Paul D. Boyer, Adenosine Triphosphate (ATP), and the Binding Change
-- October 1975, DOE Technical Report, 1975 A Perspective of the Binding Change Mechanism for ATP Synthesis Reports, Vol. 18, No. 3, 1998 ATP Synthesis and the Binding Change Mechanism: The Work of Paul D. Boyer Mechanism of ATP Synthesis Additional Web Pages: Adenosine Triphosphate: The Energy Currency of Life Paul D
Yamazaki, Yasuhiro; Yasui, Kenta; Hashizume, Takahiro; Suto, Arisa; Mori, Ayaka; Murata, Yuzuki; Yamaguchi, Masahiko; Ikari, Akira; Sugatani, Junko
2015-10-01
The adenosine triphosphate-binding cassette (ABC) half-transporters Abcg5 and Abcg8 promote the secretion of neutral sterol into bile. Studies have demonstrated the diet-induced gene expression of these transporters, but the regulation of their trafficking when the nutritional status changes in the liver remains to be elucidated. Here, we generated a novel in vivo kinetic analysis that can monitor the intracellular trafficking of Abcg5/Abcg8 in living mouse liver by in vivo transfection of the genes of fluorescent protein-tagged transporters and investigated how hypernutrition affects the canalicular trafficking of these transporters. The kinetic analysis showed that lithogenic diet consumption accelerated the translocation of newly synthesized fluorescent-tagged transporters to intracellular pools in an endosomal compartment and enhanced the recruitment of these pooled gene products into the bile canalicular membrane in mouse liver. Because some ABC transporters are reported to be recruited from intracellular pools to the bile canaliculi by cyclic adenosine monophosphate (cAMP) signaling, we next evaluated the involvement of this machinery in a diet-induced event. Administration of a protein kinase A inhibitor, N-(2-{[3-(4-bromophenyl)-2-propenyl]amino}ethyl)-5-isoquinolinesulfonamide, decreased the canalicular expression of native Abcg5/Abcg8 in lithogenic diet-fed mice, and injection of a cAMP analog, dibutyryl cAMP, transiently increased their levels in standard diet-fed mice, indicating the involvement of cAMP signaling. Indeed, canalicular trafficking of the fluorescent-tagged Abcg5/Abcg8 was enhanced by dibutyryl cAMP administration. These observations suggest that diet-induced lipid loading into liver accelerates the trafficking of Abcg5/Abcg8 to the bile canalicular membrane through cAMP signaling machinery. © 2015 by the American Association for the Study of Liver Diseases.
Shin, Jin A; Jeong, Sae Im; Kim, Hye Won; Jang, Gyeonghui; Ryu, Dong-Ryeol; Ahn, Young-Ho; Choi, Ji Ha; Choi, Youn-Hee; Park, Eun-Mi
2018-06-01
The adenosine triphosphate-binding cassette efflux transporter ABCG2, which is located in the blood-brain barrier limits the entry of endogenous compounds and xenobiotics into the brain, and its expression and activity are regulated by estrogen. This study was aimed to define the role of ABCG2 in estrogen-mediated neuroprotection against ischemic injury. ABCG2 protein levels before and after ischemic stroke were increased in the brain of female mice by ovariectomy, which were reversed by estrogen replacement. In brain endothelial cell line bEnd.3, estrogen reduced the basal ABCG2 protein level and efflux activity and protected cells from ischemic injury without inducing ABCG2 expression. When bEnd.3 cells were transfected with ABCG2 small interfering RNA, ischemia-induced cell death was reduced, and the intracellular concentration of glutathione, an antioxidant that is transported by ABCG2, was increased. In addition, after ischemic stroke in ovariectomized mice, estrogen prevented the reduction of intracellular glutathione level in brain microvessels. These data suggested that the suppression of ABCG2 by estrogen is involved in neuroprotection against ischemic injury by increasing intracellular glutathione, and that the modulation of ABCG2 activity offers a therapeutic target for brain diseases in estrogen-deficient aged women. Copyright © 2018 Elsevier Inc. All rights reserved.
Farawela, Hala M; Khorshied, Mervat M; Kassem, Neemat M; Kassem, Heba A; Zawam, Hamdy M
2014-08-01
Multidrug resistance (MDR1) represents a major obstacle in the chemotherapeutic treatment of acute leukemia (AL). Adenosine triphosphate ATP-binding cassette (ABCB5) and MDR1 genes are integral membrane proteins belonging to ATP-binding cassette transporters superfamily. The present work aimed to investigate the impact of ABCB5 and MDR1 genes expression on the response to chemotherapy in a cohort of Egyptian AL patients. The study included 90 patients: 53 AML cases and 37 ALL cases in addition to 20 healthy volunteers as controls. Quantitative assessment of MDR1 and ABCB5 genes expression was performed by quantitative real-time polymerase chain reaction. Additional prognostic molecular markers were determined as internal tandem duplications of the FLT3 gene (FLT3-ITD) and nucleophosmin gene mutation (NPM1) for AML cases, and mbcr-abl fusion transcript for B-ALL cases. In AML patients, ABCB5 and MDR1 expression levels did not differ significantly between de novo and relapsed cases and did not correlate with the overall survival or disease-free survival. AML patients were stratified according to the studied genetic markers, and complete remission rate was found to be more prominent in patients having low expression of MDR1 and ABCB5 genes together with mutated NPM1 gene. In ALL patients, ABCB5 gene expression level was significantly higher in relapsed cases and MDR1 gene expression was significantly higher in patients with resistant disease. In conclusion, the results obtained by the current study provide additional evidence of the role played by these genes as predictive factors for resistance of leukemic cells to chemotherapy and hence treatment outcome.
Lu, Na; Wang, Baoying; Deng, Xiaohui; Zhao, Honggang; Wang, Yong; Li, Dongliang
2014-01-01
After hypoxia, ischemia, or inflammatory injuries to the central nervous system, the damaged cells release a large amount of adenosine triphosphate, which may cause secondary neuronal death. Autophagy is a form of cell death that also has neuroprotective effects. Cell Counting Kit assay, monodansylcadaverine staining, flow cytometry, western blotting, and real-time PCR were used to determine the effects of exogenous adenosine triphosphate treatment at different concentrations (2, 4, 6, 8, 10 mmol/L) over time (1, 2, 3, and 6 hours) on the apoptosis and autophagy of SH-SY5Y cells. High concentrations of extracellular adenosine triphosphate induced autophagy and apoptosis of SH-SY5Y cells. The enhanced autophagy first appeared, and peaked at 1 hour after treatment with adenosine triphosphate. Cell apoptosis peaked at 3 hours, and persisted through 6 hours. With prolonged exposure to the adenosine triphosphate treatment, the fraction of apoptotic cells increased. These data suggest that the SH-SY5Y neural cells initiated autophagy against apoptosis within an hour of adenosine triphosphate treatment to protect themselves against injury. PMID:25368646
ABC gene expression profiles have clinical importance and possibly form a new hallmark of cancer.
Dvorak, Pavel; Pesta, Martin; Soucek, Pavel
2017-05-01
Adenosine triphosphate-binding cassette proteins constitute a large family of active transporters through extracellular and intracellular membranes. Increased drug efflux based on adenosine triphosphate-binding cassette protein activity is related to the development of cancer cell chemoresistance. Several articles have focused on adenosine triphosphate-binding cassette gene expression profiles (signatures), based on the expression of all 49 human adenosine triphosphate-binding cassette genes, in individual tumor types and reported connections to established clinicopathological features. The aim of this study was to test our theory about the existence of adenosine triphosphate-binding cassette gene expression profiles common to multiple types of tumors, which may modify tumor progression and provide clinically relevant information. Such general adenosine triphosphate-binding cassette profiles could constitute a new attribute of carcinogenesis. Our combined cohort consisted of tissues from 151 cancer patients-breast, colorectal, and pancreatic carcinomas. Standard protocols for RNA isolation and quantitative real-time polymerase chain reaction were followed. Gene expression data from individual tumor types as well as a merged tumor dataset were analyzed by bioinformatics tools. Several general adenosine triphosphate-binding cassette profiles, with differences in gene functions, were established and shown to have significant relations to clinicopathological features such as tumor size, histological grade, or clinical stage. Genes ABCC7, A3, A8, A12, and C8 prevailed among the most upregulated or downregulated ones. In conclusion, the results supported our theory about general adenosine triphosphate-binding cassette gene expression profiles and their importance for cancer on clinical as well as research levels. The presence of ABCC7 (official symbol CFTR) among the genes with key roles in the profiles supports the emerging evidence about its crucial role in various
Enzymatic regeneration of adenosine triphosphate cofactor
NASA Technical Reports Server (NTRS)
Marshall, D. L.
1974-01-01
Regenerating adenosine triphosphate (ATP) from adenosine diphosphate (ADP) by enzymatic process which utilizes carbamyl phosphate as phosphoryl donor is technique used to regenerate expensive cofactors. Process allows complex enzymatic reactions to be considered as candidates for large-scale continuous processes.
The Role of Extracellular Adenosine Triphosphate in Ischemic Organ Injury.
Zhao, Hailin; Kilgas, Susan; Alam, Azeem; Eguchi, Shiori; Ma, Daqing
2016-05-01
Ischemic tissue injury contributes to significant morbidity and mortality and is implicated in a range of pathologic conditions, including but not limited to myocardial infarction, ischemic stroke, and acute kidney injury. The associated reperfusion phase is responsible for the activation of the innate and adaptive immune system, further accentuating inflammation. Adenosine triphosphate molecule has been implicated in various ischemic conditions, including stroke and myocardial infarction. Adenosine triphosphate is a well-defined intracellular energy transfer and is commonly referred to as the body's "energy currency." However, Laboratory studies have demonstrated that extracellular adenosine triphosphate has the ability to initiate inflammation and is therefore referred to as a damage-associated molecular pattern. Purinergic receptors-dependent signaling, proinflammatory cytokine release, increased Ca influx into cells, and subsequent apoptosis have been shown to form a common underlying extracellular adenosine triphosphate molecular mechanism in ischemic organ injury. In this review, we aim to discuss the molecular mechanisms behind adenosine triphosphate-mediated ischemic tissue injury and evaluate the role of extracellular adenosine triphosphate in ischemic injury in specific organs, in order to provide a greater understanding of the pathophysiology of this complex process. We also appraise potential future therapeutic strategies to limit damage in various organs, including the heart, brain, kidneys, and lungs.
Systemic Adenosine Triphosphate Impairs Neutrophil Chemotaxis and Host Defense in Sepsis.
Li, Xiaoou; Kondo, Yutaka; Bao, Yi; Staudenmaier, Laura; Lee, Albert; Zhang, Jingping; Ledderose, Carola; Junger, Wolfgang G
2017-01-01
Sepsis remains an unresolved clinical problem. Therapeutic strategies focusing on inhibition of neutrophils (polymorphonuclear neutrophils) have failed, which indicates that a more detailed understanding of the underlying pathophysiology of sepsis is required. Polymorphonuclear neutrophil activation and chemotaxis require cellular adenosine triphosphate release via pannexin-1 channels that fuel autocrine feedback via purinergic receptors. In the current study, we examined the roles of endogenous and systemic adenosine triphosphate on polymorphonuclear neutrophil activation and host defense in sepsis. Prospective randomized animal investigation and in vitro studies. Preclinical academic research laboratory. Wild-type C57BL/6 mice, pannexin-1 knockout mice, and healthy human subjects used to obtain polymorphonuclear neutrophils for in vitro studies. Wild-type and pannexin-1 knockout mice were treated with suramin or apyrase to block the endogenous or systemic effects of adenosine triphosphate. Mice were subjected to cecal ligation and puncture and polymorphonuclear neutrophil activation (CD11b integrin expression), organ (liver) injury (plasma aspartate aminotransferase), bacterial spread, and survival were monitored. Human polymorphonuclear neutrophils were used to study the effect of systemic adenosine triphosphate and apyrase on chemotaxis. Inhibiting endogenous adenosine triphosphate reduced polymorphonuclear neutrophil activation and organ injury, but increased the spread of bacteria and mortality in sepsis. By contrast, removal of systemic adenosine triphosphate improved bacterial clearance and survival in sepsis by improving polymorphonuclear neutrophil chemotaxis. Systemic adenosine triphosphate impairs polymorphonuclear neutrophil functions by disrupting the endogenous purinergic signaling mechanisms that regulate cell activation and chemotaxis. Removal of systemic adenosine triphosphate improves polymorphonuclear neutrophil function and host defenses
Capture and quality control mechanisms for adenosine-5'-triphosphate binding.
Li, Li; Martinis, Susan A; Luthey-Schulten, Zaida
2013-04-24
The catalytic events in members of the nucleotidylyl transferase superfamily are initiated by a millisecond binding of ATP in the active site. Through metadynamics simulations on a class I aminoacyl-tRNA synthetase (aaRSs), the largest group in the superfamily, we calculate the free energy landscape of ATP selection and binding. Mutagenesis studies and fluorescence spectroscopy validated the identification of the most populated intermediate states. The rapid first binding step involves formation of encounter complexes captured through a fly casting mechanism that acts upon the triphosphate moiety of ATP. In the slower nucleoside binding step, a conserved histidine in the HxxH motif orients the incoming ATP through base-stacking interactions resulting in a deep minimum in the free energy surface. Mutation of this histidine significantly decreases the binding affinity measured experimentally and computationally. The metadynamics simulations further reveal an intermediate quality control state that the synthetases and most likely other members of the superfamily use to select ATP over other nucleoside triphosphates.
Yu, Cheng-Ju; Wu, Su-Mei; Tseng, Wei-Lung
2013-09-17
We report that magnetite nanoparticles (Fe3O4 NPs) act as an efficient quencher for boron dipyrromethene-conjugated adenosine 5'-triphosphate (BODIPY-ATP) that is highly fluorescent in bulk solution. BODIPY-ATP molecules attached to the surface of Fe3O4 NPs through the coordination between the triphosphate group of BODIPY-ATP and Fe(3+)/Fe(2+) on the NP surface. The formed complexes induced an apparent reduction in the BODIPY-ATP fluorescence resulting from an oxidative-photoinduced electron transfer (PET) from the BODIPY-ATP excited state to an unfilled d shell of Fe(3+)/Fe(2+) on the NP surface. A comparison of the Stern-Volmer quenching constant between Fe(3+) and Fe(2+) suggests that Fe(3+) on the NP surface dominantly controls this quenching process. The efficiency for Fe3O4 NP-induced fluorescence quenching of the BODIPY-ATP was enhanced by increasing the concentration of Fe3O4 NPs and lowering the pH of the solution to below 6.0. We found that pyrophosphate and ATP compete with BODIPY-ATP for binding to Fe3O4 NPs. Thus, we amplified BODIPY-ATP fluorescence in the presence of increasing the pyrophosphate and ATP concentration; the detection limits at a signal-to-noise ratio of 3 for pyrophosphate and ATP were determined to be 7 and 30 nM, respectively. The Fe3O4 NP-based competitive binding assay detected ATP and pyrophosphate in only 5 min. The selectivity of this assay for ATP over metal ions, amino acids, and adenosine analogues is particularly high. The practicality of using the developed method to determine ATP in a single drop of blood is also validated.
Cheng, Ying; Mansfield, Kylie J; Allen, Wendy; Walsh, Colin A; Burcher, Elizabeth; Moore, Kate H
2010-03-01
Adenosine triphosphate released from urothelium during stretch stimulates afferent nerves and conveys information on bladder fullness. We measured adenosine triphosphate released during cystometric bladder filling in women with idiopathic detrusor overactivity and stress incontinence (controls), and assessed whether the level of released adenosine triphosphate is related to cystometric parameters. Routine cystometry was done in 51 controls and 48 women with detrusor overactivity who were 28 to 87 years old. Voided urodynamic fluid was collected and stored at -30 C. Adenosine triphosphate was measured by a bioluminescence assay. Adenosine triphosphate levels were similar in voided urodynamic fluid of controls and patients with detrusor overactivity (p = 0.79). A significant inverse correlation was seen between adenosine triphosphate and maximal cystometric capacity in controls (p = 0.013), and between voided volume and adenosine triphosphate in controls (p = 0.015) and detrusor overactivity cases (p = 0.019). A significant correlation between first desire to void and adenosine triphosphate was also noted in detrusor overactivity cases (p = 0.033) but not in controls (p = 0.58). No correlation was seen between adenosine triphosphate and detrusor pressure during filling or voiding. Adenosine triphosphate measurement in voided urodynamic fluid is a novel approach to understanding signals that may contribute to the urgency sensation (a sudden compelling desire to pass urine). The inverse correlation between adenosine triphosphate in voided urodynamic fluid and first desire to void suggests that adenosine triphosphate has a role in modulating the early filling sensation in patients with detrusor overactivity. 2010 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.
Sugiyama, Kentaro; Tsukaguchi, Mahoto; Toyama, Akira; Satoh, Hiroshi; Saito, Kazuhide; Nakagawa, Yuki; Takahashi, Kota; Tanaka, Sachiko; Onda, Kenji; Hirano, Toshihiko
2014-06-01
The adenosine triphosphate assay using peripheral lymphocytes may be useful to evaluate the risks of acute rejection and infection in kidney transplant patients. We used the adenosine triphosphate assay to evaluate differences between recipients who were treated with cyclosporine- or tacrolimus-based immunosuppressive therapy. Adenosine triphosphate levels were measured in peripheral CD4+ cells before and after transplant and were correlated with clinical outcomes in 45 kidney transplant recipients. These recipients received immunosuppressive therapy with either cyclosporine (23 patients) or tacrolimus (22 patients). Adenosine triphosphate levels were significantly lower in the cyclosporine- than tacrolimus-based therapy groups from 2 to 6 weeks after transplant. Adenosine triphosphate levels were similar between these groups before and 1 week after transplant. The frequency of cytomegalovirus infection was greater in the recipients who received cyclosporine (17 patients [74%]) than tacrolimus (6 patients [27%]; P ≦ .003). The frequency of acute rejection episodes was similar between the cyclosporine and tacrolimus groups. These observations suggest that cyclosporine-based immunosuppressive therapy causes excessive immunosuppression compared with tacrolimus-based therapy, evidenced by the lymphocyte adenosine triphosphate levels. The adenosine triphosphate assay using peripheral CD4+ cells may be a useful method for predicting the occurrence of cytomegalovirus infections in kidney transplant recipients.
Torres, Bryan T; Jimenez, David A; Budsberg, Steven C
2016-07-19
Adenosine triphosphate has been shown to stimulate nociceptive nerve terminals in joints. Elevated synovial fluid adenosine triphosphate concentrations as well as a correlation between synovial fluid adenosine triphosphate concentrations and osteoarthritic knee pain has been demonstrated in humans, but not yet in dogs. This study documented elevated synovial fluid adenosine triphosphate concentrations in the stifles of dogs with secondary osteoarthritis and urate-induced synovitis, as compared to normal stifles.
Chemoelectrical energy conversion of adenosine triphosphate
NASA Astrophysics Data System (ADS)
Sundaresan, Vishnu Baba; Sarles, Stephen Andrew; Leo, Donald J.
2007-04-01
Plant and animal cell membranes transport charged species, neutral molecules and water through ion pumps and channels. The energy required for moving species against established concentration and charge gradients is provided by the biological fuel - adenosine triphosphate (ATP) -synthesized within the cell. The adenosine triphosphatase (ATPases) in a plant cell membrane hydrolyze ATP in the cell cytoplasm to pump protons across the cell membrane. This establishes a proton gradient across the membrane from the cell exterior into the cell cytoplasm. This proton motive force stimulates ion channels that transport nutrients and other species into the cell. This article discusses a device that converts the chemical energy stored in adenosine triphosphate into electrical power using a transporter protein, ATPase. The V-type ATPase proteins used in our prototype are extracted from red beet(Beta vulgaris) tonoplast membranes and reconstituted in a bilayer lipid membrane or BLM formed from POPC and POPS lipids. A pH7 medium that can support ATP hydrolysis is provided on both sides of the membrane and ATP is dissolved in the pH7 buffer on one side of the membrane. Hydrolysis of ATP results in the formation of a phosphate ion and adenosine diphosphate. The energy from the reaction activates ATPase in the BLM and moves a proton across the membrane. The charge gradient established across the BLM due to the reaction and ion transport is converted into electrical current by half-cell reference electrodes. The prototype ATPase cell with an effective BLM area of 4.15 mm2 carrying 15 μl of ATPase proteins was observed to develop a steady state peak power output of 70 nW, which corresponds to a specific power of 1.69 μW/cm2 and a current density of 43.4 μA/cm2 of membrane area.
21 CFR 864.7040 - Adenosine triphosphate release assay.
Code of Federal Regulations, 2014 CFR
2014-04-01
... device that measures the release of adenosine triphosphate (ATP) from platelets following aggregation. This measurement is made on platelet-rich plasma using a photometer and a luminescent firefly extract. Simultaneous measurements of platelet aggregation and ATP release are used to evaluate platelet function...
21 CFR 864.7040 - Adenosine triphosphate release assay.
Code of Federal Regulations, 2011 CFR
2011-04-01
... device that measures the release of adenosine triphosphate (ATP) from platelets following aggregation. This measurement is made on platelet-rich plasma using a photometer and a luminescent firefly extract. Simultaneous measurements of platelet aggregation and ATP release are used to evaluate platelet function...
21 CFR 864.7040 - Adenosine triphosphate release assay.
Code of Federal Regulations, 2013 CFR
2013-04-01
... device that measures the release of adenosine triphosphate (ATP) from platelets following aggregation. This measurement is made on platelet-rich plasma using a photometer and a luminescent firefly extract. Simultaneous measurements of platelet aggregation and ATP release are used to evaluate platelet function...
21 CFR 864.7040 - Adenosine triphosphate release assay.
Code of Federal Regulations, 2010 CFR
2010-04-01
... device that measures the release of adenosine triphosphate (ATP) from platelets following aggregation. This measurement is made on platelet-rich plasma using a photometer and a luminescent firefly extract. Simultaneous measurements of platelet aggregation and ATP release are used to evaluate platelet function...
21 CFR 864.7040 - Adenosine triphosphate release assay.
Code of Federal Regulations, 2012 CFR
2012-04-01
... device that measures the release of adenosine triphosphate (ATP) from platelets following aggregation. This measurement is made on platelet-rich plasma using a photometer and a luminescent firefly extract. Simultaneous measurements of platelet aggregation and ATP release are used to evaluate platelet function...
Kivi, Rait; Solovjova, Karina; Haljasorg, Tõiv; Arukuusk, Piret; Järv, Jaak
2016-12-01
The allosteric influence of adenosine triphosphate (ATP) on the binding effectiveness of a series of peptide inhibitors with the catalytic subunit of 3'5'-cyclic adenosine monophosphate dependent protein kinase was investigated, and the dependence of this effect on peptide structure was analyzed. The allosteric effect was calculated as ratio of peptide binding effectiveness with the enzyme-ATP complex and with the free enzyme, quantified by the competitive inhibition of the enzyme in the presence of ATP excess, and by the enzyme-peptide complex denaturation assay, respectively It was found that the principle "better binding-stronger allostery" holds for interactions of the studied peptides with the enzyme, indicating that allostery and peptide binding with the free enzyme are governed by the same specificity pattern. This means that the allosteric regulation does not include new ligand-protein interactions, but changes the intensity (strength) of the interatomic forces that govern the complex formation in the case of each individual ligand. We propose that the allosteric regulation can be explained by the alteration of the intrinsic dynamics of the protein by ligand binding, and that this phenomenon, in turn, modulates the ligand off-rate from its binding site as well as the binding affinity. The positive allostery could therefore be induced by a reduction in the enzyme's overall intrinsic dynamics.
Randak, Christoph O.; Dong, Qian; Ver Heul, Amanda R.; Elcock, Adrian H.; Welsh, Michael J.
2013-01-01
Cystic fibrosis transmembrane conductance regulator (CFTR) is an anion channel in the ATP-binding cassette (ABC) transporter protein family. In the presence of ATP and physiologically relevant concentrations of AMP, CFTR exhibits adenylate kinase activity (ATP + AMP ⇆ 2 ADP). Previous studies suggested that the interaction of nucleotide triphosphate with CFTR at ATP-binding site 2 is required for this activity. Two other ABC proteins, Rad50 and a structural maintenance of chromosome protein, also have adenylate kinase activity. All three ABC adenylate kinases bind and hydrolyze ATP in the absence of other nucleotides. However, little is known about how an ABC adenylate kinase interacts with ATP and AMP when both are present. Based on data from non-ABC adenylate kinases, we hypothesized that ATP and AMP mutually influence their interaction with CFTR at separate binding sites. We further hypothesized that only one of the two CFTR ATP-binding sites is involved in the adenylate kinase reaction. We found that 8-azidoadenosine 5′-triphosphate (8-N3-ATP) and 8-azidoadenosine 5′-monophosphate (8-N3-AMP) photolabeled separate sites in CFTR. Labeling of the AMP-binding site with 8-N3-AMP required the presence of ATP. Conversely, AMP enhanced photolabeling with 8-N3-ATP at ATP-binding site 2. The adenylate kinase active center probe P1,P5-di(adenosine-5′) pentaphosphate interacted simultaneously with an AMP-binding site and ATP-binding site 2. These results show that ATP and AMP interact with separate binding sites but mutually influence their interaction with the ABC adenylate kinase CFTR. They further indicate that the active center of the adenylate kinase comprises ATP-binding site 2. PMID:23921386
Filippov, Sergey; Pinkosky, Stephen L; Newton, Roger S
2014-08-01
To review the profile of ETC-1002, as shown in preclinical and clinical studies, including LDL-cholesterol (LDL-C)-lowering activity and beneficial effects on other cardiometabolic risk markers as they relate to the inhibition of adenosine triphosphate-citrate lyase and the activation of adenosine monophosphate-activated protein kinase. ETC-1002 is an adenosine triphosphate-citrate lyase inhibitor/adenosine monophosphate-activated protein kinase activator currently in Phase 2b clinical development. In seven Phase 1 and Phase 2a clinical studies, ETC-1002 dosed once daily for 2-12 weeks has lowered LDL-C and reduced high-sensitivity C-reactive protein by up to 40%, with neutral to positive effects on glucose levels, blood pressure, and body weight. Importantly, use of ETC-1002 in statin-intolerant patients has shown statin-like lowering of LDL-C without the muscle pain and weakness responsible for discontinuation of statin use by many patients. ETC-1002 has also been shown to produce an incremental benefit, lowering LDL-C as an add-on therapy to a low-dose statin. In over 300 individuals in studies of up to 12 weeks, ETC-1002 has been well tolerated with no serious adverse effects. Because adenosine triphosphate-citrate lyase and adenosine monophosphate-activated protein kinase play central roles in regulating lipid and glucose metabolism, pharmacological modulation of these two enzymes could provide an important therapeutic alternative for statin-intolerant patients with hypercholesterolemia.
Spaans, Floor; Melgert, Barbro N; Borghuis, Theo; Klok, Pieter A; de Vos, Paul; Bakker, Winston W; van Goor, Harry; Faas, Marijke M
2014-09-01
Changes in the systemic immune response are found in preeclampsia. This may be related to high extracellular adenosine triphosphate (ATP) levels. The question arose whether ATP could affect immune responses in pregnancy. Previously, we investigated whether ATP affected monocyte activation and subpopulations. Here, we investigated ATP-induced changes in other immune cell populations in pregnant rats, systemically and in the kidney, an affected organ in preeclampsia. Using flow cytometry or immunohistochemistry, blood and kidney leukocytes were studied in pregnant and non-pregnant rats at different intervals after ATP or saline infusion. Adenosine triphosphate (ATP) infusion induced increased peripheral blood non-classical monocytes and decreased T lymphocyte subsets in pregnant rats only, higher glomerular macrophage and T lymphocyte numbers in non-pregnant animals 1 day after infusion, and higher glomerular macrophage numbers in pregnant rats 6 days after infusion. Adenosine triphosphate (ATP) infusion in pregnant rats induced a pregnancy-specific inflammatory response. Increased ATP levels could potentially contribute to development of the inflammatory response of preeclampsia. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Cho, Kang Jun; Koh, Jun Sung; Choi, Jinbong; Kim, Joon Chul
2017-12-01
We investigated changes in the levels of adenosine triphosphate and nitric oxide in the urothelium of men with detrusor underactivity and benign prostatic hyperplasia. We prospectively enrolled in study 30 men who planned to undergo surgical treatment for benign prostatic hyperplasia. The 15 patients with a bladder contractility index less than 100 were assigned to the detrusor underactivity group while the 15 with a bladder contractility index more than 100 were assigned to the no detrusor underactivity group. Bladder mucosal specimens were collected at surgical prostate resection, and adenosine triphosphate and endothelial nitric oxide synthase were analyzed in these specimens. The levels of adenosine triphosphate and endothelial nitric oxide synthase were compared between the 2 groups. The correlation of urodynamic parameters with adenosine triphosphate and endothelial nitric oxide synthase was assessed in all patients. Mean ± SEM endothelial nitric oxide synthase did not significantly differ between the detrusor underactivity and no underactivity groups (3.393 ± 0.969 vs 1.941 ± 0.377 IU/ml, p = 0.247). However, the mean level of adenosine triphosphate in the detrusor underactivity group was significantly lower than in the no detrusor underactivity group (1.289 ± 0.320 vs 9.262 ± 3.285 pmol, p = 0.011). In addition, in all patients adenosine triphosphate positively correlated with the bladder contractility index (r = 0.478, p = 0.018) and with detrusor pressure on maximal flow (r = 0.411, p = 0.046). Adenosine triphosphate was significantly decreased in the urothelium in men with detrusor underactivity and benign prostatic hyperplasia, reflecting the change in detrusor function. Copyright © 2017 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.
Fedan, J. S.
1987-01-01
The effects of incubating the guinea-pig isolated vas deferens in the presence of adenine nucleotides (adenosine triphosphate, ATP; adenosine diphosphate, ADP; and adenosine monophosphate, AMP), or in the presence of their phosphorothioate analogues (adenosine 5'-O-(3-thiotriphosphate), ATP gamma S; adenosine 5'-O-(2-thiodiphosphate), ADP beta S; and adenosine 5'-monophosphorothioate, AMP alpha S), on contractile responses to ATP were compared. After challenge with a low (1 microM) or high (300 microM) concentration of ATP to obtain control responses, one vas deferens of a pair was incubated for 5 min with one of the adenine nucleotides, while the contralateral preparation was incubated with the corresponding phosphorothioate analogue. At the conclusion of the incubation the preparations were challenged again with ATP. Incubation with AMP or AMP alpha S resulted in a transient potentiation of responses to 1 microM and 300 microM ATP. The potentiation following incubation with AMP alpha S was larger than that produced by AMP. After incubation with ADP, ADP beta S, ATP and ATP gamma S, responses to 1 microM ATP were decreased, while those to 300 microM ATP were unaffected. Thus, incubation with AMP and AMP alpha S results in potentiation, rather than inhibition, of ATP-induced responses. On the other hand, 5'-diphosphate, 5'-triphosphate, 5'-O-(2-thiodiphosphate) and 5'-O-(3-thiotriphosphate) moieties on adenosine have no effect or cause autoinhibition. These results indicate that AMP exerts a potentiating effect on reactivity to exogenous ATP. AMP arising from the enzymatic degradation of ATP might modulate the level of response to ATP released endogenously as a cotransmitter. PMID:3038248
Liao, Yu-Ju; Shiang, Yen-Chun; Chen, Li-Yi; Hsu, Chia-Lun; Huang, Chih-Ching; Chang, Huan-Tsung
2013-11-08
We have developed a simple and selective nanosensor for the optical detection of adenosine triphosphate (ATP) using globular actin-conjugated gold/silver nanorods (G-actin-Au/Ag NRs). By simply mixing G-actin and Au/Ag NRs (length ~56 nm and diameter ~12 nm), G-actin-Au/Ag NRs were prepared which were stable in physiological solutions (25 mM Tris-HCl, 150 mM NaCl, 5.0 mM KCl, 3.0 mM MgCl2 and 1.0 mM CaCl2; pH 7.4). Introduction of ATP into the G-actin-Au/Ag NR solutions in the presence of excess G-actin induced the formation of filamentous actin-conjugated Au/Ag NR aggregates through ATP-induced polymerization of G-actin. When compared to G-actin-modified spherical Au nanoparticles having a size of 13 nm or 56 nm, G-actin-Au/Ag NRs provided better sensitivity for ATP, mainly because the longitudinal surface plasmon absorbance of the Au/Ag NR has a more sensitive response to aggregation. This G-actin-Au/Ag NR probe provided high sensitivity (limit of detection 25 nM) for ATP with remarkable selectivity (>10-fold) over other adenine nucleotides (adenosine, adenosine monophosphate and adenosine diphosphate) and nucleoside triphosphates (guanosine triphosphate, cytidine triphosphate and uridine triphosphate). It also allowed the determination of ATP concentrations in plasma samples without conducting tedious sample pretreatments; the only necessary step was simple dilution. Our experimental results are in good agreement with those obtained from a commercial luciferin-luciferase bioluminescence assay. Our simple, sensitive and selective approach appears to have a practical potential for the clinical diagnosis of diseases (e.g. cystic fibrosis) associated with changes in ATP concentrations.
NASA Astrophysics Data System (ADS)
Liao, Yu-Ju; Shiang, Yen-Chun; Chen, Li-Yi; Hsu, Chia-Lun; Huang, Chih-Ching; Chang, Huan-Tsung
2013-11-01
We have developed a simple and selective nanosensor for the optical detection of adenosine triphosphate (ATP) using globular actin-conjugated gold/silver nanorods (G-actin-Au/Ag NRs). By simply mixing G-actin and Au/Ag NRs (length ˜56 nm and diameter ˜12 nm), G-actin-Au/Ag NRs were prepared which were stable in physiological solutions (25 mM Tris-HCl, 150 mM NaCl, 5.0 mM KCl, 3.0 mM MgCl2 and 1.0 mM CaCl2; pH 7.4). Introduction of ATP into the G-actin-Au/Ag NR solutions in the presence of excess G-actin induced the formation of filamentous actin-conjugated Au/Ag NR aggregates through ATP-induced polymerization of G-actin. When compared to G-actin-modified spherical Au nanoparticles having a size of 13 nm or 56 nm, G-actin-Au/Ag NRs provided better sensitivity for ATP, mainly because the longitudinal surface plasmon absorbance of the Au/Ag NR has a more sensitive response to aggregation. This G-actin-Au/Ag NR probe provided high sensitivity (limit of detection 25 nM) for ATP with remarkable selectivity (>10-fold) over other adenine nucleotides (adenosine, adenosine monophosphate and adenosine diphosphate) and nucleoside triphosphates (guanosine triphosphate, cytidine triphosphate and uridine triphosphate). It also allowed the determination of ATP concentrations in plasma samples without conducting tedious sample pretreatments; the only necessary step was simple dilution. Our experimental results are in good agreement with those obtained from a commercial luciferin-luciferase bioluminescence assay. Our simple, sensitive and selective approach appears to have a practical potential for the clinical diagnosis of diseases (e.g. cystic fibrosis) associated with changes in ATP concentrations.
Delaunay, Jean-Louis; Bruneau, Alix; Hoffmann, Brice; Durand-Schneider, Anne-Marie; Barbu, Véronique; Jacquemin, Emmanuel; Maurice, Michèle; Housset, Chantal; Callebaut, Isabelle; Aït-Slimane, Tounsia
2017-02-01
ABCB4 (MDR3) is an adenosine triphosphate (ATP)-binding cassette (ABC) transporter expressed at the canalicular membrane of hepatocytes, where it mediates phosphatidylcholine (PC) secretion. Variations in the ABCB4 gene are responsible for several biliary diseases, including progressive familial intrahepatic cholestasis type 3 (PFIC3), a rare disease that can be lethal in the absence of liver transplantation. In this study, we investigated the effect and potential rescue of ABCB4 missense variations that reside in the highly conserved motifs of ABC transporters, involved in ATP binding. Five disease-causing variations in these motifs have been identified in ABCB4 (G535D, G536R, S1076C, S1176L, and G1178S), three of which are homologous to the gating mutations of cystic fibrosis transmembrane conductance regulator (CFTR or ABCC7; i.e., G551D, S1251N, and G1349D), that were previously shown to be function defective and corrected by ivacaftor (VX-770; Kalydeco), a clinically approved CFTR potentiator. Three-dimensional structural modeling predicted that all five ABCB4 variants would disrupt critical interactions in the binding of ATP and thereby impair ATP-induced nucleotide-binding domain dimerization and ABCB4 function. This prediction was confirmed by expression in cell models, which showed that the ABCB4 mutants were normally processed and targeted to the plasma membrane, whereas their PC secretion activity was dramatically decreased. As also hypothesized on the basis of molecular modeling, PC secretion activity of the mutants was rescued by the CFTR potentiator, ivacaftor (VX-770). Disease-causing variations in the ATP-binding sites of ABCB4 cause defects in PC secretion, which can be rescued by ivacaftor. These results provide the first experimental evidence that ivacaftor is a potential therapy for selected patients who harbor mutations in the ATP-binding sites of ABCB4. (Hepatology 2017;65:560-570). © 2016 by the American Association for the Study of Liver
Imaging Adenosine Triphosphate (ATP)
Rajendran, Megha; Dane, Eric; Conley, Jason; Tantama, Mathew
2016-01-01
Adenosine triphosphate (ATP) is a universal mediator of metabolism and signaling across unicellular and multicellular species. There is a fundamental interdependence between the dynamics of ATP and the physiology that occurs inside and outside the cell. Characterizing and understanding ATP dynamics provides valuable mechanistic insight into processes that range from neurotransmission to the chemotaxis of immune cells. Therefore, we require the methodology to interrogate both temporal and spatial components of ATP dynamics from the subcellular to organismal levels in live specimens. Over the last several decades, a number of molecular probes that are specific for ATP have been developed. These probes have been combined with imaging approaches, particularly optical microscopy, to enable qualitative and quantitative detection of this critical molecule. In this review, we survey current examples of technologies that are available to visualize ATP in living cells and identify areas where new tools and approaches are needed to expand our capabilities. PMID:27638696
Imaging Adenosine Triphosphate (ATP).
Rajendran, Megha; Dane, Eric; Conley, Jason; Tantama, Mathew
2016-08-01
Adenosine triphosphate (ATP) is a universal mediator of metabolism and signaling across unicellular and multicellular species. There is a fundamental interdependence between the dynamics of ATP and the physiology that occurs inside and outside the cell. Characterizing and understanding ATP dynamics provide valuable mechanistic insight into processes that range from neurotransmission to the chemotaxis of immune cells. Therefore, we require the methodology to interrogate both temporal and spatial components of ATP dynamics from the subcellular to the organismal levels in live specimens. Over the last several decades, a number of molecular probes that are specific to ATP have been developed. These probes have been combined with imaging approaches, particularly optical microscopy, to enable qualitative and quantitative detection of this critical molecule. In this review, we survey current examples of technologies available for visualizing ATP in living cells, and identify areas where new tools and approaches are needed to expand our capabilities. © 2016 Marine Biological Laboratory.
Laboratory procedures manual for the firefly luciferase assay for adenosine triphosphate (ATP)
NASA Technical Reports Server (NTRS)
Chappelle, E. W.; Picciolo, G. L.; Curtis, C. A.; Knust, E. A.; Nibley, D. A.; Vance, R. B.
1975-01-01
A manual on the procedures and instruments developed for the adenosine triphosphate (ATP) luciferase assay is presented. Data cover, laboratory maintenance, maintenance of bacterial cultures, bacteria measurement, reagents, luciferase procedures, and determination of microbal susceptibility to antibiotics.
Li, Zheng; Wang, Yijing; Liu, Ying; Zeng, Yongyi; Huang, Aimin; Peng, Niancai; Liu, Xiaolong; Liu, Jingfeng
2013-09-07
We designed a novel aptamer based biosensor (aptasensor) for ultrasensitive detection of adenosine triphosphate (ATP) through resonance energy transfer (RET). The ATP aptamer was modified with Cy3 at the 3' end, and a green quantum dot (525) was attached to the 5' end of its complementary sequence respectively. The ATP aptamer and its complementary sequence could assemble into a duplex structure in the absence of target ATP, and then decrease the distance between the quantum dot and Cy3 which could produce significant RET signal. Upon ATP binding, the ATP aptamer could dissociate with its complementary sequence and then increase the distance between the quantum dot and Cy3 which would significantly decrease the RET signal. Therefore, the ATP detection could be easily achieved through detection of the fluorescence intensity ratio between 525 nm and 560 nm. The results show that the emission fluorescence intensity ratio of 525/560 is linearly related to the logarithmic concentration of ATP. The linear range of this aptasensor is from 0.1 nM to 1 μM, and the detection limit is lower down to 0.01 nM. Excellent selectivity of this aptasensor for ATP has been demonstrated through the detection of thymidine triphosphate (TTP), cytidine triphosphate (CTP), guanosine triphosphate (GTP) and adenosine diphosphate (ADP) respectively as control. The method we described here could easily detect ATP with excellent selectivity, linearity and sensitivity down to the nanomolar range, as well as avoid photobleaching.
Vasodilatory responsiveness to adenosine triphosphate in ageing humans.
Kirby, Brett S; Crecelius, Anne R; Voyles, Wyatt F; Dinenno, Frank A
2010-10-15
Endothelium-dependent vasodilatation is reduced with advancing age in humans, as evidenced by blunted vasodilator responsiveness to acetylcholine (ACh). Circulating adenosine triphosphate (ATP) has been implicated in the control of skeletal muscle vascular tone during mismatches in oxygen delivery and demand (e.g. exercise) via binding to purinergic receptors (P2Y) on the endothelium evoking subsequent vasodilatation, and ageing is typically associated with reductions in muscle blood flow under such conditions. Therefore, we tested the hypothesis that ATP-mediated vasodilatation is impaired with age in healthy humans. We measured forearm blood flow (venous occlusion plethysmography) and calculated vascular conductance (FVC) responses to local intra-arterial infusions of ACh, ATP, and sodium nitroprusside (SNP) before and during ascorbic acid (AA) infusion in 13 young and 13 older adults. The peak increase in FVC to ACh was significantly impaired in older compared with young adults (262 ± 71% vs. 618 ± 97%; P < 0.05), and this difference was abolished during AA infusion (510 ± 82% vs. 556 ± 71%; not significant, NS). In contrast, peak FVC responses were not different between older and young adults to either ATP (675 ± 105% vs. 734 ± 126%) or SNP (1116 ± 111% vs. 1138 ± 148%) and AA infusion did not alter these responses in either age group (both NS). In another group of six young and six older adults, we determined whether vasodilator responses to adenosine and ATP were influenced by P1-receptor blockade via aminophylline. The peak FVC responses to adenosine were not different in young (350 ± 65%) versus older adults (360 ± 80%), and aminophylline blunted these responses by ∼50% in both groups. The peak FVC responses to ATP were again not different in young and older adults, and aminophylline did not impact the vasodilatation in either group. Thus, in contrast to the observed impairments in ACh responses, the vasodilatory response to exogenous ATP is not
Maldonado, Claudio; Pushpakumar, Sathnur B; Perez-Abadia, Gustavo; Arumugam, Sengodagounder; Lane, Andrew N
2013-05-01
Ischemia-reperfusion injury is a devastating complication that occurs in allotransplantation and replantation of limbs. Over the years, several preservation strategies have been used to conserve the critical levels of intracellular adenosine triphosphate (ATP) during ischemia to sustain the ion gradients across the membranes and thus the tissue viability. The administration of exogenous ATP to ischemic tissues is known to provide beneficial effects during reperfusion, but it is unclear whether it provides protection during ischemia. The purpose of the present study was to determine the effect of ATP administration on high-energy phosphate levels in ischemic skeletal muscle and to examine the role of purinergic and adenosine receptors in mediating the response to exogenous ATP. The extensor digitorum longus muscles of Fischer rats were subjected to ischemia and treated with different concentrations of ATP with or without purinergic and adenosine receptor blockers. Phosphorus-31 nuclear magnetic resonance spectroscopy was used to measure the rate of decay of ATP, phosphocreatine (PCr), and the formation of adenosine monophosphate and acidification. Phosphorylated compounds were analyzed using a simple model of energy metabolism, and the PCr half-life was used as an index of internal depletion of ATP to distinguish between intracellular and extracellular ATP. PCr decay was rapid in all muscle groups and was followed by gradual ATP decay. The half-life of PCr was significantly longer in the ATP-treated muscles than in the vehicle controls and was maximally prolonged by treating with slow hydrolyzing adenosine 5'-O-(3-thio)triphosphate. Purinoceptor (P2X) blockade with ATP treatment significantly increased the half-life of PCr, and adenosine receptor blockers blunted the response. Administration of adenosine to ischemic muscles significantly increased the half-life of PCr compared with that in the vehicle controls. Exogenous ATP administration to ischemic skeletal
Zhao, Qiang; Lv, Qin; Wang, Hailin
2015-08-15
We previously reported a fluorescence anisotropy (FA) approach for small molecules using tetramethylrhodamine (TMR) labeled aptamer. It relies on target-binding induced change of intramolecular interaction between TMR and guanine (G) base. TMR-labeling sites are crucial for this approach. Only terminal ends and thymine (T) bases could be tested for TMR labeling in our previous work, possibly causing limitation in analysis of different targets with this FA strategy. Here, taking the analysis of adenosine triphosphate (ATP) as an example, we demonstrated a success of conjugating TMR on other bases of aptamer adenine (A) or cytosine (C) bases and an achievement of full mapping various labeling sites of aptamers. We successfully constructed aptamer fluorescence anisotropy (FA) sensors for adenosine triphosphate (ATP). We conjugated single TMR on adenine (A), cytosine (C), or thymine (T) bases or terminals of a 25-mer aptamer against ATP and tested FA responses of 14 TMR-labeled aptamer to ATP. The aptamers having TMR labeled on the 16th base C or 23rd base A were screened out and exhibited significant FA-decreasing or FA-increasing responses upon ATP, respectively. These two favorable TMR-labeled aptamers enabled direct FA sensing ATP with a detection limit of 1 µM and the analysis of ATP in diluted serum. The comprehensive screening various TMR labeling sites of aptamers facilitates the successful construction of FA sensors using TMR-labeled aptamers. It will expand application of TMR-G interaction based aptamer FA strategy to a variety of targets. Copyright © 2015 Elsevier B.V. All rights reserved.
Huo, Yuan; Qi, Liang; Lv, Xiao-Jun; Lai, Ting; Zhang, Jing; Zhang, Zhi-Qi
2016-04-15
Adenosine triphosphate (ATP) is the most direct source of energy in organisms. This study is the first to demonstrate that ATP-aptamer complexes provide greater protection for unmodified gold nanoparticles (AuNPs) against salt-induced aggregation than either aptamer or ATP alone. This protective effect was confirmed using transmission electron microscopy, dynamic light scattering, Zeta potential measurement, and fluorescence polarization techniques. Utilizing controlled particle aggregation/dispersion as a gauge, a sensitive and selective aptasensor for colorimetric detection of ATP was developed using ATP-binding aptamers as the identification element and unmodified AuNPs as the probe. This aptasensor exhibited a good linear relationship between the absorbance and the logarithm concentration of ATP within a 50-1000 nM range. ATP analogs such as guanosine triphosphate, uridine triphosphate and cytidine triphosphate resulted in little or no interference in the determination of ATP. Copyright © 2015 Elsevier B.V. All rights reserved.
Optical Aptasensors for Adenosine Triphosphate
Ng, Stella; Lim, Hui Si; Ma, Qian; Gao, Zhiqiang
2016-01-01
Nucleic acids are among the most researched and applied biomolecules. Their diverse two- and three-dimensional structures in conjunction with their robust chemistry and ease of manipulation provide a rare opportunity for sensor applications. Moreover, their high biocompatibility has seen them being used in the construction of in vivo assays. Various nucleic acid-based devices have been extensively studied as either the principal element in discrete molecule-like sensors or as the main component in the fabrication of sensing devices. The use of aptamers in sensors - aptasensors, in particular, has led to improvements in sensitivity, selectivity, and multiplexing capacity for a wide verity of analytes like proteins, nucleic acids, as well as small biomolecules such as glucose and adenosine triphosphate (ATP). This article reviews the progress in the use of aptamers as the principal component in sensors for optical detection of ATP with an emphasis on sensing mechanism, performance, and applications with some discussion on challenges and perspectives. PMID:27446501
Optical Aptasensors for Adenosine Triphosphate.
Ng, Stella; Lim, Hui Si; Ma, Qian; Gao, Zhiqiang
2016-01-01
Nucleic acids are among the most researched and applied biomolecules. Their diverse two- and three-dimensional structures in conjunction with their robust chemistry and ease of manipulation provide a rare opportunity for sensor applications. Moreover, their high biocompatibility has seen them being used in the construction of in vivo assays. Various nucleic acid-based devices have been extensively studied as either the principal element in discrete molecule-like sensors or as the main component in the fabrication of sensing devices. The use of aptamers in sensors - aptasensors, in particular, has led to improvements in sensitivity, selectivity, and multiplexing capacity for a wide verity of analytes like proteins, nucleic acids, as well as small biomolecules such as glucose and adenosine triphosphate (ATP). This article reviews the progress in the use of aptamers as the principal component in sensors for optical detection of ATP with an emphasis on sensing mechanism, performance, and applications with some discussion on challenges and perspectives.
Hu, Jie-Bi; Chen, Ting-Ru; Chen, Yu-Chie; Urban, Pawel L
2015-01-30
In order to ascertain optimum conditions for biocatalytic processes carried out in vitro, we have designed a bio-opto-electronic system which ensures real-time compensation for depletion of adenosine triphosphate (ATP) in reactions involving transfer of phosphate groups. The system covers ATP concentration range of 2-48 μM. The report demonstrates feasibility of the device operation using apyrase as the ATP-depleting enzyme.
A G-quadruplex-based Label-free Fluorometric Aptasensor for Adenosine Triphosphate Detection.
Li, Li Juan; Tian, Xue; Kong, Xiang Juan; Chu, Xia
2015-01-01
A G-quadruplex-based, label-free fluorescence assay was demonstrated for the detection of adenosine triphosphate (ATP). A double-stranded DNA (dsDNA), hybridized by ATP-aptamer and its complementary sequence, was employed as a substrate for ATP binding. SYBR Green I (SG I) was a fluorescent probe and exonuclease III (Exo III) was a nuclease to digest the dsDNA. Consequently, in the absence of ATP, the dsDNA was inset with SG I and was digested by Exo III, resulting in a low background signal. In the presence of ATP, the aptamer in dsDNA folded into a G-quadruplex structure that resisted the digestion of Exo III. SG I was inserted into the structure, showing high fluorescence. Owing to a decrease of the background noise, a high signal-to-noise ratio could be obtained. This sensor can detect ATP with a concentration ranging from 50 μM to 5 mM, and possesses a capacity for the sensitive determination of other targets.
Butler, Stephen J
2014-11-24
Two tripodal fluorescent probes Zn⋅L(1,2) have been synthesised, and their anion-binding capabilities were examined by using fluorescence spectroscopy. Probe Zn⋅L(1) allows the selective and ratiometric detection of adenosine triphosphate (ATP) at physiological pH, even in the presence of several competing anions, such as ADP, phosphate and bicarbonate. The probe was applied to the real-time monitoring of the apyrase-catalysed hydrolysis of ATP, in a medium that mimics an extracellular fluid. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Liu, Xiaojie; Lin, Bixia; Yu, Ying; Cao, Yujuan; Guo, Manli
2018-04-02
A multifunctional fluorescent probe is synthesized for the determination of adenosine 5'-triphosphate (ATP). The 6-carboxyfluorescein-labeled aptamer (FAM-aptamer) was bound to the surface of magnetite nanoparticles coated with polydopamine (Fe 3 O 4 @PDA) by π-π stacking interaction to form the multifunctional probe. The probe has three functions including recognition, magnetic separation, and yielding a fluorescent signal. In the presence of ATP, FAM-aptamer on the surface of the probe binds to ATP and returns to the solution. Thus, the fluorescence of the supernatant is enhanced and can be related to the concentration of ATP. Fluorescence intensities were measured at excitation/emission wavelengths of 494/526 nm. Response is linear in the 0.1-100 μM ATP concentration range, and the detection limit is 89 nM. The probe was applied to the quantitation of ATP in spiked human urine and serum samples, with recoveries ranging between 94.8 and 102%. Graphical abstract A multifunctional fluorescent probe based on the use of FAM-aptamer and Fe 3 O 4 @PDA is described for the determination of ATP in spiked human urine and serum samples. FAM-aptamer: 6-carboxyfluorescein-labeled aptamer; Fe 3 O 4 @PDA: magnetite nanoparticles coated with polydopamine. ATP: adenosine 5'-triphosphate.
Sustained release carrier for adenosine triphosphate as signaling molecule.
Wischke, Christian; Weigel, Judith; Bulavina, Larisa; Lendlein, Andreas
2014-12-10
Adenosine triphosphate (ATP) is a molecule with a fascinating variety of intracellular and extracellular biological functions that go far beyond energy metabolism. Due to its limited passive diffusion through biological membranes, controlled release systems may allow to interact with ATP-mediated extracellular processes. In this study, two release systems were explored to evaluate the capacity for either long-term or short-term release: (i) Poly[(rac-lactide)-co-glycolide] (PLGA) implant rods were capable of ATP release over days to weeks, depending on the PLGA molecular weight and end-group capping, but were also associated with partial hydrolytic degradation of ATP to ADP and AMP, but not adenosine. (ii) Thermosensitive methylcellulose hydrogels with a gelation occurring at body temperature allowed combining adjustable loading levels and the capacity for injection, with injection forces less than 50N even for small 27G needles. Finally, a first in vitro study illustrated purinergic-triggered response of primary murine microglia to ATP released from hydrogels, demonstrating the potential relevance for biomedical applications. Copyright © 2014 Elsevier B.V. All rights reserved.
Enzymatic properties of Staphylococcus aureus adenosine synthase (AdsA)
2011-01-01
Background Staphylococcus aureus is a human pathogen that produces extracellular adenosine to evade clearance by the host immune system, an activity attributed to the 5'-nucleotidase activity of adenosine synthase (AdsA). In mammals, conversion of adenosine triphosphate to adenosine is catalyzed in a two-step process: ecto-nucleoside triphosphate diphosphohydrolases (ecto-NTDPases) hydrolyze ATP and ADP to AMP, whereas 5'-nucleotidases hydrolyze AMP to adenosine. NTPDases harbor apyrase conserved regions (ACRs) that are critical for activity. Results NTPDase ACR motifs are absent in AdsA, yet we report here that recombinant AdsA hydrolyzes ADP and ATP in addition to AMP. Competition assays suggest that hydrolysis occurs following binding of all three substrates at a unique site. Alanine substitution of two amino acids, aspartic acid 127 and histidine 196 within the 5'-nucleotidase signature sequence, leads to reduced AMP or ADP hydrolysis but does not affect the binding of these substrates. Conclusion Collectively, these results provide insight into the unique ability of AdsA to produce adenosine through the consecutive hydrolysis of ATP, ADP and AMP, thereby endowing S. aureus with the ability to modulate host immune responses. PMID:22035583
Extraction and analysis of adenosine triphosphate from aquatic environments
Stephens, Doyle W.; Shultz, David J.
1981-01-01
A variety of adenosine triphosphate (ATP) extraction procedures have been investigated for their applicability to samples from aquatic environments. The cold sulfuric-oxalic acid procedure was best suited to samples consisting of water, periphyton, and sediments. Due to cation and fulvic acid interferences, a spike with a known quantity of ATP was necessary to estimate losses when sediments were extracted. Variable colonization densities for periphyton required that several replicates be extracted to characterize acdurately the periphyton community. Extracted samples were stable at room temperature for one to five hours, depending on the ATP concentration, if the pH was below 2. Neutralized samples which were quick frozen and stored at -30°C were stable for months.
Qi, Wenjing; Liu, Zhongyuan; Zhang, Wei; Halawa, Mohamed Ibrahim; Xu, Guobao
2016-10-12
Zr(IV) can form phosphate and Zr(IV) (-PO₃ 2- -Zr 4+ -) complex owing to the high affinity between Zr(IV) with phosphate. Zr(IV) can induce the aggregation of gold nanoparticles (AuNPs), while adenosine triphosphate(ATP) can prevent Zr(IV)-induced aggregation of AuNPs. Herein, a visual and plasmon resonance absorption (PRA)sensor for ATP have been developed using AuNPs based on the high affinity between Zr(IV)with ATP. AuNPs get aggregated in the presence of certain concentrations of Zr(IV). After the addition of ATP, ATP reacts with Zr(IV) and prevents AuNPs from aggregation, enabling the detection of ATP. Because of the fast interaction of ATP with Zr(IV), ATP can be detected with a detection limit of 0.5 μM within 2 min by the naked eye. Moreover, ATP can be detected by the PRA technique with higher sensitivity. The A 520nm / A 650nm values in PRA spectra increase linearly with the concentrations of ATP from 0.1 μM to 15 μM (r = 0.9945) with a detection limit of 28 nM. The proposed visual and PRA sensor exhibit good selectivity against adenosine, adenosine monophosphate, guanosine triphosphate, cytidine triphosphate and uridine triphosphate. The recoveries for the analysis of ATP in synthetic samples range from 95.3% to 102.0%. Therefore, the proposed novel sensor for ATP is promising for real-time or on-site detection of ATP.
Metabolic Cooperative Control of Electrolyte Levels by Adenosine Triphosphate in the Frog Muscle
Gulati, J.; Ochsenfeld, M. M.; Ling, G. N.
1971-01-01
This study examines the effects of metabolic inhibitors on the content of cellular K, Na, and adenosine triphosphate (ATP). ATP and K are seen to fall in the inhibited tissues. The ATP content is correlated with the K content. The role of ATP is examined according to a recent biophysical approach. It is suggested that ATP may control the electrolyte levels by inducing conformational changes in the cytoplasmic proteins. PMID:5316285
Gorzkiewicz, Michał; Buczkowski, Adam; Appelhans, Dietmar; Voit, Brigitte; Pułaski, Łukasz; Pałecz, Bartłomiej; Klajnert-Maculewicz, Barbara
2018-06-10
Adenosine analogue drugs (such as fludarabine or cladribine) require transporter-mediated uptake into cells and subsequent phosphorylation for anticancer activity. Therefore, application of nanocarrier systems for direct delivery of active triphosphate forms has been proposed. Here, we applied isothermal titration calorimetry and zeta potential titration to determine the stoichiometry and thermodynamic parameters of interactions between 4th generation poly(propyleneimine) dendrimers (unmodified or sugar-modified for increased biocompatibility) and ATP as a model adenosine nucleotide. We showed that glycodendrimers have the ability to efficiently interact with nucleoside triphosphates and to form stable complexes via electrostatic interactions between the ionized phosphate and amino groups on the nucleotide and the dendrimer, respectively. The complexation process is spontaneous, enthalpy-driven and depends on buffer composition (strongest interactions in organic buffer) and pH (more binding sites in acidic pH). These properties allow us to consider maltose-modified dendrimers as especially promising carriers for adenosine analogues. Copyright © 2018 Elsevier B.V. All rights reserved.
Tiret, Brice; Brouillet, Emmanuel; Valette, Julien
2016-09-01
With the increased spectral resolution made possible at high fields, a second, smaller inorganic phosphate resonance can be resolved on (31)P magnetic resonance spectra in the rat brain. Saturation transfer was used to estimate de novo adenosine triphosphate synthesis reaction rate. While the main inorganic phosphate pool is used by adenosine triphosphate synthase, the second pool is inactive for this reaction. Accounting for this new pool may not only help us understand (31)P magnetic resonance spectroscopy metabolic profiles better but also better quantify adenosine triphosphate synthesis. © The Author(s) 2016.
Adenosine triphosphate (ATP) as a possible indicator of extraterrestrial biology
NASA Technical Reports Server (NTRS)
Chappelle, E. W.; Picciolo, G. L.
1974-01-01
The ubiquity of adenosine triphosphate (ATP) in terrestrial organisms provides the basis for proposing the assay of this vital metabolic intermediate for detecting extraterrestrial biological activity. If an organic carbon chemistry is present on the planets, the occurrence of ATP is possible either from biosynthetic or purely chemical reactions. However, ATP's relative complexity minimizes the probability of abiogenic synthesis. A sensitive technique for the quantitative detection of ATP was developed using the firefly bioluminescent reaction. The procedure was used successfully for the determination of the ATP content of soil and bacteria. This technique is also being investigated from the standpoint of its application in clinical medicine.
NASA Astrophysics Data System (ADS)
Hou, Faju; Miao, Yanhong; Jiang, Chongqiu
2005-10-01
A new spectrofluorimetric method was developed for determination of adenosine disodium triphosphate (ATP). We studied the interactions between oxytetracycline (OTC)-Eu 3+ complex and adenosine disodium triphosphate (ATP) by using UV-vis absorption and fluorescence spectra. Using oxytetracycline (OTC)-Eu 3+ as a fluorescence probe, under the optimum conditions, ATP can remarkably enhance the fluorescence intensity of the OTC-Eu 3+ complex at λ = 612 nm and the enhanced fluorescence intensity of Eu 3+ ion is in proportion to the concentration of ATP. Optimum conditions for the determination of ATP were also investigated. The linear ranges for ATP are 8.00 × 10 -8-1.50 × 10 -6 mol L -1 with detection limits of 2.67 × 10 -9 mol L -1. This method is simple, practical and relatively free interference from coexisting substances and can be successfully applied to determination of ATP in samples. The mechanism of fluorescence enhancement between oxytetracycline (OTC)-Eu 3+ complex and ATP was also studied.
Hung, Szu-Ying; Shih, Ya-Chen; Tseng, Wei-Lung
2015-02-01
This study describes the development of a simple, enzyme-free, label-free, sensitive, and selective system for detecting adenosine based on the use of Tween 20-stabilized gold nanoparticles (Tween 20-AuNPs) as an efficient fluorescence quencher for boron dipyrromethene-conjugated adenosine 5'-triphosphate (BODIPY-ATP) and as a recognition element for adenosine. BODIPY-ATP can interact with Tween 20-AuNPs through the coordination between the adenine group of BODIPY-ATP and Au atoms on the NP surface, thereby causing the fluorescence quenching of BODIPY-ATP through the nanometal surface energy transfer (NSET) effect. When adenosine attaches to the NP surface, the attached adenosine exhibits additional electrostatic attraction to BODIPY-ATP. As a result, the presence of adenosine enhances the efficiency of AuNPs in fluorescence quenching of BODIPY-ATP. The AuNP-induced fluorescence quenching of BODIPY-ATP progressively increased with an increase in the concentration of adenosine; the detection limit at a signal-to-noise ratio of 3 for adenosine was determined to be 60nM. The selectivity of the proposed system was more than 1000-fold for adenosine over any adenosine analogs and other nucleotides. The proposed system combined with a phenylboronic acid-containing column was successfully applied to the determination of adenosine in urine. Copyright © 2014 Elsevier B.V. All rights reserved.
Qi, Wenjing; Liu, Zhongyuan; Zhang, Wei; Halawa, Mohamed Ibrahim; Xu, Guobao
2016-01-01
Zr(IV) can form phosphate and Zr(IV) (–PO32−–Zr4+–) complex owing to the high affinity between Zr(IV) with phosphate. Zr(IV) can induce the aggregation of gold nanoparticles (AuNPs), while adenosine triphosphate(ATP) can prevent Zr(IV)-induced aggregation of AuNPs. Herein, a visual and plasmon resonance absorption (PRA)sensor for ATP have been developed using AuNPs based on the high affinity between Zr(IV)with ATP. AuNPs get aggregated in the presence of certain concentrations of Zr(IV). After the addition of ATP, ATP reacts with Zr(IV) and prevents AuNPs from aggregation, enabling the detection of ATP. Because of the fast interaction of ATP with Zr(IV), ATP can be detected with a detection limit of 0.5 μM within 2 min by the naked eye. Moreover, ATP can be detected by the PRA technique with higher sensitivity. The A520nm/A650nm values in PRA spectra increase linearly with the concentrations of ATP from 0.1 μM to 15 μM (r = 0.9945) with a detection limit of 28 nM. The proposed visual and PRA sensor exhibit good selectivity against adenosine, adenosine monophosphate, guanosine triphosphate, cytidine triphosphate and uridine triphosphate. The recoveries for the analysis of ATP in synthetic samples range from 95.3% to 102.0%. Therefore, the proposed novel sensor for ATP is promising for real-time or on-site detection of ATP. PMID:27754349
Extraction and quantification of adenosine triphosphate in mammalian tissues and cells.
Chida, Junji; Kido, Hiroshi
2014-01-01
Adenosine 5'-triphosphate (ATP) is the "energy currency" of organisms and plays central roles in bioenergetics, whereby its level is used to evaluate cell viability, proliferation, death, and energy transmission. In this chapter, we describe an improved and efficient method for extraction of ATP from tissues and cells using phenol-based reagents. The chaotropic extraction reagents reported so far co-precipitate ATP with insoluble proteins during extraction and with salts during neutralization. In comparison, the phenol-based reagents extract ATP well without the risks of co-precipitation. The extracted ATP can be quantified by the luciferase assay or high-performance liquid chromatography.
Hybrid integrated biological-solid-state system powered with adenosine triphosphate.
Roseman, Jared M; Lin, Jianxun; Ramakrishnan, Siddharth; Rosenstein, Jacob K; Shepard, Kenneth L
2015-12-07
There is enormous potential in combining the capabilities of the biological and the solid state to create hybrid engineered systems. While there have been recent efforts to harness power from naturally occurring potentials in living systems in plants and animals to power complementary metal-oxide-semiconductor integrated circuits, here we report the first successful effort to isolate the energetics of an electrogenic ion pump in an engineered in vitro environment to power such an artificial system. An integrated circuit is powered by adenosine triphosphate through the action of Na(+)/K(+) adenosine triphosphatases in an integrated in vitro lipid bilayer membrane. The ion pumps (active in the membrane at numbers exceeding 2 × 10(6) mm(-2)) are able to sustain a short-circuit current of 32.6 pA mm(-2) and an open-circuit voltage of 78 mV, providing for a maximum power transfer of 1.27 pW mm(-2) from a single bilayer. Two series-stacked bilayers provide a voltage sufficient to operate an integrated circuit with a conversion efficiency of chemical to electrical energy of 14.9%.
Puzenko, Alexander; Levy, Evgeniya; Shendrik, Andrey; Talary, Mark S; Caduff, Andreas; Feldman, Yuri
2012-11-21
In this, the third part of our series on the dielectric spectrum symmetrical broadening of water, we consider the nucleotide aqueous solutions. Where in Parts I [E. Levy et al., J. Chem. Phys. 136, 114502 (2012)] and II [E. Levy et al., J. Chem. Phys. 136, 114503 (2012)], the dipole-dipole or ion-dipole interaction had a dominant feature, now the interplay between these two types of dipole-matrix interactions will be considered. We present the results of high frequency dielectric measurements of different concentrations of adenosine monophosphate/adenosine-5'-triphosphate aqueous solutions. We observed the Cole-Cole broadening of the main relaxation peak of the solvent in the solutions. Moreover, depending on the nucleotide concentration, we observed both types of dipole-matrix interaction. The 3D trajectory approach (described in detail in Part I) is applied in order to highlight the differences between the two types of interaction.
Huang, Xiang; Li, Yuqin; Zhang, Xiaoshan; Zhang, Xin; Chen, Yaowen; Gao, Wenhua
2015-09-07
An efficient aptasensor was developed in which graphene oxide (GO) was employed as an indicator for both electrochemical impedance spectroscopy and electrochemiluminescence (ECL) signal generation. The aptasensor was fabricated by self-assembling the ECL probe of a thiolated adenosine triphosphate binding aptamer (ABA) tagged with a Ru complex (Ru(bpy)3(2+) derivatives) onto the surface of gold nanoparticle (AuNP) modified glassy carbon electrode (GCE). ABA immobilized onto AuNP modified GCE could strongly adsorb GO due to the strong π-π interaction between ABA and graphene oxide; ECL quenching of the Ru complex then takes place because of energy transfer and electron transfer, and a large increase of the electron transfer resistance (Ret) of the electrode. While in the presence of target adenosine triphosphate (ATP), the ABA prefers to form ABA-ATP bioaffinity complexes, which have weak affinity to graphene oxide and keep the graphene oxide away from the electrode surface, thus allowing the ECL signal enhancement, and in conjunction with the decrease of the Ret. Because of the high ECL quenching efficiency, unique structure, and electronic properties of graphene oxide, the Ret and ECL intensity versus the logarithm of ATP concentration was linear in the wide range from 10 pM to 10 nM with an ultra-low detection limit of 6.7 pM to 4.8 pM, respectively. The proposed aptasensor exhibited excellent reproducibility, stability, and outstanding selectivity, and ATP could be effectively distinguished from its analogues. More significantly, this efficient ECL aptasensor strategy based on GO acting both as an electrochemical and ECL signal indicator is general and can be easily extended to other biological binding events.
Rocha, Jeová Nina
2016-01-01
To determine adenosine 5'-triphosphate levels in the interstice of spinal cord L6-S1 segment, under basal conditions or during mechanical and chemical activation of urinary bladder afferents. A microdialysis probe was transversally implanted in the dorsal half of spinal cord L6-S1 segment in female rats. Microdialysate was collected at 15 minutes intervals during 135 minutes, in anesthetized animals. Adenosine 5'-triphosphate concentrations were determined with a bioluminescent assay. In one group of animals (n=7) microdialysate samples were obtained with an empty bladder during a 10-minutes bladder distension to 20 or 40cmH2O with either saline, saline with acetic acid or saline with capsaicin. In another group of animals (n=6) bladder distention was performed and the microdialysis solution contained the ectonucleotidase inhibitor ARL 67156. Basal extracellular adenosine triphosphate levels were 110.9±35.34fmol/15 minutes, (mean±SEM, n=13), and bladder distention was associated with a significant increase in adenosine 5'-triphosphate levels which was not observed after bladder distention with saline solution containing capsaicin (10µM). Microdialysis with solution containing ARL 67156 (1mM) was associated with significantly higher extracellular adenosine 5'-triphosphate levels and no further increase in adenosine 5'-triphosphate was observed during bladder distension. Adenosine 5'-triphosphate was present in the interstice of L6-S1 spinal cord segments, was degraded by ectonucleotidase, and its concentration increased following the activation of bladder mechanosensitive but not of the chemosensitive afferents fibers. Adenosine 5'-triphosphate may originate either from the central endings of bladder mechanosensitive primary afferent neurons, or most likely from intrinsic spinal neurons, or glial cells and its release appears to be modulated by capsaicin activated bladder primary afferent or by adenosine 5'-triphosphate itself. Determinar as concentra
Nozaki, T; Arase, T; Shigeta, Y; Asai, T; Leustek, T; Takeuchi, T
1998-12-08
A gene encoding adenosine-5'-triphosphate sulfurylase (AS) was cloned from the enteric protozoan parasite Entamoeba histolytica by polymerase chain reaction using degenerate oligonucleotide primers corresponding to conserved regions of the protein from a variety of organisms. The deduced amino acid sequence of E. histolytica AS revealed a calculated molecular mass of 47925 Da and an unusual basic pI of 9.38. The amebic protein sequence showed 23-48% identities with AS from bacteria, yeasts, fungi, plants, and animals with the highest identities being to Synechocystis sp. and Bacillus subtilis (48 and 44%, respectively). Four conserved blocks including putative sulfate-binding and phosphate-binding regions were highly conserved in the E. histolytica AS. The upstream region of the AS gene contained three conserved elements reported for other E. histolytica genes. A recombinant E. histolytica AS revealed enzymatic activity, measured in both the forward and reverse directions. Expression of the E. histolytica AS complemented cysteine auxotrophy of the AS-deficient Escherichia coli strains. Genomic hybridization revealed that the AS gene exists as a single copy gene. In the literature, this is the first description of an AS gene in Protozoa.
NASA Astrophysics Data System (ADS)
Wei, J.; Dong, C.; Chen, B.
2017-04-01
We employ a mechanical model of sarcomere to quantitatively investigate how adenosine triphosphate (ATP) concentration affects motor force regulation during skeletal muscle contraction. Our simulation indicates that there can be negative cross-bridges resisting contraction within the sarcomere and higher ATP concentration would decrease the resistance force from negative cross-bridges by promoting their timely detachment. It is revealed that the motor force is well regulated only when ATP concentration is above a certain level. These predictions may provide insights into the role of ATP in regulating coordination among multiple motors.
Zhou, Zi-Ming; Yu, Yong; Zhao, Yuan-Di
2012-09-21
We designed an aptasensor for the detection of adenosine triphosphate (ATP) based on chemiluminescence resonance energy transfer (CRET). An adenosine aptamer was cut into two pieces of ssDNA, which were attached to quantum dots (QDs) and horse radish peroxidase (HRP), respectively. They could reassemble into specific structures in the presence of ATP and then decrease the distance of HRP and QDs. ATP detection can be easily realized according to the fluorescent intensity of QDs, which is excited by CRET between luminol and QDs. Results show that the concentration of ATP is linear relation with the fluorescent intensity of the peak of QDs emission and the linear range for the linear equation is from 50 μM to 231 μM and the detection limit was 185 nM. When the concentration of ATP was 2 mM, the efficiency of CRET is 13.6%. Good specificity for ATP had been demonstrated compared to thymidine triphosphate (TTP), cytidine triphosphate (CTP) and guanosine triphosphate (GTP), when 1 mM of each was added, respectively. This method needs no external light source and can avoid autofluorescence and photobleaching, and ATP can be detected selectively, specifically, and sensitively in a low micromolar range, which means that the strategy reported here can be applicable to the detection of several other target molecules.
Noble Gas Xenon Is a Novel Adenosine Triphosphate-sensitive Potassium Channel Opener
Bantel, Carsten; Maze, Mervyn; Trapp, Stefan
2010-01-01
Background Adenosine triphosphate-sensitive potassium (KATP) channels in brain are involved in neuroprotective mechanisms. Pharmacologic activation of these channels is seen as beneficial, but clinical exploitation by using classic K+ channel openers is hampered by their inability to cross the blood–brain barrier. This is different with the inhalational anesthetic xenon, which recently has been suggested to activate KATP channels; it partitions freely into the brain. Methods To evaluate the type and mechanism of interaction of xenon with neuronal-type KATP channels, these channels, consisting of Kir6.2 pore-forming subunits and sulfonylurea receptor-1 regulatory subunits, were expressed in HEK293 cells and whole cell, and excised patch-clamp recordings were performed. Results Xenon, in contrast to classic KATP channel openers, acted directly on the Kir6.2 subunit of the channel. It had no effect on the closely related, adenosine triphosphate (ATP)-regulated Kir1.1 channel and failed to activate an ATP-insensitive mutant version of Kir6.2. Furthermore, concentration–inhibition curves for ATP obtained from inside-out patches in the absence or presence of 80% xenon revealed that xenon reduced the sensitivity of the KATP channel to ATP. This was reflected in an approximately fourfold shift of the concentration causing half-maximal inhibition (IC50) from 26 ± 4 to 96 ± 6 μm. Conclusions Xenon represents a novel KATP channel opener that increases KATP currents independently of the sulfonylurea receptor-1 subunit by reducing ATP inhibition of the channel. Through this action and by its ability to readily partition across the blood–brain barrier, xenon has considerable potential in clinical settings of neuronal injury, including stroke. PMID:20179498
Footprint traversal by adenosine-triphosphate-dependent chromatin remodeler motor.
Garai, Ashok; Mani, Jesrael; Chowdhury, Debashish
2012-04-01
Adenosine-triphosphate (ATP)-dependent chromatin remodeling enzymes (CREs) are biomolecular motors in eukaryotic cells. These are driven by a chemical fuel, namely, ATP. CREs actively participate in many cellular processes that require accessibility of specific segments of DNA which are packaged as chromatin. The basic unit of chromatin is a nucleosome where 146 bp ∼ 50 nm of a double-stranded DNA (dsDNA) is wrapped around a spool formed by histone proteins. The helical path of histone-DNA contact on a nucleosome is also called "footprint." We investigate the mechanism of footprint traversal by a CRE that translocates along the dsDNA. Our two-state model of a CRE captures effectively two distinct chemical (or conformational) states in the mechanochemical cycle of each ATP-dependent CRE. We calculate the mean time of traversal. Our predictions on the ATP dependence of the mean traversal time can be tested by carrying out in vitro experiments on mononucleosomes.
Guarnieri, Michael T.; Blagg, Brian S. J.
2011-01-01
Abstract Bacterial histidine kinases (HK) are members of the GHKL superfamily, which share a unique adenosine triphosphate (ATP)-binding Bergerat fold. Our previous studies have shown that Gyrase, Hsp90, MutL (GHL) inhibitors bind to the ATP-binding pocket of HK and may provide lead compounds for the design of novel antibiotics targeting these kinases. In this article, we developed a competition assay using the fluorescent ATP analog, 2′,3′-O-(2,4,6-trinitrophenyl) adenosine 5′-triphosphate. The method can be used for high-throughput screening of compound libraries targeting HKs or other ATP-binding proteins. We utilized the assay to screen a library of GHL inhibitors targeting the bacterial HK PhoQ, and discuss the applications of the 2′,3′-O-(2,4,6-trinitrophenyl) adenosine 5′-triphosphate competition assay beyond GHKL inhibitor screening. PMID:21050069
Silva, Isabel; Ferreirinha, Fátima; Magalhães-Cardoso, Maria Teresa; Silva-Ramos, Miguel; Correia-de-Sá, Paulo
2015-10-01
Deregulation of purinergic bladder signaling may contribute to persistent detrusor overactivity in patients with bladder outlet obstruction. Activation of uridine diphosphate sensitive P2Y6 receptors increases voiding frequency in rats indirectly by releasing adenosine triphosphate from the urothelium. To our knowledge this mechanism has never been tested in the human bladder. We examined the role of the uridine diphosphate sensitive P2Y6 receptor on tetrodotoxin insensitive nonneuronal adenosine triphosphate and [(3)H]acetylcholine release from the human urothelium with the lamina propria of control organ donors and patients with benign prostatic hyperplasia. The adenosine triphosphate-to-[(3)H]acetylcholine ratio was fivefold higher in mucosal urothelium/lamina propria strips from benign prostatic hyperplasia patients than control men. The selective P2Y6 receptor agonist PSB0474 (100 nM) augmented by a similar amount adenosine triphosphate and [(3)H]acetylcholine release from mucosal urothelium/lamina propria strips from both groups of individuals. The facilitatory effect of PSB0474 was prevented by MRS2578 (50 nM) and by carbenoxolone (10 μM), which block P2Y6 receptor and pannexin-1 hemichannels, respectively. Blockade of P2X3 (and/or P2X2/3) receptors with A317491 (100 nM) also attenuated release facilitation by PSB0474 in control men but not in patients with benign prostatic hyperplasia. Immunolocalization studies showed that P2Y6, P2X2 and P2X3 receptors were present in choline acetyltransferase positive urothelial cells. In contrast to P2Y6 staining, choline acetyltransferase, P2X2 and P2X3 immunoreactivity decreased in the urothelium of benign prostatic hyperplasia patients. Activation of P2Y6 receptor amplifies mucosal adenosine triphosphate release underlying bladder overactivity in patients with benign prostatic hyperplasia. Therefore, we propose selective P2Y6 receptor blockade as a novel therapeutic strategy to control persistent storage symptoms in
Gracia, Eduard; Pérez-Capote, Kamil; Moreno, Estefanía; Barkešová, Jana; Mallol, Josefa; Lluís, Carme; Franco, Rafael; Cortés, Antoni; Casadó, Vicent; Canela, Enric I
2011-05-01
A2ARs (adenosine A2A receptors) are highly enriched in the striatum, which is the main motor control CNS (central nervous system) area. BRET (bioluminescence resonance energy transfer) assays showed that A2AR homomers may act as cell-surface ADA (adenosine deaminase; EC 3.5.4.4)-binding proteins. ADA binding affected the quaternary structure of A2ARs present on the cell surface. ADA binding to adenosine A2ARs increased both agonist and antagonist affinity on ligand binding to striatal membranes where these proteins are co-expressed. ADA also increased receptor-mediated ERK1/2 (extracellular-signal-regulated kinase 1/2) phosphorylation. Collectively, the results of the present study show that ADA, apart from regulating the concentration of extracellular adenosine, may behave as an allosteric modulator that markedly enhances ligand affinity and receptor function. This powerful regulation may have implications for the physiology and pharmacology of neuronal A2ARs.
Mittelstädt, Gerd; Moggré, Gert‐Jan; Panjikar, Santosh; Nazmi, Ali Reza
2016-01-01
Abstract Adenosine triphosphate phosphoribosyltransferase (ATP‐PRT) catalyzes the first committed step of the histidine biosynthesis in plants and microorganisms. Here, we present the functional and structural characterization of the ATP‐PRT from the pathogenic ε‐proteobacteria Campylobacter jejuni (CjeATP‐PRT). This enzyme is a member of the long form (HisGL) ATP‐PRT and is allosterically inhibited by histidine, which binds to a remote regulatory domain, and competitively inhibited by AMP. In the crystalline form, CjeATP‐PRT was found to adopt two distinctly different hexameric conformations, with an open homohexameric structure observed in the presence of substrate ATP, and a more compact closed form present when inhibitor histidine is bound. CjeATP‐PRT was observed to adopt only a hexameric quaternary structure in solution, contradicting previous hypotheses favoring an allosteric mechanism driven by an oligomer equilibrium. Instead, this study supports the conclusion that the ATP‐PRT long form hexamer is the active species; the tightening of this structure in response to remote histidine binding results in an inhibited enzyme. PMID:27191057
Mittelstädt, Gerd; Moggré, Gert-Jan; Panjikar, Santosh; Nazmi, Ali Reza; Parker, Emily J
2016-08-01
Adenosine triphosphate phosphoribosyltransferase (ATP-PRT) catalyzes the first committed step of the histidine biosynthesis in plants and microorganisms. Here, we present the functional and structural characterization of the ATP-PRT from the pathogenic ε-proteobacteria Campylobacter jejuni (CjeATP-PRT). This enzyme is a member of the long form (HisGL ) ATP-PRT and is allosterically inhibited by histidine, which binds to a remote regulatory domain, and competitively inhibited by AMP. In the crystalline form, CjeATP-PRT was found to adopt two distinctly different hexameric conformations, with an open homohexameric structure observed in the presence of substrate ATP, and a more compact closed form present when inhibitor histidine is bound. CjeATP-PRT was observed to adopt only a hexameric quaternary structure in solution, contradicting previous hypotheses favoring an allosteric mechanism driven by an oligomer equilibrium. Instead, this study supports the conclusion that the ATP-PRT long form hexamer is the active species; the tightening of this structure in response to remote histidine binding results in an inhibited enzyme. © 2016 The Protein Society.
Synthesis of γ-Phosphate-Labeled and Doubly Labeled Adenosine Triphosphate Analogs.
Hacker, Stephan M; Welter, Moritz; Marx, Andreas
2015-03-09
This unit describes the synthesis of γ-phosphate-labeled and doubly labeled adenosine triphosphate (ATP) analogs and their characterization using the phosphodiesterase I from Crotalus adamanteus (snake venom phosphodiesterase; SVPD). In the key step of the synthesis, ATP or an ATP analog, bearing a linker containing a trifluoroacetamide group attached to the nucleoside, are modified with an azide-containing linker at the terminal phosphate using an alkylation reaction. Subsequently, different labels are introduced to the linkers by transformation of one functional group to an amine and coupling to an N-hydroxysuccinimide ester. Specifically, the Staudinger reaction of the azide is employed as a straightforward means to obtain an amine in the presence of various labels. Furthermore, the fluorescence characteristics of a fluorogenic, doubly labeled ATP analog are investigated following enzymatic cleavage by SVPD. Copyright © 2015 John Wiley & Sons, Inc.
Tantry, Subramanyam J; Markad, Shankar D; Shinde, Vikas; Bhat, Jyothi; Balakrishnan, Gayathri; Gupta, Amit K; Ambady, Anisha; Raichurkar, Anandkumar; Kedari, Chaitanyakumar; Sharma, Sreevalli; Mudugal, Naina V; Narayan, Ashwini; Naveen Kumar, C N; Nanduri, Robert; Bharath, Sowmya; Reddy, Jitendar; Panduga, Vijender; Prabhakar, K R; Kandaswamy, Karthikeyan; Saralaya, Ramanatha; Kaur, Parvinder; Dinesh, Neela; Guptha, Supreeth; Rich, Kirsty; Murray, David; Plant, Helen; Preston, Marian; Ashton, Helen; Plant, Darren; Walsh, Jarrod; Alcock, Peter; Naylor, Kathryn; Collier, Matthew; Whiteaker, James; McLaughlin, Robert E; Mallya, Meenakshi; Panda, Manoranjan; Rudrapatna, Suresh; Ramachandran, Vasanthi; Shandil, Radha; Sambandamurthy, Vasan K; Mdluli, Khisi; Cooper, Christopher B; Rubin, Harvey; Yano, Takahiro; Iyer, Pravin; Narayanan, Shridhar; Kavanagh, Stefan; Mukherjee, Kakoli; Balasubramanian, V; Hosagrahara, Vinayak P; Solapure, Suresh; Ravishankar, Sudha; Hameed P, Shahul
2017-02-23
The approval of bedaquiline to treat tuberculosis has validated adenosine triphosphate (ATP) synthase as an attractive target to kill Mycobacterium tuberculosis (Mtb). Herein, we report the discovery of two diverse lead series imidazo[1,2-a]pyridine ethers (IPE) and squaramides (SQA) as inhibitors of mycobacterial ATP synthesis. Through medicinal chemistry exploration, we established a robust structure-activity relationship of these two scaffolds, resulting in nanomolar potencies in an ATP synthesis inhibition assay. A biochemical deconvolution cascade suggested cytochrome c oxidase as the potential target of IPE class of molecules, whereas characterization of spontaneous resistant mutants of SQAs unambiguously identified ATP synthase as its molecular target. Absence of cross resistance against bedaquiline resistant mutants suggested a different binding site for SQAs on ATP synthase. Furthermore, SQAs were found to be noncytotoxic and demonstrated efficacy in a mouse model of tuberculosis infection.
