Science.gov

Sample records for adenosine triphosphate atp-binding

  1. Extracellular adenosine triphosphate and adenosine in cancer.

    PubMed

    Stagg, J; Smyth, M J

    2010-09-30

    Adenosine triphosphate (ATP) is actively released in the extracellular environment in response to tissue damage and cellular stress. Through the activation of P2X and P2Y receptors, extracellular ATP enhances tissue repair, promotes the recruitment of immune phagocytes and dendritic cells, and acts as a co-activator of NLR family, pyrin domain-containing 3 (NLRP3) inflammasomes. The conversion of extracellular ATP to adenosine, in contrast, essentially through the enzymatic activity of the ecto-nucleotidases CD39 and CD73, acts as a negative-feedback mechanism to prevent excessive immune responses. Here we review the effects of extracellular ATP and adenosine on tumorigenesis. First, we summarize the functions of extracellular ATP and adenosine in the context of tumor immunity. Second, we present an overview of the immunosuppressive and pro-angiogenic effects of extracellular adenosine. Third, we present experimental evidence that extracellular ATP and adenosine receptors are expressed by tumor cells and enhance tumor growth. Finally, we discuss recent studies, including our own work, which suggest that therapeutic approaches that promote ATP-mediated activation of inflammasomes, or inhibit the accumulation of tumor-derived extracellular adenosine, may constitute effective new means to induce anticancer activity.

  2. Formycin triphosphate as a probe for the ATP binding site involved in the activation of guanylate cyclase.

    PubMed

    Chang, C H; Yu, Z N; Song, D L

    1992-10-01

    Formycin A triphosphate (FTP), a fluorescent analog of ATP, slightly increased basal guanylate cyclase activity, but significantly potentiated guanylate cyclase activity stimulated by atrial natriuretic factor (ANF) in rat lung membranes. FTP potentiated ANF-stimulated guanylate cyclase activity with an EC50 at about 90 microM and inhibited ATP-stimulated guanylate cyclase activity with an IC50 at about 100 microM. These results indicate that FTP binds more tightly than ATP for the same binding site. Therefore, FTP would be an excellent tool for studying the ATP binding site.

  3. Optical Aptasensors for Adenosine Triphosphate

    PubMed Central

    Ng, Stella; Lim, Hui Si; Ma, Qian; Gao, Zhiqiang

    2016-01-01

    Nucleic acids are among the most researched and applied biomolecules. Their diverse two- and three-dimensional structures in conjunction with their robust chemistry and ease of manipulation provide a rare opportunity for sensor applications. Moreover, their high biocompatibility has seen them being used in the construction of in vivo assays. Various nucleic acid-based devices have been extensively studied as either the principal element in discrete molecule-like sensors or as the main component in the fabrication of sensing devices. The use of aptamers in sensors - aptasensors, in particular, has led to improvements in sensitivity, selectivity, and multiplexing capacity for a wide verity of analytes like proteins, nucleic acids, as well as small biomolecules such as glucose and adenosine triphosphate (ATP). This article reviews the progress in the use of aptamers as the principal component in sensors for optical detection of ATP with an emphasis on sensing mechanism, performance, and applications with some discussion on challenges and perspectives. PMID:27446501

  4. 21 CFR 864.7040 - Adenosine triphosphate release assay.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Adenosine triphosphate release assay. 864.7040... Adenosine triphosphate release assay. (a) Identification. An adenosine triphosphate release assay is a device that measures the release of adenosine triphosphate (ATP) from platelets following...

  5. 21 CFR 864.7040 - Adenosine triphosphate release assay.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Adenosine triphosphate release assay. 864.7040... Adenosine triphosphate release assay. (a) Identification. An adenosine triphosphate release assay is a device that measures the release of adenosine triphosphate (ATP) from platelets following...

  6. 21 CFR 864.7040 - Adenosine triphosphate release assay.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Adenosine triphosphate release assay. 864.7040... Adenosine triphosphate release assay. (a) Identification. An adenosine triphosphate release assay is a device that measures the release of adenosine triphosphate (ATP) from platelets following...

  7. Enzymatic regeneration of adenosine triphosphate cofactor

    NASA Technical Reports Server (NTRS)

    Marshall, D. L.

    1974-01-01

    Regenerating adenosine triphosphate (ATP) from adenosine diphosphate (ADP) by enzymatic process which utilizes carbamyl phosphate as phosphoryl donor is technique used to regenerate expensive cofactors. Process allows complex enzymatic reactions to be considered as candidates for large-scale continuous processes.

  8. Chemoelectrical energy conversion of adenosine triphosphate

    NASA Astrophysics Data System (ADS)

    Sundaresan, Vishnu Baba; Sarles, Stephen Andrew; Leo, Donald J.

    2007-04-01

    Plant and animal cell membranes transport charged species, neutral molecules and water through ion pumps and channels. The energy required for moving species against established concentration and charge gradients is provided by the biological fuel - adenosine triphosphate (ATP) -synthesized within the cell. The adenosine triphosphatase (ATPases) in a plant cell membrane hydrolyze ATP in the cell cytoplasm to pump protons across the cell membrane. This establishes a proton gradient across the membrane from the cell exterior into the cell cytoplasm. This proton motive force stimulates ion channels that transport nutrients and other species into the cell. This article discusses a device that converts the chemical energy stored in adenosine triphosphate into electrical power using a transporter protein, ATPase. The V-type ATPase proteins used in our prototype are extracted from red beet(Beta vulgaris) tonoplast membranes and reconstituted in a bilayer lipid membrane or BLM formed from POPC and POPS lipids. A pH7 medium that can support ATP hydrolysis is provided on both sides of the membrane and ATP is dissolved in the pH7 buffer on one side of the membrane. Hydrolysis of ATP results in the formation of a phosphate ion and adenosine diphosphate. The energy from the reaction activates ATPase in the BLM and moves a proton across the membrane. The charge gradient established across the BLM due to the reaction and ion transport is converted into electrical current by half-cell reference electrodes. The prototype ATPase cell with an effective BLM area of 4.15 mm2 carrying 15 μl of ATPase proteins was observed to develop a steady state peak power output of 70 nW, which corresponds to a specific power of 1.69 μW/cm2 and a current density of 43.4 μA/cm2 of membrane area.

  9. Detecting adenosine triphosphate in the pericellular space.

    PubMed

    Falzoni, Simonetta; Donvito, Giovanna; Di Virgilio, Francesco

    2013-06-06

    Release of adenosine triphosphate (ATP) into the extracellular space occurs in response to a multiplicity of physiological and pathological stimuli in virtually all cells and tissues. A role for extracellular ATP has been identified in processes as different as neurotransmission, endocrine and exocrine secretion, smooth muscle contraction, bone metabolism, cell proliferation, immunity and inflammation. However, ATP measurement in the extracellular space has proved a daunting task until recently. To tackle this challenge, some years ago, we designed and engineered a novel luciferase probe targeted to and expressed on the outer aspect of the plasma membrane. This novel probe was constructed by appending to firefly luciferase the N-terminal leader sequence and the C-terminal glycophosphatidylinositol anchor of the folate receptor. This chimeric protein, named plasma membrane luciferase, is targeted and localized to the outer side of the plasma membrane. With this probe, we have generated stably transfected HEK293 cell clones that act as an in vitro and in vivo sensor of the extracellular ATP concentration in several disease conditions, such as experimentally induced tumours and inflammation.

  10. Evidence that release of adenosine triphosphate from endothelial cells during increased shear stress is vesicular.

    PubMed

    Bodin, P; Burnstock, G

    2001-12-01

    In response to increased shear stress, vascular endothelial cells release adenosine triphosphate (ATP) by an unknown mechanism. We have investigated this mechanism using different approaches. First, we discovered that quinacrine, used to locate intracellular stores of ATP bound to peptides, displayed a granular fluorescence, typical of vesicular storage. Second, we found that two inhibitors of vesicular transport (monensin and N-ethylmaleimide) produced a highly significant reduction in the release of ATP from vascular endothelial cells in response to increased shear stress. Preliminary experiments using inhibitors of the cystic fibrosis transmembrane regulator, the sulfonylurea receptor, and the multidrug resistance protein showed no involvement of these ATP-binding cassette transporter proteins (previously characterized in endothelial cells) in the mechanism of release of ATP. We suggest, therefore, that the release of ATP from vascular endothelial cells, like that of nerve cells, is probably by vesicular exocytosis.

  11. Computer-assisted analysis of adenosine triphosphate data.

    PubMed

    Erkenbrecher, C W; Crabtree, S J; Stevenson, L H

    1976-09-01

    A computer program has been written to assist in the analysis of adenosine 5'-triphosphate data. The program is designed to calculate a dilution curve and to correct sample and adenosine 5'-triphosphate standard data for background and dilution effects. In addition, basic statistical parameters and estimates of biomass carbon are also calculated for each group of samples and printed in a convenient format. The versatility of the program to analyze data from both qauatic and terrestrial samples is noted as well as its potential use with various types of instrumentation and extraction techniques.

  12. 21 CFR 864.7040 - Adenosine triphosphate release assay.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... device that measures the release of adenosine triphosphate (ATP) from platelets following aggregation. This measurement is made on platelet-rich plasma using a photometer and a luminescent firefly extract. Simultaneous measurements of platelet aggregation and ATP release are used to evaluate platelet...

  13. 21 CFR 864.7040 - Adenosine triphosphate release assay.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... device that measures the release of adenosine triphosphate (ATP) from platelets following aggregation. This measurement is made on platelet-rich plasma using a photometer and a luminescent firefly extract. Simultaneous measurements of platelet aggregation and ATP release are used to evaluate platelet...

  14. A sensitive aptasensor for colorimetric detection of adenosine triphosphate based on the protective effect of ATP-aptamer complexes on unmodified gold nanoparticles.

    PubMed

    Huo, Yuan; Qi, Liang; Lv, Xiao-Jun; Lai, Ting; Zhang, Jing; Zhang, Zhi-Qi

    2016-04-15

    Adenosine triphosphate (ATP) is the most direct source of energy in organisms. This study is the first to demonstrate that ATP-aptamer complexes provide greater protection for unmodified gold nanoparticles (AuNPs) against salt-induced aggregation than either aptamer or ATP alone. This protective effect was confirmed using transmission electron microscopy, dynamic light scattering, Zeta potential measurement, and fluorescence polarization techniques. Utilizing controlled particle aggregation/dispersion as a gauge, a sensitive and selective aptasensor for colorimetric detection of ATP was developed using ATP-binding aptamers as the identification element and unmodified AuNPs as the probe. This aptasensor exhibited a good linear relationship between the absorbance and the logarithm concentration of ATP within a 50-1000 nM range. ATP analogs such as guanosine triphosphate, uridine triphosphate and cytidine triphosphate resulted in little or no interference in the determination of ATP.

  15. Cyclic adenosine monophosphate-dependent vascular responses to purinergic agonists adenosine triphosphate and uridine triphosphate in the anesthetized mouse.

    PubMed

    Shah, Mrugeshkumar K; Kadowitz, Philip J

    2002-01-01

    The mechanism by which purinergic agonist adenosine triphosphate (ATP) and uridine triphosphate (UTP) decrease systemic arterial pressure in the anesthetized mouse was investigated. Intravenous injections of adenosine triphosphate (ATP) and uridine triphosphate (UTP) produced dose-dependent decreases in systemic blood pressure in the mouse. The order of potency was ATP > UTP. Vasodilator responses to ATP and UTP were altered by the cyclic adenosine monophosphate (cAMP) phosphodiesterase inhibitor rolipram. The vascular responses to ATP and UTP were not altered by a nitric oxide synthase inhibitor, a cyclooxygenase inhibitor, a cGMP phosphodiesterase inhibitor, or a particular P2 receptor antagonist. These data suggest that ATP and UTP cause a decrease in systemic arterial pressure in the mouse via a cAMP-dependent pathway via a novel P2 receptor linked to adenylate cyclase and that nitric oxide release, prostaglandin synthesis, cGMP, and P2X1, P2Y1, and P2Y4 receptors play little or no role in the vascular effects of these purinergic agonists in the mouse.

  16. A G-quadruplex-based Label-free Fluorometric Aptasensor for Adenosine Triphosphate Detection.

    PubMed

    Li, Li Juan; Tian, Xue; Kong, Xiang Juan; Chu, Xia

    2015-01-01

    A G-quadruplex-based, label-free fluorescence assay was demonstrated for the detection of adenosine triphosphate (ATP). A double-stranded DNA (dsDNA), hybridized by ATP-aptamer and its complementary sequence, was employed as a substrate for ATP binding. SYBR Green I (SG I) was a fluorescent probe and exonuclease III (Exo III) was a nuclease to digest the dsDNA. Consequently, in the absence of ATP, the dsDNA was inset with SG I and was digested by Exo III, resulting in a low background signal. In the presence of ATP, the aptamer in dsDNA folded into a G-quadruplex structure that resisted the digestion of Exo III. SG I was inserted into the structure, showing high fluorescence. Owing to a decrease of the background noise, a high signal-to-noise ratio could be obtained. This sensor can detect ATP with a concentration ranging from 50 μM to 5 mM, and possesses a capacity for the sensitive determination of other targets.

  17. Electrochemiluminescence aptasensor for adenosine triphosphate detection using host-guest recognition between metallocyclodextrin complex and aptamer.

    PubMed

    Chen, Hong; Chen, Qiong; Zhao, Yingying; Zhang, Fan; Yang, Fan; Tang, Jie; He, Pingang

    2014-04-01

    A sensitive and label-free electrochemiluminescence (ECL) aptasensor for the detection of adenosine triphosphate (ATP) was successfully designed using host-guest recognition between a metallocyclodextrin complex, i.e., tris(bipyridine)ruthenium(II)-β-cyclodextrin [tris(bpyRu)-β-CD], and an ATP-binding aptamer. In the protocol, the NH2-terminated aptamer was immobilized on a glassy carbon electrode (GCE) by a coupling interaction. After host-guest recognition between tris(bpyRu)-β-CD and aptamer, the tris(bpyRu)-β-CD/aptamer/GCE produced a strong ECL signal as a result of the photoactive properties of tris(bpyRu)-β-CD. However, in the presence of ATP, the ATP/aptamer complex was formed preferentially, which restricted host-guest recognition, and therefore less tris(bpyRu)-β-CD was attached to the GCE surface, resulting in an obvious decrease in the ECL intensity. Under optimal determination conditions, an excellent logarithmic linear relationship between the ECL decrease and ATP concentration was obtained in the range 10.0-0.05 nM, with a detection limit of 0.01 nM at the S/N ratio of 3. The proposed ECL-based ATP aptasensor exhibited high sensitivity and selectivity, without time-consuming signal-labeling procedures, and is considered to be a promising model for detection of aptamer-specific targets.

  18. Adenosine triphosphate (ATP) as a possible indicator of extraterrestrial biology

    NASA Technical Reports Server (NTRS)

    Chappelle, E. W.; Picciolo, G. L.

    1974-01-01

    The ubiquity of adenosine triphosphate (ATP) in terrestrial organisms provides the basis for proposing the assay of this vital metabolic intermediate for detecting extraterrestrial biological activity. If an organic carbon chemistry is present on the planets, the occurrence of ATP is possible either from biosynthetic or purely chemical reactions. However, ATP's relative complexity minimizes the probability of abiogenic synthesis. A sensitive technique for the quantitative detection of ATP was developed using the firefly bioluminescent reaction. The procedure was used successfully for the determination of the ATP content of soil and bacteria. This technique is also being investigated from the standpoint of its application in clinical medicine.

  19. Autophagy occurs within an hour of adenosine triphosphate treatment after nerve cell damage: the neuroprotective effects of adenosine triphosphate against apoptosis.

    PubMed

    Lu, Na; Wang, Baoying; Deng, Xiaohui; Zhao, Honggang; Wang, Yong; Li, Dongliang

    2014-09-01

    After hypoxia, ischemia, or inflammatory injuries to the central nervous system, the damaged cells release a large amount of adenosine triphosphate, which may cause secondary neuronal death. Autophagy is a form of cell death that also has neuroprotective effects. Cell Counting Kit assay, monodansylcadaverine staining, flow cytometry, western blotting, and real-time PCR were used to determine the effects of exogenous adenosine triphosphate treatment at different concentrations (2, 4, 6, 8, 10 mmol/L) over time (1, 2, 3, and 6 hours) on the apoptosis and autophagy of SH-SY5Y cells. High concentrations of extracellular adenosine triphosphate induced autophagy and apoptosis of SH-SY5Y cells. The enhanced autophagy first appeared, and peaked at 1 hour after treatment with adenosine triphosphate. Cell apoptosis peaked at 3 hours, and persisted through 6 hours. With prolonged exposure to the adenosine triphosphate treatment, the fraction of apoptotic cells increased. These data suggest that the SH-SY5Y neural cells initiated autophagy against apoptosis within an hour of adenosine triphosphate treatment to protect themselves against injury.

  20. Autophagy occurs within an hour of adenosine triphosphate treatment after nerve cell damage: the neuroprotective effects of adenosine triphosphate against apoptosis

    PubMed Central

    Lu, Na; Wang, Baoying; Deng, Xiaohui; Zhao, Honggang; Wang, Yong; Li, Dongliang

    2014-01-01

    After hypoxia, ischemia, or inflammatory injuries to the central nervous system, the damaged cells release a large amount of adenosine triphosphate, which may cause secondary neuronal death. Autophagy is a form of cell death that also has neuroprotective effects. Cell Counting Kit assay, monodansylcadaverine staining, flow cytometry, western blotting, and real-time PCR were used to determine the effects of exogenous adenosine triphosphate treatment at different concentrations (2, 4, 6, 8, 10 mmol/L) over time (1, 2, 3, and 6 hours) on the apoptosis and autophagy of SH-SY5Y cells. High concentrations of extracellular adenosine triphosphate induced autophagy and apoptosis of SH-SY5Y cells. The enhanced autophagy first appeared, and peaked at 1 hour after treatment with adenosine triphosphate. Cell apoptosis peaked at 3 hours, and persisted through 6 hours. With prolonged exposure to the adenosine triphosphate treatment, the fraction of apoptotic cells increased. These data suggest that the SH-SY5Y neural cells initiated autophagy against apoptosis within an hour of adenosine triphosphate treatment to protect themselves against injury. PMID:25368646

  1. Extraction and analysis of adenosine triphosphate from aquatic environments

    USGS Publications Warehouse

    Stephens, Doyle W.; Shultz, David J.

    1981-01-01

    A variety of adenosine triphosphate (ATP) extraction procedures have been investigated for their applicability to samples from aquatic environments. The cold sulfuric-oxalic acid procedure was best suited to samples consisting of water, periphyton, and sediments. Due to cation and fulvic acid interferences, a spike with a known quantity of ATP was necessary to estimate losses when sediments were extracted. Variable colonization densities for periphyton required that several replicates be extracted to characterize accurately the periphyton community. Extracted samples were stable at room temperature for one to five hours, depending on the ATP concentration, if the pH was below 2. Neutralized samples which were quick frozen and stored at -30C were stable for months. (USGS)

  2. A novel aptasensor for the ultra-sensitive detection of adenosine triphosphate via aptamer/quantum dot based resonance energy transfer.

    PubMed

    Li, Zheng; Wang, Yijing; Liu, Ying; Zeng, Yongyi; Huang, Aimin; Peng, Niancai; Liu, Xiaolong; Liu, Jingfeng

    2013-09-07

    We designed a novel aptamer based biosensor (aptasensor) for ultrasensitive detection of adenosine triphosphate (ATP) through resonance energy transfer (RET). The ATP aptamer was modified with Cy3 at the 3' end, and a green quantum dot (525) was attached to the 5' end of its complementary sequence respectively. The ATP aptamer and its complementary sequence could assemble into a duplex structure in the absence of target ATP, and then decrease the distance between the quantum dot and Cy3 which could produce significant RET signal. Upon ATP binding, the ATP aptamer could dissociate with its complementary sequence and then increase the distance between the quantum dot and Cy3 which would significantly decrease the RET signal. Therefore, the ATP detection could be easily achieved through detection of the fluorescence intensity ratio between 525 nm and 560 nm. The results show that the emission fluorescence intensity ratio of 525/560 is linearly related to the logarithmic concentration of ATP. The linear range of this aptasensor is from 0.1 nM to 1 μM, and the detection limit is lower down to 0.01 nM. Excellent selectivity of this aptasensor for ATP has been demonstrated through the detection of thymidine triphosphate (TTP), cytidine triphosphate (CTP), guanosine triphosphate (GTP) and adenosine diphosphate (ADP) respectively as control. The method we described here could easily detect ATP with excellent selectivity, linearity and sensitivity down to the nanomolar range, as well as avoid photobleaching.

  3. Sustained release carrier for adenosine triphosphate as signaling molecule.

    PubMed

    Wischke, Christian; Weigel, Judith; Bulavina, Larisa; Lendlein, Andreas

    2014-12-10

    Adenosine triphosphate (ATP) is a molecule with a fascinating variety of intracellular and extracellular biological functions that go far beyond energy metabolism. Due to its limited passive diffusion through biological membranes, controlled release systems may allow to interact with ATP-mediated extracellular processes. In this study, two release systems were explored to evaluate the capacity for either long-term or short-term release: (i) Poly[(rac-lactide)-co-glycolide] (PLGA) implant rods were capable of ATP release over days to weeks, depending on the PLGA molecular weight and end-group capping, but were also associated with partial hydrolytic degradation of ATP to ADP and AMP, but not adenosine. (ii) Thermosensitive methylcellulose hydrogels with a gelation occurring at body temperature allowed combining adjustable loading levels and the capacity for injection, with injection forces less than 50N even for small 27G needles. Finally, a first in vitro study illustrated purinergic-triggered response of primary murine microglia to ATP released from hydrogels, demonstrating the potential relevance for biomedical applications.

  4. Magnetite nanoparticle-induced fluorescence quenching of adenosine triphosphate-BODIPY Conjugates: application to adenosine triphosphate and pyrophosphate sensing.

    PubMed

    Yu, Cheng-Ju; Wu, Su-Mei; Tseng, Wei-Lung

    2013-09-17

    We report that magnetite nanoparticles (Fe3O4 NPs) act as an efficient quencher for boron dipyrromethene-conjugated adenosine 5'-triphosphate (BODIPY-ATP) that is highly fluorescent in bulk solution. BODIPY-ATP molecules attached to the surface of Fe3O4 NPs through the coordination between the triphosphate group of BODIPY-ATP and Fe(3+)/Fe(2+) on the NP surface. The formed complexes induced an apparent reduction in the BODIPY-ATP fluorescence resulting from an oxidative-photoinduced electron transfer (PET) from the BODIPY-ATP excited state to an unfilled d shell of Fe(3+)/Fe(2+) on the NP surface. A comparison of the Stern-Volmer quenching constant between Fe(3+) and Fe(2+) suggests that Fe(3+) on the NP surface dominantly controls this quenching process. The efficiency for Fe3O4 NP-induced fluorescence quenching of the BODIPY-ATP was enhanced by increasing the concentration of Fe3O4 NPs and lowering the pH of the solution to below 6.0. We found that pyrophosphate and ATP compete with BODIPY-ATP for binding to Fe3O4 NPs. Thus, we amplified BODIPY-ATP fluorescence in the presence of increasing the pyrophosphate and ATP concentration; the detection limits at a signal-to-noise ratio of 3 for pyrophosphate and ATP were determined to be 7 and 30 nM, respectively. The Fe3O4 NP-based competitive binding assay detected ATP and pyrophosphate in only 5 min. The selectivity of this assay for ATP over metal ions, amino acids, and adenosine analogues is particularly high. The practicality of using the developed method to determine ATP in a single drop of blood is also validated.

  5. Laboratory procedures manual for the firefly luciferase assay for adenosine triphosphate (ATP)

    NASA Technical Reports Server (NTRS)

    Chappelle, E. W.; Picciolo, G. L.; Curtis, C. A.; Knust, E. A.; Nibley, D. A.; Vance, R. B.

    1975-01-01

    A manual on the procedures and instruments developed for the adenosine triphosphate (ATP) luciferase assay is presented. Data cover, laboratory maintenance, maintenance of bacterial cultures, bacteria measurement, reagents, luciferase procedures, and determination of microbal susceptibility to antibiotics.

  6. Intracellular Adenosine Triphosphate Deprivation through Lanthanide-Doped Nanoparticles.

    PubMed

    Tian, Jing; Zeng, Xiao; Xie, Xiaoji; Han, Sanyang; Liew, Oi-Wah; Chen, Yei-Tsung; Wang, Lianhui; Liu, Xiaogang

    2015-05-27

    Growing interest in lanthanide-doped nanoparticles for biological and medical uses has brought particular attention to their safety concerns. However, the intrinsic toxicity of this new class of optical nanomaterials in biological systems has not been fully evaluated. In this work, we systematically evaluate the long-term cytotoxicity of lanthanide-doped nanoparticles (NaGdF4 and NaYF4) to HeLa cells by monitoring cell viability (mitochondrial activity), adenosine triphosphate (ATP) level, and cell membrane integrity (lactate dehydrogenase release), respectively. Importantly, we find that ligand-free lanthanide-doped nanoparticles induce intracellular ATP deprivation of HeLa cells, resulting in a significant decrease in cell viability after exposure for 7 days. We attribute the particle-induced cell death to two distinct cell death pathways, autophagy and apoptosis, which are primarily mediated via the interaction between the nanoparticle and the phosphate group of cellular ATP. The understanding gained from the investigation of cytotoxicity associated with lanthanide-doped nanoparticles provides keen insights into the safe use of these nanoparticles in biological systems.

  7. Footprint traversal by adenosine-triphosphate-dependent chromatin remodeler motor

    NASA Astrophysics Data System (ADS)

    Garai, Ashok; Mani, Jesrael; Chowdhury, Debashish

    2012-04-01

    Adenosine-triphosphate (ATP)-dependent chromatin remodeling enzymes (CREs) are biomolecular motors in eukaryotic cells. These are driven by a chemical fuel, namely, ATP. CREs actively participate in many cellular processes that require accessibility of specific segments of DNA which are packaged as chromatin. The basic unit of chromatin is a nucleosome where 146 bp ˜ 50 nm of a double-stranded DNA (dsDNA) is wrapped around a spool formed by histone proteins. The helical path of histone-DNA contact on a nucleosome is also called “footprint.” We investigate the mechanism of footprint traversal by a CRE that translocates along the dsDNA. Our two-state model of a CRE captures effectively two distinct chemical (or conformational) states in the mechanochemical cycle of each ATP-dependent CRE. We calculate the mean time of traversal. Our predictions on the ATP dependence of the mean traversal time can be tested by carrying out in vitro experiments on mononucleosomes.

  8. Behavior and stability of adenosine triphosphate (ATP) during chlorine disinfection.

    PubMed

    Nescerecka, Alina; Juhna, Talis; Hammes, Frederik

    2016-09-15

    Adenosine triphosphate (ATP) analysis is a cultivation-independent alternative method for the determination of bacterial viability in both chlorinated and non-chlorinated water. Here we investigated the behavior and stability of ATP during chlorination in detail. Different sodium hypochlorite doses (0-22.4 mg-Cl2 L(-1); 5 min exposure) were applied to an Escherichia coli pure culture suspended in filtered river water. We observed decreasing intracellular ATP with increasing chlorine concentrations, but extracellular ATP concentrations only increased when the chlorine dose exceeded 0.35 mg L(-1). The release of ATP from chlorine-damaged bacteria coincided with severe membrane damage detected with flow cytometry (FCM). The stability of extracellular ATP was subsequently studied in different water matrixes, and we found that extracellular ATP was stable in sterile deionized water and also in chlorinated water until extremely high chlorine doses (≤11.2 mg-Cl2 L(-1); 5 min exposure). In contrast, ATP decreased relatively slowly (k = 0.145 h(-1)) in 0.1 μm filtered river water, presumably due to degradation by either extracellular enzymes or the fraction of bacteria that were able to pass through the filter. Extracellular ATP decreased considerably faster (k = 0.368 h(-1)) during batch growth of a river water bacterial community. A series of growth potential tests showed that extracellular ATP molecules were utilized as a phosphorus source during bacteria proliferation. From the combined data we conclude that ATP released from bacteria at high chlorine doses could promote bacteria regrowth, contributing to biological instability in drinking water distribution systems.

  9. Adenosine triphosphate inhibits melatonin synthesis in the rat pineal gland.

    PubMed

    Souza-Teodoro, Luis Henrique; Dargenio-Garcia, Letícia; Petrilli-Lapa, Camila Lopes; Souza, Ewerton da Silva; Fernandes, Pedro A C M; Markus, Regina P; Ferreira, Zulma S

    2016-03-01

    Adenosine triphosphate (ATP) is released onto the pinealocyte, along with noradrenaline, from sympathetic neurons and triggers P2Y1 receptors that enhance β-adrenergic-induced N-acetylserotonin (NAS) synthesis. Nevertheless, the biotransformation of NAS into melatonin, which occurs due to the subsequent methylation by acetylserotonin O-methyltransferase (ASMT; EC 2.1.1.4), has not yet been evaluated in the presence of purinergic stimulation. We therefore evaluated the effects of purinergic signaling on melatonin synthesis induced by β-adrenergic stimulation. ATP increased NAS levels, but, surprisingly, inhibited melatonin synthesis in an inverse, concentration-dependent manner. Our results demonstrate that enhanced NAS levels, which depend on phospholipase C (PLC) activity (but not the induction of gene transcription), are a post-translational effect. By contrast, melatonin reduction is related to an ASMT inhibition of expression at both the gene transcription and protein levels. These results were independent of nuclear factor-kappa B (NF-kB) translocation. Neither the P2Y1 receptor activation nor the PLC-mediated pathway was involved in the decrease in melatonin, indicating that ATP regulates pineal metabolism through different mechanisms. Taken together, our data demonstrate that purinergic signaling differentially modulates NAS and melatonin synthesis and point to a regulatory role for ATP as a cotransmitter in the control of ASMT, the rate-limiting enzyme in melatonin synthesis. The endogenous production of melatonin regulates defense responses; therefore, understanding the mechanisms involving ASMT regulation might provide novel insights into the development and progression of neurological disorders since melatonin presents anti-inflammatory, neuroprotective, and neurogenic effects.

  10. The synthesis of 2'-methylseleno adenosine and guanosine 5'-triphosphates.

    PubMed

    Santner, Tobias; Siegmund, Vanessa; Marx, Andreas; Micura, Ronald

    2012-04-01

    Modified nucleoside triphosphates (NTPs) represent powerful building blocks to generate nucleic acids with novel properties by enzymatic synthesis. We have recently demonstrated the access to 2'-SeCH(3)-uridine and 2'-SeCH(3)-cytidine derivatized RNAs for applications in RNA crystallography, using the corresponding nucleoside triphosphates and distinct mutants of T7 RNA polymerase. In the present note, we introduce the chemical synthesis of the novel 2'-methylseleno-2'-deoxyadenosine and -guanosine 5'-triphosphates (2'-SeCH(3)-ATP and 2'-SeCH(3)-GTP) that represent further candidates for the enzymatic RNA synthesis with engineered RNA polymerases.

  11. Clickable 5'-γ-ferrocenyl adenosine triphosphate bioconjugates in kinase-catalyzed phosphorylations.

    PubMed

    Wang, Nan; She, Zhe; Lin, Yen-Chun; Martić, Sanela; Mann, David J; Kraatz, Heinz-Bernhard

    2015-03-23

    Clickable co-substrate: A tri-functional 5'-γ-ferrocenyl adenosine triphosphate (Fc-ATP) derivative containing a clickable site was synthesized. This compound is an effective co-substrate in kinase-catalyzed phosphorylation reactions, which can be detected by both electrochemical and immunoassay detection methods. The clickable reaction site makes direct modification possible, which greatly expands its application.

  12. Determination of adenosine triphosphate on marine particulates: synthesis of methods for use on OTEC samples

    SciTech Connect

    Jones, A.T.; Hartwig, E.O.

    1982-08-01

    Adenosine triphosphate (ATP) is an indicator of living biomass in marine particulates. This report details the method used by Lawrence Berkeley Laboratory to analyze particulate ATP in samples taken from oligotrophic, tropical ocean waters. It represents a synthesis of previously published methods.

  13. Determination of Adenosine Triphosphate on Marine Particulates:Synthesis of Methods for Use on OTEC Samples

    SciTech Connect

    Jones, Anthony T.; Hartwig, Eric O.

    1982-08-01

    Adenosine triphosphate (ATP) is an indicator of living biomass in marine particulates. This report details the method used by Lawrence Berkeley Laboratory to analyze particulate ATP in samples taken from oligotrophic, tropical ocean waters. It represents a synthesis of previously published methods.

  14. Extracellular adenosine triphosphate affects the response of human macrophages infected with Mycobacterium tuberculosis.

    PubMed

    Dubois-Colas, Nicolas; Petit-Jentreau, Laetitia; Barreiro, Luis B; Durand, Sylvère; Soubigou, Guillaume; Lecointe, Cécile; Klibi, Jihène; Rezaï, Keyvan; Lokiec, François; Coppée, Jean-Yves; Gicquel, Brigitte; Tailleux, Ludovic

    2014-09-01

    Granulomas are the hallmark of Mycobacterium tuberculosis infection. As the host fails to control the bacteria, the center of the granuloma exhibits necrosis resulting from the dying of infected macrophages. The release of the intracellular pool of nucleotides into the surrounding medium may modulate the response of newly infected macrophages, although this has never been investigated. Here, we show that extracellular adenosine triphosphate (ATP) indirectly modulates the expression of 272 genes in human macrophages infected with M. tuberculosis and that it induces their alternative activation. ATP is rapidly hydrolyzed by the ecto-ATPase CD39 into adenosine monophosphate (AMP), and it is AMP that regulates the macrophage response through the adenosine A2A receptor. Our findings reveal a previously unrecognized role for the purinergic pathway in the host response to M. tuberculosis. Dampening inflammation through signaling via the adenosine A2A receptor may limit tissue damage but may also favor bacterial immune escape.

  15. Metabolic Cooperative Control of Electrolyte Levels by Adenosine Triphosphate in the Frog Muscle

    PubMed Central

    Gulati, J.; Ochsenfeld, M. M.; Ling, G. N.

    1971-01-01

    This study examines the effects of metabolic inhibitors on the content of cellular K, Na, and adenosine triphosphate (ATP). ATP and K are seen to fall in the inhibited tissues. The ATP content is correlated with the K content. The role of ATP is examined according to a recent biophysical approach. It is suggested that ATP may control the electrolyte levels by inducing conformational changes in the cytoplasmic proteins. PMID:5316285

  16. Microcontroller-assisted compensation of adenosine triphosphate levels: instrument and method development.

    PubMed

    Hu, Jie-Bi; Chen, Ting-Ru; Chen, Yu-Chie; Urban, Pawel L

    2015-01-30

    In order to ascertain optimum conditions for biocatalytic processes carried out in vitro, we have designed a bio-opto-electronic system which ensures real-time compensation for depletion of adenosine triphosphate (ATP) in reactions involving transfer of phosphate groups. The system covers ATP concentration range of 2-48 μM. The report demonstrates feasibility of the device operation using apyrase as the ATP-depleting enzyme.

  17. Functional defect of variants in the adenosine triphosphate-binding sites of ABCB4 and their rescue by the cystic fibrosis transmembrane conductance regulator potentiator, ivacaftor (VX-770).

    PubMed

    Delaunay, Jean-Louis; Bruneau, Alix; Hoffmann, Brice; Durand-Schneider, Anne-Marie; Barbu, Véronique; Jacquemin, Emmanuel; Maurice, Michèle; Housset, Chantal; Callebaut, Isabelle; Aït-Slimane, Tounsia

    2017-02-01

    ABCB4 (MDR3) is an adenosine triphosphate (ATP)-binding cassette (ABC) transporter expressed at the canalicular membrane of hepatocytes, where it mediates phosphatidylcholine (PC) secretion. Variations in the ABCB4 gene are responsible for several biliary diseases, including progressive familial intrahepatic cholestasis type 3 (PFIC3), a rare disease that can be lethal in the absence of liver transplantation. In this study, we investigated the effect and potential rescue of ABCB4 missense variations that reside in the highly conserved motifs of ABC transporters, involved in ATP binding. Five disease-causing variations in these motifs have been identified in ABCB4 (G535D, G536R, S1076C, S1176L, and G1178S), three of which are homologous to the gating mutations of cystic fibrosis transmembrane conductance regulator (CFTR or ABCC7; i.e., G551D, S1251N, and G1349D), that were previously shown to be function defective and corrected by ivacaftor (VX-770; Kalydeco), a clinically approved CFTR potentiator. Three-dimensional structural modeling predicted that all five ABCB4 variants would disrupt critical interactions in the binding of ATP and thereby impair ATP-induced nucleotide-binding domain dimerization and ABCB4 function. This prediction was confirmed by expression in cell models, which showed that the ABCB4 mutants were normally processed and targeted to the plasma membrane, whereas their PC secretion activity was dramatically decreased. As also hypothesized on the basis of molecular modeling, PC secretion activity of the mutants was rescued by the CFTR potentiator, ivacaftor (VX-770).

  18. Some aspects of adenosine triphosphate synthesis from adenine and adenosine in human red blood cells

    PubMed Central

    Whittam, R.; Wiley, J. S.

    1968-01-01

    1. The synthesis of ATP has been studied in human erythrocytes. Fresh cells showed no net synthesis of ATP when incubated with adenine or adenosine, although labelled adenine was incorporated into ATP in small amounts. 2. Cold-stored cells (3-6 weeks old) became progressively depleted of adenine nucleotides but incubation with adenosine or adenine plus inosine restored the ATP concentration to normal within 4 hr. Incorporation of labelled adenine or adenosine into the ATP of incubated stored cells corresponded to net ATP synthesis by these cells. 3. Synthesis of ATP from adenosine plus adenine together was 75% derived from adenine and only 25% from adenosine, indicating that nucleotide synthesis from adenine inhibits the simultaneous synthesis of nucleotide from adenosine. PMID:5723519

  19. The breakdown of adenosine triphosphate in the contraction cycle of the frog sartorius muscle

    PubMed Central

    Mommaerts, W. F. H. M.; Wallner, A.

    1967-01-01

    1. It is confirmed that a fluorodinitrobenzene (FDNB)-treated frog sartorius muscle does not split phosphorylcreatine in the course of its contraction cycle, but does use adenosine triphosphate (ATP). 2. Good stoicheiometric relations between the diminution of ATP and the formation of adenosine diphosphate (ADP), adenosine monophosphate (AMP) and phosphate are obtained, and in a 0·2 sec tetanus at 0° C the net break-down of ATP amounts to 0·27, the total equivalent break-down to 0·34 μmoles/g. 3. There is no difference in this quantity between muscles interrupted at the height of contraction and those that have also relaxed, and, in experiments specifically designed to determine relaxation metabolism separately, no such metabolism is found. Thus, all the ATP-break-down occurs in the contraction phase. PMID:6065882

  20. Fluorescence detection of adenosine triphosphate in an aqueous solution using a combination of copper(II) complexes.

    PubMed

    Kataev, Evgeny; Arnold, René; Rüffer, Tobias; Lang, Heinrich

    2012-08-06

    Fluorescent ligands have been designed to form ternary complexes with a Cu(II) cation and phosphates in a buffer solution at physiological pH 7.4. It has been shown that a combination of two different ligands and CuCl(2) allows one to achieve high adenosine triphosphate/adenosine diphosphate, adenosine 5'-monophosphate selectivity, and ratiometric fluorescence sensing, while separately each ligand complex does not have such properties.

  1. Fluorescence detection of adenosine triphosphate through an aptamer-molecular beacon multiple probe.

    PubMed

    Zeng, Xiaodan; Zhang, Xiaoling; Yang, Wen; Jia, Hongying; Li, Yamin

    2012-05-01

    An aptamer-molecular beacon (MB) multiple fluorescent probe for adenosine triphosphate (ATP) assay is proposed in this article. The ATP aptamer was used as a molecular recognition part, and an oligonucleotide (short strand, SS) partially complementary with the aptamer and an MB was used as the other part. In the presence of ATP, the aptamer bound with it, accompanied by the hybridization of MB and SS and the fluorescence recovering. Wherever there is only very weak fluorescence can be measured in the absence of ATP. Based on the relationship of recovering fluorescence and the concentration of ATP, a method for quantifying ATP has been developed. The fluorescence intensity was proportional to the concentration of ATP in the range of 10 to 500 nM with a detection limit of 0.1 nM. Moreover, this method was able to detect ATP with high selectivity in the presence of guanosine triphosphate (GTP), cytidine triphosphate (CTP), and uridine triphosphate (UTP). This method is proved to be simple with high sensitivity, selectivity, and specificity.

  2. Extraction and quantification of adenosine triphosphate in mammalian tissues and cells.

    PubMed

    Chida, Junji; Kido, Hiroshi

    2014-01-01

    Adenosine 5'-triphosphate (ATP) is the "energy currency" of organisms and plays central roles in bioenergetics, whereby its level is used to evaluate cell viability, proliferation, death, and energy transmission. In this chapter, we describe an improved and efficient method for extraction of ATP from tissues and cells using phenol-based reagents. The chaotropic extraction reagents reported so far co-precipitate ATP with insoluble proteins during extraction and with salts during neutralization. In comparison, the phenol-based reagents extract ATP well without the risks of co-precipitation. The extracted ATP can be quantified by the luciferase assay or high-performance liquid chromatography.

  3. Enhanced Diffusion of Molecular Motors in the Presence of Adenosine Triphosphate and External Force

    NASA Astrophysics Data System (ADS)

    Shinagawa, Ryota; Sasaki, Kazuo

    2016-06-01

    The diffusion of a molecular motor in the presence of a constant external force is considered on the basis of a simple theoretical model. The motor is represented by a Brownian particle moving in a series of parabolic potentials placed periodically on a line, and the potential is switched stochastically from one parabola to another by a chemical reaction, which corresponds to the hydrolysis or synthesis of adenosine triphosphate (ATP) in motor proteins. It is found that the diffusion coefficient as a function of the force exhibits peaks. The mechanism of this diffusion enhancement and the possibility of observing it in F1-ATPase, a biological rotary motor, are discussed.

  4. [An adenosine triphosphate bioluminescence assay for detecting the number of living cells].

    PubMed

    Liu, S; Peng, Z; Wang, H; Lou, J; He, B; Tang, Q; Qiu, D

    2000-06-01

    The method for detecting the number of living cells was studied. Using an adenosine triphosphate (ATP) bioluminescence assay, the present authors reported a perfect linear relationship between lg ATP concentrations and lg luminescence counts (r = 0.9963) as well as a relationship between lg number of cells and lg ATP luminescence counts (r = 0.9922). The detectable cells ranged from 10(2) to 10(6) cells/ml, the coefficients of variation 1-3%. This method is simple, accurate and sensitive and has a high reproducibility.

  5. Effects of adenosine triphosphate concentration on motor force regulation during skeletal muscle contraction

    NASA Astrophysics Data System (ADS)

    Wei, J.; Dong, C.; Chen, B.

    2017-03-01

    We employ a mechanical model of sarcomere to quantitatively investigate how adenosine triphosphate (ATP) concentration affects motor force regulation during skeletal muscle contraction. Our simulation indicates that there can be negative cross-bridges resisting contraction within the sarcomere and higher ATP concentration would decrease the resistance force from negative cross-bridges by promoting their timely detachment. It is revealed that the motor force is well regulated only when ATP concentration is above a certain level. These predictions may provide insights into the role of ATP in regulating coordination among multiple motors.

  6. Reexamination of magnetic isotope and field effects on adenosine triphosphate production by creatine kinase.

    PubMed

    Crotty, Darragh; Silkstone, Gary; Poddar, Soumya; Ranson, Richard; Prina-Mello, Adriele; Wilson, Michael T; Coey, J M D

    2012-01-31

    The influence of isotopically enriched magnesium on the creatine kinase catalyzed phosphorylation of adenosine diphosphate is examined in two independent series of experiments where adenosine triphosphate (ATP) concentrations were determined by a luciferase-linked luminescence end-point assay or a real-time spectrophotometric assay. No increase was observed between the rates of ATP production with natural Mg, (24)Mg, and (25)Mg, nor was any significant magnetic field effect observed in magnetic fields from 3 to 1,000 mT. Our results are in conflict with those reported by Buchachenko et al. [J Am Chem Soc 130:12868-12869 (2008)], and they challenge these authors' general claims that a large (two- to threefold) magnetic isotope effect is "universally observable" for ATP-producing enzymes [Her Russ Acad Sci 80:22-28 (2010)] and that "enzymatic phosphorylation is an ion-radical, electron-spin-selective process" [Proc Natl Acad Sci USA 101:10793-10796 (2005)].

  7. Tween 20-stabilized gold nanoparticles combined with adenosine triphosphate-BODIPY conjugates for the fluorescence detection of adenosine with more than 1000-fold selectivity.

    PubMed

    Hung, Szu-Ying; Shih, Ya-Chen; Tseng, Wei-Lung

    2015-02-01

    This study describes the development of a simple, enzyme-free, label-free, sensitive, and selective system for detecting adenosine based on the use of Tween 20-stabilized gold nanoparticles (Tween 20-AuNPs) as an efficient fluorescence quencher for boron dipyrromethene-conjugated adenosine 5'-triphosphate (BODIPY-ATP) and as a recognition element for adenosine. BODIPY-ATP can interact with Tween 20-AuNPs through the coordination between the adenine group of BODIPY-ATP and Au atoms on the NP surface, thereby causing the fluorescence quenching of BODIPY-ATP through the nanometal surface energy transfer (NSET) effect. When adenosine attaches to the NP surface, the attached adenosine exhibits additional electrostatic attraction to BODIPY-ATP. As a result, the presence of adenosine enhances the efficiency of AuNPs in fluorescence quenching of BODIPY-ATP. The AuNP-induced fluorescence quenching of BODIPY-ATP progressively increased with an increase in the concentration of adenosine; the detection limit at a signal-to-noise ratio of 3 for adenosine was determined to be 60nM. The selectivity of the proposed system was more than 1000-fold for adenosine over any adenosine analogs and other nucleotides. The proposed system combined with a phenylboronic acid-containing column was successfully applied to the determination of adenosine in urine.

  8. Vascular CD39/ENTPD1 Directly Promotes Tumor Cell Growth by Scavenging Extracellular Adenosine Triphosphate12

    PubMed Central

    Feng, Lili; Sun, Xiaofeng; Csizmadia, Eva; Han, Lihui; Bian, Shu; Murakami, Takashi; Wang, Xin; Robson, Simon C; Wu, Yan

    2011-01-01

    Extracellular adenosine triphosphate (ATP) is known to boost immune responses in the tumor microenvironment but might also contribute directly to cancer cell death. CD39/ENTPD1 is the dominant ectonucleotidase expressed by endothelial cells and regulatory T cells and catalyzes the sequential hydrolysis of ATP to AMP that is further degraded to adenosine by CD73/ecto-5′-nucleotidase. We have previously shown that deletion of Cd39 results in decreased growth of transplanted tumors in mice, as a result of both defective angiogenesis and heightened innate immune responses (secondary to loss of adenosinergic immune suppression). Whether alterations in local extracellular ATP and adenosine levels as a result of CD39 bioactivity directly affect tumor growth and cytotoxicity has not been investigated to date. We show here that extracellular ATP exerts antitumor activity by directly inhibiting cell proliferation and promoting cancer cell death. ATP-induced antiproliferative effects and cell death are, in large part, mediated through P2X7 receptor signaling. Tumors in Cd39 null mice exhibit increased necrosis in association with P2X7 expression. We further demonstrate that exogenous soluble NTPDase, or CD39 expression by cocultured liver sinusoidal endothelial cells, stimulates tumor cell proliferation and limits cell death triggered by extracellular ATP. Collectively, our findings indicate that local expression of CD39 directly promotes tumor cell growth by scavenging extracellular ATP. Pharmacological or targeted inhibition of CD39 enzymatic activity may find utility as an adjunct therapy in cancer management. PMID:21390184

  9. Fluorescence aptameric sensor for isothermal circular strand-displacement polymerization amplification detection of adenosine triphosphate.

    PubMed

    Song, Weiling; Zhang, Qiao; Xie, Xuxu; Zhang, Shusheng

    2014-11-15

    In this work, isothermal circular strand-displacement polymerization amplification assay is developed for highly specific and sensitive detection of adenosine triphosphate (ATP). The amplification process consists of circular common target molecule-displacement polymerization (CCDP) and circular nucleic acid strand-displacement polymerization (CNDP). In the presence of ATP, the complementary strand was released from the aptamer by the target recognition of ATP, and catalyzed the subsequent cycle reaction. With the polymerase and primer, the displaced target triggers the process of CCDP. With the involvement of nicking endonuclease, the released complementary strand triggers the CNDP. Combined CCDP with CNDP, the exponentially produced fluorescence probes are obtained, achieving a detection limit of ATP as low as 2.6 × 10(-10)M. Moreover, the proposed strategy exhibits an excellent specificity and is successfully applied in real sample assay which demonstrates potential application in practical samples.

  10. Adenosine triphosphate acts as a paracrine signaling molecule to reduce the motility of T cells.

    PubMed

    Wang, Chiuhui Mary; Ploia, Cristina; Anselmi, Fabio; Sarukhan, Adelaida; Viola, Antonella

    2014-06-17

    Organization of immune responses requires exchange of information between cells. This is achieved through either direct cell-cell contacts and establishment of temporary synapses or the release of soluble factors, such as cytokines and chemokines. Here we show a novel form of cell-to-cell communication based on adenosine triphosphate (ATP). ATP released by stimulated T cells induces P2X4/P2X7-mediated calcium waves in the neighboring lymphocytes. Our data obtained in lymph node slices suggest that, during T-cell priming, ATP acts as a paracrine messenger to reduce the motility of lymphocytes and that this may be relevant to allow optimal tissue scanning by T cells.

  11. A Destabilized Case of Stable Effort Angina Pectoris Induced by Low-dose Adenosine Triphosphate.

    PubMed

    Sueta, Daisuke; Kojima, Sunao; Izumiya, Yasuhiro; Yamamuro, Megumi; Kaikita, Koichi; Hokimoto, Seiji; Ogawa, Hisao

    A 79-year-old man was diagnosed with sudden deafness. He had previously experienced a suspected episode of angina pectoris. At a local hospital, after 500 mg of hydrocortisone and 80 mg adenosine triphosphate (ATP) were administered, he became aware of chest discomfort. An electrocardiogram revealed serious ST-segment depressions. He was diagnosed with a non-ST elevated myocardial infarction (NSTEMI). Emergency coronary angiography revealed triple vessel disease, and the lesion was successfully stented. The mechanisms whereby the stable effort angina pectoris destabilized in this case were thought to include a reduction of the local blood flow because of an ATP product and probable thrombus formation in response to the administered steroids.

  12. Synthesis of γ-Phosphate-Labeled and Doubly Labeled Adenosine Triphosphate Analogs.

    PubMed

    Hacker, Stephan M; Welter, Moritz; Marx, Andreas

    2015-03-09

    This unit describes the synthesis of γ-phosphate-labeled and doubly labeled adenosine triphosphate (ATP) analogs and their characterization using the phosphodiesterase I from Crotalus adamanteus (snake venom phosphodiesterase; SVPD). In the key step of the synthesis, ATP or an ATP analog, bearing a linker containing a trifluoroacetamide group attached to the nucleoside, are modified with an azide-containing linker at the terminal phosphate using an alkylation reaction. Subsequently, different labels are introduced to the linkers by transformation of one functional group to an amine and coupling to an N-hydroxysuccinimide ester. Specifically, the Staudinger reaction of the azide is employed as a straightforward means to obtain an amine in the presence of various labels. Furthermore, the fluorescence characteristics of a fluorogenic, doubly labeled ATP analog are investigated following enzymatic cleavage by SVPD.

  13. A Destabilized Case of Stable Effort Angina Pectoris Induced by Low-dose Adenosine Triphosphate

    PubMed Central

    Sueta, Daisuke; Kojima, Sunao; Izumiya, Yasuhiro; Yamamuro, Megumi; Kaikita, Koichi; Hokimoto, Seiji; Ogawa, Hisao

    2016-01-01

    A 79-year-old man was diagnosed with sudden deafness. He had previously experienced a suspected episode of angina pectoris. At a local hospital, after 500 mg of hydrocortisone and 80 mg adenosine triphosphate (ATP) were administered, he became aware of chest discomfort. An electrocardiogram revealed serious ST-segment depressions. He was diagnosed with a non-ST elevated myocardial infarction (NSTEMI). Emergency coronary angiography revealed triple vessel disease, and the lesion was successfully stented. The mechanisms whereby the stable effort angina pectoris destabilized in this case were thought to include a reduction of the local blood flow because of an ATP product and probable thrombus formation in response to the administered steroids. PMID:27853071

  14. Erythrocyte 2,3-diphosphoglycerate and adenosine-triphosphate in cretins living at high altitude.

    PubMed

    Adams, W H

    1976-01-01

    A comparison of concentrations of 2,3-diphosphoglycerate (2,3-DPG) and adenosine-triphosphate (ATP) in the red cells of cretins and normal controls living at 3,700 m in the Nepal Himalayas has shown that 2,3-DPG and ATP levels were higher in the cretins. A negative correlation between hemoglobin and 2.3-DPG level was found. Chronic hypoxia appears to have provided the additional stress required to differentiate the significance of thyroid hormone deficiency in producing anemia from its effect on 2,3-DPG levels. If thyroid hormone is in fact one regulator of 2,3-DPG, the anemia of hypothyroidism appears to be more significant. This also suggest that the anemia of hypothyroidism, is at least in part, "pathologic" as opposed to "adaptive".

  15. Fabrication of Adenosine Triphosphate-Molecule Recognition Chip by Means of Bioluminous Enzyme Luciferase

    NASA Astrophysics Data System (ADS)

    Tanii, Takashi; Goto, Tomomi; Iida, Tomoyuki; Koh-Masahara, Meishoku; Ohdomari, Iwao

    2001-10-01

    We have succeeded in detecting the adenosine triphosphate (ATP) concentration in a solution quantitatively using an ATP-molecule recognition chip. The ATP-molecule recognition chip is composed of a silicon photodiode on which bioluminous enzyme luciferase is immobilized. When the chip was immersed in an ATP-containing solution, the luciferase emitted light and the photoinduced current detected by the photodiode was in proportion to the ATP concentration. We found that the photoinduced current fits the Michaelis-Menten plot. These results indicate that the luciferase is successfully immobilized on the silicon chip without losing the bioluminous activity and that the proposed device enables us to detect the ATP concentration in a solution by measuring the photoinduced current.

  16. Aptamer fluorescence anisotropy sensors for adenosine triphosphate by comprehensive screening tetramethylrhodamine labeled nucleotides.

    PubMed

    Zhao, Qiang; Lv, Qin; Wang, Hailin

    2015-08-15

    We previously reported a fluorescence anisotropy (FA) approach for small molecules using tetramethylrhodamine (TMR) labeled aptamer. It relies on target-binding induced change of intramolecular interaction between TMR and guanine (G) base. TMR-labeling sites are crucial for this approach. Only terminal ends and thymine (T) bases could be tested for TMR labeling in our previous work, possibly causing limitation in analysis of different targets with this FA strategy. Here, taking the analysis of adenosine triphosphate (ATP) as an example, we demonstrated a success of conjugating TMR on other bases of aptamer adenine (A) or cytosine (C) bases and an achievement of full mapping various labeling sites of aptamers. We successfully constructed aptamer fluorescence anisotropy (FA) sensors for adenosine triphosphate (ATP). We conjugated single TMR on adenine (A), cytosine (C), or thymine (T) bases or terminals of a 25-mer aptamer against ATP and tested FA responses of 14 TMR-labeled aptamer to ATP. The aptamers having TMR labeled on the 16th base C or 23rd base A were screened out and exhibited significant FA-decreasing or FA-increasing responses upon ATP, respectively. These two favorable TMR-labeled aptamers enabled direct FA sensing ATP with a detection limit of 1 µM and the analysis of ATP in diluted serum. The comprehensive screening various TMR labeling sites of aptamers facilitates the successful construction of FA sensors using TMR-labeled aptamers. It will expand application of TMR-G interaction based aptamer FA strategy to a variety of targets.

  17. Reexamination of magnetic isotope and field effects on adenosine triphosphate production by creatine kinase

    PubMed Central

    Crotty, Darragh; Silkstone, Gary; Poddar, Soumya; Ranson, Richard; Prina-Mello, Adriele; Wilson, Michael T.; Coey, J. M. D.

    2012-01-01

    The influence of isotopically enriched magnesium on the creatine kinase catalyzed phosphorylation of adenosine diphosphate is examined in two independent series of experiments where adenosine triphosphate (ATP) concentrations were determined by a luciferase-linked luminescence end-point assay or a real-time spectrophotometric assay. No increase was observed between the rates of ATP production with natural Mg, 24Mg, and 25Mg, nor was any significant magnetic field effect observed in magnetic fields from 3 to 1,000 mT. Our results are in conflict with those reported by Buchachenko et al. [J Am Chem Soc 130:12868–12869 (2008)], and they challenge these authors’ general claims that a large (two- to threefold) magnetic isotope effect is “universally observable” for ATP-producing enzymes [Her Russ Acad Sci 80:22–28 (2010)] and that “enzymatic phosphorylation is an ion-radical, electron-spin-selective process” [Proc Natl Acad Sci USA 101:10793–10796 (2005)]. PMID:22198842

  18. Hybrid integrated biological-solid-state system powered with adenosine triphosphate

    NASA Astrophysics Data System (ADS)

    Roseman, Jared M.; Lin, Jianxun; Ramakrishnan, Siddharth; Rosenstein, Jacob K.; Shepard, Kenneth L.

    2015-12-01

    There is enormous potential in combining the capabilities of the biological and the solid state to create hybrid engineered systems. While there have been recent efforts to harness power from naturally occurring potentials in living systems in plants and animals to power complementary metal-oxide-semiconductor integrated circuits, here we report the first successful effort to isolate the energetics of an electrogenic ion pump in an engineered in vitro environment to power such an artificial system. An integrated circuit is powered by adenosine triphosphate through the action of Na+/K+ adenosine triphosphatases in an integrated in vitro lipid bilayer membrane. The ion pumps (active in the membrane at numbers exceeding 2 × 106 mm-2) are able to sustain a short-circuit current of 32.6 pA mm-2 and an open-circuit voltage of 78 mV, providing for a maximum power transfer of 1.27 pW mm-2 from a single bilayer. Two series-stacked bilayers provide a voltage sufficient to operate an integrated circuit with a conversion efficiency of chemical to electrical energy of 14.9%.

  19. Effect of adenosine triphosphate and some derivatives on cerebral blood flow and metabolism.

    PubMed Central

    Forrester, T; Harper, A M; MacKenzie, E T; Thomson, E M

    1979-01-01

    1. Responses of cerebral blood vessels to peri- and intravascular doses of ATP (adenosine triphosphate) and some derivatives were studied in cat and baboon. 2. Perivascular application of ATP to cat pial arterioles gave a threshold dilatory effect at a concentration of 10(-11) M. This figure is comparable to the amount of ATP calculated to be released from electrically stimulated brain slices. 3. It is concluded that adenine nucleotides have a major role to play in the local control of cerebral blood flow. 4. Intracarotid injection of ATP showed a calculated threshold effect at 4 x 10(8) M in the cat and 4 x 10(-9) M in the baboon. 5. The threshold response of the vasculature to intracarotid adenosine lay between 4 x 10(-7) M and 4 x 10(-6) M in the baboon. Little effect was produced with AMP, pyrophosphate and inorganic phosphate. 6. Intracarotid ATP increased the oxygen consumption of the baboon brain parenchyma. This effect was attributed in part to an elevation of the cellular cyclic AMP levels. 7. Osmotic disruption of the blood-brain barrier in baboon did not affect the vasodilatory or metabolic effect of intracarotid ATP. 8. It is postulated that circulating purine compounds mediate a form of metabolic communication inthe body. Also, release of purine compounds from active local nerves might influence cerebral blood flow. PMID:119042

  20. Hybrid integrated biological–solid-state system powered with adenosine triphosphate

    PubMed Central

    Roseman, Jared M.; Lin, Jianxun; Ramakrishnan, Siddharth; Rosenstein, Jacob K.; Shepard, Kenneth L.

    2015-01-01

    There is enormous potential in combining the capabilities of the biological and the solid state to create hybrid engineered systems. While there have been recent efforts to harness power from naturally occurring potentials in living systems in plants and animals to power complementary metal-oxide-semiconductor integrated circuits, here we report the first successful effort to isolate the energetics of an electrogenic ion pump in an engineered in vitro environment to power such an artificial system. An integrated circuit is powered by adenosine triphosphate through the action of Na+/K+ adenosine triphosphatases in an integrated in vitro lipid bilayer membrane. The ion pumps (active in the membrane at numbers exceeding 2 × 106 mm−2) are able to sustain a short-circuit current of 32.6 pA mm−2 and an open-circuit voltage of 78 mV, providing for a maximum power transfer of 1.27 pW mm−2 from a single bilayer. Two series-stacked bilayers provide a voltage sufficient to operate an integrated circuit with a conversion efficiency of chemical to electrical energy of 14.9%. PMID:26638983

  1. Extracellular adenosine 5’-triphosphate concentrations changes in rat spinal cord associated with the activation of urinary bladder afferents. A microdialysis study

    PubMed Central

    Rocha, Jeová Nina

    2016-01-01

    ABSTRACT Objective To determine adenosine 5’-triphosphate levels in the interstice of spinal cord L6-S1 segment, under basal conditions or during mechanical and chemical activation of urinary bladder afferents. Methods A microdialysis probe was transversally implanted in the dorsal half of spinal cord L6-S1 segment in female rats. Microdialysate was collected at 15 minutes intervals during 135 minutes, in anesthetized animals. Adenosine 5’-triphosphate concentrations were determined with a bioluminescent assay. In one group of animals (n=7) microdialysate samples were obtained with an empty bladder during a 10-minutes bladder distension to 20 or 40cmH2O with either saline, saline with acetic acid or saline with capsaicin. In another group of animals (n=6) bladder distention was performed and the microdialysis solution contained the ectonucleotidase inhibitor ARL 67156. Results Basal extracellular adenosine triphosphate levels were 110.9±35.34fmol/15 minutes, (mean±SEM, n=13), and bladder distention was associated with a significant increase in adenosine 5’-triphosphate levels which was not observed after bladder distention with saline solution containing capsaicin (10µM). Microdialysis with solution containing ARL 67156 (1mM) was associated with significantly higher extracellular adenosine 5’-triphosphate levels and no further increase in adenosine 5’-triphosphate was observed during bladder distension. Conclusion Adenosine 5’-triphosphate was present in the interstice of L6-S1 spinal cord segments, was degraded by ectonucleotidase, and its concentration increased following the activation of bladder mechanosensitive but not of the chemosensitive afferents fibers. Adenosine 5’-triphosphate may originate either from the central endings of bladder mechanosensitive primary afferent neurons, or most likely from intrinsic spinal neurons, or glial cells and its release appears to be modulated by capsaicin activated bladder primary afferent or by adenosine

  2. Detection of adenosine triphosphate through polymerization-induced aggregation of actin-conjugated gold/silver nanorods

    NASA Astrophysics Data System (ADS)

    Liao, Yu-Ju; Shiang, Yen-Chun; Chen, Li-Yi; Hsu, Chia-Lun; Huang, Chih-Ching; Chang, Huan-Tsung

    2013-11-01

    We have developed a simple and selective nanosensor for the optical detection of adenosine triphosphate (ATP) using globular actin-conjugated gold/silver nanorods (G-actin-Au/Ag NRs). By simply mixing G-actin and Au/Ag NRs (length ˜56 nm and diameter ˜12 nm), G-actin-Au/Ag NRs were prepared which were stable in physiological solutions (25 mM Tris-HCl, 150 mM NaCl, 5.0 mM KCl, 3.0 mM MgCl2 and 1.0 mM CaCl2; pH 7.4). Introduction of ATP into the G-actin-Au/Ag NR solutions in the presence of excess G-actin induced the formation of filamentous actin-conjugated Au/Ag NR aggregates through ATP-induced polymerization of G-actin. When compared to G-actin-modified spherical Au nanoparticles having a size of 13 nm or 56 nm, G-actin-Au/Ag NRs provided better sensitivity for ATP, mainly because the longitudinal surface plasmon absorbance of the Au/Ag NR has a more sensitive response to aggregation. This G-actin-Au/Ag NR probe provided high sensitivity (limit of detection 25 nM) for ATP with remarkable selectivity (>10-fold) over other adenine nucleotides (adenosine, adenosine monophosphate and adenosine diphosphate) and nucleoside triphosphates (guanosine triphosphate, cytidine triphosphate and uridine triphosphate). It also allowed the determination of ATP concentrations in plasma samples without conducting tedious sample pretreatments; the only necessary step was simple dilution. Our experimental results are in good agreement with those obtained from a commercial luciferin-luciferase bioluminescence assay. Our simple, sensitive and selective approach appears to have a practical potential for the clinical diagnosis of diseases (e.g. cystic fibrosis) associated with changes in ATP concentrations.

  3. Detection of adenosine triphosphate through polymerization-induced aggregation of actin-conjugated gold/silver nanorods.

    PubMed

    Liao, Yu-Ju; Shiang, Yen-Chun; Chen, Li-Yi; Hsu, Chia-Lun; Huang, Chih-Ching; Chang, Huan-Tsung

    2013-11-08

    We have developed a simple and selective nanosensor for the optical detection of adenosine triphosphate (ATP) using globular actin-conjugated gold/silver nanorods (G-actin-Au/Ag NRs). By simply mixing G-actin and Au/Ag NRs (length ~56 nm and diameter ~12 nm), G-actin-Au/Ag NRs were prepared which were stable in physiological solutions (25 mM Tris-HCl, 150 mM NaCl, 5.0 mM KCl, 3.0 mM MgCl2 and 1.0 mM CaCl2; pH 7.4). Introduction of ATP into the G-actin-Au/Ag NR solutions in the presence of excess G-actin induced the formation of filamentous actin-conjugated Au/Ag NR aggregates through ATP-induced polymerization of G-actin. When compared to G-actin-modified spherical Au nanoparticles having a size of 13 nm or 56 nm, G-actin-Au/Ag NRs provided better sensitivity for ATP, mainly because the longitudinal surface plasmon absorbance of the Au/Ag NR has a more sensitive response to aggregation. This G-actin-Au/Ag NR probe provided high sensitivity (limit of detection 25 nM) for ATP with remarkable selectivity (>10-fold) over other adenine nucleotides (adenosine, adenosine monophosphate and adenosine diphosphate) and nucleoside triphosphates (guanosine triphosphate, cytidine triphosphate and uridine triphosphate). It also allowed the determination of ATP concentrations in plasma samples without conducting tedious sample pretreatments; the only necessary step was simple dilution. Our experimental results are in good agreement with those obtained from a commercial luciferin-luciferase bioluminescence assay. Our simple, sensitive and selective approach appears to have a practical potential for the clinical diagnosis of diseases (e.g. cystic fibrosis) associated with changes in ATP concentrations.

  4. Effects of caffeine on fractional flow reserve values measured using intravenous adenosine triphosphate.

    PubMed

    Nakayama, Masafumi; Chikamori, Taishiro; Uchiyama, Takashi; Kimura, Yo; Hijikata, Nobuhiro; Ito, Ryosuke; Yuhara, Mikio; Sato, Hideaki; Kobori, Yuichi; Yamashina, Akira

    2017-01-21

    We investigated the effects of caffeine intake on fractional flow reserve (FFR) values measured using intravenous adenosine triphosphate (ATP) before cardiac catheterization. Caffeine is a competitive antagonist for adenosine receptors; however, it is unclear whether this antagonism affects FFR values. Patients were evenly randomized into 2 groups preceding the FFR study. In the caffeine group (n = 15), participants were given coffee containing 222 mg of caffeine 2 h before the catheterization. In the non-caffeine group (n = 15), participants were instructed not to take any caffeine-containing drinks or foods for at least 12 h before the catheterization. FFR was performed in patients with more than intermediate coronary stenosis using the intravenous infusion of ATP at 140 μg/kg/min (normal dose) and 170 μg/kg/min (high dose), and the intracoronary infusion of papaverine. FFR was followed for 30 s after maximal hyperemia. In the non-caffeine group, the FFR values measured with ATP infusion were not significantly different from those measured with papaverine infusion. However, in the caffeine group, the FFR values were significantly higher after ATP infusion than after papaverine infusion (P = 0.002 and P = 0.007, at normal and high dose ATP vs. papaverine, respectively). FFR values with ATP infusion were significantly increased 30 s after maximal hyperemia (P = 0.001 and P < 0.001 for normal and high dose ATP, respectively). The stability of the FFR values using papaverine showed no significant difference between the 2 groups. Caffeine intake before the FFR study affected FFR values and their stability. These effects could not be reversed by an increased ATP dose.

  5. Usefulness of adenosine triphosphate-atropine stress echocardiography for detecting coronary artery stenosis.

    PubMed

    Miyazono, Y; Kisanuki, A; Toyonaga, K; Matsushita, R; Otsuji, Y; Arima, S; Nakao, S; Tanaka, H

    1998-08-01

    There have been few studies on adenosine triphosphate (AT) stress echocardiography. The AT stress test may have fewer adverse effects than the adenosine stress test. The addition of atropine to AT echocardiography may enhance the sensitivity for detection of coronary artery disease (CAD). The purpose of this study was to determine the utility of AT-atropine echocardiography for detection of CAD. The group studied consisted of 112 patients with suspected CAD. Sixty-one patients did not have a history of prior myocardial infarction (group I) and 51 patients did (group II). AT was infused intravenously at 180 microg/kg/min for 14 minutes. Atropine (0.25 mg intravenously, repeated up to maximum total dose of 1 mg) was administered starting after 8 minutes of AT infusion. Ischemic response was defined as new or worsening wall motion abnormality occurring during the infusion. The sensitivity and specificity for detection of CAD were assessed using the representative echocardiograms during single AT infusion and AT-atropine infusion. Sixty-two patients had CAD. Fifty-eight patients (52%) developed minor side effects that resolved promptly. The rate-pressure product (10(3)/mm Hg beats/min) was significantly increased at 12 minutes of infusion (12.4+/-3.2) compared with that at baseline (9.1+/-2.3) and that at 6 minutes of infusion (9.4+/-2.1). The sensitivity for detection of CAD was 45% for AT echocardiography and 74% for AT-atropine echocardiography. The specificity was 94% for AT echocardiography and 90% for AT-atropine echocardiography. The sensitivity and specificity of AT-atropine echocardiography was 78% and 93%, respectively, in group I, and 70% and 86%, respectively, in group II. In conclusion, AT-atropine stress echocardiography seems to be well tolerated, safe, and useful for detection of CAD.

  6. Evidence of a calcium-induced structural change in the ATP-binding site of the sarcoplasmic-reticulum Ca2+-ATPase using terbium formycin triphosphate as an analogue of Mg-ATP.

    PubMed

    Girardet, J L; Dupont, Y; Lacapere, J J

    1989-09-01

    Terbium ions and terbium formycin triphosphate have been used to investigate the interactions between the cation and nucleotide binding sites of the sarcoplasmic reticulum Ca2+-ATPase. Three classes of Tb3+-binding sites have been found: a first class of low-affinity (Kd = 10 microM) corresponds to magnesium binding sites, located near a tryptophan residue of the protein; a second class of much higher affinity (less than 0.1 microM) corresponds to the calcium transport sites, their occupancy by terbium induces the E1 to E2 conformational change of the Ca2+-ATPase; a third class of sites is revealed by following the fluorescence transfer from formycin triphosphate (FTP) to terbium, evidencing that terbium ions can also bind into the nucleotide binding site at the same time as FTP. Substitution of H2O by D2O shows that Tb-FTP binding to the enzyme nucleotide site is associated with an important dehydration of the terbium ions associated with FTP. Two terbium ions, at least, bind to the Ca2+-ATPase in the close vicinity of FTP when this nucleotide is bound to the ATPase nucleotide site. Addition of calcium quenches the fluorescence signal of the terbium-FTP complex bound to the enzyme. Calcium concentration dependence shows that this effect is associated with the replacement of terbium by calcium in the transport sites, inducing the E2----E1 transconformation when calcium is bound. One interpretation of this fluorescence quenching is that the E1----E2 transition induces an important structural change in the nucleotide site. Another interpretation is that the high-affinity calcium sites are located very close to the Tb-FTP complex bound to the nucleotide site.

  7. Use of extractable adenosine triphosphate to estimate the viable cell mass in dental plaque samples obtained from monkeys.

    PubMed Central

    Robrish, S A; Kemp, C W; Bowen, W H

    1978-01-01

    The viable cell mass in plaque samples obtained from monkeys was estimated by determining the concentration of extractable adenosine triphosphate (ATP), and total cell mass was estimated by measuring the protein content. The results were expressed in terms of the specific ATP and protein contents of Streptococcus sanguis. The viable counts estimated by these techniques were comparable to or exceeded viable counts obtained by other investigators using conventional bacteriological methods. PMID:417674

  8. Adenosine Triphosphate stimulates differentiation and mineralization in human osteoblast-like Saos-2 cells.

    PubMed

    Cutarelli, Alessandro; Marini, Mario; Tancredi, Virginia; D'Arcangelo, Giovanna; Murdocca, Michela; Frank, Claudio; Tarantino, Umberto

    2016-05-01

    In the last years adenosine triphosphate (ATP) and subsequent purinergic system activation through P2 receptors were investigated highlighting their pivotal role in bone tissue biology. In osteoblasts ATP can regulate several activities like cell proliferation, cell death, cell differentiation and matrix mineralization. Since controversial results exist, in this study we analyzed the ATP effects on differentiation and mineralization in human osteoblast-like Saos-2 cells. We showed for the first time the altered functional activity of ATP receptors. Despite that, we found that ATP can reduce cell proliferation and stimulate osteogenic differentiation mainly in the early stages of in vitro maturation as evidenced by the enhanced expression of alkaline phosphatase (ALP), Runt-related transcription factor 2 (Runx2) and Osteocalcin (OC) genes and by the increased ALP activity. Moreover, we found that ATP can affect mineralization in a biphasic manner, at low concentrations ATP always increases mineral deposition while at high concentrations it always reduces mineral deposition. In conclusion, we show the osteogenic effect of ATP on both early and late stage activities like differentiation and mineralization, for the first time in human osteoblastic cells.

  9. An adenosine triphosphate-independent proteasome activator contributes to the virulence of Mycobacterium tuberculosis.

    PubMed

    Jastrab, Jordan B; Wang, Tong; Murphy, J Patrick; Bai, Lin; Hu, Kuan; Merkx, Remco; Huang, Jessica; Chatterjee, Champak; Ovaa, Huib; Gygi, Steven P; Li, Huilin; Darwin, K Heran

    2015-04-07

    Mycobacterium tuberculosis encodes a proteasome that is highly similar to eukaryotic proteasomes and is required to cause lethal infections in animals. The only pathway known to target proteins for proteasomal degradation in bacteria is pupylation, which is functionally analogous to eukaryotic ubiquitylation. However, evidence suggests that the M. tuberculosis proteasome contributes to pupylation-independent pathways as well. To identify new proteasome cofactors that might contribute to such pathways, we isolated proteins that bound to proteasomes overproduced in M. tuberculosis and found a previously uncharacterized protein, Rv3780, which formed rings and capped M. tuberculosis proteasome core particles. Rv3780 enhanced peptide and protein degradation by proteasomes in an adenosine triphosphate (ATP)-independent manner. We identified putative Rv3780-dependent proteasome substrates and found that Rv3780 promoted robust degradation of the heat shock protein repressor, HspR. Importantly, an M. tuberculosis Rv3780 mutant had a general growth defect, was sensitive to heat stress, and was attenuated for growth in mice. Collectively, these data demonstrate that ATP-independent proteasome activators are not confined to eukaryotes and can contribute to the virulence of one the world's most devastating pathogens.

  10. Galactosylated chitosan oligosaccharide nanoparticles for hepatocellular carcinoma cell-targeted delivery of adenosine triphosphate.

    PubMed

    Zhu, Xiu Liang; Du, Yong Zhong; Yu, Ri Sheng; Liu, Ping; Shi, Dan; Chen, Ying; Wang, Ying; Huang, Fang Fang

    2013-07-29

    Nanoparticles composed of galactosylated chitosan oligosaccharide (Gal-CSO) and adenosine triphosphate (ATP) were prepared for hepatocellular carcinoma cell-specific uptake, and the characteristics of Gal-CSO/ATP nanoparticles were evaluated. CSO/ATP nanoparticles were prepared as a control. The average diameter and zeta potential of Gal-CSO/ATP nanoparticles were 51.03 ± 3.26 nm and 30.50 ± 1.25 mV, respectively, suggesting suitable properties for a drug delivery system. Subsequently, the cytotoxicity of Gal-CSO/ATP nanoparticles were examined by the methyl tetrazolium (MTT) assay, and the half maximal inhibitory concentration (IC50) values were calculated with HepG2 (human hepatocellular carcinoma cell line) cells. The results showed that the cytotoxic effect of nanoparticles on HepG2 cells was low. In the meantime, it was also found that the Gal-CSO/ATP nanoparticles could be uptaken by HepG2 cells, due to expression of the asialoglycoprotein receptor (ASGP-R) on their surfaces. The presented results indicate that the Gal-CSO nanoparticles might be very attractive to be used as an intracellular drug delivery carrier for hepatocellular carcinoma cell targeting, thus warranting further in vivo or clinical investigations.

  11. Homogeneously ultrasensitive electrochemical detection of adenosine triphosphate based on multiple signal amplification strategy.

    PubMed

    Chen, Xiaojun; Ge, Lingna; Guo, Buhua; Yan, Ming; Hao, Ning; Xu, Lin

    2014-08-15

    An ultrasensitive electrochemical aptasensor was successfully fabricated for the detection of adenosine triphosphate (ATP). For the first time, one detection system combined several elements: magnetic aptamer sequences for target recognition and separation, a DNAzyme assisted cyclic signal amplification strategy, layer-by-layer (LBL) quantum dots (QDs) composites for promoting square wave anodic stripping voltammetric (SWASV) analysis and Bi, Nafion (Nf) and three-dimensional ordered macroporous polyaniline-ionic liquid (Bi/Nf/3DOM PANI-IL) film modified glassy carbon electrode (GCE) for monitoring enhanced SWASV signal. The modification of Nf/3DOM PANI-IL on GCE showed that the preconcentration efficiency was improved by the electrostatic absorption of Cd(2+) with negative Nf layer with the enhanced analytical sensitivity due to a large active surface area of 3DOM structure. The increased SWASV peak current values of the label (CdS)4@SiO2 composites were found to be proportional to the logarithmic value of ATP concentrations in the range of 1pM-10nM and 10nM-1µM, with the detection limit as low as 0.5pM. The proposed aptasensor has shown an excellent performance such as high sensitivity, good selectivity and analytical application in real samples. The results demonstrated that the multiple signal amplified strategy we developed was feasible for clinical ATP assay and would provide a promising model for the detection of other small molecules.

  12. Intracellular and extracellular adenosine triphosphate in regulation of insulin secretion from pancreatic β cells (β).

    PubMed

    Wang, Chunjiong; Geng, Bin; Cui, Qinghua; Guan, Youfei; Yang, Jichun

    2014-03-01

    Adenosine triphosphate (ATP) synthesis and release in mitochondria play critical roles in regulating insulin secretion in pancreatic β cells. Mitochondrial dysfunction is mainly characterized by a decrease in ATP production, which is a central event in the progression of pancreatic β cell dysfunction and diabetes. ATP has been demonstrated to regulate insulin secretion via several pathways: (i) Intracellular ATP directly closes ATP-sensitive potassium channel to open L-type calcium channel, leading to an increase in free cytosolic calcium levels and exocytosis of insulin granules; (ii) A decrease in ATP production is always associated with an increase in production of reactive oxygen species, which exerts deleterious effects on pancreatic β cell survival and insulin secretion; and (iii) ATP can be co-secreted with insulin from pancreatic β cells, and the released ATP functions as an autocrine signal to modulate insulin secretory process via P2 receptors on the cell membrane. In this review, the recent findings regarding the role and mechanism of ATP synthesis and release in regulation of insulin secretion from pancreatic β cells will be summarized and discussed.

  13. A target-triggered strand displacement reaction cycle: the design and application in adenosine triphosphate sensing.

    PubMed

    Cheng, Sheng; Zheng, Bin; Wang, Mozhen; Lam, Michael Hon-Wah; Ge, Xuewu

    2014-02-01

    A strand displacement reaction (SDR) system that runs solely on oligonucleotides has been developed for the amplification detection of adenosine triphosphate (ATP). It involves a target-induced SDR and an entropy-driven catalytic cycle of two SDRs with five oligonucleotides, denoted as substrate, fuel, catalyst, C-1, and C-2. Catalyst, released from the ATP aptamer-catalyst duplex by ATP molecule, catalyzes the SDRs to finally form the substrate-fuel duplex. All of the intermediates in the catalytic SDR processes have been identified by polyacrylamide gel electrophoresis (PAGE) analysis. The introduction of ATP into the SDR system will induce the ATP aptamer to form G-quadruplex conformation so as to release catalyst and trigger the SDR cycle. When the substrate and C-2 oligonucleotides were labeled with a carboxyfluorescein (FAM) fluorophore and a 4-([4-(dimethylamino)phenyl]azo)benzoic acid (DABCYL) quencher, this SDR catalytic system exhibited a "turn-on" response for ATP. The condition for detecting ATP, such as Mg²⁺ concentration, has been optimized to afford a detection limit of 20 nM. This work provides an enzyme-free biosensing strategy and has potential application in aptamer-based biosensing.

  14. Aptamer-based electrochemical biosensor for detection of adenosine triphosphate using a nanoporous gold platform.

    PubMed

    Kashefi-Kheyrabadi, Leila; Mehrgardi, Masoud A

    2013-12-01

    In spite of the promising applications of aptamers in the bioassays, the development of aptamer-based electrochemical biosensors with the improved limit of detection has remained a great challenge. A strategy for the amplification of signal, based on application of nanostructures as platforms for the construction of an electrochemical adenosine triphosphate (ATP) aptasensor, is introduced in the present manuscript. A sandwich assay is designed by immobilizing a fragment of aptamer on a nanoporous gold electrode (NPGE) and its association to second fragment in the presence of ATP. Consequently, 3, 4-diaminobenzoic acid (DABA), as a molecular reporter, is covalently attached to the amine-label of the second fragment, and the direct oxidation signal of DABA is followed as the analytical signal. The sensor can detect the concentrations of ATP as low as submicromolar scales. Furthermore, 3.2% decrease in signal is observed by keeping the aptasensor at 4 °C for a week in buffer solution, implying a desirable stability. Moreover, analog nucleotides, including GTP, UTP and CTP, do not show serious interferences and this sensor easily detects its target in deproteinized human blood plasma.

  15. A Graphene and Aptamer Based Liquid Gated FET-Like Electrochemical Biosensor to Detect Adenosine Triphosphate.

    PubMed

    Mukherjee, Souvik; Meshik, Xenia; Choi, Min; Farid, Sidra; Datta, Debopam; Lan, Yi; Poduri, Shripriya; Sarkar, Ketaki; Baterdene, Undarmaa; Huang, Ching-En; Wang, Yung Yu; Burke, Peter; Dutta, Mitra; Stroscio, Michael A

    2015-12-01

    Here we report successful demonstration of a FET-like electrochemical nano-biosensor to accurately detect ultralow concentrations of adenosine triphosphate. As a 2D material, graphene is a promising candidate due to its large surface area, biocompatibility, and demonstrated surface binding chemistries and has been employed as the conducting channel. A short 20-base DNA aptamer is used as the sensing element to ensure that the interaction between the analyte and the aptamer occurs within the Debye length of the electrolyte (PBS). Significant increase in the drain current with progressive addition of ATP is observed whereas for control experiments, no distinct change in the drain current occurs. The sensor is found to be highly sensitive in the nanomolar (nM) to micromolar ( μM) range with a high sensitivity of 2.55 μA (mM) (-1), a detection limit as low as 10 pM, and it has potential application in medical and biological settings to detect low traces of ATP. This simplistic design strategy can be further extended to efficiently detect a broad range of other target analytes.

  16. Improving environmental cleaning in clinical areas: staff education based on adenosine triphosphate readings.

    PubMed

    Villanueva, Ariadna; Guanche, Humberto

    2016-11-01

    Aim To describe the effect of education on environmental cleaning in patient care areas using adenosine triphosphate (ATP) readings. Method A quality improvement initiative was developed in a community hospital in Qatar. Over a two-month period, an infection-control practitioner monitored ATP readings in patient care areas, at any time and regardless of the time of the previous disinfection. The initiative included staff education, use of ATP readings and the drawing up of quarterly quality reports. The ATP readings were considered 'pass', meaning well cleaned, or 'fail', meaning non-cleaned, according to the following standards:>250 relative light units (RLU) in non-critical units and<200RLU for critical units. The proportion of test passes was calculated per 100 tests performed. Results A total of 1,617 tests were performed, after which 1,259 (78%) surfaces were identified as well cleaned. The lowest proportion of non-pass and higher ATP readings was observed in non-critical areas. The test points with the lowest proportion of passes were telephones (40.5%), a medication dispensing system (58.5%), an oximeter (66.7%) and callbox buttons (67.6%). A sustained increase in test passes was observed during the study period. Conclusion There was an improvement in environmental cleaning due to monitoring of ATP on surfaces and staff education.

