt, Jennifer S.

    2008-01-01

    Based on binding studies undertaken by electrospray ionization-mass spectrometry, a synthetic pyrrole-inosine nucleoside, 1, capable of forming an extended three-point Hoogsteen-type hydrogen-bonding interaction with guanine, is shown to form specific complexes with two different quadruplex DNA structures [dTG4T]4 and d(T2G4)4 as well as guanine rich duplex DNA. The binding interactions of two other analogs were evaluated in order to unravel the structural features that contribute to specific DNA recognition. The importance of the Hoogsteen interactions was confirmed through the absence of specific binding when the pyrrole NH hydrogen-bonding site was blocked or removed. While 2, with a large blocking group, was not found to interact with virtually any form of DNA, 3, with the pyrrole functionality missing, was found to interact non-specifically with several types of DNA. The specific binding of 1 to guanine rich DNA emphasizes the necessity of careful ligand design for specific sequence recognition. PMID:18790136

  17. Diminution in adenine nucleotide hydrolysis by platelets and serum from rats submitted to Walker 256 tumour.

    PubMed

    Buffon, Andréia; Ribeiro, Vanessa B; Schanoski, Alessandra S; Sarkis, João J F

    2006-01-01

    Extracellular adenine nucleotide hydrolysis in the circulation is mediated by the action of an NTPDase (CD39, apyrase) and of a 5'-nucleotidase (CD73), presenting as a final product, adenosine. Among other properties described for adenine nucleotides, an anti-cancer activity is suggested, since ATP is considered a cytotoxic molecule in several tumour cell systems. Conversely, some studies demonstrate that adenosine presents a tumour-promoting activity. In this study, we evaluated the pattern of adenine nucleotide hydrolysis by serum and platelets from rats submitted to the Walker 256 tumour model. Extracellular adenine nucleotide hydrolysis by blood serum and platelets obtained from rats at, 6, 10 and 15 days after the subcutaneous Walker 256 tumour inoculation, was evaluated. Our results demonstrate a significant reduction in ATP, ADP and AMP hydrolysis in blood serum at 6, 10 and 15 days after tumour induction. In platelets, a significant reduction in ATP and AMP hydrolysis was observed at 10 and 15 days after tumour induction, while an inhibition of ADP hydrolysis was observed at all times studied. Based on these results, it is possible to suggest a physiologic protection mechanism against the tumoral process in circulation. The inhibition in nucleotide hydrolysis observed probably maintains ATP levels elevated (cytotoxic compound) and, at the same time, reduces the adenosine production (tumour-promoting molecule) in the circulation.

  18. Ameliorative Effect of Chrysin on Adenine-Induced Chronic Kidney Disease in Rats

    PubMed Central

    Ali, Badreldin H.; Adham, Sirin A.; Al Za’abi, Mohammed; Waly, Mostafa I.; Yasin, Javed; Nemmar, Abderrahim; Schupp, Nicole

    2015-01-01

    Chrysin (5, 7- dihydroxyflavone) is a flavonoid with several pharmacological properties that include antioxidant, anti-inflammatory and antiapoptotic activities. in this work, we investigated some effects of three graded oral doses of chrysin (10, 50 and 250 mg/kg) on kidney structure and function in rats with experimental chronic renal disease (CKD) induced by adenine (0.25% w/w in feed for 35 days), which is known to involve inflammation and oxidative stress. Using several indices in plasma, urine and kidney homogenates, adenine was found to impair kidney function as it lowered creatinine clearance and increased plasma concentrations of creatinine, urea, neutrophil gelatinase-associated lipocalin and N-Acetyl-beta-D-glucosaminidase activity. Furthermore, it raised plasma concentrations of the uremic toxin indoxyl sulfate, some inflammatory cytokines and urinary albumin concentration. Renal morphology was severely damaged and histopathological markers of inflammation and fibrosis were especially increased. In renal homogenates, antioxidant indices, including superoxide dismutase and catalase activities, total antioxidant capacity and reduced glutathione were all adversely affected. Most of these adenine – induced actions were moderately and dose -dependently mitigated by chrysin, especially at the highest dose. Chrysin did not cause any overt adverse effect on the treated rats. The results suggest that different doses of chrysin produce variable salutary effects against adenine-induced CKD in rats, and that, pending further pharmacological and toxicological studies, its usability as a possible ameliorative agent in human CKD should be considered. PMID:25909514

  19. Ameliorative effect of chrysin on adenine-induced chronic kidney disease in rats.

    PubMed

    Ali, Badreldin H; Adham, Sirin A; Al Za'abi, Mohammed; Waly, Mostafa I; Yasin, Javed; Nemmar, Abderrahim; Schupp, Nicole

    2015-01-01

    Chrysin (5, 7- dihydroxyflavone) is a flavonoid with several pharmacological properties that include antioxidant, anti-inflammatory and antiapoptotic activities. in this work, we investigated some effects of three graded oral doses of chrysin (10, 50 and 250 mg/kg) on kidney structure and function in rats with experimental chronic renal disease (CKD) induced by adenine (0.25% w/w in feed for 35 days), which is known to involve inflammation and oxidative stress. Using several indices in plasma, urine and kidney homogenates, adenine was found to impair kidney function as it lowered creatinine clearance and increased plasma concentrations of creatinine, urea, neutrophil gelatinase-associated lipocalin and N-Acetyl-beta-D-glucosaminidase activity. Furthermore, it raised plasma concentrations of the uremic toxin indoxyl sulfate, some inflammatory cytokines and urinary albumin concentration. Renal morphology was severely damaged and histopathological markers of inflammation and fibrosis were especially increased. In renal homogenates, antioxidant indices, including superoxide dismutase and catalase activities, total antioxidant capacity and reduced glutathione were all adversely affected. Most of these adenine - induced actions were moderately and dose -dependently mitigated by chrysin, especially at the highest dose. Chrysin did not cause any overt adverse effect on the treated rats. The results suggest that different doses of chrysin produce variable salutary effects against adenine-induced CKD in rats, and that, pending further pharmacological and toxicological studies, its usability as a possible ameliorative agent in human CKD should be considered.

  20. Effect of atracylodes rhizome polysaccharide in rats with adenine-induced chronic renal failure.

    PubMed

    Yang, C; Liu, C; Zhou, Q; Xie, Y C; Qiu, X M; Feng, X

    2015-01-01

    The aim of the study was to elucidate the therapeutic effects of Atracylodes rhizome polysaccharide on adenine-induced chronic renal failure in rats. Fifty male Sprague Dawley rats were selected and randomly divided in to 5 groups (n=10 rats per group): The normal control group, the chronic renal failure pathological control group, the dexamethasone treatment group and two Atracylodes rhizome polysaccharide treatment groups, treated with two different concentrations of the polysaccharide, the Atracylodes rhizome polysaccharide high group and the Atracylodes rhizome polysaccharide low group. All the rats, except those in the normal control group were fed adenine-enriched diets, containing 10 g adenine per kg food for 3 weeks. After being fed with adenine, the dexamethasone treatment group, Atracylodes rhizome polysaccharide high group and Atracylodes rhizome polysaccharide low group rats were administered the drug orally for 2 weeks. On day 35, the kidney coefficient of the rats and the serum levels of creatinine, blood urea nitrogen, total protein and hemalbumin were determined. Subsequent to experimentation on a model of chronic renal failure in rats, the preparation was proven to be able to reduce serum levels of creatinine, blood urea nitrogen and hemalbumin levels (P<0.05) and improve renal function. Atracylodes rhizome polysaccharide had reversed the majority of the indices of chronic renal failure in rats.

  1. The Effect of Adenine Repeats on G-quadruplex/hemin Peroxidase Mimicking DNAzyme Activity.

    PubMed

    Chen, Jielin; Guo, Yuehua; Zhou, Jun; Ju, Huangxian

    2017-03-23

    The catalytic activity of G-quadruplex/hemin is much lower than that of proteinous enzymes, so it is very important to increase its activity. Very recently, flanking sequences, which can be regarded as an external part of G-quadruplexes, were found to enhance the activity of G-quadruplex/hemin DNAzyme. However, little is known about the effect of internal parts, such as loop sequences and linkers, on the activity. In the present study, adenine repeats were incorporated into several designed G-quadruplex structures either in the loops, bulges, or linkers, and the constructed G-quadruplex/hemin DNAzyme exhibit about fivefold improvement in peroxidase-mimicking activity in some cases. The enhancement effect may result from the formation of compound I, protoporphyrin⋅Fe(IV) =O(.+) , accelerated by dA repeats, which was demonstrated by H2 O2 decay kinetics and pH dependency analysis. The novel enhancement methods described here may help in the development of high-activity DNAzymes, illustrated by a dimer G-quadruplex with flanking adenine at one end, a relatively long adenine run in one loop, and another adenine run in the linker.

  2. Macrophage Trafficking as Key Mediator of Adenine-Induced Kidney Injury

    PubMed Central

    Braga, Tárcio Teodoro; Felizardo, Raphael José Ferreira; Andrade-Oliveira, Vinícius; Hiyane, Meire Ioshie; da Silva, João Santana; Câmara, Niels Olsen Saraiva

    2014-01-01

    Macrophages play a special role in the onset of several diseases, including acute and chronic kidney injuries. In this sense, tubule interstitial nephritis (TIN) represents an underestimated insult, which can be triggered by different stimuli and, in the absence of a proper regulation, can lead to fibrosis deposition. Based on this perception, we evaluated the participation of macrophage recruitment in the development of TIN. Initially, we provided adenine-enriched food to WT and searched for macrophage presence and action in the kidney. Also, a group of animals were depleted of macrophages with the clodronate liposome while receiving adenine-enriched diet. We collected blood and renal tissue from these animals and renal function, inflammation, and fibrosis were evaluated. We observed higher expression of chemokines in the kidneys of adenine-fed mice and a substantial protection when macrophages were depleted. Then, we specifically investigated the role of some key chemokines, CCR5 and CCL3, in this TIN experimental model. Interestingly, CCR5 KO and CCL3 KO animals showed less renal dysfunction and a decreased proinflammatory profile. Furthermore, in those animals, there was less profibrotic signaling. In conclusion, we can suggest that macrophage infiltration is important for the onset of renal injury in the adenine-induced TIN. PMID:25132730

  3. The effect of activated charcoal on adenine-induced chronic renal failure in rats.

    PubMed

    Ali, Badreldin H; Alza'abi, Mohamed; Ramkumar, Aishwarya; Al-Lawati, Intisar; Waly, Mostafa I; Beegam, Sumaya; Nemmar, Abderrahim; Brand, Susanne; Schupp, Nicole

    2014-03-01

    Activated charcoal (AC) is a sorbent that has been shown to remove urinary toxins like urea and indoxyl sulfate. Here, the influence of AC on kidney function of rats with experimental chronic renal failure (CRF) is investigated. CRF was induced in rats by feeding adenine (0.75%) for four weeks. As an intervention, AC was added to the feed at concentrations of 10%, 15% or 20%. Adenine treatment impaired kidney function: it lowered creatinine clearance and increased plasma concentrations of creatinine, urea, neutrophil gelatinase-associated lipocalin and vanin-1. Furthermore, it raised plasma concentrations of the uremic toxins indoxyl sulfate, phosphate and uric acid. Renal morphology was severely damaged and histopathological markers of inflammation and fibrosis were especially increased. In renal homogenates, antioxidant indices, including superoxide dismutase and catalase activity, total antioxidant capacity and reduced glutathione were adversely affected. Most of these changes were significantly ameliorated by dietary administration of AC at a concentration of 20%, while effects induced by lower doses of dietary AC on adenine nephrotoxicity were not statistically significant. The results suggest that charcoal is a useful sorbent agent in dietary adenine-induced CRF in rats and that its usability as a nephroprotective agent in human kidney disease should be studied.

  4. High membrane potential promotes alkenal-induced mitochondrial uncoupling and influences adenine nucleotide translocase conformation.

    PubMed

    Azzu, Vian; Parker, Nadeene; Brand, Martin D

    2008-07-15

    Mitochondria generate reactive oxygen species, whose downstream lipid peroxidation products, such as 4-hydroxynonenal, induce uncoupling of oxidative phosphorylation by increasing proton leak through mitochondrial inner membrane proteins such as the uncoupling proteins and adenine nucleotide translocase. Using mitochondria from rat liver, which lack uncoupling proteins, in the present study we show that energization (specifically, high membrane potential) is required for 4-hydroxynonenal to activate proton conductance mediated by adenine nucleotide translocase. Prolonging the time at high membrane potential promotes greater uncoupling. 4-Hydroxynonenal-induced uncoupling via adenine nucleotide translocase is prevented but not readily reversed by addition of carboxyatractylate, suggesting a permanent change (such as adduct formation) that renders the translocase leaky to protons. In contrast with the irreversibility of proton conductance, carboxyatractylate added after 4-hydroxynonenal still inhibits nucleotide translocation, implying that the proton conductance and nucleotide translocation pathways are different. We propose a model to relate adenine nucleotide translocase conformation to proton conductance in the presence or absence of 4-hydroxynonenal and/or carboxyatractylate.

  5. Lead(II)-catalyzed oxidation of guanine in solution studied with electrospray ionization mass spectrometry.

    PubMed

    Banu, Laura; Blagojevic, Voislav; Bohme, Diethard K

    2012-10-04

    The oxidation of guanine was investigated in water/methanol solution both in the absence and in the presence of Pb(II) with a variable temperature reactor coupled to a tandem mass spectrometer that allowed signature ions of solution reagents and products to be monitored by electrospray ionization (ESI). Two different oxidizing agents were employed, one strong (peroxymonosulfuric acid) and one weaker (hydrogen peroxide). Peroxymonosulfuric acid was observed to oxidize guanine rapidly at room temperature, k(app) > 10(-2) s(-1), whether in the absence or in the presence of Pb(II), to produce spiroiminohydantoin. Guanine did not show measurable oxidation by hydrogen peroxide in the absence of Pb(II) at concentrations of H(2)O(2) up to 1 M at temperatures up to 333 K (k(app) < 3 × 10(-8) s(-1) at 298 K), but in the presence of Pb(II), it was observed to produce both 5-carboxamido-5-formamido-2-iminohydantoin (2-Ih) and imidazolone (Iz) in a ratio of 2.3 ± 0.1 with a total rate enhancement of more than 4 × 10(3). The activation energy was measured to be 82 ± 11 kJ mol(-1) and is more than 120 kJ mol(-1) lower than that for the uncatalyzed oxidation with hydrogen peroxide measured to be at least 208 ± 26 kJ mol(-1). An activation energy of 113 ± 9 kJ mol(-1) has been reported by Bruskov et al. (Nucleic Acids Res.2002, 30, 1354) for the heat-induced oxidation by hydrogen peroxide of guanine embedded as guanosine in DNA which leads to the production of 8-oxo-7,8-dihydro-guanine (8-oxo-Gua). The atomic lead dication lowers the activation energy by activating the hydrogen peroxide oxidant, possibly by O-O bond activation, and by directing the oxidation, possibly through coordination to the functional groups adjacent to the carbon C5: the C6 carbonyl group and the N7 nitrogen. The coupling of tandem mass spectrometry (MS(2)) with a simple variable temperature reactor by ESI proved to be very effective for measuring reaction kinetics and activation energies in solution

  6. Photosensitized Oxidation of Hypoxanthine and Xanthine by Aluminum Phthalocyanine Tetrasulfonate. Role of the Alkylating Quinone 2,5-Dichloro-diaziridinyl-1,4-benzoquinone

    PubMed Central

    Alegria, Antonio E.; Inostroza, Yaritza; Kumar, Ajay

    2009-01-01

    Photoirradiation of nitrogen-saturated aqueous solutions containing aluminum phthalocyanine tetrasulfonate (AlPcS4) at 675 nm in the presence of 2,5-dichloro-diaziridinyl-1,4-benzoquinone (AZDClQ) and hypoxanthine (HX) produces the oxidized HX derivatives, xanthine (X) and uric acid (UA). Concentrations of the AZDClQ semiquinone, X and UA increase at the expense of HX with an increase in irradiation time. Almost negligible decomposition of HX, as well as very low amounts of X, are detected if photolysis occurs under identical conditions but in the absence of AZDClQ. Addition of calf-thymus DNA produces quinone-DNA covalent adducts after photolysis of anaerobic samples containing quinone, DNA and AlPcS4, in the presence or absence of HX and at pH 5.5. However, larger amounts of quinone-DNA adducts are detected if HX is present. The results presented here could have applications in the photodynamic treatment of hypoxic tissues such as solid tumors, under conditions of high HX concentration, where Type-I pathways could be more important than singlet oxygen generation. PMID:18627517

  7. Gender-specific frequency of background somatic mutations at the hypoxanthine phosphoribosyltransferase locus in cord blood T lymphocytes from preterm newborns

    PubMed Central

    Yoshioka, Makoto; Vacek, Pamela M.; Poseno, Tina; Silver, Robert; Finette, Barry A.

    1999-01-01

    Limited information is available regarding the frequency, spectrum, and clinical relevance of somatic mutations in the developing fetus. The goal of this study was to determine somatic mutant frequencies (Mfs) at the hypoxanthine phosphoribosyltransferase (HPRT) reporter gene in cord blood T lymphocytes from preterm infants to gain insight into in utero mutational events. Mf determinations were made by using the HPRT T cell cloning assay on cord blood samples from 52 preterm infants. Natural logarithm Mfs (lnMfs) from preterm infants were compared with results from our database for full-term infants. Our analysis revealed higher lnMfs in cord blood T lymphocytes from preterm compared with full-term infants (P = 0.008). In addition, preterm females had significantly higher lnMfs compared with full-term females (P < 0.001), whereas preterm males were found to have significantly lower lnMfs than preterm females (P = 0.005). Regression analyses also demonstrate a significant relationship between lnMf and gestational age for preterm females that does not exist for preterm males. These results demonstrate the gender-specific association between Mf and age in humans. PMID:9892677

  8. The role of the C-terminal region on the oligomeric state and enzymatic activity of Trypanosoma cruzi hypoxanthine phosphoribosyl transferase.

    PubMed

    Valsecchi, Wanda M; Cousido-Siah, Alexandra; Defelipe, Lucas A; Mitschler, André; Podjarny, Alberto; Santos, Javier; Delfino, José M

    2016-06-01

    Hypoxanthine phosphoribosyl transferase from Trypanosoma cruzi (TcHPRT) is a critical enzyme for the survival of the parasite. This work demonstrates that the full-length form in solution adopts a stable and enzymatically active tetrameric form, exhibiting large inter-subunit surfaces. Although this protein irreversibly aggregates during unfolding, oligomerization is reversible and can be modulated by low concentrations of urea. When the C-terminal region, which is predicted as a disordered stretch, is excised by proteolysis, TcHPRT adopts a dimeric state, suggesting that the C-terminal region acts as a main guide for the quaternary arrangement. These results are in agreement with X-ray crystallographic data presented in this work. On the other hand, the C-terminal region exhibits a modulatory role on the enzyme, as attested by the enhanced activity observed for the dimeric form. Bisphosphonates act as substrate-mimetics, uncovering long-range communications among the active sites. All in all, this work contributes to establish new ways applicable to the design of novel inhibitors that could eventually result in new drugs against parasitic diseases.

  9. Administration of α-Galactosylceramide Improves Adenine-Induced Renal Injury.

    PubMed

    Aguiar, Cristhiane Favero; Naffah-de-Souza, Cristiane; Castoldi, Angela; Corrêa-Costa, Matheus; Braga, Tárcio T; Naka, Érika L; Amano, Mariane T; Abate, Débora T R S; Hiyane, Meire I; Cenedeze, Marcos A; Pacheco e Silva Filho, Alvaro; Câmara, Niels O S

    2015-06-18

    Natural killer T (NKT) cells are a subset of lymphocytes that reacts to glycolipids presented by CD1d. Invariant NKT cells (iNKT) correspond to >90% of the total population of NKTs and reacts to α-galactosylceramide (αGalCer). αGalCer promotes a complex mixture of Th1 and Th2 cytokines, as interferon (IFN)-γ and interleukin (IL)-4. NKT cells and IFN-γ are known to participate in some models of renal diseases, but further studies are still necessary to elucidate their mechanisms. The aim of our study was to analyze the participation of iNKT cells in an experimental model of tubule-interstitial nephritis. We used 8-wk-old C57BL/6j, Jα18KO and IFN-γKO mice. They were fed a 0.25% adenine diet for 10 d. Both adenine-fed wild-type (WT) and Jα18KO mice exhibited renal dysfunction, but adenine-fed Jα18KO mice presented higher expression of kidney injury molecule-1 (KIM-1), tumor necrosis factor (TNF)-α and type I collagen. To analyze the role of activated iNKT cells in our model, we administered αGalCer in WT mice during adenine ingestion. After αGalCer injection, we observed a significant reduction in serum creatinine, proinflammatory cytokines and renal fibrosis. However, this improvement in renal function was not observed in IFN-γKO mice after αGalCer treatment and adenine feeding, illustrating that this cytokine plays a role in our model. Our findings may suggest that IFN-γ production is one of the factors contributing to improved renal function after αGalCer administration.

  10. ON THE INTERACTION OF ADENINE WITH IONIZING RADIATION: MECHANISTICAL STUDIES AND ASTROBIOLOGICAL IMPLICATIONS

    SciTech Connect

    Evans, Nicholas L.; Ullrich, Susanne; Bennett, Chris J.; Kaiser, Ralf I.

    2011-04-01

    The molecular inventory available on the prebiotic Earth was likely derived from both terrestrial and extraterrestrial sources. A complete description of which extraterrestrial molecules may have seeded early Earth is therefore necessary to fully understand the prebiotic evolution which led to life. Galactic cosmic rays (GCRs) are expected to cause both the formation and destruction of important biomolecules-including nucleic acid bases such as adenine-in the interstellar medium within the ices condensed on interstellar grains. The interstellar ultraviolet (UV) component is expected to photochemically degrade gas-phase adenine on a short timescale of only several years. However, the destruction rate is expected to be significantly reduced when adenine is shielded in dense molecular clouds or even within the ices of interstellar grains. Here, biomolecule destruction by the energetic charged particle component of the GCR becomes important as it is not fully attenuated. Presented here are results on the destruction rate of the nucleobase adenine in the solid state at 10 K by energetic electrons, as generated in the track of cosmic ray particles as they penetrate ices. When both UV and energetic charged particle destructive processes are taken into account, the half-life of adenine within dense interstellar clouds is found to be {approx}6 Myr, which is on the order of a star-forming molecular cloud. We also discuss chemical reaction pathways within the ices to explain the production of observed species, including the formation of nitriles (R-C{identical_to}N), epoxides (C-O-C), and carbonyl functions (R-C=O).

  11. Administration of α-Galactosylceramide Improves Adenine-Induced Renal Injury

    PubMed Central

    Aguiar, Cristhiane Favero; Naffah-de-Souza, Cristiane; Castoldi, Angela; Corrêa-Costa, Matheus; Braga, Tárcio T; Naka, Érika L; Amano, Mariane T; Abate, Débora T R S; Hiyane, Meire I; Cenedeze, Marcos A; Filho, Alvaro Pacheco e Silva; Câmara, Niels O S

    2015-01-01

    Natural killer T (NKT) cells are a subset of lymphocytes that reacts to glycolipids presented by CD1d. Invariant NKT cells (iNKT) correspond to >90% of the total population of NKTs and reacts to α-galactosylceramide (αGalCer). αGalCer promotes a complex mixture of Th1 and Th2 cytokines, as interferon (IFN)-γ and interleukin (IL)-4. NKT cells and IFN-γ are known to participate in some models of renal diseases, but further studies are still necessary to elucidate their mechanisms. The aim of our study was to analyze the participation of iNKT cells in an experimental model of tubule-interstitial nephritis. We used 8-wk-old C57BL/6j, Jα18KO and IFN-γKO mice. They were fed a 0.25% adenine diet for 10 d. Both adenine-fed wild-type (WT) and Jα18KO mice exhibited renal dysfunction, but adenine-fed Jα18KO mice presented higher expression of kidney injury molecule-1 (KIM-1), tumor necrosis factor (TNF)-α and type I collagen. To analyze the role of activated iNKT cells in our model, we administered αGalCer in WT mice during adenine ingestion. After αGalCer injection, we observed a significant reduction in serum creatinine, proinflammatory cytokines and renal fibrosis. However, this improvement in renal function was not observed in IFN-γKO mice after αGalCer treatment and adenine feeding, illustrating that this cytokine plays a role in our model. Our findings may suggest that IFN-γ production is one of the factors contributing to improved renal function after αGalCer administration. PMID:26101952

  12. Differences in Electrostatic Potential Around DNA Fragments Containing Adenine and 8-oxo-Adenine. An Analysis Based on Regular Cylindrical Projection

    SciTech Connect

    Haranczyk, Maciej; Miller, John H; Gutowski, Maciej S

    2007-07-01

    Changes of electrostatic potential (EP) around the DNA molecule resulting from chemical modifications of nucleotides may play a role in enzymatic recognition of damaged sites. Effects of chemical modifications of nucleotides on the structure of DNA have been characterized through large scale density functional theory computations. Quantum mechanical structural optimizations of DNA fragments with three pairs of nucleotides and accompanying counteractions were performed with a B3LYP exchange-correlation functional and 6-31G** basis sets. The “intact” DNA fragment contained adenine in the middle layer, while the “damaged” fragment had the adenine replaced with 8-oxo-adenine. The electrostatic potential around these DNA fragments was projected on a cylindrical surface around the double helix. The two-dimensional maps of EP of the intact and damaged DNA fragments were analyzed to identify these modifications of EP that result from the occurrence of 8-oxo-adenine (8oA). It was found that distortions of a phosphate group neighboring 8oA and displacements of the accompanying countercation are clearly reflected in the EP maps. Helpful discussions Michel Dupuis are gratefully acknowledged. Authors wish to thank Marcel Swart for directing us to a compilation of van der Waals radii. This work was supported by the: (i) US DOE Office of Biological and Environmental Research, Low Dose Radiation Research Program (M.G. and M.H.), (ii) the Office of Science (BER), U. S. Department of Energy, Grant No. DE-FG03-02ER63470 (JHM), (iii) Polish State Committee for Scientific Research (KBN) Grant DS/8221-4-0140-6 (MG), (iv) European Social Funds (EFS) ZPORR/2.22/II/2.6/ARP/U/2/05 (M.H.). M.H. holds the Foundation for Polish Science (FNP) award for young scientists. The calculations were performed at the Academic Computer Center in Gdansk (TASK) and at the Molecular Science Computing Facility (MSCF) in the William R. Wiley Environmental Molecular Sciences Laboratory, a national

  13. Guanine nucleotide exchange factor Dock7 mediates HGF-induced glioblastoma cell invasion via Rac activation

    PubMed Central

    Murray, D W; Didier, S; Chan, A; Paulino, V; Van Aelst, L; Ruggieri, R; Tran, N L; Byrne, A T; Symons, M

    2014-01-01

    Background: Glioblastoma multiforme (GBM), a highly invasive primary brain tumour, remains an incurable disease. Rho GTPases and their activators, guanine nucleotide exchange factors (GEFs), have central roles in GBM invasion. Anti-angiogenic therapies may stimulate GBM invasion via HGF/c-Met signalling. We aim to identify mediators of HGF-induced GBM invasion that may represent targets in a combination anti-angiogenic/anti-invasion therapeutic paradigm. Methods: Guanine nucleotide exchange factor expression was measured by microarray analysis and western blotting. Specific depletion of proteins was accomplished using siRNA. Cell invasion was determined using matrigel and brain slice assays. Cell proliferation and survival were monitored using sulforhodamine B and colony formation assays. Guanine nucleotide exchange factor and GTPase activities were determined using specific affinity precipitation assays. Results: We found that expression of Dock7, a GEF, is elevated in human GBM tissue in comparison with non-neoplastic brain. We showed that Dock7 mediates serum- and HGF-induced glioblastoma cell invasion. We also showed that Dock7 co-immunoprecipitates with c-Met and that this interaction is enhanced upon HGF stimulation in a manner that is dependent on the adaptor protein Gab1. Dock7 and Gab1 also co-immunoprecipitate in an HGF-dependent manner. Furthermore, Gab1 is required for HGF-induced Dock7 and Rac1 activation and glioblastoma cell invasion. Conclusions: Dock7 mediates HGF-induced GBM invasion. Targeting Dock7 in GBM may inhibit c-MET-mediated invasion in tumours treated with anti-angiogenic regimens. PMID:24518591

  14. Interactions of. beta. -adrenergic receptors with guanine nucleotide-binding proteins

    SciTech Connect

    Abramson, S.N.

    1985-01-01

    The properties of ..beta..-adrenergic receptors were investigated with radioligand binding assays using the agonists (/sup 3/H)hydroxybenzyl-isoproterenol (/sup 3/H-HBI) and (/sup 3/H)epinephrine (/sup 3/H-EPI), and the antagonist (/sup 125/I)iodopindolol (/sup 125/I-IPIN). Membranes prepared from L6 myoblasts bound (/sup 3/H)HBI, (/sup 3/H)EPI, and (/sup 125/I)IPIN with high affinity and Scatchard plots revealed densities of 222 +/- 23, 111 +/- 7, and 325 +/- 37 fmol/mg of protein, respectively. Binding of (/sup 3/H)HBI and (/sup 3/H)EPI was inhibited allosterically by guanine nucleotides. Membranes prepared from wild-type S49 lymphoma cells bound (/sup 3/H)HBI and (/sup 125/I)IPIN with high affinity and Scatchard plots revealed densities of 48.9 +/- 7.1 and 196 +/- 29 fmol/mg of protein, respectively. Binding of (/sup 3/H)HBI was inhibited allosterically by GTP. Similar results were obtained with membranes prepared from the adenylate cyclase deficient variant of S49 lymphoma cells (cyc-), which does not contain a functional stimulatory guanine nucleotide-binding protein (N/sub s/), but does contain a functional inhibitory guanine nucleotide-binding protein (N/sub i/). Binding of (/sup 3/H)HBI to membranes prepared from cyc- S49 cells was inhibited by pretreatment of cells with pertussis toxin. These results suggest that ..beta..-adrenergic receptors on membranes prepared from cyc- S49 cells interact with N/sub i/ to form a ternary complex composed of agonist, receptor, and N/sub i/.

  15. Effect O6-guanine alkylation on DNA flexibility studied by comparative molecular dynamics simulations.

    PubMed

    Kara, Mahmut; Drsata, Tomas; Lankas, Filip; Zacharias, Martin

    2015-01-01

    Alkylation of guanine at the O6 atom is a highly mutagenic DNA lesion because it alters the coding specificity of the base causing G:C to A:T transversion mutations. Specific DNA repair enzymes, e.g. O(6)-alkylguanin-DNA-Transferases (AGT), recognize and repair such damage after looping out the damaged base to transfer it into the enzyme active site. The exact mechanism how the repair enzyme identifies a damaged site within a large surplus of undamaged DNA is not fully understood. The O(6)-alkylation of guanine may change the deformability of DNA which may facilitate the initial binding of a repair enzyme at the damaged site. In order to characterize the effect of O(6)-methyl-guanine (O(6)-MeG) containing base pairs on the DNA deformability extensive comparative molecular dynamics (MD) simulations on duplex DNA with central G:C, O(6)-MeG:C or O(6)-MeG:T base pairs were performed. The simulations indicate significant differences in the helical deformability due to the presence of O(6)-MeG compared to regular undamaged DNA. This includes enhanced base pair opening, shear and stagger motions and alterations in the backbone fine structure caused in part by transient rupture of the base pairing at the damaged site and transient insertion of water molecules. It is likely that the increased opening motions of O(6)-MeG:C or O(6)-MeG:T base pairs play a decisive role for the induced fit recognition or for the looping out of the damaged base by repair enzymes.