Snapshots of the maltose transporter during ATP hydrolysis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Oldham, Michael L.; Chen, Jue
2011-12-05
ATP-binding cassette transporters are powered by ATP, but the mechanism by which these transporters hydrolyze ATP is unclear. In this study, four crystal structures of the full-length wild-type maltose transporter, stabilized by adenosine 5{prime}-({beta},{gamma}-imido)triphosphate or ADP in conjunction with phosphate analogs BeF{sub 3}{sup -}, VO{sub 4}{sup 3-}, or AlF{sub 4}{sup -}, were determined to 2.2- to 2.4-{angstrom} resolution. These structures led to the assignment of two enzymatic states during ATP hydrolysis and demonstrate specific functional roles of highly conserved residues in the nucleotide-binding domain, suggesting that ATP-binding cassette transporters catalyze ATP hydrolysis via a general base mechanism.
Fazilat, Shahram; Sauerwein, Rebecca; McLeod, Jennifer; Finlayson, Tyler; Adam, Emilia; Engle, John; Gagneja, Prashant; Maier, Tom; Machida, Curtis A
2010-01-01
Dentistry has undergone a shift in caries management toward prevention and improved oral hygiene and diagnosis. Caries prevention now represents one of the most important aspects of modern dental practice. The purpose of this cross-sectional study was to demonstrate the use of adenosine triphosphate- (ATP-) driven bioluminescence as an innovative tool for the rapid chairside enumeration of oral bacteria (including plague streptococci) and assessment of oral hygiene and caries risk. Thirty-three pediatric patients (7- to 12-year-old males and females) were examined, and plague specimens, in addition to stimulated saliva, were collected from representative teeth within each quadrant. Oral specimens (n=150 specimens) were assessed by plating on enriched and selective agars, to enumerate total bacteria and streptococci, and subjected to adenosine triphosphate- (ATP-) driven bioluminescence determinations using a luciferase-based assay system. Statistical correlations, linking ATP values to numbers of total bacteria, oral streptococci and mutans streptococci, yielded highly significant r values of 0.854, 0.840, and 0.796, respectively Our clinical data is consistent with the hypothesis that ATP measurements have a strong statistical association with bacterial number in plague and saliva specimens, including numbers for oral streptococci, and may be used as a potential assessment tool for oral hygiene and caries risk in children.
Goodford, P J; St-Louis, J; Wootton, R
1978-01-01
1. Oxygen dissociation curves have been measured for human haemoglobin solutions with different concentrations of the allosteric effectors 2,3-diphosphoglycerate, adenosine triphosphate and inositol hexaphosphate. 2. Each effector produces a concentration dependent right shift of the oxygen dissociation curve, but a point is reached where the shift is maximal and increasing the effector concentration has no further effect. 3. Mathematical models based on the Monod, Wyman & Changeux (1965) treatment of allosteric proteins have been fitted to the data. For each compound the simple two-state model and its extension to take account of subunit inequivalence were shown to be inadequate, and a better fit was obtained by allowing the effector to lower the oxygen affinity of the deoxy conformational state as well as binding preferentially to this conformation. PMID:722582
Fang, Yu; Shi, Wen; Hu, Yiming; Li, Xiaohua; Ma, Huimin
2018-05-24
A new dual-function fluorescent probe is developed for detecting nitroreductase (NTR) and adenosine triphosphate (ATP) with different responses. Imaging application of the probe reveals that intracellular NTR and ATP display an adverse changing trend during a hypoxic process and ATP can serve as a new sign for cell hypoxia.
Hupertan, V; Neuzillet, Y; Stücker, O; Pons, C; Leammel, E; Lebret, T
2012-12-01
Purines and more specifically adenosine monophosphate (AMP) and adenosine triphosphate (ATP) have a strong relaxant effect on smooth muscle cells of the dog, rabbit and human corpus cavernosum, to approximately the same degree as nitric oxide (NO). However, purines are considered as modulators of erectile function rather than key mediators. This suggests that the use of purines combined with NO donors could be effective to treat some specific erectile disorders. The relaxation induced by the combination of l-arginine (Arg), a natural substrate for NO synthase, was assessed with a purine-nucleotide (AMP, ATP) on a rabbit corpus cavernosum model, to determine if these substances could potentiate each other's effect. When a pre-contraction was induced by phenylephrine, AMP alone induced a 43% CC relaxation rate and ATP alone a 26% rate. The relaxation rate induced by Arg was lower in comparison (8% at 5.10(-4) m vs. 25% at AMP 5.10(-4) m and 15% at ATP 5.10(-4) m). NO synthase inhibitor n-nitro-l-arginine did not modify the relaxing effect provoked by AMP suggesting that the mechanism of action of this nucleotide does not involve the NO pathway. The combination of Arg at 5.10(-4) m with either AMP or ATP at different doses ranging from 5.10(-4) to 10(-3) m significantly enhanced the relaxing response reaching rates of 62 and 80% respectively, leading to a synergistic effect. The present data indicate that a 'NO donor' combined with an 'adenosine donor' could be an effective therapeutic approach. © 2012 The Authors. International Journal of Andrology © 2012 European Academy of Andrology.
Adenosine triphosphate acts as a paracrine signaling molecule to reduce the motility of T cells
Wang, Chiuhui Mary; Ploia, Cristina; Anselmi, Fabio; Sarukhan, Adelaida; Viola, Antonella
2014-01-01
Organization of immune responses requires exchange of information between cells. This is achieved through either direct cell–cell contacts and establishment of temporary synapses or the release of soluble factors, such as cytokines and chemokines. Here we show a novel form of cell-to-cell communication based on adenosine triphosphate (ATP). ATP released by stimulated T cells induces P2X4/P2X7-mediated calcium waves in the neighboring lymphocytes. Our data obtained in lymph node slices suggest that, during T-cell priming, ATP acts as a paracrine messenger to reduce the motility of lymphocytes and that this may be relevant to allow optimal tissue scanning by T cells. PMID:24843045
Chen, Hong; Chen, Qiong; Zhao, Yingying; Zhang, Fan; Yang, Fan; Tang, Jie; He, Pingang
2014-04-01
A sensitive and label-free electrochemiluminescence (ECL) aptasensor for the detection of adenosine triphosphate (ATP) was successfully designed using host-guest recognition between a metallocyclodextrin complex, i.e., tris(bipyridine)ruthenium(II)-β-cyclodextrin [tris(bpyRu)-β-CD], and an ATP-binding aptamer. In the protocol, the NH2-terminated aptamer was immobilized on a glassy carbon electrode (GCE) by a coupling interaction. After host-guest recognition between tris(bpyRu)-β-CD and aptamer, the tris(bpyRu)-β-CD/aptamer/GCE produced a strong ECL signal as a result of the photoactive properties of tris(bpyRu)-β-CD. However, in the presence of ATP, the ATP/aptamer complex was formed preferentially, which restricted host-guest recognition, and therefore less tris(bpyRu)-β-CD was attached to the GCE surface, resulting in an obvious decrease in the ECL intensity. Under optimal determination conditions, an excellent logarithmic linear relationship between the ECL decrease and ATP concentration was obtained in the range 10.0-0.05 nM, with a detection limit of 0.01 nM at the S/N ratio of 3. The proposed ECL-based ATP aptasensor exhibited high sensitivity and selectivity, without time-consuming signal-labeling procedures, and is considered to be a promising model for detection of aptamer-specific targets. Copyright © 2014. Published by Elsevier B.V.
Yu, Ping; He, Xiulan; Zhang, Li; Mao, Lanqun
2015-01-20
Adenosine triphosphate (ATP) aptamer has been widely used as a recognition unit for biosensor development; however, its relatively poor specificity toward ATP against adenosine-5'-diphosphate (ADP) and adenosine-5'-monophosphate (AMP) essentially limits the application of the biosensors in real systems, especially in the complex cerebral system. In this study, for the first time, we demonstrate a dual recognition unit strategy (DRUS) to construct a highly selective and sensitive ATP biosensor by combining the recognition ability of aptamer toward A nucleobase and of polyimidazolium toward phosphate. The biosensors are constructed by first confining the polyimidazolium onto a gold surface by surface-initiated atom transfer radical polymerization (SI-ATRP), and then the aptamer onto electrode surface by electrostatic self-assembly to form dual-recognition-unit-functionalized electrodes. The constructed biosensor based on DRUS not only shows an ultrahigh sensitivity toward ATP with a detection limit down to the subattomole level but also an ultrahigh selectivity toward ATP without interference from ADP and AMP. The constructed biosensor is used for selective and sensitive sensing of the extracellular ATP in the cerebral system by combining in vivo microdialysis and can be used as a promising neurotechnology to probing cerebral ATP concentration.
Hwang, Jung Hwan; Kim, Yong-Hoon; Noh, Jung-Ran; Choi, Dong-Hee; Kim, Kyoung-Shim; Lee, Chul-Ho
2015-10-01
The hepatic cell death induced by acetaminophen (APAP) is closely related to cellular adenosine triphosphate (ATP) depletion, which is mainly caused by mitochondrial dysfunction. Adenosine monophosphate (AMP)-activated protein kinase (AMPK) is a key sensor of low energy status. AMPK regulates metabolic homeostasis by stimulating catabolic metabolism and suppressing anabolic pathways to increase cellular energy levels. We found that the decrease in active phosphorylation of AMPK in response to APAP correlates with decreased ATP levels, in vivo. Therefore, we hypothesized that the enhanced production of ATP via AMPK stimulation can lead to amelioration of APAP-induced liver failure. A769662, an allosteric activator of AMPK, produced a strong synergistic effect on AMPK Thr172 phosphorylation with APAP in primary hepatocytes and liver tissue. Interestingly, activation of AMPK by A769662 ameliorated the APAP-induced hepatotoxicity in C57BL/6N mice treated with APAP at a dose of 400 mg/kg intraperitoneally. However, mice treated with APAP alone developed massive centrilobular necrosis, and APAP increased their serum alanine aminotransferase and aspartate aminotransferase levels. Furthermore, A769662 administration prevented the loss of intracellular ATP without interfering with the APAP-mediated reduction of mitochondrial dysfunction. In contrast, inhibition of glycolysis by 2-deoxy-glucose eliminated the beneficial effects of A769662 on APAP-mediated liver injury. In conclusion, A769662 can effectively protect mice against APAP-induced liver injury through ATP synthesis by anaerobic glycolysis. Furthermore, stimulation of AMPK may have potential therapeutic application for APAP overdose.
Stanely Mainzen Prince, P
2013-03-01
Cardiac mitochondrial damage plays an important role in the pathology of myocardial infarction. The protective effects of (-) epicatechin on cardiac mitochondrial damage in isoproterenol induced myocardial infarction were evaluated in rats. Rats were pretreated with (-) epicatechin (20 mg/kg body weight) daily for a period of 21 days. After the pretreatment period, isoproterenol (100 mg/kg body weight) was injected subcutaneously into rats twice at an interval of 24 h to induce myocardial infarction. Isoproterenol induced myocardial infarcted rats showed a significant increase in the levels of cardiac diagnostic markers, heart mitochondrial lipid peroxidation, calcium, and a significant decrease in the activities/levels of heart mitochondrial glutathione peroxidase, glutathione reductase, reduced glutathione, isocitrate, succinate, malate, α-ketoglutarate and NADH-dehydrogenases, cytochrome-C-oxidase and adenosine triphosphate. (-) Epicatechin pretreatment showed significant protective effects on all the biochemical parameters evaluated. The in vitro study revealed the superoxide and hydroxyl radical scavenging activity of (-) epicatechin. The possible mechanisms for the beneficial effects of (-) epicatechin on cardiac mitochondria could be attributed to scavenging of free radicals, decreasing calcium, increasing multi-enzymes (antioxidant, tricarboxylic acid cycle and respiratory chain enzymes), reduced glutathione and adenosine triphosphate. Thus, (-) epicatechin attenuated mitochondrial damage in isoproterenol induced myocardial infarcted rats. Copyright © 2012 Elsevier Ltd. All rights reserved.
Intracellular Adenosine Triphosphate Delivery Enhanced Skin Wound Healing in Rabbits
Wang, Jianpu; Zhang, Qunwei; Wan, Rong; Mo, Yiqun; Li, Ming; Tseng, Michael T.; Chien, Sufan
2016-01-01
Small unilamellar lipid vesicles were used to encapsulate adenosine triphosphate (ATP-vesicles) for intracellular energy delivery. This technique was tested in full-thickness skin wounds in 16 adult rabbits. One ear was rendered ischemic by using a minimally invasive surgery. The other ear served as a normal control. Four circular full-thickness wounds were created on the ventral side of each ear. ATP-vesicles or saline was used and the wounds were covered with Tegaderm (3M, St. Paul, MN). Dressing was changed and digital photos were taken daily until all the wounds were healed. The mean healing times of ATP-vesicles–treated wounds were significantly shorter than that of saline-treated wounds on ischemic and nonischemic ears. Histologic study indicated better-developed granular tissue and reepithelial-ization in the ATP-vesicles–treated wounds. The wounds treated by ATP-vesicles exhibited extremely fast granular tissue growth. More CD31 positive cells were seen in the ATP-vesicles–treated wounds. This preliminary study shows that direct intracellular delivery of ATP can accelerate the healing process of skin wounds on ischemic and nonischemic rabbit ears. The extremely fast granular tissue growth was something never seen or reported in the past. PMID:19158531
A novel conductometric biosensor based on hexokinase for determination of adenosine triphosphate.
Kucherenko, I S; Kucherenko, D Yu; Soldatkin, O O; Lagarde, F; Dzyadevych, S V; Soldatkin, A P
2016-04-01
The paper presents a simple and inexpensive reusable biosensor for determination of the concentration of adenosine-5'-triphosphate (ATP) in aqueous samples. The biosensor is based on a conductometric transducer which contains two pairs of gold interdigitated electrodes. An enzyme hexokinase was immobilized onto one pair of electrodes, and bovine serum albumin-onto another pair (thus, a differential mode of measurement was used). Conditions of hexokinase immobilization on the transducer by cross-linking via glutaraldehyde were optimized. Influence of experimental conditions (concentration of magnesium ions, ionic strength and concentration of the working buffer) on the biosensor work was studied. The reproducibility of biosensor responses and operational stability of the biosensor were checked during one week. Dry storage at -18 °C was shown to be the best conditions to store the biosensor. The biosensor was successfully applied for measurements of ATP concentration in pharmaceutical samples. The proposed biosensor may be used in future for determination of ATP and/or glucose in water samples. Copyright © 2016 Elsevier B.V. All rights reserved.
Ren, Hu-Bo; Yan, Xiu-Ping
2012-08-15
An ultrasonic assisted approach was developed for rapid synthesis of highly water soluble phosphorescent adenosine triphosphate (ATP)-capped Mn-doped ZnS QDs. The prepared ATP-capped Mn-doped ZnS QDs allow selective phosphorescent detection of arginine and methylated arginine based on the specific recognition nature of supramolecular Mg(2+)-ATP-arginine ternary system in combination with the phosphorescence property of Mn-doped ZnS QDs. The developed QD based probe gives excellent selectivity and reproducibility (1.7% relative standard deviation for 11 replicate detections of 10 μM arginine) and low detection limit (3 s, 0.23 μM), and favors biological applications due to the effective elimination of interference from scattering light and autofluorescence. Copyright © 2012 Elsevier B.V. All rights reserved.
Hwang, Jung Hwan; Kim, Yong-Hoon; Noh, Jung-Ran; Choi, Dong-Hee; Kim, Kyoung-Shim; Lee, Chul-Ho
2015-01-01
The hepatic cell death induced by acetaminophen (APAP) is closely related to cellular adenosine triphosphate (ATP) depletion, which is mainly caused by mitochondrial dysfunction. Adenosine monophosphate (AMP)-activated protein kinase (AMPK) is a key sensor of low energy status. AMPK regulates metabolic homeostasis by stimulating catabolic metabolism and suppressing anabolic pathways to increase cellular energy levels. We found that the decrease in active phosphorylation of AMPK in response to APAP correlates with decreased ATP levels, in vivo. Therefore, we hypothesized that the enhanced production of ATP via AMPK stimulation can lead to amelioration of APAP-induced liver failure. A769662, an allosteric activator of AMPK, produced a strong synergistic effect on AMPK Thr172 phosphorylation with APAP in primary hepatocytes and liver tissue. Interestingly, activation of AMPK by A769662 ameliorated the APAP-induced hepatotoxicity in C57BL/6N mice treated with APAP at a dose of 400 mg/kg intraperitoneally. However, mice treated with APAP alone developed massive centrilobular necrosis, and APAP increased their serum alanine aminotransferase and aspartate aminotransferase levels. Furthermore, A769662 administration prevented the loss of intracellular ATP without interfering with the APAP-mediated reduction of mitochondrial dysfunction. In contrast, inhibition of glycolysis by 2-deoxy-glucose eliminated the beneficial effects of A769662 on APAP-mediated liver injury. In conclusion, A769662 can effectively protect mice against APAP-induced liver injury through ATP synthesis by anaerobic glycolysis. Furthermore, stimulation of AMPK may have potential therapeutic application for APAP overdose. PMID:26434492
Fragakis, Nikolaos; Antoniadis, Antonios P; Saviano, Massimo; Vassilikos, Vassilios; Pappone, Carlo
2015-03-15
Syncope is a significant source of cardiovascular-related morbidity yet the etiology is frequently obscure and the identification of patients at highest risk is challenging. Adenosine (AD) and adenosine triphosphate (ATP) administrations have been suggested as potentially useful non-invasive tools in the diagnostic workup of patients with neurally-mediated or bradycardia-related syncope. It has been postulated that both compounds by modulating the autonomic innervation in the heart and exerting negative chronotropic and dromotropic effects in the conduction system, may unmask the mechanism of syncope. However, the clinical implications derived from the efficacy of both tests in the investigation of syncope remain unclear mainly due to inconclusive and occasionally contradictory results of published studies. This review article summarizes recent and past information in the use of ATP and AD in the investigation of syncope with emphasis on clinical trials. We present the current level of evidence for the use of these agents in clinical practice, identify areas where further research is warranted and highlight the future perspectives of these agents as complements to an accurate risk-stratification of patients with syncope. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Seyfried, P.L.; Horgan, C.B.L.
1981-10-01
A firefly luciferase assay of bacterial adenosine triphosphate (ATP) was developed to measure the toxic effects of cadmium ions on aquatic organisms. Toxicity was monitored using intracellular (I/C) ATP (in micrograms per litre) as well as plate counts (colony-forming units per millilitre). The bacteria, which belonged mainly to the families Enterobacteriaceae and Pseudomonadaceae, exhibited varying degrees of resistance to up to 100 ppm cadmium when grown in a glucose-salts medium at pH 6.8. Among the organisms tested, cadmium resistance decreased in the following order: Pseudomonas vesicularis > P. aeruginosa > Enterobacter sp. > P. fluorescens > Chromobacter sp. > Serratiamore » sp. A rise in the pH of the growth medium from 5 to 7 resulted in increased toxicity of cadmium.« less
Huang, Yu-Shan; Chen, Yee-Chun; Chen, Mei-Ling; Cheng, Aristine; Hung, I-Chen; Wang, Jann-Tay; Sheng, Wang-Huei; Chang, Shan-Chwen
2015-08-01
Environmental cleaning is essential in reducing microbial colonization and health care-associated infections in hospitals. However, there is no consensus for the standard method to assess hospital cleanliness, and comparisons of newer methodology, such as adenosine triphosphate bioluminescence assay, with the traditional methods are limited. A prospective study was conducted at a medical center between January 2013 and August 2013. In each selected room, 10-12 high-touch surfaces were sampled before and after terminal cleaning. The adequacy of cleaning was evaluated by visual inspection, aerobic colony counts (ACCs), and adenosine triphosphate (ATP) bioluminescence assay. Eighty-five environmental surfaces from 8 rooms were evaluated by all 3 methods. The overall inadequacy defined by visual inspection, ACC, and ATP level was 11.8%, 20.0%, and 50.6% before cleaning and 4.7%, 5.9%, 21.2% after cleaning, respectively. A correlation between the ACC and ATP was found (r = 0.285, P < .001) using log10 values. Using ACCs <2.5 colony forming units/cm(2) as the cutoff for cleanliness, the ATP assay had better sensitivity than visual inspection (63.6% vs 27.3%). The receiver operating characteristics of the ATP assay indicated that the optimal ATP cutoff value was estimated to be 5.57 relative light units/cm(2). ATP bioluminescence assay is a sensitive and rapid tool in evaluating the quality of terminal cleaning. We emphasize the value of using a quantitative method to monitor environmental cleaning at hospitals. Copyright © 2015 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.
Eltzschig, Holger K; Thompson, Linda F; Karhausen, Jorn; Cotta, Richard J; Ibla, Juan C; Robson, Simon C; Colgan, Sean P
2004-12-15
Hypoxia is a well-documented inflammatory stimulus and results in tissue polymorphonuclear leukocyte (PMN) accumulation. Likewise, increased tissue adenosine levels are commonly associated with hypoxia, and given the anti-inflammatory properties of adenosine, we hypothesized that adenosine production via adenine nucleotide metabolism at the vascular surface triggers an endogenous anti-inflammatory response during hypoxia. Initial in vitro studies indicated that endogenously generated adenosine, through activation of PMN adenosine A(2A) and A(2B) receptors, functions as an antiadhesive signal for PMN binding to microvascular endothelia. Intravascular nucleotides released by inflammatory cells undergo phosphohydrolysis via hypoxia-induced CD39 ectoapyrase (CD39 converts adenosine triphosphate/adenosine diphosphate [ATP/ADP] to adenosine monophosphate [AMP]) and CD73 ecto-5'-nucleotidase (CD73 converts AMP to adenosine). Extensions of our in vitro findings using cd39- and cd73-null animals revealed that extracellular adenosine produced through adenine nucleotide metabolism during hypoxia is a potent anti-inflammatory signal for PMNs in vivo. These findings identify CD39 and CD73 as critical control points for endogenous adenosine generation and implicate this pathway as an innate mechanism to attenuate excessive tissue PMN accumulation.
Odagaki, Yuji; Kinoshita, Masakazu; Ota, Toshio; Meana, J Javier; Callado, Luis F; Matsuoka, Isao; García-Sevilla, Jesús A
2018-06-01
Adenosine signaling plays a complex role in multiple physiological processes in the brain, and its dysfunction has been implicated in pathophysiology of neuropsychiatric diseases such as schizophrenia and affective disorders. In the present study, the coupling between adenosine A 1 receptor and G-protein was assessed by means of two [ 35 S]GTPγS binding assays, i.e., conventional filtration method and [ 35 S]GTPγS binding/immunoprecipitation in rat and human brain membranes. The latter method provides information about adenosine A 1 receptor-mediated Gα i-3 activation in rat as well as human brain membranes. On the other hand, adenosine-stimulated [ 35 S]GTPγS binding determined with conventional assay derives from functional activation of Gα i/o proteins (not restricted only to Gα i-3 ) coupled to adenosine A 1 receptors. The determination of adenosine concentrations in the samples used in the present study indicates the possibility that the assay mixture under our experimental conditions contains residual endogenous adenosine at nanomolar concentrations, which was also suggested by the results on the effects of adenosine receptor antagonists on basal [ 35 S]GTPγS binding level. The effects of adenosine deaminase (ADA) on basal binding also support the presence of adenosine. Nevertheless, the varied patterns of ADA discouraged us from adding ADA into assay medium routinely. The concentration-dependent increases elicited by adenosine were determined in 40 subjects without any neuropsychiatric disorders. The increases in %E max values determined by conventional assay according to aging and postmortem delay should be taken into account in future studies focusing on the effects of psychiatric disorders on adenosine A 1 receptor/G-protein interaction in postmortem human brain tissue.
Gicquel, Thomas; Victoni, Tatiana; Fautrel, Alain; Robert, Sacha; Gleonnec, Florence; Guezingar, Marie; Couillin, Isabelle; Catros, Véronique; Boichot, Elisabeth; Lagente, Vincent
2014-04-01
Adenosine triphosphate (ATP) has been described as a danger signal activating the NOD-like receptor-family protein 3 (NLRP3)-inflammasome leading to the pro-inflammatory cytokine, interleukin (IL)-1β, release in the lung. The NLRP3-inflammasome pathway has been previously described to be involved in experimental collagen deposition and the development of pulmonary fibrosis. The aim of the present study was to investigate the role of the NLRP3 inflammasome pathway and P2X7 purinergic receptor in the activation of human macrophages in vitro by ATP. We showed that adenosine 5'-[γ-thio]triphosphate tetralithium salt (ATPγS) and 2',3'-O-(4-benzoylbenzoyl) adenosine 5'-triphosphate (BzATP), two stable analogs of ATP, are able to potentiate the release of IL-1β from human monocyte-derived macrophages induced by low concentration of lipopolysaccharide (LPS). However, in the same conditions no increase in IL-1α and IL-6 was observed. Immunochemistry has shown that human macrophages natively express NLRP3 and purinergic P2X7 receptors (P2X7 R). NLRP3 and IL-1β mRNA expression were induced from LPS-primed macrophages, but also after 5-h treatment of BzATP as analysed by reverse transcription quantitative polymerase chain reaction. However, other inflammasome pathways (NLRP1, NLRP2, NLRC4, NLRP6 and AIM2) and P2X7 R were not induced by BzATP. We observed that P2X7 R antagonists, A-438079 and A-740003, were able to reduce the release of IL-1β, but not of IL-1α and IL-6 from macrophages stimulated by ATPγS or BzATP. The present results showed the involvement of the P2X7 R-NLRP3 inflammasome pathway in the secretion of IL-1β from ATP-stimulated human macrophages, and suggest that P2X7 R were not involved in IL-1α and IL-6 release. This study also points out that repression of the P2X7 R represents a novel potential therapeutic approach to control fibrosis in lung injury. © 2014 Wiley Publishing Asia Pty Ltd.
Feng, Lili; Sun, Xiaofeng; Csizmadia, Eva; Han, Lihui; Bian, Shu; Murakami, Takashi; Wang, Xin; Robson, Simon C; Wu, Yan
2011-01-01
Extracellular adenosine triphosphate (ATP) is known to boost immune responses in the tumor microenvironment but might also contribute directly to cancer cell death. CD39/ENTPD1 is the dominant ectonucleotidase expressed by endothelial cells and regulatory T cells and catalyzes the sequential hydrolysis of ATP to AMP that is further degraded to adenosine by CD73/ecto-5′-nucleotidase. We have previously shown that deletion of Cd39 results in decreased growth of transplanted tumors in mice, as a result of both defective angiogenesis and heightened innate immune responses (secondary to loss of adenosinergic immune suppression). Whether alterations in local extracellular ATP and adenosine levels as a result of CD39 bioactivity directly affect tumor growth and cytotoxicity has not been investigated to date. We show here that extracellular ATP exerts antitumor activity by directly inhibiting cell proliferation and promoting cancer cell death. ATP-induced antiproliferative effects and cell death are, in large part, mediated through P2X7 receptor signaling. Tumors in Cd39 null mice exhibit increased necrosis in association with P2X7 expression. We further demonstrate that exogenous soluble NTPDase, or CD39 expression by cocultured liver sinusoidal endothelial cells, stimulates tumor cell proliferation and limits cell death triggered by extracellular ATP. Collectively, our findings indicate that local expression of CD39 directly promotes tumor cell growth by scavenging extracellular ATP. Pharmacological or targeted inhibition of CD39 enzymatic activity may find utility as an adjunct therapy in cancer management. PMID:21390184
Ratajczak, Katarzyna; Stobiecka, Magdalena
2017-07-20
The interactions of fluorescent probes and biomolecules with nanocarriers are of key importance to the emerging targeted drug delivery systems. Graphene oxide nanosheets (GONs) as the nanocarriers offer biocompatibility and robust drug binding capacity. The interactions of GONs with fluorophores lead to strong fluorescence quenching, which may interfere with fluorescence bioimaging and biodetection. Herein, we report on the interactions and energy transfers in a model ternary system: GONs-FITC-ATP, where FITC is a model fluorophore (fluorescein isothiocyanate) and ATP is a common biomolecule (adenosine-5'-triphosphate). We have found that FITC fluorescence is considerably quenched by ATP (the quenching constant K SV = 113 ± 22 M -1 ). The temperature coefficient of K SV is positive (α T = 4.15 M -1 deg -1 ). The detailed analysis of a model for internal self-quenching of FITC indicates that the temperature dependence of the net quenching efficiency η for the FITC-ATP pair is dominated by FITC internal self-quenching modes with their contribution estimated at 79%. The quenching of FITC by GONs is much stronger (K SV = 598 ± 29 M -1 ) than that of FITC-ATP and is associated with the formation of supramolecular assemblies bound with hydrogen bonding and π-π stacking interactions. For the analysis of the complex behavior of the ternary system GONs-FITC-ATP, a model of chemisorption of ATP on GONs, with partial blocking of FITC quenching, has been developed. Our results indicate that ATP acts as a moderator for FITC quenching by GONs. The interactions between ATP, FITC, and GONs have been corroborated using molecular dynamics and quantum mechanical calculations.
Kobori, Atsushi; Shizuta, Satoshi; Inoue, Koichi; Kaitani, Kazuaki; Morimoto, Takeshi; Nakazawa, Yuko; Ozawa, Tomoya; Kurotobi, Toshiya; Morishima, Itsuro; Miura, Fumiharu; Watanabe, Tetsuya; Masuda, Masaharu; Naito, Masaki; Fujimoto, Hajime; Nishida, Taku; Furukawa, Yoshio; Shirayama, Takeshi; Tanaka, Mariko; Okajima, Katsunori; Yao, Takenori; Egami, Yasuyuki; Satomi, Kazuhiro; Noda, Takashi; Miyamoto, Koji; Haruna, Tetsuya; Kawaji, Tetsuma; Yoshizawa, Takashi; Toyota, Toshiaki; Yahata, Mitsuhiko; Nakai, Kentaro; Sugiyama, Hiroaki; Higashi, Yukei; Ito, Makoto; Horie, Minoru; Kusano, Kengo F; Shimizu, Wataru; Kamakura, Shiro; Kimura, Takeshi
2015-12-07
Most of recurrent atrial tachyarrhythmias after pulmonary vein isolation (PVI) for atrial fibrillation (AF) are due to reconnection of PVs. The aim of the present study was to evaluate whether elimination of adenosine triphosphate (ATP)-induced dormant PV conduction by additional energy applications during the first ablation procedure could reduce the incidence of recurrent atrial tachyarrhythmias. We randomly assigned 2113 patients with paroxysmal, persistent, or long-lasting AF to either ATP-guided PVI (1112 patients) or conventional PVI (1001 patients). The primary endpoint was recurrent atrial tachyarrhythmias lasting for >30 s or those requiring repeat ablation, hospital admission, or usage of Vaughan Williams class I or III antiarrhythmic drugs at 1 year with the blanking period of 90 days post ablation. Among patients assigned to ATP-guided PVI, 0.4 mg/kg body weight of ATP provoked dormant PV conduction in 307 patients (27.6%). Additional radiofrequency energy applications successfully eliminated dormant conduction in 302 patients (98.4%). At 1 year, 68.7% of patients in the ATP-guided PVI group and 67.1% of patients in the conventional PVI group were free from the primary endpoint, with no significant difference (adjusted hazard ratio [HR] 0.89; 95% confidence interval [CI] 0.74-1.09; P = 0.25). The results were consistent across all the prespecified subgroups. Also, there was no significant difference in the 1-year event-free rates from repeat ablation for any atrial tachyarrhythmia between the groups (adjusted HR 0.83; 95% CI 0.65-1.08; P = 0.16). In the catheter ablation for AF, we found no significant reduction in the 1-year incidence of recurrent atrial tachyarrhythmias by ATP-guided PVI compared with conventional PVI. Published on behalf of the European Society of Cardiology. All rights reserved. © The Author 2015. For permissions please email: journals.permissions@oup.com.
NASA Technical Reports Server (NTRS)
Picciolo, G. L.; Tuttle, S. A.; Schrock, C. G.; Deming, J. W.; Barza, M. J.; Wienstein, L.; Chappelle, E. W.
1977-01-01
The development of a rapid method for determining microbial susceptibilities to antibiotics using the firefly luciferase assay for adenosine triphosphate (ATP) is documented. The reduction of bacterial ATP by an antimicrobial agent was determined to be a valid measure of drug effect in most cases. The effect of 12 antibiotics on 8 different bacterial species gave a 94 percent correlation with the standard Kirby-Buer-Agar disc diffusion method. A 93 percent correlation was obtained when the ATP assay method was applied directly to 50 urine specimens from patients with urinary tract infections. Urine samples were centrifuged first to that bacterial pellets could be suspended in broth. No primary isolation or subculturing was required. Mixed cultures in which one species was predominant gave accurate results for the most abundant organism. Since the method is based on an increase in bacterial ATP with time, the presence of leukocytes did not interfere with the interpretation of results. Both the incubation procedure and the ATP assays are compatible with automation.
Pham, Xuan-Hung; Hahm, Eunil; Kim, Tae Han; Kim, Hyung-Mo; Lee, Sang Hun; Lee, Yoon-Sik; Jeong, Dae Hong; Jun, Bong-Hyun
2017-06-23
In this study, we prepared adenosine triphosphate (ATP) encapsulated liposomes, and assessed their applicability for the surface enhanced Raman scattering (SERS)-based assays with gold-silver alloy (Au@Ag)-assembled silica nanoparticles (NPs; SiO₂@Au@Ag). The liposomes were prepared by the thin film hydration method from a mixture of l-α-phosphatidylcholine, cholesterol, and PE-PEG2000 in chloroform; evaporating the solvent, followed by hydration of the resulting thin film with ATP in phosphate-buffered saline (PBS). Upon lysis of the liposome, the SERS intensity of the SiO₂@Au@Ag NPs increased with the logarithm of number of ATP-encapsulated liposomes after lysis in the range of 8 × 10⁶ to 8 × 10 10 . The detection limit of liposome was calculated to be 1.3 × 10 -17 mol. The successful application of ATP-encapsulated liposomes to SiO₂@Au@Ag NPs based SERS analysis has opened a new avenue for Raman label chemical (RCL)-encapsulated liposome-enhanced SERS-based immunoassays.
Suaebah, Evi; Naramura, Takuro; Myodo, Miho; Hasegawa, Masataka; Shoji, Shuichi; Buendia, Jorge J.; Kawarada, Hiroshi
2017-01-01
Here, we propose simple diamond functionalization by carboxyl termination for adenosine triphosphate (ATP) detection by an aptamer. The high-sensitivity label-free aptamer sensor for ATP detection was fabricated on nanocrystalline diamond (NCD). Carboxyl termination of the NCD surface by vacuum ultraviolet excimer laser and fluorine termination of the background region as a passivated layer were investigated by X-ray photoelectron spectroscopy. Single strand DNA (amide modification) was used as the supporting biomolecule to immobilize into the diamond surface via carboxyl termination and become a double strand with aptamer. ATP detection by aptamer was observed as a 66% fluorescence signal intensity decrease of the hybridization intensity signal. The sensor operation was also investigated by the field-effect characteristics. The shift of the drain current–drain voltage characteristics was used as the indicator for detection of ATP. From the field-effect characteristics, the shift of the drain current–drain voltage was observed in the negative direction. The negative charge direction shows that the aptamer is capable of detecting ATP. The ability of the sensor to detect ATP was investigated by fabricating a field-effect transistor on the modified NCD surface. PMID:28753998
Suaebah, Evi; Naramura, Takuro; Myodo, Miho; Hasegawa, Masataka; Shoji, Shuichi; Buendia, Jorge J; Kawarada, Hiroshi
2017-07-21
Here, we propose simple diamond functionalization by carboxyl termination for adenosine triphosphate (ATP) detection by an aptamer. The high-sensitivity label-free aptamer sensor for ATP detection was fabricated on nanocrystalline diamond (NCD). Carboxyl termination of the NCD surface by vacuum ultraviolet excimer laser and fluorine termination of the background region as a passivated layer were investigated by X-ray photoelectron spectroscopy. Single strand DNA (amide modification) was used as the supporting biomolecule to immobilize into the diamond surface via carboxyl termination and become a double strand with aptamer. ATP detection by aptamer was observed as a 66% fluorescence signal intensity decrease of the hybridization intensity signal. The sensor operation was also investigated by the field-effect characteristics. The shift of the drain current-drain voltage characteristics was used as the indicator for detection of ATP. From the field-effect characteristics, the shift of the drain current-drain voltage was observed in the negative direction. The negative charge direction shows that the aptamer is capable of detecting ATP. The ability of the sensor to detect ATP was investigated by fabricating a field-effect transistor on the modified NCD surface.
Identification of widespread adenosine nucleotide binding in Mycobacterium tuberculosis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ansong, Charles; Ortega, Corrie; Payne, Samuel H.
The annotation of protein function is almost completely performed by in silico approaches. However, computational prediction of protein function is frequently incomplete and error prone. In Mycobacterium tuberculosis (Mtb), ~25% of all genes have no predicted function and are annotated as hypothetical proteins. This lack of functional information severely limits our understanding of Mtb pathogenicity. Current tools for experimental functional annotation are limited and often do not scale to entire protein families. Here, we report a generally applicable chemical biology platform to functionally annotate bacterial proteins by combining activity-based protein profiling (ABPP) and quantitative LC-MS-based proteomics. As an example ofmore » this approach for high-throughput protein functional validation and discovery, we experimentally annotate the families of ATP-binding proteins in Mtb. Our data experimentally validate prior in silico predictions of >250 ATPases and adenosine nucleotide-binding proteins, and reveal 73 hypothetical proteins as novel ATP-binding proteins. We identify adenosine cofactor interactions with many hypothetical proteins containing a diversity of unrelated sequences, providing a new and expanded view of adenosine nucleotide binding in Mtb. Furthermore, many of these hypothetical proteins are both unique to Mycobacteria and essential for infection, suggesting specialized functions in mycobacterial physiology and pathogenicity. Thus, we provide a generally applicable approach for high throughput protein function discovery and validation, and highlight several ways in which application of activity-based proteomics data can improve the quality of functional annotations to facilitate novel biological insights.« less
Ghosh, Amrita; Shrivastav, Anupama; Jose, D Amilan; Mishra, Sanjiv K; Chandrakanth, C K; Mishra, Sandhya; Das, Amitava
2008-07-15
The chromogenic complex 1 x Zn (where 1 is (E)-4-(4-dimethylamino-phenylazo)-N,N-bispyridin-2-ylmethyl-benzenesulfonamide) showed high affinity toward the phosphate ion in tetrabutylammonium phosphate in acetonitrile solution and could preferentially bind to adenosine triphosphate (ATP) in aqueous solution at physiological pH. This binding caused a visual change in color, whereas no such change was noticed with other related anions (adenosine monophosphate, adenosine diphosphate, pyrophosphate, and phosphate) of biological significance. Thus, 1 x Zn could be used as a staining agent for different biological cells through binding to the ATP, generated in situ by the mitochondria (in eukaryotes). For prokaryotes (bacteria) the cell membrane takes care of the cells' energy conversion, since they lack mitochondria. ATP is produced in their unique cell structure on the cell membrane, which is not found in any eukaryotes. These stained cells could be viewed with normal light microscopy. This reagent could even be used for distinguishing the gram-positive and the gram-negative bacteria (prokaryotes). This dye was found to be nonlipophilic in nature and nontoxic to living microbes (eukaryotes and prokaryotes). Further, stained cells were found to grow in their respective media, and this confirmed the maintenance of viability of the microbes even after staining, unlike with many other dyes available commercially.
NASA Astrophysics Data System (ADS)
Tsyganov, M. M.; Ibragimova, M. K.; Karabut, I. V.; Freydin, M. B.; Choinzonov, E. L.; Litvyakov, N. V.
2015-11-01
Our previous research establishes that changes of expression of the ATP-binding cassette genes family is connected with the neoadjuvant chemotherapy effect. However, the mechanism of regulation of resistance gene expression remains unclear. As many researchers believe, single nucleotide polymorphisms can be involved in this process. Thereupon, microarray analysis is used to study polymorphisms in ATP-binding cassette genes. It is thus found that MDR gene expression is connected with 5 polymorphisms, i.e. rs241432, rs241429, rs241430, rs3784867, rs59409230, which participate in the regulation of expression of own genes.
Ribosome protection by antibiotic resistance ATP-binding cassette protein.
Su, Weixin; Kumar, Veerendra; Ding, Yichen; Ero, Rya; Serra, Aida; Lee, Benjamin Sian Teck; Wong, Andrew See Weng; Shi, Jian; Sze, Siu Kwan; Yang, Liang; Gao, Yong-Gui
2018-05-15
The ribosome is one of the richest targets for antibiotics. Unfortunately, antibiotic resistance is an urgent issue in clinical practice. Several ATP-binding cassette family proteins confer resistance to ribosome-targeting antibiotics through a yet unknown mechanism. Among them, MsrE has been implicated in macrolide resistance. Here, we report the cryo-EM structure of ATP form MsrE bound to the ribosome. Unlike previously characterized ribosomal protection proteins, MsrE is shown to bind to ribosomal exit site. Our structure reveals that the domain linker forms a unique needle-like arrangement with two crossed helices connected by an extended loop projecting into the peptidyl-transferase center and the nascent peptide exit tunnel, where numerous antibiotics bind. In combination with biochemical assays, our structure provides insight into how MsrE binding leads to conformational changes, which results in the release of the drug. This mechanism appears to be universal for the ABC-F type ribosome protection proteins. Copyright © 2018 the Author(s). Published by PNAS.
Zhang, Fang; Su, Xin; Huang, Gang; Xin, Xiao-Feng; Cao, E-Hong; Shi, Yi; Song, Yong
2017-01-01
Adenosine triphosphate (ATP) is a key mediator to alert the immune dysfunction by acting on P2 receptors. Here, we found that allergen challenge caused an increase of ATP secretion in a murine model of neutrophilic asthma, which correlated well with neutrophil counts and interleukin-17 production. When ATP signaling was blocked by intratracheal administration of the ATP receptor antagonist suramin before challenge, neutrophilic airway inflammation, airway hyperresponsiveness, and Th17-type responses were reduced significantly. Also, neutrophilic inflammation was abrogated when airway ATP levels were locally neutralized using apyrase. Furthermore, ATP promoted the Th17 polarization of splenic CD4 + T cells from DO11.10 mice in vitro. In addition, ovalbumin (OVA) challenge induced neutrophilic inflammation and Th17 polarization in DO11.10 mice, whereas administration of suramin before challenge alleviated these parameters. Thus, ATP may serve as a marker of neutrophilic asthma, and local blockade of ATP signaling might provide an alternative method to prevent Th17-mediated airway inflammation in neutrophilic asthma.
NASA Technical Reports Server (NTRS)
Vellend, H.; Tuttle, S. A.; Barza, M.; Weinstein, L.; Picciolo, G. L.; Chappelle, E. W.
1975-01-01
Luciferase assay for adenosine triphosphate (ATP) was optimized for pure bacteria in broth in order to evaluate if changes in bacterial ATP content could be used as a rapid measure of antibiotic effect on microorganisms. Broth cultures of log phase bacteria were incubated at 310 K (37 C) for 2.5 hours at antimicrobial concentrations which resulted in the best discrimination between sensitive and resistant strains. Eighty-seven strains of 11 bacterial species were studied for their susceptibility to 12 commonly used antimicrobial agents: ampicillin, Penicillin G, nafcillin, carbenicillin, cephalothin, tetracycline, erythromycin, clindamycin, gentamicin, nitrofurantoin, colistin, and chloramplenicol. The major advantage of the ATP system over existing methods of rapid microbial susceptibility testing is that the assay can be made specific for bacterial ATP.
Nakayama, Masafumi; Chikamori, Taishiro; Uchiyama, Takashi; Kimura, Yo; Hijikata, Nobuhiro; Ito, Ryosuke; Yuhara, Mikio; Sato, Hideaki; Kobori, Yuichi; Yamashina, Akira
2018-04-01
We investigated the effects of caffeine intake on fractional flow reserve (FFR) values measured using intravenous adenosine triphosphate (ATP) before cardiac catheterization. Caffeine is a competitive antagonist for adenosine receptors; however, it is unclear whether this antagonism affects FFR values. Patients were evenly randomized into 2 groups preceding the FFR study. In the caffeine group (n = 15), participants were given coffee containing 222 mg of caffeine 2 h before the catheterization. In the non-caffeine group (n = 15), participants were instructed not to take any caffeine-containing drinks or foods for at least 12 h before the catheterization. FFR was performed in patients with more than intermediate coronary stenosis using the intravenous infusion of ATP at 140 μg/kg/min (normal dose) and 170 μg/kg/min (high dose), and the intracoronary infusion of papaverine. FFR was followed for 30 s after maximal hyperemia. In the non-caffeine group, the FFR values measured with ATP infusion were not significantly different from those measured with papaverine infusion. However, in the caffeine group, the FFR values were significantly higher after ATP infusion than after papaverine infusion (P = 0.002 and P = 0.007, at normal and high dose ATP vs. papaverine, respectively). FFR values with ATP infusion were significantly increased 30 s after maximal hyperemia (P = 0.001 and P < 0.001 for normal and high dose ATP, respectively). The stability of the FFR values using papaverine showed no significant difference between the 2 groups. Caffeine intake before the FFR study affected FFR values and their stability. These effects could not be reversed by an increased ATP dose.
Chen, Lifen; Chen, Zhong-Ning
2015-01-01
A multifunctional label-free biosensor for the detection of Hg(2+), adenosine triphosphate and thrombin has been developed based on the changing of the electrochemical impedance spectroscopy (EIS) from the modified electrodes when nucleic acid subunits interacting with different targets. The modified electrode consists of three interaction sections, including DNA with T-T mismatch recognizing Hg(2+) to form T-Hg(2+)-T complex, split DNA chip against ATP, and DNA domin against thrombin to form G-quadruplex. Upon DNA interaction with thrombin or ATP, an increased charge transfer resistance (Rct) had been detected. However, a decreased Rct against Hg(2+) was obtained. The Rct difference (ΔRct) has relationship with the concentration of the different targets, Hg(2+), ATP and thrombin can be selectively detected with the detection limit of 0.03, 0.25, and 0.20 nmol L(-1), respectively. To separately detect the three analytes existing in the same sample, ATP aptamer, G-rich DNA strands and EDTA were applied to mask ATP, Hg(2+) or thrombin separately. Copyright © 2014 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jastrab, Jordan B.; Wang, Tong; Murphy, J. Patrick
Mycobacterium tuberculosis encodes a proteasome that is highly similar to eukaryotic proteasomes and is required to cause lethal infections in animals. The only pathway known to target proteins for proteasomal degradation in bacteria is pupylation, which is functionally analogous to eukaryotic ubiquitylation. However, evidence suggests that the M. tuberculosis proteasome contributes to pupylation-independent pathways as well. To identify new proteasome cofactors that might contribute to such pathways, we isolated proteins that bound to proteasomes overproduced in M. tuberculosis and found a previously uncharacterized protein, Rv3780, which formed rings and capped M. tuberculosis proteasome core particles. Rv3780 enhanced peptide and proteinmore » degradation by proteasomes in an adenosine triphosphate (ATP)-independent manner. We identified putative Rv3780-dependent proteasome substrates and found that Rv3780 promoted robust degradation of the heat shock protein repressor, HspR. Importantly, an M. tuberculosis Rv3780 mutant had a general growth defect, was sensitive to heat stress, and was attenuated for growth in mice. Collectively, these data demonstrate that ATP-independent proteasome activators are not confined to eukaryotes and can contribute to the virulence of one the world’s most devastating pathogens.« less
Cutarelli, Alessandro; Marini, Mario; Tancredi, Virginia; D'Arcangelo, Giovanna; Murdocca, Michela; Frank, Claudio; Tarantino, Umberto
2016-05-01
In the last years adenosine triphosphate (ATP) and subsequent purinergic system activation through P2 receptors were investigated highlighting their pivotal role in bone tissue biology. In osteoblasts ATP can regulate several activities like cell proliferation, cell death, cell differentiation and matrix mineralization. Since controversial results exist, in this study we analyzed the ATP effects on differentiation and mineralization in human osteoblast-like Saos-2 cells. We showed for the first time the altered functional activity of ATP receptors. Despite that, we found that ATP can reduce cell proliferation and stimulate osteogenic differentiation mainly in the early stages of in vitro maturation as evidenced by the enhanced expression of alkaline phosphatase (ALP), Runt-related transcription factor 2 (Runx2) and Osteocalcin (OC) genes and by the increased ALP activity. Moreover, we found that ATP can affect mineralization in a biphasic manner, at low concentrations ATP always increases mineral deposition while at high concentrations it always reduces mineral deposition. In conclusion, we show the osteogenic effect of ATP on both early and late stage activities like differentiation and mineralization, for the first time in human osteoblastic cells. © 2016 Japanese Society of Developmental Biologists.
Jastrab, Jordan B.; Wang, Tong; Murphy, J. Patrick; ...
2015-03-23
Mycobacterium tuberculosis encodes a proteasome that is highly similar to eukaryotic proteasomes and is required to cause lethal infections in animals. The only pathway known to target proteins for proteasomal degradation in bacteria is pupylation, which is functionally analogous to eukaryotic ubiquitylation. However, evidence suggests that the M. tuberculosis proteasome contributes to pupylation-independent pathways as well. To identify new proteasome cofactors that might contribute to such pathways, we isolated proteins that bound to proteasomes overproduced in M. tuberculosis and found a previously uncharacterized protein, Rv3780, which formed rings and capped M. tuberculosis proteasome core particles. Rv3780 enhanced peptide and proteinmore » degradation by proteasomes in an adenosine triphosphate (ATP)-independent manner. We identified putative Rv3780-dependent proteasome substrates and found that Rv3780 promoted robust degradation of the heat shock protein repressor, HspR. Importantly, an M. tuberculosis Rv3780 mutant had a general growth defect, was sensitive to heat stress, and was attenuated for growth in mice. Collectively, these data demonstrate that ATP-independent proteasome activators are not confined to eukaryotes and can contribute to the virulence of one the world’s most devastating pathogens.« less
Naguib, Fardos N. M.; Rais, Reem H.; Al Safarjalani, Omar N.; el Kouni, Mahmoud H.
2015-01-01
Toxoplasma gondii has an extraordinarily ability to utilize adenosine (Ado) as the primary source of all necessary purines in this parasite which lacks de novo purine biosynthesis. The activity of T. gondii adenosine kinase (TgAK, EC 2.7.1.20) is responsible for this efficient salvage of Ado in T. gondii. To fully understand this remarkable efficiency of TgAK in the utilization of Ado, complete kinetic parameters of this enzyme are necessary. Initial velocity and product inhibition studies of TgAK demonstrated that the basic mechanism of this enzyme is a hybrid random bi-uni ping-pong uni-bi. Initial velocity studies showed an intersecting pattern, consistent with substrate-enzyme-co-substrate complex formation and a binding pattern indicating that binding of the substrate interferes with the binding of the co-substrate and vice versa. Estimated kinetic parameters were KAdo = 0.002 ± 0.0002 mM, KATP = 0.05 ± 0.008 mM, and Vmax = 920 ± 35 μmol/min/mg protein. Ado exhibited substrate inhibition suggesting the presence of more than one binding site for Ado on the enzyme. ATP relieved substrate inhibition by Ado. Thus, Ado also binds to the ATP binding site. AMP was competitive with ATP, inferring that AMP binds to the same site as ATP. AMP, ADP and ATP were non-competitive with Ado, therefore, none of these nucleotides binds to the Ado binding site. Combining ATP with ADP was additive. Therefore, the binding of either ATP or ADP does not interfere with the binding of the other. It is concluded that for every ATP consumed, TgAK generates three new AMPs. These findings along with the fact that a wide range of nucleoside 5′-mono, di, and triphosphates could substitute for ATP as phosphate donors in this reaction may explain the efficient and central role played by TgAK in the utilization of Ado as the major source from which all other purines can be synthesized in T. gondii. PMID:26112826
Li, Dapeng; Zhang, Longteng; Song, Sijia; Wang, Zhiying; Kong, Chunli; Luo, Yongkang
2017-06-01
Biochemical and microbial changes after harvest strongly affect the final quality and shelf life of fish and fish products. In this study, the role of microbes in the degradation of adenosine triphosphate (ATP), and the origin of adenosine monophosphate deaminase (AMPD) and acid phosphatase (ACP) in common carp fillets during different stages of chilled storage (at 4°C) were investigated. The content of ATP, ADP, AMP, IMP, HxR, and Hx, the activity of AMPD and ACP, and the total count of viable, Aeromonas, Pseudomonas, H 2 S-producing bacteria, and lactic acid bacteria were examined. Results indicated that the population of microbial communities in control samples increased with storage time, and Pseudomonas peaked on the 10th day of storage. Changes in AMPD activity were less related to the abundance of microbes during the entire storage period. However, ACP was derived from both fish muscle and microbial secretion during the middle and late stages of storage. Degradation of ATP to IMP was not affected by spoilage bacteria, but the hydrolysis of IMP, and the transformation of HxR to Hx was affected considerably by the spoilage bacteria. Copyright © 2016 Elsevier Ltd. All rights reserved.
Olafsdottir, Lovisa B; Wright, Sharon B; Smithey, Anne; Heroux, Riley; Hirsch, Elizabeth B; Chen, Alice; Lane, Benjamin; Sawhney, Mandeep S; Snyder, Graham M
2017-06-01
OBJECTIVE The aim of this study was to quantify the correlation between adenosine triphosphate (ATP) measurements and bacterial cultures from duodenoscopes for evaluation of contamination following high-level disinfection. DESIGN Duodenoscopes used for any intended endoscopic retrograde cholangiopancreatography (ERCP) procedure were included. Microbiologic and ATP data were collected concomitantly and in the same manner from ERCP duodenoscopes. SETTING A high-volume endoscopy unit at a tertiary referral acute-care facility. METHODS Duodenoscopes were sampled for ATP and bacterial contamination in a contemporaneous and highly standardized fashion using a "flush-brush-flush" method for the working channel (WC) and a dry flocked swab for the elevator mechanism (EM). Specimens were processed for any aerobic bacterial growth (colony-forming units, CFU). Growth of CFU>0 and ATP relative light unit (RLU)>0 was considered a contaminated result. Frequency of discord between among WC and EM measurements were calculated using 2×2 contingency tables. The Spearman correlation coefficient was used to calculate the relatedness of bacterial contamination and ATP as continuous measurements. RESULTS The Spearman correlation coefficient did not demonstrate significant relatedness between ATP and CFU for either a WC or EM site. Among 390 duodenoscope sampling events, ATP and CFU assessments of contamination were discordant in 82 of 390 WC measurements (21%) and 331 of 390 of EM measurements (84.9%). The EM was frequently and markedly positive by ATP measurement. CONCLUSION ATP measurements correlate poorly with a microbiologic standard assessing duodenoscope contamination, particularly for EM sampling. ATP may reflect biological material other than nonviable aerobic bacteria and may not serve as an adequate marker of bacterial contamination. Infect Control Hosp Epidemiol 2017;38:678-684.
Adenosine triphosphate inhibits melatonin synthesis in the rat pineal gland.
Souza-Teodoro, Luis Henrique; Dargenio-Garcia, Letícia; Petrilli-Lapa, Camila Lopes; Souza, Ewerton da Silva; Fernandes, Pedro A C M; Markus, Regina P; Ferreira, Zulma S
2016-03-01
Adenosine triphosphate (ATP) is released onto the pinealocyte, along with noradrenaline, from sympathetic neurons and triggers P2Y1 receptors that enhance β-adrenergic-induced N-acetylserotonin (NAS) synthesis. Nevertheless, the biotransformation of NAS into melatonin, which occurs due to the subsequent methylation by acetylserotonin O-methyltransferase (ASMT; EC 2.1.1.4), has not yet been evaluated in the presence of purinergic stimulation. We therefore evaluated the effects of purinergic signaling on melatonin synthesis induced by β-adrenergic stimulation. ATP increased NAS levels, but, surprisingly, inhibited melatonin synthesis in an inverse, concentration-dependent manner. Our results demonstrate that enhanced NAS levels, which depend on phospholipase C (PLC) activity (but not the induction of gene transcription), are a post-translational effect. By contrast, melatonin reduction is related to an ASMT inhibition of expression at both the gene transcription and protein levels. These results were independent of nuclear factor-kappa B (NF-kB) translocation. Neither the P2Y1 receptor activation nor the PLC-mediated pathway was involved in the decrease in melatonin, indicating that ATP regulates pineal metabolism through different mechanisms. Taken together, our data demonstrate that purinergic signaling differentially modulates NAS and melatonin synthesis and point to a regulatory role for ATP as a cotransmitter in the control of ASMT, the rate-limiting enzyme in melatonin synthesis. The endogenous production of melatonin regulates defense responses; therefore, understanding the mechanisms involving ASMT regulation might provide novel insights into the development and progression of neurological disorders since melatonin presents anti-inflammatory, neuroprotective, and neurogenic effects. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Long, Gong; Zhang, Guo Qiang
2014-12-01
Functional exercise after total knee arthroplasty (TKA) is necessary. However, it may be a difficult and painful process for the patient. Desirable methods of relieving the patient's pain are worth exploring. Oral supplement of adenosine triphosphate (ATP) is a potential option. In the present study, we decide to investigate whether short-term administration of ATP benefits patients undergoing TKA. A total of 244 subjects were randomized to receive 120mg ATP or placebo each day for 4weeks. Significant differences in quadriceps strength, pain scores at postoperative days 7, 14, 21, and 28 and total opioid consumption were detected. It follows that oral supplement of ATP could benefit patients recovering from TKA. Copyright © 2014 Elsevier Inc. All rights reserved.
A High Affinity Adenosine Kinase from Anopheles gambiae
Cassera, María B.; Ho, Meng-Chiao; Merino, Emilio F.; Burgos, Emmanuel S.; Rinaldo-Matthis, Agnes; Almo, Steven C.; Schramm, Vern L.
2011-01-01
Genome analysis revealed a mosquito orthologue of adenosine kinase in Anopheles gambiae (AgAK; the most important vector for the transmission of Plasmodium falciparum in Africa). P. falciparum are purine auxotrophs and do not express an adenosine kinase but rely on their hosts for purines. AgAK was kinetically characterized and found to have the highest affinity for adenosine (Km 8.1 nM) of any known adenosine kinase. AgAK is specific for adenosine at the nucleoside site but several nucleotide triphosphate phosphoryl donors are tolerated. The AgAK crystal structure with a bound bisubstrate analogue Ap4A (2.0 Å resolution) reveals interactions for adenosine, ATP and the geometry for phosphoryl transfer. The polyphosphate charge is partly neutralized by a bound Mg2+ ion and an ion pair to a catalytic site Arg. The AgAK structure consists of a large catalytic core in a three-layered α/β/α sandwich, and a small cap domain in contact with adenosine. The specificity and tight-binding for adenosine arises from hydrogen bond interactions of Asn14, Leu16, Leu40, Leu133, Leu168, Phe168 and Thr171 and the backbone of Ile39 and Phe168 with the adenine ring as well as through hydrogen bond interactions between Asp18, Gly64 and Asn68 and the ribosyl 2′- and 3′-hydroxyl groups. The structure is more similar to human adenosine kinase (48% identity) than to AK from Toxoplasma gondii (31% identity). With this extraordinary affinity for AgAK, adenosine is efficiently captured and converted to AMP at near the diffusion limit, suggesting an important role of this enzyme to maintain the adenine nucleotide pool. mRNA analysis verifies that AgAK transcripts are produced in the adult insects. PMID:21247194
A High-Affinity Adenosine Kinase from Anopheles Gambiae
DOE Office of Scientific and Technical Information (OSTI.GOV)
M Cassera; M Ho; E Merino
2011-12-31
Genome analysis revealed a mosquito orthologue of adenosine kinase in Anopheles gambiae (AgAK; the most important vector for the transmission of Plasmodium falciparum in Africa). P. falciparum are purine auxotrophs and do not express an adenosine kinase but rely on their hosts for purines. AgAK was kinetically characterized and found to have the highest affinity for adenosine (K{sub m} = 8.1 nM) of any known adenosine kinase. AgAK is specific for adenosine at the nucleoside site, but several nucleotide triphosphate phosphoryl donors are tolerated. The AgAK crystal structure with a bound bisubstrate analogue Ap{sub 4}A (2.0 {angstrom} resolution) reveals interactionsmore » for adenosine and ATP and the geometry for phosphoryl transfer. The polyphosphate charge is partly neutralized by a bound Mg{sup 2+} ion and an ion pair to a catalytic site Arg. The AgAK structure consists of a large catalytic core in a three-layer {alpha}/{beta}/{alpha} sandwich, and a small cap domain in contact with adenosine. The specificity and tight binding for adenosine arise from hydrogen bond interactions of Asn14, Leu16, Leu40, Leu133, Leu168, Phe168, and Thr171 and the backbone of Ile39 and Phe168 with the adenine ring as well as through hydrogen bond interactions between Asp18, Gly64, and Asn68 and the ribosyl 2'- and 3'-hydroxyl groups. The structure is more similar to that of human adenosine kinase (48% identical) than to that of AK from Toxoplasma gondii (31% identical). With this extraordinary affinity for AgAK, adenosine is efficiently captured and converted to AMP at near the diffusion limit, suggesting an important role for this enzyme in the maintenance of the adenine nucleotide pool. mRNA analysis verifies that AgAK transcripts are produced in the adult insects.« less
How Native and Alien Metal Cations Bind ATP: Implications for Lithium as a Therapeutic Agent
NASA Astrophysics Data System (ADS)
Dudev, Todor; Grauffel, Cédric; Lim, Carmay
2017-02-01
Adenosine triphosphate (ATP), the major energy currency of the cell, exists in solution mostly as ATP-Mg. Recent experiments suggest that Mg2+ interacts with the highly charged ATP triphosphate group and Li+ can co-bind with the native Mg2+ to form ATP-Mg-Li and modulate the neuronal purine receptor response. However, it is unclear how the negatively charged ATP triphosphate group binds Mg2+ and Li+ (i.e. which phosphate group(s) bind Mg2+/Li+) and how the ATP solution conformation depends on the type of metal cation and the metal-binding mode. Here, we reveal the preferred ATP-binding mode of Mg2+/Li+ alone and combined: Mg2+ prefers to bind ATP tridentately to each of the three phosphate groups, but Li+ prefers to bind bidentately to the terminal two phosphates. We show that the solution ATP conformation depends on the cation and its binding site/mode, but it does not change significantly when Li+ binds to Mg2+-loaded ATP. Hence, ATP-Mg-Li, like Mg2+-ATP, can fit in the ATP-binding site of the host enzyme/receptor, activating specific signaling pathways.
A Small Aptamer with Strong and Specific Recognition of the Triphosphate of ATP
Sazani, Peter L.; Larralde, Rosa
2004-01-01
We report the in vitro selection of an RNA-based ATP aptamer with the ability to discriminate between adenosine ligands based on their 5‘ phosphorylation state. Previous selection of ATP aptamers yielded molecules that do not significantly discriminate between ligands at the 5‘ position. By applying a selective pressure that demands recognition of the 5‘ triphosphate, we obtained an aptamer that binds to ATP with a Kd of approximately 5 μM, and to AMP with a Kd of approximately 5.5 mM, a difference of 1100-fold. This aptamer demonstrates the ability of small RNAs to interact with negatively charged moieties. PMID:15237981
Lin, Jia-Hui; Yang, Ya-Chun; Shih, Ya-Chen; Hung, Szu-Ying; Lu, Chi-Yu; Tseng, Wei-Lung
2016-03-15
Fluorescent boron dipyrromethene (BODIPY) analogs are often used as sensors for detecting various species because of their relatively high extinction coefficients, outstanding fluorescence quantum yields, photostability, and pH-independent fluorescence. However, there is little-to-no information in the literature that describes the use of BODIPY analogs for detecting alkaline phosphatase (ALP) activity and inhibition. This study discovered that the fluorescence of BODIPY-conjugated adenosine triphosphate (BODIPY-ATP) was quenched by Fe(III) ions through photoinduced electron transfer. The ALP-catalyzed hydrolysis of BODIPY-ATP resulted in the formation of BODIPY-adenosine and phosphate ions. The fluorescence of the generated BODIPY-adenosine was insensitive to the change in the concentration of Fe(III) ions. Thus, the Fe(III)-induced fluorescence quenching of BODIPY-ATP can be paired with its ALP-mediated dephosphorylation to design a turn-on fluorescence probe for ALP sensing. A method detection limit at a signal-to-noise ratio of 3 for ALP was estimated to be 0.02 units/L (~6 pM; 1 ng/mL). This probe was used for the screening of ALP inhibitors, including Na3VO4, imidazole, and arginine. Because ALP is widely used in enzyme-linked immunosorbent assays, the probe was coupled to an ALP-linked immunosorbent assay for the sensitive and selective detection of immunoglobulin G (IgG). The lowest detectable concentration for IgG in this system was 5 ng/mL. Compared with the use of 3,6-fluorescein diphosphate as a signal reporter in an ALP-linked immunosorbent assay, the proposed system provided comparable sensitivity, large linear range, and high stability over temperature and pH changes. Copyright © 2015 Elsevier B.V. All rights reserved.
Wang, Dongmei; Xiao, Xiaoqing; Xu, Shen; Liu, Yong; Li, Yongxin
2018-01-15
In this work, single Au nanowire electrodes (AuNWEs) were fabricated by laser-assisted pulling/hydrofluoric acid (HF) etching process, which then were characterized by transmission electron microscopy (TEM), electrochemical method and finite-element simulation. The as-prepared single AuNWEs were used to construct electrochemical aptamer-based nanosensors (E-AB nanosensors) based on the formation of Au-S bond that duplex DNA tagged with methylene blue (MB) was modified on the surface of electrode. In the presence of adenosine triphosphate (ATP), the MB-labeled aptamer dissociated from the duplex DNA due to the strong specific affinity between aptamer and target, which lead to the reduction of MB electrochemical signals. Moreover, BSA was employed to further passivate electrode surface bonding sites for the stable of the sensor. The as-prepared E-AB nanosensor has been used for ATP assay with excellent sensitivity and selectivity, even in a complex system like cerebrospinal fluid of rat brain. Considering the unique properties of good stability, larger surface area and smaller overall dimensions, this E-AB nanosensor should be an ideal platform for widely sensing applications in living bio-system. Copyright © 2017 Elsevier B.V. All rights reserved.
Monitoring of endoscope reprocessing with an adenosine triphosphate (ATP) bioluminescence method.
Parohl, Nina; Stiefenhöfer, Doris; Heiligtag, Sabine; Reuter, Henning; Dopadlik, Dana; Mosel, Frank; Gerken, Guido; Dechêne, Alexander; Heintschel von Heinegg, Evelyn; Jochum, Christoph; Buer, Jan; Popp, Walter
2017-01-01
Background: The arising challenges over endoscope reprocessing quality proposes to look for possibilities to measure and control the process of endoscope reprocessing. Aim: The goal of this study was to evaluate the feasibility of monitoring endoscope reprocessing with an adenosine triphosphate (ATP) based bioluminescence system. Methods: 60 samples of eight gastroscopes have been assessed from routine clinical use in a major university hospital in Germany. Endoscopes have been assessed with an ATP system and microbial cultures at different timepoints during the reprocessing. Findings: After the bedside flush the mean ATP level in relative light units (RLU) was 19,437 RLU, after the manual cleaning 667 RLU and after the automated endoscope reprocessor (AER) 227 RLU. After the manual cleaning the mean total viable count (TVC) per endoscope was 15.3 CFU/10 ml, and after the AER 5.7 CFU/10 ml. Our results show that there are reprocessing cycles which are not able to clean a patient used endoscope. Conclusion: Our data suggest that monitoring of flexible endoscope with ATP can identify a number of different influence factors, like the endoscope condition and the endoscopic procedure, or especially the quality of the bedside flush and manual cleaning before the AER. More process control is one option to identify and improve influence factors to finally increase the overall reprocessing quality, best of all by different methods. ATP measurement seems to be a valid technique that allows an immediate repeat of the manual cleaning if the ATP results after manual cleaning exceed the established cutoff of 200 RLU.
Wang, Xu-Zhen; Jin, Zhan-Kui; Tian, Xiao-Hui; Xue, Wu-Jun; Tian, Pu-Xun; Ding, Xiao-Ming; Zheng, Jin; Li, Yang; Jing, Xin; Luo, Zi-Zhen
2014-01-01
Peripheral blood CD4+ T cell adenosine triphosphate (ATP) release has been reported to be an adjunct tool to evaluate global cellular immune response in solid-organ transplant recipients. However, the correlation between the ATP level and rejection was controversial. The aim of this prospective clinical study was to explore the association between the intracellular ATP level and the occurrence, progression, and treatment of acute rejection (AR) episodes, determine the predicting value of intracellular ATP level for AR in kidney transplant (KT) recipients. In the period of October 2011 to October 2012, 140 KT recipients were recruited and followed for six months after transplantation. Patients were categorized into stable group and AR group according to their clinical course. Whole blood samples were collected pretransplantation, and at 7, 14, 21, and 28days, and at 2, 3, 4, 5 and 6months post-transplantation. Additional blood samples were obtained from AR patients on the day AR occurred, on the day before and 3 and 7days after intravenous anti-rejection therapy started, and on the day when AR reversed. The intracellular ATP in CD4+ T cells was detected by ImmuKnow Immune Cell Function Assay according to the manufacturer's instruction. The absolute number of CD4+ T cells and the trough levels of tacrolimus and cyclosporine were also measured. The ATP level detected on the day AR occurred (627.07±149.85ng/ml) was obviously higher than that of the stable group (320.48±149.11ng/ml, P<0.05). ATP value decreased to 265.35±84.33ng/m at the end of anti-rejection therapy, which was obviously lower than that measured on the day before the anti-rejection therapy started (665.87±162.85ng/ml, P<0.05). ROC analysis revealed that increased intracellular adenosine triphosphate level showed better sensitivity and specificity than those obtained using single time point detection (89.5% vs 85.0%;95.0% vs 88.9%). The best cutoff value was 172.55ng/ml. A positive correlation
Wu, Jian; Jones, John M; Nguyen-Huu, Xuong; Ten Eyck, Lynn F; Taylor, Susan S
2004-06-01
Cyclic adenosine 5'-monophosphate (cAMP) is an ancient signaling molecule, and in vertebrates, a primary target for cAMP is cAMP-dependent protein kinase (PKA). (R(p))-adenosine 3',5'-cyclic monophosphothioate ((R(p))-cAMPS) and its analogues are the only known competitive inhibitors and antagonists for cAMP activation of PKA, while (S(p))-adenosine 3',5'-cyclic monophosphothioate ((S(p))-cAMPS) functions as an agonist. The crystal structures of a Delta(1-91) deletion mutant of the RIalpha regulatory subunit of PKA bound to (R(p))-cAMPS and (S(p))-cAMPS were determined at 2.4 and 2.3 A resolution, respectively. While the structures are similar to each other and to the crystal structure of RIalpha bound to cAMP, differences in the dynamical properties of the protein when (R(p))-cAMPS is bound are apparent. The structures highlight the critical importance of the exocyclic oxygen's interaction with the invariant arginine in the phosphate binding cassette (PBC) and the importance of this interaction for the dynamical properties of the interactions that radiate out from the PBC. The conformations of the phosphate binding cassettes containing two invariant arginine residues (Arg209 on domain A, and Arg333 on domain B) are somewhat different due to the sulfur interacting with this arginine. Furthermore, the B-site ligand together with the entire domain B show significant differences in their overall dynamic properties in the crystal structure of Delta(1-91) RIalpha complexed with (R(p))-cAMPS phosphothioate analogue ((R(p))-RIalpha) compared to the cAMP- and (S(p))-cAMPS-bound type I and II regulatory subunits, based on the temperature factors. In all structures, two structural solvent molecules exist within the A-site ligand binding pocket; both mediate water-bridged interactions between the ligand and the protein. No structured waters are in the B-site pocket. Owing to the higher resolution data, the N-terminal segment (109-117) of the RIalpha subunit can also be traced
Nucleotide-dependent bisANS binding to tubulin.
Chakraborty, S; Sarkar, N; Bhattacharyya, B
1999-07-13
Non-covalent hydrophobic probes such as 5, 5'-bis(8-anilino-1-naphthalenesulfonate) (bisANS) have become increasingly popular to gain information about protein structure and conformation. However, there are limitations as bisANS binds non-specifically at multiple sites of many proteins. Successful use of this probe depends upon the development of binding conditions where only specific dye-protein interaction will occur. In this report, we have shown that the binding of bisANS to tubulin occurs instantaneously, specifically at one high affinity site when 1 mM guanosine 5'-triphosphate (GTP) is included in the reaction medium. Substantial portions of protein secondary structure and colchicine binding activity of tubulin are lost upon bisANS binding in absence of GTP. BisANS binding increases with time and occurs at multiple sites in the absence of GTP. Like GTP, other analogs, guanosine 5'-diphosphate, guanosine 5'-monophosphate and adenosine 5'-triphosphate, also displace bisANS from the lower affinity sites of tubulin. We believe that these multiple binding sites are generated due to the bisANS-induced structural changes on tubulin and the presence of GTP and other nucleotides protect those structural changes.
Behavior and stability of adenosine triphosphate (ATP) during chlorine disinfection.
Nescerecka, Alina; Juhna, Talis; Hammes, Frederik
2016-09-15
Adenosine triphosphate (ATP) analysis is a cultivation-independent alternative method for the determination of bacterial viability in both chlorinated and non-chlorinated water. Here we investigated the behavior and stability of ATP during chlorination in detail. Different sodium hypochlorite doses (0-22.4 mg-Cl2 L(-1); 5 min exposure) were applied to an Escherichia coli pure culture suspended in filtered river water. We observed decreasing intracellular ATP with increasing chlorine concentrations, but extracellular ATP concentrations only increased when the chlorine dose exceeded 0.35 mg L(-1). The release of ATP from chlorine-damaged bacteria coincided with severe membrane damage detected with flow cytometry (FCM). The stability of extracellular ATP was subsequently studied in different water matrixes, and we found that extracellular ATP was stable in sterile deionized water and also in chlorinated water until extremely high chlorine doses (≤11.2 mg-Cl2 L(-1); 5 min exposure). In contrast, ATP decreased relatively slowly (k = 0.145 h(-1)) in 0.1 μm filtered river water, presumably due to degradation by either extracellular enzymes or the fraction of bacteria that were able to pass through the filter. Extracellular ATP decreased considerably faster (k = 0.368 h(-1)) during batch growth of a river water bacterial community. A series of growth potential tests showed that extracellular ATP molecules were utilized as a phosphorus source during bacteria proliferation. From the combined data we conclude that ATP released from bacteria at high chlorine doses could promote bacteria regrowth, contributing to biological instability in drinking water distribution systems. Copyright © 2016 Elsevier Ltd. All rights reserved.
Snell, C. R.; Snell, P. H.
1984-01-01
We have demonstrated high affinity diazepam binding sites of the Ro5-4864 benzodiazepine receptor subtype on 108CC15 neuroblastoma X glioma hybrid cells. These cells were previously shown to have purinoceptors of the A2 adenosine subtype and we have now found that [3H]-adenosine can be displaced from this binding site by the benzodiazepines and related compounds that can also bind to the Ro5-4864 site. Diazepam was found to have no intrinsic activity at the A2-receptor as measured by the stimulation of adenosine 3':5'-cyclic monophosphate (cyclic AMP) production in this cell line. At concentrations sufficient to compete for the A2-receptor, diazepam was shown to facilitate, by approximately 2 fold, the stimulation of cyclic AMP by adenosine. These effects are not due to inhibition of adenosine uptake or phosphodiesterase activity, but are probably a consequence of modulation of the coupling of the A2-receptor to cyclic AMP production in this hybrid cell line. PMID:6150742
Peroxisomal ATP-binding cassette transporters form mainly tetramers
Geillon, Flore; Gondcaille, Catherine; Raas, Quentin; Dias, Alexandre M. M.; Pecqueur, Delphine; Truntzer, Caroline; Lucchi, Géraldine; Ducoroy, Patrick; Falson, Pierre; Savary, Stéphane; Trompier, Doriane
2017-01-01
ABCD1 and its homolog ABCD2 are peroxisomal ATP-binding cassette (ABC) half-transporters of fatty acyl-CoAs with both distinct and overlapping substrate specificities. Although it is established that ABC half-transporters have at least to dimerize to generate a functional unit, functional equivalents of tetramers (i.e. dimers of full-length transporters) have also been reported. However, oligomerization of peroxisomal ABCD transporters is incompletely understood but is of potential significance because more complex oligomerization might lead to differences in substrate specificity. In this work, we have characterized the quaternary structure of the ABCD1 and ABCD2 proteins in the peroxisomal membrane. Using various biochemical approaches, we clearly demonstrate that both transporters exist as both homo- and heterotetramers, with a predominance of homotetramers. In addition to tetramers, some larger molecular ABCD assemblies were also found but represented only a minor fraction. By using quantitative co-immunoprecipitation assays coupled with tandem mass spectrometry, we identified potential binding partners of ABCD2 involved in polyunsaturated fatty-acid metabolism. Interestingly, we identified calcium ATPases as ABCD2-binding partners, suggesting a role of ABCD2 in calcium signaling. In conclusion, we have shown here that ABCD1 and its homolog ABCD2 exist mainly as homotetramers in the peroxisomal membrane. PMID:28258215
Villanueva, Ariadna; Guanche, Humberto
2016-11-01
Aim To describe the effect of education on environmental cleaning in patient care areas using adenosine triphosphate (ATP) readings. Method A quality improvement initiative was developed in a community hospital in Qatar. Over a two-month period, an infection-control practitioner monitored ATP readings in patient care areas, at any time and regardless of the time of the previous disinfection. The initiative included staff education, use of ATP readings and the drawing up of quarterly quality reports. The ATP readings were considered 'pass', meaning well cleaned, or 'fail', meaning non-cleaned, according to the following standards:>250 relative light units (RLU) in non-critical units and<200RLU for critical units. The proportion of test passes was calculated per 100 tests performed. Results A total of 1,617 tests were performed, after which 1,259 (78%) surfaces were identified as well cleaned. The lowest proportion of non-pass and higher ATP readings was observed in non-critical areas. The test points with the lowest proportion of passes were telephones (40.5%), a medication dispensing system (58.5%), an oximeter (66.7%) and callbox buttons (67.6%). A sustained increase in test passes was observed during the study period. Conclusion There was an improvement in environmental cleaning due to monitoring of ATP on surfaces and staff education.
Zhang, Xiaoyu; Song, Chunxia; Yang, Ke; Hong, Wenwen; Lu, Ying; Yu, Ping; Mao, Lanqun
2018-04-17
Electrochemical aptasensors generally include three elements, that is, recognition element, signal-transformation element, and regeneration element. In this study, a new adenosine triphosphate (ATP) aptasensor is developed by combining three elements into one DNA oligonucleotide chain. In the DNA oligonucleotide chain, DNA aptamer is used as the recognition element, ferrocene group attached at the 3'-end of the aptamer is used as the signal-transformation element, and azobenzene moiety embedded into the DNA chain is used as the regeneration element. In addition to the similar analytical properties with the traditional ones, the aptasensor developed here is easily regenerated with UV-light irradiation. The current response recorded on the aptasensor increases with increasing the concentration of ATP in the incubation solution and is linear with the logarithm of ATP concentration in the range from 1 nM to 100 μM. The limit of detection is 0.5 nM (S/N = 3). The basal level of ATP in the rat brain cortex microdialysate is determined to be 21.33 ± 4.1 nM ( n = 3). After being challenged with ATP, the aptasensor could be readily regenerated by UV-light irradiation for more than seven cycles. The regeneration of the aptasensor is proposed to be regulated by conversing azobenzene from its trans to cis form under UV irradiation.
Purpura, Martin; Rathmacher, John A; Sharp, Matthew H; Lowery, Ryan P; Shields, Kevin A; Partl, Jeremy M; Wilson, Jacob M; Jäger, Ralf
2017-01-01
Oral adenosine-5'-triphosphate (ATP) administration has failed to increase plasma ATP levels; however, chronic supplementation with ATP has shown to increase power, strength, lean body mass, and blood flow in trained athletes. The purpose of this study was to investigate the effects of ATP supplementation on postexercise ATP levels and on muscle activation and excitability and power following a repeated sprint bout. In a double-blind, placebo-controlled, randomized design, 42 healthy male individuals were given either 400 mg of ATP as disodium salt or placebo for 2 weeks prior to an exercise bout. During the exercise bout, muscle activation and excitability (ME, ratio of power output to muscle activation) and Wingate test peak power were measured during all sprints. ATP and metabolites were measured at baseline, after supplementation, and immediately following exercise. Oral ATP supplementation prevented a drop in ATP, adenosine-5'-diphosphate (ADP), and adenosine-5'-monophosphate (AMP) levels postexercise (p < 0.05). No group by time interaction was observed for muscle activation. Following the supplementation period, muscle excitability significantly decreased in later bouts 8, 9, and 10 in the placebo group (-30.5, -28.3, and -27.9%, respectively; p < 0.02), whereas ATP supplementation prevented the decline in later bouts. ATP significantly increased Wingate peak power in later bouts compared to baseline (bout 8: +18.3%, bout 10: +16.3%). Oral ATP administration prevents exercise-induced declines in ATP and its metabolite and enhances peak power and muscular excitability, which may be beneficial for sports requiring repeated high-intensity sprinting bouts.
Wang, Chunjiong; Geng, Bin; Cui, Qinghua; Guan, Youfei; Yang, Jichun
2014-03-01
Adenosine triphosphate (ATP) synthesis and release in mitochondria play critical roles in regulating insulin secretion in pancreatic β cells. Mitochondrial dysfunction is mainly characterized by a decrease in ATP production, which is a central event in the progression of pancreatic β cell dysfunction and diabetes. ATP has been demonstrated to regulate insulin secretion via several pathways: (i) Intracellular ATP directly closes ATP-sensitive potassium channel to open L-type calcium channel, leading to an increase in free cytosolic calcium levels and exocytosis of insulin granules; (ii) A decrease in ATP production is always associated with an increase in production of reactive oxygen species, which exerts deleterious effects on pancreatic β cell survival and insulin secretion; and (iii) ATP can be co-secreted with insulin from pancreatic β cells, and the released ATP functions as an autocrine signal to modulate insulin secretory process via P2 receptors on the cell membrane. In this review, the recent findings regarding the role and mechanism of ATP synthesis and release in regulation of insulin secretion from pancreatic β cells will be summarized and discussed. © 2013 Ruijin Hospital, Shanghai Jiaotong University School of Medicine and Wiley Publishing Asia Pty Ltd.
Autoradiography of P2x ATP receptors in the rat brain.
Balcar, V. J.; Li, Y.; Killinger, S.; Bennett, M. R.
1995-01-01
1. Binding of a P2x receptor specific radioligand, [3H]-alpha,beta-methylene adenosine triphosphate ([3H]-alpha,beta-MeATP) to sections of rat brain was reversible and association/dissociation parameters indicated that it consisted of two saturable components. Non-specific binding was very low (< 7% at 10 nM ligand concentration). 2. The binding was completely inhibited by suramin (IC50 approximately 14-26 microM) but none of the ligands specific for P2y receptors such as 2-methylthio-adenosine triphosphate (2-methyl-S-ATP) and 2-chloro-adenosine triphosphate (2-C1-ATP) nor 2-methylthio-adenosine diphosphate (2-methyl-S-ADP) a ligand for the P2 receptor on blood platelets ('P2T' type) produced strong inhibitions except for P1,P4-di(adenosine-5')tetraphosphate (Ap4A). 3. Inhibitors of Na+,K(+)-dependent adenosine triphosphatase (ATPase) ouabain, P1-ligand adenosine and an inhibitor of transport of, respectively, adenosine and cyclic nucleotides, dilazep, had no effect. 4. The highest density of P2x binding sites was found to be in the cerebellar cortex but the binding sites were present in all major brain regions, especially in areas known to receive strong excitatory innervation. Images Figure 2 PMID:7670731
DOE Office of Scientific and Technical Information (OSTI.GOV)
Deshpande, Chandrika N.; Harrop, Stephen J.; Boucher, Yan
2012-02-15
The direct isolation of integron gene cassettes from cultivated and environmental microbial sources allows an assessment of the impact of the integron/gene cassette system on the emergence of new phenotypes, such as drug resistance or virulence. A structural approach is being exploited to investigate the modularity and function of novel integron gene cassettes. We report the 1.8 {angstrom} crystal structure of Cass2, an integron-associated protein derived from an environmental V. cholerae. The structure defines a monomeric beta-barrel protein with a fold related to the effector-binding portion of AraC/XylS transcription activators. The closest homologs of Cass2 are multi-drug binding proteins, suchmore » as BmrR. Consistent with this, a binding pocket made up of hydrophobic residues and a single glutamate side chain is evident in Cass2, occupied in the crystal form by polyethylene glycol. Fluorescence assays demonstrate that Cass2 is capable of binding cationic drug compounds with submicromolar affinity. The Cass2 module possesses a protein interaction surface proximal to its drug-binding cavity with features homologous to those seen in multi-domain transcriptional regulators. Genetic analysis identifies Cass2 to be representative of a larger family of independent effector-binding proteins associated with lateral gene transfer within Vibrio and closely-related species. We propose that the Cass2 family not only has capacity to form functional transcription regulator complexes, but represents possible evolutionary precursors to multi-domain regulators associated with cationic drug compounds.« less
NASA Technical Reports Server (NTRS)
Bush, V. N.; Picciolo, G. L.; Chappelle, E. W.