  17. A multifunctional label-free electrochemical impedance biosensor for Hg(2+), adenosine triphosphate and thrombin.

    PubMed

    Chen, Lifen; Chen, Zhong-Ning

    2015-01-01

    A multifunctional label-free biosensor for the detection of Hg(2+), adenosine triphosphate and thrombin has been developed based on the changing of the electrochemical impedance spectroscopy (EIS) from the modified electrodes when nucleic acid subunits interacting with different targets. The modified electrode consists of three interaction sections, including DNA with T-T mismatch recognizing Hg(2+) to form T-Hg(2+)-T complex, split DNA chip against ATP, and DNA domin against thrombin to form G-quadruplex. Upon DNA interaction with thrombin or ATP, an increased charge transfer resistance (Rct) had been detected. However, a decreased Rct against Hg(2+) was obtained. The Rct difference (ΔRct) has relationship with the concentration of the different targets, Hg(2+), ATP and thrombin can be selectively detected with the detection limit of 0.03, 0.25, and 0.20 nmol L(-1), respectively. To separately detect the three analytes existing in the same sample, ATP aptamer, G-rich DNA strands and EDTA were applied to mask ATP, Hg(2+) or thrombin separately.

  18. Fullerene derived molecularly imprinted polymer for chemosensing of adenosine-5'-triphosphate (ATP).

    PubMed

    Sharma, Piyush S; Dabrowski, Marcin; Noworyta, Krzysztof; Huynh, Tan-Phat; Kc, Chandra B; Sobczak, Janusz W; Pieta, Piotr; D'Souza, Francis; Kutner, Wlodzimierz

    2014-09-24

    For molecular imprinting of oxidatively electroactive analytes by electropolymerization, we used herein reductively electroactive functional monomers. As a proof of concept, we applied C60 fullerene adducts as such for the first time. For that, we derivatized C60 to bear either an uracil or an amide, or a carboxy addend for recognition of the adenosine-5'-triphosphate (ATP) oxidizable analyte with the ATP-templated molecularly imprinted polymer (MIP-ATP). Accordingly, the ATP complex with all of the functional monomers formed in solution was potentiodynamically electropolymerized to deposit an MIP-ATP film either on an Au electrode of the quartz crystal resonator or on a Pt disk electrode for the piezoelectric microgravimetry (PM) or capacitive impedimetry (CI) determination of ATP, respectively, under the flow-injection analysis (FIA) conditions. The apparent imprinting factor for ATP was ∼4.0. After extraction of the ATP template, analytical performance of the resulting chemosensors, including detectability, sensitivity, and selectivity, was characterized. The limit of detection was 0.3 and 0.03mM ATP for the PM and CI chemosensor, respectively. The MIP-ATP film discriminated structural analogues of ATP quite well. The Langmuir, Freundlich, and Langmuir-Freundlich isotherms were fitted to the experimental data of the ATP sorption and sorption stability constants appeared to be nearly independent of the adopted sorption model.

  19. Double-functionalized gold nanoparticles with split aptamer for the detection of adenosine triphosphate.

    PubMed

    Cheng, Sheng; Zheng, Bin; Wang, Mozhen; Lam, Michael Hon-Wah; Ge, Xuewu

    2013-10-15

    A newly designed functionalization type for gold nanoparticles (AuNP) with split aptamer has been developed for the detection of adenosine triphosphate (ATP). The ATP aptamer was split into two parts with their 5' prime or 3' prime modified with thiol. Both the 5' SH and 3' SH modified strands for each split aptamer fragment were functionalized onto the same AuNP to construct double-functionalized AuNP-DNA conjugates. Thus, the split aptamer can be reassembled into intact folded structure in the presence of ATP molecule with two potential assembly types, which induces the assembly of AuNP-DNA conjugates. In this double-functionalized system, the traditional assembly type might facilitate another assembly type, which was found to give much higher LSPR change in the presence of ATP than the traditional assembly type, and improve the sensitivity for ATP detection. Time courses of the assemble processes with different assembly types, Mg(2+) concentrations, and aptamer fragments densities on AuNP were followed using the absorption ratio at 650 nm and 520 nm. ATP response with this newly designed system was investigated using absorption spectra and dynamic light scattering method.

  20. Red blood cells (RBCs), epoxyeicosatrienoic acids (EETs) and adenosine triphosphate (ATP).

    PubMed

    Jiang, Houli; Anderson, Gail D; McGiff, John C

    2010-01-01

    In addition to serving as carriers of O(2), red blood cells (RBCs) regulate vascular resistance and the distribution of microvascular perfusion by liberating adenosine triphosphate (ATP) and epoxyeicosatrienoic acids (EETs) upon exposure to a low O(2) environment. Therefore, RBCs act as sensors that respond to low pO(2) by releasing millimolar amounts of ATP, a signaling molecule, and lipid mediators (EETs). The release of EETs occurs by a mechanism that is activated by ATP stimulation of P2X(7) receptors coupled to ATP transporters, which should greatly amplify the circulatory response to ATP. RBCs are reservoirs of EETs and the primary sources of plasma EETs, which are esterified to the phospholipids of lipoproteins. Levels of free EETs in plasma are low, about 3% of circulating EETs. RBC EETs are produced by direct oxidation of arachidonic acid (AA) esterified to glycerophospholipids and the monooxygenase-like activity of hemoglobin. On release, EETs affect vascular tone, produce profibrinolysis and dampen inflammation. A soluble epoxide hydrolase (sEH) regulates the concentrations of RBC and vascular EETs by metabolizing both cis- and trans-EETs to form dihydroxyeicosatrienoic acids (DHETs). The function and pathophysiological roles of trans-EETs and erythro-DHETs has yet to be integrated into a physiological and pathophysiological context.

  1. Using silicon nanowire devices to detect adenosine triphosphate liberated from electrically stimulated HeLa cells.

    PubMed

    Chen, C C; Chen, Y-Z; Huang, Y-J; Sheu, J-T

    2011-01-15

    In this study, we used a biosensor chip featuring Abl tyrosine kinase-modified silicon nanowire field-effect transistors (SiNW-FETs) to detect adenosine triphosphate (ATP) liberated from HeLa cells that had been electrically stimulated. Cells that are cultured in high-ionic-strength media or buffer environments usually undermine the sensitivity and selectively of SiNW-FET-based sensors. Therefore, we first examined the performance of the biosensor chip incorporating the SiNW-FETs in both low- and high-ionic-strength buffer solutions. Next, we stimulated, using a sinusoidal wave (1.0 V, 50 Hz, 10 min), HeLa cells that had been cultured on a cell-culture chip featuring interdigitated electrodes. The extracellular ATP concentration increased by ca. 18.4-fold after electrical stimulation. Finally, we detected the presence of extracellular ATP after removing a small amount of buffer solution from the cell-cultured chip and introducing it into the biosensor chip.

  2. Production and utilization of dissolved adenosine 5'-triphosphate in marine and freshwater ecosystems

    SciTech Connect

    Peele, E.R.

    1985-01-01

    Concentrations of dissolved adenosine triphosphate (DATP) were influenced primarily by in situ biological processes such as uptake by heterotrophic microorganisms and release by either phytoplankton or zooplankton or through zooplankton-phytoplankton interactions. Rapid turnover of dissolved ATP via uptake by bacterioplankton was observed in an estuary (Sapelo Island, Georgia) and two freshwater lakes (Lake Oglethorpe, Georgia and Lago Lake, Georgia). Turnover times for DATP, based on microbial assimilation of (/sup 3/H)ATP, were on the order of hours to days in all three environments. DATP was not taken up intact by the natural microbial populations; rather, it was degraded to adenine, ribose and inorganic phosphate prior to or during transport. The primary mechanism for DATP uptake was via dephosphorylation of the nucleotide and cleavage of resultant nucleoside to adenine and ribose which then entered the cells by separate transport systems. The rate of DATP assimilation by freshwater microorganisms varied markedly-over a diel cycle. Results from microcosm experiments in which the authors compared the rates of DATP release by phytoplankton (Chlamydomonas sp.) alone, zooplankton (Daphnia sp.) alone or phytoplankton and zooplankton together under feeding conditions supported those hypotheses. Net extracellular release of DATP by Chlamydomonas was negligible in short-term experiments, and in systems containing both Daphnia and Chlamydomonas, changes in DATP over time were approximately 3-fold greater than the sum of changes observed in systems containing either organism alone.

  3. Bond cleavages of adenosine 5'-triphosphate induced by monochromatic soft X-rays

    NASA Astrophysics Data System (ADS)

    Fujii, K.; Narita, A.; Yokoya, A.

    2014-04-01

    To investigate which type of bond is likely to be cleaved by soft X-ray exposure to an adenosine 5'-triphosphate (ATP), we observed spectral changes in X-ray absorption near edge structure (XANES) around nitrogen and oxygen K-edge of an ATP film by soft X-ray irradiation. Experiments were performed at a synchrotron soft X-ray beamline at SPring-8, Japan. The XANES spectra around the nitrogen and oxygen .K-edge slightly varied by exposure to 560 eV soft X-rays. These changes are originated from the cleavage of C-N bonds between a sugar and a nucleobase site and of C-O, P-O or O-H bond of sugar and phosphate site. From the comparison between the change in XANES intensity of σ* peak at nitrogen and that at oxygen K-edges, it is inferred that the C-O, P-O or O-H bond of sugar and phosphate is much efficiently cleaved than the C-N of N-glycoside bond by the exposure of 560 eV soft X-ray to ATP film.

  4. Digoxin and Adenosine Triphosphate Enhance the Functional Properties of Tissue-Engineered Cartilage

    PubMed Central

    Makris, Eleftherios A.; Huang, Brian J.; Hu, Jerry C.; Chen-Izu, Ye

    2015-01-01

    Toward developing engineered cartilage for the treatment of cartilage defects, achieving relevant functional properties before implantation remains a significant challenge. Various chemical and mechanical stimuli have been used to enhance the functional properties of engineered musculoskeletal tissues. Recently, Ca2+-modulating agents have been used to enhance matrix synthesis and biomechanical properties of engineered cartilage. The objective of this study was to determine whether other known Ca2+ modulators, digoxin and adenosine triphosphate (ATP), can be employed as novel stimuli to increase collagen synthesis and functional properties of engineered cartilage. Neocartilage constructs were formed by scaffold-free self-assembling of primary bovine articular chondrocytes. Digoxin, ATP, or both agents were added to the culture medium for 1 h/day on days 10–14. After 4 weeks of culture, neocartilage properties were assessed for gross morphology, biochemical composition, and biomechanical properties. Digoxin and ATP were found to increase neocartilage collagen content by 52–110% over untreated controls, while maintaining proteoglycan content near native tissue values. Furthermore, digoxin and ATP increased the tensile modulus by 280% and 180%, respectively, while the application of both agents increased the modulus by 380%. The trends in tensile properties were found to correlate with the amount of collagen cross-linking. Live Ca2+ imaging experiments revealed that both digoxin and ATP were able to increase Ca2+ oscillations in monolayer-cultured chondrocytes. This study provides a novel approach toward directing neocartilage maturation and enhancing its functional properties using novel Ca2+ modulators. PMID:25473799

  5. Application of firefly luciferase assay for adenosine triphosphate (ATP) to antimicrobial drug sensitivity testing

    NASA Technical Reports Server (NTRS)

    Picciolo, G. L.; Tuttle, S. A.; Schrock, C. G.; Deming, J. W.; Barza, M. J.; Wienstein, L.; Chappelle, E. W.

    1977-01-01

    The development of a rapid method for determining microbial susceptibilities to antibiotics using the firefly luciferase assay for adenosine triphosphate (ATP) is documented. The reduction of bacterial ATP by an antimicrobial agent was determined to be a valid measure of drug effect in most cases. The effect of 12 antibiotics on 8 different bacterial species gave a 94 percent correlation with the standard Kirby-Buer-Agar disc diffusion method. A 93 percent correlation was obtained when the ATP assay method was applied directly to 50 urine specimens from patients with urinary tract infections. Urine samples were centrifuged first to that bacterial pellets could be suspended in broth. No primary isolation or subculturing was required. Mixed cultures in which one species was predominant gave accurate results for the most abundant organism. Since the method is based on an increase in bacterial ATP with time, the presence of leukocytes did not interfere with the interpretation of results. Both the incubation procedure and the ATP assays are compatible with automation.

  6. A novel conductometric biosensor based on hexokinase for determination of adenosine triphosphate.

    PubMed

    Kucherenko, I S; Kucherenko, D Yu; Soldatkin, O O; Lagarde, F; Dzyadevych, S V; Soldatkin, A P

    2016-04-01

    The paper presents a simple and inexpensive reusable biosensor for determination of the concentration of adenosine-5'-triphosphate (ATP) in aqueous samples. The biosensor is based on a conductometric transducer which contains two pairs of gold interdigitated electrodes. An enzyme hexokinase was immobilized onto one pair of electrodes, and bovine serum albumin-onto another pair (thus, a differential mode of measurement was used). Conditions of hexokinase immobilization on the transducer by cross-linking via glutaraldehyde were optimized. Influence of experimental conditions (concentration of magnesium ions, ionic strength and concentration of the working buffer) on the biosensor work was studied. The reproducibility of biosensor responses and operational stability of the biosensor were checked during one week. Dry storage at -18 °C was shown to be the best conditions to store the biosensor. The biosensor was successfully applied for measurements of ATP concentration in pharmaceutical samples. The proposed biosensor may be used in future for determination of ATP and/or glucose in water samples.

  7. Detection of adenosine 5'-triphosphate by fluorescence variation of oligonucleotide-templated silver nanoclusters.

    PubMed

    Lee, Jennifer Daneen; Cang, Jinshun; Chen, Ying-Chieh; Chen, Wei-Yu; Ou, Chung-Mao; Chang, Huan-Tsung

    2014-08-15

    Oligonucleotide-templated Ag nanoclusters (DNA-Ag NCs) prepared from AgNO3 using an oligonucleotide (5'-TAACCCCTAACCCCT-3') as a template and NaBH4 as a reducing agent have been used for sensing of adenosine 5'-triphosphate (ATP). The fluorescence intensity and emission wavelength of DNA-Ag NCs are dependent on the pH value and ATP concentration. At pH 3.0 and 11.0, ATP shows greater effects on fluorescence of the DNA-Ag NCs. Upon increasing ATP concentration from 10 to 50μM, their emission wavelength at pH 3.0 shifts from 525 to 585nm. At pH 11.0, their fluorescence intensity (510nm) increases upon increasing ATP concentration. The circular dichroism (CD), electrospray ionization-mass spectrometry (ESI-MS), absorption, and fluorescence results indicate that ATP and pH affect the interactions between DNAs and Ag atoms, resulting in changes in their fluorescence. The DNA-Ag NCs allow detection of ATP over a concentration range of 0.1-10μM, with a limit of detection 33nM. Practicality of the DNA-Ag NCs probe has been validated with the determination of ATP concentrations in the lysate of MDA-MB-231 breast carcinoma cells.

  8. An adenosine triphosphate-independent proteasome activator contributes to the virulence of Mycobacterium tuberculosis

    SciTech Connect

    Jastrab, Jordan B.; Wang, Tong; Murphy, J. Patrick; Bai, Lin; Hu, Kuan; Merkx, Remco; Huang, Jessica; Chatterjee, Champak; Ovaa, Huib; Gygi, Steven P.; Li, Huilin; Darwin, K. Heran

    2015-03-23

    Mycobacterium tuberculosis encodes a proteasome that is highly similar to eukaryotic proteasomes and is required to cause lethal infections in animals. The only pathway known to target proteins for proteasomal degradation in bacteria is pupylation, which is functionally analogous to eukaryotic ubiquitylation. However, evidence suggests that the M. tuberculosis proteasome contributes to pupylation-independent pathways as well. To identify new proteasome cofactors that might contribute to such pathways, we isolated proteins that bound to proteasomes overproduced in M. tuberculosis and found a previously uncharacterized protein, Rv3780, which formed rings and capped M. tuberculosis proteasome core particles. Rv3780 enhanced peptide and protein degradation by proteasomes in an adenosine triphosphate (ATP)-independent manner. We identified putative Rv3780-dependent proteasome substrates and found that Rv3780 promoted robust degradation of the heat shock protein repressor, HspR. Importantly, an M. tuberculosis Rv3780 mutant had a general growth defect, was sensitive to heat stress, and was attenuated for growth in mice. Collectively, these data demonstrate that ATP-independent proteasome activators are not confined to eukaryotes and can contribute to the virulence of one the world’s most devastating pathogens.

  9. An adenosine triphosphate-independent proteasome activator contributes to the virulence of Mycobacterium tuberculosis

    DOE PAGES

    Jastrab, Jordan B.; Wang, Tong; Murphy, J. Patrick; ...

    2015-03-23

    Mycobacterium tuberculosis encodes a proteasome that is highly similar to eukaryotic proteasomes and is required to cause lethal infections in animals. The only pathway known to target proteins for proteasomal degradation in bacteria is pupylation, which is functionally analogous to eukaryotic ubiquitylation. However, evidence suggests that the M. tuberculosis proteasome contributes to pupylation-independent pathways as well. To identify new proteasome cofactors that might contribute to such pathways, we isolated proteins that bound to proteasomes overproduced in M. tuberculosis and found a previously uncharacterized protein, Rv3780, which formed rings and capped M. tuberculosis proteasome core particles. Rv3780 enhanced peptide and proteinmore » degradation by proteasomes in an adenosine triphosphate (ATP)-independent manner. We identified putative Rv3780-dependent proteasome substrates and found that Rv3780 promoted robust degradation of the heat shock protein repressor, HspR. Importantly, an M. tuberculosis Rv3780 mutant had a general growth defect, was sensitive to heat stress, and was attenuated for growth in mice. Collectively, these data demonstrate that ATP-independent proteasome activators are not confined to eukaryotes and can contribute to the virulence of one the world’s most devastating pathogens.« less

  10. Enzyme-based field-effect transistor for adenosine triphosphate (ATP) sensing.

    PubMed

    Migita, Satoshi; Ozasa, Kazunari; Tanaka, Tomoya; Haruyama, Tetsuya

    2007-01-01

    Adenosine triphosphate (ATP) not only functions as an energy-carrier substance and an informative molecule, but also acts as a marker substance in studies of both bio-traces and cellular/tissular viability. Due to the importance of the ATP function for living organisms, in situ assays of ATP are in demand in various fields, e.g., hygiene. In the present study, we developed an ATP sensor that combines the selective catalytic activity of enzyme and the properties of an ion selective field effect transistor (ISFET). In this system, the ATP hydrolyrase, "apyrase (EC 3.6.1.5.)" is encased in a gel and mounted on a Ta(2)O(5) ISFET gate surface. When the enzyme layer selectively catalyzes the dephosphorylation of ATP, protons are accumulated at the gate because the enzymatic reaction produces H(+) as a byproduct. Based on the interfacial enzymatic reaction, the response from the ISFET is completely dependent upon the ATP concentration in the bulk solution. This device is readily applicable to practical in situ ATP measurement, e.g. hygienic usage.

  11. Light scattering change precedes loss of cerebral adenosine triphosphate in a rat global ischemic brain model.

    PubMed

    Kawauchi, Satoko; Sato, Shunichi; Ooigawa, Hidetoshi; Nawashiro, Hiroshi; Ishihara, Miya; Kikuchi, Makoto

    2009-08-14

    Measurement of intrinsic optical signals (IOSs) is an attractive technique for monitoring tissue viability in brains since it enables noninvasive, real-time monitoring of morphological characteristics as well as physiological and biochemical characteristics of tissue. We previously showed that light scattering signals reflecting cellular morphological characteristics were closely related to the IOSs associated with the redox states of cytochrome c oxidase in the mitochondrial respiratory chain. In the present study, we examined the relationship between light scattering and energy metabolism. Light scattering signals were transcranially measured in rat brains after oxygen and glucose deprivation, and the results were compared with concentrations of cerebral adenosine triphosphate (ATP) measured by luciferin-luciferase bioluminescence assay. Electrophysiological signal was also recorded simultaneously. After starting saline infusion, EEG activity ceased at 108+/-17s, even after which both the light scattering signal and ATP concentration remained at initial levels. However, light scattering started to change in three phases at 236+/-15s and then cerebral ATP concentration started to decrease at about 260s. ATP concentration significantly decreased during the triphasic scattering change, indicating that the start of scattering change preceded the loss of cerebral ATP. The mean time difference between the start of triphasic scattering change and the onset of ATP loss was about 24s in the present model. DC potential measurement showed that the triphasic scattering change was associated with anoxic depolarization. These findings suggest that light scattering signal can be used as an indicator of loss of tissue viability in brains.

  12. Adenosine triphosphate bioluminescence analysis for rapid screening of microbial contamination in non-sterile pharmaceutical samples.

    PubMed

    Jimenez, Luis

    2004-01-01

    An Adenosine Triphosphate (ATP) bioluminescence system was compared and validated against standard methods for rapid microbiological monitoring of several non-sterile pharmaceutical formulations such as creams, tablets, and capsules. Results obtained using 1%, 2.5%, and 10% of product suspensions indicated that most samples that did not contain non-microbial ATP neither inhibited the bioluminescence reaction nor did something else. Ten percent product suspensions were inoculated with different concentrations of Pseudomonas aeruginosa, Staphylococcus aureus, Escherichia coli, Salmonella typhimurium, Candida albicans, and Aspergillus niger. Samples were incubated for 24-120 h at 35 degrees C with shaking. Results indicated a strong inhibitory effect of microbial growth, as no microorganisms were detected by using the ATP bioluminescence assay. However, when 1% and 2.5% product suspensions were spiked with the same microorganisms, positive detection was confirmed. After incubation, all microorganisms were detected by the bioluminescence system within 24-72 h. All positive samples were confirmed by using standard plating media. However, to optimize detection of all microorganisms, different enrichment media were developed.

  13. An efficient extraction method for quantitation of adenosine triphosphate in mammalian tissues and cells.

    PubMed

    Chida, Junji; Yamane, Kazuhiko; Takei, Tunetomo; Kido, Hiroshi

    2012-05-21

    Firefly bioluminescence is widely used in the measurement of adenosine 5'-triphosphate (ATP) levels in biological materials. For such assays in tissues and cells, ATP must be extracted away from protein in the initial step and extraction efficacy is the main determinant of the assay accuracy. Extraction reagents recommended in the commercially available ATP assay kits are chaotropic reagents, trichloroacetic acid (TCA), perchloric acid (PCA), and ethylene glycol (EG), which extract nucleotides through protein precipitation and/or nucleotidase inactivation. We found that these reagents are particularly useful for measuring ATP levels in materials with relatively low protein concentrations such as blood cells, cultured cells, and bacteria. However, these methods are not suitable for ATP extraction from tissues with high protein concentrations, because some ATP may be co-precipitated with the insolubilized protein during homogenization and extraction, and it could also be precipitated by neutralization in the acid extracts. Here we found that a phenol-based extraction method markedly increased the ATP and other nucleotides extracted from tissues. In addition, phenol extraction does not require neutralization before the luciferin-luciferase assay step. ATP levels analyzed by luciferase assay in various tissues extracted by Tris-EDTA-saturated phenol (phenol-TE) were over 17.8-fold higher than those extracted by TCA and over 550-fold higher than those in EG extracts. Here we report a simple, rapid, and reliable phenol-TE extraction procedure for ATP measurement in tissues and cells by luciferase assay.

  14. Digoxin and adenosine triphosphate enhance the functional properties of tissue-engineered cartilage.

    PubMed

    Makris, Eleftherios A; Huang, Brian J; Hu, Jerry C; Chen-Izu, Ye; Athanasiou, Kyriacos A

    2015-03-01

    Toward developing engineered cartilage for the treatment of cartilage defects, achieving relevant functional properties before implantation remains a significant challenge. Various chemical and mechanical stimuli have been used to enhance the functional properties of engineered musculoskeletal tissues. Recently, Ca(2+)-modulating agents have been used to enhance matrix synthesis and biomechanical properties of engineered cartilage. The objective of this study was to determine whether other known Ca(2+) modulators, digoxin and adenosine triphosphate (ATP), can be employed as novel stimuli to increase collagen synthesis and functional properties of engineered cartilage. Neocartilage constructs were formed by scaffold-free self-assembling of primary bovine articular chondrocytes. Digoxin, ATP, or both agents were added to the culture medium for 1 h/day on days 10-14. After 4 weeks of culture, neocartilage properties were assessed for gross morphology, biochemical composition, and biomechanical properties. Digoxin and ATP were found to increase neocartilage collagen content by 52-110% over untreated controls, while maintaining proteoglycan content near native tissue values. Furthermore, digoxin and ATP increased the tensile modulus by 280% and 180%, respectively, while the application of both agents increased the modulus by 380%. The trends in tensile properties were found to correlate with the amount of collagen cross-linking. Live Ca(2+) imaging experiments revealed that both digoxin and ATP were able to increase Ca(2+) oscillations in monolayer-cultured chondrocytes. This study provides a novel approach toward directing neocartilage maturation and enhancing its functional properties using novel Ca(2+) modulators.

  15. Unique energetic properties of Adenosine Tri-Phosphate in comparison to similar compounds using density functional theory

    NASA Astrophysics Data System (ADS)

    Muraszko, Kevin; Halloran, Thomas; Malinovskaya, Svetlana; Leopold, Philip

    2015-05-01

    Adenosine Tri-Phosphate (ATP) is arguably the most critical compound to all life known on Earth, serving as the main energy transport and storage in cellular biology. Why in particular did nature ``choose'' ATP instead of a similar compound? We are seeking to answer this question by comparing the energetic properties of ATP to similar compounds. We discuss 3-D models for ATP, variants of the molecule based on all of the separate nucleobases, and ATP's twin molecule Adenosine Di-Phosphate. All calculations were done using Density Functional Theory. The results showed that purine compounds like Adenosine and Guanosine produce similar bond angles, making these viable unlike the other nucleobases. We have analyzed the chiral properties of ATP by comparing the ground-state-energies of ATP-cis and ATP-trans and have shown that ATP-cis is the more energetically favorable of the two. This is consistent with observations in nature.

  16. The kinetics of magnesium adenosine triphosphate cleavage in skinned muscle fibres of the rabbit.

    PubMed Central

    Ferenczi, M A; Homsher, E; Trentham, D R

    1984-01-01

    The time course of magnesium adenosine triphosphate (Mg ATP) cleavage in chemically skinned muscle fibres of the rabbit was measured by a method in which Mg ATP cleavage was initiated by photolytic release of ATP from P3-1-(2-nitro)phenylethyladenosine 5'-triphosphate (caged ATP) and terminated by rapid freezing 50 ms to 8 s later. Up to 5 mM-ATP was released following a single 50 ns laser pulse at 347 nm. Mg ATP cleavage was measured at 19 degrees C in the presence and absence of calcium ions, for fibres near rest length and stretched beyond overlap of the myofilaments. At full overlap and in the absence of calcium (less than 10(-8) M) and nucleotide, the fibres developed rigor tension. Following the laser pulse the tension decreased to that of a relaxed fibre in two distinct phases. The first phase lasted about 40 ms and was followed by a second phase during which tension decreased to zero with an approximately exponential time course with a rate constant of 11 s-1. In the presence of 2 X 10(-5) M-free calcium ions, the initial phase following the laser flash lasted approximately 13 ms, and was followed by an exponential rise of tension with a rate constant of 28 s-1. The active tension reached by the muscle fibres was 54 kN/m2. For fibres stretched beyond overlap, no change in tension was observed following the release of Mg ATP. Under all conditions the time course of Mg ATP cleavage was biphasic, and consisted of a rapid initial burst of ADP formation, complete within 50 ms, followed by a slower steady-state rate of Mg ATP cleavage. The number of molecules of Mg ATP cleaved during the burst was approximately equal to the number of myosin subfragment 1 heads for fibres at full myofilament overlap, and equal to 0.7 molecules per myosin subfragment 1 head for fibres stretched beyond overlap. At full overlap in the presence of calcium ions, the steady-state rate equalled 1.8 mol Mg ATP cleaved per mole myosin subfragment 1 head per second. In all other cases the

  17. Visual and Plasmon Resonance Absorption Sensor for Adenosine Triphosphate Based on the High Affinity between Phosphate and Zr(IV)

    PubMed Central

    Qi, Wenjing; Liu, Zhongyuan; Zhang, Wei; Halawa, Mohamed Ibrahim; Xu, Guobao

    2016-01-01

    Zr(IV) can form phosphate and Zr(IV) (–PO32−–Zr4+–) complex owing to the high affinity between Zr(IV) with phosphate. Zr(IV) can induce the aggregation of gold nanoparticles (AuNPs), while adenosine triphosphate(ATP) can prevent Zr(IV)-induced aggregation of AuNPs. Herein, a visual and plasmon resonance absorption (PRA)sensor for ATP have been developed using AuNPs based on the high affinity between Zr(IV)with ATP. AuNPs get aggregated in the presence of certain concentrations of Zr(IV). After the addition of ATP, ATP reacts with Zr(IV) and prevents AuNPs from aggregation, enabling the detection of ATP. Because of the fast interaction of ATP with Zr(IV), ATP can be detected with a detection limit of 0.5 μM within 2 min by the naked eye. Moreover, ATP can be detected by the PRA technique with higher sensitivity. The A520nm/A650nm values in PRA spectra increase linearly with the concentrations of ATP from 0.1 μM to 15 μM (r = 0.9945) with a detection limit of 28 nM. The proposed visual and PRA sensor exhibit good selectivity against adenosine, adenosine monophosphate, guanosine triphosphate, cytidine triphosphate and uridine triphosphate. The recoveries for the analysis of ATP in synthetic samples range from 95.3% to 102.0%. Therefore, the proposed novel sensor for ATP is promising for real-time or on-site detection of ATP. PMID:27754349

  18. Visual and Plasmon Resonance Absorption Sensor for Adenosine Triphosphate Based on the High Affinity between Phosphate and Zr(IV).

    PubMed

    Qi, Wenjing; Liu, Zhongyuan; Zhang, Wei; Halawa, Mohamed Ibrahim; Xu, Guobao

    2016-10-12

    Zr(IV) can form phosphate and Zr(IV) (-PO₃(2-)-Zr(4+)-) complex owing to the high affinity between Zr(IV) with phosphate. Zr(IV) can induce the aggregation of gold nanoparticles (AuNPs), while adenosine triphosphate(ATP) can prevent Zr(IV)-induced aggregation of AuNPs. Herein, a visual and plasmon resonance absorption (PRA)sensor for ATP have been developed using AuNPs based on the high affinity between Zr(IV)with ATP. AuNPs get aggregated in the presence of certain concentrations of Zr(IV). After the addition of ATP, ATP reacts with Zr(IV) and prevents AuNPs from aggregation, enabling the detection of ATP. Because of the fast interaction of ATP with Zr(IV), ATP can be detected with a detection limit of 0.5 μM within 2 min by the naked eye. Moreover, ATP can be detected by the PRA technique with higher sensitivity. The A520nm/A650nm values in PRA spectra increase linearly with the concentrations of ATP from 0.1 μM to 15 μM (r = 0.9945) with a detection limit of 28 nM. The proposed visual and PRA sensor exhibit good selectivity against adenosine, adenosine monophosphate, guanosine triphosphate, cytidine triphosphate and uridine triphosphate. The recoveries for the analysis of ATP in synthetic samples range from 95.3% to 102.0%. Therefore, the proposed novel sensor for ATP is promising for real-time or on-site detection of ATP.

  19. Optimization of adenosine 5'-triphosphate extraction for the measurement of acidogenic biomass utilizing whey wastewater.

    PubMed

    Lee, Changsoo; Kim, Jaai; Hwang, Seokhwan

    2006-08-01

    A set of experiments was carried out to maximize adenosine 5'-triphosphate (ATP) extraction efficiency from acidogenic culture using whey wastewater. ATP concentrations at different microbial concentrations increased linearly as microbial concentration decreased. More than 50% of ATP was extracted from the sample of 39 mg volatile suspended solids (VSS)/l compared to the sample of 2.8 g VSS/l. The ATP concentrations of the corresponding samples were 0.74+/-0.06 and 0.49+/-0.05 mg/l, respectively. For low VSS concentrations ranging from 39 to 92 mg/l, the extracted ATP concentration did not vary significantly at 0.73+/-0.01 mg ATP/l. Response surface methodology with a central composite in cube design for the experiments was used to locate the optimum for maximal ATP extraction with respect to boiling and bead beating treatments. The overall designed intervals were from 0 to 15 min and from 0 to 3 min for boiling and bead beating, respectively. The extracted ATP concentration ranged from 0.01 to 0.74 mg/l within the design boundary. The following is a partial cubic model where eta is the concentration of ATP and x ( k ) is the corresponding variable term (k=boiling time and bead beating time in order): eta=0.629+0.035x (1)-0.818x (2)-0.002x (1) x (2)-0.003x (1) (2) +0.254x (2) (2) +0.002x (1) (2) x (2). This model successfully approximates the response of ATP concentration with respect to the boiling- and bead beating-time. The condition for maximal ATP extraction was 5.6 min boiling without bead beating. The maximal ATP concentration using the model was 0.74 mg/l, which was identical to the experimental value at optimum condition for ATP extraction.

  20. Adenosine triphosphate-induced photoreceptor death and retinal remodeling in rats.

    PubMed

    Vessey, Kirstan A; Greferath, Ursula; Aplin, Felix P; Jobling, Andrew I; Phipps, Joanna A; Ho, Tracy; De Iongh, Robbert U; Fletcher, Erica L

    2014-09-01

    Many common causes of blindness involve the death of retinal photoreceptors, followed by progressive inner retinal cell remodeling. For an inducible model of retinal degeneration to be useful, it must recapitulate these changes. Intravitreal administration of adenosine triphosphate (ATP) has recently been found to induce acute photoreceptor death. The aim of this study was to characterize the chronic effects of ATP on retinal integrity. Five-week-old, dark agouti rats were administered 50 mM ATP into the vitreous of one eye and saline into the other. Vision was assessed using the electroretinogram and optokinetic response and retinal morphology investigated via histology. ATP caused significant loss of visual function within 1 day and loss of 50% of the photoreceptors within 1 week. At 3 months, 80% of photoreceptor nuclei were lost, and total photoreceptor loss occurred by 6 months. The degeneration and remodeling were similar to those found in heritable retinal dystrophies and age-related macular degeneration and included inner retinal neuronal loss, migration, and formation of new synapses; Müller cell gliosis, migration, and scarring; blood vessel loss; and retinal pigment epithelium migration. In addition, extreme degeneration and remodeling events, such as neuronal and glial migration outside the neural retina and proliferative changes in glial cells, were observed. These extreme changes were also observed in the 2-year-old P23H rhodopsin transgenic rat model of retinitis pigmentosa. This ATP-induced model of retinal degeneration may provide a valuable tool for developing pharmaceutical therapies or for testing electronic implants aimed at restoring vision.

  1. Antihyperlipidemic activity of adenosine triphosphate in rabbits fed a high-fat diet and hyperlipidemic patients.

    PubMed

    Zhang, Lianshan; Liang, Libin; Tong, Tong; Qin, Yuguo; Xu, Yanping; Tong, Xinglong

    2016-10-01

    Context Recently, adenosine triphosphate (ATP) was occasionally found to decrease the triglyceride (TG) levels in several hyperlipidemic patients in our clinical practice. Objective The study investigates the anti-hyperlipidemic effects of ATP in a high-fat fed rabbit model and hyperlipidemic patients. Materials and methods Twenty-four rabbits were randomly divided into three groups of eight animals each as follows: normal diet, high-fat diet and high-fat diet + ATP group. ATP supplementation (40 mg/day) was started at the 20th day and lasted for 10 days. Serum concentrations of total cholesterol (TC), TG, LDL-C, HDL-C were measured on the 20th day and 30th day. Heart, liver and aorta were subjected histopathological examination. Twenty outpatients diagnosed primary hyperlipidemia took ATP at a dose of 60 mg twice a day for 1 week. Results Feeding rabbits with a high-fat diet resulted in a significant elevation of lipid parameters including TC, TG, LDL-C, VLDL-C compared to the normal diet group (p < 0.01). ATP treatment significantly decreased serum TG level (p < 0.01), whilst other parameters remained statistically unaltered. Meanwhile, ATP significantly reduced the thickness of fat layer in cardiac epicardium (p < 0.05) and pathological gradation of ballooning degeneration in hepatocytes (p < 0.05). After taking ATP for 1 week, hyperlipidemia patients exhibited a significant decrease of TG (p < 0.01), but other lipid parameters had no significant change. Discussion and conclusion The study indicates that ATP selectively decreases serum TG levels in high-fat diet rabbits and hyperlipidemic patients. Therefore, ATP supplementation may provide an effective approach to control TG level.

  2. Adenosine triphosphate-induced photoreceptor death and retinal remodeling in rats

    PubMed Central

    Vessey, Kirstan A; Greferath, Ursula; Aplin, Felix P; Jobling, Andrew I; Phipps, Joanna A; Ho, Tracy; De Iongh, Robbert U; Fletcher, Erica L

    2014-01-01

    Many common causes of blindness involve the death of retinal photoreceptors, followed by progressive inner retinal cell remodeling. For an inducible model of retinal degeneration to be useful, it must recapitulate these changes. Intravitreal administration of adenosine triphosphate (ATP) has recently been found to induce acute photoreceptor death. The aim of this study was to characterize the chronic effects of ATP on retinal integrity. Five-week-old, dark agouti rats were administered 50 mM ATP into the vitreous of one eye and saline into the other. Vision was assessed using the electroretinogram and optokinetic response and retinal morphology investigated via histology. ATP caused significant loss of visual function within 1 day and loss of 50% of the photoreceptors within 1 week. At 3 months, 80% of photoreceptor nuclei were lost, and total photoreceptor loss occurred by 6 months. The degeneration and remodeling were similar to those found in heritable retinal dystrophies and age-related macular degeneration and included inner retinal neuronal loss, migration, and formation of new synapses; Müller cell gliosis, migration, and scarring; blood vessel loss; and retinal pigment epithelium migration. In addition, extreme degeneration and remodeling events, such as neuronal and glial migration outside the neural retina and proliferative changes in glial cells, were observed. These extreme changes were also observed in the 2-year-old P23H rhodopsin transgenic rat model of retinitis pigmentosa. This ATP-induced model of retinal degeneration may provide a valuable tool for developing pharmaceutical therapies or for testing electronic implants aimed at restoring vision. J. Comp. Neurol. 522:2928–2950, 2014. © 2014 Wiley Periodicals, Inc. PMID:24639102

  3. Hydrogen sulfide decreases adenosine triphosphate levels in aortic rings and leads to vasorelaxation via metabolic inhibition

    PubMed Central

    Kiss, Levente; Deitch, Edwin A; Szabó, Csaba

    2014-01-01

    Aims Hydrogen sulfide (H2S) at low concentrations serves as a physiological endogenous vasodilator molecule, while at higher concentrations it can trigger cytotoxic effects. The aim of our study was to elucidate the potential mechanisms responsible for the effects of H2S on vascular tone. Main methods We measured the vascular tone in vitro in precontracted rat thoracic aortic rings and we have tested the effect of different oxygen levels and a variety of inhibitors affecting known vasodilatory pathways. We have also compared the vascular effect of high concentrations of H2S to those of pharmacological inhibitors of oxidative phosphorylation. Furthermore, we measured adenosine triphosphate (ATP)-levels in the same vascular tissues. Key findings We have found that in rat aortic rings: (1) H2S decreases ATP levels; (2) relaxations to H2S depend on the ambient oxygen concentration; (3) prostaglandins do not take part in the H2S induced relaxations; (4) the 3':5'-cyclic guanosine monophosphate (cGMP) – nitric oxide (NO) pathway does not have a role in the relaxations (5) the role of KATP channels is limited, while Cl−/HCO3− channels have a role in the relaxations. (6): We have observed that high concentrations of H2S relax the aortic rings in a fashion similar to sodium cyanide, and both agents reduce cellular ATP levels to a comparable degree. Significance H2S, a new gasotransmitter of emerging importance, leads to relaxation via Cl−/HCO3− channels and metabolic inhibition and the interactions of these two factors depend on the oxygen levels of the tissue. PMID:18790700

  4. Monitoring of endoscope reprocessing with an adenosine triphosphate (ATP) bioluminescence method

    PubMed Central

    Parohl, Nina; Stiefenhöfer, Doris; Heiligtag, Sabine; Reuter, Henning; Dopadlik, Dana; Mosel, Frank; Gerken, Guido; Dechêne, Alexander; Heintschel von Heinegg, Evelyn; Jochum, Christoph; Buer, Jan; Popp, Walter

    2017-01-01

    Background: The arising challenges over endoscope reprocessing quality proposes to look for possibilities to measure and control the process of endoscope reprocessing. Aim: The goal of this study was to evaluate the feasibility of monitoring endoscope reprocessing with an adenosine triphosphate (ATP) based bioluminescence system. Methods: 60 samples of eight gastroscopes have been assessed from routine clinical use in a major university hospital in Germany. Endoscopes have been assessed with an ATP system and microbial cultures at different timepoints during the reprocessing. Findings: After the bedside flush the mean ATP level in relative light units (RLU) was 19,437 RLU, after the manual cleaning 667 RLU and after the automated endoscope reprocessor (AER) 227 RLU. After the manual cleaning the mean total viable count (TVC) per endoscope was 15.3 CFU/10 ml, and after the AER 5.7 CFU/10 ml. Our results show that there are reprocessing cycles which are not able to clean a patient used endoscope. Conclusion: Our data suggest that monitoring of flexible endoscope with ATP can identify a number of different influence factors, like the endoscope condition and the endoscopic procedure, or especially the quality of the bedside flush and manual cleaning before the AER. More process control is one option to identify and improve influence factors to finally increase the overall reprocessing quality, best of all by different methods. ATP measurement seems to be a valid technique that allows an immediate repeat of the manual cleaning if the ATP results after manual cleaning exceed the established cutoff of 200 RLU.

  5. Insertion of proteolipid protein into oligodendrocyte mitochondria regulates extracellular pH and adenosine triphosphate.

    PubMed

    Appikatla, Sunita; Bessert, Denise; Lee, Icksoo; Hüttemann, Maik; Mullins, Chadwick; Somayajulu-Nitu, Mallika; Yao, Fayi; Skoff, Robert P

    2014-03-01

    Proteolipid protein (PLP) and DM20, the most abundant myelin proteins, are coded by the human PLP1 and non-human Plp1 PLP gene. Mutations in the PLP1 gene cause Pelizaeus-Merzbacher disease (PMD) with duplications of the native PLP1 gene accounting for 70% of PLP1 mutations. Humans with PLP1 duplications and mice with extra Plp1 copies have extensive neuronal degeneration. The mechanism that causes neuronal degeneration is unknown. We show that native PLP traffics to mitochondria when the gene is duplicated in mice and in humans. This report is the first demonstration of a specific cellular defect in brains of PMD patients; it validates rodent models as ideal models to study PMD. Insertion of nuclear-encoded mitochondrial proteins requires specific import pathways; we show that specific cysteine motifs, part of the Mia40/Erv1 mitochondrial import pathway, are present in PLP and are required for its insertion into mitochondria. Insertion of native PLP into mitochondria of transfected cells acidifies media, partially due to increased lactate; it also increases adenosine triphosphate (ATP) in the media. The same abnormalities are found in the extracellular space of mouse brains with extra copies of Plp1. These physiological abnormalities are preventable by mutations in PLP cysteine motifs, a hallmark of the Mia40/Erv1 pathway. Increased extracellular ATP and acidosis lead to neuronal degeneration. Our findings may be the mechanism by which microglia are activated and proinflammatory molecules are upregulated in Plp1 transgenic mice (Tatar et al. (2010) ASN Neuro 2:art:e00043). Manipulation of this metabolic pathway may restore normal metabolism and provide therapy for PMD patients.

  6. Effect of adenosine 5'-triphosphate infusions on the nutritional status and survival of preterminal cancer patients.

    PubMed

    Beijer, Sandra; Hupperets, Pierre S; van den Borne, Ben E; Eussen, Simone R; van Henten, Arjen M; van den Beuken-van Everdingen, Marieke; de Graeff, Alexander; Ambergen, Ton A; van den Brandt, Piet A; Dagnelie, Pieter C

    2009-08-01

    The aim of the study was to investigate the effect of intravenous infusions of adenosine 5'-triphosphate (ATP) on nutritional status and survival in preterminal cancer patients. Ninety-nine preterminal cancer patients (estimated life expectancy 1-6 months) with mixed tumor types were randomly allocated to receive either intravenous ATP weekly (8-10 h/week, maximum 50 microg/kg/min) for 8 weeks, or no ATP (control group). Nutritional status parameters were assessed until 8 weeks, and analyzed by repeated-measures analysis of covariance. Cox proportional hazards models were fitted to assess the effect of ATP on short-term (0-8 weeks) and long-term (0-6 months) survival. Fifty-one patients were randomized to ATP and 48 to the control group. Results showed a significant favorable effect of ATP on triceps skin fold thickness [between-group difference per 8 weeks 1.76 mm, 95% confidence interval (CI): 0.48-3.12 mm; P = 0.009] and on short-term survival [0-8 weeks hazard ratio (HR): 0.40, 95% CI: 0.17-0.95; P = 0.037]. In weight-stable patients and in lung cancer patients, long-term survival (0-6 months) was also significantly better in ATP-treated patients (weight-stable patients HR: 0.40, 95% CI: 0.19-0.83; P = 0.014; patients with lung cancer: HR: 0.35, 95% CI: 0.14-0.88; P = 0.025). In conclusion, in this population of preterminal cancer patients, ATP infusions, at the dose and schedule studied, had a favorable effect on triceps skin fold thickness and survival, especially in weight-stable patients and patients with lung cancer. Larger studies are warranted to confirm these findings and to further define the effect of ATP on tumor growth and survival.

  7. Molecular structure of tetraaqua adenosine 5'-triphosphate aluminium(III) complex: A study involving Raman spectroscopy, theoretical DFT and potentiometry

    NASA Astrophysics Data System (ADS)

    Tenório, Thaís; Silva, Andréa M.; Ramos, Joanna Maria; Buarque, Camilla D.; Felcman, Judith

    2013-03-01

    The Alzheimer's disease is one of the most common neurodegenerative diseases that affect elderly population, due to the formation of β-amyloid protein aggregate and several symptoms, especially progressive cognitive decline. The result is a decrease in capture of glucose by cells leading to obliteration, meddling in the Krebs cycle, the principal biochemical route to the energy production leading to a decline in the levels of adenosine 5'-triphosphate. Aluminium(III) is connected to Alzheimer's and its ion provides raise fluidity of the plasma membrane, decrease cell viability and aggregation of amyloid plaques. Studies reveal that AlATP complex promotes the formation of reactive fibrils of β-amyloid protein and independent amyloidogenic peptides, suggesting the action of the complex as a chaperone in the role pathogenic process. In this research, one of complexes formed by Al(III) and adenosine 5'-triphosphate in aqueous solution is analyzed by potentiometry, Raman spectroscopy and ab initio calculations. The value of the log KAlATP found was 9.21 ± 0.01 and adenosine 5'-triphosphate should act as a bidentate ligand in the complex. Raman spectroscopy and potentiometry indicate that donor atoms are the oxygen of the phosphate β and the oxygen of the phosphate γ, the terminal phosphates. Computational calculations using Density Functional Theory, with hybrid functions B3LYP and 6-311++G(d,p) basis set regarding water solvent effects, have confirmed the results. Frontier molecular orbitals, electrostatic potential contour surface, electrostatic potential mapped and Mulliken charges of the title molecule were also investigated.

  8. Effects of adenosine triphosphate (ATP) on early recovery after total knee arthroplasty (TKA): a randomized, double-blind, controlled study.

    PubMed

    Long, Gong; Zhang, Guo Qiang

    2014-12-01

    Functional exercise after total knee arthroplasty (TKA) is necessary. However, it may be a difficult and painful process for the patient. Desirable methods of relieving the patient's pain are worth exploring. Oral supplement of adenosine triphosphate (ATP) is a potential option. In the present study, we decide to investigate whether short-term administration of ATP benefits patients undergoing TKA. A total of 244 subjects were randomized to receive 120mg ATP or placebo each day for 4weeks. Significant differences in quadriceps strength, pain scores at postoperative days 7, 14, 21, and 28 and total opioid consumption were detected. It follows that oral supplement of ATP could benefit patients recovering from TKA.

  9. Assessment of an innovative antimicrobial surface disinfectant in the operating room environment using adenosine triphosphate bioluminescence assay.

    PubMed

    Lewis, Brian D; Spencer, Maureen; Rossi, Peter J; Lee, Cheong J; Brown, Kellie R; Malinowski, Michael; Seabrook, Gary R; Edmiston, Charles E

    2015-03-01

    Terminal cleaning in the operating room is a critical step in preventing the transmission of health care-associated pathogens. The persistent disinfectant activity of a novel isopropyl alcohol/organofunctional silane solution (ISO) was evaluated in 4 operating rooms after terminal cleaning. Adenosine triphosphate bioluminescence documented a significant difference (P < .048) in surface bioburden on IOS-treated surfaces versus controls. RODAC plate cultures revealed a significant (P < .001) reduction in microbial contamination on IOS-treated surfaces compared with controls. Further studies are warranted to validate the persistent disinfectant activity of ISO within selective health care settings.

  10. Nitrogen and phosphorus co-doped graphene quantum dots: synthesis from adenosine triphosphate, optical properties, and cellular imaging.

    PubMed

    Ananthanarayanan, Arundithi; Wang, Yue; Routh, Parimal; Sk, Mahasin Alam; Than, Aung; Lin, Ming; Zhang, Jie; Chen, Jie; Sun, Handong; Chen, Peng

    2015-05-07

    Graphene quantum dots (GQDs) are emerging zero-dimensional materials promising a wide spectrum of applications, particularly, as superior fluorescent reporters for bio-imaging and optical sensing. Heteroatom doping can endow GQDs with new or improved photoluminescence properties. Here, we demonstrate a simple strategy for the synthesis of nitrogen and phosphorus co-doped GQDs from a single biomolecule precursor (adenosine triphosphate - ATP). Such ATP-GQDs exhibit high fluorescence quantum yield, strong two-photon upconversion, small molecular weight, high photostability, and good biocompatibility. Furthermore, transferrin conjugated ATP-GQDs have been used for imaging and real-time tracking of transferrin receptors in live cells.

  11. Inotropic responses of the frog ventricle to adenosine triphosphate and related changes in endogenous cyclic nucleotides.

    PubMed Central

    Flitney, F W; Singh, J

    1980-01-01

    1. A study has been made of a well documented but poorly understood response of the isolated frog ventricle to treatment with exogenous adenosine 5' triphosphate (ATP). Measurements of membrane potential, isometric twitch tension and levels of endogenous 3',5'-cyclic nucleotides have been made at various times during the ATP-induced response. 2. ATP elicits a characteristic triphasic response, which comprises an initial, abrupt increase in contractility, rising to a maximum within a few beats (first phase); followed by a period when the twitch amplitude falls, sometimes to below the control level (second phase); and superceded by a more slowly developing and longer-lasting increase in contractile force (third phase). The response is unaffected by atropine, propranolol or phentolamine. However, the prostaglandin synthetase inhibitor indomethacin depresses the first phase and entirely suppresses the third phase. 3. The inotropic effects of ATP are accompanied by changes in the shape of the action potential. These effects are dose-related. The duration of the action potential (D-30mV) and its positive overshoot (O) are increased during all phases of the response, for [ATP]o's up to 10(-5) M. However, at higher [ATP]o's, D-30mV and O ar both reduced during the second phase (but not the first or third phase), when isometric twitch tension is also depressed. The relationship between action potential duration and twitch tension (P) for different [ATP]o's is linear for all three phases of the response, but the slopes of the curves (delta P/delta D) are markedly different, indicating that the sensitivity of the contractile system to membrane depolarization is not constant, but varies continuously throughout the response. 4. ATP has a potent stimulatory effect on the metabolism of endogenous 3',5'-cyclic nucleotides. The time courses of the changes in adenosine 3','5-cyclic monophosphate (3',5'-cyclic AMP) and guanosine 3',5'-cyclic monophosphate (3',5'-cyclic GMP) are

  12. Conformational Changes Produced by ATP Binding to the Plasma Membrane Calcium Pump*

    PubMed Central

    Mangialavori, Irene C.; Ferreira-Gomes, Mariela S.; Saffioti, Nicolás A.; González-Lebrero, Rodolfo M.; Rossi, Rolando C.; Rossi, Juan Pablo F. C.

    2013-01-01

    The aim of this work was to study the plasma membrane calcium pump (PMCA) reaction cycle by characterizing conformational changes associated with calcium, ATP, and vanadate binding to purified PMCA. This was accomplished by studying the exposure of PMCA to surrounding phospholipids by measuring the incorporation of the photoactivatable phosphatidylcholine analog 1-O-hexadecanoyl-2-O-[9-[[[2-[125I]iodo-4-(trifluoromethyl-3H-diazirin-3-yl)benzyl]oxy]carbonyl]nonanoyl]-sn-glycero-3-phosphocholine to the protein. ATP could bind to the different vanadate-bound states of the enzyme either in the presence or in the absence of Ca2+ with high apparent affinity. Conformational movements of the ATP binding domain were determined using the fluorescent analog 2′(3′)-O-(2,4,6-trinitrophenyl)adenosine 5′-triphosphate. To assess the conformational behavior of the Ca2+ binding domain, we also studied the occlusion of Ca2+, both in the presence and in the absence of ATP and with or without vanadate. Results show the existence of occluded species in the presence of vanadate and/or ATP. This allowed the development of a model that describes the transport of Ca2+ and its relation with ATP hydrolysis. This is the first approach that uses a conformational study to describe the PMCA P-type ATPase reaction cycle, adding important features to the classical E1-E2 model devised using kinetics methodology only. PMID:24025327

  13. Conformational changes produced by ATP binding to the plasma membrane calcium pump.

    PubMed

    Mangialavori, Irene C; Ferreira-Gomes, Mariela S; Saffioti, Nicolás A; González-Lebrero, Rodolfo M; Rossi, Rolando C; Rossi, Juan Pablo F C

    2013-10-25

    The aim of this work was to study the plasma membrane calcium pump (PMCA) reaction cycle by characterizing conformational changes associated with calcium, ATP, and vanadate binding to purified PMCA. This was accomplished by studying the exposure of PMCA to surrounding phospholipids by measuring the incorporation of the photoactivatable phosphatidylcholine analog 1-O-hexadecanoyl-2-O-[9-[[[2-[(125)I]iodo-4-(trifluoromethyl-3H-diazirin-3-yl)benzyl]oxy]carbonyl]nonanoyl]-sn-glycero-3-phosphocholine to the protein. ATP could bind to the different vanadate-bound states of the enzyme either in the presence or in the absence of Ca(2+) with high apparent affinity. Conformational movements of the ATP binding domain were determined using the fluorescent analog 2'(3')-O-(2,4,6-trinitrophenyl)adenosine 5'-triphosphate. To assess the conformational behavior of the Ca(2+) binding domain, we also studied the occlusion of Ca(2+), both in the presence and in the absence of ATP and with or without vanadate. Results show the existence of occluded species in the presence of vanadate and/or ATP. This allowed the development of a model that describes the transport of Ca(2+) and its relation with ATP hydrolysis. This is the first approach that uses a conformational study to describe the PMCA P-type ATPase reaction cycle, adding important features to the classical E1-E2 model devised using kinetics methodology only.

  14. Nitrogen and phosphorus co-doped graphene quantum dots: synthesis from adenosine triphosphate, optical properties, and cellular imaging

    NASA Astrophysics Data System (ADS)

    Ananthanarayanan, Arundithi; Wang, Yue; Routh, Parimal; Sk, Mahasin Alam; Than, Aung; Lin, Ming; Zhang, Jie; Chen, Jie; Sun, Handong; Chen, Peng

    2015-04-01

    Graphene quantum dots (GQDs) are emerging zero-dimensional materials promising a wide spectrum of applications, particularly, as superior fluorescent reporters for bio-imaging and optical sensing. Heteroatom doping can endow GQDs with new or improved photoluminescence properties. Here, we demonstrate a simple strategy for the synthesis of nitrogen and phosphorus co-doped GQDs from a single biomolecule precursor (adenosine triphosphate - ATP). Such ATP-GQDs exhibit high fluorescence quantum yield, strong two-photon upconversion, small molecular weight, high photostability, and good biocompatibility. Furthermore, transferrin conjugated ATP-GQDs have been used for imaging and real-time tracking of transferrin receptors in live cells.Graphene quantum dots (GQDs) are emerging zero-dimensional materials promising a wide spectrum of applications, particularly, as superior fluorescent reporters for bio-imaging and optical sensing. Heteroatom doping can endow GQDs with new or improved photoluminescence properties. Here, we demonstrate a simple strategy for the synthesis of nitrogen and phosphorus co-doped GQDs from a single biomolecule precursor (adenosine triphosphate - ATP). Such ATP-GQDs exhibit high fluorescence quantum yield, strong two-photon upconversion, small molecular weight, high photostability, and good biocompatibility. Furthermore, transferrin conjugated ATP-GQDs have been used for imaging and real-time tracking of transferrin receptors in live cells. Electronic supplementary information (ESI) available: Supplementary figures related to characterization, computational studies and protein conjugation. See DOI: 10.1039/c5nr01519g

  15. Terbium ion-coordinated carbon dots for fluorescent aptasensing of adenosine 5'-triphosphate with unmodified gold nanoparticles.

    PubMed

    Xu, Mingdi; Gao, Zhuangqiang; Zhou, Qian; Lin, Youxiu; Lu, Minghua; Tang, Dianping

    2016-12-15

    This work reports on a novel time-resolved fluorescent aptasensing platform for the quantitative monitoring of adenosine 5'-triphosphate (ATP) by interaction of dispersive/agglomerate gold nanoparticles (AuNPs) with terbium ion-coordinated carbon dots (Tb-CDs). To construct such a fluorescent nanoprobe, Tb-CDs with high-efficient fluorescent intensity are first synthesized by the microwave method with terbium ions (Tb(3+)). The aptasensing system consists of ATP aptamer, AuNP and Tb-CD. The dispersive/agglomerate gold nanoparticles are acquired through the reaction of the aptamer with target ATP. Upon target ATP introduction, the aptamers bind with the analytes to form new aptamer-ATP complexes and coat on the surface of AuNPs to inhibit their aggregation in the high salt solution. In this case, the fluorescent signal of Tb-CDs is quenched by the dispersive AuNPs on the basis of the fluorescence resonance energy transfer (FRET). At the absence of target analyte, gold nanoparticles tend to aggregate in the high salt state even if the aptamers are present. Thus, the added Tb-CDs maintain their intrinsic fluorescent intensity. Experimental results indicated that the aptasensing system exhibited good fluorescent responses toward ATP in the dynamic range from 40nM to 4.0μM with a detection limit of 8.5nM at 3sblank criterion. The repeatability and intermediate precision is less than 9.5% at three concentrations including 0.04, 0.4 and 2.0μM ATP. The selectivity was acceptable toward guanosine 5'-triphosphate, uridine 5'-triphosphate and cytidine 5'-triphosphate. The methodology was applied to evaluate the blank human serum spiked with target ATP, and the recoveries (at 3 concentration levels) ranged between 97.0% and 103.7%. Importantly, this detection scheme is rapid, simple, cost-effective, and does not require extensive sample preparation or separation.

  16. Dual recognition unit strategy improves the specificity of the adenosine triphosphate (ATP) aptamer biosensor for cerebral ATP assay.

    PubMed

    Yu, Ping; He, Xiulan; Zhang, Li; Mao, Lanqun

    2015-01-20

    Adenosine triphosphate (ATP) aptamer has been widely used as a recognition unit for biosensor development; however, its relatively poor specificity toward ATP against adenosine-5'-diphosphate (ADP) and adenosine-5'-monophosphate (AMP) essentially limits the application of the biosensors in real systems, especially in the complex cerebral system. In this study, for the first time, we demonstrate a dual recognition unit strategy (DRUS) to construct a highly selective and sensitive ATP biosensor by combining the recognition ability of aptamer toward A nucleobase and of polyimidazolium toward phosphate. The biosensors are constructed by first confining the polyimidazolium onto a gold surface by surface-initiated atom transfer radical polymerization (SI-ATRP), and then the aptamer onto electrode surface by electrostatic self-assembly to form dual-recognition-unit-functionalized electrodes. The constructed biosensor based on DRUS not only shows an ultrahigh sensitivity toward ATP with a detection limit down to the subattomole level but also an ultrahigh selectivity toward ATP without interference from ADP and AMP. The constructed biosensor is used for selective and sensitive sensing of the extracellular ATP in the cerebral system by combining in vivo microdialysis and can be used as a promising neurotechnology to probing cerebral ATP concentration.

  17. Fast determination of adenosine 5'-triphosphate (ATP) and its catabolites in royal jelly using ultraperformance liquid chromatography.

    PubMed

    Zhou, Ling; Xue, XiaoFeng; Zhou, JinHui; Li, Yi; Zhao, Jing; Wu, LiMing

    2012-09-12

    To obtain insight into the metabolic regulation of adenosine 5'-triphosphate (ATP) in royal jelly and to determine whether ATP and its catabolites can be used as objective parameters to evaluate the freshness and quality of royal jelly (RJ), a rapid ultraperformance liquid chromatography (UPLC) method has been developed for feasible separation and quantitation of ATP and its catabolites in RJ, namely, adenosine 5'-diphosphate (ADP), adenosine 5'-monophosphate (AMP), inosine monophosphate (IMP), inosine (HxR), and hypoxanthine (Hx). The analytes in the sample were extracted using 5% precooled perchloric acid. Chromatographic separation was performed on a Waters Acquity UPLC system with a Waters BEH Shield RP18 column and gradient elution based on a mixture of two solvents: solvent A, 50 mM phosphate buffer (pH 6.5); and solvent B, acetonitrile. The recoveries were in the range of 86.0-102.3% with RSD of no more than 3.6%. The correlation coefficients of six analytes were high (r(2) ≥ 0.9988) and within the test ranges. The limits of detection and quantification for the investigated compounds were lower, at 0.36-0.68 and 1.22-2.30 mg/kg, respectively. The overall intra- and interday RSDs were no more than 1.8%. The developed method was successfully applied to the analysis of the analytes in samples. The results showed that ATP in RJ sequentially degrades to ADP, AMP, IMP, HxR, and Hx during storage.

  18. Separation of adenosine diphosphate--adenosine triphosphate-exchange activity from the cerebral microsomal sodium-plus-potassium ion-stimulated adenosine triphosphatase.

    PubMed

    Stahl, W L; Sattin, A; McIlwain, H

    1966-05-01

    1. A microsomal fraction from ox cerebral cortex catalysed [(14)C]ADP-ATP exchange at a speed similar to that at which it liberated P(i) from ATP in the presence of Na(+), K(+) and Mg(2+). 2. Repeated washing the fraction with MgATP solutions solubilized most of the exchange activity and left the adenosine triphosphatase insoluble and little changed in activity. The exchange activity was accompanied by negligible adenosine-triphosphatase activity and was enriched by precipitation at chosen pH and by DEAE-Sephadex. At no stage was its activity affected by Na(+), K(+) or ouabain. 3. The washed microsomal fraction was exposed to a variety of reagents; a sodium iodide-cysteine treatment increased both adenosine-triphosphatase and exchange activities, as also did a synthetic zeolite. Preparations were obtained with exchange activities less than 3% of their Na(+)-plus-K(+)-stimulated adenosine-triphosphatase activity. Some contribution to the residual exchange activity was made by an adenylate kinase. 4. Thus over 95% of the microsomal ADP-ATP-exchange activity does not take part in the Na(+)-plus-K(+)-stimulated adenosine-triphosphatase reaction. Participation of some of the residual 3% of the ADP-ATP-exchange activity has not been excluded, but there appears no firm evidence for its participation in the adenosine triphosphatase; the bearing of this conclusion on mechanisms proposed for the Na(+)-plus-K(+)-stimulated adenosine triphosphatase is indicated.

  19. Adenosine Triphosphate-Triggered Release of Macromolecular and Nanoparticle Loads from Aptamer/DNA-Cross-Linked Microcapsules.

    PubMed

    Liao, Wei-Ching; Lu, Chun-Hua; Hartmann, Raimo; Wang, Fuan; Sohn, Yang Sung; Parak, Wolfgang J; Willner, Itamar

    2015-09-22

    The synthesis of stimuli-responsive DNA microcapsules acting as carriers for different payloads, and being dissociated through the formation of aptamer-ligand complexes is described. Specifically, stimuli-responsive anti-adenosine triphosphate (ATP) aptamer-cross-linked DNA-stabilized microcapsules loaded with tetramethylrhodamine-modified dextran (TMR-D), CdSe/ZnS quantum dots (QDs), or microperoxidase-11 (MP-11) are presented. In the presence of ATP as trigger, the microcapsules are dissociated through the formation of aptamer-ATP complexes, resulting in the release of the respective loads. Selective unlocking of the capsules is demonstrated, and CTP, GTP, or TTP do not unlock the pores. The ATP-triggered release of MP-11 from the microcapsules enables the MP-11-catalyzed oxidation of Amplex UltraRed by H2O2 to the fluorescent product resorufin.

  20. A rapid method for the determination of microbial susceptibility using the firefly luciferase assay for adenosine triphosphate (ATP)

    NASA Technical Reports Server (NTRS)

    Vellend, H.; Tuttle, S. A.; Barza, M.; Weinstein, L.; Picciolo, G. L.; Chappelle, E. W.

    1975-01-01

    Luciferase assay for adenosine triphosphate (ATP) was optimized for pure bacteria in broth in order to evaluate if changes in bacterial ATP content could be used as a rapid measure of antibiotic effect on microorganisms. Broth cultures of log phase bacteria were incubated at 310 K (37 C) for 2.5 hours at antimicrobial concentrations which resulted in the best discrimination between sensitive and resistant strains. Eighty-seven strains of 11 bacterial species were studied for their susceptibility to 12 commonly used antimicrobial agents: ampicillin, Penicillin G, nafcillin, carbenicillin, cephalothin, tetracycline, erythromycin, clindamycin, gentamicin, nitrofurantoin, colistin, and chloramplenicol. The major advantage of the ATP system over existing methods of rapid microbial susceptibility testing is that the assay can be made specific for bacterial ATP.

  1. Detection of somatic coliphages through a bioluminescence assay measuring phage mediated release of adenylate kinase and adenosine 5'-triphosphate.

    PubMed

    Guzmán Luna, Carolina; Costán-Longares, Ana; Lucena, Francisco; Jofre, Joan

    2009-10-01

    The feasibility of detecting somatic coliphages by phage infection of Escherichia coli WG5 and measurement of phage propagation by the lysis mediated release of the bacterial host adenylate kinase (AK) and adenosine 5'-triphosphate (ATP) detected by a bioluminescent signal was evaluated. After 2h of incubation, all cultures infected with reference bacteriophage phiX174 showed a significant increase in the bioluminescent signal, even with number of phages as low as less of 10 plaque forming units (PFU). Naturally occurring somatic coliphages ensured a significant bioluminescent signal after 3h of infection when >10 PFU were inoculated. These results indicate that an easy and reliable method to detect low numbers of coliphages in less than 3h is feasible.

  2. Enhanced Production of Adenosine Triphosphate by Pharmacological Activation of Adenosine Monophosphate-Activated Protein Kinase Ameliorates Acetaminophen-Induced Liver Injury.

    PubMed

    Hwang, Jung Hwan; Kim, Yong-Hoon; Noh, Jung-Ran; Choi, Dong-Hee; Kim, Kyoung-Shim; Lee, Chul-Ho

    2015-10-01

    The hepatic cell death induced by acetaminophen (APAP) is closely related to cellular adenosine triphosphate (ATP) depletion, which is mainly caused by mitochondrial dysfunction. Adenosine monophosphate (AMP)-activated protein kinase (AMPK) is a key sensor of low energy status. AMPK regulates metabolic homeostasis by stimulating catabolic metabolism and suppressing anabolic pathways to increase cellular energy levels. We found that the decrease in active phosphorylation of AMPK in response to APAP correlates with decreased ATP levels, in vivo. Therefore, we hypothesized that the enhanced production of ATP via AMPK stimulation can lead to amelioration of APAP-induced liver failure. A769662, an allosteric activator of AMPK, produced a strong synergistic effect on AMPK Thr172 phosphorylation with APAP in primary hepatocytes and liver tissue. Interestingly, activation of AMPK by A769662 ameliorated the APAP-induced hepatotoxicity in C57BL/6N mice treated with APAP at a dose of 400 mg/kg intraperitoneally. However, mice treated with APAP alone developed massive centrilobular necrosis, and APAP increased their serum alanine aminotransferase and aspartate aminotransferase levels. Furthermore, A769662 administration prevented the loss of intracellular ATP without interfering with the APAP-mediated reduction of mitochondrial dysfunction. In contrast, inhibition of glycolysis by 2-deoxy-glucose eliminated the beneficial effects of A769662 on APAP-mediated liver injury. In conclusion, A769662 can effectively protect mice against APAP-induced liver injury through ATP synthesis by anaerobic glycolysis. Furthermore, stimulation of AMPK may have potential therapeutic application for APAP overdose.

  3. The use of adenosine and adenosine triphosphate testing in the diagnosis, risk stratification and management of patients with syncope: current evidence and future perspectives.

    PubMed

    Fragakis, Nikolaos; Antoniadis, Antonios P; Saviano, Massimo; Vassilikos, Vassilios; Pappone, Carlo

    2015-03-15

    Syncope is a significant source of cardiovascular-related morbidity yet the etiology is frequently obscure and the identification of patients at highest risk is challenging. Adenosine (AD) and adenosine triphosphate (ATP) administrations have been suggested as potentially useful non-invasive tools in the diagnostic workup of patients with neurally-mediated or bradycardia-related syncope. It has been postulated that both compounds by modulating the autonomic innervation in the heart and exerting negative chronotropic and dromotropic effects in the conduction system, may unmask the mechanism of syncope. However, the clinical implications derived from the efficacy of both tests in the investigation of syncope remain unclear mainly due to inconclusive and occasionally contradictory results of published studies. This review article summarizes recent and past information in the use of ATP and AD in the investigation of syncope with emphasis on clinical trials. We present the current level of evidence for the use of these agents in clinical practice, identify areas where further research is warranted and highlight the future perspectives of these agents as complements to an accurate risk-stratification of patients with syncope.

  4. Adenosine 5' triphosphate evoked mobilization of intracellular calcium in central nervous system white matter of adult mouse optic nerve.

    PubMed

    James, G; Butt, A M

    1999-06-11

    Although it has been established that immature glial cells express functional purinergic receptors, the responsiveness of mature glial cells in vivo had not been elucidated. This question was addressed using fura-2 ratiometric measurements of [Ca2+]i in the adult mouse optic nerve, a central nervous system (CNS) white matter tract, taking advantage of the facts that (i), the optic nerve contains glial cells but not neurons and (ii), that fura-2 loads primarily astrocytes in isolated intact optic nerves. We show that adenosine 5' triphosphate (ATP) evoked an increase in [Ca2+]i in a concentration-dependent manner with a half-maximal effect at 3 microm ATP, and with a rank order of agonist potency of ATP > ADP > alpha,beta-methyline-ATP > UDP > adenosine. The results indicate mainly P2Y and P2X components, consistent with the in vitro astroglial purinergic receptor profile. The in vivo response of mature glia to ATP may be important in their response to CNS damage.

  5. The role of microorganisms in the degradation of adenosine triphosphate (ATP) in chill-stored common carp (Cyprinus carpio) fillets.

    PubMed

    Li, Dapeng; Zhang, Longteng; Song, Sijia; Wang, Zhiying; Kong, Chunli; Luo, Yongkang

    2017-06-01

    Biochemical and microbial changes after harvest strongly affect the final quality and shelf life of fish and fish products. In this study, the role of microbes in the degradation of adenosine triphosphate (ATP), and the origin of adenosine monophosphate deaminase (AMPD) and acid phosphatase (ACP) in common carp fillets during different stages of chilled storage (at 4°C) were investigated. The content of ATP, ADP, AMP, IMP, HxR, and Hx, the activity of AMPD and ACP, and the total count of viable, Aeromonas, Pseudomonas, H2S-producing bacteria, and lactic acid bacteria were examined. Results indicated that the population of microbial communities in control samples increased with storage time, and Pseudomonas peaked on the 10th day of storage. Changes in AMPD activity were less related to the abundance of microbes during the entire storage period. However, ACP was derived from both fish muscle and microbial secretion during the middle and late stages of storage. Degradation of ATP to IMP was not affected by spoilage bacteria, but the hydrolysis of IMP, and the transformation of HxR to Hx was affected considerably by the spoilage bacteria.

  6. Photoinduced electron transfer between Fe(III) and adenosine triphosphate-BODIPY conjugates: Application to alkaline-phosphatase-linked immunoassay.

    PubMed

    Lin, Jia-Hui; Yang, Ya-Chun; Shih, Ya-Chen; Hung, Szu-Ying; Lu, Chi-Yu; Tseng, Wei-Lung

    2016-03-15

    Fluorescent boron dipyrromethene (BODIPY) analogs are often used as sensors for detecting various species because of their relatively high extinction coefficients, outstanding fluorescence quantum yields, photostability, and pH-independent fluorescence. However, there is little-to-no information in the literature that describes the use of BODIPY analogs for detecting alkaline phosphatase (ALP) activity and inhibition. This study discovered that the fluorescence of BODIPY-conjugated adenosine triphosphate (BODIPY-ATP) was quenched by Fe(III) ions through photoinduced electron transfer. The ALP-catalyzed hydrolysis of BODIPY-ATP resulted in the formation of BODIPY-adenosine and phosphate ions. The fluorescence of the generated BODIPY-adenosine was insensitive to the change in the concentration of Fe(III) ions. Thus, the Fe(III)-induced fluorescence quenching of BODIPY-ATP can be paired with its ALP-mediated dephosphorylation to design a turn-on fluorescence probe for ALP sensing. A method detection limit at a signal-to-noise ratio of 3 for ALP was estimated to be 0.02 units/L (~6 pM; 1 ng/mL). This probe was used for the screening of ALP inhibitors, including Na3VO4, imidazole, and arginine. Because ALP is widely used in enzyme-linked immunosorbent assays, the probe was coupled to an ALP-linked immunosorbent assay for the sensitive and selective detection of immunoglobulin G (IgG). The lowest detectable concentration for IgG in this system was 5 ng/mL. Compared with the use of 3,6-fluorescein diphosphate as a signal reporter in an ALP-linked immunosorbent assay, the proposed system provided comparable sensitivity, large linear range, and high stability over temperature and pH changes.

  7. The ATP-binding cassette transporter OsABCG15 is required for anther development and pollen fertility in rice.

    PubMed

    Niu, Bai-Xiao; He, Fu-Rong; He, Ming; Ren, Ding; Chen, Le-Tian; Liu, Yao-Guang

    2013-08-01

    Plant male reproductive development is a complex biological process, but the underlying mechanism is not well understood. Here, we characterized a rice (Oryza sativa L.) male sterile mutant. Based on map-based cloning and sequence analysis, we identified a 1,459-bp deletion in an adenosine triphosphate (ATP)-binding cassette (ABC) transporter gene, OsABCG15, causing abnormal anthers and male sterility. Therefore, we named this mutant osabcg15. Expression analysis showed that OsABCG15 is expressed specifically in developmental anthers from stage 8 (meiosis II stage) to stage 10 (late microspore stage). Two genes CYP704B2 and WDA1, involved in the biosynthesis of very-long-chain fatty acids for the establishment of the anther cuticle and pollen exine, were downregulated in osabcg15 mutant, suggesting that OsABCG15 may play a key function in the processes related to sporopollenin biosynthesis or sporopollenin transfer from tapetal cells to anther locules. Consistently, histological analysis showed that osabcg15 mutants developed obvious abnormality in postmeiotic tapetum degeneration, leading to rapid degredation of young microspores. The results suggest that OsABCG15 plays a critical role in exine formation and pollen development, similar to the homologous gene of AtABCG26 in Arabidopsis. This work is helpful to understand the regulatory network in rice anther development.

  8. Disruption of de Novo Adenosine Triphosphate (ATP) Biosynthesis Abolishes Virulence in Cryptococcus neoformans.

    PubMed

    Blundell, Ross D; Williams, Simon J; Arras, Samantha D M; Chitty, Jessica L; Blake, Kirsten L; Ericsson, Daniel J; Tibrewal, Nidhi; Rohr, Jurgen; Koh, Y Q Andre E; Kappler, Ulrike; Robertson, Avril A B; Butler, Mark S; Cooper, Matthew A; Kobe, Bostjan; Fraser, James A

    2016-09-09

    Opportunistic fungal pathogens such as Cryptococcus neoformans are a growing cause of morbidity and mortality among immunocompromised populations worldwide. To address the current paucity of antifungal therapeutic agents, further research into fungal-specific drug targets is required. Adenylosuccinate synthetase (AdSS) is a crucial enzyme in the adeosine triphosphate (ATP) biosynthetic pathway, catalyzing the formation of adenylosuccinate from inosine monophosphate and aspartate. We have investigated the potential of this enzyme as an antifungal drug target, finding that loss of function results in adenine auxotrophy in C. neoformans, as well as complete loss of virulence in a murine model. Cryptococcal AdSS was expressed and purified in Escherichia coli and the enzyme's crystal structure determined, the first example of a structure of this enzyme from fungi. Together with enzyme kinetic studies, this structural information enabled comparison of the fungal enzyme with the human orthologue and revealed species-specific differences potentially exploitable via rational drug design. These results validate AdSS as a promising antifungal drug target and lay a foundation for future in silico and in vitro screens for novel antifungal compounds.

  9. Probing the Interaction at the Nano-Bio Interface Using Raman Spectroscopy: ZnO Nanoparticles and Adenosine Triphosphate Biomolecules.

    PubMed

    Bhaumik, A; Shearin, A M; Delong, R; Wanekaya, A; Ghosh, K

    2014-08-14

    With the advent of nanobiotechnology, there will be an increase in the interaction between engineered nanomaterials and biomolecules. Nanoconjugates with cells, organelles, and intracellular structures containing DNA, RNA, and proteins establish sequences of nano-bio boundaries that depend on several intricate complex biophysicochemical reactions. Given the complexity of these interactions, and their import in governing life at the molecular level, it is extremely important to begin to understand such nanoparticle-biomaterial association. Here we report a unique method of probing the kinematics between an energy biomolecule, adenosine triphosphate (ATP), and hydrothermally synthesized ZnO nanostructures using micro Raman spectroscopy, X-ray diffraction, and electron microscopy experiments. For the first time we have shown by Raman spectroscopy analysis that the ZnO nanostructures interact strongly with the nitrogen (N7) atom in the adenine ring of the ATP biomolecule. Raman spectroscopy also confirms the importance of nucleotide base NH2 group hydrogen bonding with water molecules and phosphate group ionization and their pH dependence. Calculation of molecular bond force constants from Raman spectroscopy reinforces our experimental data. These data present convincing evidence of pH-dependent interactions between ATP and zinc oxide nanomaterials. Significantly, Raman spectroscopy is able to probe such difficult to study and subtle nano-bio interactions and may be applied to elegantly elucidate the nano-bio interface more generally.

  10. Adenosine triphosphate prevents serum deprivation-induced apoptosis in human mesenchymal stem cells via activation of the MAPK signaling pathways.

    PubMed

    Berlier, Jessica L; Rigutto, Sabrina; Dalla Valle, Antoine; Lechanteur, Jessica; Soyfoo, Muhammad S; Gangji, Valerie; Rasschaert, Joanne

    2015-01-01

    Human mesenchymal stem cells (hMSC) are multipotent cells derived from various sources including adipose and placental tissues as well as bone marrow. Owing to their regenerative and immunomodulatory properties, their use as a potential therapeutic tool is being extensively tested. However, one of the major hurdles in using cell-based therapy is the use of fetal bovine serum that can trigger immune responses, viral and prion diseases. The development of a culture medium devoid of serum while preserving cell viability is therefore a major challenge. In this study, we demonstrated that adenosine triphosphate (ATP) restrained serum deprivation-induced cell death in hMSC by preventing caspases 3/7 activation and modulating ERK1/2 and p38 MAPK signaling pathways. We also showed that serum deprivation conditions triggered dephosphorylation of the proapoptotic protein Bad leading to cell death. Adjunction of ATP restored the phosphorylation state of Bad. Furthermore, ATP significantly modulated the expression of proapoptopic and antiapoptotic genes, in favor of an antiapoptotic profile expression. Finally, we established that hMSC released a high amount of ATP in the extracellular medium when cultured in a serum-free medium. Collectively, our results demonstrate that ATP favors hMSC viability in serum deprivation conditions. Moreover, they shed light on the cardinal role of the MAPK pathways, ERK1/2 and p38 MAPK, in promoting hMSC survival.

  11. Nicking endonuclease-assisted recycling of target-aptamer complex for sensitive electrochemical detection of adenosine triphosphate.

    PubMed

    Hu, Tianxing; Wen, Wei; Zhang, Xiuhua; Wang, Shengfu

    2016-02-21

    An electrochemical biosensor was developed for the detection of adenosine triphosphate (ATP) based on target-induced conformation switching and nicking endonuclease (NEase)-assisted signal amplification. The electrochemical biosensor was constructed by base pairing and target recognition. After capture DNA hybridized with the gold electrode, a significant current of Methylene Blue (MB) was obtained by differential pulse voltammetry. In the presence of ATP, the hairpin DNA formed a G-quadruplex structure due to the specific recognition between hairpin DNA and ATP. Then the exposed part of the target-aptamer complex hybridized with the 3'-terminus of capture DNA to form a specific nicking site for Nb.BbvCI, which led to NEase-assisted target-aptamer complex recycling. The released target-aptamer complex hybridized with the remaining capture DNA. Nb.BbvCI-assisted target-aptamer complex recycling caused the continuous cleavage of capture DNA with MB at its 5'-terminus, resulting in release of a certain amount of DNA fragment labeled with MB. Then the current value decreased significantly. The reduced current showed a linear range from 10 nM to 1 μM with a limit of detection as low as 3.4 nM. Furthermore, the proposed strategy can be used for the detection of similar substances.

  12. Adenosine triphosphate-competitive mTOR inhibitors: a new class of immunosuppressive agents that inhibit allograft rejection.

    PubMed

    Rosborough, B R; Raïch-Regué, D; Liu, Q; Venkataramanan, R; Turnquist, H R; Thomson, A W

    2014-09-01

    The mechanistic/mammalian target of rapamycin (mTOR) is inhibited clinically to suppress T cell function and prevent allograft rejection. mTOR is the kinase subunit of two mTOR-containing complexes, mTOR complex (mTORC) 1 and 2. Although mTORC1 is inhibited by the macrolide immunosuppressant rapamycin (RAPA), its efficacy may be limited by its inability to block mTORC1 completely and its limited effect on mTORC2. Adenosine triphosphate (ATP)-competitive mTOR inhibitors are an emerging class of mTOR inhibitors that compete with ATP at the mTOR active site and inhibit any mTOR-containing complex. Since this class of compounds has not been investigated for their immunosuppressive potential, our goal was to determine the influence of a prototypic ATP-competitive mTOR inhibitor on allograft survival. AZD8055 proved to be a potent suppressor of T cell proliferation. Moreover, a short, 10-day course of the agent successfully prolonged murine MHC-mismatched, vascularized heart transplant survival. This therapeutic effect was associated with increased graft-infiltrating regulatory T cells and reduced CD4(+) and CD8(+) T cell interferon-γ production. These studies establish for the first time, that ATP-competitive mTOR inhibition can prolong organ allograft survival and warrant further investigation of this next generation mTOR inhibitors.

  13. Supplementation of exogenous adenosine 5'-triphosphate enhances mechanical properties of 3D cell-agarose constructs for cartilage tissue engineering.

    PubMed

    Gadjanski, Ivana; Yodmuang, Supansa; Spiller, Kara; Bhumiratana, Sarindr; Vunjak-Novakovic, Gordana

    2013-10-01

    Formation of tissue-engineered cartilage is greatly enhanced by mechanical stimulation. However, direct mechanical stimulation is not always a suitable method, and the utilization of mechanisms underlying mechanotransduction might allow for a highly effective and less aggressive alternate means of stimulation. In particular, the purinergic, adenosine 5'-triphosphate (ATP)-mediated signaling pathway is strongly implicated in mechanotransduction within the articular cartilage. We investigated the effects of transient and continuous exogenous ATP supplementation on mechanical properties of cartilaginous constructs engineered using bovine chondrocytes and human mesenchymal stem cells (hMSCs) encapsulated in an agarose hydrogel. For both cell types, we have observed significant increases in equilibrium and dynamic compressive moduli after transient ATP treatment applied in the fourth week of cultivation. Continuous ATP treatment over 4 weeks of culture only slightly improved the mechanical properties of the constructs, without major changes in the total glycosaminoglycan (GAG) and collagen content. Structure-function analyses showed that transiently ATP-treated constructs, and in particular those based on hMSCs, had the highest level of correlation between compositional and mechanical properties. Transiently treated groups showed intense staining of the territorial matrix for GAGs and collagen type II. These results indicate that transient ATP treatment can improve functional mechanical properties of cartilaginous constructs based on chondrogenic cells and agarose hydrogels, possibly by improving the structural organization of the bulk phase and territorial extracellular matrix (ECM), that is, by increasing correlation slopes between the content of the ECM components (GAG, collagen) and mechanical properties of the construct.

