Science.gov

Sample records for adh gene family

  1. Phylogenetic analysis of the nuclear alcohol dehydrogenase (Adh) gene family in Carex section Acrocystis (Cyperaceae) and combined analyses of Adh and nuclear ribosomal ITS and ETS sequences for inferring species relationships.

    PubMed

    Roalson, Eric H; Friar, Elizabeth A

    2004-12-01

    We analyzed sequence variation for the alcohol dehydrogenase (Adh) gene family in Carex section Acrocystis (Cyperaceae) to reconstruct Adh gene trees for Acrocystis species and to characterize the structure of the Adh gene family in Carex. Two Adh loci were included with ITS and ETS sequences in a combined Bayesian inference analysis of Carex section Acrocystis to gain a better understanding of species relationships in the section. In addition, we comment on how the results presented here contribute to our knowledge of the birth-death process of the Adh gene family in angiosperms. It appears that the structure of the Adh gene family in Carex is complex with possibly six loci present in the gene family. Additionally, variation among Acrocystis species within loci is quite low, and there is little phylogenetic resolution in the individual datasets. Bayesian inference analysis of the combined ITS, ETS, Adh1, and Adh2 datasets resulted in a moderately well-supported phylogenetic hypothesis of relationships in the section which is discussed in relation to previous hypotheses of relationships.

  2. Cloning and functional analysis of adhS gene encoding quinoprotein alcohol dehydrogenase subunit III from Acetobacter pasteurianus SKU1108.

    PubMed

    Masud, Uraiwan; Matsushita, Kazunobu; Theeragool, Gunjana

    2010-03-31

    The adhS gene which encodes the smallest subunit, subunit III, of quinoprotein alcohol dehydrogenase (PQQ-ADH) from Acetobacter pasteurianus SKU1108 has been cloned and characterized. The role of this subunit on the function of PQQ-ADH was investigated by construction of adhS gene disruptant and mutants. The adhS gene disruptant completely lost its PQQ-ADH activity and acetate-producing ability but retained acetic acid toleration. In contrast, this disruptant grew well, even better than the wild type, in the ethanol containing medium even though its PQQ-ADH activity and ethanol oxidizing ability was completely lost, while NAD(+)-dependent ADH (NAD(+)-ADH) was induced. Heme staining and immunoblot analysis of both membrane and soluble fractions with anti-ADH subunit III suggested that ethanol did not affect the adhS gene expression but induced PQQ-ADH activity. Over-expressed adhS did not enhance acetic acid production in both the wild type and the adhS disruptant. In addition, deletion analysis of upstream region of adhS gene suggested that its tentative promoter(s) might be located at around 118-268 bp upstream from an initiation codon. Random mutagenesis of adhS gene revealed that complete loss of PQQ-ADH activity and ethanol oxidizing ability were observed in the mutants' lack of the 140 and 73 amino acid residues at the C-terminal, whereas the lack of 22 amino acid residues at the C-terminal affected neither the PQQ-ADH activity nor ethanol oxidizing ability. In addition, some amino acid substitutions such as Leu18Gln, Ala26Val, Val36Ile, Val54Ile, Gly55Asp, Val70Ala and Val107Ala did not show any affect on PQQ-ADH activity and ethanol oxidizing ability. Interestingly, alteration of Thr104Lys led to a complete loss of ethanol oxidizing ability. However, point mutation at the possible promoter region also exhibited low PQQ-ADH activity and ethanol oxidizing ability. This result suggests that 104Thr might be involved in molecular coupling with subunit I in order

  3. Structure, Expression, Chromosomal Location and Product of the Gene Encoding Adh2 in Petunia

    PubMed Central

    Gregerson, R. G.; Cameron, L.; McLean, M.; Dennis, P.; Strommer, J.

    1993-01-01

    In most higher plants the genes encoding alcohol dehydrogenase comprise a small gene family, usually with two members. The Adh1 gene of Petunia has been cloned and analyzed, but a second identifiable gene was not recovered from any of three genomic libraries. We have therefore employed the polymerase chain reaction to obtain the major portion of a second Adh gene. From sequence, mapping and northern data we conclude this gene encodes ADH2, the major anaerobically inducible Adh gene of Petunia. The availability of both Adh1 and Adh2 from Petunia has permitted us to compare their structures and patterns of expression to those of the well-studied Adh genes of maize, of which one is highly expressed developmentally, while both are induced in response to hypoxia. Despite their evolutionary distance, evidenced by deduced amino acid sequence as well as taxonomic classification, the pairs of genes are regulated in strikingly similar ways in maize and Petunia. Our findings suggest a significant biological basis for the regulatory strategy employed by these distant species for differential expression of multiple Adh genes. PMID:8096485

  4. Opossum alcohol dehydrogenases: Sequences, structures, phylogeny and evolution: evidence for the tandem location of ADH genes on opossum chromosome 5.

    PubMed

    Holmes, Roger S

    2009-03-16

    BLAT (BLAST-Like Alignment Tool) analyses and interrogations of the recently published opossum genome were undertaken using previously reported rat ADH amino acid sequences. Evidence is presented for six opossum ADH genes localized on chromosome 5 and organized in a comparable ADH gene cluster to that reported for human and rat ADH genes. The predicted amino acid sequences and secondary structures for the opossum ADH subunits and the intron-exon boundaries for opossum ADH genes showed a high degree of similarity with other mammalian ADHs, and four opossum ADH classes were identified, namely ADH1, ADH3, ADH6 and ADH4 (for which three genes were observed: ADH4A, ADH4B and ADH4C). Previous biochemical analyses of opossum ADHs have reported the tissue distribution and properties for these enzymes: ADH1, the major liver enzyme; ADH3, widely distributed in opossum tissues with similar kinetic properties to mammalian class 3 ADHs; and ADH4, for which several forms were localized in extrahepatic tissues, especially in the digestive system and in the eye. These ADHs are likely to perform similar functions to those reported for other mammalian ADHs in the metabolism of ingested and endogenous alcohols and aldehydes. Phylogenetic analyses examined opossum, human, rat, chicken and cod ADHs, and supported the proposed designation of opossum ADHs as class I (ADH1), class III (ADH3), class IV (ADH4A, ADH4B and ADH4C) and class VI (ADH6). Percentage substitution rates were examined for ADHs during vertebrate evolution which indicated that ADH3 is evolving at a much slower rate to that of the other ADH classes.

  5. The Alcohol Dehydrogenase Gene Family in Melon (Cucumis melo L.): Bioinformatic Analysis and Expression Patterns

    PubMed Central

    Jin, Yazhong; Zhang, Chong; Liu, Wei; Tang, Yufan; Qi, Hongyan; Chen, Hao; Cao, Songxiao

    2016-01-01

    Alcohol dehydrogenases (ADH), encoded by multigene family in plants, play a critical role in plant growth, development, adaptation, fruit ripening and aroma production. Thirteen ADH genes were identified in melon genome, including 12 ADHs and one formaldehyde dehydrogenease (FDH), designated CmADH1-12 and CmFDH1, in which CmADH1 and CmADH2 have been isolated in Cantaloupe. ADH genes shared a lower identity with each other at the protein level and had different intron-exon structure at nucleotide level. No typical signal peptides were found in all CmADHs, and CmADH proteins might locate in the cytoplasm. The phylogenetic tree revealed that 13 ADH genes were divided into three groups respectively, namely long-, medium-, and short-chain ADH subfamily, and CmADH1,3-11, which belongs to the medium-chain ADH subfamily, fell into six medium-chain ADH subgroups. CmADH12 may belong to the long-chain ADH subfamily, while CmFDH1 may be a Class III ADH and serve as an ancestral ADH in melon. Expression profiling revealed that CmADH1, CmADH2, CmADH10 and CmFDH1 were moderately or strongly expressed in different vegetative tissues and fruit at medium and late developmental stages, while CmADH8 and CmADH12 were highly expressed in fruit after 20 days. CmADH3 showed preferential expression in young tissues. CmADH4 only had slight expression in root. Promoter analysis revealed several motifs of CmADH genes involved in the gene expression modulated by various hormones, and the response pattern of CmADH genes to ABA, IAA and ethylene were different. These CmADHs were divided into ethylene-sensitive and –insensitive groups, and the functions of CmADHs were discussed. PMID:27242871

  6. Characterization of polymorphisms of genes ADH2, ADH3, ALDH2 and CYP2E1 and relationship to the alcoholism in a Colombian population

    PubMed Central

    Méndez, Claudia

    2015-01-01

    Objective: Identify and characterize polymorphisms of genes ADH2, ADH3, ALDH2 and CYP2E1 in a Colombian population residing in the city of Bogotá and determine its possible relationship to the alcoholism. Methods: ADH2, ADH3, ALDH2, and CYP2E1 genotypes a population of 148 individuals with non-problematic alcohol and 65 individuals with alcoholism were determined with TaqMan probes and PCR-RFLP. DNA was obtained from peripheral blood white cells. Results: Significant difference was found in family history of alcoholism and use of other psychoactive substances to compare alcoholics with controls. When allelic frequencies for each category (gender) were considered, frequency of A2 allele carriers in ADH2 was found higher in male patients than controls. In women, the relative frequency for c1 allele in CYP2E1 was lower in controls than alcoholics. The ALDH2 locus is monomorphic. No significant differences in allele distributions of the loci examined to compare two populations were observed, however when stratifying the same trend was found that these differences tended to be significant. Conclusions: This study allows us to conclude the positive association between family history of alcoholism and alcoholism suggesting that there is a favourable hereditary predisposition. Since substance dependence requires interaction of multiple genes, the combination of genotypes ADH2 * 2, CYP2E1 * 1 combined with genotype homozygous ALDH2 * 1 found in this study could be leading to the population to a potential risk to alcoholism. PMID:26848198

  7. Isolation and DNA sequence of ADH3, a nuclear gene encoding the mitochondrial isozyme of alcohol dehydrogenase in Saccharomyces cerevisiae.

    PubMed Central

    Young, E T; Pilgrim, D

    1985-01-01

    The Saccharomyces cerevisiae nuclear gene, ADH3, that encodes the mitochondrial alcohol dehydrogenase isozyme ADH III was cloned by virtue of its nucleotide homology to ADH1 and ADH2. Both chromosomal and plasmid-encoded ADH III isozymes were repressed by glucose and migrated heterogeneously on nondenaturing gels. Nucleotide sequence analysis indicated 73 and 74% identity for ADH3 with ADH1 and ADH2, respectively. The amino acid identity between the predicted ADH III polypeptide and ADH I and ADH II was 79 and 80%, respectively. The open reading frame encoding ADH III has a highly basic 27-amino-acid amino-terminal extension relative to ADH I and ADH II. The nucleotide sequence of the presumed leader peptide has a high degree of identity with the untranslated leader regions of ADH1 and ADH2 mRNAs. A strain containing a null allele of ADH3 did not have a detectably altered phenotype. The cloned gene integrated at the ADH3 locus, indicating that this is the structural gene for ADH III. Images PMID:2943982

  8. Genome-wide responses to carbonyl electrophiles in Bacillus subtilis: control of the thiol-dependent formaldehyde dehydrogenase AdhA and cysteine proteinase YraA by the MerR-family regulator YraB (AdhR).

    PubMed

    Nguyen, Thi Thu Huyen; Eiamphungporn, Warawan; Mäder, Ulrike; Liebeke, Manuel; Lalk, Michael; Hecker, Michael; Helmann, John D; Antelmann, Haike

    2009-02-01

    Quinones and alpha,beta-unsaturated carbonyls are naturally occurring electrophiles that target cysteine residues via thiol-(S)-alkylation. We analysed the global expression profile of Bacillus subtilis to the toxic carbonyls methylglyoxal (MG) and formaldehyde (FA). Both carbonyl compounds cause a stress response characteristic for thiol-reactive electrophiles as revealed by the induction of the Spx, CtsR, CymR, PerR, ArsR, CzrA, CsoR and SigmaD regulons. MG and FA triggered also a SOS response which indicates DNA damage. Protection against FA is mediated by both the hxlAB operon, encoding the ribulose monophosphate pathway for FA fixation, and a thiol-dependent formaldehyde dehydrogenase (AdhA) and DJ-1/PfpI-family cysteine proteinase (YraA). The adhA-yraA operon and the yraC gene, encoding a gamma-carboxymuconolactone decarboxylase, are positively regulated by the MerR-family regulator, YraB(AdhR). AdhR binds specifically to its target promoters which contain a 7-4-7 inverted repeat (CTTAAAG-N4-CTTTAAG) between the -35 and -10 elements. Activation of adhA-yraA transcription by AdhR requires the conserved Cys52 residue in vivo. We speculate that AdhR is redox-regulated via thiol-(S)-alkylation by aldehydes and that AdhA and YraA are specifically involved in reduction of aldehydes and degradation or repair of damaged thiol-containing proteins respectively.

  9. Replication Study of ESCC Susceptibility Genetic Polymorphisms Locating in the ADH1B-ADH1C-ADH7 Cluster Identified by GWAS

    PubMed Central

    Xu, Xiaoling; Pan, Wenting; Ge, Yunxia; Zhou, Changchun; Liu, Chao; Gao, Jia; Yang, Ming; Mao, Weimin

    2014-01-01

    China was one of the countries with highest esophageal squamous cell carcinoma (ESCC) incidence and mortality worldwide. Alcohol drinking has been identified as a major environmental risk-factor related to ESCC. The alcohol dehydrogenase (ADH) family are major enzymes involved in the alcohol-metabolizing pathways, including alcohol dehydrogenase 1B (ADH1B) and ADH1C. Interestingly, ADH1B and ADH1C genes locate tandemly with ADH7 in a genomic segment as a gene cluster, and are all polymorphic. Several ESCC susceptibility single nucleotide polymorphisms (SNPs) of the ADH1B-ADH1C-ADH7 cluster have been identified previously through a genome-wide association study (GWAS). In the study, we examined the association between five ADH1B-ADH1C-ADH7 cluster SNPs (rs1042026, rs17033, rs1614972, rs1789903 and rs17028973) and risk of developing ESCC. Genotypes were determined in two independent case-control sets from two regions of China. Odds ratios (ORs) and 95% confidence intervals (CIs) were estimated by logistic regression. Our data demonstrated that these ADH1B-ADH1C-ADH7 cluster SNPs confer susceptibility to ESCC in these two case-control sets, which were consistent to results of the previous GWAS. PMID:24722735

  10. Replication study of ESCC susceptibility genetic polymorphisms locating in the ADH1B-ADH1C-ADH7 cluster identified by GWAS.

    PubMed

    Wang, Jiwen; Wei, Jinyu; Xu, Xiaoling; Pan, Wenting; Ge, Yunxia; Zhou, Changchun; Liu, Chao; Gao, Jia; Yang, Ming; Mao, Weimin

    2014-01-01

    China was one of the countries with highest esophageal squamous cell carcinoma (ESCC) incidence and mortality worldwide. Alcohol drinking has been identified as a major environmental risk-factor related to ESCC. The alcohol dehydrogenase (ADH) family are major enzymes involved in the alcohol-metabolizing pathways, including alcohol dehydrogenase 1B (ADH1B) and ADH1C. Interestingly, ADH1B and ADH1C genes locate tandemly with ADH7 in a genomic segment as a gene cluster, and are all polymorphic. Several ESCC susceptibility single nucleotide polymorphisms (SNPs) of the ADH1B-ADH1C-ADH7 cluster have been identified previously through a genome-wide association study (GWAS). In the study, we examined the association between five ADH1B-ADH1C-ADH7 cluster SNPs (rs1042026, rs17033, rs1614972, rs1789903 and rs17028973) and risk of developing ESCC. Genotypes were determined in two independent case-control sets from two regions of China. Odds ratios (ORs) and 95% confidence intervals (CIs) were estimated by logistic regression. Our data demonstrated that these ADH1B-ADH1C-ADH7 cluster SNPs confer susceptibility to ESCC in these two case-control sets, which were consistent to results of the previous GWAS.