1975-01-01
Luciferase assay for adenosine triphosphate (ATP) was used as a rapid method to determine the number of bacteria in a urine sample after nonbacterial components were removed. Accurate cellular ATP values, determined when bacteria were grown in an environment similar to that in which they were found, were necessary for the calculation of bacterial titer in urine. Cellular ATP values vary depending on the extraction method, the cell growth phase, and cell growth conditions. ATP per cell values of stationary E. coli grown in urine were two times greater than ATP per cell values of cells grown in trypticase soy broth. Glucose and urea were examined as possible components responsible for the cellular ATP variation.
Wang, Hao; Tian, Zhixin
2018-06-06
Analysis of phosphoproteins always faces the challenge of low stoichiometry, which demands highly selective and efficient enrichment in the initial sample preparation. Here we report our synthesis of the novel titanium (IV) ion immobilized adenosine triphosphate functionalized silica nanoparticles (Ti 4+ -ATP-NPs) for efficient enrichment of intact phosphoproteins. The average diameter of Ti 4+ -ATP-NPs was about 128 nm with good dispersibility and the saturated adsorption capacity for β-casein was 1046.5 mg/g. In addition, Ti 4+ -ATP-NPs exhibited high specificity and selectivity in enriching phosphoproteins from both standard protein mixtures and complex biological samples (non-fat milk, chicken egg white and mouse heart tissue extract) as demonstrated by SDS-PAGE. Copyright © 2018 Elsevier B.V. All rights reserved.
Saberi, Zeinab; Rezaei, Behzad; Khayamian, Taghi
2018-06-01
A new fluorimetric aptasensor was designed for the determination of adenosine triphosphate (ATP) based on magnetic nanoparticles (MNPs) and carbon dots (CDs). In this analytical strategy, an ATP aptamer was conjugated on MNPs and a complementary strand of the aptamer (CS) was labeled with CDs. The aptamer and its CS were hybridized to form a double helical structure. The hybridized aptamers could be used for the specific recognition of ATP in a biological complex matrix using a strong magnetic field to remove the interfering effect. In the absence of ATP, no CDs-CS could be released into the solution and this resulted in a weak fluorescence signal. In the presence of ATP, the target binds to its aptamer and causes the dissociation of the double helical structure and liberation of the CS, such that a strong fluorescence signal was generated. The increased fluorescence signal was proportional to ATP concentration. The limit of detection was estimated to be 1.0 pmol L -1 with a dynamic range of 3.0 pmol L -1 to 5.0 nmol L -1 . The specific aptasensor was applied to detect ATP in human serum samples with satisfactory results. Moreover, molecular dynamic simulation (MDS) studies were used to analyze interactions of the ATP molecule with the aptamer. Copyright © 2018 John Wiley & Sons, Ltd.
Kucherenko, Ivan S; Didukh, Daria Yu; Soldatkin, Oleksandr O; Soldatkin, Alexei P
2014-06-03
The majority of biosensors for adenosine-5'-triphosphate (ATP) determination are based on cascades of enzymatic reactions; therefore, they are sensitive to glucose or glycerol (depending on the enzymatic system) as well as to ATP. The presence of unknown concentrations of these substances in the sample greatly complicates the determination of ATP. To overcome this disadvantage of known biosensors, we developed a biosensor system consisting of two biosensors: the first one is based on glucose oxidase and is intended for measuring glucose concentration, and the second one is based on glucose oxidase and hexokinase and is sensitive toward both glucose and ATP. Using glucose concentration measured by the first biosensor, we can analyze the total response to glucose and ATP obtained by the second biosensor. Platinum disc electrodes were used as amperometric transducers. The polyphenilenediamine membrane was deposited onto the surface of platinum electrodes to avoid the response to electroactive substances. The effect of glucose concentration on biosensor determination of ATP was studied. The reproducibility of biosensor responses to glucose and ATP during a day was tested (relative standard deviation, RSD, of responses to glucose was 3-6% and to ATP was 8-12%) as well as storage stability of the biosensors (no decrease of glucose responses and 43% drop of ATP responses during 50 days). The measurements of ATP and glucose in pharmaceutical vials (including mixtures of ATP and glucose) were carried out. It was shown that the developed biosensor system can be used for simultaneous analysis of glucose and ATP concentrations in water solutions.
Digoxin and Adenosine Triphosphate Enhance the Functional Properties of Tissue-Engineered Cartilage
Makris, Eleftherios A.; Huang, Brian J.; Hu, Jerry C.; Chen-Izu, Ye
2015-01-01
Toward developing engineered cartilage for the treatment of cartilage defects, achieving relevant functional properties before implantation remains a significant challenge. Various chemical and mechanical stimuli have been used to enhance the functional properties of engineered musculoskeletal tissues. Recently, Ca2+-modulating agents have been used to enhance matrix synthesis and biomechanical properties of engineered cartilage. The objective of this study was to determine whether other known Ca2+ modulators, digoxin and adenosine triphosphate (ATP), can be employed as novel stimuli to increase collagen synthesis and functional properties of engineered cartilage. Neocartilage constructs were formed by scaffold-free self-assembling of primary bovine articular chondrocytes. Digoxin, ATP, or both agents were added to the culture medium for 1 h/day on days 10–14. After 4 weeks of culture, neocartilage properties were assessed for gross morphology, biochemical composition, and biomechanical properties. Digoxin and ATP were found to increase neocartilage collagen content by 52–110% over untreated controls, while maintaining proteoglycan content near native tissue values. Furthermore, digoxin and ATP increased the tensile modulus by 280% and 180%, respectively, while the application of both agents increased the modulus by 380%. The trends in tensile properties were found to correlate with the amount of collagen cross-linking. Live Ca2+ imaging experiments revealed that both digoxin and ATP were able to increase Ca2+ oscillations in monolayer-cultured chondrocytes. This study provides a novel approach toward directing neocartilage maturation and enhancing its functional properties using novel Ca2+ modulators. PMID:25473799
Skeletal muscle expresses the extracellular cyclic AMP–adenosine pathway
Chiavegatti, T; Costa, V L; Araújo, M S; Godinho, R O
2007-01-01
Background and purpose: cAMP is a key intracellular signalling molecule that regulates multiple processes of the vertebrate skeletal muscle. We have shown that cAMP can be actively pumped out from the skeletal muscle cell. Since in other tissues, cAMP efflux had been associated with extracellular generation of adenosine, in the present study we have assessed the fate of interstitial cAMP and the existence of an extracellular cAMP-adenosine signalling pathway in skeletal muscle. Experimental approach: cAMP efflux and/or its extracellular degradation were analysed by incubating rat cultured skeletal muscle with exogenous cAMP, forskolin or isoprenaline. cAMP and its metabolites were quantified by radioassay or HPLC, respectively. Key results: Incubation of cells with exogenous cAMP was followed by interstitial accumulation of 5′-AMP and adenosine, a phenomenon inhibited by selective inhibitors of ecto-phosphodiesterase (DPSPX) and ecto-nucleotidase (AMPCP). Activation of adenylyl cyclase (AC) in cultured cells with forskolin or isoprenaline increased cAMP efflux and extracellular generation of 5′-AMP and adenosine. Extracellular cAMP-adenosine pathway was also observed after direct and receptor-dependent stimulation of AC in rat extensor muscle ex vivo. These events were attenuated by probenecid, an inhibitor of ATP binding cassette family transporters. Conclusions and implications: Our results show the existence of an extracellular biochemical cascade that converts cAMP into adenosine. The functional relevance of this extracellular signalling system may involve a feedback modulation of cellular response initiated by several G protein-coupled receptor ligands, amplifying cAMP influence to a paracrine mode, through its metabolite, adenosine. PMID:18157164
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zoghbi, M. E.; Altenberg, G. A.
The functional unit of ATP-binding cassette (ABC) transporters consists of two transmembrane domains and two nucleotide-binding domains (NBDs). ATP binding elicits association of the two NBDs, forming a dimer in a head-to-tail arrangement, with two nucleotides “sandwiched” at the dimer interface. Each of the two nucleotide-binding sites is formed by residues from the two NBDs. We recently found that the prototypical NBD MJ0796 from Methanocaldococcus jannaschii dimerizes in response to ATP binding and dissociates completely following ATP hydrolysis. However, it is still unknown whether dissociation of NBD dimers follows ATP hydrolysis at one or both nucleotide-binding sites. Here, we usedmore » luminescence resonance energy transfer to study heterodimers formed by one active (donor-labeled) and one catalytically defective (acceptor-labeled) NBD. Rapid mixing experiments in a stop-flow chamber showed that NBD heterodimers with one functional and one inactive site dissociated at a rate indistinguishable from that of dimers with two hydrolysis-competent sites. Comparison of the rates of NBD dimer dissociation and ATP hydrolysis indicated that dissociation followed hydrolysis of one ATP. We conclude that ATP hydrolysis at one nucleotide-binding site drives NBD dimer dissociation.« less
Adenosine Triphosphate Regresses Endometrial Explants in a Rat Model of Endometriosis.
Zhang, Chen; Gao, Li; Yi, Yanhong; Han, Hongjing; Cheng, Hongyan; Ye, Xue; Ma, Ruiqiong; Sun, Kunkun; Cui, Heng; Chang, Xiaohong
2016-07-01
The aim of this study was to determine the effects of adenosine triphosphate (ATP) in a rat endometriosis model. After surgical induction of endometriosis, 3 rats were killed, and explants were measured in the remaining 19 rats, which were then randomly assigned to 4 groups. Group 1 (n = 4) received normal saline (2 mL/d intragastric [IG]), group 2 (n = 4) gestrinone (0.5 mg/kg/d IG), group 3 (n = 5) ATP (3.4 mg/kg/d IG), and group 4 (n = 6) ATP (1.0 mg/kg/d; intramuscularly), respectively. Four weeks after medication, they were euthanized to evaluate histological features of explants and eutopic uterine tissues. To test the effect of ATP on the growth of eutopic endometrium stromal cells, proliferation rates of hEM15A cells at 24, 48, and 72 hours after treatment with different concentrations of ATP and vehicle control were detected with the Cell Counting Kit-8 (CCK-8) method. There was a significant difference between pretreatment and posttreatment volumes within group 2 (positive control; P = .048) and group 4 (P = .044). On condition that pretreatment implant size was similar in both groups (P = .516), regression of explants in group 4 was significantly higher than that in group 1 (negative control; P = .035). Epithelial cells were significantly better preserved in group 1 than in group 3 (P = .008) and group 4 (P = .037). The CCK-8 assay showed no significant difference in proliferation among hEM15A cells treated with ATP and controls. These results suggest that ATP regresses endometriotic tissues in a rat endometriosis model but has no impact on the growth of eutopic endometrium stromal cells. © The Author(s) 2016.
Hur, H; Kim, N K; Kim, H G; Min, B S; Lee, K Y; Shin, S J; Cheon, J H; Choi, S H
2012-01-01
Background: This study aims to evaluate the effectiveness of adenosine triphosphate-based chemotherapy response assay (ATP-CRA)-guided neoadjuvant chemotherapy for increasing resectability in patients with unresectable colorectal liver metastasis. Patients and methods: Patients were randomised into two groups: Group A was treated by conventional chemotherapy regimen and Group B was treated by chemotherapy regimen according to the ATP-CRA. Three chemotherapeutic agents (5-fluorouracil, oxaliplatin and irinotecan) were tested by ATP-CRA and more sensitive agents were selected. Either FOLFOX or FOLFIRI was administered. Between Group A and B, treatment response and resectability were compared. Results: Between November 2008 and October 2010, a total 63 patients were randomised to Group A (N=32) or Group B (N=31). FOLFOX was more preferred in Group A than in Group B (26 out of 32 (81.3%) vs 20 out of 31 (64.5%)). Group B showed better treatment response than Group A (48.4% vs 21.9%, P=0.027). The resectability of hepatic lesion was higher in Group B (35.5% vs 12.5%, P=0.032). Mean duration from chemotherapy onset to the time of liver resection was 11 cycles (range 4–12) in Group A and 8 cycles (range 8–16) in Group B. Conclusion: This study showed that tailored-chemotherapy based on ATP-CRA could improve the treatment response and resectability in initially unresectable colorectal liver metastasis. PMID:22068817
Lowery, Ryan P; Joy, Jordan M; Rathmacher, John A; Baier, Shawn M; Fuller, John C; Shelley, Mack C; Jäger, Ralf; Purpura, Martin; Wilson, Stephanie M C; Wilson, Jacob M
2016-07-01
Lowery, RP, Joy, JM, Rathmacher, JA, Baier, SM, Fuller, JC Jr, Shelley, MC II, Jäger, R, Purpura, M, Wilson, SMC, and Wilson, JM. Interaction of beta-hydroxy-beta-methylbutyrate free acid and adenosine triphosphate on muscle mass, strength, and power in resistance trained individuals. J Strength Cond Res 30(7): 1843-1854, 2016-Adenosine-5'-triphosphate (ATP) supplementation helps maintain performance under high fatiguing contractions and with greater fatigue recovery demands also increase. Current evidence suggests that the free acid form of β-hydroxy-β-methylbutyrate (HMB-FA) acts by speeding regenerative capacity of skeletal muscle after high-intensity or prolonged exercise. Therefore, we investigated the effects of 12 weeks of HMB-FA (3 g) and ATP (400 mg) administration on lean body mass (LBM), strength, and power in trained individuals. A 3-phase double-blind, placebo-, and diet-controlled study was conducted. Phases consisted of an 8-week periodized resistance training program (phase 1), followed by a 2-week overreaching cycle (phase 2), and a 2-week taper (phase 3). Lean body mass was increased by a combination of HMB-FA/ATP by 12.7% (p < 0.001). In a similar fashion, strength gains after training were increased in HMB-FA/ATP-supplemented subjects by 23.5% (p < 0.001). Vertical jump and Wingate power were increased in the HMB-FA/ATP-supplemented group compared with the placebo-supplemented group, and the 12-week increases were 21.5 and 23.7%, respectively. During the overreaching cycle, strength and power declined in the placebo group (4.3-5.7%), whereas supplementation with HMB-FA/ATP resulted in continued strength gains (1.3%). In conclusion, HMB-FA and ATP in combination with resistance exercise training enhanced LBM, power, and strength. In addition, HMB-FA plus ATP blunted the typical response to overreaching, resulting in a further increase in strength during that period. It seems that the combination of HMB-FA/ATP could benefit those who
Biswas-Fiss, Esther E.; Affet, Stephanie; Ha, Malissa; Biswas, Subhasis B.
2012-01-01
The retina-specific ATP binding cassette transporter, ABCA4 protein, is associated with a broad range of inherited macular degenerations, including Stargardt disease, autosomal recessive cone rod dystrophy, and fundus flavimaculatus. In order to understand its role in retinal transport in rod out segment discs, we have investigated the interactions of the soluble domains of ABCA4 with both 11-cis- and all-trans-retinal. Using fluorescence anisotropy-based binding analysis and recombinant polypeptides derived from the amino acid sequences of the four soluble domains of ABCA4, we demonstrated that the nucleotide binding domain 1 (NBD1) specifically bound 11-cis-retinal. Its affinity for all-trans-retinal was markedly reduced. Stargardt disease-associated mutations in this domain resulted in attenuation of 11-cis-retinal binding. Significant differences in 11-cis-retinal binding affinities were observed between NBD1 and other cytoplasmic and lumenal domains of ABCA4. The results suggest a possible role of ABCA4 and, in particular, the NBD1 domain in 11-cis-retinal binding. These results also correlate well with a recent report on the in vivo role of ABCA4 in 11-cis-retinal transport. PMID:23144455
Cheng, Sheng; Zheng, Bin; Wang, Mozhen; Lam, Michael Hon-Wah; Ge, Xuewu
2014-02-01
A strand displacement reaction (SDR) system that runs solely on oligonucleotides has been developed for the amplification detection of adenosine triphosphate (ATP). It involves a target-induced SDR and an entropy-driven catalytic cycle of two SDRs with five oligonucleotides, denoted as substrate, fuel, catalyst, C-1, and C-2. Catalyst, released from the ATP aptamer-catalyst duplex by ATP molecule, catalyzes the SDRs to finally form the substrate-fuel duplex. All of the intermediates in the catalytic SDR processes have been identified by polyacrylamide gel electrophoresis (PAGE) analysis. The introduction of ATP into the SDR system will induce the ATP aptamer to form G-quadruplex conformation so as to release catalyst and trigger the SDR cycle. When the substrate and C-2 oligonucleotides were labeled with a carboxyfluorescein (FAM) fluorophore and a 4-([4-(dimethylamino)phenyl]azo)benzoic acid (DABCYL) quencher, this SDR catalytic system exhibited a "turn-on" response for ATP. The condition for detecting ATP, such as Mg²⁺ concentration, has been optimized to afford a detection limit of 20 nM. This work provides an enzyme-free biosensing strategy and has potential application in aptamer-based biosensing. Copyright © 2013 Elsevier Inc. All rights reserved.
Zhao, Guochao; Shi, Jianxin; Liang, Wanqi; Xue, Feiyang; Luo, Qian; Zhu, Lu; Qu, Guorun; Chen, Mingjiao; Schreiber, Lukas; Zhang, Dabing
2015-01-01
Male reproduction in higher plants requires the support of various metabolites, including lipid molecules produced in the innermost anther wall layer (the tapetum), but how the molecules are allocated among different anther tissues remains largely unknown. Previously, rice (Oryza sativa) ATP binding cassette G15 (ABCG15) and its Arabidopsis (Arabidopsis thaliana) ortholog were shown to be required for pollen exine formation. Here, we report the significant role of OsABCG26 in regulating the development of anther cuticle and pollen exine together with OsABCG15 in rice. Cytological and chemical analyses indicate that osabcg26 shows reduced transport of lipidic molecules from tapetal cells for anther cuticle development. Supportively, the localization of OsABCG26 is on the plasma membrane of the anther wall layers. By contrast, OsABCG15 is polarly localized in tapetal plasma membrane facing anther locules. osabcg26 osabcg15 double mutant displays an almost complete absence of anther cuticle and pollen exine, similar to that of osabcg15 single mutant. Taken together, we propose that OsABCG26 and OsABCG15 collaboratively regulate rice male reproduction: OsABCG26 is mainly responsible for the transport of lipidic molecules from tapetal cells to anther wall layers, whereas OsABCG15 mainly is responsible for the export of lipidic molecules from the tapetal cells to anther locules for pollen exine development. PMID:26392263
The Binding Site of Human Adenosine Deaminase for Cd26/Dipeptidyl Peptidase IV
Richard, Eva; Arredondo-Vega, Francisco X.; Santisteban, Ines; Kelly, Susan J.; Patel, Dhavalkumar D.; Hershfield, Michael S.
2000-01-01
Human, but not murine, adenosine deaminase (ADA) forms a complex with the cell membrane protein CD26/dipeptidyl peptidase IV. CD26-bound ADA has been postulated to regulate extracellular adenosine levels and to modulate the costimulatory function of CD26 on T lymphocytes. Absence of ADA–CD26 binding has been implicated in causing severe combined immunodeficiency due to ADA deficiency. Using human–mouse ADA hybrids and ADA point mutants, we have localized the amino acids critical for CD26 binding to the helical segment 126–143. Arg142 in human ADA and Gln142 in mouse ADA largely determine the capacity to bind CD26. Recombinant human ADA bearing the R142Q mutation had normal catalytic activity per molecule, but markedly impaired binding to a CD26+ ADA-deficient human T cell line. Reduced CD26 binding was also found with ADA from red cells and T cells of a healthy individual whose only expressed ADA has the R142Q mutation. Conversely, ADA with the E217K active site mutation, the only ADA expressed by a severely immunodeficient patient, showed normal CD26 binding. These findings argue that ADA binding to CD26 is not essential for immune function in humans. PMID:11067872
Hohl, Michael; Hürlimann, Lea M; Böhm, Simon; Schöppe, Jendrik; Grütter, Markus G; Bordignon, Enrica; Seeger, Markus A
2014-07-29
ATP binding cassette (ABC) transporters mediate vital transport processes in every living cell. ATP hydrolysis, which fuels transport, displays positive cooperativity in numerous ABC transporters. In particular, heterodimeric ABC exporters exhibit pronounced allosteric coupling between a catalytically impaired degenerate site, where nucleotides bind tightly, and a consensus site, at which ATP is hydrolyzed in every transport cycle. Whereas the functional phenomenon of cooperativity is well described, its structural basis remains poorly understood. Here, we present the apo structure of the heterodimeric ABC exporter TM287/288 and compare it to the previously solved structure with adenosine 5'-(β,γ-imido)triphosphate (AMP-PNP) bound at the degenerate site. In contrast to other ABC exporter structures, the nucleotide binding domains (NBDs) of TM287/288 remain in molecular contact even in the absence of nucleotides, and the arrangement of the transmembrane domains (TMDs) is not influenced by AMP-PNP binding, a notion confirmed by double electron-electron resonance (DEER) measurements. Nucleotide binding at the degenerate site results in structural rearrangements, which are transmitted to the consensus site via two D-loops located at the NBD interface. These loops owe their name from a highly conserved aspartate and are directly connected to the catalytically important Walker B motif. The D-loop at the degenerate site ties the NBDs together even in the absence of nucleotides and substitution of its aspartate by alanine is well-tolerated. By contrast, the D-loop of the consensus site is flexible and the aspartate to alanine mutation and conformational restriction by cross-linking strongly reduces ATP hydrolysis and substrate transport.
Guo, Xiaoqing; Dumas, Melanie; Robinson, Bonnie L; Ali, Syed F; Paule, Merle G; Gu, Qiang; Kanungo, Jyotshna
2017-02-01
Verapamil is a Ca 2 + channel blocker and is highly prescribed as an anti-anginal, antiarrhythmic and antihypertensive drug. Ketamine, an antagonist of the Ca 2 + -permeable N-methyl-d-aspartate-type glutamate receptors, is a pediatric anesthetic. Previously we have shown that acetyl l-carnitine (ALCAR) reverses ketamine-induced attenuation of heart rate and neurotoxicity in zebrafish embryos. Here, we used 48 h post-fertilization zebrafish embryos that were exposed to relevant drugs for 2 or 4 h. Heart beat and overall development were monitored in vivo. In 48 h post-fertilization embryos, 2 mm ketamine reduced heart rate in a 2 or 4 h exposure and 0.5 mm ALCAR neutralized this effect. ALCAR could reverse ketamine's effect, possibly through a compensatory mechanism involving extracellular Ca 2 + entry through L-type Ca 2 + channels that ALCAR is known to activate. Hence, we used verapamil to block the L-type Ca 2 + channels. Verapamil was more potent in attenuating heart rate and inducing morphological defects in the embryos compared to ketamine at specific times of exposure. ALCAR reversed cardiotoxicity and developmental toxicity in the embryos exposed to verapamil or verapamil plus ketamine, even in the presence of 3,4,5-trimethoxybenzoic acid 8-(diethylamino)octyl ester, an inhibitor of intracellular Ca 2 + release suggesting that ALCAR acts via effectors downstream of Ca 2 + . In fact, ALCAR's protective effect was blunted by oligomycin A, an inhibitor of adenosine triphosphate synthase that acts downstream of Ca 2 + during adenosine triphosphate generation. We have identified, for the first time, using in vivo studies, a downstream effector of ALCAR that is critical in abrogating ketamine- and verapamil-induced developmental toxicities. Published 2016. This article is a U.S. Government work and is in the public domain in the USA. Published 2016. This article is a U.S. Government work and is in the public domain in the USA.
Kobayashi, Takehito; Nakagome, Kazuyuki; Noguchi, Toru; Kobayashi, Kiyoko; Ueda, Yutaka; Soma, Tomoyuki; Ikebuchi, Kenji; Nakamoto, Hidetomo; Nagata, Makoto
2017-09-01
Recent evidence has suggested that the innate immune response may play a role in the development of eosinophilic airway inflammation. We previously reported that uric acid (UA) and adenosine triphosphate (ATP), two important damage-associated molecular pattern molecules (DAMPs), activate eosinophil functions, suggesting that these molecules may be involved in the development of eosinophilic airway inflammation. The objective of this study was to measure the concentrations of DAMPs including UA and ATP in the bronchoalveolar lavage fluid (BALF) of patients with eosinophilic pneumonia (EP). BAL was performed in patients with EP including acute and chronic eosinophilic pneumonia, and in patients with hypersensitivity pneumonia, and sarcoidosis. UA, ATP, and cytokine concentrations in the BALF were then measured. The UA concentration was increased in the BALF of EP patients. UA concentrations correlated with eosinophil numbers, and with eosinophil-derived neurotoxin and interleukin (IL)-5 concentrations. Furthermore, the ATP concentration was increased in the BALF of EP patients and ATP concentrations correlated with UA concentrations. Moreover, IL-33 was increased in EP patients and IL-33 concentrations correlated with UA and ATP concentrations. The UA and ATP concentration was increased in the BALF of EP patients. UA concentrations correlated with eosinophil numbers, and with ATP and IL-33 concentrations. Our findings suggest that DAMPs such as UA and ATP play a role in the pathogenesis of EP. Copyright © 2017 Japanese Society of Allergology. Production and hosting by Elsevier B.V. All rights reserved.
Validation of adenosine triphosphate to audit manual cleaning of flexible endoscope channels.
Alfa, Michelle J; Fatima, Iram; Olson, Nancy
2013-03-01
Compliance with cleaning of flexible endoscope channels cannot be verified using visual inspection. Adenosine triphosphate (ATP) has been suggested as a possible rapid cleaning monitor for flexible endoscope channels. There have not been published validation studies to specify the level of ATP that indicates inadequate cleaning has been achieved. The objective of this study was to validate the Clean-Trace (3M Inc, St. Paul, MN) ATP water test method for monitoring manual cleaning of flexible endoscopes. This was a simulated use study using a duodenoscope as the test device. Artificial test soil containing 10(6) colony-forming units of Pseudomonas aeruginosa and Enterococcus faecalis was used to perfuse all channels. The flush sample method for the suction-biopsy (L1) or air-water channel (L2) using 40 and 20 mLs sterile reverse osmosis water, respectively, was validated. Residuals of ATP, protein, hemoglobin, and bioburden were quantitated from channel samples taken from uncleaned, partially cleaned, and fully cleaned duodenoscopes. The benchmarks for clean were as follows: <6.4 μg/cm(2) protein, <2.2 μg/cm(2) hemoglobin, and <4-log10 colony-forming units/cm(2) bioburden. The average ATP in clean channel samples was 27.7 RLUs and 154 RLUs for L1 and L2, respectively (<200 RLUs for all channels). The average protein, hemoglobin, and bioburden benchmarks were achieved if <200 RLUs were detected. If the channel sample was >200 RLUs, the residual organic and bioburden levels would exceed the acceptable benchmarks. Our data validated that flexible endoscopes that have complete manual cleaning will have <200 RLUs by the Clean-Trace ATP test. Copyright © 2013 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Mosby, Inc. All rights reserved.
Adenosine triphosphate as a molecular mediator of the vascular response to injury.
Guth, Christy M; Luo, Weifung; Jolayemi, Olukemi; Chadalavada, Kalyan S; Komalavilas, Padmini; Cheung-Flynn, Joyce; Brophy, Colleen M
2017-08-01
Human saphenous veins used for arterial bypass undergo stretch injury at the time of harvest and preimplant preparation. Vascular injury promotes intimal hyperplasia, the leading cause of graft failure, but the molecular events leading to this response are largely unknown. This study investigated adenosine triphosphate (ATP) as a potential molecular mediator in the vascular response to stretch injury, and the downstream effects of the purinergic receptor, P2X7R, and p38 MAPK activation. A subfailure stretch rat aorta model was used to determine the effect of stretch injury on release of ATP and vasomotor responses. Stretch-injured tissues were treated with apyrase, the P2X7R antagonist, A438079, or the p38 MAPK inhibitor, SB203580, and subsequent contractile forces were measured using a muscle bath. An exogenous ATP (eATP) injury model was developed and the experiment repeated. Change in p38 MAPK phosphorylation after stretch and eATP tissue injury was determined using Western blotting. Noninjured tissue was incubated in the p38 MAPK activator, anisomycin, and subsequent contractile function and p38 MAPK phosphorylation were analyzed. Stretch injury was associated with release of ATP. Contractile function was decreased in tissue subjected to subfailure stretch, eATP, and anisomycin. Contractile function was restored by apyrase, P2X7R antagonism, and p38-MAPK inhibition. Stretch, eATP, and anisomycin-injured tissue demonstrated increased phosphorylation of p38 MAPK. Taken together, these data suggest that the vascular response to stretch injury is associated with release of ATP and activation of the P2X7R/P38 MAPK pathway, resulting in contractile dysfunction. Modulation of this pathway in vein grafts after harvest and before implantation may reduce the vascular response to injury. Copyright © 2017 Elsevier Inc. All rights reserved.
Kauv, Paul; Ayache, Samar S; Créange, Alain; Chalah, Moussa A; Lefaucheur, Jean-Pascal; Hodel, Jérôme; Brugières, Pierre
2017-01-01
Phosphorus magnetic resonance spectroscopy (31P-MRS) has previously shown abnormal changes in energy metabolites in the brain of multiple sclerosis (MS) patients. However, the relationship between these energy metabolites - particularly adenosine triphosphate (ATP) - and the disease severity remains unclear. The objective of this study was to determine whether measuring ATP metabolites can help to predict disease severity in MS patients. 31P-MRS at 3 tesla was performed in 9 relapsing remitting (RRMS), 9 secondary progressive MS patients (SPMS), and 10 age-matched healthy controls. ATP metabolites (expressed as %) in normally appearing white matter of the centrum semiovale were compared between patients and healthy controls. The relationship between Expanded Disability Status Scale (EDSS) and ATP metabolites was evaluated. RRMS and SPMS patients had higher phosphocreatine (PCr) and lower phosphodiesters than healthy controls. In addition, RRMS patients had higher β-ATP% than SPMS patients. β-ATP% was negatively correlated with EDSS in all patients. Our findings suggest a defective PCr metabolism in both patient groups, and a higher state of energy production in RRMS that might reflect a compensatory mechanism in face of the increased needs. The correlation of β-ATP with EDSS makes it a candidate biomarker for assessing MS disease severity. © 2017 S. Karger AG, Basel.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wiley, J.S.; Dubyak, G.R.
Extracellular adenosine triphosphate (ATP) is known to reversibly increase the cation permeability of a variety of freshly isolated and cultured cell types. In this study the effects of extracellular ATP were studied using peripheral blood lymphocytes (PBL) isolated from both normal subjects and from patients with chronic lymphocytic leukemia (CLL). Changes in the permeability to Na+, Rb+, and Li+ ions were measured using conventional isotope and flame photometry techniques. In addition, changes in cytosolic (Ca2+) were fluorimetrically monitored to assess possible changes in net Ca2+ influx. ATP produced a 12-fold increase in 22Na+ influx into CLL cells but only amore » 3.5-fold increase in this flux in PBL cells. A maximal response was produced by 0.1 mmol/L ATP in the absence of Mg2+, while a twofold molar excess of Mg2+ over ATP abolished the response. ATP had no effect on the passive (ouabain-insensitive) 86Rb+ influx into PBL cells but stimulated this flux by fivefold in the CLL cells. Li+ influx into CLL cells was also stimulated threefold by ATP. Under these same conditions ATP also produced a net increase in total cell Na and a decrease in total cell K in the CLL cells. Exclusion of two normally impermeable dyes, trypan blue and ethidium bromide, was not altered in the ATP-treated CLL cells. Finally, extracellular ATP (3 mmol/L) produced no significant change in the cytosolic (Ca2+) of normal, monocyte-depleted populations of PBL. Conversely, this same concentration of ATP produced a very rapid and a significant (an average threefold peak change) increase in the cytosolic (Ca2+) of cell preparations derived from five out of nine CLL patients. In these latter CLL cells, the ATP-induced elevation in cytosolic (Ca2+) appeared to be due to a net increase in Ca2+ influx, since no elevations were observed when the extracellular (Ca2+) was reduced to less than 0.1 mmol/L.« less
ATP-Binding Cassette Proteins: Towards a Computational View of Mechanism
NASA Astrophysics Data System (ADS)
Liao, Jielou
2004-03-01
Many large machine proteins can generate mechanical force and undergo large-scale conformational changes (LSCC) to perform varying biological tasks in living cells by utilizing ATP. Important examples include ATP-binding cassette (ABC) transporters. They are membrane proteins that couple ATP binding and hydrolysis to the translocation of substrates across membranes [1]. To interpret how the mechanical force generated by ATP binding and hydrolysis is propagated, a coarse-grained ATP-dependent harmonic network model (HNM) [2,3] is applied to the ABC protein, BtuCD. This protein machine transports vitamin B12 across membranes. The analysis shows that subunits of the protein move against each other in a concerted manner. The lowest-frequency modes of the BtuCD protein are found to link the functionally critical domains, and are suggested to be responsible for large-scale ATP-coupled conformational changes. [1] K. P. Locher, A. T. Lee and D. C. Rees. Science 296, 1091-1098 (2002). [2] Atilgan, A. R., S. R. Durell, R. L. Jernigan, M. C. Demirel, O. Keskin, and I. Bahar. Biophys. J. 80, 505-515(2002); M. M Tirion, Phys. Rev. Lett. 77, 1905-1908 (1996). [3] J. -L. Liao and D. N. Beratan, 2003, to be published.
Miao, Yu; Wang, Cheng-long; Yin, Hui-jun; Shi, Da-zhuo; Chen, Ke-ji
2005-04-18
To establish method for the quantitative determination of adenosine phosphates in rat myocardium by optimized high performance liquid chromatogram (HPLC). ODS HYPERSIL C(18) column and a mobile phase of 50 mmol/L tribasic potassium phosphate buffer solution (pH 6.5), with UV detector at 254 nm were used. The average recovery rates of myocardial adenosine triphosphate (ATP), adenosine diphosphate (ADP) and adenosine monophosphate (AMP) were 99%-107%, 96%-104% and 95%-119%, respectively; relative standard deviations (RSDs) of within-day and between-days were less than 1.5% and 5.1%, respectively. The method is simple, rapid and accurate, and can be used to analyse the adenosine phosphates in myocardium.
Cultured astrocytes do not release adenosine during hypoxic conditions
Fujita, Takumi; Williams, Erika K; Jensen, Tina K; Smith, Nathan A; Takano, Takahiro; Tieu, Kim; Nedergaard, Maiken
2012-01-01
Recent reports based on a chemiluminescent enzymatic assay for detection of adenosine conclude that cultured astrocytes release adenosine during mildly hypoxic conditions. If so, astrocytes may suppress neural activity in early stages of hypoxia. The aim of this study was to reevaluate the observation using high-performance liquid chromatography (HPLC). The HPLC analysis showed that exposure to 20 or 120 minutes of mild hypoxia failed to increase release of adenosine triphosphate (ATP), adenosine diphosphate (ADP), adenosine monophosphate (AMP), and adenosine from cultured astrocytes. Similar results were obtained using a chemiluminescent enzymatic assay. Moreover, since the chemiluminescent enzymatic assay relies on hydrogen peroxide generation, release of free-radical scavengers from hypoxic cells can interfere with the assay. Accordingly, adenosine added to samples collected from hypoxic cultures could not be detected using the chemiluminescent enzymatic assay. Furthermore, addition of free-radical scavengers sharply reduced the sensitivity of adenosine detection. Conversely, use of a single-step assay inflated measured values due to the inability of the assay to distinguish adenosine and its metabolite inosine. These results show that cultured astrocytes do not release adenosine during mild hypoxia, an observation consistent with their high resistance to hypoxia. PMID:21989480
Ronquist, K Göran; Ek, Bo; Morrell, Jane; Stavreus-Evers, Anneli; Ström Holst, Bodil; Humblot, Patrice; Ronquist, Gunnar; Larsson, Anders
2013-10-01
Prostasomes are extracellular vesicles. Intracellularly they are enclosed by another larger vesicle, a so called "storage vesicle" equivalent to a multivesicular body of late endosomal origin. Prostasomes in their extracellular context are thought to play a crucial role in fertilization. Prostasomes were purified according to a well worked-out schedule from seminal plasmas obtained from human, canine, equine and bovine species. The various prostasomes were subjected to SDS-PAGE separation and protein banding patterns were compared. To gain knowledge of the prostasomal protein systems pertaining to prostasomes of four different species proteins were analyzed using a proteomic approach. An in vitro assay was employed to demonstrate ATP formation by prostasomes of different species. The SDS-PAGE banding pattern of prostasomes from the four species revealed a richly faceted picture with most protein bands within the molecular weight range of 10-150kDa. Some protein bands seemed to be concordant among species although differently expressed and the number of protein bands of dog prostasomes seemed to be distinctly fewer. Special emphasis was put on proteins involved in energy metabolic turnover. Prostasomes from all four species were able to form extracellular adenosine triphosphate (ATP). ATP formation was balanced by ATPase activity linked to the four types of prostasomes. These potencies of a possession of functional ATP-forming enzymes by different prostasome types should be regarded against the knowledge of ATP having a profound effect on cell responses and now explicitly on the success of the sperm cell to fertilize the ovum. This study unravels energy metabolic relationships of prostasomes from four different species. Copyright © 2013 The Authors. Published by Elsevier B.V. All rights reserved.
ROLE OF ATP BINDING CASSETTE SUB-FAMILY MEMBER 2 (ABCG2) IN MOUSE EMBRYONIC STEM CELL DEVELOPMENT.
ATP binding cassette sub-family member 2 (ABCG2), is a member of the ABC transporter superfamily and a principal xenobiotic transporter. ABCG2 is also highly expressed in certain stem cell populations where it is thought to be related to stem cell plasticity, although the role o...
Jenkins, R H; Tuma, R; Juuti, J T; Bamford, D H; Thomas, G J
1999-01-01
A novel spectrophotometric method, based upon Raman spectroscopy, has been developed for accurate quantitative determination of nucleoside triphosphate phosphohydrolase (NTPase) activity. The method relies upon simultaneous measurement in real time of the intensities of Raman marker bands diagnostic of the triphosphate (1115 cm(-1)) and diphosphate (1085 cm(-1)) moieties of the NTPase substrate and product, respectively. The reliability of the method is demonstrated for the NTPase-active RNA-packaging enzyme (protein P4) of bacteriophage phi6, for which comparative NTPase activities have been estimated independently by radiolabeling assays. The Raman-determined rate for adenosine triphosphate substrate (8.6 +/- 1.3 micromol x mg(-1) x min(-1) at 40 degrees C) is in good agreement with previous estimates. The versatility of the Raman method is demonstrated by its applicability to a variety of nucleotide substrates of P4, including the natural ribonucleoside triphosphates (ATP, GTP) and dideoxynucleoside triphosphates (ddATP, ddGTP). Advantages of the present protocol include conservative sample requirements (approximately 10(-6) g enzyme/protocol) and relative ease of data collection and analysis. The latter conveniences are particularly advantageous for the measurement of activation energies of phosphohydrolase activity.
Quan, Erik; Mahmood, Rizwan; Naik, Amar; Sargon, Peter; Shastri, Nikhil; Venu, Mukund; Parada, Jorge P; Gupta, Neil
2018-05-21
There have been reported outbreaks of carbapenem-resistant Enterobacteriaceae infections linked to endoscopes with elevator mechanisms. Adenosine triphosphate (ATP) testing has been used as a marker for bioburden and monitoring manual cleaning for flexible endoscopes with and without an elevator mechanism. The objective of this study was to determine whether routine ATP testing could identify areas of improvement in cleaning of endoscopes with an elevator mechanism. ATP testing after manual cleaning of TJF-Q180V duodenoscopes and GF-UCT180 linear echoendoscopes (Olympus America Inc, Center Valley, PA) was implemented. Samples were tested from the distal end, the elevator mechanism, and water flushed through the lumen of the biopsy channel. Data were recorded and compared by time point, test point, and reprocessing technician. Overall failure rate was 6.99% (295 out of 4,219). The highest percentage of failed ATP tests (17.05%) was reported in the first quarter of routine testing, with an overall decrease in rates over time. The elevator mechanism and working channel lumen had higher failure rates than the distal end. Quality of manual cleaning between reprocessing technicians showed variation. ATP testing is effective in identifying residual organic material and improving quality of manual cleaning of endoscopes with an elevator mechanism. Cleaning efficacy is influenced by reprocessing technicians and location tested on the endoscope. Close attention to the working channel and elevator mechanism during manual cleaning is warranted. Copyright © 2018 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.
Wright, Michael; Miller, Andrew D
2006-02-15
Tandem synthetic-biosynthetic procedures were used to prepare two novel fluorescent labelled affinity probes for diadenosine-5',5'''-P1,P4-tetraphosphate (Ap4A)-binding studies. These compounds (dial-mant-Ap4A and azido-mant-Ap4A) are shown to clearly distinguish known Ap4A-binding proteins from Escherichia coli (LysU and GroEL) and a variety of other control proteins. Successful labelling of chaperonin GroEL appears to be allosteric with respect to the well-characterized adenosine 5'-triphosphate (ATP)-binding site, suggesting that GroEL possesses a distinct Ap4A-binding site.
Sun, Yi-Min; Li, Hong-Lei; Guo, Qi-Hao; Wu, Ping; Hong, Zhen; Lu, Chuan-Zhen; Wu, Zhi-Ying
2012-07-01
Recent studies highlight a potential role of cholesterol metabolic disturbance in the pathophysiology of Alzheimer disease (AD). The adenosine triphosphate (ATP)-binding cassette transporter 1 (ABCA1) gene resides within proximity of linkage peaks on chromosome 9q influence AD and plays a key role in cellular cholesterol efflux in the brain. We studied the role of R219K and V825I polymorphisms of ABCA1 in modulating the risk of AD in 321 AD patients and 349 comparisons of Chinese Han. Genotyping of R219K and V825I were performed by PCR-restriction fragment length polymorphism analysis. The genotype distribution of R219K was different with more RK in total AD group (χ(2) = 8.705, df = 2, p = 0.013), late-onset AD (LOAD) group (χ(2) = 10.636, df = 2, p = 0.005), APOE non-ε4ε4 group (χ(2) = 9.900, df = 2, p = 0.007), and female AD group (χ(2) = 8.369, df = 2, p = 0.015). Logistic regression manifested the risk of AD increased in RK carriers in total AD group (Wald = 6.102, df = 1, p = 0.014, odds ratio [OR]: 1.546, 95% confidence interval [95% CI]: 1.094-2.185), LOAD group (Wald = 7.746, df = 1, p = 0.005, OR: 1.921, 95% CI: 1.213-3.041), and APOE non-ε4ε4 group (Wald = 6.399, df = 1, p = 0.011, OR: 1.586, 95% CI: 1.109-2.266). K allele (RK + KK) also increased the risk of AD compared with RR allele in LOAD group (Wald = 4.750, df = 1, p = 0.029, OR: 1.619, 95% CI: 1.050-2.497). However, no discrepancy was found in V825I. In R219K, age at onset (AAO) was significantly lower by 4.9 years on average in patients of KK genotype than those of RK in APOE ε4 carrying group and higher by 5.5 years in patients of KK genotype than those of RR in APOE ε4 noncarrying group. In V825I, AAO was diseased by 4.3 years in II genotype compared with VV genotype in APOE ε4 noncarrying group and 3.4 years in APOE ε4ε4 noncarrying group. The results indicated that the RK genotype or K allele (RK + KK) of R219K may relate to the development of AD in the east of China.
Characterisation of single domain ATP-binding cassette protien homologues of Theileria parva.
Kibe, M K; Macklin, M; Gobright, E; Bishop, R; Urakawa, T; ole-MoiYoi, O K
2001-09-01
Two distinct genes encoding single domain, ATP-binding cassette transport protein homologues of Theileria parva were cloned and sequenced. Neither of the genes is tandemly duplicated. One gene, TpABC1, encodes a predicted protein of 593 amino acids with an N-terminal hydrophobic domain containing six potential membrane-spanning segments. A single discontinuous ATP-binding element was located in the C-terminal region of TpABC1. The second gene, TpABC2, also contains a single C-terminal ATP-binding motif. Copies of TpABC2 were present at four loci in the T. parva genome on three different chromosomes. TpABC1 exhibited allelic polymorphism between stocks of the parasite. Comparison of cDNA and genomic sequences revealed that TpABC1 contained seven short introns, between 29 and 84 bp in length. The full-length TpABC1 protein was expressed in insect cells using the baculovirus system. Application of antibodies raised against the recombinant antigen to western blots of T. parva piroplasm lysates detected an 85 kDa protein in this life-cycle stage.
Ambruso, D R; Hawkins, B; Johnson, D L; Fritzberg, A R; Klingensmith, W C; McCabe, E R
1986-06-01
Conditions for blood storage are chosen to assure adequate levels of adenosine triphosphate (ATP) and 2,3-diphosphoglycerate (2,3-DPG). Because of the invasive nature of the techniques, biochemical assays are not routinely used to measure levels of these compounds in stored blood. However, 31P NMR spectroscopy measures phosphorylated intermediates in intact cells and could be used without disruption of the storage pack. We compared levels of ATP and 2,3-DPG measured by 31P spectroscopy and standard enzyme-linked biochemical assays in whole blood (WB) and packed red blood cells (PRBCs) at weekly intervals during a 35-day storage period. NMR demonstrated a marked decrease in 2,3-DPG and an increase in inorganic phosphate after the first week of storage. No significant differences in ATP concentrations were seen in WB during the storage period, but a significant decrease in ATP in PRBCs was documented. There was good agreement in levels of ATP and 2,3-DPG measured by NMR and biochemical techniques. 31P NMR spectroscopy is a noninvasive technique for measuring ATP and 2,3-DPG which has a potential use in quality assurance of stored blood.
Bushon, R.N.; Likirdopulos, C.A.; Brady, A.M.G.
2009-01-01
Untreated wastewater samples from California, North Carolina, and Ohio were analyzed by the immunomagnetic separation/adenosine triphosphate (IMS/ATP) method and the traditional culture-based method for E. coli and enterococci concentrations. The IMS/ATP method concentrates target bacteria by immunomagnetic separation and then quantifies captured bacteria by measuring bioluminescence induced by release of ATP from the bacterial cells. Results from this method are available within 1 h from the start of sample processing. Significant linear correlations were found between the IMS/ATP results and results from traditional culture-based methods for E. coli and enterococci enumeration for one location in California, two locations in North Carolina, and one location in Ohio (r??values ranged from 0.87 to 0.97). No significant linear relation was found for a second location in California that treats a complex mixture of residential and industrial wastewater. With the exception of one location, IMS/ATP showed promise as a rapid method for the quantification of faecal-indicator organisms in wastewater.
Wagner, Marc C.E.
2011-01-01
Extracellular adenosine triphosphate (eATP) is a potent molecule that has the capacity to modulate various aspects of cell functions including gene expression. This element of modulation is essential to the role of ATP as a therapeutic agent. The hypothesis presented is that ATP can have an important impact on the treatment of HIV infection. This is supported in part by published research, although a much greater role for ATP is suggested than prior authors ever thought possible. ATP has the ability to enhance the immune system and could thus improve the host’s own defense mechanisms to eradicate the virus-infected cells and restore normal immune function. This could provide effective therapy when used in conjunction with highly active antiretroviral therapies (HAART) to eliminate the latently infected cells. The key lies in applying ATP through the methodology described. This article presents a strategy for using ATP therapeutically along with background evidence to substantiate the importance of using ATP in the treatment of HIV infection. PMID:21675943
He, Yanlong; Tian, Jianniao; Hu, Kun; Zhang, Juanni; Chen, Sheng; Jiang, Yixuan; Zhao, Yanchun; Zhao, Shulin
2013-11-13
In this work, an ultrasensitive fluorescent polarization immunoassay (FPIA) method based on the quantum dot/aptamer/antibody/gold nanoparticles ensemble has been developed for the detection of adenosine triphosphate (ATP). DNA hybridization is formed when ATP is present in the PBS solution containing the DNA-conjugated quantum dots (QDs) and antibody-AuNPs. The substantial sensitivity improvement of the antibody-AuNPs-enhanced method is mainly attributed to the slower rotation of fluorescent unit when QDs-labeled oligonucleotides hybridize with antibody modified the gold nanoparticle. As a result, the fluorescent polarization (FP) values of the system increase significantly. Under the optimal conditions, a linear response with ATP concentration is ranged from 8×10(-12) M to 2.40×10(-4) M. The detection limit reached as low as 1.8 pM. The developed work provides a sensitive and selective immunoassay protocol for ATP detection, which could be applied in more bioanalytical systems. Crown Copyright © 2013. Published by Elsevier B.V. All rights reserved.
Takahashi, Mamoru; Ohsumi, Akihiro; Ohata, Keiji; Kondo, Takeshi; Motoyama, Hideki; Hijiya, Kyoko; Aoyama, Akihiro; Date, Hiroshi; Chen-Yoshikawa, Toyofumi F
2017-06-01
The ImmuKnow (IK) assay is a comprehensive immune function test that involves measuring adenosine triphosphate produced by the cluster of differentiation 4+ T lymphocytes in peripheral blood. The aim of this study was to analyze the time trends of IK values and assess the relationship between IK values and infections in lung transplants. We prospectively collected 178 blood samples from 22 deceased-donor lung transplant (DDLT) recipients and 17 living-donor lobar lung transplant (LDLLT) recipients. A surveillance IK assay was performed postoperatively, then after 1 week and 1, 3, 6, and 12 months. Time trends of IK values in stable recipients peaked 1 week after DDLT (477 ± 247 ATP ng/ml), and 1 month after LDLLT (433 ± 134 ng/ml), followed by a gradual decline over 1 year. The mean IK values in infections were significantly lower than those in the stable state (119 vs 312 ATP ng/ml, p = 0.0002). IK values increased sharply after lung transplantation and then decreased gradually over time in the first year, suggesting a natural history of immune function. IK values were also significantly reduced during infections. These results may provide new insights into the utility of immune monitoring after lung transplantation.
NANOFF, CHRISTIAN; JACOBSON, KENNETH A.; STILES, GARY L.
2012-01-01
SUMMARY Agonist binding to the A2 adenosine receptor (A2AR) and its regulation by guanine nucleotides was studied using the newly developed radioligand 125l-2-[4-(2-{2-[(4-ammnophenyl)methylcarbonylamino]ethylaminnocarbonyl}ethyl)phenyl]ethylamino-5′-N-ethylcarboxamidoadenosine (1251-PAPA-APEC) and its photoaffinity analog 125l-azido-PAPA-APEC. A single protein of Mr 45,000, displaying the appropriate A2AR pharmacology, is Iabeled in membranes from bovine striatum, PC12 cells, and frog erythrocytes. In DDT1 MF2 cells the labeled protein has a slightly lower molecular weight. Incorporation of 125l-azido-PAPA-APEC into membranes from rabbit striatum, however, reveals two specifically labeled peptides (Mr ~47,O00 and 38,000), both of which display A2AR pharmacology. Inhibition of protease activity leads to a decrease in the amount of the Mr 38,000 protein, with only the Mr 47,000 protein remaining. This suggests that the Mr 38,000 peptide is a proteolytic product of the Mr 47,000 A2AR protein. In membranes containing the intact undigested A2AR protein, guanine nucleotides induce a small to insignificant decrease in agonist binding, which is atypical of stimulatory Gs-coupled receptors. This minimal effect is observed in rabbit striatal membranes prepared in the presence of protease inhibitors, as well as in the other tissues studied. Binding to rabbit stnatal membranes that possess the partially digested receptor protein, however, reveals a 50% reduction in maximal specific agonist binding upon addition of guanine nucleotides. Inhibition of proteolysis in rabbit striatum, on the other hand, results in a diminished ability of guanine nucleotides to regulate agonist binding. Thus, the enhanced effectiveness of guanine nucleotides in rabbit striatal membranes is associated with the generation of the Mr 38,000 peptide fragment. Guanosine 5′-(β,γ-imido)triphosphate reduces photoaffinity labeling by 55% in the Mr 38,000 protein, whereas the labeling is decreased by
Wu, Liping; Oshima, Tadayuki; Fukui, Hirokazu; Watari, Jiro; Miwa, Hiroto
2017-07-01
Immune-mediated mucosal inflammation characterized by the release of interleukin (IL)-8 is associated with gastroesophageal reflux disease. ATP released by human esophageal epithelial cells (HEECs) mediates the release of cytokines through P2 nucleotide receptors that are present on various cells, including HEECs. This study characterized and identified human esophageal epithelial P2 receptors that are responsible for ATP-mediated release of IL-8 by using a human esophageal stratified squamous epithelial model. Primary HEECs were cultured with the use of an air-liquid interface (ALI) system. The ATP analogue adenosine 5'-O-3-thiotriphosphate (ATP-γ-S) was added to the basolateral compartment, and IL-8 release was measured. Involvement of the P2Y2 receptor was assessed with the use of selective and non-selective receptor antagonists and a P2Y2 receptor agonist. Expression of the P2Y2 receptor was assessed using western blotting and immunohistochemistry. Adenosine triphosphate-γ-S induced IL-8 release through the P2Y2 receptor. A P2Y2 receptor antagonist but not a P2X3 receptor antagonist or a P2Y1 receptor antagonist blocked ATP-γ-S-mediated IL-8 release. Conversely, a P2Y2 receptor agonist induced IL-8 release. Western blotting and immunohistochemistry of the P2Y2 receptor showed strong expression of the P2Y2 receptor on ALI-cultured HEECs and in human esophagus. Inhibition of extracellular signal-regulated kinase but not of protein kinase C blocked the ATP-mediated release of IL-8. ATP-γ-S induced phosphorylation of extracellular signal-regulated kinase, and a P2Y2 receptor antagonist blocked this phosphorylation. Interleukin-8 release after purinergic stimulation in ALI-cultured HEECs is mediated through P2Y2 receptor activation. ATP-induced IL-8 release maybe involved in the pathogenesis of refractory gastroesophageal reflux disease. © 2016 Journal of Gastroenterology and Hepatology Foundation and John Wiley & Sons Australia, Ltd.
The Yeast Plasma Membrane ATP Binding Cassette (ABC) Transporter Aus1
Marek, Magdalena; Milles, Sigrid; Schreiber, Gabriele; Daleke, David L.; Dittmar, Gunnar; Herrmann, Andreas; Müller, Peter; Pomorski, Thomas Günther
2011-01-01
The ATP binding cassette (ABC) transporter Aus1 is expressed under anaerobic growth conditions at the plasma membrane of the yeast Saccharomyces cerevisiae and is required for sterol uptake. These observations suggest that Aus1 promotes the translocation of sterols across membranes, but the precise transport mechanism has yet to be identified. In this study, an extraction and purification procedure was developed to characterize the Aus1 transporter. The detergent-solubilized protein was able to bind and hydrolyze ATP. Mutagenesis of the conserved lysine to methionine in the Walker A motif abolished ATP hydrolysis. Likewise, ATP hydrolysis was inhibited by classical inhibitors of ABC transporters. Upon reconstitution into proteoliposomes, the ATPase activity of Aus1 was specifically stimulated by phosphatidylserine (PS) in a stereoselective manner. We also found that Aus1-dependent sterol uptake, but not Aus1 expression and trafficking to the plasma membrane, was affected by changes in cellular PS levels. These results suggest a direct interaction between Aus1 and PS that is critical for the activity of the transporter. PMID:21521689
Wang, Guixiang; Su, Xiaoli; Xu, Qingjun; Xu, Guiyun; Lin, Jiehua; Luo, Xiliang
2018-03-15
Direct detection of targets in complex biological media with conventional biosensors is an enormous challenge due to the nonspecific adsorption and severe biofouling. In this work, a facile strategy for sensitive and low fouling detection of adenosine triphosphate (ATP) is developed through the construction of a mixed self-assembled biosensing interface, which was composed of zwitterionic peptide (antifouling material) and ATP aptamer (bio-recognition element). The peptide and aptamer (both containing thiol groups) were simultaneously self-assembled onto gold electrode surface electrodeposited with gold nanoparticles. The developed aptasensor possessed high selectivity and sensitivity for ATP, and it showed a wide linear response range towards ATP from 0.1pM to 5nM. Owing to the presence of peptide with excellent antifouling property in the biosensing interface, the aptasensor can detect ATP in complex biological media with remarkably reduced biofouling or nonspecific adsorption effect. Moreover, it can directly detect ATP in 1% human whole blood without suffering from any significant interference, indicating its great potential for practical assaying of ATP in biological samples. Copyright © 2017 Elsevier B.V. All rights reserved.
Clifton, Matthew C.; Simon, Michael J.; Erramilli, Satchal K.; Zhang, Huide; Zaitseva, Jelena; Hermodson, Mark A.; Stauffacher, Cynthia V.
2015-01-01
Bacterial ATP-binding cassette (ABC) importers are primary active transporters that are critical for nutrient uptake. Based on structural and functional studies, ABC importers can be divided into two distinct classes, type I and type II. Type I importers follow a strict alternating access mechanism that is driven by the presence of the substrate. Type II importers accept substrates in a nucleotide-free state, with hydrolysis driving an inward facing conformation. The ribose transporter in Escherichia coli is a tripartite complex consisting of a cytoplasmic ATP-binding cassette protein, RbsA, with fused nucleotide binding domains; a transmembrane domain homodimer, RbsC2; and a periplasmic substrate binding protein, RbsB. To investigate the transport mechanism of the complex RbsABC2, we probed intersubunit interactions by varying the presence of the substrate ribose and the hydrolysis cofactors, ATP/ADP and Mg2+. We were able to purify a full complex, RbsABC2, in the presence of stable, transition state mimics (ATP, Mg2+, and VO4); a RbsAC complex in the presence of ADP and Mg2+; and a heretofore unobserved RbsBC complex in the absence of cofactors. The presence of excess ribose also destabilized complex formation between RbsB and RbsC. These observations suggest that RbsABC2 shares functional traits with both type I and type II importers, as well as possessing unique features, and employs a distinct mechanism relative to other ABC transporters. PMID:25533465
Visrodia, Kavel; Hanada, Yuri; Pennington, Kelly M; Tosh, Pritish K; Topazian, Mark D; Petersen, Bret T
2017-07-01
Recent reports of infectious outbreaks linked to duodenoscopes have led to proposals for duodenoscope surveillance culturing, which has inherent limitations. We aimed to assess the feasibility of real-time adenosine triphosphate (ATP) testing after manual cleaning and its ability to predict reprocessing adequacy, as determined by terminal duodenoscope cultures. Clinically used duodenoscopes underwent reprocessing per current guidelines. After manual cleaning, ATP samples were obtained from the elevator, within the proximal biopsy port, and by flushing of the biopsy channel. After high-level disinfection (HLD), aerobic cultures of the elevator and biopsy channel were obtained using sterile technique. Duodenoscopes with any ATP sample ≥200 relative light units underwent repeated cycles of cleaning, ATP testing, HLD, and terminal culturing. Twenty clinically used duodenoscopes were included; 18 underwent a second reprocessing cycle, and 6 underwent a third reprocessing cycle because of detection of high ATP. After the initial reprocessing cycle, 12 of 20 (60%) duodenoscopes had positive culture results, most commonly yielding gram-negative bacilli (GNB, n = 11 from 9 duodenoscopes), and catalase-positive gram-positive cocci (CP-GPC, n = 7 from 7 duodenoscopes), suggesting staphylococcal organisms. Ambient environmental controls also showed GNB and CP-GPC growth. The overall sensitivity and specificity of ATP testing compared with terminal cultures were 30% and 53%, respectively. ATP sampling appears to correlate poorly with terminal culture results and cannot be recommended as a surrogate for terminal cultures. The performance and interpretation of cultures remains complicated by the potential recovery of environmental contaminants. Copyright © 2017 American Society for Gastrointestinal Endoscopy. Published by Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yanik, G.M. Jr.
Behavioral and biochemical approaches have been used to determine the relative contribution of endogenous adenosine and adenosine receptors to the sleep-wake cycle in the rat. Adenosine concentrations in specific areas of the rat brain were not affected by 24 hours of total sleep deprivation, or by 24 or 48 hours of REM sleep deprivation. In order to assess the effect of REM sleep deprivation on adenosine A/sub 1/ receptors, /sup 3/H-L-PIA binding was measured. The Bmax values for /sup 3/H-L-PIA binding to membrane preparations of the cortices and corpus striata from 48 hour REM sleep-deprived animals were increased 14.8% andmore » 23%, respectively. These increases were not maintained following the cessation of sleep deprivation and recovered within 2 hours. The results of a 96 hour REM deprivation experiment were similar to those of the 48 hour REM sleep deprivation experiment. However, these increases were not evident in similar structures taken from stress control animals, and conclusively demonstrated that the changes in /sup 3/H-L-PIA binding resulted from REM sleep deprivation and not from stress.« less
Selvaraj, S; Ghebremichael, M; Li, M; Foli, Y; Langs-Barlow, A; Ogbuagu, A; Barakat, L; Tubridy, E; Edifor, R; Lam, W; Cheng, Y-C; Paintsil, E
2014-07-01
We hypothesized that competition between nucleotide reverse-transcriptase inhibitor triphosphate and endogenous deoxyribonucleotide triphosphate (dNTP) may lead to depletion of dNTP pools and mitochondrial dysfunction independent of polymerase-γ (pol-γ) inhibition. We collected peripheral blood mononuclear cells from 75 adults (25 cases: HIV-infected patients with mitochondrial toxicity, 25 HIV-infected positive controls, and 25 HIV-negative controls). We observed statistically significant individual and group differences in ribonucleotide (RN) and deoxyribonucleotide (dRN) pools. The median values for the RN pools were 10,062 (interquartile range (IQR): 7,090-12,590), 4,360 (IQR: 3,058-6,838), and 2,968 (IQR: 2,538-4,436) pmol/10(6) cells for negative controls, positive controls, and cases, respectively. Cases had significantly higher absolute mitochondrial DNA copy number as compared with negative controls (P < 0.05). Moreover, cases had significantly higher expression levels of pol-γ, nucleotide transporters, cellular kinases, and adenosine triphosphate (ATP)-binding cassette (ABC) proteins as compared with controls. Antiretroviral therapy (ART) perturbs RN and dRN pools. Depletion of RN and dRN pools may be associated with ART-induced mitochondrial toxicity independent of pol-γ inhibition.
Qi, Wenjing; Zhao, Jianming; Zhang, Wei; Liu, Zhongyuan; Xu, Min; Anjum, Saima; Majeed, Saadat; Xu, Guobao
2013-07-17
Owing to its high affinity with phosphate, Zr(IV) can induce the aggregation of adenosine 5'-triphosphate (ATP)-stabilized AuNPs, leading to the change of surface plasmon resonance (SPR) absorption spectra and color of ATP-stabilized AuNP solutions. Based on these phenomena, visual and SPR sensors for Zr(IV) have been developed for the first time. The A(660 nm)/A(518 nm) values of ATP-stabilized AuNPs in SPR absorption spectra increase linearly with the concentrations of Zr(IV) from 0.5 μM to 100 μM (r=0.9971) with a detection limit of 95 nM. A visual Zr(IV) detection is achieved with a detection limit of 30 μM. The sensor shows excellent selectivity against other metal ions, such as Cu(2+), Fe(3+), Cd(2+), and Pb(2+). The recoveries for the detection of 5 μM, 10 μM, 25 μM and 75 μM Zr(IV) in lake water samples are 96.0%, 97.0%, 95.6% and 102.4%, respectively. The recoveries of the proposed SPR method are comparable with those of ICP-OES method. Copyright © 2013 Elsevier B.V. All rights reserved.
Kutryb-Zajac, Barbara; Mateuszuk, Lukasz; Zukowska, Paulina; Jasztal, Agnieszka; Zabielska, Magdalena A; Toczek, Marta; Jablonska, Patrycja; Zakrzewska, Agnieszka; Sitek, Barbara; Rogowski, Jan; Lango, Romuald; Slominska, Ewa M; Chlopicki, Stefan; Smolenski, Ryszard T
2016-11-01
Extracellular nucleotides and adenosine that are formed or degraded by membrane-bound ecto-enzymes could affect atherosclerosis by regulating the inflammation and thrombosis. This study aimed to evaluate a relation between ecto-enzymes that convert extracellular adenosine triphosphate to adenine dinucleotide phosphate, adenosine monophosphate, adenosine, and inosine on the surface of the vessel wall with the severity or progression of experimental and clinical atherosclerosis. Furthermore, we tested whether the inhibition of adenosine deaminase will block the development of experimental atherosclerosis. Vascular activities of ecto-nucleoside triphosphate diphosphohydrolase 1, ecto-5'-nucleotidase, and ecto-adenosine deaminase (eADA) were measured in aortas of apolipoprotein E-/- low density lipoprotein receptor (ApoE-/-LDLR-/-) and wild-type mice as well as in human aortas. Plaques were analysed in the entire aorta, aortic root, and brachiocephalic artery by Oil-Red O and Orcein Martius Scarlet Blue staining and vascular accumulation of macrophages. The cellular location of ecto-enzymes was analysed by immunofluorescence. The effect of eADA inhibition on atherosclerosis progression was studied by a 2-month deoxycoformycin treatment of ApoE-/-LDLR-/- mice. The vascular eADA activity prominently increased in ApoE-/-LDLR-/- mice when compared with wild type already at the age of 1 month and progressed along atherosclerosis development, reaching a 10-fold difference at 10 months. The activity of eADA correlated with atherosclerotic changes in human aortas. High abundance of eADA in atherosclerotic vessels originated from activated endothelial cells and macrophages. There were no changes in ecto-nucleoside triphosphate diphosphohydrolase 1 activity, whereas ecto-5'-nucleotidase was moderately decreased in ApoE-/-LDLR-/- mice. Deoxycoformycin treatment attenuated plaque development in aortic root and brachiocephalic artery of ApoE-/-LDLR-/- mice, suppressed vascular
Bayliss, Jill; Delarosa, Sara; Wu, Jianfeng; Peterson, Jonathan R; Eboda, Oluwatobi N; Su, Grace L; Hemmila, Mark; Krebsbach, Paul H; Cederna, Paul S; Wang, Stewart C; Xi, Chuanwu; Levi, Benjamin
2014-01-01
Extracellular adenosine triphosphate (ATP), present in thermally injured tissue, modulates the inflammatory response and causes significant tissue damage. The authors hypothesize that neutrophil infiltration and ensuing tissue necrosis would be mitigated by removing ATP-dependent signaling at the burn site. Mice were subjected to 30% TBSA partial-thickness scald burn by dorsal skin immersion in a water bath at 60 or 20°C (nonburn controls). In the treatment arm, an ATP hydrolyzing enzyme, apyrase, was applied directly to the site immediately after injury. Skin was harvested after 24 hours and 5 days for hematoxylin and eosin stain, elastase, and Ki-67 staining. Tumor necrosis factor (TNF)-α and interferon (IFN)-β expression were measured through quantitative real-time polymerase chain reaction. At 24 hours, the amount of neutrophil infiltration was different between the burn and burn + apyrase groups (P < .001). Necrosis was less extensive in the apyrase group when compared with the burn group at 24 hours and 5 days. TNF-α and IFN-β expression at 24 hours in the apyrase group was lower than in the burn group (P < .05). However, Ki-67 signaling was not significantly different among the groups. The results of this study support the role of extracellular ATP in neutrophil activity. The authors demonstrate that ATP hydrolysis at the burn site allays the neutrophil response to thermal injury and reduces tissue necrosis. This decrease in inflammation and tissue necrosis is at least partially because of TNF-α and IFN-β signaling. Apyrase could be used as topical inflammatory regulators to quell the injury caused by inflammation.
Beyer, K; Nuscher, B
1996-12-10
The interaction of cardiolipin with the isolated ADP/ATP carrier protein from beef heart mitochondria has been studied by means of the unmasking of a single cysteinyl residue, Cys56, which accompanies the conformational transition of the protein [Leblanc, P., & Clauser, H, (1972) FEBS Lett. 23, 107-113]. The unmasking was monitored by using the static fluorescence of the sulfhydryl reagent N-(1-pyrenyl)maleimide (PYM). The rate of PYM binding that was observed after initiation of the conformational transition by ADP was drastically reduced in the presence of cardiolipin (CL). Phospholipids other than CL were much less effective. It can be shown that the conformational transition and the binding reaction are both affected by CL, although to varying extents. An enhancement of the rate of the ADP-dependent PYM binding was observed upon digestion of the protein bound phospholipid by phospholipase A2. The phospholipase treatment also led to an increased ADP-independent PYM binding, thus indicating that the ADP control of the carrier transition was gradually lost. The ADP control could be fully restored through the addition of CL, provided that the phospholipase incubation had been terminated after approximately 1 h. These results will be discussed in relation to an earlier report of tight cardiolipin binding [Beyer, K., & Klingenberg, M. (1985) Biochemistry 24, 3821-3826] and to current structural models of the ADP/ATP carrier protein.
Li, Dapeng; Qin, Na; Zhang, Longteng; Lv, Jian; Li, Qingzheng; Luo, Yongkang
2016-11-15
The impact of different concentrations of Na(+), K(+), Ca(2+), Mg(2+), Fe(2+), and Zn(2+) on the degradation of adenosine triphosphate (ATP) and the influence of these ions on the activity of adenosine monophosphate deaminase (AMP-deaminase) and acid phosphatase (ACP) in common carp fillets (in vivo) during 4°C storage was examined. The content of ATP, inosine monophosphate (IMP), and hypoxanthine (Hx), and the activity of AMP-deaminase and ACP were determined. Results indicated that the effects of different concentrations of six kinds of metal ions on AMP-deaminase and ACP were not the same. Na(+), K(+), Fe(2+), and Zn(2+) enhanced AMP-deaminase activity, which led to the rapid degradation of ATP and to the generation of a large quantity of IMP within a short time. Ca(2+) and Mg(2+) delayed the change in AMP-deaminase and ACP activity in carp and caused a further delay in the degradation of ATP. Fe(2+) and Zn(2+) inhibited ACP activity, which reduced the decomposition of IMP and the formation of Hx. Copyright © 2016 Elsevier Ltd. All rights reserved.
Thuwanut, P; Tipkantha, W; Siriaroonrat, B; Comizzoli, P; Chatdarong, K
2017-04-01
The Indochinese leopard (Panthera pardus delacouri) population, included in CITES Appendix I, has been declining for decades. Proper gamete preservation condition is critical for breeding programme management using artificial insemination or in vitro fertilization (IVF). The present study aimed at investigating the impact of post-thawing treatment of leopard semen with extracellular adenosine 5'-triphosphate (ATPe) on sperm quality (including morphological traits and ability to fertilize an oocyte). Semen from six adult male leopards was collected by electroejaculation (one ejaculation per cat). After the evaluation of the fresh sample quality, the semen was cryopreserved (10 × 10 6 cells per straw; two straws per cat). After thawing, the sperm sample from the first straw of each cat was divided into three aliquots: control (no ATPe), supplemented with 1.0 or 2.5 mM ATPe that were evaluated for sperm quality at 10, 30 min and 3 hr post-thawing. The sperm sample from the second straw, supplemented with 0, 1.0 or 2.5 mM ATPe for 30 min, was assessed for IVF with domestic cat oocytes. Sperm quality (all metrics) was negatively affected by the cryopreservation process (p ≤ .05). However, the percentage of sperm motility, level of progressive motility and percentage of plasma membrane integrity did not differ (p > .05) among post-thawing groups. The sperm mitochondrial membrane potential was enhanced (p ≤ .05) by ATPe treatment (1.0 and 2.5 mM; 10 min to 3 hr of incubation). Furthermore, incubation of ATPe (1.0 and 2.5 mM) for 30 min could promote sperm velocity patterns (curvilinear velocity; VCL and straight line velocity; VSL) (p ≤ .05). The percentage of pronuclear formation and cleaved embryos was increased (p ≤ .05) after 1.0 ATPe treatment (49.8 ± 2.8; 45.9 ± 1.5) compared to 0 mM (41.4 ± 3.3; 38.9 ± 0.5) whereas the number of sperm binding/oocyte did not significantly differ among groups. In summary, we suggest that ATPe
Inhibition of Dengue Virus RNA Synthesis by an Adenosine Nucleoside ▿ †
Chen, Yen-Liang; Yin, Zheng; Duraiswamy, Jeyaraj; Schul, Wouter; Lim, Chin Chin; Liu, Boping; Xu, Hao Ying; Qing, Min; Yip, Andy; Wang, Gang; Chan, Wai Ling; Tan, Hui Pen; Lo, Melissa; Liung, Sarah; Kondreddi, Ravinder Reddy; Rao, Ranga; Gu, Helen; He, Handan; Keller, Thomas H.; Shi, Pei-Yong
2010-01-01
We recently reported that (2R,3R,4R,5R)-2-(4-amino-pyrrolo[2,3-d]pyrimidin-7-yl)-3-ethynyl-5-hydroxy-methyl-tetrahydro-furan-3,4-diol is a potent inhibitor of dengue virus (DENV), with 50% effective concentration (EC50) and cytotoxic concentration (CC50) values of 0.7 μM and >100 μM, respectively. Here we describe the synthesis, structure-activity relationship, and antiviral characterization of the inhibitor. In an AG129 mouse model, a single-dose treatment of DENV-infected mice with the compound suppressed peak viremia and completely prevented death. Mode-of-action analysis using a DENV replicon indicated that the compound blocks viral RNA synthesis. Recombinant adenosine kinase could convert the compound to a monophosphate form. Suppression of host adenosine kinase, using a specific inhibitor (iodotubercidin) or small interfering RNA (siRNA), abolished or reduced the compound's antiviral activity in cell culture. Studies of rats showed that 14C-labeled compound was converted to mono-, di-, and triphosphate metabolites in vivo. Collectively, the results suggest that this adenosine inhibitor is phosphorylated to an active (triphosphate) form which functions as a chain terminator for viral RNA synthesis. PMID:20457821
Yang, Ya-Chun; Wang, Yen-Ting; Tseng, Wei-Lung
2017-03-22
Numerous compounds such as protein and double-stranded DNA have been shown to efficiently inhibit intrinsic peroxidase-mimic activity in Fe 3 O 4 nanoparticles (NP) and other related nanomaterials. However, only a few studies have focused on finding new compounds for enhancing the catalytic activity of Fe 3 O 4 NP-related nanomaterials. Herein, phosphate containing adenosine analogs are reported to enhance the oxidation reaction of hydrogen peroxide (H 2 O 2 ) and amplex ultrared (AU) for improving the peroxidase-like activity in Fe 3 O 4 NPs. This enhancement is suggested to be a result of the binding of adenosine analogs to Fe 2+ /Fe 3+ sites on the NP surface and from adenosine 5'-monophosphate (AMP) acting as the distal histidine residue of horseradish peroxidase for activating H 2 O 2 . Phosphate containing adenosine analogs revealed the following trend for the enhanced activity of Fe 3 O 4 NPs: AMP > adenosine 5'-diphosphate > adenosine 5'-triphosphate. The peroxidase-like activity in the Fe 3 O 4 NPs progressively increased with increasing AMP concentration and polyadenosine length. The Michaelis constant for AMP attached Fe 3 O 4 NPs is 5.3-fold lower and the maximum velocity is 2.7-fold higher than those of the bare Fe 3 O 4 NPs. Furthermore, on the basis of AMP promoted peroxidase mimicking activity in the Fe 3 O 4 NPs and the adsorption of protein on the NP surface, a selective fluorescent turn-off system for the detection of urinary protein is developed.
Bushon, R.N.; Brady, A.M.; Likirdopulos, C.A.; Cireddu, J.V.
2009-01-01
Aims: The aim of this study was to examine a rapid method for detecting Escherichia coli and enterococci in recreational water. Methods and Results: Water samples were assayed for E. coli and enterococci by traditional and immunomagnetic separation/adenosine triphosphate (IMS/ATP) methods. Three sample treatments were evaluated for the IMS/ATP method: double filtration, single filtration, and direct analysis. Pearson's correlation analysis showed strong, significant, linear relations between IMS/ATP and traditional methods for all sample treatments; strongest linear correlations were with the direct analysis (r = 0.62 and 0.77 for E. coli and enterococci, respectively). Additionally, simple linear regression was used to estimate bacteria concentrations as a function of IMS/ATP results. The correct classification of water-quality criteria was 67% for E. coli and 80% for enterococci. Conclusions: The IMS/ATP method is a viable alternative to traditional methods for faecal-indicator bacteria. Significance and Impact of the Study: The IMS/ATP method addresses critical public health needs for the rapid detection of faecal-indicator contamination and has potential for satisfying US legislative mandates requiring methods to detect bathing water contamination in 2 h or less. Moreover, IMS/ATP equipment is considerably less costly and more portable than that for molecular methods, making the method suitable for field applications. ?? 2009 The Authors.
Qian, Zhaosheng; Chai, Lujing; Tang, Cong; Huang, Yuanyuan; Chen, Jianrong; Feng, Hui
2015-03-03
A convenient, reliable, and highly sensitive real-time assay for alkaline phosphatase (ALP) activity in the continuous and recyclable way is established on the basis of aggregation and disaggregation of carbon quantum dots (CQDs) through the competitive assay approach. CQDs and adenosine triphosphate (ATP) were used as the fluorescent indicator and substrate for ALP activity assessment, respectively. Richness of carboxyl groups on the surface of CQDs enables their severe aggregation triggered by cerium ions, which results in effective fluorescence quenching. Under the catalytic hydrolysis of ALP, ATP can be rapidly transformed to phosphate ions. Stronger affinity of phosphate ions to cerium ions than carboxyl groups is taken advantage of to achieve fluorescence recovery induced by redispersion of CQDs in the presence of ALP and ATP. Quantitative evaluation of ALP activity in a broad range from 4.6 to 383.3 U/L with the detection limit of 1.4 U/L can be realized in this way, which endows the assay with high enough sensitivity for practical detection in human serum. The assay can be used in a recyclable way for more than three times since the generated product CePO4 as a precipitate can be easily removed from the standard assay system. This strategy broadens the sensing application of fluorescent CQDs with excellent biocompatibility and provides an example based on disaggregation in optical probe development.
Kerr, Ian D; Jones, Peter M; George, Anthony M
2010-02-01
One of the Holy Grails of ATP-binding cassette transporter research is a structural understanding of drug binding and transport in a eukaryotic multidrug resistance pump. These transporters are front-line mediators of drug resistance in cancers and represent an important therapeutic target in future chemotherapy. Although there has been intensive biochemical research into the human multidrug pumps, their 3D structure at atomic resolution remains unknown. The recent determination of the structure of a mouse P-glycoprotein at subatomic resolution is complemented by structures for a number of prokaryotic homologues. These structures have provided advances into our knowledge of the ATP-binding cassette exporter structure and mechanism, and have provided the template data for a number of homology modelling studies designed to reconcile biochemical data on these clinically important proteins.
Predictive Structure and Topology of Peroxisomal ATP-Binding Cassette (ABC) Transporters
Andreoletti, Pierre; Raas, Quentin; Gondcaille, Catherine; Cherkaoui-Malki, Mustapha; Trompier, Doriane; Savary, Stéphane
2017-01-01
The peroxisomal ATP-binding Cassette (ABC) transporters, which are called ABCD1, ABCD2 and ABCD3, are transmembrane proteins involved in the transport of various lipids that allow their degradation inside the organelle. Defective ABCD1 leads to the accumulation of very long-chain fatty acids and is associated with a complex and severe neurodegenerative disorder called X-linked adrenoleukodystrophy (X-ALD). Although the nucleotide-binding domain is highly conserved and characterized within the ABC transporters family, solid data are missing for the transmembrane domain (TMD) of ABCD proteins. The lack of a clear consensus on the secondary and tertiary structure of the TMDs weakens any structure-function hypothesis based on the very diverse ABCD1 mutations found in X-ALD patients. Therefore, we first reinvestigated thoroughly the structure-function data available and performed refined alignments of ABCD protein sequences. Based on the 2.85 Å resolution crystal structure of the mitochondrial ABC transporter ABCB10, here we propose a structural model of peroxisomal ABCD proteins that specifies the position of the transmembrane and coupling helices, and highlight functional motifs and putative important amino acid residues. PMID:28737695
USDA-ARS?s Scientific Manuscript database
Individuals with type 2 diabetes mellitus are at increased risk of developing atherosclerosis. This may be partially attributable to suppression of macrophage ATP-binding cassette (ABC) transporter mediated cholesterol efflux by sustained elevated blood glucose concentrations. Two models were used...
Zeglis, Brian M.; Pierre, Valérie C.; Kaiser, Jens T.; Barton, Jacqueline K.
2009-01-01
Two crystal structures are determined for Δ-Rh(bpy)2(chrysi)3+ (chrysi = 5,6-chrysenequinone diimine) bound to the oligonucleotide duplex 5′-CGGAAATTACCG-3′ containing two adenosine-adenosine mismatches (italics) through metalloinsertion. Diffraction quality crystals with two different space groups (P3221 and P43212) were obtained under very similar crystallization conditions. In both structures, the bulky rhodium complex inserts into the two mismatched sites from the minor groove side, ejecting the mismatched bases into the major groove. The conformational changes are localized to the mismatched site; the metal complex replaces the mismatched base pair without an increase in base pair rise. The expansive metal complex is accommodated in the duplex by a slight opening in the phosphodiester backbone; all sugars retain a C2′-endo puckering, and flanking base pairs neither stretch nor shear. The structures differ, however, in that in one of the structures, an additional metal complex is bound by intercalation from the major groove at the central 5′-AT-3′ step. We conclude that this additional metal complex is intercalated into this central step because of crystal packing forces. The structures described here of Δ-Rh(bpy)2(chrysi)3+ bound to thermodynamically destabilized AA mismatches share critical features with binding by metalloinsertion in two other oligonucleotides containing different single base mismatches. These results underscore the generality of the metalloinsertion as a new mode of non-covalent binding by small molecules with a DNA duplex. PMID:19374348
Dong, Qian; Ernst, Sarah E.; Ostedgaard, Lynda S.; Shah, Viral S.; Ver Heul, Amanda R.; Welsh, Michael J.; Randak, Christoph O.
2015-01-01
The ATP-binding cassette (ABC) transporter cystic fibrosis transmembrane conductance regulator (CFTR) and two other non-membrane-bound ABC proteins, Rad50 and a structural maintenance of chromosome (SMC) protein, exhibit adenylate kinase activity in the presence of physiologic concentrations of ATP and AMP or ADP (ATP + AMP ⇆ 2 ADP). The crystal structure of the nucleotide-binding domain of an SMC protein in complex with the adenylate kinase bisubstrate inhibitor P1,P5-di(adenosine-5′) pentaphosphate (Ap5A) suggests that AMP binds to the conserved Q-loop glutamine during the adenylate kinase reaction. Therefore, we hypothesized that mutating the corresponding residue in CFTR, Gln-1291, selectively disrupts adenylate kinase-dependent channel gating at physiologic nucleotide concentrations. We found that substituting Gln-1291 with bulky side-chain amino acids abolished the effects of Ap5A, AMP, and adenosine 5′-monophosphoramidate on CFTR channel function. 8-Azidoadenosine 5′-monophosphate photolabeling of the AMP-binding site and adenylate kinase activity were disrupted in Q1291F CFTR. The Gln-1291 mutations did not alter the potency of ATP at stimulating current or ATP-dependent gating when ATP was the only nucleotide present. However, when physiologic concentrations of ADP and AMP were added, adenylate kinase-deficient Q1291F channels opened significantly less than wild type. Consistent with this result, we found that Q1291F CFTR displayed significantly reduced Cl− channel function in well differentiated primary human airway epithelia. These results indicate that a highly conserved residue of an ABC transporter plays an important role in adenylate kinase-dependent CFTR gating. Furthermore, the results suggest that adenylate kinase activity is important for normal CFTR channel function in airway epithelia. PMID:25887396
Dong, Qian; Ernst, Sarah E; Ostedgaard, Lynda S; Shah, Viral S; Ver Heul, Amanda R; Welsh, Michael J; Randak, Christoph O
2015-05-29
The ATP-binding cassette (ABC) transporter cystic fibrosis transmembrane conductance regulator (CFTR) and two other non-membrane-bound ABC proteins, Rad50 and a structural maintenance of chromosome (SMC) protein, exhibit adenylate kinase activity in the presence of physiologic concentrations of ATP and AMP or ADP (ATP + AMP ⇆ 2 ADP). The crystal structure of the nucleotide-binding domain of an SMC protein in complex with the adenylate kinase bisubstrate inhibitor P(1),P(5)-di(adenosine-5') pentaphosphate (Ap5A) suggests that AMP binds to the conserved Q-loop glutamine during the adenylate kinase reaction. Therefore, we hypothesized that mutating the corresponding residue in CFTR, Gln-1291, selectively disrupts adenylate kinase-dependent channel gating at physiologic nucleotide concentrations. We found that substituting Gln-1291 with bulky side-chain amino acids abolished the effects of Ap5A, AMP, and adenosine 5'-monophosphoramidate on CFTR channel function. 8-Azidoadenosine 5'-monophosphate photolabeling of the AMP-binding site and adenylate kinase activity were disrupted in Q1291F CFTR. The Gln-1291 mutations did not alter the potency of ATP at stimulating current or ATP-dependent gating when ATP was the only nucleotide present. However, when physiologic concentrations of ADP and AMP were added, adenylate kinase-deficient Q1291F channels opened significantly less than wild type. Consistent with this result, we found that Q1291F CFTR displayed significantly reduced Cl(-) channel function in well differentiated primary human airway epithelia. These results indicate that a highly conserved residue of an ABC transporter plays an important role in adenylate kinase-dependent CFTR gating. Furthermore, the results suggest that adenylate kinase activity is important for normal CFTR channel function in airway epithelia. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Masitinib antagonizes ATP-binding cassette subfamily G member 2-mediated multidrug resistance
KATHAWALA, RISHIL J.; CHEN, JUN-JIANG; ZHANG, YUN-KAI; WANG, YI-JUN; PATEL, ATISH; WANG, DE-SHEN; TALELE, TANAJI T.; ASHBY, CHARLES R.; CHEN, ZHE-SHENG
2014-01-01
In this in vitro study, we determined whether masitinib could reverse multidrug resistance (MDR) in cells overexpressing the ATP binding cassette subfamily G member 2 (ABCG2) transporter. Masitinib (1.25 and 2.5 μM) significantly decreases the resistance to mitoxantrone (MX), SN38 and doxorubicin in HEK293 and H460 cells overexpressing the ABCG2 transporter. In addition, masitinib (2.5 μM) significantly increased the intracellular accumulation of [3H]-MX, a substrate for ABCG2, by inhibiting the function of ABCG2 and significantly decreased the efflux of [3H]-MX. However, masitinib (2.5 μM) did not significantly alter the expression of the ABCG2 protein. In addition, a docking model suggested that masitinib binds within the transmembrane region of a homology-modeled human ABCG2 transporter. Overall, our in vitro findings suggest that masitinib reverses MDR to various anti-neoplastic drugs in HEK293 and H460 cells overexpressing ABCG2 by inhibiting their transport activity as opposed to altering their levels of expression. PMID:24626598
Watanabe, Seiji; Kono, Yasuo; Oishi-Tobinaga, Yoko; Yamada, Shin-ichi; Hara, Masato; Kano, Tatsuhiko
2002-10-01
To compare the effects of the stimulation of adenosine receptors and acetylcholine receptors in the cardiac conduction system in patients with ischemic heart disease. Prospective. University hospital. Patients scheduled for coronary artery bypass graft surgery (n = 37). The patients were divided into 3 groups: control group (n = 9), adenosine triphosphate (ATP) group (n = 12), and edrophonium group (n = 16). ATP (10 mg) or edrophonium (0.25 mg/kg) followed by saline or the same amount of saline was injected through a central venous catheter. ATP induced atrioventricular block in 10 of 12 patients (83%). The ATP injection produced a more prominent prolongation in the PQ duration (P-R interval) (139%) than in the P-P interval (105%) at the last beat before the development of atrioventricular block. The prolongation in the P-P interval (11%, average 85 msec) and PQ duration during atrioventricular block disappeared immediately after the restoration of atrioventricular conduction. After edrophonium, the maximal prolongation in P-P (118%, p < 0.01) and PQ (120%, p < 0.01) intervals was the same. P-P interval remained prolonged (p < 0.01) after PQ interval returned to baseline. Neither ATP nor edrophonium affected the QRS duration. These findings suggest that ATP predominantly inhibited atrioventricular conduction rather than the firing rate of sinoatrial nodes, and edrophonium inhibited both proportionally even with prolonged inhibitory action on the sinoatrial nodes. An injection of ATP is needed only when a transient cardiac standstill is requested, such as in endovascular grafting surgery. Edrophonium may be used to slow heart rate during coronary artery bypass graft surgery. Copyright 2002, Elsevier Science (USA). All rights reserved.