  14. Influence of Thromboxane A2 on the Regulation of Adenosine Triphosphate-Sensitive Potassium Channels in Mouse Ventricular Myocytes

    PubMed Central

    Jeong, In Seok; Cho, Hwa Jin; Cho, Jeong Gwan; Kim, Sang Hyung; Na, Kook Joo

    2016-01-01

    Background and Objectives Adenosine triphosphate (ATP)-sensitive potassium (KATP) channels play an important role in myocardial protection. We examined the effects of thromboxane A2 on the regulation of KATP channel activity in single ventricular myocytes. Subjects and Methods Single ventricular myocytes were isolated from the hearts of adult Institute of Cancer Research (ICR) mice by enzymatic digestion. Single channel activity was recorded by excised inside-out and cell-attached patch clamp configurations at −60 mV holding potential during the perfusion of an ATP-free K-5 solution. Results In the excised inside-out patches, the thromboxane A2 analog, U46619, decreased the KATP channel activity in a dose-dependent manner; however, the thromboxane A2 receptor antagonist, SQ29548, did not significantly attenuate the inhibitory effect of U46619. In the cell-attached patches, U46619 inhibited dinitrophenol (DNP)-induced KATP channel activity in a dose-dependent manner, and SQ29548 attenuated the inhibitory effects of U46619 on DNP-induced KATP channel activity. Conclusion Thromboxane A2 may inhibit KATP channel activity, and may have a harmful effect on ischemic myocardium. PMID:27482267

  15. Electrochemiluminescence of blue-luminescent graphene quantum dots and its application in ultrasensitive aptasensor for adenosine triphosphate detection.

    PubMed

    Lu, Juanjuan; Yan, Mei; Ge, Lei; Ge, Shenguang; Wang, Shaowei; Yan, Jixian; Yu, Jinghua

    2013-09-15

    A simple approach based on exfoliating and disintegrating treatments for graphite oxide, followed by hydrothermal synthesis, was developed to prepare water-soluble graphene quantum dots (GQDs). The as-prepared GQDs exhibited bright blue emission under ultraviolet irradiation (∼365nm), and showed an excitation-independent photoluminescence feature. More importantly, a newly anodic electrochemiluminescence (ECL) was observed from the water-soluble GQDs with H2O2 as coreactant for the first time, and the ECL induced a strong light emission at a low potential (ca. 0.4V vs. Ag/AgCl). The ECL mechanism is investigated in detail. Employing SiO2 nanospheres as signal carrier, a novel SiO2/GQDs ECL signal amplification labels were synthesized based on which a ultrasensitive ECL aptamer sensor was proposed. Under the optimized experimental conditions, the proposed ECL aptamer sensor exhibited excellent analytical performance for adenosine triphosphate (ATP) determination, ranging from 5.0×10(-12) to 5.0×10(-9)molL(-1) with the detection limit of 1.5×10(-12)molL(-1). Due to the low cytotoxicity and excellent biocompatibility, GQDs are demonstrated to be an eco-friendly material as well as excellent ECL labeling agents for biosensor.

  16. Controlled injection of a liquid into ultra-high vacuum: Submonolayers of adenosine triphosphate deposited on Cu(110)

    NASA Astrophysics Data System (ADS)

    Sobrado, J. M.; Martín-Gago, J. A.

    2016-10-01

    We have combined a fast-valve device with vacuum technology for implementing a new method that allows introducing liquid solutions in an ultra-high vacuum chamber in the form of very small droplets. This technical development allows the easy deposition of (bio) organic molecules or small nanoparticles on a surface in a fully in-situ process, avoiding possible contamination due to the handle of the material. Moreover, our experimental set-up is suitable for any liquid and does not require any voltage application as in electrospray. We can easily change the operating regime from liquid droplet injection to the formation of a highly dispersive jet of micro-droplets by exclusively adjusting external parameters. Due to the nature of the injection process, the operational protocol makes possible the deposition of delicate molecular species that cannot be thermally sublimated. In particular, we have used this system to study the deposition of adenosine triphosphate on Cu(110). The structure of the layer was analyzed by X-ray photoemission spectroscopy and the evolution of the signal from the deposited molecule with the number of injections indicates that the molecular coverage can be controlled with submonolayer precision.

  17. Carbon quantum dots-based recyclable real-time fluorescence assay for alkaline phosphatase with adenosine triphosphate as substrate.

    PubMed

    Qian, Zhaosheng; Chai, Lujing; Tang, Cong; Huang, Yuanyuan; Chen, Jianrong; Feng, Hui

    2015-03-03

    A convenient, reliable, and highly sensitive real-time assay for alkaline phosphatase (ALP) activity in the continuous and recyclable way is established on the basis of aggregation and disaggregation of carbon quantum dots (CQDs) through the competitive assay approach. CQDs and adenosine triphosphate (ATP) were used as the fluorescent indicator and substrate for ALP activity assessment, respectively. Richness of carboxyl groups on the surface of CQDs enables their severe aggregation triggered by cerium ions, which results in effective fluorescence quenching. Under the catalytic hydrolysis of ALP, ATP can be rapidly transformed to phosphate ions. Stronger affinity of phosphate ions to cerium ions than carboxyl groups is taken advantage of to achieve fluorescence recovery induced by redispersion of CQDs in the presence of ALP and ATP. Quantitative evaluation of ALP activity in a broad range from 4.6 to 383.3 U/L with the detection limit of 1.4 U/L can be realized in this way, which endows the assay with high enough sensitivity for practical detection in human serum. The assay can be used in a recyclable way for more than three times since the generated product CePO4 as a precipitate can be easily removed from the standard assay system. This strategy broadens the sensing application of fluorescent CQDs with excellent biocompatibility and provides an example based on disaggregation in optical probe development.

  18. A sensor for adenosine triphosphate fabricated by laser-induced forward transfer of luciferase onto a poly(dimethylsiloxane) microchip

    NASA Astrophysics Data System (ADS)

    Tsuboi, Yasuyuki; Furuhata, Yosuke; Kitamura, Noboru

    2007-08-01

    Laser-induced forward transfer (LIFT) of the enzyme luciferase was explored as a potential technique to be used in the fabrication of a microchip adenosine triphosphate (ATP) sensor. Poly(dimethylsiloxane) (PDMS) was selected as the substrate for deposition of the luciferase. In comparison with other solid substrates, such as glass and polystyrene, it was found that the flexibility of PDMS made it a superior substrate for the immobilization of micro-spots of luciferase. LIFT of luciferase onto a PDMS substrate using a 355 nm laser was successfully carried out, while the bioactivity of the enzyme was maintained. Yellow luminescence ascribed to luciferase was observed from a transferred spot on the PDMS chip from the enzymatic reaction between luciferin and ATP. A microchip ATP sensor was also fabricated by attaching a small photodiode to the PDMS chip. On the basis of the fabricated microchip, the Michaelis-Menten relation between the luminescence intensity from the spot, and the ATP concentration was confirmed. The potential for fabricating biosensors using a combination of the LIFT technique with a PDMS substrate was shown to be very good.

  19. Rapid detection of Escherichia coli and enterococci in recreational water using an immunomagnetic separation/adenosine triphosphate technique

    USGS Publications Warehouse

    Bushon, R.N.; Brady, A.M.; Likirdopulos, C.A.; Cireddu, J.V.

    2009-01-01

    Aims: The aim of this study was to examine a rapid method for detecting Escherichia coli and enterococci in recreational water. Methods and Results: Water samples were assayed for E. coli and enterococci by traditional and immunomagnetic separation/adenosine triphosphate (IMS/ATP) methods. Three sample treatments were evaluated for the IMS/ATP method: double filtration, single filtration, and direct analysis. Pearson's correlation analysis showed strong, significant, linear relations between IMS/ATP and traditional methods for all sample treatments; strongest linear correlations were with the direct analysis (r = 0.62 and 0.77 for E. coli and enterococci, respectively). Additionally, simple linear regression was used to estimate bacteria concentrations as a function of IMS/ATP results. The correct classification of water-quality criteria was 67% for E. coli and 80% for enterococci. Conclusions: The IMS/ATP method is a viable alternative to traditional methods for faecal-indicator bacteria. Significance and Impact of the Study: The IMS/ATP method addresses critical public health needs for the rapid detection of faecal-indicator contamination and has potential for satisfying US legislative mandates requiring methods to detect bathing water contamination in 2 h or less. Moreover, IMS/ATP equipment is considerably less costly and more portable than that for molecular methods, making the method suitable for field applications. ?? 2009 The Authors.

  20. Action of angiotensin II, 5-hydroxytryptamine and adenosine triphosphate on ionic currents in single ear artery cells of the rabbit.

    PubMed

    Hughes, A D; Bolton, T B

    1995-10-01

    1. Angiotensin II, 5-hydroxytryptamine (5-HT) and adenosine triphosphate (ATP) evoked a transient inward current in isolated single car artery cells of rabbit held at -60 mV by whole cell voltage clamp in physiological saline using a KCL-containing pipette solution. Under these conditions agonist did not activate a calcium-dependent potassium current. 2. Responses to each agonist were transient and desensitized rapidly. Inward current at -60 mV holding potential was not abolished by blockade of voltage-dependent calcium channels or by buffering intracellular calcium with BAPTA, a calcium chelator, or following depletion of intracellular calcium stores with ryanodine. 3. The shape of the current-voltage relationships and the reversal potentials of the current induced by angiotensin II, 5-HT and ATP were similar under a variety of ionic conditions. Agonist-induced current was unaffected by replacing intracellular chloride with citrate ions or by replacing intracellular sodium with caesium or extracellular sodium with barium or calcium. Replacement of extracellular sodium with Tris shifted the reversal potential in all cases by around 30 mV negatively. 4. These data suggest that angiotensin II, 5-HT and ATP activate similar cationic conductances which are relatively non-selective allowing mono- and divalent cations to cross the smooth muscle cell membrane. These channels may allow the influx of calcium under physiological conditions.

  1. Calcium and adenosine triphosphate control of cellular pathology: asparaginase-induced pancreatitis elicited via protease-activated receptor 2

    PubMed Central

    Peng, Shuang; Gerasimenko, Julia V.; Tsugorka, Tatiana; Gryshchenko, Oleksiy; Samarasinghe, Sujith; Gerasimenko, Oleg V.

    2016-01-01

    Exocytotic secretion of digestive enzymes from pancreatic acinar cells is elicited by physiological cytosolic Ca2+ signals, occurring as repetitive short-lasting spikes largely confined to the secretory granule region, that stimulate mitochondrial adenosine triphosphate (ATP) production. By contrast, sustained global cytosolic Ca2+ elevations decrease ATP levels and cause necrosis, leading to the disease acute pancreatitis (AP). Toxic Ca2+ signals can be evoked by products of alcohol and fatty acids as well as bile acids. Here, we have investigated the mechanism by which l-asparaginase evokes AP. Asparaginase is an essential element in the successful treatment of acute lymphoblastic leukaemia, the most common type of cancer affecting children, but AP is a side-effect occurring in about 5–10% of cases. Like other pancreatitis-inducing agents, asparaginase evoked intracellular Ca2+ release followed by Ca2+ entry and also substantially reduced Ca2+ extrusion because of decreased intracellular ATP levels. The toxic Ca2+ signals caused extensive necrosis. The asparaginase-induced pathology depended on protease-activated receptor 2 and its inhibition prevented the toxic Ca2+ signals and necrosis. We tested the effects of inhibiting the Ca2+ release-activated Ca2+ entry by the Ca2+ channel inhibitor GSK-7975A. This markedly reduced asparaginase-induced Ca2+ entry and also protected effectively against the development of necrosis. This article is part of the themed issue ‘Evolution brings Ca2+ and ATP together to control life and death’. PMID:27377732

  2. A new strategy for the detection of adenosine triphosphate by aptamer/quantum dot biosensor based on chemiluminescence resonance energy transfer.

    PubMed

    Zhou, Zi-Ming; Yu, Yong; Zhao, Yuan-Di

    2012-09-21

    We designed an aptasensor for the detection of adenosine triphosphate (ATP) based on chemiluminescence resonance energy transfer (CRET). An adenosine aptamer was cut into two pieces of ssDNA, which were attached to quantum dots (QDs) and horse radish peroxidase (HRP), respectively. They could reassemble into specific structures in the presence of ATP and then decrease the distance of HRP and QDs. ATP detection can be easily realized according to the fluorescent intensity of QDs, which is excited by CRET between luminol and QDs. Results show that the concentration of ATP is linear relation with the fluorescent intensity of the peak of QDs emission and the linear range for the linear equation is from 50 μM to 231 μM and the detection limit was 185 nM. When the concentration of ATP was 2 mM, the efficiency of CRET is 13.6%. Good specificity for ATP had been demonstrated compared to thymidine triphosphate (TTP), cytidine triphosphate (CTP) and guanosine triphosphate (GTP), when 1 mM of each was added, respectively. This method needs no external light source and can avoid autofluorescence and photobleaching, and ATP can be detected selectively, specifically, and sensitively in a low micromolar range, which means that the strategy reported here can be applicable to the detection of several other target molecules.

  3. Adsorption of nucleotides on biomimetic apatite: The case of adenosine 5⿲ triphosphate (ATP)

    NASA Astrophysics Data System (ADS)

    Hammami, Khaled; El-Feki, Hafed; Marsan, Olivier; Drouet, Christophe

    2016-01-01

    ATP is a well-known energy supplier in cells. The idea to associate ATP to pharmaceutical formulations/biotechnological devices to promote cells activity by potentially modulating their microenvironment thus appears as an appealing novel approach. Since biomimetic nanocrystalline apatites have shown great promise for biomedical applications (bone regeneration, cells diagnostics/therapeutics, ⿦), thanks to a high surface reactivity and an intrinsically high biocompatibility, the present contribution was aimed at exploring ATP/apatite interactions. ATP adsorption on a synthetic carbonated nanocrystalline apatite preliminarily characterized (by XRD, FTIR, Raman, TG-DTA and SEM-EDX) was investigated in detail, pointing out a good agreement with Sips isothermal features. Adsorption characteristics were compared to those previously obtained on monophosphate nucleotides (AMP, CMP), unveiling some specificities. ATP was found to adsorb effectively onto biomimetic apatite: despite smaller values of the affinity constant KS and the exponential factor m, larger adsorbed amounts were reached for ATP as compared to AMP for any given concentration in solution. m < 1 suggests that the ATP/apatite adsorption process is mostly guided by direct surface bonding rather than through stabilizing intermolecular interactions. Although standard οGads ° was estimated to only ⿿4 kJ/mol, the large value of Nmax led to significantly negative effective οGads values down to ⿿33 kJ/mol, reflecting the spontaneous character of adsorption process. Vibrational spectroscopy data (FTIR and Raman) pointed out spectral modifications upon adsorption, confirming chemical-like interactions where both the triphosphate group of ATP and its nucleic base were involved. The present study is intended to serve as a basis for future research works involving ATP and apatite nanocrystals/nanoparticles in view of biomedical applications (e.g. bone tissue engineering, intracellular drug delivery, ⿦).

  4. On the use of X-ray absorption spectroscopy to elucidate the structure of lutetium adenosine mono- and triphosphate complexes.

    PubMed

    Mostapha, S; Berthon, C; Fontaine-Vive, F; Gaysinski, M; Guérin, L; Guillaumont, D; Massi, L; Monfardini, I; Solari, P L; Thomas, O P; Charbonnel, M C; Den Auwer, C

    2014-02-01

    Although the physiological impact of the actinide elements as nuclear toxicants has been widely investigated for half a century, a description of their interactions with biological molecules remains limited. It is however of primary importance to better assess the determinants of actinide speciation in cells and more generally in living organisms to unravel the molecular processes underlying actinide transport and deposition in tissues. The biological pathways of this family of elements in case of accidental contamination or chronic natural exposure (in the case of uranium rich soils for instance) are therefore a crucial issue of public health and of societal impact. Because of the high chemical affinity of those actinide elements for phosphate groups and the ubiquity of such chemical functions in biochemistry, phosphate derivatives are considered as probable targets of these cations. Among them, nucleotides and in particular adenosine mono- (AMP) and triphosphate (ATP) nucleotides occur in more chemical reactions than any other compounds on the earth's surface, except water, and are therefore critical target molecules. In the present study, we are interested in trans-plutonium actinide elements, in particular americium and curium that are more rarely considered in environmental and bioaccumulation studies than early actinides like uranium, neptunium and plutonium. A first step in this strategy is to work with chemical analogues like lanthanides that are not radioactive and therefore allow extended physical chemical characterization to be conducted that are difficult to perform with radioactive materials. We describe herein the interaction of lutetium(III) with adenosine AMP and ATP. With AMP and ATP, insoluble amorphous compounds have been obtained with molar ratios of 1:2 and 1:1, respectively. With an excess of ATP, with 1:2 molar ratio, a soluble complex has been obtained. A combination of spectroscopic techniques (IR, NMR, ESI-MS, EXAFS) together with quantum

  5. An exonuclease I-based label-free fluorometric aptasensor for adenosine triphosphate (ATP) detection with a wide concentration range.

    PubMed

    Wei, Yanli; Chen, Yanxia; Li, Huanhuan; Shuang, Shaomin; Dong, Chuan; Wang, Gufeng

    2015-01-15

    A novel aptamer-based label-free assay for sensitive and selective detection of ATP was developed. This assay employs a new aptamer/fluorescent probe system that shows resistance to exonuclease I (Exo I) digestion upon binding to ATP molecules. In the absence of ATP, the complex between the ATP-binding aptamer (ATP-aptamer) and a DNA binding dye, berberine, is digested upon the addition of exonuclease I, leading to the release of berberine into solution and consequently, quenched berberine fluorescence. In the presence of ATP, the ATP-binding aptamer folds into a G-quadruplex structure that is resistant to Exo I digestion. Accordingly, berberine is protected in the G-quadruplex structure and high fluorescence intensity is observed. As such, based on the fluorescence signal change, a label-free fluorescence assay for ATP was developed. Factors affecting the analysis of ATP including the concentration of ATP-binding aptamer, reaction time, temperature and the concentration of Exo I were comprehensively investigated. Under optimal conditions, the fluorescence intensity of the sensing system displayed a response for ATP in a wide range up to 17.5 mM with a detection limit of 140 nM.

  6. Appearance of adenosine triphosphate in the coronary sinus effluent from isolated working rat heart in response to hypoxia.

    PubMed Central

    Clemens, M G; Forrester, T

    1981-01-01

    1. A working rat heart preparation was used to study the release of adenosine-5'-triphosphate (ATP) into the coronary sinus effluent in response to hypoxia. 2. The left ventricle was set to pump against an hydrostatic pressure of 65 cm water; the left atrial filling pressure was kept constant at 10 cm water. The power output of the heart at these pressures was estimated to be approximately one half of the maximum power development. 3. Samples for ATP assay were collected (a) 30 sec before onset of hypoxia, (b) 60-90 sec after onset of hypoxia, (c) 5 min after restoration of oxygenated buffer solution. Respective concentrations of ATP were (nM +/- S.E.) 0.63 (+/- 0.18), 4.70 (+/- 0.39) and 0.63 (+/- 0.06). The total amounts of ATP detected were (p-mole/min) 5.9 (+/- 0.9), 46.1 (+/- 6.0) and 5.5 (+/- 1.2) respectively. 4. Viability of the hearts was judged to be satisfactory on the following grounds. Alterations in left atrial filling pressure produced typical Frank-Starling responses of the left ventricle. Oxygen extraction from the perfusate increased in response to increased workload. Coronary blood flow increased immediately upon introduction of hypoxic conditions and mechanical recovery from hypoxia was always complete within 5 min of restoring oxygen. 5. In view of the marked extracellular ATPase activity it is concluded that significant vasodilatory concentrations of ATP are released into the myocardial extracellular space in response to hypoxia. A scheme is proposed describing the possible role of adenine nucleotides in the local control of myocardial blood flow. PMID:7264990

  7. Intrapulmonary arteries respond to serotonin and adenosine triphosphate in broiler chickens susceptible to idiopathic pulmonary arterial hypertension.

    PubMed

    Kluess, H A; Stafford, J; Evanson, K W; Stone, A J; Worley, J; Wideman, R F

    2012-06-01

    This study examined factors contributing to increased vascular resistance and plexiform lesion formation in broiler chickens susceptible to idiopathic pulmonary arterial hypertension (IPAH). A diet supplemented with excess tryptophan (high-Trp diet), the precursor for serotonin, was used to accelerate the development of IPAH. Broilers fed the high-Trp diet had higher pulmonary arterial pressures than broilers fed the control diet, and plexiform lesion incidences tended to be higher (P = 0.11) in the high-Trp group than in the control group at 30 d of age. The intrapulmonary arteries were assessed for vasoconstriction in response to serotonin and adenosine triphosphate (ATP) and for activities of key metabolic enzymes for serotonin and ATP. The pulmonary artery (defined as the first major branch of the pulmonary artery inside the lung) and the primary pulmonary arterial rami (defined as the second major branch of the pulmonary artery inside the lung) both exhibited vasoconstriction in response to serotonin and ATP. This is the first study to demonstrate purinergic-mediated vasoconstriction in intrapulmonary arteries from broilers. Arteriole responsiveness did not differ between broilers fed the control diet or the high-Trp diet. Therefore, the high-Trp diet enhanced the development of IPAH but did not affect the artery's sensitivity to serotonin or ATP. Monoamine oxidase activity, responsible for the breakdown of serotonin, was severely impaired in pulmonary arteries from broilers in the high-Trp group. Accordingly, serotonin may persist longer and elicit an amplified response in broilers fed the high-Trp diet.

  8. A cascade amplification strategy based on rolling circle amplification and hydroxylamine amplified gold nanoparticles enables chemiluminescence detection of adenosine triphosphate.

    PubMed

    Wang, Ping; Zhang, Tonghuan; Yang, Taoyi; Jin, Nan; Zhao, Yanjun; Fan, Aiping

    2014-08-07

    A highly sensitive and selective chemiluminescent (CL) biosensor for adenosine triphosphate (ATP) was developed by taking advantage of the ATP-dependent enzymatic reaction (ATP-DER), the powerful signal amplification capability of rolling circle amplification (RCA), and hydroxylamine-amplified gold nanoparticles (Au NPs). The strategy relies on the ability of ATP, a cofactor of T4 DNA ligase, to trigger the ligation-RCA reaction. In the presence of ATP, the T4 DNA ligase catalyzes the ligation reaction between the two ends of the padlock probe, producing a closed circular DNA template that initiates the RCA reaction with phi29 DNA polymerase and dNTP. Therein, many complementary copies of the circular template can be generated. The ATP-DER is eventually converted into a detectable CL signal after a series of processes, including gold probe hybridization, hydroxylamine amplification, and oxidative gold metal dissolution coupled with a simple and sensitive luminol CL reaction. The CL signal is directly proportional to the ATP level. The results showed that the detection limit of the assay is 100 pM of ATP, which compares favorably with those of other ATP detection techniques. In addition, by taking advantage of ATP-DER, the proposed CL sensing system exhibits extraordinary specificity towards ATP and could distinguish the target molecule ATP from its analogues. The proposed method provides a new and versatile platform for the design of novel DNA ligation reaction-based CL sensing systems for other cofactors. This novel ATP-DER based CL sensing system may find wide applications in clinical diagnosis as well as in environmental and biomedical fields.

  9. Substrate mimicry: HIV-1 reverse transcriptase recognizes 6-modified-3'-azido-2',3'-dideoxyguanosine-5'-triphosphates as adenosine analogs.

    PubMed

    Herman, Brian D; Schinazi, Raymond F; Zhang, Hong-wang; Nettles, James H; Stanton, Richard; Detorio, Mervi; Obikhod, Aleksandr; Pradère, Ugo; Coats, Steven J; Mellors, John W; Sluis-Cremer, Nicolas

    2012-01-01

    β-D-3'-Azido-2',3'-dideoxyguanosine (3'-azido-ddG) is a potent inhibitor of HIV-1 replication with a superior resistance profile to zidovudine. Recently, we identified five novel 6-modified-3'-azido-ddG analogs that exhibit similar or superior anti-HIV-1 activity compared to 3'-azido-ddG in primary cells. To gain insight into their structure-activity-resistance relationships, we synthesized their triphosphate (TP) forms and assessed their ability to inhibit HIV-1 reverse transcriptase (RT). Steady-state and pre-steady-state kinetic experiments show that the 6-modified-3'-azido-ddGTP analogs act as adenosine rather than guanosine mimetics in DNA synthesis reactions. The order of potency of the TP analogs against wild-type RT was: 3'-azido-2,6-diaminopurine >3'-azido-6-chloropurine; 3'-azido-6-N-allylaminopurine > 2-amino-6-N,N-dimethylaminopurine; 2-amino-6-methoxypurine. Molecular modeling studies reveal unique hydrogen-bonding interactions between the nucleotide analogs and the template thymine base in the active site of RT. Surprisingly, the structure-activity relationship of the analogs differed in HIV-1 RT ATP-mediated excision assays of their monophosphate forms, suggesting that it may be possible to rationally design a modified base analog that is efficiently incorporated by RT but serves as a poor substrate for ATP-mediated excision reactions. Overall, these studies identify a promising strategy to design novel nucleoside analogs that exert profound antiviral activity against both WT and drug-resistant HIV-1.

  10. Rapid and direct estimation of active biomass on granular activated carbon through adenosine tri-phosphate (ATP) determination.

    PubMed

    Velten, Silvana; Hammes, Frederik; Boller, Markus; Egli, Thomas

    2007-05-01

    Granular activated carbon (GAC) filtration is used during drinking water treatment for the removal of micropollutants such as taste and odour compounds, halogenated hydrocarbons, pesticides and pharmaceuticals. In addition, the active microbial biomass established on GAC is responsible for the removal of biodegradable dissolved organic carbon compounds present in water or formed during oxidation (e.g., ozonation and chlorination) processes. In order to conduct correct kinetic evaluations of DOC removal during drinking water treatment, and to assess the state and performance of full-scale GAC filter installations, an accurate and sensitive method for active biomass determination on GAC is required. We have developed a straight-forward method based on direct measurement of the total adenosine tri-phosphate (ATP) content of a GAC sample and other support media. In this method, we have combined flow-cytometric absolute cell counting and ATP analysis to derive case-specific ATP/cell conversion values. In this study, we present the detailed standardisation of the ATP method. An uncertainty assessment has shown that heterogeneous colonisation of the GAC particles makes the largest contribution to the combined standard uncertainty of the method. The method was applied for the investigation of biofilm formation during the start-up period of a GAC pilot-scale plant treating Lake Zurich water. A rapid increase in the biomass of up to 1.1 x 10(10)cells/g GAC dry weight (DW) within the first 33 days was observed, followed by a slight decrease to an average steady-state concentration of 7.9 x 10(9)cells/g GAC DW. It was shown that the method can be used to determine the biomass attached to the GAC for both stable and developing biofilms.

  11. Lack of correlation between Legionella colonization and microbial population quantification using heterotrophic plate count and adenosine triphosphate bioluminescence measurement.

    PubMed

    Duda, Scott; Baron, Julianne L; Wagener, Marilyn M; Vidic, Radisav D; Stout, Janet E

    2015-07-01

    This investigation compared biological quantification of potable and non-potable (cooling) water samples using pour plate heterotrophic plate count (HPC) methods and adenosine triphosphate (ATP) concentration measurement using bioluminescence. The relationship between these measurements and the presence of Legionella spp. was also examined. HPC for potable and non-potable water were cultured on R2A and PCA, respectively. Results indicated a strong correlation between HPC and ATP measurements in potable water (R = 0.90, p < 0.001). In the make-up water and two cooling towers, the correlations between ATP and HPC were much weaker but statistically significant (make-up water: R = 0.37, p = 0.005; cooling tower 1: R = 0.52, p < 0.001; cooling tower 2: R = 0.54, p < 0.001). For potable and non-potable samples, HPC exhibited higher measurement variability than ATP. However, ATP measurements showed higher microbial concentrations than HPC measurements. Following chlorination of the cooling towers, ATP measurements indicated very low bacterial concentrations (<10 colony-forming units (CFU)/mL) despite high HPC concentrations (>1000 CFU/mL) which consisted primarily of non-tuberculous mycobacteria. HPC concentrations have been suggested to be predictive of Legionella presence, although this has not been proven. Our evaluation showed that HPC or ATP demonstrated a fair predictive capacity for Legionella positivity in potable water (HPC: receiver operating characteristic (ROC) = 0.70; ATP: ROC = 0.78; p = 0.003). However, HPC or ATP correctly classified sites as positive only 64 and 62% of the time, respectively. No correlation between HPC or ATP and Legionella colonization in non-potable water samples was found (HPC: ROC = 0.28; ATP: ROC = 0.44; p = 0.193).

  12. Nitrite-induced methemoglobinaemia affects blood ionized and total magnesium level by hydrolysis of plasma adenosine triphosphate in rat.

    PubMed

    Rahman, Md Mizanur; Kim, Shang-Jin; Kim, Gi-Beum; Hong, Chul-Un; Lee, Young-Up; Kim, Sung-Zoo; Kim, Jin-Shang; Kang, Hyung-Sub

    2009-11-01

    The objective of this study was to evaluate the effects of sodium nitrite (NaNO(2))-induced methemoglobinaemia on plasma ATP (adenosine triphosphate) and corresponding changes of blood-ionized magnesium (iMg(2+)) as well as total magnesium (tMg(2+)) in a time-dependent manner. This study was performed on male Sprague-Dawley rats to which NaNO(2) was injected (10 mg/kg i.p.) to induce methemoglobinaemia. Methemoglobin (MetHb) in blood was measured before (0 min.) and after 10, 30, 60 and 120 min. of NaNO(2) injection. At respective time points, the tMg(2+), blood ions and gases were measured by atomic absorption spectrometry and ion selective electrode, respectively. Haematological parameters were checked by automatic blood cell count, and blood films were observed under light microscope. Plasma ATP was measured by bioluminescence assay using a luminometer, and plasma proteins were measured by an automatic analyser. Blood cell count (RBC, WBC and platelet), haematocrit, and haemoglobin were found to be decreased with the advancement of MetHb concentration. With the gradual increase of MetHb concentration, the plasma ATP decreased and blood iMg(2+) and plasma tMg(2+) increased significantly as time passed by in comparison with the pre-drug values. A significant decrease of the ratio of ionized calcium to iMg(2+), Na(+) and increase of K(+) was observed. In conclusion, NaNO(2)-induced methemoglobinaemia is a cause of hydrolysis of plasma ATP which is responsible for the increase of blood iMg(2+) and plasma tMg(2+) in rats.

  13. Effects of cyclooxygenase-2 inhibitor and adenosine triphosphate-sensitive potassium channel opener in syngeneic mouse islet transplantation.

    PubMed

    Juang, J-H; Kuo, C-H

    2010-12-01

    In the initial days after transplantation, islet grafts may be attacked by cytokines via cyclooxygenase-2 (COX-2), producing primary nonfunction. In addition, chronic overstimulation of β-cells may impair insulin secretion. To enhance the function of transplanted islets, the present study investigated the effects of rofecoxib, a COX-2 inhibitor, and NN414 (6-chloro-3-[1-methylcyclopropyl]amino-4H-thieno[3,2-e]-1,2,4-thiadiazine 1,1-dioxide), an adenosine triphosphate-sensitive potassium channel opener, on islet transplantation. Male inbred C57BL/6 mice were used as donors and recipients. One hundred fifty islets were isolated via collagenase digestion and density gradient, and syngeneically transplanted under the kidney capsule in mice with streptozotocin-induced diabetes. Recipients were treated with or without rofecoxib, 10 mg/kg/d orally, or with or without NN414, 3 mg/kg/d orally, for 4 weeks. After transplantation, recipient body weight, blood glucose concentration, and intraperitoneal glucose tolerance were measured. The grafted kidney was extracted for determination of insulin content at 4 weeks. In the rofecoxib-treated and NN414-treated groups and both control groups, body weight remained stable, and the blood glucose concentration decreased progressively. However, at 4 weeks after transplantation in the groups treated or not treated with rofecoxib or NN414, no significant difference was observed in recipient body weight, blood glucose concentration, and glucose tolerance or in insulin content of the graft. These data indicate that posttransplantation treatment with rofecoxib or NN414 has no beneficial effect on transplantation outcome in diabetic mouse recipients engrafted with a marginal islet mass.

  14. Depletion of cellular adenosine triphosphate and hepatocellular damage in rat after subchronic exposure to leachate from anthropogenic recycling site.

    PubMed

    Akintunde, J K; Oboh, G

    2015-11-01

    One of the major hazards arising from recycling sites is the generation of leachate containing mixed metal. This study evaluated the toxic effects of leachate obtained from Elewi Odo municipal auto-battery recycling site (EOMABRSL) on male liver functions using hepatic indices and biomarker of cellular adenosine triphosphate (ATP) in rat via the oral route. Concentrations of heavy metals analysis showed that lead, cadmium, nickel, chromium, manganese, and iron were 1.5-, 2-, 2.5-, 1.36-, 19.61-, and 8.89-folds, respectively, higher than acceptable limits set by regulatory authority World Health Organization. Copper, zinc, and cobalt were 5.9-, 300-, and 1.02-folds, respectively, lower than permissible limits. The EOMABRSL was administered at 20, 40, 60, 80, and 100% concentrations to adult male rats for 60 days. Following exposure, plasma and livers were collected for several biochemistry assays. Exposure of animals to EOMABRSL resulted in 27.51, 28.14, 63.93, 28.42, and 40.16% increase in aspartate aminotransferase activity, whereas it elevated alanine aminotransferase activity by 5.35, 22.33, 88.68, 183.02, and 193.08%, respectively, when compared with the control. Similarly, γ-glutamyl transferase activity increased by 111.22, 114.19, 122.96, 573.14, and 437.02%, respectively, when compared with the control. EOMABRSL administration significantly decreased catalase activity and reduced glutathione level and superoxide dismutase with concomitant increase in malondialdehyde and hydrogen peroxide levels. Also, significant (p < 0.05) decrease in lactate dehydrogenase (LDH) activity (marker of cellular ATP) was observed. Taken together, the hepatotoxicity of EOMABRSL could be due to the depletion of LDH and induction of oxidative damage, which may suggest possible health hazards in subjects with occupational or environmental exposure.

  15. Ratiometric detection of adenosine triphosphate (ATP) in water and real-time monitoring of apyrase activity with a tripodal zinc complex.

    PubMed

    Butler, Stephen J

    2014-11-24

    Two tripodal fluorescent probes Zn⋅L(1,2) have been synthesised, and their anion-binding capabilities were examined by using fluorescence spectroscopy. Probe Zn⋅L(1) allows the selective and ratiometric detection of adenosine triphosphate (ATP) at physiological pH, even in the presence of several competing anions, such as ADP, phosphate and bicarbonate. The probe was applied to the real-time monitoring of the apyrase-catalysed hydrolysis of ATP, in a medium that mimics an extracellular fluid.

  16. Oral adenosine-5’-triphosphate (ATP) administration increases blood flow following exercise in animals and humans

    PubMed Central

    2014-01-01

    Introduction Extracellular adenosine triphosphate (ATP) stimulates vasodilation by binding to endothelial ATP-selective P2Y2 receptors; a phenomenon, which is posited to be accelerated during exercise. Herein, we used a rat model to examine how different dosages of acute oral ATP administration affected the femoral blood flow response prior to, during, and after an exercise bout. In addition, we performed a single dose chronic administration pilot study in resistance trained athletes. Methods Animal study: Male Wistar rats were gavage-fed the body surface area, species adjusted human equivalent dose (HED) of either 100 mg (n=4), 400 mg (n=4), 1,000 mg (n=5) or 1,600 mg (n=5) of oral ATP as a disodium salt (Peak ATP®, TSI, Missoula, MT). Rats that were not gavage-fed were used as controls (CTL, n=5). Blood flow was monitored continuously: a) 60 min prior to, b) during and c) 90 min following an electrically-evoked leg-kicking exercise. Human Study: In a pilot study, 12 college-aged resistance-trained subjects were given 400 mg of ATP (Peak ATP®, TSI, Missoula, MT) daily for 12 weeks, and prior to an acute arm exercise bout at weeks 1, 4, 8, and 12. Ultrasonography-determined volumetric blood flow and vessel dilation in the brachial artery was measured at rest, at rest 30 minutes after supplementation, and then at 0, 3, and 6 minutes after the exercise. Results Animal Study: Rats fed 1,000 mg HED demonstrated significantly greater recovery blood flow (p < 0.01) and total blood flow AUC values (p < 0.05) compared to CTL rats. Specifically, blood flow was elevated in rats fed 1,000 mg HED versus CTL rats at 20 to 90 min post exercise when examining 10-min blood flow intervals (p < 0.05). When examining within-group differences relative to baseline values, rats fed the 1,000 mg and 1,600 mg HED exhibited the most robust increases in blood flow during exercise and into the recovery period. Human study: At weeks 1, 8, and 12, ATP supplementation significantly increased

  17. Beneficial effect of extracellular adenosine 5'-triphosphate treatment on the Indochinese leopard (Panthera pardus delacouri) sperm quality after cryopreservation.

    PubMed

    Thuwanut, P; Tipkantha, W; Siriaroonrat, B; Comizzoli, P; Chatdarong, K

    2016-11-22

    The Indochinese leopard (Panthera pardus delacouri) population, included in CITES Appendix I, has been declining for decades. Proper gamete preservation condition is critical for breeding programme management using artificial insemination or in vitro fertilization (IVF). The present study aimed at investigating the impact of post-thawing treatment of leopard semen with extracellular adenosine 5'-triphosphate (ATPe) on sperm quality (including morphological traits and ability to fertilize an oocyte). Semen from six adult male leopards was collected by electroejaculation (one ejaculation per cat). After the evaluation of the fresh sample quality, the semen was cryopreserved (10 × 10(6) cells per straw; two straws per cat). After thawing, the sperm sample from the first straw of each cat was divided into three aliquots: control (no ATPe), supplemented with 1.0 or 2.5 mM ATPe that were evaluated for sperm quality at 10, 30 min and 3 hr post-thawing. The sperm sample from the second straw, supplemented with 0, 1.0 or 2.5 mM ATPe for 30 min, was assessed for IVF with domestic cat oocytes. Sperm quality (all metrics) was negatively affected by the cryopreservation process (p ≤ .05). However, the percentage of sperm motility, level of progressive motility and percentage of plasma membrane integrity did not differ (p > .05) among post-thawing groups. The sperm mitochondrial membrane potential was enhanced (p ≤ .05) by ATPe treatment (1.0 and 2.5 mM; 10 min to 3 hr of incubation). Furthermore, incubation of ATPe (1.0 and 2.5 mM) for 30 min could promote sperm velocity patterns (curvilinear velocity; VCL and straight line velocity; VSL) (p ≤ .05). The percentage of pronuclear formation and cleaved embryos was increased (p ≤ .05) after 1.0 ATPe treatment (49.8 ± 2.8; 45.9 ± 1.5) compared to 0 mM (41.4 ± 3.3; 38.9 ± 0.5) whereas the number of sperm binding/oocyte did not significantly differ among groups. In summary, we suggest that ATPe

  18. Voltage-dependent magnesium block of adenosine-triphosphate-sensitive potassium channel in guinea-pig ventricular cells.

    PubMed Central

    Horie, M; Irisawa, H; Noma, A

    1987-01-01

    1. The adenosine-5'-triphosphate (ATP)-sensitive K+ channel of guinea-pig ventricular cells was examined in the presence and absence of internal Mg2+ or Na+ using an open cell-attached configuration of the patch-clamp technique. 2. Millimolar concentrations of internal Mg2+ ([Mg2+]i) produced marked fluctuations in the outward current, and the amplitude of the open-channel current was reduced with increasing [Mg2+]i. Millimolar Na+ applied internally also decreased the mean amplitude of the outward current, but the increase in current noise was not obvious. These effects became larger when the membrane potential was shifted to be more positive from the K+ equilibrium potential (EK). At potentials negative to EK the inward current was affected by neither internal Mg2+ nor Na+. 3. The external application of Na+, Mg2+ or Ca2+, however, failed to affect the single-channel current. 4. After removal of both internal Mg2+ and Na+, the mean open-channel current-voltage relationship became virtually linear. Referring to these unblocked values, relative amplitudes were determined at different levels of [Mg2+]i or [Na+]i. The dose-response relations gave a Hill coefficient of approximately 1 for Mg2+ block and approximately 2 for Na+ block. The half-maximum concentrations (Kh) for both Mg2+ and Na+ block were shifted to lower values with increasing positive potentials. 5. The power-density spectrum of the open-channel current noise induced by internal Mg2+ showed a Lorentzian function with a corner frequency above 1 kHz, suggesting that the current noise is due to rapid fluctuations of open-channel current between blocked and unblocked states. The corner frequencies gave Mg2+ block and unblock rate constants which were of the order of 10(7) M-1 s-1 and 10(4) s-1, respectively. 6. With increasing external K+ concentration ([K+]o) from 0 to 140 mM the current fluctuations became less prominent, and Kh for Mg2+ block was shifted to higher values. Raising [K+]o enhanced the

  19. Comparison of plate counts, Petrifilm, dipslides, and adenosine triphosphate bioluminescence for monitoring bacteria in cooling-tower waters.

    PubMed

    Mueller, Sherry A; Anderson, James E; Kim, Byung R; Ball, James C

    2009-04-01

    Effective bacterial control in cooling-tower systems requires accurate and timely methods to count bacteria. Plate-count methods are difficult to implement on-site, because they are time- and labor-intensive and require sterile techniques. Several field-applicable methods (dipslides, Petrifilm, and adenosine triphosphate [ATP] bioluminescence) were compared with the plate count for two sample matrices--phosphate-buffered saline solution containing a pure culture of Pseudomonas fluorescens and cooling-tower water containing an undefined mixed bacterial culture. For the pure culture, (1) counts determined on nutrient agar and plate-count agar (PCA) media and expressed as colony-forming units (CFU) per milliliter were equivalent to those on R2A medium (p = 1.0 and p = 1.0, respectively); (2) Petrifilm counts were not significantly different from R2A plate counts (p = 0.99); (3) the dipslide counts were up to 2 log units higher than R2A plate counts, but this discrepancy was not statistically significant (p = 0.06); and (4) a discernable correlation (r2 = 0.67) existed between ATP readings and plate counts. For cooling-tower water samples (n = 62), (1) bacterial counts using R2A medium were higher (but not significant; p = 0.63) than nutrient agar and significantly higher than tryptone-glucose yeast extract (TGE; p = 0.03) and PCA (p < 0.001); (2) Petrifilm counts were significantly lower than nutrient agar or R2A (p = 0.02 and p < 0.001, respectively), but not statistically different from TGE, PCA, and dipslides (p = 0.55, p = 0.69, and p = 0.91, respectively); (3) the dipslide method yielded bacteria counts 1 to 3 log units lower than nutrient agar and R2A (p < 0.001), but was not significantly different from Petrifilm (p = 0.91), PCA (p = 1.00) or TGE (p = 0.07); (4) the differences between dipslides and the other methods became greater with a 6-day incubation time; and (5) the correlation between ATP readings and plate counts varied from system to system, was poor

  20. Molecular determinants for ATP-binding in proteins: a data mining and quantum chemical analysis.

    PubMed

    Mao, Lisong; Wang, Yanli; Liu, Yuemin; Hu, Xiche

    2004-02-20

    Adenosine 5'-triphosphate (ATP) plays an essential role in all forms of life. Molecular recognition of ATP in proteins is a subject of great importance for understanding enzymatic mechanism and for drug design. We have carried out a large-scale data mining of the Protein Data Bank (PDB) to analyze molecular determinants for recognition of the adenine moiety of ATP by proteins. Non-bonded intermolecular interactions (hydrogen bonding, pi-pi stacking interactions, and cation-pi interactions) between adenine base and surrounding residues in its binding pockets are systematically analyzed for 68 non-redundant, high-resolution crystal structures of adenylate-binding proteins. In addition to confirming the importance of the widely known hydrogen bonding, we found out that cation-pi interactions between adenine base and positively charged residues (Lys and Arg) and pi-pi stacking interactions between adenine base and surrounding aromatic residues (Phe, Tyr, Trp) are also crucial for adenine binding in proteins. On average, there exist 2.7 hydrogen bonding interactions, 1.0 pi-pi stacking interactions, and 0.8 cation-pi interactions in each adenylate-binding protein complex. Furthermore, a high-level quantum chemical analysis was performed to analyze contributions of each of the three forms of intermolecular interactions (i.e. hydrogen bonding, pi-pi stacking interactions, and cation-pi interactions) to the overall binding force of the adenine moiety of ATP in proteins. Intermolecular interaction energies for representative configurations of intermolecular complexes were analyzed using the supermolecular approach at the MP2/6-311 + G* level, which resulted in substantial interaction strengths for all the three forms of intermolecular interactions. This work represents a timely undertaking at a historical moment when a large number of X-ray crystallographic structures of proteins with bound ATP ligands have become available, and when high-level quantum chemical analysis of

  1. Involvement of purinergic receptors and NOD-like receptor-family protein 3-inflammasome pathway in the adenosine triphosphate-induced cytokine release from macrophages.

    PubMed

    Gicquel, Thomas; Victoni, Tatiana; Fautrel, Alain; Robert, Sacha; Gleonnec, Florence; Guezingar, Marie; Couillin, Isabelle; Catros, Véronique; Boichot, Elisabeth; Lagente, Vincent

    2014-04-01

    Adenosine triphosphate (ATP) has been described as a danger signal activating the NOD-like receptor-family protein 3 (NLRP3)-inflammasome leading to the pro-inflammatory cytokine, interleukin (IL)-1β, release in the lung. The NLRP3-inflammasome pathway has been previously described to be involved in experimental collagen deposition and the development of pulmonary fibrosis. The aim of the present study was to investigate the role of the NLRP3 inflammasome pathway and P2X7 purinergic receptor in the activation of human macrophages in vitro by ATP. We showed that adenosine 5'-[γ-thio]triphosphate tetralithium salt (ATPγS) and 2',3'-O-(4-benzoylbenzoyl) adenosine 5'-triphosphate (BzATP), two stable analogs of ATP, are able to potentiate the release of IL-1β from human monocyte-derived macrophages induced by low concentration of lipopolysaccharide (LPS). However, in the same conditions no increase in IL-1α and IL-6 was observed. Immunochemistry has shown that human macrophages natively express NLRP3 and purinergic P2X7 receptors (P2X7 R). NLRP3 and IL-1β mRNA expression were induced from LPS-primed macrophages, but also after 5-h treatment of BzATP as analysed by reverse transcription quantitative polymerase chain reaction. However, other inflammasome pathways (NLRP1, NLRP2, NLRC4, NLRP6 and AIM2) and P2X7 R were not induced by BzATP. We observed that P2X7 R antagonists, A-438079 and A-740003, were able to reduce the release of IL-1β, but not of IL-1α and IL-6 from macrophages stimulated by ATPγS or BzATP. The present results showed the involvement of the P2X7 R-NLRP3 inflammasome pathway in the secretion of IL-1β from ATP-stimulated human macrophages, and suggest that P2X7 R were not involved in IL-1α and IL-6 release. This study also points out that repression of the P2X7 R represents a novel potential therapeutic approach to control fibrosis in lung injury.

  2. Point mutation of adenosine triphosphate-binding motif generated rigor kinesin that selectively blocks anterograde lysosome membrane transport

    PubMed Central

    1995-01-01

    In the study of motor proteins, the molecular mechanism of mechanochemical coupling, as well as the cellular role of these proteins, is an important issue. To assess these questions we introduced cDNA of wild-type and site-directed mutant kinesin heavy chains into fibroblasts, and analyzed the behavior of the recombinant proteins and the mechanisms involved in organelle transports. Overexpression of wild-type kinesin significantly promoted elongation of cellular processes. Wild-type kinesin accumulated at the tips of the long processes, whereas the kinesin mutants, which contained either a T93N- or T93I mutation in the ATP-binding motif, tightly bound to microtubules in the center of the cells. These mutant kinesins could bind to microtubules in vitro, but could not dissociate from them even in the presence of ATP, and did not support microtubule motility in vitro, thereby indicating rigor-type mutations. Retrograde transport from the Golgi apparatus to the endoplasmic reticulum, as well as lysosome dispersion, was shown to be a microtubule-dependent, plus-end- directed movement. The latter was selectively blocked in the rigor- mutant cells, although the microtubule minus-end-directed motion of lysosomes was not affected. We found the point mutations that make kinesin motor in strong binding state with microtubules in vitro and showed that this mutant causes a dominant effect that selectively blocks anterograde lysosome membrane transports in vivo. PMID:7490281

  3. Communication: Near edge x-ray absorption fine structure spectroscopy of aqueous adenosine triphosphate at the carbon and nitrogen K-edges.

    PubMed

    Kelly, Daniel N; Schwartz, Craig P; Uejio, Janel S; Duffin, Andrew M; England, Alice H; Saykally, Richard J

    2010-09-14

    Near edge x-ray absorption fine structure (NEXAFS) spectroscopy at the nitrogen and carbon K-edges was used to study the hydration of adenosine triphosphate in liquid microjets. The total electron yield spectra were recorded as a function of concentration, pH, and the presence of sodium, magnesium, and copper ions (Na(+)/Mg(2+)/Cu(2+)). Significant spectral changes were observed upon protonation of the adenine ring, but not under conditions that promote π-stacking, such as high concentration or presence of Mg(2+), indicating that NEXAFS is insensitive to the phenomenon. Intramolecular inner-sphere association of Cu(2+) did create observable broadening of the nitrogen spectrum, whereas outer-sphere association with Mg(2+) did not.

  4. The effect of growth phase and medium on the use of the firefly adenosine triphosphate (ATP) assay for the quantitation of bacteria

    NASA Technical Reports Server (NTRS)

    Bush, V. N.; Picciolo, G. L.; Chappelle, E. W.

    1975-01-01

    Luciferase assay for adenosine triphosphate (ATP) was used as a rapid method to determine the number of bacteria in a urine sample after nonbacterial components were removed. Accurate cellular ATP values, determined when bacteria were grown in an environment similar to that in which they were found, were necessary for the calculation of bacterial titer in urine. Cellular ATP values vary depending on the extraction method, the cell growth phase, and cell growth conditions. ATP per cell values of stationary E. coli grown in urine were two times greater than ATP per cell values of cells grown in trypticase soy broth. Glucose and urea were examined as possible components responsible for the cellular ATP variation.

  5. Acetyl L-carnitine targets adenosine triphosphate synthase in protecting zebrafish embryos from toxicities induced by verapamil and ketamine: An in vivo assessment.

    PubMed

    Guo, Xiaoqing; Dumas, Melanie; Robinson, Bonnie L; Ali, Syed F; Paule, Merle G; Gu, Qiang; Kanungo, Jyotshna

    2017-02-01

    Verapamil is a Ca(2)(+) channel blocker and is highly prescribed as an anti-anginal, antiarrhythmic and antihypertensive drug. Ketamine, an antagonist of the Ca(2)(+) -permeable N-methyl-d-aspartate-type glutamate receptors, is a pediatric anesthetic. Previously we have shown that acetyl l-carnitine (ALCAR) reverses ketamine-induced attenuation of heart rate and neurotoxicity in zebrafish embryos. Here, we used 48 h post-fertilization zebrafish embryos that were exposed to relevant drugs for 2 or 4 h. Heart beat and overall development were monitored in vivo. In 48 h post-fertilization embryos, 2 mm ketamine reduced heart rate in a 2 or 4 h exposure and 0.5 mm ALCAR neutralized this effect. ALCAR could reverse ketamine's effect, possibly through a compensatory mechanism involving extracellular Ca(2)(+) entry through L-type Ca(2)(+) channels that ALCAR is known to activate. Hence, we used verapamil to block the L-type Ca(2)(+) channels. Verapamil was more potent in attenuating heart rate and inducing morphological defects in the embryos compared to ketamine at specific times of exposure. ALCAR reversed cardiotoxicity and developmental toxicity in the embryos exposed to verapamil or verapamil plus ketamine, even in the presence of 3,4,5-trimethoxybenzoic acid 8-(diethylamino)octyl ester, an inhibitor of intracellular Ca(2)(+) release suggesting that ALCAR acts via effectors downstream of Ca(2)(+) . In fact, ALCAR's protective effect was blunted by oligomycin A, an inhibitor of adenosine triphosphate synthase that acts downstream of Ca(2)(+) during adenosine triphosphate generation. We have identified, for the first time, using in vivo studies, a downstream effector of ALCAR that is critical in abrogating ketamine- and verapamil-induced developmental toxicities. Published 2016. This article is a U.S. Government work and is in the public domain in the USA.

  6. An efficient signal-on aptamer-based biosensor for adenosine triphosphate detection using graphene oxide both as an electrochemical and electrochemiluminescence signal indicator.

    PubMed

    Huang, Xiang; Li, Yuqin; Zhang, Xiaoshan; Zhang, Xin; Chen, Yaowen; Gao, Wenhua

    2015-09-07

    An efficient aptasensor was developed in which graphene oxide (GO) was employed as an indicator for both electrochemical impedance spectroscopy and electrochemiluminescence (ECL) signal generation. The aptasensor was fabricated by self-assembling the ECL probe of a thiolated adenosine triphosphate binding aptamer (ABA) tagged with a Ru complex (Ru(bpy)3(2+) derivatives) onto the surface of gold nanoparticle (AuNP) modified glassy carbon electrode (GCE). ABA immobilized onto AuNP modified GCE could strongly adsorb GO due to the strong π-π interaction between ABA and graphene oxide; ECL quenching of the Ru complex then takes place because of energy transfer and electron transfer, and a large increase of the electron transfer resistance (Ret) of the electrode. While in the presence of target adenosine triphosphate (ATP), the ABA prefers to form ABA-ATP bioaffinity complexes, which have weak affinity to graphene oxide and keep the graphene oxide away from the electrode surface, thus allowing the ECL signal enhancement, and in conjunction with the decrease of the Ret. Because of the high ECL quenching efficiency, unique structure, and electronic properties of graphene oxide, the Ret and ECL intensity versus the logarithm of ATP concentration was linear in the wide range from 10 pM to 10 nM with an ultra-low detection limit of 6.7 pM to 4.8 pM, respectively. The proposed aptasensor exhibited excellent reproducibility, stability, and outstanding selectivity, and ATP could be effectively distinguished from its analogues. More significantly, this efficient ECL aptasensor strategy based on GO acting both as an electrochemical and ECL signal indicator is general and can be easily extended to other biological binding events.

  7. Acetyl L-carnitine targets adenosine triphosphate synthase in protecting zebrafish embryos from toxicities induced by verapamil and ketamine: An in vivo assessment

    PubMed Central

    Guo, Xiaoqing; Dumas, Melanie; Robinson, Bonnie L.; Ali, Syed F.; Paule, Merle G.; Gu, Qiang; Kanungo, Jyotshna

    2016-01-01

    Verapamil is a Ca2+ channel blocker and is highly prescribed as an anti-anginal, antiarrhythmic and antihypertensive drug. Ketamine, an antagonist of the Ca2+-permeable N-methyl-D-aspartate-type glutamate receptors, is a pediatric anesthetic. Previously we have shown that acetyl L-carnitine (ALCAR) reverses ketamine-induced attenuation of heart rate and neurotoxicity in zebrafish embryos. Here, we used 48 h post-fertilization zebrafish embryos that were exposed to relevant drugs for 2 or 4 h. Heart beat and overall development were monitored in vivo. In 48 h post-fertilization embryos, 2 mM ketamine reduced heart rate in a 2 or 4 h exposure and 0.5 mM ALCAR neutralized this effect. ALCAR could reverse ketamine’s effect, possibly through a compensatory mechanism involving extracellular Ca2+ entry through L-type Ca2+ channels that ALCAR is known to activate. Hence, we used verapamil to block the L-type Ca2+ channels. Verapamil was more potent in attenuating heart rate and inducing morphological defects in the embryos compared to ketamine at specific times of exposure. ALCAR reversed cardiotoxicity and developmental toxicity in the embryos exposed to verapamil or verapamil plus ketamine, even in the presence of 3,4,5-trimethoxybenzoic acid 8-(diethylamino)octyl ester, an inhibitor of intracellular Ca2+ release suggesting that ALCAR acts via effectors downstream of Ca2+. In fact, ALCAR’s protective effect was blunted by oligomycin A, an inhibitor of adenosine triphosphate synthase that acts downstream of Ca2+ during adenosine triphosphate generation. We have identified, for the first time, using in vivo studies, a downstream effector of ALCAR that is critical in abrogating ketamine- and verapamil-induced developmental toxicities. Published 2016. This article is a U.S. Government work and is in the public domain in the USA. PMID:27191126

  8. Biological effects of exogenous adenosine 5 prime -triphosphate on cultured mammalian cells: Evidence for a receptor mechanism and its regulation by desensitization

    SciTech Connect

    Gonzalez, F.A.

    1989-01-01

    Exogenous adenosine 5{prime}-triphosphate (ATP) mobilized intracellular calcium in human carcinoma A43l cells and in Swiss 3T3 and 3T6 mouse fibroblasts by increasing inositol trisphosphate similar to well down growth factors (platelet-derived growth factor (PDGF), epidermal growth factor (EGF), bradykinin (BK), serum). Calcium mobilization was examined by video imaging of fura-2 fluorescence is single cells, following the radioactive isotope {sup 45}Ca, and monitoring the decrease in fluorescence of cells loaded with chlortetracycline. Uridine 5{prime}-triphosphate, but not other nucleotides, mimicked ATP. Single-cell analysis revealed synchronous responses in 10 sec to ATP, BK or serum, while PDGF (3T3) and EGF (A431) produced slower signals with significant cell-to-cell variation. PDGF desensitized 3T3 cells to ATP and BK added 100 sec later but ATP or BK did not desensitized to PDGF. Homologous desensitization was seen with all agonists. Heterologous desensitization was also observed in A431 cells where ATP desensitized to serum, but serum did not to ATP. ATP-stimulated calcium entry was detected after 10 sec in A431 cells, but not in Swiss 3T6 cells. Entry started before significant efflux had occurred and did not fit the capacitance model of Putney. A 2-3 hr ATP pretreatment produced a homologous desensitization state that required 20 hr to disappear, probably due to down-regulation of the putative ATP receptors.

  9. Characterization of a multiple endogenously expressed adenosine triphosphate-binding cassette transporters using nuclear and cellular membrane affinity chromatography columns.

    PubMed

    Habicht, K-L; Singh, N S; Khadeer, M A; Shimmo, R; Wainer, I W; Moaddel, R

    2014-04-25

    Glioblastoma multiforme is an aggressive form of human astrocytoma, with poor prognosis due to multi-drug resistance to a number of anticancer drugs. The observed multi-drug resistance is primarily due to the efflux activity of ATP-Binding Cassette (ABC) efflux transporters such as Pgp, MRP1 and BCRP. The expression of these transporters has been demonstrated in nuclear and cellular membranes of the LN-229 human glioblastoma cell line. Nuclear membrane and cellular membrane fragments from LN-229 cells were immobilized on the IAM stationary phase to create nuclear and cellular membrane affinity chromatography columns, (NMAC(LN-229)) and (CMAC(LN-229)), respectively. Pgp, MRP1 and BCRP transporters co-immobilized on both columns were characterized and compared by establishing the binding affinities for estrone-3-sulfate (3.8 vs. 3.7μM), verapamil (0.6 vs. 0.7μM) and prazosin (0.099 vs. 0.033μM) on each column and no significant differences were observed. Since the marker ligands had overlapping selectivities, the selective characterization of each transporter was carried out by saturation of the binding sites of the non-targeted transporters. The addition of verapamil (Pgp and MRP1 substrate) to the mobile phase allowed the comparative screening of eight compounds at the nuclear and cellular BCRP using etoposide as the marker ligand. AZT increased the retention of etoposide (+15%), a positive allosteric interaction, on the CMAC(LN-229) column and decreased it (-5%) on the NMAC(LN-229), while the opposite effect was produced by rhodamine. The results indicate that there are differences between the cellular and nuclear membrane expressed BCRP and that NMAC and CMAC columns can be used to probe these differences.

  10. Effects of different concentrations of metal ions on degradation of adenosine triphosphate in common carp (Cyprinus carpio) fillets stored at 4°C: An in vivo study.

    PubMed

    Li, Dapeng; Qin, Na; Zhang, Longteng; Lv, Jian; Li, Qingzheng; Luo, Yongkang

    2016-11-15

    The impact of different concentrations of Na(+), K(+), Ca(2+), Mg(2+), Fe(2+), and Zn(2+) on the degradation of adenosine triphosphate (ATP) and the influence of these ions on the activity of adenosine monophosphate deaminase (AMP-deaminase) and acid phosphatase (ACP) in common carp fillets (in vivo) during 4°C storage was examined. The content of ATP, inosine monophosphate (IMP), and hypoxanthine (Hx), and the activity of AMP-deaminase and ACP were determined. Results indicated that the effects of different concentrations of six kinds of metal ions on AMP-deaminase and ACP were not the same. Na(+), K(+), Fe(2+), and Zn(2+) enhanced AMP-deaminase activity, which led to the rapid degradation of ATP and to the generation of a large quantity of IMP within a short time. Ca(2+) and Mg(2+) delayed the change in AMP-deaminase and ACP activity in carp and caused a further delay in the degradation of ATP. Fe(2+) and Zn(2+) inhibited ACP activity, which reduced the decomposition of IMP and the formation of Hx.

  11. Interaction of Beta-Hydroxy-Beta-Methylbutyrate Free Acid and Adenosine Triphosphate on Muscle Mass, Strength, and Power in Resistance Trained Individuals.

    PubMed

    Lowery, Ryan P; Joy, Jordan M; Rathmacher, John A; Baier, Shawn M; Fuller, John C; Shelley, Mack C; Jäger, Ralf; Purpura, Martin; Wilson, Stephanie M C; Wilson, Jacob M

    2016-07-01

    Lowery, RP, Joy, JM, Rathmacher, JA, Baier, SM, Fuller, JC Jr, Shelley, MC II, Jäger, R, Purpura, M, Wilson, SMC, and Wilson, JM. Interaction of beta-hydroxy-beta-methylbutyrate free acid and adenosine triphosphate on muscle mass, strength, and power in resistance trained individuals. J Strength Cond Res 30(7): 1843-1854, 2016-Adenosine-5'-triphosphate (ATP) supplementation helps maintain performance under high fatiguing contractions and with greater fatigue recovery demands also increase. Current evidence suggests that the free acid form of β-hydroxy-β-methylbutyrate (HMB-FA) acts by speeding regenerative capacity of skeletal muscle after high-intensity or prolonged exercise. Therefore, we investigated the effects of 12 weeks of HMB-FA (3 g) and ATP (400 mg) administration on lean body mass (LBM), strength, and power in trained individuals. A 3-phase double-blind, placebo-, and diet-controlled study was conducted. Phases consisted of an 8-week periodized resistance training program (phase 1), followed by a 2-week overreaching cycle (phase 2), and a 2-week taper (phase 3). Lean body mass was increased by a combination of HMB-FA/ATP by 12.7% (p < 0.001). In a similar fashion, strength gains after training were increased in HMB-FA/ATP-supplemented subjects by 23.5% (p < 0.001). Vertical jump and Wingate power were increased in the HMB-FA/ATP-supplemented group compared with the placebo-supplemented group, and the 12-week increases were 21.5 and 23.7%, respectively. During the overreaching cycle, strength and power declined in the placebo group (4.3-5.7%), whereas supplementation with HMB-FA/ATP resulted in continued strength gains (1.3%). In conclusion, HMB-FA and ATP in combination with resistance exercise training enhanced LBM, power, and strength. In addition, HMB-FA plus ATP blunted the typical response to overreaching, resulting in a further increase in strength during that period. It seems that the combination of HMB-FA/ATP could benefit those who

  12. Difference Between Dormant Conduction Sites Revealed by Adenosine Triphosphate Provocation and Unipolar Pace-Capture Sites Along the Ablation Line After Pulmonary Vein Isolation.

    PubMed

    Kogawa, Rikitake; Okumura, Yasuo; Watanabe, Ichiro; Sonoda, Kazumasa; Sasaki, Naoko; Takahashi, Keiko; Iso, Kazuki; Nagashima, Koichi; Ohkubo, Kimie; Nakai, Toshiko; Kunimoto, Satoshi; Hirayama, Atsushi

    2016-01-01

    Dormant pulmonary vein (PV) conduction revealed by adenosine/adenosine triphosphate (ATP) provocation test and exit block to the left atrium by pacing from the PV side of the ablation line ("pace and ablate" method) are used to ensure durable pulmonary vein isolation (PVI). However, the mechanistic relation between ATP-provoked PV reconnection and the unexcitable gap along the ablation line is unclear.Forty-five patients with atrial fibrillation (AF) (paroxysmal: 31 patients, persistent: 14 patients; age: 61.1 ± 9.7 years) underwent extensive encircling PVI (EEPVI, 179 PVs). After completion of EEPVI, an ATP provocation test (30 mg, bolus injection) and unipolar pacing (output, 10 mA; pulse width, 2 ms) were performed along the previous EEPVI ablation line to identify excitable gaps. Dormant conduction was revealed in 29 (34 sites) of 179 PVs (16.2%) after EEP-VI (22/45 patients). Pace capture was revealed in 59 (89 sites) of 179 PVs (33.0%) after EEPVI (39/45 patients), and overlapping sites, ie, sites showing both dormant conduction and pace capture, were observed in 22 of 179 (12.3%) PVs (17/45 patients).Some of the ATP-provoked dormant PV reconnection sites were identical to the sites with excitable gaps revealed by pace capture, but most of the PV sites were differently distributed, suggesting that the main underling mechanism differs between these two forms of reconnection. These findings also suggest that performance of the ATP provocation test followed by the "pace and ablate" method can reduce the occurrence of chronic PV reconnections.

  13. Adenosine triphosphate regulates the activity of guinea pig Cav1.2 channel by direct binding to the channel in a dose-dependent manner.

    PubMed

    Feng, Rui; Xu, Jianjun; Minobe, Etsuko; Kameyama, Asako; Yang, Lei; Yu, Lifeng; Hao, Liying; Kameyama, Masaki

    2014-05-01

    The present study is to investigate the mechanism by which ATP regulates Cav1.2 channel activity. Ventricular tissue was obtained from adult guinea pig hearts using collagenase. Ca(2+) channel activity was monitored using the patch-clamp technique. Proteins were purified using wheat germ agglutinin-Sepharose, and the concentration was determined using the Coomassie brilliant blue technique. ATP binding to the Cav1.2 channel was examined using the photoaffinity method. EDA-ATP-biotin maintains Ca(2+) channel activity in inside-out membrane patches. ATP directly bound to the Cav1.2 channel in a dose-dependent manner, and at least two molecules of ATP bound to one molecule of the Cav1.2 channel. Low levels of calmodulin (CaM) increased ATP binding to the Cav1.2 channel, but higher levels of CaM decreased ATP binding to the Cav1.2 channel. In addition, Ca(2+) was another regulator for ATP binding to the Cav1.2 channel. Furthermore, ATP bound to GST-fusion peptides of NH2-terminal region (amino acids 6-140) and proximal COOH-terminal region (amino acids 1,509-1,789) of the main subunit (α1C) of the Cav1.2 channel. Our data suggest that ATP might regulate Cav1.2 channel activity by directly binding to the Cav1.2 channel in a dose-dependent manner. In addition, the ATP-binding effect to the Cav1.2 channel was both CaM- and Ca(2+) dependent.

  14. Flow cytometry and adenosine tri-phosphate analysis: alternative possibilities to evaluate major bacteriological changes in drinking water treatment and distribution systems.

    PubMed

    Vital, Marius; Dignum, Marco; Magic-Knezev, Aleksandra; Ross, Petra; Rietveld, Luuk; Hammes, Frederik

    2012-10-01

    An ever-growing need exists for rapid, quantitative and meaningful methods to quantify and characterize the effect of different treatment steps on the microbiological processes and events that occur during drinking water treatment and distribution. Here we compared cultivation-independent flow cytometry (FCM) and adenosine tri-phosphate (ATP) analysis with conventional cultivation-based microbiological methods, on water samples from two full-scale treatment and distribution systems. The two systems consist of nearly identical treatment trains, but their raw water quality and pre-treatment differed significantly. All of the drinking water treatment processes affected the microbiological content of the water considerably, but once treated, the finished water remained remarkably stable throughout the distribution system. Both the FCM and ATP data were able to describe the microbiology of the systems accurately, providing meaningful process data when combined with other parameters such as dissolved organic carbon analysis. Importantly, the results highlighted a complimentary value of the two independent methods: while similar trends were mostly observed, variations in ATP-per-cell values between water samples were adequately explained by differences in the FCM fingerprints of the samples. This work demonstrates the value of alternative microbial methods for process/system control, optimization and routine monitoring of the general microbial quality of water during treatment and distribution.

  15. Proline modulates the effect of bisphosphonate on calcium levels and adenosine triphosphate production in cell lines derived from bovine Echinococcus granulosus protoscoleces.

    PubMed

    Fuchs, A G; Echeverría, C I; Pérez Rojo, F G; Prieto González, E A; Roldán, E J A

    2014-12-01

    Bisphosphonates have been proposed as pharmacological agents against parasite and cancer cell growth. The effect of these compounds on helminthic cell viability and acellular compartment morphology, however, has not yet been studied. The effects of different types of bisphosphonates, namely etidronate (EHDP), pamidronate (APD), alendronate (ABP), ibandronate (IB) and olpadronate (OPD), and their interaction with amiloride, 1,25-dihydroxycholecalciferol (D3) and proline were evaluated on a cell line derived from bovine Echinococcus granulousus protoscoleces (EGPE) that forms cystic colonies in agarose. The EGPE cell line allowed testing the effect of bisphosphonates alone and in association with other compounds that could modulate calcium apposition/deposition, and were useful in measuring the impact of these compounds on cell growth, cystic colony formation and calcium storage. Decreased cell growth and cystic colony formation were found with EHDP, IB and OPD, and increased calcium storage with EHDP only. Calcium storage in EGPE cells appeared to be sensitive to the effect of amiloride, D3 and proline. Proline decreased calcium storage and increased colony formation. Changes in calcium storage may be associated with degenerative changes of the cysts, as shown in the in vitro colony model and linked to an adenosine triphosphate (ATP) decrease. In conclusion, bisphosphonates could be suitable tempering drugs to treat cestode infections.

  16. Development of an immune function assay by measuring intracellular adenosine triphosphate (iATP) levels in mitogen-stimulated CD4+ T lymphocytes.

    PubMed

    Naderi, Hadi; Najafi, Alireza; Khoshroo, Mohammad; Tajik, Nader

    2016-01-01

    We developed an immune function assay for monitoring CD4+ T cells activity based on changes in intracellular adenosine triphosphate (iATP) levels after phytohemagglutinin (PHA) stimulation. Blood samples were obtained from 40 healthy subjects and 30 RTRs and incubated with 5 µg/mL of PHA for 15-18 hr at 37°C and 5% CO2. Afterward, the CD4+ T cells were separated by antibody-coated magnetic beads and lysed. Then, iATP content in unstimulated and stimulated conditions was measured by luciferin-luciferase reaction using a log-log standard curve. The iATP levels showed significant increase in CD4+ T cells in both healthy persons (mean: 550 ± 142 ng/mL vs. 109 ± 54 ng/mL) and RTRs (mean: 394 ± 160 ng/mL vs. 52 ± 37 ng/mL) after PHA stimulation (P < 0.001). However, the iATP production in RTRs was significantly lower than that in healthy individuals; both prior to and after stimulation with PHA (P < 0.001). No gender-specific difference in iATP production was observed between women and men subjects. This rapid and low-cost assay reflects the degree of immune cell function through assessment of CD4+ T cells activation. Thus, it can be used for evaluation of immune system status in immunodeficient individuals as well as in immunosuppressed transplant recipients who needs drug adjustment.

  17. A fluorescent aptasensor for amplified label-free detection of adenosine triphosphate based on core-shell Ag@SiO2 nanoparticles.

    PubMed

    Song, Quanwei; Peng, Manshu; Wang, Le; He, Dacheng; Ouyang, Jin

    2016-03-15

    The novel, facile and universal aptamer-based methods for the highly sensitive and selective fluorescence detection of important biomolecules have attracted considerable interest. Here, we present a label-free aptasensor for adenosine triphosphate (ATP) detection in aqueous solutions by using an ultra-sensitive nucleic acid stain PicoGreen (PG) as a fluorescent indicator and core-shell Ag@SiO2 nanoparticles (NPs) as a metal-enhanced fluorescence (MEF) platform. In the presence of ATP, the complementary DNA (cDNA)/aptamer duplexes confined onto the Ag@SiO2 NPs surface can release their aptamers into the buffered solution, causing a significant reduction in fluorescence intensity. By virtue of the amplified fluorescence signal, this aptasensor toward ATP can achieve a detection limit of 14.2 nM with a wide linear range and exhibit a good assay performance in complex biological samples. This sensing approach is cost-effective and efficient because it avoids the fluorescence labeling process and the use of any enzymes. Hence, this method may offer an alternative tool for determining the concentrations of ATP in biochemical and biomedical research.

  18. A sensitive quartz crystal microbalance assay of adenosine triphosphate via DNAzyme-activated and aptamer-based target-triggering circular amplification.

    PubMed

    Song, Weiling; Zhu, Zheng; Mao, Yaning; Zhang, Shusheng

    2014-03-15

    In this work, a simple and novel quartz crystal microbalance (QCM) assay is demonstrated to selectively and sensitively detect the adenosine triphosphate (ATP). The amplification process consists of circular nucleic acid strand-displacement polymerization, aptamer recognition strategy and nanoparticle signal amplification. With the involvement of an aptamer-based complex, two amplification reaction templates and AuNP-functionalized probes, the whole circle amplification process is triggered by the target recognition of ATP. As an efficient mass amplifier, AuNP-functionalized probes are introduced to enhance the QCM signals. As a result of DNA multiple amplification, a large number of AuNP-functionalized probes are released and hybridized with the capture probes on the gold electrode. Therefore the QCM signals are significantly enhanced, reaching a detection limit of ATP as low as 1.3 nM. This strategy can be conveniently used for any aptamer-target binding events with other biological detection such as protein and small molecules. Moreover, the practical determination of ATP in cancer cells demonstrates the feasibility of this QCM approach and potential application in clinical diagnostics.

  19. An ultrasensitive quantum dots fluorescent polarization immunoassay based on the antibody modified Au nanoparticles amplifying for the detection of adenosine triphosphate.

    PubMed

    He, Yanlong; Tian, Jianniao; Hu, Kun; Zhang, Juanni; Chen, Sheng; Jiang, Yixuan; Zhao, Yanchun; Zhao, Shulin

    2013-11-13

    In this work, an ultrasensitive fluorescent polarization immunoassay (FPIA) method based on the quantum dot/aptamer/antibody/gold nanoparticles ensemble has been developed for the detection of adenosine triphosphate (ATP). DNA hybridization is formed when ATP is present in the PBS solution containing the DNA-conjugated quantum dots (QDs) and antibody-AuNPs. The substantial sensitivity improvement of the antibody-AuNPs-enhanced method is mainly attributed to the slower rotation of fluorescent unit when QDs-labeled oligonucleotides hybridize with antibody modified the gold nanoparticle. As a result, the fluorescent polarization (FP) values of the system increase significantly. Under the optimal conditions, a linear response with ATP concentration is ranged from 8×10(-12) M to 2.40×10(-4) M. The detection limit reached as low as 1.8 pM. The developed work provides a sensitive and selective immunoassay protocol for ATP detection, which could be applied in more bioanalytical systems.

  20. Use of 5'-γ-ferrocenyl adenosine triphosphate (Fc-ATP) bioconjugates having poly(ethylene glycol) spacers in kinase-catalyzed phosphorylations.

    PubMed

    Martić, Sanela; Rains, Meghan K; Freeman, Daniel; Kraatz, Heinz-Bernhard

    2011-08-17

    The 5'-γ-ferrocenyl adenosine triphosphate (Fc-ATP) bioconjugates (3 and 4), containing the poly(ethylene glycol) spacers, were synthesized and compared to a hydrophobic analogue as co-substrates for the following protein kinases: sarcoma related kinase (Src), cyclin-dependent kinase (CDK), casein kinase II (CK2α), and protein kinase A (PKA). Electrochemical kinase assays indicate that the hydrophobic Fc-ATP analogue was an optimal co-substrate for which K(M) values were determined to be in the 30-200 μM range, depending on the particular protein kinase. The luminescence kinase assay demonstrated the kinase utility for all Fc-ATP conjugates, which is in line with the electrochemical data. Moreover, Fc-ATP bioconjugates exhibit competitive behavior with respect to ATP. Relatively poor performance of the polar Fc-ATP bioconjugates as co-substrates for protein kinases was presumably due to the additional H-bonding and electrostatic interactions of the poly(ethylene glycol) linkers of Fc-ATP with the kinase catalytic site and the target peptides. Phosphorylation of the full-length protein, His-tagged pro-caspase-3, was demonstrated through Fc-phosphoamide transfer to the Ser residues of the surface-bound protein by electrochemical means. These results suggest that electrochemical detection of the peptide and protein Fc-phosphorylation via tailored Fc-ATP co-substrates may be useful for probing protein-protein interactions.

  1. Effects of an ATP analogue, adenosine 5'-[α-thio]-triphosphate, on F1-ATPase rotary catalysis, torque generation, and inhibited intermediated formation.

    PubMed

    Yukawa, Ayako; Watanabe, Rikiya; Noji, Hiroyuki

    2015-03-13

    F1-ATPase (F1), an important rotary motor protein, converts the chemical energy of ATP hydrolysis into mechanical energy using rotary motion with extremely high efficiency. The energy-conversion mechanism for this molecular motor has been extensively clarified by previous studies, which indicate that the interactions between the catalytic residues and the β- and γ-phosphates of ATP are indispensable for efficient catalysis and torque generation. However, the role of α-phosphate is largely unknown. In this study, we observed the rotation of F1 fuelled with an ATP analogue, adenosine 5'-[α-thio]-triphosphate (ATPαS), in which the oxygen has been substituted with a sulfur ion to perturb the α-phosphate/F1 interactions. In doing so, we have revealed that ATPαS does not appear to have any impact on the kinetic properties of the motor or on torque generation compared to ATP. On the other hand, F1 was observed to lapse into the ADP-inhibited intermediate states when in the presence of ATPαS more severely than in the presence of ATP, suggesting that the α-phosphate group of ATP contributes to the avoidance of ADP-inhibited intermediate formation.

  2. Evaluation of the Relationship between the Adenosine Triphosphate (ATP) Bioluminescence Assay and the Presence of Bacillus anthracis Spores and Vegetative Cells

    PubMed Central

    Gibbs, Shawn G.; Sayles, Harlan; Colbert, Erica M.; Hewlett, Angela; Chaika, Oleg; Smith, Philip W.

    2014-01-01

    Background: The Adenosine triphosphate (ATP) bioluminescence assay was utilized in laboratory evaluations to determine the presence and concentration of vegetative and spore forms of Bacillus anthracis Sterne 34F2. Methods: Seventeen surfaces from the healthcare environment were selected for evaluation. Surfaces were inoculated with 50 µL of organism suspensions at three concentrations of 104, 106, 108 colony forming units per surface (CFU/surface) of B. anthracis. Culture-based methods and ATP based methods were utilized to determine concentrations. Results: When all concentrations were evaluated together, a positive correlation between log-adjusted CFU and Relative Light Units (RLU) for endospores and vegetative cells was established. When concentrations were evaluated separately, a significant correlation was not demonstrated. Conclusions: This study demonstrated a positive correlation for ATP and culture-based methods for the vegetative cells of B. anthracis. When evaluating the endospores and combining both metabolic states, the ATP measurements and CFU recovered did not correspond to the initial concentrations on the evaluated surfaces. The results of our study show that the low ATP signal which does not correlate well to the CFU results would not make the ATP measuring devises effective in confirming contamination residual from a bioterrorist event. PMID:24879485

  3. Effects of bicarbonate buffer on acetylcholine-, adenosine 5'triphosphate-, and cyanide-induced responses in the cat petrosal ganglion in vitro.

    PubMed

    Soto, Carolina R; Arroyo, Jorge; Alcayaga, Julio

    2002-01-01

    Acetylcholine (ACh), adenosine 5'-triphosphate (ATP) and sodium cyanide (NaCN) activate petrosal ganglion (PG) neurons in vitro, and evoke ventilatory reflexes in situ, which are abolished after bilateral chemosensory denervation. Because in our previous experiments we superfused the isolated PG with solutions free of CO2/HCO3- buffer, we studied its effects on the PG responses evoked in vitro. PGs from adult cats were superfused at a constant pH, with HEPES-supplemented (5 mM) saline with or without CO2/HCO3- (5%/26.2 mM) buffer, and carotid (sinus) nerve frequency discharge (fCN) recorded. Increases in fCN evoked by ACh, ATP and NaCN in CO2- free saline were significantly reduced (P < 0.05, Wilcoxon test) when CO2/HCO3- was present in the superfusion medium. Thus, the presence of CO2/HCO3- buffer appears to reduce PG neurons sensitivity to ACh, ATP and NaCN, an effect that may underlie the lack of ventilatory reflexes after bilateral chemodenervation.

  4. Adenosine Triphosphate (ATP) Inhibits Voltage-Sensitive Potassium Currents in Isolated Hensen's Cells and Nifedipine Protects Against Noise-Induced Hearing Loss in Guinea Pigs.

    PubMed

    Ye, Rui; Liu, Jun; Jia, Zhiying; Wang, Hongyang; Wang, YongAn; Sun, Wei; Wu, Xuan; Zhao, Zhifei; Niu, Baolong; Li, Xingqi; Dai, Guanghai; Li, Jianxiong

    2016-06-13

    BACKGROUND There is increasing evidence that adenosine triphosphate (ATP), a well-known neurotransmitter and neuromodulator in the central nervous system, plays an important role as an extracellular chemical messenger in the cochlea. MATERIAL AND METHODS Using a whole-cell recording technique, we studied the effects of ATP on isolated Hensen's cells, which are supporting cells in the cochlea, to determine if they are involved in the transduction of ions with hair cells. RESULTS ATP (0.1-10 µM) reduced the potassium current (IK+) in the majority of the recorded Hensen's cells (21 out of 25 cells). An inward current was also induced by high concentrations of ATP (100 µM to 10 mM), which was reversibly blocked by 100 µM suramin (a purinergic antagonist) and blocked by nifedipine (an L-type calcium channel blocker). After the cochleas were perfused with artificial perilymph solutions containing nifedipine and exposed to noise, the amplitude increase in the compound action potential (CAP) threshold and the reduction in cochlear microphonics was lower than when they were exposed to noise alone. CONCLUSIONS Our results suggest that ATP can block IK+ channels at a low concentration and induce an inward Ca2+ current at high concentrations, which is reversed by purinergic receptors. Nifedipine may have a partially protective effect on noise-induced hearing loss (NIHL).

  5. Transcranial low-level laser therapy (810 nm) temporarily inhibits peripheral nociception: photoneuromodulation of glutamate receptors, prostatic acid phophatase, and adenosine triphosphate

    PubMed Central

    Pires de Sousa, Marcelo Victor; Ferraresi, Cleber; Kawakubo, Masayoshi; Kaippert, Beatriz; Yoshimura, Elisabeth Mateus; Hamblin, Michael R.

    2016-01-01

    Abstract. Photobiomodulation or low-level light therapy has been shown to attenuate both acute and chronic pain, but the mechanism of action is not well understood. In most cases, the light is applied to the painful area, but in the present study we applied light to the head. We found that transcranial laser therapy (TLT) applied to mouse head with specific parameters (810 nm laser, 300  mW/cm2, 7.2 or 36  J/cm2) decreased the reaction to pain in the foot evoked either by pressure (von Frey filaments), cold, or inflammation (formalin injection) or in the tail (evoked by heat). The pain threshold increasing is maximum around 2 h after TLT, remains up to 6 h, and is finished 24 h after TLT. The mechanisms were investigated by quantification of adenosine triphosphate (ATP), immunofluorescence, and hematoxylin and eosin (H&E) staining of brain tissues. TLT increased ATP and prostatic acid phosphatase (an endogenous analgesic) and reduced the amount of glutamate receptor (mediating a neurotransmitter responsible for conducting nociceptive information). There was no change in the concentration of tubulin, a constituent of the cytoskeleton, and the H&E staining revealed no tissue damage. PMID:26835486

  6. Comparison of immunomagnetic separation/adenosine triphosphate rapid method to traditional culture-based method for E. coli and enterococci enumeration in wastewater

    USGS Publications Warehouse

    Bushon, R.N.; Likirdopulos, C.A.; Brady, A.M.G.