  11. Effects of glucose, ethanol and acetic acid on regulation of ADH2 gene from Lachancea fermentati

    PubMed Central

    Yaacob, Norhayati; Salleh, Abu Bakar; Abdul Rahman, Nor Aini

    2016-01-01

    Background. Not all yeast alcohol dehydrogenase 2 (ADH2) are repressed by glucose, as reported in Saccharomyces cerevisiae. Pichia stipitis ADH2 is regulated by oxygen instead of glucose, whereas Kluyveromyces marxianus ADH2 is regulated by neither glucose nor ethanol. For this reason, ADH2 regulation of yeasts may be species dependent, leading to a different type of expression and fermentation efficiency. Lachancea fermentati is a highly efficient ethanol producer, fast-growing cells and adapted to fermentation-related stresses such as ethanol and organic acid, but the metabolic information regarding the regulation of glucose and ethanol production is still lacking. Methods. Our investigation started with the stimulation of ADH2 activity from S. cerevisiae and L. fermentati by glucose and ethanol induction in a glucose-repressed medium. The study also embarked on the retrospective analysis of ADH2 genomic and protein level through direct sequencing and sites identification. Based on the sequence generated, we demonstrated ADH2 gene expression highlighting the conserved NAD(P)-binding domain in the context of glucose fermentation and ethanol production. Results. An increase of ADH2 activity was observed in starved L. fermentati (LfeADH2) and S. cerevisiae (SceADH2) in response to 2% (w/v) glucose induction. These suggest that in the presence of glucose, ADH2 activity was activated instead of being repressed. An induction of 0.5% (v/v) ethanol also increased LfeADH2 activity, promoting ethanol resistance, whereas accumulating acetic acid at a later stage of fermentation stimulated ADH2 activity and enhanced glucose consumption rates. The lack in upper stream activating sequence (UAS) and TATA elements hindered the possibility of Adr1 binding to LfeADH2. Transcription factors such as SP1 and RAP1 observed in LfeADH2 sequence have been implicated in the regulation of many genes including ADH2. In glucose fermentation, L. fermentati exhibited a bell-shaped ADH2

  12. The Xenopus alcohol dehydrogenase gene family: characterization and comparative analysis incorporating amphibian and reptilian genomes

    PubMed Central

    2014-01-01

    Background The alcohol dehydrogenase (ADH) gene family uniquely illustrates the concept of enzymogenesis. In vertebrates, tandem duplications gave rise to a multiplicity of forms that have been classified in eight enzyme classes, according to primary structure and function. Some of these classes appear to be exclusive of particular organisms, such as the frog ADH8, a unique NADP+-dependent ADH enzyme. This work describes the ADH system of Xenopus, as a model organism, and explores the first amphibian and reptilian genomes released in order to contribute towards a better knowledge of the vertebrate ADH gene family. Results Xenopus cDNA and genomic sequences along with expressed sequence tags (ESTs) were used in phylogenetic analyses and structure-function correlations of amphibian ADHs. Novel ADH sequences identified in the genomes of Anolis carolinensis (anole lizard) and Pelodiscus sinensis (turtle) were also included in these studies. Tissue and stage-specific libraries provided expression data, which has been supported by mRNA detection in Xenopus laevis tissues and regulatory elements in promoter regions. Exon-intron boundaries, position and orientation of ADH genes were deduced from the amphibian and reptilian genome assemblies, thus revealing syntenic regions and gene rearrangements with respect to the human genome. Our results reveal the high complexity of the ADH system in amphibians, with eleven genes, coding for seven enzyme classes in Xenopus tropicalis. Frogs possess the amphibian-specific ADH8 and the novel ADH1-derived forms ADH9 and ADH10. In addition, they exhibit ADH1, ADH2, ADH3 and ADH7, also present in reptiles and birds. Class-specific signatures have been assigned to ADH7, and ancestral ADH2 is predicted to be a mixed-class as the ostrich enzyme, structurally close to mammalian ADH2 but with class-I kinetic properties. Remarkably, many ADH1 and ADH7 forms are observed in the lizard, probably due to lineage-specific duplications. ADH4 is not

  13. Molecular Characterization and Transcriptional Analysis of adhE2, the Gene Encoding the NADH-Dependent Aldehyde/Alcohol Dehydrogenase Responsible for Butanol Production in Alcohologenic Cultures of Clostridium acetobutylicum ATCC 824

    PubMed Central

    Fontaine, Lisa; Meynial-Salles, Isabelle; Girbal, Laurence; Yang, Xinghong; Croux, Christian; Soucaille, Philippe

    2002-01-01

    The adhE2 gene of Clostridium acetobutylicum ATCC 824, coding for an aldehyde/alcohol dehydrogenase (AADH), was characterized from molecular and biochemical points of view. The 2,577-bp adhE2 codes for a 94.4-kDa protein. adhE2 is expressed, as a monocistronic operon, in alcohologenic cultures and not in solventogenic cultures. Primer extension analysis identified two transcriptional start sites 160 and 215 bp upstream of the adhE2 start codon. The expression of adhE2 from a plasmid in the DG1 mutant of C. acetobutylicum, a mutant cured of the pSOL1 megaplasmid, restored butanol production and provided elevated activities of NADH-dependent butyraldehyde and butanol dehydrogenases. The recombinant AdhE2 protein expressed in E. coli as a Strep-tag fusion protein and purified to homogeneity also demonstrated NADH-dependent butyraldehyde and butanol dehydrogenase activities. This is the second AADH identified in C. acetobutylicum ATCC 824, and to our knowledge this is the first example of a bacterium with two AADHs. It is noteworthy that the two corresponding genes, adhE and adhE2, are carried by the pSOL1 megaplasmid of C. acetobutylicum ATCC 824. PMID:11790753

  14. Increased Variation in Adh Enzyme Activity in Drosophila Mutation-Accumulation Experiment Is Not Due to Transposable Elements at the Adh Structural Gene

    PubMed Central

    Aquadro, C. F.; Tachida, H.; Langley, C. H.; Harada, K.; Mukai, T.

    1990-01-01

    We present here a molecular analysis of the region surrounding the structural gene encoding alcohol dehydrogenase (Adh) in 47 lines of Drosophila melanogaster that have each accumulated mutations for 300 generations. While these lines show a significant increase in variation of alcohol dehydrogenase enzyme activity compared to control lines, we found no restriction map variation in a 13-kb region including the complete Adh structural gene and roughly 5 kb of both 5' and 3' sequences. Thus, the rapid accumulation of ADH activity variation after 28,200 allele generations does not appear to have been due to the mobilization of transposable elements into or out of the Adh structural gene region. PMID:1963870

  15. ADH5 — EDRN Public Portal

    Cancer.gov

    ADH5 is a member of the alcohol dehydrogenase family. This protein forms a homodimer. ADH5 is ineffective in oxidizing ethanol, but exhibits high activity for oxidation of long-chain primary alcohols and for oxidation of S-hydroxymethyl-glutathione, a spontaneous adduct between formaldehyde and glutathione. There are several non-transcribed pseuodogenes related to this gene.

  16. Molecular cloning of alcohol dehydrogenase genes of the yeast Pichia stipitis and identification of the fermentative ADH.

    PubMed

    Passoth, V; Schäfer, B; Liebel, B; Weierstall, T; Klinner, U

    1998-10-01

    Two Pichia stipitis ADH genes (PsADH1 and PsADH2) were isolated by complementation of a Saccharomyces cerevisiae Adh(-)-mutant. The genes enabled the transformants to grow in the presence of antimycin A on glucose, to use ethanol as sole carbon source and made them sensitive to allylalcohol. The sequences of the genes showed similarities of 70-77% to sequences of ADH genes of Candida albicans, Kluyveromyces lactis, K. marxianus, and S. cerevisiae and about 60% homology to those of Schizosaccharomyces pombe and Aspergillus flavus. Southern hybridization experiments suggested that P. stipitis has only these two ADH genes. Both genes are located on the largest chromosome of P. stipitis. PsADH2 encodes for the ADH activity that is responsible for ethanol formation at oxygen limitation. The gene is regulated at the transcriptional level. Moreover, also in cells grown on ethanol, only PsADH2 transcript was found. PsADH1 transcript was detected under aerobic conditions on fermentable carbon sources.

  17. Temperature and water loss affect ADH activity and gene expression in grape berry during postharvest dehydration.

    PubMed

    Cirilli, Marco; Bellincontro, Andrea; De Santis, Diana; Botondi, Rinaldo; Colao, Maria Chiara; Muleo, Rosario; Mencarelli, Fabio

    2012-05-01

    Clusters of Aleatico wine grape were picked at 18°Brix and placed at 10, 20, or 30°C, 45% relative humidity (RH) and 1.5m/s of air flow to dehydrate the berries up to 40% of loss of initial fresh weight. Sampling was done at 0%, 10%, 20%, 30%, and 40% weight loss (wl). ADH (alcohol dehydrogenase) gene expression, enzyme activity, and related metabolites were analysed. At 10°C, acetaldehyde increased rapidly and then declined, while ethanol continued to rise. At 20°C, acetaldehyde and ethanol increased significantly with the same pattern and declined at 40%wl. At 30°C, acetaldehyde did not increase but ethanol increased rapidly already at 10%wl. At the latter temperature, a significant increase in acetic acid and ethyl acetate occurred, while at 10°C their values were low. At 30°C, the ADH activity (ethanol to acetaldehyde direction), increased rapidly but acetaldehyde did not rise because of its oxidation to acetic acid, which increased together with ethyl acetate. At 10°C, the ADH activity increased at 20%wl and continued to rise even at 40%wl, meaning that ethanol oxidation was delayed. At 20°C, the behaviour was intermediate to the other temperatures. The relative expression of the VvAdh2 gene was the highest at 10°C already at 10%wl in a synchrony with the ADH activity, indicating a rapid response likely due to low temperature. The expression subsequently declined. At 20 and 30°C, the expression was lower and increased slightly during dehydration in combination with the ADH activity. This imbalance between gene expression and ADH activity at 10°C, as well as the unexpected expression of the carotenoid cleavage dioxygenase 1 (CCD1) gene, opens the discussion on the stress sensitivity and transcription event during postharvest dehydration, and the importance of carefully monitoring temperature during dehydration.

  18. The ADH1B and DRD2 gene polymorphism may modify the protective effect of the ALDH2 gene against heroin dependence.

    PubMed

    Wang, Tzu-Yun; Lee, Sheng-Yu; Chen, Shiou-Lan; Chang, Yun-Hsuan; Chen, Shih-Heng; Chu, Chun-Hsien; Huang, San-Yuan; Tzeng, Nian-Sheng; Wang, Chen-Lin; Yeh, Pin-Hsi; Lee, I Hui; Yeh, Tzung Lieh; Yang, Yen Kuang; Lu, Ru-Band

    2013-06-03

    Understanding the influences of genes involved in dopamine and serotonin metabolism, such as the aldehyde dehydrogenase 2 (ALDH2) and alcohol dehydrogenase 1B (ADH1B) genes, is critical for understanding addictive behavior. In addition, dopamine D2 receptor (DRD2) gene may also interact with the dopamine metabolizing genes and link to addiction. Therefore, we investigated the association between the ALDH2, ADH1B and DRD2 polymorphisms and heroin dependence. Heroin-dependent Han Chinese patients (n=304) and healthy controls (n=335) were recruited. Genotypes of ALDH2, ADH1B and DRD2 polymorphisms were analyzed using a polymerase chain reaction with restriction fragment length polymorphism. The frequency of the ALDH2*1/*1 genotype was significantly lower in heroin-dependent patients than in controls, but the frequency of ADH1B and DRD2 genotypes was not significantly different. Further stratification of the ALDH2 gene with the ADH1B gene showed that the protective effect of ALDH2*1/*1 existed only in patients who also carried the ADH1B*1/*1 and ADH1B*1/*2 genotype. Logistic regression analysis showed a significant interaction between ALDH2 and ADH1B (P=0.022) and DRD2, ALDH2 and ADH1B in patients (P=0.037). The ALDH2*1/*1, ADH1B*1/*1, and ADH1B*1/*2 genotypes may interact and protect their carriers against heroin dependence and the protective effect may be varied by the DRD2 gene polymorphism. We conclude that the protective effect of the ALDH2 polymorphism against heroin dependence may be modified by the ADH1B and DRD2 polymorphism.

  19. Polymorphisms in Alcohol Metabolism Genes ADH1B and ALDH2, Alcohol Consumption and Colorectal Cancer

    PubMed Central

    Crous-Bou, Marta; Rennert, Gad; Cuadras, Daniel; Salazar, Ramon; Cordero, David; Saltz Rennert, Hedy; Lejbkowicz, Flavio; Kopelovich, Levy; Monroe Lipkin, Steven; Bernard Gruber, Stephen; Moreno, Victor

    2013-01-01

    Background Colorectal cancer (CRC) is a leading cause of cancer death worldwide. Epidemiological risk factors for CRC included alcohol intake, which is mainly metabolized to acetaldehyde by alcohol dehydrogenase and further oxidized to acetate by aldehyde dehydrogenase; consequently, the role of genes in the alcohol metabolism pathways is of particular interest. The aim of this study is to analyze the association between SNPs in ADH1B and ALDH2 genes and CRC risk, and also the main effect of alcohol consumption on CRC risk in the study population. Methodology/Principal Findings SNPs from ADH1B and ALDH2 genes, included in alcohol metabolism pathway, were genotyped in 1694 CRC cases and 1851 matched controls from the Molecular Epidemiology of Colorectal Cancer study. Information on clinicopathological characteristics, lifestyle and dietary habits were also obtained. Logistic regression and association analysis were conducted. A positive association between alcohol consumption and CRC risk was observed in male participants from the Molecular Epidemiology of Colorectal Cancer study (MECC) study (OR = 1.47; 95%CI = 1.18-1.81). Moreover, the SNPs rs1229984 in ADH1B gene was found to be associated with CRC risk: under the recessive model, the OR was 1.75 for A/A genotype (95%CI = 1.21-2.52; p-value = 0.0025). A path analysis based on structural equation modeling showed a direct effect of ADH1B gene polymorphisms on colorectal carcinogenesis and also an indirect effect mediated through alcohol consumption. Conclusions/Significance Genetic polymorphisms in the alcohol metabolism pathways have a potential role in colorectal carcinogenesis, probably due to the differences in the ethanol metabolism and acetaldehyde oxidation of these enzyme variants. PMID:24282520

  20. High diversity and no significant selection signal of human ADH1B gene in Tibet

    PubMed Central

    2012-01-01

    Background ADH1B is one of the most studied human genes with many polymorphic sites. One of the single nucleotide polymorphism (SNP), rs1229984, coding for the Arg48His substitution, have been associated with many serious diseases including alcoholism and cancers of the digestive system. The derived allele, ADH1B*48His, reaches high frequency only in East Asia and Southwest Asia, and is highly associated with agriculture. Micro-evolutionary study has defined seven haplogroups for ADH1B based on seven SNPs encompassing the gene. Three of those haplogroups, H5, H6, and H7, contain the ADH1B*48His allele. H5 occurs in Southwest Asia and the other two are found in East Asia. H7 is derived from H6 by the derived allele of rs3811801. The H7 haplotype has been shown to have undergone significant positive selection in Han Chinese, Hmong, Koreans, Japanese, Khazak, Mongols, and so on. Methods In the present study, we tested whether Tibetans also showed evidence for selection by typing 23 SNPs in the region covering the ADH1B gene in 1,175 individuals from 12 Tibetan populations representing all districts of the Tibet Autonomous Region. Multiple statistics were estimated to examine the gene diversities and positive selection signals among the Tibetans and other populations in East Asia. Results The larger Tibetan populations (Qamdo, Lhasa, Nagqu, Nyingchi, Shannan, and Shigatse) comprised mostly farmers, have around 12% of H7, and 2% of H6. The smaller populations, living on hunting or recently switched to farming, have lower H7 frequencies (Tingri 9%, Gongbo 8%, Monba and Sherpa 6%). Luoba (2%) and Deng (0%) have even lower frequencies. Long-range haplotype analyses revealed very weak signals of positive selection for H7 among Tibetans. Interestingly, the haplotype diversity of H7 is higher in Tibetans than in any other populations studied, indicating a longer diversification history for that haplogroup in Tibetans. Network analysis on the long-range haplotypes revealed

  1. Differential interactions of promoter elements in stress responses of the Arabidopsis Adh gene.

    PubMed Central

    Dolferus, R; Jacobs, M; Peacock, W J; Dennis, E S

    1994-01-01

    The Adh (alcohol dehydrogenase, EC 1.1.1.1.) gene from Arabidopsis thaliana (L.) Heynh. can be induced by dehydration and cold, as well as by hypoxia. A 1-kb promoter fragment (CADH: -964 to +53) is sufficient to confer the stress induction and tissue-specific developmental expression characteristics of the Adh gene to a beta-glucuronidase reporter gene. Deletion mapping of the 5' end and site-specific mutagenesis identified four regions of the promoter essential for expression under the three stress conditions. Some sequence elements are important for response to all three stress treatments, whereas others are stress specific. The most critical region essential for expression of the Arabidopsis Adh promoter under all three environmental stresses (region IV: -172 to -141) contains sequences homologous to the GT motif (-160 to -152) and the GC motif (-147 to -144) of the maize Adh1 anaerobic responsive element. Region III (-235 to -172) contains two regions shown by R.J. Ferl and B.H. Laughner ([1989] Plant Mol Biol 12: 357-366) to bind regulatory proteins; mutation of the G-box-1 region (5'-CCACGTGG-3', -216 to -209) does not affect expression under uninduced or hypoxic conditions, but significantly reduces induction by cold stress and, to a lesser extent, by dehydration stress. Mutation of the other G-box-like sequence (G-box-2: 5'-CCAAGTGG-3', -193 to -182) does not change hypoxic response and affects cold and dehydration stress only slightly. G-box-2 mutations also promote high levels of expression under uninduced conditions. Deletion of region I (-964 to -510) results in increased expression under uninduced and all stress conditions, suggesting that this region contains a repressor binding site. Region II (-510 to -384) contains a positive regulatory element and is necessary for high expression levels under all treatments. PMID:7972489

  2. ADH single nucleotide polymorphism associations with alcohol metabolism in vivo

    PubMed Central

    Birley, Andrew J.; James, Michael R.; Dickson, Peter A.; Montgomery, Grant W.; Heath, Andrew C.; Martin, Nicholas G.; Whitfield, John B.

    2009-01-01

    We have previously found that variation in alcohol metabolism in Europeans is linked to the chromosome 4q region containing the ADH gene family. We have now typed 103 single nucleotide polymorphisms (SNPs) across this region to test for allelic associations with variation in blood and breath alcohol concentrations after an alcohol challenge. In vivo alcohol metabolism was modelled with three parameters that identified the absorption and rise of alcohol concentration following ingestion, and the rate of elimination. Alleles of ADH7 SNPs were associated with the early stages of alcohol metabolism, with additional effects in the ADH1A, ADH1B and ADH4 regions. Rate of elimination was associated with SNPs in the intragenic region between ADH7 and ADH1C, and across ADH1C and ADH1B. SNPs affecting alcohol metabolism did not correspond to those reported to affect alcohol dependence or alcohol-related disease. The combined SNP associations with early- and late-stage metabolism only account for approximately 20% of the total genetic variance linked to the ADH region, and most of the variance for in vivo alcohol metabolism linked to this region is yet to be explained. PMID:19193628

  3. The Analysis of Polymorphism of Alcohol Dehydrogenase 3 (ADH3) Gene and Influence of Liver Function Status in Indonesia.