  16. Effect of hydration on the lowest singlet PiPi* excited-state geometry of guanine: a theoretical study.

    PubMed

    Shukla, M K; Leszczynski, Jerzy

    2005-09-15

    An ab-initio computational study was performed to investigate the effect of explicit hydration on the ground and lowest singlet PiPi* excited-state geometry and on the selected stretching vibrational frequencies corresponding to the different NH sites of the guanine acting as hydrogen-bond donors. The studied systems consisted of guanine interacting with one, three, five, six, and seven water molecules. Ground-state geometries were optimized at the HF level, while excited-state geometries were optimized at the CIS level. The 6-311G(d,p) basis set was used in all calculations. The nature of potential energy surfaces was ascertained via the harmonic vibrational frequency analysis; all structures were found minima at the respective potential energy surfaces. The changes in the geometry and the stretching vibrational frequencies of hydrogen-bond-donating sites of the guanine in the ground and excited state consequent to the hydration are discussed. It was found that the first solvation shell of the guanine can accommodate up to six water molecules. The addition of the another water molecule distorts the hydrogen-bonding network by displacing other neighboring water molecules away from the guanine plane.

  17. Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

    NASA Astrophysics Data System (ADS)

    Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

    2015-05-01

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

  18. Silver (I) as DNA glue: Ag(+)-mediated guanine pairing revealed by removing Watson-Crick constraints.

    PubMed

    Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G

    2015-05-14

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

  19. Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

    PubMed Central

    Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

    2015-01-01

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536

  20. Fluorescent Sensing of Guanine and Guanosine Monophosphate with Conjugated Receptors Incorporating Aniline and Naphthyridine Moieties.

    PubMed

    Lu, Shao-Hung; Phang, Riping; Fang, Jim-Min

    2016-04-15

    Ethyne-linked naphthyridine-aniline conjugated molecules are selective sensors of decylguanine in dichloromethane and guanosine monophosphate in water (Kass = 16,000 M(-1)). The 2-acetamido-1,8-naphthyridine moiety binds with guanine in a DAA-ADD triply hydrogen-bonded motif. The aniline moiety enhances an electron-donating effect, and the substituent is tuned to attain extra hydrogen bonds, π-π stacking, and electrostatic interactions. The proposed binding modes are supported by a Job plot, ESI-MS, (1)H NMR, UV-vis, and fluorescence spectral analyses.

  1. Electron and hole transfer from DNA base radicals to oxidized products of guanine in DNA.

    PubMed

    Cai, Zhongli; Sevilla, Michael D

    2003-03-01

    An investigation of electron and hole transfer to oxidized guanine bases in DNA is reported. Guanine in DNA was preferentially oxidized by Br(2)(*-) at 298 K to 8-oxo-7,8-dihydro-guanine (8-oxo-G) and higher oxidation products. HPLC-EC analysis of irradiated DNA shows that the formation of 8-oxo-G could not be increased above the ratio of one 8-oxo-G to 127 +/- 6 bp regardless of dose. 8-oxo-G can be produced only at low levels because it is further oxidized to other species. These oxidation products of guanine have been extensively investigated and identified by others. Our electron spin resonance studies suggest that at 77 K 8-oxo-G is a trap for radiation-produced holes, but certain further oxidation products of 8-oxo-G (G(ox)) are found to be efficient electron traps. Gamma irradiation of oxidized DNA samples in frozen (D(2)O) aqueous ices and glassy 7 M LiBr solutions resulted in radicals formed by electron attachment to the G(ox) sites that were monitored by electron spin resonance spectroscopy (ESR) at 77 K. These ESR spectra suggest that those oxidation products of 8-oxo-G containing alpha-diketo groups account for the electron traps (G(ox)) in oxidized DNA with oxaluric acid a likely major trap. Electron transfer from DNA anion radicals to G(ox) was followed by monitoring of their ESR signals with time at 77 K. Using typical values for the tunneling constant beta estimates of the relative amount of G(ox) to base pairs were obtained. Radicals formed by UV photolysis of oxidized DNA in 8 M NaClO(4) glassy aqueous solutions were also investigated. The 8-oxo-G cation accounts for less than 10% of all the radicals observed after either gamma irradiation of oxidized DNA in frozen (D(2)O) aqueous solution or UV photolysis of oxidized DNA in 8 M NaClO(4) glassy aqueous solutions. We estimate hole transfer distances of about 7 +/- 1 bp at 1 min from G(*+) to 8-oxo-G.

  2. Generation of guanine-thymidine cross-links in DNA by peroxynitrite/carbon dioxide.

    PubMed

    Yun, Byeong Hwa; Geacintov, Nicholas E; Shafirovich, Vladimir

    2011-07-18

    Nitrosoperoxycarbonate derived from the combination of carbon dioxide and peroxynitrite is an important chemical mediator of inflammation. In aqueous solutions, it rapidly decomposes to the reactive species CO(3)(•-) and (•)NO(2) radicals that are known to initiate the selective oxidation and nitration of guanine in DNA. We have previously demonstrated that the reactions of carbonate radical anions with guanine in 2'-deoxyoligoribonucleotides generate a previously unknown intrastrand cross-linked guanine-thymine product G*-T* with a covalent bond between the C8 (G*) and the thymine N3 (T*) atoms (Crean Nucleic Acids Res. 2008, 36, 742-755). In this work, we demonstrate that G*-T* cross-linked products are also formed when peroxynitrite (0.1 mM) reacts with native DNA in aqueous solutions (pH 7.5-7.7) containing 25 mM carbon dioxide/bicarbonate, in addition to the well-known nitration/oxidation products of guanine such as 8-nitroguanine (8-nitro-G), 5-guanidino-4-nitroimidazole (NIm), 8-oxo-7,8-dehydroguanine (8-oxo-G), and spiroiminodihydantoin (Sp). The yields of these products, after enzymatic digestion with P1 nuclease and alkaline phosphatase to the nucleotide level and reversed phase HPLC separation, were compared with those obtained with the uniformly, isotopically labeled (15)N,(13)C-labeled 2'-deoxy oligoribonucleotides 5'-dGpT and 5'-dGpCpT. The d(G*pT*) and d(G*-T*) cross-linked products derived from the di- and trioligonucleotides, respectively, were used as standards for identifying the analogous lesions in calf thymus DNA by isotope dilution LC-MS/MS methods in the selected reaction monitoring mode. The NIm and 8-nitro-G are the major products formed (∼0.05% each), and lesser amounts of 8-oxo-G (∼0.02%) and d(G*pT*) and d(G*-T*) enzymatic digestion products (∼0.002% each) were found. It is shown that the formation of d(G*pT*) enzyme digestion product can arise only from intrastrand cross-links, whereas d(G*-T*) can arise from both interstrand

  3. Solvent effect on the anharmonic vibrational frequencies in guanine-cytosine base pair

    NASA Astrophysics Data System (ADS)

    Bende, A.; Muntean, C. M.

    2012-02-01

    We present an ab initio study of the vibrational properties of cytosine and guanine in the Watson-Crick and Hoogsteen base pair configurations. The results are obtained by considering the DFT method together with the Polarizable Continuum Model (PCM) using PBE and B3PW91 exchange-correlation functionals and triple-ζ valence basis set. We investigate the importance of anharmonic corrections for the vibrational modes taking into account the solvent effect of the water environment. In particular, the unusual anharmonic effect of the H+ vibration in the case of the Hoogsteen base pair configuration is discussed.

  4. Experimental treatment of Staphylococcus aureus bovine intramammary infection using a guanine riboswitch ligand analog.

    PubMed

    Ster, C; Allard, M; Boulanger, S; Lamontagne Boulet, M; Mulhbacher, J; Lafontaine, D A; Marsault, E; Lacasse, P; Malouin, F

    2013-02-01

    Staphylococcus aureus is a leading cause of intramammary infections (IMI). We recently demonstrated that Staph. aureus strains express the gene guaA during bovine IMI. This gene codes for a guanosine monophosphate synthetase and its expression is regulated by a guanine riboswitch. The guanine analog 2,5,6-triaminopyrimidine-4-one (PC1) is a ligand of the guanine riboswitch. Interactions between PC1 and its target result in inhibition of guanosine monophosphate synthesis and subsequent death of the bacterium. The present study describes the investigational use of PC1 for therapy of Staph. aureus IMI in lactating cows. The in vitro minimal inhibitory concentration of PC1 ranged from 0.5 to 4 μg/mL for a variety of Staph. aureus and Staphylococcus epidermidis strains and required a reducing agent for stability and full potency. A safety assessment study was performed, whereby the healthy quarters of 4 cows were infused with increasing doses of PC1 (0, 150, 250, and 500 mg). Over the 44 h following infusions, no obvious adverse effect was observed. Ten Holstein multiparous cows in mid lactation were then experimentally infused into 3 of the quarters with approximately 50 cfu of Staph. aureus strain SHY97-3906 and infection was allowed to progress for 2 wk before starting PC1 treatment. Bacterial counts reached then about 10(3) to 10(4) cfu/mL of milk. Infected quarters were treated with 1 of 3 doses of PC1 (0, 250, or 500 mg) after each morning and evening milking for 7d (i.e., 14 intramammary infusions of PC1). During the treatment period, milk from PC1-treated quarters showed a significant reduction in bacterial concentrations. However, this reduction of Staph. aureus count in milk was not maintained during the 4 wk following the end of the treatment and only 15% of the PC1-treated quarters underwent bacteriological cure. The somatic cell count and the quarter milk production were not affected by treatments. Although bacterial clearance was not achieved following

  5. Differences in nitric oxide steady states between arginine, hypoxanthine, uracil auxotrophs (AHU) and non-AHU strains of Neisseria gonorrhoeae during anaerobic respiration in the presence of nitrite.

    PubMed

    Barth, Kenneth; Clark, Virginia L

    2008-08-01

    Neisseria gonorrhoeae can grow by anaerobic respiration using nitrite as an alternative electron acceptor. Under these growth conditions, N. gonorrhoeae produces and degrades nitric oxide (NO), an important host defense molecule. Laboratory strain F62 has been shown to establish and maintain a NO steady-state level that is a function of the nitrite reductase/NO reductase ratio and is independent of cell number. The nitrite reductase activities (122-197 nmol NO2 reduced x min(-1) x OD600(-1)) and NO reductase activities (88-155 nmol NO reduced x min(-1) x OD600(-1)) in a variety of gonococcal clinical isolates were similar to the specific activities seen in F62 (241 nmol NO2 reduced x min(-1) x OD600(-1) and 88 nmol NO reduced x min(-1) x OD600(-1), respectively). In seven gonococcal strains, the NO steady-state levels established in the presence of nitrite were similar to that of F62 (801-2121 nmol x L-1 NO), while six of the strains, identified as arginine, hypoxanthine, and uracil auxotrophs (AHU), that cause asymptomatic infection in men had either two- to threefold (373-579 nmol x L-1 NO) or about 100-fold (13-24 nmol x L-1 NO) lower NO steady-state concentrations. All tested strains in the presence of a NO donor, 2,2'-(hydroxynitrosohydrazono)bis-ethanimine/NO, quickly lowered and maintained NO levels in the noninflammatory range of NO (<300 nmol x L-1). The generation of a NO steady-state concentration was directly affected by alterations in respiratory control in both F62 and an AHU strain, although differences in membrane function are suspected to be responsible for NO steady-state level differences in AHU strains.

  6. Neonatal hypothyroidism affects the adenine nucleotides metabolism in astrocyte cultures from rat brain.

    PubMed

    Braganhol, Elizandra; Bruno, Alessandra Nejar; Bavaresco, Luci; Barreto-Chaves, Maria Luiza M; Sarkis, João José Freitas; Battastini, Ana Maria Oliveira

    2006-04-01

    Neonatal hypothyroidism is associated with multiple and severe brain alterations. We recently demonstrated a significant increase in hydrolysis of AMP to adenosine in brain of hypothyroid rats at different ages. However, the origin of this effect was unclear. Considering the effects of adenine nucleotides to brain functions and the harmful effects of neonatal hypothyroidism to normal development of the central nervous system, in this study we investigated the metabolism of adenine nucleotides in hippocampal, cortical and cerebellar astrocyte cultures from rats submitted to neonatal hypothyroidism. ATP and AMP hydrolysis were enhanced by 52 and 210%, respectively, in cerebellar astrocytes from hypothyroid rats. In hippocampus of hypothyroid rats, the 47% increase in AMP hydrolysis was significantly reverted when the astrocytes were treated with T3. Therefore, the imbalance in the ATP and adenosine levels in astrocytes, during brain development, may contribute to some of the effects described in neonatal hypothyroidism.

  7. From formamide to adenine: a self-catalytic mechanism for an abiotic approach.

    PubMed

    Wang, Jing; Gu, Jiande; Nguyen, Minh Tho; Springsteen, Greg; Leszczynski, Jerzy

    2013-11-14

    Mechanisms for abiotic reaction pathways from formamide (H2NCHO) to adenine are presented herein. Formamide is a simple C1 building block hypothesized to be a precursor to many protometabolic compounds. On the basis of a step-by-step mechanism of the reaction pathways, formamide is suggested to be more reactive in addition reactions than HCN. In addition to its simplicity, the formamide self-catalyzed mechanism is energetically (kinetically) more viable than either a water-catalyzed mechanism or noncatalyzed processes. Moreover, this self-catalyzed mechanism accounts for the yields of purine and adenine previously observed in experiments. This mechanism may elucidate processes that were vital for the emergence of life on the early earth.

  8. Critical appraisal of excited state nonadiabatic dynamics simulations of 9H-adenine.

    PubMed

    Barbatti, Mario; Lan, Zhenggang; Crespo-Otero, Rachel; Szymczak, Jaroslaw J; Lischka, Hans; Thiel, Walter

    2012-12-14

    In spite of the importance of nonadiabatic dynamics simulations for the understanding of ultrafast photo-induced phenomena, simulations based on different methodologies have often led to contradictory results. In this work, we proceed through a comprehensive investigation of on-the-fly surface-hopping simulations of 9H-adenine in the gas phase using different electronic structure theories (ab initio, semi-empirical, and density functional methods). Simulations that employ ab initio and semi-empirical multireference configuration interaction methods predict the experimentally observed ultrafast deactivation of 9H-adenine with similar time scales, however, through different internal conversion channels. Simulations based on time-dependent density functional theory with six different hybrid and range-corrected functionals fail to predict the ultrafast deactivation. The origin of these differences is analyzed by systematic calculations of the relevant reaction pathways, which show that these discrepancies can always be traced back to topographical features of the underlying potential energy surfaces.

  9. Theoretical Study of Tautomerization Reactions for the Ground and First Excited Electronic States of Adenine

    NASA Technical Reports Server (NTRS)

    Salter, Latasha M.; Chaban, Galina M.; Kwak, Dochan (Technical Monitor)

    2002-01-01

    Geometrical structures and energetic properties for different tautomers of adenine are calculated in this study, using multi-configurational wave functions. Both the ground and the lowest singlet excited state potential energy surfaces are studied. Four tautomeric forms are considered, and their energetic order is found to be different on the ground and the excited state potential energy surfaces. Minimum energy reaction paths are obtained for hydrogen atom transfer (tautomerization) reactions in the ground and the lowest excited electronic states. It is found that the barrier heights and the shapes of the reaction paths are different for the ground and the excited electronic states, suggesting that the probability of such tautomerization reaction is higher on the excited state potential energy surface. This tautomerization process should become possible in the presence of water or other polar solvent molecules and should play an important role in the photochemistry of adenine.

  10. Induction of nucleoside phosphorylase in Enterobacter aerogenes and enzymatic synthesis of adenine arabinoside.

    PubMed

    Wei, Xiao-Kun; Ding, Qing-Bao; Zhang, Lu; Guo, Yong-Li; Ou, Lin; Wang, Chang-Lu

    2008-07-01

    Nucleoside phosphorylases (NPases) were found to be induced in Enterobacter aerogenes DGO-04, and cytidine and cytidine 5'-monophosphate (CMP) were the best inducers. Five mmol/L to fifteen mmol/L cytidine or CMP could distinctly increase the activities of purine nucleoside phosphorylase (PNPase), uridine phosphorylase (UPase) and thymidine phosphorylase (TPase) when they were added into medium from 0 to 8 h. In the process of enzymatic synthesis of adenine arabinoside from adenine and uracil arabinoside with wet cells of Enterobacter aerogenes DGO-04 induced by cytidine or CMP, the reaction time could be shortened from 36 to 6 h. After enzymatic reaction the activity of NPase in the cells induced remained higher than that in the cells uninduced.

  11. Adenine Nucleotides Control Proliferation In Vivo of Rat Retinal Progenitors by P2Y1 Receptor.

    PubMed

    de Almeida-Pereira, Luana; Magalhães, Camila Feitosa; Repossi, Marinna Garcia; Thorstenberg, Maria Luiza Prates; Sholl-Franco, Alfred; Coutinho-Silva, Robson; Ventura, Ana Lucia Marques; Fragel-Madeira, Lucianne

    2016-08-24

    Previous studies demonstrated that exogenous ATP is able to regulate proliferation of retinal progenitor cells (RPCs) in vitro possibly via P2Y1 receptor, a G protein-coupled receptor. Here, we evaluated the function of adenine nucleotides in vivo during retinal development of newborn rats. Intravitreal injection of apyrase, an enzyme that hydrolyzes nucleotides, reduced cell proliferation in retinas at postnatal day 2 (P2). This decrease was reversed when retinas were treated together with ATPγ-S or ADPβ-S, two hydrolysis-resistant analogs of ATP and ADP, respectively. During early postnatal days (P0 to P5), an increase in ectonucleotidase (E-NTPDase) activity was observed in the retina, suggesting a decrease in the availability of adenine nucleotides, coinciding with the end of proliferation. Interestingly, intravitreal injection of the E-NTPDase inhibitor ARL67156 increased proliferation by around 60 % at P5 rats. Furthermore, immunolabeling against P2Y1 receptor was observed overall in retina layers from P2 rats, including proliferating Ki-67-positive cells in the neuroblastic layer (NBL), suggesting that this receptor could be responsible for the action of adenine nucleotides upon proliferation of RPCs. Accordingly, intravitreal injection of MRS2179, a selective antagonist of P2Y1 receptors, reduced cell proliferation by approximately 20 % in P2 rats. Moreover, treatment with MRS 2179 caused an increase in p57(KIP2) and cyclin D1 expression, a reduction in cyclin E and Rb phosphorylated expression and in BrdU-positive cell number. These data suggest that the adenine nucleotides modulate the proliferation of rat RPCs via activation of P2Y1 receptors regulating transition from G1 to S phase of the cell cycle.

  12. Geometric consequences of electron delocalization for adenine tautomers in aqueous solution.

    PubMed

    Raczyńska, Ewa D; Makowski, Mariusz

    2014-06-01

    Geometric consequences of electron delocalization were studied for all possible adenine tautomers in aqueous solution by means of ab initio methods {PCM(water)//DFT(B3LYP)/6-311+G(d,p)} and compared to those in the gas phase {DFT(B3LYP)/6-311+G(d,p)}. To measure the consequences of any type of resonance conjugation (π-π, n-π, and σ-π), the geometry-based harmonic oscillator model of electron delocalization (HOMED) index, recently extended to the isolated (DFT) and hydrated (PCM//DFT) molecules, was applied to the molecular fragments (imidazole, pyrimidine, 4-aminopyrimidine, and purine) and also to the whole tautomeric system. For individual tautomers, the resonance conjugations and consequently the bond lengths strongly depend on the position of the labile protons. The HOMED indices are larger for tautomers (or their fragments) possessing the labile proton(s) at the N rather than C atom. Solvent interactions with adenine tautomers slightly increase the resonance conjugations. Consequently, they slightly shorten the single bonds and lengthen the double bonds. When going from the gas phase to water solution, the HOMED indices increase (by less than 0.15 units). There is a good relation between the HOMED indices estimated in water solution and those in the gas phase for the neutral and ionized forms of adenine. Subtle effects, being a consequence of intramolecular interactions between the neighboring groups, are so strongly reduced by solvent that the relation between the HOMED indices and the relative energies for the neutral adenine tautomers seems to be better in water solution than in the gas phase.

  13. Synthesis of metal-adeninate frameworks with high separation capacity on C2/C1 hydrocarbons

    NASA Astrophysics Data System (ADS)

    He, Yan-Ping; Zhou, Nan; Tan, Yan-Xi; Wang, Fei; Zhang, Jian

    2016-06-01

    By introducing isophthalic acid or 2,5-thiophenedicarboxylic acid to assemble with adenine and cadmium salt, two isostructural and anionic porous metal-organic frameworks (1 and 2) possessing the novel (4,8)-connected sqc topology are presented here. 1 shows permanent porosity with Langmuir surface area of 770.1 m2/g and exhibits high separation capacity on C2/C1 hydrocarbons.

  14. DNA Bases Thymine and Adenine in Bio-Organic Light Emitting Diodes

    DTIC Science & Technology

    2014-11-24

    DNA Bases Thymine and Adenine in Bio-Organic Light Emitting Diodes Eliot F. Gomez1, Vishak Venkatraman1, James G. Grote2 & Andrew J. Steckl1...45433-7707 USA. We report on the use of nucleic acid bases (NBs) in organic light emitting diodes (OLEDs). NBs are small molecules that are the basic...polymer has been a frequent natural material integrated in electronic devices. DNA has been used in organic light - emitting diodes (OLEDs)4,5,7–14

  15. Dietary L-lysine prevents arterial calcification in adenine-induced uremic rats.

    PubMed

    Shimomura, Akihiro; Matsui, Isao; Hamano, Takayuki; Ishimoto, Takuya; Katou, Yumiko; Takehana, Kenji; Inoue, Kazunori; Kusunoki, Yasuo; Mori, Daisuke; Nakano, Chikako; Obi, Yoshitsugu; Fujii, Naohiko; Takabatake, Yoshitsugu; Nakano, Takayoshi; Tsubakihara, Yoshiharu; Isaka, Yoshitaka; Rakugi, Hiromi

    2014-09-01

    Vascular calcification (VC) is a life-threatening complication of CKD. Severe protein restriction causes a shortage of essential amino acids, and exacerbates VC in rats. Therefore, we investigated the effects of dietary l-lysine, the first-limiting amino acid of cereal grains, on VC. Male Sprague-Dawley rats at age 13 weeks were divided randomly into four groups: low-protein (LP) diet (group LP), LP diet+adenine (group Ade), LP diet+adenine+glycine (group Gly) as a control amino acid group, and LP diet+adenine+l-lysine·HCl (group Lys). At age 18 weeks, group LP had no VC, whereas groups Ade and Gly had comparable levels of severe VC. l-Lysine supplementation almost completely ameliorated VC. Physical parameters and serum creatinine, urea nitrogen, and phosphate did not differ among groups Ade, Gly, and Lys. Notably, serum calcium in group Lys was slightly but significantly higher than in groups Ade and Gly. Dietary l-lysine strongly suppressed plasma intact parathyroid hormone in adenine rats and supported a proper bone-vascular axis. The conserved orientation of the femoral apatite in group Lys also evidenced the bone-protective effects of l-lysine. Dietary l-lysine elevated plasma alanine, proline, arginine, and homoarginine but not lysine. Analyses in vitro demonstrated that alanine and proline inhibit apoptosis of cultured vascular smooth muscle cells, and that arginine and homoarginine attenuate mineral precipitations in a supersaturated calcium/phosphate solution. In conclusion, dietary supplementation of l-lysine ameliorated VC by modifying key pathways that exacerbate VC.

  16. Synthesis of rigid homo- and heteroditopic nucleobase-terminated molecules incorporating adenine and/or thymine.

    PubMed

    Jacobsen, Mikkel F; Andersen, Casper S; Knudsen, Martin M; Gothelf, Kurt V

    2007-07-19

    A series of homo- and heteroditopic thymine- and/or adenine-terminated molecules incorporating rigid aryl or oligo(phenylene ethynylene) linkers has been efficiently synthesized. The key steps involved in the synthesis are the construction of the N-arylated nucleobases using the Chan-Lam-Evans-modified Ullman coupling and their further elaboration using the Sonogashira coupling. Furthermore, the synthesis of a rigid tripodal thymine derivative is reported.

  17. Dietary l-Lysine Prevents Arterial Calcification in Adenine-Induced Uremic Rats

    PubMed Central

    Shimomura, Akihiro; Matsui, Isao; Hamano, Takayuki; Ishimoto, Takuya; Katou, Yumiko; Takehana, Kenji; Inoue, Kazunori; Kusunoki, Yasuo; Mori, Daisuke; Nakano, Chikako; Obi, Yoshitsugu; Fujii, Naohiko; Takabatake, Yoshitsugu; Nakano, Takayoshi; Tsubakihara, Yoshiharu; Rakugi, Hiromi

    2014-01-01

    Vascular calcification (VC) is a life-threatening complication of CKD. Severe protein restriction causes a shortage of essential amino acids, and exacerbates VC in rats. Therefore, we investigated the effects of dietary l-lysine, the first-limiting amino acid of cereal grains, on VC. Male Sprague-Dawley rats at age 13 weeks were divided randomly into four groups: low-protein (LP) diet (group LP), LP diet+adenine (group Ade), LP diet+adenine+glycine (group Gly) as a control amino acid group, and LP diet+adenine+l-lysine·HCl (group Lys). At age 18 weeks, group LP had no VC, whereas groups Ade and Gly had comparable levels of severe VC. l-Lysine supplementation almost completely ameliorated VC. Physical parameters and serum creatinine, urea nitrogen, and phosphate did not differ among groups Ade, Gly, and Lys. Notably, serum calcium in group Lys was slightly but significantly higher than in groups Ade and Gly. Dietary l-lysine strongly suppressed plasma intact parathyroid hormone in adenine rats and supported a proper bone-vascular axis. The conserved orientation of the femoral apatite in group Lys also evidenced the bone-protective effects of l-lysine. Dietary l-lysine elevated plasma alanine, proline, arginine, and homoarginine but not lysine. Analyses in vitro demonstrated that alanine and proline inhibit apoptosis of cultured vascular smooth muscle cells, and that arginine and homoarginine attenuate mineral precipitations in a supersaturated calcium/phosphate solution. In conclusion, dietary supplementation of l-lysine ameliorated VC by modifying key pathways that exacerbate VC. PMID:24652795

  18. Adenine nucleotides stimulate migration in wounded cultures of kidney epithelial cells.

    PubMed Central

    Kartha, S; Toback, F G

    1992-01-01

    Adenine nucleotides speed structural and functional recovery when administered after experimental renal injury in the rat and stimulate proliferation of kidney epithelial cells. As cell migration is a component of renal regeneration after acute tubular necrosis, we have used an in vitro model of wound healing to study this process. High density, quiescent monkey kidney epithelial cultures were wounded by mechanically scraping away defined regions of the monolayer to simulate the effect of cell loss after tubular necrosis and the number of cells that migrated into the denuded area was counted. Migration was independent of cell proliferation. Provision of adenosine, adenine nucleotides, or cyclic AMP increased the number of migrating cells and accelerated repair of the wound. Other purine and pyrimidine nucleotides were not effective. Arginine-glycine-aspartic acid-serine peptide, which blocks the binding of extracellular fibronectin to its cell surface receptor, completely inhibited migration in the presence or absence of ADP. Very low concentrations of epidermal growth factor (K0.5 approximately 0.3 ng/ml) stimulated migration, whereas transforming growth factor-beta 2 was inhibitory (Ki approximately 0.2 ng/ml). Thus, adenosine and/or adenine nucleotides released from injured or dying renal cells, or administered exogenously, may stimulate surviving cells in the wounded nephron to migrate along the basement membrane, thereby rapidly restoring tubular structure and function. Images PMID:1634617

  19. Mechanism of charge separation in DNA by hole transfer through consecutive adenines.

    PubMed

    Kawai, Kiyohiko; Osakada, Yasuko; Fujitsuka, Mamoru; Majima, Tetsuro

    2008-01-01

    To investigate the mechanism of charge separation in DNA with consecutive adenines adjacent to a photosensitizer (Sens), a series of naphthalimide (NI) and 5-bromouracil ((br)U)-modified DNAs were prepared, and the quantum yields of formation of the charge-separated states (Phi) upon photo-excitation of the Sens NI in DNA were measured. The Phi was modulated by the incorporation site of (br)U, which changes the oxidation potential of its complementary A through hydrogen bonding and the hole-transfer rates between adenines. The results were interpreted as charge separation by means of the initial charge transfer between NI in the singlet excited state and the second- and third-nearest adenine to the NI. In addition, the oxidation of the A nearest to NI leads to the rapid charge recombination within a contact ion pair. This suggests that the charge-separation process can be refined to maximize the Phi by putting a redox-inactive spacer base pair between a photosensitizer and an A-T stretch.

  20. Identification of a Campylobacter coli methyltransferase targeting adenines at GATC sites.

    PubMed

    Dutta, Vikrant; Altermann, Eric; Crespo, Maria D; Olson, Jonathan W; Siletzky, Robin M; Kathariou, Sophia

    2016-12-02

    Campylobacter coli can infect humans and colonize multiple other animals but its host-associated genes or adaptations are poorly understood. Adenine methylation at GATC sites, resulting in MboI resistance of genomic DNA, was earlier frequently detected among C. coli from swine but not among turkey-derived isolates. The underlying genetic basis has remained unknown. Comparative genome sequence analyses of C. coli 6461, a swine-derived strain with MboI-resistant DNA, revealed two chromosomal ORFs, 0059 and 0060, encoding a putative DNA methyltransferase and a conserved hypothetical protein, respectively, which were lacking from the genome of the turkey-derived C. coli strain 11601, which had MboI-susceptible DNA. To determine whether the ORF0059 mediated MboI resistance and hence encoded a putative N6-adenine DNA methyltransferase, the gene was cloned immediately upstream of a chloramphenicol resistance cassette (cat) and a PCR fragment harboring ORF0059-cat was transformed into C. coli 11601. The transformants had MboI-resistant DNA, suggesting a direct role of this gene in methylation of adenines at GATC sites. In-silico analyses suggested that the ORF0059-ORF0060 cassette was more frequent among C. coli from swine than certain other sources (e.g. cattle, humans). Potential impacts of ORF0059-mediated methylation on C. coli host preference and other adaptations remain to be elucidated.

  1. Absorption by DNA single strands of adenine isolated in vacuo: The role of multiple chromophores

    NASA Astrophysics Data System (ADS)

    Nielsen, Lisbeth Munksgaard; Pedersen, Sara Øvad; Kirketerp, Maj-Britt Suhr; Nielsen, Steen Brøndsted

    2012-02-01

    The degree of electronic coupling between DNA bases is a topic being up for much debate. Here we report on the intrinsic electronic properties of isolated DNA strands in vacuo free of solvent, which is a good starting point for high-level excited states calculations. Action spectra of DNA single strands of adenine reveal sign of exciton coupling between stacked bases from blueshifted absorption bands (˜3 nm) relative to that of the dAMP mononucleotide (one adenine base). The bands are blueshifted by about 10 nm compared to those of solvated strands, which is a shift similar to that for the adenine molecule and the dAMP mononucleotide. Desolvation has little effect on the bandwidth, which implies that inhomogenous broadening of the absorption bands in aqueous solution is of minor importance compared to, e.g., conformational disorder. Finally, at high photon energies, internal conversion competes with electron detachment since dissociation of the bare photoexcited ions on the microsecond time scale is measured.

  2. Monitoring potential molecular interactions of adenine with other amino acids using Raman spectroscopy and DFT modeling.