Song, Quanwei; Peng, Manshu; Wang, Le; He, Dacheng; Ouyang, Jin
2016-03-15
The novel, facile and universal aptamer-based methods for the highly sensitive and selective fluorescence detection of important biomolecules have attracted considerable interest. Here, we present a label-free aptasensor for adenosine triphosphate (ATP) detection in aqueous solutions by using an ultra-sensitive nucleic acid stain PicoGreen (PG) as a fluorescent indicator and core-shell Ag@SiO2 nanoparticles (NPs) as a metal-enhanced fluorescence (MEF) platform. In the presence of ATP, the complementary DNA (cDNA)/aptamer duplexes confined onto the Ag@SiO2 NPs surface can release their aptamers into the buffered solution, causing a significant reduction in fluorescence intensity. By virtue of the amplified fluorescence signal, this aptasensor toward ATP can achieve a detection limit of 14.2 nM with a wide linear range and exhibit a good assay performance in complex biological samples. This sensing approach is cost-effective and efficient because it avoids the fluorescence labeling process and the use of any enzymes. Hence, this method may offer an alternative tool for determining the concentrations of ATP in biochemical and biomedical research. Copyright © 2015 Elsevier B.V. All rights reserved.
Sakkal, Leon A; Rajkowski, Kyle Z; Armen, Roger S
2017-06-05
Following insights from recent crystal structures of the muscarinic acetylcholine receptor, binding modes of Positive Allosteric Modulators (PAMs) were predicted under the assumption that PAMs should bind to the extracellular surface of the active state. A series of well-characterized PAMs for adenosine (A 1 R, A 2A R, A 3 R) and muscarinic acetylcholine (M 1 R, M 5 R) receptors were modeled using both rigid and flexible receptor CHARMM-based molecular docking. Studies of adenosine receptors investigated the molecular basis of the probe-dependence of PAM activity by modeling in complex with specific agonist radioligands. Consensus binding modes map common pharmacophore features of several chemical series to specific binding interactions. These models provide a rationalization of how PAM binding slows agonist radioligand dissociation kinetics. M 1 R PAMs were predicted to bind in the analogous M 2 R PAM LY2119620 binding site. The M 5 R NAM (ML-375) was predicted to bind in the PAM (ML-380) binding site with a unique induced-fit receptor conformation. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
ATP-Binding Cassette Efflux Transporters in Human Placenta
Ni, Zhanglin; Mao, Qingcheng
2010-01-01
Pregnant women are often complicated with diseases including viral or bacterial infections, epilepsy, hypertension, or pregnancy-induced conditions such as depression and gestational diabetes that require treatment with medication. In addition, substance abuse during pregnancy remains a major public health problem. Many drugs used by pregnant women are off label without the necessary dose, efficacy, and safety data required for rational dosing regimens of these drugs. Thus, a major concern arising from the widespread use of drugs by pregnant women is the transfer of drugs across the placental barrier, leading to potential toxicity to the developing fetus. Knowledge regarding the ATP-binding cassette (ABC) efflux transporters, which play an important role in drug transfer across the placental barrier, is absolutely critical for optimizing the therapeutic strategy to treat the mother while protecting the fetus during pregnancy. Such transporters include P-glycoprotein (P-gp, gene symbol ABCB1), the breast cancer resistance protein (BCRP, gene symbol ABCG2), and the multidrug resistance proteins (MRPs, gene symbol ABCCs). In this review, we summarize the current knowledge with respect to developmental expression and regulation, membrane localization, functional significance, and genetic polymorphisms of these ABC transporters in the placenta and their relevance to fetal drug exposure and toxicity. PMID:21118087
Wang, Wei; Yi, Xiaosong; Ren, Yanfang; Xie, Qiufei
2016-10-01
Adenosine 5'-triphosphate (ATP) is a potent signaling molecule that regulates diverse biological activities in cells. Its effects on human dental pulp cells (HDPCs) remain unknown. This study aimed to examine the effects of ATP on proliferation and differentiation of HDPCs. Reverse transcription polymerase chain reaction was performed to explore the mRNA expression of P2 receptor subtypes. Cell Counting Kit-8 test and flow cytometry analysis were used to examine the effects of ATP on proliferation and cell cycle of HDPCs. The effects of ATP on differentiation of HDPCs were examined by using alizarin red S staining, energy-dispersive x-ray analysis, Western blot analysis, and real-time polymerase chain reaction. The purinoceptors P2X3, P2X4, P2X5, P2X7, and all P2Y receptor subtypes were confirmed to present in HDPCs. ATP enhanced HDPC proliferation at 10 μmol/L concentration. However, it inhibited cell proliferation by arresting the cell cycle in G0G1 phase (P < .05 versus control) and induced odontoblastic differentiation, ERK/MAPK activation, and dentin matrix protein 1 (DMP1) and dentin sialophosphoprotein (DSPP) mRNA transcriptions at 800 μmol/L concentration. Suramin, an ATP receptor antagonist, inhibited ERK/MAPK activation and HDPC odontoblastic differentiation (P < .05 versus control). Extracellular ATP activates P2 receptors and downstream signaling events that induce HDPC odontogenic differentiation. Thus, ATP may promote dental pulp tissue healing and repair through P2 signaling. Results provide new insights into the molecular regulation of pulpal wound healing. Copyright © 2016 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.
Zhang, Lianshan; Liang, Libin; Tong, Tong; Qin, Yuguo; Xu, Yanping; Tong, Xinglong
2016-10-01
Context Recently, adenosine triphosphate (ATP) was occasionally found to decrease the triglyceride (TG) levels in several hyperlipidemic patients in our clinical practice. Objective The study investigates the anti-hyperlipidemic effects of ATP in a high-fat fed rabbit model and hyperlipidemic patients. Materials and methods Twenty-four rabbits were randomly divided into three groups of eight animals each as follows: normal diet, high-fat diet and high-fat diet + ATP group. ATP supplementation (40 mg/day) was started at the 20th day and lasted for 10 days. Serum concentrations of total cholesterol (TC), TG, LDL-C, HDL-C were measured on the 20th day and 30th day. Heart, liver and aorta were subjected histopathological examination. Twenty outpatients diagnosed primary hyperlipidemia took ATP at a dose of 60 mg twice a day for 1 week. Results Feeding rabbits with a high-fat diet resulted in a significant elevation of lipid parameters including TC, TG, LDL-C, VLDL-C compared to the normal diet group (p < 0.01). ATP treatment significantly decreased serum TG level (p < 0.01), whilst other parameters remained statistically unaltered. Meanwhile, ATP significantly reduced the thickness of fat layer in cardiac epicardium (p < 0.05) and pathological gradation of ballooning degeneration in hepatocytes (p < 0.05). After taking ATP for 1 week, hyperlipidemia patients exhibited a significant decrease of TG (p < 0.01), but other lipid parameters had no significant change. Discussion and conclusion The study indicates that ATP selectively decreases serum TG levels in high-fat diet rabbits and hyperlipidemic patients. Therefore, ATP supplementation may provide an effective approach to control TG level.
Lin, Chunshui; Cai, Zhixiong; Wang, Yiru; Zhu, Zhi; Yang, Chaoyong James; Chen, Xi
2014-07-15
A simple, rapid, label-free, and ultrasensitive fluorescence strategy for adenosine triphosphate (ATP) detection was developed using a loop DNA probe with low background noise. In this strategy, a loop DNA probe, which is the substrate for both ligation and digestion enzyme reaction, was designed. SYBR green I (SG I), a double-stranded specific dye, was applied for the readout fluorescence signal. Exonuclease I (Exo I) and exonuclease III (Exo III), sequence-independent nucleases, were selected to digest the loop DNA probe in order to minimize the background fluorescence signal. As a result, in the absence of ATP, the loop DNA was completely digested by Exo I and Exo III, leading to low background fluorescence owing to the weak electrostatic interaction between SG I and mononucleotides. On the other hand, ATP induced the ligation of the nicking site, and the sealed loop DNA resisted the digestion of Exo I and ExoIII, resulting in a remarkable increase of fluorescence response. Upon background noise reduction, the sensitivity of the ATP determination was improved significantly, and the detection limitation was found to be 1.2 pM, which is much lower than that in almost all the previously reported methods. This strategy has promise for wide application in the determination of ATP.
Ito, Mai; Arakawa, Toshiya; Okayama, Miki; Shitara, Akiko; Mizoguchi, Itaru; Takuma, Taishin
2014-11-01
The periodontal ligament (PDL) receives mechanical stress (MS) from dental occlusion or orthodontic tooth movement. Mechanical stress is thought to be a trigger for remodeling of the PDL and alveolar bone, although its signaling mechanism is still unclear. So we investigated the effect of MS on adenosine triphosphate (ATP) release and extracellular signal-regulated kinases (ERK) phosphorylation in PDL cells. Mechanical stress was applied to human PDL cells as centrifugation-mediated gravity loading. Apyrase, Ca(2+)-free medium and purinergic receptor agonists and antagonists were utilized to analyze the contribution of purinergic receptors to ERK phosphorylation. Gravity loading and ATP increased ERK phosphorylation by 5 and 2.5 times, respectively. Gravity loading induced ATP release from PDL cells by tenfold. Apyrase and suramin diminished ERK phosphorylation induced by both gravity loading and ATP. Under Ca(2+)-free conditions the phosphorylation by gravity loading was partially decreased, whereas ATP-induced phosphorylation was unaffected. Receptors P2Y4 and P2Y6 were prominently expressed in the PDL cells. Gravity loading induced ATP release and ERK phosphorylation in PDL fibroblasts, and ATP signaling via P2Y receptors was partially involved in this phosphorylation, which in turn would enhance gene expression for the remodeling of PDL tissue during orthodontic tooth movement. © 2013 Wiley Publishing Asia Pty Ltd.
Detergent-free purification of ABC (ATP-binding-cassette) transporters.
Gulati, Sonali; Jamshad, Mohammed; Knowles, Timothy J; Morrison, Kerrie A; Downing, Rebecca; Cant, Natasha; Collins, Richard; Koenderink, Jan B; Ford, Robert C; Overduin, Michael; Kerr, Ian D; Dafforn, Timothy R; Rothnie, Alice J
2014-07-15
ABC (ATP-binding-cassette) transporters carry out many vital functions and are involved in numerous diseases, but study of the structure and function of these proteins is often hampered by their large size and membrane location. Membrane protein purification usually utilizes detergents to solubilize the protein from the membrane, effectively removing it from its native lipid environment. Subsequently, lipids have to be added back and detergent removed to reconstitute the protein into a lipid bilayer. In the present study, we present the application of a new methodology for the extraction and purification of ABC transporters without the use of detergent, instead, using a copolymer, SMA (polystyrene-co-maleic acid). SMA inserts into a bilayer and assembles into discrete particles, essentially solubilizing the membrane into small discs of bilayer encircled by a polymer, termed SMALPs (SMA lipid particles). We show that this polymer can extract several eukaryotic ABC transporters, P-glycoprotein (ABCB1), MRP1 (multidrug-resistance protein 1; ABCC1), MRP4 (ABCC4), ABCG2 and CFTR (cystic fibrosis transmembrane conductance regulator; ABCC7), from a range of different expression systems. The SMALP-encapsulated ABC transporters can be purified by affinity chromatography, and are able to bind ligands comparably with those in native membranes or detergent micelles. A greater degree of purity and enhanced stability is seen compared with detergent solubilization. The present study demonstrates that eukaryotic ABC transporters can be extracted and purified without ever being removed from their lipid bilayer environment, opening up a wide range of possibilities for the future study of their structure and function.
Peng, Shuang; Gerasimenko, Julia V.; Tsugorka, Tatiana; Gryshchenko, Oleksiy; Samarasinghe, Sujith; Gerasimenko, Oleg V.
2016-01-01
Exocytotic secretion of digestive enzymes from pancreatic acinar cells is elicited by physiological cytosolic Ca2+ signals, occurring as repetitive short-lasting spikes largely confined to the secretory granule region, that stimulate mitochondrial adenosine triphosphate (ATP) production. By contrast, sustained global cytosolic Ca2+ elevations decrease ATP levels and cause necrosis, leading to the disease acute pancreatitis (AP). Toxic Ca2+ signals can be evoked by products of alcohol and fatty acids as well as bile acids. Here, we have investigated the mechanism by which l-asparaginase evokes AP. Asparaginase is an essential element in the successful treatment of acute lymphoblastic leukaemia, the most common type of cancer affecting children, but AP is a side-effect occurring in about 5–10% of cases. Like other pancreatitis-inducing agents, asparaginase evoked intracellular Ca2+ release followed by Ca2+ entry and also substantially reduced Ca2+ extrusion because of decreased intracellular ATP levels. The toxic Ca2+ signals caused extensive necrosis. The asparaginase-induced pathology depended on protease-activated receptor 2 and its inhibition prevented the toxic Ca2+ signals and necrosis. We tested the effects of inhibiting the Ca2+ release-activated Ca2+ entry by the Ca2+ channel inhibitor GSK-7975A. This markedly reduced asparaginase-induced Ca2+ entry and also protected effectively against the development of necrosis. This article is part of the themed issue ‘Evolution brings Ca2+ and ATP together to control life and death’. PMID:27377732
Peng, Shuang; Gerasimenko, Julia V; Tsugorka, Tatiana; Gryshchenko, Oleksiy; Samarasinghe, Sujith; Petersen, Ole H; Gerasimenko, Oleg V
2016-08-05
Exocytotic secretion of digestive enzymes from pancreatic acinar cells is elicited by physiological cytosolic Ca(2+) signals, occurring as repetitive short-lasting spikes largely confined to the secretory granule region, that stimulate mitochondrial adenosine triphosphate (ATP) production. By contrast, sustained global cytosolic Ca(2+) elevations decrease ATP levels and cause necrosis, leading to the disease acute pancreatitis (AP). Toxic Ca(2+) signals can be evoked by products of alcohol and fatty acids as well as bile acids. Here, we have investigated the mechanism by which l-asparaginase evokes AP. Asparaginase is an essential element in the successful treatment of acute lymphoblastic leukaemia, the most common type of cancer affecting children, but AP is a side-effect occurring in about 5-10% of cases. Like other pancreatitis-inducing agents, asparaginase evoked intracellular Ca(2+) release followed by Ca(2+) entry and also substantially reduced Ca(2+) extrusion because of decreased intracellular ATP levels. The toxic Ca(2+) signals caused extensive necrosis. The asparaginase-induced pathology depended on protease-activated receptor 2 and its inhibition prevented the toxic Ca(2+) signals and necrosis. We tested the effects of inhibiting the Ca(2+) release-activated Ca(2+) entry by the Ca(2+) channel inhibitor GSK-7975A. This markedly reduced asparaginase-induced Ca(2+) entry and also protected effectively against the development of necrosis.This article is part of the themed issue 'Evolution brings Ca(2+) and ATP together to control life and death'. © 2016 The Authors.
Chi, Yan; Wang, Le; Liu, Yuanyuan; Ma, Yanhua; Wang, Renjun; Han, Xiaofei; Qiao, Hui; Lin, Jiabin; Matsuura, Eiji; Liu, Shuqian; Liu, Qingping
2014-06-01
ATP binding cassette transporter A1 (ABCA1) is a member of the ATP-binding cassette transporter family. It plays an essential role in mediating the efflux of excess cholesterol. It is known that peroxisome proliferator-activated receptor gamma (PPARγ) promoted ABCA1 expression. We previously found 7-ketocholesteryl-9-carboxynonanoate (oxLig-1) upregulated ABCA1 partially through CD36 mediated signals. In the present study, we intended to test if PPARγ signally is involved in the upregulation mediated by oxLig-1. First, we docked oxLig-1 and the ligand-binding domain (LBD) of PPARγ by using AutoDock 3.05 and subsequently confirmed the binding by ELISA assay. Western blotting analyses showed that oxLig-1 induces liver X receptor alpha (LXRα), PPARγ and consequently ABCA1 expression. Furthermore, oxLig-1 significantly enhanced ApoA-I-mediated cholesterol efflux. Pretreatment with an inhibitor for PPARγ (GW9662) or/and LXRα (GGPP) attenuated oxLig-1-induced ABCA1 expression. Under PPARγ knockdown by using PPARγ-shRNA, oxLig-1-induced ABCA1 expression and cholesterol efflux in THP-1 macrophages was blocked by 62% and 25% respectively. These observations suggest that oxLig-1 is a novel PPARγ agonist, promoting ApoA-I-mediated cholesterol efflux from THP-1 macrophages by increasing ABCA1 expression via induction of PPARγ. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Automated cassette-to-cassette substrate handling system
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kraus, Joseph Arthur; Boyer, Jeremy James; Mack, Joseph
2014-03-18
An automated cassette-to-cassette substrate handling system includes a cassette storage module for storing a plurality of substrates in cassettes before and after processing. A substrate carrier storage module stores a plurality of substrate carriers. A substrate carrier loading/unloading module loads substrates from the cassette storage module onto the plurality of substrate carriers and unloads substrates from the plurality of substrate carriers to the cassette storage module. A transport mechanism transports the plurality of substrates between the cassette storage module and the plurality of substrate carriers and transports the plurality of substrate carriers between the substrate carrier loading/unloading module and amore » processing chamber. A vision system recognizes recesses in the plurality of substrate carriers corresponding to empty substrate positions in the substrate carrier. A processor receives data from the vision system and instructs the transport mechanism to transport substrates to positions on the substrate carrier in response to the received data.« less
Kogawa, Rikitake; Okumura, Yasuo; Watanabe, Ichiro; Sonoda, Kazumasa; Sasaki, Naoko; Takahashi, Keiko; Iso, Kazuki; Nagashima, Koichi; Ohkubo, Kimie; Nakai, Toshiko; Kunimoto, Satoshi; Hirayama, Atsushi
2016-01-01
Dormant pulmonary vein (PV) conduction revealed by adenosine/adenosine triphosphate (ATP) provocation test and exit block to the left atrium by pacing from the PV side of the ablation line ("pace and ablate" method) are used to ensure durable pulmonary vein isolation (PVI). However, the mechanistic relation between ATP-provoked PV reconnection and the unexcitable gap along the ablation line is unclear.Forty-five patients with atrial fibrillation (AF) (paroxysmal: 31 patients, persistent: 14 patients; age: 61.1 ± 9.7 years) underwent extensive encircling PVI (EEPVI, 179 PVs). After completion of EEPVI, an ATP provocation test (30 mg, bolus injection) and unipolar pacing (output, 10 mA; pulse width, 2 ms) were performed along the previous EEPVI ablation line to identify excitable gaps. Dormant conduction was revealed in 29 (34 sites) of 179 PVs (16.2%) after EEP-VI (22/45 patients). Pace capture was revealed in 59 (89 sites) of 179 PVs (33.0%) after EEPVI (39/45 patients), and overlapping sites, ie, sites showing both dormant conduction and pace capture, were observed in 22 of 179 (12.3%) PVs (17/45 patients).Some of the ATP-provoked dormant PV reconnection sites were identical to the sites with excitable gaps revealed by pace capture, but most of the PV sites were differently distributed, suggesting that the main underling mechanism differs between these two forms of reconnection. These findings also suggest that performance of the ATP provocation test followed by the "pace and ablate" method can reduce the occurrence of chronic PV reconnections.
Moni, R W; Romero, F S; Daly, J W
1995-08-01
1. Adenoregulin is an amphilic peptide isolated from skin mucus of the tree frog, Phyllomedusa bicolor. Synthetic adenoregulin enhanced the binding of agonists to several G-protein-coupled receptors in rat brain membranes. 2. The maximal enhancement of agonist binding, and in parentheses, the concentration of adenoregulin affording maximal enhancement were as follows: 60% (20 microM) for A1-adenosine receptors, 30% (100 microM) for A2a-adenosine receptors, 20% (2 microM) for alpha 2-adrenergic receptors, and 30% (10 microM) for 5HT1A receptors. High affinity agonist binding for A1-, alpha 2-, and 5HT1A-receptors was virtually abolished by GTP gamma S in the presence of adenoregulin, but was only partially abolished in its absence. Magnesium ions increased the binding of agonists to receptors and reduced the enhancement elicited by adenoregulin. 3. The effect of adenoregulin on binding of N6-cyclohexyladenosine ([3H]CHA) to A1-receptors was relatively slow and was irreversible. Adenoregulin increased the Bmax value for [3H]CHA binding sites, and the proportion of high affinity states, and slowed the rate of [3H]CHA dissociation. Binding of the A1-selective antagonist, [3H]DPCPX, was maximally enhanced by only 13% at 2 microM adenoregulin. Basal and A1-adenosine receptor-stimulated binding of [35S]GTP gamma S were maximally enhanced 45% and 23%, respectively, by 50 microM adenoregulin. In CHAPS-solubilized membranes from rat cortex, the binding of both [3H]CHA and [3H]DPCPX were enhanced by adenoregulin. Binding of [3H]CHA to membranes from DDT1 MF-2 cells was maximally enhanced 17% at 20 microM adenoregulin. In intact DDT1 MF-2 cells, 20 microM adenoregulin did not potentiate the inhibition of cyclic AMP accumulation mediated via the adenosine A1 receptor. 4. It is proposed that adenoregulin enhances agonist binding through a mechanism involving enhancement of guanyl nucleotide exchange at G-proteins, resulting in a conversion of receptors into a high affinity state
Gibbs, Shawn G; Sayles, Harlan; Colbert, Erica M; Hewlett, Angela; Chaika, Oleg; Smith, Philip W
2014-05-28
The Adenosine triphosphate (ATP) bioluminescence assay was utilized in laboratory evaluations to determine the presence and concentration of vegetative and spore forms of Bacillus anthracis Sterne 34F2. Seventeen surfaces from the healthcare environment were selected for evaluation. Surfaces were inoculated with 50 µL of organism suspensions at three concentrations of 104, 106, 108 colony forming units per surface (CFU/surface) of B. anthracis. Culture-based methods and ATP based methods were utilized to determine concentrations. When all concentrations were evaluated together, a positive correlation between log-adjusted CFU and Relative Light Units (RLU) for endospores and vegetative cells was established. When concentrations were evaluated separately, a significant correlation was not demonstrated. This study demonstrated a positive correlation for ATP and culture-based methods for the vegetative cells of B. anthracis. When evaluating the endospores and combining both metabolic states, the ATP measurements and CFU recovered did not correspond to the initial concentrations on the evaluated surfaces. The results of our study show that the low ATP signal which does not correlate well to the CFU results would not make the ATP measuring devises effective in confirming contamination residual from a bioterrorist event.
Aptamer-Binding Directed DNA Origami Pattern for Logic Gates.
Yang, Jing; Jiang, Shuoxing; Liu, Xiangrong; Pan, Linqiang; Zhang, Cheng
2016-12-14
In this study, an aptamer-substrate strategy is introduced to control programmable DNA origami pattern. Combined with DNA aptamer-substrate binding and DNAzyme-cutting, small DNA tiles were specifically controlled to fill into the predesigned DNA origami frame. Here, a set of DNA logic gates (OR, YES, and AND) are performed in response to the stimuli of adenosine triphosphate (ATP) and cocaine. The experimental results are confirmed by AFM imaging and time-dependent fluorescence changes, demonstrating that the geometric patterns are regulated in a controllable and programmable manner. Our approach provides a new platform for engineering programmable origami nanopatterns and constructing complex DNA nanodevices.
Omori, Takashi; Idehara, Kenji; Kojima, Hajime; Sozu, Takashi; Arima, Kazunori; Goto, Hirohiko; Hanada, Tomohiko; Ikarashi, Yoshiaki; Inoda, Taketo; Kanazawa, Yukiko; Kosaka, Tadashi; Maki, Eiji; Morimoto, Takashi; Shinoda, Shinsuke; Shinoda, Naoki; Takeyoshi, Masahiro; Tanaka, Masashi; Uratani, Mamoru; Usami, Masahito; Yamanaka, Atsushi; Yoneda, Tomofumi; Yoshimura, Isao; Yuasa, Atsuko
2008-01-01
The murine local lymph node assay (LLNA) is a well-established alternative to the guinea pig maximization test (GPMT) or Buehler test (BT) for the assessment of the skin sensitizing ability of drugs and chemicals. Daicel Chemical Industries Ltd. has developed a modified LLNA based on the adenosine triphosphate (ATP) content (LLNA-DA). We conducted 2 interlaboratory validation studies to evaluate the reliability and relevance of LLNA-DA. The experiment involved 17 laboratories, wherein 14 chemicals were examined under blinded conditions. In the first study, 3 chemicals were examined in 10 laboratories and the remaining 9 were examined in 3 laboratories. In the second study, 1 chemical was examined in 7 laboratories and the remaining 4 chemicals were examined in 4 laboratories. The data were expressed as the ATP content for each chemical-treated group, and the stimulation index (SI) for each chemical-treated group was determined as the increase in the ATP content relative to the concurrent vehicle control group. An SI of 3 was set as the cut-off value for exhibiting skin sensitization activity. The results of the first study obtained in the experiments conducted for the 3 chemicals that were examined in all the 10 laboratories and for 5 of the remaining 9 chemicals were sufficiently consistent with small variations in their SI values. The sensitivity, specificity, and accuracy of LLNA-DA against those of GPMT/BT were 7/8 (87.5%), 3/3 (100%), and 10/11 (90.9%), respectively. In the second study, all the 5 chemicals studied demonstrated acceptably small interlaboratory variations. In the first study, a large variation was observed for 2 chemicals; in the second study, this variation was small. It was attributed to the application of dimethylsulfoxide as the solvent for the metallic salts. In conclusion, these 2 studies provide good evidence for the reliability of the LLNA-DA.
Mairbäurl, Heimo; Ruppe, Florian A; Bärtsch, Peter
2013-10-01
Specific adenosine triphosphate (ATP) release from red blood cells has been discussed as a possible mediator controlling microcirculation in states of decreased tissue oxygen. Because intravascular hemolysis might also contribute to plasma ATP, we tested in vitro which portion of ATP release is due to hemolysis in typical exercise-induced strains to the red blood cells (shear stress, deoxygenation, and lactic acidosis). Human erythrocytes were suspended in dextran-containing media (hematocrit 10%) and were exposed to shear stress in a rotating Couette viscometer at 37°C. Desaturation (oxygen saturation of hemoglobin ∼20%) was achieved by tonometry with N2 before shear stress exposure. Cells not exposed to shear stress were used as controls. Na lactate (15 mM), lactic acid (15 mM, pH 7.0), and HCl (pH 7.0) were added to simulate exercise-induced lactic acidosis. After incubation, extracellular hemoglobin was measured to quantify hemolysis. ATP was measured with the luciferase assay. Shear stress increased extracellular ATP in a stress-related and time-dependent manner. Hypoxia induced a ∼10-fold increase in extracellular ATP in nonsheared cells and shear stress-exposed cells. Lactic acid had no significant effect on ATP release and hemolysis. In normoxic cells, approximately 20%-50% of extracellular ATP was due to hemolysis. This proportion decreased to less than 10% in hypoxic cells. Our results indicate that when exposing red blood cells to typical strains they encounter when passing through capillaries of exercising skeletal muscle, ATP release from red blood cells is caused mainly by deoxygenation and shear stress, whereas lactic acidosis had only a minor effect. Hemolysis effects were decreased when hemoglobin was deoxygenated. Together, by specific release and hemolysis, extracellular ATP reaches values that have been shown to cause local vasodilatation.
Patel, B A
2014-02-01
Mechanical stimulation of the mucosal epithelium results in increased serotonin (5-HT) release from enterochromaffin (EC) cells. Little is known about how this process varies in different regions of the intestinal tract; however, purines are felt to play a role. We studied the relationship between mechanical stimulation, adenosine triphosphate (ATP), and 5-HT release from ileal and colonic mucosal tissue. Amperometric recordings of ATP and 5-HT were carried out using an ATP biosensor and boron-doped diamond microelectrode. Levels of extracellular ATP and 5-HT were monitored using high performance liquid chromatography. Under basal conditions, 5-HT levels were significantly decreased in the ileum (p < 0.001) but not the colon in the presence of the P2 antagonist suramin (100 μM). Ecto-ATPase inhibitor ARL67156 (10 μM) elevated ATP levels in the ileum and colon (both p < 0.001), but only 5-HT levels in the ileum (p < 0.001). Exogenous ATP increased 5-HT release in the presence of tetrodotoxin in the ileum (p < 0.001), but had not effect in the colon. Mechanical stimulation increased levels of 5-HT in the ileum (p < 0.001) and colon (p < 0.01), but levels returned to baseline in the presence of suramin and MRS2179 in the ileum. The onset of 5-HT release was delayed following mechanical stimulation. The rise time of the ATP response was quicker than that of 5-HT during mechanical stimulation. During mechanical stimulation of the mucosal epithelium, ATP mediates 5-HT release from EC cells in the ileum, but not the colon. Mucosal 5-HT signaling following mechanical stimulation is varied in different regions of the intestinal tract. © 2013 John Wiley & Sons Ltd.
Dwivedi, Yogesh; Rao, Jagadeesh Sridhara; Rizavi, Hooriyah S; Kotowski, Jacek; Conley, Robert R; Roberts, Rosalinda C; Tamminga, Carol A; Pandey, Ghanshyam N
2003-03-01
Cyclic adenosine monophosphate response element binding protein (CREB) is a transcription factor that, on phosphorylation by protein kinases, is activated, and in response, regulates the transcription of many neuronally expressed genes. In view of the recent observations that catalytic properties and/or expression of many kinases that mediate their physiological responses through the activation of CREB are altered in the postmortem brain of subjects who commit suicide (hereafter referred to as suicide subjects), we examined the status of CREB in suicidal behavior. These studies were performed in Brodmann area (BA) 9 and hippocampus obtained from 26 suicide subjects and 20 nonpsychiatric healthy control subjects. Messenger RNA levels of CREB and neuron-specific enolase were determined in total RNA by means of quantitative reverse transcriptase-polymerase chain reaction. Protein levels and the functional characteristics of CREB were determined in nuclear fractions by means of Western blot and cyclic adenosine monophosphate response element (CRE)-DNA binding activity, respectively. In the same nuclear fraction, we determined the catalytic activity of cyclic adenosine monophosphate-stimulated protein kinase A by means of enzymatic assay. We observed a significant reduction in messenger RNA and protein levels of CREB, CRE-DNA binding activity, and basal and cyclic adenosine monophosphate-stimulated protein kinase A activity in BA 9 and hippocampus of suicide subjects, without any change in messenger RNA levels of neuron-specific enolase in BA 9. Except for protein kinase A activity, changes in CREB expression and CRE-DNA binding activity were present in all suicide subjects, irrespective of diagnosis. These changes were unrelated to postmortem intervals, age, sex, or antidepressant treatment. Given the significance of CREB in mediating various physiological functions through gene transcription, our results of decreased expression and functional characteristics of CREB
Mahajan, Shikha; Manetsch, Roman; Merkler, David J.; Stevens Jr., Stanley M.
2015-01-01
Proteomics is a powerful approach used for investigating the complex molecular mechanisms of disease pathogenesis and progression. An important challenge in modern protein profiling approaches involves targeting of specific protein activities in order to identify altered molecular processes associated with disease pathophysiology. Adenosine-binding proteins represent an important subset of the proteome where aberrant expression or activity changes of these proteins have been implicated in numerous human diseases. Herein, we describe an affinity-based approach for the enrichment of adenosine-binding proteins from a complex cell proteome. A novel N 6-biotinylated-8-azido-adenosine probe (AdoR probe) was synthesized, which contains a reactive group that forms a covalent bond with the target proteins, as well as a biotin tag for affinity enrichment using avidin chromatography. Probe specificity was confirmed with protein standards prior to further evaluation in a complex protein mixture consisting of a lysate derived from mouse neuroblastoma N18TG2 cells. Protein identification and relative quantitation using mass spectrometry allowed for the identification of small variations in abundance of nucleoside- and nucleotide-binding proteins in these samples where a significant enrichment of AdoR-binding proteins in the labeled proteome from the neuroblastoma cells was observed. The results from this study demonstrate the utility of this method to enrich for nucleoside- and nucleotide-binding proteins in a complex protein mixture, pointing towards a unique set of proteins that can be examined in the context of further understanding mechanisms of disease, or fundamental biological processes in general. PMID:25671571
Pan, Li; Lin, Haidan; Tian, Si; Bai, Dingqun; Kong, Yuhan; Yu, Lehua
2017-09-01
To study the mechanisms of human glioblastoma cell resistance to methyl ester pyropheophorbide-a-mediated photodynamic therapy (MPPa-PDT) and the relationship between the cells and adenosine triphosphate-binding cassette superfamily G member 2 (ABCG2). The sensitivity of four human glioma cell lines (U87, A172, SHG-44, and U251) to MPPa-PDT was detected with a CCK-8 assay. Cell apoptosis, intracellular MPPa, and singlet oxygen were tested with flow cytometry. The mRNA and protein expression of ATP-binding cassette transporters (ABCG2, MRP1, and MDR1) were detected by PCR and Western blot, respectively. Both the sensitivity to MPPa-PDT and intracellular MPPa in A172 were the lowest among the four cell lines, while expression of ABCG2 mRNA and protein in A172 were the highest. The intracellular MPPa and ROS in A172 receiving MPPa-PDT significantly increased after using the ABCG2 inhibitor fumitremorgin C (FTC). Both cell viability and apoptosis in A172 cells undergoing MPPa-PDT were significantly improved with FTC. ABCG2 plays a significant role in the resistance of A172 to MPPa-PDT. Lasers Surg. Med. 49:719-726, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Martić, Sanela; Rains, Meghan K; Freeman, Daniel; Kraatz, Heinz-Bernhard
2011-08-17
The 5'-γ-ferrocenyl adenosine triphosphate (Fc-ATP) bioconjugates (3 and 4), containing the poly(ethylene glycol) spacers, were synthesized and compared to a hydrophobic analogue as co-substrates for the following protein kinases: sarcoma related kinase (Src), cyclin-dependent kinase (CDK), casein kinase II (CK2α), and protein kinase A (PKA). Electrochemical kinase assays indicate that the hydrophobic Fc-ATP analogue was an optimal co-substrate for which K(M) values were determined to be in the 30-200 μM range, depending on the particular protein kinase. The luminescence kinase assay demonstrated the kinase utility for all Fc-ATP conjugates, which is in line with the electrochemical data. Moreover, Fc-ATP bioconjugates exhibit competitive behavior with respect to ATP. Relatively poor performance of the polar Fc-ATP bioconjugates as co-substrates for protein kinases was presumably due to the additional H-bonding and electrostatic interactions of the poly(ethylene glycol) linkers of Fc-ATP with the kinase catalytic site and the target peptides. Phosphorylation of the full-length protein, His-tagged pro-caspase-3, was demonstrated through Fc-phosphoamide transfer to the Ser residues of the surface-bound protein by electrochemical means. These results suggest that electrochemical detection of the peptide and protein Fc-phosphorylation via tailored Fc-ATP co-substrates may be useful for probing protein-protein interactions.
Nally, J. E.; Muir, T. C.; Guild, S. B.
1992-01-01
1. The effects of noradrenaline and alpha,beta,methylene adenosine 5'-triphosphate (alpha,beta,methylene ATP) on polyphosphoinositide metabolism, phosphatidylcholine hydrolysis and contraction in rabbit saphenous arteries were investigated. The effect of noradrenaline upon polyphosphoinositide metabolism was also investigated in the rat tail artery. 2. Noradrenaline (10(-7)-10(-4) M) evoked a concentration-dependent increase in total inositol phosphate accumulation in the rat tail but not in the rabbit saphenous artery. Propranolol (3 x 10(-6) M) did not alter this result in the rabbit saphenous artery. In addition, alpha,beta,methylene ATP (10(-6) M) significantly increased total inositol phosphate accumulation in the rabbit saphenous artery, while potassium chloride (8 x 10(-2) M) was ineffective. 3. Phorbol 1,2-myristate 1,3-acetate (3 x 10(-8) M) enhanced noradrenaline (10(-2)-10(-4) M)-evoked contractions in rabbit saphenous artery. The contractile responses to potassium chloride (1- 16 x 10(-2) M) in tissues treated with 6-hydroxydopamine (5 x 10(-4) M), in vitro, were unaffected by these concentrations of the phorbol ester. 4. Noradrenaline (10(-6)-10(-4) M) evoked a concentration-dependent increase in the levels of choline and choline phosphate, but not in those of glycerophosphocholine, in the rabbit saphenous artery. Choline levels increased significantly over the first 15-30 s then declined to control levels within 2 min of addition of noradrenaline (10(-5) M). A smaller initial rise in choline phosphate levels (15-30 s) was followed by a larger secondary rise at 2-4 min.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:1327389
USDA-ARS?s Scientific Manuscript database
ATP-binding cassette (ABC) transporters are essential for membrane translocation in diverse biological processes, such as plant development and defense response. Here, a general control non-derepressible (GCN)-type ABC transporter gene, designated LrABCF1, was identified from Cucumber mosaic virus (...
Li, M; Marubayashi, A; Nakaya, Y; Fukui, K; Arase, S
2001-12-01
The mechanism by which minoxidil, an adenosine-triphosphate-sensitive potassium channel opener, induces hypertrichosis remains to be elucidated. Minoxidil has been reported to stimulate the production of vascular endothelial growth factor, a possible promoter of hair growth, in cultured dermal papilla cells. The mechanism of production of vascular endothelial growth factor remains unclear, however. We hypothesize that adenosine serves as a mediator of vascular endothelial growth factor production. Minoxidil-induced increases in levels of intracellular Ca(2+) and vascular endothelial growth factor production in cultured dermal papilla cells were found to be inhibited by 8-sulfophenyl theophylline, a specific antagonist for adenosine receptors, suggesting that dermal papilla cells possess adenosine receptors and sulfonylurea receptors, the latter of which is a well-known target receptor for adenosine-triphosphate-sensitive potassium channel openers. The expression of sulfonylurea receptor 2B and of the adenosine A1, A2A, and A2B receptors was detected in dermal papilla cells by means of reverse transcription polymerase chain reaction analysis. In order to determine which of the adenosine receptor subtypes contribute to minoxidil-induced hair growth, the effects of subtype-specific antagonists for adenosine receptors were investigated. Significant inhibition in increase in intracellular calcium level by minoxidil or adenosine was observed as the result of pretreatment with 8-cyclopentyl-1,3-dipropylxanthine, an antagonist for adenosine A1 receptor, but not by 3,7-dimethyl-1-propargyl-xanthine, an antagonist for adenosine A2 receptor, whereas vascular endothelial growth factor production was blocked by both adenosine A1 and A2 receptor antagonists. These results indicate that the effect of minoxidil is mediated by adenosine, which triggers intracellular signal transduction via both adenosine A1 and A2 receptors, and that the expression of sulfonylurea receptor 2B in
Serum albumin promotes ATP-binding cassette transporter-dependent sterol uptake in yeast.
Marek, Magdalena; Silvestro, Daniele; Fredslund, Maria D; Andersen, Tonni G; Pomorski, Thomas G
2014-12-01
Sterol uptake in fungi is a multistep process that involves interaction between external sterols and the cell wall, incorporation of sterol molecules into the plasma membrane, and subsequent integration into intracellular membranes for turnover. ATP-binding cassette (ABC) transporters have been implicated in sterol uptake, but key features of their activity remain to be elucidated. Here, we apply fluorescent cholesterol (NBD-cholesterol) to monitor sterol uptake under anaerobic and aerobic conditions in two fungal species, Candida glabrata (Cg) and Saccharomyces cerevisiae (Sc). We found that in both fungal species, ABC transporter-dependent uptake of cholesterol under anaerobic conditions and in mutants lacking HEM1 gene is promoted in the presence of the serum protein albumin that is able to bind the sterol molecule. Furthermore, the C. glabrata ABC transporter CgAus1p expressed in S. cerevisiae requires the presence of serum or albumin for efficient cholesterol uptake. These results suggest that albumin can serve as sterol donor in ABC transporter-dependent sterol uptake, a process potentially important for growth of C. glabrata inside infected humans. © 2014 The Authors. FEMS Yeast Research published by John Wiley & Sons Ltd on behalf of Federation of European Microbiological Societies.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liang, B.T.
1989-06-01
Adenosine receptors in a spontaneously contracting atrial myocyte culture from 14-day chick embryos were characterized by radioligand binding studies and by examining the involvement of G-protein in coupling these receptors to a high-affinity state and to the adenylate cyclase and the myocyte contractility. Binding of the antagonist radioligand (3H)-8-cyclopentyl-1,3-diproylxanthine ((3H)CPX) was rapid, reversible and saturable and was to a homogeneous population of sites with a Kd value of 2.1 +/- 0.2 nM and an apparent maximum binding of 26.2 +/- 3 fmol/mg of protein (n = 10, +/- S.E.). Guanyl-5-yl-(beta, gamma-imido)diphosphate had no effect on either the Kd or themore » maximum binding and CPX reversed the N6-R-phenyl-2-propyladenosine-induced inhibition of adenylate cyclase activity and contractility, indicating that (3H) CPX is an antagonist radioligand. Competition curves for (3H) CPX binding by a series of reference adenosine agonists were consistent with labeling of an A1 adenosine receptor and were better fit by a two-site model than by a one-site model. ADP-ribosylation of the G-protein by the endogenous NAD+ in the presence of pertussis toxin shifted the competition curves from bi to monophasic with Ki values similar to those of the KL observed in the absence of prior pertussis intoxication. The adenosine agonists were capable of inhibiting both the adenylate cyclase activity and myocyte contractility in either the absence or the presence of isoproterenol. The A1 adenosine receptor-selective antagonist CPX reversed these agonist effects. The order of ability of the reference adenosine receptor agonists in causing these inhibitory effects was similar to the order of potency of the same agonists in inhibiting the specific (3H)CPX binding (N6-R-phenyl-2-propyladenosine greater than N6-S-phenyl-2-propyladenosine or N-ethyladenosine-5'-uronic acid).« less
Koo, Tai Yeon; Lee, Jae-Ghi; Yan, Ji-Jing; Jang, Joon Young; Ju, Kyung Don; Han, Miyeun; Oh, Kook-Hwan; Ahn, Curie; Yang, Jaeseok
2017-08-01
Extracellular adenosine triphosphate (ATP) binds to purinergic receptors and, as a danger molecule, promotes inflammatory responses. Here we tested whether periodate-oxidized ATP (oATP), a P2X7 receptor (P2X7R) antagonist can attenuate renal ischemia-reperfusion injury and clarify the related cellular mechanisms. Treatment with oATP prior to ischemia-reperfusion injury decreased blood urea nitrogen, serum creatinine, the tubular injury score, and tubular epithelial cell apoptosis after injury. The infiltration of dendritic cells, neutrophils, macrophages, CD69 + CD4 + , and CD44 + CD4 + T cells was attenuated, but renal Foxp3 + CD4 + Treg infiltration was increased by oATP. The levels of IL-6 and CCL2 were reduced in the oATP group. Additionally, oATP treatment following injury improved renal function, decreased the infiltration of innate and adaptive effector cells, and increased the renal infiltration of Foxp3 + CD4 + Tregs. Post-ischemia-reperfusion injury oATP treatment increased tubular cell proliferation and reduced renal fibrosis. oATP treatment attenuated renal functional deterioration after ischemia-reperfusion injury in RAG-1 knockout mice; however, Treg depletion using PC61 abrogated the beneficial effects of oATP in wild-type mice. Furthermore, oATP treatment after transfer of Tregs from wild-type mice improved the beneficial effects of Tregs on ischemia-reperfusion injury, but treatment after transfer of Tregs from P2X7R knockout mice did not. Renal ischemia-reperfusion injury was also attenuated in P2X7R knockout mice. Experiments using bone marrow chimeras established that P2X7R expression on hematopoietic cells rather than non-hematopoietic cells, such as tubular epithelial cells, plays a major role in ischemia-reperfusion injury. Thus, oATP attenuated acute renal damage and facilitated renal recovery in ischemia-reperfusion injury by expansion of Tregs. Copyright © 2017 International Society of Nephrology. Published by Elsevier Inc. All rights
Kwon, Hye Youn; Kim, Im-kyung; Kang, Jeonghyun; Sohn, Seung-Kook; Lee, Kang Young
2016-01-01
Purpose We evaluated the usefulness of the in vitro adenosine triphosphate-based chemotherapy response assay (ATP-CRA) for prediction of clinical response to fluorouracil-based adjuvant chemotherapy in stage II colorectal cancer. Materials and Methods Tumor specimens of 86 patients with pathologically confirmed stage II colorectal adenocarcinoma were tested for chemosensitivity to fluorouracil. Chemosensitivity was determined by cell death rate (CDR) of drug-exposed cells, calculated by comparing the intracellular ATP level with that of untreated controls. Results Among the 86 enrolled patients who underwent radical surgery followed by fluorouracil-based adjuvant chemotherapy, recurrence was found in 11 patients (12.7%). The CDR ≥ 20% group was associated with better disease-free survival than the CDR < 20% group (89.4% vs. 70.1%, p=0.027). Multivariate analysis showed that CDR < 20% and T4 stage were poor prognostic factors for disease-free survival after fluorouracil-based adjuvant chemotherapy. Conclusion In stage II colorectal cancer, the in vitro ATP-CRA may be useful in identifying patients likely to benefit from fluorouracil-based adjuvant chemotherapy. PMID:26511802
Pellegrini, Peter; Sauerwein, Rebecca; Finlayson, Tyler; McLeod, Jennifer; Covell, David A; Maier, Tom; Machida, Curtis A
2009-04-01
Enamel decalcification is a common problem in orthodontics. The objectives of this randomized clinical study were to enumerate and compare plaque bacteria surrounding 2 bracket types, self-ligating (SL) vs elastomeric ligating (E), and to determine whether adenosine triphosphate (ATP)-driven bioluminescence could be used for rapid assessment of bacterial load in plaque. Patients (ages, 11-17 years) were bonded with SL and E brackets in 14 maxillary and 12 mandibular arches by using a split-mouth design. Recall visits were at 1 and 5 weeks after bonding. Plaque specimens were assayed for oral bacteria and subjected to ATP-driven bioluminescence determinations with a luciferin-based assay. In most patients, teeth bonded with SL attachments had fewer bacteria in plaque than did teeth bonded with E brackets. At 1 and 5 weeks after bonding, the means for SL vs E brackets were statistically lower for total bacteria and oral streptococci (P <0.05). ATP bioluminescence values were statistically correlated to the total oral bacteria and oral streptococci, with correlation coefficients of 0.895 and 0.843, respectively. SL appliances promote reduced retention of oral bacteria, and ATP bioluminescence might be a useful tool in the rapid quantification of bacterial load and the assessment of oral hygiene during orthodontic treatment.
de Korte, Dirk; Kleine, Mya; Korsten, Herbert G H; Verhoeven, Arthur J
2008-06-01
Current additive solutions (ASs) for red cells (RBCs) do not maintain a constant level of critical metabolites such as adenosine triphosphate (ATP) and 2,3-diphosphoglycerate acid (2,3-DPG) during cold storage. From the literature it is known that the intracellular pH is an important determinant of RBC metabolism. Therefore, a new, alkaline, AS was developed with the aim to allow cold storage of RBCs with stable product characteristics. Whole blood-derived RBCs (leukoreduced) were resuspended in experimental medium phosphate-adenine-guanosine-glucose-gluconate-mannitol (PAGGG-M; pH 8.2) with and without washing in the same medium. During cold storage several in vitro variables, such as intracellular pH, 2,3-DPG, ATP, and hemolysis, were analyzed. During cold storage, RBCs resuspended in PAGGG-M showed a constant ATP level (approx. 6 mumol/g Hb) and a very limited hemolysis (<0.2%). The 2,3-DPG content showed an increase until Day 21 (150% of initial level), followed by a slow decrease, with at Day 35 still 100 percent of the initial level. RBCs washed in PAGGG-M even showed a continuous increase of 2,3-DPG during 35 days, with a maximum level of 200 percent of the initial value. The effect of PAGGG-M appears to be related to long-lasting effects of the initial intracellular pH shortly after production. Resuspension of RBCs in our alkaline medium PAGGG-M resulted in a RBC unit of high quality during storage for up to at least 35 days, with 2,3-DPG levels of higher than 10 mumol per g Hb, hemolysis of less than 0.2 percent, and ATP levels of higher than 5 mumol per g Hb.
Gill, Gordon N.; Garren, Leonard D.
1969-01-01
The binding of cyclic 3′,5′-adenosine monophosphate (cyclic AMP) within the adrenal cortical cell was studied. Cyclic AMP binds specifically to a protein which is associated predominantly with the microsomal fraction of the cell. The binding protein was purified approximately 100-fold. PMID:4308274
Alfa, Michelle J; Fatima, Iram; Olson, Nancy
2013-03-01
The study objective was to verify that the adenosine triphosphate (ATP) benchmark of <200 relative light units (RLUs) was achievable in a busy endoscopy clinic that followed the manufacturer's manual cleaning instructions. All channels from patient-used colonoscopes (20) and duodenoscopes (20) in a tertiary care hospital endoscopy clinic were sampled after manual cleaning and tested for residual ATP. The ATP test benchmark for adequate manual cleaning was set at <200 RLUs. The benchmark for protein was <6.4 μg/cm(2), and, for bioburden, it was <4-log10 colony-forming units/cm(2). Our data demonstrated that 96% (115/120) of channels from 20 colonoscopes and 20 duodenoscopes evaluated met the ATP benchmark of <200 RLUs. The 5 channels that exceeded 200 RLUs were all elevator guide-wire channels. All 120 of the manually cleaned endoscopes tested had protein and bioburden levels that were compliant with accepted benchmarks for manual cleaning for suction-biopsy, air-water, and auxiliary water channels. Our data confirmed that, by following the endoscope manufacturer's manual cleaning recommendations, 96% of channels in gastrointestinal endoscopes would have <200 RLUs for the ATP test kit evaluated and would meet the accepted clean benchmarks for protein and bioburden. Copyright © 2013 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Mosby, Inc. All rights reserved.
Park, Joon Seong; Kim, Jae Keun; Yoon, Dong Sup
2016-11-01
Gemcitabine-based regimens represent the standard systemic first line treatment in patients after pancreatic resection. However, the clinical impact of gemcitabine varies significantly in individuals because of chemoresistance. An in vitro adenosine triphosphate based chemotherapy response assay (ATP-CRA) was designed to evaluate the sensitivity of cancer cells to various chemotherapeutic agents. This study investigated the correlation between in vitro gemcitabine sensitivity of tumor cells and early recurrence after curative resection. From January 2007 to December 2010, the ATP-CRA for gemcitabine was tested in 64 patients surgically treated for pancreas cancer at Gangnam Severance Hospital, Seoul, Korea. We analyzed the relationship between chemosensitivity and early systemic recurrence in patients with pancreas cancer to predict disease-free survival (DFS) after curative resection in pancreas cancer. The mean cell death rate (CDR) was 20.0 (±14.5) and divided into two groups according to the mean values of the CDR. Lymphovascular invasion was more frequently shown in gemcitabine resistance group without statistical significance. In univariate and multivariate analysis, advanced tumor stage and gemcitabine sensitive group (CDR ≥ 20) were identified as independent prognostic factors for DFS. Gemcitabine sensitivity measured by ATP-CRA was well correlated with in vivo drug responsibility to predict early recurrence following gemcitabine-based adjuvant chemotherapy in patients with pancreas cancer. © 2016 Wiley Periodicals, Inc.
Zhang, Hui; Wang, Yi-Jun; Zhang, Yun-Kai; Wang, De-Shen; Kathawala, Rishil J; Patel, Atish; Talele, Tanaji T; Chen, Zhe-Sheng; Fu, Li-Wu
2014-08-01
AST1306, an inhibitor of EGFR and ErbB2, is currently in phase I of clinical trials. We evaluated the effect of AST306 on the reversal of multidrug resistance (MDR) induced by ATP-binding cassette (ABC) transporters. We found that AST1306 significantly sensitized the ABC subfamily G member 2 (ABCG2)-overexpressing cells to ABCG2 substrate chemotherapeutics. AST1306 significantly increased intracellular accumulation of [(3)H]-mitoxantrone in ABCG2-overexpressing cells by blocking ABCG2 efflux function. Moreover, AST1306 stimulated the ATPase activity of ABCG2. Homology modeling predicted the binding conformation of AST1306 to be within the transmembrane region of ABCG2. In conclusion, AST1306 could notably reverse ABCG2-mediated MDR. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Sethi, Saurabh; Huang, Robert J.; Barakat, Monique T.; Banaei, Niaz; Friedland, Shai; Banerjee, Subhas
2017-01-01
Background/Aims Recent outbreaks of duodenoscope-transmitted infections underscore the importance of adequate endoscope reprocessing. Adenosine triphosphate (ATP) bioluminescence testing allows rapid evaluation of endoscopes for bacteriological/biological residue. In this prospective study we evaluate the utility of ATP in bacteriological surveillance, and the effects of endoscopy staff education and dual cycles of cleaning and high-level disinfection (HLD) on endoscope reprocessing. Methods ATP bioluminescence was measured after pre-cleaning, manual cleaning and HLD on rinsates from suction-biopsy channels of all endoscopes and elevator channels of duodenoscopes/linear echoendoscopes after use. ATP bioluminescence was re-measured in duodenoscopes (1) after re-education and competency testing of endoscopy staff, and subsequently (2) after 2 cycles of pre-cleaning and manual cleaning and single cycle of HLD, or (3) after 2 cycles of pre-cleaning, manual cleaning and HLD. Results The ideal ATP bioluminescence benchmark of <200 relative light units (RLUs) after manual cleaning was achieved from suction-biopsy channel rinsates of all endoscopes, but 9 of 10 duodenoscope elevator channel rinsates failed to meet this benchmark. Re-education reduced RLUs in duodenoscope elevator channel rinsates after pre-cleaning (23218.0 vs 1340.5 RLUs, p<0.01) and HLD (177.0 vs 12.0 RLUs, p<0.01). After 2 cycles of manual cleaning/HLD, duodenoscope elevator channel RLUs achieved levels similar to sterile water, with corresponding negative cultures. Conclusions ATP testing offers a rapid, inexpensive alternative for detection of endoscope microbial residue. Re-education of endoscopy staff and 2 cycles of cleaning and HLD decrease elevator channel RLUs to levels similar to sterile water and may therefore minimize the risk of transmission of infections by duodenoscopes. PMID:27818222
Huang, Hong; Yan, Youyi; Zuo, Zhong; Yang, Lin; Li, Bin; Song, Yu; Liao, Linchuan
2010-09-01
Although the change in adenosine phosphate levels in muscles may contribute to the development of rigor mortis, the relationship between their levels and the onset and development of rigor mortis has not been well elucidated. In the current study, levels of the adenosine phosphates including adenosine triphosphate (ATP), adenosine diphosphate (ADP), and adenosine monophosphate (AMP) in gastrocnemius at various postmortem intervals of 180 rats from different death modes were detected by high performance liquid chromatography. The results showed that the levels of ATP and ADP significantly decreased along with the postmortem period of rats from different death mode whereas the AMP level remained the same. In addition, it was found that changes in the ATP levels in muscles after death correlated well with the development of rigor mortis. Therefore, the ATP level could serve as a reference parameter for the deduction of rigor mortis in forensic science.
Li, Pei; Zhang, Jing; Zhu, Yuanfang; Liu, Ming; Xuan, Jin
2015-11-01
Renin synthesis and release is the rate-limiting step in the renin-angiotensin system, because cyclic adenosine monophosphate (cAMP) has been identified as dominant pathway for renin gene expression, and cAMP response element-binding protein (CREB) is found in the human and mouse renin promoter. This study aimed to evaluate the role of CREB in expression of the renin gene. We created conditional deletion of CREB in mice with low-sodium diet, specifically in renin cells of the kidney. To assess the effect of CREB on renin expression, immunostaining of renin was used in samples from wild-type mice and mice with gene knock-down of CREB. Cyclic AMP response element-binding-protein-binding protein (CBP) and p300 were measured in cultured renin cells of the mice, and RNA detection was done with real-time polymerase chain reaction. With low-sodium diet, renin was expressed along the whole wall of the afferent glomerular arterioles in wild-type mice, while there was no increase or even decrease in renin expression in CREB-specific deletion mice; RNA level of renin in cultured cells decreased by 50% with single knock-down of CREB, CBP, or p300, and decreased 70% with triple knock-down of CREB, CBP, and p300. This study found that CREB was important for renin synthesis and the role of CREB can be achieved through the recruitment of co-activators CBP and p300.
Goren, A; Naccarato, T; Situm, M; Kovacevic, M; Lotti, T; McCoy, J
2017-01-01
Topical minoxidil is the only topical drug approved by the US Food and Drug Administration (FDA) for the treatment of androgenetic alopecia. However, the exact mechanism by which minoxidil stimulates anagen phase and promotes hair growth is not fully understood. In the late telegen phase of the hair follicle growth cycle, stem cells located in the bulge region differentiate and re-enter anagen phase, a period of growth lasting 2-6 years. In androgenetic alopecia, the anagen phase is shortened and a progressive miniaturization of hair follicles occurs, eventually leading to hair loss. Several studies have demonstrated that minoxidil increases the amount of intracellular Ca2+, which has been shown to up-regulate the enzyme adenosine triphosphate (ATP) synthase. A recent study demonstrated that ATP synthase, independent of its role in ATP synthesis, promotes stem cell differentiation. As such, we propose that minoxidil induced Ca2+ influx can increase stem cell differentiation and may be a key factor in the mechanism by which minoxidil facilitates hair growth. Based on our theory, we provide a roadmap for the development of a new class of drugs for the treatment of androgenetic alopecia.
AMP is an adenosine A1 receptor agonist.
Rittiner, Joseph E; Korboukh, Ilia; Hull-Ryde, Emily A; Jin, Jian; Janzen, William P; Frye, Stephen V; Zylka, Mark J
2012-02-17
Numerous receptors for ATP, ADP, and adenosine exist; however, it is currently unknown whether a receptor for the related nucleotide adenosine 5'-monophosphate (AMP) exists. Using a novel cell-based assay to visualize adenosine receptor activation in real time, we found that AMP and a non-hydrolyzable AMP analog (deoxyadenosine 5'-monophosphonate, ACP) directly activated the adenosine A(1) receptor (A(1)R). In contrast, AMP only activated the adenosine A(2B) receptor (A(2B)R) after hydrolysis to adenosine by ecto-5'-nucleotidase (NT5E, CD73) or prostatic acid phosphatase (PAP, ACPP). Adenosine and AMP were equipotent human A(1)R agonists in our real-time assay and in a cAMP accumulation assay. ACP also depressed cAMP levels in mouse cortical neurons through activation of endogenous A(1)R. Non-selective purinergic receptor antagonists (pyridoxalphosphate-6-azophenyl-2',4'-disulfonic acid and suramin) did not block adenosine- or AMP-evoked activation. Moreover, mutation of His-251 in the human A(1)R ligand binding pocket reduced AMP potency without affecting adenosine potency. In contrast, mutation of a different binding pocket residue (His-278) eliminated responses to AMP and to adenosine. Taken together, our study indicates that the physiologically relevant nucleotide AMP is a full agonist of A(1)R. In addition, our study suggests that some of the physiological effects of AMP may be direct, and not indirect through ectonucleotidases that hydrolyze this nucleotide to adenosine.
Flitney, F W; Singh, J
1980-07-01
1. A study has been made of a well documented but poorly understood response of the isolated frog ventricle to treatment with exogenous adenosine 5' triphosphate (ATP). Measurements of membrane potential, isometric twitch tension and levels of endogenous 3',5'-cyclic nucleotides have been made at various times during the ATP-induced response. 2. ATP elicits a characteristic triphasic response, which comprises an initial, abrupt increase in contractility, rising to a maximum within a few beats (first phase); followed by a period when the twitch amplitude falls, sometimes to below the control level (second phase); and superceded by a more slowly developing and longer-lasting increase in contractile force (third phase). The response is unaffected by atropine, propranolol or phentolamine. However, the prostaglandin synthetase inhibitor indomethacin depresses the first phase and entirely suppresses the third phase. 3. The inotropic effects of ATP are accompanied by changes in the shape of the action potential. These effects are dose-related. The duration of the action potential (D-30mV) and its positive overshoot (O) are increased during all phases of the response, for [ATP]o's up to 10(-5) M. However, at higher [ATP]o's, D-30mV and O ar both reduced during the second phase (but not the first or third phase), when isometric twitch tension is also depressed. The relationship between action potential duration and twitch tension (P) for different [ATP]o's is linear for all three phases of the response, but the slopes of the curves (delta P/delta D) are markedly different, indicating that the sensitivity of the contractile system to membrane depolarization is not constant, but varies continuously throughout the response. 4. ATP has a potent stimulatory effect on the metabolism of endogenous 3',5'-cyclic nucleotides. The time courses of the changes in adenosine 3','5-cyclic monophosphate (3',5'-cyclic AMP) and guanosine 3',5'-cyclic monophosphate (3',5'-cyclic GMP) are
Yukawa, Ayako; Watanabe, Rikiya; Noji, Hiroyuki
2015-03-13
F1-ATPase (F1), an important rotary motor protein, converts the chemical energy of ATP hydrolysis into mechanical energy using rotary motion with extremely high efficiency. The energy-conversion mechanism for this molecular motor has been extensively clarified by previous studies, which indicate that the interactions between the catalytic residues and the β- and γ-phosphates of ATP are indispensable for efficient catalysis and torque generation. However, the role of α-phosphate is largely unknown. In this study, we observed the rotation of F1 fuelled with an ATP analogue, adenosine 5'-[α-thio]-triphosphate (ATPαS), in which the oxygen has been substituted with a sulfur ion to perturb the α-phosphate/F1 interactions. In doing so, we have revealed that ATPαS does not appear to have any impact on the kinetic properties of the motor or on torque generation compared to ATP. On the other hand, F1 was observed to lapse into the ADP-inhibited intermediate states when in the presence of ATPαS more severely than in the presence of ATP, suggesting that the α-phosphate group of ATP contributes to the avoidance of ADP-inhibited intermediate formation. Copyright © 2015 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Miao, Y.C.; Liu, C.
2010-12-28
Lignin is a complex biopolymer derived primarily from the condensation of three monomeric precursors, the monolignols. The synthesis of monolignols occurs in the cytoplasm. To reach the cell wall where they are oxidized and polymerized, they must be transported across the cell membrane. However, the molecular mechanisms underlying the transport process are unclear. There are conflicting views about whether the transport of these precursors occurs by passive diffusion or is an energized active process; further, we know little about what chemical forms are required. Using isolated plasma and vacuolar membrane vesicles prepared from Arabidopsis, together with applying different transporter inhibitorsmore » in the assays, we examined the uptake of monolignols and their derivatives by these native membrane vesicles. We demonstrate that the transport of lignin precursors across plasmalemma and their sequestration into vacuoles are ATP-dependent primary-transport processes, involving ATP-binding cassette-like transporters. Moreover, we show that both plasma and vacuolar membrane vesicles selectively transport different forms of lignin precursors. In the presence of ATP, the inverted plasma membrane vesicles preferentially take up monolignol aglycones, whereas the vacuolar vesicles are more specific for glucoconjugates, suggesting that the different ATP-binding cassette-like transporters recognize different chemical forms in conveying them to distinct sites, and that glucosylation of monolignols is necessary for their vacuolar storage but not required for direct transport into the cell wall in Arabidopsis.« less
Neurochemical Measurement of Adenosine in Discrete Brain Regions of Five Strains of Inbred Mice
Pani, Amar K.; Jiao, Yun; Sample, Kenneth J.; Smeyne, Richard J.
2014-01-01
Adenosine (ADO), a non-classical neurotransmitter and neuromodulator, and its metabolites adenosine triphosphate (ATP), adenosine diphosphate (ADP) and adenosine monophosphate (AMP), have been shown to play an important role in a number of biochemical processes. Although their signaling is well described, it has been difficult to directly, accurately and simultaneously quantitate these purines in tissue or fluids. Here, we describe a novel method for measuring adenosine (ADO) and its metabolites using high performance liquid chromatography with electrochemical detection (HPLC-ECD). Using this chromatographic technique, we examined baseline levels of ADO and ATP, ADP and AMP in 6 different brain regions of the C57BL/6J mouse: stratum, cortex, hippocampus, olfactory bulb, substantia nigra and cerebellum and compared ADO levels in 5 different strains of mice (C57BL/6J, Swiss-Webster, FVB/NJ, 129P/J, and BALB/c). These studies demonstrate that baseline levels of purines vary significantly among the brain regions as well as between different mouse strains. These dissimilarities in purine concentrations may explain the variable phenotypes among background strains described in neurological disease models. PMID:24642754
Kudlow, J E; Leung, Y
1984-06-15
Epidermal growth factor (EGF), after binding to its receptor, activates a tyrosine-specific protein kinase which phosphorylates several substrates, including the EGF receptor itself. The effects of a photoaffinity analogue of ATP, 3'-O-(3-[N-(4-azido-2-nitrophenyl)amino]propionyl)adenosine 5'-triphosphate (arylazido-beta-alanyl-ATP) on the EGF-dependent protein kinase in A431 human tumour cell plasma membrane vesicles was investigated. This analogue was capable of inactivating the EGF-receptor kinase in a photodependent manner. Partial inactivation occurred at an analogue concentration of 1 microM and complete inactivation occurred at 10 microM when a 2 min light exposure was used. Arylazido-beta-alanine at 100 microM and ATP at 100 microM were incapable of inactivating the enzyme with 2 min of light exposure. The photodependent inactivation of the enzyme by the analogue could be partially blocked by 20 mM-ATP and more effectively blocked by either 20 mM-adenosine 5'-[beta gamma-imido]triphosphate or 20 mM-guanosine 5'-[beta gamma-imido]triphosphate, indicating nucleotide-binding site specificity. Arylazido-beta-alanyl-[alpha-32P]ATP was capable of labelling membrane proteins in a photodependent manner. Numerous proteins were labelled, the most prominent of which ran with an apparent Mr of 53000 on polyacrylamide-gel electrophoresis. A band of minor intensity was seen of Mr corresponding to the EGF receptor (170000). Immunoprecipitation of affinity-labelled and solubilized membranes with an anti-(EGF receptor) monoclonal antibody demonstrated that the Mr 170000 receptor protein was photoaffinity labelled by the analogue. The Mr 53000 peptide was not specifically bound by the anti-receptor antibody. The affinity labelling of the receptor was not enhanced by EGF, suggesting that EGF stimulation of the kinase activity does not result from changes in the affinity of the kinase for ATP. These studies demonstrate that arylazido-beta-alanyl-ATP interacts with the ATP-binding
Pliotas, Christos; Grayer, Samuel C; Ekkerman, Silvia; Chan, Anthony K N; Healy, Jess; Marius, Phedra; Bartlett, Wendy; Khan, Amjad; Cortopassi, Wilian A; Chandler, Shane A; Rasmussen, Tim; Benesch, Justin L P; Paton, Robert S; Claridge, Timothy D W; Miller, Samantha; Booth, Ian R; Naismith, James H; Conway, Stuart J
2017-08-15
Ligand binding is one of the most fundamental properties of proteins. Ligand functions fall into three basic types: substrates, regulatory molecules, and cofactors essential to protein stability, reactivity, or enzyme-substrate complex formation. The regulation of potassium ion movement in bacteria is predominantly under the control of regulatory ligands that gate the relevant channels and transporters, which possess subunits or domains that contain Rossmann folds (RFs). Here we demonstrate that adenosine monophosphate (AMP) is bound to both RFs of the dimeric bacterial Kef potassium efflux system (Kef), where it plays a structural role. We conclude that AMP binds with high affinity, ensuring that the site is fully occupied at all times in the cell. Loss of the ability to bind AMP, we demonstrate, causes protein, and likely dimer, instability and consequent loss of function. Kef system function is regulated via the reversible binding of comparatively low-affinity glutathione-based ligands at the interface between the dimer subunits. We propose this interfacial binding site is itself stabilized, at least in part, by AMP binding.
2017-01-01
Ligand binding is one of the most fundamental properties of proteins. Ligand functions fall into three basic types: substrates, regulatory molecules, and cofactors essential to protein stability, reactivity, or enzyme–substrate complex formation. The regulation of potassium ion movement in bacteria is predominantly under the control of regulatory ligands that gate the relevant channels and transporters, which possess subunits or domains that contain Rossmann folds (RFs). Here we demonstrate that adenosine monophosphate (AMP) is bound to both RFs of the dimeric bacterial Kef potassium efflux system (Kef), where it plays a structural role. We conclude that AMP binds with high affinity, ensuring that the site is fully occupied at all times in the cell. Loss of the ability to bind AMP, we demonstrate, causes protein, and likely dimer, instability and consequent loss of function. Kef system function is regulated via the reversible binding of comparatively low-affinity glutathione-based ligands at the interface between the dimer subunits. We propose this interfacial binding site is itself stabilized, at least in part, by AMP binding. PMID:28656748
ATP-binding cassette exporters: structure and mechanism with a focus on P-glycoprotein and MRP1.
Arana, Maite Rocío; Altenberg, Guillermo
2017-10-12
The majority of proteins that belong to the ATP-binding cassette (ABC) superfamily are transporters that mediate the efflux of substrates from cells. These exporters include multidrug resistance proteins of the ABCB and ABCC subfamilies, such as P-glycoprotein (Pgp) and MRP1, respectively. These proteins are not only involved in the resistance of cancer to cytotoxic agents, but also in the protection from endo and xenobiotics, and the determination of drug pharmacokinetics, as well as in the pathophysiology of a variety of disorders. Here, we present a review of the information available on ABC exporters, with a focus on Pgp, MRP1 and related proteins. We describe tissue localization and function of these transporters in health and disease, and discuss the mechanisms of substrate transport. We also correlate recent structural information with the function of the exporters, and discuss details of their molecular mechanism with a focus on the nucleotide-binding domains. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
AMP Is an Adenosine A1 Receptor Agonist*
Rittiner, Joseph E.; Korboukh, Ilia; Hull-Ryde, Emily A.; Jin, Jian; Janzen, William P.; Frye, Stephen V.; Zylka, Mark J.
2012-01-01
Numerous receptors for ATP, ADP, and adenosine exist; however, it is currently unknown whether a receptor for the related nucleotide adenosine 5′-monophosphate (AMP) exists. Using a novel cell-based assay to visualize adenosine receptor activation in real time, we found that AMP and a non-hydrolyzable AMP analog (deoxyadenosine 5′-monophosphonate, ACP) directly activated the adenosine A1 receptor (A1R). In contrast, AMP only activated the adenosine A2B receptor (A2BR) after hydrolysis to adenosine by ecto-5′-nucleotidase (NT5E, CD73) or prostatic acid phosphatase (PAP, ACPP). Adenosine and AMP were equipotent human A1R agonists in our real-time assay and in a cAMP accumulation assay. ACP also depressed cAMP levels in mouse cortical neurons through activation of endogenous A1R. Non-selective purinergic receptor antagonists (pyridoxalphosphate-6-azophenyl-2′,4′-disulfonic acid and suramin) did not block adenosine- or AMP-evoked activation. Moreover, mutation of His-251 in the human A1R ligand binding pocket reduced AMP potency without affecting adenosine potency. In contrast, mutation of a different binding pocket residue (His-278) eliminated responses to AMP and to adenosine. Taken together, our study indicates that the physiologically relevant nucleotide AMP is a full agonist of A1R. In addition, our study suggests that some of the physiological effects of AMP may be direct, and not indirect through ectonucleotidases that hydrolyze this nucleotide to adenosine. PMID:22215671
Gao, Yu-tao; Wu, Ling-ying; Zhang, Wei; Zhao, Dan; Li, Ning; Tian, Hai-mei; Wang, Xiao-bing; Li, Mo; Sun, Yang-chun; Li, Nan; Li, Xiao-guang
2013-05-01
To investigate the efficacy of adenosine triphosphate (ATP)-tumor chemosensitivity assay (TCA) directed chemotherapy in patients with recurrent epithelial ovarian cancer. From August 2010 to June 2012, recurrent epithelial ovarian cancer patients were prospectively enrollmented in Cancer Hospital, Peking Union Medical College,Chinese Academy of Medical Sciences.The entry criteria are as follows: (1) Histologically proven to be epithelial ovarian cancer. (2) Patients of recurrent ovarian cancer with bidimensionally measurable tumor, or ascitic or pleural fluid for testing. (3) Karnofsky performance status > 60. (4) A life expectancy of at least more than 6 months.According to patients desires, they were assigned into two groups: assay-directed therapy group and physician's-choice therapy group, patients' clinical and pathological characteristics, response rate to chemotherapy and progression-free survival (PFS) were compared between two groups. A total of 113 patients with recurrent epithelial ovarian cancer were prospectively enrollmented to assay-directed chemotherapy (n = 56) or physician's-choice chemotherapy (n = 57).There was no difference in median age,types of recurrence, surgical-pathological stage, pathological type, tumor grade, times of recurrence, residual disease at secondary cytoreductive surgery between assay-directed group and physician's-choice group. The overall response rate (ORR) and median PFS in the ATP-TCA group was 66% (37/56) and 7 months, while the ORR in the control group was 46% (26/57, P = 0.037), the median PFS was 4 months (P = 0.040). For platinum-resistant patients, the ORR between ATP-TCA directed chemotherapy 59% (16/27) and control group 25% (7/28) were significantly different (P = 0.010), and the median PFS between two groups were also significantly different (5 months and 2 months, respectively, P = 0.003). ATP-TCA directed chemotherapy could improve ORR and PFS in patients with recurrent epithelial ovarian cancer, especially
Knape, L; Hambraeus, A; Lytsy, B
2015-10-01
The adenosine triphosphate (ATP) method is widely accepted as a quality control method to complement visual assessment, in the specifications of requirements, when purchasing cleaning contractors in Swedish hospitals. To examine whether the amount of biological load, as measured by ATP on frequently touched near-patient surfaces, had been reduced after an intervention; to evaluate the correlation between visual assessment and ATP levels on the same surfaces; to identify aspects of the performance of the ATP method as a tool in evaluating hospital cleanliness. A prospective intervention study in three phases was carried out in a medical ward and an intensive care unit (ICU) at a regional hospital in mid-Sweden between 2012 and 2013. Existing cleaning procedures were defined and baseline tests were sampled by visual inspection and ATP measurements of ten frequently touched surfaces in patients' rooms before and after intervention. The intervention consisted of educating nursing staff about the importance of hospital cleaning and direct feedback of ATP levels before and after cleaning. The mixed model showed a significant decrease in ATP levels after the intervention (P < 0.001). Relative light unit values were lower in the ICU. Cleanliness as judged by visual assessments improved. In the logistic regression analysis, there was a significant association between visual assessments and ATP levels. Direct feedback of ATP levels, together with education and introduction of written cleaning protocols, were effective tools to improve cleanliness. Visual assessment correlated with the level of ATP but the correlation was not absolute. The ATP method could serve as an educational tool for staff, but is not enough to assess hospital cleanliness in general as only a limited part of a large area is covered. Copyright © 2015 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.
Sethi, Saurabh; Huang, Robert J; Barakat, Monique T; Banaei, Niaz; Friedland, Shai; Banerjee, Subhas
2017-06-01
Recent outbreaks of duodenoscope-transmitted infections underscore the importance of adequate endoscope reprocessing. Adenosine triphosphate (ATP) bioluminescence testing allows rapid evaluation of endoscopes for bacteriologic/biologic residue. In this prospective study we evaluate the utility of ATP in bacteriologic surveillance and the effects of endoscopy staff education and dual cycles of cleaning and high-level disinfection (HLD) on endoscope reprocessing. ATP bioluminescence was measured after precleaning, manual cleaning, and HLD on rinsates from suction-biopsy channels of all endoscopes and elevator channels of duodenoscopes/linear echoendoscopes after use. ATP bioluminescence was remeasured in duodenoscopes (1) after re-education and competency testing of endoscopy staff and subsequently (2) after 2 cycles of precleaning and manual cleaning and single cycle of HLD or (3) after 2 cycles of precleaning, manual cleaning, and HLD. The ideal ATP bioluminescence benchmark of <200 relative light units (RLUs) after manual cleaning was achieved from suction-biopsy channel rinsates of all endoscopes, but 9 of 10 duodenoscope elevator channel rinsates failed to meet this benchmark. Re-education reduced RLUs in duodenoscope elevator channel rinsates after precleaning (23,218.0 vs 1340.5 RLUs, P < .01) and HLD (177.0 vs 12.0 RLUs, P < .01). After 2 cycles of manual cleaning/HLD, duodenoscope elevator channel RLUs achieved levels similar to sterile water, with corresponding negative cultures. ATP testing offers a rapid, inexpensive alternative for detection of endoscope microbial residue. Re-education of endoscopy staff and 2 cycles of cleaning and HLD decreased elevator channel RLUs to levels similar to sterile water and may therefore minimize the risk of transmission of infections by duodenoscopes. Copyright © 2017 American Society for Gastrointestinal Endoscopy. Published by Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Majer, Günter; Southan, Alexander
2017-06-01
The diffusion of small molecules through hydrogels is of great importance for many applications. Especially in biological contexts, the diffusion of nutrients through hydrogel networks defines whether cells can survive inside the hydrogel or not. In this contribution, hydrogels based on poly(ethylene glycol) diacrylate with mesh sizes ranging from ξ = 1.1 to 12.9 nm are prepared using polymers with number-average molecular weights between Mn = 700 and 8000 g/mol. Precise measurements of diffusion coefficients D of adenosine triphosphate (ATP), an important energy carrier in biological systems, in these hydrogels are performed by pulsed field gradient nuclear magnetic resonance. Depending on the mesh size, ξ, and on the polymer volume fraction of the hydrogel after swelling, ϕ, it is possible to tune the relative ATP diffusion coefficient D/D0 in the hydrogels to values between 0.14 and 0.77 compared to the ATP diffusion coefficient D0 in water. The diffusion coefficients of ATP in these hydrogels are compared with predictions of various mathematical expressions developed under different model assumptions. The experimental data are found to be in good agreement with the predictions of a modified obstruction model or the free volume theory in combination with the sieving behavior of the polymer chains. No reasonable agreement was found with the pure hydrodynamic model.
Manga, Kiran; Serban, Geo; Schwartz, Joseph; Slotky, Ronit; Patel, Nita; Fan, Jianshe; Bai, Xiaolin; Chari, Ajai; Savage, David; Suciu-Foca, Nicole; Colovai, Adriana I
2010-07-01
Hematopoietic stem cell (HSC) transplantation is an important therapeutic option for patients with hematologic malignancies. To explore the immunomodulatory effects of HSC mobilization agents, we studied the function and phenotype of CD4(+) T cells from 16 adult patients with hematologic malignancies undergoing HSC mobilization treatment for autologous transplantation. Immune cell function was determined using the Immuknow (Cylex) assay by measuring the amount of adenosine triphosphate (ATP) produced by CD4(+) cells from whole blood. ATP activity measured in G-CSF-treated patients was significantly higher than that measured in healthy individuals or "nonmobilized" patients. In patients treated with G-CSF, CD4(+) T cells were predominantly CD25(low)FOXP3(low), consistent with an activated phenotype. However, T-cell depletion did not abrogate ATP production in blood samples from G-CSF-treated patients, indicating that CD4(+) myeloid cells contributed to the increased ATP levels observed in these patients. There was a significant correlation between ATP activity and patient survival, suggesting that efficient activation of CD4(+) cells during mobilization treatment predicts a low risk of disease relapse. Monitoring immune cell reactivity using the Immuknow assay may assist in the clinical management of patients with hematologic malignancies and optimization of HSC mobilization protocols. Copyright 2010 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.
Ding, Guan-Jun; Zhu, Ying-Jie; Qi, Chao; Sun, Tuan-Wei; Wu, Jin; Chen, Feng
2015-06-26
A facile and environmentally friendly approach has been developed to prepare yolk-shell porous microspheres of calcium phosphate by using calcium L-lactate pentahydrate (CL) as the calcium source and adenosine 5'-triphosphate disodium salt (ATP) as the phosphate source through the microwave-assisted hydrothermal method. The effects of the concentration of CL, the microwave hydrothermal temperature, and the time on the morphology and crystal phase of the product are investigated. The possible formation mechanism of yolk-shell porous microspheres of calcium phosphate is proposed. Hemoglobin from bovine red cells (Hb) and ibuprofen (IBU) are used to explore the application potential of yolk-shell porous microspheres of calcium phosphate in protein/drug loading and delivery. The experimental results indicate that the as-prepared yolk-shell porous microspheres of calcium phosphate have relatively high protein/drug loading capacity, sustained protein/drug release, favorable pH-responsive release behavior, and a high biocompatibility in the cytotoxicity test. Therefore, the yolk-shell porous microspheres of calcium phosphate have promising applications in various biomedical fields such as protein/drug delivery. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Chen, Chiliang; Malek, Adel A.; Wargo, Matthew J.; Hogan, Deborah A.; Beattie, Gwyn A.
2017-01-01
Summary We identified a choline, betaine and carnitine transporter, designated Cbc, from Pseudomonas syringae and Pseudomonas aeruginosa that is unusual among members of the ATP-binding cassette (ABC) transporter family in its use of multiple periplasmic substrate-binding proteins (SBPs) that are highly specific for their substrates. The SBP encoded by the cbcXWV operon, CbcX, binds choline with a high affinity (Km, 2.6 μM) and, although it also binds betaine (Km, 24.2 μM), CbcXWV-mediated betaine uptake did not occur in the presence of choline. The CbcX orthologue ChoX from Sinorhizobium meliloti was similar to CbcX in these binding properties. The core transporter CbcWV also interacts with the carnitine-specific SBP CaiX (Km, 24 μM) and the betaine-specific SBP BetX (Km, 0.6 μM). Unlike most ABC transporter loci, caiX, betX and cbcXWV are separated in the genome. CaiX-mediated carnitine uptake was reduced by CbcX and BetX only when they were bound by their individual ligands, providing the first in vivo evidence for a higher affinity for ligand-bound than ligand-free SBPs by an ABC transporter. These studies demonstrate not only that the Cbc transporter serves as a useful model for exploring ABC transporter component interactions, but also that the orphan SBP genes common to bacterial genomes can encode functional SBPs. PMID:19919675
Chen, Chiliang; Malek, Adel A; Wargo, Matthew J; Hogan, Deborah A; Beattie, Gwyn A
2010-01-01
We identified a choline, betaine and carnitine transporter, designated Cbc, from Pseudomonas syringae and Pseudomonas aeruginosa that is unusual among members of the ATP-binding cassette (ABC) transporter family in its use of multiple periplasmic substrate-binding proteins (SBPs) that are highly specific for their substrates. The SBP encoded by the cbcXWV operon, CbcX, binds choline with a high affinity (K(m), 2.6 microM) and, although it also binds betaine (K(m), 24.2 microM), CbcXWV-mediated betaine uptake did not occur in the presence of choline. The CbcX orthologue ChoX from Sinorhizobium meliloti was similar to CbcX in these binding properties. The core transporter CbcWV also interacts with the carnitine-specific SBP CaiX (K(m), 24 microM) and the betaine-specific SBP BetX (K(m), 0.6 microM). Unlike most ABC transporter loci, caiX, betX and cbcXWV are separated in the genome. CaiX-mediated carnitine uptake was reduced by CbcX and BetX only when they were bound by their individual ligands, providing the first in vivo evidence for a higher affinity for ligand-bound than ligand-free SBPs by an ABC transporter. These studies demonstrate not only that the Cbc transporter serves as a useful model for exploring ABC transporter component interactions, but also that the orphan SBP genes common to bacterial genomes can encode functional SBPs.