    PubMed

    Suhartini; Mustofa; Nurhantari, Yudha; Rianto, Bambang Udji Djoko

    2017-01-31

    Indonesian culture actually has no historical record of behaviors in consuming alcohol, but there are many recent reports of alcohol abuse among Asian people involving their traditional drink. In genotype studies, the damage of the liver caused by consuming alcohol is influenced by the presence of the polymorphism enzyme gene. The lack of study regarding such topic is a signal to further investigate ADH3 gene distribution and its effect on liver function status. The total of 197 research subjects of Javanese descent received alcohol dehydrogenase 3 (ADH3) genetic polymorphism and liver status tests in the city of Yogyakarta, Indonesian. An analytical study with a cross-sectional design was then conducted on the subjects, with the resulting isolated DNAs amplified through polymerase chain reaction (PCR). The genotype of ADH3 was determined by means of restriction fragment length polymorphism (RFLP) using Ssp1 restricting enzyme. Liver function status was assessed by measuring serum glutamic oxaloacetic transaminase (SGOT), serum glutamic pyruvate transaminase (SGPT) and gamma glutamyl transferase (GGT) using a photometric system. Gene types of ADH3*1 (2.1%), ADH3*2 (82.7%) and ADH3*1/3*2 (15.2%) on the subjects were concluded, finding that there is no difference between the gender. In conclusion most of the ADH3 gene polymorphism of the subjects were ADH3*2 (82.7%). The influence of genetic polymorphisms on the status of liver function in the subjects showed significant difference according to GGT measurement, but the same cannot be said on the other two values measuring SGOT and SGPT.

  4. The Arabidopsis Adh gene exhibits diverse nucleosome arrangements within a small DNase I-sensitive domain.

    PubMed Central

    Vega-Palas, M A; Ferl, R J

    1995-01-01

    The alcohol dehydrogenase (Adh) gene from Arabidopsis shows enhanced sensitivity to DNase I in cells that express the gene. This generalized sensitivity to DNase I is demarcated by position -500 on the 5' side and the end of the mRNA on the 3' side. Thus, the gene defined as the promoter and mRNA coding region corresponds very closely in size with the gene defined as a nuclease-sensitive domain. This is a remarkably close correspondence between a sensitive domain and a eukaryotic transcriptional unit, because previously reported DNase I-sensitive domains include large regions of DNA that are not transcribed. Nucleosomes are present in the coding region of the Adh gene when it is expressed, indicating that the transcriptional elongation process causes nucleosome disruption rather than release of nucleosomes from the coding region. In addition, the regulatory region contains a loosely positioned nucleosome that is separated from adjacent nucleosomes by internucleosomic DNA segments longer than the average linker DNA in bulk chromatin. This specific array of nucleosomes coexists with bound transcription factors that could contribute to the organization of the nucleosome arrangement. These results enhance our understanding of the complex interactions among DNA, nucleosomes, and transcription factors during gene expression in plants. PMID:8535143

  5. Cloning of the Arabidopsis and Rice Formaldehyde Dehydrogenase Genes: Implications for the Origin of Plant Adh Enzymes

    PubMed Central

    Dolferus, R.; Osterman, J. C.; Peacock, W. J.; Dennis, E. S.

    1997-01-01

    This article reports the cloning of the genes encoding the Arabidopsis and rice class III ADH enzymes, members of the alcohol dehydrogenase or medium chain reductase/dehydrogenase superfamily of proteins with glutathione-dependent formaldehyde dehydrogenase activity (GSH-FDH). Both genes contain eight introns in exactly the same positions, and these positions are conserved in plant ethanol-active Adh genes (class P). These data provide further evidence that plant class P genes have evolved from class III genes by gene duplication and acquisition of new substrate specificities. The position of introns and similarities in the nucleic acid and amino acid sequences of the different classes of ADH enzymes in plants and humans suggest that plant and animal class III enzymes diverged before they duplicated to give rise to plant and animal ethanol-active ADH enzymes. Plant class P ADH enzymes have gained substrate specificities and evolved promoters with different expression properties, in keeping with their metabolic function as part of the alcohol fermentation pathway. PMID:9215914

  6. Alcohol dehydrogenase gene ADH3 activates glucose alcoholic fermentation in genetically engineered Dekkera bruxellensis yeast.

    PubMed

    Schifferdecker, Anna Judith; Siurkus, Juozas; Andersen, Mikael Rørdam; Joerck-Ramberg, Dorte; Ling, Zhihao; Zhou, Nerve; Blevins, James E; Sibirny, Andriy A; Piškur, Jure; Ishchuk, Olena P

    2016-04-01

    Dekkera bruxellensis is a non-conventional Crabtree-positive yeast with a good ethanol production capability. Compared to Saccharomyces cerevisiae, its tolerance to acidic pH and its utilization of alternative carbon sources make it a promising organism for producing biofuel. In this study, we developed an auxotrophic transformation system and an expression vector, which enabled the manipulation of D. bruxellensis, thereby improving its fermentative performance. Its gene ADH3, coding for alcohol dehydrogenase, was cloned and overexpressed under the control of the strong and constitutive promoter TEF1. Our recombinant D. bruxellensis strain displayed 1.4 and 1.7 times faster specific glucose consumption rate during aerobic and anaerobic glucose fermentations, respectively; it yielded 1.2 times and 1.5 times more ethanol than did the parental strain under aerobic and anaerobic conditions, respectively. The overexpression of ADH3 in D. bruxellensis also reduced the inhibition of fermentation by anaerobiosis, the "Custer effect". Thus, the fermentative capacity of D. bruxellensis could be further improved by metabolic engineering.

  7. A distinct type of alcohol dehydrogenase, adh4+, complements ethanol fermentation in an adh1-deficient strain of Schizosaccharomyces pombe.

    PubMed

    Sakurai, Masao; Tohda, Hideki; Kumagai, Hiromichi; Giga-Hama, Yuko

    2004-03-01

    In the fission yeast Schizosaccharomyces pombe, only one alcohol dehydrogenase gene, adh1(+), has been identified. To elucidate the influence of adh1(+) on ethanol fermentation, we constructed the adh1 null strain (delta adh1). The delta adh1 cells still produced ethanol and grew fermentatively as the wild-type cells. Both DNA microarray and RT-PCR analysis demonstrated that this ethanol production is caused by the enhanced expression of a Saccharomyces cerevisiae ADH4-like gene product (SPAC5H10.06C named adh4(+)). Since the strain lacking both adh1 and adh4 genes (delta adh1 delta adh4) showed non-fermentative retarded growth, only these two ADHs produce ethanol for fermentative growth. This is the first observation that a S. cerevisiae ADH4-like alcohol dehydrogenase functions in yeast ethanol fermentation.

  8. SPINK1, ADH2, and ALDH2 gene variants and alcoholic chronic pancreatitis in Japan.

    PubMed

    Shimosegawa, Tooru; Kume, Kiyoshi; Masamune, Atsushi

    2008-03-01

    The serine protease inhibitor Kazal type 1 (SPINK1) is a potent antiprotease and an important inactivation factor of intrapancreatic trypsin activity. Loss of function by the SPINK1 mutations leads to decreased inhibitory capacity. The significance of SPINK1 mutations in alcoholic chronic pancreatitis (CP) in Japan and its functional role remain unclear. The aim of the present study was to clarify the incidence of SPINK1, alcohol dehydrogenase 2 (ADH2) and aldehyde dehydrogenase 2 (ALDH2) variants in CP patients in Japan. One hundred and 86 patients with CP, and 527 healthy volunteers were enrolled. Mutational analyses were performed by polymerase chain reaction-restriction fragment length polymorphism and direct sequencing. Serum pancreatic secretory trypsin inhibitor (PSTI) level was measured by radioimmunoassay. The frequencies of N34S and IVS3 + 2T > C in the SPINK1 gene were significantly higher in patients with non-alcoholic CP (12.9% and 8.6%, respectively) than in normal subjects (0.37% and 0%). In total, 18 of 93 (19.4%) patients with non-alcoholic CP had at least one SPINK1 mutation. Concerning alcoholic CP, we found IVS3 + 2T > C in a small number of patients (3.9%). Serum PSTI concentration was decreased in patients with the IVS3 + 2T > C mutation. The frequency of the ADH2*2 allele in the alcoholic CP group was significantly higher than that in alcoholics without pancreatitis. The frequency of the ALDH2*2 allele was significantly low in patients with alcoholic CP compared with healthy controls. In conclusion, SPINK1 mutations were associated with non-alcoholic CP. Furthermore, we revealed the amount of wild-type PSTI was decreased in patients with IVS3 + 2T > C mutation. Variants of alcohol-metabolizing enzymes appeared in the relation to alcoholic CP.

  9. Overexpression of ADH1 and HXT1 genes in the yeast Saccharomyces cerevisiae improves the fermentative efficiency during tequila elaboration.

    PubMed

    Gutiérrez-Lomelí, Melesio; Torres-Guzmán, Juan Carlos; González-Hernández, Gloria Angélica; Cira-Chávez, Luis Alberto; Pelayo-Ortiz, Carlos; Ramírez-Córdova, Jose de Jesús

    2008-05-01

    This work assessed the effect of the overexpression of ADH1 and HXT1 genes in the Saccharomyces cerevisiae AR5 strain during fermentation of Agave tequilana Weber blue variety must. Both genes were cloned individually and simultaneously into a yeast centromere plasmid. Two transformant strains overexpressing ADH1 and HXT1 individually and one strain overexpressing both genes were randomly selected and named A1, A3 and A5 respectively. Overexpression effect on growth and ethanol production of the A1, A3 and A5 strains was evaluated in fermentative conditions in A. tequilana Weber blue variety must and YPD medium. During growth in YPD and Agave media, all the recombinant strains showed lower cell mass formation than the wild type AR5 strain. Adh enzymatic activity in the recombinant strains A1 and A5 cultivated in A. tequilana and YPD medium was higher than in the wild type. The overexpression of both genes individually and simultaneously had no significant effect on ethanol formation; however, the fermentative efficiency of the A5 strain increased from 80.33% to 84.57% and 89.40% to 94.29% in YPD and Agave medium respectively.

  10. Multiway real-time PCR gene expression profiling in yeast Saccharomyces cerevisiae reveals altered transcriptional response of ADH-genes to glucose stimuli

    PubMed Central

    Ståhlberg, Anders; Elbing, Karin; Andrade-Garda, José Manuel; Sjögreen, Björn; Forootan, Amin; Kubista, Mikael

    2008-01-01

    Background The large sensitivity, high reproducibility and essentially unlimited dynamic range of real-time PCR to measure gene expression in complex samples provides the opportunity for powerful multivariate and multiway studies of biological phenomena. In multiway studies samples are characterized by their expression profiles to monitor changes over time, effect of treatment, drug dosage etc. Here we perform a multiway study of the temporal response of four yeast Saccharomyces cerevisiae strains with different glucose uptake rates upon altered metabolic conditions. Results We measured the expression of 18 genes as function of time after addition of glucose to four strains of yeast grown in ethanol. The data are analyzed by matrix-augmented PCA, which is a generalization of PCA for 3-way data, and the results are confirmed by hierarchical clustering and clustering by Kohonen self-organizing map. Our approach identifies gene groups that respond similarly to the change of nutrient, and genes that behave differently in mutant strains. Of particular interest is our finding that ADH4 and ADH6 show a behavior typical of glucose-induced genes, while ADH3 and ADH5 are repressed after glucose addition. Conclusion Multiway real-time PCR gene expression profiling is a powerful technique which can be utilized to characterize functions of new genes by, for example, comparing their temporal response after perturbation in different genetic variants of the studied subject. The technique also identifies genes that show perturbed expression in specific strains. PMID:18412983

  11. Cellulosic Ethanol Production by Recombinant Cellulolytic Bacteria Harbouring pdc and adh II Genes of Zymomonas mobilis

    PubMed Central

    Piriya, P. Sobana; Vasan, P. Thirumalai; Padma, V. S.; Vidhyadevi, U.; Archana, K.; Vennison, S. John

    2012-01-01

    The ethanol fermenting genes such as pyruvate decarboxylase (pdc) and alcohol dehydrogenase II (adh II) were cloned from Zymomonas mobilis and transformed into three different cellulolytic bacteria, namely Enterobacter cloacae JV, Proteus mirabilis JV and Erwinia chrysanthemi and their cellulosic ethanol production capability was studied. Recombinant E. cloacae JV was found to produce 4.5% and 3.5% (v/v) ethanol, respectively, when CMC and 4% NaOH pretreated bagasse were used as substrates, whereas recombinant P. mirabilis and E. chrysanthemi with the same substrates could only produce 4%, 3.5%, 1%, and 1.5 % of ethanol, respectively. The recombinant E. cloacae strain produced twofold higher percentage of ethanol than the wild type. The recombinant E. cloacae strain could be improved further by increasing its ethanol tolerance capability through media optimization and also by combining multigene cellulase expression for enhancing ethanol production from various types of lignocellulosic biomass so that it can be used for industrial level ethanol production. PMID:22919503

  12. Temporal expression of the human alcohol dehydrogenase gene family during liver development correlates with differential promoter activation by hepatocyte nuclear factor 1, CCAAT/enhancer-binding protein alpha, liver activator protein, and D-element-binding protein.

    PubMed Central

    van Ooij, C; Snyder, R C; Paeper, B W; Duester, G

    1992-01-01

    The human class I alcohol dehydrogenase (ADH) gene family consists of ADH1, ADH2, and ADH3, which are sequentially activated in early fetal, late fetal, and postnatal liver, respectively. Analysis of ADH promoters revealed differential activation by several factors previously shown to control liver transcription. In cotransfection assays, the ADH1 promoter, but not the ADH2 or ADH3 promoter, was shown to respond to hepatocyte nuclear factor 1 (HNF-1), which has previously been shown to regulate transcription in early liver development. The ADH2 promoter, but not the ADH1 or ADH3 promoter, was shown to respond to CCAAT/enhancer-binding protein alpha (C/EBP alpha), a transcription factor particularly active during late fetal liver and early postnatal liver development. The ADH1, ADH2, and ADH3 promoters all responded to the liver transcription factors liver activator protein (LAP) and D-element-binding protein (DBP), which are most active in postnatal liver. For all three promoters, the activation by LAP or DBP was higher than that seen by HNF-1 or C/EBP alpha, and a significant synergism between C/EBP alpha and LAP was noticed for the ADH2 and ADH3 promoters when both factors were simultaneously cotransfected. A hierarchy of ADH promoter responsiveness to C/EBP alpha and LAP homo- and heterodimers is suggested. In all three ADH genes, LAP bound to the same four sites previously reported for C/EBP alpha (i.e., -160, -120, -40, and -20 bp), but DBP bound strongly only to the site located at -40 bp relative to the transcriptional start. Mutational analysis of ADH2 indicated that the -40 bp element accounts for most of the promoter regulation by the bZIP factors analyzed. These studies suggest that HNF-1 and C/EBP alpha help establish ADH gene family transcription in fetal liver and that LAP and DBP help maintain high-level ADH gene family transcription in postnatal liver. Images PMID:1620113

  13. Regulation of nitrogen metabolism, starch utilisation and the beta-hbd-adh1 gene cluster in Clostridium acetobutylicum.

    PubMed

    Woods, D R; Reid, S J

    1995-10-01

    The successful genetic manipulation of Clostridium acetobutylicum for the increased production of solvents will depend on an understanding of gene structure and regulation in the bacterium. The glutamine synthetase (glnA) gene is regulated by antisense RNA, transcribed from a downstream promoter, in the opposite direction to the glnA gene. An open reading frame (ORF) was detected downstream of the glnA gene, which has sequence homology to response regulators with anti-termination activity and may be involved in sensing nitrogen conditions. The expression of the linked beta-hbd, adh1 and fixB genes was investigated throughout the bacterial growth cycle by RNA hybridisation techniques. The adh1 gene was independently expressed as a 2.4-kb transcript which peaked at 12 h, immediately prior to the solventogenic phase. The beta-hbd and fixB genes were transcribed throughout the acidogenic and solventogenic phases. A regulator gene, regA, which complements a Bacillus subtilis ccpA mutant, has been identified and sequenced from C. acetobutylicum P262. The regA gene repressed the degradation of starch by an uncharacterised C. acetobutylicum gene, and may therefore play a role in the utilisation of carbohydrate substrates in this organism.