    PubMed

    Singh, Shweta; Donfack, P; Srivastava, Sunil K; Singh, Dheeraj K; Materny, A; Asthana, B P; Mishra, P C

    2015-01-01

    We report on the modes of inter-molecular interaction between adenine (Ade) and the amino acids: glycine (Gly), lysine (Lys) and arginine (Arg) using Raman spectroscopy of binary mixtures of adenine and each of the three amino acids at varying molar ratios in the spectral region 1550-550 cm(-1). We focused our attention on certain specific changes in the Raman bands of adenine arising due to its interaction with the amino acids. While the changes are less apparent in the Ade/Gly system, in the Ade/Lys or Ade/Arg systems, significant changes are observed, particularly in the Ade Raman bands that involve the amino group moiety and the N7 and N1 atoms of the purine ring. The ν(N1-C6), ν(N1-C2), δ(C8-H) and δ(N7-C8-N9) vibrations at 1486, 1332, 1253 and 948 cm(-1) show spectral changes on varying the Ade to amino acid molar ratio, the extent of variation being different for the three amino acids. This observation suggests a specific interaction mode between Ade and Lys or Arg, which is due to the hydrogen bonding. The measured spectral changes provide a clear indication that the interaction of Ade depends strongly on the structures of the amino acids, especially their side chains. Density functional theory (DFT) calculations were carried out to elucidate the most probable interaction modes of Ade with the different amino acids.

  3. Selective self-assembly of adenine-silver nanoparticles forms rings resembling the size of cells.

    PubMed

    Choi, Sungmoon; Park, Soonyoung; Yang, Seon-Ah; Jeong, Yujin; Yu, Junhua

    2015-12-08

    Self-assembly has played critical roles in the construction of functional nanomaterials. However, the structure of the macroscale multicomponent materials built by the self-assembly of nanoscale building blocks is hard to predict due to multiple intermolecular interactions of great complexity. Evaporation of solvents is usually an important approach to induce kinetically stable assemblies of building blocks with a large-scale specific arrangement. During such a deweting process, we tried to monitor the possible interactions between silver nanoparticles and nucleobases at a larger scale by epifluorescence microscopy, thanks to the doping of silver nanoparticles with luminescent silver nanodots. ssDNA oligomer-stabilized silver nanoparticles and adenine self-assemble to form ring-like compartments similar to the size of modern cells. However, the silver ions only dismantle the self-assembly of adenine. The rings are thermodynamically stable as the drying process only enrich the nanoparticles-nucleobase mixture to a concentration that activates the self-assembly. The permeable membrane-like edge of the ring is composed of adenine filaments glued together by silver nanoparticles. Interestingly, chemicals are partially confined and accumulated inside the ring, suggesting that this might be used as a microreactor to speed up chemical reactions during a dewetting process.

  4. Selective self-assembly of adenine-silver nanoparticles forms rings resembling the size of cells

    NASA Astrophysics Data System (ADS)

    Choi, Sungmoon; Park, Soonyoung; Yang, Seon-Ah; Jeong, Yujin; Yu, Junhua

    2015-12-01

    Self-assembly has played critical roles in the construction of functional nanomaterials. However, the structure of the macroscale multicomponent materials built by the self-assembly of nanoscale building blocks is hard to predict due to multiple intermolecular interactions of great complexity. Evaporation of solvents is usually an important approach to induce kinetically stable assemblies of building blocks with a large-scale specific arrangement. During such a deweting process, we tried to monitor the possible interactions between silver nanoparticles and nucleobases at a larger scale by epifluorescence microscopy, thanks to the doping of silver nanoparticles with luminescent silver nanodots. ssDNA oligomer-stabilized silver nanoparticles and adenine self-assemble to form ring-like compartments similar to the size of modern cells. However, the silver ions only dismantle the self-assembly of adenine. The rings are thermodynamically stable as the drying process only enrich the nanoparticles-nucleobase mixture to a concentration that activates the self-assembly. The permeable membrane-like edge of the ring is composed of adenine filaments glued together by silver nanoparticles. Interestingly, chemicals are partially confined and accumulated inside the ring, suggesting that this might be used as a microreactor to speed up chemical reactions during a dewetting process.

  5. White spot syndrome virus VP12 interacts with adenine nucleotide translocase of Litopenaeus vannamei.

    PubMed

    Ma, Fang-fang; Chou, Zhi-guang; Liu, Qing-hui; Guan, Guangkuo; Li, Chen; Huang, Jie

    2014-05-01

    White spot syndrome virus VP12 contains cell attachment motif RGD which is considered to be critical for host cell binding. Until now, the function of this protein remains undefined. In this study, we explored the interaction of VP12 with host cells. A new shrimp protein (adenine nucleotide translocase of Litopenaeus vannamei, LvANT) is selected by far-western overlay assay. Tissue distribution of adenine nucleotide translocase mRNA showed that it was commonly spread in all the tissues detected. Cellular localization of LvANT in shrimp hemocytes showed that it was primarily located in the cytoplasm of hemocytes and colocalized with mitochondria. ELISA and far-western blot assay confirmed that VP12 interacted with LvANT. In vivo neutralization assay showed that anti-LvANT antibody can significantly reduce the mortality of shrimp challenged by WSSV at 48h post-treatment. Our results collectively showed that VP12 is involved in host cell binding via interaction with adenine nucleotide translocase.

  6. Stability Constants of Mixed Ligand Complexes of Nickel(II) with Adenine and Some Amino Acids

    PubMed Central

    Türkel, Naciye

    2015-01-01

    Nickel is one of the essential trace elements found in biological systems. It is mostly found in nickel-based enzymes as an essential cofactor. It forms coordination complexes with amino acids within enzymes. Nickel is also present in nucleic acids, though its function in DNA or RNA is still not clearly understood. In this study, complex formation tendencies of Ni(II) with adenine and certain L-amino acids such as aspartic acid, glutamic acid, asparagine, leucine, phenylalanine, and tryptophan were investigated in an aqueous medium. Potentiometric equilibrium measurements showed that both binary and ternary complexes of Ni(II) form with adenine and the above-mentioned L-amino acids. Ternary complexes of Ni(II)-adenine-L-amino acids are formed by stepwise mechanisms. Relative stabilities of the ternary complexes are compared with those of the corresponding binary complexes in terms of Δlog10⁡K, log10⁡X, and % RS values. It was shown that the most stable ternary complex is Ni(II):Ade:L-Asn while the weakest one is Ni(II):Ade:L-Phe in aqueous solution used in this research. In addition, results of this research clearly show that various binary and ternary type Ni(II) complexes are formed in different concentrations as a function of pH in aqueous solution. PMID:26843852

  7. Heptacopper(II) and dicopper(II)-adenine complexes: synthesis, structural characterization, and magnetic properties

    DOE PAGES

    Leite Ferreira, B. J. M.; Brandão, Paula; Dos Santos, A. M.; ...

    2015-07-13

    The syntheses, crystal structures, and magnetic properties of two new copper(II) complexes with molecular formulas [Cu7(μ2-OH2)6(μ3-O)6(adenine)6(NO3)26H2O (1) and [Cu2(μ2-H2O)2(adenine)2(H2O)4](NO3)42H2O (2) are reported. We composed the heptanuclear compound of a central octahedral CuO6 core sharing edges with six adjacent copper octahedra. In 2, the copper octahedra shares one equatorial edge. In both compounds, these basic copper cluster units are further linked by water bridges and bridging adenine ligands through N3 and N9 donors. All copper(II) centers exhibit Jahn-Teller distorted octahedral coordination characteristic of a d9 center. Our study of the magnetic properties of the heptacopper complex revealed a dominant ferromagnetic intra-clustermore » interaction, while the dicopper complex exhibits antiferromagnetic intra-dimer interactions with weakly ferromagnetic inter-dimer interaction.« less

  8. Adenine Synthesis in a Model Prebiotic Reaction: Connecting Origin of Life Chemistry with Biology.

    PubMed

    Anumukonda, Lakshmi N; Young, Avery; Lynn, David G; Buckley, Ragan; Warrayat, Amena; Graves, Christina L; Bean, Heather D; Hud, Nicholas V

    2011-12-01

    Many high school laboratory experiments demonstrate concepts related to biological evolution, but few exist that allow students to investigate life's chemical origins. This series of laboratory experiments has been developed to allow students to explore and appreciate the deep connection that exists between prebiotic chemistry, chemical evolution, and contemporary biological systems. In the first experiment of the series, students synthesize adenine, one of the purine nucleobases of DNA and RNA, from plausibly prebiotic precursor molecules. Students compare their product to authentic standards using thin-layer chromatography. The second and third experiments of the series allow students to extract DNA from a familiar organism, the strawberry, and hydrolyze it, releasing adenine, which they can then compare to the previously chemically-synthesized adenine. A fourth, optional experiment is included where the technique of thin-layer chromatography is introduced and chromatographic skills are developed for use in the other three experiments that comprise this series. Concepts relating to organic and analytical chemistry, as well as biochemistry and DNA structure, are incorporated throughout, allowing this series of laboratory experiments to be easily inserted into existing laboratory courses and to reinforce concepts already included in any high school chemistry or biology curriculum.

  9. Adenine Synthesis in a Model Prebiotic Reaction: Connecting Origin of Life Chemistry with Biology

    PubMed Central

    2011-01-01

    Many high school laboratory experiments demonstrate concepts related to biological evolution, but few exist that allow students to investigate life’s chemical origins. This series of laboratory experiments has been developed to allow students to explore and appreciate the deep connection that exists between prebiotic chemistry, chemical evolution, and contemporary biological systems. In the first experiment of the series, students synthesize adenine, one of the purine nucleobases of DNA and RNA, from plausibly prebiotic precursor molecules. Students compare their product to authentic standards using thin-layer chromatography. The second and third experiments of the series allow students to extract DNA from a familiar organism, the strawberry, and hydrolyze it, releasing adenine, which they can then compare to the previously chemically-synthesized adenine. A fourth, optional experiment is included where the technique of thin-layer chromatography is introduced and chromatographic skills are developed for use in the other three experiments that comprise this series. Concepts relating to organic and analytical chemistry, as well as biochemistry and DNA structure, are incorporated throughout, allowing this series of laboratory experiments to be easily inserted into existing laboratory courses and to reinforce concepts already included in any high school chemistry or biology curriculum. PMID:22075932

  10. Unusual folded conformation of nicotinamide adenine dinucleotide bound to flavin reductase P.

    PubMed Central

    Tanner, J. J.; Tu, S. C.; Barbour, L. J.; Barnes, C. L.; Krause, K. L.

    1999-01-01

    The 2.1 A resolution crystal structure of flavin reductase P with the inhibitor nicotinamide adenine dinucleotide (NAD) bound in the active site has been determined. NAD adopts a novel, folded conformation in which the nicotinamide and adenine rings stack in parallel with an inter-ring distance of 3.6 A. The pyrophosphate binds next to the flavin cofactor isoalloxazine, while the stacked nicotinamide/adenine moiety faces away from the flavin. The observed NAD conformation is quite different from the extended conformations observed in other enzyme/NAD(P) structures; however, it resembles the conformation proposed for NAD in solution. The flavin reductase P/NAD structure provides new information about the conformational diversity of NAD, which is important for understanding catalysis. This structure offers the first crystallographic evidence of a folded NAD with ring stacking, and it is the first enzyme structure containing an FMN cofactor interacting with NAD(P). Analysis of the structure suggests a possible dynamic mechanism underlying NADPH substrate specificity and product release that involves unfolding and folding of NADP(H). PMID:10493573

  11. Heptacopper(II) and dicopper(II)-adenine complexes: synthesis, structural characterization, and magnetic properties

    SciTech Connect

    Leite Ferreira, B. J. M.; Brandão, Paula; Dos Santos, A. M.; Gai, Z.; Cruz, C.; Reis, M. S.; Santos, T. M.; Félix, V.

    2015-07-13

    The syntheses, crystal structures, and magnetic properties of two new copper(II) complexes with molecular formulas [Cu72-OH2)63-O)6(adenine)6(NO3)26H2O (1) and [Cu22-H2O)2(adenine)2(H2O)4](NO3)42H2O (2) are reported. We composed the heptanuclear compound of a central octahedral CuO6 core sharing edges with six adjacent copper octahedra. In 2, the copper octahedra shares one equatorial edge. In both compounds, these basic copper cluster units are further linked by water bridges and bridging adenine ligands through N3 and N9 donors. All copper(II) centers exhibit Jahn-Teller distorted octahedral coordination characteristic of a d9 center. Our study of the magnetic properties of the heptacopper complex revealed a dominant ferromagnetic intra-cluster interaction, while the dicopper complex exhibits antiferromagnetic intra-dimer interactions with weakly ferromagnetic inter-dimer interaction.

  12. Properties of Nicotinamide Adenine Dinucleotide Phosphate-Dependent Formate Dehydrogenase from Clostridium thermoaceticum

    PubMed Central

    Li, Lan-Fun; Ljungdahl, Lars; Wood, Harland G.

    1966-01-01

    Li, Lan-Fun (Western Reserve University School of Medicine, Cleveland, Ohio), Lars Ljungdahl, and Harland G. Wood. Properties of nicotinamide adenine dinucleotide phosphate-dependent formate dehydrogenase from Clostridium thermoaceticum. J. Bacteriol. 92: 405–412. 1966.—A nicotinamide adenine dinucleotide phosphate (NADP)-dependent formate dehydrogenase has been isolated from C. thermoaceticum. The enzyme is very sensitive to oxygen and requires sulfhydryl compounds for activity. The apparent Km at 50 C and pH 7.0 for NADP is 5.9 × 10−5m and for formate, 2.2 × 10−4m. The enzyme is most active at about 60 C and at pH values between 7.0 and 9.0. The enzyme catalyzes an exchange between C14O2 and formate, which requires NADP, but net synthesis of formate from CO2 and reduced nicotinamide adenine dinucleotide phosphate could not be demonstrated. The reaction does not involve ferredoxin. PMID:16562128

  13. Photoinduced formation of hydrogen peroxide in aqueous solutions of adenine derivatives at 77 K

    NASA Astrophysics Data System (ADS)

    Lozinova, T. A.; Lobanov, A. V.; Lander, A. V.

    2016-11-01

    The amount of hydrogen peroxide in aqueous solutions of adenine (A), adenosine (Ado), cytidine (Cyt), and thymine (T) containing 0.1 M NaCl and irradiated with near-UV light at 77 K is determined. It is established by comparing the results to data obtained earlier that the amount of H2O2 detected in the defrosted samples following identical irradiation falls in the order Ado > adenosine-5'-diphosphate (ADP) > A >> Cyt. The formation of H2O2 was not detected for T. The formation of H2O2 in solutions of adenine derivatives was observed when the samples were irradiated with light having wavelengths in the ranges λ = 240-400 nm and 290-450 nm. The latter covers only the long wave absorption range of these compounds. It is shown that the change in the intensity of irradiation that strongly affected the intensity of EPR signals of irradiated samples prior to defrosting affected the amount of detected H2O2 only slightly, and the effect was not unidirectional. The results from determining H2O2 in the samples of adenine derivatives are compared to estimates of the content of free peroxyl radicals, obtained by analyzing EPR spectra. Plausible mechanisms of the processes are discussed.

  14. Selective self-assembly of adenine-silver nanoparticles forms rings resembling the size of cells

    PubMed Central

    Choi, Sungmoon; Park, Soonyoung; Yang, Seon-Ah; Jeong, Yujin; Yu, Junhua

    2015-01-01

    Self-assembly has played critical roles in the construction of functional nanomaterials. However, the structure of the macroscale multicomponent materials built by the self-assembly of nanoscale building blocks is hard to predict due to multiple intermolecular interactions of great complexity. Evaporation of solvents is usually an important approach to induce kinetically stable assemblies of building blocks with a large-scale specific arrangement. During such a deweting process, we tried to monitor the possible interactions between silver nanoparticles and nucleobases at a larger scale by epifluorescence microscopy, thanks to the doping of silver nanoparticles with luminescent silver nanodots. ssDNA oligomer-stabilized silver nanoparticles and adenine self-assemble to form ring-like compartments similar to the size of modern cells. However, the silver ions only dismantle the self-assembly of adenine. The rings are thermodynamically stable as the drying process only enrich the nanoparticles-nucleobase mixture to a concentration that activates the self-assembly. The permeable membrane-like edge of the ring is composed of adenine filaments glued together by silver nanoparticles. Interestingly, chemicals are partially confined and accumulated inside the ring, suggesting that this might be used as a microreactor to speed up chemical reactions during a dewetting process. PMID:26643504

  15. An experimental and theoretical vibrational study of interaction of adenine and thymine with artificial seawaters: A prebiotic chemistry experiment.

    PubMed

    Anizelli, Pedro R; Baú, João P T; Nabeshima, Henrique S; da Costa, Marcello F; de Santana, Henrique; Zaia, Dimas A M

    2014-05-21

    Nucleic acid bases play important roles in living beings. Thus, their interaction with salts the prebiotic Earth could be an important issue for the understanding of origin of life. In this study, the effect of pH and artificial seawaters on the structure of adenine and thymine was studied via parallel determinations using FT-IR, Raman spectroscopy and theoretical calculations. Thymine and adenine lyophilized in solutions at basic and acidic conditions showed characteristic bands of the enol-imino tautomer due to the deprotonation and the hydrochloride form due to protonation, respectively. The interaction of thymine and adenine with different seawaters representative of different geological periods on Earth was also studied. In the case of thymine a strong interaction with Sr(2+) promoted changes in the Raman and infrared spectra. For adenine changes in infrared and Raman spectra were observed in the presence of salts from all seawaters tested. The experimental results were compared to theoretical calculations, which showed structural changes due to the presence of ions Na(+), Mg(2+), Ca(2+) and Sr(2+) of artificial seawaters. For thymine the bands arising from C4=C5 and C6=O stretching were shifted to lower values, and for adenine, a new band at 1310cm(-1) was observed. The reactivity of adenine and thymine was studied by comparing changes in nucleophilicity and energy of the HOMO orbital.

  16. Effect of gum arabic on oxidative stress and inflammation in adenine-induced chronic renal failure in rats.

    PubMed

    Ali, Badreldin H; Al-Husseni, Isehaq; Beegam, Sumyia; Al-Shukaili, Ahmed; Nemmar, Abderrahim; Schierling, Simone; Queisser, Nina; Schupp, Nicole

    2013-01-01

    Inflammation and oxidative stress are known to be involved in the pathogenesis of chronic kidney disease in humans, and in chronic renal failure (CRF) in rats. The aim of this work was to study the role of inflammation and oxidative stress in adenine-induced CRF and the effect thereon of the purported nephroprotective agent gum arabic (GA). Rats were divided into four groups and treated for 4 weeks as follows: control, adenine in feed (0.75%, w/w), GA in drinking water (15%, w/v) and adenine+GA, as before. Urine, blood and kidneys were collected from the rats at the end of the treatment for analysis of conventional renal function tests (plasma creatinine and urea concentration). In addition, the concentrations of the pro-inflammatory cytokine TNF-α and the oxidative stress markers glutathione and superoxide dismutase, renal apoptosis, superoxide formation and DNA double strand break frequency, detected by immunohistochemistry for γ-H2AX, were measured. Adenine significantly increased the concentrations of urea and creatinine in plasma, significantly decreased the creatinine clearance and induced significant increases in the concentration of the measured inflammatory mediators. Further, it caused oxidative stress and DNA damage. Treatment with GA significantly ameliorated these actions. The mechanism of the reported salutary effect of GA in adenine-induced CRF is associated with mitigation of the adenine-induced inflammation and generation of free radicals.

  17. An experimental and theoretical vibrational study of interaction of adenine and thymine with artificial seawaters: A prebiotic chemistry experiment

    NASA Astrophysics Data System (ADS)

    Anizelli, Pedro R.; Baú, João P. T.; Nabeshima, Henrique S.; da Costa, Marcello F.; de Santana, Henrique; Zaia, Dimas A. M.

    Nucleic acid bases play important roles in living beings. Thus, their interaction with salts the prebiotic Earth could be an important issue for the understanding of origin of life. In this study, the effect of pH and artificial seawaters on the structure of adenine and thymine was studied via parallel determinations using FT-IR, Raman spectroscopy and theoretical calculations. Thymine and adenine lyophilized in solutions at basic and acidic conditions showed characteristic bands of the enol-imino tautomer due to the deprotonation and the hydrochloride form due to protonation, respectively. The interaction of thymine and adenine with different seawaters representative of different geological periods on Earth was also studied. In the case of thymine a strong interaction with Sr2+ promoted changes in the Raman and infrared spectra. For adenine changes in infrared and Raman spectra were observed in the presence of salts from all seawaters tested. The experimental results were compared to theoretical calculations, which showed structural changes due to the presence of ions Na+, Mg2+, Ca2+ and Sr2+ of artificial seawaters. For thymine the bands arising from C4dbnd C5 and C6dbnd O stretching were shifted to lower values, and for adenine, a new band at 1310 cm-1 was observed. The reactivity of adenine and thymine was studied by comparing changes in nucleophilicity and energy of the HOMO orbital.

  18. Human Rho Guanine Nucleotide Exchange Factor 11 (ARHGEF11) Regulates Dendritic Morphogenesis

    PubMed Central

    Mizuki, Yutaka; Takaki, Manabu; Sakamoto, Shinji; Okamoto, Sojiro; Kishimoto, Makiko; Okahisa, Yuko; Itoh, Masahiko; Yamada, Norihito

    2016-01-01

    Disturbances of synaptic connectivity during perinatal and adolescent periods have been hypothesized to be related to the pathophysiology of schizophrenia. Rho guanine nucleotide exchange factor 11 (ARHGEF11) is a specific guanine nucleotide exchange factors (GEF) for RhoA, which is a critical regulator of actin cytoskeleton dynamics and organization of dendritic spines and inhibitor of spine maintenance. ARHGEF11 variants are reported to be associated with a higher risk for the onset of schizophrenia in a Japanese population; however, how ARHGEF11 contributes to the pathogenesis of schizophrenia in dendritic spines is unknown. Therefore, we first studied the distribution, binding, and function of ARHGEF11 in the dendritic spines of the rat cerebral cortex. After subcellular fractionation of the rat cerebral cortex, ARHGEF11 was detected with synaptophysin and post-synaptic density protein 95 (PSD-95) in the P2 fractions including synaptosomal fractions containing presynaptic and postsynaptic density proteins. Endogenous ARHGEF11 was coimmunoprecipitated with synaptophysin or PSD-95. In cortical primary neurons at 28 days in vitro, immunostaining revealed that ARHGEF11 located in the dendrites and dendritic spines and colocalized with PSD-95 and synaptophysin. Overexpression of exogenous ARHGEF11 significantly decreased the number of spines (p = 0.008). These results indicate that ARHGEF11 is likely to be associated with synaptic membranes and regulation of spine. PMID:28036092

  19. Guanine nucleotide exchange factors for RhoGTPases: good therapeutic targets for cancer therapy?

    PubMed

    Lazer, Galit; Katzav, Shulamit

    2011-06-01

    Rho guanosine triphosphatases (GTPases) are a family of small proteins which function as molecular switches in a variety of signaling pathways following stimulation of cell surface receptors. RhoGTPases regulate numerous cellular processes including cytoskeleton organization, gene transcription, cell proliferation, migration, growth and cell survival. Because of their central role in regulating processes that are dysregulated in cancer, it seems reasonable that defects in the RhoGTPase pathway may be involved in the development of cancer. RhoGTPase activity is regulated by a number of protein families: guanine nucleotide exchange factors (GEFs), GTPase activating proteins (GAPs) and guanine nucleotide-dissociation inhibitors (GDIs). This review discusses the participation of RhoGTPases and their regulators, especially GEFs in human cancers. In particular, we focus on the involvement of the RhoGTPase GEF, Vav1, a hematopoietic specific signal transducer which is involved in human neuroblastoma, pancreatic ductal carcinoma and lung cancer. Finally, we summarize recent advances in the design and application of a number of molecules that specifically target individual RhoGTPases or their regulators or effectors, and discuss their potential for cancer therapy.

  20. Cytosolic Na+ Controls an Epithelial Na+ Channel Via the Go Guanine Nucleotide-Binding Regulatory Protein

    NASA Astrophysics Data System (ADS)

    Komwatana, P.; Dinudom, A.; Young, J. A.; Cook, D. I.

    1996-07-01

    In tight Na+-absorbing epithelial cells, the rate of Na+ entry through amiloride-sensitive apical membrane Na+ channels is matched to basolateral Na+ extrusion so that cell Na+ concentration and volume remain steady. Control of this process by regulation of apical Na+ channels has been attributed to changes in cytosolic Ca2+ concentration or pH, secondary to changes in cytosolic Na+ concentration, although cytosolic Cl- seems also to be involved. Using mouse mandibular gland duct cells, we now demonstrate that increasing cytosolic Na+ concentration inhibits apical Na+ channels independent of changes in cytosolic Ca2+, pH, or Cl-, and the effect is blocked by GDP-β -S, pertussis toxin, and antibodies against the α -subunits of guanine nucleotide-binding regulatory proteins (Go). In contrast, the inhibitory effect of cytosolic anions is blocked by antibodies to inhibitory guanine nucleotide-binding regulatory proteins (Gi1/Gi2. It thus appears that apical Na+ channels are regulated by Go and Gi proteins, the activities of which are controlled, respectively, by cytosolic Na+ and Cl-.

  1. The NEIL glycosylases remove oxidized guanine lesions from telomeric and promoter quadruplex DNA structures

    PubMed Central

    Zhou, Jia; Fleming, Aaron M.; Averill, April M.; Burrows, Cynthia J.; Wallace, Susan S.

    2015-01-01

    G-quadruplex is a four-stranded G-rich DNA structure that is highly susceptible to oxidation. Despite the important roles that G-quadruplexes play in telomere biology and gene transcription, neither the impact of guanine lesions on the stability of quadruplexes nor their repair are well understood. Here, we show that the oxidized guanine lesions 8-oxo-7,8-dihydroguanine (8-oxoG), guanidinohydantoin (Gh) and spiroiminodihydantoin (Sp) reduce the thermostability and alter the folding of telomeric quadruplexes in a location-dependent manner. Also, the NEIL1 and NEIL3 DNA glycosylases can remove hydantoin lesions but none of the glycosylases, including OGG1, are able to remove 8-oxoG from telomeric quadruplexes. Interestingly, a hydantoin lesion at the site most prone to oxidation in quadruplex DNA is not efficiently removed by NEIL1 or NEIL3. However, NEIL1, NEIL2 and NEIL3 remove hydantoins from telomeric quadruplexes formed by five TTAGGG repeats much more rapidly than the commonly studied four-repeat quadruplex structures. We also show that APE1 cleaves furan in selected positions in Na+-coordinated telomeric quadruplexes. In promoter G-quadruplex DNA, the NEIL glycosylases primarily remove Gh from Na+-coordinated antiparallel quadruplexes but not K+-coordinated parallel quadruplexes containing VEGF or c-MYC promoter sequences. Thus, the NEIL DNA glycosylases may be involved in both telomere maintenance and in gene regulation. PMID:25813041

  2. Base and Nucleotide Excision Repair of Oxidatively Generated Guanine Lesions in DNA.

    PubMed

    Shafirovich, Vladimir; Kropachev, Konstantin; Anderson, Thomas; Liu, Zhi; Kolbanovskiy, Marina; Martin, Brooke D; Sugden, Kent; Shim, Yoonjung; Chen, Xuejing; Min, Jung-Hyun; Geacintov, Nicholas E

    2016-03-04

    The well known biomarker of oxidative stress, 8-oxo-7,8-dihydroguanine, is more susceptible to further oxidation than the parent guanine base and can be oxidatively transformed to the genotoxic spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) lesions. Incubation of 135-mer duplexes with single Sp or Gh lesions in human cell extracts yields a characteristic nucleotide excision repair (NER)-induced ladder of short dual incision oligonucleotide fragments in addition to base excision repair (BER) incision products. The ladders were not observed when NER was inhibited either by mouse monoclonal antibody (5F12) to human XPA or in XPC(-/-) fibroblast cell extracts. However, normal NER activity appeared when the XPC(-/-) cell extracts were complemented with XPC-RAD23B proteins. The Sp and Gh lesions are excellent substrates of both BER and NER. In contrast, 5-guanidino-4-nitroimidazole, a product of the oxidation of guanine in DNA by peroxynitrite, is an excellent substrate of BER only. In the case of mouse embryonic fibroblasts, BER of the Sp lesion is strongly reduced in NEIL1(-/-) relative to NEIL1(+/+) extracts. In summary, in human cell extracts, BER and NER activities co-exist and excise Gh and Sp DNA lesions, suggesting that the relative NER/BER product ratios may depend on competitive BER and NER protein binding to these lesions.

  3. Cytosolic Na+ controls and epithelial Na+ channel via the Go guanine nucleotide-binding regulatory protein.

    PubMed Central

    Komwatana, P; Dinudom, A; Young, J A; Cook, D I

    1996-01-01

    In tight Na+-absorbing epithelial cells, the fate of Na+ entry through amiloride-sensitive apical membrane Na+ channels is matched to basolateral Na+ extrusion so that cell Na+ concentration and volume remain steady. Control of this process by regulation of apical Na+ channels has been attributed to changes in cytosolic Ca2+ concentration or pH, secondary to changes in cytosolic Na+ concentration, although cytosolic Cl- seems also to be involved. Using mouse mandibular gland duct cells, we now demonstrate that increasing cytosolic Na+ concentration inhibits apical Na+ channels independent of changes in cytosolic Ca2+, pH, or Cl-, and the effect is blocked by GDP-beta-S, pertussis toxin, and antibodies against the alpha-subunits of guanine nucleotide-binding regulatory proteins (Go). In contrast, the inhibitory effect of cytosolic anions is blocked by antibodies to inhibitory guanine nucleotide-binding regulatory proteins (Gi1/Gi2. It thus appears that apical Na+ channels are regulated by Go and Gi proteins, the activities of which are controlled, respectively, by cytosolic Na+ and Cl-. Images Fig. 4 PMID:8755611

  4. Chromosomal localization of genes encoding guanine nucleotide-binding protein subunits in mouse and human

    SciTech Connect

    Blatt, C.; Eversole-Cire, P.; Cohn, V.H.; Zollman, S.; Fournier, R.E.K.; Mohandas, L.T.; Nesbitt, M.; Lugo, T.; Jones, D.T.; Reed, R.R.; Weiner, L.P.; Sparkes, R.S.; Simon, M.I. )

    1988-10-01

    A variety of genes have been identified that specify the synthesis of the components of guanine nucleotide-binding proteins (G proteins). Eight different guanine nucleotide-binding {alpha}-subunit proteins, two different {beta} subunits, and one {gamma} subunit have been described. Hybridization of cDNA clones with DNA from human-mouse somatic cell hybrids was used to assign many of these genes to human chromosomes. The retinal-specific transducin subunit genes GNAT1 and GNAT2 were on chromosomes 3 and 1; GNAI1, GNAI2, and GNAI3 were assigned to chromosomes 7, 3, and 1, respectively; GNAZ and GNAS were found on chromosomes 22 and 20. The {beta} subunits were also assigned-GNB1 to chromosome 1 and GNB2 to chromosome 7. Restriction fragment length polymorphisms were used to map the homologues of some of these genes in the mouse. GNAT1 and GNAI2 were found to map adjacent to each other on mouse chromosome 9 and GNAT2 was mapped on chromosome 17. The mouse GNB1 gene was assigned to chromosome 19. These mapping assignments will be useful in defining the extend of the G{alpha} gene family and may help in attempts to correlate specific genetic diseases and with genes corresponding to G proteins.