    2009-01-01

    Untreated wastewater samples from California, North Carolina, and Ohio were analyzed by the immunomagnetic separation/adenosine triphosphate (IMS/ATP) method and the traditional culture-based method for E. coli and enterococci concentrations. The IMS/ATP method concentrates target bacteria by immunomagnetic separation and then quantifies captured bacteria by measuring bioluminescence induced by release of ATP from the bacterial cells. Results from this method are available within 1 h from the start of sample processing. Significant linear correlations were found between the IMS/ATP results and results from traditional culture-based methods for E. coli and enterococci enumeration for one location in California, two locations in North Carolina, and one location in Ohio (r??values ranged from 0.87 to 0.97). No significant linear relation was found for a second location in California that treats a complex mixture of residential and industrial wastewater. With the exception of one location, IMS/ATP showed promise as a rapid method for the quantification of faecal-indicator organisms in wastewater.

  7. The Therapeutic Potential of Adenosine Triphosphate as an Immune Modulator in the Treatment of HIV/AIDS: A Combination Approach with HAART

    PubMed Central

    Wagner, Marc C.E.

    2011-01-01

    Extracellular adenosine triphosphate (eATP) is a potent molecule that has the capacity to modulate various aspects of cell functions including gene expression. This element of modulation is essential to the role of ATP as a therapeutic agent. The hypothesis presented is that ATP can have an important impact on the treatment of HIV infection. This is supported in part by published research, although a much greater role for ATP is suggested than prior authors ever thought possible. ATP has the ability to enhance the immune system and could thus improve the host’s own defense mechanisms to eradicate the virus-infected cells and restore normal immune function. This could provide effective therapy when used in conjunction with highly active antiretroviral therapies (HAART) to eliminate the latently infected cells. The key lies in applying ATP through the methodology described. This article presents a strategy for using ATP therapeutically along with background evidence to substantiate the importance of using ATP in the treatment of HIV infection. PMID:21675943

  8. Use of a Sampling Area-Adjusted Adenosine Triphosphate Bioluminescence Assay Based on Digital Image Quantification to Assess the Cleanliness of Hospital Surfaces

    PubMed Central

    Ho, Yu-Huai; Wang, Lih-Shinn; Jiang, Hui-Li; Chang, Chih-Hui; Hsieh, Chia-Jung; Chang, Dan-Chi; Tu, Hsin-Yu; Chiu, Tan-Yun; Chao, Huei-Jen; Tseng, Chun-Chieh

    2016-01-01

    Contaminated surfaces play an important role in the transmission of pathogens. We sought to establish a criterion that could indicate “cleanliness” using a sampling area–adjusted adenosine triphosphate (ATP) assay. In the first phase of the study, target surfaces were selected for swab sampling before and after daily cleaning; then, an aerobic colony count (ACC) plate assay of bacteria and antibiotic-resistant bacteria was conducted. ATP swabs were also tested, and the ATP readings were reported as relative light units (RLUs). The results of the ACC and ATP assays were adjusted according to the sampling area. During the second phase of the study, a new cleaning process employing sodium dichloroisocyanurate (NaDCC) was implemented for comparison. Using the criterion of 2.5 colony-forming units (CFU)/cm2, 45% of the sampled sites were successfully cleaned during phase one of the study. During phase two, the pass rates of the surface samples (64%) were significantly improved, except under stringent (5 RLU/cm2) and lax (500 RLU) ATP criteria. Using receiver-operating characteristic curve analysis, the best cut-off point for an area-adjusted ATP level was 7.34 RLU/cm2, which corresponded to culture-assay levels of <2.5 CFU/cm2. An area adjustment of the ATP assay improved the degree of correlation with the ACC-assay results from weak to moderate. PMID:27294944

  9. Comparison of immunomagnetic separation/adenosine triphosphate rapid method to traditional culture-based method for E. coli and enterococci enumeration in wastewater.

    PubMed

    Bushon, Rebecca N; Likirdopulos, Christina A; Brady, Amie M G

    2009-11-01

    Untreated wastewater samples from California, North Carolina, and Ohio were analyzed by the immunomagnetic separation/adenosine triphosphate (IMS/ATP) method and the traditional culture-based method for E. coli and enterococci concentrations. The IMS/ATP method concentrates target bacteria by immunomagnetic separation and then quantifies captured bacteria by measuring bioluminescence induced by release of ATP from the bacterial cells. Results from this method are available within 1h from the start of sample processing. Significant linear correlations were found between the IMS/ATP results and results from traditional culture-based methods for E. coli and enterococci enumeration for one location in California, two locations in North Carolina, and one location in Ohio (r values ranged from 0.87 to 0.97). No significant linear relation was found for a second location in California that treats a complex mixture of residential and industrial wastewater. With the exception of one location, IMS/ATP showed promise as a rapid method for the quantification of faecal-indicator organisms in wastewater.

  10. Use of a Sampling Area-Adjusted Adenosine Triphosphate Bioluminescence Assay Based on Digital Image Quantification to Assess the Cleanliness of Hospital Surfaces.

    PubMed

    Ho, Yu-Huai; Wang, Lih-Shinn; Jiang, Hui-Li; Chang, Chih-Hui; Hsieh, Chia-Jung; Chang, Dan-Chi; Tu, Hsin-Yu; Chiu, Tan-Yun; Chao, Huei-Jen; Tseng, Chun-Chieh

    2016-06-09

    Contaminated surfaces play an important role in the transmission of pathogens. We sought to establish a criterion that could indicate "cleanliness" using a sampling area-adjusted adenosine triphosphate (ATP) assay. In the first phase of the study, target surfaces were selected for swab sampling before and after daily cleaning; then, an aerobic colony count (ACC) plate assay of bacteria and antibiotic-resistant bacteria was conducted. ATP swabs were also tested, and the ATP readings were reported as relative light units (RLUs). The results of the ACC and ATP assays were adjusted according to the sampling area. During the second phase of the study, a new cleaning process employing sodium dichloroisocyanurate (NaDCC) was implemented for comparison. Using the criterion of 2.5 colony-forming units (CFU)/cm², 45% of the sampled sites were successfully cleaned during phase one of the study. During phase two, the pass rates of the surface samples (64%) were significantly improved, except under stringent (5 RLU/cm²) and lax (500 RLU) ATP criteria. Using receiver-operating characteristic curve analysis, the best cut-off point for an area-adjusted ATP level was 7.34 RLU/cm², which corresponded to culture-assay levels of <2.5 CFU/cm². An area adjustment of the ATP assay improved the degree of correlation with the ACC-assay results from weak to moderate.

  11. Adenosine triphosphate stress 99mTc-methoxyisobutylisonitrile gated myocardial perfusion imaging efficacy in diagnosing stent restenosis following coronary stent implantation

    PubMed Central

    Zhang, Pengfei; Chen, Song; Li, Yang; Du, Qiuhong; Wang, Lijuan; Sun, Yingxian; Li, Yaming

    2016-01-01

    Coronary stent restenosis rate following implantation is considerably high. The adenosine stress gated myocardial perfusion imaging (G-MPI) method has been widely used in the diagnosis, risk stratification and prognosis evaluation of coronary heart disease; however, the high cost of adenosine limits its clinical application. The aim of the present study was to investigate the efficacy of adenosine triphosphate (ATP) stress 99mTc-methoxyisobutylisonitrile (99mTc-MIBI) G-MPI for diagnosis in-stent restenosis following coronary stent implantation. Data from 66 patients with typical angina pectoris symptoms who had undergone percutaneous coronary stent implantation >3 months prior to participation in the study were analyzed. All the patients underwent ATP stress 99mTc-MIBI G-MPI and coronary artery angiography as the criterion diagnostic standard within 1 month. The sensitivity, specificity, and accuracy of ATP stress 99mTc-MIBI G-MPI in the assessment of in-stent restenosis were calculated. In addition, Fisher's exact probability methods were used to compare differences between experimental groups. Among 66 patients with a total of 99 implanted coronary arterial branches, 39 patients (59%) with 45 coronary arteries (45%) presented in-stent restenosis. The diagnostic sensitivity, specificity, accuracy, positive predictive and negative predictive value of ATP stress 99mTc-MIBI G-MPI for assessing stent restenosis in all patients were 85, 89, 86, 92 and 80%, respectively. Similarly, these values in patients with myocardial infarction were 79, 88, 83, 88 and 78%, respectively, while in patients without myocardial infarction the values were 90, 91, 90, 95 and 83%, respectively. Therefore, the diagnostic efficacy of ATP stress 99mTc-MIBI G-MPI in patients without myocardial infarction was higher compared with those with myocardial infarction; however, no significant difference was observed between the two groups. Furthermore, the sensitivity, specificity and accuracy for

  12. Adenosine triphosphate stress (99m)Tc-methoxyisobutylisonitrile gated myocardial perfusion imaging efficacy in diagnosing stent restenosis following coronary stent implantation.

    PubMed

    Zhang, Pengfei; Chen, Song; Li, Yang; Du, Qiuhong; Wang, Lijuan; Sun, Yingxian; Li, Yaming

    2016-12-01

    Coronary stent restenosis rate following implantation is considerably high. The adenosine stress gated myocardial perfusion imaging (G-MPI) method has been widely used in the diagnosis, risk stratification and prognosis evaluation of coronary heart disease; however, the high cost of adenosine limits its clinical application. The aim of the present study was to investigate the efficacy of adenosine triphosphate (ATP) stress (99m)Tc-methoxyisobutylisonitrile ((99m)Tc-MIBI) G-MPI for diagnosis in-stent restenosis following coronary stent implantation. Data from 66 patients with typical angina pectoris symptoms who had undergone percutaneous coronary stent implantation >3 months prior to participation in the study were analyzed. All the patients underwent ATP stress (99m)Tc-MIBI G-MPI and coronary artery angiography as the criterion diagnostic standard within 1 month. The sensitivity, specificity, and accuracy of ATP stress (99m)Tc-MIBI G-MPI in the assessment of in-stent restenosis were calculated. In addition, Fisher's exact probability methods were used to compare differences between experimental groups. Among 66 patients with a total of 99 implanted coronary arterial branches, 39 patients (59%) with 45 coronary arteries (45%) presented in-stent restenosis. The diagnostic sensitivity, specificity, accuracy, positive predictive and negative predictive value of ATP stress (99m)Tc-MIBI G-MPI for assessing stent restenosis in all patients were 85, 89, 86, 92 and 80%, respectively. Similarly, these values in patients with myocardial infarction were 79, 88, 83, 88 and 78%, respectively, while in patients without myocardial infarction the values were 90, 91, 90, 95 and 83%, respectively. Therefore, the diagnostic efficacy of ATP stress (99m)Tc-MIBI G-MPI in patients without myocardial infarction was higher compared with those with myocardial infarction; however, no significant difference was observed between the two groups. Furthermore, the sensitivity, specificity and

  13. Monitoring of intracellular adenosine triphosphate in CD4(+) T cells to predict the occurrence of cytomegalovirus disease in kidney transplant recipients.

    PubMed

    Pérez-Jacoiste Asín, María Asunción; Fernández-Ruiz, Mario; López-Medrano, Francisco; Aquilino, Carolina; González, Esther; Ruiz-Merlo, Tamara; Gutiérrez, Eduardo; San Juan, Rafael; Paz-Artal, Estela; Andrés, Amado; Aguado, José Maria

    2016-10-01

    The measurement of intracellular concentrations of adenosine triphosphate (iATP) in phytohemagglutinin-stimulated CD4(+) T cells constitutes a surrogate marker for post-transplant cell-mediated immunity (CMI). This assay has shown suboptimal accuracy for predicting infection after kidney transplantation (KT). We hypothesize that its predictive capacity depends on the specific contribution of the CMI to host-pathogen interactions. We assessed iATP levels in 100 KT recipients at baseline and months 1, 3, and 6 (363 measurements). No association was found between iATP at month 1 and the risk for overall or bacterial infection, although such association was evident for cytomegalovirus (CMV) disease (multivariate-adjusted hazard ratio [per 50-unit increment]: 0.83; P-value = 0.048). There were no significant differences in mean iATP between stable patients (319.4 ng/ml) and those developing overall (304.1 ng/ml) or bacterial infection (346.9 ng/ml) over the 45 days following monitoring. However, iATP was significantly lower in patients who developed CMV disease (223.5 ng/ml; P-values <0.002). The optimal cutoff (265 ng/ml) for predicting CMV disease in patients not receiving antiviral prophylaxis yielded sensitivity, specificity, positive, and negative predictive values of 85.7%, 68.3%, 15.2%, and 98.6%, respectively. In conclusion, a non-pathogen-specific monitoring of CMI by means of iATP informs the risk of CMV disease in KT recipients.

  14. Mechanosensitive release of adenosine 5'-triphosphate through pannexin channels and mechanosensitive upregulation of pannexin channels in optic nerve head astrocytes: a mechanism for purinergic involvement in chronic strain.

    PubMed

    Beckel, Jonathan M; Argall, Arthur J; Lim, Jason C; Xia, Jingsheng; Lu, Wennan; Coffey, Erin E; Macarak, Edward J; Shahidullah, Mohammed; Delamere, Nicholas A; Zode, Gulab S; Sheffield, Val C; Shestopalov, Valery I; Laties, Alan M; Mitchell, Claire H

    2014-09-01

    As adenosine 5'-triphosphate (ATP) released from astrocytes can modulate many neural signaling systems, the triggers and pathways for this ATP release are important. Here, the ability of mechanical strain to trigger ATP release through pannexin channels and the effects of sustained strain on pannexin expression were examined in rat optic nerve head astrocytes. Astrocytes released ATP when subjected to 5% of equibiaxial strain or to hypotonic swelling. Although astrocytes expressed mRNA for pannexins 1-3, connexin 43, and VNUT, pharmacological analysis suggested a predominant role for pannexins in mechanosensitive ATP release, with Rho kinase contribution. Astrocytes from panx1(-/-) mice had reduced baseline and stimulated levels of extracellular ATP, confirming the role for pannexins. Swelling astrocytes triggered a regulatory volume decrease that was inhibited by apyrase or probenecid. The swelling-induced rise in calcium was inhibited by P2X7 receptor antagonists A438079 and AZ10606120, in addition to apyrase and carbenoxolone. Extended stretch of astrocytes in vitro upregulated expression of panx1 and panx2 mRNA. A similar upregulation was observed in vivo in optic nerve head tissue from the Tg-MYOC(Y437H) mouse model of chronic glaucoma; genes for panx1, panx2, and panx3 were increased, whereas immunohistochemistry confirmed increased expression of pannexin 1 protein. In summary, astrocytes released ATP in response to mechanical strain, with pannexin 1 the predominant efflux pathway. Sustained strain upregulated pannexins in vitro and in vivo. Together, these findings provide a mechanism by which extracellular ATP remains elevated under chronic mechanical strain, as found in the optic nerve head of patients with glaucoma.

  15. Supplementation of Exogenous Adenosine 5′-Triphosphate Enhances Mechanical Properties of 3D Cell–Agarose Constructs for Cartilage Tissue Engineering

    PubMed Central

    Gadjanski, Ivana; Yodmuang, Supansa; Spiller, Kara; Bhumiratana, Sarindr

    2013-01-01

    Formation of tissue-engineered cartilage is greatly enhanced by mechanical stimulation. However, direct mechanical stimulation is not always a suitable method, and the utilization of mechanisms underlying mechanotransduction might allow for a highly effective and less aggressive alternate means of stimulation. In particular, the purinergic, adenosine 5′-triphosphate (ATP)-mediated signaling pathway is strongly implicated in mechanotransduction within the articular cartilage. We investigated the effects of transient and continuous exogenous ATP supplementation on mechanical properties of cartilaginous constructs engineered using bovine chondrocytes and human mesenchymal stem cells (hMSCs) encapsulated in an agarose hydrogel. For both cell types, we have observed significant increases in equilibrium and dynamic compressive moduli after transient ATP treatment applied in the fourth week of cultivation. Continuous ATP treatment over 4 weeks of culture only slightly improved the mechanical properties of the constructs, without major changes in the total glycosaminoglycan (GAG) and collagen content. Structure–function analyses showed that transiently ATP-treated constructs, and in particular those based on hMSCs, had the highest level of correlation between compositional and mechanical properties. Transiently treated groups showed intense staining of the territorial matrix for GAGs and collagen type II. These results indicate that transient ATP treatment can improve functional mechanical properties of cartilaginous constructs based on chondrogenic cells and agarose hydrogels, possibly by improving the structural organization of the bulk phase and territorial extracellular matrix (ECM), that is, by increasing correlation slopes between the content of the ECM components (GAG, collagen) and mechanical properties of the construct. PMID:23651296

  16. Multidrug Resistance-Associated Protein 2 Expression Is Upregulated by Adenosine 5’-Triphosphate in Colorectal Cancer Cells and Enhances Their Survival to Chemotherapeutic Drugs

    PubMed Central

    Vinette, Valérie; Placet, Morgane; Arguin, Guillaume; Gendron, Fernand-Pierre

    2015-01-01

    Extracellular adenosine 5’-triphosphate (ATP) is a signaling molecule that induces a plethora of effects ranging from the regulation of cell proliferation to modulation of cancerous cell behavior. In colorectal cancer, ATP was reported to stimulate epithelial cell proliferation and possibly promote resistance to anti-cancer treatments. However, the exact role of this danger-signaling molecule on cancerous intestinal epithelial cells (IECs) in response to chemotherapeutic agents remains unknown. To address how ATP may influence the response of cancerous IECs to chemotherapeutic agents, we used Caco-2 cells, which display enterocyte-like features, to determine the effect of ATP on the expression of multidrug resistance-associated protein 2 (MRP2). Gene and protein expression were determined by quantitative real-time PCR (qRT-PCR) and Western blotting. Resistance to etoposide, cisplatin and doxorubicin was determined by MTT assays in response to ATP stimulation of Caco-2 cells and in cells for which MRP2 expression was down-regulated by shRNA. ATP increased the expression of MRP2 at both the mRNA and protein levels. MRP2 expression involved an ATP-dependent stimulation of the MEK/ERK signaling pathway that was associated with an increase in relative resistance of Caco-2 cells to etoposide. Abolition of MRP2 expression using shRNA significantly reduced the protective effect of MRP2 toward etoposide as well as to cisplatin and doxorubicin. This study describes the mechanism by which ATP may contribute to the chemoresistance of cancerous IECs in colorectal cancer. Given the heterogeneity of colorectal adenocarcinoma responses to anti-cancer drugs, these findings call for further study to understand the role of P2 receptors in cancer drug therapy and to develop novel therapies aimed at regulating P2 receptor activity. PMID:26295158

  17. Using an Adenosine Triphosphate Bioluminescent Assay to Determine Effective Antibiotic Combinations against Carbapenem-Resistant Gram Negative Bacteria within 24 Hours

    PubMed Central

    Cai, Yiying; Leck, Hui; Lim, Tze Peng; Teo, Jocelyn; Lee, Winnie; Hsu, Li Yang; Koh, Tse Hsien; Tan, Thuan Tong; Tan, Thean-Yen; Kwa, Andrea Lay-Hoon

    2015-01-01

    Background Current in vitro combination testing methods involve enumeration by bacterial plating, which is labor-intensive and time-consuming. Measurement of bioluminescence, released when bacterial adenosine triphosphate binds to firefly luciferin-luciferase, has been proposed as a surrogate for bacterial counts. We developed an ATP bioluminescent combination testing assay with a rapid turnaround time of 24h to determine effective antibiotic combinations. Methods 100 strains of carbapenem-resistant (CR) GNB [30 Acinetobacter baumannii (AB), 30 Pseudomonas aeruginosa (PA) and 40 Klebsiella pneumoniae (KP)] were used. Bacterial suspensions (105 CFU/ml) were added to 96-well plates containing clinically achievable concentrations of multiple single and two-antibiotic combinations. At 24h, the luminescence intensity of each well was measured. Receiver operator characteristic curves were plotted to determine optimal luminescence threshold (TRLU) to discriminate between inhibitory/non-inhibitory combinations when compared to viable plating. The unweighted accuracy (UA) [(sensitivity + specificity)/2] of TRLU values was determined. External validation was further done using 50 additional CR-GNB. Results Predictive accuracies of TRLU were high for when all antibiotic combinations and species were collectively analyzed (TRLU = 0.81, UA = 89%). When individual thresholds for each species were determined, UA remained high. Predictive accuracy was highest for KP (TRLU = 0.81, UA = 91%), and lowest for AB (TRLU = 0.83, UA = 87%). Upon external validation, high overall accuracy (91%) was observed. The assay distinguished inhibitory/non-inhibitory combinations with UA of 80%, 94% and 93% for AB, PA and KP respectively. Conclusion We developed an assay that is robust at identifying useful combinations with a rapid turn-around time of 24h, and may be employed to guide the timely selection of effective antibiotic combinations. PMID:26460891

  18. Hybridization chain reaction-based colorimetric aptasensor of adenosine 5'-triphosphate on unmodified gold nanoparticles and two label-free hairpin probes.

    PubMed

    Gao, Zhuangqiang; Qiu, Zhenli; Lu, Minghua; Shu, Jian; Tang, Dianping

    2017-03-15

    This work designs a new label-free aptasensor for the colorimetric determination of small molecules (adenosine 5'-triphosphate, ATP) by using visible gold nanoparticles as the signal-generation tags, based on target-triggered hybridization chain reaction (HCR) between two hairpin DNA probes. The assay is carried out referring to the change in the color/absorbance by salt-induced aggregation of gold nanoparticles after the interaction with hairpins, gold nanoparticles and ATP. To construct such an assay system, two hairpin DNA probes with a short single-stranded DNA at the sticky end are utilized for interaction with gold nanoparticles. In the absence of target ATP, the hairpin DNA probes can prevent gold nanoparticles from the salt-induced aggregation through the interaction of the single-stranded DNA at the sticky end with gold nanoparticles. Upon target ATP introduction, the aptamer-based hairpin probe is opened to expose a new sticky end for the strand-displacement reaction with another complementary hairpin, thus resulting in the decreasing single-stranded DNA because of the consumption of hairpins. In this case, gold nanoparticles are uncovered owing to the formation of double-stranded DNA, which causes their aggregation upon addition of the salt, thereby leading to the change in the red-to-blue color. Under the optimal conditions, the HCR-based colorimetric assay presents good visible color or absorbance responses for the determination of target ATP at a concentration as low as 1.0nM. Importantly, the methodology can be further extended to quantitatively or qualitatively monitor other small molecules or biotoxins by changing the sequence of the corresponding aptamer.

  19. Effects of chronic digitalization on cardiac and renal Na+ + K+-dependent adenosine triphosphate activity and circulating catecholamines in the dog.

    PubMed

    Nechay, B R; Jackson, R E; Ziegler, M G; Neldon, S L; Thompson, J D

    1981-09-01

    To extend our understanding of the mechanism of action of digitalis drugs, we studied electrocardiograms (ECGs), renal function, plasma concentrations of catecholamines, and myocardial and renal Na+ + K+-dependent adenosine triphosphate (Na+ + K+ ATPase) activity in chronically digitalized dogs. Five healthy, male, mongrel dogs received a therapeutic regimen of digoxin (0.1 mg/kg on day 1 in three divided doses followed by 0.025 mg/kg per day) orally for 2-4 months. This resulted in plasma digoxin concentrations of 1.1 to 4.7 ng/ml as determined by radioimmunoassay. Six control dogs received daily gelatin capsules by mouth. ECGs monitored throughout the study showed no changes. Digitalized dogs had elevated plasma norepinephrine concentrations (347 vs. 137 pg/ml in controls) and no change in plasma epinephrine concentrations. Digitalized dogs had elevated glomerular filtration rates (0.74 vs. 0.94 ml/min per g of kidney) without significant changes in renal handling of electrolytes and water. All of the above studies were done without the aid of restraining drugs or infusions. The animals were killed with an overdose of pentobarbital for in vitro studies. In digitalized dogs, microsomal Na+ + K+ ATPase-specific activity was 26 to 33% lower in the renal cortex, medulla, and papilla, and 46% lower in the cardiac left ventricle than in control dogs. Digitalization did not alter the osmolalities of renal tissues. We conclude that chronic reduction Na+ + K+ ATPase activity by one-third dose does not cause abnormalities in renal handling of electrolytes and water, and inhibition of Na+ + K+ ATPase in the left ventricular muscle by one-half is associated with no obvious ECG changes in the dog. Further, elevated plasma norepinephrine concentrations may contribute to both the therapeutic and the toxic effects of digitalis.

  20. In situ amplified electrochemical aptasensing for sensitive detection of adenosine triphosphate by coupling target-induced hybridization chain reaction with the assembly of silver nanotags.

    PubMed

    Zhou, Qian; Lin, Youxiu; Lin, Yuping; Wei, Qiaohua; Chen, Guonan; Tang, Dianping

    2016-01-01

    Biomolecular immobilization and construction of the sensing platform are usually crucial for the successful development of a high-efficiency detection system. Herein we report on a novel and label-free signal-amplified aptasensing for sensitive electrochemical detection of small molecules (adenosine triphosphate, ATP, used in this case) by coupling with target-induced hybridization chain reaction (HCR) and the assembly of electroactive silver nanotags. The system mainly consisted of two alternating hairpin probes, a partial-pairing trigger-aptamer duplex DNA and a capture probe immobilized on the electrode. Upon target ATP introduction, the analyte attacked the aptamer and released the trigger DNA, which was captured by capture DNA immobilized on the electrode to form a newly partial-pairing double-stranded DNA. Thereafter, the exposed domain at trigger DNA could be utilized as the initator strand to open the hairpin probes in sequence, and propagated a chain reaction of hybridization events between two alternating hairpins to form a long nicked double-helix. The electrochemical signal derived from the assembled silver nanotags on the nicked double-helix. Under optimal conditions, the electrochemical aptasensor could exhibit a high sensitivity and a low detection limit, and allowed the detection of ATP at a concentration as low as 0.03 pM. Our design showed a high selectivity for target ATP against its analogs because of the high-specificity ATP-aptamer reaction, and its applicable for monitoring ATP in the spiking serum samples. Improtantly, the distinct advantages of the developed aptasensor make it hold a great potential for the development of simple and robust sensing strategies for the detection of other small molecules by controlling the apatmer sequence.

  1. Effects of oral adenosine-5′-triphosphate supplementation on athletic performance, skeletal muscle hypertrophy and recovery in resistance-trained men

    PubMed Central

    2013-01-01

    Background Currently, there is a lack of studies examining the effects of adenosine-5′-triphosphate (ATP) supplementation utilizing a long-term, periodized resistance-training program (RT) in resistance-trained populations. Therefore, we investigated the effects of 12 weeks of 400 mg per day of oral ATP on muscular adaptations in trained individuals. We also sought to determine the effects of ATP on muscle protein breakdown, cortisol, and performance during an overreaching cycle. Methods The study was a 3-phase randomized, double-blind, and placebo- and diet-controlled intervention. Phase 1 was a periodized resistance-training program. Phase 2 consisted of a two week overreaching cycle in which volume and frequency were increased followed by a 2-week taper (Phase 3). Muscle mass, strength, and power were examined at weeks 0, 4, 8, and 12 to assess the chronic effects of ATP; assessment performance variables also occurred at the end of weeks 9 and 10, corresponding to the mid and endpoints of the overreaching cycle. Results There were time (p < 0.001), and group x time effects for increased total body strength (+55.3 ± 6.0 kg ATP vs. + 22.4 ± 7.1 kg placebo, p < 0.001); increased vertical jump power (+ 796 ± 75 ATP vs. 614 ± 52 watts placebo, p < 0.001); and greater ultrasound determined muscle thickness (+4.9 ± 1.0 ATP vs. (2.5 ± 0.6 mm placebo, p < 0.02) with ATP supplementation. During the overreaching cycle, there were group x time effects for strength and power, which decreased to a greater extent in the placebo group. Protein breakdown was also lower in the ATP group. Conclusions Our results suggest oral ATP supplementation may enhance muscular adaptations following 12-weeks of resistance training, and prevent decrements in performance following overreaching. No statistically or clinically significant changes in blood chemistry or hematology were observed. Trial registration ClinicalTrials.gov NCT01508338 PMID

  2. Effect of extracellular adenosine 5'-triphosphate on cryopreserved epididymal cat sperm intracellular ATP concentration, sperm quality, and in vitro fertilizing ability.

    PubMed

    Thuwanut, Paweena; Arya, Nlin; Comizzoli, Pierre; Chatdarong, Kaywalee

    2015-09-15

    Intracellular adenosine 5'-triphosphate (ATP) is essential for supporting sperm function in the fertilization process. During cryopreservation, damage of sperm mitochondrial membrane usually leads to compromised production of intracellular ATP. Recently, extracellular ATP (ATPe) was introduced as a potent activator of sperm motility and fertilizing ability. This study aimed to evaluate (1) levels of intracellular ATP in frozen-thawed epididymal cat sperm after incubation with ATPe and (2) effects of ATPe on epididymal cat sperm parameters after freezing and thawing. Eighteen male cats were included. For each replicate, epididymal sperm from two cats were pooled to one sample (N = 9). Each pooled sample was cryopreserved with the Tris-egg yolk extender into three straws. After thawing, the first and second straws were incubated with 0-, 1.0-, or 2.5-mM ATPe for 10 minutes and evaluated for sperm quality at 10 minutes, 1, 3, and 6 hours after thawing and fertilizing ability. The third straw was evaluated for intracellular ATP concentration in control and with 2.5-mM ATPe treatment. Higher concentration of intracellular sperm ATP was observed in the samples treated with 2.5-mM ATPe compared to the controls (0.339 ± 0.06 μg/2 × 10(6) sperm vs. 0.002 ± 0.003 μg/2 × 10(6) sperm, P ≤ 0.05). In addition, incubation with 2.5-mM ATPe for 10 minutes promoted sperm motility (56.7 ± 5.0 vs. 53.3 ± 4.4%, P ≤ 0.05) and progressive motility (3.1 ± 0.2 vs. 2.8 ± 0.4, P ≤ 0.05), mitochondrial membrane potential (36.4 ± 5.5 vs. 28.7 ± 4.8%, P ≤ 0.05), and blastocyst rate (36.1 ± 7.0 and 28.8 ± 7.4%, P ≤ 0.05) compared with the controls. In contrast, ATPe remarkably interfered acrosome integrity after 6 hours of postthawed incubation. In sum, the present finding that optimal incubation time of postthaw epididymal cat sperm under proper ATPe condition might constitute a rationale for the studies on other endangered wild felids regarding sperm quality and embryo

  3. The Tomato R Gene Products I-2 and Mi-1 Are Functional ATP Binding Proteins with ATPase Activity

    PubMed Central

    Tameling, Wladimir I. L.; Elzinga, Sandra D. J.; Darmin, Patricia S.; Vossen, Jack H.; Takken, Frank L. W.; Haring, Michel A.; Cornelissen, Ben J. C.

    2002-01-01

    Most plant disease resistance (R) genes known today encode proteins with a central nucleotide binding site (NBS) and a C-terminal Leu-rich repeat (LRR) domain. The NBS contains three ATP/GTP binding motifs known as the kinase-1a or P-loop, kinase-2, and kinase-3a motifs. In this article, we show that the NBS of R proteins forms a functional nucleotide binding pocket. The N-terminal halves of two tomato R proteins, I-2 conferring resistance to Fusarium oxysporum and Mi-1 conferring resistance to root-knot nematodes and potato aphids, were produced as glutathione S-transferase fusions in Escherichia coli. In a filter binding assay, purified I-2 was found to bind ATP rather than other nucleoside triphosphates. ATP binding appeared to be fully dependent on the presence of a divalent cation. A mutant I-2 protein containing a mutation in the P-loop showed a strongly reduced ATP binding capacity. Thin layer chromatography revealed that both I-2 and Mi-1 exerted ATPase activity. Based on the strong conservation of NBS domains in R proteins of the NBS-LRR class, we propose that they all are capable of binding and hydrolyzing ATP. PMID:12417711

  4. ATP binding cassette G transporters and plant male reproduction

    PubMed Central

    Zhao, Guochao; Shi, Jianxin; Liang, Wanqi; Zhang, Dabing

    2016-01-01

    ABSTRACT The function of ATP Binding Cassette G (ABCG) transporters in the regulation of plant vegetative organs development has been well characterized in various plant species. In contrast, their function in reproductive development particularly male reproductive development received considerably less attention till some ABCG transporters was reported to be associated with anther and pollen wall development in Arabidopsis thaliana and rice (Oryza sativa) during the past decade. This mini-review summarizes current knowledge of ABCG transporters regarding to their roles in male reproduction and underlying genetic and biochemical mechanisms, which makes it evident that ABCG transporters represent one of those conserved and divergent components closely related to male reproduction in plants. This mini-review also discusses the current challenges and future perspectives in this particular field. PMID:26906115

  5. Activation or block of adenosine triphosphate-sensitive potassium channel have opposite effects on postcardioplegic myocardial dysfunction, "stunning". A multivariate prediction based on relative operating characteristic curve.

    PubMed

    Puddu, P E; Sugimoto, S; Monti, F; Iwashiro, K; Dawodu, A A; Schiariti, M; Chiavarelli, R; Marino, B; Campa, P P

    1995-09-01

    The relative effects of nicotinic acid (NA) and nitroglycerin (NT) added to cold high K+ cardioplegia were studied, to represent the two moieties of the adenosine triphosphate-sensitive potassium channel (KATP) activator nicorandil (N). In addition, we made a pooled analysis of a large series of experiments performed in our Laboratory to investigate the effects of KATP activation by N, or block (by glibenclamide, G), on postcardioplegic myocardial dysfunction. In both studies, reversibility from myocardial dysfunction (stunning) was assessed by the positive inotropic agent dobutamine. Guinea pig papillary muscle preparations were immersed in Tyrode's solution (O2 content 16 ml/l, 37 degrees C), then hypoxic (O2 content 5 ml/l) superfusion with hypothermic (20 degrees C) cardioplegic Saint Thomas' Hospital solution (STHS) was performed for 120 min. We investigated: A) 5 groups based on treatments added to STHS: 1) saline (Control (C)); 2) N = 1 mmol/L; 3) G = 1 mumol/L (also given for 15 min in Tyrode's solution); 4) NA = 1 mmol/L; 5) NT = 100 mumol/L; B) 76 consecutive experiments and we defined, independent of whether just before or during STHS: 1) KATP activation (by N, in the concentration range 1 mumol/L to 1 mmol/L, n = 36); 2) KATP block (by G 1 mumol/L, either alone or just before N, n = 20); 3) controls (n = 20) (either saline, n = 12, or saline plus dimethyl sulfoxide, as vehicle, at the ratio 100 to 1, n = 8). Absolute isometric contractility variables were evaluated along with percent changes of baseline values: 1) at 30 s of STHS, 2) after 60 min of reoxygenation with Tyrode's solution and 3) following further 15 min of dobutamine 10 mumol/L. In all preparations, developed tension (DT), time to peak tension (TPT), DT/TPT and time to arrest (TTA) were measured. In study A): TTA was significantly abbreviated (intergroup F = 5.79, p < 0.001) in N (49 +/- 11 s, mean +/- SD) p < 0.01 vs C and NA). At 30 s of STHS %DT/TPT was unchanged among groups. By

  6. Comparison of the Immunomagnetic Separation/Adenosine Triphosphate Rapid Method and the Modified mTEC Membrane-Filtration Method for Enumeration of Escherichia coli

    USGS Publications Warehouse

    Brady, Amie M.G.; Bushon, Rebecca N.; Bertke, Erin E.

    2009-01-01

    Water quality at beaches is monitored for fecal indicator bacteria by traditional, culture-based methods that can take 18 to 24 hours to obtain results. A rapid detection method that provides estimated concentrations of fecal indicator bacteria within 1 hour from the start of sample processing would allow beach managers to post advisories or close the beach when the conditions are actually considered unsafe instead of a day later, when conditions may have changed. A rapid method that couples immunomagnetic separation with adenosine triphosphate detection (IMS/ATP rapid method) was evaluated through monitoring of Escherichia coli (E. coli) at three Lake Erie beaches in Ohio (Edgewater and Villa Angela in Cleveland and Huntington in Bay Village). Beach water samples were collected between 4 and 5 days per week during the recreational seasons (May through September) of 2006 and 2007. Composite samples were created in the lab from two point samples collected at each beach and were shown to be comparable substitutes for analysis of two individual samples. E. coli concentrations in composite samples, as determined by the culture-based method, ranged from 4 to 24,000 colony-forming units per 100 milliliters during this study across all beaches. Turbidity also was measured for each sample and ranged from 0.8 to 260 neophelometric turbidity ratio units. Environmental variables were noted at the time of sampling, including number of birds at the beach and wave height. Rainfall amounts were measured at National Weather Service stations at local airports. Turbidity, rainfall, and wave height were significantly related to the culture-based method results each year and for both years combined at each beach. The number of birds at the beach was significantly related to the culture-based method results only at Edgewater during 2006 and during both years combined. Results of the IMS/ATP method were compared to results of the culture-based method for samples by year for each beach

  7. Microbial Group Specific Uptake Kinetics of Inorganic Phosphate and Adenosine-5′-Triphosphate (ATP) in the North Pacific Subtropical Gyre

    PubMed Central

    Björkman, Karin; Duhamel, Solange; Karl, David M.

    2012-01-01

    We investigated the concentration dependent uptake of inorganic phosphate (Pi) and adenosine-5′-triphosphate (ATP) in microbial populations in the North Pacific Subtropical Gyre (NPSG). We used radiotracers to measure substrate uptake into whole water communities, differentiated microbial size classes, and two flow sorted groups; Prochlorococcus (PRO) and non-pigmented bacteria (NPB). The Pi concentrations, uptake rates, and Pi pool turnover times (Tt) were (mean, ±SD); 54.9 ± 35.0 nmol L−1 (n = 22), 4.8 ± 1.9 nmol L−1 day−1 (n = 19), and 14.7 ± 10.2 days (n = 19), respectively. Pi uptake into >2 μm cells was on average 12 ± 7% (n = 15) of the total uptake. The kinetic response to Pi (10–500 nmol L−1) was small, indicating that the microorganisms were close to their maximum uptake velocity (Vmax). Vmax averaged 8.0 ± 3.6 nmol L−1 day−1 (n = 19) in the >0.2 μm group, with half saturation constants (Km) of 40 ± 28 nmol L−1 (n = 19). PRO had three times the cell specific Pi uptake rate of NPB, at ambient concentrations, but when adjusted to cells L−1 the rates were similar, and these two groups were equally competitive for Pi. The Tt of γ-P-ATP in the >0.2 μm group were shorter than for the Pi pool (4.4 ± 1.0 days; n = 6), but this difference diminished in the larger size classes. The kinetic response to ATP was large in the >0.2 μm class with Vmax exceeding the rates at ambient concentrations (mean 62 ± 27 times; n = 6) with a mean Vmax for γ-P-ATP of 2.8 ± 1.0 nmol L−1 day−1, and Km at 11.5 ± 5.4 nmol L−1 (n = 6). The NPB contribution to γ-P-ATP uptake was high (95 ± 3%, n = 4) at ambient concentrations but decreased to ∼50% at the highest ATP amendment. PRO had Km values 5–10 times greater than NPB. The above indicates that PRO and NPB were in close competition in terms of Pi acquisition

  8. Spatial and Temporal Variability in the Concentration and Turnover of the Inorganic Phosphate and Adenosine-5'-triphosphate pools in the North Pacific Subtropical Gyre

    NASA Astrophysics Data System (ADS)

    Björkman, Karin; Church, Matthew; Karl, David

    2015-04-01

    The microbial community's utilization of inorganic phosphate (Pi) and adenosine-5'-triphosphate (ATP) as a function of the Pi pool concentration was studied over a multi-year period at Station ALOHA (22.75˚N, 158˚W) in the North Pacific Subtropical Gyre (NPSG). Additionally, the spatial variability in these same properties was investigated along an east-west transect from California to Hawaii in the Fall of 2014. We used radiotracer techniques to determine the turnover times of the Pi or ATP pools respectively, and assessed the net production of dissolved organic phosphorus, and Pi hydrolysis rate from ATP. Pi concentrations in the upper water column at Station ALOHA are temporally highly dynamic, with periods of <10 nM-P to near 200 nM-P recorded within the top 50 m over the past decades of observations. During the California to Hawaii transect Pi concentrations showed a similarly large range (<10 to >200 nM-P), emphasizing the spatially and temporally mosaic nature of the upper ocean of this large biome. The Pi-pool turnover time ranged from a few hours to several weeks, and was strongly correlated with measured Pi pool concentrations (r2=0.8; n=30 Station ALOHA; n=15 transect). The calculated Pi uptake rates at Station ALOHA averaged 3.7±1.3 nM-P d-1 (n=30), reflecting the typically low maximum Pi uptake rates of the Prochlorococcus dominated community and the predominantly non-limiting Pi conditions. The Pi uptake rates along the transect were more variable than Station ALOHA (averaging 9.2±4.7 nM=P d-1, n=15), possibly due to a more diverse planktonic community structure, including stations with elevated concentrations of chlorophyll and primary productivity. The turnover time of the dissolved ATP pool was typically substantially shorter than for the Pi-pool (2-5 days at Station ALOHA; 0.3-2.5 days along the transect), likely reflecting its low nanomolar to picomolar ambient pool concentrations. However, at stations with the lowest SRP concentrations the

  9. Crystal structure of ATP-binding subunit of an ABC transporter from Geobacillus kaustophilus.

    PubMed

    Manjula, M; Pampa, K J; Kumar, S M; Mukherjee, S; Kunishima, N; Rangappa, K S; Lokanath, N K

    2015-03-27

    The ATP binding cassette (ABC) transporters, represent one of the largest superfamilies of primary transporters, which are very essential for various biological functions. The crystal structure of ATP-binding subunit of an ABC transporter from Geobacillus kaustophilus has been determined at 1.77 Å resolution. The crystal structure revealed that the protomer has two thick arms, (arm I and II), which resemble 'L' shape. The ATP-binding pocket is located close to the end of arm I. ATP molecule is docked into the active site of the protein. The dimeric crystal structure of ATP-binding subunit of ABC transporter from G. kaustophilus has been compared with the previously reported crystal structure of ATP-binding subunit of ABC transporter from Salmonella typhimurium.

  10. ATP Binding Turns Plant Cryptochrome Into an Efficient Natural Photoswitch

    NASA Astrophysics Data System (ADS)

    Müller, Pavel; Bouly, Jean-Pierre; Hitomi, Kenichi; Balland, Véronique; Getzoff, Elizabeth D.; Ritz, Thorsten; Brettel, Klaus

    2014-06-01

    Cryptochromes are flavoproteins that drive diverse developmental light-responses in plants and participate in the circadian clock in animals. Plant cryptochromes have found application as photoswitches in optogenetics. We have studied effects of pH and ATP on the functionally relevant photoreduction of the oxidized FAD cofactor to the semi-reduced FADH. radical in isolated Arabidopsis cryptochrome 1 by transient absorption spectroscopy on nanosecond to millisecond timescales. In the absence of ATP, the yield of light-induced radicals strongly decreased with increasing pH from 6.5 to 8.5. With ATP present, these yields were significantly higher and virtually pH-independent up to pH 9. Analysis of our data in light of the crystallographic structure suggests that ATP-binding shifts the pKa of aspartic acid D396, the putative proton donor to FAD.-, from ~7.4 to >9, and favours a reaction pathway yielding long-lived aspartate D396-. Its negative charge could trigger conformational changes necessary for signal transduction.

  11. ATP-Binding Cassette Efflux Transporters in Human Placenta

    PubMed Central

    Ni, Zhanglin; Mao, Qingcheng

    2010-01-01

    Pregnant women are often complicated with diseases including viral or bacterial infections, epilepsy, hypertension, or pregnancy-induced conditions such as depression and gestational diabetes that require treatment with medication. In addition, substance abuse during pregnancy remains a major public health problem. Many drugs used by pregnant women are off label without the necessary dose, efficacy, and safety data required for rational dosing regimens of these drugs. Thus, a major concern arising from the widespread use of drugs by pregnant women is the transfer of drugs across the placental barrier, leading to potential toxicity to the developing fetus. Knowledge regarding the ATP-binding cassette (ABC) efflux transporters, which play an important role in drug transfer across the placental barrier, is absolutely critical for optimizing the therapeutic strategy to treat the mother while protecting the fetus during pregnancy. Such transporters include P-glycoprotein (P-gp, gene symbol ABCB1), the breast cancer resistance protein (BCRP, gene symbol ABCG2), and the multidrug resistance proteins (MRPs, gene symbol ABCCs). In this review, we summarize the current knowledge with respect to developmental expression and regulation, membrane localization, functional significance, and genetic polymorphisms of these ABC transporters in the placenta and their relevance to fetal drug exposure and toxicity. PMID:21118087

  12. ATP Binding Turns Plant Cryptochrome Into an Efficient Natural Photoswitch

    PubMed Central

    Müller, Pavel; Bouly, Jean-Pierre; Hitomi, Kenichi; Balland, Véronique; Getzoff, Elizabeth D.; Ritz, Thorsten; Brettel, Klaus

    2014-01-01

    Cryptochromes are flavoproteins that drive diverse developmental light-responses in plants and participate in the circadian clock in animals. Plant cryptochromes have found application as photoswitches in optogenetics. We have studied effects of pH and ATP on the functionally relevant photoreduction of the oxidized FAD cofactor to the semi-reduced FADH· radical in isolated Arabidopsis cryptochrome 1 by transient absorption spectroscopy on nanosecond to millisecond timescales. In the absence of ATP, the yield of light-induced radicals strongly decreased with increasing pH from 6.5 to 8.5. With ATP present, these yields were significantly higher and virtually pH-independent up to pH 9. Analysis of our data in light of the crystallographic structure suggests that ATP-binding shifts the pKa of aspartic acid D396, the putative proton donor to FAD·−, from ~7.4 to >9, and favours a reaction pathway yielding long-lived aspartate D396−. Its negative charge could trigger conformational changes necessary for signal transduction. PMID:24898692

  13. ATP-binding cassette transporters in reproduction: a new frontier

    PubMed Central

    Bloise, E.; Ortiga-Carvalho, T.M.; Reis, F.M.; Lye, S.J.; Gibb, W.; Matthews, S.G.

    2016-01-01

    BACKGROUND The transmembrane ATP-binding cassette (ABC) transporters actively efflux an array of clinically relevant compounds across biological barriers, and modulate biodistribution of many physiological and pharmacological factors. To date, over 48 ABC transporters have been identified and shown to be directly and indirectly involved in peri-implantation events and fetal/placental development. They efflux cholesterol, steroid hormones, vitamins, cytokines, chemokines, prostaglandins, diverse xenobiotics and environmental toxins, playing a critical role in regulating drug disposition, immunological responses and lipid trafficking, as well as preventing fetal accumulation of drugs and environmental toxins. METHODS This review examines ABC transporters as important mediators of placental barrier functions and key reproductive processes. Expression, localization and function of all identified ABC transporters were systematically reviewed using PubMed and Google Scholar websites to identify relevant studies examining ABC transporters in reproductive tissues in physiological and pathophysiological states. Only reports written in English were incorporated with no restriction on year of publication. While a major focus has been placed on the human, extensive evidence from animal studies is utilized to describe current understanding of the regulation and function of ABC transporters relevant to human reproduction. RESULTS ABC transporters are modulators of steroidogenesis, fertilization, implantation, nutrient transport and immunological responses, and function as ‘gatekeepers’ at various barrier sites (i.e. blood-testes barrier and placenta) against potentially harmful xenobiotic factors, including drugs and environmental toxins. These roles appear to be species dependent and change as a function of gestation and development. The best-described ABC transporters in reproductive tissues (primarily in the placenta) are the multidrug transporters p-glycoprotein and

  14. A Computational Analysis of ATP Binding of SV40 Large Tumor Antigen Helicase Motor

    PubMed Central

    Shi, Yemin; Liu, Hanbin; Gai, Dahai; Ma, Jianpeng; Chen, Xiaojiang S.

    2009-01-01

    Simian Virus 40 Large Tumor Antigen (LTag) is an efficient helicase motor that unwinds and translocates DNA. The DNA unwinding and translocation of LTag is powered by ATP binding and hydrolysis at the nucleotide pocket between two adjacent subunits of an LTag hexamer. Based on the set of high-resolution hexameric structures of LTag helicase in different nucleotide binding states, we simulated a conformational transition pathway of the ATP binding process using the targeted molecular dynamics method and calculated the corresponding energy profile using the linear response approximation (LRA) version of the semi-macroscopic Protein Dipoles Langevin Dipoles method (PDLD/S). The simulation results suggest a three-step process for the ATP binding from the initial interaction to the final tight binding at the nucleotide pocket, in which ATP is eventually “locked” by three pairs of charge-charge interactions across the pocket. Such a “cross-locking” ATP binding process is similar to the binding zipper model reported for the F1-ATPase hexameric motor. The simulation also shows a transition mechanism of Mg2+ coordination to form the Mg-ATP complex during ATP binding, which is accompanied by the large conformational changes of LTag. This simulation study of the ATP binding process to an LTag and the accompanying conformational changes in the context of a hexamer leads to a refined cooperative iris model that has been proposed previously. PMID:19779548

  15. ATP-binding site of adenylate kinase: mechanistic implications of its homology with ras-encoded p21, F1-ATPase, and other nucleotide-binding proteins.

    PubMed

    Fry, D C; Kuby, S A; Mildvan, A S

    1986-02-01

    The MgATP binding site of adenylate kinase, located by a combination of NMR and x-ray diffraction, is near three protein segments, five to seven amino acids in length, that are homologous in sequence to segments found in other nucleotide-binding phosphotransferases, such as myosin and F1-ATPase, ras p21 and transducin GTPases, and cAMP-dependent and src protein kinases, suggesting equivalent mechanistic roles of these segments in all of these proteins. Segment 1 is a glycine-rich flexible loop that, on adenylate kinase, may control access to the ATP-binding site by changing its conformation. Segment 2 is an alpha-helix containing two hydrophobic residues that interact with the adenine-ribose moiety of ATP, and a lysine that may bind to the beta- and gamma-phosphates of ATP. Segment 3 is a hydrophobic strand of parallel beta-pleated sheet, terminated by a carboxylate, that flanks the triphosphate binding site. The various reported mutations of ras p21 that convert it to a transforming agent all appear to involve segment 1, and such substitutions may alter the properties of p21 by hindering a conformational change at this segment. In F1-ATPase, the flexible loop may, by its position, control both the accessibility and the ATP/ADP equilibrium constant on the enzyme.

  16. ATP-binding site of adenylate kinase: mechanistic implications of its homology with ras-encoded p21, F1-ATPase, and other nucleotide-binding proteins.

    PubMed Central

    Fry, D C; Kuby, S A; Mildvan, A S

    1986-01-01

    The MgATP binding site of adenylate kinase, located by a combination of NMR and x-ray diffraction, is near three protein segments, five to seven amino acids in length, that are homologous in sequence to segments found in other nucleotide-binding phosphotransferases, such as myosin and F1-ATPase, ras p21 and transducin GTPases, and cAMP-dependent and src protein kinases, suggesting equivalent mechanistic roles of these segments in all of these proteins. Segment 1 is a glycine-rich flexible loop that, on adenylate kinase, may control access to the ATP-binding site by changing its conformation. Segment 2 is an alpha-helix containing two hydrophobic residues that interact with the adenine-ribose moiety of ATP, and a lysine that may bind to the beta- and gamma-phosphates of ATP. Segment 3 is a hydrophobic strand of parallel beta-pleated sheet, terminated by a carboxylate, that flanks the triphosphate binding site. The various reported mutations of ras p21 that convert it to a transforming agent all appear to involve segment 1, and such substitutions may alter the properties of p21 by hindering a conformational change at this segment. In F1-ATPase, the flexible loop may, by its position, control both the accessibility and the ATP/ADP equilibrium constant on the enzyme. Images PMID:2869483

  17. Conservation of an ATP-binding domain among RecA proteins from Proteus vulgaris, Erwinia carotovora, Shigella flexneri, and Escherichia coli K-12 and B/r.

    PubMed

    Knight, K L; Hess, R M; McEntee, K

    1988-06-01

    The purified RecA proteins encoded by the cloned genes from Proteus vulgaris, Erwinia carotovora, Shigella flexneri, and Escherichia coli B/r were compared with the RecA protein from E. coli K-12. Each of the proteins hydrolyzed ATP in the presence of single-stranded DNA, and each was covalently modified with the photoaffinity ATP analog 8-azidoadenosine 5'-triphosphate (8N3ATP). Two-dimensional tryptic maps of the four heterologous RecA proteins demonstrated considerable structural conservation among these bacterial genera. Moreover, when the [alpha-32P]8N3ATP-modified proteins were digested with trypsin and analyzed by high-performance liquid chromatography, a single peak of radioactivity was detected in each of the digests and these peptides eluted identically with the tryptic peptide T31 of the E. coli K-12 RecA protein, which was the unique site of 8N3ATP photolabeling. Each of the heterologous recA genes hybridized to oligonucleotide probes derived from the ATP-binding domain sequence of the E. coli K-12 gene. These last results demonstrate that the ATP-binding domain of the RecA protein has been strongly conserved for greater than 10(7) years.

  18. Conservation of an ATP-binding domain among recA proteins from Proteus vulgaris, erwinia carotovora, Shigella flexneri, and Escherichia coli K-12 and B/r

    SciTech Connect

    Knight, K.L.; Hess, R.M.; McEntee, K.

    1988-06-01

    The purified RecA proteins encoded by the cloned genes from Proteus vulgaris, Erwinia carotovora, Shigella flexneri, and Escherichia coli B/r were compared with the RecA protein from E. coli K-12. Each of the proteins hydrolyzed ATP in the presence of single-stranded DNA, and each was covalently modified with the photoaffinity ATP analog 8-azidoadenosine 5'-triphosphate (8N/sub 3/ATP). Two-dimensional tryptic maps of the four heterologous RecA proteins demonstrated considerable structural conservation among these bacterial genera. Moreover, when the (..cap alpha..-/sup 32/P)8N/sub 3/ATP-modified proteins were digested with trypsin and analyzed by high-performance liquid chromatography, a single peak of radioactivity was detected in each of the digests and these peptides eluted identically with the tryptic peptide T/sub 31/ of the E. coli K-12 RecA protein, which was the unique site of 8N/sub 3/ATP photolabeling. Each of the heterologous recA genes hybridized to oligonucleotide probes derived from the ATP-binding domain sequence of the E. coli K-12 gene. These last results demonstrate that the ATP-binding domain of the RecA protein has been strongly conserved for greater than 10/sup 7/ years.

  19. The opposing effects of calmodulin, adenosine 5 prime -triphosphate, and pertussis toxin on phorbol ester induced inhibition of atrial natriuretic factor stimulated guanylate cyclase in SK-NEP-1 cells

    SciTech Connect

    Sekiya, M.; Frohlich, E.D.; Cole, F.E. )

    1991-01-01

    In the present study, we investigated the effects of calmodulin, adenosine 5{prime}-triphosphate (ATP) and pertussis toxin (PT) on phorbol ester (PMA) induced inhibition of ANF-stimulated cyclic GMP formation in cells from the human renal cell line, SK-NEP-1. PMA inhibited ANF-stimulated guanylate cyclase activity in particulate membranes by about 65%. Calmodulin reversed this inhibition in a dose dependent manner. ATP potentiated Mg++ but not Mn++ supported guanylate cyclase activity. In PMA treated membranes, ATP potentiating effects were abolished. PMA also inhibited ANF-stimulated cGMP accumulation, but pretreatment with PT prevented this PMA inhibition. PT did not affect basal or ANF-stimulated cGMP accumulation. In conclusion, these results demonstrated that PMA inhibited ANF stimulation of particulate guanylate cyclase in opposition to the activating effects of calmodulin or ATP in SK-NEP-1 cells. The protein kinase C inhibitory effects appeared to be mediated via a PT-sensitive G protein.

  20. Influence of ATP-binding cassette transporters in root exudation of phytoalexins, signals, and disease resistance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The roots of plants secrete compounds as a way to exchange information with organ-isms living in the soil. Here, we report the involvement of seven root-expressed ATP-binding cassette (ABC) transporters corresponding to both full and half-size molecules (Atabcg36, Atabcg37, Atabcc5, Atabcf1, Atabcf3...

  1. Molecular mechanism of ATP binding and ion channel activation in P2X receptors

    SciTech Connect

    Hattori, Motoyuki; Gouaux, Eric

    2012-10-24

    P2X receptors are trimeric ATP-activated ion channels permeable to Na{sup +}, K{sup +} and Ca{sup 2+}. The seven P2X receptor subtypes are implicated in physiological processes that include modulation of synaptic transmission, contraction of smooth muscle, secretion of chemical transmitters and regulation of immune responses. Despite the importance of P2X receptors in cellular physiology, the three-dimensional composition of the ATP-binding site, the structural mechanism of ATP-dependent ion channel gating and the architecture of the open ion channel pore are unknown. Here we report the crystal structure of the zebrafish P2X4 receptor in complex with ATP and a new structure of the apo receptor. The agonist-bound structure reveals a previously unseen ATP-binding motif and an open ion channel pore. ATP binding induces cleft closure of the nucleotide-binding pocket, flexing of the lower body {beta}-sheet and a radial expansion of the extracellular vestibule. The structural widening of the extracellular vestibule is directly coupled to the opening of the ion channel pore by way of an iris-like expansion of the transmembrane helices. The structural delineation of the ATP-binding site and the ion channel pore, together with the conformational changes associated with ion channel gating, will stimulate development of new pharmacological agents.

  2. Oral administration of amino acidic supplements improves protein and energy profiles in skeletal muscle of aged rats: elongation of functional performance and acceleration of mitochondrial recovery in adenosine triphosphate after exhaustive exertion.

    PubMed

    Chen Scarabelli, Carol; McCauley, Roy B; Yuan, Zhaokan; Di Rezze, Justin; Patel, David; Putt, Jeff; Raddino, Riccardo; Allebban, Zuhair; Abboud, John; Scarabelli, Gabriele M; Chilukuri, Karuna; Gardin, Julius; Saravolatz, Louis; Faggian, Giuseppe; Mazzucco, Alessandro; Scarabelli, Tiziano M

    2008-06-02

    Sarcopenia is an inevitable age-related degenerative process chiefly characterized by decreased synthesis of muscle proteins and impaired mitochondrial function, leading to progressive loss of muscle mass. Here, we sought to probe whether long-term administration of oral amino acids (AAs) can increase protein and adenosine triphosphate (ATP) content in the gastrocnemius muscle of aged rats, enhancing functional performance. To this end, 6- and 24-month-old male Fisher 344 rats were divided into 3 groups: group A (6-month-old rats) and group B (24-month-old rats) were used as adult and senescent control group, respectively, while group C (24-month-old rats) was used as senescent treated group and underwent 1-month oral treatment with a mixture of mainly essential AAs. Untreated senescent animals exhibited a 30% reduction in total and fractional protein content, as well as a 50% reduction in ATP content and production, compared with adult control rats (p <0.001). Long-term supplementation with mixed AAs significantly improved protein and high-energy phosphate content, as well as the rate of mitochondrial ATP production, conforming their values to those of adult control animals (p <0.001). The improved availability of protein and high-energy substrates in the gastrocnemius muscle of treated aged rats paralleled a significant enhancement in functional performance assessed by swim test, with dramatic elongation of maximal exertion times compared with untreated senescent rats (p <0.001). In line with these findings, we observed that, after 6 hours of rest following exhaustive swimming, the recovery in mitochondrial ATP content was approximately 70% in adult control rats, approximately 60% in senescent control rats, and normalized in treated rats as compared with animals of the same age unexposed to maximal exertion (p <0.001). In conclusion, nutritional supplementation with oral AAs improved protein and energy profiles in the gastrocnemius of treated rats, enhancing

  3. Identification of a MAP 2-like ATP-binding protein associated with axoplasmic vesicles that translocate on isolated microtubules

    PubMed Central

    1986-01-01

    Axoplasmic vesicles were purified and observed to translocate on isolated microtubules in an ATP-dependent, trypsin-sensitive manner, implying that ATP-binding polypeptides essential for force generation were present on the vesicle surface. To identify these proteins [alpha 32P]8-azidoadenosine 5'-triphosphate ([alpha 32P]8-N3ATP), a photoaffinity analogue of ATP, was used. The results presented here identify and characterize a vesicle-associated polypeptide having a relative molecular mass of 292 kD that bound [alpha 32P]8-N3ATP. The incorporation of label is ultraviolet light-dependent and ATP- sensitive. Moreover, the 292-kD polypeptide could be isolated in association with vesicles or microtubules, depending on the conditions used, and the data indicate that the 292-kD polypeptide is similar to mammalian brain microtubule-associated protein 2 (MAP 2) for the following reasons: The 292-kD polypeptide isolated from either squid axoplasm or optic lobe cross-reacts with antiserum to porcine brain MAP 2. Furthermore, it purifies with taxol-stabilized microtubules and is released with salt. Based on these characteristics, the 292-kD polypeptide is distinct from the known force-generating molecules myosin and flagellar dynein, as well as the 110-130-kD kinesin-like polypeptides that have recently been described (Brady, S. T., 1985, Nature (Lond.), 317:73-75; Vale, R. D., T. S. Reese, and M. P. Sheetz, 1985b, Cell, 42:39-50; Scholey, J. M., M. E. Porter, P. M. Grissom, and J. R. McIntosh, 1985, Nature (Lond.), 318:483-486). Because the 292-kD polypeptide binds ATP and is associated with vesicles that translocate on purified MAP-free microtubules in an ATP-dependent fashion, it is therefore believed to be involved in vesicle-microtubule interactions that promote organelle motility. PMID:3091608

  4. ATP-Binding Cassette Proteins: Towards a Computational View of Mechanism

    NASA Astrophysics Data System (ADS)

    Liao, Jielou

    2004-03-01

    Many large machine proteins can generate mechanical force and undergo large-scale conformational changes (LSCC) to perform varying biological tasks in living cells by utilizing ATP. Important examples include ATP-binding cassette (ABC) transporters. They are membrane proteins that couple ATP binding and hydrolysis to the translocation of substrates across membranes [1]. To interpret how the mechanical force generated by ATP binding and hydrolysis is propagated, a coarse-grained ATP-dependent harmonic network model (HNM) [2,3] is applied to the ABC protein, BtuCD. This protein machine transports vitamin B12 across membranes. The analysis shows that subunits of the protein move against each other in a concerted manner. The lowest-frequency modes of the BtuCD protein are found to link the functionally critical domains, and are suggested to be responsible for large-scale ATP-coupled conformational changes. [1] K. P. Locher, A. T. Lee and D. C. Rees. Science 296, 1091-1098 (2002). [2] Atilgan, A. R., S. R. Durell, R. L. Jernigan, M. C. Demirel, O. Keskin, and I. Bahar. Biophys. J. 80, 505-515(2002); M. M Tirion, Phys. Rev. Lett. 77, 1905-1908 (1996). [3] J. -L. Liao and D. N. Beratan, 2003, to be published.

  5. The power stroke driven by ATP binding in CFTR as studied by molecular dynamics simulations.

    PubMed

    Furukawa-Hagiya, Tomoka; Furuta, Tadaomi; Chiba, Shuntaro; Sohma, Yoshiro; Sakurai, Minoru

    2013-01-10

    Cystic fibrosis transmembrane conductance regulator (CFTR) is a chloride channel belonging to the ATP binding cassette (ABC) protein superfamily. Currently, it remains unclear how ATP binding causes the opening of the channel gate at the molecular level. To clarify this mechanism, we first constructed an atomic model of the inward-facing CFTR using the X-ray structures of other ABC proteins. Molecular dynamics (MD) simulations were then performed to explore the structure and dynamics of the inward-facing CFTR in a membrane environment. In the MgATP-bound state, two nucleotide-binding domains (NBDs) formed a head-to-tail type of dimer, in which the ATP molecules were sandwiched between the Walker A and signature motifs. Alternatively, one of the final MD structures in the apo state was similar to that of a "closed-apo" conformation found in the X-ray analysis of ATP-free MsbA. Principal component analysis for the MD trajectory indicated that NBD dimerization causes significant structural and dynamical changes in the transmembrane domains (TMDs), which is likely indicative of the formation of a chloride ion access path. This study suggests that the free energy gain from ATP binding acts as a driving force not only for NBD dimerization but also for NBD-TMD concerted motions.

  6. Kinetic mechanism of Toxoplasma gondii adenosine kinase and the highly efficient utilization of adenosine.

    PubMed

    Naguib, Fardos N M; Rais, Reem H; Al Safarjalani, Omar N; el Kouni, Mahmoud H

    2015-10-01

    Initial velocity and product inhibition studies of Toxoplasma gondii adenosine kinase (TgAK, EC 2.7.1.20) demonstrated that the basic mechanism of this enzyme is a hybrid random bi-uni ping-pong uni-bi. Initial velocity studies showed an intersecting pattern, consistent with substrate-enzyme-co-substrate complex formation and a binding pattern indicating that binding of the substrate interferes with the binding of the co-substrate and vice versa. Estimated kinetic parameters were KAdo=0.002±0.0002 mM, KATP=0.05±0.008 mM, and Vmax=920±35 μmol/min/mg protein. Ado exhibited substrate inhibition suggesting the presence of more than one binding site for Ado on the enzyme. ATP relieved substrate inhibition by Ado. Thus, Ado also binds to the ATP binding site. AMP was competitive with ATP, inferring that AMP binds to the same site as ATP. AMP, ADP and ATP were non-competitive with Ado, therefore, none of these nucleotides binds to the Ado binding site. Combining ATP with ADP was additive. Therefore, the binding of either ATP or ADP does not interfere with the binding of the other. It is concluded that for every ATP consumed, TgAK generates three new AMPs. These findings along with the fact that a wide range of nucleoside 5'-mono, di, and triphosphates could substitute for ATP as phosphate donors in this reaction may explain the efficient and central role played by TgAK in the utilization of Ado as the major source from which all other purines can be synthesized in T. gondii.

  7. Solution structure and function in trifluoroethanol of PP-50, an ATP-binding peptide from F1ATPase.

    PubMed

    Chuang, W J; Abeygunawardana, C; Gittis, A G; Pedersen, P L; Mildvan, A S

    1995-05-10

    PP-50, a synthetic peptide, based on residues 141-190 of the beta-subunit of mitochondrial F1ATPase, containing the GX4GKT consensus sequence for nucleoside triphosphate binding, binds ATP tightly (Kd = 17.5 microM) as found by fluorescence titration at pH 4.0. CD and 2D proton NMR studies at pH 4.0 revealed two beta-turns, regions of extended secondary structure, transient tertiary structure, and flexibility in the GX4GKT region (W.J. Chuang, C. Abeygunawardana, P. L. Pedersen, and A. S. Mildvan, 1992, Biochemistry 31, 7915-7921). CD titration of PP-50 with trifluoroethanol (TFE) reveals a decrease in ellipticity at 208 and 222 nm, saturating at 25% TFE. Computer analysis indicates that 25% TFE increases the helix content from 5.8 to 28.6%, decreases the beta-structure from 30.2 to 20.2% and decreases the coil content from 64 to 51.2%. Fluorescence titrations of H2ATP2- with PP-50 in 25% TFE yields a Kd of 7.3 microM, 2.4-fold tighter than in H2O, probably due to TFE increasing the activity of H2ATP2- . PP-50 completely quenches the fluorescence of H2ATP2- in 25% TFE, while in H2O the fluorescence quenching is only 62%. In H2O the binding of H2ATP2- increases the structure of PP-50 as detected by CD, but in 25% TFE no significant change in CD is found on binding either H2ATP2- or Mg2+ HATP (Kd = 14 microM). The complete proton NMR spectrum of PP-50 in 25% TFE has been assigned. The solution structure, determined by distance geometry, molecular dynamics with simulated annealing, and energy minimization, consists of a coil (residues 1-8), a strand (residues 9-12), a loop (residues 13-22) containing the GX4GKT consensus sequence (residues 16-23), an alpha-helix (residues 23-36), a turn (residues 38-41), and a coil (residues 42-50), similar to that of the corresponding region of the X-ray structure of F1ATPase (J.P. Abrahams, A.G.W. Leslie, R. Lutter, and J. E. Walker, 1994 Nature 370, 621-628) and to the structure of a homologous peptide from the ATP-binding site of

  8. Purine metabolism in adenosine deaminase deficiency.

    PubMed Central

    Mills, G C; Schmalstieg, F C; Trimmer, K B; Goldman, A S; Goldblum, R M

    1976-01-01

    Purine and pyrimidine metabolites were measured in erythrocytes, plasma, and urine of a 5-month-old infant with adenosine deaminase (adenosine aminohydrolase, EC 3.5.4.4) deficiency. Adenosine and adenine were measured using newly devised ion exchange separation techniques and a sensitive fluorescence assay. Plasma adenosine levels were increased, whereas adenosine was normal in erythrocytes and not detectable in urine. Increased amounts of adenine were found in erythrocytes and urine as well as in the plasma. Erythrocyte adenosine 5'-monophosphate and adenosine diphosphate concentrations were normal, but adenosine triphosphate content was greatly elevated. Because of the possibility of pyrimidine starvation, pyrimidine nucleotides (pyrimidine coenzymes) in erythrocytes and orotic acid in urine were measured. Pyrimidine nucleotide concentrations were normal, while orotic acid was not detected. These studies suggest that the immune deficiency associated with adenosine deaminase deficiency may be related to increased amounts of adenine, adenosine, or adenine nucleotides. PMID:1066699

  9. Structural and Enzymatic Insights into the ATP Binding and Autophosphorylation Mechanism of a Sensor Histidine Kinase*

    PubMed Central

    Trajtenberg, Felipe; Graña, Martin; Ruétalo, Natalia; Botti, Horacio; Buschiazzo, Alejandro

    2010-01-01

    DesK is a sensor histidine kinase (HK) that allows Bacillus subtilis to respond to cold shock, triggering the adaptation of membrane fluidity via transcriptional control of a fatty acid desaturase. It belongs to the HK family HPK7, which includes the nitrogen metabolism regulators NarX/Q and the antibiotic sensor LiaS among other important sensor kinases. Structural information on different HK families is still scarce and several questions remain, particularly concerning the molecular features that determine HK specificity during its catalytic autophosphorylation and subsequent response-regulator phosphotransfer reactions. To analyze the ATP-binding features of HPK7 HKs and dissect their mechanism of autophosphorylation at the molecular level, we have studied DesK in complex with ATP using high resolution structural approaches in combination with biochemical studies. We report the first crystal structure of an HK in complex with its natural nucleotidic substrate. The general fold of the ATP-binding domain of DesK is conserved, compared with well studied members of other families. Yet, DesK displays a far more compact structure at the ATP-binding pocket: the ATP lid loop is much shorter with no secondary structural organization and becomes ordered upon ATP loading. Sequence conservation mapping onto the molecular surface, semi-flexible protein-protein docking simulations, and structure-based point mutagenesis allow us to propose a specific domain-domain geometry during autophosphorylation catalysis. Supporting our hypotheses, we have been able to trap an autophosphorylating intermediate state, by protein engineering at the predicted domain-domain interaction surface. PMID:20507988

  10. Cystic fibrosis transmembrane conductance regulator: a chloride channel gated by ATP binding and hydrolysis.

    PubMed

    Bompadre, Silvia G; Hwang, Tzyh-Chang

    2007-08-25

    The cystic fibrosis transmembrane conductance regulator (CFTR) is a chloride channel that belongs to the ATP-binding cassette (ABC) transporter superfamily. Defective function of CFTR is responsible for cystic fibrosis (CF), the most common lethal autosomal recessive disorder in Caucasian populations. The disease is manifested in defective chloride transport across the epithelial cells in various tissues. To date, more than 1400 different mutations have been identified as CF-associated. CFTR is regulated by phosphorylation in its regulatory (R) domain, and gated by ATP binding and hydrolysis at its two nucleotide-binding domains (NBD1 and NBD2). Recent studies reveal that the NBDs of CFTR may dimerize as observed in other ABC proteins. Upon dimerization of CFTR's two NBDs, in a head-to-tail configuration, the two ATP-binding pockets (ABP1 and ABP2) are formed by the canonical Walker A and B motifs from one NBD and the signature sequence from the partner NBD. Mutations of the amino acids that interact with ATP reveal that the two ABPs play distinct roles in controlling ATP-dependent gating of CFTR. It was proposed that binding of ATP to the ABP2, which is formed by the Walker A and B in NBD2 and the signature sequence in NBD1, is critical for catalyzing channel opening. While binding of ATP to the ABP1 alone may not increase the opening rate, it does contribute to the stabilization of the open channel conformation. Several disease-associated mutations of the CFTR channel are characterized by gating defects. Understanding how CFTR's two NBDs work together to gate the channel could provide considerable mechanistic information for future pharmacological studies, which could pave the way for tailored drug design for therapeutical interventions in CF.

  11. Functionally Important ATP Binding and Hydrolysis Sites in Escherichia coli MsbA †

    PubMed Central

    Westfahl, Kathryn M.; Merten, Jacqueline A.; Buchaklian, Adam H.; Klug, Candice S.

    2009-01-01

    ATP-binding cassette (ABC) transporters make up one of the largest classes of proteins found in nature, and their ability to move a variety of substrates across the membrane using energy from the binding or hydrolysis of ATP is essential to an array of human pathologies and to bacterial viability. MsbA is an essential ABC transporter that specifically transports lipid A across the inner membranes of Gram-negative organisms such as Escherichia coli. The exact mechanisms of function during the binding and hydrolysis of ATP at the molecular level remain unclear. The studies presented and summarized in this work directly address the role and local dynamics of specific residues within the conserved ABC motifs in E. coli MsbA using in vivo growth and biochemical activity assays coupled with site-directed spin labeling electron paramagnetic resonance (EPR) spectroscopy motional and accessibility analysis. This first comprehensive analysis of the specific residues in these motifs within MsbA indicates that closure of the dimer interface does not occur upon ATP binding in this transporter. PMID:19053284

  12. The Lipid Bilayer Modulates the Structure and Function of an ATP-binding Cassette Exporter.

    PubMed

    Zoghbi, Maria E; Cooper, Rebecca S; Altenberg, Guillermo A

    2016-02-26

    ATP-binding cassette exporters use the energy of ATP hydrolysis to transport substrates across membranes by switching between inward- and outward-facing conformations. Essentially all structural studies of these proteins have been performed with the proteins in detergent micelles, locked in specific conformations and/or at low temperature. Here, we used luminescence resonance energy transfer spectroscopy to study the prototypical ATP-binding cassette exporter MsbA reconstituted in nanodiscs at 37 °C while it performs ATP hydrolysis. We found major differences when comparing MsbA in these native-like conditions with double electron-electron resonance data and the crystal structure of MsbA in the open inward-facing conformation. The most striking differences include a significantly smaller separation between the nucleotide-binding domains and a larger fraction of molecules with associated nucleotide-binding domains in the nucleotide-free apo state. These studies stress the importance of studying membrane proteins in an environment that approaches physiological conditions.

  13. Formation of a Chloride-conducting State in the Maltose ATP-binding Cassette (ABC) Transporter.

    PubMed

    Carlson, Michael L; Bao, Huan; Duong, Franck

    2016-06-03

    ATP-binding cassette transporters use an alternating access mechanism to move substrates across cellular membranes. This mode of transport ensures the selective passage of molecules while preserving membrane impermeability. The crystal structures of MalFGK2, inward- and outward-facing, show that the transporter is sealed against ions and small molecules. It has yet to be determined whether membrane impermeability is maintained when MalFGK2 cycles between these two conformations. Through the use of a mutant that resides in intermediate conformations close to the transition state, we demonstrate that not only is chloride conductance occurring, but also to a degree large enough to compromise cell viability. Introduction of mutations in the periplasmic gate lead to the formation of a channel that is quasi-permanently open. MalFGK2 must therefore stay away from these ion-conducting conformations to preserve the membrane barrier; otherwise, a few mutations that increase access to the ion-conducting states are enough to convert an ATP-binding cassette transporter into a channel.

  14. The nodulin vfENOD18 is an ATP-binding protein in infected cells of Vicia faba L. nodules.

    PubMed

    Becker, J D; Moreira, L M; Kapp, D; Frosch, S C; Pühler, A; Perlic, A M

    2001-12-01

    Recently we described the novel nodulin gene VfENOD18, whose corresponding transcripts were restricted to the nitrogen-fixing zone III of broad bean root nodules. To characterize VfENOD18 on the protein level, polyclonal antibodies were generated using the purified recombinant VfENOD18 protein produced in Escherichia coli by employing the pMAL-c expression system. These antibodies recognized immunoreactive proteins isolated from indeterminate nodules of different leguminous plants, but also from non-symbiotic tissues of Glycine max and from tissues of Arabidopsis thaliana and Zea mays. Using immunogold labelling the nodulin VfENOD18 was localized to the cytoplasm of infected cells in the nitrogen-fixing zone of broad bean nodules. Due to the homology of the VfENOD18 sequence to that of the ATP-binding protein MJ0577 from the hyperthermophile Methanococcus jannaschii the recombinant VfENOD18 protein was tested for ATP-binding. Using the biotin photoaffinity ATP analogue 8N3ATP[gamma]biotin it could be demonstrated that VfENOD18 is an ATP-binding protein. PCR experiments revealed that the amino acid sequences of the putative C-terminal ATP-binding sites of the VfENOD 18 homologues from Lens culinaris, Vicia hirsuta, Vicia sativa and Vicia villosa were conserved. We propose that VfENOD18 is a member of a novel family of ATP-binding proteins in plants.

  15. Transport in technicolor: Mapping ATP-binding cassette transporters in sea urchin embryos

    PubMed Central

    Gökirmak, Tufan; Shipp, Lauren E.; Campanale, Joseph P.; Nicklisch, Sascha C.T.; Hamdoun, Amro

    2014-01-01

    One quarter of eukaryotic genes encode membrane proteins. These include nearly 1000 transporters that translocate nutrients, signaling molecules, and xenobiotics across membranes. While it is well appreciated that membrane transport is critical for development, the specific roles of many transporters have remained cryptic, in part because of their abundance and the diversity of their substrates. Multi-drug resistance ATP-binding cassette (ABC) efflux transporters are one example of cryptic membrane proteins. Although most organisms utilize these ABC transporters during embryonic development, many of these transporters have broad substrate specificity, and their developmental functions remain incompletely understood. Here, we review advances in our understanding of ABC transporters in sea urchin embryos, and methods developed to spatially and temporally map these proteins. These studies reveal that multifunctional transporters are required for signaling, homeostasis, and protection of the embryo, and shed light on how they are integrated into ancestral developmental pathways recapitulated in disease. PMID:25156004

  16. ATP-binding cassette transporters in tumor endothelial cells and resistance to metronomic chemotherapy.

    PubMed

    Hida, Kyoko; Kikuchi, Hiroshi; Maishi, Nako; Hida, Yasuhiro

    2017-02-16

    Drug resistance is a major problem in anticancer therapy. ATP-binding cassette (ABC) transporters have a role in the multidrug resistance. A new regimen of chemotherapy has been proposed, called "metronomic chemotherapy". Metronomic chemotherapy is the frequent, regular administration of drug doses designed to maintain low, but active, concentrations of chemotherapeutic drugs over prolonged periods of time, without causing serious toxicities. Metronomic chemotherapy regimens were developed to optimize the antitumor efficacy of agents that target the tumor vasculature instead of tumor cells, and to reduce toxicity of antineoplastic drugs [1]. Nevertheless, recent studies revealed that ABC transporters are expressed at a higher level in the endothelium in the tumor. To avoid resistance to metronomic anti-angiogenic chemotherapy, ABC transporter inhibition of tumor endothelial cells may be a promising strategy. In this mini-review, we discuss the possible mechanism of resistance to metronomic chemotherapy from the viewpoint of tumor endothelial cell biology, focusing on ABC transporters.

  17. Protection against chemotherapy-induced alopecia: targeting ATP-binding cassette transporters in the hair follicle?

    PubMed

    Haslam, Iain S; Pitre, Aaron; Schuetz, John D; Paus, Ralf

    2013-11-01

    Currently, efficacious treatments for chemotherapy-induced alopecia (hair loss) are lacking, and incidences of permanent hair loss following high-dose chemotherapy are on the increase. In this article, we describe mechanisms by which the pharmacological defense status of the hair follicle might be enhanced, thereby reducing the accumulation of cytotoxic cancer drugs and preventing or reducing hair loss and damage. We believe this could be achieved via the selective increase in ATP-binding cassette (ABC) transporter expression within the hair follicle epithelium, following application of topical agonists for regulatory nuclear receptors. Clinical application would require the development of hair follicle-targeted formulations, potentially utilizing nanoparticle technology. This novel approach has the potential to yield entirely new therapeutic options for the treatment and management of chemotherapy-induced alopecia, providing significant psychological and physical benefit to cancer patients.

  18. The ATP binding cassette transporter, ABCG1, localizes to cortical actin filaments

    PubMed Central

    Pandzic, Elvis; Gelissen, Ingrid C.; Whan, Renee; Barter, Philip J.; Sviridov, Dmitri; Gaus, Katharina; Rye, Kerry-Anne; Cochran, Blake J.

    2017-01-01

    The ATP-binding cassette sub-family G member 1 (ABCG1) exports cellular cholesterol to high-density lipoproteins (HDL). However, a number of recent studies have suggested ABCG1 is predominantly localised to intracellular membranes. In this study, we found that ABCG1 was organized into two distinct cellular pools: one at the plasma membrane and the other associated with the endoplasmic reticulum (ER). The plasma membrane fraction was organized into filamentous structures that were associated with cortical actin filaments. Inhibition of actin polymerization resulted in complete disruption of ABCG1 filaments. Cholesterol loading of the cells increased the formation of the filamentous ABCG1, the proximity of filamentous ABCG1 to actin filaments and the diffusion rate of membrane associated ABCG1. Our findings suggest that the actin cytoskeleton plays a critical role in the plasma membrane localization of ABCG1. PMID:28165022

  19. Structural Features of the ATP-Binding Cassette (ABC) Transporter ABCA3

    PubMed Central

    Paolini, Alessandro; Baldassarre, Antonella; Del Gaudio, Ilaria; Masotti, Andrea

    2015-01-01

    In this review we reported and discussed the structural features of the ATP-Binding Cassette (ABC) transporter ABCA3 and how the use of bioinformatics tools could help researchers to obtain a reliable structural model of this important transporter. In fact, a model of ABCA3 is still lacking and no crystallographic structures (of the transporter or of its orthologues) are available. With the advent of next generation sequencing, many disease-causing mutations have been discovered and many more will be found in the future. In the last few years, ABCA3 mutations have been reported to have important pediatric implications. Thus, clinicians need a reliable structure to locate relevant mutations of this transporter and make genotype/phenotype correlations of patients affected by ABCA3-related diseases. In conclusion, we strongly believe that the model preliminarily generated by these novel bioinformatics tools could be the starting point to obtain more refined models of the ABCA3 transporter. PMID:26295388

  20. Microarray study of single nucleotide polymorphisms and expression of ATP-binding cassette genes in breast tumors

    NASA Astrophysics Data System (ADS)

    Tsyganov, M. M.; Ibragimova, M. K.; Karabut, I. V.; Freydin, M. B.; Choinzonov, E. L.; Litvyakov, N. V.

    2015-11-01

    Our previous research establishes that changes of expression of the ATP-binding cassette genes family is connected with the neoadjuvant chemotherapy effect. However, the mechanism of regulation of resistance gene expression remains unclear. As many researchers believe, single nucleotide polymorphisms can be involved in this process. Thereupon, microarray analysis is used to study polymorphisms in ATP-binding cassette genes. It is thus found that MDR gene expression is connected with 5 polymorphisms, i.e. rs241432, rs241429, rs241430, rs3784867, rs59409230, which participate in the regulation of expression of own genes.