  14. Evidence for a role for AtMYB2 in the induction of the Arabidopsis alcohol dehydrogenase gene (ADH1) by low oxygen.

    PubMed Central

    Hoeren, F U; Dolferus, R; Wu, Y; Peacock, W J; Dennis, E S

    1998-01-01

    The transcription factor AtMYB2 binds to two sequence motifs in the promoter of the Arabidopsis ADH1 gene. The binding to the GT-motif (5'-TGGTTT-3') is essential for induction of ADH1 by low oxygen, while binding to the second motif, MBS-2, is not essential for induction. We show that AtMYB2 is induced by hypoxia with kinetics compatible with a role in the regulation of ADH1. Like ADH1, AtMYB2 has root-limited expression. When driven by a constitutive promoter, AtMYB2 is able to transactivate ADH1 expression in transient assays in both Arabidopsis and Nicotiana plumbaginifolia protoplasts, and in particle bombardment of Pisum sativum leaves. Mutation of the GT-motif abolished binding of AtMYB2 and caused loss of activity of the ADH1 promoter in both transient assays and transgenic Arabidopsis plants. These results are consistent with AtMYB2 being a key regulatory factor in the induction of the ADH1 promoter by low oxygen. PMID:9611167

  15. Promoter elements required for developmental expression of the maize Adh1 gene in transgenic rice.

    PubMed Central

    Kyozuka, J; Olive, M; Peacock, W J; Dennis, E S; Shimamoto, K

    1994-01-01

    To define the regions of the maize alcohol dehydrogenase 1 (Adh1) promoter that confer tissue-specific expression, a series of 5' promoter deletions and substitution mutations were linked to the Escherichia coli beta-glucuronidase A (uidA) reporter gene and introduced into rice plants. A region between -140 and -99 not only conferred anaerobically inducible expression in the roots of transgenic plants but was also required for expression in the root cap, embryo, and in endosperm under aerobic conditions. GC-rich (GC-1, GC-2, and GC-3) or GT-rich (GT-1 and GT-2) sequence motifs in this region were necessary for expression in these tissues, as they were in anaerobic expression. Expression in the root cap under aerobic conditions required all the GC- and GT-rich motifs. The GT-1, GC-1, GC-2, and GC-3 motifs, and to a lesser extent the GT-2 motif, were also required for anaerobic responsiveness in rice roots. All elements except the GC-3 motif were needed for endosperm-specific expression. The GC-2 motif and perhaps the GT-1 motif appeared to be the only elements required for high-level expression in the embryos of rice seeds. Promoter regions important for shoot-, embryo-, and pollen-specific expression were proximal to -99, and nucleotides required for shoot-specific expression occurred between positions -72 and -43. Pollen-specific expression required a sequence element outside the promoter region, between +54 and +106 of the untranslated leader, as well as a silencer element in the promoter between -72 and -43. PMID:8061518

  16. The Genetics of a Small Autosomal Region of DROSOPHILA MELANOGASTER Containing the Structural Gene for Alcohol Dehydrogenase. I. Characterization of Deficiencies and Mapping of ADH and Visible Mutations

    PubMed Central

    Woodruff, R. C.; Ashburner, M.

    1979-01-01

    The position of the structural gene coding for alcohol dehydrogenase (ADH) in Drosophila melanogaster has been shown to be within polytene chromosome bands 35B1 and 35B3, most probably within 35B2. The genetic and cytological properties of twelve deficiencies in polytene chromosome region 34–35 have been characterized, eleven of which include Adh. Also mapped cytogenetically are seven other recessive visible mutant loci. Flies heterozygous for overlapping deficiencies that include both the Adh locus and that for the outspread mutant (osp: a recessive wing phenotype) are homozygous viable and show a complete ADH negative phenotype and strong osp phenotype. These deficiencies probably include two polytene chromosome bands, 35B2 and 35B3. PMID:115743

  17. A single nucleotide polymorphism (SNP839) in the adh1 reference gene affects the quantitation of genetically modified maize (Zea mays L.).

    PubMed

    Broothaerts, Wim; Corbisier, Philippe; Schimmel, Heinz; Trapmann, Stefanie; Vincent, Sandra; Emons, Hendrik

    2008-10-08

    The real-time PCR methods recommended in the European Union for the quantitation of genetically modified (GM) maize events NK603, GA21, and MON 863 measure the number of copies of the GM event in relation to those of the maize-specific adh1 reference gene. The study reported here revealed that the targeted 70 base pair adh1 region exhibits a single nucleotide polymorphism (SNP839) that hampers the binding of the reverse primer used in the adh1 detection method. Partial fragments of the adh1-A and adh1-F allele were cloned. By allele-specific real-time PCR, it was shown that SNP839 corresponds to a common allelic polymorphism in maize. As a result, the quantitation of the GM maize events mentioned is positively or negatively biased, depending on the adh1 genotype of sample and calibrant. Therefore, it is proposed to revise the quantitative detection methods for NK603, GA21, and MON 863 maize.

  18. Expression pattern, ethanol-metabolizing activities, and cellular localization of alcohol and aldehyde dehydrogenases in human large bowel: association of the functional polymorphisms of ADH and ALDH genes with hemorrhoids and colorectal cancer.

    PubMed

    Chiang, Chien-Ping; Jao, Shu-Wen; Lee, Shiao-Pieng; Chen, Pei-Chi; Chung, Chia-Chi; Lee, Shou-Lun; Nieh, Shin; Yin, Shih-Jiun

    2012-02-01

    Alcohol dehydrogenase (ADH) and aldehyde dehydrogenase (ALDH) are principal enzymes responsible for metabolism of ethanol. Functional polymorphisms of ADH1B, ADH1C, and ALDH2 genes occur among racial populations. The goal of this study was to systematically determine the functional expressions and cellular localization of ADHs and ALDHs in human rectal mucosa, the lesions of adenocarcinoma and hemorrhoid, and the genetic association of allelic variations of ADH and ALDH with large bowel disorders. Twenty-one surgical specimens of rectal adenocarcinoma and the adjacent normal mucosa, including 16 paired tissues of rectal tumor, normal mucosae of rectum and sigmoid colon from the same individuals, and 18 surgical mixed hemorrhoid specimens and leukocyte DNA samples from 103 colorectal cancer patients, 67 hemorrhoid patients, and 545 control subjects recruited in previous study, were investigated. The isozyme/allozyme expression patterns of ADH and ALDH were identified by isoelectric focusing and the activities were assayed spectrophotometrically. The protein contents of ADH/ALDH isozymes were determined by immunoblotting using the corresponding purified class-specific antibodies; the cellular activity and protein localizations were detected by immunohistochemistry and histochemistry, respectively. Genotypes of ADH1B, ADH1C, and ALDH2 were determined by polymerase chain reaction-restriction fragment length polymorphisms. At 33mM ethanol, pH 7.5, the activity of ADH1C*1/1 phenotypes exhibited 87% higher than that of the ADH1C*1/*2 phenotypes in normal rectal mucosa. The activity of ALDH2-active phenotypes of rectal mucosa was 33% greater than ALDH2-inactive phenotypes at 200μM acetaldehyde. The protein contents in normal rectal mucosa were in the following order: ADH1>ALDH2>ADH3≈ALDH1A1, whereas those of ADH2, ADH4, and ALDH3A1 were fairly low. Both activity and content of ADH1 were significantly decreased in rectal tumors, whereas the ALDH activity remained

  19. A new regulatory element mediates ethanol repression of KlADH3, a Kluyveromyces lactis gene coding for a mitochondrial alcohol dehydrogenase.

    PubMed

    Saliola, Michele; Getuli, Claudia; Mazzoni, Cristina; Fantozzi, Ivana; Falcone, Claudio

    2007-08-01

    KlADH3 is a Kluyveromyces lactis alcohol dehydrogenase gene induced in the presence of all respiratory carbon sources except ethanol, which specifically represses this gene. Deletion analysis of the KlADH3 promoter revealed the presence of both positive and negative elements. However, by site-directed mutagenesis and gel retardation experiments, we identified a 15-bp element responsible for the transcriptional repression of this gene by ethanol. In particular, this element showed putative sites required for the sequential binding of ethanol-induced factors responsible for the repressed conditions, and the binding of additional factors relieved repression. In addition, we showed that the ethanol element was required for in vivo repression of KlAdh3 activity.

  20. A 5-hydroxymethyl furfural reducing enzyme encoded by the Saccharomyces cerevisiae ADH6 gene conveys HMF tolerance.

    PubMed

    Petersson, Anneli; Almeida, João R M; Modig, Tobias; Karhumaa, Kaisa; Hahn-Hägerdal, Bärbel; Gorwa-Grauslund, Marie F; Lidén, Gunnar

    2006-04-30

    The fermentation of lignocellulose hydrolysates by Saccharomyces cerevisiae for fuel ethanol production is inhibited by 5-hydroxymethyl furfural (HMF), a furan derivative which is formed during the hydrolysis of lignocellulosic materials. The inhibition can be avoided if the yeast strain used in the fermentation has the ability to reduce HMF to 5-hydroxymethylfurfuryl alcohol. To enable the identification of enzyme(s) responsible for HMF conversion in S. cerevisiae, microarray analyses of two strains with different abilities to convert HMF were performed. Based on the expression data, a subset of 15 reductase genes was chosen to be further examined using an overexpression strain collection. Three candidate genes were cloned from two different strains, TMB3000 and the laboratory strain CEN.PK 113-5D, and overexpressed using a strong promoter in the strain CEN.PK 113-5D. Strains overexpressing ADH6 had increased HMF conversion activity in cell-free crude extracts with both NADPH and NADH as co-factors. In vitro activities were recorded of 8 mU/mg with NADH as co-factor and as high as 1200 mU/mg for the NADPH-coupled reduction. Yeast strains overexpressing ADH6 also had a substantially higher in vivo conversion rate of HMF in both aerobic and anaerobic cultures, showing that the overexpression indeed conveyed the desired increased reduction capacity.

  1. Characterization of the Saccharomyces cerevisiae YMR318C (ADH6) gene product as a broad specificity NADPH-dependent alcohol dehydrogenase: relevance in aldehyde reduction.

    PubMed Central

    Larroy, Carol; Fernández, M Rosario; González, Eva; Parés, Xavier; Biosca, Josep A

    2002-01-01

    YMR318C represents an open reading frame from Saccharomyces cerevisiae with unknown function. It possesses a conserved sequence motif, the zinc-containing alcohol dehydrogenase (ADH) signature, specific to the medium-chain zinc-containing ADHs. In the present study, the YMR318C gene product has been purified to homogeneity from overexpressing yeast cells, and found to be a homodimeric ADH, composed of 40 kDa subunits and with a pI of 5.0-5.4. The enzyme was strictly specific for NADPH and was active with a wide variety of substrates, including aliphatic (linear and branched-chain) and aromatic primary alcohols and aldehydes. Aldehydes were processed with a 50-fold higher catalytic efficiency than that for the corresponding alcohols. The highest k(cat)/K(m) values were found with pentanal>veratraldehyde > hexanal > 3-methylbutanal >cinnamaldehyde. Taking into consideration the substrate specificity and sequence characteristics of the YMR318C gene product, we have proposed this gene to be called ADH6. The disruption of ADH6 was not lethal for the yeast under laboratory conditions. Although S. cerevisiae is considered a non lignin-degrading organism, the catalytic activity of ADHVI can direct veratraldehyde and anisaldehyde, arising from the oxidation of lignocellulose by fungal lignin peroxidases, to the lignin biodegradation pathway. ADHVI is the only S. cerevisiae enzyme able to significantly reduce veratraldehyde in vivo, and its overexpression allowed yeast to grow under toxic concentrations of this aldehyde. The enzyme may also be involved in the synthesis of fusel alcohols. To our knowledge this is the first NADPH-dependent medium-chain ADH to be characterized in S. cerevisiae. PMID:11742541

  2. A phylogenetic analysis of the genus Fragaria (strawberry) using intron-containing sequence from the ADH-1 gene.

    PubMed

    DiMeglio, Laura M; Staudt, Günter; Yu, Hongrun; Davis, Thomas M

    2014-01-01

    The genus Fragaria encompasses species at ploidy levels ranging from diploid to decaploid. The cultivated strawberry, Fragaria×ananassa, and its two immediate progenitors, F. chiloensis and F. virginiana, are octoploids. To elucidate the ancestries of these octoploid species, we performed a phylogenetic analysis using intron-containing sequences of the nuclear ADH-1 gene from 39 germplasm accessions representing nineteen Fragaria species and one outgroup species, Dasiphora fruticosa. All trees from Maximum Parsimony and Maximum Likelihood analyses showed two major clades, Clade A and Clade B. Each of the sampled octoploids contributed alleles to both major clades. All octoploid-derived alleles in Clade A clustered with alleles of diploid F. vesca, with the exception of one octoploid allele that clustered with the alleles of diploid F. mandshurica. All octoploid-derived alleles in clade B clustered with the alleles of only one diploid species, F. iinumae. When gaps encoded as binary characters were included in the Maximum Parsimony analysis, tree resolution was improved with the addition of six nodes, and the bootstrap support was generally higher, rising above the 50% threshold for an additional nine branches. These results, coupled with the congruence of the sequence data and the coded gap data, validate and encourage the employment of sequence sets containing gaps for phylogenetic analysis. Our phylogenetic conclusions, based upon sequence data from the ADH-1 gene located on F. vesca linkage group II, complement and generally agree with those obtained from analyses of protein-encoding genes GBSSI-2 and DHAR located on F. vesca linkage groups V and VII, respectively, but differ from a previous study that utilized rDNA sequences and did not detect the ancestral role of F. iinumae.

  3. A Phylogenetic Analysis of the Genus Fragaria (Strawberry) Using Intron-Containing Sequence from the ADH-1 Gene

    PubMed Central

    DiMeglio, Laura M.; Yu, Hongrun; Davis, Thomas M.

    2014-01-01

    The genus Fragaria encompasses species at ploidy levels ranging from diploid to decaploid. The cultivated strawberry, Fragaria×ananassa, and its two immediate progenitors, F. chiloensis and F. virginiana, are octoploids. To elucidate the ancestries of these octoploid species, we performed a phylogenetic analysis using intron-containing sequences of the nuclear ADH-1 gene from 39 germplasm accessions representing nineteen Fragaria species and one outgroup species, Dasiphora fruticosa. All trees from Maximum Parsimony and Maximum Likelihood analyses showed two major clades, Clade A and Clade B. Each of the sampled octoploids contributed alleles to both major clades. All octoploid-derived alleles in Clade A clustered with alleles of diploid F. vesca, with the exception of one octoploid allele that clustered with the alleles of diploid F. mandshurica. All octoploid-derived alleles in clade B clustered with the alleles of only one diploid species, F. iinumae. When gaps encoded as binary characters were included in the Maximum Parsimony analysis, tree resolution was improved with the addition of six nodes, and the bootstrap support was generally higher, rising above the 50% threshold for an additional nine branches. These results, coupled with the congruence of the sequence data and the coded gap data, validate and encourage the employment of sequence sets containing gaps for phylogenetic analysis. Our phylogenetic conclusions, based upon sequence data from the ADH-1 gene located on F. vesca linkage group II, complement and generally agree with those obtained from analyses of protein-encoding genes GBSSI-2 and DHAR located on F. vesca linkage groups V and VII, respectively, but differ from a previous study that utilized rDNA sequences and did not detect the ancestral role of F. iinumae. PMID:25078607

  4. Characterization of the temperate bacteriophage phi adh and plasmid transduction in Lactobacillus acidophilus ADH.

    PubMed

    Raya, R R; Kleeman, E G; Luchansky, J B; Klaenhammer, T R

    1989-09-01

    Lactobacillus acidophilus ADH is lysogenic and harbors an inducible prophage, phi adh. Bacteriophage were detected in cell lysates induced by treatment with mitomycin C or UV light. Electron microscopy of lysates revealed phage particles with a hexagonal head (62 nm) and a long, noncontractile, flexible tail (398 nm) ending in at last five short fibers. Phage phi adh was classified within Bradley's B1 phage group and the Siphoviridae family. The phi adh genome is a linear double-stranded DNA molecule of 41.7 kilobase pairs with cohesive ends: a physical map of the phi adh genome was constructed. A prophage-cured derivative of strain ADH, designated NCK102, was isolated from cells that survived UV exposure. NCK102 did not exhibit mitomycin C-induced lysis, but broth cultures lysed upon addition of phage. Phage phi adh produced clear plaques on NCK102 in media containing 10 mM CaCl2 at pH values between 5.2 and 5.5. A relysogenized derivative (NCK103) of NCK102 was isolated that exhibited mitomycin C-induced lysis and superinfection immunity to phage phi adh. Hybridization experiments showed that the phi adh genome was present in the ADH and NCK103 chromosomes, but absent in NCK102. These results demonstrated classic lytic and lysogenic cycles of replication for the temperate phage phi adh induced from L. acidophilus ADH. Phage phi adh also mediates transduction of plasmid DNA. Transductants of strain ADH containing pC194, pGK12, pGB354, and pVA797 were detected at frequencies in the range of 3.6 x 10(-8) to 8.3 x 10(-10) per PFU. Rearrangements or deletions were not detected in these plasmids as a consequence of transduction. This is the first description of plasmid transduction in the genus Lactobacillus.

  5. Characterizing gene family evolution

    PubMed Central

    Liberles, David A.

    2008-01-01

    Gene families are widely used in comparative genomics, molecular evolution, and in systematics. However, they are constructed in different manners, their data analyzed and interpreted differently, with different underlying assumptions, leading to sometimes divergent conclusions. In systematics, concepts like monophyly and the dichotomy between homoplasy and homology have been central to the analysis of phylogenies. We critique the traditional use of such concepts as applied to gene families and give examples of incorrect inferences they may lead to. Operational definitions that have emerged within functional genomics are contrasted with the common formal definitions derived from systematics. Lastly, we question the utility of layers of homology and the meaning of homology at the character state level in the context of sequence evolution. From this, we move forward to present an idealized strategy for characterizing gene family evolution for both systematic and functional purposes, including recent methodological improvements. PMID:19461954

  6. ADH (Antidiuretic Hormone) Test

    MedlinePlus

    ... stored in the posterior pituitary gland at the base of the brain. ADH helps regulate water balance ... of ADH (vasopressin). Several blood and urine osmolality measurements are performed at timed intervals before and after ...