Schmitt, Cristiane; Pires Maciel, Amanda Luiz; Boszczowski, Icaro; da Silva, Thaís Pereira; Neves, Eliane Aparecida Job; Rossini, Giulio Fabio; Rizek, Camila; Costa, Silvia Figueiredo; Lourenço, Rogério Ferreira; Alfa, Michelle J
2018-05-18
Using adenosine triphosphate (ATP) tests to assess manual cleaning of gastroscopes and to determine the associated workload in a busy endoscopy unit. Patient-used gastroscopes were sampled before and after cleaning to assess ATP levels, bioburden, and protein. Samples were collected by flushing 20 mL of sterile water through the biopsy port to the distal end. Time spent for reprocessing and performing the ATP test was recorded. Twenty-four samples were collected from 10 gastroscopes. After manual cleaning, 14/24 (58.3%) samples had no microbial growth (mean, 21 colony-forming units/cm 2 ), and in 22/24 (91.7%) samples the protein was undetectable (mean, 0.04 µg/cm 2 ). ATP test was above the cutoff (200 relative light units [RLU]) in 17/24 (70.8%) samples (mean, 498 RLU). After the second cleaning, 11/17 (64.7%) gastroscopes still failed the ATP test (mean, 321.2 RLU). The mean time spent to perform manual cleaning and ATP tests was 16 and 8 minutes, respectively. Hence, each test increased the length of time for cleaning plus testing cleanliness by 50%. Further studies regarding the optimal cutoff for ATP tests are needed. ATP tests for cleaning monitoring are easy to perform and provide immediate feedback to the team. However, the increased workload needs to be considered. Copyright © 2018 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.
Wahlestedt, C; Reis, D J; Yoo, H; Adamsson, M; Andersson, D; Edvinsson, L
1992-08-31
Postganglionic sympathetic nerves release norepinephrine (NE) as their primary neurotransmitter at vascular and other targets. However, much evidence supports involvement of additional messengers, co-transmitters, which are co-released with NE upon sympathetic nerve stimulation and thereby contribute to their actions, e.g., vasoconstriction. Two such putative co-transmitters, neuropeptide Y (NPY) and adenosine triphosphate (ATP) have been of particular interest since they fulfill several neurotransmitter criteria. Importantly, hitherto it has been difficult to antagonize vasoconstriction evoked by either NPY or ATP with agents that are devoid of intrinsic activity. The present study describes the ability of a novel inositol phosphate, D-myo-inositol 1,2,6-trisphosphate (Ins[1,2,6]P3; PP-56) to in vitro potently block vasoconstrictor responses elicited by NPY and ATP, but not by NE, as studied in guinea-pig isolated basilar artery. The action of Ins[1,2,6]P3 does not seem to occur through antagonism at NPY- or ATP-receptor recognition sites, labeled by 125I-peptide YY and 35S-gamma-ATP, respectively, in membranes of rat cultured vena cava vascular smooth muscle cells. However, it does involve inhibition of the influx of Ca2+ induced by either co-transmitter in these same vena cava cells. It is proposed that Ins[1,2,6]P3 may be a useful functional antagonist of non-adrenergic component(s) of the vasoconstrictor response to sympathetic nerve stimulation.
Rubinstein, D; Warrendorf, E
1975-06-01
The levels of adenosine triphosphate (ATP) and 2,3-diphosphoglycerate in freshly drawn human erythrocytes can be tripled by a 2 h incubation at 37 degrees C in a medium containing 21 mM glucose, 1.8 mM adenine, 5 mM pyruvate, 10 mM inosine, and 96 mM phosphate. Similar incubation conditions will restore the levels of ATP and 2,3-diphosphoglycerate in erythrocytes from blood levels preserved for 12 and 15 weeks, respectively, to those of fresh cells. Omission of pyruvate from the incubation medium further increases the level of ATP slightly, but there is little elevation of 2,3-diphosphoglycerate. Under these conditions labelled pyruvate and lactate production from [14-C]glucose or [14-C]inosine is not diminished, but labelled fructose 1,6-diphosphate, rather than 2,3-diphosphoglycerate, accumulates. In addition, omission of pyruvate from the incubation medium, with a concomitant decrease in accumulation of 2,3-diphosphoglycerate, diminishes the concentration of inorganic phosphate required for optimal ATP elevation. A 5 h incubation in the glucose-adenine-pyruvate-inosine-phosphate medium elevates the levels of ATP and 2,3-diphosphoglycerate in erythrocytes from blood preserved in the cold for 15 weeks to twice that of fresh cells, indicating that the cells retain their metabolic potential even after prolonged storage at 2 degrees C. The medium may provide a method of rejuvenating 10-12 week cold-preserved erythrocytes for transfusion purposes, by a 1 h incubation at 37 degrees C.
Emission of volatile organic compounds from petunia flowers is facilitated by an ABC transporter.
Adebesin, Funmilayo; Widhalm, Joshua R; Boachon, Benoît; Lefèvre, François; Pierman, Baptiste; Lynch, Joseph H; Alam, Iftekhar; Junqueira, Bruna; Benke, Ryan; Ray, Shaunak; Porter, Justin A; Yanagisawa, Makoto; Wetzstein, Hazel Y; Morgan, John A; Boutry, Marc; Schuurink, Robert C; Dudareva, Natalia
2017-06-30
Plants synthesize a diversity of volatile molecules that are important for reproduction and defense, serve as practical products for humans, and influence atmospheric chemistry and climate. Despite progress in deciphering plant volatile biosynthesis, their release from the cell has been poorly understood. The default assumption has been that volatiles passively diffuse out of cells. By characterization of a Petunia hybrida adenosine triphosphate-binding cassette (ABC) transporter, PhABCG1, we demonstrate that passage of volatiles across the plasma membrane relies on active transport. PhABCG1 down-regulation by RNA interference results in decreased emission of volatiles, which accumulate to toxic levels in the plasma membrane. This study provides direct proof of a biologically mediated mechanism of volatile emission. Copyright © 2017 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.
Gadjanski, Ivana; Yodmuang, Supansa; Spiller, Kara; Bhumiratana, Sarindr; Vunjak-Novakovic, Gordana
2013-10-01
Formation of tissue-engineered cartilage is greatly enhanced by mechanical stimulation. However, direct mechanical stimulation is not always a suitable method, and the utilization of mechanisms underlying mechanotransduction might allow for a highly effective and less aggressive alternate means of stimulation. In particular, the purinergic, adenosine 5'-triphosphate (ATP)-mediated signaling pathway is strongly implicated in mechanotransduction within the articular cartilage. We investigated the effects of transient and continuous exogenous ATP supplementation on mechanical properties of cartilaginous constructs engineered using bovine chondrocytes and human mesenchymal stem cells (hMSCs) encapsulated in an agarose hydrogel. For both cell types, we have observed significant increases in equilibrium and dynamic compressive moduli after transient ATP treatment applied in the fourth week of cultivation. Continuous ATP treatment over 4 weeks of culture only slightly improved the mechanical properties of the constructs, without major changes in the total glycosaminoglycan (GAG) and collagen content. Structure-function analyses showed that transiently ATP-treated constructs, and in particular those based on hMSCs, had the highest level of correlation between compositional and mechanical properties. Transiently treated groups showed intense staining of the territorial matrix for GAGs and collagen type II. These results indicate that transient ATP treatment can improve functional mechanical properties of cartilaginous constructs based on chondrogenic cells and agarose hydrogels, possibly by improving the structural organization of the bulk phase and territorial extracellular matrix (ECM), that is, by increasing correlation slopes between the content of the ECM components (GAG, collagen) and mechanical properties of the construct.
Wang, Yi-Jun; Zhang, Yun-Kai; Kathawala, Rishil J.; Chen, Zhe-Sheng
2014-01-01
The phenomenon of multidrug resistance (MDR) has attenuated the efficacy of anticancer drugs and the possibility of successful cancer chemotherapy. ATP-binding cassette (ABC) transporters play an essential role in mediating MDR in cancer cells by increasing efflux of drugs from cancer cells, hence reducing the intracellular accumulation of chemotherapeutic drugs. Interestingly, small-molecule tyrosine kinase inhibitors (TKIs), such as AST1306, lapatinib, linsitinib, masitinib, motesanib, nilotinib, telatinib and WHI-P154, have been found to have the capability to overcome anticancer drug resistance by inhibiting ABC transporters in recent years. This review will focus on some of the latest and clinical developments with ABC transporters, TKIs and anticancer drug resistance. PMID:25268163
Lewis, R S; Fidel, J; Dassanayake, S; Court, M H; Burke, N S; Mealey, K L
2017-06-01
ABCG2 (ATP binding cassette subfamily G, member 2) mediates resistance to a variety of cytotoxic agents. Although human ABCG2 is well characterized, the function of canine ABCG2 has not been studied previously. Feline ABCG2 has an amino acid substitution in the adenosine triphosphate-binding domain that decreases its transport capacity relative to human ABCG2. Our goal was to compare canine ABCG2-mediated chemotherapeutic drug resistance to feline ABCG2-mediated chemotherapeutic drug resistance. HEK-293 cells stably transfected with plasmid containing canine ABCG2, feline ABCG2 or no ABCG2 were exposed to carboplatin, doxorubicin, mitoxantrone, toceranib or vincristine, and cell survival was subsequently determined. Canine ABCG2 conferred a greater degree of chemotherapy resistance than feline ABCG2 for mitoxantrone. Neither canine nor feline ABCG2 conferred resistance to doxorubicin, vincristine or toceranib. Canine, but not feline, ABCG2 conferred resistance to carboplatin, a drug that is not reported to be a substrate for ABCG2 in other species. © 2015 John Wiley & Sons Ltd.
Hida, Kyoko; Kikuchi, Hiroshi; Maishi, Nako; Hida, Yasuhiro
2017-08-01
Drug resistance is a major problem in anticancer therapy. ATP-binding cassette (ABC) transporters have a role in the multidrug resistance. A new regimen of chemotherapy has been proposed, called "metronomic chemotherapy". Metronomic chemotherapy is the frequent, regular administration of drug doses designed to maintain low, but active, concentrations of chemotherapeutic drugs over prolonged periods of time, without causing serious toxicities. Metronomic chemotherapy regimens were developed to optimize the antitumor efficacy of agents that target the tumor vasculature instead of tumor cells, and to reduce toxicity of antineoplastic drugs [1]. Nevertheless, recent studies revealed that ABC transporters are expressed at a higher level in the endothelium in the tumor. To avoid resistance to metronomic anti-angiogenic chemotherapy, ABC transporter inhibition of tumor endothelial cells may be a promising strategy. In this mini-review, we discuss the possible mechanism of resistance to metronomic chemotherapy from the viewpoint of tumor endothelial cell biology, focusing on ABC transporters. Copyright © 2017. Published by Elsevier B.V.
Asymmetric interactions in the adenosine-binding pockets of the MS2 coat protein dimer
Powell, Amy J; Peabody, David S
2001-01-01
Background The X-ray structure of the MS2 coat protein-operator RNA complex reveals the existence of quasi-synmetric interactions of adenosines -4 and -10 in pockets formed on different subunits of the coat protein dimer. Both pockets utilize the same five amino acid residues, namely Val29, Thr45, Ser47, Thr59, and Lys61. We call these sites the adenosine-binding pockets. Results We present here a heterodimer complementation analysis of the contributions of individual A-pocket amino acids to the binding of A-4 and A-10 in different halves of the dimer. Various substitutions of A-pocket residues were introduced into one half of single-chain coat protein heterodimers where they were tested for their abilities to complement Y85H or T91I substitutions (defects in the A-4 and A-10 half-sites, respectively) present in the other dimer half. Conclusions These experiments provide functional tests of interactions predicted from structural analyses, demonstrating the importance of certain amino acid-nucleotide contacts observed in the crystal structure, and showing that others make little or no contribution to the stability of the complex. In summary, Val29 and Lys61 form important stabilizing interactions with both A-4 and A-10. Meanwhile, Ser47 and Thr59 interact primarily with A-10. The important interactions with Thr45 are restricted to A-4. PMID:11504563
ATP binding cassette G1-dependent cholesterol efflux during inflammation.
de Beer, Maria C; Ji, Ailing; Jahangiri, Anisa; Vaughan, Ashley M; de Beer, Frederick C; van der Westhuyzen, Deneys R; Webb, Nancy R
2011-02-01
ATP binding cassette transporter G1 (ABCG1) mediates the transport of cellular cholesterol to HDL, and it plays a key role in maintaining macrophage cholesterol homeostasis. During inflammation, HDL undergoes substantial remodeling, acquiring lipid changes and serum amyloid A (SAA) as a major apolipoprotein. In the current study, we investigated whether remodeling of HDL that occurs during acute inflammation impacts ABCG1-dependent efflux. Our data indicate that lipid free SAA acts similarly to apolipoprotein A-I (apoA-I) in mediating sequential efflux from ABCA1 and ABCG1. Compared with normal mouse HDL, acute phase (AP) mouse HDL containing SAA exhibited a modest but significant 17% increase in ABCG1-dependent efflux. Interestingly, AP HDL isolated from mice lacking SAA (SAAKO mice) was even more effective in promoting ABCG1 efflux. Hydrolysis with Group IIA secretory phospholipase A(2) (sPLA(2)-IIA) significantly reduced the ability of AP HDL from SAAKO mice to serve as a substrate for ABCG1-mediated cholesterol transfer, indicating that phospholipid (PL) enrichment, and not the presence of SAA, is responsible for alterations in efflux. AP human HDL, which is not PL-enriched, was somewhat less effective in mediating ABCG1-dependent efflux compared with normal human HDL. Our data indicate that inflammatory remodeling of HDL impacts ABCG1-dependent efflux independent of SAA.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sekiya, M.; Frohlich, E.D.; Cole, F.E.
1991-01-01
In the present study, we investigated the effects of calmodulin, adenosine 5{prime}-triphosphate (ATP) and pertussis toxin (PT) on phorbol ester (PMA) induced inhibition of ANF-stimulated cyclic GMP formation in cells from the human renal cell line, SK-NEP-1. PMA inhibited ANF-stimulated guanylate cyclase activity in particulate membranes by about 65%. Calmodulin reversed this inhibition in a dose dependent manner. ATP potentiated Mg++ but not Mn++ supported guanylate cyclase activity. In PMA treated membranes, ATP potentiating effects were abolished. PMA also inhibited ANF-stimulated cGMP accumulation, but pretreatment with PT prevented this PMA inhibition. PT did not affect basal or ANF-stimulated cGMP accumulation.more » In conclusion, these results demonstrated that PMA inhibited ANF stimulation of particulate guanylate cyclase in opposition to the activating effects of calmodulin or ATP in SK-NEP-1 cells. The protein kinase C inhibitory effects appeared to be mediated via a PT-sensitive G protein.« less
Ho, Yu-Huai; Wang, Lih-Shinn; Jiang, Hui-Li; Chang, Chih-Hui; Hsieh, Chia-Jung; Chang, Dan-Chi; Tu, Hsin-Yu; Chiu, Tan-Yun; Chao, Huei-Jen; Tseng, Chun-Chieh
2016-06-09
Contaminated surfaces play an important role in the transmission of pathogens. We sought to establish a criterion that could indicate "cleanliness" using a sampling area-adjusted adenosine triphosphate (ATP) assay. In the first phase of the study, target surfaces were selected for swab sampling before and after daily cleaning; then, an aerobic colony count (ACC) plate assay of bacteria and antibiotic-resistant bacteria was conducted. ATP swabs were also tested, and the ATP readings were reported as relative light units (RLUs). The results of the ACC and ATP assays were adjusted according to the sampling area. During the second phase of the study, a new cleaning process employing sodium dichloroisocyanurate (NaDCC) was implemented for comparison. Using the criterion of 2.5 colony-forming units (CFU)/cm², 45% of the sampled sites were successfully cleaned during phase one of the study. During phase two, the pass rates of the surface samples (64%) were significantly improved, except under stringent (5 RLU/cm²) and lax (500 RLU) ATP criteria. Using receiver-operating characteristic curve analysis, the best cut-off point for an area-adjusted ATP level was 7.34 RLU/cm², which corresponded to culture-assay levels of <2.5 CFU/cm². An area adjustment of the ATP assay improved the degree of correlation with the ACC-assay results from weak to moderate.
Fang, Ming; Chai, Yiqiu; Chen, Guanjv; Wang, Huidong; Huang, Bo
The diamondback moth, Plutella xylostella, is one of the most important pests of cruciferous crops. We have earlier shown that N6-(2-hydroxyethyl)-adenosine (HEA) exhibits insecticidal activity against P. xylostella. In the present study we investigated the possible mechanism of insecticidal action of HEA on P. xylostella. HEA is a derivative of adenosine, therefore, we speculated whether it acts via P. xylostella adenosine receptor (PxAdoR). We used RNAi approach to silence PxAdoR gene and used antagonist of denosine receptor (AdoR) to study the insecticidal effect of HEA. We cloned the whole sequence of PxAdoR gene. A BLAST search using NCBI protein database showed a 61% identity with the Drosophila adenosine receptor (DmAdoR) and a 32-35% identity with human AdoR. Though the amino acids sequence of PxAdoR was different compared to other adenosine receptors, most of the amino acids that are known to be important for adenosine receptor ligand binding and signaling were present. However, only 30% binding sites key residues was similar between PxAdoR and A1R. HEA, at a dose of 1 mg/mL, was found to be lethal to the second-instar larvae of P. xylostella, and a significant reduction of mortality and growth inhibition ratio were obtained when HEA was administered to the larvae along with PxAdoR-dsRNA or antagonist of AdoR (SCH58261) for 36, 48, or 60 h. Especially at 48 h, the rate of growth inhibition of the PxAdoR knockdown group was 3.5-fold less than that of the HEA group, and the corrected mortality of SCH58261 group was reduced almost 2-fold compared with the HEA group. Our findings show that HEA may exert its insecticidal activity against P. xylostella larvae via acting on PxAdoR.
5' adenosine monophosphate-activated protein kinase, metabolism and exercise.
Aschenbach, William G; Sakamoto, Kei; Goodyear, Laurie J
2004-01-01
The 5' adenosine monophosphate-activated protein kinase (AMPK) is a member of a metabolite-sensing protein kinase family that functions as a metabolic 'fuel gauge' in skeletal muscle. AMPK is a ubiquitous heterotrimeric protein, consisting of an alpha catalytic, and beta and gamma regulatory subunits that exist in multiple isoforms and are all required for full enzymatic activity. During exercise, AMPK becomes activated in skeletal muscle in response to changes in cellular energy status (e.g. increased adenosine monophosphate [AMP]/adenosine triphosphate [ATP] and creatine/phosphocreatine ratios) in an intensity-dependent manner, and serves to inhibit ATP-consuming pathways, and activate pathways involved in carbohydrate and fatty-acid metabolism to restore ATP levels. Recent evidence shows that although AMPK plays this key metabolic role during acute bouts of exercise, it is also an important component of the adaptive response of skeletal muscles to endurance exercise training because of its ability to alter muscle fuel reserves and expression of several exercise-responsive genes. This review discusses the putative roles of AMPK in acute and chronic exercise responses, and suggests avenues for future AMPK research in exercise physiology and biochemistry.
Beharry, Seelochan; Zhong, Ming; Molday, Robert S
2004-12-24
ABCA4, a member of the family of ATP binding cassette (ABC) proteins found in rod and cone photoreceptors, has been implicated in the transport of retinoid compounds across the outer segment disk membrane following the photoactivation of rhodopsin. Mutations in the ABCA4 gene are responsible for Stargardt macular dystrophy and related retinal degenerative diseases that cause a loss in vision. To identify the retinoid substrate that interacts with ABCA4, we have isolated ABCA4 from rod outer segment disk membranes on an immunoaffinity matrix and analyzed retinoid compounds that bind to ABCA4 using high performance liquid chromatography and radiolabeling methods. When all-trans-retinal was added to ABCA4 in the presence of phosphatidylethanolamine, approximately 0.9 mol of N-retinylidene-phosphatidylethanolamine and 0.3 mol of all-trans-retinal were bound per mol of ABCA4 with an apparent K(d) of 2-5 microm. ATP and GTP released these retinoids from ABCA4, whereas ADP, GDP, and nonhydrolyzable derivatives, adenosine 5'-(beta,gamma-imido)triphosphate and guanosine 5'-(beta,gamma-imido)triphosphate, were ineffective. One mole of N-retinyl-phosphatidylethanolamine, the reduced form of N-retinylidene-phosphatidylethanolamine, bound per mol of ABCA4, whereas 0.3 mol of all-trans-retinal were bound in the absence of phosphatidylethanolamine. No binding of all-trans-retinol to ABCA4 was observed. Our results indicate that ABCA4 preferentially binds N-retinylidene-phosphatidylethanolamine with high affinity in the absence of ATP. Our studies further suggest that ATP binding and hydrolysis induces a protein conformational change that causes N-retinylidene-phosphatidylethanolamine to dissociate from ABCA4.
Passive transport and binding of lead by human red blood cells.
Simons, T J
1986-01-01
The uptake of Pb into human red blood cells has been studied using Pb buffers. Passive Pb movements can be studied conveniently when the cells are depleted of adenosine 5'-triphosphate (ATP), to eliminate active transport, and of inorganic phosphate, to prevent precipitation of lead phosphate. Pb can cross the membrane passively in either direction. Influx and efflux show similar properties. Passive Pb transport is strongly stimulated by HCO3-, and is reduced by replacing Cl- with ClO4-. It is inhibited by low concentrations of 4-acetamido-4'-isothiocyanostilbene-2,2'-disulphonic acid (SITS) and 4,4'-diisothiocyanostilbene-2.2'-disulphonic acid (DIDS), characteristic inhibitors of anion transport. Pb uptake is unaffected by varying the external concentrations of Na+, K+ and Ca2+. When Pb enters the cell, it binds mainly to haemoglobin. The ratio of bound Pb:free Pb2+ in the cytosol is estimated to be 6000:1. Pb binding to haemoglobin is unaffected by oxygenation. Binding to albumin is quantitatively similar to binding to haemoglobin. The implications of these results for the transport and binding of Pb in the blood are discussed. PMID:3795106
Passive transport and binding of lead by human red blood cells.
Simons, T J
1986-09-01
The uptake of Pb into human red blood cells has been studied using Pb buffers. Passive Pb movements can be studied conveniently when the cells are depleted of adenosine 5'-triphosphate (ATP), to eliminate active transport, and of inorganic phosphate, to prevent precipitation of lead phosphate. Pb can cross the membrane passively in either direction. Influx and efflux show similar properties. Passive Pb transport is strongly stimulated by HCO3-, and is reduced by replacing Cl- with ClO4-. It is inhibited by low concentrations of 4-acetamido-4'-isothiocyanostilbene-2,2'-disulphonic acid (SITS) and 4,4'-diisothiocyanostilbene-2.2'-disulphonic acid (DIDS), characteristic inhibitors of anion transport. Pb uptake is unaffected by varying the external concentrations of Na+, K+ and Ca2+. When Pb enters the cell, it binds mainly to haemoglobin. The ratio of bound Pb:free Pb2+ in the cytosol is estimated to be 6000:1. Pb binding to haemoglobin is unaffected by oxygenation. Binding to albumin is quantitatively similar to binding to haemoglobin. The implications of these results for the transport and binding of Pb in the blood are discussed.
Synergistic effects of ATP and RNA binding to human DEAD-box protein DDX1.
Kellner, Julian N; Reinstein, Jochen; Meinhart, Anton
2015-03-11
RNA helicases of the DEAD-box protein family form the largest group of helicases. The human DEAD-box protein 1 (DDX1) plays an important role in tRNA and mRNA processing, is involved in tumor progression and is also hijacked by several virus families such as HIV-1 for replication and nuclear export. Although important in many cellular processes, the mechanism of DDX1's enzymatic function is unknown. We have performed equilibrium titrations and transient kinetics to determine affinities for nucleotides and RNA. We find an exceptional tight binding of DDX1 to adenosine diphosphate (ADP), one of the strongest affinities observed for DEAD-box helicases. ADP binds tighter by three orders of magnitude when compared to adenosine triphosphate (ATP), arresting the enzyme in a potential dead-end ADP conformation under physiological conditions. We thus suggest that a nucleotide exchange factor leads to DDX1 recycling. Furthermore, we find a strong cooperativity in binding of RNA and ATP to DDX1 that is also reflected in ATP hydrolysis. We present a model in which either ATP or RNA binding alone can partially shift the equilibrium from an 'open' to a 'closed'-state; this shift appears to be not further pronounced substantially even in the presence of both RNA and ATP as the low rate of ATP hydrolysis does not change. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Proszkowiec-Weglarz, M; Richards, M P
2009-01-01
The 5'-adenosine monophosphate-activated protein kinase (AMPK) is a highly conserved serine-threonine protein kinase and a key part of a kinase-signaling cascade that senses cellular energy status (adenosine monophosphate:adenosine triphosphate ratio) and acts to maintain energy homeostasis by coordinately regulating energy-consuming and energy-generating metabolic pathways. The objective of this study was to investigate aspects of the AMPK pathway in the liver, brain, breast muscle, and heart from d 12 of incubation through hatch in chickens. We first determined mRNA and protein expression profiles for a major upstream AMPK kinase, LKB1, which is known to activate (phosphorylate) AMPK in response to increases in the adenosine monophosphate:adenosine triphosphate ratio. Expression of LKB1 protein was greatest in the brain, which demonstrated tissue-specific patterns for phosphorylation. Next, AMPK subunit mRNA and protein expression profiles were determined. Significant changes in AMPK subunit mRNA expression occurred in all tissues from d 12 of incubation to hatch. Differences in the levels of active (phosphorylated) AMPK as well as alpha and beta subunit proteins were observed in all 4 tissues during embryonic development. Finally, we determined the protein level and phosphorylation status of an important downstream target for AMPK, acetyl-coenzyme A carboxylase. The expression of acetyl-co-enzyme A carboxylase and phosphorylated acetyl-coenzyme A was greater in the brain than the liver, but was undetectable by Western blotting in the breast muscle and heart throughout the period of study. Together, our results are the first to demonstrate the expression and activity of the AMPK pathway in key tissues during the transition from embryonic to posthatch development in chickens.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pandey, V.N.; Modak, M.J.
Terminal deoxynucleotidyltransferase is the only DNA polymerase that is strongly inhibited in the presence of ATP. We have labeled calf terminal deoxynucleotidyltransferase with (/sup 32/P)ATP in order to identify its binding site in terminal deoxynucleotidyltransferase. The specificity of ATP cross-linking to terminal deoxynucleotidyltransferase is shown by the competitive inhibition of the overall cross-linking reaction by deoxynucleoside triphosphates, as well as the ATP analogs Ap4A and Ap5A. Tryptic peptide mapping of (/sup 32/P)ATP-labeled enzyme revealed a peptide fraction that contained the majority of cross-linked ATP. The properties, chromatographic characteristics, amino acid composition, and sequence analysis of this peptide fraction were identicalmore » with those found associated with dTTP cross-linked terminal deoxynucleotidyl-transferase peptide. The involvement of the same 2 cysteine residues in the crosslinking of both nucleotides further confirmed the unity of the ATP and dTTP binding domain that contains residues 224-237 in the primary amino acid sequence of calf terminal deoxynucleotidyltransferase.« less
Wang, Ping; Zhang, Tonghuan; Yang, Taoyi; Jin, Nan; Zhao, Yanjun; Fan, Aiping
2014-08-07
A highly sensitive and selective chemiluminescent (CL) biosensor for adenosine triphosphate (ATP) was developed by taking advantage of the ATP-dependent enzymatic reaction (ATP-DER), the powerful signal amplification capability of rolling circle amplification (RCA), and hydroxylamine-amplified gold nanoparticles (Au NPs). The strategy relies on the ability of ATP, a cofactor of T4 DNA ligase, to trigger the ligation-RCA reaction. In the presence of ATP, the T4 DNA ligase catalyzes the ligation reaction between the two ends of the padlock probe, producing a closed circular DNA template that initiates the RCA reaction with phi29 DNA polymerase and dNTP. Therein, many complementary copies of the circular template can be generated. The ATP-DER is eventually converted into a detectable CL signal after a series of processes, including gold probe hybridization, hydroxylamine amplification, and oxidative gold metal dissolution coupled with a simple and sensitive luminol CL reaction. The CL signal is directly proportional to the ATP level. The results showed that the detection limit of the assay is 100 pM of ATP, which compares favorably with those of other ATP detection techniques. In addition, by taking advantage of ATP-DER, the proposed CL sensing system exhibits extraordinary specificity towards ATP and could distinguish the target molecule ATP from its analogues. The proposed method provides a new and versatile platform for the design of novel DNA ligation reaction-based CL sensing systems for other cofactors. This novel ATP-DER based CL sensing system may find wide applications in clinical diagnosis as well as in environmental and biomedical fields.
Solga, Steven F.; Horska, Alena; Hemker, Susanne; Crawford, Stephen; Diggs, Charalett; Diehl, Anna Mae; Brancati, Frederick L.; Clark, Jeanne M.
2009-01-01
Background/Aims Magnetic resonance spectroscopy (MRS) measures hepatic fat and adenosine triphosphate (ATP), but magnetic resonance studies are challenging in obese subjects. We aimed to evaluate the inter- and intrarater reliability and stability of hepatic fat and ATP measurements in a cohort of overweight and obese adults. Methods We measured hepatic fat and ATP using proton MRS (1H MRS) and phosphorus MRS (31P MRS) at baseline in adults enrolled in the Action for Health in Diabetes (Look AHEAD) clinical trial at one site. Using logistic regression, we determined factors associated with successful MRS data acquisition. We calculated the intra- and inter-rater reliability for hepatic fat and ATP based on 20 scans analysed twice by two readers. We also calculated the stability of these measures three times on five healthy volunteers. Results Of 244 participants recruited into our ancillary study, 185 agreed to MRS. We obtained usable hepatic fat data from 151 (82%) and ATP data from 105 (58%). Obesity was the strongest predictor of failed data acquisition; every unit increase in the body mass index reduced the likelihood of successful fat data by 11% and ATP data by 14%. The inter- and intrarater reliability were excellent for fat (intraclass correlation coefficient = 0.99), but substantially more variable for ATP. Fat measures appeared relatively stable, but this was less true for ATP. Conclusions Obesity can hinder 1H and 31P MRS data acquisition and subsequent analysis. This impact was greater for hepatic ATP than hepatic fat. PMID:18331237
Stenesen, Drew; Suh, Jae Myoung; Seo, Jin; Yu, Kweon; Lee, Kyu-Sun; Kim, Jong-Seok; Min, Kyung-Jin; Graff, Jonathan M.
2012-01-01
SUMMARY A common thread among conserved lifespan regulators lies within intertwined roles in metabolism and energy homeostasis. We show that heterozygous mutations of adenosine monophosphate (AMP) biosynthetic enzymes extend Drosophila lifespan. The lifespan benefit of these mutations depends upon increased AMP to adenosine triphosphate (ATP) and adenosine diphosphate (ADP) to ATP ratios and adenosine monophosphate-activated protein kinase (AMPK). Transgenic expression of AMPK in adult fat body or adult muscle, key metabolic tissues, extended lifespan, while AMPK RNAi reduced lifespan. Supplementing adenine, a substrate for AMP biosynthesis, to the diet of long-lived AMP biosynthesis mutants reversed lifespan extension. Remarkably, this simple change in diet also blocked the pro-longevity effects of dietary restriction. These data establish AMP biosynthesis, adenosine nucleotide ratios, and AMPK as determinants of adult lifespan, provide a mechanistic link between cellular anabolism and energy sensing pathways, and indicate that dietary adenine manipulations might alter metabolism to influence animal lifespan. PMID:23312286
Okamoto, Takumi; Kawaguchi, Kosuke; Watanabe, Shiro; Agustina, Rina; Ikejima, Toshiki; Ikeda, Keisuke; Nakano, Minoru; Morita, Masashi; Imanaka, Tsuneo
2018-02-19
In mammals, four ATP-binding cassette (ABC) proteins belonging to subfamily D have been identified. ABCD1‒3 are located on peroxisomal membrane and play an important role in the transportation of various fatty acid-CoA derivatives, including very long chain fatty acid-CoA, into peroxisomes. ABCD4 is located on lysosomal membrane and is suggested to be involved in the transport of vitamin B 12 from lysosomes to the cytosol. However, the precise transport mechanism by which these ABC transporters facilitate the import or export of substrate has yet to be well elucidated. In this study, the overexpression of human ABCD1‒4 in the methylotrophic yeast Pichia pastoris and a purification procedure were developed. The detergent-solubilized proteins were reconstituted into liposomes. ABCD1‒4 displayed stable ATPase activity, which was inhibited by AlF 3 . Furthermore, ABCD1‒4 were found to possess an equal levels of acyl-CoA thioesterase activity. Proteoliposomes is expected to be an aid in the further biochemical characterization of ABCD transporters. Copyright © 2018 Elsevier Inc. All rights reserved.
Role of adenosine receptors in caffeine tolerance
DOE Office of Scientific and Technical Information (OSTI.GOV)
Holtzman, S.G.; Mante, S.; Minneman, K.P.
1991-01-01
Caffeine is a competitive antagonist at adenosine receptors. Receptor up-regulation during chronic drug treatment has been proposed to be the mechanism of tolerance to the behavioral stimulant effects of caffeine. This study reassessed the role of adenosine receptors in caffeine tolerance. Separate groups of rats were given scheduled access to drinking bottles containing plain tap water or a 0.1% solution of caffeine. Daily drug intake averaged 60-75 mg/kg and resulted in complete tolerance to caffeine-induced stimulation of locomotor activity, which could not be surmounted by increasing the dose of caffeine. 5'-N-ethylcarboxamidoadenosine (0.001-1.0 mg/kg) dose dependently decreased the locomotor activity ofmore » caffeine-tolerant rats and their water-treated controls but was 8-fold more potent in the latter group. Caffeine (1.0-10 mg/kg) injected concurrently with 5-N-ethylcarboxamidoadenosine antagonized the decreases in locomotor activity comparably in both groups. Apparent pA2 values for tolerant and control rats also were comparable: 5.05 and 5.11. Thus, the adenosine-antagonist activity of caffeine was undiminished in tolerant rats. The effects of chronic caffeine administration on parameters of adenosine receptor binding and function were measured in cerebral cortex. There were no differences between brain tissue from control and caffeine-treated rats in number and affinity of adenosine binding sites or in receptor-mediated increases (A2 adenosine receptor) and decreases (A1 adenosine receptor) in cAMP accumulation. These results are consistent with theoretical arguments that changes in receptor density should not affect the potency of a competitive antagonist. Experimental evidence and theoretical considerations indicate that up-regulation of adenosine receptors is not the mechanism of tolerance to caffeine-induced stimulation of locomotor activity.« less
Wu, Jing; Li, Guorong; Luna, Coralia; Spasojevic, Ivan; Epstein, David L.; Gonzalez, Pedro
2012-01-01
Purpose. To investigate the mechanisms for endogenous production of extracellular adenosine in trabecular meshwork (TM) cells and evaluate its physiological relevance to the regulation of aqueous humor outflow facility. Methods. Extra-cellular levels of adenosine monophosphate (AMP) and adenosine in porcine trabecular meshwork (PTM) cells treated with adenosine triphosphate (ATP), AMP, cAMP or forskolin with or without specific inhibitors of phosphodiesterases (IBMX) and CD73 (AMPCP) were determined by high-pressure liquid chromatography fluorometry. Extracellular adenosine was also evaluated in cell cultures subjected to cyclic mechanical stress (CMS) (20% stretching; 1 Hz) and after disruption of lipid rafts with methyl-β-cyclodextrin. Expression of CD39 and CD73 in porcine TM cells and tissue were examined by Q-PCR and Western blot. The effect of inhibition of CD73 on outflow facility was evaluated in perfused living mouse eyes. Results. PTM cells generated extracellular adenosine from extracellular ATP and AMP but not from extracellular cAMP. Increased intracellular cAMP mediated by forskolin led to a significant increase in extracellular adenosine production that was not prevented by IBMX. Inhibition of CD73 resulted, in all cases, in a significant decrease in extracellular adenosine. CMS induced a significant activation of extracellular adenosine production. Inhibition of CD73 activity with AMPCP in living mouse eyes resulted in a significant decrease in outflow facility. Conclusions. These results support the concept that the extracellular adenosine pathway might play an important role in the homeostatic regulation of outflow resistance in the TM, and suggest a novel mechanism by which pathologic alteration of the TM, such as increased tissue rigidity, could lead to abnormal elevation of IOP in glaucoma. PMID:22997289
Mostapha, S; Berthon, C; Fontaine-Vive, F; Gaysinski, M; Guérin, L; Guillaumont, D; Massi, L; Monfardini, I; Solari, P L; Thomas, O P; Charbonnel, M C; Den Auwer, C
2014-02-01
Although the physiological impact of the actinide elements as nuclear toxicants has been widely investigated for half a century, a description of their interactions with biological molecules remains limited. It is however of primary importance to better assess the determinants of actinide speciation in cells and more generally in living organisms to unravel the molecular processes underlying actinide transport and deposition in tissues. The biological pathways of this family of elements in case of accidental contamination or chronic natural exposure (in the case of uranium rich soils for instance) are therefore a crucial issue of public health and of societal impact. Because of the high chemical affinity of those actinide elements for phosphate groups and the ubiquity of such chemical functions in biochemistry, phosphate derivatives are considered as probable targets of these cations. Among them, nucleotides and in particular adenosine mono- (AMP) and triphosphate (ATP) nucleotides occur in more chemical reactions than any other compounds on the earth's surface, except water, and are therefore critical target molecules. In the present study, we are interested in trans-plutonium actinide elements, in particular americium and curium that are more rarely considered in environmental and bioaccumulation studies than early actinides like uranium, neptunium and plutonium. A first step in this strategy is to work with chemical analogues like lanthanides that are not radioactive and therefore allow extended physical chemical characterization to be conducted that are difficult to perform with radioactive materials. We describe herein the interaction of lutetium(III) with adenosine AMP and ATP. With AMP and ATP, insoluble amorphous compounds have been obtained with molar ratios of 1:2 and 1:1, respectively. With an excess of ATP, with 1:2 molar ratio, a soluble complex has been obtained. A combination of spectroscopic techniques (IR, NMR, ESI-MS, EXAFS) together with quantum
Ye, Rui; Liu, Jun; Jia, Zhiying; Wang, Hongyang; Wang, YongAn; Sun, Wei; Wu, Xuan; Zhao, Zhifei; Niu, Baolong; Li, Xingqi; Dai, Guanghai; Li, Jianxiong
2016-06-13
BACKGROUND There is increasing evidence that adenosine triphosphate (ATP), a well-known neurotransmitter and neuromodulator in the central nervous system, plays an important role as an extracellular chemical messenger in the cochlea. MATERIAL AND METHODS Using a whole-cell recording technique, we studied the effects of ATP on isolated Hensen's cells, which are supporting cells in the cochlea, to determine if they are involved in the transduction of ions with hair cells. RESULTS ATP (0.1-10 µM) reduced the potassium current (IK+) in the majority of the recorded Hensen's cells (21 out of 25 cells). An inward current was also induced by high concentrations of ATP (100 µM to 10 mM), which was reversibly blocked by 100 µM suramin (a purinergic antagonist) and blocked by nifedipine (an L-type calcium channel blocker). After the cochleas were perfused with artificial perilymph solutions containing nifedipine and exposed to noise, the amplitude increase in the compound action potential (CAP) threshold and the reduction in cochlear microphonics was lower than when they were exposed to noise alone. CONCLUSIONS Our results suggest that ATP can block IK+ channels at a low concentration and induce an inward Ca2+ current at high concentrations, which is reversed by purinergic receptors. Nifedipine may have a partially protective effect on noise-induced hearing loss (NIHL).
Francisella DnaK Inhibits Tissue-nonspecific Alkaline Phosphatase*
Arulanandam, Bernard P.; Chetty, Senthilnath Lakshmana; Yu, Jieh-Juen; Leonard, Sean; Klose, Karl; Seshu, Janakiram; Cap, Andrew; Valdes, James J.; Chambers, James P.
2012-01-01
Following pulmonary infection with Francisella tularensis, we observed an unexpected but significant reduction of alkaline phosphatase, an enzyme normally up-regulated following inflammation. However, no reduction was observed in mice infected with a closely related Gram-negative pneumonic organism (Klebsiella pneumoniae) suggesting the inhibition may be Francisella-specific. In similar fashion to in vivo observations, addition of Francisella lysate to exogenous alkaline phosphatase (tissue-nonspecific isozyme) was inhibitory. Partial purification and subsequent proteomic analysis indicated the inhibitory factor to be the heat shock protein DnaK. Incubation with increasing amounts of anti-DnaK antibody reduced the inhibitory effect in a dose-dependent manner. Furthermore, DnaK contains an adenosine triphosphate binding domain at its N terminus, and addition of adenosine triphosphate enhances dissociation of DnaK with its target protein, e.g. alkaline phosphatase. Addition of adenosine triphosphate resulted in decreased DnaK co-immunoprecipitated with alkaline phosphatase as well as reduction of Francisella-mediated alkaline phosphatase inhibition further supporting the binding of Francisella DnaK to alkaline phosphatase. Release of DnaK via secretion and/or bacterial cell lysis into the extracellular milieu and inhibition of plasma alkaline phosphatase could promote an orchestrated, inflammatory response advantageous to Francisella. PMID:22923614
Francisella DnaK inhibits tissue-nonspecific alkaline phosphatase.
Arulanandam, Bernard P; Chetty, Senthilnath Lakshmana; Yu, Jieh-Juen; Leonard, Sean; Klose, Karl; Seshu, Janakiram; Cap, Andrew; Valdes, James J; Chambers, James P
2012-10-26
Following pulmonary infection with Francisella tularensis, we observed an unexpected but significant reduction of alkaline phosphatase, an enzyme normally up-regulated following inflammation. However, no reduction was observed in mice infected with a closely related gram-negative pneumonic organism (Klebsiella pneumoniae) suggesting the inhibition may be Francisella-specific. In similar fashion to in vivo observations, addition of Francisella lysate to exogenous alkaline phosphatase (tissue-nonspecific isozyme) was inhibitory. Partial purification and subsequent proteomic analysis indicated the inhibitory factor to be the heat shock protein DnaK. Incubation with increasing amounts of anti-DnaK antibody reduced the inhibitory effect in a dose-dependent manner. Furthermore, DnaK contains an adenosine triphosphate binding domain at its N terminus, and addition of adenosine triphosphate enhances dissociation of DnaK with its target protein, e.g. alkaline phosphatase. Addition of adenosine triphosphate resulted in decreased DnaK co-immunoprecipitated with alkaline phosphatase as well as reduction of Francisella-mediated alkaline phosphatase inhibition further supporting the binding of Francisella DnaK to alkaline phosphatase. Release of DnaK via secretion and/or bacterial cell lysis into the extracellular milieu and inhibition of plasma alkaline phosphatase could promote an orchestrated, inflammatory response advantageous to Francisella.
Ren, Jimin; Sherry, A Dean; Malloy, Craig R
2015-12-01
The goal of this study was to amplify the effects of magnetization exchange between γ-adenosine triphosphate (ATP) and inorganic phosphate (Pi) for evaluation of ATP synthesis rates in human skeletal muscle. The strategy works by simultaneously inverting the (31) P resonances of phosphocreatine (PCr) and ATP using a wide bandwidth, adiabatic inversion radiofrequency pulse followed by observing dynamic changes in intensity of the noninverted Pi signal versus the delay time between the inversion and observation pulses. This band inversion technique significantly delays recovery of γ-ATP magnetization; consequently, the exchange reaction, Pi ↔ γ-ATP, is readily detected and easily analyzed. The ATP synthesis rate measured from high-quality spectral data using this method was 0.073 ± 0.011 s(-1) in resting human skeletal muscle (N = 10). The T1 of Pi was 6.93 ± 1.90 s, consistent with the intrinsic T1 of Pi at this field. The apparent T1 of γ-ATP was 4.07 ± 0.32 s, about two-fold longer than its intrinsic T1 due to storage of magnetization in PCr. Band inversion provides an effective method to amplify the effects of magnetization transfer between γ-ATP and Pi. The resulting data can be easily analyzed to obtain the ATP synthesis rate using a two-site exchange model. © 2014 Wiley Periodicals, Inc.
Fang, Ming; Chai, Yiqiu; Chen, Guanjv; Wang, Huidong; Huang, Bo
2016-01-01
The diamondback moth, Plutella xylostella, is one of the most important pests of cruciferous crops. We have earlier shown that N6-(2-hydroxyethyl)-adenosine (HEA) exhibits insecticidal activity against P. xylostella. In the present study we investigated the possible mechanism of insecticidal action of HEA on P. xylostella. HEA is a derivative of adenosine, therefore, we speculated whether it acts via P. xylostella adenosine receptor (PxAdoR). We used RNAi approach to silence PxAdoR gene and used antagonist of denosine receptor (AdoR) to study the insecticidal effect of HEA. We cloned the whole sequence of PxAdoR gene. A BLAST search using NCBI protein database showed a 61% identity with the Drosophila adenosine receptor (DmAdoR) and a 32–35% identity with human AdoR. Though the amino acids sequence of PxAdoR was different compared to other adenosine receptors, most of the amino acids that are known to be important for adenosine receptor ligand binding and signaling were present. However, only 30% binding sites key residues was similar between PxAdoR and A1R. HEA, at a dose of 1 mg/mL, was found to be lethal to the second-instar larvae of P. xylostella, and a significant reduction of mortality and growth inhibition ratio were obtained when HEA was administered to the larvae along with PxAdoR-dsRNA or antagonist of AdoR (SCH58261) for 36, 48, or 60 h. Especially at 48 h, the rate of growth inhibition of the PxAdoR knockdown group was 3.5-fold less than that of the HEA group, and the corrected mortality of SCH58261 group was reduced almost 2-fold compared with the HEA group. Our findings show that HEA may exert its insecticidal activity against P. xylostella larvae via acting on PxAdoR. PMID:27668428
Kobayashi, M; Takatori, T; Iwadate, K; Nakajima, M
1996-10-25
We examined the changes in adenosine triphosphate (ATP), lactic acid, adenosine diphosphate (ADP) and adenosine monophosphate (AMP) in five different rat muscles after death. Rigor mortis has been thought to occur simultaneously in dead muscles and hence to start in small muscles sooner than in large muscles. In this study we found that the rate of decrease in ATP was significantly different in each muscle. The greatest drop in ATP was observed in the masseter muscle. These findings contradict the conventional theory of rigor mortis. Similarly, the rates of change in ADP and lactic acid, which are thought to be related to the consumption or production of ATP, were different in each muscle. However, the rate of change of AMP was the same in each muscle.
Akintunde, J K; Oboh, G
2015-11-01
One of the major hazards arising from recycling sites is the generation of leachate containing mixed metal. This study evaluated the toxic effects of leachate obtained from Elewi Odo municipal auto-battery recycling site (EOMABRSL) on male liver functions using hepatic indices and biomarker of cellular adenosine triphosphate (ATP) in rat via the oral route. Concentrations of heavy metals analysis showed that lead, cadmium, nickel, chromium, manganese, and iron were 1.5-, 2-, 2.5-, 1.36-, 19.61-, and 8.89-folds, respectively, higher than acceptable limits set by regulatory authority World Health Organization. Copper, zinc, and cobalt were 5.9-, 300-, and 1.02-folds, respectively, lower than permissible limits. The EOMABRSL was administered at 20, 40, 60, 80, and 100% concentrations to adult male rats for 60 days. Following exposure, plasma and livers were collected for several biochemistry assays. Exposure of animals to EOMABRSL resulted in 27.51, 28.14, 63.93, 28.42, and 40.16% increase in aspartate aminotransferase activity, whereas it elevated alanine aminotransferase activity by 5.35, 22.33, 88.68, 183.02, and 193.08%, respectively, when compared with the control. Similarly, γ-glutamyl transferase activity increased by 111.22, 114.19, 122.96, 573.14, and 437.02%, respectively, when compared with the control. EOMABRSL administration significantly decreased catalase activity and reduced glutathione level and superoxide dismutase with concomitant increase in malondialdehyde and hydrogen peroxide levels. Also, significant (p < 0.05) decrease in lactate dehydrogenase (LDH) activity (marker of cellular ATP) was observed. Taken together, the hepatotoxicity of EOMABRSL could be due to the depletion of LDH and induction of oxidative damage, which may suggest possible health hazards in subjects with occupational or environmental exposure. © The Author(s) 2015.
Sugiyama, Akifumi; Shitan, Nobukazu; Yazaki, Kazufumi
2008-01-01
Legume plants have a unique ability to fix atmospheric nitrogen via symbiosis with rhizobia. For the establishment of symbiosis, legume plants secrete signaling molecules such as flavonoids from root tissues, leading to the attraction of rhizobia and the induction of rhizobial nod genes. Genistein and daidzein are found in soybean root exudates and function as signal molecules in soybean-Bradyrhizobium japonicum chemical communication. Although it is more than 20 years since these signal flavonoids were identified, almost nothing has been characterized concerning the membrane transport process of these molecules from soybean roots. To elucidate the transport mechanism we performed membrane transport assays with plasma membrane-enriched vesicles and various inhibitors. As a result, we concluded that an ATP-binding cassette-type transporter is involved in the secretion of genistein from soybean roots. The possible involvement of a pleiotropic drug resistance-type ABC transporter in this secretion is also discussed.
Adenosine Monophosphate (AMP)-Activated Protein Kinase: A New Target for Nutraceutical Compounds.
Marín-Aguilar, Fabiola; Pavillard, Luis E; Giampieri, Francesca; Bullón, Pedro; Cordero, Mario D
2017-01-29
Adenosine monophosphate-activated protein kinase (AMPK) is an important energy sensor which is activated by increases in adenosine monophosphate (AMP)/adenosine triphosphate (ATP) ratio and/or adenosine diphosphate (ADP)/ATP ratio, and increases different metabolic pathways such as fatty acid oxidation, glucose transport and mitochondrial biogenesis. In this sense, AMPK maintains cellular energy homeostasis by induction of catabolism and inhibition of ATP-consuming biosynthetic pathways to preserve ATP levels. Several studies indicate a reduction of AMPK sensitivity to cellular stress during aging and this could impair the downstream signaling and the maintenance of the cellular energy balance and the stress resistance. However, several diseases have been related with an AMPK dysfunction. Alterations in AMPK signaling decrease mitochondrial biogenesis, increase cellular stress and induce inflammation, which are typical events of the aging process and have been associated to several pathological processes. In this sense, in the last few years AMPK has been identified as a very interesting target and different nutraceutical compounds are being studied for an interesting potential effect on AMPK induction. In this review, we will evaluate the interaction of the different nutraceutical compounds to induce the AMPK phosphorylation and the applications in diseases such as cancer, type II diabetes, neurodegenerative diseases or cardiovascular diseases.
Adenosine Monophosphate (AMP)-Activated Protein Kinase: A New Target for Nutraceutical Compounds
Marín-Aguilar, Fabiola; Pavillard, Luis E.; Giampieri, Francesca; Bullón, Pedro; Cordero, Mario D.
2017-01-01
Adenosine monophosphate-activated protein kinase (AMPK) is an important energy sensor which is activated by increases in adenosine monophosphate (AMP)/adenosine triphosphate (ATP) ratio and/or adenosine diphosphate (ADP)/ATP ratio, and increases different metabolic pathways such as fatty acid oxidation, glucose transport and mitochondrial biogenesis. In this sense, AMPK maintains cellular energy homeostasis by induction of catabolism and inhibition of ATP-consuming biosynthetic pathways to preserve ATP levels. Several studies indicate a reduction of AMPK sensitivity to cellular stress during aging and this could impair the downstream signaling and the maintenance of the cellular energy balance and the stress resistance. However, several diseases have been related with an AMPK dysfunction. Alterations in AMPK signaling decrease mitochondrial biogenesis, increase cellular stress and induce inflammation, which are typical events of the aging process and have been associated to several pathological processes. In this sense, in the last few years AMPK has been identified as a very interesting target and different nutraceutical compounds are being studied for an interesting potential effect on AMPK induction. In this review, we will evaluate the interaction of the different nutraceutical compounds to induce the AMPK phosphorylation and the applications in diseases such as cancer, type II diabetes, neurodegenerative diseases or cardiovascular diseases. PMID:28146060
Gulati, Sonia; Balderes, Dina; Kim, Christine; Guo, Zhongmin A.; Wilcox, Lisa; Area-Gomez, Estela; Snider, Jamie; Wolinski, Heimo; Stagljar, Igor; Granato, Juliana T.; Ruggles, Kelly V.; DeGiorgis, Joseph A.; Kohlwein, Sepp D.; Schon, Eric A.; Sturley, Stephen L.
2015-01-01
A key component of eukaryotic lipid homeostasis is the esterification of sterols with fatty acids by sterol O-acyltransferases (SOATs). The esterification reactions are allosterically activated by their sterol substrates, the majority of which accumulate at the plasma membrane. We demonstrate that in yeast, sterol transport from the plasma membrane to the site of esterification is associated with the physical interaction of the major SOAT, acyl-coenzyme A:cholesterol acyltransferase (ACAT)-related enzyme (Are)2p, with 2 plasma membrane ATP-binding cassette (ABC) transporters: Aus1p and Pdr11p. Are2p, Aus1p, and Pdr11p, unlike the minor acyltransferase, Are1p, colocalize to sterol and sphingolipid-enriched, detergent-resistant microdomains (DRMs). Deletion of either ABC transporter results in Are2p relocalization to detergent-soluble membrane domains and a significant decrease (53–36%) in esterification of exogenous sterol. Similarly, in murine tissues, the SOAT1/Acat1 enzyme and activity localize to DRMs. This subcellular localization is diminished upon deletion of murine ABC transporters, such as Abcg1, which itself is DRM associated. We propose that the close proximity of sterol esterification and transport proteins to each other combined with their residence in lipid-enriched membrane microdomains facilitates rapid, high-capacity sterol transport and esterification, obviating any requirement for soluble intermediary proteins.—Gulati, S., Balderes, D., Kim, C., Guo, Z. A., Wilcox, L., Area-Gomez, E., Snider, J., Wolinski, H., Stagljar, I., Granato, J. T., Ruggles, K. V., DeGiorgis, J. A., Kohlwein, S. D., Schon, E. A., Sturley, S. L. ATP-binding cassette transporters and sterol O-acyltransferases interact at membrane microdomains to modulate sterol uptake and esterification. PMID:26220175
Gao, Zhuangqiang; Qiu, Zhenli; Lu, Minghua; Shu, Jian; Tang, Dianping
2017-03-15
This work designs a new label-free aptasensor for the colorimetric determination of small molecules (adenosine 5'-triphosphate, ATP) by using visible gold nanoparticles as the signal-generation tags, based on target-triggered hybridization chain reaction (HCR) between two hairpin DNA probes. The assay is carried out referring to the change in the color/absorbance by salt-induced aggregation of gold nanoparticles after the interaction with hairpins, gold nanoparticles and ATP. To construct such an assay system, two hairpin DNA probes with a short single-stranded DNA at the sticky end are utilized for interaction with gold nanoparticles. In the absence of target ATP, the hairpin DNA probes can prevent gold nanoparticles from the salt-induced aggregation through the interaction of the single-stranded DNA at the sticky end with gold nanoparticles. Upon target ATP introduction, the aptamer-based hairpin probe is opened to expose a new sticky end for the strand-displacement reaction with another complementary hairpin, thus resulting in the decreasing single-stranded DNA because of the consumption of hairpins. In this case, gold nanoparticles are uncovered owing to the formation of double-stranded DNA, which causes their aggregation upon addition of the salt, thereby leading to the change in the red-to-blue color. Under the optimal conditions, the HCR-based colorimetric assay presents good visible color or absorbance responses for the determination of target ATP at a concentration as low as 1.0nM. Importantly, the methodology can be further extended to quantitatively or qualitatively monitor other small molecules or biotoxins by changing the sequence of the corresponding aptamer. Copyright © 2016 Elsevier B.V. All rights reserved.
Molecular Evidence of Adenosine Deaminase Linking Adenosine A2A Receptor and CD26 Proteins
Moreno, Estefanía; Canet, Júlia; Gracia, Eduard; Lluís, Carme; Mallol, Josefa; Canela, Enric I.; Cortés, Antoni; Casadó, Vicent
2018-01-01
Adenosine is an endogenous purine nucleoside that acts in all living systems as a homeostatic network regulator through many pathways, which are adenosine receptor (AR)-dependent and -independent. From a metabolic point of view, adenosine deaminase (ADA) is an essential protein in the regulation of the total intracellular and extracellular adenosine in a tissue. In addition to its cytosolic localization, ADA is also expressed as an ecto-enzyme on the surface of different cells. Dipeptidyl peptidase IV (CD26) and some ARs act as binding proteins for extracellular ADA in humans. Since CD26 and ARs interact with ADA at opposite sites, we have investigated if ADA can function as a cell-to-cell communication molecule by bridging the anchoring molecules CD26 and A2AR present on the surfaces of the interacting cells. By combining site-directed mutagenesis of ADA amino acids involved in binding to A2AR and a modification of the bioluminescence resonance energy transfer (BRET) technique that allows detection of interactions between two proteins expressed in different cell populations with low steric hindrance (NanoBRET), we show direct evidence of the specific formation of trimeric complexes CD26-ADA-A2AR involving two cells. By dynamic mass redistribution assays and ligand binding experiments, we also demonstrate that A2AR-NanoLuc fusion proteins are functional. The existence of this ternary complex is in good agreement with the hypothesis that ADA could bridge T-cells (expressing CD26) and dendritic cells (expressing A2AR). This is a new metabolic function for ecto-ADA that, being a single chain protein, it has been considered as an example of moonlighting protein, because it performs more than one functional role (as a catalyst, a costimulator, an allosteric modulator and a cell-to-cell connector) without partitioning these functions in different subunits. PMID:29497379
Molecular Evidence of Adenosine Deaminase Linking Adenosine A2A Receptor and CD26 Proteins.
Moreno, Estefanía; Canet, Júlia; Gracia, Eduard; Lluís, Carme; Mallol, Josefa; Canela, Enric I; Cortés, Antoni; Casadó, Vicent
2018-01-01
Adenosine is an endogenous purine nucleoside that acts in all living systems as a homeostatic network regulator through many pathways, which are adenosine receptor (AR)-dependent and -independent. From a metabolic point of view, adenosine deaminase (ADA) is an essential protein in the regulation of the total intracellular and extracellular adenosine in a tissue. In addition to its cytosolic localization, ADA is also expressed as an ecto-enzyme on the surface of different cells. Dipeptidyl peptidase IV (CD26) and some ARs act as binding proteins for extracellular ADA in humans. Since CD26 and ARs interact with ADA at opposite sites, we have investigated if ADA can function as a cell-to-cell communication molecule by bridging the anchoring molecules CD26 and A 2A R present on the surfaces of the interacting cells. By combining site-directed mutagenesis of ADA amino acids involved in binding to A 2A R and a modification of the bioluminescence resonance energy transfer (BRET) technique that allows detection of interactions between two proteins expressed in different cell populations with low steric hindrance (NanoBRET), we show direct evidence of the specific formation of trimeric complexes CD26-ADA-A 2A R involving two cells. By dynamic mass redistribution assays and ligand binding experiments, we also demonstrate that A 2A R-NanoLuc fusion proteins are functional. The existence of this ternary complex is in good agreement with the hypothesis that ADA could bridge T-cells (expressing CD26) and dendritic cells (expressing A 2A R). This is a new metabolic function for ecto-ADA that, being a single chain protein, it has been considered as an example of moonlighting protein, because it performs more than one functional role (as a catalyst, a costimulator, an allosteric modulator and a cell-to-cell connector) without partitioning these functions in different subunits.
The NLRP3 inflammasome is activated by nanoparticles through ATP, ADP and adenosine
Baron, L; Gombault, A; Fanny, M; Villeret, B; Savigny, F; Guillou, N; Panek, C; Le Bert, M; Lagente, V; Rassendren, F; Riteau, N; Couillin, I
2015-01-01
The NLR pyrin domain containing 3 (NLRP3) inflammasome is a major component of the innate immune system, but its mechanism of activation by a wide range of molecules remains largely unknown. Widely used nano-sized inorganic metal oxides such as silica dioxide (nano-SiO2) and titanium dioxide (nano-TiO2) activate the NLRP3 inflammasome in macrophages similarly to silica or asbestos micro-sized particles. By investigating towards the molecular mechanisms of inflammasome activation in response to nanoparticles, we show here that active adenosine triphosphate (ATP) release and subsequent ATP, adenosine diphosphate (ADP) and adenosine receptor signalling are required for inflammasome activation. Nano-SiO2 or nano-TiO2 caused a significant increase in P2Y1, P2Y2, A2A and/or A2B receptor expression, whereas the P2X7 receptor was downregulated. Interestingly, IL-1β secretion in response to nanoparticles is increased by enhanced ATP and ADP hydrolysis, whereas it is decreased by adenosine degradation or selective A2A or A2B receptor inhibition. Downstream of these receptors, our results show that nanoparticles activate the NLRP3 inflammasome via activation of PLC-InsP3 and/or inhibition of adenylate cyclase (ADCY)-cAMP pathways. Finally, a high dose of adenosine triggers inflammasome activation and IL-1β secretion through adenosine cellular uptake by nucleotide transporters and by its subsequent transformation in ATP by adenosine kinase. In summary, we show for the first time that extracellular adenosine activates the NLRP3 inflammasome by two ways: by interacting with adenosine receptors at nanomolar/micromolar concentrations and through cellular uptake by equilibrative nucleoside transporters at millimolar concentrations. These findings provide new molecular insights on the mechanisms of NLRP3 inflammasome activation and new therapeutic strategies to control inflammation. PMID:25654762
Structure, function, and evolution of bacterial ATP-binding cassette systems
DOE Office of Scientific and Technical Information (OSTI.GOV)
Davidson, A.L.; Dassa, E.; Orelle, C.
2010-07-27
The ATP-binding cassette (ABC) systems constitute one of the largest superfamilies of paralogous sequences. All ABC systems share a highly conserved ATP-hydrolyzing domain or protein (the ABC; also referred to as a nucleotide-binding domain [NBD]) that is unequivocally characterized by three short sequence motifs (Fig. 1): these are the Walker A and Walker B motifs, indicative of the presence of a nucleotide-binding site, and the signature motif, unique to ABC proteins, located upstream of the Walker B motif (426). Other motifs diagnostic of ABC proteins are also indicated in Fig. 1. The biological significance of these motifs is discussed inmore » Structure, Function, and Dynamics of the ABC. ABC systems are widespread among living organisms and have been detected in all genera of the three kingdoms of life, with remarkable conservation in the primary sequence of the cassette and in the organization of the constitutive domains or subunits (203, 420). ABC systems couple the energy of ATP hydrolysis to an impressively large variety of essential biological phenomena, comprising not only transmembrane (TM) transport, for which they are best known, but also several non-transport-related processes, such as translation elongation (62) and DNA repair (174). Although ABC systems deserve much attention because they are involved in severe human inherited diseases (107), they were first discovered and characterized in detail in prokaryotes, as early as the 1970s (13, 148, 238, 468). The most extensively analyzed systems were the high-affinity histidine and maltose uptake systems of Salmonella enterica serovar Typhimurium and Escherichia coli. Over 2 decades ago, after the completion of the nucleotide sequences encoding these transporters in the respective laboratories of Giovanna Ames and Maurice Hofnung, Hiroshi Nikaido and colleagues noticed that the two systems displayed a global similarity in the nature of their components and, moreover, that the primary sequences of
DOE Office of Scientific and Technical Information (OSTI.GOV)
Browne, E.S.; Bhalla, V.K.
1991-02-01
Rat testicular interstitial cells were separated by three different gradient-density procedures and, with each, two biochemically and morphologically distinct cell fractions were isolated. The lighter density cells in fraction-I bound iodine 125-labeled human chorionic gonadotropin (hCG) with high-affinity (apparent equilibrium dissociation constant, Kd, approximately 10{sup {minus} 10} M) without producing either cyclic adenosine monophosphate or testosterone in response to hormone action. The heavier-density cells displayed morphologic features typical of Leydig cells and produced cyclic adenosine monophosphate and testosterone in the presence of hCG without detectable {sup 125}I-labeled hCG high-affinity binding. These cell fractions were further characterized by studies using deglycosylatedmore » hCG, a known antagonist to hCG action. Cell concentration-dependent studies with purified Leydig cells revealed that maximal testosterone production was achieved when lower cell concentrations (0.5 x 10(6) cells/250 microliters) were used for in vitro hCG stimulation assays. Under these conditions, the {sup 125}I-labeled hCG binding was barely detectable (2.24 fmol; 2,698 sites/cell). Furthermore, these studies revealed that the hCG-specific binding in Leydig cells is overestimated by the classic method for nonspecific binding correction using excess unlabeled hormone. An alternate method is presented.« less
Crystal structures of the adenylate sensor from fission yeast AMP-activated protein kinase.
Townley, Robert; Shapiro, Lawrence
2007-03-23
The 5'-AMP (adenosine monophosphate)-activated protein kinase (AMPK) coordinates metabolic function with energy availability by responding to changes in intracellular ATP (adenosine triphosphate) and AMP concentrations. Here, we report crystal structures at 2.9 and 2.6 A resolution for ATP- and AMP-bound forms of a core alphabetagamma adenylate-binding domain from the fission yeast AMPK homolog. ATP and AMP bind competitively to a single site in the gamma subunit, with their respective phosphate groups positioned near function-impairing mutants. Unexpectedly, ATP binds without counterions, amplifying its electrostatic effects on a critical regulatory region where all three subunits converge.
Functional effects of uridine triphosphate on human skinned skeletal muscle fibers.
Vianna-Jorge, R; Oliveira, C F; Mounier, Y; Suarez-Kurtz, G
1998-02-01
Chemically skinned human skeletal muscle fibers were used to study the effects of uridine triphosphate (UTP) on the tension-pCa relationship and on Ca2+ uptake and release by the sarcoplasmic reticulum (SR). Total replacement (2.5 mM) of adenosine triphosphate (ATP) with UTP (i) displaced the tension-pCa relationship to the left along the abcissae and increased maximum Ca(2+)-activated tension, both effects being larger in slow- than in fast-type fibers; (ii) markedly reduced Ca2+ uptake by the SR (evaluated by the caffeine-evoked tension) in both fiber types; (iii) had no effect on the rate of depletion of caffeine-sensitive Ca2+ stores during soaking in relaxing solutions; (iv) induced tension in slow- but not in fast-type fibers. The effects on the SR functional properties are consistent with the notion that UTP is a poor substitute for ATP as a substrate for the Ca ATPase pump and as an agonist of the ryanodine-sensitive Ca(2+)-release channel. The UTP-induced tension in human slow-type fibers is attributed to effect(s) of the nucleotide on the tension-pCa relationship of the contractile machinery. The present data reveal important differences between the effects of UTP on human versus rat muscle fibers.
Bhagavat, Raghu; Srinivasan, Narayanaswamy; Chandra, Nagasuma
2017-09-01
Nucleoside triphosphate (NTP) ligands are of high biological importance and are essential for all life forms. A pre-requisite for them to participate in diverse biochemical processes is their recognition by diverse proteins. It is thus of great interest to understand the basis for such recognition in different proteins. Towards this, we have used a structural bioinformatics approach and analyze structures of 4677 NTP complexes available in Protein Data Bank (PDB). Binding sites were extracted and compared exhaustively using PocketMatch, a sensitive in-house site comparison algorithm, which resulted in grouping the entire dataset into 27 site-types. Each of these site-types represent a structural motif comprised of two or more residue conservations, derived using another in-house tool for superposing binding sites, PocketAlign. The 27 site-types could be grouped further into 9 super-types by considering partial similarities in the sites, which indicated that the individual site-types comprise different combinations of one or more site features. A scan across PDB using the 27 structural motifs determined the motifs to be specific to NTP binding sites, and a computational alanine mutagenesis indicated that residues identified to be highly conserved in the motifs are also most contributing to binding. Alternate orientations of the ligand in several site-types were observed and rationalized, indicating the possibility of some residues serving as anchors for NTP recognition. The presence of multiple site-types and the grouping of multiple folds into each site-type is strongly suggestive of convergent evolution. Knowledge of determinants obtained from this study will be useful for detecting function in unknown proteins. Proteins 2017; 85:1699-1712. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Video Cartridges and Cassettes.
ERIC Educational Resources Information Center
Kletter, Richard C.; Hudson, Heather
The economic and social significance of video cassettes (viewer-controlled playback system) is explored in this report. The potential effect of video cassettes on industrial training, education, libraries, and television is analyzed in conjunction with the anticipated hardware developments. The entire video cassette industry is reviewed firm by…
ATP Hydrolysis Mechanism in a Maltose Transporter Explored by QM/MM Metadynamics Simulation.
Hsu, Wei-Lin; Furuta, Tadaomi; Sakurai, Minoru
2016-11-03
Translocation of substrates across the cell membrane by adenosine 5'-triphosphate (ATP)-binding cassette (ABC) transporters depends on the energy provided by ATP hydrolysis within the nucleotide-binding domains (NBDs). However, the detailed mechanism remains unclear. In this study, we focused on maltose transporter NBDs (MalK 2 ) and performed a quantum mechanical/molecular mechanical (QM/MM) well-tempered metadynamics simulation to address this issue. We explored the free-energy profile along an assigned collective variable. As a result, it was determined that the activation free energy is approximately 10.5 kcal/mol, and the reaction released approximately 3.8 kcal/mol of free energy, indicating that the reaction of interest is a one-step exothermic reaction. The dissociation of the ATP γ-phosphate seems to be the rate-limiting step, which supports the so-called dissociative model. Moreover, Glu159, located in the Walker B motif, acts as a base to abstract the proton from the lytic water, but is not the catalytic base, which corresponds to an atypical general base catalysis model. We also observed two interesting proton transfers: transfer from the His192 ε-position nitrogen to the dissociated inorganic phosphate, Pi, and transfer from the Lys42 side chain to adenosine 5'-diphosphate β-phosphate. These proton transfers would stabilize the posthydrolysis state. Our study provides significant insight into the ATP hydrolysis mechanism in MalK 2 from a dynamical viewpoint, and this insight would be applicable to other ABC transporters.
Lozos, Vasileios A; Toumpoulis, Ioannis K; Agrogiannis, Georgios; Giamarellos-Bourboulis, Evangelos J; Chamogeorgakis, Themistocles P; Rizos, Ioannis K; Patsouris, Efstratios S; Anagnostopoulos, Constantine E; Rokkas, Chris K
2013-01-01
Potassium adenosine triphosphate (KATP) channel openers have been involved in the enhancement of ischemic tolerance in various tissues. The purpose of the present study is to evaluate the effects of aprikalim, a specific KATP channel opener, on spinal cord ischemic injury. Fifty-four rabbits were randomly assigned to three groups: group 1 (n = 18, sham operation), group 2 (n = 18, 30 min of normothermic aortic cross-clamping) and group 3 (n = 18, aprikalim 100 μg/kg was administered 15 min before 30 min of normothermic aortic cross-clamping). Neurologic evaluation was performed according to the modified Tarlov scale. Six animals from each group were sacrificed at 24, 48 and 168 h postoperatively. The lumbar spinal cords were harvested and examined histologically. The motor neurons were counted and the histologic lesions were scored (0-3, 3: normal). Group 3 (aprikalim group) had better Tarlov scores compared to group 2 at all-time points (P < 0.025). The histologic changes were proportional to the Tarlov scores and group 3 had better functional outcome as compared to group 2 at 168 h (number of neurons: 21.2 ± 4.9 vs. 8.0 ± 2.7, P < 0.001 and histologic score: 1.67 ± 1.03 vs. 0.50 ± 0.55, P = 0.03). Although aprikalim exhibited improved effect on clinical and histologic neurologic outcome when compared to normothermic spinal cord ischemia, animals in group 3 had worse Tarlov score, reduced number of motor neurons and worse histologic score when compared to group 1 (sham operation) at 168 h (P = 0.003, P = 0.001 and P = 0.019 respectively). Aprikalim reduces the severity of spinal cord ischemic injury in a rabbit model of spinal cord ischemia. Copyright © 2013 Surgical Associates Ltd. Published by Elsevier Ltd. All rights reserved.
Akintunde, Jacob K; Bolarin, Olakunle Enock; Akintunde, Daniel G
2016-03-01
Garlic capsule (GAR) and/or selenium- vitamin A, C, E (S-VACE) might be useful in the treatment of lung diseases. The present study evaluated the toxicity of lisinopril (LIS) in the lungs of male rats and the reversal effect of GAR and/or selenium-vitamins A, C, and E (S-VACE). Group I served as the control, whereas animals in groups II, III, IV, and V received 28 mg of LIS/kg body weight by gavage. Group III was co-treated with GAR at a therapeutic dosage of 250 mg/kg body weight per day. Group IV was co-treated with S-VACE at dosage of 500 mg/kg body weight per day. Lastly, group V was co-treated with GAR and S-VACE at dosages of 250 and 500 mg/kg body weight per day, respectively. The experiment lasted for 8 days (sub-acute exposure). Administration of therapeutic dose of LIS to male rats depleted enzymatic antioxidants (superoxide dismutase and catalase) and cellular adenosine triphosphate content with concomitant increase in lipid peroxidation. Histopathology examination showed damage to the epithelial cells of the airways. These effects were prevented by both single and combination treatment of GAR and S-VACE in male rats with LIS-induced lung toxicity. We therefore concluded that the combination of GAR and S-VACE can be a novel therapy for the management of lung diseases in humans.
Stukkens, Yvan; Bultreys, Alain; Grec, Sébastien; Trombik, Tomasz; Vanham, Delphine; Boutry, Marc
2005-09-01
Nicotiana plumbaginifolia NpPDR1, a plasma membrane pleiotropic drug resistance-type ATP-binding cassette transporter formerly named NpABC1, has been suggested to transport the diterpene sclareol, an antifungal compound. However, direct evidence for a role of pleiotropic drug resistance transporters in the plant defense is still lacking. In situ immunolocalization and histochemical analysis using the gusA reporter gene showed that NpPDR1 was constitutively expressed in the whole root, in the leaf glandular trichomes, and in the flower petals. However, NpPDR1 expression was induced in the whole leaf following infection with the fungus Botrytis cinerea, and the bacteria Pseudomonas syringae pv tabaci, Pseudomonas fluorescens, and Pseudomonas marginalis pv marginalis, which do not induce a hypersensitive response in N. plumbaginifolia, whereas a weaker response was observed using P. syringae pv syringae, which does induce a hypersensitive response. Induced NpPDR1 expression was more associated with the jasmonic acid than the salicylic acid signaling pathway. These data suggest that NpPDR1 is involved in both constitutive and jasmonic acid-dependent induced defense. Transgenic plants in which NpPDR1 expression was prevented by RNA interference showed increased sensitivity to sclareol and reduced resistance to B. cinerea. These data show that NpPDR1 is involved in pathogen resistance and thus demonstrate a new role for the ATP-binding cassette transporter family.
Mitamura, Toshiaki; Yamamura, Yoshimi; Kurosaki, Fumiya
2011-01-01
Translocation of two Rac/Rop guanosine 5'-triphosphate-binding proteins from Scoparia dulcis, Sdrac-1 and Sdrac-2, was examined employing transformed belladonna which overproduces these proteins as glutathione-S-transferase-tagged forms. The transferase activities of the fused proteins in microsomal fraction of belladonna markedly increased by the incubation with methyl jasmonate either in Sdrac-1 or Sdrac-2 transformant, while low and constant activities were observed in the untreated control. Recombinant Sdrac-2 protein was found to bind to prenyl chain in the presence of cell extracts prepared from methyl jasmonate-treated S. dulcis, however, Sdrac-1 was palmitoylated by the addition of the cell extracts. These results suggest that both Sdrac-1 and Sdrac-2 translocate to plant membranes by the stimulation with methyl jasmonate, however, targeting of these proteins is triggered by the independent modification mechanisms, palmitoylation for Sdrac-1 and prenylation for Sdrac-2.
Jeong, Byung-Cheon; Park, Si Hoon; Yoo, Kyoung Shin; Shin, Jeong Sheop; Song, Hyun Kyu
2013-07-01
Cystathionine β-synthase (CBS) domains are small intracellular modules that can act as binding domains for adenosine derivatives, and they may regulate the activity of associated enzymes or other functional domains. Among these, the single CBS domain-containing proteins, CBSXs, from Arabidopsis thaliana, have recently been identified as redox regulators of the thioredoxin system. Here, the crystal structure of CBSX2 in complex with adenosine monophosphate (AMP) is reported at 2.2Å resolution. The structure of dimeric CBSX2 with bound-AMP is shown to be approximately flat, which is in stark contrast to the bent form of apo-CBSXs. This conformational change in quaternary structure is triggered by a local structural change of the unique α5 helix, and by moving each loop P into an open conformation to accommodate incoming ligands. Furthermore, subtle rearrangement of the dimer interface triggers movement of all subunits, and consequently, the bent structure of the CBSX2 dimer becomes a flat structure. This reshaping of the structure upon complex formation with adenosine-containing ligand provides evidence that ligand-induced conformational reorganization of antiparallel CBS domains is an important regulatory mechanism. Copyright © 2013 Elsevier Inc. All rights reserved.
Peycke, Laura E; Hosgood, Giselle; Davidson, Jacqueline R; Tetens, Joanne; Taylor, H Wayne
2005-07-01
The objective of this study was to determine if experimental gastric dilatation volvulus (GDV) would decrease adenosine triphosphate (ATP) concentration and increase membrane conductance of the canine gastric and jejunal mucosa. Male dogs (n = 15) weighing between 20 and 30 kg were used. Dogs were randomly assigned to 1 of 3 equal groups: Group 1 was control, group 2 was GDV, and group 3 was ischemia. All dogs were anesthetized for 210 min. Group 1 had no manipulation. Group 2 had GDV experimentally induced for 120 min followed by decompression, derotation, and reperfusion for 90 min. Group 3 had GDV experimentally induced for 210 min. Gastric (fundus and pylorus) and jejunal tissue was taken at 0, 120, and 210 min from all of the dogs. Tissue was analyzed for ATP concentration, mucosal conductance, and microscopic changes. The ATP concentration in the fundus did not change significantly from baseline in group 2, but decreased significantly below baseline at 210 min in group 3. The ATP concentration in the jejunum decreased significantly below baseline in groups 2 and 3 at 120 min, remaining significantly decreased in group 3 but returning to baseline at 210 min in group 2. Mucosal conductance of the fundus did not change significantly in any dog. Mucosal conductance of the jejunum increased at 120 min in groups 2 and 3, and became significantly increased above baseline at 210 min. The jejunal mucosa showed more profound cellular changes than the gastric mucosa. The jejunum showed substantial decreases in ATP concentration with an increase in mucosal conductance, suggesting cell membrane dysfunction. Dogs sustaining a GDV are likely to have a change in the activity of mucosal cells in the jejunum, which may be important in the pathophysiology of GDV.
2005-01-01
Abstract The objective of this study was to determine if experimental gastric dilatation volvulus (GDV) would decrease adenosine triphosphate (ATP) concentration and increase membrane conductance of the canine gastric and jejunal mucosa. Male dogs (n = 15) weighing between 20 and 30 kg were used. Dogs were randomly assigned to 1 of 3 equal groups: Group 1 was control, group 2 was GDV, and group 3 was ischemia. All dogs were anesthetized for 210 min. Group 1 had no manipulation. Group 2 had GDV experimentally induced for 120 min followed by decompression, derotation, and reperfusion for 90 min. Group 3 had GDV experimentally induced for 210 min. Gastric (fundus and pylorus) and jejunal tissue was taken at 0, 120, and 210 min from all of the dogs. Tissue was analyzed for ATP concentration, mucosal conductance, and microscopic changes. The ATP concentration in the fundus did not change significantly from baseline in group 2, but decreased significantly below baseline at 210 min in group 3. The ATP concentration in the jejunum decreased significantly below baseline in groups 2 and 3 at 120 min, remaining significantly decreased in group 3 but returning to baseline at 210 min in group 2. Mucosal conductance of the fundus did not change significantly in any dog. Mucosal conductance of the jejunum increased at 120 min in groups 2 and 3, and became significantly increased above baseline at 210 min. The jejunal mucosa showed more profound cellular changes than the gastric mucosa. The jejunum showed substantial decreases in ATP concentration with an increase in mucosal conductance, suggesting cell membrane dysfunction. Dogs sustaining a GDV are likely to have a change in the activity of mucosal cells in the jejunum, which may be important in the pathophysiology of GDV. PMID:16187546
Amoushahi, Mahboobeh; Salehnia, Mojdeh; HosseinKhani, Saman
2013-01-01
Background: The mitochondria are an important source of adenosine triphosphate (ATP) production in pre-implantation embryo. Therefore, the objective of this study was to investigate the effect of vitrification and in vitro culture of mouse embryos on their mitochondrial distribution and ATP content. Methods: The embryos at 2-PN, 4-cell and blastocyst stages were collected from the oviduct of stimulated pregnant mice and uterine horns. Then, the embryos were vitrified with the cryotop method using ethylene glycol and dimethylsulphoxide. After evaluating the survival rates of vitrified embryos, their development to hatching stages were assessed. The ATP content of collected in vivo and in vitro embryos at different stages was measured by luciferin-luciferase bioluminescence assay. The distribution of mitochondria was studied using Mito-tracker green staining under a fluorescent microscope. Results: The survival rates of vitrified embryos at 2-PN, 4-cell and early blastocyst stages were 84.3, 87.87 and 89.89%, respectively. The hatching rates in previous developmental stages in vitrified group were 57.44, 66.73 and 70.89% and in non-vitrified group were 66.32, 73.25 and 75.89%, respectively (P>0.05). The ATP content of in vivo or in vitro collected embryos was not significantly different in both vitrified and non-vitrified groups (P>0.05). Mitochondrial distribution of vitrified and non-vitrified 2-PN embryos was similar, but some clampings or large aggregation of mitochondria within the vitrified 4-cell embryos was prominent. Conclusions: Vitrification method did not affect the mouse embryo ATP content. Also, the cellular stress was not induced by this procedure and the safety of vitrification was shown. PMID:23748889
Li, Na; Liu, Shi Gang; Fan, Yu Zhu; Ju, Yan Jun; Xiao, Na; Luo, Hong Qun; Li, Nian Bing
2018-07-12
The various synthetic routes of carbon dots (C-dots) feature a considerable step toward their potential use in chemical sensors and biotechnology. Herein, by coupling phosphorus and nitrogen element introduction, the adenosine-derived N/P co-doped C-dots with fluorescence enhancement were achieved. By separately employing adenosine, adenosine monophosphate, adenosine diphosphate, and adenosine-5'-triphosphate as precursors, the effect of N/P co-doping on the fluorescence emission is discussed in detail. The formed C-dots with adenosine monophosphate exhibited strong blue fluorescence with a high quantum yield of 33.81%. Then the C-dots were employed as a fluorescent probe and utilized to develop a fast, sensitive, and selective picric acid sensor. The fluorescence of C-dots can be quenched by picric acid immediately, giving rise to a picric acid determination down to 30 nM. The possible mechanism of fluorescence quenching was discussed, which was proved to be inner filter effect and static quenching. Moreover, this method has the potential to detect picric acid in environmental water samples. Copyright © 2018 Elsevier B.V. All rights reserved.
Mueller, Sherry A; Anderson, James E; Kim, Byung R; Ball, James C
2009-04-01
Effective bacterial control in cooling-tower systems requires accurate and timely methods to count bacteria. Plate-count methods are difficult to implement on-site, because they are time- and labor-intensive and require sterile techniques. Several field-applicable methods (dipslides, Petrifilm, and adenosine triphosphate [ATP] bioluminescence) were compared with the plate count for two sample matrices--phosphate-buffered saline solution containing a pure culture of Pseudomonas fluorescens and cooling-tower water containing an undefined mixed bacterial culture. For the pure culture, (1) counts determined on nutrient agar and plate-count agar (PCA) media and expressed as colony-forming units (CFU) per milliliter were equivalent to those on R2A medium (p = 1.0 and p = 1.0, respectively); (2) Petrifilm counts were not significantly different from R2A plate counts (p = 0.99); (3) the dipslide counts were up to 2 log units higher than R2A plate counts, but this discrepancy was not statistically significant (p = 0.06); and (4) a discernable correlation (r2 = 0.67) existed between ATP readings and plate counts. For cooling-tower water samples (n = 62), (1) bacterial counts using R2A medium were higher (but not significant; p = 0.63) than nutrient agar and significantly higher than tryptone-glucose yeast extract (TGE; p = 0.03) and PCA (p < 0.001); (2) Petrifilm counts were significantly lower than nutrient agar or R2A (p = 0.02 and p < 0.001, respectively), but not statistically different from TGE, PCA, and dipslides (p = 0.55, p = 0.69, and p = 0.91, respectively); (3) the dipslide method yielded bacteria counts 1 to 3 log units lower than nutrient agar and R2A (p < 0.001), but was not significantly different from Petrifilm (p = 0.91), PCA (p = 1.00) or TGE (p = 0.07); (4) the differences between dipslides and the other methods became greater with a 6-day incubation time; and (5) the correlation between ATP readings and plate counts varied from system to system, was poor
Burger, Patrick; Korsten, Herbert; De Korte, Dirk; Rombout, Eva; Van Bruggen, Robin; Verhoeven, Arthur J
2010-11-01
Current additive solutions (ASs) for red blood cells (RBCs) do not maintain constant 2,3-diphosphoglycerate (DPG) and adenosine triphosphate (ATP) levels during cold storage. We have previously shown that with a new AS called phosphate-adenine-glucose-guanosine-gluconate-mannitol (PAGGGM), both 2,3-DPG and ATP could be maintained throughout storage for 35 days. In this study, the mechanism underlying the effect of PAGGGM on RBC storage was studied in more detail. By using double-erythrocytapheresis units (leukoreduced), a direct comparison could be made between the current AS saline-adenine-glucose-mannitol (SAGM) and the experimental solution PAGGGM. During cold storage, several in vitro characteristics were analyzed. In agreement with our previous findings with single RBCs, PAGGGM maintained 2,3-DPG and ATP levels for 35 days of cold storage. Furthermore, glucose consumption and lactate production were higher in PAGGGM units during the first 21 days of cold storage. Fructose-1,6-diphophate and dihydroxyacetone phosphate levels were also increased during the first 21 days of storage in PAGGGM units. These results indicate that it is likely that phosphofructokinase (PFK) activity is enhanced in PAGGGM units relative to SAGM units. After 21 days, PFK activity also decreases in PAGGGM units, but sufficient metabolic reserve in these units prevents depletion of 2,3-DPG and ATP. © 2010 American Association of Blood Banks.