  5. New investigations of the guanine trichloro cuprate(II) complex crystal

    NASA Astrophysics Data System (ADS)

    Fabijanić, Ivana; Matković-Čalogović, Dubravka; Pilepić, Viktor; Ivanišević, Irena; Mohaček-Grošev, Vlasta; Sanković, Krešimir

    2017-01-01

    Crystals of the guanine trichloro cuprate(II) complex, (HGua)2[Cu2Cl6]·2H2O (HGua = protonated guanine), were prepared and analysed by spectroscopic (IR, Raman) and computational methods. A new single-crystal X-ray diffraction analysis was conducted to obtain data with lower standard uncertainties than those in the previously published structure. Raman and IR spectroscopy and quantum-mechanical analysis gave us new insight into the vibrational states of the (HGua)2[Cu2Cl6]·2H2O crystal. The vibrational spectra of the crystal were assigned by performing a normal coordinate analysis for a free dimer with a centre of inversion as the only symmetry element. The stretching vibration observed at 279 cm-1 in the infrared spectrum corresponds to the N-Cu bond. The noncovalent interaction (NCI) plots and quantum theory of atoms in molecules (QTAIM) analysis of the electron density obtained from periodic DFT calculations elucidated the interactions that exist within the crystal structure. Closed-shell ionic attractions, as well as weak and medium strength hydrogen bonds, prevailed in the crystal packing.

  6. Monitoring one-electron photo-oxidation of guanine in DNA crystals using ultrafast infrared spectroscopy

    NASA Astrophysics Data System (ADS)

    Hall, James P.; Poynton, Fergus E.; Keane, Páraic M.; Gurung, Sarah P.; Brazier, John A.; Cardin, David J.; Winter, Graeme; Gunnlaugsson, Thorfinnur; Sazanovich, Igor V.; Towrie, Michael; Cardin, Christine J.; Kelly, John M.; Quinn, Susan J.

    2015-12-01

    To understand the molecular origins of diseases caused by ultraviolet and visible light, and also to develop photodynamic therapy, it is important to resolve the mechanism of photoinduced DNA damage. Damage to DNA bound to a photosensitizer molecule frequently proceeds by one-electron photo-oxidation of guanine, but the precise dynamics of this process are sensitive to the location and the orientation of the photosensitizer, which are very difficult to define in solution. To overcome this, ultrafast time-resolved infrared (TRIR) spectroscopy was performed on photoexcited ruthenium polypyridyl-DNA crystals, the atomic structure of which was determined by X-ray crystallography. By combining the X-ray and TRIR data we are able to define both the geometry of the reaction site and the rates of individual steps in a reversible photoinduced electron-transfer process. This allows us to propose an individual guanine as the reaction site and, intriguingly, reveals that the dynamics in the crystal state are quite similar to those observed in the solvent medium.

  7. Ozone therapy ameliorates tubulointerstitial inflammation by regulating TLR4 in adenine-induced CKD rats.

    PubMed

    Chen, Zhiyuan; Liu, Xiuheng; Yu, Gang; Chen, Hui; Wang, Lei; Wang, Zhishun; Qiu, Tao; Weng, Xiaodong

    2016-06-01

    Tubulointerstitium inflammation is a common pathway aggravating chronic kidney disease (CKD) progression and the mechanism is partly associated with excessive activation of toll-like receptor 4 (TLR4) in tubulointerstitium. Ozone therapy is demonstrated to alleviate inflammation in some experiments. The aim of this study is to examine whether ozone therapy could ameliorate chronic tubulointerstitium inflammation by suppressing TLR4 in adenine-induced CKD rats. Sprague-Dawley rats were fed with 0.75% adenine-containing diet to induce CKD and tubulointerstitium inflammation injury. Ozone therapy (1.1 mg/kg) was simultaneously administrated by rectal insufflations (i.r.). After 4 weeks, serum and kidney samples were collected for detection. Renal function and systemic electrolyte were detected. Renal pathological changes were assessed by hematoxylin-eosin (H&E) staining and Masson trichrome (MT) staining. Immunohistochemistry, Western blot and Real-time PCR were applied to evaluate tubulointerstitium inflammation as well as the expression of TLR4 and phosphorylated nuclear factor kappa B P65 (p-NF-κB P65) in rats. The results showed ozone therapy improved serious renal insufficiency, systemic electrolyte disorder and tubulointerstitium morphology damages in adenine-induced CKD rats. In addition, ozone therapy suppressed excessive activation of TLR4 and p-NF-κB P65 in the tubulointerstitium of adenine-induced CKD rats, accompanied by the reduction of inflammation-related cytokines including monocyte chemoattractant protein-1 (MCP-1), tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β) and interleukin-6 (IL-6). The protein expression of TLR4 was positively correlated with the protein expression levels of MCP-1 (r = 0.7863, p < 0.01) and TNF-α (r = 0.7547, p < 0.01) in CKD rats. These findings indicated ozone therapy could attenuate tubulointerstitium inflammation injury in adenine-induced CKD rats and the mechanism might associate with the

  8. Identification of three major DNA adducts formed by the carcinogenic air pollutant 3-nitrobenzanthrone in rat lung at the C8 and N2 position of guanine and at the N6 position of adenine.

    PubMed

    Arlt, Volker M; Schmeiser, Heinz H; Osborne, Martin R; Kawanishi, Masanobu; Kanno, Takaharu; Yagi, Takashi; Phillips, David H; Takamura-Enya, Takeji

    2006-05-01

    3-Nitrobenzanthrone (3-NBA) is a potent mutagen and potential human carcinogen identified in diesel exhaust and ambient air particulate matter. Previously, we detected the formation of 3-NBA-derived DNA adducts in rodent tissues by 32P-postlabeling, all of which are derived from reductive metabolites of 3-NBA bound to purine bases, but structural identification of these adducts has not yet been reported. We have now prepared 3-NBA-derived DNA adduct standards for 32P-postlabeling by reacting N-acetoxy-3-aminobenzanthrone (N-Aco-ABA) with purine nucleotides. Three deoxyguanosine (dG) adducts have been characterised as N-(2'-deoxyguanosin-8-yl)-3-aminobenzanthrone-3'-phosphate (dG3'p-C8-N-ABA), 2-(2'-deoxyguanosin-N2-yl)-3-aminobenzanthrone-3'-phosphate (dG3'p-N2-ABA) and 2-(2'-deoxyguanosin-8-yl)-3-aminobenzanthrone-3'-phosphate (dG3'p-C8-C2-ABA), and a deoxyadenosine (dA) adduct was characterised as 2-(2'-deoxyadenosin-N6-yl)-3-aminobenzanthrone-3'-phosphate (dA3'p-N6-ABA). 3-NBA-derived DNA adducts formed experimentally in vivo and in vitro were compared with the chemically synthesised adducts. The major 3-NBA-derived DNA adduct formed in rat lung cochromatographed with dG3'p-N2-ABA in two independent systems (thin layer and high-performance liquid chromatography). This is also the major adduct formed in tissue of rats or mice treated with 3-aminobenzanthrone (3-ABA), the major human metabolite of 3-NBA. Similarly, dG3'p-C8-N-ABA and dA3'p-N6-ABA cochromatographed with two other adducts formed in various organs of rats or mice treated either with 3-NBA or 3-ABA, whereas dG3'p-C8-C2-ABA did not cochromatograph with any of the adducts found in vivo. Utilizing different enzymatic systems in vitro, including human hepatic microsomes and cytosols, and purified and recombinant enzymes, we found that a variety of enzymes [NAD(P)H:quinone oxidoreductase, xanthine oxidase, NADPH:cytochrome P450 oxidoreductase, cytochrome P450s 1A1 and 1A2, N,O-acetyltransferases 1 and 2, sulfotransferases 1A1 and 1A2, and myeloperoxidase] are able to catalyse the formation of 2-(2'-deoxyguanosin-N2-yl)-3-aminobenzanthrone, N-(2'-deoxyguanosin-8-yl)-3-aminobenzanthrone and 2-(2'-deoxyadenosin-N6-yl)-3-aminobenzanthrone in DNA, after incubation with 3-NBA and/or 3-ABA.

  9. Hydroxyl Radical (OH•) Reaction with Guanine in an Aqueous Environment: A DFT Study

    PubMed Central

    Kumar, Anil; Pottiboyina, Venkata; Sevilla, Michael D.

    2011-01-01

    The reaction of hydroxyl radical (OH•) with DNA accounts for about half of radiation-induced DNA damage in living systems. Previous literature reports point out that the reaction of OH• with DNA proceeds mainly through the addition of OH• to the C=C bond of the DNA bases. However, recently it has been reported that the principal reaction of OH• with dGuo (deoxyguanosine) is the direct hydrogen atom abstraction from its exocyclic amine group rather than addition of OH• to the C=C bond. In the present work, these two reaction pathways of OH• attack on guanine (G) in the presence of water molecules (aqueous environment) are investigated using the density functional theory (DFT) B3LYP method with 6-31G* and 6-31++G** basis sets. The calculations show that the initial addition of the OH• at C4=C5 double bond of guanine is barrier free and the adduct radical (G-OH•) has only a small activation barrier of ca. 1 – 6 kcal/mol leading to the formation of a metastable ion-pair intermediate (G•+---OH−). The formation of ion-pair is a result of the highly oxidizing nature of the OH• in aqueous media. The resulting ion-pair (G•+---OH−) deprotonates to form H2O and neutral G radicals favoring G(N1-H)• with an activation barrier of ca. 5 kcal/mol. The overall process from the G(C4)-OH• (adduct) to G(N1-H)• and water is found to be exothermic in nature by more than 13 kcal/mol. (G-OH•), (G•+---OH−), and G(N1-H)• were further characterized by the CAM-B3LYP calculations of their UV-visible spectra and good agreement between theory and experiment is achieved. Our calculations for the direct hydrogen abstraction pathway from N1 and N2 sites of guanine by the OH• show that this is also a competitive route to produce G(N2-H)•, G(N1-H)• and H2O. PMID:22050033

  10. Pathways of arachidonic acid peroxyl radical reactions and product formation with guanine radicals.

    PubMed

    Crean, Conor; Geacintov, Nicholas E; Shafirovich, Vladimir

    2008-02-01

    Peroxyl radicals were derived from the one-electron oxidation of polyunsaturated fatty acids by sulfate radicals that were generated by the photodissociation of peroxodisulfate anions in air-equilibrated aqueous solutions. Reactions of these peroxyl and neutral guanine radicals, also generated by oxidation with sulfate radicals, were investigated by laser kinetic spectroscopy, and the guanine oxidation products were identified by HPLC and mass spectrometry methods. Sulfate radicals rapidly oxidize arachidonic (ArAc), linoleic (LnAc), and palmitoleic (PmAc) acids with similar rate constants, (2-4) x 10 (9) M (-1) s (-1). The C-centered radicals derived from the oxidation of ArAc and LnAc include nonconjugated Rn(.) ( approximately 80%) and conjugated bis-allylic Rba(.) ( approximately 20%) radicals. The latter were detectable in the absence of oxygen by their prominent, narrow absorption band at 280 nm. The Rn(.) radicals of ArAc (containing three bis-allylic sites) transform to the Rba(.) radicals via an intramolecular H-atom abstraction [rate constant (7.5 +/- 0.7) x 10 (4) s (-1)]. In contrast, the Rn(.) radicals of LnAc that contain only one bis-allylic site do not transform intramolecularly to the Rba(.) radicals. In the case of PmAc, which contains only one double bond, the Rba(.) radicals are not observed. The Rn(.) radicals of PmAc rapidly combine with oxygen with a rate constant of (3.8 +/- 0.4) x 10(9) M(-1) s(-1). The Rba(.) radicals of ArAc are less reactive and react with oxygen with a rate constant of (2.2 +/- 0.2) x 10 (8) M (-1) s (-1). The ArAc peroxyl radicals formed spontaneously eliminate superoxide radical anions [rate constant = (3.4 +/- 0.3) x 10 (4) M (-1) s (-1)]. The stable oxidative lesions derived from the 2',3',5'-tri- O-acetylguanosine or 2',3',5'-tri- O-acetyl-8-oxo-7,8-dihydroguanosine radicals and their subsequent reactions with ArAc peroxyl radicals were also investigated. The major products found were the 2,5-diamino-4 H

  11. Biologically relevant oxidants cause bound proteins to readily oxidatively cross-link at Guanine.

    PubMed

    Solivio, Morwena J; Nemera, Dessalegn B; Sallans, Larry; Merino, Edward J

    2012-02-20

    Oxidative DNA-protein cross-links have received less attention than other types of DNA damage and remain as one of the least understood types of oxidative lesion. A model system using ribonuclease A and a 27-nucleotide DNA was used to determine the propensity of oxidative cross-linking to occur in the presence of oxidants. Cross-link formation was examined using four different oxidation systems that generate singlet oxygen, superoxide, and metal-based Fenton reactions. It is shown that oxidative cross-linking occurs in yields ranging from 14% to a maximal yield of 61% in all oxidative systems when equivalent concentrations of DNA and protein are present. Because singlet oxygen is the most efficient oxidation system in generating DNA-protein cross-links, it was chosen for further analyses. Cross-linking occurred with single-stranded DNA binding protein and not with bovine serum albumin. Addition of salt lowered nonspecific binding affinity and lowered cross-link yield by up to 59%. The yield of cross-linking increased with increased ratios of protein compared with DNA. Cross-linking was highly dependent on the number of guanines in a DNA sequence. Loss of guanine content on the 27-nucleotide DNA led to nearly complete loss in cross-linking, while primer extension studies showed cross-links to predominantly occur at guanine base on a 100-nucleotide DNA. The chemical species generated were examined using two peptides derived from the ribonuclease A sequence, N-acetyl-AAAKF and N-acetyl-AYKTT, which were cross-linked to 2'-deoxyguanosine. The cross-link products were spiroiminodihydantoin, guanidinohydantoin, and tyrosyl-based adducts. Formation of tyrosine-based adducts may be competitive with the more well-studied lysine-based cross-links. We conclude that oxidative cross-links may be present at high levels in cells since the propensity to oxidatively cross-link is high and so much of the genomic DNA is coated with protein.

  12. UVA-visible photo-excitation of guanine radical cations produces sugar radicals in DNA and model structures

    PubMed Central

    Adhikary, Amitava; Malkhasian, Aramice Y. S.; Collins, Sean; Koppen, Jessica; Becker, David; Sevilla, Michael D.

    2005-01-01

    This work presents evidence that photo-excitation of guanine radical cations results in high yields of deoxyribose sugar radicals in DNA, guanine deoxyribonucleosides and deoxyribonucleotides. In dsDNA at low temperatures, formation of C1′• is observed from photo-excitation of G•+ in the 310–480 nm range with no C1′• formation observed ≥520 nm. Illumination of guanine radical cations in 2′dG, 3′-dGMP and 5′-dGMP in aqueous LiCl glasses at 143 K is found to result in remarkably high yields (∼85–95%) of sugar radicals, namely C1′•, C3′• and C5′•. The amount of each of the sugar radicals formed varies dramatically with compound structure and temperature of illumination. Radical assignments were confirmed using selective deuteration at C5′ or C3′ in 2′-dG and at C8 in all the guanine nucleosides/tides. Studies of the effect of temperature, pH, and wavelength of excitation provide important information about the mechanism of formation of these sugar radicals. Time-dependent density functional theory calculations verify that specific excited states in G•+ show considerable hole delocalization into the sugar structure, in accord with our proposed mechanism of action, namely deprotonation from the sugar moiety of the excited molecular radical cation. PMID:16204456

  13. Solution structures of oligonucleotides containing either a guanine or a cytosine in front of a gap of one nucleotide

    NASA Astrophysics Data System (ADS)

    Boulard, Y.; Faibis, V.; Fazakerley, G. V.

    1999-10-01

    We report NMR and molecular modelling studies on two DNA duplexes containing a gap of one nucleotides. The difference between the two oligonucleotides lies in the central base face to the gap, a guanine or a cytosine. For the gapG, we observed in solution a B-form conformation where the guanine stacks in the helix. For the gapC, we reveal the existence of two species, one majority where the cytosine is inside the helix and a second for which the cytosine is extrahelical. Nous présentons une étude par RMN et modélisation moléculaire sur deux duplexes d'ADN contenant une lacune de un nucléotide. La différence entre les deux oligonucléotides réside dans la base centrale en face de la lacune, une guanine ou une cytosine. Pour le duplex appelé gapG, nous observons en solution une hélice de type B dans laquelle la guanine est empilée à l'intérieur de l'hélice. Dans le cas du duplex gapC, nous montrons l'existence de deux formes, l'une où la cytosine est à l'intérieur de l'hélice; la seconde où la cytosine est extra hélicale.

  14. NF-κB activation mediates crystal translocation and interstitial inflammation in adenine overload nephropathy.

    PubMed

    Okabe, Cristiene; Borges, Raquel Lerner; de Almeida, Danilo Candido; Fanelli, Camilla; Barlette, Grasiela Pedreira; Machado, Flavia Gomes; Arias, Simone Costa Alarcon; Malheiros, Denise Maria Avancini Costa; Camara, Niels Olsen Saraiva; Zatz, Roberto; Fujihara, Clarice Kazue

    2013-07-15

    Adenine overload promotes intratubular crystal precipitation and interstitial nephritis. We showed recently that these abnormalities are strongly attenuated in mice knockout for Toll-like receptors-2, -4, MyD88, ASC, or caspase-1. We now investigated whether NF-κB activation also plays a pathogenic role in this model. Adult male Munich-Wistar rats were distributed among three groups: C (n = 17), receiving standard chow; ADE (n = 17), given adenine in the chow at 0.7% for 1 wk and 0.5% for 2 wk; and ADE + pyrrolidine dithiocarbamate (PDTC; n = 14), receiving adenine as above and the NF-κB inhibitor PDTC (120 mg·kg⁻¹·day⁻¹ in the drinking water). After 3 wk, widespread crystal deposition was seen in tubular lumina and in the renal interstitium, along with granuloma formation, collagen accumulation, intense tubulointerstitial proliferation, and increased interstitial expression of inflammatory mediators. Part of the crystals were segregated from tubular lumina by a newly formed cell layer and, at more advanced stages, appeared to be extruded to the interstitium. p65 nuclear translocation and IKK-α increased abundance indicated activation of the NF-κB system. PDTC treatment prevented p65 migration and normalized IKK-α, limited crystal shift to the interstitium, and strongly attenuated interstitial fibrosis/inflammation. These findings indicate that the complex inflammatory phenomena associated with this model depend, at least in part, on NF-κB activation, and suggest that the NF-κB system may become a therapeutic target in the treatment of chronic kidney disease.

  15. The effects of cyclic adenosine 3',5'-monophosphate and other adenine nucleotides on body temperature.

    PubMed Central

    Dascombe, M J; Milton, A S

    1975-01-01

    1. Adenosine 3',5'-monophosphate (cAMP), its dibutyryl derivative (Db-cAMP) and other adenine nucleotides have been micro-injected into the hypothalamic region of the unanaesthetized cat and the effects on body temperature, and on behavioural and autonomic thermoregulatory activities observed. 2. Db-cAMP and cAMP both produced hypothermia when applied to the pre-optic anterior hypothalamus. With Db-cAMP the hypothermia was shown to be dose dependent between 50 and 500 mug (0-096-0-96 mumole). 3. AMP, ADP and ATP also produced hypothermia when injected into the pre-optic anterior hypothalamus. 4. The order of relative potencies of the adenine nucleotides with respect both to the hypothermia produced and to the autonomic thermoregulatory effects observed were similar. Db-cAMP was most potent and cAMP least. 5. Micro-injection into the pre-optic anterior hypothalamus of many substances including saline produced in most cats a non-specific rise in body temperature apparently the result of tissue damage. Intraperitoneal injection of 4-acetamidophenol (paracetamol 50 mg/kg) reduced or abolished this febrile response. 6. The hypothermic effect of the adenine nucleotides has been compared with the effects produced in these same cats by micro-injections of noradrenaline, 5-hydroxytryptamine, a mixture of acetylcholine and physostigmine (1:1), EDTA and excess Ca2+ ions. 7. It is concluded that as Db-cAMP and cAMP both produce hypothermia, it is unlikely that endogenous cAMP in the pre-optic anterior hypothalamus mediates the hyperthermic responses to pyrogens and prostaglandins. PMID:170396

  16. Brain Injury Alters Ectonucleotidase Activities and Adenine Nucleotide Levels in Rat Serum

    PubMed Central

    Laketa, Danijela; Savić, Jasmina; Bjelobaba, Ivana; Lavrnja, Irena; Vasić, Vesna; Stojiljković, Mirjana; Nedeljković, Nadežda

    2015-01-01

    Summary Background Cortical stab injury (CSI) induces changes in the activity, expression and cellular distribution of specific ectonucleotidases at the injury site. Also, several experimentally induced neuropathologies are associated with changes in soluble ectonucleotidase activities in the plasma and serum, whilst various insults to the brain alter purine compounds levels in cerebrospinal fluid, but also in serum, indicating that insults to the brain may induce alterations in nucleotides release and rate of their hydrolysis in the vascular system. Since adenine nucleotides and adenosine regulate diverse cellular functions in the vascular system, including vascular tone, platelet aggregation and inflammatory responses of lymphocytes and macrophages, alterations of ectonucleotidase activities in the vascular system may be relevant for the clinical outcome of the primary insult. Methods We explored ectonucleotidase activities using specific enzyme assays and determined adenine nucleotides concentrations by the UPLC method in the rat serum after cortical stab injury. Results At 4-h post-injury, ATP and AMP hydrolysis increased by about 60% and 40%, respectively, while phosphodiesterase activity remained unchanged. Also, at 4-h post-injury a marked decrease in ATP concentration and more than 2-fold increase in AMP concentration were recorded. Conclusions CSI induces rapid up-regulation of nucleotide catabolizing soluble ectonucleotidases in rat serum, which leads to the observed shift in serum nucleotide levels. The results obtained imply that ectonucleotidases and adenine nucleotides participate in the communication between the brain and the vascular system in physiological and pathological conditions and thereby may be involved in the development of various human neuropathologies.

  17. Conformational behavior of flavin adenine dinucleotide: conserved stereochemistry in bound and free states.

    PubMed

    Kuppuraj, Gopi; Kruise, Dennis; Yura, Kei

    2014-11-26

    Metabolic enzymes utilize the cofactor flavin adenine dinucleotide (FAD) to catalyze essential biochemical reactions. Because these enzymes have been implicated in disease pathways, it will be necessary to target them via FAD-based structural analogues that can either activate/inhibit the enzymatic activity. To achieve this, it is important to explore the conformational space of FAD in the enzyme-bound and free states. Herein, we analyze X-ray crystallographic data of the enzyme-bound FAD conformations and sample conformations of the molecule in explicit water by molecular dynamics (MD) simulations. Enzyme-bound FAD conformations segregate into five distinct groups based on dihedral angle principal component analysis (PCA). A notable feature in the bound FADs is that the adenine base and isoalloxazine ring are oppositely oriented relative to the pyrophosphate axis characterized by near trans hypothetical dihedral angle "δV" values. Not surprisingly, MD simulations in water show final compact but not perfectly stacked ring structures in FAD. Simulation data did not reveal noticeable changes in overall conformational dynamics of the dinucleotide in reduced and oxidized forms and in the presence and/or absence of ions. During unfolding-folding dynamics, the riboflavin moiety is more flexible than the adenosine monophosphate group in the molecule. Conversely, the isoalloxazine ring is more stable than the variable adenine base. The pyrophosphate group depicts an unusually highly organized fluctuation illustrated by its dihedral angle distribution. Conformations sampled from enzymes and MD are quantified. The extent to which the protein shifts the distribution from the unbound state is discussed in terms of prevalent FAD shapes and dihedral angle population.

  18. Adenine Nucleotide Levels in the Cytosol, Chloroplasts, and Mitochondria of Wheat Leaf Protoplasts 1

    PubMed Central

    Stitt, Mark; Lilley, Ross McC.; Heldt, Hans W.

    1982-01-01

    Recently, a new method has been described, in which membrane filtration is used to allow the levels of adenine nucleotides in the chloroplast stroma, the cytosol, and the mitochondrial matrix to be measured. This method is now used to investigate the effect of illumination, of respiratory inhibitors, and of uncouplers on the distribution of ATP, ADP, and AMP in wheat (Triticum aestivum var. `Timmo') leaf protoplasts. (a) The adenine nucleotides are apparently equilibrated by adenylate kinase in the stroma and the cytosol, but not in the mitochondrial matrix. (b) The ATP/ADP quotient in the cytosol is considerably higher than that in the mitochondrial matrix or the chloroplast stroma. (c) A large gradient exists between the ATP/ADP quotients in the cytosol and the mitochondrial matrix in the dark, with a very low ATP/ADP quotient in the mitochondria. This gradient is lowered by uncouplers or respiratory inhibitors showing that, as in animal tissues, it reflects the energization of the mitochondria. (d) In the dark, the stromal ATP/ADP is lower than in the light, and appears to be maintained, at least in part, by import from the cytosol. (e) The cytosolic ATP/ADP, however, actually decreases in the light. This contradicts the widespread assumption, that export of photosynthetically produced ATP from the chloroplast leads to an increase in the cytosolic ATP/ADP, which then inhibits oxidative phosphorylation in the mitochondria. (f) The mitochondrial ATP/ADP increases in the light, and the gradient between the cytosol and mitochondrial matrix falls. This is also difficult to understand in terms of an inhibition of oxidative phosphorylation in the light due to a lack of ADP in the cytosol. (g) The significance of the measured variations in the adenine nucleotide pools are discussed with respect to the diurnal carbohydrate metabolism in a leaf, and to the metabolic function of the chloroplast, the cytosol and the mitochondria. PMID:16662653

  19. Targeting of Polycomb Repressive Complex 2 to RNA by Short Repeats of Consecutive Guanines.

    PubMed

    Wang, Xueyin; Goodrich, Karen J; Gooding, Anne R; Naeem, Haroon; Archer, Stuart; Paucek, Richard D; Youmans, Daniel T; Cech, Thomas R; Davidovich, Chen

    2017-03-16

    Polycomb repressive complex 2 (PRC2) is a histone methyltransferase that trimethylates H3K27, a mark of repressed chromatin. Mammalian PRC2 binds RNA promiscuously, with thousands of target transcripts in vivo. But what does PRC2 recognize in these RNAs? Here we show that purified human PRC2 recognizes G > C,U ≫ A in single-stranded RNA and has a high affinity for folded guanine quadruplex (G4) structures but little binding to duplex RNAs. Importantly, G-tract motifs are significantly enriched among PRC2-binding transcripts in vivo. DNA sequences coding for PRC2-binding RNA motifs are enriched at PRC2-binding sites on chromatin and H3K27me3-modified nucleosomes. Collectively, the abundance of PRC2-binding RNA motifs rationalizes the promiscuous RNA binding of PRC2, and their enrichment at Polycomb target genes provides a means for RNA-mediated regulation.

  20. A direct-dynamics study of proton transfer through water bridges in guanine and 7-azaindole

    NASA Astrophysics Data System (ADS)

    Smedarchina, Zorka; Siebrand, Willem; Fernández-Ramos, Antonio; Gorb, Leonid; Leszczynski, Jerzy

    2000-01-01

    To evaluate the efficiency of bridges of water molecules as proton conduits, multidimensional ab initio proton transfer rate constants are reported for complexes of guanine and 7-azaindole with one and two water molecules. These water molecules form hydrogen-bonded bridges between functional groups involved in tautomerization via proton transfer and catalyze this transfer. Structures and energies of the relevant stationary configurations are optimized at the second-order Møller-Plesset level and vibrational force fields are evaluated at the Hartree-Fock level. The proton transfer rate constants, calculated with the instanton method, show the effect of the structure and strength of the hydrogen bonds, reflected in couplings between the tunneling mode and the other vibrations of the complexes. The results indicate that strongly hydrogen-bonded, strain-free water bridges can serve as very efficient proton conduits.

  1. Novel designed enediynes: molecular design, chemical synthesis, mode of cycloaromatization and guanine-specific DNA cleavage.

    PubMed

    Toshima, K; Ohta, K; Kano, T; Nakamura, T; Nakata, M; Kinoshita, M; Matsumura, S

    1996-01-01

    The molecular design and chemical synthesis of novel enediyne molecules related to the neocarzinostatin chromophore (1), and their chemical and DNA cleaving properties are described. The 10-membered enediyne triols 16-18 were effectively synthesized from xylitol (10) in a short step, and found to be quite stable when handled at room temperature. The representative and acylated enediyne 16 was cycloaromatized by 1,8-diazabicyclo[5.4.0]undec-7-ene (DBU) in cyclohexa-1,4-diene-benzene to give the benzenoid product 21 through a radical pathway. On the other hand, the enediyne 16 was cycloaromatized by diethylamine in dimethyl sulfoxide-Tris-HCl, pH 8.5 buffer to afford another benzenoid product 22 as a diethylamine adduct through a polar pathway. Furthermore, the enediynes 16-18 were found to exhibit guanine-specific DNA cleavage under weakly basic conditions with no additive.

  2. Synaptic functions of the IQSEC family of ADP-ribosylation factor guanine nucleotide exchange factors.

    PubMed

    Um, Ji Won

    2016-06-28

    Postsynaptic scaffolding proteins interact with numerous synaptic proteins to ensure the organization and specialization of functional excitatory and inhibitory synapses. IQSECs (IQ motif and SEC7 domain-containing proteins) are a class of ADP ribosylation factor-guanine nucleotide exchange factors (ARF-GEFs), whose functions are beginning to be understood as both scaffolding and signaling proteins. Specifically, IQSEC1 binds to PSD-95, and IQSEC2 functions as a regulator of AMPA receptor trafficking at excitatory synapses, whereas IQSEC3 interacts with gephyrin to promote inhibitory synapse development. Here, I review the currently known findings on IQSECs and discuss the possible relations between dysfunctions of IQSECs and the pathophysiology of brain disorders.

  3. Final Technical Report: Genetic Control of Nitrogen Assimilation in Klebsiella oxytoca.

    SciTech Connect

    Valley Stewart

    2007-03-07

    Klebsiella oxytoca, an enterobacterium closely related to Escherichia coli and amenable to molecular genetic analysis, is a long-established model organism for studies of bacterial nitrogen assimilation. Our work concerned utilization of purines, nitrogen-rich compounds that are widespread in the biosphere. This project began with our observation that molybdenum cofactor (chlorate-resistant) mutants can use (hypo)xanthine as sole nitrogen source (Garzón et al., J. Bacteriol. 174:6298, 1992). Since xanthine dehydrogenase is a molybdoenzyme, Klebsiella must use an alternate route for (hypo)xanthine catabolsim. We identified and characterized a cluster of 22 genes that encode the enzymes, permeases and regulators for utilizing hypoxanthine and xanthine as sole nitrogen source. (Hypoxanthine and xanthine arise from deamination of adenine and guanine, respectively.) Growth and complementation tests with insertion mutants, combined with protein sequence comparisons, allow us to assign probable functions for the products of these genes and to deduce the overall pathway. We present genetic evidence that the first two enzymes for the Klebsiella purine utilization pathway have been recruited from pathways involved in catabolism of aromatic compounds. The first, HxaAB enzyme catalyzing (hypo)xanthine oxidation, is related to well-studied aromatic ring hydroxylating oxygenases such as phthalate dioxygenase. The second, HxbA enzyme catalyzing urate hydroxylation, is related to single-component monooxygenases. Thus, the Klebsiella purine utilization pathway has likely experienced non-orthologous gene displacement, substituting these oxygenases for the conventional enzymes, xanthine dehydrogenase and uricase. We also present evidence that transcription of the hxaAB operon is subject to dual regulation: global general nitrogen regulation (Ntr) through an unknown mechanism, and (hypo)xanthine induction mediated by a LysR-type activator.