  7. The sulfatase gene family.

    PubMed

    Parenti, G; Meroni, G; Ballabio, A

    1997-06-01

    During the past few years, molecular analyses have provided important insights into the biochemistry and genetics of the sulfatase family of enzymes, identifying the molecular bases of inherited diseases caused by sulfatase deficiencies. New members of the sulfatase gene family have been identified in man and other species using a genomic approach. These include the gene encoding arylsulfatase E, which is involved in X-linked recessive chondrodysplasia punctata, a disorder of cartilage and bone development. Another important breakthrough has been the discovery of the biochemical basis of multiple sulfatase deficiency, an autosomal recessive disorder characterized by a severe of all sulfatase activities. These discoveries, together with the resolution of the crystallographic structure of sulfatases, have improved our understanding of the function and evolution of this fascinating family of enzymes.

  8. The Complete Sequence of 340 kb of DNA around the Rice Adh1–Adh2 Region Reveals Interrupted Colinearity with Maize Chromosome 4

    PubMed Central

    Tarchini, Renato; Biddle, Phyllis; Wineland, Robin; Tingey, Scott; Rafalski, Antoni

    2000-01-01

    A 2.3-centimorgan (cM) segment of rice chromosome 11 consisting of 340 kb of DNA sequence around the alcohol dehydrogenase Adh1 and Adh2 loci was completely sequenced, revealing the presence of 33 putative genes, including several apparently involved in disease resistance. Fourteen of the genes were confirmed by identifying the corresponding transcripts. Five genes, spanning 1.9 cM of the region, cross-hybridized with maize genomic DNA and were genetically mapped in maize, revealing a stretch of colinearity with maize chromosome 4. The Adh1 gene marked one significant interruption. This gene mapped to maize chromosome 1, indicating a possible translocation of Adh1 after the evolutionary divergence leading to maize and sorghum. Several other genes, most notably genes similar to known disease resistance genes, showed no cross-hybridization with maize genomic DNA, suggesting sequence divergence or absence of these sequences in maize, which is in contrast to several other well-conserved genes, including Adh1 and Adh2. These findings indicate that the use of rice as the model system for other cereals may sometimes be complicated by the presence of rapidly evolving gene families and microtranslocations. Seven retrotransposons and eight transposons were identified in this rice segment, including a Tc1/Mariner–like element, which is new to rice. In contrast to maize, retroelements are less frequent in rice. Only 14.4% of this genome segment consist of retroelements. Miniature inverted repeat transposable elements were found to be the most frequently occurring class of repetitive elements, accounting for 18.8% of the total repetitive DNA. PMID:10715324

  9. Adh1 and Adh1/4 knockout mice as possible rodent models for presymptomatic Parkinson's disease.

    PubMed

    Anvret, Anna; Ran, Caroline; Westerlund, Marie; Gellhaar, Sandra; Lindqvist, Eva; Pernold, Karin; Lundströmer, Karin; Duester, Gregg; Felder, Michael R; Galter, Dagmar; Belin, Andrea Carmine

    2012-02-01

    Alcohol dehydrogenases (ADH) catalyze the reversible metabolism of many types of alcohols and aldehydes to prevent the possible toxic accumulation of these compounds. ADHs are of interest in Parkinson's disease (PD) since these compounds can be harmful to dopamine (DA) neurons. Genetic variants in ADH1C and ADH4 have been found to associate with PD and lack of Adh4 gene activity in a mouse model has recently been reported to induce changes in the DA system. Adh1 knockout (Adh1-/-) and Adh1/4 double knockout (Adh1/4-/-) mice were investigated for possible changes in DA system related activity, biochemical parameters and olfactory function compared to wild-type (WT) mice. Locomotor activity was tested at ∼7 (adult) and >15 months of age to mimic the late onset of PD. Adh1-/- and Adh1/4-/- mice displayed a significantly higher spontaneous locomotor activity than WT littermates. Both apomorphine and d-amphetamine increased total distance activity in Adh1-/- mice at both age intervals and in Adh1/4-/- mice at 7 months of age compared to WT mice. No significant changes were found regarding olfactory function, however biochemical data showed decreased 3,4-dihydroxyphenylacetic acid (DOPAC)/DA ratios in the olfactory bulb and decreased homovanillic acid (HVA)/DA ratios in the olfactory bulb, frontal cortex and striatum of Adh1/4-/- mice compared to WT mice. Our results suggest that lack of Adh1 alone or Adh1 and Adh4 together lead to changes in DA system related behavior, and that these knockout mice might be possible rodent models to study presymptomatic PD.

  10. Rare ADH Variant Constellations are Specific for Alcohol Dependence

    PubMed Central

    Zuo, Lingjun; Zhang, Heping; Malison, Robert T.; Li, Chiang-Shan R.; Zhang, Xiang-Yang; Wang, Fei; Lu, Lingeng; Lu, Lin; Wang, Xiaoping; Krystal, John H.; Zhang, Fengyu; Deng, Hong-Wen; Luo, Xingguang

    2013-01-01

    Aims: Some of the well-known functional alcohol dehydrogenase (ADH) gene variants (e.g. ADH1B*2, ADH1B*3 and ADH1C*2) that significantly affect the risk of alcohol dependence are rare variants in most populations. In the present study, we comprehensively examined the associations between rare ADH variants [minor allele frequency (MAF) <0.05] and alcohol dependence, with several other neuropsychiatric and neurological disorders as reference. Methods: A total of 49,358 subjects in 22 independent cohorts with 11 different neuropsychiatric and neurological disorders were analyzed, including 3 cohorts with alcohol dependence. The entire ADH gene cluster (ADH7–ADH1C–ADH1B–ADH1A–ADH6–ADH4–ADH5 at Chr4) was imputed in all samples using the same reference panels that included whole-genome sequencing data. We stringently cleaned the phenotype and genotype data to obtain a total of 870 single nucleotide polymorphisms with 0< MAF <0.05 for association analysis. Results: We found that a rare variant constellation across the entire ADH gene cluster was significantly associated with alcohol dependence in European-Americans (Fp1: simulated global P = 0.045), European-Australians (Fp5: global P = 0.027; collapsing: P = 0.038) and African-Americans (Fp5: global P = 0.050; collapsing: P = 0.038), but not with any other neuropsychiatric disease. Association signals in this region came principally from ADH6, ADH7, ADH1B and ADH1C. In particular, a rare ADH6 variant constellation showed a replicable association with alcohol dependence across these three independent cohorts. No individual rare variants were statistically significantly associated with any disease examined after group- and region-wide correction for multiple comparisons. Conclusion: We conclude that rare ADH variants are specific for alcohol dependence. The ADH gene cluster may harbor a causal variant(s) for alcohol dependence. PMID:23019235

  11. Molecular Variation of Adh and P6 Genes in an African Population of Drosophila Melanogaster and Its Relation to Chromosomal Inversions

    PubMed Central

    Benassi, V.; Aulard, S.; Mazeau, S.; Veuille, M.

    1993-01-01

    Four-cutter molecular polymorphism of Adh and P6, and chromosome inversion polymorphism of chromosome II were investigated in 95 isogenic lines of an Ivory Coast population of Drosophila melanogaster, a species assumed to have recently spread throughout the world from a West African origin. The P6 gene showed little linkage disequilibrium with the In(2L)t inversion, although it is located within this inversion. This suggests that the inversion and the P6 locus have extensively exchanged genetic information through either double crossover or gene conversion. Allozymic variation in ADH was in linkage disequilibrium with In(2L)t and In(2R)NS inversions. Evidence suggests either that inversion linkage with the Fast allele is selectively maintained, or that this allele only recently appeared. Molecular polymorphism at the Adh locus in the Ivory Coast is not higher than in North American populations. New haplotypes specific to the African population were found, some of them connect the ``Wa(s)-like'' haplotypes found at high frequencies in the United States to the other slow haplotypes. Their relation with In(2L)t supports the hypothesis that Wa(s) recently recombined away from an In(2L)t chromosome which may be the cause of its divergence from the other haplotypes. PMID:8349110

  12. Efficient production of lycopene in Saccharomyces cerevisiae by expression of synthetic crt genes from a plasmid harboring the ADH2 promoter.

    PubMed

    Bahieldin, Ahmed; Gadalla, Nour O; Al-Garni, Saleh M; Almehdar, Hussein; Noor, Samah; Hassan, Sabah M; Shokry, Ahmed M; Sabir, Jamal S M; Murata, Norio

    2014-03-01

    Lycopene is an effective antioxidant proposed as a possible treatment for some cancers and other degenerative human conditions. This study aims at generation of a yeast strain (Saccharomyces cerevisiae) of efficient productivity of lycopene by overexpressing synthetic genes derived from crtE, crtB and crtI genes of Erwinia uredovora. These synthetic genes were constructed in accordance with the preferred codon usage in S. cerevisiae but with no changes in amino acid sequences of the gene products. S. cerevisiae cells were transformed with these synthetic crt genes, whose expression was regulated by the ADH2 promoter, which is de-repressed upon glucose depletion. The RT-PCR and Western blotting analyses indicated that the synthetic crt genes were efficiently transcribed and translated in crt-transformed S. cerevisiae cells. The highest level of lycopene in one of the transformed lines was 3.3mglycopene/g dry cell weight, which is higher than the previously reported levels of lycopene in other microorganisms transformed with the three genes. These results suggest the excellence of using the synthetic crt genes and the ADH2 promoter in generation of recombinant S. cerevisiae that produces a high level of lycopene. The level of ergosterol was reversely correlated to that of lycopene in crt-transformed S. cerevisiae cells, suggesting that two pathways for lycopene and ergosterol syntheses compete for the use of farnesyl diphosphate.

  13. Identification of a G‐Protein Subunit‐α11 Gain‐of‐Function Mutation, Val340Met, in a Family With Autosomal Dominant Hypocalcemia Type 2 (ADH2)

    PubMed Central

    Piret, Sian E; Gorvin, Caroline M; Pagnamenta, Alistair T; Howles, Sarah A; Cranston, Treena; Rust, Nigel; Nesbit, M Andrew; Glaser, Ben; Taylor, Jenny C; Buchs, Andreas E; Hannan, Fadil M

    2016-01-01

    ABSTRACT Autosomal dominant hypocalcemia (ADH) is characterized by hypocalcemia, inappropriately low serum parathyroid hormone concentrations and hypercalciuria. ADH is genetically heterogeneous with ADH type 1 (ADH1), the predominant form, being caused by germline gain‐of‐function mutations of the G‐protein coupled calcium‐sensing receptor (CaSR), and ADH2 caused by germline gain‐of‐function mutations of G‐protein subunit α‐11 (Gα11). To date Gα11 mutations causing ADH2 have been reported in only five probands. We investigated a multigenerational nonconsanguineous family, from Iran, with ADH and keratoconus which are not known to be associated, for causative mutations by whole‐exome sequencing in two individuals with hypoparathyroidism, of whom one also had keratoconus, followed by cosegregation analysis of variants. This identified a novel heterozygous germline Val340Met Gα11 mutation in both individuals, and this was also present in the other two relatives with hypocalcemia that were tested. Three‐dimensional modeling revealed the Val340Met mutation to likely alter the conformation of the C‐terminal α5 helix, which may affect G‐protein coupled receptor binding and G‐protein activation. In vitro functional expression of wild‐type (Val340) and mutant (Met340) Gα11 proteins in HEK293 cells stably expressing the CaSR, demonstrated that the intracellular calcium responses following stimulation with extracellular calcium, of the mutant Met340 Gα11 led to a leftward shift of the concentration‐response curve with a significantly (p < 0.0001) reduced mean half‐maximal concentration (EC50) value of 2.44 mM (95% CI, 2.31 to 2.77 mM) when compared to the wild‐type EC50 of 3.14 mM (95% CI, 3.03 to 3.26 mM), consistent with a gain‐of‐function mutation. A novel His403Gln variant in transforming growth factor, beta‐induced (TGFBI), that may be causing keratoconus was also identified, indicating likely digenic

  14. Ethanol production by Escherichia coli strains co-expressing Zymomonas PDC and ADH genes

    DOEpatents

    Ingram, Lonnie O.; Conway, Tyrrell; Alterthum, Flavio

    1991-01-01

    A novel operon and plasmids comprising genes which code for the alcohol dehydrogenase and pyruvate decarboxylase activities of Zymomonas mobilis are described. Also disclosed are methods for increasing the growth of microorganisms or eukaryotic cells and methods for reducing the accumulation of undesirable metabolic products in the growth medium of microorganisms or cells.

  15. The influence of genetic polymorphisms in XRCC3 and ADH5 genes on the frequency of genotoxicity biomarkers in workers exposed to formaldehyde.

    PubMed

    Ladeira, Carina; Viegas, Susana; Carolino, Elisabete; Gomes, Manuel C; Brito, Miguel

    2013-04-01

    The International Agency for Research on Cancer classified formaldehyde as carcinogenic to humans because there is "sufficient epidemiological evidence that it causes nasopharyngeal cancer in humans". Genes involved in DNA repair and maintenance of genome integrity are critically involved in protecting against mutations that lead to cancer and/or inherited genetic disease. Association studies have recently provided evidence for a link between DNA repair polymorphisms and micronucleus (MN) induction. We used the cytokinesis-block micronucleus (CBMN assay) in peripheral lymphocytes and MN test in buccal cells to investigate the effects of XRCC3 Thr241Met, ADH5 Val309Ile, and Asp353Glu polymorphisms on the frequency of genotoxicity biomarkers in individuals occupationally exposed to formaldehyde (n = 54) and unexposed workers (n = 82). XRCC3 participates in DNA double-strand break/recombination repair, while ADH5 is an important component of cellular metabolism for the elimination of formaldehyde. Exposed workers had significantly higher frequencies (P < 0.01) than controls for all genotoxicity biomarkers evaluated in this study. Moreover, there were significant associations between XRCC3 genotypes and nuclear buds, namely XRCC3 Met/Met (OR = 3.975, CI 1.053-14.998, P = 0.042) and XRCC3 Thr/Met (OR = 5.632, CI 1.673-18.961, P = 0.005) in comparison with XRCC3 Thr/Thr. ADH5 polymorphisms did not show significant effects. This study highlights the importance of integrating genotoxicity biomarkers and genetic polymorphisms in human biomonitoring studies.

  16. In vitro expression of Candida albicans alcohol dehydrogenase genes involved in acetaldehyde metabolism.

    PubMed

    Bakri, M M; Rich, A M; Cannon, R D; Holmes, A R

    2015-02-01

    Alcohol consumption is a risk factor for oral cancer, possibly via its conversion to acetaldehyde, a known carcinogen. The oral commensal yeast Candida albicans may be one of the agents responsible for this conversion intra-orally. The alcohol dehydrogenase (Adh) family of enzymes are involved in acetaldehyde metabolism in yeast but, for C. albicans it is not known which family member is responsible for the conversion of ethanol to acetaldehyde. In this study we determined the expression of mRNAs from three C. albicans Adh genes (CaADH1, CaADH2 and CaCDH3) for cells grown in different culture media at different growth phases by Northern blot analysis and quantitative reverse transcription polymerase chain reaction. CaADH1 was constitutively expressed under all growth conditions but there was differential expression of CaADH2. CaADH3 expression was not detected. To investigate whether CaAdh1p or CaAdh2p can contribute to alcohol catabolism in C. albicans, each gene from the reference strain C. albicans SC5314 was expressed in Saccharomyces cerevisiae. Cell extracts from an CaAdh1p-expressing S. cerevisiae recombinant, but not an CaAdh2p-expressing recombinant, or an empty vector control strain, possessed ethanol-utilizing Adh activity above endogenous S. cerevisiae activity. Furthermore, expression of C. albicans Adh1p in a recombinant S. cerevisiae strain in which the endogenous ScADH2 gene (known to convert ethanol to acetaldehyde in this yeast) had been deleted, conferred an NAD-dependent ethanol-utilizing, and so acetaldehyde-producing, Adh activity. We conclude that CaAdh1p is the enzyme responsible for ethanol use under in vitro growth conditions, and may contribute to the intra-oral production of acetaldehyde.

  17. DkPK Genes Promote Natural Deastringency in C-PCNA Persimmon by Up-regulating DkPDC and DkADH Expression

    PubMed Central

    Guan, Changfei; Du, Xiaoyun; Zhang, Qinglin; Ma, Fengwang; Luo, Zhengrong; Yang, Yong

    2017-01-01

    The astringency of Chinese pollination-constant non-astringent (C-PCNA) persimmon (Diospyros kaki Thunb.) can be naturally removed on the tree. This process is controlled by a single locus and is dominant against other types of persimmons; therefore, this variant is an important candidate for commercial cultivation and the breeding of PCNA cultivars. In our previous study, six full-length coding sequences (CDS) for pyruvate kinase genes (DkPK1-6) were isolated, and DkPK1 is thought to be involved in the natural deastringency of C-PCNA persimmon fruit. Here, we characterize the eight other DkPK genes (DkPK7-14) from C-PCNA persimmon fruit based on transcriptome data. The transcript changes in DkPK7-14 genes and correlations with the proanthocyanidin (PA) content were investigated during different fruit development stages in C-PCNA, J-PCNA, and non-PCNA persimmon; DkPK7 and DkPK8 exhibited up-regulation patterns during the last developmental stage in C-PCNA persimmon that was negatively correlated with the decrease in soluble PAs. Phylogenetic analysis and subcellular localization analysis revealed that DkPK7 and DkPK8 are cytosolic proteins. Notably, DkPK7 and DkPK8 were ubiquitously expressed in various persimmon organs and abundantly up-regulated in seeds. Furthermore, transient over-expression of DkPK7 and DkPK8 in persimmon leaves led to a significant decrease in the content of soluble PAs but a significant increase in the expression levels of the pyruvate decarboxylase (DkPDC) and alcohol dehydrogenase genes (DkADH), which are closely related to acetaldehyde metabolism. The accumulated acetaldehyde that results from the up-regulation of the DkPDC and DkADH genes can combine with soluble PAs to form insoluble PAs, resulting in the removal of astringency from persimmon fruit. Thus, we suggest that both DkPK7 and DkPK8 are likely to be involved in natural deastringency via the up-regulation of DkPDC and DkADH expression during the last developmental stage in C

  18. Molecular basis of the size polymorphism of the first intron of the Adh-1 gene of the mediterranean fruit fly, Ceratitis capitata.