Characterization of the swine adipocyte A1 adenosine receptor using an optimized assay system.
Dong, Q; Schuchman, J; Carey, G B
1994-07-01
The radioligand binding assay of A1 adenosine receptors in adipocyte crude plasma membrane from Yucatan miniature swine was optimized by evaluating 17 factors involved in the assay. Significant effects of CHAPS, adenosine deaminase, EDTA, pre-rinsing glass fiber filters and pH were found for the binding measurements. Using the optimized procedure, [3H]8-cyclopentyl-1,3-dipropylxanthine, ([3H]-DPCPX) binding to A1 adenosine receptors in swine subcutaneous adipocyte crude plasma membrane was measured; Bmax and Kd values were 479 +/- 77 fmol/mg protein and 0.87 +/- 0.10 nM, respectively. Values for mesenteric adipose tissue from sedentary swine and subcutaneous adipose tissue from exercise-trained swine were also measured.
Stukkens, Yvan; Bultreys, Alain; Grec, Sébastien; Trombik, Tomasz; Vanham, Delphine; Boutry, Marc
2005-01-01
Nicotiana plumbaginifolia NpPDR1, a plasma membrane pleiotropic drug resistance-type ATP-binding cassette transporter formerly named NpABC1, has been suggested to transport the diterpene sclareol, an antifungal compound. However, direct evidence for a role of pleiotropic drug resistance transporters in the plant defense is still lacking. In situ immunolocalization and histochemical analysis using the gusA reporter gene showed that NpPDR1 was constitutively expressed in the whole root, in the leaf glandular trichomes, and in the flower petals. However, NpPDR1 expression was induced in the whole leaf following infection with the fungus Botrytis cinerea, and the bacteria Pseudomonas syringae pv tabaci, Pseudomonas fluorescens, and Pseudomonas marginalis pv marginalis, which do not induce a hypersensitive response in N. plumbaginifolia, whereas a weaker response was observed using P. syringae pv syringae, which does induce a hypersensitive response. Induced NpPDR1 expression was more associated with the jasmonic acid than the salicylic acid signaling pathway. These data suggest that NpPDR1 is involved in both constitutive and jasmonic acid-dependent induced defense. Transgenic plants in which NpPDR1 expression was prevented by RNA interference showed increased sensitivity to sclareol and reduced resistance to B. cinerea. These data show that NpPDR1 is involved in pathogen resistance and thus demonstrate a new role for the ATP-binding cassette transporter family. PMID:16126865
Long-range coupling between ATP-binding and lever-arm regions in myosin via dielectric allostery
NASA Astrophysics Data System (ADS)
Sato, Takato; Ohnuki, Jun; Takano, Mitsunori
2017-12-01
A protein molecule is a dielectric substance, so the binding of a ligand is expected to induce dielectric response in the protein molecule, considering that ligands are charged or polar in general. We previously reported that binding of adenosine triphosphate (ATP) to molecular motor myosin actually induces such a dielectric response in myosin due to the net negative charge of ATP. By this dielectric response, referred to as "dielectric allostery," spatially separated two regions in myosin, the ATP-binding region and the actin-binding region, are allosterically coupled. In this study, from the statistically stringent analyses of the extensive molecular dynamics simulation data obtained in the ATP-free and the ATP-bound states, we show that there exists the dielectric allostery that transmits the signal of ATP binding toward the distant lever-arm region. The ATP-binding-induced electrostatic potential change observed on the surface of the main domain induced a movement of the converter subdomain from which the lever arm extends. The dielectric response was found to be caused by an underlying large-scale concerted rearrangement of the electrostatic bond network, in which highly conserved charged/polar residues are involved. Our study suggests the importance of the dielectric property for molecular machines in exerting their function.
Peters, E; Geraci, S; Heemskerk, S; Wilmer, M J; Bilos, A; Kraenzlin, B; Gretz, N; Pickkers, P; Masereeuw, R
2015-10-01
Recently, two phase-II trials demonstrated improved renal function in critically ill patients with sepsis-associated acute kidney injury treated with the enzyme alkaline phosphatase. Here, we elucidated the dual active effect on renal protection of alkaline phosphatase. The effect of human recombinant alkaline phosphatase (recAP) on LPS-induced renal injury was studied in Sprague-Dawley rats. Renal function was assessed by transcutaneous measurement of FITC-sinistrin elimination in freely moving, awake rats. The mechanism of action of recAP was further investigated in vitro using conditionally immortalized human proximal tubular epithelial cells (ciPTEC). In vivo, LPS administration significantly prolonged FITC-sinistrin half-life and increased fractional urea excretion, which was prevented by recAP co-administration. Moreover, recAP prevented LPS-induced increase in proximal tubule injury marker, kidney injury molecule-1 expression and excretion. In vitro, LPS-induced production of TNF-α, IL-6 and IL-8 was significantly attenuated by recAP. This effect was linked to dephosphorylation, as enzymatically inactive recAP had no effect on LPS-induced cytokine production. RecAP-mediated protection resulted in increased adenosine levels through dephosphorylation of LPS-induced extracellular ADP and ATP. Also, recAP attenuated LPS-induced increased expression of adenosine A2A receptor. However, the A2A receptor antagonist ZM-241385 did not diminish the effects of recAP. These results indicate that the ability of recAP to reduce renal inflammation may account for the beneficial effect observed in septic acute kidney injury patients, and that dephosphorylation of ATP and LPS are responsible for this protective effect. © 2015 The British Pharmacological Society.
Rijpma, Sanna R; van der Velden, Maarten; González-Pons, Maria; Annoura, Takeshi; van Schaijk, Ben C L; van Gemert, Geert-Jan; van den Heuvel, Jeroen J M W; Ramesar, Jai; Chevalley-Maurel, Severine; Ploemen, Ivo H; Khan, Shahid M; Franetich, Jean-Francois; Mazier, Dominique; de Wilt, Johannes H W; Serrano, Adelfa E; Russel, Frans G M; Janse, Chris J; Sauerwein, Robert W; Koenderink, Jan B; Franke-Fayard, Blandine M
2016-03-01
Multidrug resistance-associated proteins (MRPs) belong to the C-family of ATP-binding cassette (ABC) transport proteins and are known to transport a variety of physiologically important compounds and to be involved in the extrusion of pharmaceuticals. Rodent malaria parasites encode a single ABC transporter subfamily C protein, whereas human parasites encode two: MRP1 and MRP2. Although associated with drug resistance, their biological function and substrates remain unknown. To elucidate the role of MRP throughout the parasite life cycle, Plasmodium berghei and Plasmodium falciparum mutants lacking MRP expression were generated. P. berghei mutants lacking expression of the single MRP as well as P. falciparum mutants lacking MRP1, MRP2 or both proteins have similar blood stage growth kinetics and drug-sensitivity profiles as wild type parasites. We show that MRP1-deficient parasites readily invade primary human hepatocytes and develop into mature liver stages. In contrast, both P. falciparum MRP2-deficient parasites and P. berghei mutants lacking MRP protein expression abort in mid to late liver stage development, failing to produce mature liver stages. The combined P. berghei and P. falciparum data are the first demonstration of a critical role of an ABC transporter during Plasmodium liver stage development. © 2015 John Wiley & Sons Ltd.
Kumar, Vivek; Chapple, Christopher R; Rosario, Derek; Tophill, Paul R; Chess-Williams, Russell
2010-06-01
There is increased evidence to suggest a role for nonadrenergic-noncholinergic neurotransmission in the pathogenesis of bladder dysfunction. In this set of experiments, we have assessed the contribution of the urothelium to purinergic activity by quantifying the amount of adenosine triphosphate (ATP) released from the urothelium of patients with idiopathic detrusor overactivity (IDO) and with neurogenic detrusor overactivity (NDO) and comparing these releases to those of controls. Bladder tissue with urodynamically and clinically proven NDO (n=8) and IDO (n=8) were included in this study. The carefully dissected urothelium was stimulated by mechanically stretching as well as electrically stimulating and the ATP; thus, release was quantified. We used a Lucy Anthos 1 luminometre (Anthos Labtec Instruments GmBH, Wals, Austria) to perform the assay. The results were analysed using Stingray software (Dazdaq Ltd, Brighton, UK). Both mechanical stretch and electric field stimulation (EFS) led to increased ATP release in both sets of tissues with overactivity compared to the controls; this rise was even more significant for the IDO urothelium (2416.7±479.8 pmol/g [p<0.005]) than for the NDO urothelium (133.1±22.4 pmol/g [p<0.01]); values for the controls were 77.6±16.2 pmol/g. ATP release following mechanical stretch was more sensitive to tetrodotoxin in bladders with NDO compared to those with IDO as well as to the controls, with ATP levels falling from 233.5±20.7 pmol/g to 107.2±11.6 pmol/g, expressed as percentage of basal levels (p<0.002). The experiments were performed in vitro, and the female patients were a mix of peri- and postmenopausal states. These experiments suggested a significant rise in ATP release from the urothelium of bladders with NDO as well as those with IDO in comparison to controls. Most of the ATP released from bladders with NDO is primarily from neuronal sources. Copyright © 2009 European Association of Urology. Published by Elsevier B
Ding, Q; Quah, S Y; Tan, K S
2016-10-01
Extracellular ATP (eATP) is an important intercellular signaling molecule secreted by activated immune cells or released by damaged cells. In mammalian cells, a rapid increase of ATP concentration in the extracellular space sends a danger signal, which alerts the immune system of an impending danger, resulting in recruitment and priming of phagocytes. Recent studies show that bacteria also release ATP into the extracellular milieu, suggesting a potential role for eATP in host-microbe interactions. It is currently unknown if any oral bacteria release eATP. As eATP triggers and amplifies innate immunity and inflammation, we hypothesized that eATP secreted from periodontal bacteria may contribute to inflammation in periodontitis. The aims of this study were to determine if periodontal bacteria secrete ATP, and to determine the function of bacterially derived eATP as an inducer of inflammation. Our results showed that Aggregatibacter actinomycetemcomitans, but not Porphyromonas gingivalis, Prevotella intermedia, or Fusobacterium nucleatum, secreted ATP into the culture supernatant. Exposure of periodontal fibroblasts to filter sterilized culture supernatant of A. actinomycetemcomitans induced chemokine expression in an eATP-dependent manner. This occurred independently of cyclic adenosine monophosphate and phospholipase C, suggesting that ionotrophic P2X receptor is involved in sensing of bacterial eATP. Silencing of P2X7 receptor in periodontal fibroblasts led to a significant reduction in bacterial eATP-induced chemokine response. Furthermore, bacterial eATP served as a potent chemoattractant for neutrophils and monocytes. Collectively, our findings provide evidence for secreted ATP of A. actinomycetemcomitans as a novel virulence factor contributing to inflammation during periodontal disease. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Badin, M S; Graf, L; Iyer, J K; Moffat, K A; Seecharan, J L; Hayward, C P M
2016-12-01
Lumi-aggregometry quantification of platelet dense granule adenosine triphosphate (ATP) release is commonly used for diagnosing platelet function disorders. As the test findings show considerable variability for healthy controls, we postulated that patient findings might also be variable and investigated patients who were assessed for dense granule ATP release defects more than once. Analyses were performed on prospectively collected data for first and second tests for subjects tested for dense granule ATP release defects more than once by the Hamilton Regional Laboratory Program (HRLMP) between January 2007 and June 2013 (cohort I). Similar analyses were performed for subjects who were recruited to a platelet disorder study (cohort II) and were assessed for ATP release defects more than once before October 2015. A total of 150 unique subjects had multiple ATP release tests. Results with individual agonists were variable for many subjects. While normal findings with all tested agonists were often confirmed by the second test (cohort I: 83%; cohort II: 100%), impaired release with multiple agonists was confirmed in only some subjects (cohort I: 34%; cohort II: 54%). Inconsistent findings were common (cohort I: 36%; cohort II: 39%). ISTH bleeding scores showed no relationship to the test findings. The finding of impaired ATP release with 2 or more agonists on both tests was not associated with an increased likelihood of a definite bleeding disorder. The variability in platelet dense granule ATP release findings amongst patients assessed for diagnostic purposes suggests that the test has limited value for diagnosing platelet disorders. © 2016 John Wiley & Sons Ltd.
Herman, Brian D.; Schinazi, Raymond F.; Zhang, Hong-wang; Nettles, James H.; Stanton, Richard; Detorio, Mervi; Obikhod, Aleksandr; Pradère, Ugo; Coats, Steven J.; Mellors, John W.; Sluis-Cremer, Nicolas
2012-01-01
β-D-3′-Azido-2′,3′-dideoxyguanosine (3′-azido-ddG) is a potent inhibitor of HIV-1 replication with a superior resistance profile to zidovudine. Recently, we identified five novel 6-modified-3′-azido-ddG analogs that exhibit similar or superior anti-HIV-1 activity compared to 3′-azido-ddG in primary cells. To gain insight into their structure–activity–resistance relationships, we synthesized their triphosphate (TP) forms and assessed their ability to inhibit HIV-1 reverse transcriptase (RT). Steady-state and pre-steady-state kinetic experiments show that the 6-modified-3′-azido-ddGTP analogs act as adenosine rather than guanosine mimetics in DNA synthesis reactions. The order of potency of the TP analogs against wild-type RT was: 3′-azido-2,6-diaminopurine >3′-azido-6-chloropurine; 3′-azido-6-N-allylaminopurine > 2-amino-6-N,N-dimethylaminopurine; 2-amino-6-methoxypurine. Molecular modeling studies reveal unique hydrogen-bonding interactions between the nucleotide analogs and the template thymine base in the active site of RT. Surprisingly, the structure–activity relationship of the analogs differed in HIV-1 RT ATP-mediated excision assays of their monophosphate forms, suggesting that it may be possible to rationally design a modified base analog that is efficiently incorporated by RT but serves as a poor substrate for ATP-mediated excision reactions. Overall, these studies identify a promising strategy to design novel nucleoside analogs that exert profound antiviral activity against both WT and drug-resistant HIV-1. PMID:21914723
Jeong, Chang-Bum; Kim, Hui-Su; Kang, Hye-Min; Lee, Jae-Seong
2017-04-01
The ATP-binding cassette (ABC) protein superfamily is known to play a fundamental role in biological processes and is highly conserved across animal taxa. The ABC proteins function as active transporters for multiple substrates across the cellular membrane by ATP hydrolysis. As this superfamily is derived from a common ancestor, ABC genes have evolved via lineage-specific duplications through the process of adaptation. In this review, we summarized information about the ABC gene families in aquatic invertebrates, considering their evolution and putative functions in defense mechanisms. Phylogenetic analysis was conducted to examine the evolutionary significance of ABC gene families in aquatic invertebrates. Particularly, a massive expansion of multixenobiotic resistance (MXR)-mediated efflux transporters was identified in the absence of the ABCG2 (BCRP) gene in Ecdysozoa and Platyzoa, suggesting that a loss of Abcg2 gene occurred sporadically in these species during divergence of Protostome to Lophotrochozoa. Furthermore, in aquatic invertebrates, the ecotoxicological significance of MXR is discussed while considering the role of MXR-mediated efflux transporters in response to various environmental pollutants. Copyright © 2017 Elsevier B.V. All rights reserved.
Hayward, C P M; Moffat, K A; Castilloux, J-F; Liu, Y; Seecharan, J; Tasneem, S; Carlino, S; Cormier, A; Rivard, G E
2012-04-01
Platelet aggregometry and dense granule adenosine triphosphate (ATP) release assays are helpful to diagnose platelet disorders. Some laboratories simultaneously measure aggregation and ATP release using Chronolume® a commercial reagent containing D-luciferin, firefly luciferase and magnesium. Chronolume® can potentiate sub-maximal aggregation responses, normalising canine platelet disorder findings. We investigated if Chronolume® potentiates human platelet aggregation responses after observing discrepancies suspicious of potentiation. Among patients simultaneously tested by light transmission aggregometry (LTA) on two instruments, 18/43 (42%), including 14/24 (58%) with platelet disorders, showed full secondary aggregation with one or more agonists only in tests with Chronolume®. As subjects with Quebec platelet disorder (QPD) did not show the expected absent secondary aggregation responses to epinephrine in tests with Chronolume®, the reason for the discrepancy was investigated using samples from 10 QPD subjects. Like sub-threshold ADP (0.75 μM), Chronolume® significantly increased QPD LTA responses to epinephrine (p<0.0001) and it increased both initial and secondary aggregation responses, leading to dense granule release. This potentiation was not restricted to QPD and it was mimicked adding 1-2 mM magnesium, but not D-luciferin or firefly luciferase, to LTA assays. Chronolume® potentiated the ADP aggregation responses of QPD subjects with a reduced response. Furthermore, it increased whole blood aggregation responses of healthy control samples to multiple agonists, tested at concentrations used for the diagnosis of platelet disorders (p values <0.05). Laboratories should be aware that measuring ATP release with Chronolume® can potentiate LTA and whole blood aggregation responses, which alters findings for some human platelet disorders, including QPD.
Kanjanamekanant, K; Luckprom, P; Pavasant, P
2013-04-01
Mechanical stress is an important factor in maintaining homeostasis of the periodontium. Interleukin-1beta (IL-1β) and adenosine triphosphate (ATP) are considered potent inflammatory mediators. In macrophages, ATP-activated P2X7 receptor is involved in IL-1β processing and release. Our previous works demonstrated mechanical stress-induced expression of osteopontin and RANKL through the ATP/P2Y1 receptor in human periodontal ligament (HPDL) cells. This study was designed to examine the effect of mechanical stress on IL-1β expression in HPDL cells, as well as the mechanism and involvement of ATP and the P2 purinergic receptor. Cultured HPDL cells were treated with continuous compressive loading. IL-1β expression was analyzed at both mRNA and protein levels, using RT-PCR and ELISA, respectively. Cell viability was examined using the MTT assay. ATP was also used to stimulate HPDL cells. Inhibitors, antagonists and the small interfering RNA (siRNA) technique were used to investigate the role of ATP and the specific P2 subtypes responsible for IL-1β induction along with the intracellular mechanism. Mechanical stress could up-regulate IL-1β expression through the release of ATP in HPDL cells. ATP alone was also capable of increasing IL-1β expression. The induction of IL-1β was markedly inhibited by inhibitors and by siRNA targeting the P2X7 receptor. ATP-stimulated IL-1β expression was also diminished by intracellular calcium inhibitors. Our work clearly indicates the capability of HPDL cells to respond directly to mechanical stimulation. The results signified the important roles of ATP/P2 purinergic receptors, as well as intracellular calcium signaling, in mechanical stress-induced inflammation via up-regulation of the proinflammatory cytokine, IL-1β, in HPDL cells. © 2012 John Wiley & Sons A/S.
Zhang, D-D; Yu, H-L; Ma, W-W; Liu, Q-R; Han, J; Wang, H; Xiao, R
2015-08-06
Cholesterol metabolism is important for neuronal function in the central nervous system (CNS). The oxysterol 27-hydroxycholesterol (27-OHC) is a cholesterol metabolite that crosses the blood-brain barrier (BBB) and may be a useful substitutive marker for neurodegenerative diseases. However, the effects of 27-OHC on learning and memory and the underlying mechanisms are unclear. To determine this mechanism, we investigated learning and memory and cholesterol metabolism in rat brain following the injection of various doses of 27-OHC into the caudal vein. We found that 27-OHC increased cholesterol levels and upregulated the expression of liver X receptor-α (LXR-α) and adenosine triphosphate (ATP)-binding cassette transporter protein family member A1 (ABCA1). In addition, 27-OHC decreased the expression of 3-hydroxy-3-methylglutaryl-CoA reductase (HMG-CR) and low-density lipoprotein receptor (LDLR) in rat brain tissues. These findings suggest that 27-OHC may negatively modulate cognitive effects and cholesterol metabolism in the brain. Copyright © 2015 IBRO. Published by Elsevier Ltd. All rights reserved.
Rice, Austin J; Harrison, Alistair; Alvarez, Frances J D; Davidson, Amy L; Pinkett, Heather W
2014-05-23
Embedded in the plasma membrane of all bacteria, ATP binding cassette (ABC) importers facilitate the uptake of several vital nutrients and cofactors. The ABC transporter, MolBC-A, imports molybdate by passing substrate from the binding protein MolA to a membrane-spanning translocation pathway of MolB. To understand the mechanism of transport in the biological membrane as a whole, the effects of the lipid bilayer on transport needed to be addressed. Continuous wave-electron paramagnetic resonance and in vivo molybdate uptake studies were used to test the impact of the lipid environment on the mechanism and function of MolBC-A. Working with the bacterium Haemophilus influenzae, we found that MolBC-A functions as a low affinity molybdate transporter in its native environment. In periods of high extracellular molybdate concentration, H. influenzae makes use of parallel molybdate transport systems (MolBC-A and ModBC-A) to take up a greater amount of molybdate than a strain with ModBC-A alone. In addition, the movement of the translocation pathway in response to nucleotide binding and hydrolysis in a lipid environment is conserved when compared with in-detergent analysis. However, electron paramagnetic resonance spectroscopy indicates that a lipid environment restricts the flexibility of the MolBC translocation pathway. By combining continuous wave-electron paramagnetic resonance spectroscopy and substrate uptake studies, we reveal details of molybdate transport and the logistics of uptake systems that employ multiple transporters for the same substrate, offering insight into the mechanisms of nutrient uptake in bacteria. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Human adenosine A2A receptor binds calmodulin with high affinity in a calcium-dependent manner.
Piirainen, Henni; Hellman, Maarit; Tossavainen, Helena; Permi, Perttu; Kursula, Petri; Jaakola, Veli-Pekka
2015-02-17
Understanding how ligands bind to G-protein-coupled receptors and how binding changes receptor structure to affect signaling is critical for developing a complete picture of the signal transduction process. The adenosine A2A receptor (A2AR) is a particularly interesting example, as it has an exceptionally long intracellular carboxyl terminus, which is predicted to be mainly disordered. Experimental data on the structure of the A2AR C-terminus is lacking, because published structures of A2AR do not include the C-terminus. Calmodulin has been reported to bind to the A2AR C-terminus, with a possible binding site on helix 8, next to the membrane. The biological meaning of the interaction as well as its calcium dependence, thermodynamic parameters, and organization of the proteins in the complex are unclear. Here, we characterized the structure of the A2AR C-terminus and the A2AR C-terminus-calmodulin complex using different biophysical methods, including native gel and analytical gel filtration, isothermal titration calorimetry, NMR spectroscopy, and small-angle X-ray scattering. We found that the C-terminus is disordered and flexible, and it binds with high affinity (Kd = 98 nM) to calmodulin without major conformational changes in the domain. Calmodulin binds to helix 8 of the A2AR in a calcium-dependent manner that can displace binding of A2AR to lipid vesicles. We also predicted and classified putative calmodulin-binding sites in a larger group of G-protein-coupled receptors. Copyright © 2015 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Kulkarni, Supriya R.; Donepudi, Ajay C.; Xu, Jialin; Wei, Wei; Cheng, Qiuqiong C.; Driscoll, Maureen V.; Johnson, Delinda A.; Johnson, Jeffrey A.; Li, Xiaoling
2014-01-01
Abstract Aims: The purpose of this study was to determine whether 3′-5′-cyclic adenosine monophosphate (cAMP)-protein kinase A (PKA) and Sirtuin-1 (SIRT1) dependent mechanisms modulate ATP-binding Cassette (ABC) transport protein expression. ABC transport proteins (ABCC2–4) are essential for chemical elimination from hepatocytes and biliary excretion. Nuclear factor-E2 related-factor 2 (NRF2) is a transcription factor that mediates ABCC induction in response to chemical inducers and liver injury. However, a role for NRF2 in the regulation of transporter expression in nonchemical models of liver perturbation is largely undescribed. Results: Here we show that fasting increased NRF2 target gene expression through NRF2- and SIRT1–dependent mechanisms. In intact mouse liver, fasting induces NRF2 target gene expression by at least 1.5 to 5-fold. In mouse and human hepatocytes, treatment with 8-Bromoadenosine-cAMP, a cAMP analogue, increased NRF2 target gene expression and antioxidant response element activity, which was decreased by the PKA inhibitor, H-89. Moreover, fasting induced NRF2 target gene expression was decreased in liver and hepatocytes of SIRT1 liver-specific null mice and NRF2-null mice. Lastly, NRF2 and SIRT1 were recruited to MAREs and Antioxidant Response Elements (AREs) in the human ABCC2 promoter. Innovation: Oxidative stress mediated NRF2 activation is well described, yet the influence of basic metabolic processes on NRF2 activation is just emerging. Conclusion: The current data point toward a novel role of nutrient status in regulation of NRF2 activity and the antioxidant response, and indicates that cAMP/PKA and SIRT1 are upstream regulators for fasting-induced activation of the NRF2-ARE pathway. Antioxid. Redox Signal. 20, 15–30. PMID:23725046
Ren, Min; Liu, Yujie; Zhao, Huiya; Dong, Shixia; Jiang, Zhonghui; Li, Keting; Tian, Jiawei
2016-10-01
Effects of ischemic postconditioning (IPostC) and adenosine triphosphate (ATP)-mediated pharmacologic postconditioning (ATP-PPostC) on cardiac function were evaluated by speckle tracking imaging (STI)-based echocardiography. A myocardial I/R model was induced in rabbits by reversible ligation of the left ventricular branch of coronary artery. Rabbits were randomized into three groups: ischemia and reperfusion (IR) (no further intervention), IPostC, and ATP-PPostC groups. Cardiac function was evaluated by conventional and STI-based echocardiography. Myocardial necrosis, apoptosis, and myocardial mRNAs of apoptosis-related proteins (Bcl-2 and Bax) were evaluated. Speckle tracking imaging (STI)-based echocardiography revealed that IPostC and ATP-PPostC were associated with better preserved global and regional cardiac function, as indicated by significantly increased GLSrsys, GLSrd, GLSsys, SrLsys, SrLd, and SLsys in both groups (all P<.5). Subsequent pathologic studies indicate that the percentage of necrotic myocardium and permillage of apoptotic cells were significantly lower in the IPostC and ATP-PPostC groups than in the IR group (all P<.05). Moreover, both IPostC and ATP-PPostC were associated with increased Bcl-2 mRNA levels and reduced Bax mRNA levels. IPostC and ATP-PPostC may exert cardioprotective functions by better preservation of cardiac function during the I/R process and at least partly via attenuation of myocardial apoptosis. © 2016 John Wiley & Sons Ltd.
Detrimental effects of adenosine signaling in sickle cell disease
Zhang, Yujin; Dai, Yingbo; Wen, Jiaming; Zhang, Weiru; Grenz, Almut; Sun, Hong; Tao, Lijian; Lu, Guangxiu; Alexander, Danny C; Milburn, Michael V; Carter-Dawson, Louvenia; Lewis, Dorothy E; Zhang, Wenzheng; Eltzschig, Holger K; Kellems, Rodney E; Blackburn, Michael R; Juneja, Harinder S; Xia, Yang
2016-01-01
Hypoxia can act as an initial trigger to induce erythrocyte sickling and eventual end organ damage in sickle cell disease (SCD). Many factors and metabolites are altered in response to hypoxia and may contribute to the pathogenesis of the disease. Using metabolomic profiling, we found that the steady-state concentration of adenosine in the blood was elevated in a transgenic mouse model of SCD. Adenosine concentrations were similarly elevated in the blood of humans with SCD. Increased adenosine levels promoted sickling, hemolysis and damage to multiple tissues in SCD transgenic mice and promoted sickling of human erythrocytes. Using biochemical, genetic and pharmacological approaches, we showed that adenosine A2B receptor (A2BR)-mediated induction of 2,3-diphosphoglycerate, an erythrocyte-specific metabolite that decreases the oxygen binding affinity of hemoglobin, underlies the induction of erythrocyte sickling by excess adenosine both in cultured human red blood cells and in SCD transgenic mice. Thus, excessive adenosine signaling through the A2BR has a pathological role in SCD. These findings may provide new therapeutic possibilities for this disease. PMID:21170046
Detrimental effects of adenosine signaling in sickle cell disease.
Zhang, Yujin; Dai, Yingbo; Wen, Jiaming; Zhang, Weiru; Grenz, Almut; Sun, Hong; Tao, Lijian; Lu, Guangxiu; Alexander, Danny C; Milburn, Michael V; Carter-Dawson, Louvenia; Lewis, Dorothy E; Zhang, Wenzheng; Eltzschig, Holger K; Kellems, Rodney E; Blackburn, Michael R; Juneja, Harinder S; Xia, Yang
2011-01-01
Hypoxia can act as an initial trigger to induce erythrocyte sickling and eventual end organ damage in sickle cell disease (SCD). Many factors and metabolites are altered in response to hypoxia and may contribute to the pathogenesis of the disease. Using metabolomic profiling, we found that the steady-state concentration of adenosine in the blood was elevated in a transgenic mouse model of SCD. Adenosine concentrations were similarly elevated in the blood of humans with SCD. Increased adenosine levels promoted sickling, hemolysis and damage to multiple tissues in SCD transgenic mice and promoted sickling of human erythrocytes. Using biochemical, genetic and pharmacological approaches, we showed that adenosine A(2B) receptor (A(2B)R)-mediated induction of 2,3-diphosphoglycerate, an erythrocyte-specific metabolite that decreases the oxygen binding affinity of hemoglobin, underlies the induction of erythrocyte sickling by excess adenosine both in cultured human red blood cells and in SCD transgenic mice. Thus, excessive adenosine signaling through the A(2B)R has a pathological role in SCD. These findings may provide new therapeutic possibilities for this disease.
Ap4A and ADP-beta-S binding to P2 purinoceptors present on rat brain synaptic terminals.
Pintor, J.; Díaz-Rey, M. A.; Miras-Portugal, M. T.
1993-01-01
1. Diadenosine tetraphosphate (Ap4A) a dinucleotide stored and released from rat brain synaptic terminals presents two types of affinity binding sites in synaptosomes. When [3H]-Ap4A was used for binding studies a Kd value of 0.10 +/- 0.014 nM and a Bmax value of 16.6 +/- 1.2 fmol mg-1 protein were obtained for the high affinity binding site from the Scatchard analysis. The second binding site, obtained by displacement studies, showed a Ki value of 0.57 +/- 0.09 microM. 2. Displacement of [3H]-Ap4A by non-labelled Ap4A and P2-purinoceptor ligands showed a displacement order of Ap4A > adenosine 5'-O-(2-thiodiphosphate) (ADP-beta-S) > 5'-adenylyl-imidodiphosphate (AMP-PNP) > alpha,beta-methylene adenosine 5'-triphosphate (alpha,beta-MeATP) in both sites revealed by the Ki values of 0.017 nM, 0.030 nM, 0.058 nM and 0.147 nM respectively for the high affinity binding site and values of 0.57 microM, 0.87 microM, 2.20 microM and 4.28 microM respectively for the second binding site. 3. Studies of the P2-purinoceptors present in synaptosomes were also performed with [35S]-ADP-beta-S. This radioligand showed two binding sites the first with Kd and Bmax values of 0.11 +/- 0.022 nM and 3.9 +/- 2.1 fmol mg-1 of protein respectively for the high affinity binding site obtained from the Scatchard plot. The second binding site showed a Ki of 0.018 +/- 0.0035 microM obtained from displacement curves. 4. Competition studies with diadenosine polyphosphates of [35S]-ADP-beta-S binding showed a displacement order of Ap4A > Ap5A > Ap6A in the high affinity binding site and Ki values of 0.023 nM, 0.081 nM and 5.72 nM respectively.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8485620
Rapiejko, P J; Malbon, C C
1987-01-01
The effects of short-term hyperthyroidism in vivo on the status of the components of the fat-cell hormone-sensitive adenylate cyclase were investigated. The number of beta-adrenergic receptors was elevated by about 25% in membranes of fat-cells isolated from hyperthyroid rats as compared with euthyroid rats, but their affinity for radioligand was unchanged. Membranes of hyperthyroid-rat fat-cells displayed less than 65% of the normal complement of receptors for [3H]cyclohexyladenosine. The affinity of the receptors for this ligand was normal. In contrast with the marked increase in the amounts of the alpha-subunits of the guanine nucleotide-binding proteins Gi (Mr 41,000) and Go (Mr 39,000) observed in the hypothyroid state [Malbon, Rapiejko & Mangano (1985) J. Biol. Chem. 260, 2558-2564], the amounts of alpha-Gi, alpha-Go as well as alpha-Gs subunits [Mr 42,000 (major) and 46,000/48,000 (minor)] were not changed by hyperthyroidism. Adenylate cyclase activity in response to forskolin, guanosine 5'-[gamma-thio]triphosphate or isoprenaline, in contrast, was decreased by 30-50% in fat-cell membranes from hyperthyroid rats. Fat-cells isolated from hyperthyroid rats accumulated cyclic AMP to less than 50% of the extent in their euthyroid counterparts in the presence of adenosine deaminase and either adrenaline or forskolin, suggesting a decrease in the amount or activity of the catalytic subunit of adenylate cyclase. In the absence of exogenous adenosine deaminase, cyclic AMP accumulation in response to adrenaline was elevated rather than decreased in fat-cells from hyperthyroid rats. The inhibitory influence of adenosine is apparently limited in the hyperthyroid state by the decreased complement of inhibitory R-site purinergic receptors in these fat-cells. Short-term hyperthyroidism modulates the fat-cell adenylate cyclase system at the receptor level (beta-receptor number increased, R-site purinergic-receptor number decreased) and the catalytic subunit of adenylate
Zhang, B Q; Fang, W G; Zhang, Y; Liu, S F; Zeng, X J
2017-11-01
Objective: To investigate gender specific association between single nucleotide polymorphism rs2231142 and hyperuricemia. Method: A matched case-control study was conducted in a faculty cohort of a tertiary hospital in Beijing. The enrollment criteria were faculty member of the hospital with signed consent. The exclusion criteria were tumor, previous renal diseases, renal function damage, pregnancy, currently taking medicines that could increase or decrease serum uric acid level, and those who had gout. Males with serum uric acid>416.4 μmol/L and females with serum uric acid> 359.6 μmol/L were enrolled as hyperuricemia group. Subjects with normal serum uric acid were randomly enrolled at 1∶2 ratio after matching for gender, age, renal function and body mass index. Rs2231142(C>A) was assayed by amplification refractory mutation system polymerase chain reaction, with common forward primer: 5' GGCTTTGCAGACATCTATGG 3', C specific reverse primer: 5'CGAAGAGCTGCTGAGAAATG 3', and A specific reverse primer: 5' CGAAGAGCTGCTGAGAAATT 3'.Association between rs2231142 and hyperuricemia was analyzed in the general study group, as well as different gender and age groups. Results: A total of 198 subjects with hyperuricemia and 370 controls were enrolled. The A allele frequency of rs2231142 was significantly higher in the hyperuricemia group than control group (38.38% vs 26.62%, P <0.001), with an OR for hyperuricemia of 2.89 (95% CI 1.91-4.37, P <0.001). After adjustment for hypertension, hyperglycemia and dyslipidemia, the OR was 2.99 (95% CI 1.94 - 4.62, P <0.001). Subgroup analysis showed that the ORs were 3.83 (95% CI 2.03-7.24, P <0.001) in male and 2.30 (95% CI 1.32-4.00, P =0.003) in female. In those 55 years or older, the gender differences of ORs were decreased, with ORs of 3.23 (95% CI 1.02-10.29, P =0.047) in male and 3.06 (95% CI 1.37-6.84, P =0.006) in female. While in those less than 55 years, the gender differences of ORs were enlarged, with ORs of 4.11 (95% CI 1.92-8.79, P <0.001) in males and 1.73 (95% CI 0.80-3.76, P =0.165) in females. Interaction study between gender and rs2231142 did not reach significant level in both the gender group and two age groups. Conclusion: Single nucleotide polymorphism rs2231142 A allele is an independent risk factor for hyperuricemia in this tertiary hospital faculty cohort. The ORs are higher in male than those in female, especially in those less than 55 years old.
Chao, Julie; Weathersbee, Carolyn J.
1974-01-01
Cyclic adenosine 3′, 5′-monophosphate (AMP) stimulates maltodextrin phosphorylase synthesis in Escherichia coli cells induced with maltose. A maximal effect occurs at 2 to 3 mM cyclic AMP. The action of cyclic AMP is specific, inasmuch as adenosine triphosphate, 3′-AMP, 5′-AMP, adenosine, and dibutyryl cyclic AMP are inactive. Glucose, α-methyl glucoside, 2-deoxyglucose, and pyridoxal 5′-phosphate repress maltodextrin phosphorylase synthesis. This repression is reversed by cyclic AMP. The action of cyclic AMP appears to be at the transcriptional level, since cyclic AMP fails to stimulate phosphorylase production in induced cells in which messenger ribonucleic acid synthesis has been arrested by rifampin or by inducer removal. The two other enzymes involved in the metabolism of maltose, amylomaltase and maltose permease, are also induced in this strain of E. coli and affected by glucose and cyclic AMP in a manner similar to phosphorylase. PMID:4358043
Suzuki, Mayumi; Oki, Tomomi; Sugiyama, Tomomi; Umegaki, Keizo; Uchida, Shinya; Yamada, Shizuo
2007-06-01
To elucidate the in vitro and ex vivo effects of saw palmetto extract (SPE) on autonomic receptors in the rat lower urinary tract. The in vitro binding affinities for alpha 1-adrenergic, muscarinic, and purinergic receptors in the rat prostate and bladder were measured by radioligand binding assays. Rats received vehicle or SPE (0.6 to 60 mg/kg/day) orally for 4 weeks, and alpha 1-adrenergic and muscarinic receptor binding in tissues of these rats were measured. Saw palmetto extract inhibited specific binding of [3H]prazosin and [N-methyl-3H]scopolamine methyl chloride (NMS) but not alpha, beta-methylene adenosine triphosphate [2,8-(3)H]tetrasodium salt in the rat prostate and bladder. The binding activity of SPE for muscarinic receptors was four times greater than that for alpha 1-adrenergic receptors. Scatchard analysis revealed that SPE significantly reduced the maximal number of binding sites (Bmax) for each radioligand in the prostate and bladder under in vitro condition. Repeated oral administration of SPE to rats brought about significant alteration in Bmax for prostatic [3H]prazosin binding and for bladder [3H]NMS binding. Such alteration by SPE was selective to the receptors in the lower urinary tract. Saw palmetto extract exerts significant binding activity on autonomic receptors in the lower urinary tract under in vitro and in vivo conditions.
Reaction kinetics and inhibition of adenosine kinase from Leishmania donovani.
Bhaumik, D; Datta, A K
1988-04-01
The reaction kinetics and the inhibitor specificity of adenosine kinase (ATP:adenosine 5'-phosphotransferase, EC 2.7.1.20) from Leishmania donovani, have been analysed using homogeneous preparation of the enzyme. The reaction proceeds with equimolar stoichiometry of each reactant. Double reciprocal plots of initial velocity studies in the absence of products yielded intersecting lines for both adenosine and Mg2+-ATP. AMP is a competitive inhibitor of the enzyme with respect to adenosine and noncompetitive inhibitor with respect to ATP. In contrast, ADP was a noncompetitive inhibitor with respect to both adenosine and ATP, with inhibition by ADP becoming uncompetitive at very high concentration of ATP. Parallel equilibrium dialysis experiments against [3H]adenosine and [gamma-32P]ATP resulted in binding of adenosine to fre enzyme. Tubercidin (7-deazaadenosine) and 6-methyl-mercaptopurine riboside acted as substrates for the enzyme and were found to inhibit adenosine phosphorylation competitively in vitro. 'Substrate efficiency (Vmax/Km)' and 'turnover numbers (Kcat)' of the enzyme with respect to specific analogs were determined. Taken together the results suggest that (a) the kinetic mechanism of adenosine kinase is sequential Bi-Bi, (b) AMP and ADP may regulate enzyme activity in vivo and (c) tubercidin and 6-methylmercaptopurine riboside are monophosphorylated by the parasite enzyme.
Adenosine monophosphate as a mediator of ATP effects at P1 purinoceptors
Ross, Fiona M; Brodie, Martin J; Stone, Trevor W
1998-01-01
When perfused with a medium containing no added magnesium and 4-aminopyridine (4AP) (50 μM) hippocampal slices generated epileptiform bursts of an interictal nature. We have shown in a previous study that adenosine 5′-triphosphate (ATP) depressed epileptiform activity and that this effect was blocked by the adenosine A1 receptor antagonist cyclopentyltheophylline but was not affected by adenosine deaminase. This implied that ATP might act indirectly at P1 receptors or at a xanthine-sensitive P2 receptor. The aim of the present study was to investigate further the action of ATP on epileptiform activity.ATP can be metabolized by ecto-nucleotidases to adenosine 5′-diphosphate (ADP), adenosine 5′-monophosphate (AMP) and adenosine, respectively. Each of these metabolites can activate receptors in its own right: P2 receptors for ADP and P1 receptors for AMP and adenosine.We now show that both AMP and ATP (50 μM) significantly decrease epileptiform discharge rate in a rapid and reversible manner. 5′Adenylic acid deaminase (AMP deaminase, AMPase) (0.2 u ml−1), when perfused alone did not significantly alter the discharge rate over the 10 min superfusion period used for drug application. When perfused concurrently with AMP (50 μM), AMP deaminase prevented the depressant effect of AMP on discharge rate.AMP deaminase, at a concentration of 0.2 u ml−1 which annulled the effect of AMP (50 μM), prevented the inhibitory activity of ATP (50 μM). A higher concentration of ATP (200 μM) depressed the frequency of spontaneous bursts to approximately 30% control and this response was also prevented by AMP deaminase.Superfusion of the slices with 5′-nucleotidase also prevented the inhibitory activity of ATP on epileptiform discharges.The results suggest that AMP mediates the inhibitory effects of ATP on epileptiform activity, a conclusion which can explain the earlier finding that cyclopentyltheophylline but not adenosine deaminase inhibited the
Caceres, Gisela; Robey, Robert W.; Sokol, Lubomir; McGraw, Kathy L.; Clark, Justine; Lawrence, Nicholas J.; Sebti, Said M.; Wiese, Michael; List, Alan F.
2015-01-01
Transmembrane drug export mediated by the ATP-binding cassette (ABC) transporter P-glycoprotein contributes to clinical resistance to antineoplastics. In this study, we identified the substituted quinoline HG-829 as a novel, noncompetitive, and potent P-glycoprotein inhibitor that overcomes in vitro and in vivo drug resistance. We found that nontoxic concentrations of HG-829 restored sensitivity to P-glycoprotein oncolytic substrates. In ABCB1-overexpressing cell lines, HG-829 significantly enhanced cytotoxicity to daunorubicin, paclitaxel, vinblastine, vincristine, and etoposide. Coadministration of HG-829 fully restored in vivo antitumor activity of daunorubicin in mice without added toxicity. Functional assays showed that HG-829 is not a Pgp substrate or competitive inhibitor of Pgp-mediated drug efflux but rather acts as a noncompetitive modulator of P-glycoprotein transport function. Taken together, our findings indicate that HG-829 is a potent, long-acting, and noncompetitive modulator of P-glycoprotein export function that may offer therapeutic promise for multidrugresistant malignancies. PMID:22761337
2013-01-01
Background Currently, there is a lack of studies examining the effects of adenosine-5′-triphosphate (ATP) supplementation utilizing a long-term, periodized resistance-training program (RT) in resistance-trained populations. Therefore, we investigated the effects of 12 weeks of 400 mg per day of oral ATP on muscular adaptations in trained individuals. We also sought to determine the effects of ATP on muscle protein breakdown, cortisol, and performance during an overreaching cycle. Methods The study was a 3-phase randomized, double-blind, and placebo- and diet-controlled intervention. Phase 1 was a periodized resistance-training program. Phase 2 consisted of a two week overreaching cycle in which volume and frequency were increased followed by a 2-week taper (Phase 3). Muscle mass, strength, and power were examined at weeks 0, 4, 8, and 12 to assess the chronic effects of ATP; assessment performance variables also occurred at the end of weeks 9 and 10, corresponding to the mid and endpoints of the overreaching cycle. Results There were time (p < 0.001), and group x time effects for increased total body strength (+55.3 ± 6.0 kg ATP vs. + 22.4 ± 7.1 kg placebo, p < 0.001); increased vertical jump power (+ 796 ± 75 ATP vs. 614 ± 52 watts placebo, p < 0.001); and greater ultrasound determined muscle thickness (+4.9 ± 1.0 ATP vs. (2.5 ± 0.6 mm placebo, p < 0.02) with ATP supplementation. During the overreaching cycle, there were group x time effects for strength and power, which decreased to a greater extent in the placebo group. Protein breakdown was also lower in the ATP group. Conclusions Our results suggest oral ATP supplementation may enhance muscular adaptations following 12-weeks of resistance training, and prevent decrements in performance following overreaching. No statistically or clinically significant changes in blood chemistry or hematology were observed. Trial registration ClinicalTrials.gov NCT01508338 PMID
Zhang, Shusheng; Yan, Yameng; Bi, Sai
2009-11-01
In the present study, binary and triplex DNA molecular beacons, as signaling probes based on a luminol-H(2)O(2)-horseradish peroxidase (HRP)-fluorescein chemiluminescence resonance energy transfer (CRET) system and structure-switching aptamers for highly sensitive detection of small molecules, are developed using adenosine triphosphate (ATP) as a model analyte to demonstrate the generality of the strategy. This CRET process occurs from donor luminol to acceptor fluorescein, which is oxidized by H(2)O(2) and catalyzed by HRP. DNA aptamer for ATP is first attached on the surface of magnetic nanoparticles (MNPs). The cDNA linker has an extension that hybridizes with two other DNAs (LumAuNP-DNA and F-DNA) or three other DNAs (HRP-DNA, LumAuNP-DNA, and F-DNA) to fabricate CRET-BMBP-MNP or CRET-TMBP-MNP conjugates that provide the CRET signals. Thus, in the absence of ATP, when the MNPs are removed from the solution, they also take with them the linker DNA and the CRET signal probes, and no CRET signal can be detected. However, when ATP is introduced, a competition for the ATP aptamer between ATP and the cDNA linker occurs. As a result, CRET-BMBP and CRET-TMBP are forced to dissociate from the MNP surface based on the structure switching of the aptamer. The CRET signals are proportional to the concentration of ATP. In order to accelerate the rate of the aptamer structure-switching process, an invader DNA is introduced into the proposed strategy. The present CRET system provides a low detection limit of 1.1 x 10(-7) and 3.2 x 10(-7) M for ATP detection by BMBP and TMBP, respectively, which also exhibits a good selectivity for ATP detection. Sample assays of ATP in K562 leukemia cells and 4T1 breast cancer cells confirm the reliability and practicality of the protocol, which reveal a good prospect of this platform for biological sample analysis.
Zhang, Jinlin; Tang, Cheng; Zhang, Yonghua; Su, X I
2014-04-01
Adenosine triphosphate (ATP) has been used to provoke dormant pulmonary vein (PV) conduction after circumferential PV isolation (CPVI). However, there have been no systematic studies examining the incidence and the mechanism of ATP-induced atrial fibrillation (AF) following CPVI in paroxysmal AF. In this study, we explore the mechanism of ATP-induced AF and assess the feasibility of eliminating this response by additional radiofrequency (RF) ablation. A total of 300 consecutive patients with paroxysmal AF underwent CPVI. After all PVs were isolated, intravenous ATP (40 mg) was administered during an intravenous isoproterenol (ISP) infusion (5 μg/min). AF was reproducibly induced by ATP in 39 patients. Non-PV foci were confirmed and located in 29 of these patients at the onset of AF, including 27 foci in the superior vena cava (SVC), 1 focus in the crista terminalis, and 1 focus near the antrum of the PV. In all these cases, ATP-induced AF was eliminated after the non-PV foci were successfully ablated. For the other 10 patients, the foci triggering AF could not be confirmed or located due to the transient effect of ATP, thus no further ablation was performed. After a mean follow-up period of 18.7 ± 6.4 (8-24) months, the success rate in the ATP-induced AF group was not significantly different compared with the conventional treatment group who did not exhibit ATP-induced AF (76.9% vs 67.3%; P = 0.25). But in the subgroup of which the ATP-induced AF could be eliminated by additional RF ablation, the success rate was significantly higher than the non-ATP inducible group (86.2% vs 67.3%; P = 0.04). A large proportion of the ATP-induced AF post CPVI were initiated by rapid firing in the SVC. Eliminating this response by additional ablation may have an influence on clinical results of paroxysmal AF ablation. © 2014 Wiley Periodicals, Inc.
Kimura, Yoshio; Tanaka, Chihiro; Oka, Manami
2018-07-01
Myxococcus xanthus generates diadenosine tetraphosphates (Ap 4 A) and diadenosine pentaphosphates (Ap 5 A) under various stress conditions. M. xanthus lysyl-tRNA synthetase (LysS) efficiently synthesizes Ap 4 A from ATP, Ap 5 A from ATP and adenosine tetraphosphate (Ap 4 ), and Ap 4 from ATP and triphosphate. To identify other M. xanthus enzymes that can catalyze Ap 4 A and Ap 4 synthesis, 15 M. xanthus aminoacyl-tRNA synthetases (aaRSs), four acyl-CoA synthetases (Acys), three acetyl-CoA synthetases (Aces), phosphoglycerate kinase (Pgk), and adenylate kinase (Adk) were expressed in Escherichia coli and examined for Ap 4 A or Ap 4 synthetase activity using ATP or ATP and triphosphate as substrates. Among the tested enzymes, LysS had the highest Ap 4 A synthetase activity. AlaRS, SerRS, and LeuRS1 showed high ADP synthetase activity with ATP as a substrate in the presence of pyrophosphatase, and also demonstrated the ability to produce Ap 4 from ATP and triphosphate in the absence of pyrophosphatase. Ap 4 formation by AlaRS, SerRS, and LeuRS1 was approximately 4- to 13-fold higher compared with that of Ap 4 A, suggesting that these enzymes prefer triphosphate over ATP as a substrate in the second reaction. Some of the recombinant M. xanthus Acys and Aces also synthesized Ap 4 from ATP and triphosphate. However, Pgk was capable of catalyzing the production of Ap 4 from ATP and 3-phosphoglycerate in the presence of Mg 2+ and did not require triphosphate, suggesting that this enzyme is mainly responsible for Ap 4 synthesis in M. xanthus.
Conformational change of adenosine deaminase during ligand-exchange in a crystal.
Kinoshita, Takayoshi; Tada, Toshiji; Nakanishi, Isao
2008-08-15
Adenosine deaminase (ADA) perpetuates chronic inflammation by degrading extracellular adenosine which is toxic for lymphocytes. ADA has two distinct conformations: open form and closed form. From the crystal structures with various ligands, the non-nucleoside type inhibitors bind to the active site occupying the critical water-binding-position and sustain the open form of apo-ADA. In contrast, substrate mimics do not occupy the critical position, and induce the large conformational change to the closed form. However, it is difficult to predict the binding of (+)-erythro-9-(2-hydroxy-3-nonyl)adenine (EHNA), as it possesses characteristic parts of both the substrate and the non-nucleoside inhibitors. The crystal structure shows that EHNA binds to the open form through a novel recognition of the adenine base accompanying conformational change from the closed form of the PR-ADA complex in crystalline state.
Blundell, Ross D; Williams, Simon J; Arras, Samantha D M; Chitty, Jessica L; Blake, Kirsten L; Ericsson, Daniel J; Tibrewal, Nidhi; Rohr, Jurgen; Koh, Y Q Andre E; Kappler, Ulrike; Robertson, Avril A B; Butler, Mark S; Cooper, Matthew A; Kobe, Bostjan; Fraser, James A
2016-09-09
Opportunistic fungal pathogens such as Cryptococcus neoformans are a growing cause of morbidity and mortality among immunocompromised populations worldwide. To address the current paucity of antifungal therapeutic agents, further research into fungal-specific drug targets is required. Adenylosuccinate synthetase (AdSS) is a crucial enzyme in the adeosine triphosphate (ATP) biosynthetic pathway, catalyzing the formation of adenylosuccinate from inosine monophosphate and aspartate. We have investigated the potential of this enzyme as an antifungal drug target, finding that loss of function results in adenine auxotrophy in C. neoformans, as well as complete loss of virulence in a murine model. Cryptococcal AdSS was expressed and purified in Escherichia coli and the enzyme's crystal structure determined, the first example of a structure of this enzyme from fungi. Together with enzyme kinetic studies, this structural information enabled comparison of the fungal enzyme with the human orthologue and revealed species-specific differences potentially exploitable via rational drug design. These results validate AdSS as a promising antifungal drug target and lay a foundation for future in silico and in vitro screens for novel antifungal compounds.
1986-01-01
Paddle and Burnstock (326), Williams and Forrester (463), Forrester and Williams (151) and Clemens and Forrester (82) provide evidence that hypoxia may...an ATp4 - receptor. Fed. Proc. 45:208, 1986. (abstr) 99. Dahlen , S.E. and Hedqvist, P. ATP, B,y-methylene ATP andN adenosine inhibit non-cholinergic...regulation of skeletal muscle blood low. Circ Res. 29:375-384, 1971. 117. Dodd, J., Jahr, C.E., Hamilton, P.N., Heath, M.J., Matthew , W.P., and Jessell, T.M
ATP-binding cassette transporters in reproduction: a new frontier
Bloise, E.; Ortiga-Carvalho, T.M.; Reis, F.M.; Lye, S.J.; Gibb, W.; Matthews, S.G.
2016-01-01
BACKGROUND The transmembrane ATP-binding cassette (ABC) transporters actively efflux an array of clinically relevant compounds across biological barriers, and modulate biodistribution of many physiological and pharmacological factors. To date, over 48 ABC transporters have been identified and shown to be directly and indirectly involved in peri-implantation events and fetal/placental development. They efflux cholesterol, steroid hormones, vitamins, cytokines, chemokines, prostaglandins, diverse xenobiotics and environmental toxins, playing a critical role in regulating drug disposition, immunological responses and lipid trafficking, as well as preventing fetal accumulation of drugs and environmental toxins. METHODS This review examines ABC transporters as important mediators of placental barrier functions and key reproductive processes. Expression, localization and function of all identified ABC transporters were systematically reviewed using PubMed and Google Scholar websites to identify relevant studies examining ABC transporters in reproductive tissues in physiological and pathophysiological states. Only reports written in English were incorporated with no restriction on year of publication. While a major focus has been placed on the human, extensive evidence from animal studies is utilized to describe current understanding of the regulation and function of ABC transporters relevant to human reproduction. RESULTS ABC transporters are modulators of steroidogenesis, fertilization, implantation, nutrient transport and immunological responses, and function as ‘gatekeepers’ at various barrier sites (i.e. blood-testes barrier and placenta) against potentially harmful xenobiotic factors, including drugs and environmental toxins. These roles appear to be species dependent and change as a function of gestation and development. The best-described ABC transporters in reproductive tissues (primarily in the placenta) are the multidrug transporters p-glycoprotein and
Whole-Genome Survey of the Putative ATP-Binding Cassette Transporter Family Genes in Vitis vinifera
Çakır, Birsen; Kılıçkaya, Ozan
2013-01-01
The ATP-binding cassette (ABC) protein superfamily constitutes one of the largest protein families known in plants. In this report, we performed a complete inventory of ABC protein genes in Vitis vinifera, the whole genome of which has been sequenced. By comparison with ABC protein members of Arabidopsis thaliana, we identified 135 putative ABC proteins with 1 or 2 NBDs in V. vinifera. Of these, 120 encode intrinsic membrane proteins, and 15 encode proteins missing TMDs. V. vinifera ABC proteins can be divided into 13 subfamilies with 79 “full-size,” 41 “half-size,” and 15 “soluble” putative ABC proteins. The main feature of the Vitis ABC superfamily is the presence of 2 large subfamilies, ABCG (pleiotropic drug resistance and white-brown complex homolog) and ABCC (multidrug resistance-associated protein). We identified orthologs of V. vinifera putative ABC transporters in different species. This work represents the first complete inventory of ABC transporters in V. vinifera. The identification of Vitis ABC transporters and their comparative analysis with the Arabidopsis counterparts revealed a strong conservation between the 2 species. This inventory could help elucidate the biological and physiological functions of these transporters in V. vinifera. PMID:24244377
Trinucleotide cassettes increase diversity of T7 phage-displayed peptide library.
Krumpe, Lauren R H; Schumacher, Kathryn M; McMahon, James B; Makowski, Lee; Mori, Toshiyuki
2007-10-05
Amino acid sequence diversity is introduced into a phage-displayed peptide library by randomizing library oligonucleotide DNA. We recently evaluated the diversity of peptide libraries displayed on T7 lytic phage and M13 filamentous phage and showed that T7 phage can display a more diverse amino acid sequence repertoire due to differing processes of viral morphogenesis. In this study, we evaluated and compared the diversity of a 12-mer T7 phage-displayed peptide library randomized using codon-corrected trinucleotide cassettes with a T7 and an M13 12-mer phage-displayed peptide library constructed using the degenerate codon randomization method. We herein demonstrate that the combination of trinucleotide cassette amino acid codon randomization and T7 phage display construction methods resulted in a significant enhancement to the functional diversity of a 12-mer peptide library. This novel library exhibited superior amino acid uniformity and order-of-magnitude increases in amino acid sequence diversity as compared to degenerate codon randomized peptide libraries. Comparative analyses of the biophysical characteristics of the 12-mer peptide libraries revealed the trinucleotide cassette-randomized library to be a unique resource. The combination of T7 phage display and trinucleotide cassette randomization resulted in a novel resource for the potential isolation of binding peptides for new and previously studied molecular targets.
Huang, Liusheng; Lizak, Patricia; Aweeka, Francesca; Long-Boyle, Janel
2013-12-01
Fludarabine is a nucleoside analog routinely used in conditioning regimens of pediatric allogeneic stem cell transplantation to promote stem cell engraftment. In children, it remains a challenge to accurately and precisely quantify the active intracellular triphosphate species of fludarabine in vivo, primarily due to limitations on blood volume and inadequate assay sensitivity. Here we report a liquid chromatography tandem mass spectrometry (LC-MS/MS) method for determination of fludarabine triphosphate in human peripheral blood mononuclear cells (PBMC). PBMC (∼5 million cells) were collected and lysed in 1mL 70% methanol containing 1.2mM tris buffer (pH 7.4). The lysate (80μL) was mixed with internal standard (2-chloro-adenosine triphosphate, 150ng/mL, 20μL) and injected onto an API5000 LC-MS/MS system. Separation was achieved on a hypercarb column (100mm×2.1mm, 3μm) eluted with 100mM ammonium acetate (pH 9.8) and acetonitrile in a gradient mode at a flow rate of 0.4mL/min. Multiple reactions monitoring (MRM) and electrospray ionization in negative mode (ESI(-)) were used for detection. The ion pairs 524.0/158.6 for the drug and 540.0/158.8 for the IS were selected for quantification and 524.0/425.7 used for confirmation. Retention time was 3.0 and 3.4min for fludarabine triphosphate and the IS, respectively. The concentration range for the calibration curve was 1.52-76nM. Our method is simple, fast, and has been successfully applied in a clinical dose-concentration study in children to quantify intracellular fludarabine in low volume clinical samples. The median concentration was 1.03 and 3.19pmole/million PBMC at trough and peak time points, respectively. Fludarabine triphosphate is degraded in water within hours but relatively stable in 70% methanol-tris (1.2mM, pH 7.4). One limitation is that the hypercarb column takes a longer time to equilibrate than conventional reverse phase columns, and peaks become broad and distorted if the column is not washed
Side population cells in the human vocal fold.
Yamashita, Masaru; Hirano, Shigeru; Kanemaru, Shin-ichi; Tsuji, Shunichiro; Suehiro, Atsushi; Ito, Juichi
2007-11-01
The regenerative processes of the vocal fold, or the existence of stem cells in the folds, are unknown. Side population (SP) cells are defined as cells that have the ability to exclude the DNA binding dye, Hoechst 33342. They are regarded as a cell population enriched with stem cells and can be isolated from non-SP cells by a fluorescence-activated cell sorter. This study was designed to determine whether SP cells exist in the human vocal fold, as a first step in elucidating the regenerative mechanisms of the vocal fold. Seven human excised larynges were used in this study. Two were used for fluorescence-activated cell sorter analysis, and 5 were subjected to immunohistochemical analysis with antibodies against an adenosine triphosphate binding cassette transporter family member, ABCG2, which is expressed in SP cells. The number of SP cells in the human vocal fold was about 0.2% of the total number of cells. ABCG2-positive cells were identified in both the epithelium and subepithelial tissue throughout the entire vocal fold. This preliminary study demonstrated the existence of SP cells in the human vocal fold. Further studies are warranted to clarify how these cells work in the vocal fold, particularly in the regenerative process.
A continuous spectrophotometric assay for monitoring adenosine 5'-monophosphate production.
First, Eric A
2015-08-15
A number of biologically important enzymes release adenosine 5'-monophosphate (AMP) as a product, including aminoacyl-tRNA synthetases, cyclic AMP (cAMP) phosphodiesterases, ubiquitin and ubiquitin-like ligases, DNA ligases, coenzyme A (CoA) ligases, polyA deadenylases, and ribonucleases. In contrast to the abundance of assays available for monitoring the conversion of adenosine 5'-triphosphate (ATP) to ADP, there are relatively few assays for monitoring the conversion of ATP (or cAMP) to AMP. In this article, we describe a homogeneous assay that continuously monitors the production of AMP. Specifically, we have coupled the conversion of AMP to inosine 5'-monophosphate (IMP) (by AMP deaminase) to the oxidation of IMP (by IMP dehydrogenase). This results in the reduction of oxidized nicotine adenine dinucleotide (NAD(+)) to reduced nicotine adenine dinucleotide (NADH), allowing AMP formation to be monitored by the change in the absorbance at 340 nm. Changes in AMP concentrations of 5 μM or more can be reliably detected. The ease of use and relatively low expense make the AMP assay suitable for both high-throughput screening and kinetic analyses. Copyright © 2015 Elsevier Inc. All rights reserved.
Adenine formation from adenosine by mycoplasmas: adenosine phosphorylase activity.
Hatanaka, M; Del Giudice, R; Long, C
1975-01-01
Mammalian cells have enzymes to convert adenosine to inosine by deamination and inosine to hypoxanthine by phosphorolysis, but they do not possess the enzymes necessary to form the free base, adenine, from adenosine. Mycoplasmas grown in broth or in cell cultures can produce adenine from adenosine. This activity was detected in a variety of mycoplasmatales, and the enzyme was shown to be adenosine phosphorylase. Adenosine formation from adenine and ribose 1-phosphate, the reverse reaction of adenine formation from adenosine, was also observed with the mycoplasma enzyme. Adenosine phosphorylase is apparently common to the mycoplasmatales but it is not universal, and the organisms can be divided into three groups on the basis of their use of adenosine as substrate. Thirteen of 16 Mycoplasma, Acholeplasma, and Siroplasma species tested exhibit adenosine phosphorylase activity. M. lipophilium differed from the other mycoplasmas and shared with mammalian cells the ability to convert adenosine to inosine by deamination. M. pneumoniae and the unclassified M. sp. 70-159 showed no reaction with adenosine. Adenosine phosphorylase activity offers an additional method for the detection of mycoplasma contamination of cells. The patterns of nucleoside metabolism will provide additional characteristics for identification of mycoplasmas and also may provide new insight into the classification of mycoplasmas. PMID:236559
Ability of γδ T cells to modulate the Foxp3 T cell response is dependent on adenosine.
Liang, Dongchun; Woo, Jeong-Im; Shao, Hui; Born, Willi K; O'Brien, Rebecca L; Kaplan, Henry J; Sun, Deming
2018-01-01
Whether γδ T cells inhibit or enhance the Foxp3 T cell response depends upon their activation status. The critical enhancing effector in the supernatant is adenosine. Activated γδ T cells express adenosine receptors at high levels, which enables them to deprive Foxp3+ T cells of adenosine, and to inhibit their expansion. Meanwhile, cell-free supernatants of γδ T cell cultures enhance Foxp3 T cell expansion. Thus, inhibition and enhancement by γδ T cells of Foxp3 T cell response are a reflection of the balance between adenosine production and absorption by γδ T cells. Non-activated γδ T cells produce adenosine but bind little, and thus enhance the Foxp3 T cell response. Activated γδ T cells express high density of adenosine receptors and have a greatly increased ability to bind adenosine. Extracellular adenosine metabolism and expression of adenosine receptor A2ARs by γδ T cells played a major role in the outcome of γδ and Foxp3 T cell interactions. A better understanding of the functional conversion of γδ T cells could lead to γδ T cell-targeted immunotherapies for related diseases.
Choi, Seong H; Gharahmany, Ghazal; Walzem, Rosemary L; Meade, Thomas H; Smith, Stephen B
2018-03-01
We hypothesized that consumption of saturated fatty acids in the form of high-fat ground beef for 5 weeks would depress liver X receptor signaling targets in peripheral blood mononuclear cells (PBMC) and that changes in gene expression would be associated with the corresponding changes in lipoprotein cholesterol (C) concentrations. Older men (n = 5, age 68.0 ± 4.6 years) and postmenopausal women (n = 7, age 60.9 ± 3.1 years) were assigned randomly to consume ground-beef containing 18% total fat (18F) or 25% total fat (25F), five patties per week for 5 weeks with an intervening 4-week washout period. The 25F and 18F ground-beef increased (p < 0.05) the intake of saturated fat, monounsaturated fat, palmitic acid, and stearic acid, but the 25F ground-beef increased only the intake of oleic acid (p < 0.05). The ground-beefs 18F and 25F increased the plasma concentration of palmitic acid (p < 0.05) and decreased the plasma concentrations of arachidonic, eicosapentaenoic, and docosahexaenic acids (p < 0.05). The interventions of 18F and 25F ground-beef decreased very low-density lipoprotein C concentrations and increased particle diameters and low-density lipoprotein (LDL)-I-C and LDL-II-C concentrations (p < 0.05). The ground-beef 25F decreased PBMC mRNA levels for the adenosine triphosphate (ATP) binding cassette A, ATP binding cassette G1, sterol regulatory element binding protein-1, and LDL receptor (LDLR) (p < 0.05). The ground-beef 18F increased mRNA levels for stearoyl-CoA desaturase-1 (p < 0.05). We conclude that the increased LDL particle size and LDL-I-C and LDL-II-C concentrations following the 25F ground-beef intervention may have been caused by decreased hepatic LDLR gene expression. © 2018 AOCS.
Reichenbach, A; Dettmer, D; Brückner, G; Neumann, M; Birkenmeyer, G
1985-03-22
Rabbit retinal Müller cells were isolated by means of papaine and mechanical dissociation. These cells were shown to have a well preserved morphology and to preserve viability for many hours. Intense wheat germ agglutinin binding occurs on the photoreceptor side of Müller cells, especially in the microvillous region. Rabbit retinal Müller cells have a Na+,K+-activated adenosine triphosphatase activity in the same order of magnitude as brain astroglial cells.
Regulation of renal adenosine A(1) receptors: effect of dietary sodium chloride.
Smith, J A; Whitaker, E M; Yaktubay, N; Morton, M J; Bowmer, C J; Yates, M S
1999-11-12
The influence of dietary NaCl on the regulation of renal adenosine A(1) receptors was investigated in the rat. Renal membranes from rats fed on a diet low (0.04%) in NaCl showed a 46% increase in B(max) for the binding of [3H]-1,3-dipropyl-8-cyclopentylxanthine ([3H]DPCPX), a selective adenosine A(1) receptor antagonist, compared to membranes from rats fed on a normal diet (0.4% NaCl). Conversely, a high NaCl diet (4.0%) resulted in a 37% decrease in B(max). Levels of renal adenosine A(1) receptor mRNA were 65% lower in rats on a high salt diet. Autoradiographic studies showed that, for the inner medullary collecting ducts, a low NaCl diet resulted in a 30% increase in [3H]DPCPX binding with a 39% decrease noted in rats maintained on a high salt diet. The results indicate that changes in adenosine A(1) receptor density may represent a novel mechanism whereby the kidneys adapt to changes in salt load.
Adenosine A2A receptor agonists with potent antiplatelet activity.
Fuentes, Eduardo; Fuentes, Manuel; Caballero, Julio; Palomo, Iván; Hinz, Sonja; El-Tayeb, Ali; Müller, Christa E
2018-05-01
Selected adenosine A 2A receptor agonists (PSB-15826, PSB-12404, and PSB-16301) have been evaluated as new antiplatelet agents. In addition, radioligand-binding studies and receptor-docking experiments were performed in order to explain their differential biological effects on a molecular level. Among the tested adenosine derivatives, PSB-15826 was the most potent compound to inhibit platelet aggregation (EC 50 0.32 ± 0.05 µmol/L) and platelet P-selectin cell-surface localization (EC 50 0.062 ± 0.2 µmol/L), and to increase intraplatelets cAMP levels (EC 50 0.24 ± 0.01 µmol/L). The compound was more active than CGS21680 (EC 50 0.97±0.07 µmol/L) and equipotent to NECA (EC 50 0.31 ± 0.05 µmol/L) in platelet aggregation induced by ADP. In contrast to the results from cAMP assays, K i values determined in radioligand-binding studies were not predictive of the A 2A agonists' antiplatelet activity. Docking studies revealed the key molecular determinants of this new family of adenosine A 2A receptor agonists: differences in activities are related to π-stacking interactions between the ligands and the residue His264 in the extracellular loop of the adenosine A 2A receptor which may result in increased residence times. In conclusion, these results provide an improved understanding of the requirements of antiplatelet adenosine A 2A receptor agonists.
Goldfarb, P. S. G.; Rodnight, R.
1970-01-01
1. The intrinsic Na+, K+, Mg2+ and Ca2+ contents of a preparation of membrane fragments from ox brain were determined by emission flame photometry. 2. Centrifugal washing of the preparation with imidazole-buffered EDTA solutions decreased the bound Na+ from 90±20 to 24±12, the bound K+ from 27±3 to 7±2, the bound Mg2+ from 20±2 to 3±1 and the bound calcium from 8±1 to <1nmol/mg of protein. 3. The activities of the Na++K++Mg2+-stimulated adenosine triphosphatase and the Na+-dependent reaction forming bound phosphate were compared in the unwashed and washed preparations at an ATP concentration of 2.5μm (ATP/protein ratio 12.5pmol/μg). 4. The Na+-dependent hydrolysis of ATP as well as the plateau concentration of bound phosphate and the rate of dephosphorylation were decreased in the washed preparation. The time-course of formation and decline of bound phosphate was fully restored by the addition of 2.5μm-magnesium chloride and 2μm-potassium chloride. Addition of 2.5μm-magnesium chloride alone fully restored the plateau concentration of bound phosphate, but the rate of dephosphorylation was only slightly increased. Na+-dependent ATP hydrolysis was partly restored with 2.5μm-magnesium chloride; addition of K+ in the range 2–10μm-potassium chloride then further restored hydrolysis but not to the control rate. 5. Pretreatment of the washed preparation at 0°C with 0.5nmol of K+/mg of protein so that the final added K+ in the reaction mixture was 0.1μm restored the Na+-dependent hydrolysis of ATP and the time-course of the reaction forming bound phosphate. 6. The binding of [42K]potassium chloride by the washed membrane preparation was examined. Binding in a solution containing 10nmol of K+/mg of protein was linear over a period of 20min and was inhibited by Na+. Half-maximal inhibition of 42K+-binding required a 100-fold excess of sodium chloride. 7. It was concluded (a) that a significant fraction of the apparent Na+-dependent hydrolysis of ATP observed
Satoh, Shinya; Mori, Kyoko; Onomura, Daichi; Ueda, Youki; Dansako, Hiromichi; Honda, Masao; Kaneko, Shuichi; Ikeda, Masanori; Kato, Nobuyuki
2017-08-01
Ribavirin (RBV) has been widely used as an antiviral reagent, specifically for patients with chronic hepatitis C. We previously demonstrated that adenosine kinase, which monophosphorylates RBV into the metabolically active form, is a key determinant for RBV sensitivity against hepatitis C virus RNA replication. However, the precise mechanism of RBV action and whether RBV affects cellular metabolism remain unclear. Analysis of liver gene expression profiles obtained from patients with advanced chronic hepatitis C treated with the combination of pegylated interferon and RBV showed that the adenosine kinase expression level tends to be lower in patients who are overweight and significantly decreases with progression to advanced fibrosis stages. In our effort to investigate whether RBV affects cellular metabolism, we found that RBV treatment under clinically achievable concentrations suppressed lipogenesis in hepatic cells. In this process, guanosine triphosphate depletion through inosine monophosphate dehydrogenase inhibition by RBV and adenosine monophosphate-activated protein kinase-related kinases, especially microtubule affinity regulating kinase 4, were required. In addition, RBV treatment led to the down-regulation of retinoid X receptor α (RXRα), a key nuclear receptor in various metabolic processes, including lipogenesis. Moreover, we found that guanosine triphosphate depletion in cells induced the down-regulation of RXRα, which was mediated by microtubule affinity regulating kinase 4. Overexpression of RXRα attenuated the RBV action for suppression of lipogenic genes and intracellular neutral lipids, suggesting that down-regulation of RXRα was required for the suppression of lipogenesis in RBV action. Conclusion : We provide novel insights about RBV action in lipogenesis and its mechanisms involving inosine monophosphate dehydrogenase inhibition, adenosine monophosphate-activated protein kinase-related kinases, and down-regulation of RXRα. RBV may be a
Marek, Magdalena; Milles, Sigrid; Schreiber, Gabriele; Daleke, David L; Dittmar, Gunnar; Herrmann, Andreas; Müller, Peter; Pomorski, Thomas Günther
2011-06-17
The ATP binding cassette (ABC) transporter Aus1 is expressed under anaerobic growth conditions at the plasma membrane of the yeast Saccharomyces cerevisiae and is required for sterol uptake. These observations suggest that Aus1 promotes the translocation of sterols across membranes, but the precise transport mechanism has yet to be identified. In this study, an extraction and purification procedure was developed to characterize the Aus1 transporter. The detergent-solubilized protein was able to bind and hydrolyze ATP. Mutagenesis of the conserved lysine to methionine in the Walker A motif abolished ATP hydrolysis. Likewise, ATP hydrolysis was inhibited by classical inhibitors of ABC transporters. Upon reconstitution into proteoliposomes, the ATPase activity of Aus1 was specifically stimulated by phosphatidylserine (PS) in a stereoselective manner. We also found that Aus1-dependent sterol uptake, but not Aus1 expression and trafficking to the plasma membrane, was affected by changes in cellular PS levels. These results suggest a direct interaction between Aus1 and PS that is critical for the activity of the transporter.
Ahn, Jinhi; Beharry, Seelochan; Molday, Laurie L; Molday, Robert S
2003-10-10
ABCR, also known as ABCA4, is a member of the superfamily of ATP binding cassette transporters that is believed to transport retinal or retinylidene-phosphatidylethanolamine across photoreceptor disk membranes. Mutations in the ABCR gene are responsible for Stargardt macular dystrophy and related retinal dystrophies that cause severe loss in vision. ABCR consists of two tandemly arranged halves each containing a membrane spanning segment followed by a large extracellular/lumen domain, a multi-spanning membrane domain, and a nucleotide binding domain (NBD). To define the role of each NBD, we examined the nucleotide binding and ATPase activities of the N and C halves of ABCR individually and co-expressed in COS-1 cells and derived from trypsin-cleaved ABCR in disk membranes. When disk membranes or membranes from co-transfected cells were photoaffinity labeled with 8-azido-ATP and 8-azido-ADP, only the NBD2 in the C-half bound and trapped the nucleotide. Co-expressed half-molecules displayed basal and retinal-stimulated ATPase activity similar to full-length ABCR. The individually expressed N-half displayed weak 8-azido-ATP labeling and low basal ATPase activity that was not stimulated by retinal, whereas the C-half did not bind ATP and exhibited little if any ATPase activity. Purified ABCR contained one tightly bound ADP, presumably in NBD1. Our results indicate that only NBD2 of ABCR binds and hydrolyzes ATP in the presence or absence of retinal. NBD1, containing a bound ADP, associates with NBD2 to play a crucial, non-catalytic role in ABCR function.
Hinrichs, John W J; Klappe, Karin; Hummel, Ina; Kok, Jan W
2004-02-13
In this study we show that P-glycoprotein in multidrug-resistant 2780AD human ovarian carcinoma cells and multidrug resistance-associated protein 1 in multidrug-resistant HT29col human colon carcinoma cells are predominantly located in Lubrol-based detergent-insoluble glycosphingolipid-enriched membrane domains. This localization is independent of caveolae, since 2780AD cells do not express caveolin-1. Although HT29col cells do express caveolin-1, the ATP-binding cassette transporter and caveolin-1 were dissociated on the basis of differential solubility in Triton X-100 and absence of microscopical colocalization. While both the multidrug resistance-associated protein 1 and caveolin-1 are located in Lubrol-based membrane domains, they occupy different regions of these domains.
Feng, Rui; Xu, Jianjun; Minobe, Etsuko; Kameyama, Asako; Yang, Lei; Yu, Lifeng; Hao, Liying; Kameyama, Masaki
2014-05-01
The present study is to investigate the mechanism by which ATP regulates Cav1.2 channel activity. Ventricular tissue was obtained from adult guinea pig hearts using collagenase. Ca(2+) channel activity was monitored using the patch-clamp technique. Proteins were purified using wheat germ agglutinin-Sepharose, and the concentration was determined using the Coomassie brilliant blue technique. ATP binding to the Cav1.2 channel was examined using the photoaffinity method. EDA-ATP-biotin maintains Ca(2+) channel activity in inside-out membrane patches. ATP directly bound to the Cav1.2 channel in a dose-dependent manner, and at least two molecules of ATP bound to one molecule of the Cav1.2 channel. Low levels of calmodulin (CaM) increased ATP binding to the Cav1.2 channel, but higher levels of CaM decreased ATP binding to the Cav1.2 channel. In addition, Ca(2+) was another regulator for ATP binding to the Cav1.2 channel. Furthermore, ATP bound to GST-fusion peptides of NH2-terminal region (amino acids 6-140) and proximal COOH-terminal region (amino acids 1,509-1,789) of the main subunit (α1C) of the Cav1.2 channel. Our data suggest that ATP might regulate Cav1.2 channel activity by directly binding to the Cav1.2 channel in a dose-dependent manner. In addition, the ATP-binding effect to the Cav1.2 channel was both CaM- and Ca(2+) dependent.
Mitamura, Toshiaki; Shite, Masato; Yamamura, Yoshimi; Kurosaki, Fumiya
2009-06-01
A cDNA clone, designated Sd-racrop (969 bp), was isolated from seedlings of Scoparia dulcis. This gene contains an open reading frame encoding the protein of 197 amino acid residues with high homology to Rac/Rop small guanosine 5'-triphosphate-binding proteins from various plant sources. In Southern hybridization analysis, the restriction digests prepared from genomic DNA of S. dulcis showed a main signal together with a few weakly hybridized bands. The transcriptional level of Sd-racrop showed a transient decrease by exposure of the leaf tissues of S. dulcis to the ethylene-generating reagent 2-chloroethylphosphonic acid. However, an appreciable increase in gene expression was reproducibly observed upon treatment of the plant with methyl jasmonate. These results suggest that the Sd-racrop product plays roles in ethylene- and methyl jasmonate-induced responses of S. dulcis accompanying the change in the transcriptional level, however, the cellular events mediated by this protein toward these external stimuli would be regulated by various mechanisms.
Janjua, M Burhan; Makepeace, Carol M; Anastacio, Melissa M; Schuessler, Richard B; Nichols, Colin G; Lawton, Jennifer S
2014-10-01
Adenosine triphosphate-sensitive (KATP) potassium channel opener diazoxide (DZX) maintains myocyte volume and contractility during stress via an unknown mechanism when administered at the onset of stress. This study was performed to investigate the cardioprotective potential of DZX when added after the onset of the stresses of hyperkalemic cardioplegia, metabolic inhibition, and hypo-osmotic stress. Isolated mouse ventricular and human atrial myocytes were exposed to control Tyrode's solution (TYR) for 10 to 20 minutes, test solution for 30 minutes (hypothermic hyperkalemic cardioplegia [CPG], CPG + 100uM diazoxide [CPG+DZX], metabolic inhibition [MI], MI+DZX, mild hypo-osmotic stress [0.9T], or 0.9T + DZX), with DZX added after 10 or 20 minutes of stress, followed by 20 minutes of re-exposure to TYR (±DZX). Myocyte volume (human + mouse) and contractility (mouse) were compared. Mouse and human myocytes demonstrated significant swelling during exposure to CPG, MI, and hypo-osmotic stress that was not prevented by DZX when administered either at 10 or 20 minutes after the onset of stress. Contractility after the stress of CPG in mouse myocytes significantly declined when DZX was administered 20 minutes after the onset of stress (p < 0.05 vs TYR). Contractility after hypo-osmotic stress in mouse myocytes was not altered by the addition of DZX. To maintain myocyte volume homeostasis and contractility during stress (hyperkalemic cardioplegia, metabolic inhibition, and hypo-osmotic stress), KATP channel opener diazoxide requires administration at the onset of stress in this isolated myocyte model. These data have potential implications for any future clinical application of diazoxide. Copyright © 2014 American College of Surgeons. Published by Elsevier Inc. All rights reserved.
Yao, Zhiming; Zhu, Hui; Li, Wenchan; Chen, Congxia; Wang, Hua; Shi, Lei; Zhang, Wenjie
2017-04-01
We investigated the cardiac risk stratification value of adenosine triphosphate stress myocardial perfusion imaging (ATP-MPI) in patients aged 70 years and older with suspected coronary artery disease (CAD). We identified a series of 415 consecutive patients aged 70 years and older with suspected CAD, who had undergone ATP-MPI with 99m Tc-MIBI. The presence of a fixed and/or reversible perfusion defect was considered as an abnormal MPI. Follow-up was available in 399 patients (96.1%) over 3.45 ± 1.71 years after excluding 16 patients who underwent early coronary revascularization <60 days after MPI. The major adverse cardiac events (MACE), including cardiac death, nonfatal infarction, and late coronary revascularization, were recorded. One hundred twenty-five (31.3%) patients had abnormal MPI and the remaining had normal MPI. A multivariable analysis using Cox regression demonstrated that abnormal MPI was independently associated with MACE (hazard ratio 19.50 and 95% confidence interval 5.91-64.31, P value .000). The patients with SSS > 8 had significantly higher cumulative MACE rate than patients with SSS ≤ 8 had (37.8% vs 5.2%, respectively, P < .001). The Kaplan-Meier cumulative MACE-free survival in patients with abnormal MPI (57.0%) was significantly lower than that in patients with normal MPI (89.6%), P < .0001. Among patients with SSS > 8, the Kaplan-Meier cumulative MACE-free survival were 36.9% in patients ≥80 years old and 49.5% in patients 70-79 years old, respectively, P < .05. However, among patients with SSS ≤ 8, there was no difference between the Kaplan-Meier cumulative MACE-free survivals of these two age groups. ATP-MPI data are useful for the prediction of major adverse cardiac events in patients aged 70 years and older with suspected CAD.
Vilches-Flores, Alonso; Tovar, Armando R; Marin-Hernandez, Alvaro; Rojas-Ochoa, Alberto; Fernandez-Mejia, Cristina
2010-07-01
Besides its role as a carboxylase prosthetic group, biotin has important effects on gene expression. However, the molecular mechanisms through which biotin exerts these effects are largely unknown. We previously found that biotin increases pancreatic glucokinase expression. We have now explored the mechanisms underlying this effect. Pancreatic islets from Wistar rats were treated with biotin, in the presence or absence of different types of inhibitors. Glucokinase mRNA and 18s rRNA abundance were determined by real-time PCR. Adenosine triphosphate (ATP) content was analyzed by fluorometry. Biotin treatment increased glucokinase mRNA abundance approximately one fold after 2 h; the effect was sustained up to 24 h. Inhibition of soluble guanylate cyclase or protein kinase G (PKG) signalling suppressed biotin-induced glucokinase expression. The cascade of events downstream of PKG in biotin-mediated gene transcription is not known. We found that inhibition of insulin secretion with diazoxide or nifedipine prevented biotin-stimulated glucokinase mRNA increase. Biotin treatment increased islet ATP content (control: 4.68+/-0.28; biotin treated: 6.62+/-0.26 pmol/islet) at 30 min. Inhibition of PKG activity suppressed the effects of biotin on ATP content. Insulin antibodies or inhibitors of phosphoinositol-3-kinase/Akt insulin signalling pathway prevented biotin-induced glucokinase expression. The nucleotide 8-Br-cGMP mimicked the biotin effects. We propose that the induction of pancreatic glucokinase mRNA by biotin involves guanylate cyclase and PKG activation, which leads to an increase in ATP content. This induces insulin secretion via ATP-sensitive potassium channels. Autocrine insulin, in turn, activates phosphoinositol-3-kinase/Akt signalling. Our results offer new insights into the pathways that participate in biotin-mediated gene expression. (c) 2010 Elsevier Inc. All rights reserved.
Shite, Masato; Yamamura, Yoshimi; Hayashi, Toshimitsu; Kurosaki, Fumiya
2008-11-01
A homology-based cloning strategy yielded Sdga, a cDNA clone presumably encoding alpha-subunit of heterotrimeric guanosine 5'-triphosphate-binding protein complex, from leaf tissues of Scoparia dulcis. Phylogenetic tree analysis of G-protein alpha-subunits from various biological sources suggested that, unlike in animal cells, classification of Galpha-proteins into specific subfamilies could not be applicable to the proteins from higher plants. Restriction digests of genomic DNA of S. dulcis showed a single hybridized signal in Southern blot analysis, suggesting that Sdga is a sole gene encoding Galpha-subunit in this plant. The expression level of Sdga appeared to be maintained at almost constant level after exposure of the leaves to methyl jasmonate as analyzed by reverse-transcription polymerase chain reaction. These results suggest that Sdga plays roles in methyl jasmonate-induced responses of S. dulcis without a notable change in the transcriptional level.