  1. Structure-Function Analysis of Peroxisomal ATP-binding Cassette Transporters Using Chimeric Dimers*

    PubMed Central

    Geillon, Flore; Gondcaille, Catherine; Charbonnier, Soëli; Van Roermund, Carlo W.; Lopez, Tatiana E.; Dias, Alexandre M. M.; Pais de Barros, Jean-Paul; Arnould, Christine; Wanders, Ronald J.; Trompier, Doriane; Savary, Stéphane

    2014-01-01

    ABCD1 and ABCD2 are two closely related ATP-binding cassette half-transporters predicted to homodimerize and form peroxisomal importers for fatty acyl-CoAs. Available evidence has shown that ABCD1 and ABCD2 display a distinct but overlapping substrate specificity, although much remains to be learned in this respect as well as in their capability to form functional heterodimers. Using a cell model expressing an ABCD2-EGFP fusion protein, we first demonstrated by proximity ligation assay and co-immunoprecipitation assay that ABCD1 interacts with ABCD2. Next, we tested in the pxa1/pxa2Δ yeast mutant the functionality of ABCD1/ABCD2 dimers by expressing chimeric proteins mimicking homo- or heterodimers. For further structure-function analysis of ABCD1/ABCD2 dimers, we expressed chimeric dimers fused to enhanced GFP in human skin fibroblasts of X-linked adrenoleukodystrophy patients. These cells are devoid of ABCD1 and accumulate very long-chain fatty acids (C26:0 and C26:1). We checked that the chimeric proteins were correctly expressed and targeted to the peroxisomes. Very long-chain fatty acid levels were partially restored in transfected X-linked adrenoleukodystrophy fibroblasts regardless of the chimeric construct used, thus demonstrating functionality of both homo- and heterodimers. Interestingly, the level of C24:6 n-3, the immediate precursor of docosahexaenoic acid, was decreased in cells expressing chimeric proteins containing at least one ABCD2 moiety. Our data demonstrate for the first time that both homo- and heterodimers of ABCD1 and ABCD2 are functionally active. Interestingly, the role of ABCD2 (in homo- and heterodimeric forms) in the metabolism of polyunsaturated fatty acids is clearly evidenced, and the chimeric dimers provide a novel tool to study substrate specificity of peroxisomal ATP-binding cassette transporters. PMID:25043761

  2. Human erythrocyte dematin and protein 4.2 (pallidin) are ATP binding proteins.

    PubMed

    Azim, A C; Marfatia, S M; Korsgren, C; Dotimas, E; Cohen, C M; Chishti, A H

    1996-03-05

    Dematin and protein 4.2 are peripheral membrane proteins associated with the cytoplasmic surface of the human erythrocyte plasma membrane. Isoforms of dematin and protein 4.2 exist in many nonerythroid cells. In solution, dematin is a trimeric protein containing two subunits of 48 kDa and one subunit of 52 kDa. Recent determination of the primary structure of the 52 kDa subunit of dematin showed that it contains an additional 22-amino acid sequence in the headpiece domain. An alignment of the 22-amino acid insertion sequence revealed that the 52 kDa subunit of dematin shares a novel 11-amino acid motif with protein 4.2. In this communication, we report that the conserved 11-amino acid motif in dematin52 and protein 4.2 contains a nucleotide binding P-loop. Direct binding of ATP is demonstrated to the glutathione S-transferase fusion proteins containing corresponding segments of dematin52 and protein 4.2 as well as to purified protein 4.2. The binding of ATP to the recombinant domains of dematin52 and protein 4.2 is specific, saturable, and of high affinity. The nucleotide specificity of the P-loop is restricted to ATP since no detectable binding was observed with GTP. These results show that the 11-amino acid motif provides an ATP binding site in dematin52 and protein 4.2. Although the functional significance of ATP binding is not yet clear, our findings open new perspectives for the function of dematin and protein 4.2 in vivo.

  3. Complexed Structures of Formylglycinamide Ribonucleotide Amidotransferase from Thermotoga maritima Describe a Novel ATP Binding Protein Superfamily

    SciTech Connect

    Morar, Mariya; Anand, Ruchi; Hoskins, Aaron A.; Stubbe, JoAnne; Ealick, Steven E.

    2008-09-11

    Formylglycinamide ribonucleotide amidotransferase (FGAR-AT) catalyzes the ATP-dependent synthesis of formylglycinamidine ribonucleotide (FGAM) from formylglycinamide ribonucleotide (FGAR) and glutamine in the fourth step of the purine biosynthetic pathway. FGAR-AT is encoded by the purL gene. Two types of PurL have been detected. The first type, found in eukaryotes and Gram-negative bacteria, consists of a single 140 kDa polypeptide chain and is designated large PurL (lgPurL). The second type, small PurL (smPurL), is found in archaea and Gram-positive bacteria and consists of an 80 kDa polypeptide chain. SmPurL requires two additional gene products, PurQ and PurS, for activity. PurL is a member of a protein superfamily that contains a novel ATP-binding domain. Structures of several members of this superfamily are available in the unliganded form. We determined five different structures of FGAR-AT from Thermotoga maritima in the presence of substrates, a substrate analogue, and a product. These complexes have allowed a detailed description of the novel ATP-binding motif. The availability of a ternary complex enabled mapping of the active site, thus identifying potential residues involved in catalysis. The complexes show a conformational change in the active site compared to the unliganded structure. Surprising discoveries, an ATP molecule in an auxiliary site of the protein and the conformational changes associated with its binding, provoke speculation about the regulatory role of the auxiliary site in formation of the PurLSQ complex as well as the evolutionary relationship of PurLs from different organisms.

  4. ROLE OF ATP BINDING CASSETTE SUB-FAMILY MEMBER 2 (ABCG2) IN MOUSE EMBRYONIC STEM CELL DEVELOPMENT.

    EPA Science Inventory

    ATP binding cassette sub-family member 2 (ABCG2), is a member of the ABC transporter superfamily and a principal xenobiotic transporter. ABCG2 is also highly expressed in certain stem cell populations where it is thought to be related to stem cell plasticity, although the role o...

  5. Identification of ATP-binding regions in the RyR1 Ca²⁺ release channel.

    PubMed

    Popova, Olga B; Baker, Mariah R; Tran, Tina P; Le, Tri; Serysheva, Irina I

    2012-01-01

    ATP is an important modulator of gating in type 1 ryanodine receptor (RyR1), also known as a Ca²⁺ release channel in skeletal muscle cells. The activating effect of ATP on this channel is achieved by directly binding to one or more sites on the RyR1 protein. However, the number and location of these sites have yet to be determined. To identify the ATP-binding regions within RyR1 we used 2N₃ATP-2',3'-Biotin-LC-Hydrazone (BioATP-HDZ), a photo-reactive ATP analog to covalently label the channel. We found that BioATP-HDZ binds RyR1 specifically with an IC₅₀ = 0.6±0.2 mM, comparable with the reported EC50 for activation of RyR1 with ATP. Controlled proteolysis of labeled RyR1 followed by sequence analysis revealed three fragments with apparent molecular masses of 95, 45 and 70 kDa that were crosslinked by BioATP-HDZ and identified as RyR1 sequences. Our analysis identified four glycine-rich consensus motifs that can potentially constitute ATP-binding sites and are located within the N-terminal 95-kDa fragment. These putative nucleotide-binding sequences include amino acids 699-704, 701-706, 1081-1084 and 1195-1200, which are conserved among the three RyR isoforms. Located next to the N-terminal disease hotspot region in RyR1, these sequences may communicate the effects of ATP-binding to channel function by tuning conformational motions within the neighboring cytoplasmic regulatory domains. Two other labeled fragments lack ATP-binding consensus motifs and may form non-canonical ATP-binding sites. Based on domain topology in the 3D structure of RyR1 it is also conceivable that the identified ATP-binding regions, despite their wide separation in the primary sequence, may actually constitute the same non-contiguous ATP-binding pocket within the channel tetramer.

  6. Expression of ATP-Binding Cassette Transporters B1 and C1 after Severe Traumatic Brain Injury in Humans

    PubMed Central

    Willyerd, F. Anthony; Empey, Philip E.; Philbrick, Ashley; Ikonomovic, Milos D.; Puccio, Ava M.; Kochanek, Patrick M.; Okonkwo, David O.

    2016-01-01

    Abstract Adenosine triphosphate-binding cassette (ABC) transport proteins ABCC1 and ABCB1 (also known as multidrug resistance-associated protein 1 and p-glycoprotein, respectively), are key membrane efflux transporters of drugs and endogenous substrates, including in the brain. The impact of traumatic brain injury (TBI) on ABCC1 and ABCB1 expression in humans is unknown. We hypothesized that ABCC1 and ABCB1 expression would be altered in brain tissue from patients acutely after severe TBI. Archived TBI samples (n=10) from our Brain Trauma Research Center and control samples (n=7) from our Alzheimer Disease Research Center were obtained under Institutional Review Board approval. Protein was extracted from fresh frozen cortical brain tissue for Western blot analysis and sections were obtained from fixed cortical tissue for immunohistochemistry. Relative abundance of ABCC1 was increased in samples from TBI versus controls (2.8±2.5 fold; p=0.005). ABCC1 immunohistochemistry was consistent with Western blot data, with increased immunoreactivity in cerebral blood vessel walls, as well as cells with the morphological appearance of neurons and glia in TBI versus controls. Relative abundance of ABCB1 was similar between TBI and controls (p=0.76), and ABCB1 immunoreactivity was primarily associated with cerebral blood vessels in both groups. These human data show that TBI increases ABCC1 expression in the brain, consistent with possible implications for both patients receiving pharmacological inhibitors and/or substrates of ABCC1 after TBI. PMID:25891836

  7. Agrobacterium rhizogenes GALLS Protein Contains Domains for ATP Binding, Nuclear Localization, and Type IV Secretion▿

    PubMed Central

    Hodges, Larry D.; Vergunst, Annette C.; Neal-McKinney, Jason; den Dulk-Ras, Amke; Moyer, Deborah M.; Hooykaas, Paul J. J.; Ream, Walt

    2006-01-01

    Agrobacterium tumefaciens and Agrobacterium rhizogenes are closely related plant pathogens that cause different diseases, crown gall and hairy root. Both diseases result from transfer, integration, and expression of plasmid-encoded bacterial genes located on the transferred DNA (T-DNA) in the plant genome. Bacterial virulence (Vir) proteins necessary for infection are also translocated into plant cells. Transfer of single-stranded DNA (ssDNA) and Vir proteins requires a type IV secretion system, a protein complex spanning the bacterial envelope. A. tumefaciens translocates the ssDNA-binding protein VirE2 into plant cells, where it binds single-stranded T-DNA and helps target it to the nucleus. Although some strains of A. rhizogenes lack VirE2, they are pathogenic and transfer T-DNA efficiently. Instead, these bacteria express the GALLS protein, which is essential for their virulence. The GALLS protein can complement an A. tumefaciens virE2 mutant for tumor formation, indicating that GALLS can substitute for VirE2. Unlike VirE2, GALLS contains ATP-binding and helicase motifs similar to those in TraA, a strand transferase involved in conjugation. Both GALLS and VirE2 contain nuclear localization sequences and a C-terminal type IV secretion signal. Here we show that mutations in any of these domains abolished the ability of GALLS to substitute for VirE2. PMID:17012398

  8. Functional analysis of the ATP-binding cassette (ABC) transporter gene family of Tribolium castaneum

    PubMed Central

    2013-01-01

    Background The ATP-binding cassette (ABC) transporters belong to a large superfamily of proteins that have important physiological functions in all living organisms. Most are integral membrane proteins that transport a broad spectrum of substrates across lipid membranes. In insects, ABC transporters are of special interest because of their role in insecticide resistance. Results We have identified 73 ABC transporter genes in the genome of T. castaneum, which group into eight subfamilies (ABCA-H). This coleopteran ABC family is significantly larger than those reported for insects in other taxonomic groups. Phylogenetic analysis revealed that this increase is due to gene expansion within a single clade of subfamily ABCC. We performed an RNA interference (RNAi) screen to study the function of ABC transporters during development. In ten cases, injection of double-stranded RNA (dsRNA) into larvae caused developmental phenotypes, which included growth arrest and localized melanization, eye pigmentation defects, abnormal cuticle formation, egg-laying and egg-hatching defects, and mortality due to abortive molting and desiccation. Some of the ABC transporters we studied in closer detail to examine their role in lipid, ecdysteroid and eye pigment transport. Conclusions The results from our study provide new insights into the physiological function of ABC transporters in T. castaneum, and may help to establish new target sites for insect control. PMID:23324493

  9. Biophysical Approaches Facilitate Computational Drug Discovery for ATP-Binding Cassette Proteins

    PubMed Central

    Molinski, Steven V.; Bozóky, Zoltán; Iram, Surtaj H.

    2017-01-01

    Although membrane proteins represent most therapeutically relevant drug targets, the availability of atomic resolution structures for this class of proteins has been limited. Structural characterization has been hampered by the biophysical nature of these polytopic transporters, receptors, and channels, and recent innovations to in vitro techniques aim to mitigate these challenges. One such class of membrane proteins, the ATP-binding cassette (ABC) superfamily, are broadly expressed throughout the human body, required for normal physiology and disease-causing when mutated, yet lacks sufficient structural representation in the Protein Data Bank. However, recent improvements to biophysical techniques (e.g., cryo-electron microscopy) have allowed for previously “hard-to-study” ABC proteins to be characterized at high resolution, providing insight into molecular mechanisms-of-action as well as revealing novel druggable sites for therapy design. These new advances provide ample opportunity for computational methods (e.g., virtual screening, molecular dynamics simulations, and structure-based drug design) to catalyze the discovery of novel small molecule therapeutics that can be easily translated from computer to bench and subsequently to the patient's bedside. In this review, we explore the utility of recent advances in biophysical methods coupled with well-established in silico techniques towards drug development for diseases caused by dysfunctional ABC proteins.

  10. Structure-guided Development of Specific Pyruvate Dehydrogenase Kinase Inhibitors Targeting the ATP-binding Pocket*

    PubMed Central

    Tso, Shih-Chia; Qi, Xiangbing; Gui, Wen-Jun; Wu, Cheng-Yang; Chuang, Jacinta L.; Wernstedt-Asterholm, Ingrid; Morlock, Lorraine K.; Owens, Kyle R.; Scherer, Philipp E.; Williams, Noelle S.; Tambar, Uttam K.; Wynn, R. Max; Chuang, David T.

    2014-01-01

    Pyruvate dehydrogenase kinase isoforms (PDKs 1–4) negatively regulate activity of the mitochondrial pyruvate dehydrogenase complex by reversible phosphorylation. PDK isoforms are up-regulated in obesity, diabetes, heart failure, and cancer and are potential therapeutic targets for these important human diseases. Here, we employed a structure-guided design to convert a known Hsp90 inhibitor to a series of highly specific PDK inhibitors, based on structural conservation in the ATP-binding pocket. The key step involved the substitution of a carbonyl group in the parent compound with a sulfonyl in the PDK inhibitors. The final compound of this series, 2-[(2,4-dihydroxyphenyl)sulfonyl]isoindoline-4,6-diol, designated PS10, inhibits all four PDK isoforms with IC50 = 0.8 μm for PDK2. The administration of PS10 (70 mg/kg) to diet-induced obese mice significantly augments pyruvate dehydrogenase complex activity with reduced phosphorylation in different tissues. Prolonged PS10 treatments result in improved glucose tolerance and notably lessened hepatic steatosis in the mouse model. The results support the pharmacological approach of targeting PDK to control both glucose and fat levels in obesity and type 2 diabetes. PMID:24356970

  11. Caveolin-1 and ATP binding cassette transporter A1 and G1-mediated cholesterol efflux.

    PubMed

    Wang, Faqi; Gu, Hong-mei; Zhang, Da-wei

    2014-01-01

    Atherosclerosis is one major cause of cardiovascular diseases, the leading cause of death in industrialized countries. Reverse cholesterol transport (RCT) is thought to be one primary pathway to protect against atherosclerosis. The first and rate-limiting step of RCT is ATP-binding cassette transport A1 (ABCA1) and ABCG1-mediated cholesterol efflux from the cells. Recently, caveolin-1 (CAV1), a scaffolding protein that organizes and concentrates certain caveolin-interacting signaling molecules and receptors within caveolae membranes, has been shown to regulate ABCA1 and ABCG1-mediated cholesterol efflux probably via interacting with them. In the present review, we summarize the current knowledge and views on the regulatory role of CAV1 on the cholesterol homeostasis with emphasis on the association of CAV1 with ABCA1 and ABCG1. We conclude that the dominance of the positive regulation by CAV1 on the ABCA1 and ABCG1-mediated cholesterol efflux is depending on the species, cell types, as well as the levels of CAV1 expression.

  12. Molecular Characterization of LjABCG1, an ATP-Binding Cassette Protein in Lotus japonicus

    PubMed Central

    Sugiyama, Akifumi; Fukuda, Shoju; Takanashi, Kojiro; Yoshioka, Miki; Yoshioka, Hirofumi; Narusaka, Yoshihiro; Narusaka, Mari; Kojima, Mikiko; Sakakibara, Hitoshi; Shitan, Nobukazu; Sato, Shusei; Tabata, Satoshi; Kawaguchi, Masayoshi; Yazaki, Kazufumi

    2015-01-01

    LjABCG1, a full-size ABCG subfamily of ATP-binding cassette proteins of a model legume, Lotus japonicus, was reported as a gene highly expressed during the early stages of nodulation, but have not been characterized in detail. In this study we showed that the induction of LjABCG1 expression was remarkable by methyl jasmonate treatment, and reporter gene experiments indicated that LjABCG1 was strongly expressed in the nodule parenchyma and cell layers adjacent to the root vascular tissue toward the nodule. LjABCG1 was suggested to be localized at the plasma membrane based on the fractionation of microsomal membranes as well as separation via aqueous two-phase partitioning. The physiological functions of LjABCG1 in symbiosis and pathogenesis were analyzed in homologous and heterologous systems. LjABCG1 knock-down L. japonicus plants did not show clear phenotypic differences in nodule formation, and not in defense against Pseudomonas syringae, either. In contrast, when LjABCG1 was expressed in the Arabidopsis pdr8-1 mutant, the penetration frequency of Phytophthora infestans, a potato late blight pathogen, was significantly reduced in LjABCG1/pdr8-1 than in pdr8-1 plants. This finding indicated that LjABCG1, at least partially, complemented the phenotype of pdr8 in Arabidopsis, suggesting the multiple roles of this protein in plant-microbe interactions. PMID:26418593

  13. A Plant Plasma Membrane ATP Binding Cassette–Type Transporter Is Involved in Antifungal Terpenoid Secretion

    PubMed Central

    Jasiński, Michal; Stukkens, Yvan; Degand, Hervé; Purnelle, Bénédicte; Marchand-Brynaert, Jacqueline; Boutry, Marc

    2001-01-01

    ATP binding cassette (ABC) transporters, which are found in all species, are known mainly for their ability to confer drug resistance. To date, most of the ABC transporters characterized in plants have been localized in the vacuolar membrane and are considered to be involved in the intracellular sequestration of cytotoxins. Working on the assumption that certain ABC transporters might be involved in defense metabolite secretion and their expression might be regulated by the concentration of these metabolites, we treated a Nicotiana plumbaginifolia cell culture with sclareolide, a close analog of sclareol, an antifungal diterpene produced at the leaf surface of Nicotiana spp; this resulted in the appearance of a 160-kD plasma membrane protein, which was partially sequenced. The corresponding cDNA (NpABC1) was cloned and shown to encode an ABC transporter. In vitro and in situ immunodetection showed NpABC1 to be localized in the plasma membrane. Under normal conditions, expression was found in the leaf epidermis. In cell culture and in leaf tissues, NpABC1 expression was strongly enhanced by sclareolide and sclareol. In parallel with NpABC1 induction, cells acquired the ability to excrete a labeled synthetic sclareolide derivative. These data suggest that NpABC1 is involved in the secretion of a secondary metabolite that plays a role in plant defense. PMID:11340184

  14. ATP binding by NLRP7 is required for inflammasome activation in response to bacterial lipopeptides.

    PubMed

    Radian, Alexander D; Khare, Sonal; Chu, Lan H; Dorfleutner, Andrea; Stehlik, Christian

    2015-10-01

    Nucleotide-binding oligimerization domain (NOD)-like receptors (NLRs) are pattern recognition receptors (PRRs) involved in innate immune responses. NLRs encode a central nucleotide-binding domain (NBD) consisting of the NAIP, CIITA, HET-E and TP1 (NACHT) domain and the NACHT associated domain (NAD), which facilitates receptor oligomerization and downstream inflammasome signaling. The NBD contains highly conserved regions, known as Walker motifs, that are required for nucleotide binding and hydrolysis. The NLR containing a PYRIN domain (PYD) 7 (NLRP7) has been recently shown to assemble an ASC and caspase-1-containing high molecular weight inflammasome complex in response to microbial acylated lipopeptides and Staphylococcus aureus infection. However, the molecular mechanism responsible for NLRP7 inflammasome activation is still elusive. Here we demonstrate that the NBD of NLRP7 is an ATP binding domain and has ATPase activity. We further show that an intact nucleotide-binding Walker A motif is required for NBD-mediated nucleotide binding and hydrolysis, oligomerization, and NLRP7 inflammasome formation and activity. Accordingly, THP-1 cells expressing a mutated Walker A motif display defective NLRP7 inflammasome activation, interleukin (IL)-1β release and pyroptosis in response to acylated lipopeptides and S. aureus infection. Taken together, our results provide novel insights into the mechanism of NLRP7 inflammasome assembly.

  15. A conserved mitochondrial ATP-binding cassette transporter exports glutathione polysulfide for cytosolic metal cofactor assembly.

    PubMed

    Schaedler, Theresia A; Thornton, Jeremy D; Kruse, Inga; Schwarzländer, Markus; Meyer, Andreas J; van Veen, Hendrik W; Balk, Janneke

    2014-08-22

    An ATP-binding cassette transporter located in the inner mitochondrial membrane is involved in iron-sulfur cluster and molybdenum cofactor assembly in the cytosol, but the transported substrate is unknown. ATM3 (ABCB25) from Arabidopsis thaliana and its functional orthologue Atm1 from Saccharomyces cerevisiae were expressed in Lactococcus lactis and studied in inside-out membrane vesicles and in purified form. Both proteins selectively transported glutathione disulfide (GSSG) but not reduced glutathione in agreement with a 3-fold stimulation of ATPase activity by GSSG. By contrast, Fe(2+) alone or in combination with glutathione did not stimulate ATPase activity. Arabidopsis atm3 mutants were hypersensitive to an inhibitor of glutathione biosynthesis and accumulated GSSG in the mitochondria. The growth phenotype of atm3-1 was strongly enhanced by depletion of the mitochondrion-localized, GSH-dependent persulfide oxygenase ETHE1, suggesting that the physiological substrate of ATM3 contains persulfide in addition to glutathione. Consistent with this idea, a transportomics approach using mass spectrometry showed that glutathione trisulfide (GS-S-SG) was transported by Atm1. We propose that mitochondria export glutathione polysulfide, containing glutathione and persulfide, for iron-sulfur cluster assembly in the cytosol.

  16. The role of ATP binding cassette transporters in tissue defense and organ regeneration.

    PubMed

    Huls, Miriam; Russel, Frans G M; Masereeuw, Rosalinde

    2009-01-01

    ATP binding cassette (ABC) transporters are ATP-dependent membrane proteins predominantly expressed in excretory organs, such as the liver, intestine, blood-brain barrier, blood-testes barrier, placenta, and kidney. Here, they play an important role in the absorption, distribution, and excretion of drugs, xenobiotics, and endogenous compounds. In addition, the ABC transporters, P-glycoprotein (P-gp/ABCB1) and breast cancer resistance protein (BCRP/ABCG2), are highly expressed in a population of primitive stem cells: the side population (SP). SP cells were originally discovered in bone marrow by their capacity to exclude rhodamine 123 and Hoechst dye 33342; however, extensive research also revealed their presence in other nonhematopoietic tissues. The expression levels of BCRP and P-gp are tightly controlled and may determine the differentiation of SP cells toward other more specialized cell types. Although their exact function in these cells is still not clear, they may protect the cells by pumping out toxicants and harmful products of oxidative stress. Transplantation studies in animals revealed that bone marrow-derived SP cells contribute to organ repopulation and tissue repair after damage, e.g., in liver and heart. The role of SP cells in regeneration of damaged kidney segments is not yet clarified. This review focuses on the role of ABC transporters in tissue defense and regeneration, with specific attention to P-gp and BCRP in organ regeneration and repair.

  17. Three-Dimensional Structures Reveal Multiple ADP/ATP Binding Modes

    SciTech Connect

    C Simmons; C Magee; D Smith; L Lauman; J Chaput; J Allen

    2011-12-31

    The creation of synthetic enzymes with predefined functions represents a major challenge in future synthetic biology applications. Here, we describe six structures of de novo proteins that have been determined using protein crystallography to address how simple enzymes perform catalysis. Three structures are of a protein, DX, selected for its stability and ability to tightly bind ATP. Despite the addition of ATP to the crystallization conditions, the presence of a bound but distorted ATP was found only under excess ATP conditions, with ADP being present under equimolar conditions or when crystallized for a prolonged period of time. A bound ADP cofactor was evident when Asp was substituted for Val at residue 65, but ATP in a linear configuration is present when Phe was substituted for Tyr at residue 43. These new structures complement previously determined structures of DX and the protein with the Phe 43 to Tyr substitution [Simmons, C. R., et al. (2009) ACS Chem. Biol. 4, 649-658] and together demonstrate the multiple ADP/ATP binding modes from which a model emerges in which the DX protein binds ATP in a configuration that represents a transitional state for the catalysis of ATP to ADP through a slow, metal-free reaction capable of multiple turnovers. This unusual observation suggests that design-free methods can be used to generate novel protein scaffolds that are tailor-made for catalysis.

  18. An ATP-binding cassette transporter is a major glycoprotein of sea urchin sperm membranes.

    PubMed

    Mengerink, Kathryn J; Vacquier, Victor D

    2002-10-25

    Sperm are terminally differentiated cells that undergo several membrane-altering events before fusion with eggs. One event, the sea urchin sperm acrosome reaction (AR), is blocked by the lectin wheat germ agglutinin (WGA). In an effort to identify proteins involved in the AR induction, the peptide sequence was obtained from a 220-kDa WGA-binding protein. Degenerate PCR and library screening resulted in the full-length deduced amino acid sequence of an ATP-binding cassette transporter, suABCA. The protein of 1,764 residues has two transmembrane regions, two nucleotide-binding domains, and is most closely related to the human ABC subfamily A member 3 transporter (ABCA3). Sequence analysis suggests a large extracellular loop between transmembrane spanning segments 7 and 8, with five N-linked glycosylation sites. An antibody made to the loop region binds to non-permeabilized cells, supporting that this region is extracellular. suABCA is found in sperm membrane vesicles, it can be solubilized with nonionic detergents, and it shifts from 220 to 200 kDa upon protein:N-glycanase F digestion. suABCA localizes to the entire surface of sperm in a punctate pattern, but is not detected in lipid rafts. Based on its relationship to subfamily A, suABCA is most likely involved in phospholipid or cholesterol transport. This is the first investigation of an ABC transporter in animal sperm.

  19. Analysis of the effect of the bovine adenosine triphosphate-binding cassette transporter G2 single nucleotide polymorphism Y581S on transcellular transport of veterinary drugs using new cell culture models.

    PubMed

    Real, R; González-Lobato, L; Baro, M F; Valbuena, S; de la Fuente, A; Prieto, J G; Alvarez, A I; Marques, M M; Merino, G

    2011-12-01

    In commercial dairy production, the risk of drug residues and environmental pollutants in milk from ruminants has become an outstanding problem. One of the main determinants of active drug secretion into milk is the ATP-binding cassette transporter G2/breast cancer resistance protein (ABCG2/BCRP). It is located in several organs associated with drug absorption, metabolism, and excretion, and its expression is highly induced during lactation in the mammary gland of ruminants, mice, and humans. As a consequence, potential contamination of milk could expose suckling infants to xenotoxins. In cows, a SNP for this protein affecting quality and quantity of milk production has been described previously (Y581S). In this study, our main purpose was to determine whether this polymorphism has an effect on transcellular transport of veterinary drugs because this could alter substrate pharmacokinetics and milk residues. We stably expressed the wild-type bovine ABCG2 and the Y581S variant in Madin-Darby canine kidney epithelial cells (MDCKII) and MEF3.8 cell lines generating cell models in which the functionality of the bovine transporter could be addressed. Functional studies confirmed the greater functional activity in mitoxantrone accumulation assays for the Y581S variant with a greater relative V(MAX) value (P = 0.040) and showed for the first time that the Y581S variant presents greater transcellular transport of the model ABCG2 substrate nitrofurantoin (P = 0.024) and of 3 veterinary antibiotics, the fluoroquinolone agents enrofloxacin (P = 0.035), danofloxacin (P = 0.001), and difloxacin (P = 0.008), identified as new substrates of the bovine ABCG2. In addition, the inhibitory effect of the macrocyclic lactone ivermectin on the activity of wild-type bovine ABCG2 and the Y581S variant was also confirmed, showing a greater inhibitory potency on the wild-type protein at all the concentrations tested (5 μM, P = 0.017; 10 μM, P = 0.001; 25 μM, P = 0.008; and 50 μM, P = 0

  20. Crystal structures of the ATP-binding and ADP-release dwells of the V1 rotary motor

    PubMed Central

    Suzuki, Kano; Mizutani, Kenji; Maruyama, Shintaro; Shimono, Kazumi; Imai, Fabiana L.; Muneyuki, Eiro; Kakinuma, Yoshimi; Ishizuka-Katsura, Yoshiko; Shirouzu, Mikako; Yokoyama, Shigeyuki; Yamato, Ichiro; Murata, Takeshi

    2016-01-01

    V1-ATPases are highly conserved ATP-driven rotary molecular motors found in various membrane systems. We recently reported the crystal structures for the Enterococcus hirae A3B3DF (V1) complex, corresponding to the catalytic dwell state waiting for ATP hydrolysis. Here we present the crystal structures for two other dwell states obtained by soaking nucleotide-free V1 crystals in ADP. In the presence of 20 μM ADP, two ADP molecules bind to two of three binding sites and cooperatively induce conformational changes of the third site to an ATP-binding mode, corresponding to the ATP-binding dwell. In the presence of 2 mM ADP, all nucleotide-binding sites are occupied by ADP to induce conformational changes corresponding to the ADP-release dwell. Based on these and previous findings, we propose a V1-ATPase rotational mechanism model. PMID:27807367

  1. Detergent-free purification of ABC (ATP-binding-cassette) transporters.

    PubMed

    Gulati, Sonali; Jamshad, Mohammed; Knowles, Timothy J; Morrison, Kerrie A; Downing, Rebecca; Cant, Natasha; Collins, Richard; Koenderink, Jan B; Ford, Robert C; Overduin, Michael; Kerr, Ian D; Dafforn, Timothy R; Rothnie, Alice J

    2014-07-15

    ABC (ATP-binding-cassette) transporters carry out many vital functions and are involved in numerous diseases, but study of the structure and function of these proteins is often hampered by their large size and membrane location. Membrane protein purification usually utilizes detergents to solubilize the protein from the membrane, effectively removing it from its native lipid environment. Subsequently, lipids have to be added back and detergent removed to reconstitute the protein into a lipid bilayer. In the present study, we present the application of a new methodology for the extraction and purification of ABC transporters without the use of detergent, instead, using a copolymer, SMA (polystyrene-co-maleic acid). SMA inserts into a bilayer and assembles into discrete particles, essentially solubilizing the membrane into small discs of bilayer encircled by a polymer, termed SMALPs (SMA lipid particles). We show that this polymer can extract several eukaryotic ABC transporters, P-glycoprotein (ABCB1), MRP1 (multidrug-resistance protein 1; ABCC1), MRP4 (ABCC4), ABCG2 and CFTR (cystic fibrosis transmembrane conductance regulator; ABCC7), from a range of different expression systems. The SMALP-encapsulated ABC transporters can be purified by affinity chromatography, and are able to bind ligands comparably with those in native membranes or detergent micelles. A greater degree of purity and enhanced stability is seen compared with detergent solubilization. The present study demonstrates that eukaryotic ABC transporters can be extracted and purified without ever being removed from their lipid bilayer environment, opening up a wide range of possibilities for the future study of their structure and function.

  2. Structure of an antibacterial peptide ATP-binding cassette transporter in a novel outward occluded state

    PubMed Central

    Choudhury, Hassanul G.; Tong, Zhen; Mathavan, Indran; Li, Yanyan; Iwata, So; Zirah, Séverine; Rebuffat, Sylvie; van Veen, Hendrik W.; Beis, Konstantinos

    2014-01-01

    Enterobacteriaceae produce antimicrobial peptides for survival under nutrient starvation. Microcin J25 (MccJ25) is an antimicrobial peptide with a unique lasso topology. It is secreted by the ATP-binding cassette (ABC) exporter McjD, which ensures self-immunity of the producing strain through efficient export of the toxic mature peptide from the cell. Here we have determined the crystal structure of McjD from Escherichia coli at 2.7-Å resolution, which is to the authors’ knowledge the first structure of an antibacterial peptide ABC transporter. Our functional and biochemical analyses demonstrate McjD-dependent immunity to MccJ25 through efflux of the peptide. McjD can directly bind MccJ25 and displays a basal ATPase activity that is stimulated by MccJ25 in both detergent solution and proteoliposomes. McjD adopts a new conformation, termed nucleotide-bound outward occluded. The new conformation defines a clear cavity; mutagenesis and ligand binding studies of the cavity have identified Phe86, Asn134, and Asn302 as important for recognition of MccJ25. Comparisons with the inward-open MsbA and outward-open Sav1866 structures show that McjD has structural similarities with both states without the intertwining of transmembrane (TM) helices. The occluded state is formed by rotation of TMs 1 and 2 toward the equivalent TMs of the opposite monomer, unlike Sav1866 where they intertwine with TMs 3–6 of the opposite monomer. Cysteine cross-linking studies on the McjD dimer in inside-out membrane vesicles of E. coli confirmed the presence of the occluded state. We therefore propose that the outward-occluded state represents a transition intermediate between the outward-open and inward-open conformation of ABC exporters. PMID:24920594

  3. Small Substrate Transport and Mechanism of a Molybdate ATP Binding Cassette Transporter in a Lipid Environment*

    PubMed Central

    Rice, Austin J.; Harrison, Alistair; Alvarez, Frances J. D.; Davidson, Amy L.; Pinkett, Heather W.

    2014-01-01

    Embedded in the plasma membrane of all bacteria, ATP binding cassette (ABC) importers facilitate the uptake of several vital nutrients and cofactors. The ABC transporter, MolBC-A, imports molybdate by passing substrate from the binding protein MolA to a membrane-spanning translocation pathway of MolB. To understand the mechanism of transport in the biological membrane as a whole, the effects of the lipid bilayer on transport needed to be addressed. Continuous wave-electron paramagnetic resonance and in vivo molybdate uptake studies were used to test the impact of the lipid environment on the mechanism and function of MolBC-A. Working with the bacterium Haemophilus influenzae, we found that MolBC-A functions as a low affinity molybdate transporter in its native environment. In periods of high extracellular molybdate concentration, H. influenzae makes use of parallel molybdate transport systems (MolBC-A and ModBC-A) to take up a greater amount of molybdate than a strain with ModBC-A alone. In addition, the movement of the translocation pathway in response to nucleotide binding and hydrolysis in a lipid environment is conserved when compared with in-detergent analysis. However, electron paramagnetic resonance spectroscopy indicates that a lipid environment restricts the flexibility of the MolBC translocation pathway. By combining continuous wave-electron paramagnetic resonance spectroscopy and substrate uptake studies, we reveal details of molybdate transport and the logistics of uptake systems that employ multiple transporters for the same substrate, offering insight into the mechanisms of nutrient uptake in bacteria. PMID:24722984

  4. ATP Binding Cassette Transporter Mediates Both Heme and Pesticide Detoxification in Tick Midgut Cells

    PubMed Central

    Lara, Flavio Alves; Pohl, Paula C.; Gandara, Ana Caroline; Ferreira, Jessica da Silva; Nascimento-Silva, Maria Clara; Bechara, Gervásio Henrique; Sorgine, Marcos H. F.; Almeida, Igor C.; Vaz, Itabajara da Silva; Oliveira, Pedro L.

    2015-01-01

    In ticks, the digestion of blood occurs intracellularly and proteolytic digestion of hemoglobin takes place in a dedicated type of lysosome, the digest vesicle, followed by transfer of the heme moiety of hemoglobin to a specialized organelle that accumulates large heme aggregates, called hemosomes. In the present work, we studied the uptake of fluorescent metalloporphyrins, used as heme analogs, and amitraz, one of the most regularly used acaricides to control cattle tick infestations, by Rhipicephalus (Boophilus) microplus midgut cells. Both compounds were taken up by midgut cells in vitro and accumulated inside the hemosomes. Transport of both molecules was sensitive to cyclosporine A (CsA), a well-known inhibitor of ATP binding cassette (ABC) transporters. Rhodamine 123, a fluorescent probe that is also a recognized ABC substrate, was similarly directed to the hemosome in a CsA-sensitive manner. Using an antibody against conserved domain of PgP-1-type ABC transporter, we were able to immunolocalize PgP-1 in the digest vesicle membranes. Comparison between two R. microplus strains that were resistant and susceptible to amitraz revealed that the resistant strain detoxified both amitraz and Sn-Pp IX more efficiently than the susceptible strain, a process that was also sensitive to CsA. A transcript containing an ABC transporter signature exhibited 2.5-fold increased expression in the amitraz-resistant strain when compared with the susceptible strain. RNAi-induced down-regulation of this ABC transporter led to the accumulation of metalloporphyrin in the digestive vacuole, interrupting heme traffic to the hemosome. This evidence further confirms that this transcript codes for a heme transporter. This is the first report of heme transport in a blood-feeding organism. While the primary physiological function of the hemosome is to detoxify heme and attenuate its toxicity, we suggest that the use of this acaricide detoxification pathway by ticks may represent a new

  5. ATP Binding Cassette Transporter Mediates Both Heme and Pesticide Detoxification in Tick Midgut Cells.

    PubMed

    Lara, Flavio Alves; Pohl, Paula C; Gandara, Ana Caroline; Ferreira, Jessica da Silva; Nascimento-Silva, Maria Clara; Bechara, Gervásio Henrique; Sorgine, Marcos H F; Almeida, Igor C; Vaz, Itabajara da Silva; Oliveira, Pedro L

    2015-01-01

    In ticks, the digestion of blood occurs intracellularly and proteolytic digestion of hemoglobin takes place in a dedicated type of lysosome, the digest vesicle, followed by transfer of the heme moiety of hemoglobin to a specialized organelle that accumulates large heme aggregates, called hemosomes. In the present work, we studied the uptake of fluorescent metalloporphyrins, used as heme analogs, and amitraz, one of the most regularly used acaricides to control cattle tick infestations, by Rhipicephalus (Boophilus) microplus midgut cells. Both compounds were taken up by midgut cells in vitro and accumulated inside the hemosomes. Transport of both molecules was sensitive to cyclosporine A (CsA), a well-known inhibitor of ATP binding cassette (ABC) transporters. Rhodamine 123, a fluorescent probe that is also a recognized ABC substrate, was similarly directed to the hemosome in a CsA-sensitive manner. Using an antibody against conserved domain of PgP-1-type ABC transporter, we were able to immunolocalize PgP-1 in the digest vesicle membranes. Comparison between two R. microplus strains that were resistant and susceptible to amitraz revealed that the resistant strain detoxified both amitraz and Sn-Pp IX more efficiently than the susceptible strain, a process that was also sensitive to CsA. A transcript containing an ABC transporter signature exhibited 2.5-fold increased expression in the amitraz-resistant strain when compared with the susceptible strain. RNAi-induced down-regulation of this ABC transporter led to the accumulation of metalloporphyrin in the digestive vacuole, interrupting heme traffic to the hemosome. This evidence further confirms that this transcript codes for a heme transporter. This is the first report of heme transport in a blood-feeding organism. While the primary physiological function of the hemosome is to detoxify heme and attenuate its toxicity, we suggest that the use of this acaricide detoxification pathway by ticks may represent a new

  6. Adipocyte ATP-binding cassette G1 promotes triglyceride storage, fat mass growth, and human obesity.

    PubMed

    Frisdal, Eric; Le Lay, Soazig; Hooton, Henri; Poupel, Lucie; Olivier, Maryline; Alili, Rohia; Plengpanich, Wanee; Villard, Elise F; Gilibert, Sophie; Lhomme, Marie; Superville, Alexandre; Miftah-Alkhair, Lobna; Chapman, M John; Dallinga-Thie, Geesje M; Venteclef, Nicolas; Poitou, Christine; Tordjman, Joan; Lesnik, Philippe; Kontush, Anatol; Huby, Thierry; Dugail, Isabelle; Clement, Karine; Guerin, Maryse; Le Goff, Wilfried

    2015-03-01

    The role of the ATP-binding cassette G1 (ABCG1) transporter in human pathophysiology is still largely unknown. Indeed, beyond its role in mediating free cholesterol efflux to HDL, the ABCG1 transporter equally promotes lipid accumulation in a triglyceride (TG)-rich environment through regulation of the bioavailability of lipoprotein lipase (LPL). Because both ABCG1 and LPL are expressed in adipose tissue, we hypothesized that ABCG1 is implicated in adipocyte TG storage and therefore could be a major actor in adipose tissue fat accumulation. Silencing of Abcg1 expression by RNA interference in 3T3-L1 preadipocytes compromised LPL-dependent TG accumulation during the initial phase of differentiation. Generation of stable Abcg1 knockdown 3T3-L1 adipocytes revealed that Abcg1 deficiency reduces TG storage and diminishes lipid droplet size through inhibition of Pparγ expression. Strikingly, local inhibition of adipocyte Abcg1 in adipose tissue from mice fed a high-fat diet led to a rapid decrease of adiposity and weight gain. Analysis of two frequent ABCG1 single nucleotide polymorphisms (rs1893590 [A/C] and rs1378577 [T/G]) in morbidly obese individuals indicated that elevated ABCG1 expression in adipose tissue was associated with increased PPARγ expression and adiposity concomitant to increased fat mass and BMI (haplotype AT>GC). The critical role of ABCG1 in obesity was further confirmed in independent populations of severe obese and diabetic obese individuals. This study identifies for the first time a major role of adipocyte ABCG1 in adiposity and fat mass growth and suggests that adipose ABCG1 might represent a potential therapeutic target in obesity.

  7. ATP binding cassette modulators control abscisic acid-regulated slow anion channels in guard cells

    PubMed Central

    Leonhardt, N; Vavasseur, A; Forestier, C

    1999-01-01

    In animal cells, ATP binding cassette (ABC) proteins are a large family of transporters that includes the sulfonylurea receptor and the cystic fibrosis transmembrane conductance regulator (CFTR). These two ABC proteins possess an ion channel activity and bind specific sulfonylureas, such as glibenclamide, but homologs have not been identified in plant cells. We recently have shown that there is an ABC protein in guard cells that is involved in the control of stomatal movements and guard cell outward K+ current. Because the CFTR, a chloride channel, is sensitive to glibenclamide and able to interact with K+ channels, we investigated its presence in guard cells. Potent CFTR inhibitors, such as glibenclamide and diphenylamine-2-carboxylic acid, triggered stomatal opening in darkness. The guard cell protoplast slow anion current that was recorded using the whole-cell patch-clamp technique was inhibited rapidly by glibenclamide in a dose-dependent manner; the concentration producing half-maximum inhibition was at 3 &mgr;M. Potassium channel openers, which bind to and act through the sulfonylurea receptor in animal cells, completely suppressed the stomatal opening induced by glibenclamide and recovered the glibenclamide-inhibited slow anion current. Abscisic acid is known to regulate slow anion channels and in our study was able to relieve glibenclamide inhibition of slow anion current. Moreover, in epidermal strip bioassays, the stomatal closure triggered by Ca2+ or abscisic acid was reversed by glibenclamide. These results suggest that the slow anion channel is an ABC protein or is tightly controlled by such a protein that interacts with the abscisic acid signal transduction pathway in guard cells. PMID:10368184

  8. The saci_2123 gene of the hyperthermoacidophile Sulfolobus acidocaldarius encodes an ATP-binding cassette multidrug transporter.

    PubMed

    Yang, Nuan; Driessen, Arnold J M

    2015-01-01

    Multidrug resistance (MDR) transporters are capable of secreting structurally and functionally unrelated toxic compounds from the cell. Among this group are ATP-binding cassette (ABC) transporters. These membrane proteins are typically arranged as either hetero- or homo-dimers of ABC half-transporters with each subunit consisting of a membrane domain fused at the C-terminus to an ATP-binding domain, or as full transporters in which the two subunits are fused into a single polypeptide. The saci_2123 gene of the thermoacidophilic archaeon Sulfolobus acidocaldarius is the only gene in the genome that encodes an ATP-binding cassette half-transporter, while a homologous gene is present in the genomes of S. solfataricus, S. tokodaii and S islandicus. Saci_2123 shares homology with well-characterized bacterial and mammalian MDR transporters. The saci_2132 gene is up-regulated when cells are exposed to drugs. A deletion mutant of saci_2132 was found to be more vulnerable to a set of toxic compounds, including detergents, antibiotics and uncouplers as compared to the wild-type strain, while the drug resistance could be restored through the plasmid-based expression of saci_2132. These data demonstrate that Saci_2132 is an archaeal ABC-MDR transporter and therefore it was termed Smr1 (Sulfolobus multidrug resistance transporter 1).

  9. Activity-Based Proteomics Reveals Heterogeneous Kinome and ATP-Binding Proteome Responses to MEK Inhibition in KRAS Mutant Lung Cancer.

    PubMed

    Kim, Jae-Young; Stewart, Paul A; Borne, Adam L; Fang, Bin; Welsh, Eric A; Chen, Yian Ann; Eschrich, Steven A; Koomen, John M; Haura, Eric B

    2016-06-01

    One way cancer cells can escape from targeted agents is through their ability to evade drug effects by rapidly rewiring signaling networks. Many protein classes, such as kinases and metabolic enzymes, are regulated by ATP binding and hydrolysis. We hypothesized that a system-level profiling of drug-induced alterations in ATP-binding proteomes could offer novel insights into adaptive responses. Here, we mapped global ATP-binding proteomes perturbed by two clinical MEK inhibitors, AZD6244 and MEK162, in KRAS mutant lung cancer cells as a model system harnessing a desthiobiotin-ATP probe coupled with LC-MS/MS. We observed strikingly unique ATP-binding proteome responses to MEK inhibition, which revealed heterogeneous drug-induced pathway signatures in each cell line. We also identified diverse kinome responses, indicating each cell adapts to MEK inhibition in unique ways. Despite the heterogeneity of kinome responses, decreased probe labeling of mitotic kinases and an increase of kinases linked to autophagy were identified to be common responses. Taken together, our study revealed a diversity of adaptive ATP-binding proteome and kinome responses to MEK inhibition in KRAS mutant lung cancer cells, and our study further demonstrated the utility of our approach to identify potential candidates of targetable ATP-binding enzymes involved in adaptive resistance and to develop rational drug combinations.

  10. ATP binding and hydrolysis and autophosphorylation of CbbQ encoded by the gene located downstream of RubisCO genes.

    PubMed

    Hayashi, Nobuhiro R; Igarashi, Yasuo

    2002-02-08

    CbbQ is encoded by the gene located downstream of ribulose 1,5-bisphosphate carboxylase/oxygenase genes (cbbLS) in the thermophilic hydrogen-oxidizing bacterium, Hydrogenophilus thermoluteolus. The protein possesses two nucleotide-binding motifs in its amino acid sequence, and it posttranslationally activates RubisCO. We present ATP hydrolysis and binding of CbbQ. CbbQ releases P(i) from ATP only in the presence of Mg(2+). CbbQ interacts with an 2'(3')-O-(2,4,6-trinitrophenyl)adenosine 5'-triphosphate in the presence or absence of Mg(2+). The interaction with Mg(2+) and/or a nucleotide induces a conformational change in CbbQ. Autophosphorylation of CbbQ occurs only in the absence of Mg(2+).

  11. ATP binding and hydrolysis-driven rate-determining events in the RFC-catalyzed PCNA clamp loading reaction.

    PubMed

    Sakato, Miho; Zhou, Yayan; Hingorani, Manju M

    2012-02-17

    The multi-subunit replication factor C (RFC) complex loads circular proliferating cell nuclear antigen (PCNA) clamps onto DNA where they serve as mobile tethers for polymerases and coordinate the functions of many other DNA metabolic proteins. The clamp loading reaction is complex, involving multiple components (RFC, PCNA, DNA, and ATP) and events (minimally: PCNA opening/closing, DNA binding/release, and ATP binding/hydrolysis) that yield a topologically linked clamp·DNA product in less than a second. Here, we report pre-steady-state measurements of several steps in the reaction catalyzed by Saccharomyces cerevisiae RFC and present a comprehensive kinetic model based on global analysis of the data. Highlights of the reaction mechanism are that ATP binding to RFC initiates slow activation of the clamp loader, enabling it to open PCNA (at ~2 s(-1)) and bind primer-template DNA (ptDNA). Rapid binding of ptDNA leads to formation of the RFC·ATP·PCNA(open)·ptDNA complex, which catalyzes a burst of ATP hydrolysis. Another slow step in the reaction follows ATP hydrolysis and is associated with PCNA closure around ptDNA (8 s(-1)). Dissociation of PCNA·ptDNA from RFC leads to catalytic turnover. We propose that these early and late rate-determining events are intramolecular conformational changes in RFC and PCNA that control clamp opening and closure, and that ATP binding and hydrolysis switch RFC between conformations with high and low affinities, respectively, for open PCNA and ptDNA, and thus bookend the clamp loading reaction.

  12. Activation of ATP binding for the autophosphorylation of DosS, a Mycobacterium tuberculosis histidine kinase lacking an ATP lid motif.

    PubMed

    Cho, Ha Yeon; Lee, Young-Hoon; Bae, Young-Seuk; Kim, Eungbin; Kang, Beom Sik

    2013-05-03

    The sensor histidine kinases of Mycobacterium tuberculosis, DosS and DosT, are responsible for sensing hypoxic conditions and consist of sensor and kinase cores responsible for accepting signals and phosphorylation activity, respectively. The kinase core contains a dimerization and histidine phosphate-accepting (DHp) domain and an ATP binding domain (ABD). The 13 histidine kinase genes of M. tuberculosis can be grouped based on the presence or absence of the ATP lid motif and F box (elements known to play roles in ATP binding) in their ABDs; DosS and DosT have ABDs lacking both these elements, and the crystal structures of their ABDs indicated that they were unsuitable for ATP binding, as a short loop covers the putative ATP binding site. Although the ABD alone cannot bind ATP, the kinase core is functional in autophosphorylation. Appropriate spatial arrangement of the ABD and DHp domain within the kinase core is required for both autophosphorylation and ATP binding. An ionic interaction between Arg(440) in the DHp domain and Glu(537) in the short loop of the ABD is available and may open the ATP binding site, by repositioning the short loop away from the site. Mutations at Arg(440) and Glu(537) reduce autophosphorylation activity. Unlike other histidine kinases containing an ATP lid, which protects bound ATP, DosS is unable to accept ATP until the ABD is properly positioned relative to the histidine; this may prevent unexpected ATP reactions. ATP binding can, therefore, function as a control mechanism for histidine kinase activity.

  13. Critical role of γ-phosphate in structural transition of Na,K-ATPase upon ATP binding

    NASA Astrophysics Data System (ADS)

    Petrushanko, Irina Yu.; Mitkevich, Vladimir A.; Anashkina, Anastasia A.; Klimanova, Elizaveta A.; Dergousova, Elena A.; Lopina, Olga D.; Makarov, Alexander A.

    2014-06-01

    Active transport of sodium and potassium ions by Na,K-ATPase is accompanied by the enzyme conformational transition between E1 and E2 states. ATP and ADP bind to Na,K-ATPase in the E1 conformation with similar affinity but the properties of enzyme in complexes with these nucleotides are different. We have studied thermodynamics of Na,K-ATPase binding with adenine nucleotides at different temperatures using isothermal titration calorimetry. Our data indicate that β-phosphate is involved in complex formation by increasing the affinity of adenine nucleotides to Na,K-ATPase by an order of magnitude, while γ-phosphate does not affect it. ATP binding to Na,K-ATPase in contrast to ADP binding generates a structural transition in the enzyme, which is consistent with the movement of a significant portion of the surface area to a solvent-protected state. We propose that ATP binding leads to convergence of the nucleotide-binding and phosphorylation domains transferring the enzyme from the ``E1-open'' to ``E1-closed'' conformation ready for phosphorylation.

  14. In vitro reassembly of the ribose ATP-binding cassette transporter reveals a distinct set of transport complexes.

    PubMed

    Clifton, Matthew C; Simon, Michael J; Erramilli, Satchal K; Zhang, Huide; Zaitseva, Jelena; Hermodson, Mark A; Stauffacher, Cynthia V

    2015-02-27

    Bacterial ATP-binding cassette (ABC) importers are primary active transporters that are critical for nutrient uptake. Based on structural and functional studies, ABC importers can be divided into two distinct classes, type I and type II. Type I importers follow a strict alternating access mechanism that is driven by the presence of the substrate. Type II importers accept substrates in a nucleotide-free state, with hydrolysis driving an inward facing conformation. The ribose transporter in Escherichia coli is a tripartite complex consisting of a cytoplasmic ATP-binding cassette protein, RbsA, with fused nucleotide binding domains; a transmembrane domain homodimer, RbsC2; and a periplasmic substrate binding protein, RbsB. To investigate the transport mechanism of the complex RbsABC2, we probed intersubunit interactions by varying the presence of the substrate ribose and the hydrolysis cofactors, ATP/ADP and Mg(2+). We were able to purify a full complex, RbsABC2, in the presence of stable, transition state mimics (ATP, Mg(2+), and VO4); a RbsAC complex in the presence of ADP and Mg(2+); and a heretofore unobserved RbsBC complex in the absence of cofactors. The presence of excess ribose also destabilized complex formation between RbsB and RbsC. These observations suggest that RbsABC2 shares functional traits with both type I and type II importers, as well as possessing unique features, and employs a distinct mechanism relative to other ABC transporters.

  15. ATP-Binding Pocket-Targeted Suppression of Src and Syk by Luteolin Contributes to Its Anti-Inflammatory Action

    PubMed Central

    Lee, Jeong-Oog; Jeong, Deok; Kim, Mi-Yeon; Cho, Jae Youl

    2015-01-01

    Luteolin is a flavonoid identified as a major anti-inflammatory component of Artemisia asiatica. Numerous reports have demonstrated the ability of luteolin to suppress inflammation in a variety of inflammatory conditions. However, its exact anti-inflammatory mechanism has not been fully elucidated. In the present study, the anti-inflammatory mode of action in activated macrophages of luteolin from Artemisia asiatica was examined by employing immunoblotting analysis, a luciferase reporter gene assay, enzyme assays, and an overexpression strategy. Luteolin dose-dependently inhibited the secretion of nitric oxide (NO) and prostaglandin E2 (PGE2) and diminished the levels of mRNA transcripts of inducible NO synthase (iNOS), tumor necrosis factor- (TNF-) α, and cyclooxygenase-2 (COX-2) in lipopolysaccharide- (LPS-) and pam3CSK-treated macrophage-like RAW264.7 cells without displaying cytotoxicity. Luteolin displayed potent NO-inhibitory activity and also suppressed the nuclear translocation of NF-κB (p65 and p50) via blockade of Src and Syk, but not other mitogen-activated kinases. Overexpression of wild type Src and point mutants thereof, and molecular modelling studies, suggest that the ATP-binding pocket may be the luteolin-binding site in Src. These results strongly suggest that luteolin may exert its anti-inflammatory action by suppressing the NF-κB signaling cascade via blockade of ATP binding in Src and Syk. PMID:26236111

  16. Equilibrated atomic models of outward-facing P-glycoprotein and effect of ATP binding on structural dynamics.

    PubMed

    Pan, Lurong; Aller, Stephen G

    2015-01-20

    P-glycoprotein (Pgp) is an ATP-binding cassette (ABC) transporter that alternates between inward- and outward-facing conformations to capture and force substrates out of cells like a peristaltic pump. The high degree of similarity in outward-facing structures across evolution of ABC transporters allowed construction of a high-confidence outward-facing Pgp atomic model based on crystal structures of outward-facing Sav1866 and inward-facing Pgp. The model adhered to previous experimentally determined secondary- and tertiary- configurations during all-atom molecular dynamics simulations in the presence or absence of MgATP. Three long lasting (>100 ns) meta-stable states were apparent in the presence of MgATP revealing new insights into alternating access. The two ATP-binding pockets are highly asymmetric resulting in differential control of overall structural dynamics and allosteric regulation of the drug-binding pocket. Equilibrated Pgp has a considerably different electrostatic profile compared to Sav1866 that implicates significant kinetic and thermodynamic differences in transport mechanisms.

  17. ATP-binding cassette-like transporters are involved in the transport of lignin precursors across plasma and vacuolar membranes

    SciTech Connect

    Miao, Y.C.; Liu, C.

    2010-12-28

    Lignin is a complex biopolymer derived primarily from the condensation of three monomeric precursors, the monolignols. The synthesis of monolignols occurs in the cytoplasm. To reach the cell wall where they are oxidized and polymerized, they must be transported across the cell membrane. However, the molecular mechanisms underlying the transport process are unclear. There are conflicting views about whether the transport of these precursors occurs by passive diffusion or is an energized active process; further, we know little about what chemical forms are required. Using isolated plasma and vacuolar membrane vesicles prepared from Arabidopsis, together with applying different transporter inhibitors in the assays, we examined the uptake of monolignols and their derivatives by these native membrane vesicles. We demonstrate that the transport of lignin precursors across plasmalemma and their sequestration into vacuoles are ATP-dependent primary-transport processes, involving ATP-binding cassette-like transporters. Moreover, we show that both plasma and vacuolar membrane vesicles selectively transport different forms of lignin precursors. In the presence of ATP, the inverted plasma membrane vesicles preferentially take up monolignol aglycones, whereas the vacuolar vesicles are more specific for glucoconjugates, suggesting that the different ATP-binding cassette-like transporters recognize different chemical forms in conveying them to distinct sites, and that glucosylation of monolignols is necessary for their vacuolar storage but not required for direct transport into the cell wall in Arabidopsis.

  18. Structure, function, and evolution of bacterial ATP-binding cassette systems

    SciTech Connect

    Davidson, A.L.; Dassa, E.; Orelle, C.; Chen, J.

    2010-07-27

    The ATP-binding cassette (ABC) systems constitute one of the largest superfamilies of paralogous sequences. All ABC systems share a highly conserved ATP-hydrolyzing domain or protein (the ABC; also referred to as a nucleotide-binding domain [NBD]) that is unequivocally characterized by three short sequence motifs (Fig. 1): these are the Walker A and Walker B motifs, indicative of the presence of a nucleotide-binding site, and the signature motif, unique to ABC proteins, located upstream of the Walker B motif (426). Other motifs diagnostic of ABC proteins are also indicated in Fig. 1. The biological significance of these motifs is discussed in Structure, Function, and Dynamics of the ABC. ABC systems are widespread among living organisms and have been detected in all genera of the three kingdoms of life, with remarkable conservation in the primary sequence of the cassette and in the organization of the constitutive domains or subunits (203, 420). ABC systems couple the energy of ATP hydrolysis to an impressively large variety of essential biological phenomena, comprising not only transmembrane (TM) transport, for which they are best known, but also several non-transport-related processes, such as translation elongation (62) and DNA repair (174). Although ABC systems deserve much attention because they are involved in severe human inherited diseases (107), they were first discovered and characterized in detail in prokaryotes, as early as the 1970s (13, 148, 238, 468). The most extensively analyzed systems were the high-affinity histidine and maltose uptake systems of Salmonella enterica serovar Typhimurium and Escherichia coli. Over 2 decades ago, after the completion of the nucleotide sequences encoding these transporters in the respective laboratories of Giovanna Ames and Maurice Hofnung, Hiroshi Nikaido and colleagues noticed that the two systems displayed a global similarity in the nature of their components and, moreover, that the primary sequences of MalK and

  19. Identification of widespread adenosine nucleotide binding in Mycobacterium tuberculosis

    SciTech Connect

    Ansong, Charles; Ortega, Corrie; Payne, Samuel H.; Haft, Daniel H.; Chauvigne-Hines, Lacie M.; Lewis, Michael P.; Ollodart, Anja R.; Purvine, Samuel O.; Shukla, Anil K.; Fortuin, Suereta; Smith, Richard D.; Adkins, Joshua N.; Grundner, Christoph; Wright, Aaron T.

    2013-01-24

    The annotation of protein function is almost completely performed by in silico approaches. However, computational prediction of protein function is frequently incomplete and error prone. In Mycobacterium tuberculosis (Mtb), ~25% of all genes have no predicted function and are annotated as hypothetical proteins. This lack of functional information severely limits our understanding of Mtb pathogenicity. Current tools for experimental functional annotation are limited and often do not scale to entire protein families. Here, we report a generally applicable chemical biology platform to functionally annotate bacterial proteins by combining activity-based protein profiling (ABPP) and quantitative LC-MS-based proteomics. As an example of this approach for high-throughput protein functional validation and discovery, we experimentally annotate the families of ATP-binding proteins in Mtb. Our data experimentally validate prior in silico predictions of >250 ATPases and adenosine nucleotide-binding proteins, and reveal 73 hypothetical proteins as novel ATP-binding proteins. We identify adenosine cofactor interactions with many hypothetical proteins containing a diversity of unrelated sequences, providing a new and expanded view of adenosine nucleotide binding in Mtb. Furthermore, many of these hypothetical proteins are both unique to Mycobacteria and essential for infection, suggesting specialized functions in mycobacterial physiology and pathogenicity. Thus, we provide a generally applicable approach for high throughput protein function discovery and validation, and highlight several ways in which application of activity-based proteomics data can improve the quality of functional annotations to facilitate novel biological insights.

  20. ATP binding and hydrolysis steps of the uni-site catalysis by the mitochondrial F(1)-ATPase are affected by inorganic phosphate.

    PubMed

    Milgrom, Yakov M

    2010-10-01

    The effect of inorganic phosphate (P(i)) on uni-site ATP binding and hydrolysis by the nucleotide-depleted F(1)-ATPase from beef heart mitochondria (ndMF(1)) has been investigated. It is shown for the first time that P(i) decreases the apparent rate constant of uni-site ATP binding by ndMF(1) 3-fold with the K(d) of 0.38+/-0.14mM. During uni-site ATP hydrolysis, P(i) also shifts equilibrium between bound ATP and ADP+P(i) in the direction of ATP synthesis with the K(d) of 0.17+/-0.03mM. However, 10mM P(i) does not significantly affect ATP binding during multi-site catalysis.

  1. CpABC, a Cryptosporidium parvum ATP-binding cassette protein at the host–parasite boundary in intracellular stages

    PubMed Central

    Perkins, Margaret E.; Riojas, Ynolde A.; Wu, Teresa W.; Le Blancq, Sylvie M.

    1999-01-01

    The intracellular parasite Cryptosporidium parvum develops inside a vacuole at the apex of its epithelial host cell. The developing parasite is separated from the host cell cytoplasm by a zone of attachment that consists of an extensively folded membranous structure known as the feeder organelle. It has been proposed that the feeder organelle is the site of regulation of transport of nutrients and drugs into the parasite. In this report, we localize an ≈200-kDa integral membrane protein, CpABC, from Cryptosporidium parvum to the host–parasite boundary, possibly the feeder organelle. The predicted amino acid sequence of CpABC has significant structural similarity with the cystic fibrosis conductance regulator and the multidrug resistance protein subfamily of ATP-binding cassette proteins. This is an example of a parasite-encoded transport protein localized at the parasite–host interface of an intracellular protozoan. PMID:10318953

  2. Simulation of the coupling between nucleotide binding and transmembrane domains in the ATP binding cassette transporter BtuCD.

    PubMed

    Sonne, Jacob; Kandt, Christian; Peters, Günther H; Hansen, Flemming Y; Jensen, Morten Ø; Tieleman, D Peter

    2007-04-15

    The nucleotide-induced structural rearrangements in ATP binding cassette (ABC) transporters, leading to substrate translocation, are largely unknown. We have modeled nucleotide binding and release in the vitamin B(12) importer BtuCD using perturbed elastic network calculations and biased molecular dynamics simulations. Both models predict that nucleotide release decreases the tilt between the two transmembrane domains and opens the cytoplasmic gate. Nucleotide binding has the opposite effect. The observed coupling may be relevant for all ABC transporters because of the conservation of nucleotide binding domains and the shared role of ATP in ABC transporters. The rearrangements in the cytoplasmic gate region do not provide enough space for B(12) to diffuse from the transporter pore into the cytoplasm, which could suggest that peristaltic forces are needed to exclude B(12) from the transporter pore.

  3. The Q Motif Is Involved in DNA Binding but Not ATP Binding in ChlR1 Helicase

    PubMed Central

    Ding, Hao; Guo, Manhong; Vidhyasagar, Venkatasubramanian; Talwar, Tanu; Wu, Yuliang

    2015-01-01

    Helicases are molecular motors that couple the energy of ATP hydrolysis to the unwinding of structured DNA or RNA and chromatin remodeling. The conversion of energy derived from ATP hydrolysis into unwinding and remodeling is coordinated by seven sequence motifs (I, Ia, II, III, IV, V, and VI). The Q motif, consisting of nine amino acids (GFXXPXPIQ) with an invariant glutamine (Q) residue, has been identified in some, but not all helicases. Compared to the seven well-recognized conserved helicase motifs, the role of the Q motif is less acknowledged. Mutations in the human ChlR1 (DDX11) gene are associated with a unique genetic disorder known as Warsaw Breakage Syndrome, which is characterized by cellular defects in genome maintenance. To examine the roles of the Q motif in ChlR1 helicase, we performed site directed mutagenesis of glutamine to alanine at residue 23 in the Q motif of ChlR1. ChlR1 recombinant protein was overexpressed and purified from HEK293T cells. ChlR1-Q23A mutant abolished the helicase activity of ChlR1 and displayed reduced DNA binding ability. The mutant showed impaired ATPase activity but normal ATP binding. A thermal shift assay revealed that ChlR1-Q23A has a melting point value similar to ChlR1-WT. Partial proteolysis mapping demonstrated that ChlR1-WT and Q23A have a similar globular structure, although some subtle conformational differences in these two proteins are evident. Finally, we found ChlR1 exists and functions as a monomer in solution, which is different from FANCJ, in which the Q motif is involved in protein dimerization. Taken together, our results suggest that the Q motif is involved in DNA binding but not ATP binding in ChlR1 helicase. PMID:26474416

  4. In Vitro Reassembly of the Ribose ATP-binding Cassette Transporter Reveals a Distinct Set of Transport Complexes*

    PubMed Central

    Clifton, Matthew C.; Simon, Michael J.; Erramilli, Satchal K.; Zhang, Huide; Zaitseva, Jelena; Hermodson, Mark A.; Stauffacher, Cynthia V.

    2015-01-01

    Bacterial ATP-binding cassette (ABC) importers are primary active transporters that are critical for nutrient uptake. Based on structural and functional studies, ABC importers can be divided into two distinct classes, type I and type II. Type I importers follow a strict alternating access mechanism that is driven by the presence of the substrate. Type II importers accept substrates in a nucleotide-free state, with hydrolysis driving an inward facing conformation. The ribose transporter in Escherichia coli is a tripartite complex consisting of a cytoplasmic ATP-binding cassette protein, RbsA, with fused nucleotide binding domains; a transmembrane domain homodimer, RbsC2; and a periplasmic substrate binding protein, RbsB. To investigate the transport mechanism of the complex RbsABC2, we probed intersubunit interactions by varying the presence of the substrate ribose and the hydrolysis cofactors, ATP/ADP and Mg2+. We were able to purify a full complex, RbsABC2, in the presence of stable, transition state mimics (ATP, Mg2+, and VO4); a RbsAC complex in the presence of ADP and Mg2+; and a heretofore unobserved RbsBC complex in the absence of cofactors. The presence of excess ribose also destabilized complex formation between RbsB and RbsC. These observations suggest that RbsABC2 shares functional traits with both type I and type II importers, as well as possessing unique features, and employs a distinct mechanism relative to other ABC transporters. PMID:25533465

  5. ATP-binding cassette transporters and sterol O-acyltransferases interact at membrane microdomains to modulate sterol uptake and esterification

    PubMed Central

    Gulati, Sonia; Balderes, Dina; Kim, Christine; Guo, Zhongmin A.; Wilcox, Lisa; Area-Gomez, Estela; Snider, Jamie; Wolinski, Heimo; Stagljar, Igor; Granato, Juliana T.; Ruggles, Kelly V.; DeGiorgis, Joseph A.; Kohlwein, Sepp D.; Schon, Eric A.; Sturley, Stephen L.

    2015-01-01

    A key component of eukaryotic lipid homeostasis is the esterification of sterols with fatty acids by sterol O-acyltransferases (SOATs). The esterification reactions are allosterically activated by their sterol substrates, the majority of which accumulate at the plasma membrane. We demonstrate that in yeast, sterol transport from the plasma membrane to the site of esterification is associated with the physical interaction of the major SOAT, acyl-coenzyme A:cholesterol acyltransferase (ACAT)-related enzyme (Are)2p, with 2 plasma membrane ATP-binding cassette (ABC) transporters: Aus1p and Pdr11p. Are2p, Aus1p, and Pdr11p, unlike the minor acyltransferase, Are1p, colocalize to sterol and sphingolipid-enriched, detergent-resistant microdomains (DRMs). Deletion of either ABC transporter results in Are2p relocalization to detergent-soluble membrane domains and a significant decrease (53–36%) in esterification of exogenous sterol. Similarly, in murine tissues, the SOAT1/Acat1 enzyme and activity localize to DRMs. This subcellular localization is diminished upon deletion of murine ABC transporters, such as Abcg1, which itself is DRM associated. We propose that the close proximity of sterol esterification and transport proteins to each other combined with their residence in lipid-enriched membrane microdomains facilitates rapid, high-capacity sterol transport and esterification, obviating any requirement for soluble intermediary proteins.—Gulati, S., Balderes, D., Kim, C., Guo, Z. A., Wilcox, L., Area-Gomez, E., Snider, J., Wolinski, H., Stagljar, I., Granato, J. T., Ruggles, K. V., DeGiorgis, J. A., Kohlwein, S. D., Schon, E. A., Sturley, S. L. ATP-binding cassette transporters and sterol O-acyltransferases interact at membrane microdomains to modulate sterol uptake and esterification. PMID:26220175

  6. An ATP-binding cassette transporter-like complex governs cell-wall hydrolysis at the bacterial cytokinetic ring.

    PubMed

    Yang, Desirée C; Peters, Nick T; Parzych, Katherine R; Uehara, Tsuyoshi; Markovski, Monica; Bernhardt, Thomas G

    2011-11-08

    ATP-binding cassette transporters are ubiquitous membrane protein complexes that move substrates across membranes. They do so using ATP-induced conformational changes in their nucleotide-binding domains to alter the conformation of the transport cavity formed by their transmembrane domains. In Escherichia coli, an ATP-binding cassette transporter-like complex composed of FtsE (nucleotide-binding domain) and FtsX (transmembrane domain) has long been known to be important for cytokinesis, but its role in the process has remained mysterious. Here we identify FtsEX as a regulator of cell-wall hydrolysis at the division site. Cell-wall material synthesized by the division machinery is shared initially by daughter cells and must be split by hydrolytic enzymes called "amidases" to drive daughter-cell separation. We recently showed that the amidases require activation at the cytokinetic ring by proteins with LytM domains, of which EnvC is the most critical. In this report, we demonstrate that FtsEX directly recruits EnvC to the septum via an interaction between EnvC and a periplasmic loop of FtsX. Importantly, we also show that FtsEX variants predicted to be ATPase defective still recruit EnvC to the septum but fail to promote cell separation. Our results thus suggest that amidase activation via EnvC in the periplasm is regulated by conformational changes in the FtsEX complex mediated by ATP hydrolysis in the cytoplasm. Since FtsE has been reported to interact with the tubulin-like FtsZ protein, our model provides a potential mechanism for coupling amidase activity with the contraction of the FtsZ cytoskeletal ring.

  7. Mycobacterium tuberculosis Universal Stress Protein Rv2623 Regulates Bacillary Growth by ATP Binding: Requirement for Establishing Chronic Persistent Infection

    SciTech Connect

    Drumm, J.; Mi, K; Bilder, P; Sun, M; Lim, J; Bielefeldt-Ohmann, H; Basaraba, R; So, M; Zhu, G; et. al.

    2009-01-01

    Tuberculous latency and reactivation play a significant role in the pathogenesis of tuberculosis, yet the mechanisms that regulate these processes remain unclear. The Mycobacterium tuberculosisuniversal stress protein (USP) homolog, rv2623, is among the most highly induced genes when the tubercle bacillus is subjected to hypoxia and nitrosative stress, conditions thought to promote latency. Induction of rv2623 also occurs when M. tuberculosis encounters conditions associated with growth arrest, such as the intracellular milieu of macrophages and in the lungs of mice with chronic tuberculosis. Therefore, we tested the hypothesis that Rv2623 regulates tuberculosis latency. We observed that an Rv2623-deficient mutant fails to establish chronic tuberculous infection in guinea pigs and mice, exhibiting a hypervirulence phenotype associated with increased bacterial burden and mortality. Consistent with this in vivo growth-regulatory role, constitutive overexpression of rv2623 attenuates mycobacterial growth in vitro. Biochemical analysis of purified Rv2623 suggested that this mycobacterial USP binds ATP, and the 2.9-A-resolution crystal structure revealed that Rv2623 engages ATP in a novel nucleotide-binding pocket. Structure-guided mutagenesis yielded Rv2623 mutants with reduced ATP-binding capacity. Analysis of mycobacteria overexpressing these mutants revealed that the in vitro growth-inhibitory property of Rv2623 correlates with its ability to bind ATP. Together, the results indicate that i M. tuberculosis Rv2623 regulates mycobacterial growth in vitro and in vivo, and ii Rv2623 is required for the entry of the tubercle bacillus into the chronic phase of infection in the host; in addition, iii Rv2623 binds ATP; and iv the growth-regulatory attribute of this USP is dependent on its ATP-binding activity. We propose that Rv2623 may function as an ATP-dependent signaling intermediate in a pathway that promotes persistent infection.

  8. Regulation of ATP-binding cassette transporters and cholesterol efflux by glucose in primary human monocytes and murine bone marrow-derived macrophages

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Individuals with type 2 diabetes mellitus are at increased risk of developing atherosclerosis. This may be partially attributable to suppression of macrophage ATP-binding cassette (ABC) transporter mediated cholesterol efflux by sustained elevated blood glucose concentrations. Two models were used...

  9. LrABCF1, a GCN-type ATP-binding cassette transporter from Lilium regale, is involved in defense responses against viral and fungal pathogens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    ATP-binding cassette (ABC) transporters are essential for membrane translocation in diverse biological processes, such as plant development and defense response. Here, a general control non-derepressible (GCN)-type ABC transporter gene, designated LrABCF1, was identified from Cucumber mosaic virus (...

  10. Mutating the Conserved Q-loop Glutamine 1291 Selectively Disrupts Adenylate Kinase-dependent Channel Gating of the ATP-binding Cassette (ABC) Adenylate Kinase Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) and Reduces Channel Function in Primary Human Airway Epithelia.

    PubMed

    Dong, Qian; Ernst, Sarah E; Ostedgaard, Lynda S; Shah, Viral S; Ver Heul, Amanda R; Welsh, Michael J; Randak, Christoph O

    2015-05-29

    The ATP-binding cassette (ABC) transporter cystic fibrosis transmembrane conductance regulator (CFTR) and two other non-membrane-bound ABC proteins, Rad50 and a structural maintenance of chromosome (SMC) protein, exhibit adenylate kinase activity in the presence of physiologic concentrations of ATP and AMP or ADP (ATP + AMP ⇆ 2 ADP). The crystal structure of the nucleotide-binding domain of an SMC protein in complex with the adenylate kinase bisubstrate inhibitor P(1),P(5)-di(adenosine-5') pentaphosphate (Ap5A) suggests that AMP binds to the conserved Q-loop glutamine during the adenylate kinase reaction. Therefore, we hypothesized that mutating the corresponding residue in CFTR, Gln-1291, selectively disrupts adenylate kinase-dependent channel gating at physiologic nucleotide concentrations. We found that substituting Gln-1291 with bulky side-chain amino acids abolished the effects of Ap5A, AMP, and adenosine 5'-monophosphoramidate on CFTR channel function. 8-Azidoadenosine 5'-monophosphate photolabeling of the AMP-binding site and adenylate kinase activity were disrupted in Q1291F CFTR. The Gln-1291 mutations did not alter the potency of ATP at stimulating current or ATP-dependent gating when ATP was the only nucleotide present. However, when physiologic concentrations of ADP and AMP were added, adenylate kinase-deficient Q1291F channels opened significantly less than wild type. Consistent with this result, we found that Q1291F CFTR displayed significantly reduced Cl(-) channel function in well differentiated primary human airway epithelia. These results indicate that a highly conserved residue of an ABC transporter plays an important role in adenylate kinase-dependent CFTR gating. Furthermore, the results suggest that adenylate kinase activity is important for normal CFTR channel function in airway epithelia.

  11. Mutating the Conserved Q-loop Glutamine 1291 Selectively Disrupts Adenylate Kinase-dependent Channel Gating of the ATP-binding Cassette (ABC) Adenylate Kinase Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) and Reduces Channel Function in Primary Human Airway Epithelia*

    PubMed Central

    Dong, Qian; Ernst, Sarah E.; Ostedgaard, Lynda S.; Shah, Viral S.; Ver Heul, Amanda R.; Welsh, Michael J.; Randak, Christoph O.

    2015-01-01

    The ATP-binding cassette (ABC) transporter cystic fibrosis transmembrane conductance regulator (CFTR) and two other non-membrane-bound ABC proteins, Rad50 and a structural maintenance of chromosome (SMC) protein, exhibit adenylate kinase activity in the presence of physiologic concentrations of ATP and AMP or ADP (ATP + AMP ⇆ 2 ADP). The crystal structure of the nucleotide-binding domain of an SMC protein in complex with the adenylate kinase bisubstrate inhibitor P1,P5-di(adenosine-5′) pentaphosphate (Ap5A) suggests that AMP binds to the conserved Q-loop glutamine during the adenylate kinase reaction. Therefore, we hypothesized that mutating the corresponding residue in CFTR, Gln-1291, selectively disrupts adenylate kinase-dependent channel gating at physiologic nucleotide concentrations. We found that substituting Gln-1291 with bulky side-chain amino acids abolished the effects of Ap5A, AMP, and adenosine 5′-monophosphoramidate on CFTR channel function. 8-Azidoadenosine 5′-monophosphate photolabeling of the AMP-binding site and adenylate kinase activity were disrupted in Q1291F CFTR. The Gln-1291 mutations did not alter the potency of ATP at stimulating current or ATP-dependent gating when ATP was the only nucleotide present. However, when physiologic concentrations of ADP and AMP were added, adenylate kinase-deficient Q1291F channels opened significantly less than wild type. Consistent with this result, we found that Q1291F CFTR displayed significantly reduced Cl− channel function in well differentiated primary human airway epithelia. These results indicate that a highly conserved residue of an ABC transporter plays an important role in adenylate kinase-dependent CFTR gating. Furthermore, the results suggest that adenylate kinase activity is important for normal CFTR channel function in airway epithelia. PMID:25887396

  12. Rapid, quantitative determination of bacteria in water. [adenosine triphosphate

    NASA Technical Reports Server (NTRS)

    Chappelle, E. W.; Picciolo, G. L.; Thomas, R. R.; Jeffers, E. L.; Deming, J. W. (Inventor)

    1978-01-01

    A bioluminescent assay for ATP in water borne bacteria is made by adding nitric acid to a water sample with concentrated bacteria to rupture the bacterial cells. The sample is diluted with sterile, deionized water, then mixed with a luciferase-luciferin mixture and the resulting light output of the bioluminescent reaction is measured and correlated with bacteria present. A standard and a blank also are presented so that the light output can be correlated to bacteria in the sample and system noise can be substracted from the readings. A chemiluminescent assay for iron porphyrins in water borne bacteria is made by adding luminol reagent to a water sample with concentrated bacteria and measuring the resulting light output of the chemiluminescent reaction.

  13. Bacterial adenosine triphosphate as a measure of urinary tract infection

    NASA Technical Reports Server (NTRS)

    Chappelle, E. W.; Picciolo, G. L.

    1971-01-01

    Procedure detects and counts bacteria present in urine samples. Method also determines bacterial levels in other aqueous body fluids including lymph fluid, plasma, blood, spinal fluid, saliva and mucous.

  14. Interrelationship of islet metabolism, adenosine triphosphate content and insulin release

    PubMed Central

    Ashcroft, Stephen J. H.; Weerasinghe, L. Chatra C.; Randle, Philip J.

    1973-01-01

    The oxidation of some exogenous substrates and their effects on ATP content and insulin release in mouse pancreatic islets were measured. The ATP concentration of islets incubated without exogenous substrate shows a gradual decrease, which can be prevented by glucose or mannose (20mm) or leucine (2.5mm); d-glyceraldehyde (5mm) is as effective as glucose (5mm); fructose or N-acetylglucosamine (20mm), pyruvate (10mm) and dl-3-hydroxybutyrate (2mm) are less effective; galactose (20mm), acetate (10mm), octanoate (2mm) and succinate (10mm) have no ATP-maintaining ability. Islets oxidize glucose, mannose, glyceraldehyde, leucine and, less readily, N-acetylglucosamine and glucosamine; galactose, however, is poorly metabolized. Mannoheptulose inhibits the oxidation of glucose but not of glyceraldehyde. Insulin release, measured over a 2h incubation, is stimulated by glucose, mannose, leucine, glyceraldehyde or glucosamine but not by fructose or N-acetylglucosamine. The latter, however, potentiates the effects of glucose or glyceraldehyde (5mm) or leucine (2.5mm) on release; the potentiating effects are inhibited by mannoheptulose, which also blocks glucose-, but not glyceraldehyde- or leucine-stimulated release. In the presence of glucose (20mm), metabolic inhibitors depress insulin release and islet ATP content in parallel. However, rates of insulin release and ATP content measured after incubation with various combinations of exogenous substrates do not appear to be correlated. Sulphonylureas stimulate insulin release but decrease islet ATP concentrations. These results provide further evidence of a close association between the metabolic activity of exogenous substrates and their ability to initiate insulin release. Glucoreceptor models are formulated in the light of these observations and discussed. PMID:4199014

  15. Fructose Uptake in Sinorhizobium meliloti Is Mediated by a High-Affinity ATP-Binding Cassette Transport System

    PubMed Central

    Lambert, Annie; Østerås, Magne; Mandon, Karine; Poggi, Marie-Christine; Le Rudulier, Daniel

    2001-01-01

    By transposon mutagenesis, we have isolated a mutant of Sinorhizobium meliloti which is totally unable to grow on fructose as sole carbon source as a consequence of its inability to transport this sugar. The cloning and sequencing analysis of the chromosomal DNA region flanking the TnphoA insertion revealed the presence of six open reading frames (ORFs) organized in two loci, frcRS and frcBCAK, transcribed divergently. The frcBCA genes encode the characteristic components of an ATP-binding cassette transporter (FrcB, a periplasmic substrate binding protein, FrcC, an integral membrane permease, and FrcA, an ATP-binding cytoplasmic protein), which is the unique high-affinity (Km of 6 μM) fructose uptake system in S. meliloti. The FrcK protein shows homology with some kinases, while FrcR is probably a transcriptional regulator of the repressor-ORF-kinase family. The expression of S. meliloti frcBCAK in Escherichia coli, which transports fructose only via the phosphotransferase system, resulted in the detection of a periplasmic fructose binding activity, demonstrating that FrcB is the binding protein of the Frc transporter. The analysis of substrate specificities revealed that the Frc system is also a high-affinity transporter for ribose and mannose, which are both fructose competitors for the binding to the periplasmic FrcB protein. However, the Frc mutant was still able to grow on these sugars as sole carbon source, demonstrating the presence of at least one other uptake system for mannose and ribose in S. meliloti. The expression of the frcBC genes as determined by measurements of alkaline phosphatase activity was shown to be induced by mannitol and fructose, but not by mannose, ribose, glucose, or succinate, suggesting that the Frc system is primarily targeted towards fructose. Neither Nod nor Fix phenotypes were impared in the TnphoA mutant, demonstrating that fructose uptake is not essential for nodulation and nitrogen fixation, although FrcB protein is

  16. Fructose uptake in Sinorhizobium meliloti is mediated by a high-affinity ATP-binding cassette transport system.

    PubMed

    Lambert, A; Østerås, M; Mandon, K; Poggi, M C; Le Rudulier, D

    2001-08-01

    By transposon mutagenesis, we have isolated a mutant of Sinorhizobium meliloti which is totally unable to grow on fructose as sole carbon source as a consequence of its inability to transport this sugar. The cloning and sequencing analysis of the chromosomal DNA region flanking the TnphoA insertion revealed the presence of six open reading frames (ORFs) organized in two loci, frcRS and frcBCAK, transcribed divergently. The frcBCA genes encode the characteristic components of an ATP-binding cassette transporter (FrcB, a periplasmic substrate binding protein, FrcC, an integral membrane permease, and FrcA, an ATP-binding cytoplasmic protein), which is the unique high-affinity (K(m) of 6 microM) fructose uptake system in S. meliloti. The FrcK protein shows homology with some kinases, while FrcR is probably a transcriptional regulator of the repressor-ORF-kinase family. The expression of S. meliloti frcBCAK in Escherichia coli, which transports fructose only via the phosphotransferase system, resulted in the detection of a periplasmic fructose binding activity, demonstrating that FrcB is the binding protein of the Frc transporter. The analysis of substrate specificities revealed that the Frc system is also a high-affinity transporter for ribose and mannose, which are both fructose competitors for the binding to the periplasmic FrcB protein. However, the Frc mutant was still able to grow on these sugars as sole carbon source, demonstrating the presence of at least one other uptake system for mannose and ribose in S. meliloti. The expression of the frcBC genes as determined by measurements of alkaline phosphatase activity was shown to be induced by mannitol and fructose, but not by mannose, ribose, glucose, or succinate, suggesting that the Frc system is primarily targeted towards fructose. Neither Nod nor Fix phenotypes were impared in the TnphoA mutant, demonstrating that fructose uptake is not essential for nodulation and nitrogen fixation, although FrcB protein is

  17. The PAL1 gene product is a peroxisomal ATP-binding cassette transporter in the yeast Saccharomyces cerevisiae

    PubMed Central

    1996-01-01

    The PAL1 gene was isolated using PCR and degenerate oligonucleotide primers corresponding to highly conserved amino acid sequence motifs diagnostic of the ATP-binding cassette domain of the superfamily of membrane-bound transport proteins typified by mammalian multidrug resistance transporter 1 and Saccharomyces cerevisiae Ste6. The deduced PAL1 gene product is similar in length to, has the same predicted topology as, and shares the highest degree of amino acid sequence identity with two human proteins, adrenoleukodystrophy protein and peroxisomal membrane protein (70 kD), which are both presumptive ATP- binding cassette transporters thought to be constituents of the peroxisomal membrane. As judged by hybridization of a PAL1 probe to isolated RNA and by expression of a PAL1-lacZ fusion, a PAL1 transcript was only detectable when cells were grown on oleic acid, a carbon source which requires the biogenesis of functional peroxisomes for its metabolism. A pal1delta mutant grew normally on either glucose- or glycerol-containing media; however, unlike PAL1+ cells (or the pal1delta mutant carrying the PAL1 gene on a plasmid), pal1delta cells were unable to grow on either a solid medium or a liquid medium containing oleic acid as the sole carbon source. Antibodies raised against a chimeric protein in which the COOH-terminal domain of Pal1 was fused to glutathione S-transferase specifically recognized a protein in extracts from wild-type cells only when grown on oleic acid; this species represents the PAL1 gene product because it was missing in pal1delta cells and more abundant in pal1delta cells expressing PAL1 from a multicopy plasmid. The Pal1 polypeptide was highly enriched in the organellar pellet fraction prepared from wild-type cells by differential centrifugation and comigrated upon velocity sedimentation in a Nycodenz gradient with a known component of the peroxisomal matrix, e-oxoacyl-CoA thiolase. As judged by both subcellular fractionation and indirect

  18. Whole-genome survey of the putative ATP-binding cassette transporter family genes in Vitis vinifera.

    PubMed

    Çakır, Birsen; Kılıçkaya, Ozan

    2013-01-01

    The ATP-binding cassette (ABC) protein superfamily constitutes one of the largest protein families known in plants. In this report, we performed a complete inventory of ABC protein genes in Vitis vinifera, the whole genome of which has been sequenced. By comparison with ABC protein members of Arabidopsis thaliana, we identified 135 putative ABC proteins with 1 or 2 NBDs in V. vinifera. Of these, 120 encode intrinsic membrane proteins, and 15 encode proteins missing TMDs. V. vinifera ABC proteins can be divided into 13 subfamilies with 79 "full-size," 41 "half-size," and 15 "soluble" putative ABC proteins. The main feature of the Vitis ABC superfamily is the presence of 2 large subfamilies, ABCG (pleiotropic drug resistance and white-brown complex homolog) and ABCC (multidrug resistance-associated protein). We identified orthologs of V. vinifera putative ABC transporters in different species. This work represents the first complete inventory of ABC transporters in V. vinifera. The identification of Vitis ABC transporters and their comparative analysis with the Arabidopsis counterparts revealed a strong conservation between the 2 species. This inventory could help elucidate the biological and physiological functions of these transporters in V. vinifera.