    PubMed

    Gomulski, Ludvik M; Brogna, Saverio; Babaratsas, Alekos; Gasperi, Giuliano; Zacharopoulou, Antigoni; Savakis, Charalambos; Bourtzis, Kostas

    2004-06-01

    The first intron of the gene encoding one of the alcohol dehydrogenase isoenzymes (ADH-1) in Ceratitis capitata is highly polymorphic in size. Five size variants of this intron were isolated from different strains and populations and characterized. Restriction map and sequence analysis showed that the intron size polymorphism is due to the presence or absence of (a) a copy of a defective mariner-like element, postdoc; (b) an approximately 550-bp 3' indel which exhibits no similarity to any known sequence; and (c) a central duplication of 704 bp consisting of part of the 3' end of the postdoc element, the region between postdoc and the 3' indel, and the first 20 bp of the 3' indel. The homologous Adh-1 intron was amplified from the congeneric species, Ceratitis rosa, in order to obtain an outgroup for comparative and phylogenetic analyses. The C. rosa introns were polymorphic in size, ranging from about 1100 to 2000 bp, the major difference between them being the presence or absence of a mariner-like element Crmar2, unrelated to the postdoc element. Phylogenetic analysis suggests that the shorter intron variants in C. capitata may represent the ancestral form of the intron, the longest variants apparently being the most recent.

  19. Ectopic ADH secretion

    MedlinePlus

    ... ADH. Often, there are no symptoms from a low sodium level. When symptoms do occur, they may include ... Lab tests that can confirm and help diagnose low sodium include: Comprehensive metabolic panel (includes blood sodium) Osmolality ...

  20. The genetics of alcoholism: identifying specific genes through family studies.

    PubMed

    Edenberg, Howard J; Foroud, Tatiana

    2006-09-01

    Alcoholism is a complex disorder with both genetic and environmental risk factors. Studies in humans have begun to elucidate the genetic underpinnings of the risk for alcoholism. Here we briefly review strategies for identifying individual genes in which variations affect the risk for alcoholism and related phenotypes, in the context of one large study that has successfully identified such genes. The Collaborative Study on the Genetics of Alcoholism (COGA) is a family-based study that has collected detailed phenotypic data on individuals in families with multiple alcoholic members. A genome-wide linkage approach led to the identification of chromosomal regions containing genes that influenced alcoholism risk and related phenotypes. Subsequently, single nucleotide polymorphisms (SNPs) were genotyped in positional candidate genes located within the linked chromosomal regions, and analyzed for association with these phenotypes. Using this sequential approach, COGA has detected association with GABRA2, CHRM2 and ADH4; these associations have all been replicated by other researchers. COGA has detected association to additional genes including GABRG3, TAS2R16, SNCA, OPRK1 and PDYN, results that are awaiting confirmation. These successes demonstrate that genes contributing to the risk for alcoholism can be reliably identified using human subjects.

  1. The metabolic enzyme AdhE controls the virulence of Escherichia coli O157:H7

    PubMed Central

    Beckham, Katherine S H; Connolly, James P R; Ritchie, Jennifer M; Wang, Dai; Gawthorne, Jayde A; Tahoun, Amin; Gally, David L; Burgess, Karl; Burchmore, Richard J; Smith, Brian O; Beatson, Scott A; Byron, Olwyn; Wolfe, Alan J; Douce, Gillian R; Roe, Andrew J

    2014-01-01

    Classical studies have focused on the role that individual regulators play in controlling virulence gene expression. An emerging theme, however, is that bacterial metabolism also plays a key role in this process. Our previous work identified a series of proteins that were implicated in the regulation of virulence. One of these proteins was AdhE, a bi-functional acetaldehyde-CoA dehydrogenase and alcohol dehydrogenase. Deletion of its gene (adhE) resulted in elevated levels of extracellular acetate and a stark pleiotropic phenotype: strong suppression of the Type Three Secretion System (T3SS) and overexpression of non-functional flagella. Correspondingly, the adhE mutant bound poorly to host cells and was unable to swim. Furthermore, the mutant was significantly less virulent than its parent when tested in vivo, which supports the hypothesis that attachment and motility are central to the colonization process. The molecular basis by which AdhE affects virulence gene regulation was found to be multifactorial, involving acetate-stimulated transcription of flagella expression and post-transcriptional regulation of the T3SS through Hfq. Our study reveals fascinating insights into the links between bacterial physiology, the expression of virulence genes, and the underlying molecular mechanism mechanisms by which these processes are regulated. PMID:24846743

  2. Alcohol Dehydrogenase in the Diploid Plant STEPHANOMERIA EXIGUA (Compositae): Gene Duplication, Mode of Inheritance and Linkage

    PubMed Central

    Roose, M. L.; Gottlieb, L. D.

    1980-01-01

    Study of the biochemical genetics of alcohol dehydrogenase (ADH) in the annual plant Stephanomeria exigua (Compositae) revealed that the isozymes are specified by a small family of tightly linked structural genes. One set of ADH isozymes (ADH-1) was induced in roots by flooding, and was also expressed in thickened unflooded tap roots, stems, ovaries and seeds. As in other plants, the enzymes are dimeric and form homo- and heterodimers. An electrophoretic survey of ADH-1 phenotypes in two natural populations revealed seven different ADH-1 homodimers in various phenotypes having one to eight enzyme bands. Genetic analysis of segregations from crosses involving 59 plants showed that the ADH-1 isozymes are inherited as a single Mendelian unit, Adh1. Adh1 is polymorphic for forms that specify one, two, or three different ADH-1 subunits (which combine to form homo- and heterodimers), and are expressed co-dominantly in all genotypic combinations. Staining intensity of enzymes extracted from various homozygous and heterozygous plants indicated that the different subunit types specified by Adh1 are produced in approximately equal amounts. These observations suggest that Adh1 is a compound locus consisting of one to several tightly linked (0 recombinants among 579 testcross progeny), coordinately expressed structural genes. The genes in the two triplications also occur in various duplicate complexes and thus could have originated via unequal crossing over. The ADH-2 isozyme found in pollen and seeds is apparently specified by a different gene, Adh2. Adh1 and Adh2 are tightly linked (0 recombinants among 81 testcross progeny). PMID:17249032

  3. Genetic polymorphisms of ADH1B, ADH1C and ALDH2 in Turkish alcoholics: lack of association with alcoholism and alcoholic cirrhosis.

    PubMed

    Vatansever, Sezgin; Tekin, Fatih; Salman, Esin; Altintoprak, Ender; Coskunol, Hakan; Akarca, Ulus Salih

    2015-05-17

    No data exists regarding the alcohol dehydrogenase (ADH) and aldehyde dehydrogenase (ALDH) gene polymorphisms in Turkish alcoholic cirrhotics. We studied the polymorphisms of ADH1B, ADH1C and ALDH2 genes in alcoholic cirrhotics and compared the results with non-cirrhotic alcoholics and healthy volunteers. Overall, 237 subjects were included for the study: 156 alcoholic patients (78 cirrhotics, 78 non-cirrhotic alcoholics) and 81 healthy volunteers. Three different single-nucleotide-polymorphism genotyping methods were used. ADH1C genotyping was performed using a polymerase chain reaction-restriction fragment length polymorphism method. The identified ADH1C genotypes were named according to the presence or absence of the enzyme restriction sites. ADH1B (Arg47Hys) genotyping was performed using the allele specific primer extension method, and ALDH2 (Glu487Lys) genotyping was performed by a multiplex polymerase chain reaction using two allele-specific primer pairs. For ADH1B, the frequency of allele *1 in the cirrhotics, non-cirrhotic alcoholics and healthy volunteers was 97.4%, 94.9% and 99.4%, respectively. For ADH1C, the frequency of allele *1 in the cirrhotics, non-cirrhotic alcoholics and healthy volunteers was 47%, 36.3% and 45%, respectively. There was no statistical difference between the groups for ADH1B and ADH1C (p>0.05). All alcoholic and non-alcoholic subjects (100%) had the allele *1 for ALDH2. The obtained results for ADH1B, ADH1C, and ALDH gene polymorphisms in the present study are similar to the results of Caucasian studies. ADH1B and ADH1C genetic variations are not related to the development of alcoholism or susceptibility to alcoholic cirrhosis. ALDH2 gene has no genetic variation in the Turkish population.

  4. Adh enhances Actinobacillus pleuropneumoniae pathogenicity by binding to OR5M11 and activating p38 which induces apoptosis of PAMs and IL-8 release.

    PubMed

    Wang, Lei; Qin, Wanhai; Zhang, Jing; Bao, Chuntong; Zhang, Hu; Che, Yanyi; Sun, Changjiang; Gu, Jingmin; Feng, Xin; Du, Chongtao; Han, Wenyu; Richard, Paul Langford; Lei, Liancheng

    2016-04-05

    Members of the Trimeric Autotransporter Adhesin (TAA) family play a crucial role in the adhesion of Gram-negative pathogens to host cells, but the immunopathogenesis of TAAs remains unknown. Our previous studies demonstrated that Adh from Actinobacillus pleuropneumoniae (A. pleuropneumoniae) is required for full bacterial pathogenicity. Alveolar macrophages are the first line of defense against respiratory infections. This study compared the interactions between porcine alveolar macrophages (PAMs) and wild-type A. pleuropneumoniae (5b WT) or an Adh-deletion strain (5b ΔAdh) via gene microarray, immunoprecipitation and other technologies. We found that Adh was shown to interact with the PAMs membrane protein OR5M11, an olfactory receptor, resulting in the high-level secretion of IL-8 by activation of p38 MAPK signaling pathway. Subsequently, PAMs apoptosis via the activation of the Fax and Bax signaling pathways was observed, followed by activation of caspases 8, 9, and 3. The immunological pathogenic roles of Adh were also confirmed in both murine and piglets infectious models in vivo. These results identify a novel immunological strategy for TAAs to boost the pathogenicity of A. pleuropneumoniae. Together, these datas reveal the high versatility of the Adh protein as a virulence factor and provide novel insight into the immunological pathogenic role of TAAs.

  5. The Insect SNMP Gene Family

    DTIC Science & Technology

    2009-01-01

    The insect SNMP gene family Richard G. Vogt a,*,1, Natalie E. Miller a, Rachel Litvack a, Richard A. Fandino a, Jackson Sparks a, Jon Staples a...Wallace Beltsville Agricultural Research Center Plant Sciences Institute, Invasive Insect Biocontrol and Behavior Laboratory, Bldg. 007, Rm. 030...keywords: Pheromone Receptors Olfactory Gustatory Chemosensory Gustatory Mosquito Fly a b s t r a c t SNMPs are membrane proteins observed to associate with

  6. Transcriptomic identification of ADH1B as a novel candidate gene for obesity and insulin resistance in human adipose tissue in Mexican Americans from the Veterans Administration Genetic Epidemiology Study (VAGES).

    PubMed

    Winnier, Deidre A; Fourcaudot, Marcel; Norton, Luke; Abdul-Ghani, Muhammad A; Hu, Shirley L; Farook, Vidya S; Coletta, Dawn K; Kumar, Satish; Puppala, Sobha; Chittoor, Geetha; Dyer, Thomas D; Arya, Rector; Carless, Melanie; Lehman, Donna M; Curran, Joanne E; Cromack, Douglas T; Tripathy, Devjit; Blangero, John; Duggirala, Ravindranath; Göring, Harald H H; DeFronzo, Ralph A; Jenkinson, Christopher P

    2015-01-01

    Type 2 diabetes (T2D) is a complex metabolic disease that is more prevalent in ethnic groups such as Mexican Americans, and is strongly associated with the risk factors obesity and insulin resistance. The goal of this study was to perform whole genome gene expression profiling in adipose tissue to detect common patterns of gene regulation associated with obesity and insulin resistance. We used phenotypic and genotypic data from 308 Mexican American participants from the Veterans Administration Genetic Epidemiology Study (VAGES). Basal fasting RNA was extracted from adipose tissue biopsies from a subset of 75 unrelated individuals, and gene expression data generated on the Illumina BeadArray platform. The number of gene probes with significant expression above baseline was approximately 31,000. We performed multiple regression analysis of all probes with 15 metabolic traits. Adipose tissue had 3,012 genes significantly associated with the traits of interest (false discovery rate, FDR ≤ 0.05). The significance of gene expression changes was used to select 52 genes with significant (FDR ≤ 10(-4)) gene expression changes across multiple traits. Gene sets/Pathways analysis identified one gene, alcohol dehydrogenase 1B (ADH1B) that was significantly enriched (P < 10(-60)) as a prime candidate for involvement in multiple relevant metabolic pathways. Illumina BeadChip derived ADH1B expression data was consistent with quantitative real time PCR data. We observed significant inverse correlations with waist circumference (2.8 x 10(-9)), BMI (5.4 x 10(-6)), and fasting plasma insulin (P < 0.001). These findings are consistent with a central role for ADH1B in obesity and insulin resistance and provide evidence for a novel genetic regulatory mechanism for human metabolic diseases related to these traits.

  7. Transcriptomic Identification of ADH1B as a Novel Candidate Gene for Obesity and Insulin Resistance in Human Adipose Tissue in Mexican Americans from the Veterans Administration Genetic Epidemiology Study (VAGES)

    PubMed Central

    Winnier, Deidre A.; Fourcaudot, Marcel; Norton, Luke; Abdul-Ghani, Muhammad A.; Hu, Shirley L.; Farook, Vidya S.; Coletta, Dawn K.; Kumar, Satish; Puppala, Sobha; Chittoor, Geetha; Dyer, Thomas D.; Arya, Rector; Carless, Melanie; Lehman, Donna M.; Curran, Joanne E.; Cromack, Douglas T.; Tripathy, Devjit; Blangero, John; Duggirala, Ravindranath; Göring, Harald H. H.; DeFronzo, Ralph A.; Jenkinson, Christopher P.

    2015-01-01

    Type 2 diabetes (T2D) is a complex metabolic disease that is more prevalent in ethnic groups such as Mexican Americans, and is strongly associated with the risk factors obesity and insulin resistance. The goal of this study was to perform whole genome gene expression profiling in adipose tissue to detect common patterns of gene regulation associated with obesity and insulin resistance. We used phenotypic and genotypic data from 308 Mexican American participants from the Veterans Administration Genetic Epidemiology Study (VAGES). Basal fasting RNA was extracted from adipose tissue biopsies from a subset of 75 unrelated individuals, and gene expression data generated on the Illumina BeadArray platform. The number of gene probes with significant expression above baseline was approximately 31,000. We performed multiple regression analysis of all probes with 15 metabolic traits. Adipose tissue had 3,012 genes significantly associated with the traits of interest (false discovery rate, FDR ≤ 0.05). The significance of gene expression changes was used to select 52 genes with significant (FDR ≤ 10-4) gene expression changes across multiple traits. Gene sets/Pathways analysis identified one gene, alcohol dehydrogenase 1B (ADH1B) that was significantly enriched (P < 10-60) as a prime candidate for involvement in multiple relevant metabolic pathways. Illumina BeadChip derived ADH1B expression data was consistent with quantitative real time PCR data. We observed significant inverse correlations with waist circumference (2.8 x 10-9), BMI (5.4 x 10-6), and fasting plasma insulin (P < 0.001). These findings are consistent with a central role for ADH1B in obesity and insulin resistance and provide evidence for a novel genetic regulatory mechanism for human metabolic diseases related to these traits. PMID:25830378

  8. Familial aggregation analysis of gene expressions

    PubMed Central

    Rao, Shao-Qi; Xu, Liang-De; Zhang, Guang-Mei; Li, Xia; Li, Lin; Shen, Gong-Qing; Jiang, Yang; Yang, Yue-Ying; Gong, Bin-Sheng; Jiang, Wei; Zhang, Fan; Xiao, Yun; Wang, Qing K

    2007-01-01

    Traditional studies of familial aggregation are aimed at defining the genetic (and non-genetic) causes of a disease from physiological or clinical traits. However, there has been little attempt to use genome-wide gene expressions, the direct phenotypic measures of genes, as the traits to investigate several extended issues regarding the distributions of familially aggregated genes on chromosomes or in functions. In this study we conducted a genome-wide familial aggregation analysis by using the in vitro cell gene expressions of 3300 human autosome genes (Problem 1 data provided to Genetic Analysis Workshop 15) in order to answer three basic genetics questions. First, we investigated how gene expressions aggregate among different types (degrees) of relative pairs. Second, we conducted a bioinformatics analysis of highly familially aggregated genes to see how they are distributed on chromosomes. Third, we performed a gene ontology enrichment test of familially aggregated genes to find evidence to support their functional consensus. The results indicated that 1) gene expressions did aggregate in families, especially between sibs. Of 3300 human genes analyzed, there were a total of 1105 genes with one or more significant (empirical p < 0.05) familial correlation; 2) there were several genomic hot spots where highly familially aggregated genes (e.g., the chromosome 6 HLA genes cluster) were clustered; 3) as we expected, gene ontology enrichment tests revealed that the 1105 genes were aggregating not only in families but also in functional categories. PMID:18466548

  9. Modeling Parkinson's disease genetics: altered function of the dopamine system in Adh4 knockout mice.

    PubMed

    Belin, Andrea Carmine; Westerlund, Marie; Anvret, Anna; Lindqvist, Eva; Pernold, Karin; Ogren, Sven Ove; Duester, Gregg; Galter, Dagmar

    2011-03-01

    Class IV alcohol dehydrogenase (ADH4) efficiently reduces aldehydes produced during lipid peroxidation, and may thus serve to protect from toxic effects of aldehydes e.g. on neurons. We hypothesized that ADH4 dysfunction may increase risk for Parkinson's disease (PD) and previously reported association of an ADH4 allele with PD. We found that a promoter polymorphism in this allele induced a 25-30% reduction of transcriptional activity. Based on these findings, we have now investigated whether Adh4 homo- (Adh4-/-) or heterozygous (Adh4+/-) knockout mice display any dopamine system-related changes in behavior, biochemical parameters or olfaction compared to wild-type mice. The spontaneous locomotor activity was found to be similar in the three groups, whereas administration of d-amphetamine or apomorphine induced a significant increase in horizontal activity in the Adh4-/- mice compared to wild-type mice. We measured levels of monoamines and their metabolites in striatum, frontal cortex and substantia nigra and found increased levels of dopamine and DOPAC in substantia nigra of Adh4-/- mice. Investigation of olfactory function revealed a reduced sense of smell in Adh4-/- mice accompanied by alterations in dopamine metabolite levels in the olfactory bulb. Taken together, our results suggest that lack of Adh4 gene activity induces changes in the function of the dopamine system, findings which are compatible with a role of loss-of-function mutations in ADH4 as possible risk factors for PD.