  4. Adenine arabinoside inhibition of adenovirus replication enhanced by an adenosine deaminase inhibitor.

    PubMed

    Wigand, R

    1979-01-01

    The inhibition of adenovirus multiplication by adenine arabinoside was determined by yield reduction in one-step multiplication cycle. Inhibition was greatly enhanced by an adenosine deaminase inhibitor (2-deoxycoformycin) in concentrations down to 10 ng/ml. Adenovirus types from four subgroups showed similar results. However, the enhancing effect of adenosine deaminase inhibitor was great in HeLa cells, moderate in human fibroblasts, and negligible in Vero cells. This difference could be explained by different concentrations of adenosine deaminase found in cell homogenates.

  5. Physical Separation of Streptococcal Nicotinamide Adenine Dinucleotide Glycohydrolase from Streptolysin O

    PubMed Central

    Shany, S.; Grushoff, Phyllis S.; Bernheimer, Alan W.

    1973-01-01

    Streptococcal nicotinamide adenine dinucleotide glycohydrolase (NADase) with a molecular weight of about 55,000 and an isoelectric pH of 8.55 was isolated from crude streptolysin O (SLO) preparations. NADase differed from SLO in size, charge, and immunological behavior. Streptococcal NADase is considered to have no role in the hemolytic process because it has no hemolytic activity; conversely, partially purified SLO showed no NADase activity. The hemolytic activity of crude SLO was completely inhibited by anti-tetanolysin, whereas the NADase activity in the same reaction mixture was unaffected. Experiments involving double diffusion in agar also demonstrated immunological nonidentity of the two proteins. Images PMID:4357989

  6. Cyclic AMP, membrane transport and cell division. I. Effects of various chemicals on cyclic AMP levels and rate of transport of neucleosides, hypoxanthine and deoxyglucose in several lines of cultured cells.

    PubMed

    Sheppard, J R; Plagemann, P G

    1975-04-01

    Nutrient transport rates and cyclic AMP levels have been implicated in the regulation of cell proliferation. In the present study, however, changes in intracellular cyclic AMP level in several lines of cultured cells (normal 3T3 and SV40 and polyomavirus-transformed 3T3 cells; 3T6, C6 GLIOMA, MOUSE L, and Novikoff rat hepatoma cells) by treatment with papaverine, prostaglandine E1 or isoproterenol did not correlate with the inhibition of the uridine, hypoxanthine or deoxyglucose transport rates by these chemicals. Transport inhibitions by above chemicals or Persantin or Cytochalasin B occurred in most cell lines in the absence of any measurable change in intracellular cyclic AMP concentration. Furthermore, treatment of several cell lines with 1 mM dibutyryl cyclic AMP had no immediate effect on the transport of uridine, thymidine or deoxyglucose, although the transport capacity of the cells for uridine and thymidine, but not that for deoxyglucose, decreased progressively with time of treatment. We also observed that the uridine transport system of all cell lines derived from 3T3 cells and the hypoxanthine transport system of L cells exhibited high degrees of resistance to inhibition by the various chemicals. On the other hand, deoxyglucose transport was inhibited to about the same extent by these chemicals in all the cell lines investigated.

  7. The effect of pi-stacking, h-bonding, and electrostatic interactions on the ionization energies of nucleic acid bases: adenine-adenine, thymine-thymine and adenine-thymine dimers

    SciTech Connect

    Bravaya, Ksenia B.; Kostko, Oleg; Ahmed, Musahid; Krylov, Anna I.

    2009-09-02

    A combined theoretical and experimental study of the ionized dimers of thymine and adenine, TT, AA, and AT, is presented. Adiabatic and vertical ionization energies(IEs) for monomers and dimers as well as thresholds for the appearance of the protonated species are reported and analyzed. Non-covalent interactions stronglyaffect the observed IEs. The magnitude and the nature of the effect is different for different isomers of the dimers. The computations reveal that for TT, the largestchanges in vertical IEs (0.4 eV) occur in asymmetric h-bonded and symmetric pi- stacked isomers, whereas in the lowest-energy symmetric h-bonded dimer the shiftin IEs is much smaller (0.1 eV). The origin of the shift and the character of the ionized states is different in asymmetric h-bonded and symmetric stacked isomers. Inthe former, the initial hole is localized on one of the fragments, and the shift is due to the electrostatic stabilization of the positive charge of the ionized fragment by thedipole moment of the neutral fragment. In the latter, the hole is delocalized, and the change in IE is proportional to the overlap of the fragments' MOs. The shifts in AAare much smaller due to a less effcient overlap and a smaller dipole moment. The ionization of the h-bonded dimers results in barrierless (or nearly barrierless) protontransfer, whereas the pi-stacked dimers relax to structures with the hole stabilized by the delocalization or electrostatic interactions.

  8. Recognition and activation of Rho GTPases by Vav1 and Vav2 guanine nucleotide exchange factors.

    PubMed

    Heo, Jongyun; Thapar, Roopa; Campbell, Sharon L

    2005-05-03

    Vav proteins are Rho GTPase-specific guanine nucleotide exchange factors (GEFs) that are distinguished by the tandem arrangement of Dbl homology (DH), Pleckstrin homology (PH), and cysteine rich domains (CRD). Whereas the tandem DH-PH arrangement is conserved among Rho GEFs, the presence of the CRD is unique to Vav family members and is required for efficient nucleotide exchange. We provide evidence that Vav2-mediated nucleotide exchange of Rho GTPases follows the Theorell-Chance mechanism in which the Vav2.Rho GTPase complex is the major species during the exchange process and the Vav2.GDP-Mg(2+).Rho GTPase ternary complex is present only transiently. The GTPase specificity for the DH-PH-CRD Vav2 in vitro follows this order: Rac1 > Cdc42 > RhoA. Results obtained from fluorescence anisotropy and NMR chemical shift mapping experiments indicate that the isolated Vav1 CRD is capable of directly associating with Rac1, and residues K116 and S83 that are in the proximity of the P-loop and the guanine base either are part of this binding interface or undergo a conformational change in response to CRD binding. The NMR studies are supported by kinetic measurements on Rac1 mutants S83A, K116A, and K116Q and Vav2 CRD mutant K533A in that these mutants affect both the initial binding event of Vav2 with Rac1 (k(on)) and the rate-limiting dissociation of Vav2 from the Vav2.Rac1 binary complex (thereby influencing the enzyme turnover number, k(cat)). The results suggest that the CRD domain in Vav proteins plays an active role, affecting both the k(on) and the k(cat) for Vav-mediated nucleotide exchange on Rho GTPases.

  9. Guanine nucleotide regulatory protein co-purifies with the D/sub 2/-dopamine receptor

    SciTech Connect

    Senogles, S.E.; Caron, M.G.

    1986-05-01

    The D/sub 2/-dopamine receptor from bovine anterior pituitary was purified approx.1000 fold by affinity chromatography on CMOS-Sepharose. Reconstitution of the affinity-purified receptor into phospholipid vesicles revealed the presence of high and low affinity agonist sites as detected by N-n-propylnorapomorphine (NPA) competition experiments with /sup 3/H-spiperone. High affinity agonist binding could be converted to the low affinity form by guanine nucleotides, indicating the presence of an endogenous guanine nucleotide binding protein (N protein) in the affinity-purified D/sub 2/ receptor preparations. Furthermore, this preparation contained an agonist-sensitive GTPase activity which was stimulated 2-3 fold over basal by 10 ..mu..M NPA. /sup 35/S-GTP..gamma..S binding to these preparations revealed a stoichiometry of 0.4-0.7 mole N protein/mole receptor, suggesting the N protein may be specifically coupled with the purified D/sub 2/-dopamine receptor and not present as a contaminant. Pertussis toxin treatment of the affinity purified receptor preparations prevented high affinity agonist binding, as well as agonist stimulation of the GTPase activity, presumably by inactivating the associated N protein. Pertussis toxin lead to the ADP-ribosylation of a protein of 39-40K on SDS-PAGE. These findings indicate that an endogenous N protein, N/sub i/ or N/sub o/, co-purifies with the D/sub 2/-dopamine receptor which may reflect a precoupling of this receptor with an N protein within the membranes.

  10. QUAD, a protein from hepatocyte chromatin that binds selectively to guanine-rich quadruplex DNA.

    PubMed

    Weisman-Shomer, P; Fry, M

    1993-02-15

    The single-stranded oligomer Q, whose nucleotide sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3' corresponds to the IgG switch region, forms in concentrated solutions and in the presence of alkali metal cation parallel four-stranded complexes termed G4 DNA (Sen, D., and Gilbert, W. (1988) Nature 334, 364-366). We show that G4 DNA was also formed during storage of dried oligomer Q. This quadruplex complex migrated more slowly than mono-strand oligomer Q during nondenaturing gel electrophoresis, the rate of its formation depended on the mass of stored oligomer Q, and N7 positions of guanine residues were involved in its stabilization. Here we report the purification of a protein designated QUAD that binds specifically to the G4 form of oligomer Q, from non-histone protein extracts of rabbit hepatocytes. QUAD was 80-90% purified by sequential steps of column chromatography on Sepharose 6B, DEAE-cellulose, phosphocellulose, and phenyl-Sepharose. Purified QUAD migrated on SDS-polyacrylamide gel electrophoresis as a 58 +/- 2.6-kDa polypeptide and had a native molecular mass of 57 +/- 2.5 kDa as determined by Sepharose 6B gel filtration. The dissociation constant of G4 DNA binding to QUAD was in the range of 2.5 to 7.0 x 10(-9) M/liter. Excess unlabeled monostranded oligomer Q did not compete with 5'-32P-labeled G4 DNA on its binding to QUAD. Further, that QUAD recognized the G4 DNA structure rather than a DNA sequence was also demonstrated by the inefficient competition on the binding of 5'-[32P]G4 DNA to QUAD by excess unlabeled single- or double-stranded DNA molecules that contained guanine clusters of different length or various other nucleotide sequences.

  11. Activation of AMP-Activated Protein Kinase by Adenine Alleviates TNF-Alpha-Induced Inflammation in Human Umbilical Vein Endothelial Cells.

    PubMed

    Cheng, Yi-Fang; Young, Guang-Huar; Lin, Jiun-Tsai; Jang, Hyun-Hwa; Chen, Chin-Chen; Nong, Jing-Yi; Chen, Po-Ku; Kuo, Cheng-Yi; Kao, Shao-Hsuan; Liang, Yao-Jen; Chen, Han-Min

    2015-01-01

    The AMP-activated protein kinase (AMPK) signaling system plays a key role in cellular stress by repressing the inflammatory responses induced by the nuclear factor-kappa B (NF-κB) system. Previous studies suggest that the anti-inflammatory role of AMPK involves activation by adenine, but the mechanism that allows adenine to produce these effects has not yet been elucidated. In human umbilical vein endothelial cells (HUVECs), adenine was observed to induce the phosphorylation of AMPK in both a time- and dose-dependent manner as well as its downstream target acetyl Co-A carboxylase (ACC). Adenine also attenuated NF-κB targeting of gene expression in a dose-dependent manner and decreased monocyte adhesion to HUVECs following tumor necrosis factor (TNF-α) treatment. The short hairpin RNA (shRNA) against AMPK α1 in HUVECs attenuated the adenine-induced inhibition of NF-κB activation in response to TNF-α, thereby suggesting that the anti-inflammatory role of adenine is mediated by AMPK. Following the knockdown of adenosyl phosphoribosyl transferase (APRT) in HUVECs, adenine supplementation failed to induce the phosphorylation of AMPK and ACC. Similarly, the expression of a shRNA against APRT nullified the anti-inflammatory effects of adenine in HUVECs. These results suggested that the role of adenine as an AMPK activator is related to catabolism by APRT, which increases the cellular AMP levels to activate AMPK.

  12. Activation of AMP-Activated Protein Kinase by Adenine Alleviates TNF-Alpha-Induced Inflammation in Human Umbilical Vein Endothelial Cells

    PubMed Central

    Lin, Jiun-Tsai; Jang, Hyun-Hwa; Chen, Chin-Chen; Nong, Jing-Yi; Chen, Po-Ku; Kuo, Cheng-Yi; Kao, Shao-Hsuan; Liang, Yao-Jen; Chen, Han-Min

    2015-01-01

    The AMP-activated protein kinase (AMPK) signaling system plays a key role in cellular stress by repressing the inflammatory responses induced by the nuclear factor-kappa B (NF-κB) system. Previous studies suggest that the anti-inflammatory role of AMPK involves activation by adenine, but the mechanism that allows adenine to produce these effects has not yet been elucidated. In human umbilical vein endothelial cells (HUVECs), adenine was observed to induce the phosphorylation of AMPK in both a time- and dose-dependent manner as well as its downstream target acetyl Co-A carboxylase (ACC). Adenine also attenuated NF-κB targeting of gene expression in a dose-dependent manner and decreased monocyte adhesion to HUVECs following tumor necrosis factor (TNF-α) treatment. The short hairpin RNA (shRNA) against AMPK α1 in HUVECs attenuated the adenine-induced inhibition of NF-κB activation in response to TNF-α, thereby suggesting that the anti-inflammatory role of adenine is mediated by AMPK. Following the knockdown of adenosyl phosphoribosyl transferase (APRT) in HUVECs, adenine supplementation failed to induce the phosphorylation of AMPK and ACC. Similarly, the expression of a shRNA against APRT nullified the anti-inflammatory effects of adenine in HUVECs. These results suggested that the role of adenine as an AMPK activator is related to catabolism by APRT, which increases the cellular AMP levels to activate AMPK. PMID:26544976

  13. Investigation of base pairs containing oxidized guanine using ab initio method and ABEEMσπ polarizable force field.

    PubMed

    Liu, Cui; Wang, Yang; Zhao, Dongxia; Gong, Lidong; Yang, Zhongzhi

    2014-02-01

    The integrity of the genetic information is constantly threatened by oxidizing agents. Oxidized guanines have all been linked to different types of cancers. Theoretical approaches supplement the assorted experimental techniques, and bring new sight and opportunities to investigate the underlying microscopic mechanics. Unfortunately, there is no specific force field to DNA system including oxidized guanines. Taking high level ab initio calculations as benchmark, we developed the ABEEMσπ fluctuating charge force field, which uses multiple fluctuating charges per atom. And it was applied to study the energies, structures and mutations of base pairs containing oxidized guanines. The geometries were obtained in reference to other studies or using B3LYP/6-31+G* level optimization, which is more rational and timesaving among 24 quantum mechanical methods selected and tested by this work. The energies were determined at MP2/aug-cc-pVDZ level with BSSE corrections. Results show that the constructed potential function can accurately simulate the change of H-bond and the buckled angle formed by two base planes induced by oxidized guanine, and it provides reliable information of hydrogen bonding, stacking interaction and the mutation processes. The performance of ABEEMσπ polarizable force field in predicting the bond lengths, bond angles, dipole moments etc. is generally better than those of the common force fields. And the accuracy of ABEEMσπ PFF is close to that of the MP2 method. This shows that ABEEMσπ model is a reliable choice for further research of dynamics behavior of DNA fragment including oxidized guanine.

  14. Electrochemical oxidation of guanine: electrode reaction mechanism and tailoring carbon electrode surfaces to switch between adsorptive and diffusional responses.

    PubMed

    Li, Qian; Batchelor-McAuley, Christopher; Compton, Richard G

    2010-06-03

    The electrochemical oxidation of guanine is studied in aqueous media at various carbon electrodes. Specifically edge plane pyrolytic graphite (EPPG), basal plane pyrolytic graphite (BPPG), and highly ordered pyrolytic graphite (HOPG) were used, and the voltammetry was found to vary significantly. In all cases, signals characteristic of adsorbed guanine were seen and the total charge passed varied from surface to surface in the order roughened BPPG > EPPG > BPPG > HOPG. It is of note that the peak height for the EPPG electrode is less than that found for roughened BPPG; furthermore, across the series of electrodes, there is a significant decrease in peak potential with increasing density of edge plane sites present at the electrode surface. This leads us to conclude that there are two dominating and controlling factors present: (i) the density of basal plane sites on which guanine can adsorb and (ii) the density of edge plane sites necessary for the electro-oxidation of the analyte. This conclusion is corroborated through further experiments with multi- and single-walled carbon nanotubes. Adsorption was seen to be enhanced by modification of the EPPG surface with alumina particles, and as such, increased peak signals were observed in their presence. It is further reported that via the pre-adsorption of acetone onto the graphite surface that the adsorption of guanine may be blocked, resulting in a diffusional voltammetric signal. This diffusional response has been successfully modeled and gives insight into the complex -4e(-), -4H(+) oxidation mechanism; specifically, it enables explanation of the observed change in rate-determining step with scan rate. The oxidation of guanine first proceeds via a two-electron oxidation followed by a chemical step to form 8-oxoguanine, then 8-oxoguanine is then further oxidized to form nonelectroactive products. The change is mechanism is attributed to the variation in potential of the first and second electron transfer with scan

  15. Synthesis, spectroscopic, structural and thermal characterizations of vanadyl(IV) adenine complex prospective as antidiabetic drug agent.

    PubMed

    El-Megharbel, Samy M; Hamza, Reham Z; Refat, Moamen S

    2015-01-25

    The vanadyl(IV) adenine complex; [VO(Adn)2]⋅SO4; was synthesized and characterized. The molar conductivity of this complex was measured in DMSO solution that showed an electrolyte nature. Spectroscopic investigation of the green solid complex studied here indicate that the adenine acts as a bidentate ligand, coordinated to vanadyl(IV) ions through the nitrogen atoms N7 and nitrogen atom of amino group. Thus, from the results presented the vanadyl(IV) complex has square pyramid geometry. Further characterizations using thermal analyses and scanning electron techniques was useful. The aim of this paper was to introduce a new drug model for the diabetic complications by synthesized a novel mononuclear vanadyl(IV) adenine complex to mimic insulin action and reducing blood sugar level. The antidiabetic ability of this complex was investigated in STZ-induced diabetic mice. The results suggested that VO(IV)/adenine complex has antidiabetic activity, it improved the lipid profile, it improved liver and kidney functions, also it ameliorated insulin hormone and blood glucose levels. The vanadyl(IV) complex possesses an antioxidant activity and this was clear through studying SOD, CAT, MDA, GSH and methionine synthase. The current results support the therapeutic potentiality of vanadyl(IV)/adenine complex for the management and treatment of diabetes.

  16. Synthesis, spectroscopic, structural and thermal characterizations of vanadyl(IV) adenine complex prospective as antidiabetic drug agent

    NASA Astrophysics Data System (ADS)

    El-Megharbel, Samy M.; Hamza, Reham Z.; Refat, Moamen S.

    2015-01-01

    The vanadyl(IV) adenine complex; [VO(Adn)2]ṡSO4; was synthesized and characterized. The molar conductivity of this complex was measured in DMSO solution that showed an electrolyte nature. Spectroscopic investigation of the green solid complex studied here indicate that the adenine acts as a bidentate ligand, coordinated to vanadyl(IV) ions through the nitrogen atoms N7 and nitrogen atom of amino group. Thus, from the results presented the vanadyl(IV) complex has square pyramid geometry. Further characterizations using thermal analyses and scanning electron techniques was useful. The aim of this paper was to introduce a new drug model for the diabetic complications by synthesized a novel mononuclear vanadyl(IV) adenine complex to mimic insulin action and reducing blood sugar level. The antidiabetic ability of this complex was investigated in STZ-induced diabetic mice. The results suggested that VO(IV)/adenine complex has antidiabetic activity, it improved the lipid profile, it improved liver and kidney functions, also it ameliorated insulin hormone and blood glucose levels. The vanadyl(IV) complex possesses an antioxidant activity and this was clear through studying SOD, CAT, MDA, GSH and methionine synthase. The current results support the therapeutic potentiality of vanadyl(IV)/adenine complex for the management and treatment of diabetes.

  17. Purine transport by malpighian tubules of pteridine-deficient eye color mutants of Drosophila melanogaster.

    PubMed

    Sullivan, D T; Bell, L A; Paton, D R; Sullivan, M C

    1979-06-01

    Uptakes of guanine into Malpighian tubules of wild-type Drosophila and the eye color mutants white (w), brown (bw), and pink-peach (pp) have been compared. Tubules for each of these mutants are unable to concentrate guanine intracellularly. The transport of xanthine and riboflavin is also deficient in w tubules. The transport of guanosine, adenine, hypoxanthine, and guanosine monophosphate is similar in wild-type and white Malpighian tubules. These data and other information about these mutants make it likely that these pteridine-deficient eye color mutants do not produce pigments because of the inability to transport a pteridine precursor. This view supports the hypothesis that mutants which lack both pteridine and ommochromes do so because precursors to both classes of pigments share a common transport system.

  18. Pyrazolylborate-zinc-nucleobase-complexes, 2:(1) preparations and structures of Tp(Cum,Me)Zn and Tp(Ph,Me)Zn complexes.

    PubMed

    Badura, Dirk; Vahrenkamp, Heinrich

    2002-11-18

    The interactions of the nine most significant nucleobases (thymine, uracil, dihydrouracil, cytosine, adenine, guanine, diaminopurine, xanthine, hypoxanthine, in their deprotonated forms) with zinc and with themselves in pyrazolylborate zinc complexes Tp(Cum,Me)Zn-base and Tp(Ph,Me)Zn-base are described. Except for guanine, the complexes Tp*Zn-base could be isolated in all cases. Structure determinations could be performed for seven of the eight product types. Except for dihydrouracil and xanthine, the zinc ion is attached to that nitrogen of the base which in nucleosides bears the sugar moiety. In the solid state, all zinc-bound nucleobases are involved in hydrogen bonding interactions. Except for xanthine, this includes homo base pairing across a crystallographic inversion center.

  19. Development of bright fluorescent quadracyclic adenine analogues: TDDFT-calculation supported rational design

    PubMed Central

    Foller Larsen, Anders; Dumat, Blaise; Wranne, Moa S.; Lawson, Christopher P.; Preus, Søren; Bood, Mattias; Gradén, Henrik; Marcus Wilhelmsson, L.; Grøtli, Morten

    2015-01-01

    Fluorescent base analogues (FBAs) comprise a family of increasingly important molecules for the investigation of nucleic acid structure and dynamics. We recently reported the quantum chemical calculation supported development of four microenvironment sensitive analogues of the quadracyclic adenine (qA) scaffold, the qANs, with highly promising absorptive and fluorescence properties that were very well predicted by TDDFT calculations. Herein, we report on the efficient synthesis, experimental and theoretical characterization of nine novel quadracyclic adenine derivatives. The brightest derivative, 2-CNqA, displays a 13-fold increased brightness (εΦF = 4500) compared with the parent compound qA and has the additional benefit of being a virtually microenvironment-insensitive fluorophore, making it a suitable candidate for nucleic acid incorporation and use in quantitative FRET and anisotropy experiments. TDDFT calculations, conducted on the nine novel qAs a posteriori, successfully describe the relative fluorescence quantum yield and brightness of all qA derivatives. This observation suggests that the TDDFT-based rational design strategy may be employed for the development of bright fluorophores built up from a common scaffold to reduce the otherwise costly and time-consuming screening process usually required to obtain useful and bright FBAs. PMID:26227585

  20. Suppression of feline immunodeficiency virus infection in vivo by 9-(2-phosphonomethoxyethyl)adenine.

    PubMed Central

    Egberink, H; Borst, M; Niphuis, H; Balzarini, J; Neu, H; Schellekens, H; De Clercq, E; Horzinek, M; Koolen, M

    1990-01-01

    The acyclic purine nucleoside analogue 9-(2-phosphonomethoxyethyl)adenine [PMEA; formerly referred to as 9-(2-phosphonylmethoxyethyl)adenine] is a potent and selective inhibitor of human immunodeficiency virus replication in vitro and of Moloney murine sarcoma virus-induced tumor formation in mice. In the latter system PMEA has stronger antiretroviral potency and selectivity than 3'-azido-3'-thymidine (AZT). We have now investigated the effect of the drug in cats infected with the feline immunodeficiency virus (FIV). In vitro, PMEA was found to efficiently block FIV replication in feline thymocytes (50% effective dose, 0.6 microM). When administered to cats at doses of 20, 5, or 2 mg/kg per day, PMEA caused a dose-dependent suppression of FIV replication and virus-specific antibody production. Seropositive field cats with signs of opportunistic infection (gingivitis, stomatitis, and diarrhea) showed clinical improvement during PMEA therapy (5 mg/kg per day) and recurrence of the disease after treatment was discontinued. Thus, FIV infection in cats is an excellent model to test the efficacy of selective anti-human immunodeficiency virus agents in vivo. Images PMID:2158102

  1. The chemistry of nicotinamide adenine dinucleotide (NAD) analogues containing C-nucleosides related to nicotinamide riboside.

    PubMed

    Pankiewicz, Krzysztof W; Watanabe, Kyoichi A; Lesiak-Watanabe, Krystyna; Goldstein, Barry M; Jayaram, Hiremagalur N

    2002-04-01

    Oncolytic C-nucleosides, tiazofurin (2-beta-D-ribofuranosylthiazole-4-carboxamide) and benzamide riboside (3-beta-D-ribofuranosylbenzamide) are converted in cell into active metabolites thiazole-4-carboxamide- and benzamide adenine dinucleotide, TAD and BAD, respectively. TAD and BAD as NAD analogues were found to bind at the nicotinamide adenine dinucleotide (cofactor NAD) site of inosine monophosphate dehydrogenase (IMPDH), an important target in cancer treatment. The synthesis and evaluation of anticancer activity of a number of C-nucleosides related to tiazofurin and nicotinamide riboside then followed and are reviewed herein. Interestingly, pyridine C-nucleosides (such as C-nicotinamide riboside) are not metabolized into the corresponding NAD analogues in cell. Their conversion by chemical methods is described. As dinucleotides these compounds show inhibition of IMPDH in low micromolar level. Also, the synthesis of BAD in metabolically stable bis(phosphonate) form is discussed indicating the usefulness of such preformed inhibitors in drug development. Among tiazofurin analogues, Franchetti and Grifantini found, that the replacement of the sulfur by oxygen (as in oxazafurin) but not the removal of nitrogen (tiophenfurin) of the thiazole ring resulted in inactive compounds. The anti cancer activity of their synthetic dinucleotide analogues indicate that inactive compounds are not only poorly metabolized in cell but also are weak inhibitors of IMPDH as dinucleotides.

  2. 3D Magnetically Ordered Open Supramolecular Architectures Based on Ferrimagnetic Cu/Adenine/Hydroxide Heptameric Wheels.

    PubMed

    Pérez-Aguirre, Rubén; Beobide, Garikoitz; Castillo, Oscar; de Pedro, Imanol; Luque, Antonio; Pérez-Yáñez, Sonia; Rodríguez Fernández, Jesús; Román, Pascual

    2016-08-01

    The present work provides two new examples of supramolecular metal-organic frameworks consisting of three-dimensional extended noncovalent assemblies of wheel-shaped heptanuclear [Cu7(μ-H2O)6(μ3-OH)6(μ-adeninato-κN3:κN9)6](2+) entities. The heptanuclear entity consists of a central [Cu(OH)6](4-) core connected to six additional copper(II) metal centers in a radial and planar arrangement through the hydroxides. It generates a wheel-shaped entity in which water molecules and μ-κN3:κN9 adeninato ligands bridge the peripheral copper atoms. The magnetic characterization indicates the central copper(II) center is anti-ferromagnetically coupled to external copper(II) centers, which are ferromagnetically coupled among them leading to an S = 5/2 ground state. The packing of these entities is sustained by π-π stacking interactions between the adenine nucleobases and by hydrogen bonds established among the hydroxide ligands, sulfate anions, and adenine nucleobases. The sum of both types of supramolecular interactions creates a rigid synthon that in combination with the rigidity of the heptameric entity generates an open supramolecular structure (40-50% of available space) in which additional sulfate and triethylammonium ions are located altogether with solvent molecules. These compounds represent an interesting example of materials combining both porosity and magnetic relevant features.

  3. Development of bright fluorescent quadracyclic adenine analogues: TDDFT-calculation supported rational design.

    PubMed

    Foller Larsen, Anders; Dumat, Blaise; Wranne, Moa S; Lawson, Christopher P; Preus, Søren; Bood, Mattias; Gradén, Henrik; Wilhelmsson, L Marcus; Grøtli, Morten

    2015-07-31

    Fluorescent base analogues (FBAs) comprise a family of increasingly important molecules for the investigation of nucleic acid structure and dynamics. We recently reported the quantum chemical calculation supported development of four microenvironment sensitive analogues of the quadracyclic adenine (qA) scaffold, the qANs, with highly promising absorptive and fluorescence properties that were very well predicted by TDDFT calculations. Herein, we report on the efficient synthesis, experimental and theoretical characterization of nine novel quadracyclic adenine derivatives. The brightest derivative, 2-CNqA, displays a 13-fold increased brightness (εΦF = 4500) compared with the parent compound qA and has the additional benefit of being a virtually microenvironment-insensitive fluorophore, making it a suitable candidate for nucleic acid incorporation and use in quantitative FRET and anisotropy experiments. TDDFT calculations, conducted on the nine novel qAs a posteriori, successfully describe the relative fluorescence quantum yield and brightness of all qA derivatives. This observation suggests that the TDDFT-based rational design strategy may be employed for the development of bright fluorophores built up from a common scaffold to reduce the otherwise costly and time-consuming screening process usually required to obtain useful and bright FBAs.

  4. Ultraviolet photolysis of adenine: Dissociation via the {sup 1}{pi}{sigma}{sup *} state

    SciTech Connect

    Nix, Michael G. D.; Devine, Adam L.; Cronin, Brid; Ashfold, Michael N. R.

    2007-03-28

    High resolution total kinetic energy release (TKER) spectra of the H atom fragments resulting from photodissociation of jet-cooled adenine molecules at 17 wavelengths in the range 280>{lambda}{sub phot}>214 nm are reported. TKER spectra obtained at {lambda}{sub phot}>233 nm display broad, isotropic profiles that peak at low TKER ({approx}1800 cm{sup -1}) and are largely insensitive to the choice of excitation wavelength. The bulk of these products is attributed to unintended multiphoton dissociation processes. TKER spectra recorded at {lambda}{sub phot}{<=}233 nm display additional fast structure, which is attributed to N{sub 9}-H bond fission on the {sup 1}{pi}{sigma}{sup *} potential energy surface (PES). Analysis of the kinetic energies and recoil anisotropies of the H atoms responsible for the fast structure suggests excitation to two {sup 1}{pi}{pi}{sup *} excited states (the {sup 1}L{sub a} and {sup 1}B{sub b} states) at {lambda}{sub phot}{approx}230 nm, both of which dissociate to yield H atoms together with ground state adeninyl fragments by radiationless transfer through conical intersections with the {sup 1}{pi}{sigma}{sup *} PES. Parallels with the photochemistry exhibited by other, smaller heteroaromatics (pyrrole, imidazole, phenol, etc.) are highlighted, as are inconsistencies between the present conclusions and those reached in two other recent studies of excited state adenine molecules.