Laub, Katrine Rude; Marek, Magdalena; Stanchev, Lyubomir Dimitrov; Herrera, Sara Abad; Kanashova, Tamara; Bourmaud, Adèle; Dittmar, Gunnar
2017-01-01
The ATP binding cassette (ABC) transporters Pdr11p and its paralog Aus1p are expressed under anaerobic growth conditions at the plasma membrane of the yeast Saccharomyces cerevisiae and are required for sterol uptake. However, the precise mechanism by which these ABC transporters facilitate sterol movement is unknown. In this study, an overexpression and purification procedure was developed with the aim to characterise the Pdr11p transporter. Engineering of Pdr11p variants fused at the C terminus with green fluorescent protein (Pdr11p-GFP) and containing a FLAG tag at the N terminus facilitated expression analysis and one-step purification, respectively. The detergent-solubilised and purified protein displayed a stable ATPase activity with a broad pH optimum near 7.4. Mutagenesis of the conserved lysine to methionine (K788M) in the Walker A motif abolished ATP hydrolysis. Remarkably, and in contrast to Aus1p, ATPase activity of Pdr11p was insensitive to orthovanadate and not specifically stimulated by phosphatidylserine upon reconstitution into liposomes. Our results highlight distinct differences between Pdr11p and Aus1p and create an experimental basis for further biochemical studies of both ABC transporters to elucidate their function. PMID:28922409
Bukhari, Syed Abbas; Bell, Alison M.
2016-01-01
Offspring from females that experience stressful conditions during reproduction often exhibit altered phenotypes and many of these effects are thought to arise owing to increased exposure to maternal glucocorticoids. While embryos of placental vertebrates are known to regulate exposure to maternal glucocorticoids via placental steroid metabolism, much less is known about how and whether egg-laying vertebrates can control their steroid environment during embryonic development. We tested the hypothesis that threespine stickleback (Gasterosteus aculeatus) embryos can regulate exposure to maternal steroids via active efflux of maternal steroids from the egg. Embryos rapidly (within 72 h) cleared intact steroids, but blocking ATP-binding cassette (ABC) transporters inhibited cortisol clearance. Remarkably, this efflux of cortisol was sufficient to prevent a transcriptional response of embryos to exogenous cortisol. Taken together, these findings suggest that, much like their placental counterparts, developing fish embryos can actively regulate their exposure to maternal cortisol. These findings highlight the fact that even in egg-laying vertebrates, the realized exposure to maternal steroids is mediated by both maternal and embryonic processes and this has important implications for understanding how maternal stress influences offspring development. PMID:26984623
Wichelecki, Daniel J.; Vetting, Matthew W.; Chou, Liyushang; Al-Obaidi, Nawar; Bouvier, Jason T.; Almo, Steven C.; Gerlt, John A.
2015-01-01
Innovations in the discovery of the functions of uncharacterized proteins/enzymes have become increasingly important as advances in sequencing technology flood protein databases with an exponentially growing number of open reading frames. This study documents one such innovation developed by the Enzyme Function Initiative (EFI; U54GM093342), the use of solute-binding proteins for transport systems to identify novel metabolic pathways. In a previous study, this strategy was applied to the tripartite ATP-independent periplasmic transporters. Here, we apply this strategy to the ATP-binding cassette transporters and report the discovery of novel catabolic pathways for d-altritol and galactitol in Agrobacterium tumefaciens C58. These efforts resulted in the description of three novel enzymatic reactions as follows: 1) oxidation of d-altritol to d-tagatose via a dehydrogenase in Pfam family PF00107, a previously unknown reaction; 2) phosphorylation of d-tagatose to d-tagatose 6-phosphate via a kinase in Pfam family PF00294, a previously orphan EC number; and 3) epimerization of d-tagatose 6-phosphate C-4 to d-fructose 6-phosphate via a member of Pfam family PF08013, another previously unknown reaction. The epimerization reaction catalyzed by a member of PF08013 is especially noteworthy, because the functions of members of PF08013 have been unknown. These discoveries were assisted by the following two synergistic bioinformatics web tools made available by the Enzyme Function Initiative: the EFI-Enzyme Similarity Tool and the EFI-Genome Neighborhood Tool. PMID:26472925
Murakami, Megumi; Ohnuma, Shinobu; Fukuda, Michihiro; Chufan, Eduardo E; Kudoh, Katsuyoshi; Kanehara, Keigo; Sugisawa, Norihiko; Ishida, Masaharu; Naitoh, Takeshi; Shibata, Hiroyuki; Iwabuchi, Yoshiharu; Ambudkar, Suresh V; Unno, Michiaki
2017-11-01
Multidrug resistance (MDR) caused by the overexpression of ATP-binding cassette (ABC) transporters in cancer cells is a major obstacle in cancer chemotherapy. Previous studies have shown that curcumin, a natural product and a dietary constituent of turmeric, inhibits the function of MDR-related ABC transporters, including ABCB1, ABCC1, and especially ABCG2. However, the limited bioavailability of curcumin prevents its use for modulation of the function of these transporters in the clinical setting. In this study, we investigated the effects of 24 synthetic curcumin analogs with increased bioavailability on the transport function of ABCG2. The screening of the 24 synthetic analogs by means of flow cytometry revealed that four of the curcumin analogs (GO-Y030, GO-Y078, GO-Y168, and GO-Y172) significantly inhibited the efflux of the ABCG2 substrates, mitoxantrone and pheophorbide A, from ABCG2-overexpressing K562/breast cancer resistance protein (BCRP) cells. Biochemical analyses showed that GO-Y030, GO-Y078, and GO-Y172 stimulated the ATPase activity of ABCG2 at nanomolar concentrations and inhibited the photolabeling of ABCG2 with iodoarylazidoprazosin, suggesting that these analogs interact with the substrate-binding sites of ABCG2. In addition, when used in cytotoxicity assays, GO-Y030 and GO-Y078 were found to improve the sensitivity of the anticancer drug, SN-38, in K562/BCRP cells. Taken together, these results suggest that nontoxic synthetic curcumin analogs with increased bioavailability, especially GO-Y030 and GO-Y078, inhibit the function of ABCG2 by directly interacting at the substrate-binding site. These synthetic curcumin analogs could therefore be developed as potent modulators to overcome ABCG2-mediated MDR in cancer cells. Copyright © 2017 by The American Society for Pharmacology and Experimental Therapeutics.
Paul, Soumen; Khanapur, Shivashankar; Rybczynska, Anna A; Kwizera, Chantal; Sijbesma, Jurgen W A; Ishiwata, Kiichi; Willemsen, Antoon T M; Elsinga, Philip H; Dierckx, Rudi A J O; van Waarde, Aren
2011-08-01
Activation of adenosine A(1) receptors (A(1)R) in the brain causes sedation, reduces anxiety, inhibits seizures, and promotes neuroprotection. Cerebral A(1)R can be visualized using 8-dicyclopropylmethyl-1-(11)C-methyl-3-propyl-xanthine ((11)C-MPDX) and PET. This study aims to test whether (11)C-MPDX can be used for quantitative studies of cerebral A(1)R in rodents. (11)C-MPDX was injected (intravenously) into isoflurane-anesthetized male Wistar rats (300 g). A dynamic scan of the central nervous system was obtained, using a small-animal PET camera. A cannula in a femoral artery was used for blood sampling. Three groups of animals were studied: group 1, controls (saline-treated); group 2, animals pretreated with the A(1)R antagonist 8-cyclopentyl-1,3-dipropylxanthine (DPCPX, 1 mg, intraperitoneally); and group 3, animals pretreated (intraperitoneally) with a 20% solution of ethanol in saline (2 mL) plus the adenosine kinase inhibitor 4-amino-5-(3-bromophenyl)-7-(6-morpholino-pyridin-3-yl)pyrido[2,3-d] pyrimidine dihydrochloride (ABT-702) (1 mg). DPCPX is known to occupy cerebral A(1)R, whereas ethanol and ABT-702 increase extracellular adenosine. In groups 1 and 3, the brain was clearly visualized. High uptake of (11)C-MPDX was noted in striatum, hippocampus, and cerebellum. In group 2, tracer uptake was strongly suppressed and regional differences were abolished. The treatment of group 3 resulted in an unexpected 40%-45% increase of the cerebral uptake of radioactivity as indicated by increases of PET standardized uptake value, distribution volume from Logan plot, nondisplaceable binding potential from 2-tissue-compartment model fit, and standardized uptake value from a biodistribution study performed after the PET scan. The partition coefficient of the tracer (K(1)/k(2) from the model fit) was not altered under the study conditions. (11)C-MPDX shows a regional distribution in rat brain consistent with binding to A(1)R. Tracer binding is blocked by the selective A
21 CFR 892.1850 - Radiographic film cassette.
Code of Federal Regulations, 2012 CFR
2012-04-01
... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Radiographic film cassette. 892.1850 Section 892...) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1850 Radiographic film cassette. (a) Identification. A radiographic film cassette is a device intended for use during diagnostic x-ray procedures to...
21 CFR 892.1850 - Radiographic film cassette.
Code of Federal Regulations, 2014 CFR
2014-04-01
... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Radiographic film cassette. 892.1850 Section 892...) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1850 Radiographic film cassette. (a) Identification. A radiographic film cassette is a device intended for use during diagnostic x-ray procedures to...
21 CFR 892.1850 - Radiographic film cassette.
Code of Federal Regulations, 2013 CFR
2013-04-01
... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Radiographic film cassette. 892.1850 Section 892...) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1850 Radiographic film cassette. (a) Identification. A radiographic film cassette is a device intended for use during diagnostic x-ray procedures to...
21 CFR 892.1850 - Radiographic film cassette.
Code of Federal Regulations, 2010 CFR
2010-04-01
... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Radiographic film cassette. 892.1850 Section 892...) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1850 Radiographic film cassette. (a) Identification. A radiographic film cassette is a device intended for use during diagnostic x-ray procedures to...
2012-01-01
Background Nutritional supplements designed to increase adenosine 5′-triphosphate (ATP) concentrations are commonly used by athletes as ergogenic aids. ATP is the primary source of energy for the cells, and supplementation may enhance the ability to maintain high ATP turnover during high-intensity exercise. Oral ATP supplements have beneficial effects in some but not all studies examining physical performance. One of the remaining questions is whether orally administered ATP is bioavailable. We investigated whether acute supplementation with oral ATP administered as enteric-coated pellets led to increased concentrations of ATP or its metabolites in the circulation. Methods Eight healthy volunteers participated in a cross-over study. Participants were given in random order single doses of 5000 mg ATP or placebo. To prevent degradation of ATP in the acidic environment of the stomach, the supplement was administered via two types of pH-sensitive, enteric-coated pellets (targeted at release in the proximal or distal small intestine), or via a naso-duodenal tube. Blood ATP and metabolite concentrations were monitored by HPLC for 4.5 h (naso-duodenal tube) or 7 h (pellets) post-administration. Areas under the concentration vs. time curve were calculated and compared by paired-samples t-tests. Results ATP concentrations in blood did not increase after ATP supplementation via enteric-coated pellets or naso-duodenal tube. In contrast, concentrations of the final catabolic product of ATP, uric acid, were significantly increased compared to placebo by ~50% after administration via proximal-release pellets (P = 0.003) and naso-duodenal tube (P = 0.001), but not after administration via distal-release pellets. Conclusions A single dose of orally administered ATP is not bioavailable, and this may explain why several studies did not find ergogenic effects of oral ATP supplementation. On the other hand, increases in uric acid after release of ATP in the proximal
Nucleotide binding properties of bovine brain uncoating ATPase.
Gao, B; Emoto, Y; Greene, L; Eisenberg, E
1993-04-25
Many functions of the 70-kDa heat-shock proteins (hsp70s) appear to be regulated by bound nucleotide. In this study we examined the nucleotide binding properties of purified bovine brain uncoating ATPase, one of the constitutively expressed members of the hsp70 family. We found that uncoating ATPase purified by ATP-agarose column chromatography retained one ADP molecule bound per enzyme molecule which could not be removed by extensive dialysis. Since this bound ADP exchanged rapidly with free ADP or ATP, the inability to remove the bound nucleotide was not due to slow dissociation but rather to strong binding of the nucleotide to the uncoating ATPase. In confirmation of this view, equilibrium dialysis experiments suggested that the dissociation constants for both ADP and ATP were less than 0.1 microM. Schmid et al. (Schmid, S. L., Braell, W. A., and Rothman, J. E. (1985) J. Biol. Chem 260, 10057-10062) suggested that the uncoating ATPase had two sites for bound nucleotide, one specific for ATP and one binding both ATP and ATP analogues but not ADP. In contrast, we found that enzyme with bound ADP did not bind further adenosine 5'-(beta,gamma-imino)triphosphate or dATP, nor did more than one ATP molecule bind per enzyme even in 200 microM free ATP. These results strongly suggest that the enzyme has only one binding site for nucleotide. During steady-state ATP hydrolysis, 85% of the bound nucleotide at this site was determined to be ATP and 15% ADP; this is consistent with the rate of ADP release determined in the exchange experiments noted above, where ADP release was found to be six times faster than the overall rate of ATP hydrolysis.
Adenosine signalling mediates the anti-inflammatory effects of the COX-2 inhibitor nimesulide.
Caiazzo, Elisabetta; Maione, Francesco; Morello, Silvana; Lapucci, Andrea; Paccosi, Sara; Steckel, Bodo; Lavecchia, Antonio; Parenti, Astrid; Iuvone, Teresa; Schrader, Jürgen; Ialenti, Armando; Cicala, Carla
2016-07-15
Extracellular adenosine formation from ATP is controlled by ecto-nucleoside triphosphate diphosphohydrolase (E-NTPDase/CD39) and ecto-5'-nucleotidase (e-5NT/CD73); the latter converts AMP to adenosine and inorganic phosphate, representing the rate limiting step controlling the ratio between extracellular ATP and adenosine. Evidence that cellular expression and activity of CD39 and CD73 may be subject to changes under pathophysiological conditions has identified this pathway as an endogenous modulator in several diseases and was shown to be involved in the molecular mechanism of drugs, such as methotrexate, salicylates , interferon-β. We evaluated whether CD73/adenosine/A2A signalling pathway is involved in nimesulide anti-inflammatory effect, in vivo and in vitro. We found that the adenosine A2A agonist, 4-[2-[[6-amino-9-(N-ethyl-β-d-ribofuranuronamidosyl)-9H-purin-2-yl]amino]ethyl]benzenepropanoic acid hydrochloride (CGS21680, 2mg/kg ip.), inhibited carrageenan-induced rat paw oedema and the effect was reversed by co-administration of the A2A antagonist -(2-[7-amino-2-[2-furyl][1,2,4]triazolo[2,3-a][1,3,5]triazin-5-yl-amino]ethyl)phenol (ZM241385; 3mg/kg i.p.). Nimesulide (5mg/kg i.p.) anti-inflammatory effect was inhibited by pre-treatment with ZM241385 (3mg/kg i.p.) and by local administration of the CD73 inhibitor, adenosine 5'-(α,β-methylene)diphosphate (APCP; 400μg/paw). Furthermore, we found increased activity of 5'-nucleotidase/CD73 in paws and plasma of nimesulide treated rats, 4h following oedema induction. In vitro, the inhibitory effect of nimesulide on nitrite and prostaglandin E2 production by lipopolysaccharide-activated J774 cell line was reversed by ZM241385 and APCP. Furthermore, nimesulide increased CD73 activity in J774 macrophages while it did not inhibit nitrite accumulation by lipopolysaccharide-activated SiRNA CD73 silenced J774 macrophages. Our data demonstrate that the anti-inflammatory effect of nimesulide in part is mediated by CD73
[Adenylate cyclase from rabbit heart: substrate binding site].
Perfil'eva, E A; Khropov, Iu V; Khachatrian, L; Bulargina, T V; Baranova, L A
1981-08-01
The effects of 17 ATP analogs on the solubilized rabbit heart adenylate cyclase were studied. The triphosphate chain, position 8 of the adenine base and the ribose residue of the ATP molecule were modified. Despite the presence of the alkylating groups in two former types of the analogs tested, no covalent blocking of the active site of the enzyme was observed. Most of the compounds appeared to be competitive reversible inhibitors. The kinetic data confirmed the importance of the triphosphate chain for substrate binding in the active site of adenylate cyclase. (Formula: See Text) The inhibitors with different substituents in position 8 of the adenine base had a low affinity for the enzyme. The possible orientation of the triphosphate chain and the advantages of anti-conformation of the ATP molecule for their binding in the active site of adenylate cyclase are discussed.
Immunomagnetic separation/adenosine triphosphate (IMS/ATP) assays utilize paramagnetic beads and target-specific antibodies to isolate target organisms. Following isolation, adenosine tri-phosphate (ATP) is extracted from the target population and quantified. An inversely-couple...
Okishige, Kaoru; Aoyagi, Hideshi; Ihara, Kensuke; Iwai, Shinsuke; Nakamura, Tomofumi; Yamashita, Mitsumi; Katoh, Nobutaka; Hasegawa, Tomoaki; Kawaguchi, Naohiko; Keida, Takehiko; Sasano, Tetsuo; Hirao, Kenzo
2015-11-01
Dormant conduction (DC) induced by intravenous adenosine triphosphate (ATP) after pulmonary vein (PV) isolation (PVI) could predict subsequent PV reconnection (RC) sites. This study aimed to investigate the relationship between the DC and RC sites during the long-term follow-up. Ninety-one consecutive patients (62 males; mean age, 62 ± 11 years) with symptomatic persistent (n = 18) or paroxysmal (n = 73) atrial fibrillation (AF) who underwent PVI were included in this study. After a successful PVI, we administered ATP to reveal the DC sites. In total, DC sites were observed in 46 (51%) patients, and all were left un-ablated after marking or tagging all of them using fluoroscopic images and a three-dimensional (3D) mapping system. After the follow-up period (14.8 ± 3.6 months), AF recurred in 29 (32%) patients, all of whom had a DC in the initial ablation session, and underwent redo sessions. We divided the DC sites into three groups; in group A, the RC sites differed from the DC sites, in group B, the RC sites were identical to the DC sites, and in group C, the RC sites involved both DC and other sites. As a result, 20 (69%), 3 (11.5%), and 6 (19.5%) patients belonged to groups A, B, and C, respectively. Statistical analyses comparing the agreement between DC and the RC sites yielded a weak relationship. DC sites implying RC sites had a weak agreement, and other options to predict RC sites will be required to improve the clinical benefit of CA of AF.
Crawford, Robert S.; Albadawi, Hassan; Atkins, Marvin D.; Jones, John J.; Conrad, Mark F.; Austen, William G.; Fink, Mitchell P.; Watkins, Michael T.
2011-01-01
Introduction Experiments were designed to investigate the effects of ethyl pyruvate (EP) in a murine model of hind-limb ischemia-reperfusion (IR) injury. Methods C57BL6 mice underwent 90 minutes of unilateral ischemia followed by 24 hours of reperfusion using two treatment protocols. For the preischemic treatment (pre-I) protocol, mice (n = 6) were given 300 mg/kg EP before ischemia, followed by 150 mg/kg of EP just before reperfusion and at 6 hours and 12 hours after reperfusion. In a postischemic treatment (post-I) protocol, mice (n = 7) were treated with 300 mg/kg EP at the end of the ischemic period, then 15 minutes later, and 2 hours after reperfusion and 150 mg/kg of EP at 4 hours, 6 hours, 10 hours, 16 hours, and 22 hours after reperfusion. Controls mice for both protocols were treated with lactated Ringers alone at time intervals identical to EP. Skeletal muscle levels of adenosine triphosphate (ATP), interleukin-1β, keratinocyte chemoattractant protein, and thrombin antithrombin-3 complex were measured. Skeletal muscle architectural integrity was assessed microscopically. Results ATP levels were higher in mice treated with EP compared with controls under the both treatment protocols (p = 0.02). Interleukin-1β, keratinocyte chemoattractant protein, thrombin antithrombin-3 complex (p < 0.05), and the percentage of injured fibers (p < 0.0001) were significantly decreased in treated versus control mice under the both protocols. Conclusion Muscle fiber injury and markers of tissue thrombosis and inflammation were reduced, and ATP was preserved with EP in pre-I and post-I protocols. Further investigation of the efficacy of EP to modulate IR injury in a larger animal model of IR injury is warranted. PMID:21217488
Guo, Lei; Xiao, Yongsheng; Wang, Yinsheng
2014-11-04
Phosphorylation of cellular components catalyzed by kinases plays important roles in cell signaling and proliferation. Quantitative assessment of perturbation in global kinome may provide crucial knowledge for elucidating the mechanisms underlying the cytotoxic effects of environmental toxicants. Here, we utilized an adenosine triphosphate (ATP) affinity probe coupled with stable isotope labeling by amino acids in cell culture (SILAC) to assess quantitatively the arsenite-induced alteration of global kinome in human cells. We constructed a SILAC-compatible kinome library for scheduled multiple-reaction monitoring (MRM) analysis and adopted on-the-fly recalibration of retention time shift, which provided better throughput of the analytical method and enabled the simultaneous quantification of the expression of ∼300 kinases in two LC-MRM runs. With this improved analytical method, we conducted an in-depth quantitative analysis of the perturbation of kinome of GM00637 human skin fibroblast cells induced by arsenite exposure. Several kinases involved in cell cycle progression, including cyclin-dependent kinases (CDK1 and CDK4) and Aurora kinases A, B, and C, were found to be hyperactivated, and the altered expression of CDK1 was further validated by Western analysis. In addition, treatment with a CDK inhibitor, flavopiridol, partially restored the arsenite-induced growth inhibition of human skin fibroblast cells. Thus, sodium arsenite may confer its cytotoxic effect partly through the aberrant activation of CDKs and the resultant perturbation of cell cycle progression. Together, we developed a high-throughput, SILAC-compatible, and MRM-based kinome profiling method and demonstrated that the method is powerful in deciphering the molecular modes of action of a widespread environmental toxicant. The method should be generally applicable for uncovering the cellular pathways triggered by other extracellular stimuli.
2015-01-01
Phosphorylation of cellular components catalyzed by kinases plays important roles in cell signaling and proliferation. Quantitative assessment of perturbation in global kinome may provide crucial knowledge for elucidating the mechanisms underlying the cytotoxic effects of environmental toxicants. Here, we utilized an adenosine triphosphate (ATP) affinity probe coupled with stable isotope labeling by amino acids in cell culture (SILAC) to assess quantitatively the arsenite-induced alteration of global kinome in human cells. We constructed a SILAC-compatible kinome library for scheduled multiple-reaction monitoring (MRM) analysis and adopted on-the-fly recalibration of retention time shift, which provided better throughput of the analytical method and enabled the simultaneous quantification of the expression of ∼300 kinases in two LC-MRM runs. With this improved analytical method, we conducted an in-depth quantitative analysis of the perturbation of kinome of GM00637 human skin fibroblast cells induced by arsenite exposure. Several kinases involved in cell cycle progression, including cyclin-dependent kinases (CDK1 and CDK4) and Aurora kinases A, B, and C, were found to be hyperactivated, and the altered expression of CDK1 was further validated by Western analysis. In addition, treatment with a CDK inhibitor, flavopiridol, partially restored the arsenite-induced growth inhibition of human skin fibroblast cells. Thus, sodium arsenite may confer its cytotoxic effect partly through the aberrant activation of CDKs and the resultant perturbation of cell cycle progression. Together, we developed a high-throughput, SILAC-compatible, and MRM-based kinome profiling method and demonstrated that the method is powerful in deciphering the molecular modes of action of a widespread environmental toxicant. The method should be generally applicable for uncovering the cellular pathways triggered by other extracellular stimuli. PMID:25301106
Zhou, Qian; Lin, Youxiu; Lin, Yuping; Wei, Qiaohua; Chen, Guonan; Tang, Dianping
2016-01-01
Biomolecular immobilization and construction of the sensing platform are usually crucial for the successful development of a high-efficiency detection system. Herein we report on a novel and label-free signal-amplified aptasensing for sensitive electrochemical detection of small molecules (adenosine triphosphate, ATP, used in this case) by coupling with target-induced hybridization chain reaction (HCR) and the assembly of electroactive silver nanotags. The system mainly consisted of two alternating hairpin probes, a partial-pairing trigger-aptamer duplex DNA and a capture probe immobilized on the electrode. Upon target ATP introduction, the analyte attacked the aptamer and released the trigger DNA, which was captured by capture DNA immobilized on the electrode to form a newly partial-pairing double-stranded DNA. Thereafter, the exposed domain at trigger DNA could be utilized as the initator strand to open the hairpin probes in sequence, and propagated a chain reaction of hybridization events between two alternating hairpins to form a long nicked double-helix. The electrochemical signal derived from the assembled silver nanotags on the nicked double-helix. Under optimal conditions, the electrochemical aptasensor could exhibit a high sensitivity and a low detection limit, and allowed the detection of ATP at a concentration as low as 0.03 pM. Our design showed a high selectivity for target ATP against its analogs because of the high-specificity ATP-aptamer reaction, and its applicable for monitoring ATP in the spiking serum samples. Improtantly, the distinct advantages of the developed aptasensor make it hold a great potential for the development of simple and robust sensing strategies for the detection of other small molecules by controlling the apatmer sequence. Copyright © 2015 Elsevier B.V. All rights reserved.
ATP binding cassette (ABC) transporters: expression and clinical value in glioblastoma.
Dréan, Antonin; Rosenberg, Shai; Lejeune, François-Xavier; Goli, Larissa; Nadaradjane, Aravindan Arun; Guehennec, Jérémy; Schmitt, Charlotte; Verreault, Maïté; Bielle, Franck; Mokhtari, Karima; Sanson, Marc; Carpentier, Alexandre; Delattre, Jean-Yves; Idbaih, Ahmed
2018-03-08
ATP-binding cassette transporters (ABC transporters) regulate traffic of multiple compounds, including chemotherapeutic agents, through biological membranes. They are expressed by multiple cell types and have been implicated in the drug resistance of some cancer cells. Despite significant research in ABC transporters in the context of many diseases, little is known about their expression and clinical value in glioblastoma (GBM). We analyzed expression of 49 ABC transporters in both commercial and patient-derived GBM cell lines as well as from 51 human GBM tumor biopsies. Using The Cancer Genome Atlas (TCGA) cohort as a training dataset and our cohort as a validation dataset, we also investigated the prognostic value of these ABC transporters in newly diagnosed GBM patients, treated with the standard of care. In contrast to commercial GBM cell lines, GBM-patient derived cell lines (PDCL), grown as neurospheres in a serum-free medium, express ABC transporters similarly to parental tumors. Serum appeared to slightly increase resistance to temozolomide correlating with a tendency for an increased expression of ABCB1. Some differences were observed mainly due to expression of ABC transporters by microenvironmental cells. Together, our data suggest that the efficacy of chemotherapeutic agents may be misestimated in vitro if they are the targets of efflux pumps whose expression can be modulated by serum. Interestingly, several ABC transporters have prognostic value in the TCGA dataset. In our cohort of 51 GBM patients treated with radiation therapy with concurrent and adjuvant temozolomide, ABCA13 overexpression is associated with a decreased progression free survival in univariate (p < 0.01) and multivariate analyses including MGMT promoter methylation (p = 0.05) suggesting reduced sensitivity to temozolomide in ABCA13 overexpressing GBM. Expression of ABC transporters is: (i) detected in GBM and microenvironmental cells and (ii) better reproduced in GBM
NASA Astrophysics Data System (ADS)
Schechinger, Linda Sue
I. To investigate the delivery of nucleotide-based drugs, we are studying molecular recognition of nucleotide derivatives in environments that are similar to cell membranes. The Nowick group previously discovered that membrane-like surfactant micelles tetradecyltrimethylammonium bromide (TTAB) micelle facilitate molecular of adenosine monophosphate (AMP) recognition. The micelles bind nucleotides by means of electrostatic interactions and hydrogen bonding. We observed binding by following 1H NMR chemical shift changes of unique hexylthymine protons upon addition of AMP. Cationic micelles are required for binding. In surfactant-free or sodium dodecylsulfate solutions, no hydrogen bonding is observed. These observations suggest that the cationic surfactant headgroups bind the nucleotide phosphate group, while the intramicellar base binds the nucleotide base. The micellar system was optimized to enhance binding and selectivity for adenosine nucleotides. The selectivity for adenosine and the number of phosphate groups attached to the adenosine were both investigated. Addition of cytidine, guanidine, or uridine monophosphates, results in no significant downfield shifting of the NH resonance. Selectivity for the phosphate is limited, since adenosine mono-, di-, and triphosphates all have similar binding constants. We successfully achieved molecular recognition of adenosine nucleotides in micellar environments. There is significant difference in the binding interactions between the adenosine nucleotides and three other natural nucleotides. II. The UCI Chemistry Outreach Program (UCICOP) addresses the declining interest of the nations youth for science. UCICOP brings fun and exciting chemistry experiments to local high schools, to remind students that science is fun and has many practical uses. Volunteer students and alumni of UCI perform the demonstrations using scripts and material provided by UCICOP. The preparation of scripts and materials is done by two coordinators
Wang, Xin; Teng, Zhaogang; Wang, Haiyan; Wang, Chunyan; Liu, Ying; Tang, Yuxia; Wu, Jiang; Sun, Jin; Wang, Hai; Wang, Jiandong; Lu, Guangming
2014-01-01
Resistance to cytotoxic chemotherapy is the main cause of therapeutic failure and death in women with breast cancer. Overexpression of various members of the superfamily of adenosine triphosphate binding cassette (ABC)-transporters has been shown to be associated with multidrug resistance (MDR) phenotype in breast cancer cells. MDR1 protein promotes the intracellular efflux of drugs. A novel approach to address cancer drug resistance is to take advantage of the ability of nanocarriers to sidestep drug resistance mechanisms by endosomal delivery of chemotherapeutic agents. Doxorubicin (DOX) is an anthracycline antibiotic commonly used in breast cancer chemotherapy and a substrate for ABC-mediated drug efflux. In the present study, we developed breast cancer MCF-7 cells with overexpression of MDR1 and designed mesoporous silica nanoparticles (MSNs) which were used as a drug delivery system. We tested the efficacy of DOX in the breast cancer cell line MCF-7/MDR1 and in a MCF-7/MDR1 xenograft nude mouse model using the MSNs drug delivery system. Our data show that drug resistance in the human breast cancer cell line MCF-7/MDR1 can be overcome by treatment with DOX encapsulated within mesoporous silica nanoparticles.
Gao, Bo; Russell, Amanda; Beesley, Jonathan; Chen, Xiao Qing; Healey, Sue; Henderson, Michelle; Wong, Mark; Emmanuel, Catherine; Galletta, Laura; Johnatty, Sharon E; Bowtell, David; Haber, Michelle; Norris, Murray; Harnett, Paul; Chenevix-Trench, Georgia; Balleine, Rosemary L; deFazio, Anna
2014-05-09
ABCB1 (adenosine triphosphate-binding cassette transporter B1) mediates cellular elimination of many chemotherapeutic agents including paclitaxel, which is commonly used to treat ovarian cancer. A significant association between common single nucleotide polymorphisms (SNPs) in ABCB1 and progression-free survival has been reported in patients with ovarian cancer. Variable paclitaxel clearance due to genotype specific differences in ABCB1 activity in cancer cells and/or normal tissues may underlie the association. Using cell-based models, we evaluated the correlations between ABCB1 expression, polymorphisms, transporter activity and paclitaxel sensitivity in ovarian cancer (n = 10) and lymphoblastoid (n = 19) cell lines. Close associations between ABCB1 expression, transporter function and paclitaxel sensitivity were found in lymphoblastoid cell lines, although we could not demonstrate an association with common SNPs. In ovarian cancer cell lines, ABCB1 expression was low and the association between expression and function was lost. These results suggest that ABCB1 related survival difference in ovarian cancer patients is more likely to be due to differential whole body paclitaxel clearance mediated by normal cells rather than a direct effect on cancer cells.
Rangel, Luciana Pereira; Winter, Evelyn; Gauthier, Charlotte; Terreux, Raphaël; Chiaradia-Delatorre, Louise D; Mascarello, Alessandra; Nunes, Ricardo J; Yunes, Rosendo A; Creczynski-Pasa, Tania B; Macalou, Sira; Lorendeau, Doriane; Baubichon-Cortay, Hélène; Ferreira-Pereira, Antonio; Di Pietro, Attilio
2013-01-01
Adenosine triphosphate-binding cassette subfamily G member 2 (ABCG2) plays a major role in cancer cell multidrug resistance, which contributes to low eifficacy of chemotherapy. Chalcones were recently found to be potent and specific inhibitors, but unfortunately display a significant cytotoxicity. A cellular screening against ABCG2-mediated mitoxantrone efflux was performed here by flow cytometry on 54 chalcone derivatives from three different series with a wide panel of substituents. The identified leads, with submicromolar IC50 (half maximal inhibitory concentration) values, showed that the previously identified 2′-OH-4′,6′-dimethoxyphenyl, as A-ring, could be efficiently replaced by a 2′-naphthyl group, or a 3′,4′-methylenedioxyphenyl with lower affinity. Such a structural variability indicates 3polyspecificity of the multidrug transporter for inhibitors. At least two methoxyl groups were necessary on B-ring for optimal inhibition, but substitution at positions 3, 4, and 5 induced cytotoxicity. The presence of a large O-benzyl substituent at position 4 and a 2′-naphthyl as A-ring markedly decreased the cytotoxicity, giving a high therapeutic ratio, which constitutes a critical requirement for future in-vivo assays in animal models. PMID:24109177
Bhongsatiern, Jiraganya; Ohtsuki, Sumio; Tachikawa, Masanori; Hori, Satoko; Terasaki, Tetsuya
2005-03-01
ATP-binding cassette (ABC) transporter A4 is a member of the ABC transporter subfamily A which has been reported to be exclusively expressed in the retina. In contrast, a previous report has suggested a possible relationship between ABCA4 and CNS function. The purpose of the present study was to investigate the localization of ABCA4 mRNA and protein in rat brain. In situ hybridization analysis revealed that ABCA4 mRNA was localized in the lateral ventricles. RT-PCR analysis detected ABCA4 mRNA in isolated rat choroid plexus and conditionally immortalized rat choroid plexus epithelial cells (TR-CSFB). Furthermore, ABCA4 protein was also detected in the isolated rat choroid plexus at about 250 kDa by western blot analysis, and its apparent molecular size was reduced by N-glycosidase F treatment. These results suggest that glycosylated ABCA4 protein is expressed in rat choroid plexus epithelial cells. ABCA4 may play a role in the function of the blood-cerebrospinal fluid barrier and affect CSF conditions.
Okuda, Ken-ichi; Yanagihara, Sae; Sugayama, Tomomichi; Zendo, Takeshi; Nakayama, Jiro; Sonomoto, Kenji
2010-06-01
Lantibiotics are peptide-derived antibacterial substances produced by some Gram-positive bacteria and characterized by the presence of unusual amino acids, like lanthionines and dehydrated amino acids. Because lantibiotic producers may be attacked by self-produced lantibiotics, they express immunity proteins on the cytoplasmic membrane. An ATP-binding cassette (ABC) transport system mediated by the LanFEG protein complex is a major system in lantibiotic immunity. Multiple-sequence alignment analysis revealed that LanF proteins contain the E loop, a variant of the Q loop, which is a well-conserved motif in the nucleotide-binding domains (NBDs) of general ABC transporters. To elucidate E loop function, we introduced a mutation in the NukF protein, which is involved in the nukacin-ISK-1 immunity system. Amino acid replacement of glutamic acid in the E loop with glutamine (E85Q) resulted in slight decreases in the immunity level and transport activity. Additionally, the E85A mutation severely impaired the immunity level and transport activity. On the other hand, ATPase activities of purified E85Q and E85A mutants were almost similar to that of the wild type. These results suggested that the E loop found in ABC transporters involved in lantibiotic immunity plays a significant role in the function of these transporters, especially in the structural change of transmembrane domains.
Sakamoto, Kotaro; Ishibashi, Yoshihiro; Adachi, Ryutaro; Matsumoto, Shin-Ichi; Oki, Hideyuki; Kamada, Yusuke; Sogabe, Satoshi; Zama, Yumi; Sakamoto, Jun-Ichi; Tani, Akiyoshi
2017-08-01
Cytidine triphosphate synthase 1 (CTPS1) is an enzyme expressed in activated lymphocytes that catalyzes the conversion of uridine triphosphate (UTP) to cytidine triphosphate (CTP) with ATP-dependent amination, using either L-glutamine or ammonia as the nitrogen source. Since CTP plays an important role in DNA/RNA synthesis, phospholipid synthesis, and protein sialyation, CTPS1-inhibition is expected to control lymphocyte proliferation and size expansion in inflammatory diseases. In contrast, CTPS2, an isozyme of CTPS1 possessing 74% amino acid sequence homology, is expressed in normal lymphocytes. Thus, CTPS1-selective inhibition is important to avoid undesirable side effects. Here, we report the discovery of CTpep-3: Ac-FRLGLLKAFRRLF-OH from random peptide libraries displayed on T7 phage, which exhibited CTPS1-selective binding with a K D value of 210nM in SPR analysis and CTPS1-selective inhibition with an IC 50 value of 110nM in the enzyme assay. Furthermore, two fundamentally different approaches, enzyme inhibition assay and HDX-MS, provided the same conclusion that CTpep-3 acts by binding to the amidoligase (ALase) domain on CTPS1. To our knowledge, CTpep-3 is the first CTPS1-selective inhibitor. Copyright © 2017 Elsevier Inc. All rights reserved.
Tournier, Nicolas; Declèves, Xavier; Saubaméa, Bruno; Scherrmann, Jean-Michel; Cisternino, Salvatore
2011-01-01
Some of the ATP-binding cassette (ABC) transporters like P-glycoprotein (P-gp; ABCB1, MDR1), BCRP (ABCG2) and MRPs (ABCCs) that are present at the blood-brain barrier (BBB) influence the brain pharmacokinetics (PK) of their substrates by restricting their uptake or enhancing their clearance from the brain into the blood, which has consequences for their CNS pharmacodynamics (PD). Opioid drugs have been invaluable tools for understanding the PK-PD relationships of these ABC-transporters. The effects of morphine, methadone and loperamide on the CNS are modulated by P-gp. This review examines the ways in which other opioid drugs and some of their active metabolites interact with ABC transporters and suggests new mechanisms that may be involved in the variability of the response of the CNS to these drugs like carrier-mediated system belonging to the solute carrier (SLC) superfamily. Exposure to opioids may also alter the expression of ABC transporters. P-gp can be overproduced during morphine treatment, suggesting that the drug has a direct or, more likely, an indirect action. Variations in cerebral neurotransmitters during exposure to opioids and the release of cytokines during pain could be new endogenous stimuli affecting transporter synthesis. This review concludes with an analysis of the pharmacotherapeutic and clinical impacts of the interactions between ABC transporters and opioids.
diphosphoglycerate , and adenosine triphosphate occurred with storage in both sets. 2,3 diphosphoglycerate levels were slightly higher initially in...Adenosine triphosphate levels increased significantly and remained high 24 hr after transfusion. Red cell survival decreased with storage for both
Boring, Daniel L.; Ji, Xiao-Duo; Zimmet, Jeff; Taylor, Kirk E.; Stiles, Gary L.
2012-01-01
The 1,3-phenylene diisothiocyanate conjugate of XAC (8-[4-[[[[(2-aminoethyl)amino]carbonyl]methyl]-oxy]phenyl]-l,3-dipropylxanthine, a potent A1 selective adenosine antagonist) has been characterized as an irreversible inhibitor of A1 adenosine receptors. To further extend this work, a series of analogues were prepared containing a third substituent in the phenyl isothiocyanate ring, incorporated to modify the physiochemical or spectroscopic properties of the conjugate. Symmetrical trifunctional cross-linking reagents bearing two isothiocyanate groups were prepared as general intermediates for cross-linking functionalized congeners and receptors. Xanthine isothiocyanate derivatives containing hydrophilic, fluorescent, or reactive substituents, linked via an amide, thiourea, or methylene group in the 5-position, were synthesized and found to be irreversible inhibitors of A1 adenosine receptors. The effects of the 5-substituent on water solubility and on the A1/A2 selectivity ratio derived from binding assays in rat brain membranes were examined. Inhibition of binding of [3H]-N6-(2-phenylisopropyl)-adenosine and [3H]CGS21680 (2-[[2-[4-(2-carboxyethyl)phenyl]ethyl]amino]adenosine-5′-N-ethylcarboxamide) at central A1 and A2 adenosine receptors, respectively, was measured. A conjugate of XAC and 1,3,5-triisothiocyanatobenzene was 894-fold selective for A1 receptors. Reporter groups, such as fluorescent dyes and a spin-label, were included as chain substituents in the irreversibly binding analogues, which were designed for spectroscopic assays, histochemical characterization, and biochemical characterization of the receptor protein. PMID:1868116
Adenosine production by human B cells and B cell–mediated suppression of activated T cells
Saze, Zenichiro; Schuler, Patrick J.; Hong, Chang-Sook; Cheng, Dongmei; Jackson, Edwin K.
2013-01-01
Antibody-independent role of B cells in modulating T-cell responses is incompletely understood. Freshly isolated or cultured B cells isolated from the peripheral blood of 30 normal donors were evaluated for CD39 and CD73 coexpression, the ability to produce adenosine 5′-monophosphate (AMP) and adenosine (ADO) in the presence of exogenous adenosine triphosphate (ATP) as well as A1, A2A, A2B, and A3 adenosine receptor (ADOR) expression. Human circulating B cells coexpress ectonucleotidases CD39 and CD73, hydrolyze exogenous ATP to 5′-AMP and ADO, and express messenger RNA for A1R, A2AR, and A3R. 2-chloroadenosine inhibited B-cell proliferation and cytokine expression, and only A3R selective antagonist restored B-cell functions. This suggested that B cells use the A3R for autocrine signaling and self-regulation. Mediated effects on B-cell growth ± ADOR antagonists or agonists were tested in carboxyfluorescein diacetate succinimidyl ester assays. In cocultures, resting B cells upregulated functions of CD4+ and CD8+ T cells. However, in vitro–activated B cells downregulated CD73 expression, mainly produced 5′-AMP, and inhibited T-cell proliferation and cytokine production. These B cells acquire the ability to restrict potentially harmful effects of activated T cells. Thus, B cells emerge as a key regulatory component of T cell–B cell interactions, and their dual regulatory activity is mediated by the products of ATP hydrolysis, 5′-AMP, and ADO. PMID:23678003
Using optical tweezers to relate the chemical and mechanical cross-bridge cycles.
Steffen, Walter; Sleep, John
2004-12-29
In most current models of muscle contraction there are two translational steps, the working stroke, whereby an attached myosin cross-bridge moves relative to the actin filament, and the repriming step, in which the cross-bridge returns to its original orientation. The development of single molecule methods has allowed a more detailed investigation of the relationship of these mechanical steps to the underlying biochemistry. In the normal adenosine triphosphate cycle, myosin.adenosine diphosphate.phosphate (M.ADP.Pi) binds to actin and moves it by ca. 5 nm on average before the formation of the end product, the rigor actomyosin state. All the other product-like intermediate states tested were found to give no net movement indicating that M.ADP.Pi alone binds in a pre-force state. Myosin states with bound, unhydrolysed nucleoside triphosphates also give no net movement, indicating that these must also bind in a post-force conformation and that the repriming, post- to pre-transition during the forward cycle must take place while the myosin is dissociated from actin. These observations fit in well with the structural model in which the working stroke is aligned to the opening of the switch 2 element of the ATPase site.
ATP-binding cassette transporter 1 participates in LDL oxidation by artery wall cells.
Reddy, Srinivasa T; Hama, Susan; Ng, Carey; Grijalva, Victor; Navab, Mohamad; Fogelman, Alan M
2002-11-01
We have previously reported that products of the lipoxygenase pathway, hydroperoxyoctadecadienoic acid and hydroperoxyeicosatetraenoic acid, as well as cholesterol linoleate hydroperoxides, collectively termed seeding molecules, are removed by apolipoprotein A-I (apoA-I) from the artery wall cells and render low density lipoprotein (LDL) resistant to oxidation by human artery wall cells. The mechanisms by which oxidized lipids are transported and/or transferred to lipoproteins and the pathways by which apoA-I facilitates their removal remain unclear. ATP-binding cassette transporter 1 (ABCA1) is known to facilitate the release of cellular phospholipids and cholesterol from the plasma membrane to apoA-I and high density lipoprotein. Therefore, we evaluated whether ABCA1 participates in LDL oxidation. In this report, we show that (1) chemical inhibitors of ABCA1 function, glyburide and DIDS, block artery wall cell-mediated oxidative modification of LDL, (2) inhibition of ABCA1 with the use of antisense (but not sense) oligonucleotides prevents LDL-induced lipid hydroperoxide formation and LDL-induced monocyte chemotactic activity by the artery wall cells, and (3) oxysterols that induce ABCA1 expression, such as 22(R)hydroxycholesterol, enhance cell-mediated LDL oxidation. Furthermore, we also show that 22(R)hydroxycholesterol induces the production of reactive oxygen species in the artery wall cells, which can be removed by incubating the artery wall cells with apoA-I. Our data suggest that ABCA1 plays an important role in artery wall cell-mediated modification/oxidation of LDL by modulating the release of reactive oxygen species from artery wall cells that are necessary for LDL oxidation.
Capture and quality control mechanisms for ATP binding
Li, Li; Martinis, Susan A.
2013-01-01
The catalytic events in members of the nucleotidylyl transferase superfamily are initiated by a millisecond binding of ATP in the active site. Through metadynamics simulations on a class I aminoacyl-tRNA synthetase (aaRSs), the largest group in the superfamily, we calculate the free energy landscape of ATP selection and binding. Mutagenesis studies and fluorescence spectroscopy validated the identification of the most populated intermediate states. The rapid first binding step involves formation of encounter complexes captured through a fly-casting mechanism that acts up on the triphosphate moiety of ATP. In the slower nucleoside binding step, a conserved histidine in the HxxH motif orients the incoming ATP through base-stacking interactions resulting in a deep minimum in the free energy surface. Mutation of this histidine significantly decreases the binding affinity measured experimentally and computationally. The metadynamics simulations further reveal an intermediate quality control state that the synthetases and most likely other members of the superfamily use to select ATP over other nucleoside triphosphates. PMID:23276298
Yadav, Rakesh; Bansal, Ranju; Rohilla, Suman; Kachler, Sonja; Klotz, Karl-Norbert
2016-04-01
The carboxylate amides of 8-phenyl-1,3-dimethylxanthine described herein represent a new series of selective ligands of the adenosine A2A receptors exhibiting bronchospasmolytic activity. The effects of location of 8-phenyl substitutions on the adenosine receptor (AR) binding affinities of the newly synthesized xanthines have also been studied. The compounds displayed moderate to potent binding affinities toward various adenosine receptor subtypes when evaluated through radioligand binding studies. However, most of the compounds showed the maximum affinity for the A2A subtype, some with high selectivity versus all other subtypes. Xanthine carboxylate amide 13b with a diethylaminoethylamino moiety at the para-position of the 8-phenylxanthine scaffold was identified as the most potent A2A adenosine receptor ligand with Ki=0.06μM. Similarly potent and highly A2A-selective are the isovanillin derivatives 16a and 16d. In addition, the newly synthesized xanthine derivatives showed good in vivo bronchospasmolytic activity when tested in guinea pigs. Copyright © 2016 Elsevier Inc. All rights reserved.
21 CFR 892.1860 - Radiographic film/cassette changer.
Code of Federal Regulations, 2012 CFR
2012-04-01
... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Radiographic film/cassette changer. 892.1860... (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1860 Radiographic film/cassette changer. (a) Identification. A radiographic film/cassette changer is a device intended to be used during a...
21 CFR 892.1860 - Radiographic film/cassette changer.
Code of Federal Regulations, 2011 CFR
2011-04-01
... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Radiographic film/cassette changer. 892.1860... (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1860 Radiographic film/cassette changer. (a) Identification. A radiographic film/cassette changer is a device intended to be used during a...
21 CFR 892.1860 - Radiographic film/cassette changer.
Code of Federal Regulations, 2013 CFR
2013-04-01
... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Radiographic film/cassette changer. 892.1860... (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1860 Radiographic film/cassette changer. (a) Identification. A radiographic film/cassette changer is a device intended to be used during a...
21 CFR 892.1860 - Radiographic film/cassette changer.
Code of Federal Regulations, 2014 CFR
2014-04-01
... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Radiographic film/cassette changer. 892.1860... (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1860 Radiographic film/cassette changer. (a) Identification. A radiographic film/cassette changer is a device intended to be used during a...
21 CFR 892.1860 - Radiographic film/cassette changer.
Code of Federal Regulations, 2010 CFR
2010-04-01
... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Radiographic film/cassette changer. 892.1860... (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1860 Radiographic film/cassette changer. (a) Identification. A radiographic film/cassette changer is a device intended to be used during a...
Adenosine and adenosine receptors in the pathogenesis and treatment of rheumatic diseases.
Cronstein, Bruce N; Sitkovsky, Michail
2017-01-01
Adenosine, a nucleoside derived primarily from the extracellular hydrolysis of adenine nucleotides, is a potent regulator of inflammation. Adenosine mediates its effects on inflammatory cells by engaging one or more cell-surface receptors. The expression and function of adenosine receptors on different cell types change during the course of rheumatic diseases, such as rheumatoid arthritis (RA). Targeting adenosine receptors directly for the treatment of rheumatic diseases is currently under study; however, indirect targeting of adenosine receptors by enhancing adenosine levels at inflamed sites accounts for most of the anti-inflammatory effects of methotrexate, the anchor drug for the treatment of RA. In this Review, we discuss the regulation of extracellular adenosine levels and the role of adenosine in regulating the inflammatory and immune responses in rheumatic diseases such as RA, psoriasis and other types of inflammatory arthritis. In addition, adenosine and its receptors are involved in promoting fibrous matrix production in the skin and other organs, and the role of adenosine in fibrosis and fibrosing diseases is also discussed.
Salsoso, Rocío; Farías, Marcelo; Gutiérrez, Jaime; Pardo, Fabián; Chiarello, Delia I; Toledo, Fernando; Leiva, Andrea; Mate, Alfonso; Vázquez, Carmen M; Sobrevia, Luis
2017-06-01
Adenosine is an endogenous nucleoside with pleiotropic effects in different physiological processes including circulation, renal blood flow, immune function, or glucose homeostasis. Changes in adenosine membrane transporters, adenosine receptors, and corresponding intracellular signalling network associate with development of pathologies of pregnancy, including preeclampsia. Preeclampsia is a cause of maternal and perinatal morbidity and mortality affecting 3-5% of pregnancies. Since the proposed mechanisms of preeclampsia development include adenosine-dependent biological effects, adenosine membrane transporters and receptors, and the associated signalling mechanisms might play a role in the pathophysiology of preeclampsia. Preeclampsia associates with increased adenosine concentration in the maternal blood and placental tissue, likely due to local hypoxia and ischemia (although not directly demonstrated), microthrombosis, increased catecholamine release, and platelet activation. In addition, abnormal expression and function of equilibrative nucleoside transporters is described in foetoplacental tissues from preeclampsia; however, the role of adenosine receptors in the aetiology of this disease is not well understood. Adenosine receptors activation may be related to abnormal trophoblast invasion, angiogenesis, and ischemia/reperfusion mechanisms in the placenta from preeclampsia. These mechanisms may explain only a low fraction of the associated abnormal transformation of spiral arteries in preeclampsia, triggering cellular stress and inflammatory mediators release from the placenta to the maternal circulation. Although increased adenosine concentration in preeclampsia may be a compensatory or adaptive mechanism favouring placental angiogenesis, a poor angiogenic state is found in preeclampsia. Thus, preeclampsia-associated complications might affect the cell response to adenosine due to altered expression and activity of adenosine receptors, membrane transporters
Sakamoto, K; Margolles, A; van Veen, H W; Konings, W N
2001-09-01
Lactobacillus brevis is a major contaminant of spoiled beer. The organism can grow in beer in spite of the presence of antibacterial hop compounds that give the beer a bitter taste. The hop resistance in L. brevis is, at least in part, dependent on the expression of the horA gene. The deduced amino acid sequence of HorA is 53% identical to that of LmrA, an ATP-binding cassette multidrug transporter in Lactococcus lactis. To study the role of HorA in hop resistance, HorA was functionally expressed in L. lactis as a hexa-histidine-tagged protein using the nisin-controlled gene expression system. HorA expression increased the resistance of L. lactis to hop compounds and cytotoxic drugs. Drug transport studies with L. lactis cells and membrane vesicles and with proteoliposomes containing purified HorA protein identified HorA as a new member of the ABC family of multidrug transporters.
Nagao, K; Taguchi, Y; Arioka, M; Kadokura, H; Takatsuki, A; Yoda, K; Yamasaki, M
1995-01-01
We have isolated a Schizosaccharomyces pombe gene, bfr1+, which on a multicopy plasmid vector, pDB248', confers resistance to brefeldin A (BFA), an inhibitor of intracellular protein transport. This gene encodes a novel protein of 1,531 amino acids with an intramolecular duplicated structure, each half containing a single ATP-binding consensus sequence and a set of six transmembrane sequences. This structural characteristic of bfr1+ protein resembles that of mammalian P-glycoprotein, which, by exporting a variety of anticancer drugs, has been shown to be responsible for multidrug resistance in tumor cells. Consistent with this is that S. pombe cells harboring bfr1+ on pDB248' are resistant to actinomycin D, cerulenin, and cytochalasin B, as well as to BFA. The relative positions of the ATP-binding sequences and the clusters of transmembrane sequences within the bfr1+ protein are, however, transposed in comparison with those in P-glycoprotein; the bfr1+ protein has N-terminal ATP-binding sequence followed by transmembrane segments in each half of the molecule. The bfr1+ protein exhibited significant homology in primary and secondary structures with two recently identified multidrug resistance gene products of Saccharomyces cerevisiae, Snq2 and Sts1/Pdr5/Ydr1. The bfr1+ gene is not essential for cell growth or mating, but a delta bfr1 mutant exhibited hypersensitivity to BFA. We propose that the bfr1+ protein is another member of the ATP-binding cassette superfamily and serves as an efflux pump of various antibiotics. PMID:7883711
Molecular Dynamics Pinpoint the Global Fluorine Effect in Balanoid Binding to PKCε and PKA.
Hardianto, Ari; Liu, Fei; Ranganathan, Shoba
2018-02-26
(-)-Balanol is an adenosine triphosphate mimic that inhibits protein kinase C (PKC) isozymes and cAMP-dependent protein kinase (PKA) with limited selectivity. While PKA is known as a tumor promoter, PKC isozymes can be tumor promoters or suppressors. In particular, PKCε is frequently involved in tumorigenesis and a potential target for anticancer drugs. We recently reported that stereospecific fluorination of balanol yielded a balanoid with enhanced selectivity for PKCε over other PKC isozymes and PKA, although the global fluorine effect behind the selectivity enhancement is not fully understood. Interestingly, in contrast to PKA, PKCε is more sensitive to this fluorine effect. Here we investigate the global fluorine effect on the different binding responses of PKCε and PKA to balanoids using molecular dynamics (MD) simulations. For the first time to the best of our knowledge, we found that a structurally equivalent residue in each kinase, Thr184 in PKA and Ala549 in PKCε, is essential for the different binding responses. Furthermore, the study revealed that the invariant Lys, Lys73 in PKA and Lys437 in PKCε, already known to have a crucial role in the catalytic activity of kinases, serves as the main anchor for balanol binding. Overall, while Thr184 in PKA attenuates the effect of fluorination, Ala549 permits remote response of PKCε to fluorine substitution, with implications for rational design of future balanol-based PKCε inhibitors.
ERIC Educational Resources Information Center
Library of Congress, Washington, DC. National Library Service for the Blind and Physically Handicapped.
This catalog lists cassette books produced by the National Library Service for the Blind and Physically Handicapped during 1989. Books are listed alphabetically within subject categories under nonfiction and fiction headings. Nonfiction categories include: animals and wildlife, the arts, bestsellers, biography, blindness and physical handicaps,…
NASA Astrophysics Data System (ADS)
Zyubin, A.; Lavrova, A.; Babak, S.; Malaschenko, V.; Borisova, A.; Opryshko, N.
2016-10-01
The treatment of acute lymphoblastic leukemia (ALL) can result in the side-effects such as kidney affection, hepatic failure and tissue hypoxia. We study dynamics of special biochemical marker of these pathologies - adenosine triphosphate, that is well-known substance of energy metabolism. We use methods of confocal microscopy for determining the cellular and mitochondrial concentration of adenosine triphosphate (ATP). Quantitative values of adenosine triphosphate were calculated for each patient and correlation with degree of side-effects had been done. The application of confocal microscopy for studying of side-effects and therapy of lymphoblastic leukemia is discussed.
Chen, Dafeng; Mauk, Michael; Qiu, Xianbo; Liu, Changchun; Kim, Jitae; Ramprasad, Sudhir; Ongagna, Serge; Abrams, William R.; Malamud, Daniel; Corstjens, Paul L. A. M.
2010-01-01
A self-contained, integrated, disposable, sample-to-answer, polycarbonate microfluidic cassette for nucleic acid—based detection of pathogens at the point of care was designed, constructed, and tested. The cassette comprises on-chip sample lysis, nucleic acid isolation, enzymatic amplification (polymerase chain reaction and, when needed, reverse transcription), amplicon labeling, and detection. On-chip pouches and valves facilitate fluid flow control. All the liquids and dry reagents needed for the various reactions are pre-stored in the cassette. The liquid reagents are stored in flexible pouches formed on the chip surface. Dry (RT-)PCR reagents are pre-stored in the thermal cycling, reaction chamber. The process operations include sample introduction; lysis of cells and viruses; solid-phase extraction, concentration, and purification of nucleic acids from the lysate; elution of the nucleic acids into a thermal cycling chamber and mixing with pre-stored (RT-)PCR dry reagents; thermal cycling; and detection. The PCR amplicons are labeled with digoxigenin and biotin and transmitted onto a lateral flow strip, where the target analytes bind to a test line consisting of immobilized avidin-D. The immobilized nucleic acids are labeled with up-converting phosphor (UCP) reporter particles. The operation of the cassette is automatically controlled by an analyzer that provides pouch and valve actuation with electrical motors and heating for the thermal cycling. The functionality of the device is demonstrated by detecting the presence of bacterial B.Cereus, viral armored RNA HIV, and HIV I virus in saliva samples. The cassette and actuator described here can be used to detect other diseases as well as the presence of bacterial and viral pathogens in the water supply and other fluids. PMID:20401537
Chen, Dafeng; Mauk, Michael; Qiu, Xianbo; Liu, Changchun; Kim, Jitae; Ramprasad, Sudhir; Ongagna, Serge; Abrams, William R; Malamud, Daniel; Corstjens, Paul L A M; Bau, Haim H
2010-08-01
A self-contained, integrated, disposable, sample-to-answer, polycarbonate microfluidic cassette for nucleic acid-based detection of pathogens at the point of care was designed, constructed, and tested. The cassette comprises on-chip sample lysis, nucleic acid isolation, enzymatic amplification (polymerase chain reaction and, when needed, reverse transcription), amplicon labeling, and detection. On-chip pouches and valves facilitate fluid flow control. All the liquids and dry reagents needed for the various reactions are pre-stored in the cassette. The liquid reagents are stored in flexible pouches formed on the chip surface. Dry (RT-)PCR reagents are pre-stored in the thermal cycling, reaction chamber. The process operations include sample introduction; lysis of cells and viruses; solid-phase extraction, concentration, and purification of nucleic acids from the lysate; elution of the nucleic acids into a thermal cycling chamber and mixing with pre-stored (RT-)PCR dry reagents; thermal cycling; and detection. The PCR amplicons are labeled with digoxigenin and biotin and transmitted onto a lateral flow strip, where the target analytes bind to a test line consisting of immobilized avidin-D. The immobilized nucleic acids are labeled with up-converting phosphor (UCP) reporter particles. The operation of the cassette is automatically controlled by an analyzer that provides pouch and valve actuation with electrical motors and heating for the thermal cycling. The functionality of the device is demonstrated by detecting the presence of bacterial B.Cereus, viral armored RNA HIV, and HIV I virus in saliva samples. The cassette and actuator described here can be used to detect other diseases as well as the presence of bacterial and viral pathogens in the water supply and other fluids.
Zhao, Xiao-qin; Xie, Jing-dun; Chen, Xing-gui; Sim, Hong May; Zhang, Xu; Liang, Yong-ju; Singh, Satyakam; Talele, Tanaji T; Sun, Yueli; Ambudkar, Suresh V; Chen, Zhe-Sheng; Fu, Li-wu
2012-07-01
Neratinib, an irreversible inhibitor of epidermal growth factor receptor and human epidermal receptor 2, is in phase III clinical trials for patients with human epidermal receptor 2-positive, locally advanced or metastatic breast cancer. The objective of this study was to explore the ability of neratinib to reverse tumor multidrug resistance attributable to overexpression of ATP-binding cassette (ABC) transporters. Our results showed that neratinib remarkably enhanced the sensitivity of ABCB1-overexpressing cells to ABCB1 substrates. It is noteworthy that neratinib augmented the effect of chemotherapeutic agents in inhibiting the growth of ABCB1-overexpressing primary leukemia blasts and KBv200 cell xenografts in nude mice. Furthermore, neratinib increased doxorubicin accumulation in ABCB1-overexpressing cell lines and Rhodamine 123 accumulation in ABCB1-overexpressing cell lines and primary leukemia blasts. Neratinib stimulated the ATPase activity of ABCB1 at low concentrations but inhibited it at high concentrations. Likewise, neratinib inhibited the photolabeling of ABCB1 with [(125)I]iodoarylazidoprazosin in a concentration-dependent manner (IC(50) = 0.24 μM). Neither the expression of ABCB1 at the mRNA and protein levels nor the phosphorylation of Akt was affected by neratinib at reversal concentrations. Docking simulation results were consistent with the binding conformation of neratinib within the large cavity of the transmembrane region of ABCB1, which provides computational support for the cross-reactivity of tyrosine kinase inhibitors with human ABCB1. In conclusion, neratinib can reverse ABCB1-mediated multidrug resistance in vitro, ex vivo, and in vivo by inhibiting its transport function.
Zhao, Xiao-qin; Xie, Jing-dun; Chen, Xing-gui; Sim, Hong May; Zhang, Xu; Liang, Yong-ju; Singh, Satyakam; Talele, Tanaji T.; Sun, Yueli; Ambudkar, Suresh V.; Chen, Zhe-Sheng
2012-01-01
Neratinib, an irreversible inhibitor of epidermal growth factor receptor and human epidermal receptor 2, is in phase III clinical trials for patients with human epidermal receptor 2-positive, locally advanced or metastatic breast cancer. The objective of this study was to explore the ability of neratinib to reverse tumor multidrug resistance attributable to overexpression of ATP-binding cassette (ABC) transporters. Our results showed that neratinib remarkably enhanced the sensitivity of ABCB1-overexpressing cells to ABCB1 substrates. It is noteworthy that neratinib augmented the effect of chemotherapeutic agents in inhibiting the growth of ABCB1-overexpressing primary leukemia blasts and KBv200 cell xenografts in nude mice. Furthermore, neratinib increased doxorubicin accumulation in ABCB1-overexpressing cell lines and Rhodamine 123 accumulation in ABCB1-overexpressing cell lines and primary leukemia blasts. Neratinib stimulated the ATPase activity of ABCB1 at low concentrations but inhibited it at high concentrations. Likewise, neratinib inhibited the photolabeling of ABCB1 with [125I]iodoarylazidoprazosin in a concentration-dependent manner (IC50 = 0.24 μM). Neither the expression of ABCB1 at the mRNA and protein levels nor the phosphorylation of Akt was affected by neratinib at reversal concentrations. Docking simulation results were consistent with the binding conformation of neratinib within the large cavity of the transmembrane region of ABCB1, which provides computational support for the cross-reactivity of tyrosine kinase inhibitors with human ABCB1. In conclusion, neratinib can reverse ABCB1-mediated multidrug resistance in vitro, ex vivo, and in vivo by inhibiting its transport function. PMID:22491935
Vu, Michael M. K.; Jameson, Nora E.; Masuda, Stuart J.; Lin, Dana; Larralde-Ridaura, Rosa; Lupták, Andrej
2012-01-01
SUMMARY Aptamers are structured macromolecules in vitro evolved to bind molecular targets, whereas in nature they form the ligand-binding domains of riboswitches. Adenosine aptamers of a single structural family were isolated several times from random pools but they have not been identified in genomic sequences. We used two unbiased methods, structure-based bioinformatics and human genome-based in vitro selection, to identify aptamers that form the same adenosine-binding structure in a bacterium, and several vertebrates, including humans. Two of the human aptamers map to introns of RAB3C and FGD3 genes. The RAB3C aptamer binds ATP with dissociation constants about ten times lower than physiological ATP concentration, while the minimal FGD3 aptamer binds ATP only co-transcriptionally. PMID:23102219
Lyu, J; Imachi, H; Iwama, H; Zhang, H; Murao, K
2016-05-01
ATP-binding cassette transporter A1 (ABCA1) in pancreatic beta cells influences insulin secretion and cholesterol homeostasis. The present study investigates whether insulin-like growth factor 1 (IGF-1), which mediates stimulation of ABCA1 gene expression, could also interfere with the phosphatidylinositol 3-kinase (PI3-K) cascade.ABCA1 expression was examined by real-time polymerase chain reaction (PCR), Western blot analysis, and a reporter gene assay in rat insulin-secreting INS-1 cells incubated with IGF-1. The binding of forkhead box O1 (FoxO1) protein to the ABCA1 promoter was assessed by a chromatin immunoprecipitation (ChIP) assay. ABCA1 protein levels increased in response to rising concentrations of IGF-1. Real-time PCR analysis showed a significant increase in ABCA1 mRNA expression. However, both effects were suppressed after silencing the IGF-1 receptor. In parallel with its effect on endogenous ABCA1 mRNA levels, IGF-1 induced the activity of a reporter construct containing the ABCA1 promoter, while it was abrogated by LY294002, a specific inhibitor of PI3-K. Constitutively active Akt stimulated activity of the ABCA1 promoter, and a dominant-negative mutant of Akt or mutagenesis of the FoxO1 response element in the ABCA1 promoter abolished the ability of IGF-1 to stimulate promoter activity. A ChIP assay showed that FoxO1 mediated its transcriptional activity by directly binding to the ABCA1 promoter region. The knockdown of FoxO1 disrupted the effect of IGF-1 on ABCA1 expression. Furthermore, IGF-1 promoted cholesterol efflux and reduced the pancreatic lipotoxicity. These results demonstrate that the PI3-K/Akt/FoxO1 pathway contributes to the regulation of ABCA1 expression in response to IGF-1 stimulation. © Georg Thieme Verlag KG Stuttgart · New York.
Adenosine triphosphate (ATP) reduces amyloid-β protein misfolding in vitro.
Coskuner, Orkid; Murray, Ian V J
2014-01-01
Alzheimer's disease (AD) is a devastating disease of aging that initiates decades prior to clinical manifestation and represents an impending epidemic. Two early features of AD are metabolic dysfunction and changes in amyloid-β protein (Aβ) levels. Since levels of ATP decrease over the course of the disease and Aβ is an early biomarker of AD, we sought to uncover novel linkages between the two. First and remarkably, a GxxxG motif is common between both Aβ (oligomerization motif) and nucleotide binding proteins (Rossmann fold). Second, ATP was demonstrated to protect against Aβ mediated cytotoxicity. Last, there is structural similarity between ATP and amyloid binding/inhibitory compounds such as ThioT, melatonin, and indoles. Thus, we investigated whether ATP alters misfolding of the pathologically relevant Aβ42. To test this hypothesis, we performed computational and biochemical studies. Our computational studies demonstrate that ATP interacts strongly with Tyr10 and Ser26 of Aβ fibrils in solution. Experimentally, both ATP and ADP reduced Aβ misfolding at physiological intracellular concentrations, with thresholds at ~500 μM and 1 mM respectively. This inhibition of Aβ misfolding is specific; requiring Tyr10 of Aβ and is enhanced by magnesium. Last, cerebrospinal fluid ATP levels are in the nanomolar range and decreased with AD pathology. This initial and novel finding regarding the ATP interaction with Aβ and reduction of Aβ misfolding has potential significance to the AD field. It provides an underlying mechanism for published links between metabolic dysfunction and AD. It also suggests a potential role of ATP in AD pathology, as the occurrence of misfolded extracellular Aβ mirrors lowered extracellular ATP levels. Last, the findings suggest that Aβ conformation change may be a sensor of metabolic dysfunction.
Effects of adenosine 5'-monophosphate on epidermal turnover.
Furukawa, Fukumi; Kanehara, Shoko; Harano, Fumiki; Shinohara, Shigeo; Kamimura, Junko; Kawabata, Shigekatsu; Igarashi, Sachiyo; Kawamura, Mitsuaki; Yamamoto, Yuki; Miyachi, Yoshiki
2008-10-01
The structure and function of the epidermis is maintained by cell renewal based on epidermal turnover. Epidermal turnover is delayed by aging, and it is thought that the delay of the epidermal turnover is a cause of aging alternation of skin. The epidermal turnover is related to the energy metabolism of epidermal basal cells. Adenosine 5'-triphosphate (ATP) is needed for cell renewal: cell division, and adenosine 5'-monophosphate (AMP) increases the amount of intracellular ATP. These findings suggest that AMP accelerates the epidermal turnover delayed by aging. This study investigated whether AMP and adenosine 5'-monophosphate disodium salt (AMP2Na) accelerates the epidermal turnover. An effect of AMP2Na on cell proliferation was examined by our counting of keratinocytes. An effect of AMP2Na on cell cycle was examined by our counting of basal cells in DNA synthetic period of hairless rats. The effects of AMP2Na (or AMP) on the epidermal turnover were examined by our measuring stratum corneum transit time by use of guinea pigs, and by our measuring stratum corneum surface area by use of hairless rats and in a clinical pharmacological study. The AMP2Na showed two different profiles on the proliferation of primary cultured keratinocytes. At a low concentration it induced cell growth, whereas at a high concentration it inhibited cell growth. The number of basal cells in the DNA synthetic period of AMP2Na was significantly higher than that of the vehicle in hairless rats. The stratum corneum transit time of AMP2Na was significantly shorter than that of the vehicle in guinea pigs. The corneocyte surface area of emulsion containing AMP2Na was significantly smaller than that of the vehicle in volunteers. We conclude that AMP promotes the cell proliferation and the cell cycle progression of epidermal basal cells and accelerates epidermal turnover safely. In addition, AMP is useful for skin rejuvenation in dermatology and aesthetic dermatology.
Zhu, Yu; Lu, Gui-Hua; Bian, Zhuo-Wu; Wu, Feng-Yao; Pang, Yan-Jun; Wang, Xiao-Ming; Yang, Rong-Wu; Tang, Cheng-Yi; Qi, Jin-Liang; Yang, Yong-Hua
2017-11-13
Shikonin is a naphthoquinone secondary metabolite with important medicinal value and is found in Lithospermum erythrorhizon. Considering the limited knowledge on the membrane transport mechanism of shikonin, this study investigated such molecular mechanism. We successfully isolated an ATP-binding cassette protein gene, LeMDR, from L. erythrorhizon. LeMDR is predominantly expressed in L. erythrorhizon roots, where shikonin accumulated. Functional analysis of LeMDR by using the yeast cell expression system revealed that LeMDR is possibly involved in the shikonin efflux transport. The accumulation of shikonin is lower in yeast cells transformed with LeMDR-overexpressing vector than that with empty vector. The transgenic hairy roots of L. erythrorhizon overexpressing LeMDR (MDRO) significantly enhanced shikonin production, whereas the RNA interference of LeMDR (MDRi) displayed a reverse trend. Moreover, the mRNA expression level of LeMDR was up-regulated by treatment with shikonin and shikonin-positive regulators, methyl jasmonate and indole-3-acetic acid. There might be a relationship of mutual regulation between the expression level of LeMDR and shikonin biosynthesis. Our findings demonstrated the important role of LeMDR in transmembrane transport and biosynthesis of shikonin.
Zeng, Zhu; Zuo, Fanglei; Yu, Rui; Zhang, Bo; Ma, Huiqin; Chen, Shangwu
2017-09-01
A novel lactose-responsive promoter of the ATP-binding cassette (ABC) transporter gene Lba1680 of Lactobacillus acidophilus strain 05-172 isolated from a traditionally fermented dairy product koumiss was characterized. In L. acidophilus 05-172, expression of Lba1680 was induced by lactose, with lactose-induced transcription of Lba1680 being 6.1-fold higher than that induced by glucose. This is in contrast to L. acidophilus NCFM, a strain isolated from human feces, in which expression of Lba1680 and Lba1679 is induced by glucose. Both gene expression and enzyme activity assays in L. paracasei transformed with a vector containing the inducible Lba1680 promoter (PLba1680) of strain 05-172 and a heme-dependent catalase gene as reporter confirmed that PLba1680 is specifically induced by lactose. Its regulatory expression could not be repressed by glucose, and was independent of cAMP receptor protein. This lactose-responsive promoter might be used in the expression of functional genes in L. paracasei incorporated into a lactose-rich environment, such as dairy products. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
The Howard Hughes Medical Institute cassette for storage phosphor plates
DOE Office of Scientific and Technical Information (OSTI.GOV)
Staudenmann, J.; Zotterman, W.L.; Cook, D.W.
1994-03-01
New cassettes for 201 mm{times}252 mm (8{double_prime}{times}10{double_prime}) and 201 mm{times}400 mm (8{double_prime}{times}15.75{double_prime}) storage phosphor plates have been developed at the Synchrotron Resource of the Howard Hughes Medical Institute. The purpose for this work was mainly twofold. Firstly, to diminish the number of manual operations when putting the storage phosphor plate into the cassette or when extracting it from the cassette. Secondly, to render such a cassette much lighter than the former metal cassette previously in use. These two goals were achieved by making new cassettes that are operated as one piece instead of two or three independent parts as withmore » the former systems. The cassettes have been extensively tested and found to be very useful.« less
Francisco, Rita Maria; Regalado, Ana; Ageorges, Agnès; Burla, Bo J.; Bassin, Barbara; Eisenach, Cornelia; Zarrouk, Olfa; Vialet, Sandrine; Marlin, Thérèse; Chaves, Maria Manuela; Martinoia, Enrico; Nagy, Réka
2013-01-01
Accumulation of anthocyanins in the exocarp of red grapevine (Vitis vinifera) cultivars is one of several events that characterize the onset of grape berry ripening (véraison). Despite our thorough understanding of anthocyanin biosynthesis and regulation, little is known about the molecular aspects of their transport. The participation of ATP binding cassette (ABC) proteins in vacuolar anthocyanin transport has long been a matter of debate. Here, we present biochemical evidence that an ABC protein, ABCC1, localizes to the tonoplast and is involved in the transport of glucosylated anthocyanidins. ABCC1 is expressed in the exocarp throughout berry development and ripening, with a significant increase at véraison (i.e., the onset of ripening). Transport experiments using microsomes isolated from ABCC1-expressing yeast cells showed that ABCC1 transports malvidin 3-O-glucoside. The transport strictly depends on the presence of GSH, which is cotransported with the anthocyanins and is sensitive to inhibitors of ABC proteins. By exposing anthocyanin-producing grapevine root cultures to buthionine sulphoximine, which reduced GSH levels, a decrease in anthocyanin concentration is observed. In conclusion, we provide evidence that ABCC1 acts as an anthocyanin transporter that depends on GSH without the formation of an anthocyanin-GSH conjugate. PMID:23723325
Dey, Sandip; Biswas, Chiranjit; Sengupta, Jayati
2018-06-21
The ribosome-associated GTPase HflX acts as an antiassociation factor upon binding to the 50S ribosomal subunit during heat stress in Escherichia coli Although HflX is recognized as a guanosine triphosphatase, several studies have shown that the N-terminal domain 1 of HflX is capable of hydrolyzing adenosine triphosphate (ATP), but the functional role of its adenosine triphosphatase (ATPase) activity remains unknown. We demonstrate that E. coli HflX possesses ATP-dependent RNA helicase activity and is capable of unwinding large subunit ribosomal RNA. A cryo-electron microscopy structure of the 50S-HflX complex in the presence of nonhydrolyzable analogues of ATP and guanosine triphosphate hints at a mode of action for the RNA helicase and suggests the linker helical domain may have a determinant role in RNA unwinding. Heat stress results in inactivation of the ribosome, and we show that HflX can restore heat-damaged ribosomes and improve cell survival. © 2018 Dey et al.
21 CFR 892.1870 - Radiographic film/cassette changer programmer.
Code of Federal Regulations, 2014 CFR
2014-04-01
... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Radiographic film/cassette changer programmer. 892... SERVICES (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1870 Radiographic film/cassette changer programmer. (a) Identification. A radiographic film/cassette changer programmer is a...
21 CFR 892.1870 - Radiographic film/cassette changer programmer.
Code of Federal Regulations, 2011 CFR
2011-04-01
... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Radiographic film/cassette changer programmer. 892... SERVICES (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1870 Radiographic film/cassette changer programmer. (a) Identification. A radiographic film/cassette changer programmer is a...
21 CFR 892.1870 - Radiographic film/cassette changer programmer.
Code of Federal Regulations, 2013 CFR
2013-04-01
... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Radiographic film/cassette changer programmer. 892... SERVICES (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1870 Radiographic film/cassette changer programmer. (a) Identification. A radiographic film/cassette changer programmer is a...
21 CFR 892.1870 - Radiographic film/cassette changer programmer.
Code of Federal Regulations, 2012 CFR
2012-04-01
... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Radiographic film/cassette changer programmer. 892... SERVICES (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1870 Radiographic film/cassette changer programmer. (a) Identification. A radiographic film/cassette changer programmer is a...
21 CFR 892.1870 - Radiographic film/cassette changer programmer.
Code of Federal Regulations, 2010 CFR
2010-04-01
... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Radiographic film/cassette changer programmer. 892... SERVICES (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1870 Radiographic film/cassette changer programmer. (a) Identification. A radiographic film/cassette changer programmer is a...
Cassette for handling banknotes or the like
Lundblad, Leif
1981-08-11
A cassette for banknotes and like valuable articles is provided with a displaceable lid (6) and locking means (10) for latching the lid of the cassette when the cassette is located outside a housing (25) in which it is intended to be placed. An operating means (8) is arranged to co-act with the locking means and with a latching element (15). The latching element is arranged to be released in dependence upon a pre-set program. A signal circuit is arranged to send a code signal to a detector circuit (23) when electrical contact elements on the cassette and the housing co-act with one another, which detector circuit, when the signal coincides with the signal program in the detector circuit, causes a signal to be sent for moving the latching means to a non-latching position.
Di Marino, Daniele; Oteri, Francesco; della Rocca, Blasco Morozzo; D'Annessa, Ilda; Falconi, Mattia
2012-06-01
The mitochondrial adenosine diphosphate/adenosine triphosphate (ADP/ATP) carrier-AAC-was crystallized in complex with its specific inhibitor carboxyatractyloside (CATR). The protein consists of a six-transmembrane helix bundle that defines the nucleotide translocation pathway, which is closed towards the matrix side due to sharp kinks in the odd-numbered helices. In this paper, we describe the interaction between the matrix side of the AAC transporter and the ATP(4-) molecule using carrier structures obtained through classical molecular dynamics simulation (MD) and a protein-ligand docking procedure. Fifteen structures were extracted from a previously published MD trajectory through clustering analysis, and 50 docking runs were carried out for each carrier conformation, for a total of 750 runs ("MD docking"). The results were compared to those from 750 docking runs performed on the X-ray structure ("X docking"). The docking procedure indicated the presence of a single interaction site in the X-ray structure that was conserved in the structures extracted from the MD trajectory. MD docking showed the presence of a second binding site that was not found in the X docking. The interaction strategy between the AAC transporter and the ATP(4-) molecule was analyzed by investigating the composition and 3D arrangement of the interaction pockets, together with the orientations of the substrate inside them. A relationship between sequence repeats and the ATP(4-) binding sites in the AAC carrier structure is proposed.
Forman, Mervyn B; Gillespie, Delbert G; Cheng, Dongmei; Jackson, Edwin K
2014-09-01
Intraperitoneal adenosine reduces abdominal adhesions. However, because of the ultra-short half-life and low solubility of adenosine, optimal efficacy requires multiple dosing. Here, we compared the ability of potential adenosine prodrugs to inhibit post-surgical abdominal adhesions after a single intraperitoneal dose. Abdominal adhesions were induced in mice using an electric toothbrush to damage the cecum. Also, 20 μL of 95 % ethanol was applied to the cecum to cause chemically induced injury. After injury, mice received intraperitoneally either saline (n = 18) or near-solubility limit of adenosine (23 mmol/L; n = 12); 5'-adenosine monophosphate (75 mmol/L; n = 11); 3'-adenosine monophosphate (75 mmol/L; n = 12); 2'-adenosine monophosphate (75 mmol/L; n = 12); 3',5'-cyclic adenosine monophosphate (75 mmol/L; n = 19); or 2',3'-cyclic adenosine monophosphate (75 mmol/L; n = 20). After 2 weeks, adhesion formation was scored by an observer blinded to the treatments. In a second study, intraperitoneal adenosine levels were measured using tandem mass spectrometry for 3 h after instillation of 2',3'-cyclic adenosine monophosphate (75 mmol/L) into the abdomen. The order of efficacy for attenuating adhesion formation was: 2',3'-cyclic adenosine monophosphate > 3',5'-cyclic adenosine monophosphate ≈ adenosine > 5'-adenosine monophosphate ≈ 3'-adenosine monophosphate ≈ 2'-adenosine monophosphate. The groups were compared using a one-factor analysis of variance, and the overall p value for differences between groups was p < 0.000001. Intraperitoneal administration of 2',3'-cAMP yielded pharmacologically relevant levels of adenosine in the abdominal cavity for >3 h. Administration of 2',3'-cyclic adenosine monophosphate into the surgical field is a unique, convenient and effective method of preventing post-surgical adhesions by acting as an adenosine prodrug.
Automatic cassette to cassette radiant impulse processor
NASA Astrophysics Data System (ADS)
Sheets, Ronald E.
1985-01-01
Single wafer rapid annealing using high temperature isothermal processing has become increasingly popular in recent years. In addition to annealing, this process is also being investigated for suicide formation, passivation, glass reflow and alloying. Regardless of the application, there is a strong necessity to automate in order to maintain process control, repeatability, cleanliness and throughput. These requirements have been carefully addressed during the design and development of the Model 180 Radiant Impulse Processor which is a totally automatic cassette to cassette wafer processing system. Process control and repeatability are maintained by a closed loop optical pyrometer system which maintains the wafer at the programmed temperature-time conditions. Programmed recipes containing up to 10 steps may be easily entered on the computer keyboard or loaded in from a recipe library stored on a standard 5 {1}/{4″} floppy disk. Cold wall heating chamber construction, controlled environment (N 2, A, forming gas) and quartz wafer carriers prevent contamination of the wafer during high temperature processing. Throughputs of 150-240 wafers per hour are achieved by quickly heating the wafer to temperature (450-1400°C) in 3-6 s with a high intensity, uniform (± 1%) radiant flux of 100 {W}/{cm 2}, parallel wafer handling system and a wafer cool down stage.
Castella, Barbara; Kopecka, Joanna; Sciancalepore, Patrizia; Mandili, Giorgia; Foglietta, Myriam; Mitro, Nico; Caruso, Donatella; Novelli, Francesco; Riganti, Chiara; Massaia, Massimo
2017-01-01
Vγ9Vδ2 T cells are activated by phosphoantigens, such as isopentenyl pyrophosphate (IPP), which is generated in the mevalonate pathway of antigen-presenting cells. IPP is released in the extracellular microenvironment via unknown mechanisms. Here we show that the ATP-binding cassette transporter A1 (ABCA1) mediates extracellular IPP release from dendritic cells (DC) in cooperation with apolipoprotein A-I (apoA-I) and butyrophilin-3A1. IPP concentrations in the supernatants are sufficient to induce Vγ9Vδ2 T cell proliferation after DC mevalonate pathway inhibition with zoledronic acid (ZA). ZA treatment increases ABCA1 and apoA-I expression via IPP-dependent LXRα nuclear translocation and PI3K/Akt/mTOR pathway inhibition. These results close the mechanistic gap in our understanding of extracellular IPP release from DC and provide a framework to fine-tune Vγ9Vδ2 T cell activation via mevalonate and PI3K/Akt/mTOR pathway modulation. PMID:28580927
Tosaki, A; Hellegouarch, A
1994-02-01
This study was conducted to elucidate the role of the adenosine triphosphate (ATP)-sensitive potassium channel blocking agent glibenclamide and the opener cromakalim in the mechanism of reperfusion-induced injury. Recently, ATP-sensitive potassium channel openers have been proposed to reduce ischemia/reperfusion-induced injury, including arrhythmias and heart function. Thus, one might hypothesize that pharmacologic agents that enhance the loss of potassium ions in the myocardium through ATP-sensitive potassium channels would be arrhythmogenic, and agents that interfere with tissue potassium ion loss would be antiarrhythmic. Isolated "working" guinea pig hearts and phosphorus-31 nuclear magnetic resonance spectroscopy were used to study the recovery of myocardial function and phosphorus compounds after 30, 40 and 50 min of normothermic global ischemia followed by reperfusion in untreated control and glibenclamide- and cromakalim-treated groups. After 30 min of ischemia, 1, 3, 10 and 30 mumol/liter of glibenclamide dose-dependently reduced the incidence of reperfusion-induced ventricular fibrillation (total) from its control value of 92% to 75%, 33% (p < 0.05), 33% (p < 0.05) and 42% (p < 0.05), respectively. The incidence of ventricular tachycardia followed the same pattern. A reduction of arrhythmias was also observed after 40 and 50 min of ischemia followed by reperfusion in the glibenclamide-treated hearts. Cromakalim, at the same concentrations, did not reduce the incidence of reperfusion-induced arrhythmias. During reperfusion, glibenclamide (3 and 10 mumol/liter) improved the recovery of coronary blood flow, aortic flow, myocardial contractility and tissue ATP and creatine phosphate content, but cromakalim failed to ameliorate the recovery of postischemic myocardium compared with that in the drug-free control hearts. The preservation of myocardial potassium ions and phosphorus compounds by glibenclamide can improve the recovery of postischemic function, but
Yokosawa, Takumi; Enomoto, Ryota; Uchino, Sho; Hirasawa, Ito; Umehara, Takuya; Tamura, Koji
2017-12-01
Nucleotide polymerization occurs by the nucleophilic attack of 3'-oxygen of the 3'-terminal nucleotide on the α-phosphorus of the incoming nucleotide 5'-triphosphate. The π-stacking of mononucleotides is an important factor for prebiotic RNA polymerization in terms of attaining the proximity of two reacting moieties. Adenosine and adenosine 5'-monophosphate (AMP) are known to form hydrogel in the presence of cyanuric acid at neutral pH. However, we observed that other canonical ribonucleotides did not gel under the same condition. The π-stacking-induced hydrogel formation of AMP was destroyed at pH 2.0, suggesting that the protonation of N at position 1 of adenine abolished hydrogen bonding with the NH of cyanuric acid and resulted in the deformation of the hexad of adenine and cyanuric acid. A liquid-like gel was formed in the case of adenosine with cyanuric acid and boric acid, whereas AMP caused the formation of a solid gel, implying that the negative charge inherent to AMP prevented the formation of esters of boric acid with the cis-diols of ribose. Cyanuric acid-driven oligomerizations of AMP might have been the first crucial event in the foundation of the RNA world. Copyright © 2017 Elsevier B.V. All rights reserved.