  10. The insect SNMP gene family.

    PubMed

    Vogt, Richard G; Miller, Natalie E; Litvack, Rachel; Fandino, Richard A; Sparks, Jackson; Staples, Jon; Friedman, Robert; Dickens, Joseph C

    2009-07-01

    SNMPs are membrane proteins observed to associate with chemosensory neurons in insects; in Drosophila melanogaster, SNMP1 has been shown to be essential for the detection of the pheromone cis-vaccenyl acetate (CVA). SNMPs are one of three insect gene clades related to the human fatty acid transporter CD36. We previously characterized the CD36 gene family in 4 insect Orders that effectively cover the Holometabola, or some 80% of known insect species and the 300 million years of evolution since this lineage emerged: Lepidoptera (e.g. Bombyx mori, Antheraea polyphemus, Manduca sexta, Heliothis virescens, Helicoverpa assulta, Helicoverpa armigera, Mamestra brassicae); Diptera (D. melanogaster, Drosophila pseudoobscura, Aedes aegypti, Anopheles gambiae, Culex pipiens quinquefasciatus); Hymenoptera (Apis mellifera); and Coleoptera (Tribolium castaneum). This previous study suggested a complex topography within the SNMP clade including a strongly supported SNMP1 sub-clade plus additional SNMP genes. To further resolve the SNMP clade here, we used cDNA sequences of SNMP1 and SNMP2 from various Lepidoptera species, D. melanogaster and Ae. aegypti, as well as BAC derived genomic sequences from Ae. aegypti as models for proposing corrected sequences of orthologues in the D. pseudoobscura and An. gambiae genomes, and for identifying orthologues in the B. mori and C. pipiens q. genomes. We then used these sequences to analyze the SNMP clade of the insect CD36 gene family, supporting the existence of two well supported sub-clades, SNMP1 and SNMP2, throughout the dipteran and lepidopteran lineages, and plausibly throughout the Holometabola and across a broad evolutionary time scale. We present indirect evidence based on evolutionary selection (dN/dS) that the dipteran SNMPs are expressed as functional proteins. We observed expansions of the SNMP1 sub-clade in C. pipiens q. and T. castaneum suggesting that the SNMP1s may have an expanded functional role in these species.

  11. Genetic variants in or near ADH1B and ADH1C affect susceptibility to alcohol dependence in a British and Irish population.

    PubMed

    Way, Michael; McQuillin, Andrew; Saini, Jit; Ruparelia, Kush; Lydall, Gregory J; Guerrini, Irene; Ball, David; Smith, Iain; Quadri, Giorgia; Thomson, Allan D; Kasiakogia-Worlley, Katherine; Cherian, Raquin; Gunwardena, Priyanthi; Rao, Harish; Kottalgi, Girija; Patel, Shamir; Hillman, Audrey; Douglas, Ewen; Qureshi, Sherhzad Y; Reynolds, Gerry; Jauhar, Sameer; O'Kane, Aideen; Dedman, Alex; Sharp, Sally; Kandaswamy, Radhika; Dar, Karim; Curtis, David; Morgan, Marsha Y; Gurling, Hugh M D

    2015-05-01

    Certain single nucleotide polymorphisms (SNPs) in genes encoding alcohol dehydrogenase (ADH) enzymes confer a significant protective effect against alcohol dependence syndrome (ADS) in East Asian populations. Recently, attention has focused on the role of these SNPs in determining ADS risk in European populations. To further elucidate these associations, SNPs of interest in ADH1B, ADH1C and the ADH1B/1C intergenic region were genotyped in a British and Irish population (ADS cases n = 1076: controls n = 1027) to assess their relative contribution to ADS risk. A highly significant, protective association was observed between the minor allele of rs1229984 in ADH1B and ADS risk [allelic P = 8.4 × 10(-6) , odds ratio (OR) = 0.26, 95 percent confidence interval, 0.14, 0.49]. Significant associations were also observed between ADS risk and the ADH1B/1C intergenic variant, rs1789891 [allelic P = 7.2 × 10(-5) , OR = 1.4 (1.2, 1.6)] and three non-synonymous SNPs rs698, rs1693482 and rs283413 in ADH1C. However, these associations were not completely independent; thus, while the ADH1B rs1229984 minor allele association was independent of those of the intergenic variant rs1789891 and the three ADH1C variants, the three ADH1C variants were not individually independent. In conclusion, the rare ADH1B rs1229984 mutation provides significant protection against ADS in this British and Irish population; other variants in the ADH gene cluster also alter ADS risk, although the strong linkage disequilibrium between SNPs at this location precluded clear identification of the variant(s) driving the associations.

  12. Genetic Variation in the Expression of ADH in DROSOPHILA MELANOGASTER

    PubMed Central

    Maroni, G.; Laurie-Ahlberg, C. C.; Adams, D. A.; Wilton, A. N.

    1982-01-01

    Several chromosomes derived from natural populations have been identified that affect the expression of alcohol dehydrogenase (ADH). Second chromosomes, which also carry the structural gene Adh, show a great deal of polymorphism of genetic elements that determine how much enzyme protein accumulates. The level of enzyme was measured in third instar larvae, 6-to-8-day-old males and in larval fat bodies and alimentary canals. In general, activities in the different organs and stages are highly correlated with one another. One line was found, however, in which the ADH level in the fat body is more than twice the level one would expect on the basis of the activity in alimentary canal. We have also found evidence of third-chromosome elements that affect the level of ADH. PMID:6816669

  13. Sequence variation of alcohol dehydrogenase (Adh) paralogs in cactophilic Drosophila.

    PubMed Central

    Matzkin, Luciano M; Eanes, Walter F

    2003-01-01

    This study focuses on the population genetics of alcohol dehydrogenase (Adh) in cactophilic Drosophila. Drosophila mojavensis and D. arizonae utilize cactus hosts, and each host contains a characteristic mixture of alcohol compounds. In these Drosophila species there are two functional Adh loci, an adult form (Adh-2) and a larval and ovarian form (Adh-1). Overall, the greater level of variation segregating in D. arizonae than in D. mojavensis suggests a larger population size for D. arizonae. There are markedly different patterns of variation between the paralogs across both species. A 16-bp intron haplotype segregates in both species at Adh-2, apparently the product of an ancient gene conversion event between the paralogs, which suggests that there is selection for the maintenance of the intron structure possibly for the maintenance of pre-mRNA structure. We observe a pattern of variation consistent with adaptive protein evolution in the D. mojavensis lineage at Adh-1, suggesting that the cactus host shift that occurred in the divergence of D. mojavensis from D. arizonae had an effect on the evolution of the larval expressed paralog. Contrary to previous work we estimate a recent time for both the divergence of D. mojavensis and D. arizonae (2.4 +/- 0.7 MY) and the age of the gene duplication (3.95 +/- 0.45 MY). PMID:12586706

  14. Genetic and Cytogenetic Analysis of the ADH Region in DROSOPHILA MELANOGASTER

    PubMed Central

    O'Donnell, Janis; Mandel, Howard C.; Krauss, Marc; Sofer, William

    1977-01-01

    Eighteen Adh-negative mutations were selected with 1-pentyn-3-ol after feeding of formaldehyde. Twelve of the 18 were shown by cytological and genetic analysis to be deletions. Cytological examination of the deletions allowed us to localize the Adh gene to a region including bands 35B3–5 on the left arm of chromosome 2. The deletions were also used to order known visible loci located near Adh.—The vital loci near Adh were also investigated. A total of 109 lethal mutations were generated with EMS and 33 of these, localized within a region defined by the overlap of two of the deletions, were found to belong to 13 complementation groups. If one includes three other loci known to belong there (el, Adh and Sco), a total of 16 complementation groups have been identified in the region close to Adh. PMID:408228

  15. Lineage-Specific Expansion of IFIT Gene Family: An Insight into Coevolution with IFN Gene Family

    PubMed Central

    Liu, Ying; Zhang, Yi-Bing; Liu, Ting-Kai; Gui, Jian-Fang

    2013-01-01

    In mammals, IFIT (Interferon [IFN]-induced proteins with Tetratricopeptide Repeat [TPR] motifs) family genes are involved in many cellular and viral processes, which are tightly related to mammalian IFN response. However, little is known about non-mammalian IFIT genes. In the present study, IFIT genes are identified in the genome databases from the jawed vertebrates including the cartilaginous elephant shark but not from non-vertebrates such as lancelet, sea squirt and acorn worm, suggesting that IFIT gene family originates from a vertebrate ancestor about 450 million years ago. IFIT family genes show conserved gene structure and gene arrangements. Phylogenetic analyses reveal that this gene family has expanded through lineage-specific and species-specific gene duplication. Interestingly, IFN gene family seem to share a common ancestor and a similar evolutionary mechanism; the function link of IFIT genes to IFN response is present early since the origin of both gene families, as evidenced by the finding that zebrafish IFIT genes are upregulated by fish IFNs, poly(I:C) and two transcription factors IRF3/IRF7, likely via the IFN-stimulated response elements (ISRE) within the promoters of vertebrate IFIT family genes. These coevolution features creates functional association of both family genes to fulfill a common biological process, which is likely selected by viral infection during evolution of vertebrates. Our results are helpful for understanding of evolution of vertebrate IFN system. PMID:23818968

  16. Ethanol-induced alcohol dehydrogenase E (AdhE) potentiates pneumolysin in Streptococcus pneumoniae.

    PubMed

    Luong, Truc Thanh; Kim, Eun-Hye; Bak, Jong Phil; Nguyen, Cuong Thach; Choi, Sangdun; Briles, David E; Pyo, Suhkneung; Rhee, Dong-Kwon

    2015-01-01

    Alcohol impairs the host immune system, rendering the host more vulnerable to infection. Therefore, alcoholics are at increased risk of acquiring serious bacterial infections caused by Streptococcus pneumoniae, including pneumonia. Nevertheless, how alcohol affects pneumococcal virulence remains unclear. Here, we showed that the S. pneumoniae type 2 D39 strain is ethanol tolerant and that alcohol upregulates alcohol dehydrogenase E (AdhE) and potentiates pneumolysin (Ply). Hemolytic activity, colonization, and virulence of S. pneumoniae, as well as host cell myeloperoxidase activity, proinflammatory cytokine secretion, and inflammation, were significantly attenuated in adhE mutant bacteria (ΔadhE strain) compared to D39 wild-type bacteria. Therefore, AdhE might act as a pneumococcal virulence factor. Moreover, in the presence of ethanol, S. pneumoniae AdhE produced acetaldehyde and NADH, which subsequently led Rex (redox-sensing transcriptional repressor) to dissociate from the adhE promoter. An increase in AdhE level under the ethanol condition conferred an increase in Ply and H2O2 levels. Consistently, S. pneumoniae D39 caused higher cytotoxicity to RAW 264.7 cells than the ΔadhE strain under the ethanol stress condition, and ethanol-fed mice (alcoholic mice) were more susceptible to infection with the D39 wild-type bacteria than with the ΔadhE strain. Taken together, these data indicate that AdhE increases Ply under the ethanol stress condition, thus potentiating pneumococcal virulence.

  17. Description of a large family with autosomal dominant hypercholesterolemia associated with the APOE p.Leu167del mutation

    PubMed Central

    Marduel, Marie; Ouguerram, Khadija; Serre, Valérie; Bonnefont-Rousselot, Dominique; Marques-Pinheiro, Alice; Berge, Knut Erik; Devillers, Martine; Luc, Gérald; Lecerf, Jean-Michel; Tosolini, Laurent; Erlich, Danièle; Peloso, Gina M.; Stitziel, Nathan; Nitchké, Patrick; Jaïs, Jean-Philippe; Abifadel, Marianne; Kathiresan, Sekar; Leren, Trond Paul; Rabès, Jean-Pierre; Boileau, Catherine; Varret, Mathilde

    2013-01-01

    Apo E mutants are associated with type III hyperlipoproteinemia characterized by high cholesterol and triglycerides levels. Autosomal Dominant Hypercholesterolemia (ADH), due to mutations in the LDLR, APOB or PCSK9 genes, is characterized by an isolated elevation of cholesterol due to high levels of low-density lipoproteins (LDL). We now report an exceptionally large family including 14 members with ADH. Through genome wide mapping, analysis of regional/functional candidate genes and whole exome sequencing, we identified a mutation in the APOE gene, p.Leu167del previously reported associated with sea-blue histiocytosis and familial combined hyperlipidemia. We confirmed the involvement of the APOE p.Leu167del in ADH, with (1) a predicted destabilization of an alpha-helix in the binding domain; (2) a decreased apo E level in LDL; and (3) a decreased catabolism of LDL. Our results show that mutations in the APOE gene can be associated with bona fide ADH. PMID:22949395

  18. Ethanol tolerance and membrane fatty acid adaptation in adh multiple and null mutants of Kluyveromyces lactis.

    PubMed

    Heipieper, H J; Isken, S; Saliola, M

    2000-11-01

    The effects of ethanol and 1-octanol on growth and fatty acid composition of different strains of Kluyveromyces lactis containing a mutation in the four different alcohol dehydrogenase (KlADH) genes were investigated. In the presence of ethanol and 1-octanol K. lactis reduced the fluidity of its lipids by decreasing the unsaturation index (UI) of its membrane fatty acids. In this way, a direct correlation between nonlethal ethanol concentrations and the decrease in the UI could be observed. At concentrations which totally inhibited cell growth no reaction occurred. These adaptive modifications of the fatty acid pattern of K. lactis to ethanol contrasted with those reported for Saccharomyces cerevisiae and Schizosaccharomyces pombe. Whereas these two yeasts increased the fluidity of their membrane lipids in the presence of ethanol, K. lactis reduced the fluidity (UI) of its lipids. Among the different isogenic adh negative strains tested, the strain containing no ADH (adh0) and that containing only KlADH1 were the most alcohol-sensitive. The strain with only KlADH2 showed nearly the same tolerance as reference strain CBS 2359/152 containing all four ADH genes. This suggests that the KlADH2 product could play an important role in the adaptation/detoxification reactions of K. lactis to high ethanol concentrations.

  19. Ethanol formation in adh0 mutants reveals the existence of a novel acetaldehyde-reducing activity in Saccharomyces cerevisiae.

    PubMed Central

    Drewke, C; Thielen, J; Ciriacy, M

    1990-01-01

    A strain of Saccharomyces cerevisiae has been constructed which is deficient in the four alcohol dehydrogenase (ADH) isozymes known at present. This strain (adh0), being irreversibly mutated in the genes ADH1, ADH3, and ADH4 and carrying a point mutation in the gene ADH2 coding for the glucose-repressible isozyme ADHII, still produces up to one third of the theoretical maximum yield of ethanol in a homofermentative conversion of glucose to ethanol. Analysis of the glucose metabolism of adh0 cells shows that the lack of all known ADH isozymes results in the formation of glycerol as a major fermentation product, accompanied by a significant production of acetaldehyde and acetate. Treatment of glucose-growing adh0 cells with the respiratory-chain inhibitor antimycin A leads to an immediate cessation of ethanol production, demonstrating that ethanol production in adh0 cells is dependent on mitochondrial electron transport. Reduction of acetaldehyde to ethanol in isolated mitochondria could also be demonstrated. This reduction is apparently linked to the oxidation of acetaldehyde to acetate. Preliminary data suggest that this novel type of ethanol formation in S. cerevisiae is associated with the inner mitochondrial membrane. Images PMID:2193925

  20. The ADH7 Promoter of Saccharomyces cerevisiae is Vanillin-Inducible and Enables mRNA Translation Under Severe Vanillin Stress.