  5. Adenine-functionalized Spongy Graphene for Green and High-Performance Supercapacitors.

    PubMed

    El-Gendy, Dalia M; Ghany, Nabil A Abdel; El Sherbini, E E Foad; Allam, Nageh K

    2017-02-20

    A simple method is demonstrated to prepare spongy adenine-functionalized graphene (SFG) as interconnected, porous 3-dimensional (3D) network crinkly sheets. Such 3D network structure provides better contact at the electrode/electrolyte interface and facilitates the charge transfer kinetics. The fabricated SFG was characterized by X-ray diffraction (XRD), FTIR, scanning electron microscopy (FESEM), Raman spectroscopy, thermogravimetric analysis (TGA), UV-vis absorption spectroscopy, and transmission electron microscopy (TEM). The synthesized materials have been evaluated as supercapacitor materials in 0.5 M H2SO4 using cyclic voltammetry (CV) at different potential scan rates, and galvanostatic charge/discharge tests at different current densities. The SFG electrodes showed a maximum specific capacitance of 333 F/g at scan rate of 1 mV/s and exhibited excellent cycling retention of 102% after 1000 cycles at 200 mV/s. The energy density was 64.42 Wh/kg with a power density of 599.8 W/kg at 1.0 A/g. Those figures of merit are much higher than those reported for graphene-based materials tested under similar conditions. The observed high performance can be related to the synergistic effects of the spongy structure and the adenine functionalization.

  6. Adenine-functionalized Spongy Graphene for Green and High-Performance Supercapacitors

    NASA Astrophysics Data System (ADS)

    El-Gendy, Dalia M.; Ghany, Nabil A. Abdel; El Sherbini, E. E. Foad; Allam, Nageh K.

    2017-02-01

    A simple method is demonstrated to prepare spongy adenine-functionalized graphene (SFG) as interconnected, porous 3-dimensional (3D) network crinkly sheets. Such 3D network structure provides better contact at the electrode/electrolyte interface and facilitates the charge transfer kinetics. The fabricated SFG was characterized by X-ray diffraction (XRD), FTIR, scanning electron microscopy (FESEM), Raman spectroscopy, thermogravimetric analysis (TGA), UV‑vis absorption spectroscopy, and transmission electron microscopy (TEM). The synthesized materials have been evaluated as supercapacitor materials in 0.5 M H2SO4 using cyclic voltammetry (CV) at different potential scan rates, and galvanostatic charge/discharge tests at different current densities. The SFG electrodes showed a maximum specific capacitance of 333 F/g at scan rate of 1 mV/s and exhibited excellent cycling retention of 102% after 1000 cycles at 200 mV/s. The energy density was 64.42 Wh/kg with a power density of 599.8 W/kg at 1.0 A/g. Those figures of merit are much higher than those reported for graphene-based materials tested under similar conditions. The observed high performance can be related to the synergistic effects of the spongy structure and the adenine functionalization.

  7. The impact of adenine and inventory utilization decisions on blood inventory management.

    PubMed

    Cohen, M A; Pierskalla, W P; Sassetti, R J

    1983-01-01

    The use of citrate-phosphate-dextrose-adenine as an anticoagulant for whole blood increases the storage period permitted for whole blood and red cells from 21 to 35 days. A simulation model was used to analyze the possible consequences for outdates and shortages of the addition of adenine. The model accepts as input (1) the maximum age (21 or 35 days), (2) parameters describing the demand and supply distributions, and (3) parameters describing inventory control (crossmatch recycle period, transfusion fraction, deviation from optimal target inventory levels). These parameters were varied over wide ranges, and a full factorial design was carried out. The observed shortage and outdate rates were then related (via multiple regression) to the parameter values. The resulting shortage and outdate functions indicated the effect of parameter changes, including extending the lifetime from 21 to 35 days, and the joint effect of changing more than one parameter. Conclusions indicate that, while the contribution of an increased lifetime to reducing shortages and outdates can be substantial, this contribution can be easily dissipated by relaxing the tightness of other inventory management controls.

  8. Adenine-functionalized Spongy Graphene for Green and High-Performance Supercapacitors

    PubMed Central

    El-Gendy, Dalia M.; Ghany, Nabil A. Abdel; El Sherbini, E. E. Foad; Allam, Nageh K.

    2017-01-01

    A simple method is demonstrated to prepare spongy adenine-functionalized graphene (SFG) as interconnected, porous 3-dimensional (3D) network crinkly sheets. Such 3D network structure provides better contact at the electrode/electrolyte interface and facilitates the charge transfer kinetics. The fabricated SFG was characterized by X-ray diffraction (XRD), FTIR, scanning electron microscopy (FESEM), Raman spectroscopy, thermogravimetric analysis (TGA), UV−vis absorption spectroscopy, and transmission electron microscopy (TEM). The synthesized materials have been evaluated as supercapacitor materials in 0.5 M H2SO4 using cyclic voltammetry (CV) at different potential scan rates, and galvanostatic charge/discharge tests at different current densities. The SFG electrodes showed a maximum specific capacitance of 333 F/g at scan rate of 1 mV/s and exhibited excellent cycling retention of 102% after 1000 cycles at 200 mV/s. The energy density was 64.42 Wh/kg with a power density of 599.8 W/kg at 1.0 A/g. Those figures of merit are much higher than those reported for graphene-based materials tested under similar conditions. The observed high performance can be related to the synergistic effects of the spongy structure and the adenine functionalization. PMID:28216668

  9. DNA adenine methylation of sams1 gene in symbiont-bearing Amoeba proteus.

    PubMed

    Jeon, Taeck J

    2008-10-01

    The expression of amoeba sams genes is switched from sams1 to sams2 when amoebae are infected with Legionella jeonii. To elucidate the mechanism for the inactivation of host sams1 gene by endosymbiotic bacteria, methylation states of the sams1 gene of D and xD amoebae was compared in this study. The sams1 gene of amoebae was methylated at an internal adenine residue of GATC site in symbiont-bearing xD amoebae but not in symbiont-free D amoebae, suggesting that the modification might have caused the inactivation of sams1 in xD amoebae. The sams1 gene of xD amoebae was inactivated at the transcriptional level. Analysis of DNA showed that adenine residues in L. jeonii sams were also methylated, implying that L. jeonii bacteria belong to a Dam methylase-positive strain. In addition, both SAM and Met appeared to act as negative regulators for the expression of sams1 whereas the expression of sams2 was not affected in amoebae.

  10. Theoretical study on the static and dynamic first-order hyperpolarisabilities of adenine tautomers

    NASA Astrophysics Data System (ADS)

    Alparone, Andrea

    2014-07-01

    Static and dynamic electronic and vibrational first-order hyperpolarisabilities (β) of the lowest energy neutral adenine tautomers (amine forms A7 and A9) were obtained in gaseous and aqueous phases by using Hartree-Fock, Møller-Plesset second-order and fourth-order perturbation theory (MP2 and MP4-SDQ) and conventional and long-range corrected density functional theory methods with the Dunning's correlation-consistent cc-pVDZ, aug-cc-pVDZ, aug-cc-pVTZ and d-aug-cc-pVDZ basis sets. Frequency-dependent properties were calculated at the characteristic wavelength of the Nd:YAG laser (1064 nm) for the second harmonic generation and electro-optical Pockels effect nonlinear optical processes. Solvent effects were introduced under the polarised continuum model approximation. The electronic βe values of the investigated isomers are noticeably affected by the theoretical level, basis set and solvation. In vacuum, the static and dynamic βe values of A9 are greater than the corresponding data of A7, whereas the contribution of the solvent significantly enhances the hyperpolarisabilities of the A7 tautomer, resulting in βe(A9)/βe(A7) ratios between 0.5 and 0.6. The vibrational hyperpolarisabilities of the adenine tautomers are quite close to each other.

  11. Mathematical Model for Shear Stress Dependent NO and Adenine Nucleotide Production from Endothelial Cells

    PubMed Central

    Kirby, Patrick; Buerk, Donald G.; Parikh, Jaimit; Barbee, Kenneth A.; Jaron, Dov

    2015-01-01

    We developed a mass transport model for a parallel-plate flow chamber apparatus to predict the concentrations of nitric oxide (NO) and adenine nucleotides (ATP, ADP) produced by cultured endothelial cells (ECs) and investigated how the net rates of production, degradation, and mass transport for these three chemical species vary with changes in wall shear stress (τw). These simulations provide an improved understanding of experimental results obtained with parallel-plate flow chambers and allows quantitative analysis of the relationship between τw, adenine nucleotide concentrations, and NO produced by ECs. Experimental data obtained after altering ATP and ADP concentrations with apyrase were analyzed to quantify changes in the rate of NO production (RNO). The effects of different isoforms of apyrase on ATP and ADP concentrations and nucleotide-dependent changes in RNO could be predicted with the model. A decrease in ATP was predicted with apyrase, but an increase in ADP was simulated due to degradation of ATP. We found that a simple proportional relationship relating a component of RNO to the sum of ATP and ADP provided a close match to the fitted curve for experimentally measured changes in RNO with apyrase. Estimates for the proportionality constant ranged from 0.0067 to 0.0321 μM/s increase in RNO per nM nucleotide concentration, depending on which isoform of apyrase was modeled, with the largest effect of nucleotides on RNO at low τw (< 6 dyn/cm2). PMID:26529478

  12. Effect of Electronic Excitation on Hydrogen Atom Transfer (Tautomerization) Reactions for the DNA Base Adenine

    NASA Technical Reports Server (NTRS)

    Chaban, Galina M.; Salter, Latasha M.; Kwak, Dochan (Technical Monitor)

    2002-01-01

    Geometrical structures and energetic properties for four different tautomers of adenine are calculated in this study, using multi-configurational wave functions. Both the ground and the lowest single excited state potential energy surface are studied. The energetic order of the tautomers on the ground state potential surface is 9H less than 7H less than 3H less than 1H, while on the excited state surface this order is found to be different: 3H less than 1H less than 9H less than 7H. Minimum energy reaction paths are obtained for hydrogen atom transfer (9 yields 3 tautomerization) reactions in the ground and the lowest excited electronic state. It is found that the barrier heights and the shapes of the reaction paths are different for the ground and the excited electronic state, suggesting that the probability of such tautomerization reaction is higher on the excited state potential energy surface. The barrier for this reaction in the excited state may become very low in the presence of water or other polar solvent molecules, and therefore such tautomerization reaction may play an important role in the solution phase photochemistry of adenine.

  13. Vertical Singlet Excitations on Adenine Dimer: A Time Dependent Density Functional Study

    NASA Astrophysics Data System (ADS)

    Crespo-Hernández, Carlos E.; Marai, Christopher N. J.

    2007-12-01

    The condense phase, excited state dynamics of the adenylyl(3'→5')adenine (ApA) dinucleotide has been previously studied using transient absorption spectroscopy with femtosecond time resolution (Crespo-Hernández et al. Chem. Rev. 104, 1977-2019 (2004)). An ultrafast and a long-lived component were observed with time constants of <1 ps and 60±16 ps, respectively. Comparison of the time constants measured for the dinucleotide with that for the adenine nucleotide suggested that the fast component observed in ApA could be assigned to monomer dynamics. The long-lived component observed in ApA was assigned to an excimer state that originates from a fraction of base stacked conformations present at the time of excitation. In this contribution, supermolecule calculations using the time dependent implementation of density functional theory is used to provide more insights on the origin of the initial Franck-Condon excitations. Monomer-like, localized excitations are observed for conformations having negligible base stacking interactions, whereas delocalized excitations are predicted for conformations with significant vertical base-base overlap.

  14. Microwave-assisted stereospecific synthesis of novel tetrahydropyran adenine isonucleosides and crystal structures determination

    NASA Astrophysics Data System (ADS)

    Silva, Fábio P. L.; Cirqueira, Marilia L.; Martins, Felipe T.; Vasconcellos, Mário L. A. A.

    2013-11-01

    We describe in this article stereospecific syntheses for new isonucleosides analogs of adenine 5-7 from tosyl derivatives 2-4 accessing by microwave irradiations (50-80%). The adenine reacts entirely at the N(9) position. Compounds 2-4 were prepared in two steps from the corresponding alcohols 1, 8 and 9 (81-92%). These tetrahydropyrans alcohols 1, 8 and 9 are achiral (Meso compounds) and were prepared in two steps with complete control of 2,4,6-cis relative configuration by Prins cyclization reaction (60-63%) preceded by the Barbier reaction between allyl bromide with benzaldehyde, 4-fluorobenzaldehyde and 2-naphthaldehyde respectively under Lewis acid conditions (96-98%). The configurations and preferential conformations of 5-7 were determined by crystal structure of 6. These novel isonucleosides 5-7 present in silico potentiality to act as GPCR ligand, kinase inhibitor and enzyme inhibitor, evaluated by Molinspiration program, consistent with the expected antiviral and anticancer bioactivities.

  15. A van der Waals density functional study of adenine on graphene: Single molecular adsorption and overlayer binding

    SciTech Connect

    Berland, Kristian; Cooper, Valentino R; Langreth, David C.; Schroder, Prof. Elsebeth; Chakarova-Kack, Svetla

    2011-01-01

    The adsorption of an adenine molecule on graphene is studied using a first-principles van der Waals functional (vdW-DF) [Dion et al., Phys. Rev. Lett. 92, 246401 (2004)]. The cohesive energy of an ordered adenine overlayer is also estimated. For the adsorption of a single molecule, we determine the optimal binding configuration and adsorption energy by translating and rotating the molecule. The adsorption energy for a single molecule of adenine is found to be 711 meV, which is close to the calculated adsorption energy of the similar-sized naphthalene. Based on the single molecular binding configuration, we estimate the cohesive energy of a two-dimensional ordered overlayer. We find a significantly stronger binding energy for the ordered overlayer than for single-molecule adsorption.

  16. Absolute doubly differential cross sections for ionization of adenine by 1.0-MeV protons

    SciTech Connect

    Iriki, Y.; Kikuchi, Y.; Imai, M.; Itoh, A.

    2011-09-15

    Double-differential ionization cross sections of adenine (C{sub 5}H{sub 5}N{sub 5}) by 1.0-MeV protons have been measured using a vapor-phase adenine target. Ejected electrons were analyzed by a 45 deg. parallel-plate electrostatic spectrometer in an electron energy range from 1 to 1000 eV at electron emission angles from 15 deg. to 165 deg. The effective target thickness of adenine was determined by a Rutherford forward scattering method and a vapor deposition method. Present data are in good agreement with recent calculations. Comparisons were made with other data on various hydrocarbon molecules. It was found that the ionization cross sections of these molecules can be scaled fairly well in terms of the total number of valence electrons.

  17. N(7)-protonation-induced conformational flipping in hypermodified nucleic acid base N 6-(N-glycylcarbonyl) adenine

    NASA Astrophysics Data System (ADS)

    Tewari, Ravindra

    1995-06-01

    Protonation-induced conformational changes are studied in the hypermodified nucleic acid base N 6-(N-glycylcarbonyl) adenine, gc 6Ade, using the quantum chemical perturbative configuration interaction using localised orbitals method. Protonation at the N(7) position of adenine in gc 6Ade induces reorientation of the N 6 substituent, so as to allow stabilisation through an intramolecular hydrogen bond involving N(7)H and the carbonyl oxygen in the glycylcarbonyl substituent. The relative orientation of the carboxyl group with respect to the carbonyl group in the ureido HNCONH linkage is predicted to be similar to that in unprotonated gc 6Ade. The theoretically preferred proximal conformation of N(7)-protonated gc 6Ade restores the participation of N(6)H and N(1) in the Watson-Crick base pairing similar to that in unmodified adenine. This unique orientation can be significant for altering the reading frame in codon-anticodon interactions.

  18. Comparison of the effects of adenine-ribose with adenosine for maintenance of ATP concentrations in 5-day hypothermically perfused dog kidneys.

    PubMed

    McAnulty, J F; Southard, J H; Belzer, F O

    1988-10-01

    The quality of preservation of kidneys is dependent upon a number of factors, one of which may be the concentration of adenine nucleotides in the tissue during long-term perfusion preservation. In this study we have investigated how adenine (5 mM) and ribose (5 mM) in combination affect the concentration of adenine nucleotides in dog kidney cortical tissue after 5 days of continuous hypothermic perfusion preservation. These results were compared to kidneys perfused with adenosine and without any added purine precursors of adenine nucleotide synthesis. Additionally, we investigated how these conditions affected renal tissue slice function after 5 days of preservation and how adenine plus ribose affected renal function after autotransplantation in the dog. Adenosine is nearly completely degraded during 5 days of perfusion but there was little loss of adenine (10%). The adenosine triphosphate concentration in kidney cortical tissue was higher in adenine/ribose-perfused kidneys (1.41 +/- 0.19 mumol/g) than in adenosine-perfused kidneys (0.71 +/- 0.1 mumol/g) after 5 days of preservation. Tissue slices prepared from kidneys preserved in the presence of adenine plus ribose were metabolically more functional (slice volume control and electrolyte pump activity) than slices from adenosine-perfused kidneys. Adenine plus ribose had no detrimental effects on kidneys preserved for 3 days as tested in the autotransplant model but did not yield successful 5-day preservation. Because of some potentially detrimental factors in using adenosine as an adenine nucleotide synthesis precursor, we have now switched to the combination of adenine and ribose for perfusion preservation of kidneys both in the laboratory and in the clinic.

  19. Development of a new model for the induction of chronic kidney disease via intraperitoneal adenine administration, and the effect of treatment with gum acacia thereon

    PubMed Central

    Al Za’abi, Mohammed; Al Busaidi, Mahfouda; Yasin, Javid; Schupp, Nicole; Nemmar, Abderrahim; Ali, Badreldin H

    2015-01-01

    Oral adenine (0.75% w/w in feed), is an established model for human chronic kidney disease (CKD). Gum acacia (GA) has been shown to be a nephroprotective agent in this model. Here we aimed at developing a new adenine-induced CKD model in rats via a systemic route (intraperitoneal, i.p.) and to test it with GA to obviate the possibility of a physical interaction between GA and adenine in the gut. Adenine was injected i.p. (50 or 100 mg/Kg for four weeks), and GA was given concomitantly in drinking water at a concentration of 15%, w/v. Several plasma and urinary biomarkers of oxidative stress were measured and the renal damage was assessed histopathologically. Adenine, at the two given i.p. doses, significantly reduced body weight, and increased relative kidney weight, water intake and urine output. It dose-dependently increased plasma and urinary inflammatory and oxidative stress biomarkers, and caused morphological and histological damage resembling that which has been reported with oral adenine. Concomitant treatment with GA significantly mitigated almost all the above measured indices. Administration of adenine i.p. induced CKD signs very similar to those induced by oral adenine. Therefore, this new model is quicker, more practical and accurate than the original (oral) model. GA ameliorates the CKD effects caused by adenine given i.p. suggesting that the antioxidant and anti-inflammatory properties possessed by oral GA are the main mechanism for its salutary action in adenine-induced CKD, an action that is independent of its possible interaction with adenine in the gut. PMID:25755826

  20. Molecular mechanism of the effects of guanine nucleotide and sulfhydryl reagent on muscarinic receptors in smooth muscles studied by radiation inactivation

    SciTech Connect

    Uchida, S.; Matsumoto, K.; Takeyasu, K.; Higuchi, H.; Yoshida, H.

    1982-07-01

    The molecular sizes of the units concerned in 3-quinuclidinyl benzilate (QNB) binding and in the effects of guanine nucleotide and sulfhydryl reagent on the inhibition of QNB binding by carbachol in smooth muscle of guinea pig ileum were determined to be 76,000, 179,000 and 107,000, respectively by the radiation inactivation method. One or more subunits (GTP subunit) other than the receptor subunit in a muscarinic receptor appeared to be involved in the effect of guanine nucleotide. When guanine nucleotide was present, the receptor subunit seemed to be dissociated from the GTP subunit.

  1. Nicotinic acid adenine dinucleotide phosphate-mediated calcium signalling in effector T cells regulates autoimmunity of the central nervous system

    PubMed Central

    Cordiglieri, Chiara; Odoardi, Francesca; Zhang, Bo; Nebel, Merle; Kawakami, Naoto; Klinkert, Wolfgang E. F.; Lodygin, Dimtri; Lühder, Fred; Breunig, Esther; Schild, Detlev; Ulaganathan, Vijay Kumar; Dornmair, Klaus; Dammermann, Werner; Potter, Barry V. L.; Guse, Andreas H.

    2010-01-01

    Nicotinic acid adenine dinucleotide phosphate represents a newly identified second messenger in T cells involved in antigen receptor-mediated calcium signalling. Its function in vivo is, however, unknown due to the lack of biocompatible inhibitors. Using a recently developed inhibitor, we explored the role of nicotinic acid adenine dinucleotide phosphate in autoreactive effector T cells during experimental autoimmune encephalomyelitis, the animal model for multiple sclerosis. We provide in vitro and in vivo evidence that calcium signalling controlled by nicotinic acid adenine dinucleotide phosphate is relevant for the pathogenic potential of autoimmune effector T cells. Live two photon imaging and molecular analyses revealed that nicotinic acid adenine dinucleotide phosphate signalling regulates T cell motility and re-activation upon arrival in the nervous tissues. Treatment with the nicotinic acid adenine dinucleotide phosphate inhibitor significantly reduced both the number of stable arrests of effector T cells and their invasive capacity. The levels of pro-inflammatory cytokines interferon-gamma and interleukin-17 were strongly diminished. Consecutively, the clinical symptoms of experimental autoimmune encephalomyelitis were ameliorated. In vitro, antigen-triggered T cell proliferation and cytokine production were evenly suppressed. These inhibitory effects were reversible: after wash-out of the nicotinic acid adenine dinucleotide phosphate antagonist, the effector T cells fully regained their functions. The nicotinic acid derivative BZ194 induced this transient state of non-responsiveness specifically in post-activated effector T cells. Naïve and long-lived memory T cells, which express lower levels of the putative nicotinic acid adenine dinucleotide phosphate receptor, type 1 ryanodine receptor, were not targeted. T cell priming and recall responses in vivo were not reduced. These data indicate that the nicotinic acid adenine dinucleotide phosphate

  2. Studies on the preferred uracil-adenine base pair at the cleavage site of 10-23 DNAzyme by functional group modifications on adenine.

    PubMed

    Zhu, Junfei; Li, Zhiwen; Yang, Zhenjun; He, Junlin

    2015-08-01

    10-23 DNAzyme is capable of catalytically cleaving RNA substrates with the preferred cleavage sites rAU and rGU, in which the common base pair U-dA0 forms between the substrate and the DNAzyme in the cleavage reaction. Here its conservation was studied with base modifications on dA and extra functional groups introduced. The nitrogen atom at 7- or 8-position of adenine was demonstrated to be equally important for the cleavage reaction, although it is not related to the thermal stability of the base pair. Deletion of 6-amino group led to decreased stability of the base pair and a slight slower reaction rate. Extra functional groups through 6-amino group were not favorably accommodated in the cleavage site. From these modifications at the level of functional groups, it demonstrated that the base pair U-dA0 not only contributes to the recognition and binding stability, but also it is involved in the active catalytic center by its functional groups and base stacking. This kind of chemical modifications with 7-substituted 8-aza-7-deaza-2'-deoxyadenosine at dA0 is favorable for the introduction of signal molecules for mechanistic studies and biological applications, without significant loss of the catalytic function and structural destruction.

  3. DNA lesions derived from the site selective oxidation of Guanine by carbonate radical anions.

    PubMed

    Joffe, Avrum; Geacintov, Nicholas E; Shafirovich, Vladimir

    2003-12-01

    Carbonate radical anions are potentially important oxidants of nucleic acids in physiological environments. However, the mechanisms of action are poorly understood, and the end products of oxidation of DNA by carbonate radicals have not been characterized. These oxidation pathways were explored in this work, starting from the laser pulse-induced generation of the primary radical species to the identification of the stable oxidative modifications (lesions). The cascade of events was initiated by utilizing 308 nm XeCl excimer laser pulses to generate carbonate radical anions on submicrosecond time scales. This laser flash photolysis method involved the photodissociation of persulfate to sulfate radical anions and the one electron oxidation of bicarbonate anions by the sulfate radicals to yield the carbonate radical anions. The latter were monitored by their characteristic transient absorption band at 600 nm. The rate constants of reactions of carbonate radicals with oligonucleotides increase in the ascending order: 5'-d(CCATCCTACC) [(5.7 +/- 0.6) x 10(6) M(-)(1) s(-)(1)] < 5'-d(TATAACGTTATA), self-complementary duplex [(1.4 +/- 0.2) x 10(7) M(-)(1) s(-)(1)] < 5'-d(CCATCGCTACC [(2.4 +/- 0.3) x 10(7) M(-)(1) s(-)(1)] < 5'-d(CCATC[8-oxo-G]CTACC) [(3.2 +/- 0.4) x 10(8) M(-)(1) s(-)(1)], where 8-oxo-G is 8-oxo-7,8-dihydroguanine, the product of a two electron oxidation of guanine. This remarkable enhancement of the rate constants is correlated with the presence of either G or 8-oxo-G bases in the oligonucleotides. The rate constant for the oxidation of G in a single-stranded oligonuclotide is faster by a factor of approximately 2 than in the double-stranded form. The site selective oxidation of G and 8-oxo-G residues by carbonate radicals results in the formation of unique end products, the diastereomeric spiroiminodihydantoin (Sp) lesions, the products of a four electron oxidation of guanine. These lesions, formed in high yields (40-60%), were isolated by reversed phase

  4. Clay catalysis of oligonucleotide formation: kinetics of the reaction of the 5'-phosphorimidazolides of nucleotides with the non-basic heterocycles uracil and hypoxanthine

    NASA Technical Reports Server (NTRS)

    Kawamura, K.; Ferris, J. P.

    1999-01-01

    The montmorillonite clay catalyzed condensation of activated monocleotides to oligomers of RNA is a possible first step in the formation of the proposed RNA world. The rate constants for the condensation of the phosphorimidazolide of adenosine were measured previously and these studies have been extended to the phosphorimidazolides of inosine and uridine in the present work to determine of substitution of neutral heterocycles for the basic adenine ring changes the reaction rate or regioselectivity. The oligomerization reactions of the 5'-phosphoromidazolides of uridine (ImpU) and inosine (ImpI) on montmorillonite yield oligo(U)s and oligo(I)s as long as heptamers. The rate constants for oligonucleotide formation were determined by measuring the rates of formation of the oligomers by HPLC. Both the apparent rate constants in the reaction mixture and the rate constants on the clay surface were calculated using the partition coefficients of the oligomers between the aqueous and clay phases. The rate constants for trimer formation are much greater than those dimer synthesis but there was little difference in the rate constants for the formation of trimers and higher oligomers. The overall rates of oligomerization of the phosphorimidazolides of purine and pyrimidine nucleosides in the presence of montmorillonite clay are the same suggesting that RNA formed on the primitive Earth could have contained a variety of heterocyclic bases. The rate constants for oligomerization of pyrimidine nucleotides on the clay surface are significantly higher than those of purine nucleotides since the pyrimidine nucleotides bind less strongly to the clay than do the purine nucleotides. The differences in the binding is probably due to Van der Waals interactions between the purine bases and the clay surface. Differences in the basicity of the heterocyclic ring in the nucleotide have little effect on the oligomerization process.

  5. Highly Sensitive Bacteria Quantification Using Immunomagnetic Separation and Electrochemical Detection of Guanine-Labeled Secondary Beads

    PubMed Central

    Jayamohan, Harikrishnan; Gale, Bruce K.; Minson, Bj; Lambert, Christopher J.; Gordon, Neil; Sant, Himanshu J.

    2015-01-01

    In this paper, we report the ultra-sensitive indirect electrochemical detection of E. coli O157:H7 using antibody functionalized primary (magnetic) beads for capture and polyguanine (polyG) oligonucleotide functionalized secondary (polystyrene) beads as an electrochemical tag. Vacuum filtration in combination with E. coli O157:H7 specific antibody modified magnetic beads were used for extraction of E. coli O157:H7 from 100 mL samples. The magnetic bead conjugated E. coli O157:H7 cells were then attached to polyG functionalized secondary beads to form a sandwich complex (magnetic bead/E. coli/ secondary bead). While the use of magnetic beads for immuno-based capture is well characterized, the use of oligonucleotide functionalized secondary beads helps combine amplification and potential multiplexing into the system. The antibody functionalized secondary beads can be easily modified with a different antibody to detect other pathogens from the same sample and enable potential multiplexing. The polyGs on the secondary beads enable signal amplification up to 108 guanine tags per secondary bead (7.5 × 106 biotin-FITC per secondary bead, 20 guanines per oligonucleotide) bound to the target (E. coli). A single-stranded DNA probe functionalized reduced graphene oxide modified glassy carbon electrode was used to bind the polyGs on the secondary beads. Fluorescent imaging was performed to confirm the hybridization of the complex to the electrode surface. Differential pulse voltammetry (DPV) was used to quantify the amount of polyG involved in the hybridization event with tris(2,2′-bipyridine)ruthenium(II) ( Ru(bpy)32+) as the mediator. The amount of polyG signal can be correlated to the amount of E. coli O157:H7 in the sample. The method was able to detect concentrations of E. coli O157:H7 down to 3 CFU/100 mL, which is 67 times lower than the most sensitive technique reported in literature. The signal to noise ratio for this work was 3. We also demonstrate the use of the

  6. Chronic kidney disease induced by adenine: a suitable model of growth retardation in uremia.

    PubMed

    Claramunt, Débora; Gil-Peña, Helena; Fuente, Rocío; García-López, Enrique; Loredo, Vanessa; Hernández-Frías, Olaya; Ordoñez, Flor A; Rodríguez-Suárez, Julián; Santos, Fernando

    2015-07-01

    Growth retardation is a major manifestation of chronic kidney disease (CKD) in pediatric patients. The involvement of the various pathogenic factors is difficult to evaluate in clinical studies. Here, we present an experimental model of adenine-induced CKD for the study of growth failure. Three groups (n = 10) of weaning female rats were studied: normal diet (control), 0.5% adenine diet (AD), and normal diet pair fed with AD (PF). After 21 days, serum urea nitrogen, creatinine, parathyroid hormone (PTH), weight and length gains, femur osseous front advance as an index of longitudinal growth rate, growth plate histomorphometry, chondrocyte proliferative activity, bone structure, aorta calcifications, and kidney histology were analyzed. Results are means ± SE. AD rats developed renal failure (serum urea nitrogen: 70 ± 6 mg/dl and creatinine: 0.6 ± 0.1 mg/dl) and secondary hyperparathyroidism (PTH: 480 ± 31 pg/ml). Growth retardation of AD rats was demonstrated by lower weight (AD rats: 63.3 ± 4.8 g, control rats: 112.6 ± 4.7 g, and PF rats: 60.0 ± 3.8 g) and length (AD rats: 7.2 ± 0.2 cm, control rats: 11.1 ± 0.3 cm, and PF rats: 8.1 ± 0.3 cm) gains as well as lower osseous front advances (AD rats: 141 ± 13 μm/day, control rats: 293 ± 16 μm/day, and PF rats: 251 ± 10 μm/day). The processes of chondrocyte maturation and proliferation were impaired in AD rats, as shown by lower growth plate terminal chondrocyte height (21.7 ± 2.3 vs. 26.2 ± 1.9 and 23.9 ± 1.3 μm in control and PF rats) and proliferative activity index (AD rats: 30 ± 2%, control rats: 38 ± 2%, and PF rats: 42 ± 3%). The bone primary spongiosa structure of AD rats was markedly disorganized. In conclusion, adenine-induced CKD in young rats is associated with growth retardation and disturbed endochondral ossification. This animal protocol may be a useful new experimental model to study growth in CKD.