  19. Heavy metal tolerance in the fission yeast requires an ATP-binding cassette-type vacuolar membrane transporter.

    PubMed Central

    Ortiz, D F; Kreppel, L; Speiser, D M; Scheel, G; McDonald, G; Ow, D W

    1992-01-01

    In response to heavy metal stress, plants and certain fungi, such as the fission yeast Schizosaccharomyces pombe, synthesize small metal-binding peptides known as phytochelatins. We have identified a cadmium sensitive S. pombe mutant deficient in the accumulation of a sulfide-containing phytochelatin-cadmium complex, and have isolated the gene, designated hmt1, that complements this mutant. The deduced protein sequence of the hmt1 gene product shares sequence identity with the family of ABC (ATP-binding cassette)-type transport proteins which includes the mammalian P-glycoproteins and CFTR, suggesting that the encoded product is an integral membrane protein. Analysis of fractionated fission yeast cell components indicates that the HMT1 polypeptide is associated with the vacuolar membrane. Additionally, fission yeast strains harboring an hmt1-expressing multicopy plasmid exhibit enhanced metal tolerance along with a higher intracellular level of cadmium, implying a relationship between HMT1 mediated transport and compartmentalization of heavy metals. This suggests that tissue-specific overproduction of a functional hmt1 product in transgenic plants might be a means to alter the tissue localization of these elements, such as for sequestering heavy metals away from consumable parts of crop plants. Images PMID:1396551

  20. Modulating the function of ATP-binding cassette subfamily G member 2 (ABCG2) with inhibitor cabozantinib.

    PubMed

    Zhang, Guan-Nan; Zhang, Yun-Kai; Wang, Yi-Jun; Barbuti, Anna Maria; Zhu, Xi-Jun; Yu, Xin-Yue; Wen, Ai-Wen; Wurpel, John N D; Chen, Zhe-Sheng

    2017-01-25

    Cabozantinib (XL184) is a small molecule tyrosine kinase receptor inhibitor, which targets c-Met and VEGFR2. Cabozantinib has been approved by the Food and Drug Administration to treat advanced medullary thyroid cancer and renal cell carcinoma. In the present study, we evaluated the ability of cabozantinib to modulate the function of the ATP-binding cassette subfamily G member 2 (ABCG2) by sensitizing cells that are resistant to ABCG2 substrate antineoplastic drugs. We used a drug-selected resistant cell line H460/MX20 and three ABCG2 stable transfected cell lines ABCG2-482-R2, ABCG2-482-G2, and ABCG2-482-T7, which overexpress ABCG2. Cabozantinib, at non-toxic concentrations (3 or 5μM), sensitized the ABCG2-overexpressing cells to mitoxantrone, SN-38, and topotecan. Our results indicate that cabozantinib reverses ABCG2-mediated multidrug resistance by antagonizing the drug efflux function of the ABCG2 transporter instead of downregulating its expression. The molecular docking analysis indicates that cabozantinib binds to the drug-binding site of the ABCG2 transporter. Overall, our findings demonstrate that cabozantinib inhibits the ABCG2 transporter function and consequently enhances the effect of the antineoplastic agents that are substrates of ABCG2. Cabozantinib may be a useful agent in anticancer treatment regimens for patients who are resistant to ABCG2 substrate drugs.

  1. ABCC1, an ATP Binding Cassette Protein from Grape Berry, Transports Anthocyanidin 3-O-Glucosides[W][OA

    PubMed Central

    Francisco, Rita Maria; Regalado, Ana; Ageorges, Agnès; Burla, Bo J.; Bassin, Barbara; Eisenach, Cornelia; Zarrouk, Olfa; Vialet, Sandrine; Marlin, Thérèse; Chaves, Maria Manuela; Martinoia, Enrico; Nagy, Réka

    2013-01-01

    Accumulation of anthocyanins in the exocarp of red grapevine (Vitis vinifera) cultivars is one of several events that characterize the onset of grape berry ripening (véraison). Despite our thorough understanding of anthocyanin biosynthesis and regulation, little is known about the molecular aspects of their transport. The participation of ATP binding cassette (ABC) proteins in vacuolar anthocyanin transport has long been a matter of debate. Here, we present biochemical evidence that an ABC protein, ABCC1, localizes to the tonoplast and is involved in the transport of glucosylated anthocyanidins. ABCC1 is expressed in the exocarp throughout berry development and ripening, with a significant increase at véraison (i.e., the onset of ripening). Transport experiments using microsomes isolated from ABCC1-expressing yeast cells showed that ABCC1 transports malvidin 3-O-glucoside. The transport strictly depends on the presence of GSH, which is cotransported with the anthocyanins and is sensitive to inhibitors of ABC proteins. By exposing anthocyanin-producing grapevine root cultures to buthionine sulphoximine, which reduced GSH levels, a decrease in anthocyanin concentration is observed. In conclusion, we provide evidence that ABCC1 acts as an anthocyanin transporter that depends on GSH without the formation of an anthocyanin-GSH conjugate. PMID:23723325

  2. ATP-binding cassette transporters and sterol O-acyltransferases interact at membrane microdomains to modulate sterol uptake and esterification.

    PubMed

    Gulati, Sonia; Balderes, Dina; Kim, Christine; Guo, Zhongmin A; Wilcox, Lisa; Area-Gomez, Estela; Snider, Jamie; Wolinski, Heimo; Stagljar, Igor; Granato, Juliana T; Ruggles, Kelly V; DeGiorgis, Joseph A; Kohlwein, Sepp D; Schon, Eric A; Sturley, Stephen L

    2015-11-01

    A key component of eukaryotic lipid homeostasis is the esterification of sterols with fatty acids by sterol O-acyltransferases (SOATs). The esterification reactions are allosterically activated by their sterol substrates, the majority of which accumulate at the plasma membrane. We demonstrate that in yeast, sterol transport from the plasma membrane to the site of esterification is associated with the physical interaction of the major SOAT, acyl-coenzyme A:cholesterol acyltransferase (ACAT)-related enzyme (Are)2p, with 2 plasma membrane ATP-binding cassette (ABC) transporters: Aus1p and Pdr11p. Are2p, Aus1p, and Pdr11p, unlike the minor acyltransferase, Are1p, colocalize to sterol and sphingolipid-enriched, detergent-resistant microdomains (DRMs). Deletion of either ABC transporter results in Are2p relocalization to detergent-soluble membrane domains and a significant decrease (53-36%) in esterification of exogenous sterol. Similarly, in murine tissues, the SOAT1/Acat1 enzyme and activity localize to DRMs. This subcellular localization is diminished upon deletion of murine ABC transporters, such as Abcg1, which itself is DRM associated. We propose that the close proximity of sterol esterification and transport proteins to each other combined with their residence in lipid-enriched membrane microdomains facilitates rapid, high-capacity sterol transport and esterification, obviating any requirement for soluble intermediary proteins.

  3. The ATP-binding cassette transporter-2 (ABCA2) regulates esterification of plasma membrane cholesterol by modulation of sphingolipid metabolism.

    PubMed

    Davis, Warren

    2014-01-01

    The ATP-binding cassette transporters are a large family (~48 genes divided into seven families A-G) of proteins that utilize the energy of ATP-hydrolysis to pump substrates across lipid bilayers against a concentration gradient. The ABC "A" subfamily is comprised of 13 members and transport sterols, phospholipids and bile acids. ABCA2 is the most abundant ABC transporter in human and rodent brain with highest expression in oligodendrocytes, although it is also expressed in neurons. Several groups have studied a possible connection between ABCA2 and Alzheimer's disease as well as early atherosclerosis. ABCA2 expression levels have been associated with changes in cholesterol and sphingolipid metabolism. In this paper, we hypothesized that ABCA2 expression level may regulate esterification of plasma membrane-derived cholesterol by modulation of sphingolipid metabolism. ABCA2 overexpression in N2a neuroblastoma cells was associated with an altered bilayer distribution of the sphingolipid ceramide that inhibited acylCoA:cholesterol acyltransferase (ACAT) activity and cholesterol esterification. In contrast, depletion of endogenous ABCA2 in the rat schwannoma cell line D6P2T increased esterification of plasma membrane cholesterol following treatment with exogenous bacterial sphingomyelinase. These findings suggest that control of ABCA2 expression level may be a key locus of regulation for esterification of plasma membrane-derived cholesterol through modulation of sphingolipid metabolism.

  4. Inventory and general analysis of the ATP-binding cassette (ABC) gene superfamily in maize (Zea mays L.).

    PubMed

    Pang, Kaiyuan; Li, Yanjiao; Liu, Menghan; Meng, Zhaodong; Yu, Yanli

    2013-09-10

    The metabolic functions of ATP-binding cassette (or ABC) proteins, one of the largest families of proteins presented in all organisms, have been investigated in many protozoan, animal and plant species. To facilitate more systematic and complicated studies on maize ABC proteins in the future, we present the first complete inventory of these proteins, including 130 open reading frames (ORFs), and provide general descriptions of their classifications, basic structures, typical functions, evolution track analysis and expression profiles. The 130 ORFs were assigned to eight subfamilies based on their structures and homological features. Five of these subfamilies consist of 109 proteins, containing transmembrane domains (TM) performing as transporters. The rest three subfamilies contain 21 soluble proteins involved in various functions other than molecular transport. A comparison of ABC proteins among nine selected species revealed either convergence or divergence in each of the ABC subfamilies. Generally, plant genomes contain far more ABC genes than animal genomes. The expression profiles and evolution track of each maize ABC gene were further investigated, the results of which could provide clues for analyzing their functions. Quantitative real-time polymerase chain reaction experiments (PCR) were conducted to detect induced expression in select ABC genes under several common stresses. This investigation provides valuable information for future research on stress tolerance in plants and potential strategies for enhancing maize production under stressful conditions.

  5. Linsitinib (OSI-906) antagonizes ATP-binding cassette subfamily G member 2 and subfamily C member 10-mediated drug resistance.

    PubMed

    Zhang, Hui; Kathawala, Rishil J; Wang, Yi-Jun; Zhang, Yun-Kai; Patel, Atish; Shukla, Suneet; Robey, Robert W; Talele, Tanaji T; Ashby, Charles R; Ambudkar, Suresh V; Bates, Susan E; Fu, Li-Wu; Chen, Zhe-Sheng

    2014-06-01

    In this study we investigated the effect of linsitinib on the reversal of multidrug resistance (MDR) mediated by the overexpression of the ATP-binding cassette (ABC) subfamily members ABCB1, ABCG2, ABCC1 and ABCC10. Our results indicate for the first time that linsitinib significantly potentiate the effect of anti-neoplastic drugs mitoxantrone (MX) and SN-38 in ABCG2-overexpressing cells; paclitaxel, docetaxel and vinblastine in ABCC10-overexpressing cells. Linsitinib moderately enhanced the cytotoxicity of vincristine in cell lines overexpressing ABCB1, whereas it did not alter the cytotoxicity of substrates of ABCC1. Furthermore, linsitinib significantly increased the intracellular accumulation and decreased the efflux of [(3)H]-MX in ABCG2-overexpressing cells and [(3)H]-paclitaxel in ABCC10-overexpressing cells. However, linsitinib, at a concentration that reversed MDR, did not significantly alter the expression levels of either the ABCG2 or ABCC10 transporter proteins. Furthermore, linsitinib did not significantly alter the intracellular localization of ABCG2 or ABCC10. Moreover, linsitinib stimulated the ATPase activity of ABCG2 in a concentration-dependent manner. Overall, our study suggests that linsitinib attenuates ABCG2- and ABCC10-mediated MDR by directly inhibiting their function as opposed to altering ABCG2 or ABCC10 protein expression.

  6. Multiple ATP-binding cassette transporters are involved in insecticide resistance in the small brown planthopper, Laodelphax striatellus.

    PubMed

    Sun, H; Pu, J; Chen, F; Wang, J; Han, Z

    2017-03-16

    ATP-binding cassette (ABC) transporters are membrane-bound proteins involved in the movement of various substrates, including drugs and insecticides, across the lipid membrane. Demonstration of the role of human ABC transporters in multidrug resistance has led to speculation that they might be an important mechanism controlling the fate of insecticides in insects. However, the role of ABC transporters in insects remains largely unknown. The small brown planthopper, Laodelphax striatellus Fallén, has developed resistance to most of the insecticides used for its control. Our goals were to identify the ABC transporters in La. striatellus and to examine their involvement in resistance mechanisms, using related strains resistant to chlorpyrifos, deltamethrin and imidacloprid, compared with the susceptible strain. Based on the transcriptome of La. striatellus, 40 full-length ABC transporters belonging to the ABCA-ABCH subfamilies were identified. Quantitative PCR revealed that over 20% of genes were significantly up-regulated in different resistant strains, and eight genes from the ABCB/C/D/G subfamilies were up-regulated in all three resistant strains, compared with the susceptible strain. Furthermore, synergism studies showed verapamil significantly enhanced insecticide toxicity in various resistant strains but not in the susceptible strain. These results suggest that ABC transporters might be involved in resistance to multiple insecticides in La. striatellus.

  7. Trapping the transition state of an ATP-binding cassette transporter: Evidence for a concerted mechanism of maltose transport

    PubMed Central

    Chen, Jue; Sharma, Susan; Quiocho, Florante A.; Davidson, Amy L.

    2001-01-01

    High-affinity uptake into bacterial cells is mediated by a large class of periplasmic binding protein-dependent transport systems, members of the ATP-binding cassette superfamily. In the maltose transport system of Escherichia coli, the periplasmic maltose-binding protein binds its substrate maltose with high affinity and, in addition, stimulates the ATPase activity of the membrane-associated transporter when maltose is present. Vanadate inhibits maltose transport by trapping ADP in one of the two nucleotide-binding sites of the membrane transporter immediately after ATP hydrolysis, consistent with its ability to mimic the transition state of the γ-phosphate of ATP during hydrolysis. Here we report that the maltose-binding protein becomes tightly associated with the membrane transporter in the presence of vanadate and simultaneously loses its high affinity for maltose. These results suggest a general model explaining how ATP hydrolysis is coupled to substrate transport in which a binding protein stimulates the ATPase activity of its cognate transporter by stabilizing the transition state. PMID:11171984

  8. Simulated microgravity alters the expression of cytoskeleton- and ATP-binding-related genes in MLO-Y4 osteocytes

    NASA Astrophysics Data System (ADS)

    Chen, Zhihao; Zhao, Fan; Qi, Yiduo; Hu, Lifang; Li, Dijie; Yin, Chong; Su, Peihong; Zhang, Yan; Ma, Jianhua; Qian, Jing; Zhou, Hongpo; Zou, Yiwei; Qian, Airong

    2016-12-01

    Bone undergoes dynamic modelling and remodelling processes, and it requires gravity-mediated mechanical stimulation for the maintenance of mineral content and structure. Osteocytes are the most commonly found cells in the mature bone, and they are sensitive to mechanical changes. The purpose of this study was to investigate the effects of microgravity simulated with a random position machine (RPM) on the gene expression profile of osteocytes. Genes sensitive to RPM treatment were sorted on the basis of biological processes, interactions and signalling pathways. Overall, 504 differentially expressed genes (DEGs) in osteocytes cultured under RPM conditions were found. The DEGs were further analysed using bioinformatics tools such as DAVID and iReport. A total of 15 ATP-binding and cytoskeleton-related genes were further confirmed by quantitative real-time PCR (qRT-PCR). Our findings demonstrate that the RPM affected the expression of genes involved in cytoskeleton remodelling and the energy-transfer process in osteocytes. The identification of mechanosensitive genes may enhance our understanding of the roles of osteocytes in mechanosensation and may provide some potential targets for preventing and treating bone-related diseases.

  9. Identification of mutations in regions corresponding to the two putative nucleotide (ATP)-binding folds of the cystic fibrosis gene

    SciTech Connect

    Kerem, B.; Zielenski, J.; Markiewicz, D.; Bozon, D.; Kennedy, D.; Rommens, J.M. ); Gazit, E. ); Yahav, J. ); Riordan, J.R. ); Collins, F.S. ); Tsui, Lapchee Univ. of Toronto, Ontario )

    1990-11-01

    Additional mutations in the cystic fibrosis (CF) gene were identified in the regions corresponding to the two putative nucleotide (ATP)-binding folds (NBFs) of the predicted polypeptide. The patient cohort included 46 Canadian CF families with well-characterized DNA marker haplotypes spanning the disease locus and several other families from Israel. Eleven mutations were found in the first NBF, 2 were found in the second NBF, but none was found in the R-domain. Seven of the mutations were of the missense type affecting some of the highly conserved amino acid residues in the first NBF; 3 were nonsense mutations; 2 would probably affect mRNA splicing; 2 corresponded to small deletions, including another 3-base-pair deletion different from the major mutation ({delta}F508), which could account for 70% of the CF chromosomes in the population. Nine of these mutations accounted for 12 of the 31 non-{delta}F508 CF chromosomes in the Canadian families. The highly heterogeneous nature of the remaining CF mutations provides important insights into the structure and function of the protein, but it also suggests that DNA-based genetic screening for CF carrier status will not be straightforward.

  10. L1198F Mutation Resensitizes Crizotinib to ALK by Altering the Conformation of Inhibitor and ATP Binding Sites

    PubMed Central

    Li, Jian; Sun, Rong; Wu, Yuehong; Song, Mingzhu; Li, Jia; Yang, Qianye; Chen, Xiaoyi; Bao, Jinku; Zhao, Qi

    2017-01-01

    The efficacy of anaplastic lymphoma kinase (ALK) positive non-small-cell lung cancer (NSCLC) treatment with small molecule inhibitors is greatly challenged by acquired resistance. A recent study reported the newest generation inhibitor resistant mutation L1198F led to the resensitization to crizotinib, which is the first Food and Drug Administration (FDA) approved drug for the treatment of ALK-positive NSCLC. It is of great importance to understand how this extremely rare event occurred for the purpose of overcoming the acquired resistance of such inhibitors. In this study, we exploited molecular dynamics (MD) simulation to dissect the molecular mechanisms. Our MD results revealed that L1198F mutation of ALK resulted in the conformational change at the inhibitor site and altered the binding affinity of ALK to crizotinib and lorlatinib. L1198F mutation also affected the autoactivation of ALK as supported by the identification of His1124 and Tyr1278 as critical amino acids involved in ATP binding and phosphorylation. Our findings are valuable for designing more specific and potent inhibitors for the treatment of ALK-positive NSCLC and other types of cancer. PMID:28245558

  11. Isolation and characterization of the ATP-binding cassette (ABC) transporter system genes from loofah witches' broom phytoplasma.

    PubMed

    Huang, Chun-Lin; Ho, Kuo-Chieh

    2007-10-01

    A clone containing a 3903 bp EcoRI-restriction fragment was obtained from a lambda(ZAP) genomic library of loofah witches' broom (LfWB) phytoplasma by plaque hybridization using a PCR fragment as a probe. Sequence analysis revealed that this fragment contained three open reading frames (ORFs). The deduced amino acid sequences of ORF 1 and ORF 2 showed a high homology with the ATP-binding proteins of the ABC transporter system genes of prokaryotes and eukaryotes, and encoded proteins with a molecular mass of 36 and 30 kDa, respectively. Based on amino acid sequence similarity, secondary structure, hydrophilicity and a signal peptide sequence at the N-terminus, we predicted that ORF 3 might encode a specific solute-binding prolipoprotein of the ABC transporter system with a molecular mass of 62 kDa. The cleavage site of this prolipoprotein signal peptide was similar to those of gram-positive bacteria. In addition to nutrient uptake, ABC transporter systems of bacteria also play a role in signal transduction, drug-resistance and perhaps virulence. The possible implications of the system to the survival and the pathogenesis of phytoplasma were discussed.

  12. Genome-wide analysis of the ATP-binding cassette (ABC) transporter gene family in the silkworm, Bombyx mori.

    PubMed

    Xie, Xiaodong; Cheng, Tingcai; Wang, Genhong; Duan, Jun; Niu, Weihuan; Xia, Qingyou

    2012-07-01

    The ATP-binding cassette (ABC) superfamily is a larger protein family with diverse physiological functions in all kingdoms of life. We identified 53 ABC transporters in the silkworm genome, and classified them into eight subfamilies (A-H). Comparative genome analysis revealed that the silkworm has an expanded ABCC subfamily with more members than Drosophila melanogaster, Caenorhabditis elegans, or Homo sapiens. Phylogenetic analysis showed that the ABCE and ABCF genes were highly conserved in the silkworm, indicating possible involvement in fundamental biological processes. Five multidrug resistance-related genes in the ABCB subfamily and two multidrug resistance-associated-related genes in the ABCC subfamily indicated involvement in biochemical defense. Genetic variation analysis revealed four ABC genes that might be evolving under positive selection. Moreover, the silkworm ABCC4 gene might be important for silkworm domestication. Microarray analysis showed that the silkworm ABC genes had distinct expression patterns in different tissues on day 3 of the fifth instar. These results might provide new insights for further functional studies on the ABC genes in the silkworm genome.

  13. Consensus topography in the ATP binding site of the simian virus 40 and polyomavirus large tumor antigens

    SciTech Connect

    Bradley, M.K.; Smith, T.F.; Lathrop, R.H.; Livingston, D.M.; Webster, T.A.

    1987-06-01

    The location and sequence composition of a consensus element of the nucleotide binding site in both simian virus 40 (SV40) and polyomavirus (PyV) large tumor antigens (T antigens) can be predicted with the assistance of a computer-based pattern-matching system, ARIADNE. The latter was used to optimally align elements of T antigen primary sequence and predicted secondary structure with a descriptor for a mononucleotide binding fold. Additional consensus elements of the nucleotide binding site in these two proteins were derived from comparisons of T antigen primary and predicted secondary structures with x-ray structures of the nucleotide binding sites in four otherwise unrelated proteins. Each of these elements was predicted to be encompassed within a 110-residue segment that is highly conserved between the two T antigens residues 418-528 in SV 40 T antigen and residues 565-675 in PyV. Results of biochemical and immunologic experiments on the nucleotide binding behavior of these proteins using (/sup 32/P)-Amp-labeled SV40 T antigen, were found to be consistent with these predictions. Taken together, the latter have resulted in a topological model of the ATP binding site in these two oncogene products.

  14. Stickleback embryos use ATP-binding cassette transporters as a buffer against exposure to maternally derived cortisol

    PubMed Central

    Bukhari, Syed Abbas; Bell, Alison M.

    2016-01-01

    Offspring from females that experience stressful conditions during reproduction often exhibit altered phenotypes and many of these effects are thought to arise owing to increased exposure to maternal glucocorticoids. While embryos of placental vertebrates are known to regulate exposure to maternal glucocorticoids via placental steroid metabolism, much less is known about how and whether egg-laying vertebrates can control their steroid environment during embryonic development. We tested the hypothesis that threespine stickleback (Gasterosteus aculeatus) embryos can regulate exposure to maternal steroids via active efflux of maternal steroids from the egg. Embryos rapidly (within 72 h) cleared intact steroids, but blocking ATP-binding cassette (ABC) transporters inhibited cortisol clearance. Remarkably, this efflux of cortisol was sufficient to prevent a transcriptional response of embryos to exogenous cortisol. Taken together, these findings suggest that, much like their placental counterparts, developing fish embryos can actively regulate their exposure to maternal cortisol. These findings highlight the fact that even in egg-laying vertebrates, the realized exposure to maternal steroids is mediated by both maternal and embryonic processes and this has important implications for understanding how maternal stress influences offspring development. PMID:26984623

  15. Different mechanisms of extracellular adenosine accumulation by reduction of the external Ca(2+) concentration and inhibition of adenosine metabolism in spinal astrocytes.

    PubMed

    Eguchi, Ryota; Akao, Sanae; Otsuguro, Ken-ichi; Yamaguchi, Soichiro; Ito, Shigeo

    2015-05-01

    Extracellular adenosine is a neuromodulator in the central nervous system. Astrocytes mainly participate in adenosine production, and extracellular adenosine accumulates under physiological and pathophysiological conditions. Inhibition of intracellular adenosine metabolism and reduction of the external Ca(2+) concentration ([Ca(2+)]e) participate in adenosine accumulation, but the precise mechanisms remain unclear. This study investigated the mechanisms underlying extracellular adenosine accumulation in cultured rat spinal astrocytes. The combination of adenosine kinase and deaminase (ADK/ADA) inhibition and a reduced [Ca(2+)]e increased the extracellular adenosine level. ADK/ADA inhibitors increased the level of extracellular adenosine but not of adenine nucleotides, which was suppressed by inhibition of equilibrative nucleoside transporter (ENT) 2. Unlike ADK/ADA inhibition, a reduced [Ca(2+)]e increased the extracellular level not only of adenosine but also of ATP. This adenosine increase was enhanced by ENT2 inhibition, and suppressed by sodium polyoxotungstate (ecto-nucleoside triphosphate diphosphohydrolase inhibitor). Gap junction inhibitors suppressed the increases in adenosine and adenine nucleotide levels by reduction of [Ca(2+)]e. These results indicate that extracellular adenosine accumulation by ADK/ADA inhibition is due to the adenosine release via ENT2, while that by reduction of [Ca(2+)]e is due to breakdown of ATP released via gap junction hemichannels, after which ENT2 incorporates adenosine into the cells.

  16. Optimization of the degenerated interfacial ATP binding site improves the function of disease-related mutant cystic fibrosis transmembrane conductance regulator (CFTR) channels.

    PubMed

    Tsai, Ming-Feng; Jih, Kang-Yang; Shimizu, Hiroyasu; Li, Min; Hwang, Tzyh-Chang

    2010-11-26

    The cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel, an ATP binding cassette (ABC) protein whose defects cause the deadly genetic disease cystic fibrosis (CF), encompasses two nucleotide binding domains (NBD1 and NBD2). Recent studies indicate that in the presence of ATP, the two NBDs coalesce into a dimer, trapping an ATP molecule in each of the two interfacial composite ATP binding sites (site 1 and site 2). Experimental evidence also suggests that CFTR gating is mainly controlled by ATP binding and hydrolysis in site 2, whereas site 1, which harbors several non-canonical substitutions in ATP-interacting motifs, is considered degenerated. The CF-associated mutation G551D, by introducing a bulky and negatively charged side chain into site 2, completely abolishes ATP-induced openings of CFTR. Here, we report a strategy to optimize site 1 for ATP binding by converting two amino acid residues to ABC consensus (i.e. H1348G) or more commonly seen residues in other ABC proteins (i.e. W401Y,W401F). Introducing either one or both of these mutations into G551D-CFTR confers ATP responsiveness for this disease-associated mutant channel. We further showed that the same maneuver also improved the function of WT-CFTR and the most common CF-associated ΔF508 channels, both of which rely on site 2 for gating control. Thus, our results demonstrated that the degenerated site 1 can be rebuilt to complement or support site 2 for CFTR function. Possible approaches for developing CFTR potentiators targeting site 1 will be discussed.

  17. The role of ATP-binding cassette transporter A2 in childhood acute lymphoblastic leukemia multidrug resistance.

    PubMed

    Aberuyi, N; Rahgozar, S; Moafi, A

    2014-01-01

    Acute lymphoblastic leukemia (ALL) is one of the most prevalent hematologic malignancies in children. Although the cure rate of ALL has improved over the past decades, the most important reason for ALL treatment failure is multidrug resistance (MDR) phenomenon. The current study aims to explain the mechanisms involved in multidrug resistance of childhood ALL, and introduces ATP-binding cassette transporterA2 (ABCA2) as an ABC transporter gene which may have a high impact on MDR. Benefiting from articles published inreputable journals from1994 to date and experiments newly performed by our group, a comprehensive review is written about ABCA2 and its role in MDR regarding childhood ALL. ABCA2 transports drugs from the cytoplasm into the lysosomal compartment, where they may become degraded and exported from the cell. The aforementioned mechanism may contribute to MDR. It has been reported that ABCA2 may induce resistance to mitoxantrone, estrogen derivatives and estramustine. It is resistant to the aforementioned compounds. Furthermore, the overexpression ofABCA2 in methotrexate, vinblastine and/or doxorubicin treated Jurkat cells are observed in several publications. The recent study of our group showsthatthe overexpression ofABCA2 gene in children with ALL increases the risk of MDR by 15 times. ABCA2 is the second identified member of the ABCA; ABC transporters' subfamily. ABCA2 gene expression profile is suggested to be an unfavorable prognostic factor in ALL treatment. Better understanding of the MDR mechanisms and the factors involved may improve the therapeutic outcome of ALL by modifying the treatment protocols.

  18. The role of ATP-binding cassette transporter A2 in childhood acute lymphoblastic leukemia multidrug resistance

    PubMed Central

    Aberuyi, N; Rahgozar, S; Moafi, A

    2014-01-01

    Acute lymphoblastic leukemia (ALL) is one of the most prevalent hematologic malignancies in children. Although the cure rate of ALL has improved over the past decades, the most important reason for ALL treatment failure is multidrug resistance (MDR) phenomenon. The current study aims to explain the mechanisms involved in multidrug resistance of childhood ALL, and introduces ATP-binding cassette transporterA2 (ABCA2) as an ABC transporter gene which may have a high impact on MDR. Benefiting from articles published inreputable journals from1994 to date and experiments newly performed by our group, a comprehensive review is written about ABCA2 and its role in MDR regarding childhood ALL. ABCA2 transports drugs from the cytoplasm into the lysosomal compartment, where they may become degraded and exported from the cell. The aforementioned mechanism may contribute to MDR. It has been reported that ABCA2 may induce resistance to mitoxantrone, estrogen derivatives and estramustine. It is resistant to the aforementioned compounds. Furthermore, the overexpression ofABCA2 in methotrexate, vinblastine and/or doxorubicin treated Jurkat cells are observed in several publications. The recent study of our group showsthatthe overexpression ofABCA2 gene in children with ALL increases the risk of MDR by 15 times. ABCA2 is the second identified member of the ABCA; ABC transporters' subfamily. ABCA2 gene expression profile is suggested to be an unfavorable prognostic factor in ALL treatment. Better understanding of the MDR mechanisms and the factors involved may improve the therapeutic outcome of ALL by modifying the treatment protocols. PMID:25254091

  19. Molecular cloning and functional characterization of an ATP-binding cassette transporter OtrC from Streptomyces rimosus

    PubMed Central

    2012-01-01

    Background The otrC gene of Streptomyces rimosus was previously annotated as an oxytetracycline (OTC) resistance protein. However, the amino acid sequence analysis of OtrC shows that it is a putative ATP-binding cassette (ABC) transporter with multidrug resistance function. To our knowledge, none of the ABC transporters in S. rimosus have yet been characterized. In this study, we aimed to characterize the multidrug exporter function of OtrC and evaluate its relevancy to OTC production. Results In order to investigate OtrC’s function, otrC is cloned and expressed in E. coli The exporter function of OtrC was identified by ATPase activity determination and ethidium bromide efflux assays. Also, the susceptibilities of OtrC-overexpressing cells to several structurally unrelated drugs were compared with those of OtrC-non-expressing cells by minimal inhibitory concentration (MIC) assays, indicating that OtrC functions as a drug exporter with a broad range of drug specificities. The OTC production was enhanced by 1.6-fold in M4018 (P = 0.000877) and 1.4-fold in SR16 (P = 0.00973) duplication mutants, while it decreased to 80% in disruption mutants (P = 0.0182 and 0.0124 in M4018 and SR16, respectively). Conclusions The results suggest that OtrC is an ABC transporter with multidrug resistance function, and plays an important role in self-protection by drug efflux mechanisms. This is the first report of such a protein in S. rimosus, and otrC could be a valuable target for genetic manipulation to improve the production of industrial antibiotics. PMID:22906146

  20. Functional Characterization of ATP-Binding Cassette Transporter A3 Mutations from Infants with Respiratory Distress Syndrome.

    PubMed

    Wambach, Jennifer A; Yang, Ping; Wegner, Daniel J; Heins, Hillary B; Kaliberova, Lyudmila N; Kaliberov, Sergey A; Curiel, David T; White, Frances V; Hamvas, Aaron; Hackett, Brian P; Cole, F Sessions

    2016-11-01

    Mutations in the ATP-binding cassette transporter A3 gene (ABCA3) result in severe neonatal respiratory distress syndrome and childhood interstitial lung disease. As most ABCA3 mutations are rare or private, determination of mutation pathogenicity is often based on results from in silico prediction tools, identification in unrelated diseased individuals, statistical association studies, or expert opinion. Functional biologic studies of ABCA3 mutations are needed to confirm mutation pathogenicity and inform clinical decision making. Our objective was to functionally characterize two ABCA3 mutations (p.R288K and p.R1474W) identified among term and late-preterm infants with respiratory distress syndrome with unclear pathogenicity in a genetically versatile model system. We performed transient transfection of HEK293T cells with wild-type or mutant ABCA3 alleles to assess protein processing with immunoblotting. We used transduction of A549 cells with adenoviral vectors, which concurrently silenced endogenous ABCA3 and expressed either wild-type or mutant ABCA3 alleles (p.R288K and p.R1474W) to assess immunofluorescent localization, ATPase activity, and organelle ultrastructure. Both ABCA3 mutations (p.R288K and p.R1474W) encoded proteins with reduced ATPase activity but with normal intracellular localization and protein processing. Ultrastructural phenotypes of lamellar body-like vesicles in A549 cells transduced with mutant alleles were similar to wild type. Mutant proteins encoded by ABCA3 mutations p.R288K and p.R1474W had reduced ATPase activity, a biologically plausible explanation for disruption of surfactant metabolism by impaired phospholipid transport into the lamellar body. These results also demonstrate the usefulness of a genetically versatile, human model system for functional characterization of ABCA3 mutations with unclear pathogenicity.

  1. Computational characterization of TTHA0379: A potential glycerophosphocholine binding protein of Ugp ATP-binding cassette transporter.

    PubMed

    Chandravanshi, Monika; Gogoi, Prerana; Kanaujia, Shankar Prasad

    2016-11-05

    For the de novo biosynthesis of phospholipids, byproducts such as sn-glycerol-3-phosphate (G3P) and glycerophosphocholine (GPC) of glycerophospholipid metabolic pathway are imported inside the cell by an ATP-binding cassette (ABC) transporter known as UgpABCE. Of which, UgpA and UgpE constitutes the transmembrane domains (TMDs), UgpC forms the dimer of ATP-hydrolyzing component and UgpB is the periplasmic substrate binding protein. Structurally, UgpABCE transporter displays similarity to the maltose ABC transporter of Escherichia coli; thus, has been grouped into the CUT1 (Carbohydrate Uptake Transporter-1) family of bacterial ABC transporters. Being a member of CUT1 family, several Ugp (Uptake glycerol phosphate) protein sequences in biological database(s) exhibit sequence and structure similarity to sugar ABC transporters and have been annotated as sugar binding proteins; one of such proteins is TTHA0379 from Thermus thermophilus HB8. Here, in this study, we used computational method(s) to distinguish UgpB and sugar binding proteins based on their primary and tertiary structure features. A comprehensive analysis of these proteins indicates that they are evolutionarily related to each other having common conserved features at their primary and tertiary structure levels. However, they display differences at their active sites owing to the dissimilarity in their ligand preferences. In addition, phylogenetic analysis of TTHA0379 along with UgpB and sugar binding proteins reveals that both the groups of proteins forms two distinct clades and TTHA0379 groups with UgpB proteins. Furthermore, analysis of the ligand binding pocket shows that all the essential features of glycerophosphocholine binding protein i.e. UgpB, are conserved in TTHA0379 as well. Combining these features, here, we designate TTHA0379 to be a GPC binding protein.

  2. Alternating access to the transmembrane domain of the ATP-binding cassette protein cystic fibrosis transmembrane conductance regulator (ABCC7).

    PubMed

    Wang, Wuyang; Linsdell, Paul

    2012-03-23

    The cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel is a member of the ATP-binding cassette (ABC) protein family, most members of which act as active transporters. Actively transporting ABC proteins are thought to alternate between "outwardly facing" and "inwardly facing" conformations of the transmembrane substrate pathway. In CFTR, it is assumed that the outwardly facing conformation corresponds to the channel open state, based on homology with other ABC proteins. We have used patch clamp recording to quantify the rate of access of cysteine-reactive probes to cysteines introduced into two different transmembrane regions of CFTR from both the intracellular and extracellular solutions. Two probes, the large [2-sulfonatoethyl]methanethiosulfonate (MTSES) molecule and permeant Au(CN)(2)(-) ions, were applied to either side of the membrane to modify cysteines substituted for Leu-102 (first transmembrane region) and Thr-338 (sixth transmembrane region). Channel opening and closing were altered by mutations in the nucleotide binding domains of the channel. We find that, for both MTSES and Au(CN)(2)(-), access to these two cysteines from the cytoplasmic side is faster in open channels, whereas access to these same sites from the extracellular side is faster in closed channels. These results are consistent with alternating access to the transmembrane regions, however with the open state facing inwardly and the closed state facing outwardly. Our findings therefore prompt revision of current CFTR structural and mechanistic models, as well as having broader implications for transport mechanisms in all ABC proteins. Our results also suggest possible locations of both functional and dysfunctional ("vestigial") gates within the CFTR permeation pathway.

  3. Osimertinib (AZD9291) Attenuates the Function of Multidrug Resistance-Linked ATP-Binding Cassette Transporter ABCB1 in Vitro.

    PubMed

    Hsiao, Sung-Han; Lu, Yu-Jen; Li, Yan-Qing; Huang, Yang-Hui; Hsieh, Chia-Hung; Wu, Chung-Pu

    2016-06-06

    The effectiveness of cancer chemotherapy is often circumvented by multidrug resistance (MDR) caused by the overexpression of ATP-binding cassette (ABC) drug transporter ABCB1 (MDR1, P-glycoprotein). Several epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs) have been shown previously capable of modulating the function of ABCB1 and reversing ABCB1-mediated MDR in human cancer cells. Furthermore, some TKIs are transported by ABCB1, which results in low oral bioavailability, reduced distribution, and the development of acquired resistance to these TKIs. In this study, we investigated the interaction between ABCB1 and osimertinib, a novel selective, irreversible third-generation EGFR TKI that has recently been approved by the U.S. Food and Drug Administration. We also evaluated the potential impact of ABCB1 on the efficacy of osimertinib in cancer cells, which can present a therapeutic challenge to clinicians in the future. We revealed that although osimertinib stimulates the ATPase activity of ABCB1, overexpression of ABCB1 does not confer resistance to osimertinib. Our results suggest that it is unlikely that the overexpression of ABCB1 can be a major contributor to the development of osimertinib resistance in cancer patients. More significantly, we revealed an additional action of osimertinib that directly inhibits the function of ABCB1 without affecting the expression level of ABCB1, enhances drug-induced apoptosis, and reverses the MDR phenotype in ABCB1-overexpressing cancer cells. Considering that osimertinib is a clinically approved third-generation EGFR TKI, our findings suggest that a combination therapy with osimertinib and conventional anticancer drugs may be beneficial to patients with MDR tumors.

  4. Genome-Wide Identification, Evolution, and Expression Analysis of the ATP-Binding Cassette Transporter Gene Family in Brassica rapa

    PubMed Central

    Yan, Chao; Duan, Weike; Lyu, Shanwu; Li, Ying; Hou, Xilin

    2017-01-01

    ATP-binding cassette (ABC) proteins can act as transporters of different substrates across biological membranes by hydrolyzing ATP. However, little information is available about ABC transporters in Brassica rapa, an important leafy vegetable. In the present study, we carried out genome-wide identification, characterization and molecular evolution analyses of ABC gene family in B. rapa and 9 other plant species. A total of 179 B. rapa ABC genes (BraABCs) were identified. Among them, 173 BraABCs were identified on 10 chromosomes. Based on phylogenetic analysis and domain organization, the BraABC family could be grouped into eight subfamilies. BraABCs in the same subfamily showed similar motif composition and exon-intron organization. Common and unique cis-elements involved in the transcriptional regulation were also identified in the promoter regions of BraABCs. Tissue-expression analysis of BraABCs demonstrated their diverse spatiotemporal expression profiles. Influences of the whole genome triplication (WGT) on the evolution of BraABCs were studied in detail. BraABCs were preferentially retained compared with their neighboring genes during diploidization after WGT. Synteny analysis identified 76 pairs of syntenic BraABC paralogs among the three subgenomes of B. rapa, and 10 paralog pairs underwent positive selection with ω (= Ka/Ks) ratios greater than 1. Analyses of the expression patterns of syntenic BraABC paralogs pairs across five tissues and under stress treatments revealed their functional conservation, sub-functionalization, neo-functionalization and pseudogenization during evolution. Our study presents a comprehensive overview of the ABC gene family in B. rapa and will be helpful for the further functional study of BraABCs in plant growth, development, and stress responses. PMID:28367152

  5. A Survey of the ATP-Binding Cassette (ABC) Gene Superfamily in the Salmon Louse (Lepeophtheirus salmonis)

    PubMed Central

    Heumann, Jan; Taggart, John B.; Gharbi, Karim; Bron, James E.; Bekaert, Michaël; Sturm, Armin

    2015-01-01

    Salmon lice, Lepeophtheirus salmonis (Krøyer, 1837), are fish ectoparasites causing significant economic damage in the mariculture of Atlantic salmon, Salmo salar Linnaeus, 1758. The control of L. salmonis at fish farms relies to a large extent on treatment with anti-parasitic drugs. A problem related to chemical control is the potential for development of resistance, which in L. salmonis is documented for a number of drug classes including organophosphates, pyrethroids and avermectins. The ATP-binding cassette (ABC) gene superfamily is found in all biota and includes a range of drug efflux transporters that can confer drug resistance to cancers and pathogens. Furthermore, some ABC transporters are recognised to be involved in conferral of insecticide resistance. While a number of studies have investigated ABC transporters in L. salmonis, no systematic analysis of the ABC gene family exists for this species. This study presents a genome-wide survey of ABC genes in L. salmonis for which, ABC superfamily members were identified through homology searching of the L. salmonis genome. In addition, ABC proteins were identified in a reference transcriptome of the parasite generated by high-throughput RNA sequencing (RNA-seq) of a multi-stage RNA library. Searches of both genome and transcriptome allowed the identification of a total of 33 genes / transcripts coding for ABC proteins, of which 3 were represented only in the genome and 4 only in the transcriptome. Eighteen sequences were assigned to ABC subfamilies known to contain drug transporters, i.e. subfamilies B (4 sequences), C (11) and G (2). The results suggest that the ABC gene family of L. salmonis possesses fewer members than recorded for other arthropods. The present survey of the L. salmonis ABC gene superfamily will provide the basis for further research into potential roles of ABC transporters in the toxicity of salmon delousing agents and as potential mechanisms of drug resistance. PMID:26418738

  6. HER2 as therapeutic target for overcoming ATP-binding cassette transporter-mediated chemoresistance in small cell lung cancer.

    PubMed

    Minami, Toshiyuki; Kijima, Takashi; Otani, Yasushi; Kohmo, Satoshi; Takahashi, Ryo; Nagatomo, Izumi; Hirata, Haruhiko; Suzuki, Mayumi; Inoue, Koji; Takeda, Yoshito; Kida, Hiroshi; Tachibana, Isao; Kumanogoh, Atsushi

    2012-04-01

    Small cell lung cancer (SCLC) easily acquires multidrug resistance after successful initial therapy. Overexpression of ATP-binding cassette (ABC) transporters is important for the multidrug resistance. Among them, ABCB1 and ABCG2 are known to be upregulated in chemoresistant SCLC cells. We found that human epidermal growth factor receptor 2 (HER2) expressions are also upregulated in chemoresistant SBC-3/ETP, SBC-3/SN-38, and SBC-3/CDDP cells, compared with chemosensitive SBC-3 cells. Lapatinib, a tyrosine kinase inhibitor of HER2, could not suppress proliferation of these HER2-positive SCLC cells alone but successfully restored chemosensitivity to etoposide and SN-38 with a clinically applicable concentration. The reversal effect of lapatinib was thought to be caused by inhibition of drug efflux pump functions of ABC transporters, although lapatinib itself has been reported to be a substrate for them. Moreover, knocking down of HER2 by an short interfering RNA weakened the effect of lapatinib on ABCB1, indicating the involvement of HER2 in the inhibitory mechanisms. Notably, we showed that caveolin-1 and Src play key roles in modulating ABCB1 function via HER2 inactivation. In SBC-3/ETP cells, dephosphorylation of HER2 by lapatinib activates Src and successively leads to increased caveolin-1 phosphorylation. Through this process, caveolin-1 dissociates from HER2 and strengthens association with ABCB1, and finally impairs the pump functions. Furthermore, we showed that treatment by lapatinib in combination with etoposide or irinotecan significantly suppresses the growth of subcutaneous SBC-3/ETP and SBC-3/SN-38 tumors in mice, respectively. Collectively, these results indicate that combination therapy with lapatinib and cytotoxic agents could conquer ABC transporter-mediated chemoresistance especially in HER2-positive SCLC.

  7. ATP-Binding Cassette (ABC) Transporters of the Human Respiratory Tract Pathogen, Moraxella catarrhalis: Role in Virulence

    PubMed Central

    Murphy, Timothy F; Brauer, Aimee L.; Johnson, Antoinette; Kirkham, Charmaine

    2016-01-01

    Moraxella catarrhalis is a human respiratory tract pathogen that causes otitis media (middle ear infections) in children and respiratory tract infections in adults with chronic obstructive pulmonary disease. In view of the huge global burden of disease caused by M. catarrhalis, the development of vaccines to prevent these infections and better approaches to treatment have become priorities. In previous work, we used a genome mining approach that identified three substrate binding proteins (SBPs) of ATP-binding cassette (ABC) transporters as promising candidate vaccine antigens. In the present study, we performed a comprehensive assessment of 19 SBPs of 15 ABC transporter systems in the M. catarrhalis genome by engineering knockout mutants and studying their role in assays that assess mechanisms of infection. The capacity of M. catarrhalis to survive and grow in the nutrient-limited and hostile environment of the human respiratory tract, including intracellular growth, account in part for its virulence. The results show that ABC transporters that mediate uptake of peptides, amino acids, cations and anions play important roles in pathogenesis by enabling M. catarrhalis to 1) grow in nutrient-limited conditions, 2) invade and survive in human respiratory epithelial cells and 3) persist in the lungs in a murine pulmonary clearance model. The knockout mutants of SBPs and ABC transporters showed different patterns of activity in the assay systems, supporting the conclusion that different SBPs and ABC transporters function at different stages in the pathogenesis of infection. These results indicate that ABC transporters are nutritional virulence factors, functioning to enable the survival of M catarrhalis in the diverse microenvironments of the respiratory tract. Based on the role of ABC transporters as virulence factors of M. catarrhalis, these molecules represent potential drug targets to eradicate the organism from the human respiratory tract. PMID:27391026

  8. A Novel ATP-Binding Cassette Transporter Involved in Multidrug Resistance in the Phytopathogenic Fungus Penicillium digitatum

    PubMed Central

    Nakaune, Ryoji; Adachi, Kiichi; Nawata, Osamu; Tomiyama, Masamitsu; Akutsu, Katsumi; Hibi, Tadaaki

    1998-01-01

    Demethylation inhibitor (DMI)-resistant strains of the plant pathogenic fungus Penicillium digitatum were shown to be simultaneously resistant to cycloheximide, 4-nitroquinoline-N-oxide (4NQO), and acriflavine. A PMR1 (Penicillium multidrug resistance) gene encoding an ATP-binding cassette (ABC) transporter (P-glycoprotein) was cloned from a genomic DNA library of a DMI-resistant strain (LC2) of Penicillium digitatum by heterologous hybridization with a DNA fragment containing an ABC-encoding region from Botrytis cinerea. Sequence analysis revealed significant amino acid homology to the primary structures of PMR1 (protein encoded by the PMR1 gene) and ABC transporters of Saccharomyces cerevisiae (PDR5 and SNQ2), Schizosaccharomyces pombe (HBA2), Candida albicans (CDR1), and Aspergillus nidulans (AtrA and AtrB). Disruption of the PMR1 gene of P. digitatum DMI-resistant strain LC2 demonstrated that PMR1 was an important determinant of resistance to DMIs. The effective concentrations inhibiting radial growth by 50% (EC50s) and the MICs of fenarimol and bitertanol for the PMR1 disruptants (Δpmr1 mutants) were equivalent to those for DMI-sensitive strains. Northern blot analysis indicated that severalfold more PMR1 transcript accumulated in the DMI-resistant strains compared with those in DMI-sensitive strains in the absence of fungicide. In both DMI-resistant and -sensitive strains, transcription of PMR1 was strongly enhanced within 10 min after treatment with the DMI fungicide triflumizole. These results suggested that the toxicant efflux system comprised of PMR1 participates directly in the DMI resistance of the fungus. PMID:9758830

  9. Multidrug resistance in cancer chemotherapy and xenobiotic protection mediated by the half ATP-binding cassette transporter ABCG2.

    PubMed

    Han, B; Zhang, J-T

    2004-01-01

    ABCG2, also termed BCRP/MXR/ABCP, is a half ATP-binding cassette (ABC) transporter expressed on plasma membranes. ABCG2 was independently cloned from placenta as well as cell lines selected for resistance to mitoxantrone or anthracyclines. ABCG2 consists of a nucleotide-binding domain (NBD) at the amino terminus and a transmembrane domain (TMD) at the carboxyl terminus and it is postulated to form a homodimer to perform its biological functions. Over-expression of ABCG2 in cell lines confers resistance on a wide variety of anticancer drugs including mitoxantrone, daunorubicin, doxorubicin, topotecan and epirubicin. The expression of ABCG2 has been implicated in multidrug resistance (MDR) of acute myeloid leukemia and some solid tumors. In addition, ABCG2 can transport several fluorescent dyes or toxins. ABCG2 is found to be expressed in epithelial cells of intestine and colon, liver canaliculi, and renal tubules, where it serves to eliminate the plasma level of orally administered anticancer drugs as well as ingested toxins. ABCG2 is found to be highly expressed in placenta and the luminal surface of microvessel endothelium blood-brain barrier where it may play a role in limiting the penetration of drugs, such as topotecan from the maternal plasma into the fetus and from blood to brain. A variety of inhibitors for ABCG2 including GF120918 may prove useful for sensitizing cancer cells to chemotherapy or altering the distribution of orally administered drug substrates of ABCG2. Interestingly, ABCG2 is also expressed highly in hematopoietic stem cells. However, the function of ABCG2 in stem cells is currently unknown, although it may provide protection to stem cells from a variety of xenobiotics.

  10. The Hypertrophic Cardiomyopathy Myosin Mutation R453C Alters ATP Binding and Hydrolysis of Human Cardiac β-Myosin*

    PubMed Central

    Bloemink, Marieke; Deacon, John; Langer, Stephen; Vera, Carlos; Combs, Ariana; Leinwand, Leslie; Geeves, Michael A.

    2014-01-01

    The human hypertrophic cardiomyopathy mutation R453C results in one of the more severe forms of the myopathy. Arg-453 is found in a conserved surface loop of the upper 50-kDa domain of the myosin motor domain and lies between the nucleotide binding pocket and the actin binding site. It connects to the cardiomyopathy loop via a long α-helix, helix O, and to Switch-2 via the fifth strand of the central β-sheet. The mutation is, therefore, in a position to perturb a wide range of myosin molecular activities. We report here the first detailed biochemical kinetic analysis of the motor domain of the human β-cardiac myosin carrying the R453C mutation. A recent report of the same mutation (Sommese, R. F., Sung, J., Nag, S., Sutton, S., Deacon, J. C., Choe, E., Leinwand, L. A., Ruppel, K., and Spudich, J. A. (2013) Proc. Natl. Acad. Sci. U.S.A. 110, 12607–12612) found reduced ATPase and in vitro motility but increased force production using an optical trap. Surprisingly, our results show that the mutation alters few biochemical kinetic parameters significantly. The exceptions are the rate constants for ATP binding to the motor domain (reduced by 35%) and the ATP hydrolysis step/recovery stroke (slowed 3-fold), which could be the rate-limiting step for the ATPase cycle. Effects of the mutation on the recovery stroke are consistent with a perturbation of Switch-2 closure, which is required for the recovery stroke and the subsequent ATP hydrolysis. PMID:24344137

  11. Variations in ATP-Binding Cassette Transporter Regulation during the Progression of Human Nonalcoholic Fatty Liver DiseaseS⃞

    PubMed Central

    Hardwick, Rhiannon N.; Fisher, Craig D.; Canet, Mark J.; Scheffer, George L.

    2011-01-01

    Transporters located on the sinusoidal and canalicular membranes of hepatocytes regulate the efflux of drugs and metabolites into blood and bile, respectively. Changes in the expression or function of these transporters during liver disease may lead to a greater risk of adverse drug reactions. Nonalcoholic fatty liver disease (NAFLD) is a progressive condition encompassing the relatively benign steatosis and the more severe, inflammatory state of nonalcoholic steatohepatitis (NASH). Here, we present an analysis of the effect of NAFLD progression on the major ATP-binding cassette (ABC) efflux transport proteins ABCC1–6, ABCB1, and ABCG2. Human liver samples diagnosed as normal, steatotic, NASH (fatty), and NASH (not fatty) were analyzed. Increasing trends in mRNA expression of ABCC1, ABCC4–5, ABCB1, and ABCG2 were found with NAFLD progression, whereas protein levels of all transporters exhibited increasing trends with disease progression. Immunohistochemical staining of ABCC3, ABCB1, and ABCG2 revealed no alterations in cellular localization during NAFLD progression. ABCC2 staining revealed an alternative mechanism of regulation in NASH in which the transporter appears to be internalized away from the canalicular membrane. This correlated with a preferential shift in the molecular mass of ABCC2 from 200 to 180 kDa in NASH, which has been shown to be associated with a loss of glycosylation and internalization of the protein. These data demonstrate increased expression of multiple efflux transporters as well as altered cellular localization of ABCC2 in NASH, which may have profound effects on the ability of patients with NASH to eliminate drugs in an appropriate manner. PMID:21878559

  12. Overexpression and functional characterization of an ABC (ATP-binding cassette) transporter encoded by the genes drrA and drrB of Mycobacterium tuberculosis.

    PubMed Central

    Choudhuri, Baisakhee Saha; Bhakta, Sanjib; Barik, Rajib; Basu, Joyoti; Kundu, Manikuntala; Chakrabarti, Parul

    2002-01-01

    The genes encoding ATP-binding cassette (ABC) transporters occupy 2.5% of the genome of Mycobacterium tuberculosis. However, none of these putative ABC transporters has been characterized so far. We describe the development of expression systems for simultaneous expression of the ATP-binding protein DrrA and the membrane integral protein DrrB which together behave as a functional doxorubicin efflux pump. Doxorubicin uptake in Escherichia coli or Mycobacterium smegmatis expressing DrrAB was inhibited by reserpine, an inhibitor of ABC transporters. The localization of DrrA to the membrane depended on the simultaneous expression of DrrB. ATP binding was positively regulated by doxorubicin and daunorubicin. At the same time, DrrB appeared to be sensitive to proteolysis when expressed alone in the absence of DrrA. Simultaneous expression of the two polypeptides was essential to obtain a functional doxorubicin efflux pump. Expression of DrrAB in E. coli conferred 8-fold increased resistance to ethidium bromide, a cationic compound. 2',7'-bis-(2-Carboxyethyl)-5(6)-carboxyfluorescein (BCECF), a neutral compound, also behaved as a substrate of the reconstituted efflux pump. When expressed in M. smegmatis, DrrAB conferred resistance to a number of clinically relevant, structurally unrelated antibiotics. The resistant phenotype could be reversed by verapamil and reserpine, two potent inhibitors of ABC transporters. PMID:12057006

  13. Hydrolysis at One of the Two Nucleotide-binding Sites Drives the Dissociation of ATP-binding Cassette Nucleotide-binding Domain Dimers

    SciTech Connect

    Zoghbi, M. E.; Altenberg, G. A.

    2013-10-15

    The functional unit of ATP-binding cassette (ABC) transporters consists of two transmembrane domains and two nucleotide-binding domains (NBDs). ATP binding elicits association of the two NBDs, forming a dimer in a head-to-tail arrangement, with two nucleotides “sandwiched” at the dimer interface. Each of the two nucleotide-binding sites is formed by residues from the two NBDs. We recently found that the prototypical NBD MJ0796 from Methanocaldococcus jannaschii dimerizes in response to ATP binding and dissociates completely following ATP hydrolysis. However, it is still unknown whether dissociation of NBD dimers follows ATP hydrolysis at one or both nucleotide-binding sites. Here, we used luminescence resonance energy transfer to study heterodimers formed by one active (donor-labeled) and one catalytically defective (acceptor-labeled) NBD. Rapid mixing experiments in a stop-flow chamber showed that NBD heterodimers with one functional and one inactive site dissociated at a rate indistinguishable from that of dimers with two hydrolysis-competent sites. Comparison of the rates of NBD dimer dissociation and ATP hydrolysis indicated that dissociation followed hydrolysis of one ATP. We conclude that ATP hydrolysis at one nucleotide-binding site drives NBD dimer dissociation.

  14. Relationship between a point mutation S97C in CK1δ protein and its affect on ATP-binding affinity.

    PubMed

    Kumar, Ambuj; Rajendran, Vidya; Sethumadhavan, Rao; Purohit, Rituraj

    2014-01-01

    CK1δ (Casein kinase I isoform delta) is a member of CK1 kinase family protein that mediates neurite outgrowth and the function as brain-specific microtubule-associated protein. ATP binding kinase domain of CK1δ is essential for regulating several key cell cycle signal transduction pathways. Mutation in CK1δ protein is reported to cause cancers and affects normal brain development. S97C mutation in kinase domain of CK1δ protein has been involved to induce breast cancer and ductal carcinoma. We performed molecular docking studies to examine the effect of this mutation on its ATP-binding affinity. Further, we conducted molecular dynamics simulations to understand the structural consequences of S97C mutation over the kinase domain of CK1δ protein. Docking results indicated the loss of ATP-binding affinity of mutant structure, which were further rationalized by molecular dynamics simulations, where a notable loss in 3-D conformation of CK1δ kinase domain was observed in mutant as compared to native. Our results explained the underlying molecular mechanism behind the observed cancer associated phenotype caused by S97C mutation in CK1δ protein.

  15. Discovery of a novel allosteric inhibitor-binding site in ERK5: comparison with the canonical kinase hinge ATP-binding site

    PubMed Central

    Chen, Hongming; Tucker, Julie; Wang, Xiaotao; Gavine, Paul R.; Phillips, Chris; Augustin, Martin A.; Schreiner, Patrick; Steinbacher, Stefan; Preston, Marian; Ogg, Derek

    2016-01-01

    MAP kinases act as an integration point for multiple biochemical signals and are involved in a wide variety of cellular processes such as proliferation, differentiation, regulation of transcription and development. As a member of the MAP kinase family, ERK5 (MAPK7) is involved in the downstream signalling pathways of various cell-surface receptors, including receptor tyrosine kinases and G protein-coupled receptors. In the current study, five structures of the ERK5 kinase domain co-crystallized with ERK5 inhibitors are reported. Interestingly, three of the compounds bind at a novel allosteric binding site in ERK5, while the other two bind at the typical ATP-binding site. Binding of inhibitors at the allosteric site is accompanied by displacement of the P-loop into the ATP-binding site and is shown to be ATP-competitive in an enzymatic assay of ERK5 kinase activity. Kinase selectivity data show that the most potent allosteric inhibitor exhibits superior kinase selectivity compared with the two inhibitors that bind at the canonical ATP-binding site. An analysis of these structures and comparison with both a previously published ERK5–inhibitor complex structure (PDB entry 4b99) and the structures of three other kinases (CDK2, ITK and MEK) in complex with allosteric inhibitors are presented. PMID:27139631

  16. About a switch: how P-glycoprotein (ABCB1) harnesses the energy of ATP binding and hydrolysis to do mechanical work.

    PubMed

    Sauna, Zuben E; Ambudkar, Suresh V

    2007-01-01

    The efflux of drugs by the multidrug transporter P-glycoprotein (Pgp; ABCB1) is one of the principal means by which cancer cells evade chemotherapy and exhibit multidrug resistance. Mechanistic studies of Pgp-mediated transport, however, transcend the importance of this protein per se as they help us understand the transport pathway of the ATP-binding cassette proteins in general. The ATP-binding cassette proteins comprise one of the largest protein families, are central to cellular physiology, and constitute important drug targets. The functional unit of Pgp consists of two nucleotide-binding domains (NBD) and two transmembrane domains that are involved in the transport of drug substrates. Early studies postulated that conformational changes as a result of ATP hydrolysis were transmitted to the transmembrane domains bringing about drug transport. More recent structural and biochemical studies on the other hand suggested that ATP binds at the interface of the two NBDs and induces the formation of a closed dimer, and it has been hypothesized that this dimerization and subsequent ATP hydrolysis powers transport. Based on the mutational and biochemical work on Pgp and structural studies with isolated NBDs, we review proposed schemes for the catalytic cycle of ATP hydrolysis and the transport pathway.

  17. The Deviant ATP-binding Site of the Multidrug Efflux Pump Pdr5 Plays an Active Role in the Transport Cycle*

    PubMed Central

    Furman, Christopher; Mehla, Jitender; Ananthaswamy, Neeti; Arya, Nidhi; Kulesh, Bridget; Kovach, Ildiko; Ambudkar, Suresh V.; Golin, John

    2013-01-01

    Pdr5 is the founding member of a large subfamily of evolutionarily distinct, clinically important fungal ABC transporters containing a characteristic, deviant ATP-binding site with altered Walker A, Walker B, Signature (C-loop), and Q-loop residues. In contrast to these motifs, the D-loops of the two ATP-binding sites have similar sequences, including a completely conserved aspartate residue. Alanine substitution mutants in the deviant Walker A and Signature motifs retain significant, albeit reduced, ATPase activity and drug resistance. The D-loop residue mutants D340A and D1042A showed a striking reduction in plasma membrane transporter levels. The D1042N mutation localized properly had nearly WT ATPase activity but was defective in transport and was profoundly hypersensitive to Pdr5 substrates. Therefore, there was a strong uncoupling of ATPase activity and drug efflux. Taken together, the properties of the mutants suggest an additional, critical intradomain signaling role for deviant ATP-binding sites. PMID:24019526

  18. Long-range coupling between the extracellular gates and the intracellular ATP binding domains of multidrug resistance protein pumps and cystic fibrosis transmembrane conductance regulator channels

    PubMed Central

    Wei, Shipeng; Roessler, Bryan C.; Icyuz, Mert; Chauvet, Sylvain; Tao, Binli; Hartman, John L.; Kirk, Kevin L.

    2015-01-01

    The ABCC transporter subfamily includes pumps, the long and short multidrug resistance proteins (MRPs), and an ATP-gated anion channel, the cystic fibrosis transmembrane conductance regulator (CFTR). We show that despite their thermodynamic differences, these ABCC transporter subtypes use broadly similar mechanisms to couple their extracellular gates to the ATP occupancies of their cytosolic nucleotide binding domains. A conserved extracellular phenylalanine at this gate was a prime location for producing gain of function (GOF) mutants of a long MRP in yeast (Ycf1p cadmium transporter), a short yeast MRP (Yor1p oligomycin exporter), and human CFTR channels. Extracellular gate mutations rescued ATP binding mutants of the yeast MRPs and CFTR by increasing ATP sensitivity. Control ATPase-defective MRP mutants could not be rescued by this mechanism. A CFTR double mutant with an extracellular gate mutation plus a cytosolic GOF mutation was highly active (single-channel open probability >0.3) in the absence of ATP and protein kinase A, each normally required for CFTR activity. We conclude that all 3 ABCC transporter subtypes use similar mechanisms to couple their extracellular gates to ATP occupancy, and highly active CFTR channels that bypass defects in ATP binding or phosphorylation can be produced.—Wei, S., Roessler, B. C., Icyuz, M., Chauvet, S., Tao, B., Hartman IV, J. L., Kirk, K. L. Long-range coupling between the extracellular gates and the intracellular ATP binding domains of multidrug resistance protein pumps and cystic fibrosis transmembrane conductance regulator channels. PMID:26606940

  19. Effects of a fixed-intensity of endurance training and pistacia atlantica supplementation on ATP-binding cassette G4 expression

    PubMed Central

    2013-01-01

    Background Adenosine triphosphate-cassette binding protein (ABC) type G is considered as a part of reverse cholesterol transport (RCT) process in modification and metabolism of plasma and tissue cholesterol. This study aims to evaluate the effect of endurance training with or without Pistacia atlantica (Baneh) supplementation on the female rat tissues ABC type G expression and its correlation with plasma high-density lipoprotein cholesterol (HDL-C) concentration. Methods Twenty Wistar rats (six to eight weeks old, 125–135 g weight) were arbitrarily allocated into training (n = 10) and control (n = 10) groups and further divided into saline-control (n = 5), saline-training (n = 5), Baneh-control (n = 5), and Baneh-training (n = 5). The training groups were given exercise on a motor-driven treadmill at 25 m/min (0% grade) for 60 min/day, 5 days/week for eight weeks. The rats were fed orally with Baneh extract and saline for six weeks. Seventy-two hours after the last training session, the rats were sacrificed and their tissues were excised for tissues ABCG4 expression which was detected by Real-time PCR method. Results The ABCG4 gene expressions were significantly higher in liver (P = 02), small intestine (P = 06), and visceral fat tissues (P = 04) of the trained rats compared to the tissues of the control rats, but were lower in Baneh treated rats (liver P = 045, small intestine P = 06 and visceral fat P = 004) with lower HDL-C concentrations (P = 008). Conclusions The Baneh administration lowered tissues ABCG4 expression and plasma HDL-C concentrations while endurance training increased the expression in female rat tissues. PMID:24267473

  20. The bovine ATP-binding cassette transporter ABCG2 Tyr581Ser single-nucleotide polymorphism increases milk secretion of the fluoroquinolone danofloxacin.

    PubMed

    Otero, Jon A; Real, Rebeca; de la Fuente, Álvaro; Prieto, Julio G; Marqués, Margarita; Álvarez, Ana I; Merino, Gracia

    2013-03-01

    The bovine adenosine triphosphate-binding cassette transporter G2 (ABCG2/breast cancer resistance protein) polymorphism Tyr581Ser (Y581S) has recently been shown to increase in vitro transepithelial transport of antibiotics. Since this transporter has been extensively related to the active secretion of drugs into milk, the potential in vivo effect of this polymorphism on secretion of xenobiotics in livestock could have striking consequences for milk production, the dairy industry, and public health. Our purpose was to study the in vivo effect of this polymorphism on the secretion of danofloxacin, a widely used veterinary antibiotic, into milk. Danofloxacin (1.25 mg/kg) was administered to six Y/Y 581 homozygous and six Y/S 581 heterozygous lactating cows, and plasma and milk samples were collected and analyzed by high-performance liquid chromatography. No differences were found in the pharmacokinetic parameters of danofloxacin in plasma between the two groups of animals. In contrast, Y/S heterozygous cows showed a 2-fold increase in danofloxacin levels in milk. In addition, the pharmacokinetic elimination parameters, mean residence time and elimination half-life, were significantly lower in the milk of the animals carrying the Y/S polymorphism. These in vivo results are in agreement with our previously published in vitro data, which showed a greater capacity of the S581 variant in accumulation assays, and demonstrate, for the first time, an important effect of the Y581S single-nucleotide polymorphism on antibiotic secretion into cow milk. These findings could be extended to other ABCG2 substrates, and may be relevant for the treatment of mastitis and for the design of accurate and novel strategies to handle milk residues.

  1. Up-Regulation of the ATP-Binding Cassette Transporter A1 Inhibits Hepatitis C Virus Infection

    PubMed Central

    Gondeau, Claire; Douam, Florian; Lebreton, Stéphanie; Lagaye, Sylvie; Pol, Stanislas; Helle, François; Plengpanich, Wanee; Guérin, Maryse; Bourgine, Maryline; Michel, Marie Louise; Lavillette, Dimitri; Roingeard, Philippe; le Goff, Wilfried; Budkowska, Agata

    2014-01-01

    Hepatitis C virus (HCV) establishes infection using host lipid metabolism pathways that are thus considered potential targets for indirect anti-HCV strategies. HCV enters the cell via clathrin-dependent endocytosis, interacting with several receptors, and virus-cell fusion, which depends on acidic pH and the integrity of cholesterol-rich domains of the hepatocyte membrane. The ATP-binding Cassette Transporter A1 (ABCA1) mediates cholesterol efflux from hepatocytes to extracellular Apolipoprotein A1 and moves cholesterol within cell membranes. Furthermore, it generates high-density lipoprotein (HDL) particles. HDL protects against arteriosclerosis and cardiovascular disease. We show that the up-regulation of ABCA1 gene expression and its cholesterol efflux function in Huh7.5 hepatoma cells, using the liver X receptor (LXR) agonist GW3965, impairs HCV infection and decreases levels of virus produced. ABCA1-stimulation inhibited HCV cell entry, acting on virus-host cell fusion, but had no impact on virus attachment, replication, or assembly/secretion. It did not affect infectivity or properties of virus particles produced. Silencing of the ABCA1 gene and reduction of the specific cholesterol efflux function counteracted the inhibitory effect of the GW3965 on HCV infection, providing evidence for a key role of ABCA1 in this process. Impaired virus-cell entry correlated with the reorganisation of cholesterol-rich membrane microdomains (lipid rafts). The inhibitory effect could be reversed by an exogenous cholesterol supply, indicating that restriction of HCV infection was induced by changes of cholesterol content/distribution in membrane regions essential for virus-cell fusion. Stimulation of ABCA1 expression by GW3965 inhibited HCV infection of both human primary hepatocytes and isolated human liver slices. This study reveals that pharmacological stimulation of the ABCA1-dependent cholesterol efflux pathway disrupts membrane cholesterol homeostasis, leading to the

  2. Poloxamines display a multiple inhibitory activity of ATP-binding cassette (ABC) transporters in cancer cell lines.

    PubMed

    Cuestas, María L; Sosnik, Alejandro; Mathet, Verónica L

    2011-08-01

    Primary hepatocellular carcinoma is the third most common fatal cancer worldwide with more than 500,000 annual deaths. Approximately 40% of the patients with HCC showed tumoral overexpression of transmembrane proteins belonging to the ATP-binding cassette protein superfamily (ABC) which pump drugs out of cells. The overexpression of these efflux transporters confers on the cells a multiple drug resistance phenotype, which is considered a crucial cause of treatment refractoriness in patients with cancer. The aim of this study was to investigate the inhibitory effect of different concentrations of pH- and temperature-responsive X-shaped poly(ethylene oxide)-poly(propylene oxide) block copolymers (poloxamines, Tetronic, PEO-PPO) showing a wide range of molecular weights and EO/PO ratios on the functional activity of three different ABC proteins, namely P-glycoprotein (P-gp or MDR1), breast cancer resistance protein (BCRP), and multidrug resistance-associated protein MRP1, in two human hepatocarcinoma cell lines, HepG2 and Huh7. First, the cytotoxicity of the different copolymers (at different concentrations) on both liver carcinoma cell lines was thoroughly evaluated by means of apoptosis analysis using annexin V and propidium iodide (PI). Thus, viable cells (AV-/PI-), early apoptotic cells (AV+/PI-) and late apoptotic cells (V-FITC+/PI+) were identified. Results pointed out copolymers of intermediate to high hydrophobicity and intermediate molecular weight (e.g., T904) as the most cytotoxic. Then, DiOC2, rhodamine 123 and vinblastine were used as differential substrates of these pumps. HeLa, an epithelial cell line of human cervical cancer that does not express P-gp, was used exclusively as a control and enabled the discerning between P-gp and MRP1 inhibition. Moderate to highly hydrophobic poloxamines T304, T904 and T1301 showed inhibitory activity against P-gp and BCRP but not against MRP1 in both hepatic cell lines. A remarkable dependence of this effect on the

  3. Multiple-step kinetic mechanism of DNA-independent ATP binding and hydrolysis by Escherichia coli replicative helicase DnaB protein: quantitative analysis using the rapid quench-flow method.

    PubMed

    Rajendran, S; Jezewska, M J; Bujalowski, W

    2000-11-10

    The kinetic mechanism of DNA-independent binding and hydrolysis of ATP by the E. coli replicative helicase DnaB protein has been quantitatively examined using the rapid quench-flow technique. Single-turnover studies of ATP hydrolysis, in a non-interacting active site of the helicase, indicate that bimolecular association of ATP with the site is followed by the reversible hydrolysis of nucleotide triphosphate and subsequent conformational transition of the enzyme-product complex. The simplest mechanism, which describes the data, is a three-step sequential process defined by:¿eqalign¿¿¿rm Helicase+ATP¿&¿mathop¿¿rightleftharpoons¿ ¿k_1¿_¿k_¿-1¿¿¿¿rm (H-ATP)¿¿mathop¿¿rightleftharpoons¿ ¿k_2¿_¿k_¿-2¿¿¿¿rm (H-ADP¿cdot Pi)¿¿cr &¿mathop¿¿rightleftharpoons¿ ¿k_3¿_¿k_¿-3¿¿¿¿rm (H-ADP¿cdot Pi)¿ *¿The sequential character of the mechanism excludes conformational transitions of the DnaB helicase prior to ATP binding. Analysis of relaxation times and amplitudes of the reaction allowed us to estimate all rate and equilibrium constants of partial steps of the proposed mechanism. The intrinsic binding constant for the formation of the (H-ATP) complex is K(ATP)=(1.3+/-0.5)x10(5) M(-1). The analysis of the data indicates that a part of the ATP binding energy originates from induced structural changes of the DnaB protein-ATP complex prior to ATP hydrolysis. The equilibrium constant of the chemical interconversion is K(H)=k(2)/k(-2) approximately 2 while the subsequent conformational transition is characterized by K(3)=k(3)/k(-3) approximately 30. The low value of K(H) and the presence of the subsequent energetically favorable conformational step(s) strongly suggest that free energy is released from the enzyme-product complex in the conformational transitions following the chemical step and before the product release.The combined application of single and multiple-turnover approaches show that all six nucleotide-binding sites of the Dna

  4. Halobacterial adenosine triphosphatases and the adenosine triphosphatase from Halobacterium saccharovorum

    NASA Technical Reports Server (NTRS)

    Kristjansson, Hordur; Sadler, Martha H.; Hochstein, Lawrence I.

    1986-01-01

    Membranes prepared from various members of the genus Halobacterium contained a Triton X-l00 activated adenosine triphosphatase. The enzyme from Halobacterium saccharovorum was unstable in solutions of low ionic strength and maximally active in the presence of 3.5 M NaCl. A variety of nucleotide triphosphates was hydrolyzed. MgADP, the product of ATP hydrolysis, was not hydrolyzed and was a competitive inhibitor with respect to MgATP. The enzyme from H. saccharovorum was composed of at least 2 and possibly 4 subunits. The 83-kDa and 60-kDa subunits represented about 90 percent of total protein. The 60-kDa subunit reacted with dicyclohexyl-carbodiimide when inhibition was carried out in an acidic medium. The enzyme from H. saccharovorum, possesses properties of an F(1)F(0) as well as an E(1)E(2) ATPase.

  5. Structural Models of Zebrafish (Danio rerio) NOD1 and NOD2 NACHT Domains Suggest Differential ATP Binding Orientations: Insights from Computational Modeling, Docking and Molecular Dynamics Simulations

    PubMed Central

    Maharana, Jitendra; Sahoo, Bikash Ranjan; Bej, Aritra; Sahoo, Jyoti Ranjan; Dehury, Budheswar; Patra, Mahesh Chandra; Martha, Sushma Rani; Balabantray, Sucharita; Pradhan, Sukanta Kumar; Behera, Bijay Kumar

    2015-01-01

    Nucleotide-binding oligomerization domain-containing protein 1 (NOD1) and NOD2 are cytosolic pattern recognition receptors playing pivotal roles in innate immune signaling. NOD1 and NOD2 recognize bacterial peptidoglycan derivatives iE-DAP and MDP, respectively and undergoes conformational alternation and ATP-dependent self-oligomerization of NACHT domain followed by downstream signaling. Lack of structural adequacy of NACHT domain confines our understanding about the NOD-mediated signaling mechanism. Here, we predicted the structure of NACHT domain of both NOD1 and NOD2 from model organism zebrafish (Danio rerio) using computational methods. Our study highlighted the differential ATP binding modes in NOD1 and NOD2. In NOD1, γ-phosphate of ATP faced toward the central nucleotide binding cavity like NLRC4, whereas in NOD2 the cavity was occupied by adenine moiety. The conserved ‘Lysine’ at Walker A formed hydrogen bonds (H-bonds) and Aspartic acid (Walker B) formed electrostatic interaction with ATP. At Sensor 1, Arg328 of NOD1 exhibited an H-bond with ATP, whereas corresponding Arg404 of NOD2 did not. ‘Proline’ of GxP motif (Pro386 of NOD1 and Pro464 of NOD2) interacted with adenine moiety and His511 at Sensor 2 of NOD1 interacted with γ-phosphate group of ATP. In contrast, His579 of NOD2 interacted with the adenine moiety having a relatively inverted orientation. Our findings are well supplemented with the molecular interaction of ATP with NLRC4, and consistent with mutagenesis data reported for human, which indicates evolutionary shared NOD signaling mechanism. Together, this study provides novel insights into ATP binding mechanism, and highlights the differential ATP binding modes in zebrafish NOD1 and NOD2. PMID:25811192

  6. ATP binding and hydrolysis by Saccharomyces cerevisiae Msh2-Msh3 are differentially modulated by mismatch and double-strand break repair DNA substrates.

    PubMed

    Kumar, Charanya; Eichmiller, Robin; Wang, Bangchen; Williams, Gregory M; Bianco, Piero R; Surtees, Jennifer A

    2014-06-01

    In Saccharomyces cerevisiae, Msh2-Msh3-mediated mismatch repair (MMR) recognizes and targets insertion/deletion loops for repair. Msh2-Msh3 is also required for 3' non-homologous tail removal (3'NHTR) in double-strand break repair. In both pathways, Msh2-Msh3 binds double-strand/single-strand junctions and initiates repair in an ATP-dependent manner. However, we recently demonstrated that the two pathways have distinct requirements with respect to Msh2-Msh3 activities. We identified a set of aromatic residues in the nucleotide binding pocket (FLY motif) of Msh3 that, when mutated, disrupted MMR, but left 3'NHTR largely intact. One of these mutations, msh3Y942A, was predicted to disrupt the nucleotide sandwich and allow altered positioning of ATP within the pocket. To develop a mechanistic understanding of the differential requirements for ATP binding and/or hydrolysis in the two pathways, we characterized Msh2-Msh3 and Msh2-msh3Y942A ATP binding and hydrolysis activities in the presence of MMR and 3'NHTR DNA substrates. We observed distinct, substrate-dependent ATP hydrolysis and nucleotide turnover by Msh2-Msh3, indicating that the MMR and 3'NHTR DNA substrates differentially modify the ATP binding/hydrolysis activities of Msh2-Msh3. Msh2-msh3Y942A retained the ability to bind DNA and ATP but exhibited altered ATP hydrolysis and nucleotide turnover. We propose that both ATP and structure-specific repair substrates cooperate to direct Msh2-Msh3-mediated repair and suggest an explanation for the msh3Y942A separation-of-function phenotype.

  7. Structural characterization of an MJ1267 ATP-binding cassette crystal with a complex pattern of twinning caused by promiscuous fiber packing.

    PubMed

    Yuan, Yu-Ren; Martsinkevich, Oskana; Hunt, John F

    2003-02-01

    ATP-binding cassettes represent the motor domains in ABC transporters, a superfamily of integral membrane-protein pumps that couple the hydrolysis of ATP to transmembrane solute translocation. A crystal of a Mg-ADP complex of the MJ1267 ATP-binding cassette was obtained that produced a diffraction pattern characterized by pathological streaking of the spots in the a* x b* plane. While the Laue symmetry of the diffraction pattern was P3;1m, the crystal was determined to be twinned based on intensity statistics, molecular-replacement analysis and difference Fourier analysis of an engineered single-site methylmercury derivative. The unit cell contains three similar 3(1) fibers, with two of them related by primarily translational non-crystallographic symmetry (NCS) and the third related to the first two by approximate twofold screw operations whose rotational components are very similar to the twinning operator. The promiscuous packing of these 3(1) fibers, which make both parallel and antiparallel interactions in the primary crystal lattice, can explain the twinning tendency based on the ability of the twin-related lattices to interact with one another while making only one slightly sub-optimal intermolecular contact per unit cell in the boundary region. The promiscuous fiber packing can also explain the streaking in the diffraction pattern based on the ability to form a variety of different lattices with similar inter-fiber packing interactions. The crystal structure was refined as a twin in space group P3(1) using the program CNS, yielding a free R factor of 28.9% at 2.6 A and a refined twin fraction of 0.50. The structure shows a rigid-body rotation of the ABC-transporter-specific alpha-helical subdomain (ABCalpha subdomain) in MJ1267 compared with the conformation observed for the same protein in a C2 crystal lattice; this observation suggests that the ABCalpha subdomain is flexibly attached to the F1-type ATP-binding core of the ATP-binding cassette when Mg

  8. Evaluation of the role of ATP-binding cassette transporters as a defence mechanism against temephos in populations of Aedes aegypti

    PubMed Central

    Lima, Estelita Pereira; Goulart, Marília Oliveira Fonseca; Rolim, Modesto Leite

    2014-01-01

    The role of ATP-binding cassette (ABC) transporters in the efflux of the insecticide, temephos, was assessed in the larvae of Aedes aegypti. Bioassays were conducted using mosquito populations that were either susceptible or resistant to temephos by exposure to insecticide alone or in combination with sublethal doses of the ABC transporter inhibitor, verapamil (30, 35 and 40 μM). The best result in the series was obtained with the addition of verapamil (40 μM), which led to a 2x increase in the toxicity of temephos, suggesting that ABC transporters may be partially involved in conferring resistance to the populations evaluated.

  9. The rem mutations in the ATP-binding groove of the Rad3/XPD helicase lead to Xeroderma pigmentosum-Cockayne syndrome-like phenotypes.