NASA Technical Reports Server (NTRS)
Kelbaugh, B. N.; Picciolo, G. L.; Chappelle, E. W.; Colburn, M. E. (Inventor)
1973-01-01
An automated apparatus is reported for sequentially assaying urine samples for the presence of bacterial adenosine triphosphate (ATP) that comprises a rotary table which carries a plurality of sample containing vials and automatically dispenses fluid reagents into the vials preparatory to injecting a light producing luciferase-luciferin mixture into the samples. The device automatically measures the light produced in each urine sample by a bioluminescence reaction of the free bacterial adenosine triphosphate with the luciferase-luciferin mixture. The light measured is proportional to the concentration of bacterial adenosine triphosphate which, in turn, is proportional to the number of bacteria present in the respective urine sample.
Adenosine and Ischemic Preconditioning
Liang, Bruce T.; Swierkosz, Tomasz A.; Herrmann, Howard C.; Kimmel, Stephen; Jacobson, Kenneth A.
2012-01-01
Adenosine is released in large amounts during myocardial ischemia and is capable of exerting potent cardioprotective effects in the heart. Although these observations on adenosine have been known for a long time, how adenosine acts to achieve its anti-ischemic effect remains incompletely understood. However, recent advances on the chemistry and pharmacology of adenosine receptor ligands have provided important and novel information on the function of adenosine receptor subtypes in the cardiovascular system. The development of model systems for the cardiac actions of adenosine has yielded important insights into its mechanism of action and have begun to elucidate the sequence of signalling events from receptor activation to the actual exertion of its cardioprotective effect. The present review will focus on the adenosine receptors that mediate the potent anti-ischemic effect of adenosine, new ligands at the receptors, potential molecular signalling mechanisms downstream of the receptor, mediators for cardioprotection, and possible clinical applications in cardiovascular disorders. PMID:10607860
Lu, David; Insel, Paul A.
2013-01-01
The establishment of set points for cellular activities is essential in regulating homeostasis. Here, we demonstrate key determinants of the fibrogenic set point of cardiac fibroblasts (CFs) by focusing on the pro-fibrotic activity of ATP, which is released by CFs. We tested the hypothesis that the hydrolysis of extracellular ATP by ectonucleoside triphosphate diphosphohydrolases (ENTPDs) regulates pro-fibrotic nucleotide signaling. We detected two ENTPD isoforms, ENTPD-1 and -2, in adult rat ventricular CFs. Partial knockdown of ENTPD-1 and -2 with siRNA increased basal extracellular ATP concentration and enhanced the pro-fibrotic effect of ATP stimulation. Sodium polyoxotungstate-1, an ENTPD inhibitor, not only enhanced the pro-fibrotic effects of exogenously added ATP but also increased basal expression of α-smooth muscle actin, plasminogen activator inhibitor-1 and transforming growth factor (TGF)-β, collagen synthesis, and gel contraction. Furthermore, we found that adenosine, a product of ATP hydrolysis by ENTPD, acts via A2B receptors to counterbalance the pro-fibrotic response to ATP. Removal of extracellular adenosine or inhibition of A2B receptors enhanced pro-fibrotic ATP signaling. Together, these results demonstrate the contribution of basally released ATP in establishing the set point for fibrotic activity in adult rat CFs and identify a key role for the modulation of this activity by hydrolysis of released ATP by ENTPDs. These findings also imply that cellular homeostasis and fibrotic response involve the integration of signaling that is pro-fibrotic by ATP and anti-fibrotic by adenosine and that is regulated by ENTPDs. PMID:23677997
Murray, Jayne; Valli, Emanuele; Yu, Denise M T; Truong, Alan M; Gifford, Andrew J; Eden, Georgina L; Gamble, Laura D; Hanssen, Kimberley M; Flemming, Claudia L; Tan, Alvin; Tivnan, Amanda; Allan, Sophie; Saletta, Federica; Cheung, Leanna; Ruhle, Michelle; Schuetz, John D; Henderson, Michelle J; Byrne, Jennifer A; Norris, Murray D; Haber, Michelle; Fletcher, Jamie I
2017-09-01
The ATP-binding cassette transporter ABCC4 (multidrug resistance protein 4, MRP4) mRNA level is a strong predictor of poor clinical outcome in neuroblastoma which may relate to its export of endogenous signalling molecules and chemotherapeutic agents. We sought to determine whether ABCC4 contributes to development, growth and drug response in neuroblastoma in vivo. In neuroblastoma patients, high ABCC4 protein levels were associated with reduced overall survival. Inducible knockdown of ABCC4 strongly inhibited the growth of human neuroblastoma cells in vitro and impaired the growth of neuroblastoma xenografts. Loss of Abcc4 in the Th-MYCN transgenic neuroblastoma mouse model did not impact tumour formation; however, Abcc4-null neuroblastomas were strongly sensitised to the ABCC4 substrate drug irinotecan. Our findings demonstrate a role for ABCC4 in neuroblastoma cell proliferation and chemoresistance and provide rationale for a strategy where inhibition of ABCC4 should both attenuate the growth of neuroblastoma and sensitise tumours to ABCC4 chemotherapeutic substrates. Copyright © 2017 Elsevier Ltd. All rights reserved.
Knight, Brian L; Patel, Dilip D; Humphreys, Sandy M; Wiggins, David; Gibbons, Geoffrey F
2003-11-01
Dietary supplementation with the peroxisome proliferator-activated receptor alpha (PPAR alpha) ligand WY 14,643 gave rise to a 4- to 5-fold increase in the expression of mRNA for the ATP binding cassette transporter A1 (ABCA1) in the intestine of normal mice. There was no effect in the intestine of PPAR alpha-null mice. Consumption of a high-cholesterol diet also increased intestinal ABCA1 expression. The effects of WY 14,643 and the high-cholesterol diet were not additive. WY 14,643 feeding reduced intestinal absorption of cholesterol in the normal mice, irrespective of the dietary cholesterol concentration, and this resulted in lower diet-derived cholesterol and cholesteryl ester concentrations in plasma and liver. At each concentration of dietary cholesterol, there was a similar significant inverse correlation between intestinal ABCA1 mRNA content and the amount of cholesterol absorbed. The fibrate-induced changes in the intestines of the normal mice were accompanied by an increased concentration of the mRNA encoding the sterol-regulatory element binding protein-1c gene (SREBP-1c), a known target gene for the oxysterol receptor liver X receptor alpha (LXR alpha). There was a correlation between intestinal ABCA1 mRNA and SREBP-1c mRNA contents, but not between SREBP-1c mRNA content and cholesterol absorption. These results suggest that PPAR alpha influences cholesterol absorption through modulating ABCA1 activity in the intestine by a mechanism involving LXR alpha.
Stewart, Teneale A; Azimi, Iman; Thompson, Erik W; Roberts-Thomson, Sarah J; Monteith, Gregory R
2015-03-13
Epithelial-mesenchymal transition (EMT), a process implicated in cancer metastasis, is associated with the transcriptional regulation of members of the ATP-binding cassette superfamily of efflux pumps, and drug resistance in breast cancer cells. Epidermal growth factor (EGF)-induced EMT in MDA-MB-468 breast cancer cells is calcium signal dependent. In this study induction of EMT was shown to result in the transcriptional up-regulation of ATP-binding cassette, subfamily C, member 3 (ABCC3), a member of the ABC transporter superfamily, which has a recognized role in multidrug resistance. Buffering of cytosolic free calcium inhibited EGF-mediated ABCC3 increases, indicating a calcium-dependent mode of regulation. Silencing of TRPM7 (an ion channel involved in EMT associated vimentin induction) did not inhibit ABCC3 up-regulation. Silencing of the store operated calcium entry (SOCE) pathway components ORAI1 and STIM1 also did not alter ABCC3 induction by EGF. However, the calcium permeable ion channel transient receptor potential cation channel, subfamily C, member 1 (TRPC1) appears to contribute to the regulation of both basal and EGF-induced ABCC3 mRNA. Improved understanding of the relationship between calcium signaling, EMT and the regulation of genes important in therapeutic resistance may help identify novel therapeutic targets for breast cancer. Copyright © 2015 Elsevier Inc. All rights reserved.
Guranowski, A; Starzyńska, E; Brown, P; Blackburn, G M
1997-01-01
Adenosine 5'-tetraphosphate phosphohydrolase (EC 3.6.1.14) has been purified to homogeneity from the meal of yellow lupin (Lupinus luteus) seeds. The enzyme is a single polypeptide chain of 25+/-1 kDa. It catalyses the hydrolysis of a nucleoside 5'-tetraphosphate to a nucleoside triphosphate and orthophosphate, and hydrolysis of tripolyphosphate but neither pyrophosphate nor tetraphosphate. A divalent cation, Mg2+, Co2+, Ni2+ or Mn2+, is required for these reactions. The pH optimum for hydrolysis of adenosine 5'-tetraphosphate (p4A) is 8.2, Vmax is 21+/-1.7 micromol/min per mg of protein and the Km for p4A is 3+/-0.6 microM. At saturating p4A concentrations, the rate constant for the reaction is 8.5+/-0.7 s-1 [at 30 degrees C, in 50 mM Hepes/KOH (pH8.2)/5 mM MgCl2/0.1 mM dithiothreitol]. p4A and guanosine 5'-tetraphosphate are hydrolysed at the same rate. Adenosine 5'-pentaphosphate (p5A) is degraded 1/200 as fast and is converted into ATP and two molecules of orthophosphate, which are liberated sequentially. This contrasts with the cleavage of p5A by the lupin diadenosine tetraphosphate hydrolase (EC 3.6.1.17), which gives ATP and pyrophosphate. Zn2+, F- and Ca2+ ions inhibit the hydrolysis of p4A with I50 values of 0.1, 0.12 and 0.2 mM respectively. PMID:9359862
Dintner, Sebastian; Heermann, Ralf; Fang, Chong; Jung, Kirsten; Gebhard, Susanne
2014-01-01
Resistance against antimicrobial peptides in many Firmicutes bacteria is mediated by detoxification systems that are composed of a two-component regulatory system (TCS) and an ATP-binding cassette (ABC) transporter. The histidine kinases of these systems depend entirely on the transporter for sensing of antimicrobial peptides, suggesting a novel mode of signal transduction where the transporter constitutes the actual sensor. The aim of this study was to investigate the molecular mechanisms of this unusual signaling pathway in more detail, using the bacitracin resistance system BceRS-BceAB of Bacillus subtilis as an example. To analyze the proposed communication between TCS and the ABC transporter, we characterized their interactions by bacterial two-hybrid analyses and could show that the permease BceB and the histidine kinase BceS interact directly. In vitro pulldown assays confirmed this interaction, which was found to be independent of bacitracin. Because it was unknown whether BceAB-type transporters could detect their substrate peptides directly or instead recognized the peptide-target complex in the cell envelope, we next analyzed substrate binding by the transport permease, BceB. Direct and specific binding of bacitracin by BceB was demonstrated by surface plasmon resonance spectroscopy. Finally, in vitro signal transduction assays indicated that complex formation with the transporter influenced the autophosphorylation activity of the histidine kinase. Taken together, our findings clearly show the existence of a sensory complex composed of TCS and ABC transporters and provide the first functional insights into the mechanisms of stimulus perception, signal transduction, and antimicrobial resistance employed by Bce-like detoxification systems. PMID:25118291
Torque Generation Mechanism of F1-ATPase upon NTP Binding
Arai, Hidenobu C.; Yukawa, Ayako; Iwatate, Ryu John; Kamiya, Mako; Watanabe, Rikiya; Urano, Yasuteru; Noji, Hiroyuki
2014-01-01
Molecular machines fueled by NTP play pivotal roles in a wide range of cellular activities. One common feature among NTP-driven molecular machines is that NTP binding is a major force-generating step among the elementary reaction steps comprising NTP hydrolysis. To understand the mechanism in detail,in this study, we conducted a single-molecule rotation assay of the ATP-driven rotary motor protein F1-ATPase using uridine triphosphate (UTP) and a base-free nucleotide (ribose triphosphate) to investigate the impact of a pyrimidine base or base depletion on kinetics and force generation. Although the binding rates of UTP and ribose triphosphate were 103 and 106 times, respectively, slower than that of ATP, they supported rotation, generating torque comparable to that generated by ATP. Affinity change of F1 to UTP coupled with rotation was determined, and the results again were comparable to those for ATP, suggesting that F1 exerts torque upon the affinity change to UTP via rotation similar to ATP-driven rotation. Thus, the adenine-ring significantly enhances the binding rate, although it is not directly involved in force generation. Taking into account the findings from another study on F1 with mutated phosphate-binding residues, it was proposed that progressive bond formation between the phosphate region and catalytic residues is responsible for the rotation-coupled change in affinity. PMID:24988350
Tsujimura, Shizuyo; Saito, Kazuyoshi; Nakayamada, Shingo; Tanaka, Yoshiya
2010-04-01
P-glycoprotein (P-gp) on activated lymphocytes is an adenosine triphosphate (ATP)-binding cassette transporter that causes drug resistance by exclusion of intracellular drugs in patients with active rheumatoid arthritis (RA). However, infliximab with methotrexate (MTX) can overcome P-gp-mediated drug resistance. We encounter patients who cannot continue infliximab or MTX. Here we tested how etanercept affected P-gp-mediated drug resistance in such intractable RA patients. Peripheral lymphocytes of 11 RA patients (3 switched from infliximab and 8 who could not be treated with MTX) were analyzed for P-gp expression by flow cytometry and for drug exclusion using radioisotope-labeled dexamethasone. Activated lymphocytes of RA patients overexpressed P-gp and coexpressed CD69. Incubation of these lymphocytes with dexamethasone in vitro reduced intracellular dexamethasone levels. Two-week etanercept therapy significantly reduced P-gp expression and eliminated such P-gp- and CD69-high-expressing subgroup. The reduction in P-gp resulted in recovery of intracellular dexamethasone levels in lymphocytes and improvement of disease activity, thus allowing tapering of corticosteroids. None of the patients experienced any severe adverse effects. Etanercept is useful for overcoming P-gp-mediated treatment resistance in intractable RA patients who have to discontinue infliximab or are intolerant to MTX.
Synonymous ABCA3 Variants Do Not Increase Risk for Neonatal Respiratory Distress Syndrome
Wambach, Jennifer A.; Wegner, Daniel J.; Heins, Hillary B.; Druley, Todd E.; Mitra, Robi D.; Hamvas, Aaron; Cole, F. Sessions
2014-01-01
Objective To determine whether synonymous variants in the adenosine triphosphate-binding cassette A3 transporter (ABCA3) gene increase the risk for neonatal respiratory distress syndrome (RDS) in term and late preterm infants of European and African descent. Study design Using next-generation pooled sequencing of race-stratified DNA samples from infants of European and African descent at $34 weeks gestation with and without RDS (n = 503), we scanned all exons of ABCA3, validated each synonymous variant with an independent genotyping platform, and evaluated race-stratified disease risk associated with common synonymous variants and collapsed frequencies of rare synonymous variants. Results The synonymous ABCA3 variant frequency spectrum differs between infants of European descent and those of African descent. Using in silico prediction programs and statistical strategies, we found no potentially disruptive synonymous ABCA3 variants or evidence of selection pressure. Individual common synonymous variants and collapsed frequencies of rare synonymous variants did not increase disease risk in term and late-preterm infants of European or African descent. Conclusion In contrast to rare, nonsynonymous ABCA3 mutations, synonymous ABCA3 variants do not increase the risk for neonatal RDS among term and late-preterm infants of European or African descent. PMID:24657120
Morimura, Shigeru; Suzuki, Katsuo; Takahashi, Kazuhide
2011-01-21
Investigation of the mechanism underlying cell membrane-targeted WAVE2 capture by phosphatidylinositol 3,4,5-triphosphate (PIP(3)) through IRSp53 revealed an unidentified 250-kDa protein (p250) bound to PIP(3). We identified p250 as nonmuscle myosin IIA heavy chain (MYH9) by mass spectrometry and immunoblot analysis using anti-MYH9 antibody. After stimulation with insulin-like growth factor I (IGF-I), MYH9 colocalized with PIP(3) in lamellipodia at the leading edge of cells. Depletion of MYH9 expression by small interfering RNA (siRNA) and inhibition of myosin II activity by blebbistatin abrogated the formation of actin filament (F-actin) arcs and lamellipodia induced by IGF-I. MYH9 was constitutively associated with WAVE2, which was dependent on myosin II activity, and the MYH9-WAVE2 complex colocalized to PIP(3) at the leading edge after IGF-I stimulation. These results indicate that MYH9 is required for lamellipodia formation since it provides contractile forces and tension for the F-actin network to form convex arcs at the leading edge through constitutive binding to WAVE2 and colocalization with PIP(3) in response to IGF-I. Copyright © 2010 Elsevier Inc. All rights reserved.
Adenosine and the Auditory System
Vlajkovic, Srdjan M; Housley, Gary D; Thorne, Peter R
2009-01-01
Adenosine is a signalling molecule that modulates cellular activity in the central nervous system and peripheral organs via four G protein-coupled receptors designated A1, A2A, A2B, and A3. This review surveys the literature on the role of adenosine in auditory function, particularly cochlear function and its protection from oxidative stress. The specific tissue distribution of adenosine receptors in the mammalian cochlea implicates adenosine signalling in sensory transduction and auditory neurotransmission although functional studies have demonstrated that adenosine stimulates cochlear blood flow, but does not alter the resting and sound-evoked auditory potentials. An interest in a potential otoprotective role for adenosine has recently evolved, fuelled by the capacity of A1 adenosine receptors to prevent cochlear injury caused by acoustic trauma and ototoxic drugs. The balance between A1 and A2A receptors is conceived as critical for cochlear response to oxidative stress, which is an underlying mechanism of the most common inner ear pathologies (e.g. noise-induced and age-related hearing loss, drug ototoxicity). Enzymes involved in adenosine metabolism, adenosine kinase and adenosine deaminase, are also emerging as attractive targets for controlling oxidative stress in the cochlea. Other possible targets include ectonucleotidases that generate adenosine from extracellular ATP, and nucleoside transporters, which regulate adenosine concentrations on both sides of the plasma membrane. Developments of selective adenosine receptor agonists and antagonists that can cross the blood-cochlea barrier are bolstering efforts to develop therapeutic interventions aimed at ameliorating cochlear injury. Manipulations of the adenosine signalling system thus hold significant promise in the therapeutic management of oxidative stress in the cochlea. PMID:20190966
Cassette Tape Catalog: 1980/1981 Unabridged Supplement.
ERIC Educational Resources Information Center
American Child Care Services, Hampton, VA.
This unabridged supplement to the Child Care Information Center's tape cassette catalog contains a listing of all recordings made in calendar years 1980 and 1981. This document plus "The Revised 1976 Cassette Tape Catalog,""The 1977 Addendum," and "The 1978/1979 Unabridged Supplement" together provide a complete listing of the 1,776 tape…
NASA Technical Reports Server (NTRS)
Kirby, Christopher R.; Woodman, Christopher R.; Woolridge, Dale; Tischler, Marc E.
1992-01-01
Unweighting, but not denervation, of muscle reportedly "spares" insulin receptors, increasing insulin sensitivity. Unweighting also increases beta-adrenergic responses of carbohydrate metabolism. These differential characteristics were studied further by comparing cyclic adenosine monophosphate (cAMP) accumulation and beta-adrenergic binding in normal and 3-day unweighted or denervated soleus muscle. Submaximal amounts of isoproterenol, a p-agonist, increased cAMP accumulation in vitro and in vivo (by intramuscular (IM) injection) to a greater degree (P less than .05) in unweighted muscles. Forskolin or maximal isoproterenol had similar in vitro effects in all muscles, suggesting increased beta-adrenergic sensitivity following unweighting. Increased sensitivity was confirmed by a greater receptor density (B(sub max)) for iodo-125(-)-pindolol in particulate preparations of unweighted (420 x 10(exp -18) mol/mg muscle) than of control or denervated muscles (285 x 10(exp-18) mol/mg muscle). The three dissociation constant (Kd) values were similar (20.3 to 25.8 pmol/L). Total binding capacity (11.4 fmol/muscle) did not change during 3 days of unweighting, but diminished by 30% with denervation. This result illustrates the "sparing" and loss of receptors, respectively, in these two atrophy models. In diabetic animals, IM injection of insulin diminished CAMP accumulation in the presence of theophylline in unweighted muscle (-66% +/- 2%) more than in controls (-42% +'- 6%, P less than .001). These results show that insulin affects CAMP formation in muscle, and support a greater in vivo insulin response following unweighting atrophy. These various data support a role for lysosomal proteolysis in denervation, but not in unweighting, atrophy.
Wang, Dongdong; Tosevska, Anela; Heiß, Elke H; Ladurner, Angela; Mölzer, Christine; Wallner, Marlies; Bulmer, Andrew; Wagner, Karl-Heinz; Dirsch, Verena M; Atanasov, Atanas G
2017-04-28
Mild but chronically elevated circulating unconjugated bilirubin is associated with reduced total and low-density lipoprotein cholesterol concentration, which is associated with reduced cardiovascular disease risk. We aimed to investigate whether unconjugated bilirubin influences macrophage cholesterol efflux, as a potential mechanism for the altered circulating lipoprotein concentrations observed in hyperbilirubinemic individuals. Cholesterol efflux from THP-1 macrophages was assessed using plasma obtained from normo- and hyperbilirubinemic (Gilbert syndrome) humans (n=60 per group) or (heterozygote/homozygote Gunn) rats (n=20 per group) as an acceptor. Hyperbilirubinemic plasma from patients with Gilbert syndrome and Gunn rats induced significantly reduced cholesterol efflux compared with normobilirubinemic plasma. Unconjugated bilirubin (3-17.1 μmol/L) exogenously added to plasma- or apolipoprotein A1-supplemented media also decreased macrophage cholesterol efflux in a concentration- and time-dependent manner. We also showed reduced protein expression of the ATP-binding cassette transporter A1 (ABCA1), a transmembrane cholesterol transporter involved in apolipoprotein A1-mediated cholesterol efflux, in THP-1 macrophages treated with unconjugated bilirubin and in peripheral blood mononuclear cells obtained from hyperbilirubinemic individuals. Furthermore, we demonstrated that bilirubin accelerates the degradation rate of the ABCA1 protein in THP-1 macrophages. Cholesterol efflux from THP-1 macrophages is decreased in the presence of plasma obtained from humans and rats with mild hyperbilirubinemia. A direct effect of unconjugated bilirubin on cholesterol efflux was demonstrated and is associated with decreased ABCA1 protein expression. These data improve our knowledge concerning bilirubin's impact on cholesterol transport and represent an important advancement in our understanding of bilirubin's role in cardiovascular disease. © 2017 The Authors. Published on
Lu, Y P; Li, Z S; Rea, P A
1997-07-22
Because plants produce cytotoxic compounds to which they, themselves, are susceptible and are exposed to exogenous toxins (microbial products, allelochemicals, and agrochemicals), cell survival is contingent on mechanisms for detoxifying these agents. One detoxification mechanism is the glutathione S-transferase-catalyzed glutathionation of the toxin, or an activated derivative, and transport of the conjugate out of the cytosol. We show here that a transporter responsible for the removal of glutathione S-conjugates from the cytosol, a specific Mg2+-ATPase, is encoded by the AtMRP1 gene of Arabidopsis thaliana. The sequence of AtMRP1 and the transport capabilities of membranes prepared from yeast cells transformed with plasmid-borne AtMRP1 demonstrate that this gene encodes an ATP-binding cassette transporter competent in the transport of glutathione S-conjugates of xenobiotics and endogenous substances, including herbicides and anthocyanins.
Mitochondrial deoxyribonucleoside triphosphate pools in thymidine kinase 2 deficiency.
Saada, Ann; Ben-Shalom, Efrat; Zyslin, Rivka; Miller, Chaya; Mandel, Hanna; Elpeleg, Orly
2003-10-24
Deficiency of mitochondrial thymidine kinase (TK2) is associated with mitochondrial DNA (mtDNA) depletion and manifests by severe skeletal myopathy in infancy. In order to elucidate the pathophysiology of this condition, mitochondrial deoxyribonucleoside triphosphate (dNTP) pools were determined in patients' fibroblasts. Despite normal mtDNA content and cytochrome c oxidase (COX) activity, mitochondrial dNTP pools were imbalanced. Specifically, deoxythymidine triphosphate (dTTP) content was markedly decreased, resulting in reduced dTTP:deoxycytidine triphosphate ratio. These findings underline the importance of balanced mitochondrial dNTP pools for mtDNA synthesis and may serve as the basis for future therapeutic interventions.
Matos, R; Cordeiro, J M; Coelho, A; Ferreira, S; Silva, C; Igawa, Y; Cruz, F; Charrua, A
2016-12-01
Pathophysiological mechanisms of chronic visceral pain (CVP) are unknown. This study explores the association between the sympathetic system and bladder nociceptors activity by testing the effect of a prolonged adrenergic stimulation on transient receptor potential vanilloid 1 (TRPV1) activity and on urothelial adenosine triphosphate (ATP) release. Female Wistar rats received saline, phenylephrine (PHE), PHE + silodosin, PHE + naftopidil or PHE + prazosin. TRPV1 knockout and wild-type mice received saline or PHE. Visceral pain behaviour tests were performed before and after treatment. Cystometry was performed, during saline and capsaicin infusion. Fos immunoreactivity was assessed in L6 spinal cord segment. Human urothelial ATP release induced by mechanical and thermal stimulation was evaluated. Subcutaneous, but not intrathecal, PHE administration induced pain, which was reversed by silodosin, a selective alpha 1A adrenoceptor antagonist, but not by naftopidil, a relatively selective antagonist for alpha 1D adrenoceptor. Silodosin also reversed PHE-induced bladder hyperactivity and L6 spinal cord Fos expression. Thus, in subsequent experiments, only silodosin was used. Wild-type, but not TRPV1 knockout, mice exhibited phenylephrine-induced pain. Capsaicin induced a greater increase in voiding contractions in PHE-treated rats than in control animals, and silodosin reversed this effect. When treated with PHE, ATP release from human urothelial cells was enhanced either by mechanical stimulation or by lowering the thermal threshold of urothelial TRPV1, which becomes abnormally responsive at body temperature. This study suggests that the activation of peripheral alpha 1A adrenoceptors induces CVP, probably through its interaction with TRPV1 and ATP release. © 2016 Scandinavian Physiological Society. Published by John Wiley & Sons Ltd.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jaakola, Veli-Pekka; Griffith, Mark T.; Hanson, Michael A.
2009-01-15
The adenosine class of heterotrimeric guanine nucleotide-binding protein (G protein)-coupled receptors (GPCRs) mediates the important role of extracellular adenosine in many physiological processes and is antagonized by caffeine. We have determined the crystal structure of the human A{sub 2A} adenosine receptor, in complex with a high-affinity subtype-selective antagonist, ZM241385, to 2.6 angstrom resolution. Four disulfide bridges in the extracellular domain, combined with a subtle repacking of the transmembrane helices relative to the adrenergic and rhodopsin receptor structures, define a pocket distinct from that of other structurally determined GPCRs. The arrangement allows for the binding of the antagonist in an extendedmore » conformation, perpendicular to the membrane plane. The binding site highlights an integral role for the extracellular loops, together with the helical core, in ligand recognition by this class of GPCRs and suggests a role for ZM241385 in restricting the movement of a tryptophan residue important in the activation mechanism of the class A receptors.« less
Chronic hypoxia up-regulates expression of adenosine A1 receptors in DDT1-MF2 cells.
Hammond, Lucy C; Bonnet, Claire; Kemp, Paul J; Yates, Michael S; Bowmer, Christopher J
2004-02-01
As the first step to understand how chronic hypoxia might regulate smooth muscle function in health and disease, we have employed an established immortalised cell model of smooth muscle, DDT1-MF2 cells, to address the hypothesis that adenosine A1 receptor density is modulated by O2 availability. Maximal specific binding (Bmax) of the selective adenosine A1 receptor antagonist, [3H]-DPCPX, to cell membranes increased 3.5-fold from 0.48 +/- 0.02 pmol/mg to 1.7 +/- 0.5 pmol/mg protein after 16 hr of hypoxia and this effect was not accompanied by any statistically significant changes in either binding affinity (0.84 +/- 0.2 nM vs. 1.2 +/- 0.3 nM) or Hill coefficient (1.1 +/- 0.1 vs. 0.99 +/- 0.03). Hypoxia-evoked increases in membrane receptor density were paralleled in intact DDT1-MF2 cells. In addition, the increase in [3H]-DPCPX binding to intact cells was inhibited by co-incubation during hypoxia with the translational inhibitor cycloheximide, the transcriptional blocker actinomycin D and the NFkappaB inhibitor sulphasalazine. Together, these data show that adenosine A1 receptor density is modulated, at least in part, by O2-dependent activation of the transcription factor NFkappaB and adds to the list of processes dynamically regulated by ambient oxygen availability. Since hypoxia is an initiating factor in acute renal failure, similar changes in transcription may account for up-regulation of adenosine A1 receptors noted previously in the renal vasculature of rats with acute renal failure.
Miniaturized technology for DNA typing: cassette PCR.
Manage, Dammika P; Pilarski, Linda M
2015-01-01
With the smaller size, low cost, and rapid testing capabilities, miniaturized lab-on-a-chip devices can change the way medical diagnostics are currently performed in the health-care system. We have demonstrated such a device that is self-contained, simple, disposable, and inexpensive. It is capable of performing DNA amplification on an inexpensive instrument suitable for near point of care settings. This technology will enable on the spot evaluation of patients in the clinic for faster medical decision-making and more informed therapeutic choices. Our device, a gel capillary cassette, termed cassette PCR, contains capillary reaction units each holding a defined primer set, with arrays of capillary reaction units for simultaneously detecting multiple targets. With the exception of the sample to be tested, each capillary reaction unit holds all the reagents needed for PCR in a desiccated form that can be stored at room temperature for up to 3 months and even longer in colder conditions. It relies on capillary forces for sample delivery of microliter volumes through capillaries, hence avoiding the need for pumps or valves. In the assembled cassette, the wax architecture supporting the capillaries melts during the PCR and acts as a vapor barrier as well as segregating capillaries with different primer sets. No other chip sealing techniques are required. Cassette PCR accepts raw samples such as urine, genital swabs, and blood. The cassette is made with off-the-shelf components and contains integrated positive and negative controls.
Zamanian-Daryoush, Maryam; Lindner, Daniel J.; DiDonato, Joseph A.; Wagner, Matthew; Buffa, Jennifer; Rayman, Patricia; Parks, John S.; Westerterp, Marit; Tall, Alan R.; Hazen, Stanley L.
2017-01-01
Increased circulating levels of apolipoprotein A-I (apoA-I), the major protein of high-density lipoprotein (HDL), by genetic manipulation or infusion, protects against melanoma growth and metastasis. Herein, we explored potential roles in melanoma tumorigenesis for host scavenger receptor class B, type 1 (SR-B1), and ATP-binding cassette transporters A1 (ABCA1) and G1 (ABCG1), all mediators of apoA-I and HDL sterol and lipid transport function. In a syngeneic murine melanoma tumor model, B16F10, mice with global deletion of SR-B1 expression exhibited increased plasma HDL cholesterol (HDLc) levels and decreased tumor volume, indicating host SR-B1 does not directly contribute to HDL-associated anti-tumor activity. In mice with myeloid-specific loss of ABCA1 (Abca1−M/−M; A1−M/−M), tumor growth was inhibited by ∼4.8-fold relative to wild type (WT) animals. Abcg1−M/−M (G1−M/−M) animals were also protected by 2.5-fold relative to WT, with no further inhibition of tumor growth in Abca1/Abcg1 myeloid-specific double knockout animals (DKO). Analyses of tumor-infiltrating immune cells revealed a correlation between tumor protection and decreased presence of the immune suppressive myeloid-derived suppressor cell (MDSC) subsets, Ly-6G+Ly-6CLo and Ly-6GnegLy-6CHi cells. The growth of the syngeneic MB49 murine bladder cancer cells was also inhibited in A1−M/−M mice. Collectively, our studies provide further evidence for an immune modulatory role for cholesterol homeostasis pathways in cancer. PMID:29069761
Nield, Blair S.; Willows, Robert D.; Torda, Andrew E.; Gillings, Michael R.; Holmes, Andrew J.; Nevalainen, K.M. Helena; Stokes, H.W.; Mabbutt, Bridget C.
2004-01-01
By targeting gene cassettes by polymerase chain reaction (PCR) directly from environmentally derived DNA, we are able to amplify entire open reading frames (ORFs) independently of prior sequence knowledge. Approximately 10% of the mobile genes recovered by these means can be attributed to known protein families. Here we describe the characterization of two ORFs which show moderate homology to known proteins: (1) an aminoglycoside phosphotransferase displaying 25% sequence identity with APH(7″) from Streptomyces hygroscopicus, and (2) an RNA methyltransferase sharing 25%–28% identity with a group of recently defined bacterial RNA methyltransferases distinct from the SpoU enzyme family. Our novel genes were expressed as recombinant products and assayed for appropriate enzyme activity. The aminoglycoside phosphotransferase displayed ATPase activity, consistent with the presence of characteristic Mg2+-binding residues. Unlike related APH(4) or APH(7″) enzymes, however, this activity was not enhanced by hygromycin B or kanamycin, suggesting the normal substrate to be a different aminoglycoside. The RNA methyltransferase contains sequence motifs of the RNA methyltransferase superfamily, and our recombinant version showed methyltransferase activity with RNA. Our data confirm that gene cassettes present in the environment encode folded enzymes with novel sequence variation and demonstrable catalytic activity. Our PCR approach (cassette PCR) may be used to identify a diverse range of ORFs from any environmental sample, as well as to directly access the gene pool found in mobile gene cassettes commonly associated with integrons. This gene pool can be accessed from both cultured and uncultured microbial samples as a source of new enzymes and proteins. PMID:15152095
Nield, Blair S; Willows, Robert D; Torda, Andrew E; Gillings, Michael R; Holmes, Andrew J; Nevalainen, K M Helena; Stokes, H W; Mabbutt, Bridget C
2004-06-01
By targeting gene cassettes by polymerase chain reaction (PCR) directly from environmentally derived DNA, we are able to amplify entire open reading frames (ORFs) independently of prior sequence knowledge. Approximately 10% of the mobile genes recovered by these means can be attributed to known protein families. Here we describe the characterization of two ORFs which show moderate homology to known proteins: (1) an aminoglycoside phosphotransferase displaying 25% sequence identity with APH(7") from Streptomyces hygroscopicus, and (2) an RNA methyltransferase sharing 25%-28% identity with a group of recently defined bacterial RNA methyltransferases distinct from the SpoU enzyme family. Our novel genes were expressed as recombinant products and assayed for appropriate enzyme activity. The aminoglycoside phosphotransferase displayed ATPase activity, consistent with the presence of characteristic Mg(2+)-binding residues. Unlike related APH(4) or APH(7") enzymes, however, this activity was not enhanced by hygromycin B or kanamycin, suggesting the normal substrate to be a different aminoglycoside. The RNA methyltransferase contains sequence motifs of the RNA methyltransferase superfamily, and our recombinant version showed methyltransferase activity with RNA. Our data confirm that gene cassettes present in the environment encode folded enzymes with novel sequence variation and demonstrable catalytic activity. Our PCR approach (cassette PCR) may be used to identify a diverse range of ORFs from any environmental sample, as well as to directly access the gene pool found in mobile gene cassettes commonly associated with integrons. This gene pool can be accessed from both cultured and uncultured microbial samples as a source of new enzymes and proteins.
Thorneley, R N; Cornish-Bowden, A
1977-01-01
The effects of MgADP and MgATP on the kinetics of a pre-steady-state electron-transfer reaction and on the steady-state kinetics of H2 evulution for nitrogenase proteins of K. pneumoniae were studied. MgADP was a competitive inhibitor of MgATP in the MgATP-induced electron transfer from the Fe-protein to the Mo-Fe-protein. A dissociation constant K'i = 20 micron was determined for MgADP. The release of MgADP or a coupled conformation change in the Fe-protein of K.pneumoniae occurred with a rate comparable with that of electron transfer, k approximately 2 X 10(2)S-1. Neither homotropic nor heterotropic interactions involving MgATP and MgADP were observed for this reaction. Steady-state kinetic data for H2 evolution exhibited heterotropic effects between MgADP and MgATP. The data have been fitted to symmetry and sequential-type models involving conformation changes in two identical subunits. The data suggest that the enzyme can bind up to molecules of either MgATP or MgADP, but is unable to bind both nucleotides simultaneously. The control of H2 evolution by the MgATP/MgADP ratio is not at the level of electron transfer between the Fe- and Mo-Fe-proteins. Images Fig. 2. PMID:336036
Wagmann, Lea; Maurer, Hans H; Meyer, Markus R
2017-10-27
Interactions with the human breast cancer resistance protein (hBCRP) significantly influence the pharmacokinetic properties of a drug and can even lead to drug-drug interactions. As efflux pump from the ABC superfamily, hBCRP utilized energy gained by adenosine 5'-triphosphate (ATP) hydrolysis for the transmembrane movement of its substrates, while adenosine 5'-diphosphate (ADP) and inorganic phosphate were released. The ADP liberation can be used to detect interactions with the hBCRP ATPase. An ADP quantification method based on hydrophilic interaction liquid chromatography (HILIC) coupled to high resolution tandem mass spectrometry (HR-MS/MS) was developed and successfully validated in accordance to the criteria of the guideline on bioanalytical method validation by the European Medicines Agency. ATP and adenosine 5'-monophosphate were qualitatively included to prevent interferences. Furthermore, a setup consisting of six sample sets was evolved that allowed detection of hBCRP substrate or inhibitor properties of the test compound. The hBCRP substrate sulfasalazine and the hBCRP inhibitor orthovanadate were used as controls. To prove the applicability of the procedure, the effect of amprenavir, indinavir, nelfinavir, ritonavir, and saquinavir on the hBCRP ATPase activity was tested. Nelfinavir, ritonavir, and saquinavir were identified as hBCRP ATPase inhibitors and none of the five HIV protease inhibitors turned out to be an hBCRP substrate. These findings were in line with a pervious publication. Copyright © 2017 Elsevier B.V. All rights reserved.
Dintner, Sebastian; Heermann, Ralf; Fang, Chong; Jung, Kirsten; Gebhard, Susanne
2014-10-03
Resistance against antimicrobial peptides in many Firmicutes bacteria is mediated by detoxification systems that are composed of a two-component regulatory system (TCS) and an ATP-binding cassette (ABC) transporter. The histidine kinases of these systems depend entirely on the transporter for sensing of antimicrobial peptides, suggesting a novel mode of signal transduction where the transporter constitutes the actual sensor. The aim of this study was to investigate the molecular mechanisms of this unusual signaling pathway in more detail, using the bacitracin resistance system BceRS-BceAB of Bacillus subtilis as an example. To analyze the proposed communication between TCS and the ABC transporter, we characterized their interactions by bacterial two-hybrid analyses and could show that the permease BceB and the histidine kinase BceS interact directly. In vitro pulldown assays confirmed this interaction, which was found to be independent of bacitracin. Because it was unknown whether BceAB-type transporters could detect their substrate peptides directly or instead recognized the peptide-target complex in the cell envelope, we next analyzed substrate binding by the transport permease, BceB. Direct and specific binding of bacitracin by BceB was demonstrated by surface plasmon resonance spectroscopy. Finally, in vitro signal transduction assays indicated that complex formation with the transporter influenced the autophosphorylation activity of the histidine kinase. Taken together, our findings clearly show the existence of a sensory complex composed of TCS and ABC transporters and provide the first functional insights into the mechanisms of stimulus perception, signal transduction, and antimicrobial resistance employed by Bce-like detoxification systems. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Tosh, Dilip K; Janowsky, Aaron; Eshleman, Amy J; Warnick, Eugene; Gao, Zhan-Guo; Chen, Zhoumou; Gizewski, Elizabeth; Auchampach, John A; Salvemini, Daniela; Jacobson, Kenneth A
2017-04-13
We have repurposed (N)-methanocarba adenosine derivatives (A 3 adenosine receptor (AR) agonists) to enhance radioligand binding allosterically at the human dopamine (DA) transporter (DAT) and inhibit DA uptake. We extended the structure-activity relationship of this series with small N 6 -alkyl substitution, 5'-esters, deaza modifications of adenine, and ribose restored in place of methanocarba. C2-(5-Halothien-2-yl)-ethynyl 5'-methyl 9 (MRS7292) and 5'-ethyl 10 (MRS7232) esters enhanced binding at DAT (EC 50 ∼ 35 nM) and at the norepinephrine transporter (NET). 9 and 10 were selective for DAT compared to A 3 AR in the mouse but not in humans. At DAT, the binding of two structurally dissimilar radioligands was enhanced; NET binding of only one radioligand was enhanced; SERT radioligand binding was minimally affected. 10 was more potent than cocaine at inhibiting DA uptake (IC 50 = 107 nM). Ribose analogues were weaker in DAT interaction than the corresponding bicyclics. Thus, we enhanced the neurotransmitter transporter activity of rigid nucleosides while reducing A 3 AR affinity.
Koh, Eun-Ik; Hung, Chia S.
2016-01-01
The Yersinia high-pathogenicity island (HPI) is common to multiple virulence strategies used by Escherichia coli strains associated with urinary tract infection (UTI). Among the genes in this island are ybtP and ybtQ, encoding distinctive ATP binding cassette (ABC) proteins associated with iron(III)-yersiniabactin import in Yersinia pestis. In this study, we compared the impact of ybtPQ on a model E. coli cystitis strain during in vitro culture and experimental murine infections. A ybtPQ-null mutant exhibited no growth defect under standard culture conditions, consistent with nonessentiality in this background. A growth defect phenotype was observed and genetically complemented in vitro during iron(III)-yersiniabactin-dependent growth. Following inoculation into the bladders of C3H/HEN and C3H/HeOuJ mice, this strain exhibited a profound, 106-fold competitive infection defect in the subgroup of mice that progressed to high-titer bladder infections. These results identify a virulence role for YbtPQ in the highly inflammatory microenvironment characteristic of high-titer cystitis. The profound competitive defect may relate to the apparent selection of Yersinia HPI-positive E. coli in uncomplicated clinical UTIs. PMID:26883590
Sankaranarayanan, Mugesh; Somasundar, Ashok; Seol, Eunhee; Chauhan, Ashish Singh; Kwon, Seongjin; Jung, Gyoo Yeol; Park, Sunghoon
2017-10-10
Biological 3-hydroxypropionic acid (3-HP) production from glycerol is a two-step reaction catalyzed by glycerol dehydratase (GDHt) and aldehyde dehydrogenase (ALDH). Recombinant strains developed for 3-HP production often suffer from the accumulation of a toxic intermediate, 3-hydroxypropionaldehyde (3-HPA). In order to avoid 3-HPA accumulation, balancing of the two enzymatic activities, in the present study, was attempted by employment of synthetic-regulatory cassettes comprising varying-strength promoters and bicistronic ribosome-binding sites (RBSs). When tested in recombinant Escherichia coli, the cassettes could precisely and differentially control the gene expression in transcription, protein expression and enzymatic activity. Five recombinant strains showing different expressions for GDHt were developed and studied for 3-HPA accumulation and 3-HP production. It was found that 3-HPA accumulation could be completely abolished when expressing ALDH at a level approximately 8-fold higher than that of GDHt. One of the strains, SP4, produced 625mM (56.4g/L) of 3-HP in a fed-batch bioreactor, though late-period production was limited by acetate accumulation. Overall, this study demonstrated the importance of pathway balancing in 3-HP production as well as the utility of the synthetic cassette architecture for precise control of bacterial gene expression. Copyright © 2017 Elsevier B.V. All rights reserved.
Mondal, Subhanjan; Hsiao, Kevin; Goueli, Said A
Adenosine monophosphate (AMP) is a key cellular metabolite regulating energy homeostasis and signal transduction. AMP is also a product of various enzymatic reactions, many of which are dysregulated during disease conditions. Thus, monitoring the activities of these enzymes is a primary goal for developing modulators for these enzymes. In this study, we demonstrate the versatility of an enzyme-coupled assay that quantifies the amount of AMP produced by any enzymatic reaction regardless of its substrates. We successfully implemented it to enzyme reactions that use adenosine triphosphate (ATP) as a substrate (aminoacyl tRNA synthetase and DNA ligase) by an elaborate strategy of removing residual ATP and converting AMP produced into ATP; so it can be detected using luciferase/luciferin and generating light. We also tested this assay to measure the activities of AMP-generating enzymes that do not require ATP as substrate, including phosphodiesterases (cyclic adenosine monophosphate) and Escherichia coli DNA ligases (nicotinamide adenine dinucleotide [NAD + ]). In a further elaboration of the AMP-Glo platform, we coupled it to E. coli DNA ligase, enabling measurement of NAD + and enzymes that use NAD + like monoadenosine and polyadenosine diphosphate-ribosyltransferases. Sulfotransferases use 3'-phosphoadenosine-5'-phosphosulfate as the universal sulfo-group donor and phosphoadenosine-5'-phosphate (PAP) is the universal product. PAP can be quantified by converting PAP to AMP by a Golgi-resident PAP-specific phosphatase, IMPAD1. By coupling IMPAD1 to the AMP-Glo system, we can measure the activities of sulfotransferases. Thus, by utilizing the combinations of biochemical enzymatic conversion of various cellular metabolites to AMP, we were able to demonstrate the versatility of the AMP-Glo assay.
Iakhiaeva, Elena; Wower, Jacek; Wower, Iwona K.; Zwieb, Christian
2008-01-01
The signal recognition particle (SRP) plays a pivotal role in transporting proteins to cell membranes. In higher eukaryotes, SRP consists of an RNA molecule and six proteins. The largest of the SRP proteins, SRP72, was found previously to bind to the SRP RNA. A fragment of human SRP72 (72c′) bound effectively to human SRP RNA but only weakly to the similar SRP RNA of the archaeon Methanococcus jannaschii. Chimeras between the human and M. jannaschii SRP RNAs were constructed and used as substrates for 72c′. SRP RNA helical section 5e contained the 72c′ binding site. Systematic alteration within 5e revealed that the A240G and A240C changes dramatically reduced the binding of 72c′. Human SRP RNA with a single A240G change was unable to form a complex with full-length human SRP72. Two small RNA fragments, one composed of helical section 5ef, the other of section 5e, competed equally well for the binding of 72c′, demonstrating that no other regions of the SRPR RNA were required. The biochemical data completely agreed with the nucleotide conservation pattern observed across the phylogenetic spectrum. Thus, most eukaryotic SRP RNAs are likely to require for function an adenosine within their 5e motifs. The human 5ef RNA was remarkably resistant to ribonucleolytic attack suggesting that the 240-AUC-242 “loop” and its surrounding nucleotides form a peculiar compact structure recognized only by SRP72. PMID:18441046
Differences in activity of cytochrome C oxidase in brain between sleep and wakefulness.
Nikonova, Elena V; Vijayasarathy, Camasamudram; Zhang, Lin; Cater, Jacqueline R; Galante, Raymond J; Ward, Stephen E; Avadhani, Narayan G; Pack, Allan I
2005-01-01
Increased mRNA level of subunit 1 cytochrome c oxidase (COXI) during wakefulness and after short-term sleep deprivation has been described in brain. We hypothesized that this might contribute to increased activity of cytochrome oxidase (COX) enzyme during wakefulness, as part of the mechanisms to provide sufficient amounts of adenosine triphosphate to meet increased neuronal energy demands. COX activity was measured in isolated mitochondria from different brain regions in groups of rats with 3 hours of spontaneous sleep, 3 hours of spontaneous wake, and 3 hours of sleep deprivation. The group with 3 hours of spontaneous wake was added to delineate the circadian component of changes in the enzyme activity. Northern blot analysis was performed to examine the mRNA levels of 2 subunits of the enzyme COXI and COXIV, encoded by mitochondrial and nuclear DNA, respectively. Laboratory of Biochemistry, Department of Animal Biology, and Center for Sleep and Respiratory Neurobiology, University of Pennsylvania. 2-month-old male Fischer rats (N = 21) implanted for polygraphic recording. For COX activity, there was a main effect by analysis of variance of experimental group (P < .0001) with significant increases in COX activity in wake and sleep-deprived groups as compared to the sleep group. A main effect of brain region was also significant (P < .001). There was no difference between brain regions in the degree of increase in enzyme activity in wakefulness. Both COXI and COXIV mRNA were increased with wakefulness as compared to sleep. There is an increase in COX activity after both 3 hours of spontaneous wake and 3 hours of sleep deprivation as compared with 3 hours of spontaneous sleep in diverse brain regions, which could be, in part, explained by the increased levels of bigenomic transcripts of the enzyme. This likely contributes to increased adenosine triphosphate production during wakefulness. ADP, adenosine diphosphate; ATP, adenosine triphosphate; COXI, cytochrome c
Sperlágh, B; Zsilla, G; Baranyi, M; Kékes-Szabó, A; Vizi, E S
1997-10-01
The presynaptic neuromodulation of stimulation-evoked release of [3H]-acetylcholine by endogenous adenosine, via A1-adenosine receptors, was studied in superfused hippocampal slices taken from 4-, 12- and 24-month-old rats. 8-Cyclopentyl-1,3-dimethylxanthine (0.25 microM), a selective A1-receptor antagonist, increased significantly the electrical field stimulation-induced release of [3H]-acetylcholine in slices prepared from 4- and 12-month-old rats, showing a tonic inhibitory action of endogenous adenosine via stimulation of presynaptic A1-adenosine receptors. In contrast, 8-cyclopentyl-1,3-dimethylxanthine had no effect in 24-month-old rats. 2-Chloroadenosine (10 microM), an adenosine receptor agonist decreased the release of [3H]-acetylcholine in slices taken from 4- and 12-month-old rats, and no significant change was observed in slices taken from 24-month-old rats. In order to show whether the number/or affinity of the A1-receptors was affected in aged rats, [3H]-8-cyclopentyl-1,3-dimethylxanthine binding was studied in hippocampal membranes prepared from rats of different ages. Whereas the Bmax value was significantly lower in 2-year-old rats than in younger counterparts, the dissociation constant (Kd) was not affected by aging, indicating that the density rather than the affinity of adenosine receptors was altered. Endogenous adenosine levels present in the extracellular space were also measured in the superfusate by high performance liquid chromatography (HPLC) coupled with ultraviolet detection, and an age-related increase in the adenosine level was found. In summary, our results indicate that during aging the level of adenosine in the extracellular fluid is increased in the hippocampus. There is a downregulation and reduced responsiveness of presynaptic adenosine A1-receptors, and it seems likely that these changes are due to the enhanced adenosine level in the extracellular space.
Hampras, Shalaka S; Sucheston, Lara; Weiss, Joli; Baer, Maria R; Zirpoli, Gary; Singh, Prashant K; Wetzler, Meir; Chennamaneni, Raj; Blanco, Javier G; Ford, LaurieAnn; Moysich, Kirsten B
2010-01-01
The overall survival of patients with acute myeloid leukemia (AML) remains poor due to both intrinsic and acquired chemotherapy resistance. Over expression of ATP binding cassette (ABC) proteins in AML cells has been suggested as a putative mechanism of drug resistance. Genetic variation among individuals affecting the expression or function of these proteins may contribute to inter-individual variation in treatment outcomes. DNA from pre-treatment bone marrow or blood samples from 261 patients age 20-85 years, who received cytarabine and anthracycline-based therapy at Roswell Park Cancer Institute between 1994 and 2006, was genotyped for eight non-synonymous single nucleotide polymorphisms in the ABCB1, ABCC1 and ABCG2 drug transporter genes. Heterozygous (AG) or homozygous (AA) variant genotypes for rs2231137 (G34A) in the ABCG2 (BRCP) gene, compared to the wild type (GG) genotype were associated with both significantly improved survival (HR=0.44, 95%CI=0.25-0.79), and increased odds for toxicity (OR=8.41, 95%CI= 1.10-64.28). Thus genetic polymorphisms in the ABCG2 (BRCP) gene may contribute to differential survival outcomes and toxicities in AML patients via a mechanism of decreased drug efflux in both, AML cells and normal progenitors. PMID:21311724
Liu, Xiang; Li, Shangqi; Peng, Wenzhu; Feng, Shuaisheng; Feng, Jianxin; Mahboob, Shahid; Al-Ghanim, Khalid A; Xu, Peng
2016-01-01
The ATP-binding cassette (ABC) gene family is considered to be one of the largest gene families in all forms of prokaryotic and eukaryotic life. Although the ABC transporter genes have been annotated in some species, detailed information about the ABC superfamily and the evolutionary characterization of ABC genes in common carp (Cyprinus carpio) are still unclear. In this research, we identified 61 ABC transporter genes in the common carp genome. Phylogenetic analysis revealed that they could be classified into seven subfamilies, namely 11 ABCAs, six ABCBs, 19 ABCCs, eight ABCDs, two ABCEs, four ABCFs, and 11 ABCGs. Comparative analysis of the ABC genes in seven vertebrate species including common carp, showed that at least 10 common carp genes were retained from the third round of whole genome duplication, while 12 duplicated ABC genes may have come from the fourth round of whole genome duplication. Gene losses were also observed for 14 ABC genes. Expression profiles of the 61 ABC genes in six common carp tissues (brain, heart, spleen, kidney, intestine, and gill) revealed extensive functional divergence among the ABC genes. Different copies of some genes had tissue-specific expression patterns, which may indicate some gene function specialization. This study provides essential genomic resources for future studies in common carp.
Zha, W J; Li, S H; Zhou, L; Chen, Z J; Liu, K; Yang, G C; Hu, G; He, G C; You, A Q
2015-03-30
The ATP-binding cassette (ABC) transporters belong to a large superfamily of proteins that have important physiological functions in all living organisms. In insects, ABC transporters have important functions in the transport of molecules, and are also involved in insecticide resistance, metabolism, and development. In this study, the Nilaparvata lugens Stal (Hemiptera: Delphacidae) ABCG (NlABCG) gene was identified and characterized. The complete mRNA sequence of NlABCG was 2608-bp long, with an open reading frame of 2064 bp encoding a protein comprised of 687 amino acids. The conserved regions include three N-glycosylation and 34 phosphorylation sites, as well as seven transmembrane domains. The amino acid identity with the closely related species Acyrthosiphon pisum was 42.8%. Developmental expression analysis using quantitative real-time reverse transcriptase PCR suggested that the NlABCG transcript was expressed at all developmental stages of N. lugens. The lowest expression of NlABCG was in the 1st instar, and levels increased with larval growth. The transcript profiles of NlABCG were analyzed in various tissues from a 5th instar nymph, and the highest expression was observed in the midgut. These results suggest that the sequence, characteristics, and expression of NlABCG are highly conserved, and basic information is provided for its functional analysis.
Peng, Wenzhu; Feng, Shuaisheng; Feng, Jianxin; Mahboob, Shahid; Al-Ghanim, Khalid A.
2016-01-01
The ATP-binding cassette (ABC) gene family is considered to be one of the largest gene families in all forms of prokaryotic and eukaryotic life. Although the ABC transporter genes have been annotated in some species, detailed information about the ABC superfamily and the evolutionary characterization of ABC genes in common carp (Cyprinus carpio) are still unclear. In this research, we identified 61 ABC transporter genes in the common carp genome. Phylogenetic analysis revealed that they could be classified into seven subfamilies, namely 11 ABCAs, six ABCBs, 19 ABCCs, eight ABCDs, two ABCEs, four ABCFs, and 11 ABCGs. Comparative analysis of the ABC genes in seven vertebrate species including common carp, showed that at least 10 common carp genes were retained from the third round of whole genome duplication, while 12 duplicated ABC genes may have come from the fourth round of whole genome duplication. Gene losses were also observed for 14 ABC genes. Expression profiles of the 61 ABC genes in six common carp tissues (brain, heart, spleen, kidney, intestine, and gill) revealed extensive functional divergence among the ABC genes. Different copies of some genes had tissue-specific expression patterns, which may indicate some gene function specialization. This study provides essential genomic resources for future studies in common carp. PMID:27058731
Matsuda, Shuichi; Takano, Sho; Sato, Moeko; Furukawa, Kaoru; Nagasawa, Hidetaka; Yoshikawa, Shoko; Kasuga, Jun; Tokuji, Yoshihiko; Yazaki, Kazufumi; Nakazono, Mikio; Takamure, Itsuro; Kato, Kiyoaki
2016-03-07
Water stress is one of the major environmental stresses that affect agricultural production worldwide. Water loss from plants occurs primarily through stomatal pores. Here, we report that an Oryza sativa half-size ATP-binding cassette (ABC) subfamily G protein, RCN1/OsABCG5, is involved in stomatal closure mediated by phytohormone abscisic acid (ABA) accumulation in guard cells. We found that the GFP-RCN1/OsABCG5-fusion protein was localized at the plasma membrane in guard cells. The percentage of guard cell pairs containing both ABA and GFP-RCN1/OsABCG5 increased after exogenous ABA treatment, whereas they were co-localized in guard cell pairs regardless of whether exogenous ABA was applied. ABA application resulted in a smaller increase in the percentage of guard cell pairs containing ABA in rcn1 mutant (A684P) and RCN1-RNAi than in wild-type plants. Furthermore, polyethylene glycol (drought stress)-inducible ABA accumulation in guard cells did not occur in rcn1 mutants. Stomata closure mediated by exogenous ABA application was strongly reduced in rcn1 mutants. Finally, rcn1 mutant plants had more rapid water loss from detached leaves than the wild-type plants. These results indicate that in response to drought stress, RCN1/OsABCG5 is involved in accumulation of ABA in guard cells, which is indispensable for stomatal closure. Copyright © 2016 The Author. Published by Elsevier Inc. All rights reserved.
Adenosine receptor desensitization and trafficking.
Mundell, Stuart; Kelly, Eamonn
2011-05-01
As with the majority of G-protein-coupled receptors, all four of the adenosine receptor subtypes are known to undergo agonist-induced regulation in the form of desensitization and trafficking. These processes can limit the ability of adenosine receptors to couple to intracellular signalling pathways and thus reduce the ability of adenosine receptor agonists as well as endogenous adenosine to produce cellular responses. In addition, since adenosine receptors couple to multiple signalling pathways, these pathways may desensitize differentially, while the desensitization of one pathway could even trigger signalling via another. Thus, the overall picture of adenosine receptor regulation can be complex. For all adenosine receptor subtypes, there is evidence to implicate arrestins in agonist-induced desensitization and trafficking, but there is also evidence for other possible forms of regulation, including second messenger-dependent kinase regulation, heterologous effects involving G proteins, and the involvement of non-clathrin trafficking pathways such as caveolae. In this review, the evidence implicating these mechanisms is summarized for each adenosine receptor subtype, and we also discuss those issues of adenosine receptor regulation that remain to be resolved as well as likely directions for future research in this field. Copyright © 2010 Elsevier B.V. All rights reserved.
Gulati, Sonia; Balderes, Dina; Kim, Christine; Guo, Zhongmin A; Wilcox, Lisa; Area-Gomez, Estela; Snider, Jamie; Wolinski, Heimo; Stagljar, Igor; Granato, Juliana T; Ruggles, Kelly V; DeGiorgis, Joseph A; Kohlwein, Sepp D; Schon, Eric A; Sturley, Stephen L
2015-11-01
A key component of eukaryotic lipid homeostasis is the esterification of sterols with fatty acids by sterol O-acyltransferases (SOATs). The esterification reactions are allosterically activated by their sterol substrates, the majority of which accumulate at the plasma membrane. We demonstrate that in yeast, sterol transport from the plasma membrane to the site of esterification is associated with the physical interaction of the major SOAT, acyl-coenzyme A:cholesterol acyltransferase (ACAT)-related enzyme (Are)2p, with 2 plasma membrane ATP-binding cassette (ABC) transporters: Aus1p and Pdr11p. Are2p, Aus1p, and Pdr11p, unlike the minor acyltransferase, Are1p, colocalize to sterol and sphingolipid-enriched, detergent-resistant microdomains (DRMs). Deletion of either ABC transporter results in Are2p relocalization to detergent-soluble membrane domains and a significant decrease (53-36%) in esterification of exogenous sterol. Similarly, in murine tissues, the SOAT1/Acat1 enzyme and activity localize to DRMs. This subcellular localization is diminished upon deletion of murine ABC transporters, such as Abcg1, which itself is DRM associated. We propose that the close proximity of sterol esterification and transport proteins to each other combined with their residence in lipid-enriched membrane microdomains facilitates rapid, high-capacity sterol transport and esterification, obviating any requirement for soluble intermediary proteins. © FASEB.
AMP and adenosine are both ligands for adenosine 2B receptor signaling.
Holien, Jessica K; Seibt, Benjamin; Roberts, Veena; Salvaris, Evelyn; Parker, Michael W; Cowan, Peter J; Dwyer, Karen M
2018-01-15
Adenosine is considered the canonical ligand for the adenosine 2B receptor (A 2B R). A 2B R is upregulated following kidney ischemia augmenting post ischemic blood flow and limiting tubular injury. In this context the beneficial effect of A 2B R signaling has been attributed to an increase in the pericellular concentration of adenosine. However, following renal ischemia both kidney adenosine monophosphate (AMP) and adenosine levels are substantially increased. Using computational modeling and calcium mobilization assays, we investigated whether AMP could also be a ligand for A 2B R. The computational modeling suggested that AMP interacts with more favorable energy to A 2B R compared with adenosine. Furthermore, AMPαS, a non-hydrolyzable form of AMP, increased calcium uptake by Chinese hamster ovary (CHO) cells expressing the human A 2B R, indicating preferential signaling via the G q pathway. Therefore, a putative AMP-A 2B R interaction is supported by the computational modeling data and the biological results suggest this interaction involves preferential G q activation. These data provide further insights into the role of purinergic signaling in the pathophysiology of renal IRI. Copyright © 2017 Elsevier Ltd. All rights reserved.
Lynge, J; Juel, C; Hellsten, Y
2001-01-01
The existence of adenosine transporters in plasma membrane giant vesicles from rat skeletal muscles and in primary skeletal muscle cell cultures was investigated. In addition, the contribution of intracellularly or extracellularly formed adenosine to the overall extracellular adenosine concentration during muscle contraction was determined in primary skeletal muscle cell cultures. In plasma membrane giant vesicles, the carrier-mediated adenosine transport demonstrated saturation kinetics with Km= 177 ± 36 μm and Vmax= 1.9 ± 0.2 nmol ml−1 s−1 (0.7 nmol (mg protein)−1 s−1). The existence of an adenosine transporter was further evidenced by the inhibition of the carrier-mediated adenosine transport in the presence of NBMPR (nitrobenzylthioinosine; 72 % inhibition) or dipyridamol (64 % inhibition; P < 0.05). In primary skeletal muscle cells, the rate of extracellular adenosine accumulation was 5-fold greater (P < 0.05) with electrical stimulation than without electrical stimulation. Addition of the adenosine transporter inhibitor NBMPR led to a 57 % larger (P < 0.05) rate of extracellular adenosine accumulation in the electro-stimulated muscle cells compared with control cells, demonstrating that adenosine is taken up by the skeletal muscle cells during contractions. Inhibition of ecto-5′-nucleotidase with AOPCP in electro-stimulated cells resulted in a 70 % lower (P < 0.05) rate of extracellular adenosine accumulation compared with control cells, indicating that adenosine to a large extent is formed in the extracellular space during contraction. The present study provides evidence for the existence of an NBMPR-sensitive adenosine transporter in rat skeletal muscle. Our data furthermore demonstrate that the increase in extracellular adenosine observed during electro-stimulation of skeletal muscle is due to production of adenosine in the extracellular space of skeletal muscle and that adenosine is taken up rather than released by the skeletal muscle cells
Björkman, Karin; Duhamel, Solange; Karl, David M.
2012-01-01
We investigated the concentration dependent uptake of inorganic phosphate (Pi) and adenosine-5′-triphosphate (ATP) in microbial populations in the North Pacific Subtropical Gyre (NPSG). We used radiotracers to measure substrate uptake into whole water communities, differentiated microbial size classes, and two flow sorted groups; Prochlorococcus (PRO) and non-pigmented bacteria (NPB). The Pi concentrations, uptake rates, and Pi pool turnover times (Tt) were (mean, ±SD); 54.9 ± 35.0 nmol L−1 (n = 22), 4.8 ± 1.9 nmol L−1 day−1 (n = 19), and 14.7 ± 10.2 days (n = 19), respectively. Pi uptake into >2 μm cells was on average 12 ± 7% (n = 15) of the total uptake. The kinetic response to Pi (10–500 nmol L−1) was small, indicating that the microorganisms were close to their maximum uptake velocity (Vmax). Vmax averaged 8.0 ± 3.6 nmol L−1 day−1 (n = 19) in the >0.2 μm group, with half saturation constants (Km) of 40 ± 28 nmol L−1 (n = 19). PRO had three times the cell specific Pi uptake rate of NPB, at ambient concentrations, but when adjusted to cells L−1 the rates were similar, and these two groups were equally competitive for Pi. The Tt of γ-P-ATP in the >0.2 μm group were shorter than for the Pi pool (4.4 ± 1.0 days; n = 6), but this difference diminished in the larger size classes. The kinetic response to ATP was large in the >0.2 μm class with Vmax exceeding the rates at ambient concentrations (mean 62 ± 27 times; n = 6) with a mean Vmax for γ-P-ATP of 2.8 ± 1.0 nmol L−1 day−1, and Km at 11.5 ± 5.4 nmol L−1 (n = 6). The NPB contribution to γ-P-ATP uptake was high (95 ± 3%, n = 4) at ambient concentrations but decreased to ∼50% at the highest ATP amendment. PRO had Km values 5–10 times greater than NPB. The above indicates that PRO and NPB were in close competition in terms of Pi acquisition
Marisco, Patricia C; Carvalho, Fabiano B; Rosa, Michelle M; Girardi, Bruna A; Gutierres, Jessié M; Jaques, Jeandre A S; Salla, Ana P S; Pimentel, Víctor C; Schetinger, Maria Rosa C; Leal, Daniela B R; Mello, Carlos F; Rubin, Maribel A
2013-08-01
Piracetam improves cognitive function in animals and in human beings, but its mechanism of action is still not completely known. In the present study, we investigated whether enzymes involved in extracellular adenine nucleotide metabolism, adenosine triphosphate diphosphohydrolase (NTPDase), 5'-nucleotidase and adenosine deaminase (ADA) are affected by piracetam in the hippocampus and cerebral cortex of animals subjected to scopolamine-induced memory impairment. Piracetam (0.02 μmol/5 μL, intracerebroventricular, 60 min pre-training) prevented memory impairment induced by scopolamine (1 mg/kg, intraperitoneal, immediately post-training) in the inhibitory avoidance learning and in the object recognition task. Scopolamine reduced the activity of NTPDase in hippocampus (53 % for ATP and 53 % for ADP hydrolysis) and cerebral cortex (28 % for ATP hydrolysis). Scopolamine also decreased the activity of 5'-nucleotidase (43 %) and ADA (91 %) in hippocampus. The same effect was observed in the cerebral cortex for 5'-nucleotidase (38 %) and ADA (68 %) activities. Piracetam fully prevented scopolamine-induced memory impairment and decrease of NTPDase, 5'-nucleotidase and adenosine deaminase activities in synaptosomes from cerebral cortex and hippocampus. In vitro experiments show that piracetam and scopolamine did not alter enzymatic activity in cerebral cortex synaptosomes. Moreover, piracetam prevented scopolamine-induced increase of TBARS levels in hippocampus and cerebral cortex. These results suggest that piracetam-induced improvement of memory is associated with protection against oxidative stress and maintenance of NTPDase, 5'-nucleotidase and ADA activities, and suggest the purinergic system as a putative target of piracetam.
Classroom Cassette Recorders: Low and Moderate Cost. An in Depth Report
ERIC Educational Resources Information Center
Educational Product Report, 1973
1973-01-01
Contains guidelines for selecting an audio cassette recorder, one school district's report of cassette testing for high-speed duplication, data from a survey of users and technicians in several school districts, individual laboratory analyses of 15 machines and recommendations, and comparative descriptions of 74 cassette recorders (information…
A Portable Analyzer for Pouch-Actuated, Immunoassay Cassettes
Qiu, Xianbo; Liu, Changchun; Mauk, Michael G.; Hart, Robert W.; Chen, Dafeng; Qiu, Jing; Kientz, Terry; Fiene, Jonathan; Bau, Haim H.
2011-01-01
A portable, small footprint, light, general purpose analyzer (processor) to control the flow in immunoassay cassettes and to facilitate the detection of test results is described. The durable analyzer accepts disposable cassettes that contain pouches and reaction chambers for various unit operations such as hydration of dry reagents, stirring, and incubation. The analyzer includes individually controlled, linear actuators to compress the pouches in the cassette, which facilitates the pumping and mixing of sample and reagents, and to close diaphragm-based valves for flow control. The same types of actuators are used to compress pouches and actuate valves. The analyzer also houses a compact OEM scanner/reader to excite fluorescence and detect emission from labels. The analyzer is hydraulically isolated from the cassette, reducing the possibility of cross-contamination. The analyzer facilitates programmable, automated execution of a sequence of operations such as pumping and valving in a timely fashion, reducing the level of expertise required from the operator and the possibility for errors. The analyzer’s design is modular and expandable to accommodate cassettes of various complexities and additional functionalities. In this paper, the utility of the analyzer has been demonstrated with the execution of a simple, consecutive, lateral flow assay of a model biological system and the test results were detected with up converting phosphor labels that are excited at infrared frequencies and emit in the visible spectrum. PMID:22125359
Purinergic signaling pathways in endocrine system.
Bjelobaba, Ivana; Janjic, Marija M; Stojilkovic, Stanko S
2015-09-01
Adenosine-5'-triphosphate is released by neuroendocrine, endocrine, and other cell types and acts as an extracellular agonist for ligand-gated P2X cationic channels and G protein-coupled P2Y receptors in numerous organs and tissues, including the endocrine system. The breakdown of ATP by ectonucleotidases not only terminates its extracellular messenger functions, but also provides a pathway for the generation of two additional agonists: adenosine 5'-diphosphate, acting via some P2Y receptors, and adenosine, a native agonist for G protein-coupled adenosine receptors, also expressed in the endocrine system. This article provides a review of purinergic signaling pathways in the hypothalamic magnocellular neurosecretory cells and neurohypophysis, hypothalamic parvocellular neuroendocrine system, adenohypophysis, and effector glands organized in five axes: hypothalamic-pituitary-gonadal, hypothalamic-pituitary-thyroid, hypothalamic-pituitary-adrenal, hypothalamic-pituitary-growth hormone, and hypothalamic-pituitary-prolactin. We attempted to summarize current knowledge of purinergic receptor subtypes expressed in the endocrine system, including their roles in intracellular signaling, hormone secretion, and other cell functions. We also briefly review the release mechanism for adenosine-5'-triphosphate by neuroendocrine, endocrine and surrounding cells, the enzymes involved in adenosine-5'-triphosphate hydrolysis to adenosine-5'-diphosphate and adenosine, and the relevance of this pathway for sequential activation of receptors and termination of signaling. Published by Elsevier B.V.
Purinergic Signaling Pathways in Endocrine System
Bjelobaba, Ivana; Janjic, Marija M.; Stojilkovic, Stanko S.
2015-01-01
Adenosine-5′-triphosphate is released by neuroendocrine, endocrine, and other cell types and acts as an extracellular agonist for ligand-gated P2X cationic channels and G protein-coupled P2Y receptors in numerous organs and tissues, including the endocrine system. The breakdown of ATP by ectonucleotidases not only terminates its extracellular messenger functions, but also provides a pathway for the generation of two additional agonists: adenosine 5′-diphosphate, acting via some P2Y receptors, and adenosine, a native agonist for G protein-coupled adenosine receptors, also expressed in the endocrine system. This article provides a review of purinergic signaling pathways in the hypothalamic magnocellular neurosecretory cells and neurohypophysis, hypothalamic parvocellular neuroendocrine system, adenohypophysis, and effector glands organized in five axes: hypothalamic-pituitary-gonadal, hypothalamic-pituitary-thyroid, hypothalamic-pituitary-adrenal, hypothalamic-pituitary-growth hormone, and hypothalamic-pituitary-prolactin. We attempted to summarize current knowledge of purinergic receptor subtypes expressed in the endocrine system, including their roles in intracellular signaling, hormone secretion, and other cell functions. We also briefly review the release mechanism for adenosine-5′-triphosphate by neuroendocrine, endocrine and surrounding cells, the enzymes involved in adenosine-5′-triphosphate hydrolysis to adenosine-5′-diphosphate and adenosine, and the relevance of this pathway for sequential activation of receptors and termination of signaling. PMID:25960051
Liang, Bin; Wang, Xin; Song, Xiaosu; Bai, Rui; Yang, Huiyu; Yang, Zhiming; Xiao, Chuanshi; Bian, Yunfei
2017-09-01
ATP-binding cassette transporter A1 (ABCA1) plays a crucial role in reverse cholesterol transport and exhibits anti-atherosclerosis effects. Some microRNAs (miRs) regulate ABCA1 expression, and recent studies have shown that miR-20a/b might play a critical role in atherosclerotic diseases. Here, we attempted to clarify the potential contribution of miR-20a/b in post-transcriptional regulation of ABCA1, cholesterol efflux, and atherosclerosis. We performed bioinformatics analysis and found that miR-20a/b was highly conserved and directly bound to ABCA1 mRNA with low binding free energy. Luciferase-reporter assay also confirmed that miR-20a/b significantly reduced luciferase activity associated with the ABCA1 3' untranslated region reporter construct. Additionally, miR-20a/b decreased ABCA1 expression, which, in turn, decreased cholesterol efflux and increased cholesterol content in THP-1 and RAW 264.7 macrophage-derived foam cells. In contrast, miR-20a/b inhibitors increased ABCA1 expression and cholesterol efflux, decreased cholesterol content, and inhibited foam-cell formation. Consistent with our in vitro results, miR-20a/b-treated ApoE -/- mice showed decreased ABCA1expression in the liver and reductions of reverse cholesterol transport in vivo. Furthermore, miR-20a/b regulated the formation of nascent high-density lipoprotein and promoted atherosclerotic development, whereas miR-20a/b knockdown attenuated atherosclerotic formation. miR-20 is a new miRNA capable of targeting ABCA1 and regulating ABCA1 expression. Therefore, miR-20 inhibition constitutes a new strategy for ABCA1-based treatment of atherosclerosis. Copyright © 2017 Elsevier B.V. All rights reserved.
Two nucleotide binding sites modulate ( sup 3 H) glyburide binding to rat cortex membranes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Johnson, D.E.; Gopalakrishnan, M.; Triggle, D.J.
1991-03-11
The effects of nucleotides on the binding of the ATP-dependent K{sup +}-channel antagonist ({sup 3}H)glyburide (GLB) to rat cortex membranes were examined. Nucleotide triphosphates (NTPs) and nucleotide diphosphate (NDPs) inhibited the binding of GLB. This effect was dependent on the presence of dithiothreitol (DTT). Inhibition of binding by NTPs, with the exception of ATP{gamma}S, was dependent on the presence of Mg{sup 2+}. GLB binding showed a biphasic response to ADP: up to 3 mM, ADP inhibited binding, and above this concentration GLB binding increased rapidly, and was restored to normal levels by 10 mM ADP. In the presence of Mg{supmore » 2+}, ADP did not stimulate binding. Saturation analysis in the presence of Mg{sup 2+} and increasing concentrations of ADP showed that ADP results primarily in a change of the B{sub max} for GLB binding. The differential effects of NTPS and NDPs indicate that two nucleotide binding sites regulate GLB binding.« less
Lacher, Svenja K; Mayer, Ralf; Sichardt, Kathrin; Nieber, Karen; Müller, Christa E
2007-01-15
A series of extracts of valerian roots (Valeriana officinalis L.) was prepared with solvents of different polarity. Polar as well as nonpolar extracts were found to interact with adenosine A(1) receptors. While polar extracts activated A(1) receptors (partial agonistic activity), nonpolar extracts showed antagonistic or inverse agonistic activity at A(1) receptors, as demonstrated by GTPgammaS binding assays at human recombinant A(1) receptors stably expressed in Chinese hamster ovary (CHO) cells. Guided by radioligand binding assays, fractionation of a lipophilic petroleum ether:diethyl ether (1:1) extract led to the isolation of isovaltrate, which was characterized as a potent, highly efficacious inverse agonist at adenosine A(1) receptors (K(i) rat A(1): 2.05 microM). In experiments at rat brain slices measuring post-synaptic potentials (PSPs) in cortical neurons, isovaltrate at least partly reversed the reduction in the PSPs induced by the adenosine A(1) receptor agonist N(6)-cyclopentyladenosine (CPA). Isovaltrate may serve as a new lead structure for the development of inverse agonists at adenosine A(1) receptors. The common use of hydrophilic, but not lipophilic valerian extracts as mild sleep-inducing agents is consistent with the opposite actions of hydrophilic and lipophilic extracts on adenosine receptors.
Fredslund, Folmer; Vujičić Žagar, Andreja; Andersen, Thomas Lars; Svensson, Birte; Slotboom, Dirk Jan
2016-01-01
The molecular details and impact of oligosaccharide uptake by distinct human gut microbiota (HGM) are currently not well understood. Non-digestible dietary galacto- and gluco-α-(1,6)-oligosaccharides from legumes and starch, respectively, are preferentially fermented by mainly bifidobacteria and lactobacilli in the human gut. Here we show that the solute binding protein (BlG16BP) associated with an ATP binding cassette (ABC) transporter from the probiotic Bifidobacterium animalis subsp. lactis Bl-04 binds α-(1,6)-linked glucosides and galactosides of varying size, linkage, and monosaccharide composition with preference for the trisaccharides raffinose and panose. This preference is also reflected in the α-(1,6)-galactoside uptake profile of the bacterium. Structures of BlG16BP in complex with raffinose and panose revealed the basis for the remarkable ligand binding plasticity of BlG16BP, which recognizes the non-reducing α-(1,6)-diglycoside in its ligands. BlG16BP homologues occur predominantly in bifidobacteria and a few Firmicutes but lack in other HGMs. Among seven bifidobacterial taxa, only those possessing this transporter displayed growth on α-(1,6)-glycosides. Competition assays revealed that the dominant HGM commensal Bacteroides ovatus was out-competed by B. animalis subsp. lactis Bl-04 in mixed cultures growing on raffinose, the preferred ligand for the BlG16BP. By comparison, B. ovatus mono-cultures grew very efficiently on this trisaccharide. These findings suggest that the ABC-mediated uptake of raffinose provides an important competitive advantage, particularly against dominant Bacteroides that lack glycan-specific ABC-transporters. This novel insight highlights the role of glycan transport in defining the metabolic specialization of gut bacteria. PMID:27502277
Ankireddy, Seshadri Reddy; Kim, Jongsung
2015-01-01
Microbeads are frequently used as solid supports for biomolecules such as proteins and nucleic acids in heterogeneous microfluidic assays. Chip-based, quantum dot (QD)-bead-biomolecule probes have been used for the detection of various types of DNA. In this study, we developed dopamine (DA)-functionalized InP/ZnS QDs (QDs-DA) as fluorescence probes for the detection of adenosine in microfluidic chips. The photoluminescence (PL) intensity of the QDs-DA is quenched by Zn(2+) because of the strong coordination interactions. In the presence of adenosine, Zn(2+) cations preferentially bind to adenosine, and the PL intensity of the QDs-DA is recovered. A polydimethylsiloxane-based microfluidic chip was fabricated, and adenosine detection was confirmed using QDs-DA probes.
Ankireddy, Seshadri Reddy; Kim, Jongsung
2015-01-01
Microbeads are frequently used as solid supports for biomolecules such as proteins and nucleic acids in heterogeneous microfluidic assays. Chip-based, quantum dot (QD)-bead-biomolecule probes have been used for the detection of various types of DNA. In this study, we developed dopamine (DA)-functionalized InP/ZnS QDs (QDs-DA) as fluorescence probes for the detection of adenosine in microfluidic chips. The photoluminescence (PL) intensity of the QDs-DA is quenched by Zn2+ because of the strong coordination interactions. In the presence of adenosine, Zn2+ cations preferentially bind to adenosine, and the PL intensity of the QDs-DA is recovered. A polydimethylsiloxane-based microfluidic chip was fabricated, and adenosine detection was confirmed using QDs-DA probes. PMID:26347351
Xu, Lei; Shen, Xin; Li, Bingzhi; Zhu, Chunhong; Zhou, Xuemin
2017-08-08
Adenosine is an endogenous nucleotide pivotally involved in nucleic acid and energy metabolism. Its excessive existence may indicate tumorigenesis, typically lung cancer. Encouraged by its significance as the clinical biomarker, sensitive assay methods towards adenosine have been popularized, with high cost and tedious procedures as the inevitable defects. Herein, we report a label-free aptamer-based exonuclease III (Exo III) amplification colorimetric aptasensor for the highly sensitive and cost-effective detection of adenosine. The strategy employed two unlabeled hairpin DNA oligonucleotides (HP1 and HP2), where HP1 contained the aptamer towards adenosine and HP2 embedded the guanine-rich sequence (GRS). In the presence of adenosine, hairpin HP1 could form specific binding with adenosine and trigger the unfolding of HP1's hairpin structure. The resulting adenosine-HP1 complex could hybridize with HP2, generating the Exo III recognition site. After Exo III-assisted degradation, the GRS was released from HP2, and the adenosine-HP1 was released back to the solution to combine another HP2, inducing the cycling amplification. After multiple circulations, the released ample GRSs were induced to form G-quadruplex, further catalyzing the oxidation of TMB, yielding a color change which was finally mirrored in the absorbance change. On the contrary, the absence of adenosine failed to unfold HP1, remaining color unchanged eventually. Thanks to the amplification strategy, the limit of detection was lowered to 17 nM with a broad linear range from 50 nM to 6 μM. The proposed method was successfully applied to the detection of adenosine in biological samples and satisfying recoveries were acquired. Copyright © 2017 Elsevier B.V. All rights reserved.
Shukla, Suneet; Wu, Chung-Pu; Nandigama, Krishnamachary; Ambudkar, Suresh V
2007-12-01
Vitamin K3 (menadione; 2-methyl-1,4-naphthoquinone) is a structural precursor of vitamins K1 and K2, which are essential for blood clotting. The naturally occurring structural analogue of this vitamin, plumbagin (5-hydroxy-menadione), is known to modulate cellular proliferation, apoptosis, carcinogenesis, and radioresistance. We here report that both vitamin K3 and plumbagin are substrates of the multidrug resistance-linked ATP binding cassette drug transporter, ABCG2. Vitamin K3 and plumbagin specifically inhibited the ABCG2-mediated efflux of mitoxantrone but did not have any effect on the ABCB1-mediated efflux of rhodamine 123. This inhibition of ABCG2 function was due to their interaction at the substrate-binding site(s). Vitamin K3 and plumbagin inhibited the binding of [(125)I]iodoarylazidoprazosin, a substrate of ABCG2, to this transporter in a concentration-dependent manner with IC(50) values of 7.3 and 22.6 micromol/L, respectively, but had no effect on the binding of the photoaffinity analogue to ABCB1. Both compounds stimulated ABCG2-mediated ATP hydrolysis and also inhibited the mitoxantrone-stimulated ATPase activity of the ABCG2 transporter, but did not have any significant effect on the ATPase activity of ABCB1. In a cytotoxicity assay, ABCG2-expressing HEK cells were 2.8- and 2.3-fold resistant to plumbagin and vitamin K3, respectively, compared with the control cells, suggesting that they are substrates of this transporter. Collectively, these data show for the first time that vitamin K3 is a substrate of the ABCG2 transporter. Thus, ABCG2 may have a role in the regulation of vitamin K3 levels in the body. In addition, vitamin K3 and its structural derivative, plumbagin, could potentially be used to modulate ABCG2 function.