  7. Modeling the high-energy electronic state manifold of adenine: Calibration for nonlinear electronic spectroscopy

    SciTech Connect

    Nenov, Artur Giussani, Angelo; Segarra-Martí, Javier; Jaiswal, Vishal K.; Rivalta, Ivan; Cerullo, Giulio; Mukamel, Shaul; Garavelli, Marco E-mail: marco.garavelli@ens-lyon.fr

    2015-06-07

    Pump-probe electronic spectroscopy using femtosecond laser pulses has evolved into a standard tool for tracking ultrafast excited state dynamics. Its two-dimensional (2D) counterpart is becoming an increasingly available and promising technique for resolving many of the limitations of pump-probe caused by spectral congestion. The ability to simulate pump-probe and 2D spectra from ab initio computations would allow one to link mechanistic observables like molecular motions and the making/breaking of chemical bonds to experimental observables like excited state lifetimes and quantum yields. From a theoretical standpoint, the characterization of the electronic transitions in the visible (Vis)/ultraviolet (UV), which are excited via the interaction of a molecular system with the incoming pump/probe pulses, translates into the determination of a computationally challenging number of excited states (going over 100) even for small/medium sized systems. A protocol is therefore required to evaluate the fluctuations of spectral properties like transition energies and dipole moments as a function of the computational parameters and to estimate the effect of these fluctuations on the transient spectral appearance. In the present contribution such a protocol is presented within the framework of complete and restricted active space self-consistent field theory and its second-order perturbation theory extensions. The electronic excited states of adenine have been carefully characterized through a previously presented computational recipe [Nenov et al., Comput. Theor. Chem. 1040–1041, 295-303 (2014)]. A wise reduction of the level of theory has then been performed in order to obtain a computationally less demanding approach that is still able to reproduce the characteristic features of the reference data. Foreseeing the potentiality of 2D electronic spectroscopy to track polynucleotide ground and excited state dynamics, and in particular its expected ability to provide

  8. A distinct sequence in the adenine nucleotide translocase from Artemia franciscana embryos is associated with insensitivity to bongkrekate and atypical effects of adenine nucleotides on Ca2+ uptake and sequestration.

    PubMed

    Konràd, Csaba; Kiss, Gergely; Töröcsik, Beata; Lábár, János L; Gerencser, Akos A; Mándi, Miklós; Adam-Vizi, Vera; Chinopoulos, Christos

    2011-03-01

    Mitochondria isolated from embryos of the crustacean Artemia franciscana lack the Ca(2+)-induced permeability transition pore. Although the composition of the pore described in mammalian mitochondria is unknown, the impacts of several effectors of the adenine nucleotide translocase (ANT) on pore opening are firmly established. Notably, ADP, ATP and bongkrekate delay, whereas carboxyatractyloside hastens, Ca(2+)-induced pore opening. Here, we report that adenine nucleotides decreased, whereas carboxyatractyloside increased, Ca(2+) uptake capacity in mitochondria isolated from Artemia embryos. Bongkrekate had no effect on either Ca(2+) uptake or ADP-ATP exchange rate. Transmission electron microscopy imaging of Ca(2+)-loaded Artemia mitochondria showed needle-like formations of electron-dense material in the absence of adenine nucleotides, and dot-like formations in the presence of adenine nucleotides or Mg(2+). Energy-filtered transmission electron microscopy showed the material to be rich in calcium and phosphorus. Sequencing of the Artemia mRNA coding for ANT revealed that it transcribes a protein with a stretch of amino acids in the 198-225 region with 48-56% similarity to those from other species, including the deletion of three amino acids in positions 211, 212 and 219. Mitochondria isolated from the liver of Xenopus laevis, in which the ANT shows similarity to that in Artemia except for the 198-225 amino acid region, demonstrated a Ca(2+)-induced bongkrekate-sensitive permeability transition pore, allowing the suggestion that this region of ANT may contain the binding site for bongkrekate.

  9. Oxidation of guanine by carbonate radicals derived from photolysis of carbonatotetramminecobalt(III) complexes and the pH dependence of intrastrand DNA cross-links mediated by guanine radical reactions.

    PubMed

    Crean, Conor; Lee, Young Ae; Yun, Byeong Hwa; Geacintov, Nicholas E; Shafirovich, Vladimir

    2008-08-11

    The carbonate radical anion CO(3)(*-) is a decomposition product of nitrosoperoxycarbonate derived from the combination of carbon dioxide and peroxynitrite, an important biological byproduct of the inflammatory response. The selective oxidation of guanine in DNA by CO(3)(*-) radicals is known to yield spiroiminodihydantoin (Sp) and guanidinohydantoin (Gh) products, and also a novel intrastrand cross-linked product: 5'-d(CCATCG*CT*ACC), featuring a linkage between guanine C8 (G*) and thymine N3 (T*) atoms in the oligonucleotide (Crean et al., Nucleic Acids Res. 2008, 36, 742-755). Involvement of the T-N3 (pK(a) of N3-H is 9.67) suggests that the formation of 5'-d(CCATCG*CT*ACC) might be pH-dependent. This hypothesis was tested by generating CO(3)(*-) radicals through the photodissociation of carbonatotetramminecobalt(III) complexes by steady-state UV irradiation, which allowed for studies of product yields in the pH 5.0-10.0 range. The yield of 5'-d(CCATCG*CT*ACC) at pH 10.0 is approximately 45 times greater than at pH 5.0; this is consistent with the proposed mechanism, which requires N3(H) thymine proton dissociation followed by nucleophilic addition to the C8 guanine radical.

  10. Direct demonstration of guanine nucleotide sensitive receptors for vasoactive intestinal peptide in the anterior lobe of the rat pituitary gland

    SciTech Connect

    Agui, T.; Matsumoto, K. )

    1990-05-01

    The vasoactive intestinal peptide (VIP) receptors were identified on the membranes from the rat anterior pituitary gland with ({sup 125}I)VIP. The dissociation constant (Kd) and the maximal binding capacity (Bmax) values were estimated from the competitive inhibition data. The Kd and Bmax values were 1.05 +/- 0.75 nM and 103 +/- 11 fmol/mg protein, respectively. The order of molar potency of related peptides to inhibit ({sup 125}I)VIP binding was VIP greater than peptide histidine isoleucine (PHI) greater than secretin greater than glucagon. Glucagon was not effective to inhibit the binding. ({sup 125}I)VIP binding was effectively inhibited by the addition of guanine nucleotides. The order of molar potency to inhibit the binding was Gpp(NH)p greater than GTP greater than GDP greater than GMP greater than ATP. These results directly suggest the coupling of VIP receptors with guanine nucleotide binding proteins in the anterior pituitary gland.

  11. Automated quantum chemistry based molecular dynamics simulations of electron ionization induced fragmentations of the nucleobases Uracil, Thymine, Cytosine, and Guanine.

    PubMed

    Grimme, Stefan; Bauer, Christopher Alexander

    2015-01-01

    The gas-phase decomposition pathways of electron ionization (EI)-induced radical cations of the nucleobases uracil, thymine, cytosine, and guanine are investigated by means of mixed quantum-classical molecular dynamics. No preconceived fragmentation channels are used in the calculations. The results compare well to a plethora of experimental and theoretical data for these important biomolecules. With our combined stochastic and dynamic approach, one can access in an unbiased way the energetically available decomposition mechanisms. Additionally, we are able to separate the EI mass spectra of different tautomers of cytosine and guanine. Our method (previously termed quantum chemistry electron ionization mass spectra) reproduces free nucleobase experimental mass spectra well and provides detailed mechanistic in-sight into high-energy unimolecular decomposition processes.

  12. Ruthenation of Non‐stacked Guanines in DNA G‐Quadruplex Structures: Enhancement of c‐MYC Expression

    PubMed Central

    Rodríguez, Jéssica; Mosquera, Jesús; Couceiro, José R.

    2016-01-01

    Abstract Guanine quadruplexes (GQs) are compact four‐stranded DNA structures that play a key role in the control of a variety of biological processes, including gene transcription. Bulky ruthenium complexes featuring a bipyridine, a terpyridine, and one exchangeable ligand ([Ru(terpy)(bpy)X]n+) are able to metalate exposed guanines present in the GQ of the c‐MYC promoter region that are not involved in quadruplex base pairing. qRT‐PCR and western‐blot experiments indicated that the complexes promote a remarkable increase in the expression of this oncogene. We also show that exchangeable thioether ligands (X=RSR′, Met) allow regulation of the metalating activity of the complex with visible light. PMID:27860057

  13. A Cu(II) complex of an imidazolium-based ionic liquid: synthesis, X-ray structure and application in the selective electrochemical sensing of guanine.

    PubMed

    Singh, Amanpreet; Singh, Ajnesh; Singh, Narinder

    2014-11-21

    An imidazolium-based ionic liquid containing a carboxylic acid group was synthesized and complexed with Cu(II). The resulting complex R1 was fully characterized using various techniques, including IR spectroscopy and X-ray crystallography. Binding studies of the complex R1 were performed with anions and biomolecules using cyclic voltammetry, which showed no change in its voltammogram upon the addition of various anions and most biomolecules. However, a shift in the reduction peak from +0.20 to -0.15 was observed upon the addition of guanine. This selective determination of guanine by R1 was extended by using R1 as an electrochemical sensor for guanine in various voltammetric techniques, including cyclic voltammetry, LSV and DPV. The proposed sensor showed excellent reproducibility and high selectivity and sensitivity towards guanine, with a linear range of 0-20 μM and a detection limit of 45 nM.

  14. Cap analog substrates reveal three clades of cap guanine-N2 methyltransferases with distinct methyl acceptor specificities.

    PubMed

    Benarroch, Delphine; Jankowska-Anyszka, Marzena; Stepinski, Janusz; Darzynkiewicz, Edward; Shuman, Stewart

    2010-01-01

    The Tgs proteins are structurally homologous AdoMet-dependent eukaryal enzymes that methylate the N2 atom of 7-methyl guanosine nucleotides. They have an imputed role in the synthesis of the 2,2,7-trimethylguanosine (TMG) RNA cap. Here we exploit a collection of cap-like substrates to probe the repertoire of three exemplary Tgs enzymes, from mammalian, protozoan, and viral sources, respectively. We find that human Tgs (hTgs1) is a bona fide TMG synthase adept at two separable transmethylation steps: (1) conversion of m(7)G to m(2,7)G, and (2) conversion of m(2,7)G to m(2,2,7)G. hTgs1 is unable to methylate G or m(2)G, signifying that both steps require an m(7)G cap. hTgs1 utilizes a broad range of m(7)G nucleotides, including mono-, di-, tri-, and tetraphosphate derivatives as well as cap dinucleotides with triphosphate or tetraphosphate bridges. In contrast, Giardia lamblia Tgs (GlaTgs2) exemplifies a different clade of guanine-N2 methyltransferase that synthesizes only a dimethylguanosine (DMG) cap structure and cannot per se convert DMG to TMG under any conditions tested. Methylation of benzyl(7)G and ethyl(7)G nucleotides by hTgs1 and GlaTgs2 underscored the importance of guanine N7 alkylation in providing a key pi-cation interaction in the methyl acceptor site. Mimivirus Tgs (MimiTgs) shares with the Giardia homolog the ability to catalyze only a single round of methyl addition at guanine-N2, but is distinguished by its capacity for guanine-N2 methylation in the absence of prior N7 methylation. The relaxed cap specificity of MimiTgs is revealed at alkaline pH. Our findings highlight both stark and subtle differences in acceptor specificity and reaction outcomes among Tgs family members.

  15. Guanine Deaminase Functions as Dihydropterin Deaminase in the Biosynthesis of Aurodrosopterin, a Minor Red Eye Pigment of Drosophila*

    PubMed Central

    Kim, Jaekwang; Park, Sang Ick; Ahn, Chiyoung; Kim, Heuijong; Yim, Jeongbin

    2009-01-01

    Dihydropterin deaminase, which catalyzes the conversion of 7,8-dihydropterin to 7,8-dihydrolumazine, was purified 5850-fold to apparent homogeneity from Drosophila melanogaster. Its molecular mass was estimated to be 48 kDa by gel filtration and SDS-PAGE, indicating that it is a monomer under native conditions. The pI value, temperature, and optimal pH of the enzyme were 5.5, 40 °C, and 7.5, respectively. Interestingly the enzyme had much higher activity for guanine than for 7,8-dihydropterin. The specificity constant (kcat/Km) for guanine (8.6 × 106 m−1·s−1) was 860-fold higher than that for 7,8-dihydropterin (1.0 × 104 m−1·s−1). The structural gene of the enzyme was identified by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry analysis as CG18143, located at region 82A1 on chromosome 3R. The cloned and expressed CG18143 exhibited both 7,8-dihydropterin and guanine deaminase activities. Flies with mutations in CG18143, SUPor-P/Df(3R)A321R1 transheterozygotes, had severely decreased activities in both deaminases compared with the wild type. Among several red eye pigments, the level of aurodrosopterin was specifically decreased in the mutant, and the amount of xanthine and uric acid also decreased considerably to 76 and 59% of the amounts in the wild type, respectively. In conclusion, dihydropterin deaminase encoded by CG18143 plays a role in the biosynthesis of aurodrosopterin by providing one of its precursors, 7,8-dihydrolumazine, from 7,8-dihydropterin. Dihydropterin deaminase also functions as guanine deaminase, an important enzyme for purine metabolism. PMID:19567870

  16. Structure of radicals from X-irradiated guanine derivatives: an experimental and computational study of sodium guanosine dihydrate single crystals.

    PubMed

    Jayatilaka, Nayana; Nelson, William H

    2007-02-01

    In sodium guanosine dihydrate single crystals, the guanine moiety is deprotonated at N1 due to growth from high-pH (>12) solutions. Electron paramagnetic resonance (EPR) and electron-nuclear double resonance (ENDOR) studies of crystals X-irradiated at 10 K detected evidence for three radical forms. Radical R1, characterized by two proton and two nitrogen hyperfine interactions, was identified as the product of net hydrogenation at N7 of the N1-deprotonated guanine unit. R1 exhibited an unusually distorted structure leading to net positive isotropic components of the hydrogen alpha-couplings. Radical R2, characterized by one proton and one nitrogen hyperfine coupling, was identified as the primary electron-loss product. This product is equivalent to that of deprotonation at N1 by the guanine cation and represents the first ENDOR characterization of that product. Radical R3, characterized by a single hydrogen hyperfine coupling, was identified as the product of net dehydrogenation at C1' of the ribose moiety. The identification of radicals R1-R3 was supported by density functional theory (DFT) calculations on several possible structures using the B3LYP/6-311G(2df,p)//6-31G(d,p) approach. Radical R4, detected after warming the crystals to room temperature, was identified as the well-known product of net hydrogenation of C8 of the (N1-deprotonated) guanine component. Radical R1, evidently formed by protonation of the primary electron addition product, was present as roughly 60% of the total radicals detected at 10 K. Radical R2 was present as roughly 27% of the total yield, and the concentration of R3 contributed the remaining 13%. R3 is evidently the product of one-electron oxidation followed by deprotonation; thus, the balance of oxidation and reduction products is approximately equal within experimental uncertainty.

  17. Computational prediction of one-electron reduction potentials and acid dissociation constants for guanine oxidation intermediates and products.

    PubMed

    Psciuk, Brian T; Schlegel, H Bernhard

    2013-08-15

    Reduction potentials and pK(a) values were calculated for intermediates and products along three major pathways for guanine oxidation using the B3LYP and CBS-QB3 levels of theory with the SMD implicit solvation model. N-methylated nucleobases were used as models for nucleoside species. Ensemble averaged reduction potentials at pH 7 (E7) were obtained by combining calculated standard reduction potentials with calculated pKa values in addition to accounting for tautomerization energies. Calculated pK(a) values are reasonable based on experimental estimates and chemical intuition. Pathway A leads to guanidinohydantoin (Gh) and spiroiminodihydantoin (Sp). The first step is the oxidation of 8-oxoguanine which proceeds by the loss of an electron followed by the loss of two protons and loss of another electron, yielding 8-oxopurine. The calculated E7 values for the remaining intermediates and products are at least 0.3 V higher than that of guanine, indicating that further oxidation of these species is unlikely. Pathway B leads to two formamidopyrimidine isomers (FAPyG and 2,5FAPyG). Species along this pathway have calculated reduction potentials that are much lower than the oxidation potential for guanine and would likely be very short-lived in an oxidatively stressed environment. Pathway C leads to reduced spiroiminodihydantoin and 5-carboxamido-5-formamido-2-iminohydantoin (2Ih). Similar to pathway A, the calculated reduction potentials for species along this pathway are at least 0.4 V higher than that of guanine.

  18. Rational design of hetero-ring-expanded guanine analogs with enhanced properties for modified DNA building blocks.

    PubMed

    Zhang, Jinmei; Cukier, Robert I; Bu, Yuxiang

    2007-07-19

    The properties and modes of recognition of physiological DNAs associated with the four natural nucleobases might be extended, in principle, by the design of non-natural nucleobase derivatives. The goal is an expansion of the genetic alphabet, with the possible outcome of producing new DNAs with improved physical or biological properties. In this work, a new series of hetero-ring-expanded guanine analogs are proposed, and their relevant structural characteristics and electronic properties are determined by density functional theory. The stabilities of the decamer DNA duplexes (dn.dC)10 (where n represents the corresponding expanded guanine analog designed here) are also examined, using molecular dynamics. The simulations show that the designed motifs can form stable DNA-like structures. We determined the pairing energies for the Watson-Crick (WC) hydrogen-bonded dimers between the expanded G-analogs and the natural C, and found that the pairing energies are close to those of the natural GC pair. The calculated adiabatic ionization potentials (IPs) of the size-expanded guanine analogs and their base pairs, and the corresponding vertical ionization potentials, show that some are distinctly smaller than the corresponding natural versions. The HOMO-LUMO energy gaps for most of the size-expanded guanine analogs and their WC base pairs are considerably lower than those of the corresponding natural base and base pairs. Thus, the expanded G bases may be considered as DNA genetic motifs, and they may serve as building blocks for potential biological applications and the development of molecular electronic devices.

  19. Bacterial degradation of styrene involving a novel flavin adenine dinucleotide-dependent styrene monooxygenase.

    PubMed Central

    Hartmans, S; van der Werf, M J; de Bont, J A

    1990-01-01

    By using styrene as the sole source of carbon and energy in concentrations of 10 to 500 microM, 14 strains of aerobic bacteria and two strains of fungi were isolated from various soil and water samples. In cell extracts of 11 of the bacterial isolates, a novel flavin adenine dinucleotide-requiring styrene monooxygenase activity that oxidized styrene to styrene oxide (phenyl oxirane) was detected. In one bacterial strain (S5), styrene metabolism was studied in more detail. In addition to styrene monooxygenase, cell extracts from strain S5 contained styrene oxide isomerase and phenylacetaldehyde dehydrogenase activities. A pathway for styrene degradation via styrene oxide and phenylacetaldehyde to phenylacetic acid is proposed. PMID:2339888

  20. 8-(2-Furyl)adenine derivatives as A₂A adenosine receptor ligands.

    PubMed

    Dal Ben, Diego; Buccioni, Michela; Lambertucci, Catia; Thomas, Ajiroghene; Klotz, Karl-Norbert; Federico, Stephanie; Cacciari, Barbara; Spalluto, Giampiero; Volpini, Rosaria

    2013-01-01

    Selective adenosine receptor modulators are potential tools for numerous therapeutic applications, including cardiovascular, inflammatory, and neurodegenerative diseases. In this work, the synthesis and biological evaluation at the four human adenosine receptor subtypes of a series of 9-substituted 8-(2-furyl)adenine derivatives are reported. Results show that 8-(2-furyl)-9-methyladenine is endowed with high affinity at the A₂A subtype. Further modification of this compound with introduction of arylacetyl or arylcarbamoyl groups in N(6)-position takes to different effects on the A₂A affinity and in particular on the selectivity versus the other three adenosine receptor subtypes. A molecular modelling analysis at three different A₂A receptor crystal structures provides an interpretation of the obtained biological results.

  1. External electric field promotes proton transfer in the radical cation of adenine-thymine

    NASA Astrophysics Data System (ADS)

    Zhang, Guiqing; Xie, Shijie

    2016-07-01

    According to pKa measurements, it has been predicted that proton transfer would not occur in the radical cation of adenine-thymine (A:T). However, recent theoretical calculations indicate that proton transfer takes place in the base pair in water below the room temperature. We have performed simulations of proton transfer in the cation of B-DNA stack composed of 10 A:T base pairs in water from 20 K to 300 K. Proton transfer occurs below the room temperature, meanwhile it could also be observed at the room temperature under the external electric field. Another case that interests us is that proton transfer bounces back after ˜300 fs from the appearance of proton transfer at low temperatures.

  2. Isotope effect studies of the chemical mechanism of nicotinamide adenine dinucleotide malic enzyme from Crassula

    SciTech Connect

    Grissom, C.B.; Willeford, O.; Wedding, R.T.

    1987-05-05

    The /sup 13/C primary kinetic isotope effect on the decarboxylation of malate by nicotinamide adenine dinucleotide malic enzyme from Crassula argentea is 1.0199 +/- 0.0006 with proteo L-malate-2-H and 1.0162 +/- 0.0003 with malate-2-d. The primary deuterium isotope effect is 1.45 +/- 0.10 on V/K and 1.93 +/- 0.13 on V/sub max/. This indicates a stepwise conversion of malate to pyruvate and CO/sub 2/ with hydride transfer preceding decarboxylation, thereby suggesting a discrete oxaloacetate intermediate. This is in agreement with the stepwise nature of the chemical mechanism of other malic enzymes despite the Crassula enzyme's inability to reduce or decarboxylate oxaloacetate. Differences in morphology and allosteric regulation between enzymes suggest specialization of the Crassula malic enzyme for the physiology of crassulacean and acid metabolism while maintaining the catalytic events founds in malic enzymes from animal sources.

  3. Thyroid hormone action: identification of the mitochondrial thyroid hormone receptor as adenine nucleotide translocase.

    PubMed

    Sterling, K

    1991-01-01

    A preliminary report from our laboratory suggested that the thyroid hormone triiodothyronine (T3) is bound with an association constant (Ka) approximating 2 x 10(11) M-1 by adenine nucleotide translocase (AdNT) purified from beef heart mitochondria. We now report that [125I]T3 is capable of photoaffinity labeling not only purified AdNT but also the carrier in intact beef heart mitochondria. Photoaffinity labeling in intact mitochondria was appreciably greater than that observed with purified AdNT. The covalently labeled AdNT was identified by 2-dimensional electrophoresis with pI of 10 on electrofocusing and M(r) of 31,000 on SDS gel. Identification of the covalently labeled protein as authentic AdNT was substantiated by its interaction with a specific monoclonal antibody preparation.

  4. In vitro selection of adenine-dependent ribozyme against Tpl2/Cot oncogene.

    PubMed

    Li, Yan-Li; Vergne, Jacques; Torchet, Claire; Maurel, Marie-Christine

    2009-01-01

    Hairpin ribozymes possess the properties of RNA sequence-specific recognition and site-specific cleavage. These properties make them a powerful extension of the antisense approach for the inhibition of gene expression. From a randomized RNA pool of hairpin ribozymes, using the systematic evolution of ligands by exponential enrichment, we have obtained an adenine-dependent hairpin ribozyme, Tpl2/Cot (tumour progression locus 2) ribozyme, which cleaves the Tpl2/Cot kinase mRNA sequence at nucleotides A225/G226 relative to the start codon of translation. This serine/threonine kinase activates the mitogen-activated protein kinase pathway implicated in cell proliferation in cancer. The selected 'Tpl2/Cot-YL ribozyme' efficiently cleaves its target sequence in cis and in trans; furthermore, the ribozyme efficiently cleaves a longer target sequence of 54 nucleotides in trans, as well as the full-length mRNA.

  5. Animal models of pediatric chronic kidney disease. Is adenine intake an appropriate model?

    PubMed

    Claramunt, Débora; Gil-Peña, Helena; Fuente, Rocío; Hernández-Frías, Olaya; Santos, Fernando

    2015-01-01

    Pediatric chronic kidney disease (CKD) has peculiar features. In particular, growth impairment is a major clinical manifestation of CKD that debuts in pediatric age because it presents in a large proportion of infants and children with CKD and has a profound impact on the self-esteem and social integration of the stunted patients. Several factors associated with CKD may lead to growth retardation by interfering with the normal physiology of growth plate, the organ where longitudinal growth rate takes place. The study of growth plate is hardly possible in humans and justifies the use of animal models. Young rats made uremic by 5/6 nephrectomy have been widely used as a model to investigate growth retardation in CKD. This article examines the characteristics of this model and analyzes the utilization of CKD induced by high adenine diet as an alternative research protocol.

  6. Theoretical investigation of hydrogen transfer mechanism in the adenine thymine base pair

    NASA Astrophysics Data System (ADS)

    Villani, Giovanni

    2005-09-01

    We have studied the quantum dynamics of the hydrogen bonds in the adenine-thymine base pair. Due to the position of hydrogen atoms, different tautomers are possible: the stable Watson-Crick A-T, the imino-enol A*-T* and the zwitterionic (the form with charge separation) A +-T - and A --T + structures. The common idea in the literature is that only A-T exists either because the difference of energy among this tautomer and the others is large or because the other structures are transformed quickly in A-T. Here, we show a detailed theoretical study that suggests the following conclusion: A-T is the stablest tautomer, a partially charged system is important and a small amount of the imino-enol A*-T* tautomer is present at any time. The mechanism of passage from A-T tautomer to the others has also been investigated.

  7. Metal-adeninate vertices for the construction of an exceptionally porous metal-organic framework.

    PubMed

    An, Jihyun; Farha, Omar K; Hupp, Joseph T; Pohl, Ehmke; Yeh, Joanne I; Rosi, Nathaniel L

    2012-01-03

    Metal-organic frameworks comprising metal-carboxylate cluster vertices and long, branched organic linkers are the most porous materials known, and therefore have attracted tremendous attention for many applications, including gas storage, separations, catalysis and drug delivery. To increase metal-organic framework porosity, the size and complexity of linkers has increased. Here we present a promising alternative strategy for constructing mesoporous metal-organic frameworks that addresses the size of the vertex rather than the length of the organic linker. This approach uses large metal-biomolecule clusters, in particular zinc-adeninate building units, as vertices to construct bio-MOF-100, an exclusively mesoporous metal-organic framework. Bio-MOF-100 exhibits a high surface area (4,300 m(2) g(-1)), one of the lowest crystal densities (0.302 g cm(-3)) and the largest metal-organic framework pore volume reported to date (4.3 cm(3) g(-1)).

  8. Inhibitory and Restorative Effects of Adenine Nucleotides on Rickettsial Adsorption and Hemolysis

    PubMed Central

    Winkler, Herbert H.

    1974-01-01

    The adenine nucleotides, adenosine diphosphate, adenosine triphosphate, (ATP), and the methylene-bridge analogues are inhibitors of rickettsial adsorption to and the hemolysis of sheep erythrocytes. Other nucleotides, adenosine monophosphate, cyclic adenosine monophosphate, cytosine triphosphate, and guanosine triphosphate, are without effect. Adsorption and hemolysis require the generation of energy by the rickettsiae which is usually derived from glutamate. When the generation of energy from the metabolism of glutamate is inhibited by arsenite or cyanide, the addition of ATP can supply the energy to restore hemolysis. However, in the presence of the uncouplers, ATP can not restore hemolysis. Even when functioning in a restorative role, ATP still has its inhibitory properties. These results suggest that a high-energy intermediate (X ∼ I), rather than ATP itself, is the energy source. The interactions of inhibitory nucleotides suggest that these compounds share a common transport system. PMID:4357933

  9. Vacuum-ultraviolet circular dichroism reveals DNA duplex formation between short strands of adenine and thymine.

    PubMed

    Nielsen, Lisbeth Munksgaard; Hoffmann, Søren Vrønning; Brøndsted Nielsen, Steen

    2012-11-21

    Absorbance spectroscopy is used extensively to tell when two DNA single strands come together and form a double strand. Here we show that circular dichroism in the vacuum ultraviolet region provides an even stronger indication for duplex formation in the case of short strands of adenine and thymine (4 to 16 bases in each strand). Indeed, our results show that a strong positive CD band appears at 179 nm when double strands are formed. Melting experiments were done in aqueous solution with and without added Na(+) counter ions. With additional salt present a huge increase in the 179 nm CD band was observed when lowering the temperature. A 179 nm CD marker band for duplex formation can be used to measure the kinetics for the association of two single strands. Such experiments rely on large changes at one particular wavelength since it is too time-consuming to record a full-wavelength spectrum.

  10. Intriguing radical-radical interactions among double-electron oxidized adenine-thymine base pairs

    NASA Astrophysics Data System (ADS)

    Wang, Mei; Zhao, Jing; Zhang, Laibin; Su, Xiyu; Su, Hanlei; Bu, Yuxiang

    2015-01-01

    We present a theoretical investigation of the structural and electronic properties of double-electron oxidized adenine-thymine base pair as well as its deprotonated Watson-Crick derivatives. Double-electron oxidation can destabilize the AT unit, leading to a barrier-hindered metastable A+T+ state with a dissociation channel featuring negative dissociation energy. This unusual energetic phenomenon originates from the competition of electrostatic repulsion and attractively hydrogen-bonding interaction co-existing between Arad + and Trad +. The associated double-proton-transfer process is also explored, suggesting a possible two-step mechanism. Magnetic coupling interactions of various diradical structures are controlled by both intra- and inter-molecular interactions.

  11. Conducting polymer and its composite materials based electrochemical sensor for Nicotinamide Adenine Dinucleotide (NADH).

    PubMed

    Omar, Fatin Saiha; Duraisamy, Navaneethan; Ramesh, K; Ramesh, S

    2016-05-15

    Nicotinamide Adenine Dinucleotide (NADH) is an important coenzyme in the human body that participates in many metabolic reactions. The impact of abnormal concentrations of NADH significantly causes different diseases in human body. Electrochemical detection of NADH using bare electrode is a challenging task especially in the presence of main electroactive interferences such as ascorbic acid (AA), uric acid (UA) and dopamine (DA). Modified electrodes have been widely explored to overcome the problems of poor sensitivity and selectivity occurred from bare electrodes. This review gives an overview on the progress of using conducting polymers, polyelectrolyte and its composites (co-polymer, carbonaceous, metal, metal oxide and clay) based modified electrodes for the sensing of NADH. In addition, developments on the fabrication of numerous conducting polymer composites based modified electrodes are clearly described.

  12. Surface-enhanced Raman spectroscopy (SERS) for identifying traces of adenine in different mineral and rock samples

    NASA Astrophysics Data System (ADS)

    Lafuente, B.; Navarro, R.; Sansano, A.; Rull, F.

    2012-09-01

    The aim of this study is to analyze the potentials of SERS as a technique for in-situ identification of life traces in Mars surface explorations using the Raman instrument (RLS), payload of the ESA Mars mission Exomars. This preliminary study focused on detection of adenine on a variety of rocks soils samples using macro-SERS detection.

  13. 3-Methyl-2-butenal: an enzymatic degradation product of the cytokinin, N-6-(delta-2 isopentenyl)adenine.

    PubMed

    Brownlee, B G; Hall, R H; Whitty, C D

    1975-01-01

    An enzyme preparation from immature corn kernels catalyzed cleavage of N-6-(delta-2-isopentenyl)adenine to give the aldehyde, 3-methyl-2-butenal, as the major side-chain derived product. This product, in the form of the semicarbazone, was identical with an authentic product by several criteria: chromatographic behavior, mass and ultraviolet spectra.

  14. The effects of tautomerization and protonation on the adenine-cytosine mismatches: a density functional theory study.