    PubMed

    Herrera-Moyano, Emilia; Moriel-Carretero, María; Montelone, Beth A; Aguilera, Andrés

    2014-12-01

    The eukaryotic TFIIH complex is involved in Nucleotide Excision Repair and transcription initiation. We analyzed three yeast mutations of the Rad3/XPD helicase of TFIIH known as rem (recombination and mutation phenotypes). We found that, in these mutants, incomplete NER reactions lead to replication fork breaking and the subsequent engagement of the homologous recombination machinery to restore them. Nevertheless, the penetrance varies among mutants, giving rise to a phenotype gradient. Interestingly, the mutations analyzed reside at the ATP-binding groove of Rad3 and in vivo experiments reveal a gain of DNA affinity upon damage of the mutant Rad3 proteins. Since mutations at the ATP-binding groove of XPD in humans are present in the Xeroderma pigmentosum-Cockayne Syndrome (XP-CS), we recreated rem mutations in human cells, and found that these are XP-CS-like. We propose that the balance between the loss of helicase activity and the gain of DNA affinity controls the capacity of TFIIH to open DNA during NER, and its persistence at both DNA lesions and promoters. This conditions NER efficiency and transcription resumption after damage, which in human cells would explain the XP-CS phenotype, opening new perspectives to understand the molecular basis of the role of XPD in human disease.

  10. NpPDR1, a Pleiotropic Drug Resistance-Type ATP-Binding Cassette Transporter from Nicotiana plumbaginifolia, Plays a Major Role in Plant Pathogen Defense1

    PubMed Central

    Stukkens, Yvan; Bultreys, Alain; Grec, Sébastien; Trombik, Tomasz; Vanham, Delphine; Boutry, Marc

    2005-01-01

    Nicotiana plumbaginifolia NpPDR1, a plasma membrane pleiotropic drug resistance-type ATP-binding cassette transporter formerly named NpABC1, has been suggested to transport the diterpene sclareol, an antifungal compound. However, direct evidence for a role of pleiotropic drug resistance transporters in the plant defense is still lacking. In situ immunolocalization and histochemical analysis using the gusA reporter gene showed that NpPDR1 was constitutively expressed in the whole root, in the leaf glandular trichomes, and in the flower petals. However, NpPDR1 expression was induced in the whole leaf following infection with the fungus Botrytis cinerea, and the bacteria Pseudomonas syringae pv tabaci, Pseudomonas fluorescens, and Pseudomonas marginalis pv marginalis, which do not induce a hypersensitive response in N. plumbaginifolia, whereas a weaker response was observed using P. syringae pv syringae, which does induce a hypersensitive response. Induced NpPDR1 expression was more associated with the jasmonic acid than the salicylic acid signaling pathway. These data suggest that NpPDR1 is involved in both constitutive and jasmonic acid-dependent induced defense. Transgenic plants in which NpPDR1 expression was prevented by RNA interference showed increased sensitivity to sclareol and reduced resistance to B. cinerea. These data show that NpPDR1 is involved in pathogen resistance and thus demonstrate a new role for the ATP-binding cassette transporter family. PMID:16126865

  11. The rem Mutations in the ATP-Binding Groove of the Rad3/XPD Helicase Lead to Xeroderma pigmentosum-Cockayne Syndrome-Like Phenotypes

    PubMed Central

    Montelone, Beth A.; Aguilera, Andrés

    2014-01-01

    The eukaryotic TFIIH complex is involved in Nucleotide Excision Repair and transcription initiation. We analyzed three yeast mutations of the Rad3/XPD helicase of TFIIH known as rem (recombination and mutation phenotypes). We found that, in these mutants, incomplete NER reactions lead to replication fork breaking and the subsequent engagement of the homologous recombination machinery to restore them. Nevertheless, the penetrance varies among mutants, giving rise to a phenotype gradient. Interestingly, the mutations analyzed reside at the ATP-binding groove of Rad3 and in vivo experiments reveal a gain of DNA affinity upon damage of the mutant Rad3 proteins. Since mutations at the ATP-binding groove of XPD in humans are present in the Xeroderma pigmentosum-Cockayne Syndrome (XP-CS), we recreated rem mutations in human cells, and found that these are XP-CS-like. We propose that the balance between the loss of helicase activity and the gain of DNA affinity controls the capacity of TFIIH to open DNA during NER, and its persistence at both DNA lesions and promoters. This conditions NER efficiency and transcription resumption after damage, which in human cells would explain the XP-CS phenotype, opening new perspectives to understand the molecular basis of the role of XPD in human disease. PMID:25500814

  12. Exploring new molecular architectures for anion recognition: synthesis and ATP binding properties of new cyclam-based ditopic polyammonium receptors.

    PubMed

    Pouessel, Jacky; Bazzicalupi, Carla; Bencini, Andrea; Bernard, Hélène; Giorgi, Claudia; Handel, Henri; Matera, Irene; Le Bris, Nathalie; Tripier, Raphaël; Valtancoli, Barbara

    2011-06-06

    Synthesis and characterization of three new polyamine receptors, composed of a cyclam unit (cyclam=1,4,8,11-tetraazacyclotetradecane) linked by a 2,6-dimethylpyridinyl spacer to the linear polyamines 1,4,8,11-tetraazaundecane (L1py), 1,4,7-triazaheptane (L2py), and to a quaternary ammonium group (L3py(+)), are reported. All receptors form highly charged polyammonium cations at neutral pH, suitable for anion recognition studies. ATP recognition was analyzed by using potentiometric, calorimetric, (1)H and (31)P NMR measurements in aqueous solution. All receptors form 1:1 adducts with ATP in aqueous solution, stabilized by charge-charge and hydrogen-bonding interactions between their ammonium groups and the anionic triphosphate chain of ATP. The binding ability of the three receptors for ATP increases in the order of L3py(+)

  13. Reversible transport by the ATP-binding cassette multidrug export pump LmrA: ATP synthesis at the expense of downhill ethidium uptake.

    PubMed

    Balakrishnan, Lekshmy; Venter, Henrietta; Shilling, Richard A; van Veen, Hendrik W

    2004-03-19

    The ATP dependence of ATP-binding cassette (ABC) transporters has led to the widespread acceptance that these systems are unidirectional. Interestingly, in the presence of an inwardly directed ethidium concentration gradient in ATP-depleted cells of Lactococcus lactis, the ABC multidrug transporter LmrA mediated the reverse transport (or uptake) of ethidium with an apparent K(t) of 2.0 microm. This uptake reaction was competitively inhibited by the LmrA substrate vinblastine and was significantly reduced by an E314A substitution in the membrane domain of the transporter. Similar to efflux, LmrA-mediated ethidium uptake was inhibited by the E512Q replacement in the Walker B region of the nucleotide-binding domain of the protein, which strongly reduced its drug-stimulated ATPase activity, consistent with published observations for other ABC transporters. The notion that ethidium uptake is coupled to the catalytic cycle in LmrA was further corroborated by studies in LmrA-containing cells and proteoliposomes in which reverse transport of ethidium was associated with the net synthesis of ATP. Taken together, these data demonstrate that the conformational changes required for drug transport by LmrA are (i) not too far from equilibrium under ATP-depleted conditions to be reversed by appropriate changes in ligand concentrations and (ii) not necessarily coupled to ATP hydrolysis, but associated with a reversible catalytic cycle. These findings and their thermodynamic implications shed new light on the mechanism of energy coupling in ABC transporters and have implications for the development of new modulators that could enable reverse transport-associated drug delivery in cells through their ability to uncouple ATP binding/hydrolysis from multidrug efflux.

  14. Maltose-binding protein effectively stabilizes the partially closed conformation of the ATP-binding cassette transporter MalFGK2.

    PubMed

    Weng, Jingwei; Gu, Shuo; Gao, Xin; Huang, Xuhui; Wang, Wenning

    2017-04-05

    Maltose transporter MalFGK2 is a type-I importer in the ATP-binding cassette (ABC) transporter superfamily. Upon the binding of its periplasmic binding protein, MalE, the ATPase activity of MalFGK2 can be greatly enhanced. Crystal structures of the MalFGK2-MalE-maltose complex in a so-called "pretranslocation" ("pre-T") state with a partially closed conformation suggest that the formation of this MalE-stabilized intermediate state is a key step leading to the outward-facing catalytic state. On the contrary, crosslinking and fluorescence studies suggest that ATP binding alone is sufficient to promote the outward-facing catalytic state, thereby doubting the role of MalE binding. To clarify the role of MalE binding and to gain deeper understanding of the molecular mechanisms of MalFGK2, we calculated the free energy surfaces (FESs) related to the lateral motion in the presence and absence of MalE using atomistic metadynamics simulations. The results showed that, in the absence of MalE, laterally closing motion was energetically forbidden but, upon MalE binding, more closed conformations similar to the pre-T state become more stable. The significant effect of MalE binding on the free energy landscapes was in agreement with crystallographic studies and confirmed the important role of MalE in stabilizing the pre-T state. Our simulations also revealed that the allosteric effect of MalE stimulation originates from the MalE-binding-promoted vertical motion between MalF and MalG cores, which was further supported by MD simulation of the MalE-independent mutant MalF500.

  15. Domain Interactions in the Yeast ATP Binding Cassette Transporter Ycf1p: Intragenic Suppressor Analysis of Mutations in the Nucleotide Binding Domains

    PubMed Central

    Falcón-Pérez, Juan M.; Martínez-Burgos, Mónica; Molano, Jesús; Mazón, María J.; Eraso, Pilar

    2001-01-01

    The yeast cadmium factor (Ycf1p) is a vacuolar ATP binding cassette (ABC) transporter required for heavy metal and drug detoxification. Cluster analysis shows that Ycf1p is strongly related to the human multidrug-associated protein (MRP1) and cystic fibrosis transmembrane conductance regulator and therefore may serve as an excellent model for the study of eukaryotic ABC transporter structure and function. Identifying intramolecular interactions in these transporters may help to elucidate energy transfer mechanisms during transport. To identify regions in Ycf1p that may interact to couple ATPase activity to substrate binding and/or movement across the membrane, we sought intragenic suppressors of ycf1 mutations that affect highly conserved residues presumably involved in ATP binding and/or hydrolysis. Thirteen intragenic second-site suppressors were identified for the D777N mutation which affects the invariant Asp residue in the Walker B motif of the first nucleotide binding domain (NBD1). Two of the suppressor mutations (V543I and F565L) are located in the first transmembrane domain (TMD1), nine (A1003V, A1021T, A1021V, N1027D, Q1107R, G1207D, G1207S, S1212L, and W1225C) are found within TMD2, one (S674L) is in NBD1, and another one (R1415G) is in NBD2, indicating either physical proximity or functional interactions between NBD1 and the other three domains. The original D777N mutant protein exhibits a strong defect in the apparent affinity for ATP and Vmax of transport. The phenotypic characterization of the suppressor mutants shows that suppression does not result from restoring these alterations but rather from a change in substrate specificity. We discuss the possible involvement of Asp777 in coupling ATPase activity to substrate binding and/or transport across the membrane. PMID:11466279

  16. ATP utilization by yeast replication factor C. IV. RFC ATP-binding mutants show defects in DNA replication, DNA repair, and checkpoint regulation.

    PubMed

    Schmidt, S L; Pautz, A L; Burgers, P M

    2001-09-14

    Replication factor C is required to load proliferating cell nuclear antigen onto primer-template junctions, using the energy of ATP hydrolysis. Four of the five RFC genes have consensus ATP-binding motifs. To determine the relative importance of these sites for proper DNA metabolism in the cell, the conserved lysine in the Walker A motif of RFC1, RFC2, RFC3, or RFC4 was mutated to either arginine or glutamic acid. Arginine mutations in all RFC genes tested permitted cell growth, although poor growth was observed for rfc2-K71R. A glutamic acid substitution resulted in lethality in RFC2 and RFC3 but not in RFC1 or RFC4. Most double mutants combining mutations in two RFC genes were inviable. Except for the rfc1-K359R and rfc4-K55E mutants, which were phenotypically similar to wild type in every assay, the mutants were sensitive to DNA-damaging agents. The rfc2-K71R and rfc4-K55R mutants show checkpoint defects, most likely in the intra-S phase checkpoint. Regulation of the damage-inducible RNR3 promoter was impaired in these mutants, and phosphorylation of Rad53p in response to DNA damage was specifically defective when cells were in S phase. No dramatic defects in telomere length regulation were detected in the mutants. These data demonstrate that the ATP binding function of RFC2 is important for both DNA replication and checkpoint function and, for the first time, that RFC4 also plays a role in checkpoint regulation.

  17. Localization of Adenosine Triphosphatase Activity on the Chloroplast Envelope in Tendrils of Pisum sativum1

    PubMed Central

    Sabnis, Dinkar D.; Gordon, Mildred; Galston, Arthur W.

    1970-01-01

    When samples of pea tendril tissue were incubated in the Wachstein-Meisel medium for the demonstration of adenosine triphosphatases, deposits of lead reaction product were localized between the membranes of the chloroplast envelope. The presence of Mg2+ was necessary for adenosine triphosphatase activity, and Ca2+ could not substitute for this requirement. Varying the pH of incubation to 5.5 or 9.4 inhibited enzyme activity, as did the addition of p-chloromercuribenzoic acid or N-ethylmaleimide. The adenosine triphosphatase was apparently inactivated or degraded when the plants were grown in the dark for 24 hours prior to incubation. The enzyme was substrate-specific for adenosine triphosphate; no reaction was obtained with adenosine diphosphate, uridine triphosphate, inosine triphosphate, p-nitrophenyl phosphate, and sodium β-glycerophosphate. Sites of nonspecific depositions of lead are described. The adenosine triphosphatase on the chloroplast envelope may be involved in the light-induced contraction of this organelle. Images PMID:4245003

  18. A High-Affinity Adenosine Kinase from Anopheles Gambiae

    SciTech Connect

    M Cassera; M Ho; E Merino; E Burgos; A Rinaldo-Matthis; S Almo; V Schramm

    2011-12-31

    Genome analysis revealed a mosquito orthologue of adenosine kinase in Anopheles gambiae (AgAK; the most important vector for the transmission of Plasmodium falciparum in Africa). P. falciparum are purine auxotrophs and do not express an adenosine kinase but rely on their hosts for purines. AgAK was kinetically characterized and found to have the highest affinity for adenosine (K{sub m} = 8.1 nM) of any known adenosine kinase. AgAK is specific for adenosine at the nucleoside site, but several nucleotide triphosphate phosphoryl donors are tolerated. The AgAK crystal structure with a bound bisubstrate analogue Ap{sub 4}A (2.0 {angstrom} resolution) reveals interactions for adenosine and ATP and the geometry for phosphoryl transfer. The polyphosphate charge is partly neutralized by a bound Mg{sup 2+} ion and an ion pair to a catalytic site Arg. The AgAK structure consists of a large catalytic core in a three-layer {alpha}/{beta}/{alpha} sandwich, and a small cap domain in contact with adenosine. The specificity and tight binding for adenosine arise from hydrogen bond interactions of Asn14, Leu16, Leu40, Leu133, Leu168, Phe168, and Thr171 and the backbone of Ile39 and Phe168 with the adenine ring as well as through hydrogen bond interactions between Asp18, Gly64, and Asn68 and the ribosyl 2'- and 3'-hydroxyl groups. The structure is more similar to that of human adenosine kinase (48% identical) than to that of AK from Toxoplasma gondii (31% identical). With this extraordinary affinity for AgAK, adenosine is efficiently captured and converted to AMP at near the diffusion limit, suggesting an important role for this enzyme in the maintenance of the adenine nucleotide pool. mRNA analysis verifies that AgAK transcripts are produced in the adult insects.

  19. Computer modelling reveals new conformers of the ATP binding loop of Na+/K+-ATPase involved in the transphosphorylation process of the sodium pump

    PubMed Central

    Tejral, Gracian; Sopko, Bruno; Necas, Alois; Schoner, Wilhelm

    2017-01-01

    Hydrolysis of ATP by Na+/K+-ATPase, a P-Type ATPase, catalyzing active Na+ and K+ transport through cellular membranes leads transiently to a phosphorylation of its catalytical α-subunit. Surprisingly, three-dimensional molecular structure analysis of P-type ATPases reveals that binding of ATP to the N-domain connected by a hinge to the P-domain is much too far away from the Asp369 to allow the transfer of ATP’s terminal phosphate to its aspartyl-phosphorylation site. In order to get information for how the transfer of the γ-phosphate group of ATP to the Asp369 is achieved, analogous molecular modeling of the M4–M5 loop of ATPase was performed using the crystal data of Na+/K+-ATPase of different species. Analogous molecular modeling of the cytoplasmic loop between Thr338 and Ile760 of the α2-subunit of Na+/K+-ATPase and the analysis of distances between the ATP binding site and phosphorylation site revealed the existence of two ATP binding sites in the open conformation; the first one close to Phe475 in the N-domain, the other one close to Asp369 in the P-domain. However, binding of Mg2+•ATP to any of these sites in the “open conformation” may not lead to phosphorylation of Asp369. Additional conformations of the cytoplasmic loop were found wobbling between “open conformation” <==> “semi-open conformation <==> “closed conformation” in the absence of 2Mg2+•ATP. The cytoplasmic loop’s conformational change to the “semi-open conformation”—characterized by a hydrogen bond between Arg543 and Asp611—triggers by binding of 2Mg2+•ATP to a single ATP site and conversion to the “closed conformation” the phosphorylation of Asp369 in the P-domain, and hence the start of Na+/K+-activated ATP hydrolysis. PMID:28316890

  20. Lipid absorption defects in intestine-specific microsomal triglyceride transfer protein and ATP-binding cassette transporter A1-deficient mice.

    PubMed

    Iqbal, Jahangir; Parks, John S; Hussain, M Mahmood

    2013-10-18

    We have previously described apolipoprotein B (apoB)-dependent and -independent cholesterol absorption pathways and the role of microsomal triglyceride transfer protein (MTP) and ATP-binding cassette transporter A1 (ABCA1) in these pathways. To assess the contribution of these pathways to cholesterol absorption and to determine whether there are other pathways, we generated mice that lack MTP and ABCA1, individually and in combination, in the intestine. Intestinal deletions of Mttp and Abca1 decreased plasma cholesterol concentrations by 45 and 24%, respectively, whereas their combined deletion reduced it by 59%. Acute cholesterol absorption was reduced by 28% in the absence of ABCA1, and it was reduced by 92-95% when MTP was deleted in the intestine alone or together with ABCA1. MTP deficiency significantly reduced triglyceride absorption, although ABCA1 deficiency had no effect. ABCA1 deficiency did not affect cellular lipids, but Mttp deficiency significantly increased intestinal levels of triglycerides and free fatty acids. Accumulation of intestinal free fatty acids, but not triglycerides, in Mttp-deficient intestines was prevented when mice were also deficient in intestinal ABCA1. Combined deficiency of these genes increased intestinal fatty acid oxidation as a consequence of increased expression of peroxisome proliferator-activated receptor-γ (PPARγ) and carnitine palmitoyltransferase 1α (CPT1α). These studies show that intestinal MTP and ABCA1 are critical for lipid absorption and are the main determinants of plasma and intestinal lipid levels. Reducing their activities might lower plasma lipid concentrations.

  1. Identification and analysis of the sap genes from Vibrio fischeri belonging to the ATP-binding cassette gene family required for peptide transport and resistance to antimicrobial peptides.

    PubMed

    Chen, H Y; Weng, S F; Lin, J W

    2000-03-24

    Partial nucleotide sequences of the sapD and sapF genes of the sap operon (GenBank Accession No. AF178651) from Vibrio fischeri ATCC 7744 have been determined, and the peptide transport system of ATP-binding proteins SapD and SapF encoded by the genes have been deduced. Alignment and comparison of the Sap proteins of V. fischeri, Escherichia coli, Salmonella typhimurium, and Haemophilus influenzae Rd show that these proteins are homologous. The sap operon residing in the genome enables V. fischeri to transport peptides and resist antimicrobial peptides. Nucleotide sequence and functional analyses confirm that the specific regulatory-region-like sequence R&R* that resides inside the sapD gene and before the sapF gene functions in gene expression and regulation; also, it is regulated by the LuxR-AI complex of the V. fischeri lux regulon. The putative upstream activator binding sequences SigmaUASI, SigmaUASII, SigmaUASIII TGTCGACTTGGGCCTCGCTGTCCGTATGCACA (72nd to 103rd bp), TGTCCGTATGCACA (90th to 103rd bp), and TGTTCAAGTACCAGAAAGACA (111st to 133rd bp) in the R&R* sequence, which are similar to the two-component regulator binding sequence TGT-N(8-12)-ACA and the LuxR-AI binding sequence ACCTGTAGGATCGTACAGGT in the regulatory region of the V. fischeri lux regulon, might be the specific sequences recognized by the LuxR-AI complex for enhancement.

  2. Block of ATP-binding cassette B19 ion channel activity by 5-nitro-2-(3-phenylpropylamino)-benzoic acid impairs polar auxin transport and root gravitropism.

    PubMed

    Cho, Misuk; Henry, Elizabeth M; Lewis, Daniel R; Wu, Guosheng; Muday, Gloria K; Spalding, Edgar P

    2014-12-01

    Polar transport of the hormone auxin through tissues and organs depends on membrane proteins, including some B-subgroup members of the ATP-binding cassette (ABC) transporter family. The messenger RNA level of at least one B-subgroup ABCB gene in Arabidopsis (Arabidopsis thaliana), ABCB19, increases upon treatment with the anion channel blocker 5-nitro-2-(3-phenylpropylamino)-benzoic acid (NPPB), possibly to compensate for an inhibitory effect of the drug on ABCB19 activity. Consistent with this hypothesis, NPPB blocked ion channel activity associated with ABCB19 expressed in human embryonic kidney cells as measured by patch-clamp electrophysiology. NPPB inhibited polar auxin transport through Arabidopsis seedling roots similarly to abcb19 mutations. NPPB also inhibited shootward auxin transport, which depends on the related ABCB4 protein. NPPB substantially decreased ABCB4 and ABCB19 protein levels when cycloheximide concomitantly inhibited new protein synthesis, indicating that blockage by NPPB enhances the degradation of ABCB transporters. Impairing the principal auxin transport streams in roots with NPPB caused aberrant patterns of auxin signaling reporters in root apices. Formation of the auxin-signaling gradient across the tips of gravity-stimulated roots, and its developmental consequence (gravitropism), were inhibited by micromolar concentrations of NPPB that did not affect growth rate. These results identify ion channel activity of ABCB19 that is blocked by NPPB, a compound that can now be considered an inhibitor of polar auxin transport with a defined molecular target.

  3. Lobular Distribution and Variability in Hepatic ATP Binding Cassette Protein B1 (ABCB1, P-gp): Ontogenetic Differences and Potential for Toxicity

    PubMed Central

    Abanda, Ngu Njei; Riches, Zoe; Collier, Abby C.

    2017-01-01

    The ATP Binding Cassette B1 (ABCB1) transporter has critical roles in endo- and xenobiotic efficacy and toxicity. To understand population variability in hepatic transport we determined ABCB1 mRNA and protein levels in total liver lysates sampled from 8 pre-defined sites (n = 24, 18–69 years), and in S9 from randomly acquired samples (n = 87, 7 days–87 years). ABCB1 levels did not differ significantly throughout individual livers and showed 4.4-fold protein variation between subjects. Neither mRNA nor protein levels varied with sex, ethnicity, obesity or triglycerides in lysates or S9 (that showed the same relationships), but protein levels were lower in pediatric S9 (p < 0.0001), with 76% of adult ABCB1 present at birth and predicted to mature in 5 years. Pediatric total liver lysates were not available. In summary, opportunistic collection for studying human hepatic ABCB1 is acceptable. Additionally, ABCB1 may be lower in children, indicating differential potential for toxicity and response to therapy in this special population. PMID:28218636

  4. Structural and functional characterization of an orphan ATP-binding cassette ATPase involved in manganese utilization and tolerance in Leptospira spp.

    PubMed

    Benaroudj, Nadia; Saul, Frederick; Bellalou, Jacques; Miras, Isabelle; Weber, Patrick; Bondet, Vincent; Murray, Gerald L; Adler, Ben; Ristow, Paula; Louvel, Hélène; Haouz, Ahmed; Picardeau, Mathieu

    2013-12-01

    Pathogenic Leptospira species are the etiological agents of the widespread zoonotic disease leptospirosis. Most organisms, including Leptospira, require divalent cations for proper growth, but because of their high reactivity, these metals are toxic at high concentrations. Therefore, bacteria have acquired strategies to maintain metal homeostasis, such as metal import and efflux. By screening Leptospira biflexa transposon mutants for their ability to use Mn(2+), we have identified a gene encoding a putative orphan ATP-binding cassette (ABC) ATPase of unknown function. Inactivation of this gene in both L. biflexa and L. interrogans strains led to mutants unable to grow in medium in which iron was replaced by Mn(2+), suggesting an involvement of this ABC ATPase in divalent cation uptake. A mutation in this ATPase-coding gene increased susceptibility to Mn(2+) toxicity. Recombinant ABC ATPase of the pathogen L. interrogans exhibited Mg(2+)-dependent ATPase activity involving a P-loop motif. The structure of this ATPase was solved from a crystal containing two monomers in the asymmetric unit. Each monomer adopted a canonical two-subdomain organization of the ABC ATPase fold with an α/β subdomain containing the Walker motifs and an α subdomain containing the ABC signature motif (LSSGE). The two monomers were arranged in a head-to-tail orientation, forming a V-shaped particle with all the conserved ABC motifs at the dimer interface, similar to functional ABC ATPases. These results provide the first structural and functional characterization of a leptospiral ABC ATPase.

  5. Hop resistance in the beer spoilage bacterium Lactobacillus brevis is mediated by the ATP-binding cassette multidrug transporter HorA.

    PubMed

    Sakamoto, K; Margolles, A; van Veen, H W; Konings, W N

    2001-09-01

    Lactobacillus brevis is a major contaminant of spoiled beer. The organism can grow in beer in spite of the presence of antibacterial hop compounds that give the beer a bitter taste. The hop resistance in L. brevis is, at least in part, dependent on the expression of the horA gene. The deduced amino acid sequence of HorA is 53% identical to that of LmrA, an ATP-binding cassette multidrug transporter in Lactococcus lactis. To study the role of HorA in hop resistance, HorA was functionally expressed in L. lactis as a hexa-histidine-tagged protein using the nisin-controlled gene expression system. HorA expression increased the resistance of L. lactis to hop compounds and cytotoxic drugs. Drug transport studies with L. lactis cells and membrane vesicles and with proteoliposomes containing purified HorA protein identified HorA as a new member of the ABC family of multidrug transporters.

  6. A 20(S)-protopanoxadiol derivative overcomes multi-drug resistance by antagonizing ATP-binding cassette subfamily B member 1 transporter function

    PubMed Central

    Chen, Wantao; Xu, Qin; Xiao, Meng; Hu, Lihong; Mao, Li; Wang, Xu

    2016-01-01

    In cancer cells, failure of chemotherapy is often caused by the ATP-binding cassette subfamily B member 1 (ABCB1), and few drugs have been successfully developed to overcome ABCB1-mediated multi-drug resistance (MDR). To suppress ABCB1 activity, we previously designed and synthesized a new series of derivatives based on 20(S)-protopanoxadiol (PPD). In the present study, we investigated the role of PPD derivatives in the function of ABC transporters. Non-toxic concentrations of the PPD derivative PPD12 sensitized ABCB1-overexpressing cells to their anti-cancer substrates better than either the parental PPD or inactive PPD11. PPD12 increased intracellular accumulation of adriamycin and rhodamine123 in resistant cancer cells. Although PPD12 did not suppress the expression of ABCB1 mRNA or protein, it stimulated the activity of ABCB1 ATPase. Because PPD12 is a competitive inhibitor, it was predicted to bind to the large hydrophobic cavity of homology-modeled human ABCB1. PPD12 also enhanced the efficacy of adriamycin against ABCB1-overexpressing KB/VCR xenografts in nude mice. In conclusion, PPD12 enhances the efficacy of substrate drugs in ABCB1-overexpressing cancer cells. These findings suggest that a combination therapy consisting of PPD12 with conventional chemotherapeutic agents may be an effective treatment for ABCB1-mediated MDR cancer patients. PMID:26824187

  7. Suppression of c-Myc is involved in multi-walled carbon nanotubes' down-regulation of ATP-binding cassette transporters in human colon adenocarcinoma cells.

    PubMed

    Wang, Zhaojing; Xu, Yonghong; Meng, Xiangning; Watari, Fumio; Liu, Hudan; Chen, Xiao

    2015-01-01

    Over-expression of ATP-binding cassette (ABC) transporters, a large family of integral membrane proteins that decrease cellular drug uptake and accumulation by active extrusion, is one of the major causes of cancer multi-drug resistance (MDR) that frequently leads to failure of chemotherapy. Carbon nanotubes (CNTs)-based drug delivery devices hold great promise in enhancing the efficacy of cancer chemotherapy. However, CNTs' effects on the ABC transporters remain under-investigated. In this study, we found that multiwalled carbon nanotubes (MWCNTs) reduced transport activity and expression of ABC transporters including ABCB1/Pgp and ABCC4/MRP4 in human colon adenocarcinoma Caco-2 cells. Proto-oncogene c-Myc, which directly regulates ABC gene expression, was concurrently decreased in MWCNT-treated cells and forced over-expression of c-Myc reversed MWCNTs' inhibitory effects on ABCB1 and ABCC4 expression. MWCNT-cell membrane interaction and cell membrane oxidative damage were observed. However, antioxidants such as vitamin C, β-mecaptoethanol and dimethylthiourea failed to antagonize MWCNTs' down-regulation of ABC transporters. These data suggest that MWCNTs may act on c-Myc, but not through oxidative stress, to down-regulate ABC transporter expression. Our findings thus shed light on CNTs' novel cellular effects that may be utilized to develop CNTs-based drug delivery devices to overcome ABC transporter-mediated cancer chemoresistance.

  8. Hop Resistance in the Beer Spoilage Bacterium Lactobacillus brevis Is Mediated by the ATP-Binding Cassette Multidrug Transporter HorA

    PubMed Central

    Sakamoto, Kanta; Margolles, Abelardo; van Veen, Hendrik W.; Konings, Wil N.

    2001-01-01

    Lactobacillus brevis is a major contaminant of spoiled beer. The organism can grow in beer in spite of the presence of antibacterial hop compounds that give the beer a bitter taste. The hop resistance in L. brevis is, at least in part, dependent on the expression of the horA gene. The deduced amino acid sequence of HorA is 53% identical to that of LmrA, an ATP-binding cassette multidrug transporter in Lactococcus lactis. To study the role of HorA in hop resistance, HorA was functionally expressed in L. lactis as a hexa-histidine-tagged protein using the nisin-controlled gene expression system. HorA expression increased the resistance of L. lactis to hop compounds and cytotoxic drugs. Drug transport studies with L. lactis cells and membrane vesicles and with proteoliposomes containing purified HorA protein identified HorA as a new member of the ABC family of multidrug transporters. PMID:11514522

  9. An ATP Binding Cassette Transporter Is Required for Cuticular Wax Deposition and Desiccation Tolerance in the Moss Physcomitrella patens[W

    PubMed Central

    Buda, Gregory J.; Barnes, William J.; Fich, Eric A.; Park, Sungjin; Yeats, Trevor H.; Zhao, Lingxia; Domozych, David S.; Rose, Jocelyn K.C.

    2013-01-01

    The plant cuticle is thought to be a critical evolutionary adaptation that allowed the first plants to colonize land, because of its key roles in regulating plant water status and providing protection from biotic and abiotic stresses. Much has been learned about cuticle composition and structure through genetic and biochemical studies of angiosperms, as well as underlying genetic pathways, but little is known about the cuticles of early diverging plant lineages. Here, we demonstrate that the moss Physcomitrella patens, an extant relative of the earliest terrestrial plants, has a cuticle that is analogous in both structure and chemical composition to those of angiosperms. To test whether the underlying cuticle biosynthetic pathways were also shared among distant plant lineages, we generated a genetic knockout of the moss ATP binding cassette subfamily G (ABCG) transporter Pp-ABCG7, a putative ortholog of Arabidopsis thaliana ABCG transporters involved in cuticle precursor trafficking. We show that this mutant is severely deficient in cuticular wax accumulation and has a reduced tolerance of desiccation stress compared with the wild type. This work provides evidence that the cuticle was an adaptive feature present in the first terrestrial plants and that the genes involved in their formation have been functionally conserved for over 450 million years. PMID:24163310

  10. Direct evidence in vivo of impaired macrophage-specific reverse cholesterol transport in ATP-binding cassette transporter A1-deficient mice.

    PubMed

    Calpe-Berdiel, Laura; Rotllan, Noemi; Palomer, Xavier; Ribas, Vicent; Blanco-Vaca, Francisco; Escolà-Gil, Joan Carles

    2005-12-30

    The ATP-binding cassette transporter A1 (ABCA1) is a key regulator of high-density lipoprotein (HDL) metabolism. There is strong evidence that ABCA1 is a key regulator of reverse cholesterol transport (RCT). However, this could not be proved in vivo since hepatobiliary cholesterol transport was unchanged in ABCA1-deficient mice (ABCA1-/-). We used ABCA1-/- mice to test the hypothesis that ABCA1 is a critical determinant of macrophage-specific RCT. Although this cell-specific RCT only accounts for a tiny part of total RCT, it is widely accepted that it may have a major impact on atherosclerosis susceptibility. [(3)H]cholesterol-labeled endogenous macrophages were injected intraperitoneally into wild-type ABCA1+/+, ABCA1+/- and ABCA1-/- mice maintained on a chow diet. A direct relationship was observed between ABCA1 gene dose and plasma [(3)H]cholesterol at 24 and 48 h after the injection of tracer into the mice. Forty-eight hours after this injection, ABCA1-/- mice had significantly reduced [(3)H]cholesterol in liver (2.8-fold), small intestine enterocytes (1.7-fold) and feces (2-fold). To our knowledge, this is the first direct in vivo quantitative evidence that ABCA1 is a critical determinant of macrophage-specific RCT.

  11. Whole-transcriptome survey of the putative ATP-binding cassette (ABC) transporter family genes in the latex-producing laticifers of Hevea brasiliensis.

    PubMed

    Zhiyi, Nie; Guijuan, Kang; Yu, Li; Longjun, Dai; Rizhong, Zeng

    2015-01-01

    The ATP-binding cassette (ABC) proteins or transporters constitute a large protein family in plants and are involved in many different cellular functions and processes, including solute transportation, channel regulation and molecular switches, etc. Through transcriptome sequencing, a transcriptome-wide survey and expression analysis of the ABC protein genes were carried out using the laticiferous latex from Hevea brasiliensis (rubber tree). A total of 46 putative ABC family proteins were identified in the H. brasiliensis latex. These consisted of 12 'full-size', 21 'half-size' and 13 other putative ABC proteins, and all of them showed strong conservation with their Arabidopsis thaliana counterparts. This study indicated that all eight plant ABC protein paralog subfamilies were identified in the H. brasiliensis latex, of which ABCB, ABCG and ABCI were the most abundant. Real-time quantitative reverse transcription-polymerase chain reaction assays demonstrated that gene expression of several latex ABC proteins was regulated by ethylene, jasmonic acid or bark tapping (a wound stress) stimulation, and that HbABCB15, HbABCB19, HbABCD1 and HbABCG21 responded most significantly of all to the abiotic stresses. The identification and expression analysis of the latex ABC family proteins could facilitate further investigation into their physiological involvement in latex metabolism and rubber biosynthesis by H. brasiliensis.

  12. The Arabidopsis pxa1 Mutant Is Defective in an ATP-Binding Cassette Transporter-Like Protein Required for Peroxisomal Fatty Acid β-Oxidation1

    PubMed Central

    Zolman, Bethany K.; Silva, Illeana D.; Bartel, Bonnie

    2001-01-01

    Peroxisomes are important organelles in plant metabolism, containing all the enzymes required for fatty acid β-oxidation. More than 20 proteins are required for peroxisomal biogenesis and maintenance. The Arabidopsis pxa1 mutant, originally isolated because it is resistant to the auxin indole-3-butyric acid (IBA), developmentally arrests when germinated without supplemental sucrose, suggesting defects in fatty acid β-oxidation. Because IBA is converted to the more abundant auxin, indole-3-acetic acid (IAA), in a mechanism that parallels β-oxidation, the mutant is likely to be IBA resistant because it cannot convert IBA to IAA. Adult pxa1 plants grow slowly compared with wild type, with smaller rosettes, fewer leaves, and shorter inflorescence stems, indicating that PXA1 is important throughout development. We identified the molecular defect in pxa1 using a map-based positional approach. PXA1 encodes a predicted peroxisomal ATP-binding cassette transporter that is 42% identical to the human adrenoleukodystrophy (ALD) protein, which is defective in patients with the demyelinating disorder X-linked ALD. Homology to ALD protein and other human and yeast peroxisomal transporters suggests that PXA1 imports coenzyme A esters of fatty acids and IBA into the peroxisome for β-oxidation. The pxa1 mutant makes fewer lateral roots than wild type, both in response to IBA and without exogenous hormones, suggesting that the IAA derived from IBA during seedling development promotes lateral root formation. PMID:11706205

  13. Genome-wide identification of ATP-binding cassette (ABC) transporters and their roles in response to polycyclic aromatic hydrocarbons (PAHs) in the copepod Paracyclopina nana.

    PubMed

    Jeong, Chang-Bum; Kim, Duck-Hyun; Kang, Hye-Min; Lee, Young Hwan; Kim, Hui-Su; Kim, Il-Chan; Lee, Jae-Seong

    2017-02-01

    The ATP-binding cassette (ABC) protein superfamily is one of the largest gene families and is highly conserved in all domains. The ABC proteins play roles in several biological processes, including multi-xenobiotic resistance (MXR), by functioning as transporters in the cellular membrane. They also mediate the cellular efflux of a wide range of substrates against concentration gradients. In this study, 37 ABC genes belonging to eight distinct subfamilies were identified in the marine copepod Paracyclopina nana and annotated based on a phylogenetic analysis. Also, the functions of P-glycoproteins (P-gp) and multidrug resistance-associated proteins (MRPs), conferring MXR, were verified using fluorescent substrates and specific inhibitors. The activities of MXR-mediated ABC proteins and their transcriptional level were examined in response to polyaromatic hydrocarbons (PAHs), main components of the water-accommodated fraction. This study increases the understanding of the protective role of MXR in response to PAHs over the comparative evolution of ABC gene families.

  14. Involvement of CjMDR1, a plant multidrug-resistance-type ATP-binding cassette protein, in alkaloid transport in Coptis japonica

    PubMed Central

    Shitan, Nobukazu; Bazin, Ingrid; Dan, Kazuyuki; Obata, Kazuaki; Kigawa, Koji; Ueda, Kazumitsu; Sato, Fumihiko; Forestier, Cyrille; Yazaki, Kazufumi

    2003-01-01

    Alkaloids comprise one of the largest groups of plant secondary metabolites. Berberine, a benzylisoquinoline alkaloid, is preferentially accumulated in the rhizome of Coptis japonica, a ranunculaceous plant, whereas gene expression for berberine biosynthetic enzymes has been observed specifically in root tissues, which suggests that berberine synthesized in the root is transported to the rhizome, where there is high accumulation. We recently isolated a cDNA encoding a multidrug-resistance protein (MDR)-type ATP-binding cassette (ABC) transporter (Cjmdr1) from berberine-producing cultured C. japonica cells, which is highly expressed in the rhizome. Functional analysis of Cjmdr1 by using a Xenopus oocyte expression system showed that CjMDR1 transported berberine in an inward direction, resulting in a higher accumulation of berberine in Cjmdr1-injected oocytes than in the control. Typical inhibitors of ABC proteins, such as vanadate, nifedipine, and glibenclamide, as well as ATP depletion, clearly inhibited this CjMDR1-dependent berberine uptake, suggesting that CjMDR1 functioned as an ABC transporter. Conventional membrane separation methods showed that CjMDR1 was localized in the plasma membrane of C. japonica cells. In situ hybridization indicated that Cjmdr1 mRNA was expressed preferentially in xylem tissues of the rhizome. These findings strongly suggest that CjMDR1 is involved in the translocation of berberine from the root to the rhizome. PMID:12524452

  15. Genome-wide identification of ATP-binding cassette (ABC) transporters and conservation of their xenobiotic transporter function in the monogonont rotifer (Brachionus koreanus).

    PubMed

    Jeong, Chang-Bum; Kim, Hui-Su; Kang, Hye-Min; Lee, Young Hwan; Zhou, Bingsheng; Choe, Joonho; Lee, Jae-Seong

    2017-03-01

    The ATP-binding cassette (ABC) transporter family is one of the largest gene family in animals, and members of this family are known to be involved in various biological processes due to their ability to transport a wide range of substrates across membranes using ATP cleavage-derived energy. We identified 61 ABC transporters in the genome of the monogonont rotifer Brachionus koreanus, and classified these into eight distinct subfamilies (A-H) by phylogenetic analysis. ABC transporters in the rotifer B. koreanus are comprised of 11 ABCA genes, 19 ABCB genes, 14 ABCC genes, 3 ABCD genes, 1 ABCE gene, 3 ABCF genes, 8 ABCG genes, and 2 ABCH genes. Extensive gene duplication and loss events in synteny were observed in several subfamilies. In particular, massive gene duplications of P-glycoproteins (P-gps), multidrug resistance proteins (MRPs), and Bk-Abcg-like proteins were observed. The ability of these B. koreanus proteins to function as multixenobiotic resistance (MXR) ABC transporters was validated using specific fluorescence substrates/inhibitors. The ABC transporter superfamily members identified in this study will be useful in future toxicological studies, and will facilitate comparative studies of the evolution of the ABC transporter superfamily in invertebrates.

  16. Full engagement of liganded maltose-binding protein stabilizes a semi-open ATP-binding cassette dimer in the maltose transporter

    PubMed Central

    Alvarez, Frances Joan D.; Orelle, Cédric; Huang, Yan; Bajaj, Ruchika; Everly, R. Michael; Klug, Candice S.; Davidson, Amy L.

    2015-01-01

    Summary MalFGK2 is an ATP-binding cassette (ABC) transporter that mediates the uptake of maltose/maltodextrins into Escherichia coli. A periplasmic maltose-binding protein (MBP) delivers maltose to the transmembrane subunits (MalFG) and stimulates the ATPase activity of the cytoplasmic nucleotide-binding subunits (MalK dimer). This MBP-stimulated ATPase activity is independent of maltose for purified transporter in detergent micelles. However, when the transporter is reconstituted in membrane bilayers, only the liganded form of MBP efficiently stimulates its activity. To investigate the mechanism of maltose stimulation, electron paramagnetic resonance (EPR) spectroscopy was used to study the interactions between the transporter and MBP in nanodiscs and in detergent. We found that full engagement of both lobes of maltose-bound MBP unto MalFGK2 is facilitated by nucleotides and stabilizes a semi-open MalK dimer. Maltose-bound MBP promotes the transition to the semi-open state of MalK when the transporter is in the membrane, whereas such regulation does not require maltose in detergent. We suggest that stabilization of the semi-open MalK2 conformation by maltose-bound MBP is key to the coupling of maltose transport to ATP hydrolysis in vivo, because it facilitates the progression of the MalK dimer from the open to the semi-open conformation, from which it can proceed to hydrolyze ATP. PMID:26268698

  17. Suppression of c-Myc is involved in multi-walled carbon nanotubes' down-regulation of ATP-binding cassette transporters in human colon adenocarcinoma cells

    SciTech Connect

    Wang, Zhaojing; Xu, Yonghong; Meng, Xiangning; Watari, Fumio; Liu, Hudan; Chen, Xiao

    2015-01-01

    Over-expression of ATP-binding cassette (ABC) transporters, a large family of integral membrane proteins that decrease cellular drug uptake and accumulation by active extrusion, is one of the major causes of cancer multi-drug resistance (MDR) that frequently leads to failure of chemotherapy. Carbon nanotubes (CNTs)-based drug delivery devices hold great promise in enhancing the efficacy of cancer chemotherapy. However, CNTs' effects on the ABC transporters remain under-investigated. In this study, we found that multiwalled carbon nanotubes (MWCNTs) reduced transport activity and expression of ABC transporters including ABCB1/Pgp and ABCC4/MRP4 in human colon adenocarcinoma Caco-2 cells. Proto-oncogene c-Myc, which directly regulates ABC gene expression, was concurrently decreased in MWCNT-treated cells and forced over-expression of c-Myc reversed MWCNTs' inhibitory effects on ABCB1 and ABCC4 expression. MWCNT-cell membrane interaction and cell membrane oxidative damage were observed. However, antioxidants such as vitamin C, β-mecaptoethanol and dimethylthiourea failed to antagonize MWCNTs' down-regulation of ABC transporters. These data suggest that MWCNTs may act on c-Myc, but not through oxidative stress, to down-regulate ABC transporter expression. Our findings thus shed light on CNTs' novel cellular effects that may be utilized to develop CNTs-based drug delivery devices to overcome ABC transporter-mediated cancer chemoresistance.

  18. Roles of aldo-keto reductases 1B10 and 1C3 and ATP-binding cassette transporter in docetaxel tolerance.

    PubMed

    Matsunaga, Toshiyuki; Saito, Haruhi; Endo, Satoshi; Iguchi, Kazuhiro; Soda, Midori; El-Kabbani, Ossama; Hara, Akira; Ikari, Akira

    2016-12-01

    Docetaxel (DTX) is widely used for treatment of inveterate lung and prostate cancers, but its continuous administration elicits the hyposensitivity. Here, we established the DTX-resistant variants of human lung cancer A549 and androgen-independent prostate cancer Du145 cells and found that the resistance development provoked aberrant up-regulations of aldo-keto reductase (AKR) 1B10 and AKR1C3 in A549 and Du145 cells, respectively. In addition, the sensitivity to the DTX toxicity was significantly decreased and increased by overexpression and knockdown of the two AKR isoforms, respectively. Furthermore, the resistant cells exhibited a decreased level of reactive 4-hydroxy-2-nonenal formed during DTX treatment, and the decrease was alleviated by adding the AKR inhibitors, inferring that the two AKRs confer the chemoresistance through elevating the antioxidant properties. The development of DTX resistance was also associated with enhanced expression of an ATP-binding cassette (ABC) transporter ABCB1 among the ABC transporter isoforms. The combined treatment with inhibitors of the two AKRs and ABCB1 additively sensitized the resistant cells to DTX. Intriguingly, the AKR1B10 inhibitor also suppressed the lung cancer cross-resistance against cisplatin. The results suggest that combined treatment with AKRs (1B10 and 1C3) and ABCB1 inhibitors exerts overcoming effect against the cancer resistance to DTX and cisplatin, and can be used as the adjuvant therapy.

  19. Role of NH{sub 2}-terminal hydrophobic motif in the subcellular localization of ATP-binding cassette protein subfamily D: Common features in eukaryotic organisms

    SciTech Connect

    Lee, Asaka; Asahina, Kota; Okamoto, Takumi; Kawaguchi, Kosuke; Kostsin, Dzmitry G.; Kashiwayama, Yoshinori; Takanashi, Kojiro; Yazaki, Kazufumi; Imanaka, Tsuneo; Morita, Masashi

    2014-10-24

    Highlights: • ABCD proteins classifies based on with or without NH{sub 2}-terminal hydrophobic segment. • The ABCD proteins with the segment are targeted peroxisomes. • The ABCD proteins without the segment are targeted to the endoplasmic reticulum. • The role of the segment in organelle targeting is conserved in eukaryotic organisms. - Abstract: In mammals, four ATP-binding cassette (ABC) proteins belonging to subfamily D have been identified. ABCD1–3 possesses the NH{sub 2}-terminal hydrophobic region and are targeted to peroxisomes, while ABCD4 lacking the region is targeted to the endoplasmic reticulum (ER). Based on hydropathy plot analysis, we found that several eukaryotes have ABCD protein homologs lacking the NH{sub 2}-terminal hydrophobic segment (H0 motif). To investigate whether the role of the NH{sub 2}-terminal H0 motif in subcellular localization is conserved across species, we expressed ABCD proteins from several species (metazoan, plant and fungi) in fusion with GFP in CHO cells and examined their subcellular localization. ABCD proteins possessing the NH{sub 2}-terminal H0 motif were localized to peroxisomes, while ABCD proteins lacking this region lost this capacity. In addition, the deletion of the NH{sub 2}-terminal H0 motif of ABCD protein resulted in their localization to the ER. These results suggest that the role of the NH{sub 2}-terminal H0 motif in organelle targeting is widely conserved in living organisms.

  20. Inherited surfactant deficiency due to uniparental disomy of rare mutations in the surfactant protein-B and ATP binding cassette, subfamily A, member 3 genes

    PubMed Central

    Hamvas, Aaron; Nogee, Lawrence M.; Wegner, Daniel J.; DePass, Kelcey; Christodoulou, John; Bennetts, Bruce; McQuade, Leon R.; Gray, Peter H.; Deterding, Robin R.; Carroll, Travis R.; Kammesheidt, Anja; Kasch, Laura M.; Kulkarni, Shashikant; Cole, F. Sessions

    2009-01-01

    Objective To characterize inheritance of homozygous, rare, recessive loss-of-function mutations in the surfactant protein-B (SFTPB) or ATP binding cassette, subfamily A, member 3 (ABCA3) genes in newborns with lethal respiratory failure. Study design We resequenced parents whose infants were homozygous for mutations in SFTPB or ABCA3. For infants with only one heterozygous parent, we performed microsatellite analysis for chromosomes 2 (SFTPB) and 16 (ABCA3). Results We identified one infant homozygous for the c.1549C>GAA mutation (121ins2) in SFTPB for whom only the mother was heterozygous and 3 infants homozygous for mutations in ABCA3 (p.K914R, p.P147L, and c.806_7insGCT) for whom only the fathers were heterozygous. For the SP-B deficient infant, microsatellite markers confirmed maternal heterodisomy with segmental isodisomy. Microsatellite analysis confirmed paternal isodisomy for the three ABCA3 deficient infants. Two ABCA3 deficient infants underwent lung transplantation at 3 and 5 months of age, respectively, and two infants died. None exhibited any non-pulmonary phenotype. Conclusions Uniparental disomy should be suspected in infants with rare homozygous mutations in SFTPB or ABCA3. Confirmation of parental carrier status is important to provide recurrence risk and to monitor expression of other phenotypes that may emerge through reduction to homozygosity of recessive alleles. PMID:19647838

  1. Evaluation of a Brucella melitensis mutant deficient in O-polysaccharide export system ATP-binding protein as a rough vaccine candidate.

    PubMed

    Wang, Zhen; Niu, Jian Rui; Wang, Xiao Lei; Wu, Tong Lei; Cheng, Jie; Lu, Lin; Wu, Qing Min

    2014-08-01

    Rough Brucella mutants have been sought as vaccine candidates that do not interfere with the conventional serological diagnosis of brucellosis. In this study, a rough mutant of Brucella melitensis was generated by the disruption of the wzt gene, which encodes the O-polysaccharide (O-PS) export system ATP-binding protein. In vivo, the mutant 16MΔwzt was attenuated and conferred a level of protection against B. melitensis 16M challenge similar to that conferred by the vaccine strain B. melitensis M5 in mice. In pregnant sheep, the mutant 16MΔwzt did not induce abortion. In vitro, 16MΔwzt was more susceptible to polymyxin B and complement-mediated killing than B. melitensis 16M was. Most importantly, although 16MΔwzt had a rough phenotype, it was able to synthesize O-PS and did not induce detectable specific antibodies in sheep. These results suggested that 16MΔwzt deserved to further systematic evaluation as a vaccine for target animal hosts due to its promising features.

  2. Altered Profile of Secondary Metabolites in the Root Exudates of Arabidopsis ATP-Binding Cassette Transporter Mutants1[C][W][OA

    PubMed Central

    Badri, Dayakar V.; Loyola-Vargas, Victor M.; Broeckling, Corey D.; De-la-Peña, Clelia; Jasinski, Michal; Santelia, Diana; Martinoia, Enrico; Sumner, Lloyd W.; Banta, Lois M.; Stermitz, Frank; Vivanco, Jorge M.

    2008-01-01

    Following recent indirect evidence suggesting a role for ATP-binding cassette (ABC) transporters in root exudation of phytochemicals, we identified 25 ABC transporter genes highly expressed in the root cells most likely to be involved in secretion processes. Of these 25 genes, we also selected six full-length ABC transporters and a half-size transporter for in-depth molecular and biochemical analyses. We compared the exuded root phytochemical profiles of these seven ABC transporter mutants to those of the wild type. There were three nonpolar phytochemicals missing in various ABC transporter mutants compared to the wild type when the samples were analyzed by high-performance liquid chromatography-mass spectrometry. These data suggest that more than one ABC transporter can be involved in the secretion of a given phytochemical and that a transporter can be involved in the secretion of more than one secondary metabolite. The primary and secondary metabolites present in the root exudates of the mutants were also analyzed by gas chromatography-mass spectrometry, which allowed for the identification of groups of compounds differentially found in some of the mutants compared to the wild type. For instance, the mutant Atpdr6 secreted a lower level of organic acids and Atmrp2 secreted a higher level of amino acids as compared to the wild type. We conclude that the release of phytochemicals by roots is partially controlled by ABC transporters. PMID:18065561

  3. Endocytosis and vacuolar degradation of the plasma membrane-localized Pdr5 ATP-binding cassette multidrug transporter in Saccharomyces cerevisiae.

    PubMed Central

    Egner, R; Mahé, Y; Pandjaitan, R; Kuchler, K

    1995-01-01

    Multidrug resistance (MDR) to different cytotoxic compounds in the yeast Saccharomyces cerevisiae can arise from overexpression of the Pdr5 (Sts1, Ydr1, or Lem1) ATP-binding cassette (ABC) multidrug transporter. We have raised polyclonal antibodies recognizing the yeast Pdr5 ABC transporter to study its biogenesis and to analyze the molecular mechanisms underlying MDR development. Subcellular fractionation and indirect immunofluorescence experiments showed that Pdr5 is localized in the plasma membrane. In addition, pulse-chase radiolabeling of cells and immunoprecipitation indicated that Pdr5 is a short-lived membrane protein with a half-life of about 60 to 90 min. A dramatic metabolic stabilization of Pdr5 was observed in delta pep4 mutant cells defective in vacuolar proteinases, and indirect immunofluorescence showed that Pdr5 accumulates in vacuoles of stationary-phase delta pep4 mutant cells, demonstrating that Pdr5 turnover requires vacuolar proteolysis. However, Pdr5 turnover does not require a functional proteasome, since the half-life of Pdr5 was unaffected in either pre1-1 or pre1-1 pre2-1 mutants defective in the multicatalytic cytoplasmic proteasome that is essential for cytoplasmic protein degradation. Immunofluorescence analysis revealed that vacuolar delivery of Pdr5 is blocked in conditional end4 endocytosis mutants at the restrictive temperature, showing that endocytosis delivers Pdr5 from the plasma membrane to the vacuole. PMID:7565740

  4. The maltose ATP-binding cassette transporter in the 21st century--towards a structural dynamic perspective on its mode of action.

    PubMed

    Bordignon, Enrica; Grote, Mathias; Schneider, Erwin

    2010-09-01

    The maltose/maltodextrin transport system of Escherichia coli/Salmonella, composed of periplasmic maltose-binding protein, MalE, the pore-forming subunits MalF and MalG, and a homodimer of the nucleotide-binding subunit, MalK, serves as a model for canonical ATP-binding cassette importers in general. The wealth of knowledge accumulated on the maltose transporter in more than three decades by genetic, molecular genetic and biochemical means was complemented more recently by crystal structures of the isolated MalK dimer and of two conformational states of the full transporter. Here, we summarize insights into the transport mechanism provided by these structures and draw the reader's attention to experimental tools by which the dynamics of the transporter can be studied during substrate translocation. A transport model is presented that integrates currently available biochemical, biophysical and structural data. We also present the state of knowledge on regulatory functions of the maltose transporter associated with the C-terminal domain of MalK. Finally, we will address the application of coarse-grained modelling to visualize the progression of the conformational changes of an ABC transporter with special emphasis on the maltose system, which can provide a model platform for testing and validating the bioinformatic tools.

  5. Full engagement of liganded maltose-binding protein stabilizes a semi-open ATP-binding cassette dimer in the maltose transporter.

    PubMed

    Alvarez, Frances Joan D; Orelle, Cédric; Huang, Yan; Bajaj, Ruchika; Everly, R Michael; Klug, Candice S; Davidson, Amy L

    2015-12-01

    MalFGK2 is an ATP-binding cassette (ABC) transporter that mediates the uptake of maltose/maltodextrins into Escherichia coli. A periplasmic maltose-binding protein (MBP) delivers maltose to the transmembrane subunits (MalFG) and stimulates the ATPase activity of the cytoplasmic nucleotide-binding subunits (MalK dimer). This MBP-stimulated ATPase activity is independent of maltose for purified transporter in detergent micelles. However, when the transporter is reconstituted in membrane bilayers, only the liganded form of MBP efficiently stimulates its activity. To investigate the mechanism of maltose stimulation, electron paramagnetic resonance spectroscopy was used to study the interactions between the transporter and MBP in nanodiscs and in detergent. We found that full engagement of both lobes of maltose-bound MBP unto MalFGK2 is facilitated by nucleotides and stabilizes a semi-open MalK dimer. Maltose-bound MBP promotes the transition to the semi-open state of MalK when the transporter is in the membrane, whereas such regulation does not require maltose in detergent. We suggest that stabilization of the semi-open MalK2 conformation by maltose-bound MBP is key to the coupling of maltose transport to ATP hydrolysis in vivo, because it facilitates the progression of the MalK dimer from the open to the semi-open conformation, from which it can proceed to hydrolyze ATP.

  6. Cuticular Defects in Oryza sativa ATP-binding Cassette Transporter G31 Mutant Plants Cause Dwarfism, Elevated Defense Responses and Pathogen Resistance.

    PubMed

    Garroum, Imène; Bidzinski, Przemyslaw; Daraspe, Jean; Mucciolo, Antonio; Humbel, Bruno M; Morel, Jean-Benoit; Nawrath, Christiane

    2016-06-01

    The cuticle covers the surface of the polysaccharide cell wall of leaf epidermal cells and forms an essential diffusion barrier between plant and environment. Homologs of the ATP-binding cassette (ABC) transporter AtABCG32/HvABCG31 clade are necessary for the formation of a functional cuticle in both monocots and dicots. Here we characterize the osabcg31 knockout mutant and hairpin RNA interference (RNAi)-down-regulated OsABCG31 plant lines having reduced plant growth and a permeable cuticle. The reduced content of cutin in leaves and structural alterations in the cuticle and at the cuticle-cell wall interface in plants compromised in OsABCG31 expression explain the cuticle permeability. Effects of modifications of the cuticle on plant-microbe interactions were evaluated. The cuticular alterations in OsABCG31-compromised plants did not cause deficiencies in germination of the spores or the formation of appressoria of Magnaporthe oryzae on the leaf surface, but a strong reduction of infection structures inside the plant. Genes involved in pathogen resistance were constitutively up-regulated in OsABCG31-compromised plants, thus being a possible cause of the resistance to M. oryzae and the dwarf growth phenotype. The findings show that in rice an abnormal cuticle formation may affect the signaling of plant growth and defense.

  7. A member of the PLEIOTROPIC DRUG RESISTANCE family of ATP binding cassette transporters is required for the formation of a functional cuticle in Arabidopsis.

    PubMed

    Bessire, Michael; Borel, Sandra; Fabre, Guillaume; Carraça, Luis; Efremova, Nadia; Yephremov, Alexander; Cao, Yan; Jetter, Reinhard; Jacquat, Anne-Claude; Métraux, Jean-Pierre; Nawrath, Christiane

    2011-05-01

    Although the multilayered structure of the plant cuticle was discovered many years ago, the molecular basis of its formation and the functional relevance of the layers are not understood. Here, we present the permeable cuticle1 (pec1) mutant of Arabidopsis thaliana, which displays features associated with a highly permeable cuticle in several organs. In pec1 flowers, typical cutin monomers, such as ω-hydroxylated fatty acids and 10,16-dihydroxypalmitate, are reduced to 40% of wild-type levels and are accompanied by the appearance of lipidic inclusions within the epidermal cell. The cuticular layer of the cell wall, rather than the cuticle proper, is structurally altered in pec1 petals. Therefore, a significant role for the formation of the diffusion barrier in petals can be attributed to this layer. Thus, pec1 defines a new class of mutants. The phenotypes of the pec1 mutant are caused by the knockout of ATP BINDING CASSETTEG32 (ABCG32), an ABC transporter from the PLEIOTROPIC DRUG RESISTANCE family that is localized at the plasma membrane of epidermal cells in a polar manner toward the surface of the organs. Our results suggest that ABCG32 is involved in the formation of the cuticular layer of the cell wall, most likely by exporting particular cutin precursors from the epidermal cell.

  8. Identification of a gene linked to Rhizobium meliloti ntrA whose product is homologous to a family to ATP-binding proteins.

    PubMed Central

    Albright, L M; Ronson, C W; Nixon, B T; Ausubel, F M

    1989-01-01

    The ntrA gene of Rhizobium meliloti has recently been identified and shown to be required for a diverse set of metabolic functions (C. W. Ronson, B. T. Nixon, L. M. Albright, and F. M. Ausubel, J. Bacteriol. 169:2424-2431, 1987). As a result of sequencing the ntrA gene and its flanking regions from R. meliloti, we identified an open reading frame directly upstream of ntrA, ORF1, whose predicted product is homologous to a superfamily of ATP-binding proteins involved in transport, cell division, nodulation, and DNA repair. The homology of ORF1 to this superfamily and its proximity to ntrA led us to investigate its role in symbiosis by mutagenesis and expression studies. We were unable to isolate an insertion mutation in ORF1, suggesting that ORF1 may code for an essential function. We identified the start of transcription for the ntrA gene in vegetative cells and bacteroids and showed that ORF1 and ntrA are transcriptionally unlinked. ORF1 appears to be in an operon with one or more upstream genes. Images PMID:2703463

  9. Transgenic hybrid aspen overexpressing the Atwbc19 gene encoding an ATP-binding cassette transporter confers resistance to four aminoglycoside antibiotics.

    PubMed

    Kang, Byung-Guk; Ye, Xia; Osburn, Lori D; Stewart, C N; Cheng, Zong-Ming

    2010-06-01

    Antibiotic-resistance genes of bacterial origin are invaluable markers for plant genetic engineering. However, these genes are feared to pose possible risk to human health by horizontal gene transfer from transgenic plants to bacteria, potentially resulting in antibiotic-resistant pathogenic bacteria; this is a considerable regulatory concern in some countries. The Atwbc19 gene, encoding an Arabidopsis thaliana ATP-binding cassette transporter, has been reported to confer resistance to kanamycin specifically as an alternative to bacterial antibiotic-resistance genes. In this report, we transformed hybrid aspen (Populus canescens x P. grandidentata) with the Atwbc19 gene. Unlike Atwbc19-transgenic tobacco that was only resistant to kanamycin, the transgenic Populus plants also showed resistance to three other aminoglycoside antibiotics (neomycin, geneticin, and paromomycin) at comparable levels to plants containing a CaMV35S-nptII cassette. Although it is unknown why the transgenic Populus with the Atwbc19 gene is resistant to all aminoglycoside antibiotics tested, the broad utility of the Atwbc19 gene as a reporter gene is confirmed here in a second dicot species. Because the Atwbc19 gene is plant-ubiquitous, it might serve as an alternative selectable marker to current bacterial antibiotic-resistance marker genes and alleviate the potential risk for horizontal transfer of bacterial-resistance genes in transgenic plants.

  10. The Role of Arabidopsis ABCG9 and ABCG31 ATP Binding Cassette Transporters in Pollen Fitness and the Deposition of Steryl Glycosides on the Pollen Coat[W

    PubMed Central

    Choi, Hyunju; Ohyama, Kiyoshi; Kim, Yu-Young; Jin, Jun-Young; Lee, Saet Buyl; Yamaoka, Yasuyo; Muranaka, Toshiya; Suh, Mi Chung; Fujioka, Shozo; Lee, Youngsook

    2014-01-01

    The pollen coat protects pollen grains from harmful environmental stresses such as drought and cold. Many compounds in the pollen coat are synthesized in the tapetum. However, the pathway by which they are transferred to the pollen surface remains obscure. We found that two Arabidopsis thaliana ATP binding cassette transporters, ABCG9 and ABCG31, were highly expressed in the tapetum and are involved in pollen coat deposition. Upon exposure to dry air, many abcg9 abcg31 pollen grains shriveled up and collapsed, and this phenotype was restored by complementation with ABCG9pro:GFP:ABCG9. GFP-tagged ABCG9 or ABCG31 localized to the plasma membrane. Electron microscopy revealed that the mutant pollen coat resembled the immature coat of the wild type, which contained many electron-lucent structures. Steryl glycosides were reduced to about half of wild-type levels in the abcg9 abcg31 pollen, but no differences in free sterols or steryl esters were observed. A mutant deficient in steryl glycoside biosynthesis, ugt80A2 ugt80B1, exhibited a similar phenotype. Together, these results indicate that steryl glycosides are critical for pollen fitness, by supporting pollen coat maturation, and that ABCG9 and ABCG31 contribute to the accumulation of this sterol on the surface of pollen. PMID:24474628

  11. Effect of tacrolimus on activity and expression of P-glycoprotein and ATP-binding cassette transporter A5 (ABCA5) proteins in hematoencephalic barrier cells.

    PubMed

    Quezada, Claudia Andrea; Garrido, Wallys Ximena; González-Oyarzún, Mauricio Alejandro; Rauch, María Cecilia; Salas, Mónica Roxana; San Martín, Rody Enrique; Claude, Alejandro Andrés; Yañez, Alejandro Javier; Slebe, Juan Carlos; Cárcamo, Juan Guillermo

    2008-10-01

    Tacrolimus is an agent used in clinical immunosuppressive drug therapies. A wide spectrum of adverse effects has been reported in association with this immunosuppressor, including neurotoxic effect. The upper limit of therapeutic blood concentrations of tacrolimus has been described as 30 ng/ml in immunosuppressed patients. We investigated the effect of this therapeutic dose of tacrolimus on the expression and activity of the multidrug resistance protein 1 (MDR1 or Pgp, P-glycoprotein) and ATP-binding cassette transporters A5 (ABCA5) in human brain microvascular endothelial cells (HBMEC), derived from Blood-Brain Barrier (BBB) endothelium, these being the most predominantly expressed transcripts in these cells. The expression and activity of MDR1 transporter decreased with 30 ng/ml tacrolimus. The cell viability was not changed with the therapeutic dose used. By contrast, ABCA5 transcripts, of unknown role as yet, increased their expression at this concentration. We propose that the secondary cytotoxic effects of this immunosuppressor on CSN, besides the functional blockade related to multidrug resistance proteins, such as MDR1, and probably ABCA5, could be linked to variations in the expression levels of these proteins at the BBB.

  12. Mechanical stimulation evokes rapid increases in extracellular adenosine concentration in the prefrontal cortex.

    PubMed

    Ross, Ashley E; Nguyen, Michael D; Privman, Eve; Venton, B Jill

    2014-07-01

    Mechanical perturbations can release ATP, which is broken down to adenosine. In this work, we used carbon-fiber microelectrodes and fast-scan cyclic voltammetry to measure mechanically stimulated adenosine in the brain by lowering the electrode 50 μm. Mechanical stimulation evoked adenosine in vivo (average: 3.3 ± 0.6 μM) and in brain slices (average: 0.8 ± 0.1 μM) in the prefrontal cortex. The release was transient, lasting 18 ± 2 s. Lowering a 15-μm-diameter glass pipette near the carbon-fiber microelectrode produced similar results as lowering the actual microelectrode. However, applying a small puff of artificial cerebral spinal fluid was not sufficient to evoke adenosine. Multiple stimulations within a 50-μm region of a slice did not significantly change over time or damage cells. Chelating calcium with EDTA or blocking sodium channels with tetrodotoxin significantly decreased mechanically evoked adenosine, signifying that the release is activity dependent. An alpha-amino-3-hydroxy-5-methylisoxazole-4-propionate receptor antagonist, 6-cyano-7-nitroquinoxaline-2,3-dione, did not affect mechanically stimulated adenosine; however, the nucleoside triphosphate diphosphohydrolase 1,2 and 3 (NTDPase) inhibitor POM-1 significantly reduced adenosine so a portion of adenosine is dependent on extracellular ATP metabolism. Thus, mechanical perturbations from inserting a probe in the brain cause rapid, transient adenosine signaling which might be neuroprotective. We have discovered immediate changes in adenosine concentration in the prefrontal cortex following mechanical stimulation. The adenosine increase lasts only about 20 s. Mechanically stimulated adenosine was activity dependent and mostly because of extracellular ATP metabolism. This rapid, transient increase in adenosine may help protect tissue and would occur during implantation of any electrode, such as during deep brain stimulation.

  13. Molecular phylogenetic study and expression analysis of ATP-binding cassette transporter gene family in Oryza sativa in response to salt stress.

    PubMed

    Saha, Jayita; Sengupta, Atreyee; Gupta, Kamala; Gupta, Bhaskar

    2015-02-01

    ATP-binding cassette (ABC) transporter is a large gene superfamily that utilizes the energy released from ATP hydrolysis for transporting myriad of substrates across the biological membranes. Although many investigations have been done on the structural and functional analysis of the ABC transporters in Oryza sativa, much less is known about molecular phylogenetic and global expression pattern of the complete ABC family in rice. In this study, we have carried out a comprehensive phylogenetic analysis constructing neighbor-joining and maximum-likelihood trees based on various statistical methods of different ABC protein subfamily of five plant lineages including Chlamydomonas reinhardtii (green algae), Physcomitrella patens (moss), Selaginella moellendorffii (lycophyte), Arabidopsis thaliana (dicot) and O. sativa (monocot) to explore the origin and evolutionary patterns of these ABC genes. We have identified several conserved motifs in nucleotide binding domain (NBD) of ABC proteins among all plant lineages during evolution. Amongst the different ABC protein subfamilies, 'ABCE' has not yet been identified in lower plant genomes (algae, moss and lycophytes). The result indicated that gene duplication and diversification process acted upon these genes as a major operative force creating new groups and subgroups and functional divergence during evolution. We have demonstrated that rice ABCI subfamily consists of only half size transporters that represented highly dynamic members showing maximum sequence variations among the other rice ABC subfamilies. The evolutionary and the expression analysis contribute to a deep insight into the evolution and diversity of rice ABC proteins and their roles in response to salt stress that facilitate our further understanding on rice ABC transporters.

  14. Time-resolved Fourier Transform Infrared Spectroscopy of the Nucleotide-binding Domain from the ATP-binding Cassette Transporter MsbA

    PubMed Central

    Syberg, Falk; Suveyzdis, Yan; Kötting, Carsten; Gerwert, Klaus; Hofmann, Eckhard

    2012-01-01

    MsbA is an essential Escherichia coli ATP-binding cassette (ABC) transporter involved in the flipping of lipid A across the cytoplasmic membrane. It is a close homologue of human P-glycoprotein involved in multidrug resistance, and it similarly accepts a variety of small hydrophobic xenobiotics as transport substrates. X-ray structures of three full-length ABC multidrug exporters (including MsbA) have been published recently and reveal large conformational changes during the transport cycle. However, how ATP hydrolysis couples to these conformational changes and finally the transport is still an open question. We employed time-resolved FTIR spectroscopy, a powerful method to elucidate molecular reaction mechanisms of soluble and membrane proteins, to address this question with high spatiotemporal resolution. Here, we monitored the hydrolysis reaction in the nucleotide-binding domain of MsbA at the atomic level. The isolated MsbA nucleotide-binding domain hydrolyzed ATP with Vmax = 45 nmol mg−1 min−1, similar to the full-length transporter. A Hill coefficient of 1.49 demonstrates positive cooperativity between the two catalytic sites formed upon dimerization. Global fit analysis of time-resolved FTIR data revealed two apparent rate constants of ∼1 and 0.01 s−1, which were assigned to formation of the catalytic site and hydrolysis, respectively. Using isotopically labeled ATP, we identified specific marker bands for protein-bound ATP (1245 cm−1), ADP (1101 and 1205 cm−1), and free phosphate (1078 cm−1). Cleavage of the β-phosphate–γ-phosphate bond was found to be the rate-limiting step; no protein-bound phosphate intermediate was resolved. PMID:22593573

  15. Functional and Structural Characterization of Polysaccharide Co-polymerase Proteins Required for Polymer Export in ATP-binding Cassette Transporter-dependent Capsule Biosynthesis Pathways*

    PubMed Central

    Larue, Kane; Ford, Robert C.; Willis, Lisa M.; Whitfield, Chris

    2011-01-01

    Neisseria meningitidis serogroup B and Escherichia coli K1 bacteria produce a capsular polysaccharide (CPS) that is composed of α2,8-linked polysialic acid (PSA). Biosynthesis of PSA in these bacteria occurs via an ABC (ATP-binding cassette) transporter-dependent pathway. In N. meningitidis, export of PSA to the surface of the bacterium requires two proteins that form an ABC transporter (CtrC and CtrD) and two additional proteins, CtrA and CtrB, that are proposed to form a cell envelope-spanning export complex. CtrA is a member of the outer membrane polysaccharide export (OPX) family of proteins, which are proposed to form a pore to mediate export of CPSs across the outer membrane. CtrB is an inner membrane protein belonging to the polysaccharide co-polymerase (PCP) family. PCP proteins involved in other bacterial polysaccharide assembly systems form structures that extend into the periplasm from the inner membrane. There is currently no structural information available for PCP or OPX proteins involved in an ABC transporter-dependent CPS biosynthesis pathway to support their proposed roles in polysaccharide export. Here, we report cryo-EM images of purified CtrB reconstituted into lipid bilayers. These images contained molecular top and side views of CtrB and showed that it formed a conical oligomer that extended ∼125 Å from the membrane. This structure is consistent with CtrB functioning as a component of an envelope-spanning complex. Cross-complementation of CtrA and CtrB in E. coli mutants with defects in genes encoding the corresponding PCP and OPX proteins show that PCP-OPX pairs require interactions with their cognate partners to export polysaccharide. These experiments add further support for the model of an ABC transporter-PCP-OPX multiprotein complex that functions to export CPS across the cell envelope. PMID:21454677

  16. The ATP-binding cassette transporter-2 (ABCA2) regulates cholesterol homeostasis and low-density lipoprotein receptor metabolism in N2a neuroblastoma cells.

    PubMed

    Davis, Warren

    2011-12-01

    The ATP-binding cassette transporter-2 (ABCA2) has been identified as a possible regulator of lipid metabolism. ABCA2 is most highly expressed in the brain but its effects on cholesterol homeostasis in neuronal-type cells have not been characterized. It is important to study the role of ABCA2 in regulating cholesterol homeostasis in neuronal-type cells because ABCA2 has been identified as a possible genetic risk factor for Alzheimer's disease. In this study, the effects of ABCA2 expression on cholesterol homeostasis were examined in mouse N2a neuroblastoma cells. ABCA2 reduced total, free- and esterified cholesterol levels as well as membrane cholesterol but did not perturb cholesterol distribution in organelle or lipid raft compartments. ABCA2 did not modulate de novo cholesterol biosynthesis from acetate. Cholesterol trafficking to the plasma membrane was not affected by ABCA2 but efflux to the physiological acceptor ApoE3 and mobilization of plasma membrane cholesterol to the endoplasmic reticulum for esterification were reduced by ABCA2. ABCA2 reduced esterification of serum and low-density lipoprotein-derived cholesterol but not 25-hydroxycholesterol. ABCA2 decreased low-density lipoprotein receptor (LDLR) mRNA and protein levels and increased its turnover rate. The surface expression of LDLR as well as the uptake of fluroresecent DiI-LDL was also reduced by ABCA2. Reduction of endogenous ABCA2 expression by RNAi treatment of N2a cells and rat primary cortical neurons produced the opposite effects of over-expression of ABCA2, increasing LDLR protein levels. This report identifies ABCA2 as a key regulator of cholesterol homeostasis and LDLR metabolism in neuronal cells.

  17. The Myxococcus xanthus rfbABC operon encodes an ATP-binding cassette transporter homolog required for O-antigen biosynthesis and multicellular development.

    PubMed Central

    Guo, D; Bowden, M G; Pershad, R; Kaplan, H B

    1996-01-01

    A wild-type sasA locus is critical for Myxococcus xanthus multicellular development. Mutations in the sasA locus cause defective fruiting body formation, reduce sporulation, and restore developmental expression of the early A-signal-dependent gene 4521 in the absence of A signal. The wild-type sasA locus has been located on a 14-kb cloned fragment of the M. xanthus chromosome. The nucleotide sequence of a 7-kb region containing the complete sasA locus was determined. Three open reading frames encoded by the genes, designated rfbA, B and C were identified. The deduced amino acid sequences of rfbA and rfbB show identity to the integral membrane domains and ATPase domains, respectively, of the ATP-binding cassette (ABC) transporter family. The highest identities are to a set of predicted ABC transporters required for the biosynthesis of lipopolysaccharide O-antigen in certain gram-negative bacteria. The rfbC gene encodes a predicted protein of 1,276 amino acids. This predicted protein contains a region of 358 amino acids that is 33.8% identical to the Yersinia enterocolitica O3 rfbH gene product, which is also required for O-antigen biosynthesis. Immunoblot analysis revealed that the sasA1 mutant, which was found to encode a nonsense codon in the beginning of rfbA, produced less O-antigen than sasA+ strains. These data indicate that the sasA locus is required for the biosynthesis of O-antigen and, when mutated, results in A-signal-independent expression of 4521. PMID:8626291

  18. A Mutation within the Extended X Loop Abolished Substrate-induced ATPase Activity of the Human Liver ATP-binding Cassette (ABC) Transporter MDR3*

    PubMed Central

    Kluth, Marianne; Stindt, Jan; Dröge, Carola; Linnemann, Doris; Kubitz, Ralf; Schmitt, Lutz

    2015-01-01

    The human multidrug resistance protein 3 (MDR3/ABCB4) belongs to the ubiquitous family of ATP-binding cassette (ABC) transporters and is located in the canalicular membrane of hepatocytes. There it flops the phospholipids of the phosphatidylcholine (PC) family from the inner to the outer leaflet. Here, we report the characterization of wild type MDR3 and the Q1174E mutant, which was identified previously in a patient with progressive familial intrahepatic cholestasis type 3 (PFIC-3). We expressed different variants of MDR3 in the yeast Pichia pastoris, purified the proteins via tandem affinity chromatography, and determined MDR3-specific ATPase activity in the presence or absence of phospholipids. The ATPase activity of wild type MDR3 was stimulated 2-fold by liver PC or 1,2-dioleoyl-sn-glycero-3-phosphatidylethanolamine lipids. Furthermore, the cross-linking of MDR3 with a thiol-reactive fluorophore blocked ATP hydrolysis and exhibited no PC stimulation. Similarly, phosphatidylethanolamine, phosphatidylserine, and sphingomyelin lipids did not induce an increase of wild type MDR3 ATPase activity. The phosphate analogues beryllium fluoride and aluminum fluoride led to complete inhibition of ATPase activity, whereas orthovanadate inhibited exclusively the PC-stimulated ATPase activity of MDR3. The Q1174E mutation is located in the nucleotide-binding domain in direct proximity of the leucine of the ABC signature motif and extended the X loop, which is found in ABC exporters. Our data on the Q1174E mutant demonstrated basal ATPase activity, but PC lipids were incapable of stimulating ATPase activity highlighting the role of the extended X loop in the cross-talk of the nucleotide-binding domain and the transmembrane domain. PMID:25533467

  19. A mutation within the extended X loop abolished substrate-induced ATPase activity of the human liver ATP-binding cassette (ABC) transporter MDR3.

    PubMed

    Kluth, Marianne; Stindt, Jan; Dröge, Carola; Linnemann, Doris; Kubitz, Ralf; Schmitt, Lutz

    2015-02-20

    The human multidrug resistance protein 3 (MDR3/ABCB4) belongs to the ubiquitous family of ATP-binding cassette (ABC) transporters and is located in the canalicular membrane of hepatocytes. There it flops the phospholipids of the phosphatidylcholine (PC) family from the inner to the outer leaflet. Here, we report the characterization of wild type MDR3 and the Q1174E mutant, which was identified previously in a patient with progressive familial intrahepatic cholestasis type 3 (PFIC-3). We expressed different variants of MDR3 in the yeast Pichia pastoris, purified the proteins via tandem affinity chromatography, and determined MDR3-specific ATPase activity in the presence or absence of phospholipids. The ATPase activity of wild type MDR3 was stimulated 2-fold by liver PC or 1,2-dioleoyl-sn-glycero-3-phosphatidylethanolamine lipids. Furthermore, the cross-linking of MDR3 with a thiol-reactive fluorophore blocked ATP hydrolysis and exhibited no PC stimulation. Similarly, phosphatidylethanolamine, phosphatidylserine, and sphingomyelin lipids did not induce an increase of wild type MDR3 ATPase activity. The phosphate analogues beryllium fluoride and aluminum fluoride led to complete inhibition of ATPase activity, whereas orthovanadate inhibited exclusively the PC-stimulated ATPase activity of MDR3. The Q1174E mutation is located in the nucleotide-binding domain in direct proximity of the leucine of the ABC signature motif and extended the X loop, which is found in ABC exporters. Our data on the Q1174E mutant demonstrated basal ATPase activity, but PC lipids were incapable of stimulating ATPase activity highlighting the role of the extended X loop in the cross-talk of the nucleotide-binding domain and the transmembrane domain.

  20. Polycyclic aromatic hydrocarbons (PAHs) mediate transcriptional activation of the ATP binding cassette transporter ABCB6 gene via the aryl hydrocarbon receptor (AhR).

    PubMed

    Chavan, Hemantkumar; Krishnamurthy, Partha

    2012-09-14

    Liver is endowed with a mechanism to induce hepatic cytochromes P450 (CYP450s) in response to therapeutic drugs and environmental contaminants, leading to increased detoxification and elimination of the xenobiotics. Each CYP450 is composed of an apoprotein moiety and a heme prosthetic group, which is required for CYP450 activity. Thus, under conditions of CYP450 induction, there is a coordinate increase in heme biosynthesis to compensate for the increased expression of CYP450s. ABCB6, a mitochondrial ATP binding cassette transporter, which regulates coproporphyrinogen transport from the cytoplasm into the mitochondria to complete heme biosynthesis, represents a previously unrecognized rate-limiting step in heme biosynthesis. However, it is not known if exposure to drugs and environmental contaminants induces ABCB6 expression, to assure an adequate and apparently coordinated supply of heme for the generation of functional cytochrome holoprotein. In the present study, we demonstrate that polycyclic aromatic hydrocarbons (PAHs), the widely distributed environmental toxicants shown to induce porphyrin accumulation causing hepatic porphyria, up-regulate ABCB6 expression in both mice and humans. Using siRNA technology and Abcb6 knock-out mice, we demonstrate that PAH-mediated increase in hepatic porphyrins is compromised in the absence of ABCB6. Moreover, in vivo studies in aryl hydrocarbon receptor (AhR) knock-out mice demonstrate that PAH induction of ABCB6 is mediated by AhR. Promoter activation studies combined with electrophoretic mobility shift assay and chromatin immunoprecipitation assay demonstrate direct interactions between the AhR binding sites in the ABCB6 promoter and the AhR receptor, implicating drug activation mechanisms for ABCB6 similar to those found in inducible cytochrome P450s. These studies are the first to describe direct transcriptional activation of both mouse and human ABCB6 by xenobiotics.

  1. Effects of silencing the ATP-binding cassette protein E1 gene by electroporation on the proliferation and migration of EC109 human esophageal cancer cells.

    PubMed

    Li, Xiao-Rui; Yang, Liu-Zhong; Huo, Xiao-Qing; Wang, Ying; Yang, Qing-Hui; Zhang, Qing-Qin

    2015-07-01

    In the present study, the gene expression of ATP-binding cassette protein E1 (ABCE1) in the EC109 human esophageal cancer cell line was silenced using electroporation to examine the effect if the ABCE1 gene on the growth migration and cell cycle of cancer cells. The small interference (si)RNA sequence of ABCE1 was designed and synthesized to transfect the EC109 cells by electroporation. The mRNA and protein expression levels of ABCE1 were then detected by reverse transcription quantitative polymerase chain reaction (RT-qPCR) and western blot analysis. The analysis of the cell cycle and apoptosis was performed using flow cytometry. The effect of silencing the ABCE1 gene on the proliferation, migration and invasive ability of the EC109 human esophageal cancer cells were assessed using a Cell counting kit-8 (CCK-8) and with proliferation, wound-healing and cell invasion assays. The mRNA and protein expression levels of ABCE1 were significantly lower in the experimental group compared with the control group (P<0.05). The apoptotic rate of the experimental group was markedly higher than the control group and blank group (P<0.01). The CCK-8 proliferation assay revealed that, compared with the control and blank groups, the proliferation of the EC109 cells in the experimental group was significantly inhibited (P<0.05). The wound healing assay revealed that the migration capacity of the cells in the experimental group was significantly decreased (P<0.05). The Transwell chamber assay demonstrated that the invasive ability of the EC109 cells in the experimental group was significantly decreased (P<0.01). These results revealed that ABCE1 is closely associated with cell proliferation, invasion and migration in esophageal cancer and silencing the ABCE1 gene by electroporation can significantly reduce the proliferation, invasion and migration capacity of EC109 cells in vitro.

  2. Immature human chorionic gonadotropin (hCG) in first trimester placental cells is bound to an ATP-binding protein forming high-molecular-weight hCG.

    PubMed

    Shimojo, M; Sakakibara, R; Ishiguro, M

    1993-07-01

    Human chorionic gonadotropin (hCG) in first trimester placental cells is made up of immature alpha- and beta-subunits containing only N-linked high-mannose sugar chains, which are of 21 kDa for the alpha-subunit and 23 and 19 kDa for the beta-subunit. However, the apparent molecular weight of immature hCG from placental cell extracts has been estimated from gel filtration to be much higher (100-200 kDa; high molecular weight-hCG, HMW-hCG) based on gel filtration than the theoretical value (approximately 44 kDa) of the alpha beta dimer (alpha beta-hCG). We prepared a gel-filtered fraction containing HMW-hCG and investigated treatments for converting it to alpha beta-hCG. We found that the molecular weight of HMW-hCG was decreased to close to that of alpha beta-hCG by treatment with acetone, proteases, or chelating agents. These treatments also shifted the isoelectric point of HMW-hCG from the acidic region (pI = 4-6) to the alkaline (pI = 9-11), approximating to that of alpha beta-hCG. We also found that HMW-hCG, but not acetone-treated HMW-hCG, bound to ATP-agarose resin. These results suggested that the immature alpha beta-hCG molecule in placental cells may be bound to an acidic ATP-binding protein to form HMW-hCG.

  3. ATP binding by the P-loop NTPase OsYchF1 (an unconventional G protein) contributes to biotic but not abiotic stress responses

    PubMed Central

    Cheung, Ming-Yan; Li, Xiaorong; Miao, Rui; Fong, Yu-Hang; Li, Kwan-Pok; Yung, Yuk-Lin; Yu, Mei-Hui; Wong, Kam-Bo; Lam, Hon-Ming

    2016-01-01

    G proteins are involved in almost all aspects of the cellular regulatory pathways through their ability to bind and hydrolyze GTP. The YchF subfamily, interestingly, possesses the unique ability to bind both ATP and GTP, and is possibly an ancestral form of G proteins based on phylogenetic studies and is present in all kingdoms of life. However, the biological significance of such a relaxed ligand specificity has long eluded researchers. Here, we have elucidated the different conformational changes caused by the binding of a YchF homolog in rice (OsYchF1) to ATP versus GTP by X-ray crystallography. Furthermore, by comparing the 3D relationships of the ligand position and the various amino acid residues at the binding sites in the crystal structures of the apo-bound and ligand-bound versions, a mechanism for the protein’s ability to bind both ligands is revealed. Mutation of the noncanonical G4 motif of the OsYchF1 to the canonical sequence for GTP specificity precludes the binding/hydrolysis of ATP and prevents OsYchF1 from functioning as a negative regulator of plant-defense responses, while retaining its ability to bind/hydrolyze GTP and its function as a negative regulator of abiotic stress responses, demonstrating the specific role of ATP-binding/hydrolysis in disease resistance. This discovery will have a significant impact on our understanding of the structure–function relationships of the YchF subfamily of G proteins in all kingdoms of life. PMID:26912459

  4. Association of ATP-Binding Cassette Transporter A1 (ABCA1)-565 C/T Gene Polymorphism with Hypoalphalipoproteinemia and Serum Lipids, IL-6 and CRP Levels

    PubMed Central

    Babashamsi, Mohammad Mahdi; Halalkhor, Sohrab; Moradi Firouzjah, Hamid; Parsian, Hadi; Jalali, Seyed Farzad; Babashamsi, Mohammad

    2017-01-01

    Background: ATP-binding cassette transporter A1 (ABCA1) is a membrane integral protein which plays a vital role in High Density Lipoprotein (HDL) metabolism and exerts a protective effect against Hypoalphalipoproteinemia (HA) by mediation of rate-limiting step in HDL biogenesis. In addition, this protein possesses anti-inflammatory effects by inhibiting the production of some inflammatory cytokines in macrophages. This study investigated the association of ABCA1-565 C/T gene polymorphism with HA and serum lipids, IL-6 and CRP levels. Methods: A population which consisted of 101 HA and 95 normal subjects were genotyped for ABCA1-565C/T polymorphism by Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP). The serum concentrations of lipids, IL-6 and high sensitive-CRP (hs-CRP) were measured by the relevant methods. Results: The frequency of T allele was significantly higher in the HA group than the controls (31.7 vs. 19.5%, p=0.002). Thus, carriers of the T allele (CT and TT genotypes) had a higher risk for HA (p=0.016, OR=2.04, 95% CI=1.14–3.63). T allele carriers demonstrated decreased HDL-C and increased triglyceride, IL-6 and CRP levels than those with the CC genotype. Conclusion: This study suggests that the-565 C/T polymorphism of ABCA1 gene is associated with an increased risk of HA, decreased HDL-C and increased TG, IL-6 and CRP. PMID:28090279

  5. Human Immunodeficiency Virus Protease Inhibitors Interact with ATP Binding Cassette Transporter 4/Multidrug Resistance Protein 4: A Basis for Unanticipated Enhanced Cytotoxicity

    PubMed Central

    Fukuda, Yu; Takenaka, Kazumasa; Sparreboom, Alex; Cheepala, Satish B.; Wu, Chung-Pu; Ekins, Sean; Ambudkar, Suresh V.

    2013-01-01

    Human immunodeficiency virus (HIV) pharmacotherapy, by combining different drug classes such as nucleoside analogs and HIV protease inhibitors (PIs), has increased HIV-patient life expectancy. Consequently, among these patients, an increase in non-HIV–associated cancers has produced a patient cohort requiring both HIV and cancer chemotherapy. We hypothesized that multidrug resistance protein 4/ATP binding cassette transporter 4 (MRP4/ABCC4), a widely expressed transporter of nucleoside-based antiviral medications as well as cancer therapeutics might interact with PIs. Among the PIs evaluated (nelfinavir, ritonavir, amprenavir, saquinavir, and indinavir), only nelfinavir both effectively stimulated MRP4 ATPase activity and inhibited substrate-stimulated ATPase activity. Saos2 and human embryonic kidney 293 cells engineered to overexpress MRP4 were then used to assess transport and cytotoxicity. MRP4 expression reduced intracellular accumulation of nelfinavir and consequently conferred survival advantage to nelfinavir cytotoxicity. Nelfinavir blocked Mrp4-mediated export, which is consistent with its ability to increase the sensitivity of MRP4-expressing cells to methotrexate. In contrast, targeted inactivation of Abcc4/Mrp4 in mouse cells specifically enhanced nelfinavir and 9-(2-phosphonylmethoxyethyl) adenine cytotoxicity. These results suggest that nelfinavir is both an inhibitor and substrate of MRP4. Because nelfinavir is a new MRP4/ABCC4 substrate, we developed a MRP4/ABCC4 pharmacophore model, which showed that the nelfinavir binding site is shared with chemotherapeutic substrates such as adefovir and methotrexate. Our studies reveal, for the first time, that nelfinavir, a potent and cytotoxic PI, is both a substrate and inhibitor of MRP4. These findings suggest that HIV-infected cancer patients receiving nelfinavir might experience both enhanced antitumor efficacy and unexpected adverse toxicity given the role of MRP4/ABCC4 in exporting nucleoside

  6. Functional interplay between the ATP binding cassette Msr(D) protein and the membrane facilitator superfamily Mef(E) transporter for macrolide resistance in Escherichia coli.

    PubMed

    Nunez-Samudio, Virginia; Chesneau, Olivier

    2013-04-01

    Macrolides have wide clinical applications in the treatment of community-acquired respiratory tract infections, among which streptococci are the most frequent causative agents. An active efflux-based mechanism of macrolide resistance, referred to as the M phenotype in streptococcal isolates, has been associated with the presence of mef genes that encode a subset of major facilitator superfamily (MFS) transporters like Mef(E). An msr(D) gene, adjacent to and co-transcribed with mef in the presence of erythromycin, has also been implicated in drug efflux, but its role remains elusive. Msr(D) belongs to the ATP binding cassette (ABC) proteins and harbors two fused nucleotide-binding domains with no membrane-spanning domains. The present work indicates that the major resistance traits of the M phenotype in Escherichia coli may be due to Msr(D) and not to Mef(E). Fluorescence microscopy using Mef(E) tagged with GFP linked low efficacy of the chimera in conferring macrolide resistance with improper subcellular localization. The active role of Msr(D) in directing Mef(E)-GFP to the cell poles was demonstrated, as was synergistic effect in terms of levels of resistance when both proteins were expressed. A trans-dominant negative mutation within ABC Msr(D) affecting MFS Mef(E) strongly suggests that both proteins can interact in vivo, and such a physical interaction was supported in vitro. This is the first reported example of a functional interplay between an ABC component and an MFS transporter. The direct involvement of Msr(D) in the efflux of macrolides remains to be demonstrated.

  7. Bacteriophage-mediated Glucosylation Can Modify Lipopolysaccharide O-Antigens Synthesized by an ATP-binding Cassette (ABC) Transporter-dependent Assembly Mechanism.

    PubMed

    Mann, Evan; Ovchinnikova, Olga G; King, Jerry D; Whitfield, Chris

    2015-10-16

    Lysogenic bacteriophages may encode enzymes that modify the structures of lipopolysaccharide O-antigen glycans, altering the structure of the bacteriophage receptor and resulting in serotype conversion. This can enhance virulence and has implications for antigenic diversity and vaccine development. Side chain glucosylation is a common modification strategy found in a number of bacterial species. To date, glucosylation has only been observed in O-antigens synthesized by Wzy-dependent pathways, one of the two most prevalent O-antigen synthesis systems. Here we exploited a heterologous system to study the glucosylation potential of a model O-antigen produced in an ATP-binding cassette (ABC) transporter-dependent system. Although O-antigen production is cryptic in Escherichia coli K-12, because of a mutation in the synthesis genes, it possesses a prophage glucosylation cluster, which modifies the GlcNAc residue in an α-l-Rha-(1→3)-d-GlcNAc motif found in the original O16 antigen. Raoultella terrigena ATCC 33257 produces an O-antigen possessing the same disaccharide motif, but its assembly uses an ABC transporter-dependent system. E. coli harboring the R. terrigena O-antigen biosynthesis genes produced an O-antigen displaying reduced reactivity toward antisera raised against the native R. terrigena repeat structure, indicative of an altered chemical structure. Structural determination using NMR revealed the addition of glucose side chains to the repeat units. O-antigen modification was dependent on a functional ABC transporter, consistent with modification in the periplasm, and was eliminated by deletion of the glucosylation genes from the E. coli chromosome, restoring native level antisera sensitivity and structure. There are therefore no intrinsic mechanistic barriers for bacteriophage-mediated O-antigen glucosylation in ABC transporter-dependent pathways.

  8. Seminal Plasma Characteristics and Expression of ATP-binding Cassette Transporter A1 (ABCA1) in Canine Spermatozoa from Ejaculates with Good and Bad Freezability.

    PubMed

    Schäfer-Somi, S; Palme, N

    2016-04-01

    The composition of seminal plasma and the localization of the ATP-binding cassette transporter A1 (ABCA1) in spermatozoa from good and bad freezers were compared to frozen-thawed spermatozoa from the same dog. Ejaculates were obtained from 31 stud dogs, and the sperm-rich fraction (SRF) was kept for analysis. One aliquot was used for the analysis of concentration, progressive motility (P; CASA), viability (V; CASA) and leucocyte count, and the analysis was performed by flow cytometry (FITC-PNA/PI), SCSA and HOST. In seminal plasma, concentration of albumin, cholesterol, calcium, inorganic phosphate, sodium, potassium, zinc and copper was measured. Semen smears were prepared and evaluated for the expression of ABCA1. The remainder of each ejaculate was frozen. After thawing, the quality assessment was repeated and further smears were prepared. According to post-thaw semen quality, dogs were assigned to good freezers (n = 20) or bad freezers (n = 11), the latter were defined as < 50% progressive motility and/or > 40% morphologically abnormal sperm and/or < 50% viability. Bad freezers were older than good freezers (5.3 vs 3.4 years, p < 0.05). In bad freezers, the percentage of sperm with ABCA1 signal in the acrosome was lower (26.3% vs 35.7%, p < 0.01) and the percentage of sperm with complete loss of ABCA1 signal higher (46.7% vs 30%, p < 0.01); the percentage of dead spermatozoa was higher (36.1% vs 25.5%, p < 0.05), and the concentration of cholesterol and sodium in seminal plasma was lower than in good freezers (p < 0.05). We conclude that in thawed bad freezer sperm, an increase in acrosome damages coincided with an increased loss of cholesterol transporters and cell death, and a lower cholesterol concentration in seminal plasma. Follow-up studies revealed whether a relation exists between these findings.

  9. AtMRP2, an Arabidopsis ATP binding cassette transporter able to transport glutathione S-conjugates and chlorophyll catabolites: functional comparisons with Atmrp1.

    PubMed Central

    Lu, Y P; Li, Z S; Drozdowicz, Y M; Hortensteiner, S; Martinoia, E; Rea, P A

    1998-01-01

    Three ATP binding cassette (ABC) transporter-like activities directed toward large amphipathic organic anions have recently been identified on the vacuolar membrane of plant cells. These are the Mg-ATP-energized, vanadate-inhibitable vacuolar accumulation of glutathione S-conjugates (GS conjugates), chlorophyll catabolites, and bile acids, respectively. Although each of these activities previously had been assigned to distinct pumps in native plant membranes, we describe here the molecular cloning, physical mapping, and heterologous expression of a gene, AtMRP2, from Arabidopsis thaliana that encodes a multispecific ABC transporter competent in the transport of both GS conjugates and chlorophyll catabolites. Unlike its isoform, AtMRP1, which transports the model Brassica napus chlorophyll catabolite transporter substrate Bn-NCC-1 at low efficiency, heterologously expressed AtMRP2 has the facility for simultaneous high-efficiency parallel transport of GS conjugates and Bn-NCC-1. The properties of AtMRP2 therefore establish a basis for the manipulation of two previously identified plant ABC transporter activities and provide an explanation for how the comparable transporter in native plant membranes would be systematically mistaken for two distinct transporters. These findings are discussed with respect to the functional organization of AtMRP2, the inability of AtMRP2 and AtMRP1 to transport the model bile acid transporter substrate taurocholate (despite the pronounced sensitivity of both to direct inhibition by this agent), the differential patterns of expression of their genes in the intact plant, and the high capacity of AtMRP2 for the transport of glutathionated herbicides and anthocyanins. PMID:9490749

  10. ATP-binding Cassette (ABC) Transport System Solute-binding Protein-guided Identification of Novel d-Altritol and Galactitol Catabolic Pathways in Agrobacterium tumefaciens C58*

    PubMed Central

    Wichelecki, Daniel J.; Vetting, Matthew W.; Chou, Liyushang; Al-Obaidi, Nawar; Bouvier, Jason T.; Almo, Steven C.; Gerlt, John A.

    2015-01-01

    Innovations in the discovery of the functions of uncharacterized proteins/enzymes have become increasingly important as advances in sequencing technology flood protein databases with an exponentially growing number of open reading frames. This study documents one such innovation developed by the Enzyme Function Initiative (EFI; U54GM093342), the use of solute-binding proteins for transport systems to identify novel metabolic pathways. In a previous study, this strategy was applied to the tripartite ATP-independent periplasmic transporters. Here, we apply this strategy to the ATP-binding cassette transporters and report the discovery of novel catabolic pathways for d-altritol and galactitol in Agrobacterium tumefaciens C58. These efforts resulted in the description of three novel enzymatic reactions as follows: 1) oxidation of d-altritol to d-tagatose via a dehydrogenase in Pfam family PF00107, a previously unknown reaction; 2) phosphorylation of d-tagatose to d-tagatose 6-phosphate via a kinase in Pfam family PF00294, a previously orphan EC number; and 3) epimerization of d-tagatose 6-phosphate C-4 to d-fructose 6-phosphate via a member of Pfam family PF08013, another previously unknown reaction. The epimerization reaction catalyzed by a member of PF08013 is especially noteworthy, because the functions of members of PF08013 have been unknown. These discoveries were assisted by the following two synergistic bioinformatics web tools made available by the Enzyme Function Initiative: the EFI-Enzyme Similarity Tool and the EFI-Genome Neighborhood Tool. PMID:26472925

  11. Drug interaction between sunitinib and cimetidine and contribution of the efflux transporter ATP-binding cassette C2 to biliary excretion of sunitinib in rats.

    PubMed

    Arakawa-Todo, Maki; Ueyama, Jun; Nomura, Hiroshi; Abe, Fumie; Tsukiyama, Ikuto; Matsuura, Katsuhiko; Hasegawa, Takaaki

    2013-08-01

    The present study investigated the effect of the H2 antagonist cimetidine on the pharmacokinetics of a multi-targeted receptor tyrosine kinase (RTK) inhibitor, sunitinib, in Sprague-Dawley (SD) rats and Eisai hyperbilirubinemic mutant rats (EHBR) lacking the efflux transporter, ATP-binding cassette C2 protein (ABCC2). Rats received an intraperitoneal injection of cimetidine (10 mg/kg) once a day for three days. On day 4, sunitinib (3 mg/kg) was administered intravenously 30 min after the final injection of cimetidine or saline to SD rats. Disappearance of sunitinib from plasma was significantly delayed by cimetidine. The pharmacokinetic parameter of sunitinib, systemic clearance (CLSYS), was significantly reduced and the half-life was significantly prolonged, with no change in the volume of distribution at steady-state (VSS). When the effect of cimetidine on the biliary excretion of sunitinib at steady-state condition was investigated in SD rats, cimetidine had no effect on some transporter-mediated biliary excretion of sunitinib. Furthermore, the contribution of ABCC2 to the biliary excretion of sunitinib was also examined in SD rats and EHBR. The biliary clearance of sunitinib was significantly lower in EHBR, but the biliary excretion rate of EHBR was not different from that of SD rats, and the contribution of biliary excretion to systemic elimination was small, suggesting that sunitinib is mainly eliminated by cytochrome P450 3A4 (CYP3A4)-mediated metabolism and is not excreted into the bile via ABCC2. These findings indicate that co-administration of cimetidine alters the pharmacokinetics of sunitinib probably due to inhibition of CYP3A4, suggesting the possibility that cimetidine should be used carefully for patients with cancer being treated with sunitinib therapy.

  12. Vacuolar Transport of Abscisic Acid Glucosyl Ester Is Mediated by ATP-Binding Cassette and Proton-Antiport Mechanisms in Arabidopsis1[W][OPEN

    PubMed Central

    Burla, Bo; Pfrunder, Stefanie; Nagy, Réka; Francisco, Rita Maria; Lee, Youngsook; Martinoia, Enrico

    2013-01-01

    Abscisic acid (ABA) is a key plant hormone involved in diverse physiological and developmental processes, including abiotic stress responses and the regulation of stomatal aperture and seed germination. Abscisic acid glucosyl ester (ABA-GE) is a hydrolyzable ABA conjugate that accumulates in the vacuole and presumably also in the endoplasmic reticulum. Deconjugation of ABA-GE by the endoplasmic reticulum and vacuolar β-glucosidases allows the rapid formation of free ABA in response to abiotic stress conditions such as dehydration and salt stress. ABA-GE further contributes to the maintenance of ABA homeostasis, as it is the major ABA catabolite exported from the cytosol. In this work, we identified that the import of ABA-GE into vacuoles isolated from Arabidopsis (Arabidopsis thaliana) mesophyll cells is mediated by two distinct membrane transport mechanisms: proton gradient-driven and ATP-binding cassette (ABC) transporters. Both systems have similar Km values of approximately 1 mm. According to our estimations, this low affinity appears nevertheless to be sufficient for the continuous vacuolar sequestration of ABA-GE produced in the cytosol. We further demonstrate that two tested multispecific vacuolar ABCC-type ABC transporters from Arabidopsis exhibit ABA-GE transport activity when expressed in yeast (Saccharomyces cerevisiae), which also supports the involvement of ABC transporters in ABA-GE uptake. Our findings suggest that the vacuolar ABA-GE uptake is not mediated by specific, but rather by several, possibly multispecific, transporters that are involved in the general vacuolar sequestration of conjugated metabolites. PMID:24028845

  13. Drug resistance is conferred on the model yeast Saccharomyces cerevisiae by expression of full-length melanoma-associated human ATP-binding cassette transporter ABCB5.

    PubMed

    Keniya, Mikhail V; Holmes, Ann R; Niimi, Masakazu; Lamping, Erwin; Gillet, Jean-Pierre; Gottesman, Michael M; Cannon, Richard D

    2014-10-06

    ABCB5, an ATP-binding cassette (ABC) transporter, is highly expressed in melanoma cells, and may contribute to the extreme resistance of melanomas to chemotherapy by efflux of anti-cancer drugs. Our goal was to determine whether we could functionally express human ABCB5 in the model yeast Saccharomyces cerevisiae, in order to demonstrate an efflux function for ABCB5 in the absence of background pump activity from other human transporters. Heterologous expression would also facilitate drug discovery for this important target. DNAs encoding ABCB5 sequences were cloned into the chromosomal PDR5 locus of a S. cerevisiae strain in which seven endogenous ABC transporters have been deleted. Protein expression in the yeast cells was monitored by immunodetection using both a specific anti-ABCB5 antibody and a cross-reactive anti-ABCB1 antibody. ABCB5 function in recombinant yeast cells was measured by determining whether the cells possessed increased resistance to known pump substrates, compared to the host yeast strain, in assays of yeast growth. Three ABCB5 constructs were made in yeast. One was derived from the ABCB5-β mRNA, which is highly expressed in human tissues but is a truncation of a canonical full-size ABC transporter. Two constructs contained full-length ABCB5 sequences: either a native sequence from cDNA or a synthetic sequence codon-harmonized for S. cerevisiae. Expression of all three constructs in yeast was confirmed by immunodetection. Expression of the codon-harmonized full-length ABCB5 DNA conferred increased resistance, relative to the host yeast strain, to the putative substrates rhodamine 123, daunorubicin, tetramethylrhodamine, FK506, or clorgyline. We conclude that full-length ABCB5 can be functionally expressed in S. cerevisiae and confers drug resistance.

  14. Effect of ATP-binding Cassette Transporter A1 (ABCA1) Gene Polymorphisms on Plasma Lipid Variables and Common Demographic Parameters in Greek Nurses

    PubMed Central

    Kolovou, Vana; Marvaki, Apostolia; Boutsikou, Maria; Vasilopoulos, Georgios; Degiannis, Dimitrios; Marvaki, Christina; Kolovou, Genovefa

    2016-01-01

    Objective: The present study is on line with our previous studies evaluating the influence of ATP-binding cassette transporter A1 (ABCA1) gene polymorphisms on the lipid variables of Greek student-nurses. The current study was undertaken to (1) estimate the influence of variant(s) such as rs2066715 (V825I), R219K, R1587K, I883M of ABCA1 gene on lipid variables and (2) evaluate the effect of all four ABCA1 polymorphisms on common demographic parameters. Methods: The study population involved 432 unrelated nurses (86 men) who were genotyped for ABCA1 polymorphisms and correlated according to lipid variables [total cholesterol (TC), triglycerides (TGs), high density lipoprotein cholesterol (HDL-C), low density lipoprotein cholesterol (LDL-C) and apolipoprotein (apo) A] and demographic parameters (age, gender, BMI, waist circumference). Results: According to lipid variables concentration there was no difference between genotypes and alleles of V825I, R219K and I883M polymorphisms. The LDL-C concentration was 13% lower in RR compared with RK genotype (100.7 vs. 113.9 mg/dl, p=0.013) of R1587K gene polymorphism. In regression analysis the effects of age, gender and only R1587K gene polymorphism on LDL-C concentrations were proved significant. Additionally, LDL-C was increased (by 1.29 mg/dl on average) by every year of increase of age. Moreover, females had lower LDL-C concentrations as compared with males. Conclusion: Findings suggested that only R1587K polymorphism of ABCA1 gene was associated with lipid variables, age, and gender of Greek nurses. These findings may be helpful in assessing the risk factors for premature coronary heart disease and distinct individuals with lower/higher atherosclerotic burden. PMID:27990182

  15. Thiamin diphosphate in biological chemistry: new aspects of thiamin metabolism, especially triphosphate derivatives acting other than as cofactors.

    PubMed

    Bettendorff, Lucien; Wins, Pierre

    2009-06-01

    Prokaryotes, yeasts and plants synthesize thiamin (vitamin B1) via complex pathways. Animal cells capture the vitamin through specific high-affinity transporters essential for internal thiamin homeostasis. Inside the cells, thiamin is phosphorylated to higher phosphate derivatives. Thiamin diphosphate (ThDP) is the best-known thiamin compound because of its role as an enzymatic cofactor. However, in addition to ThDP, at least three other thiamin phosphates occur naturally in most cells: thiamin monophosphate, thiamin triphosphate (ThTP) and the recently discovered adenosine thiamin triphosphate. It has been suggested that ThTP has a specific neurophysiological role, but recent data favor a much more basic metabolic function. During amino acid starvation, Escherichia coli accumulate ThTP, possibly acting as a signal involved in the adaptation of the bacteria to changing nutritional conditions. In animal cells, ThTP can phosphorylate some proteins, but the physiological significance of this mechanism remains unknown. Adenosine thiamin triphosphate, recently discovered in E. coli, accumulates during carbon starvation and might act as an alarmone. Among the proteins involved in thiamin metabolism, thiamin transporters, thiamin pyrophosphokinase and a soluble 25-kDa thiamin triphosphatase have been characterized at the molecular level, in contrast to thiamin mono- and diphosphatases whose specificities remain to be proven. A soluble enzyme catalyzing the synthesis of adenosine thiamin triphosphate from ThDP and ADP or ATP has been partially characterized in E. coli, but the mechanism of ThTP synthesis remains elusive. The data reviewed here illustrate the complexity of thiamin biochemistry, which is not restricted to the cofactor role of ThDP.

  16. Solution structure of the 45-residue MgATP-binding peptide of adenylate kinase as examined by 2-D NMR, FTIR, and CD spectroscopy.

    PubMed

    Fry, D C; Byler, D M; Susi, H; Brown, E M; Kuby, S A; Mildvan, A S

    1988-05-17

    The structure of a synthetic peptide corresponding to residues 1-45 of rabbit muscle adenylate kinase has been studied in aqueous solution by two-dimensional NMR, FTIR, and CD spectroscopy. This peptide, which binds MgATP and is believed to represent most of the MgATP-binding site of the enzyme [Fry, D.C., Kuby, S.A., & Mildvan, A.S. (1985) Biochemistry 24, 4680-4694], appears to maintain a conformation similar to that of residues 1-45 in the X-ray structure of intact porcine adenylate kinase [Sachsenheimer, W., & Schulz, G.E. (1977) J. Mol. Biol. 114, 23-26], with 42% of the residues of the peptide showing NOEs indicative of phi and psi angles corresponding to those found in the protein. The NMR studies suggest that the peptide is composed of two helical regions of residues 4-7 and 23-29, and three stretches of beta-strand at residues 8-15, 30-32, and 35-40, yielding an overall secondary structure consisting of 24% alpha-helix, 38% beta-structure, and 38% aperiodic. Although the resolution-enhanced amide I band of the peptide FTIR spectrum is broad and rather featureless, possibly due to disorder, it can be fit by using methods developed on well-characterized globular proteins. On this basis, the peptide consists of 35 +/- 10% beta-structure, 60 +/- 12% turns and aperiodic structure, and not more than 10% alpha-helix. The CD spectrum is best fit by assuming the presence of at most 13% alpha-helix in the peptide, 24 +/- 2% beta-structure, and 66 +/- 4% aperiodic. The inability of the high-frequency FTIR and CD methods to detect helices in the amount found by NMR may result from the short helical lengths as well as from static and dynamic disorder in the peptide. Upon binding of MgATP, numerous conformational changes in the backbone of the peptide are detected by NMR, with smaller alterations in the overall secondary structure as assessed by CD. Detailed assignments of resonances in the peptide spectrum and intermolecular NOEs between protons of bound MgATP and

  17. Mycophenolic acid induces ATP-binding cassette transporter A1 (ABCA1) expression through the PPAR{gamma}-LXR{alpha}-ABCA1 pathway

    SciTech Connect

    Xu, Yanni; Lai, Fangfang; Xu, Yang; Wu, Yexiang; Liu, Qi; Li, Ni; Wei, Yuzhen; Feng, Tingting; Zheng, Zhihui; Jiang, Wei; Yu, Liyan; Hong, Bin; Si, Shuyi

    2011-11-04

    Highlights: Black-Right-Pointing-Pointer Using an ABCA1p-LUC HepG2 cell line, we found that MPA upregulated ABCA1 expression. Black-Right-Pointing-Pointer MPA induced ABCA1 and LXR{alpha} protein expression in HepG2 cells. Black-Right-Pointing-Pointer PPAR{gamma} antagonist GW9662 markedly inhibited MPA-induced ABCA1 and LXR{alpha} protein expression. Black-Right-Pointing-Pointer The effect of MPA upregulating ABCA1 was due mainly to activation of the PPAR{gamma}-LXR{alpha}-ABCA1 pathway. -- Abstract: ATP-binding cassette transporter A1 (ABCA1) promotes cholesterol and phospholipid efflux from cells to lipid-poor apolipoprotein A-I and plays an important role in atherosclerosis. In a previous study, we developed a high-throughput screening method using an ABCA1p-LUC HepG2 cell line to find upregulators of ABCA1. Using this method in the present study, we found that mycophenolic acid (MPA) upregulated ABCA1 expression (EC50 = 0.09 {mu}M). MPA upregulation of ABCA1 expression was confirmed by real-time quantitative reverse transcription-PCR and Western blot analysis in HepG2 cells. Previous work has indicated that MPA is a potent agonist of peroxisome proliferator-activated receptor gamma (PPAR{gamma}; EC50 = 5.2-9.3 {mu}M). Liver X receptor {alpha} (LXR{alpha}) is a target gene of PPAR{gamma} and may directly regulate ABCA1 expression. Western blot analysis showed that MPA induced LXR{alpha} protein expression in HepG2 cells. Addition of PPAR{gamma} antagonist GW9662 markedly inhibited MPA-induced ABCA1 and LXR{alpha} protein expression. These data suggest that MPA increased ABCA1 expression mainly through activation of PPAR{gamma}. Thus, the effects of MPA on upregulation of ABCA1 expression were due mainly to activation of the PPAR{gamma}-LXR{alpha}-ABCA1 signaling pathway. This is the first report that the antiatherosclerosis activity of MPA is due to this mechanism.

  18. Characterization of the nucleoside triphosphate phosphohydrolase I gene from the Choristoneura fumiferana entomopoxvirus.

    PubMed

    Li, X; Wallis, J L; Barrett, J W; Krell, P J; Arif, B M

    1998-07-01

    Poxviruses carry the enzyme, nucleoside triphosphate phosphohydrolase I (NPH I), required for early viral transcription in the cytoplasm of infected cells. The gene (nph I) encoding this enzyme from Choristoneura fumiferana entomopoxvirus (CfEPV) has been located in the viral genome, cloned and characterized. It has an open reading frame of 1941 nucleotides, potentially encoding a protein with a predicted molecular mass of 76.04 kDa and a pI of 8.83. It has a TAAATG motif where the trinucleotide ATG represents the translational start signal an AT-rich (88%) sequence and an early transcription termination signal (TTTTTAT) upstream of the ATG codon. Northern blot analysis of mRNA from infected larvae showed that a single 4.0 kb transcript which appeared late at day 20 post infection (p.i.) and its transcription continued till day 37 p.i.. Primer extension experiments suggested that the main transcripts started at 15 bases upstream of AUG codon. NPH I homologues have been found in the genomes of other entomopoxviruses and vertebrate poxviruses. Alignment of their amino acid sequences suggested three conserved domains, two of which are considered as ATP binding domains. The most similar homologue is from the closely related entomopoxvirus. Choristoneura biennis EPV (CbEPV) where 98.2% of nucleotide and 97.2% of amino acid identities are observed, respectively. A single nucleotide difference in CfEPV nph I was sufficient to distinguish it from CbEPV by PCR amplification and digestion with a restriction enzyme.

  19. Adenosine receptor neurobiology: overview.

    PubMed

    Chen, Jiang-Fan; Lee, Chien-fei; Chern, Yijuang

    2014-01-01

    Adenosine is a naturally occurring nucleoside that is distributed ubiquitously throughout the body as a metabolic intermediary. In the brain, adenosine functions as an important upstream neuromodulator of a broad spectrum of neurotransmitters, receptors, and signaling pathways. By acting through four G-protein-coupled receptors, adenosine contributes critically to homeostasis and neuromodulatory control of a variety of normal and abnormal brain functions, ranging from synaptic plasticity, to cognition, to sleep, to motor activity to neuroinflammation, and cell death. This review begun with an overview of the gene and genome structure and the expression pattern of adenosine receptors (ARs). We feature several new developments over the past decade in our understanding of AR functions in the brain, with special focus on the identification and characterization of canonical and noncanonical signaling pathways of ARs. We provide an update on functional insights from complementary genetic-knockout and pharmacological studies on the AR control of various brain functions. We also highlight several novel and recent developments of AR neurobiology, including (i) recent breakthrough in high resolution of three-dimension structure of adenosine A2A receptors (A2ARs) in several functional status, (ii) receptor-receptor heterodimerization, (iii) AR function in glial cells, and (iv) the druggability of AR. We concluded the review with the contention that these new developments extend and strengthen the support for A1 and A2ARs in brain as therapeutic targets for neurologic and psychiatric diseases.

  20. Colorimetric sensor for triphosphates and their application as a viable staining agent for prokaryotes and eukaryotes.

    PubMed

    Ghosh, Amrita; Shrivastav, Anupama; Jose, D Amilan; Mishra, Sanjiv K; Chandrakanth, C K; Mishra, Sandhya; Das, Amitava

    2008-07-15

    The chromogenic complex 1 x Zn (where 1 is (E)-4-(4-dimethylamino-phenylazo)-N,N-bispyridin-2-ylmethyl-benzenesulfonamide) showed high affinity toward the phosphate ion in tetrabutylammonium phosphate in acetonitrile solution and could preferentially bind to adenosine triphosphate (ATP) in aqueous solution at physiological pH. This binding caused a visual change in color, whereas no such change was noticed with other related anions (adenosine monophosphate, adenosine diphosphate, pyrophosphate, and phosphate) of biological significance. Thus, 1 x Zn could be used as a staining agent for different biological cells through binding to the ATP, generated in situ by the mitochondria (in eukaryotes). For prokaryotes (bacteria) the cell membrane takes care of the cells' energy conversion, since they lack mitochondria. ATP is produced in their unique cell structure on the cell membrane, which is not found in any eukaryotes. These stained cells could be viewed with normal light microscopy. This reagent could even be used for distinguishing the gram-positive and the gram-negative bacteria (prokaryotes). This dye was found to be nonlipophilic in nature and nontoxic to living microbes (eukaryotes and prokaryotes). Further, stained cells were found to grow in their respective media, and this confirmed the maintenance of viability of the microbes even after staining, unlike with many other dyes available commercially.

  1. Fluorometric Determination of Adenosine Nucleotide Derivatives as Measures of the Microfouling, Detrital, and Sedimentary Microbial Biomass and Physiological Status

    PubMed Central

    Davis, William M.; White, David C.

    1980-01-01

    Adenosine, adenine, cyclic adenosine monophosphate (AMP), AMP, nicotinamide adenine dinucleotide, adenosine diphosphate, and adenosine triphosphate (ATP) were recovered quantitatively from aqueous portions of lipid extracts of microfouling, detrital, and sedimentary microbial communities. These could be detected quantitatively in the picomolar range by forming their 1-N6-etheno derivatives and analyzing by high-pressure liquid chromatography with fluorescence detection. Lipid extraction and subsequent analysis allowed the simultaneous measurement of the microbial community structure, total microbial biomass with the quantitative recovery of the adenine-containing cellular components, which were protected from enzymatic destruction. This extraction and fluorescent derivatization method showed equivalency with the luciferin-luciferase method for bacterial ATP measurements. Quick-freezing samples in the field with dry ice-acetone preserved the ATP and energy charge (a ratio of adenosine nucleotides) for analysis at remote laboratories. The metabolic lability of ATP in estuarine detrital and microfouling communities, as well as bacterial monocultures of constant biomass, showed ATP to be a precarious measure of biomass under some conditions. Combinations of adenosine and adenine nucleotides gave better correlations with microbial biomass measured as extractable lipid phosphate in the detrital and microfouling microbial communities than did ATP alone. Stresses such as anoxia or filtration are reflected in the rapid accumulation of intracellular adenosine and the excretion of adenosine and AMP into the surrounding milieu. Increases in AMP and adenosine may prove to be more sensitive indicators of metabolic status than the energy charge. PMID:16345633

  2. Adenosine and sleep

    SciTech Connect

    Yanik, G.M. Jr.

    1987-01-01

    Behavioral and biochemical approaches have been used to determine the relative contribution of endogenous adenosine and adenosine receptors to the sleep-wake cycle in the rat. Adenosine concentrations in specific areas of the rat brain were not affected by 24 hours of total sleep deprivation, or by 24 or 48 hours of REM sleep deprivation. In order to assess the effect of REM sleep deprivation on adenosine A/sub 1/ receptors, /sup 3/H-L-PIA binding was measured. The Bmax values for /sup 3/H-L-PIA binding to membrane preparations of the cortices and corpus striata from 48 hour REM sleep-deprived animals were increased 14.8% and 23%, respectively. These increases were not maintained following the cessation of sleep deprivation and recovered within 2 hours. The results of a 96 hour REM deprivation experiment were similar to those of the 48 hour REM sleep deprivation experiment. However, these increases were not evident in similar structures taken from stress control animals, and conclusively demonstrated that the changes in /sup 3/H-L-PIA binding resulted from REM sleep deprivation and not from stress.

  3. Studies on adenosine triphosphate transphosphorylases. Amino acid sequence of rabbit muscle ATP-AMP transphosphorylase.

    PubMed

    Kuby, S A; Palmieri, R H; Frischat, A; Fischer, A H; Wu, L H; Maland, L; Manship, M

    1984-05-22

    The total amino acid sequence of rabbit muscle adenylate kinase has been determined, and the single polypeptide chain of 194 amino acid residues starts with N-acetylmethionine and ends with leucyllysine at its carboxyl terminus, in agreement with the earlier data on its amino acid composition [Mahowald, T. A., Noltmann, E. A., & Kuby, S. A. (1962) J. Biol. Chem. 237, 1138-1145] and its carboxyl-terminus sequence [Olson, O. E., & Kuby, S. A. (1964) J. Biol. Chem. 239, 460-467]. Elucidation of the primary structure was based on tryptic and chymotryptic cleavages of the performic acid oxidized protein, cyanogen bromide cleavages of the 14C-labeled S-carboxymethylated protein at its five methionine sites (followed by maleylation of peptide fragments), and tryptic cleavages at its 12 arginine sites of the maleylated 14C-labeled S-carboxymethylated protein. Calf muscle myokinase, whose sequence has also been established, differs primarily from the rabbit muscle myokinase's sequence in the following: His-30 is replaced by Gln-30; Lys-56 is replaced by Met-56; Ala-84 and Asp 85 are replaced by Val-84 and Asn-85. A comparison of the four muscle-type adenylate kinases, whose covalent structures have now been determined, viz., rabbit, calf, porcine, and human [for the latter two sequences see Heil, A., Müller, G., Noda, L., Pinder, T., Schirmer, H., Schirmer, I., & Von Zabern, I. (1974) Eur. J. Biochem. 43, 131-144, and Von Zabern, I., Wittmann-Liebold, B., Untucht-Grau, R., Schirmer, R. H., & Pai, E. F. (1976) Eur. J. Biochem. 68, 281-290], demonstrates an extraordinary degree of homology.(ABSTRACT TRUNCATED AT 250 WORDS)

  4. Rapid Phytochrome-mediated Changes in Adenosine 5'-Triphosphate Content of Etiolated Bean Buds.

    PubMed

    White, J M; Pike, C S

    1974-01-01

    This study was designed to determine the effects of red and far red irradiation on ATP metabolism in etiolated bean buds (Phaseolus vulgaris L. var. Red Kidney). Compared to dark controls, red irradiated buds show an initial decline in ATP content at 15 seconds following a 5-minute irradiation. ATP content then rapidly rises to a peak at 1 minute, and then slowly returns to the baseline. The 1-minute promotion of ATP content is red/far red reversible. Acetylcholine does not appear to mimic red light in this system; it causes a marked decrease in ATP content.

  5. Sperm morphology, adenosine triphosphate (ATP) concentration and swimming velocity: unexpected relationships in a passerine bird

    PubMed Central

    Bennison, Clair; Brookes, Lola; Slate, Jon; Birkhead, Tim

    2016-01-01

    The relationship between sperm energetics and sperm function is poorly known, but is central to our understanding of the evolution of sperm traits. The aim of this study was to examine how sperm morphology and ATP content affect sperm swimming velocity in the zebra finch Taeniopygia guttata. We exploited the high inter-male variation in this species and created extra experimental power by increasing the number of individuals with very long or short sperm through artificial selection. We found a pronounced quadratic relationship between total sperm length and swimming velocity, with velocity increasing with length up to a point, but declining in the very longest sperm. We also found an unexpected negative association between midpiece length and ATP content: sperm with a short midpiece generally contained the highest concentration of ATP. Low intracellular ATP is therefore unlikely to explain reduced swimming velocity among the very longest sperm (which tend to have a shorter midpiece). PMID:27559067

  6. Adenosine triphosphate (ATP) reduces amyloid-β protein misfolding in vitro.

    PubMed

    Coskuner, Orkid; Murray, Ian V J

    2014-01-01

    Alzheimer's disease (AD) is a devastating disease of aging that initiates decades prior to clinical manifestation and represents an impending epidemic. Two early features of AD are metabolic dysfunction and changes in amyloid-β protein (Aβ) levels. Since levels of ATP decrease over the course of the disease and Aβ is an early biomarker of AD, we sought to uncover novel linkages between the two. First and remarkably, a GxxxG motif is common between both Aβ (oligomerization motif) and nucleotide binding proteins (Rossmann fold). Second, ATP was demonstrated to protect against Aβ mediated cytotoxicity. Last, there is structural similarity between ATP and amyloid binding/inhibitory compounds such as ThioT, melatonin, and indoles. Thus, we investigated whether ATP alters misfolding of the pathologically relevant Aβ42. To test this hypothesis, we performed computational and biochemical studies. Our computational studies demonstrate that ATP interacts strongly with Tyr10 and Ser26 of Aβ fibrils in solution. Experimentally, both ATP and ADP reduced Aβ misfolding at physiological intracellular concentrations, with thresholds at ~500 μM and 1 mM respectively. This inhibition of Aβ misfolding is specific; requiring Tyr10 of Aβ and is enhanced by magnesium. Last, cerebrospinal fluid ATP levels are in the nanomolar range and decreased with AD pathology. This initial and novel finding regarding the ATP interaction with Aβ and reduction of Aβ misfolding has potential significance to the AD field. It provides an underlying mechanism for published links between metabolic dysfunction and AD. It also suggests a potential role of ATP in AD pathology, as the occurrence of misfolded extracellular Aβ mirrors lowered extracellular ATP levels. Last, the findings suggest that Aβ conformation change may be a sensor of metabolic dysfunction.

  7. Adenosine triphosphate depletion reverses sodium-dependent, neuronal uptake of glutamate in rat hippocampal slices.

    PubMed

    Madl, J E; Burgesser, K

    1993-10-01

    Extracellular accumulations of excitatory amino acids (EAAs) may mediate ischemic neuronal damage. Metabolic insults can decrease Na+ and K+ plasma membrane gradients, thereby reducing the driving force for uptake of EAAs into cells by Na(+)-dependent EAA cotransporters. EAA accumulations could result from decreased uptake and increased release due to reversal of these cotransporters. ATP depletion, uptake, and release of EAAs were measured by HPLC in slices treated with metabolic inhibitors. Inhibition and reversal of cotransporters were determined by uptake or release of D,L-threo-beta-hydroxyaspartate (OH-Asp), an EAA analog with high affinity for cotransporters. Moderate ATP depletion (7 > ATP nmol/mg protein > 3) reduced uptake by cotransporters without increasing release of EAAs. When ATP was severely depleted (ATP < 2 nmol/mg protein), increased release of EAAs and preloaded OH-Asp occurred, consistent with reversal of cotransporters. Release of glutamine and asparagine was not increased, confirming that release was not primarily due to nonselective increased membrane permeability. ATP depletion and ouabain acted synergistically to produce EAA release, strongly suggesting release was largely mediated by inhibition of Na/K-ATPases. Severe ATP depletion decreased glutamate-like immunoreactivity primarily in axonal terminal-like structures, suggesting release occurred primarily from terminals. Moderate ATP depletion may increase extracellular EAAs by decreasing uptake. Severe ATP depletion may further increase EAAs by reversing uptake, thereby releasing cytosolic neuronal pools of EAAs.

  8. Monitoring of bacterial contamination of dental unit water lines using adenosine triphosphate bioluminescence.

    PubMed

    Watanabe, A; Tamaki, N; Yokota, K; Matsuyama, M; Kokeguchi, S

    2016-12-01

    Bacterial contamination of dental unit waterlines (DUWLs) was evaluated using ATP bioluminescence analysis and a conventional culture method. Water samples (N=44) from DUWLs were investigated for heterotrophic bacteria by culture on R2A agar, which gave counts ranging from 1.4×10(3) to 2.7×10(5) cfu/mL. The ATP bioluminescence results for DUWL samples ranged from 6 to 1189 relative light units and could be obtained within 1min; these correlated well with the culture results (r=0.727-0.855). We conclude that the results of the ATP bioluminescence assay accurately reflect the results of conventional culture-based testing. This method is potentially useful for rapid and simple monitoring of DUWL bacterial contamination.

  9. Ultrasensitive bioluminescent determinations of adenosine triphosphate (ATP) for investigating the energetics of host-grown microbes

    NASA Technical Reports Server (NTRS)

    Hanks, J. H.; Dhople, A. M.

    1975-01-01

    Stability and optimal concentrations of reagents were studied in bioluminescence assay of ATP levels. Luciferase enzyme was prepared and purified using Sephadex G-100. Interdependencies between enzyme and luciferin concentrations in presence of optimal Mg are illustrated. Optimal ionic strength was confirmed to be 0.05 M for the four buffers tested. Adapted features of the R- and H-systems are summarized, as well as the percentages of ATP pools released from representative microbes by heat and chloroform.

  10. Appearance of adenosine triphosphate in the perfusate from working frog heart.

    PubMed

    Doyle, T B; Forrester, T

    1985-09-01

    Frog hearts (Rana pipiens) were perfused in situ with Ringer's solution and the perfusate tested on firefly extract for the presence of ATP. At a normal perfusion pressure of 8 cm. H2O the rate of release of ATP into the perfusate was 8.8 (+/- S.E.1.7) pmoles.min-1. When the workload was increased by raising the perfusion pressure to 12 cm. H2O the rate of release increased to 28.3 (+/- S.E.4.8) pmoles.min-1. The rate of release was found to be proportional to the amount of workload imposed upon the heart. It is postulated that the trigger for release is hypoxia and that the release of ATP from the cardiac cell will augment contractility of the myocardium through its action upon adjacent cells via the P2 purinergic receptor. cells via the P2 purinergic receptor.

  11. Two pH optima of adenosine 5'-triphosphate dependent deoxyribonuclease from Bacillus laterosporus.

    PubMed

    Fujiyoshi, T; Nakayama, J; Anai, M

    1982-08-17

    The various catalytic activities of the ATP-dependent deoxyribonuclease (DNase) of Bacillus laterosporus have pH optima at 6.3 and 8.3. Although the pH profile of ATP-dependent DNase activity on duplex DNA is bell shaped with a maximum at about pH 8.3, ATP-dependent DNAse activity on single-stranded DNA has optima at pH 6.3 and 8.3. ATPase activities dependent on double-stranded and single-stranded DNA have a high bell-shaped peak with a maximum at pH 6.3 with a low and broad shoulder at about pH 8.3. ATP-independent DNase activity also has optima at pH 6.3 and 8.3. The ratio of the amount of ATP hydrolyzed per number of cleaved phosphodiester bonds in DNA increases with decrease in the pH value of the reaction. The ratios obtained at pH 8.3 and 6.3 were respectively about 3 and 22 with duplex DNA as substrate and 5 and 17 with single-stranded DNA as substrate. Formation of a single-stranded region of 15000-20000 nucleotides, which is linked to duplex DNA and about half of which has 3'-hydroxyl termini, was observed at about pH 6.3, but not at above pH 7.5. Furthermore, the optimum concentrations of divalent cations for the activity producing the single-stranded region and the activity hydrolyzing ATP were identical (3 mM Mn2+ or 5 mM Mg2+). Thus the two activities are closely related. These results indicate that the enzyme has two different modes of action on duplex DNA which are modulated by the pH.

  12. An adenosine triphosphate-dependent deoxyribonuclease from Bacillus laterosporus. Improved purification, subunit structure and substrate specificity.

    PubMed

    Fujiyoshi, T; Anai, M

    1981-04-01

    The ATP-dependent deoxyribonuclease from Bacillus laterosporus has been purified to near homogeneity by a procedure involving ammonium sulfate fractionation, DEAE-cellulose chromatography, Sephadex G-150 gel filtration, DEAE-Sephadex A-25 chromatography and DNA-cellulose affinity chromatography. The purified enzyme has a molecular weight of 210,000 +/- 8,000 as determined by sucrose gradient sedimentation. It is composed of two nonidentical polypeptide chains with close molecular weights of around 110,000. The substrate preference of the pure enzyme is essentially identical with the previous result obtained with the partially purified enzyme preparation (Anai, M., Mihara, T., Yamanaka, M., Shibata, T., & Takagi, Y. (1975) J. Biochem. 78, 105-114). Thus, the enzyme degrades double-stranded DNA about 100 times faster than heat-denatured DNA in the presence of ATP. Double-stranded DNA is not degraded to any measurable extent in the absence of ATP, but the enzyme exhibits activity toward denatured DNA in the absence of ATP. Furthermore, no endonuclease activity is observed on covalently closed circular duplex DNA and open circular duplex DNA.

  13. Extracellular adenosine triphosphate activates calcium mobilization in human phagocytic leukocytes and neutrophil/monocyte progenitor cells.

    PubMed Central

    Cowen, D S; Lazarus, H M; Shurin, S B; Stoll, S E; Dubyak, G R

    1989-01-01

    We have examined the ability of extracellular ATP to elicit intracellular Ca2+ mobilization in a broad range of human leukocytes at particular stages of hematopoietic differentiation. The average cytosolic [Ca2+] in various leukocyte populations was measured in Fura 2-loaded cell suspensions while the cytosolic [Ca2+] in individual, Indo 1-loaded leukocytes was assayed by flow cytometric methods. Utilizing normal blood- and marrow-derived cells, human leukemic cell lines, and mononuclear cell fractions derived from the blood of patients with various leukemias, we have found that ATP-induced Ca2+ mobilization appears restricted to leukocytes of neutrophil/monocyte ontogeny. Significant ATP-induced increases in cytosolic [Ca2+] were observed in neutrophils, monocytes, and myeloid progenitor cells as immature as myeloblasts, but not in lymphocytes. Extensive characterization of the ATP-induced changes in [Ca2+] observed in the HL-60 promyelocytic cell line have indicated these Ca2+-mobilizing effects of ATP can be correlated with an activation of inositol phospholipid breakdown via the occupation of P2-purinergic receptors Significantly, of the various agonists (FMLP, platelet-activating factor, LTB4, and ATP) which elicit equivalent and maximal Ca2+ mobilization in mature neutrophils and monocytes, ATP was the most efficacious stimulant of Ca2+ mobilization in immature neutrophil/monocyte precursors. Thus, expression of putative P2-purinergic receptors for ATP appears to precede expression of other receptor types known to activate the inositol phospholipid signaling cascades in terminally differentiated phagocytes. PMID:2708526

  14. Extracellular Adenosine Triphosphate Associated with Amphibian Erythrocytes: Inhibition of ATP Release by Anion Channel Blockers.

    DTIC Science & Technology

    1986-01-01

    amphibian sympathetic ganglion to inhibit the M current (8). ATP may affect - . dorsal root terminals in the toad spinal cord (343), and function...Perfusion Twenty-five frogs (Rana pipiens and Rana temporaria) were •de individually sacrificed by decapitation and pithing the spinal cord . During...various nucleosides and nucleotides on the isolated toad spinal cord . Gen. Pharmacol. 9:239-247, 1978. 344. Phillis, J.W. and Wu, P.H. The role of

  15. Importance of adenosine triphosphate in phospholipase A2-induced rabbit renal proximal tubule cell injury.

    PubMed Central

    Nguyen, V D; Cieslinski, D A; Humes, H D

    1988-01-01

    The pathogenesis of ischemic renal tubular cell injury involves a complex interaction of different processes, including membrane phospholipid alterations and depletion of high-energy phosphate stores. To assess the role of membrane phospholipid changes due to activation of phospholipases in renal tubule cell injury, suspensions enriched in rabbit renal proximal tubule segments were incubated with exogenous phospholipase A2 (PLA2). Exogenous PLA2 did not produce any significant change in various metabolic parameters reflective of cell injury in control nonhypoxic preparations despite a significant decrease in phosphatidylethanolamine (PE) and moderate increases in lysophosphatidylcholine (LPC) and lysophosphatidylethanolamine (LPE). In contrast, exogenous PLA2 treatment of hypoxic tubules resulted in a severe degree of cell injury, as demonstrated by marked declines in tubule K+ and ATP contents and significant decreases in tubule uncoupled respiratory rates, and was associated with significant phospholipid alterations, including marked declines in phosphatidylcholine (PC) and PE and significant rises in LPC, LPE, and free fatty acids (FFA). The injurious metabolic effects of exogenous PLA2 on hypoxic tubules were reversed by addition of ATP-MgCl2 to the tubules. The protective effect of ATP-MgCl2 was associated with increases in tubule PC and PE contents and declines in LPC, LPE, and FFA contents. These experiments thus indicate that an increase in exogenous PLA2 activity produces renal proximal tubule cell injury when cell ATP levels decline, at which point phospholipid resynthesis cannot keep pace with phospholipid degradation with resulting depletion of phospholipids and accumulation of lipid by-products. High-energy phosphate store depletion appears to be an important condition for exogenous PLA2 activity to induce renal tubule cell injury. PMID:3417866

  16. Adenosine Generated in the Bone Marrow Niche Through a CD38-Mediated Pathway Correlates With Progression of Human Myeloma

    PubMed Central

    Horenstein, Alberto L; Quarona, Valeria; Toscani, Denise; Costa, Federica; Chillemi, Antonella; Pistoia, Vito; Giuliani, Nicola; Malavasi, Fabio

    2016-01-01

    Human myeloma cells express CD38 at high levels and grow in hypoxic niches inside the bone marrow. Myeloma cells respond to hypoxia with metabolic changes leading to aerobic glycolysis, thus reducing adenosine triphosphate (ATP) and increasing NAD+. Our hypothesis is that these conditions favor the enzymatic pathways involved in the production of adenosine in the niche. Within the niche, NAD+ is able to activate a discontinuous adenosinergic pathway that relies upon CD38, CD203a and CD73 or TRACP, according to the environmental pH. The observed variability in adenosine concentrations in bone marrow aspirates is a result of the interactions taking place among myeloma and other cells in the bone marrow niche. A pilot study showed that adenosine profiles differ during disease progression. Adenosine levels were significantly higher in the bone marrow plasma of patients with symptomatic myeloma and correlated with ISS staging, suggesting that adenosine is produced in the myeloma niche at micromolar levels by an ectoenzymatic network centered on CD38. Adenosine levels increase with disease aggressiveness, a finding that supports adenosine as a potential marker of myeloma progression. PMID:27761584

  17. Expression of adenosine receptors in monocytes from patients with bronchial asthma

    PubMed Central

    Yuryeva, Ksenia; Saltykova, Irina; Ogorodova, Ludmila; Kirillova, Natalya; Kulikov, Evgeny; Korotkaya, Elena; Iakovleva, Yulia; Feoktistov, Igor; Sazonov, Alexey; Ryzhov, Sergey

    2015-01-01

    Adenosine is generated from adenosine triphosphate, which is released by stressed and damaged cells. Adenosine levels are significantly increased in patients with bronchial asthma (BA) and mediate mast cell degranulation and bronchoconstriction. Over the last decade, increasing evidence has shown that adenosine can modulate the innate immune response during monocytes differentiation towards mature myeloid cells. These adenosine-differentiated myeloid cells, characterized by co-expression of monocytes/macrophages and dendritic cell markers such as CD14 and CD209, produce high levels of pro-inflammatory cytokines, thus contributing to the pathogenesis of BA and chronic obstructive pulmonary disease. We found that expression of ADORA2A and ADORA2B are increased in monocytes obtained from patients with BA, and are associated with the generation of CD14posCD209pos pro-inflammatory cells. A positive correlation between expression of ADORA2B and IL-6 was identified in human monocytes and may explain the increased expression of IL-6 mRNA in asthmatics. Taken together, our results suggest that monocyte-specific expression of A2 adenosine receptors plays an important role in pro-inflammatory activation of human monocytes, thus contributing to the progression of asthma. PMID:26232643

  18. Rat cardiac myocyte adenosine transport and metabolism

    SciTech Connect

    Ford, D.A.; Rovetto, M.J.

    1987-01-01

    Based on the importance of myocardial adenosine and adenine nucleotide metabolism, the adenosine salvage pathway in ventricular myocytes was studied. Accurate estimates of transport rates, separate from metabolic fllux, were determined. Adenosine influx was constant between 3 and 60 s. Adenosine metabolism maintained intracellular adenosine concentrations < 10% of the extracellular adenosine concentrations and thus unidirectional influx could be measured. Myocytes transported adenosine via saturable and nonsaturable processes. A minimum estimate of the V/sub max/ of myocytic adenosine kinase indicated the saturable component of adenosine influx was independent of adenosine kinase activity. Saturable transport was inhibited by nitrobenzylthioinosine and verapamil. Extracellular adenosine taken up myocytes was rapidly phosphorylated to adenine taken up by myocytes was rapidly phosphorylated to adenine nucleotides. Not all extracellular adenosine, though, was phosphorylated on entering myocytes, since free, as opposed to protein-bound, intracellular adenosine was detected after digitonin extraction of cells in the presence of 1 mM ethylene-diaminetetraacetic acid.

  19. Neither arginine nor histidine can carry out the function of lysine-295 in the ATP-binding site of p60src.

    PubMed Central

    Kamps, M P; Sefton, B M

    1986-01-01

    All 15 protein kinases whose amino acid sequence is known contain a lysine residue at a position homologous to that of lysine-295 in p60src, the transforming protein of Rous sarcoma virus. The ATP analog p-fluorosulfonyl 5'-benzoyl adenosine inactivates both p60src and the catalytic subunit of the cyclic AMP-dependent protein kinase by modification of this lysine. We used oligonucleotide-directed mutagenesis to examine the possible functions of this residue. Lysine-295 in p60src was replaced with a glutamic acid, an arginine, or a histidine residue, and mutant p60src proteins were characterized in chicken cells infected by mutant viruses. None of these three mutant p60src proteins had tyrosine protein kinase activity in vitro, and none induced morphological transformation of infected cells. Since neither a histidine nor an arginine residue can replace the function of lysine-295, we suggest that it carries out the specialized function of proton transfer in the phosphotransferase reaction. All three mutant viruses underwent reversion to wild type during passage in tissue culture. Because the rate with which this occurred differed significantly among the mutants, reversion appears to have resulted from errors in transcription, rather than from recombination with the cellular src gene. Images PMID:2430174

  20. CryoEM and Molecular Dynamics of the Circadian KaiB-KaiC Complex Indicates That KaiB Monomers Interact with KaiC and Block ATP Binding Clefts

    SciTech Connect

    Villarreal, Seth A.; Pattanayek, Rekha; Williams, Dewight R.; Mori, Tetsuya; Qin, Ximing; Johnson, Carl H.; Egli, Martin; Stewart, Phoebe L.

    2014-10-02

    The circadian control of cellular processes in cyanobacteria is regulated by a posttranslational oscillator formed by three Kai proteins. During the oscillator cycle, KaiA serves to promote autophosphorylation of KaiC while KaiB counteracts this effect. Here, we present a crystallographic structure of the wild-type Synechococcus elongatus KaiB and a cryo-electron microscopy (cryoEM) structure of a KaiBC complex. The crystal structure shows the expected dimer core structure and significant conformational variations of the KaiB C-terminal region, which is functionally important in maintaining rhythmicity. The KaiBC sample was formed with a C-terminally truncated form of KaiC, KaiC-Δ489, which is persistently phosphorylated. The KaiB–KaiC-Δ489 structure reveals that the KaiC hexamer can bind six monomers of KaiB, which form a continuous ring of density in the KaiBC complex. We performed cryoEM-guided molecular dynamics flexible fitting simulations with crystal structures of KaiB and KaiC to probe the KaiBC protein–protein interface. This analysis indicated a favorable binding mode for the KaiB monomer on the CII end of KaiC, involving two adjacent KaiC subunits and spanning an ATP binding cleft. A KaiC mutation, R468C, which has been shown to affect the affinity of KaiB for KaiC and lengthen the period in a bioluminescence rhythm assay, is found within the middle of the predicted KaiBC interface. The proposed KaiB binding mode blocks access to the ATP binding cleft in the CII ring of KaiC, which provides insight into how KaiB might influence the phosphorylation status of KaiC.

  1. Phosphorylation at Ser²⁶ in the ATP-binding site of Ca²⁺/calmodulin-dependent kinase II as a mechanism for switching off the kinase activity.

    PubMed

    Yilmaz, Mehtap; Gangopadhyay, Samudra S; Leavis, Paul; Grabarek, Zenon; Morgan, Kathleen G

    2013-02-07

    CaMKII (Ca²⁺/calmodulin-dependent kinase II) is a serine/threonine phosphotransferase that is capable of long-term retention of activity due to autophosphorylation at a specific threonine residue within each subunit of its oligomeric structure. The γ isoform of CaMKII is a significant regulator of vascular contractility. Here, we show that phosphorylation of CaMKII γ at Ser²⁶, a residue located within the ATP-binding site, terminates the sustained activity of the enzyme. To test the physiological importance of phosphorylation at Ser²⁶, we generated a phosphospecific Ser²⁶ antibody and demonstrated an increase in Ser²⁶ phosphorylation upon depolarization and contraction of blood vessels. To determine if the phosphorylation of Ser²⁶ affects the kinase activity, we mutated Ser²⁶ to alanine or aspartic acid. The S26D mutation mimicking the phosphorylated state of CaMKII causes a dramatic decrease in Thr²⁸⁷ autophosphorylation levels and greatly reduces the catalytic activity towards an exogenous substrate (autocamtide-3), whereas the S26A mutation has no effect. These data combined with molecular modelling indicate that a negative charge at Ser²⁶ of CaMKII γ inhibits the catalytic activity of the enzyme towards its autophosphorylation site at Thr²⁸⁷ most probably by blocking ATP binding. We propose that Ser²⁶ phosphorylation constitutes an important mechanism for switching off CaMKII activity.

  2. Probing the ATP site of GRP78 with nucleotide triphosphate analogs

    DOE PAGES

    Hughes, Scott J.; Antoshchenko, Tetyana; Chen, Yun; ...

    2016-05-04

    GRP78, a member of the ER stress protein family, can relocate to the surface of cancer cells, playing key roles in promoting cell proliferation and metastasis. GRP78 consists of two major functional domains: the ATPase and protein/peptide-binding domains. The protein/peptide-binding domain of cell-surface GRP78 has served as a novel functional receptor for delivering cytotoxic agents (e.g., a apoptosis-inducing peptide or taxol) across the cell membrane. Here, we report our study on the ATPase domain of GRP78 (GRP78ATPase), whose potential as a transmembrane delivery system of cytotoxic agents (e.g., ATP-based nucleotide triphosphate analogs) remains unexploited. As the binding of ligands (ATPmore » analogs) to a receptor (GRP78ATPase) is a pre-requisite for internalization, we determined the binding affinities and modes of GRP78ATPase for ADP, ATP and several ATP analogs using surface plasmon resonance and x-ray crystallography. The tested ATP analogs contain one of the following modifications: the nitrogen at the adenine ring 7-position to a carbon atom (7-deazaATP), the oxygen at the beta-gamma bridge position to a carbon atom (AMPPCP), or the removal of the 2'-OH group (2'-deoxyATP). We found that 7-deazaATP displays an affinity and a binding mode that resemble those of ATP regardless of magnesium ion (Mg++) concentration, suggesting that GRP78 is tolerant to modifications at the 7-position. By comparison, AMPPCP's binding affinity was lower than ATP and Mg++-dependent, as the removal of Mg++ nearly abolished binding to GRP78ATPase. The AMPPCP-Mg++ structure showed evidence for the critical role of Mg++ in AMPPCP binding affinity, suggesting that while GRP78 is sensitive to modifications at the β-γ bridge position, these can be tolerated in the presence of Mg++. Furthermore, 2'-deoxyATP's binding affinity was significantly lower than those for all other nucleotides tested, even in the presence of Mg++. The 2'-deoxyATP structure showed the conformation of

  3. Interaction of 5'-P-sulfonylbenzoyl adenosine with cysteine residues of rat liver 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase

    SciTech Connect

    El-Maghrabi, M.R.; Lively, M.O.; Pilkis, S.J.

    1987-05-01

    The kinase and bisphosphatase reactions of 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase appear to be catalyzed at separate active sites. The kinase site contains 3 cysteinyl residues that are important for sugar phosphate binding but not for ATP binding. These groups are readily alkylated with iodoacetamide which decreases by 15-fold the affinity for Fru 6-P but also increases the maximal velocity of the reaction by the same extent. Incubation of the enzyme with 5'-p-fluorosulfonylbenzoyl adenosine (FSBA), an ATP analog, has no effect on the bisphosphatase activity but inactivates the kinase. The addition of dithiothreitol completely reactivates the kinase, suggesting that the reagent affected sulfhydryl groups critical for sugar phosphate binding and not the ATP site of the enzyme. Similarly, 8-Azido-ATP/UV-photoinactivated enzyme is also reactivated by dithiothreitol and involves the same sulfhydryl groups, since alkylation of the latter with iodoacetamide protects the enzyme from inactivation by FSBA and from 8-azido ATP. Cyanogen bromide cleavage of enzyme that had been alkylated with iodo(I-/sup 14/C)acetamide yielded a 20,000 dalton peptide which contained the three cysteinyl residues. It is concluded that the site of action of ATP analogs to inactivate the kinase are these cysteinyl residues rather than the ATP binding site per se.

  4. Modulation of murine dendritic cell function by adenine nucleotides and adenosine: involvement of the A(2B) receptor.

    PubMed

    Ben Addi, Abduelhakem; Lefort, Anne; Hua, Xiaoyang; Libert, Frédérick; Communi, Didier; Ledent, Catherine; Macours, Pascale; Tilley, Stephen L; Boeynaems, Jean-Marie; Robaye, Bernard

    2008-06-01

    Adenosine triphosphate has previously been shown to induce semi-mature human monocyte-derived dendritic cells (DC). These are characterized by the up-regulation of co-stimulatory molecules, the inhibition of IL-12 and the up-regulation of some genes involved in immune tolerance, such as thrombospondin-1 and indoleamine 2,3-dioxygenase. The actions of adenosine triphosphate are mediated by the P2Y(11) receptor; since there is no functional P2Y(11) gene in the murine genome, we investigated the action of adenine nucleotides on murine DC. Adenosine 5'-(3-thiotriphosphate) and adenosine inhibited the production of IL-12p70 by bone marrow-derived DC (BMDC). These inhibitions were relieved by 8-p-sulfophenyltheophylline, an adenosine receptor antagonist. The use of selective ligands and A(2B) (-/-) BMDC indicated the involvement of the A(2B) receptor. A microarray experiment, confirmed by quantitative PCR, showed that, in presence of LPS, 5'-(N-ethylcarboxamido) adenosine (NECA, the most potent A(2B) receptor agonist) regulated the expression of several genes: arginase I and II, thrombospondin-1 and vascular endothelial growth factor were up-regulated whereas CCL2 and CCL12 were down-regulated. We further showed that NECA, in combination with LPS, increased the arginase I enzymatic activity. In conclusion, the described actions of adenine nucleotides on BMDC are mediated by their degradation product, adenosine, acting on the A(2B) receptor, and will possibly lead to an impairment of Th1 response or tolerance.

  5. Neurochemical Measurement of Adenosine in Discrete Brain Regions of Five Strains of Inbred Mice

    PubMed Central

    Pani, Amar K.; Jiao, Yun; Sample, Kenneth J.; Smeyne, Richard J.

    2014-01-01

    Adenosine (ADO), a non-classical neurotransmitter and neuromodulator, and its metabolites adenosine triphosphate (ATP), adenosine diphosphate (ADP) and adenosine monophosphate (AMP), have been shown to play an important role in a number of biochemical processes. Although their signaling is well described, it has been difficult to directly, accurately and simultaneously quantitate these purines in tissue or fluids. Here, we describe a novel method for measuring adenosine (ADO) and its metabolites using high performance liquid chromatography with electrochemical detection (HPLC-ECD). Using this chromatographic technique, we examined baseline levels of ADO and ATP, ADP and AMP in 6 different brain regions of the C57BL/6J mouse: stratum, cortex, hippocampus, olfactory bulb, substantia nigra and cerebellum and compared ADO levels in 5 different strains of mice (C57BL/6J, Swiss-Webster, FVB/NJ, 129P/J, and BALB/c). These studies demonstrate that baseline levels of purines vary significantly among the brain regions as well as between different mouse strains. These dissimilarities in purine concentrations may explain the variable phenotypes among background strains described in neurological disease models. PMID:24642754

  6. Adenosine-Associated Delivery Systems

    PubMed Central

    Kazemzadeh-Narbat, Mehdi; Annabi, Nasim; Tamayol, Ali; Oklu, Rahmi; Ghanem, Amyl; Khademhosseini, Ali

    2016-01-01

    Adenosine is a naturally occurring purine nucleoside in every cell. Many critical treatments such as modulating irregular heartbeat (arrhythmias), regulation of central nervous system (CNS) activity, and inhibiting seizural episodes can be carried out using adenosine. Despite the significant potential therapeutic impact of adenosine and its derivatives, the severe side effects caused by their systemic administration have significantly limited their clinical use. In addition, due to adenosine’s extremely short half-life in human blood (less than 10 s), there is an unmet need for sustained delivery systems to enhance efficacy and reduce side effects. In this paper, various adenosine delivery techniques, including encapsulation into biodegradable polymers, cell-based delivery, implantable biomaterials, and mechanical-based delivery systems, are critically reviewed and the existing challenges are highlighted. PMID:26453156

  7. Localization of calcium stimulated adenosine triphosphatase activity in blood vessels of the skeleton

    NASA Technical Reports Server (NTRS)

    Doty, S. B.

    1985-01-01

    Alkaline phosphatase is an enzyme found in bone forming cells which decreases in certain bones as a result of hypogravity or non-weight bearing. This enzyme can also hydrolyze adenosine triphosphate. Therefore, an effort was made to localize calcium-stimulated ATPase by cytochemistry to determine whether altered bone cell activity might be related to changing calcium levels which occur during hypogravity. The results indicate that Ca(++)-ATPase is largely found along the endothelium and basal lamina of blood vessels, and not found in bone forming cells. This suggests that calcium regulation in the vicinity of bone formation may be modulated by the vasculature of the area.

  8. Nucleoside Analogue Triphosphates Allosterically Regulate Human Ribonucleotide Reductase and Identify Chemical Determinants That Drive Substrate Specificity.

    PubMed

    Knappenberger, Andrew J; Ahmad, Md Faiz; Viswanathan, Rajesh; Dealwis, Chris G; Harris, Michael E

    2016-10-18

    Class I ribonucleotide reductase (RR) maintains balanced pools of deoxyribonucleotide substrates for DNA replication by converting ribonucleoside diphosphates (NDPs) to 2'-deoxyribonucleoside diphosphates (dNDPs). Binding of deoxynucleoside triphosphate (dNTP) effectors (ATP/dATP, dGTP, and dTTP) modulates the specificity of class I RR for CDP, UDP, ADP, and GDP substrates. Crystal structures of bacterial and eukaryotic RRs show that dNTP effectors and NDP substrates bind on either side of a flexible nine-amino acid loop (loop 2). Interactions with the effector nucleobase alter loop 2 geometry, resulting in changes in specificity among the four NDP substrates of RR. However, the functional groups proposed to drive specificity remain untested. Here, we use deoxynucleoside analogue triphosphates to determine the nucleobase functional groups that drive human RR (hRR) specificity. The results demonstrate that the 5-methyl, O4, and N3 groups of dTTP contribute to specificity for GDP. The O6 and protonated N1 of dGTP direct specificity for ADP. In contrast, the unprotonated N1 of adenosine is the primary determinant of ATP/dATP-directed specificity for CDP. Structural models from X-ray crystallography of eukaryotic RR suggest that the side chain of D287 in loop 2 is involved in binding of dGTP and dTTP, but not dATP/ATP. This feature is consistent with experimental results showing that a D287A mutant of hRR is deficient in allosteric regulation by dGTP and dTTP, but not ATP/dATP. Together, these data define the effector functional groups that are the drivers of human RR specificity and provide constraints for evaluating models of allosteric regulation.

  9. An attenuated mutant of the Rv1747 ATP-binding cassette transporter of Mycobacterium tuberculosis and a mutant of its cognate kinase, PknF, show increased expression of the efflux pump-related iniBAC operon

    PubMed Central

    Spivey, Vicky L; Whalan, Rachael H; Hirst, Elizabeth M A; Smerdon, Stephen J; Buxton, Roger S

    2013-01-01

    The ATP-binding cassette transporter Rv1747 is required for the growth of Mycobacterium tuberculosis in mice and in macrophages. Its structure suggests it is an exporter. Rv1747 forms a two-gene operon with pknF coding for the serine/threonine protein kinase PknF, which positively modulates the function of the transporter. We show that deletion of Rv1747 or pknF results in a number of transcriptional changes which could be complemented by the wild type allele, most significantly up-regulation of the iniBAC genes. This operon is inducible by isoniazid and ethambutol and by a broad range of inhibitors of cell wall biosynthesis and is required for efflux pump functioning. However, neither the Rv1747 or pknF mutant showed increased susceptibility to a range of drugs and cell wall stress reagents including isoniazid and ethambutol, cell wall structure and cell division appear normal by electron microscopy, and no differences in lipoarabinomannan were found. Transcription from the pknF promoter was not induced by a range of stress reagents. We conclude that the loss of Rv1747 affects cell wall biosynthesis leading to the production of intermediates that cause induction of iniBAC transcription and implicates it in exporting a component of the cell wall, which is necessary for virulence. PMID:23915284

  10. Cross-reactivity of Antibodies Directed to the Gram-Negative Bacterium Neisseria gonorrhoeae With Heat Shock Protein 60 and ATP-Binding Protein Correlates to Reduced Mitochondrial Activity in HIBCPP Choroid Plexus Papilloma Cells.

    PubMed

    Reuss, B; Schroten, H; Ishikawa, H; Asif, A R

    2015-09-01

    Antibacterial antibodies can cause neurologic side-effects by cross-reactivity with cellular antigens. Here we investigated interactions of antibodies to Neisseria gonorrhoeae (α-NG) - maternal infections by which increases the offspring's risk for later psychosis-with HIBCPP cells, a cell culture model of choroid plexus epithelium. Immunocytochemistry and Western blotting with α-NG, revealed organelle-like intracellular staining in HIBCPP cells, and labelling of several immunoreactive bands in cellular protein. Two-dimensional Western blotting revealed several immunopositive spots, most prominent of which were identified by mass spectrometry as mitochondrially localized proteins heat shock protein 60 (Hsp60) and ATP-binding protein β-subunit (ATPB). Similarly α-NG interacted with commercial samples of these proteins as revealed by Western blotting. Three alternative methods (JC-1, Janus green and MTT staining) revealed α-NG to cause in HIBCPP cells a significant decrease in mitochondrial activity, which could be reverted by neuroleptic drugs. Immunoreactivity of α-NG with choroid plexus epithelium in human post mortem samples suggests in vivo relevance of these findings. Finally, distinctly different staining patterns of antibodies against Neisseria meningitidis (α-NM), confirmed antibody specificity. To our knowledge this is the first report that α-NG cross-reactivity with Hsp60 and ATPB impairs mitochondrial activity in choroid plexus epithelial cells, pathogenetic relevance of which needs further clarification.

  11. Change in ATP-binding cassette B1/19, glutamine synthetase and alcohol dehydrogenase gene expression during root elongation in Betula pendula Roth and Alnus glutinosa L. Gaertn in response to leachate and leonardite humic substances.

    PubMed

    Tahiri, Abdelghani; Delporte, Fabienne; Muhovski, Yordan; Ongena, Marc; Thonart, Philippe; Druart, Philippe

    2016-01-01

    Humic substances (HS) are complex and heterogeneous compounds of humified organic matter resulting from the chemical and microbiological decomposition of organic residues. HS have a positive effect on plant growth and development by improving soil structure and fertility. They have long been recognized as plant growth-promoting substances, particularly with regard to influencing nutrient uptake, root growth and architecture. The biochemical and molecular mechanisms through which HS influence plant physiology are not well understood. This study evaluated the bioactivity of landfill leachate and leonardite HS on alder (Alnus glutinosa L. Gaertn) and birch (Betula pendula Roth) during root elongation in vitro. Changes in root development were studied in relation to auxin, carbon and nitrogen metabolisms, as well as to the stress adaptive response. The cDNA fragments of putative genes encoding two ATP-binding cassette (ABC) transporters (ABCB1 and ABCB19) belonging to the B subfamily of plant ABC auxin transporters were cloned and sequenced. Molecular data indicate that HS and their humic acid (HA) fractions induce root growth by influencing polar auxin transport (PAT), as illustrated by the modulation of the ABCB transporter transcript levels (ABCB1 and ABCB19). There were also changes in alcohol dehydrogenase (ADH) and glutamine synthetase (GS) gene transcript levels in response to HS exposure. These findings confirmed that humic matter affects plant growth and development through various metabolic pathways, including hormonal, carbon and nitrogen metabolisms and stress response or signalization.

  12. 4,6-Substituted-1,3,5-triazin-2(1H)-ones as monocyclic catalytic inhibitors of human DNA topoisomerase IIα targeting the ATP binding site.

    PubMed

    Pogorelčnik, Barbara; Janežič, Matej; Sosič, Izidor; Gobec, Stanislav; Solmajer, Tom; Perdih, Andrej

    2015-08-01

    Human DNA topoisomerase IIα (htIIα) is a validated target for the development of novel anticancer agents. Starting from our discovered 4-amino-1,3,5-triazine inhibitors of htIIα, we investigated a library of 2,4,6-trisubstituted-1,3,5-triazines for novel inhibitors that bind to the htIIα ATP binding site using a combination of structure-based and ligand-based pharmacophore models and molecular docking. 4,6-substituted-1,3,5-triazin-2(1H)-ones 8, 9 and 14 were identified as novel inhibitors with activity comparable to the established drug etoposide (1). Compound 8 inhibits the htIIα decatenation in a superior fashion to etoposide. Cleavage assays demonstrated that selected compounds 8 and 14 do not act as poisons and antagonize the poison effect of etoposide. Microscale thermophoresis (MST) confirmed binding of compound 8 to the htIIα ATPase domain and compound 14 effectively inhibits the htIIα mediated ATP hydrolysis. The molecular dynamics simulation study provides further insight into the molecular recognition. The 4,6-disubstituted-1,3,5-triazin-2(1H)-ones represent the first validated monocyclic class of catalytic inhibitors that bind to the to the htIIα ATPase domain.

  13. Functional Dynamics Revealed by the Structure of the SufBCD Complex, a Novel ATP-binding Cassette (ABC) Protein That Serves as a Scaffold for Iron-Sulfur Cluster Biogenesis*

    PubMed Central

    Hirabayashi, Kei; Yuda, Eiki; Tanaka, Naoyuki; Katayama, Sumie; Iwasaki, Kenji; Matsumoto, Takashi; Kurisu, Genji; Outten, F. Wayne; Fukuyama, Keiichi; Takahashi, Yasuhiro; Wada, Kei

    2015-01-01

    ATP-binding cassette (ABC)-type ATPases are chemomechanical engines involved in diverse biological pathways. Recent genomic information reveals that ABC ATPase domains/subunits act not only in ABC transporters and structural maintenance of chromosome proteins, but also in iron-sulfur (Fe-S) cluster biogenesis. A novel type of ABC protein, the SufBCD complex, functions in the biosynthesis of nascent Fe-S clusters in almost all Eubacteria and Archaea, as well as eukaryotic chloroplasts. In this study, we determined the first crystal structure of the Escherichia coli SufBCD complex, which exhibits the common architecture of ABC proteins: two ABC ATPase components (SufC) with function-specific components (SufB-SufD protomers). Biochemical and physiological analyses based on this structure provided critical insights into Fe-S cluster assembly and revealed a dynamic conformational change driven by ABC ATPase activity. We propose a molecular mechanism for the biogenesis of the Fe-S cluster in the SufBCD complex. PMID:26472926

  14. Adenosine receptor targets for pain.

    PubMed

    Sawynok, J

    2016-12-03

    The main focus for the development of adenosine targets as analgesics to date has been A1Rs due to its antinociceptive profile in various preclinical pain models. The usefulness of systemic A1R agonists may be limited by other effects (cardiovascular, motor), but enhanced selectivity for pain might occur with partial agonists, potent and highly selective agonists, or allosteric modulators. A2AR agonists exhibit some peripheral pronociceptive effects, but also act on immune cells to suppress inflammation and on spinal glia to suppress pain signaling and may be useful for inflammatory and neuropathic pain. A2BR agonists exhibit peripheral proinflammatory effects on immune cells, but also spinal antinociceptive effects similar to A2AR agonists. A3Rs are now demonstrated to produce antinociception in several preclinical neuropathic pain models, with mechanistic actions on glial cells, and may be useful for neuropathic pain. Endogenous adenosine levels can be augmented by inhibition of metabolism (via adenosine kinase) or increased generation (via nucleotidases), and these approaches have implications for pain. Endogenous adenosine contributes to antinociception by several pharmacological agents, herbal remedies, acupuncture, transcutaneous electrical nerve stimulation, exercise, joint mobilization, and water immersion via spinal and/or peripheral effects, such that this system appears to constitute a major pain regulatory system. Finally, caffeine inhibits A1-, A2A- and A3Rs with similar potency, and dietary caffeine intake will need attention in trials of: (a) agonists and/or modulators acting at these receptors, (b) some pharmacological and herbal analgesics, and (c) manipulations that enhance endogenous adenosine levels, all of which are inhibited by caffeine and/or A1R antagonists in preclinical studies. All adenosine receptors have effects on spinal glial cells in regulating nociception, and gender differences in the involvement of such cells in chronic

  15. Adenosine Monophosphate (AMP)-Activated Protein Kinase: A New Target for Nutraceutical Compounds

    PubMed Central

    Marín-Aguilar, Fabiola; Pavillard, Luis E.; Giampieri, Francesca; Bullón, Pedro; Cordero, Mario D.

    2017-01-01

    Adenosine monophosphate-activated protein kinase (AMPK) is an important energy sensor which is activated by increases in adenosine monophosphate (AMP)/adenosine triphosphate (ATP) ratio and/or adenosine diphosphate (ADP)/ATP ratio, and increases different metabolic pathways such as fatty acid oxidation, glucose transport and mitochondrial biogenesis. In this sense, AMPK maintains cellular energy homeostasis by induction of catabolism and inhibition of ATP-consuming biosynthetic pathways to preserve ATP levels. Several studies indicate a reduction of AMPK sensitivity to cellular stress during aging and this could impair the downstream signaling and the maintenance of the cellular energy balance and the stress resistance. However, several diseases have been related with an AMPK dysfunction. Alterations in AMPK signaling decrease mitochondrial biogenesis, increase cellular stress and induce inflammation, which are typical events of the aging process and have been associated to several pathological processes. In this sense, in the last few years AMPK has been identified as a very interesting target and different nutraceutical compounds are being studied for an interesting potential effect on AMPK induction. In this review, we will evaluate the interaction of the different nutraceutical compounds to induce the AMPK phosphorylation and the applications in diseases such as cancer, type II diabetes, neurodegenerative diseases or cardiovascular diseases. PMID:28146060

  16. The A1 adenosine receptor as a new player in microglia physiology.

    PubMed

    Luongo, L; Guida, F; Imperatore, R; Napolitano, F; Gatta, L; Cristino, L; Giordano, C; Siniscalco, D; Di Marzo, V; Bellini, G; Petrelli, R; Cappellacci, L; Usiello, A; de Novellis, V; Rossi, F; Maione, S

    2014-01-01

    The purinergic system is highly involved in the regulation of microglial physiological processes. In addition to the accepted roles for the P2 X4,7 and P2 Y12 receptors