    PubMed

    Masoodi, Hamid Reza; Bagheri, Sotoodeh; Abareghi, Mahsa

    2016-06-01

    In the present work, we demonstrate the results of a theoretical study concerned with the question how tautomerization and protonation of adenine affect the various properties of adenine-cytosine mismatches. The calculations, in gas phase and in water, are performed at B3LYP/6-311++G(d,p) level. In gas phase, it is observed that any tautomeric form of investigated mismatches is more stabilized when adenine is protonated. As for the neutral mismatches, the mismatches containing amino form of cytosine and imino form of protonated adenine are more stable. The role of aromaticity on the stability of tautomeric forms of mismatches is investigated by NICS(1)ZZ index. The stability of mispairs decreases by going from gas phase to water. It can be explained using dipole moment parameter. The influence of hydrogen bonds on the stability of mismatches is examined by atoms in molecules and natural bond orbital analyses. In addition to geometrical parameters and binding energies, the study of the topological properties of electron charge density aids in better understanding of these mispairs.

  15. Influence of gamma subunit prenylation on association of guanine nucleotide-binding regulatory proteins with membranes.

    PubMed Central

    Muntz, K H; Sternweis, P C; Gilman, A G; Mumby, S M

    1992-01-01

    Two approaches were taken to address the possible role of gamma-subunit prenylation in dictating the cellular distribution of guanine nucleotide-binding regulatory proteins. Prenylation of gamma subunits was prevented by site-directed mutagenesis or by inhibiting the synthesis of mevalonate, the precursor of cellular isoprenoids. When beta or gamma subunits were transiently expressed in COS-M6 simian kidney cells (COS) cells, the proteins were found in the membrane fraction by immunoblotting. Immunofluorescence experiments indicated that the proteins were distributed to intracellular structures in addition to plasma membranes. Replacement of Cys68 of gamma with Ser prevented prenylation of the mutant protein and association of the protein with the membrane fraction of COS cells. Immunoblotting results demonstrated that some of the beta subunits were found in the cytoplasm when coexpressed with the nonprenylated mutant gamma subunit. When Neuro 2A cells were treated with compactin to inhibit protein prenylation, a fraction of endogenous beta and gamma was distributed in the cytoplasm. It is concluded that prenylation facilitates association of gamma subunits with membranes, that the cellular location of gamma influences the distribution of beta, and that prenylation is not an absolute requirement for interaction of beta and gamma. Images PMID:1550955

  16. Molecular basis of RNA guanine-7 methyltransferase (RNMT) activation by RAM.

    PubMed

    Varshney, Dhaval; Petit, Alain-Pierre; Bueren-Calabuig, Juan A; Jansen, Chimed; Fletcher, Dan A; Peggie, Mark; Weidlich, Simone; Scullion, Paul; Pisliakov, Andrei V; Cowling, Victoria H

    2016-12-01

    Maturation and translation of mRNA in eukaryotes requires the addition of the 7-methylguanosine cap. In vertebrates, the cap methyltransferase, RNA guanine-7 methyltransferase (RNMT), has an activating subunit, RNMT-Activating Miniprotein (RAM). Here we report the first crystal structure of the human RNMT in complex with the activation domain of RAM. A relatively unstructured and negatively charged RAM binds to a positively charged surface groove on RNMT, distal to the active site. This results in stabilisation of a RNMT lobe structure which co-evolved with RAM and is required for RAM binding. Structure-guided mutagenesis and molecular dynamics simulations reveal that RAM stabilises the structure and positioning of the RNMT lobe and the adjacent α-helix hinge, resulting in optimal positioning of helix A which contacts substrates in the active site. Using biophysical and biochemical approaches, we observe that RAM increases the recruitment of the methyl donor, AdoMet (S-adenosyl methionine), to RNMT. Thus we report the mechanism by which RAM allosterically activates RNMT, allowing it to function as a molecular rheostat for mRNA cap methylation.

  17. Guanine and inosine nucleotides, nucleosides and oxypurines in snail muscles as potential biomarkers of fluoride toxicity.

    PubMed

    Rać, Monika E; Safranow, Krzysztof; Dołegowska, Barbara; Machoy, Zygmunt

    2007-01-01

    The aim of the present study was to determine the toxicity of fluorides on energy metabolism in muscles of the Helix aspersa maxima snail. Qualitative and quantitative analysis of purine compounds was performed in slices of foot from mature snails with high-performance liquid chromatography. Fluoride concentrations were measured using an ion-selective electrode and gas chromatography. The results show that exposure to fluoride pollution was accompanied by a statistically significant increase in fluoride concentrations in soft tissues. This effect was already noticeable with the smallest fluoride dose. Accumulation was greatest in the shell. There is a significant and positive correlation between fluoride concentrations in foot muscles and guanine and inosine nucleotides or uridine content. The content of low-energy guanylate, inosylate and oxypurine in foot muscles significantly increased with rising dose of fluoride. The difference as compared with controls was significant only for the highest dose of fluoride. Interestingly, uric acid, the final product of purine catabolism, dominated quantitatively in the foot muscles of snails. In conclusion, increased low-energy guanylate and inosylate as well as decreased xanthine concentrations in snail muscle can be indicators of the toxic influence of fluoride on the organism. The measuring of fluoride accumulation in the shell is the most suitable bioindicator of fluoride pollution in the environment.

  18. The Guanine-Based Purinergic System: The Tale of An Orphan Neuromodulation

    PubMed Central

    Garozzo, Roberta; Frinchi, Monica; Fernandez-Dueñas, Víctor; Di Iorio, Patrizia; Ciccarelli, Renata; Caciagli, Francesco; Condorelli, Daniele F.; Ciruela, Francisco; Belluardo, Natale

    2016-01-01

    Guanine-based purines (GBPs) have been recently proposed to be not only metabolic agents but also extracellular signaling molecules that regulate important functions in the central nervous system. In such way, GBPs-mediated neuroprotection, behavioral responses and neuronal plasticity have been broadly described in the literature. However, while a number of these functions (i.e., GBPs neurothophic effects) have been well-established, the molecular mechanisms behind these GBPs-dependent effects are still unknown. Furthermore, no plasma membrane receptors for GBPs have been described so far, thus GBPs are still considered orphan neuromodulators. Interestingly, an intricate and controversial functional interplay between GBPs effects and adenosine receptors activity has been recently described, thus triggering the hypothesis that GBPs mechanism of action might somehow involve adenosine receptors. Here, we review recent data describing the GBPs role in the brain. We focus on the involvement of GBPs regulating neuronal plasticity, and on the new hypothesis based on putative GBPs receptors. Overall, we expect to shed some light on the GBPs world since although these molecules might represent excellent candidates for certain neurological diseases management, the lack of putative GBPs receptors precludes any high throughput screening intent for the search of effective GBPs-based drugs. PMID:27378923

  19. In vitro guanine nucleotide exchange activity of DHR-2/DOCKER/CZH2 domains.

    PubMed

    Côté, Jean-François; Vuori, Kristiina

    2006-01-01

    Rho family GTPases regulate a large variety of biological processes, including the reorganization of the actin cytoskeleton. Like other members of the Ras superfamily of small GTP-binding proteins, Rho GTPases cycle between a GDP-bound (inactive) and a GTP-bound (active) state, and, when active, the GTPases relay extracellular signals to a large number of downstream effectors. Guanine nucleotide exchange factors (GEFs) promote the exchange of GDP for GTP on Rho GTPases, thereby activating them. Most Rho-GEFs mediate their effects through their signature domain known as the Dbl Homology-Pleckstrin Homology (DH-PH) module. Recently, we and others identified a family of evolutionarily conserved, DOCK180-related proteins that also display GEF activity toward Rho GTPases. The DOCK180-family of proteins lacks the canonical DH-PH module. Instead, they rely on a novel domain, termed DHR-2, DOCKER, or CZH2, to exchange GDP for GTP on Rho targets. In this chapter, the experimental approach that we used to uncover the exchange activity of the DHR-2 domain of DOCK180-related proteins will be described.

  20. QuadBase2: web server for multiplexed guanine quadruplex mining and visualization.

    PubMed

    Dhapola, Parashar; Chowdhury, Shantanu

    2016-07-08

    DNA guanine quadruplexes or G4s are non-canonical DNA secondary structures which affect genomic processes like replication, transcription and recombination. G4s are computationally identified by specific nucleotide motifs which are also called putative G4 (PG4) motifs. Despite the general relevance of these structures, there is currently no tool available that can allow batch queries and genome-wide analysis of these motifs in a user-friendly interface. QuadBase2 (quadbase.igib.res.in) presents a completely reinvented web server version of previously published QuadBase database. QuadBase2 enables users to mine PG4 motifs in up to 178 eukaryotes through the EuQuad module. This module interfaces with Ensembl Compara database, to allow users mine PG4 motifs in the orthologues of genes of interest across eukaryotes. PG4 motifs can be mined across genes and their promoter sequences in 1719 prokaryotes through ProQuad module. This module includes a feature that allows genome-wide mining of PG4 motifs and their visualization as circular histograms. TetraplexFinder, the module for mining PG4 motifs in user-provided sequences is now capable of handling up to 20 MB of data. QuadBase2 is a comprehensive PG4 motif mining tool that further expands the configurations and algorithms for mining PG4 motifs in a user-friendly way.

  1. How not to do kinetics: examples involving GTPases and guanine nucleotide exchange factors.

    PubMed

    Goody, Roger S

    2014-01-01

    Guanine nucleotide exchange factors (GEFs) are crucial regulators of the action of GTPases in signal transduction and cellular regulation. Although their basic mechanism of action has been apparent for almost 20 years, there are still misconceptions concerning their properties, and these are confounded by superficial or incorrect interpretation of experimental results in individual cases. Here, an example is described in which an incorrect mechanism was derived because of an inadequate analysis of kinetic results. In a second example, a case is discussed where certain GTP analogs were erroneously described as being able to function as low molecular mass GEFs. In both cases, a lack of distinction between rates, rate constants, and apparent rate constants, together with a disregard of relative signal amplitudes, led to the misinterpretations. In a final example, it is shown how the lack of an appropriate kinetic investigation led to the false conclusion that a secreted protein from Legionella pneumophila can act not only as a GEF towards eukaryotic Rab1 but also as a factor that is able to actively dissociate the stable complex between Rab1 and GDP dissociation inhibitor.

  2. Identification of guanine exchange factor key residues involved in exchange activity and Ras interaction.

    PubMed

    Camus, C; Hermann-Le Denmat, S; Jacquet, M

    1995-09-07

    We have carried out a functional analysis of the human HGRF55 exchange factor in the yeast Saccharomyces cerevisiae. Twelve residues conserved among most of all known guanine exchange factors (GEFs) have been independently changed to alanine. Taking advantage of the ability of Hgrf55p to replace the yeast Cdc25p exchange factor, and using the two-hybrid system with RAS2ala22 allele, we have identified key residues for the interaction with Ras and/or its activation. Substitution of arginine 392 to alanine leads to a complete loss of interaction with Ras, though the protein remains stable. Substitution of Asp266 or Arg359 to alanine results in inactive proteins at 39 degrees C, still able however to interact with Ras. The other charged-to-alanine substitutions led to no detectable phenotype when present alone but most of them dramatically increased the temperature sensitive phenotype observed with [Asp266Ala] substitution. Surprisingly, the cysteine to alanine substitution in the highly conserved PCVPF/Y motif proved to be without effect, suggesting that the sulfhydryl group is not essential for stability or interaction with Ras.

  3. Guanine nucleotide exchange factor RABGEF1 regulates keratinocyte-intrinsic signaling to maintain skin homeostasis

    PubMed Central

    Marichal, Thomas; El Abbas, Sophie; Sibilano, Riccardo; Zurek, Oliwia; Reber, Laurent L.; Pirottin, Dimitri; Kim, Jinah; Chambon, Pierre; Roers, Axel; Antoine, Nadine; Kawakami, Yuko; Bureau, Fabrice; Tam, See-Ying; Tsai, Mindy

    2016-01-01

    Epidermal keratinocytes form a structural and immune barrier that is essential for skin homeostasis. However, the mechanisms that regulate epidermal barrier function are incompletely understood. Here we have found that keratinocyte-specific deletion of the gene encoding RAB guanine nucleotide exchange factor 1 (RABGEF1, also known as RABEX-5) severely impairs epidermal barrier function in mice and induces an allergic cutaneous and systemic phenotype. RABGEF1-deficient keratinocytes exhibited aberrant activation of the intrinsic IL-1R/MYD88/NF-κB signaling pathway and MYD88-dependent abnormalities in expression of structural proteins that contribute to skin barrier function. Moreover, ablation of MYD88 signaling in RABGEF1-deficient keratinocytes or deletion of Il1r1 restored skin homeostasis and prevented development of skin inflammation. We further demonstrated that epidermal RABGEF1 expression is reduced in skin lesions of humans diagnosed with either atopic dermatitis or allergic contact dermatitis as well as in an inducible mouse model of allergic dermatitis. Our findings reveal a key role for RABGEF1 in dampening keratinocyte-intrinsic MYD88 signaling and sustaining epidermal barrier function in mice, and suggest that dysregulation of RABGEF1 expression may contribute to epidermal barrier dysfunction in allergic skin disorders in mice and humans. Thus, RABGEF1-mediated regulation of IL-1R/MYD88 signaling might represent a potential therapeutic target. PMID:27820702

  4. Guanine nucleotide binding protein-like 3 is a potential prognosis indicator of gastric cancer.

    PubMed

    Chen, Jing; Dong, Shuang; Hu, Jiangfeng; Duan, Bensong; Yao, Jian; Zhang, Ruiyun; Zhou, Hongmei; Sheng, Haihui; Gao, Hengjun; Li, Shunlong; Zhang, Xianwen

    2015-01-01

    Guanine nucleotide binding protein-like 3 (GNL3) is a GIP-binding nuclear protein that has been reported to be involved in various biological processes, including cell proliferation, cellular senescence and tumorigenesis. This study aimed to investigate the expression level of GNL3 in gastric cancer and to evaluate the relationship between its expression and clinical variables and overall survival of gastric cancer patients. The expression level of GNL3 was examined in 89 human gastric cancer samples using immunohistochemistry (IHC) staining. GNL3 in gastric cancer tissues was significantly upregulated compared with paracancerous tissues. GNL3 expression in adjacent non-cancerous tissues was associated with sex and tumor size. Survival analyses showed that GNL3 expression in both gastric cancer and adjacent non-cancerous tissues were not related to overall survival. However, in the subgroup of patients with larger tumor size (≥ 6 cm), a close association was found between GNL3 expression in gastric cancer tissues and overall survival. GNL3-positive patients had a shorter survival than GNL3-negative patients. Our study suggests that GNL3 might play an important role in the progression of gastric cancer and serve as a biomarker for poor prognosis in gastric cancer patients.

  5. How Does Guanine-Cytosine Base Pair Affect Excess-Electron Transfer in DNA?

    PubMed

    Lin, Shih-Hsun; Fujitsuka, Mamoru; Majima, Tetsuro

    2015-06-25

    Charge transfer and proton transfer in DNA have attracted wide attention due to their relevance in biological processes and so on. Especially, excess-electron transfer (EET) in DNA has strong relation to DNA repair. However, our understanding on EET in DNA still remains limited. Herein, by using a strongly electron-donating photosensitizer, trimer of 3,4-ethylenedioxythiophene (3E), and an electron acceptor, diphenylacetylene (DPA), two series of functionalized DNA oligomers were synthesized for investigation of EET dynamics in DNA. The transient absorption measurements during femtosecond laser flash photolysis showed that guanine:cytosine (G:C) base pair affects EET dynamics in DNA by two possible mechanisms: the excess-electron quenching by proton transfer with the complementary G after formation of C(•-) and the EET hindrance by inserting a G:C base pair as a potential barrier in consecutive thymines (T's). In the present paper, we provided useful information based on the direct kinetic measurements, which allowed us to discuss EET through oligonucleotides for the investigation of DNA damage/repair.

  6. Electron correlation effects and density analysis of the first-order hyperpolarizability of neutral guanine tautomers.

    PubMed

    Alparone, Andrea

    2013-08-01

    Dipole moments (μ), charge distributions, and static electronic first-order hyperpolarizabilities (β(μ)) of the two lowest-energy keto tautomers of guanine (7H and 9H) were determined in the gas phase using Hartree-Fock, Møller-Plesset perturbation theory (MP2 and MP4), and DFT (PBE1PBE, B97-1, B3LYP, CAM-B3LYP) methods with Dunning's correlation-consistent aug-cc-pVDZ and d-aug-cc-pVDZ basis sets. The most stable isomer 7H exhibits a μ value smaller than that of the 9H form by a factor of ca. 3.5. The β μ value of the 9H tautomer is strongly dependent on the computational method employed, as it dramatically influences the β(μ) (9H)/β(μ) (7H) ratio, which at the highest correlated MP4/aug-cc-pVDZ level is predicted to be ca. 5. The Coulomb-attenuating hybrid exchange-correlation CAM-B3LYP method is superior to the conventional PBE1PBE, B3LYP, and B97-1 functionals in predicting the β(μ) values. Differences between the largest diagonal hyperpolarizability components were clarified through hyperpolarizability density analyses. Dipole moment and first-order hyperpolarizability are molecular properties that are potentially useful for distinguishing the 7H from the 9H tautomer.

  7. Self-catalyzed site-specific depurination of guanine residues within gene sequences.

    PubMed

    Amosova, Olga; Coulter, Richard; Fresco, Jacques R

    2006-03-21

    A self-catalyzed, site-specific guanine-depurination activity has been found to occur in short gene sequences with a potential to form a stem-loop structure. The critical features of that catalytic intermediate are a 5'-G-T-G-G-3' loop and an adjacent 5'-T.A-3' base pair of a short duplex stem stable enough to fix the loop structure required for depurination of its 5'-G residue. That residue is uniquely depurinated with a rate some 5 orders of magnitude faster than that of random "spontaneous" depurination. In contrast, all other purine residues in the sequence depurinate at the spontaneous background rate. The reaction requires no divalent cations or other cofactors and occurs under essentially physiological conditions. Such stem-loops can form in duplex DNA under superhelical stress, and their critical sequence features have been found at numerous sites in the human genome. Self-catalyzed stem-loop-mediated depurination leading to flexible apurinic sites may therefore serve some important biological role, e.g., in nucleosome positioning, genetic recombination, or chromosome superfolding.

  8. QuadBase2: web server for multiplexed guanine quadruplex mining and visualization

    PubMed Central

    Dhapola, Parashar; Chowdhury, Shantanu

    2016-01-01

    DNA guanine quadruplexes or G4s are non-canonical DNA secondary structures which affect genomic processes like replication, transcription and recombination. G4s are computationally identified by specific nucleotide motifs which are also called putative G4 (PG4) motifs. Despite the general relevance of these structures, there is currently no tool available that can allow batch queries and genome-wide analysis of these motifs in a user-friendly interface. QuadBase2 (quadbase.igib.res.in) presents a completely reinvented web server version of previously published QuadBase database. QuadBase2 enables users to mine PG4 motifs in up to 178 eukaryotes through the EuQuad module. This module interfaces with Ensembl Compara database, to allow users mine PG4 motifs in the orthologues of genes of interest across eukaryotes. PG4 motifs can be mined across genes and their promoter sequences in 1719 prokaryotes through ProQuad module. This module includes a feature that allows genome-wide mining of PG4 motifs and their visualization as circular histograms. TetraplexFinder, the module for mining PG4 motifs in user-provided sequences is now capable of handling up to 20 MB of data. QuadBase2 is a comprehensive PG4 motif mining tool that further expands the configurations and algorithms for mining PG4 motifs in a user-friendly way. PMID:27185890

  9. Theoretical investigation of hydrogen transfer mechanism in the guanine cytosine base pair

    NASA Astrophysics Data System (ADS)

    Villani, Giovanni

    2006-05-01

    We have studied the quantum-dynamics of the hydrogen bonds in the guanine-cytosine base pair. Due to the position of hydrogen atoms, different tautomers are possible: the stable Watson-Crick G-C, the imino-enol G*-C*, the imino-enol-imino-enol G #-C # and some zwitterionic structures. The common idea in the literature is that only the G-C and the G*-C* tautomers are stable with an estimate of G-C → G*-C* transition probability of 10 -6-10 -9 by the help of Boltzmann statistics. Here we show a detailed quantum theoretical study that suggests the following conclusion: G-C is the stablest tautomer, some partially charged systems (due to the movement of only one hydrogen atom) are important and a large amount of the imino-enol G*-C* (and less of the imino-enol-imino-enol G #-C # structure) tautomer is present at any time. The corresponding transition probabilities from different tautomers are not due to thermal passage, but they are a pure quantum phenomenon. These large probabilities definitively disprove the idea of these tautomers as mutation points. The mechanisms of passage from the G-C tautomer to the others have also been investigated.

  10. EspM2 is a RhoA guanine nucleotide exchange factor

    PubMed Central

    Arbeloa, Ana; Garnett, James; Lillington, James; Bulgin, Richard R; Berger, Cedric N; Lea, Susan M; Matthews, Steve; Frankel, Gad

    2010-01-01

    We investigated how the type III secretion system WxxxE effectors EspM2 of enterohaemorrhagic Escherichia coli, which triggers stress fibre formation, and SifA of Salmonella enterica serovar Typhimurium, which is involved in intracellular survival, modulate Rho GTPases. We identified a direct interaction between EspM2 or SifA and nucleotide-free RhoA. Nuclear Magnetic Resonance Spectroscopy revealed that EspM2 has a similar fold to SifA and the guanine nucleotide exchange factor (GEF) effector SopE. EspM2 induced nucleotide exchange in RhoA but not in Rac1 or H-Ras, while SifA induced nucleotide exchange in none of them. Mutating W70 of the WxxxE motif or L118 and I127 residues, which surround the catalytic loop, affected the stability of EspM2. Substitution of Q124, located within the catalytic loop of EspM2, with alanine, greatly attenuated the RhoA GEF activity in vitro and the ability of EspM2 to induce stress fibres upon ectopic expression. These results suggest that binding of SifA to RhoA does not trigger nucleotide exchange while EspM2 is a unique Rho GTPase GEF. PMID:20039879

  11. Molecular basis of RNA guanine-7 methyltransferase (RNMT) activation by RAM

    PubMed Central

    Varshney, Dhaval; Petit, Alain-Pierre; Bueren-Calabuig, Juan A.; Jansen, Chimed; Fletcher, Dan A.; Peggie, Mark; Weidlich, Simone; Scullion, Paul; Pisliakov, Andrei V.; Cowling, Victoria H.

    2016-01-01

    Maturation and translation of mRNA in eukaryotes requires the addition of the 7-methylguanosine cap. In vertebrates, the cap methyltransferase, RNA guanine-7 methyltransferase (RNMT), has an activating subunit, RNMT-Activating Miniprotein (RAM). Here we report the first crystal structure of the human RNMT in complex with the activation domain of RAM. A relatively unstructured and negatively charged RAM binds to a positively charged surface groove on RNMT, distal to the active site. This results in stabilisation of a RNMT lobe structure which co-evolved with RAM and is required for RAM binding. Structure-guided mutagenesis and molecular dynamics simulations reveal that RAM stabilises the structure and positioning of the RNMT lobe and the adjacent α-helix hinge, resulting in optimal positioning of helix A which contacts substrates in the active site. Using biophysical and biochemical approaches, we observe that RAM increases the recruitment of the methyl donor, AdoMet (S-adenosyl methionine), to RNMT. Thus we report the mechanism by which RAM allosterically activates RNMT, allowing it to function as a molecular rheostat for mRNA cap methylation. PMID:27422871

  12. The Guanine-Nucleotide Exchange Factor SGEF Plays a Crucial Role in the Formation of Atherosclerosis

    PubMed Central

    Kroon, Jeffrey; Welch, Christopher; Bakker, Erik N.; Matlung, Hanke L.; van den Berg, Timo K.; Sharek, Lisa; Doerschuk, Claire; Hahn, Klaus; Burridge, Keith

    2013-01-01

    The passage of leukocytes across the endothelium and into arterial walls is a critical step in the development of atherosclerosis. Previously, we showed in vitro that the RhoG guanine nucleotide exchange factor SGEF (Arhgef26) contributes to the formation of ICAM-1-induced endothelial docking structures that facilitate leukocyte transendothelial migration. To further explore the in vivo role of this protein during inflammation, we generated SGEF-deficient mice. When crossed with ApoE null mice and fed a Western diet, mice lacking SGEF showed a significant decrease in the formation of atherosclerosis in multiple aortic areas. A fluorescent biosensor revealed local activation of RhoG around bead-clustered ICAM-1 in mouse aortic endothelial cells. Notably, this activation was decreased in cells from SGEF-deficient aortas compared to wild type. In addition, scanning electron microscopy of intimal surfaces of SGEF−/− mouse aortas revealed reduced docking structures around beads that were coated with ICAM-1 antibody. Similarly, under conditions of flow, these beads adhered less stably to the luminal surface of carotid arteries from SGEF−/− mice. Taken together, these results show for the first time that a Rho-GEF, namely SGEF, contributes to the formation of atherosclerosis by promoting endothelial docking structures and thereby retention of leukocytes at athero-prone sites of inflammation experiencing high shear flow. SGEF may therefore provide a novel therapeutic target for inhibiting the development of atherosclerosis. PMID:23372835

  13. Guanine nucleotide exchange factor H1 can be a new biomarker of melanoma

    PubMed Central

    Shi, Jie; Guo, Bingyu; Zhang, Yu; Hui, Qiang; Chang, Peng; Tao, Kai

    2016-01-01

    Guanine nucleotide exchange factor H1 (GEF-H1), which couples microtubule dynamics to RhoA activation, is a microtubule-regulated exchange factor. Studies have shown that GEF-H1 can be involved in various cancer pathways; however, the clinical significance of GEF-H1 expression and functions in melanoma has not been established. In this study, we investigated the relationship between clinical outcomes and GEF-H1 functions in melanoma. A total of 60 cases of different grades of melanoma samples were used to detect the expression of GEF-H1. Results showed that both messenger RNA and protein levels of GEF-H1 were significantly higher in high-grade melanomas. Furthermore, patients with high GEF-H1 expression had a shorter overall survival (22 months) than patients with low level of GEF-H1 expression (33.38 months). We also found that GEF-H1 can promote the proliferation and metastasis of melanoma cells. In summary, these results suggested that GEF-H1 may be a valuable biomarker for assessing the degree and prognosis of melanoma following surgery. PMID:27462139

  14. DNA oxidation in anionic reverse micelles: ruthenium-mediated damage at Guanine in single- and double-stranded DNA.

    PubMed

    Evans, Sarah E; Mon, Soe; Singh, Robinder; Ryzhkov, Lev R; Szalai, Veronika A

    2006-04-03

    One-electron guanine oxidation in DNA has been investigated in anionic reverse micelles (RMs). A photochemical method for generating Ru3+ from the ruthenium polypyridyl complex tris(2-2'-bipyridine)ruthenium(II) chloride ([Ru(bpy)3]Cl2) is combined with high-resolution polyacrylamide gel electrophoresis (PAGE) to quantify piperidine-labile guanine oxidation products. As characterized by emission spectroscopy of Ru(bpy)3(2+), the addition of DNA to RMs containing Ru(bpy)3(2+) does not perturb the environment of Ru(bpy)3(2+). The steady-state quenching efficiency of Ru(bpy)3(2+) with K3[Fe(CN)6] in buffer solution is approximately 2-fold higher than that observed in RMs. Consistent with the difference in quenching efficiency in the two media, a 1.5-fold higher yield of piperidine-labile damage products as monitored by PAGE is observed for duplex oligonucleotide in buffer vs RMs. In contrast, a 13-fold difference in the yield of PAGE-detected G oxidation products is observed when single-stranded DNA is the substrate. Circular dichroism spectra showed that single-stranded DNA undergoes a structural change in anionic RMs. This structural change is potentially due to cation-mediated adsorption of the DNA phosphates on the anionic headgroups of the RMs, leading to protection of the guanine from oxidatively generated damage.

  15. Mapping structurally defined guanine oxidation products along DNA duplexes: influence of local sequence context and endogenous cytosine methylation.

    PubMed

    Ming, Xun; Matter, Brock; Song, Matthew; Veliath, Elizabeth; Shanley, Ryan; Jones, Roger; Tretyakova, Natalia

    2014-03-19

    DNA oxidation by reactive oxygen species is nonrandom, potentially leading to accumulation of nucleobase damage and mutations at specific sites within the genome. We now present the first quantitative data for sequence-dependent formation of structurally defined oxidative nucleobase adducts along p53 gene-derived DNA duplexes using a novel isotope labeling-based approach. Our results reveal that local nucleobase sequence context differentially alters the yields of 2,2,4-triamino-2H-oxal-5-one (Z) and 8-oxo-7,8-dihydro-2'-deoxyguanosine (OG) in double stranded DNA. While both lesions are overproduced within endogenously methylated (Me)CG dinucleotides and at 5' Gs in runs of several guanines, the formation of Z (but not OG) is strongly preferred at solvent-exposed guanine nucleobases at duplex ends. Targeted oxidation of (Me)CG sequences may be caused by a lowered ionization potential of guanine bases paired with (Me)C and the preferential intercalation of riboflavin photosensitizer adjacent to (Me)C:G base pairs. Importantly, some of the most frequently oxidized positions coincide with the known p53 lung cancer mutational "hotspots" at codons 245 (GGC), 248 (CGG), and 158 (CGC) respectively, supporting a possible role of oxidative degradation of DNA in the initiation of lung cancer.

  16. Structural outline of the detailed mechanism for elongation factor Ts-mediated guanine nucleotide exchange on elongation factor Tu.

    PubMed

    Thirup, Søren S; Van, Lan Bich; Nielsen, Tine K; Knudsen, Charlotte R

    2015-07-01

    Translation elongation factor EF-Tu belongs to the superfamily of guanine-nucleotide binding proteins, which play key cellular roles as regulatory switches. All G-proteins require activation via exchange of GDP for GTP to carry out their respective tasks. Often, guanine-nucleotide exchange factors are essential to this process. During translation, EF-Tu:GTP transports aminoacylated tRNA to the ribosome. GTP is hydrolyzed during this process, and subsequent reactivation of EF-Tu is catalyzed by EF-Ts. The reaction path of guanine-nucleotide exchange is structurally poorly defined for EF-Tu and EF-Ts. We have determined the crystal structures of the following reaction intermediates: two structures of EF-Tu:GDP:EF-Ts (2.2 and 1.8Å resolution), EF-Tu:PO4:EF-Ts (1.9Å resolution), EF-Tu:GDPNP:EF-Ts (2.2Å resolution) and EF-Tu:GDPNP:pulvomycin:Mg(2+):EF-Ts (3.5Å resolution). These structures provide snapshots throughout the entire exchange reaction and suggest a mechanism for the release of EF-Tu in its GTP conformation. An inferred sequence of events during the exchange reaction is presented.

  17. Multisite-specific archaeosine tRNA-guanine transglycosylase (ArcTGT) from Thermoplasma acidophilum, a thermo-acidophilic archaeon

    PubMed Central

    Kawamura, Takuya; Hirata, Akira; Ohno, Satoshi; Nomura, Yuichiro; Nagano, Tomoko; Nameki, Nobukazu; Yokogawa, Takashi; Hori, Hiroyuki

    2016-01-01

    Archaeosine (G+), which is found only at position 15 in many archaeal tRNA, is formed by two steps, the replacement of the guanine base with preQ0 by archaeosine tRNA-guanine transglycosylase (ArcTGT) and the subsequent modification of preQ0 to G+ by archaeosine synthase. However, tRNALeu from Thermoplasma acidophilum, a thermo-acidophilic archaeon, exceptionally has two G+13 and G+15 modifications. In this study, we focused on the biosynthesis mechanism