    PubMed

    Nguyen, Trinh T M; Iwaki, Aya; Izawa, Shingo

    2015-01-01

    Vanillin is one of the major phenolic aldehyde compounds derived from lignocellulosic biomass and acts as a potent fermentation inhibitor to repress the growth and fermentative ability of yeast. Vanillin can be reduced to its less toxic form, vanillyl alcohol, by the yeast NADPH-dependent medium chain alcohol dehydrogenases, Adh6 and Adh7. However, there is little information available regarding the regulation of their gene expression upon severe vanillin stress, which has been shown to repress the bulk translation activity in yeast cells. Therefore, in this study, we investigated expression patterns of the ADH6 and ADH7 genes in the presence of high concentrations of vanillin. We found that although both genes were transcriptionally upregulated by vanillin stress, they showed different protein expression patterns in response to vanillin. Expression of Adh6 was constitutive and gradually decreased under vanillin stress, whereas expression of Adh7 was inducible, and, importantly, occurred under severe vanillin stress. The null mutants of ADH6 or ADH7 genes were hypersensitive to vanillin and reduced vanillin less efficiently than the wild type, confirming the importance of Adh6 and Adh7 in vanillin detoxification. Additionally, we demonstrate that the ADH7 promoter is vanillin-inducible and enables effective protein synthesis even under severe vanillin stress, and it may be useful for the improvement of vanillin-tolerance and biofuel production efficiency via modification of yeast gene expression in the presence of high concentrations of vanillin.

  1. Metazoan Gene Families from Metazome

    DOE Data Explorer

    Metazome is a joint project of the Department of Energy's Joint Genome Institute and the Center for Integrative Genomics to facilitate comparative genomic studies amongst metazoans. Clusters of orthologous and paralogous genes that represent the modern descendents of ancestral gene sets are constructed at key phylogenetic nodes. These clusters allow easy access to clade specific orthology/paralogy relationships as well as clade specific genes and gene expansions. As of version 2.0.4, Metazome provides access to twenty-four sequenced and annotated metazoan genomes, clustered at nine evolutionarily significant nodes. Where possible, each gene has been annotated with PFAM, KOG, KEGG, and PANTHER assignments, and publicly available annotations from RefSeq, UniProt, Ensembl, and JGI are hyper-linked and searchable. The included organisms (by common name) are: Human, Mouse, Rat, Dog, Opossum, Chicken, Frog, Stickleback, Medaka, Fugu pufferfish; Zebrafish, Seasquirt - savignyi, Seasquirt - intestinalis, Amphioxus, Sea Urchin, Fruitfly, Mosquite, Yellow Fever Mosquito, Silkworm, Red Flour Beetle, Worm, Briggsae Worm, Owl limpet (snail), and Sea anemone. [Copied from Metazome Overview at http://www.metazome.net/Metazome_info.php

  2. Family reunion--the ZIP/prion gene family.

    PubMed

    Ehsani, Sepehr; Huo, Hairu; Salehzadeh, Ashkan; Pocanschi, Cosmin L; Watts, Joel C; Wille, Holger; Westaway, David; Rogaeva, Ekaterina; St George-Hyslop, Peter H; Schmitt-Ulms, Gerold

    2011-03-01

    Prion diseases are fatal neurodegenerative diseases of humans and animals which, in addition to sporadic and familial modes of manifestation, can be acquired via an infectious route of propagation. In disease, the prion protein (PrP(C)) undergoes a structural transition to its disease-causing form (PrP(Sc)) with profoundly different physicochemical properties. Surprisingly, despite intense interest in the prion protein, its function in the context of other cellular activities has largely remained elusive. We recently employed quantitative mass spectrometry to characterize the interactome of the prion protein in a murine neuroblastoma cell line (N2a), an established cell model for prion replication. Extensive bioinformatic analyses subsequently established an evolutionary link between the prion gene family and the family of ZIP (Zrt-, Irt-like protein) metal ion transporters. More specifically, sequence alignments, structural threading data and multiple additional pieces of evidence placed a ZIP5/ZIP6/ZIP10-like ancestor gene at the root of the PrP gene family. In this review we examine the biology of prion proteins and ZIP transporters from the viewpoint of a shared phylogenetic origin. We summarize and compare available data that shed light on genetics, function, expression, signaling, post-translational modifications and metal binding preferences of PrP and ZIP family members. Finally, we explore data indicative of retropositional origins of the prion gene founder and discuss a possible function for the prion-like (PL) domain within ZIP transporters. While throughout the article emphasis is placed on ZIP proteins, the intent is to highlight connections between PrP and ZIP transporters and uncover promising directions for future research.

  3. The human crystallin gene families

    PubMed Central

    2012-01-01

    Crystallins are the abundant, long-lived proteins of the eye lens. The major human crystallins belong to two different superfamilies: the small heat-shock proteins (α-crystallins) and the βγ-crystallins. During evolution, other proteins have sometimes been recruited as crystallins to modify the properties of the lens. In the developing human lens, the enzyme betaine-homocysteine methyltransferase serves such a role. Evolutionary modification has also resulted in loss of expression of some human crystallin genes or of specific splice forms. Crystallin organization is essential for lens transparency and mutations; even minor changes to surface residues can cause cataract and loss of vision. PMID:23199295

  4. Gene-Family Extension Measures and Correlations

    PubMed Central

    Carmi, Gon; Bolshoy, Alexander

    2016-01-01

    The existence of multiple copies of genes is a well-known phenomenon. A gene family is a set of sufficiently similar genes, formed by gene duplication. In earlier works conducted on a limited number of completely sequenced and annotated genomes it was found that size of gene family and size of genome are positively correlated. Additionally, it was found that several atypical microbes deviated from the observed general trend. In this study, we reexamined these associations on a larger dataset consisting of 1484 prokaryotic genomes and using several ranking approaches. We applied ranking methods in such a way that genomes with lower numbers of gene copies would have lower rank. Until now only simple ranking methods were used; we applied the Kemeny optimal aggregation approach as well. Regression and correlation analysis were utilized in order to accurately quantify and characterize the relationships between measures of paralog indices and genome size. In addition, boxplot analysis was employed as a method for outlier detection. We found that, in general, all paralog indexes positively correlate with an increase of genome size. As expected, different groups of atypical prokaryotic genomes were found for different types of paralog quantities. Mycoplasmataceae and Halobacteria appeared to be among the most interesting candidates for further research of evolution through gene duplication. PMID:27527218

  5. The glutamine synthetase gene family in Populus

    PubMed Central

    2011-01-01

    Background Glutamine synthetase (GS; EC: 6.3.1.2, L-glutamate: ammonia ligase ADP-forming) is a key enzyme in ammonium assimilation and metabolism of higher plants. The current work was undertaken to develop a more comprehensive understanding of molecular and biochemical features of GS gene family in poplar, and to characterize the developmental regulation of GS expression in various tissues and at various times during the poplar perennial growth. Results The GS gene family consists of 8 different genes exhibiting all structural and regulatory elements consistent with their roles as functional genes. Our results indicate that the family members are organized in 4 groups of duplicated genes, 3 of which code for cytosolic GS isoforms (GS1) and 1 which codes for the choroplastic GS isoform (GS2). Our analysis shows that Populus trichocarpa is the first plant species in which it was observed the complete GS family duplicated. Detailed expression analyses have revealed specific spatial and seasonal patterns of GS expression in poplar. These data provide insights into the metabolic function of GS isoforms in poplar and pave the way for future functional studies. Conclusions Our data suggest that GS duplicates could have been retained in order to increase the amount of enzyme in a particular cell type. This possibility could contribute to the homeostasis of nitrogen metabolism in functions associated to changes in glutamine-derived metabolic products. The presence of duplicated GS genes in poplar could also contribute to diversification of the enzymatic properties for a particular GS isoform through the assembly of GS polypeptides into homo oligomeric and/or hetero oligomeric holoenzymes in specific cell types. PMID:21867507

  6. A genetic analysis of Adh1 regulation

    SciTech Connect

    Freeling, M.

    1992-01-01

    The overall goal of our research proposal is to understand the meaning of the various cis-acting sites responsible for AdH1 expression in the entire maize plant. Progress is reported in the following areas: Studies on the TATA box and analysis of revertants of the Adh1-3F1124 allele; screening for more different mutants that affect Adh1 expression differentially; studies on cis-acting sequences required for root-specific Adh1 expression; refinement of the use of the particle gun; and functional analysis of a non- glycolytic anaerobic protein.

  7. Evolutionary history of the Asr gene family.

    PubMed

    Frankel, Nicolás; Carrari, Fernando; Hasson, Esteban; Iusem, Norberto D

    2006-08-15

    The Asr gene family is widespread in higher plants. Most Asr genes are up-regulated under different environmental stress conditions and during fruit ripening. ASR proteins are localized in the nucleus and their likely function is transcriptional regulation. In cultivated tomato, we identified a novel fourth family member, named Asr4, which maps close to its sibling genes Asr1-Asr2-Asr3 and displays an unshared region coding for a domain containing a 13-amino acid repeat. In this work we were able to expand our previous analysis for Asr2 and investigated the coding regions of the four known Asr paralogous genes in seven tomato species from different geographic locations. In addition, we performed a phylogenetic analysis on ASR proteins. The first conclusion drawn from this work is that tomato ASR proteins cluster together in the tree. This observation can be explained by a scenario of concerted evolution or birth and death of genes. Secondly, our study showed that Asr1 is highly conserved at both replacement and synonymous sites within the genus Lycopersicon. ASR1 protein sequence conservation might be associated with its multiple functions in different tissues while the low rate of synonymous substitutions suggests that silent variation in Asr1 is selectively constrained, which is probably related to its high expression levels. Finally, we found that Asr1 activation under water stress is not conserved between Lycopersicon species.

  8. NFAT Gene Family in Inflammation and Cancer

    PubMed Central

    Pan, M.-G.; Xiong, Y.; Chen, F.

    2013-01-01

    Calcineurin-NFAT signaling is critical for numerous aspects of vertebrate function during and after embryonic development. Initially discovered in T cells, the NFAT gene family, consisting of five members, regulates immune system, inflammatory response, angiogenesis, cardiac valve formation, myocardial development, axonal guidance, skeletal muscle development, bone homeostasis, development and metastasis of cancer, and many other biological processes. In this review we will focus on the NFAT literature relevant to the two closely related pathological systems: inflammation and cancer. PMID:22950383

  9. The Impact of ADH1B Alleles and Educational Status on Levels and Modes of Alcohol Consumption in Russian Male Individuals.

    PubMed

    Borinskaya, S A; Kim, A A; Rubanovich, A V; Yankovsky, N K

    2013-07-01

    Alcohol abuse is one of the main reasons behind the low life span in Russia. Both social and genetic factors affect the alcohol consumption level. The genetic factors are alleles of the alcohol dehydrogenase ADH1B and aldehyde dehydrogenaseALDH2 genes. We have typed and found frequencies for the alleles in a cohort of 642 men, ethnic Russians. The individuals of the cohort were asked to complete a questionnaire in the framework of the Izhevsk Family Study (Leon et al., 2007, 2009) regarding the amount of alcohol consumed and on the type of hazardous alcohol consumption (nonbeverage alcohol consumption and the so-called "zapoï" which is a Russian term for a heavy drinking bout lasting for at least 2 days, when an individual is withdrawn from the normal social life). The ADH1B*48His allele was found among heterozygous individuals only (N=68, 10.6% of the cohort). The ALDH2*504Lys allele was also found among heterozygous individuals only (N=2, 0.3%) The effect of ADH1B alleles and the influence of the education level on the amount and type of alcohol consumed had not previously been studied in Russians. We have found that the amount of consumed alcohol is 21.6% lower (1733 g of ethanol per year) for ADH1B*48His allele carriers in the cohort of Russian men. The amount of consumed alcohol was found to be 9.8% lower (793 g of ethanol per year) in the case when individuals had a higher education as compared to those who had a secondary- or elementary school education level in the same cohort. Hence, the protective effect of the genetic factor (ADH1B*48His allele carriage) has proven to be more pronounced than the influence of the social factor (education level) at the individual level in the cohort of Russian men. Both factors have also proven to have a protective effect against hazardous types of alcohol consumption. Zapoï was not scored among individuals of the cohort with ADH1B*48His allele carriage (OR=12.6, P=0.006), as compared to 8.4% of "zapoï" individuals who

  10. Transient overexpression of adh8a increases allyl alcohol toxicity in zebrafish embryos.

    PubMed

    Klüver, Nils; Ortmann, Julia; Paschke, Heidrun; Renner, Patrick; Ritter, Axel P; Scholz, Stefan

    2014-01-01

    Fish embryos are widely used as an alternative model to study toxicity in vertebrates. Due to their complexity, embryos are believed to more resemble an adult organism than in vitro cellular models. However, concerns have been raised with respect to the embryo's metabolic capacity. We recently identified allyl alcohol, an industrial chemical, to be several orders of magnitude less toxic to zebrafish embryo than to adult zebrafish (embryo LC50 = 478 mg/L vs. fish LC50 = 0.28 mg/L). Reports on mammals have indicated that allyl alcohol requires activation by alcohol dehydrogenases (Adh) to form the highly reactive and toxic metabolite acrolein, which shows similar toxicity in zebrafish embryos and adults. To identify if a limited metabolic capacity of embryos indeed can explain the low allyl alcohol sensitivity of zebrafish embryos, we compared the mRNA expression levels of Adh isoenzymes (adh5, adh8a, adh8b and adhfe1) during embryo development to that in adult fish. The greatest difference between embryo and adult fish was found for adh8a and adh8b expression. Therefore, we hypothesized that these genes might be required for allyl alcohol activation. Microinjection of adh8a, but not adh8b mRNA led to a significant increase of allyl alcohol toxicity in embryos similar to levels reported for adults (LC50 = 0.42 mg/L in adh8a mRNA-injected embryos). Furthermore, GC/MS analysis of adh8a-injected embryos indicated a significant decline of internal allyl alcohol concentrations from 0.23-58 ng/embryo to levels below the limit of detection (< 4.6 µg/L). Injection of neither adh8b nor gfp mRNA had an impact on internal allyl alcohol levels supporting that the increased allyl alcohol toxicity was mediated by an increase in its metabolization. These results underline the necessity to critically consider metabolic activation in the zebrafish embryo. As demonstrated here, mRNA injection is one useful approach to study the role of candidate enzymes involved in

  11. The Pax gene family: Highlights from cephalopods

    PubMed Central

    Baratte, Sébastien; Andouche, Aude; Bonnaud-Ponticelli, Laure

    2017-01-01

    Pax genes play important roles in Metazoan development. Their evolution has been extensively studied but Lophotrochozoa are usually omitted. We addressed the question of Pax paralog diversity in Lophotrochozoa by a thorough review of available databases. The existence of six Pax families (Pax1/9, Pax2/5/8, Pax3/7, Pax4/6, Paxβ, PoxNeuro) was confirmed and the lophotrochozoan Paxβ subfamily was further characterized. Contrary to the pattern reported in chordates, the Pax2/5/8 family is devoid of homeodomain in Lophotrochozoa. Expression patterns of the three main pax classes (pax2/5/8, pax3/7, pax4/6) during Sepia officinalis development showed that Pax roles taken as ancestral and common in metazoans are modified in S. officinalis, most likely due to either the morphological specificities of cephalopods or to their direct development. Some expected expression patterns were missing (e.g. pax6 in the developing retina), and some expressions in unexpected tissues have been found (e.g. pax2/5/8 in dermal tissue and in gills). This study underlines the diversity and functional plasticity of Pax genes and illustrates the difficulty of using probable gene homology as strict indicator of homology between biological structures. PMID:28253300

  12. Rubisco small subunit gene family in cassava.

    PubMed

    Yeo, T W; Mak, Y M; Ho, K K

    1999-01-01

    Cassava leaves of two different cultivars, Brazil and Buloh, were used to isolate mRNA. The mRNA isolated was successfully used in the construction of cDNA libraries for each of the cultivars. The cDNA libraries were screened for members of ribulose-1,5-bisphosphate carboxylase/oxygenase small subunit gene family and positive clones were sequenced. A total of seven different SSU genes, of which five were from cultivar Brazil and two were from cultivar Buloh, were isolated. Comparison results show that even though all the sequences are highly similar, they can be classified into three subfamilies. Homology between members of the same subfamily is higher than homology between members from the same cultivar.

  13. Characterization of alcohol dehydrogenase (ADH12) from Haloarcula marismortui, an extreme halophile from the Dead Sea.

    PubMed

    Timpson, Leanne M; Alsafadi, Diya; Mac Donnchadha, Cillín; Liddell, Susan; Sharkey, Michael A; Paradisi, Francesca

    2012-01-01

    Haloarchaeal alcohol dehydrogenases are of increasing interest as biocatalysts in the field of white biotechnology. In this study, the gene adh12 from the extreme halophile Haloarcula marismortui (HmADH12), encoding a 384 residue protein, was cloned into two vectors: pRV1 and pTA963. The resulting constructs were used to transform host strains Haloferax volcanii (DS70) and (H1209), respectively. Overexpressed His-tagged recombinant HmADH12 was purified by immobilized metal-affinity chromatography (IMAC). The His-tagged protein was visualized by SDS-PAGE, with a subunit molecular mass of 41.6 kDa, and its identity was confirmed by mass spectrometry. Purified HmADH12 catalyzed the interconversion between alcohols and aldehydes and ketones, being optimally active in the presence of 2 M KCl. It was thermoactive, with maximum activity registered at 60°C. The NADP(H) dependent enzyme was haloalkaliphilic for the oxidative reaction with optimum activity at pH 10.0. It favored a slightly acidic pH of 6.0 for catalysis of the reductive reaction. HmADH12 was significantly more tolerant than mesophilic ADHs to selected organic solvents, making it a much more suitable biocatalyst for industrial application.

  14. The tomato cis-prenyltransferase gene family.

    PubMed

    Akhtar, Tariq A; Matsuba, Yuki; Schauvinhold, Ines; Yu, Geng; Lees, Hazel A; Klein, Samuel E; Pichersky, Eran

    2013-02-01

    cis-prenyltransferases (CPTs) are predicted to be involved in the synthesis of long-chain polyisoprenoids, all with five or more isoprene (C5) units. Recently, we identified a short-chain CPT, neryl diphosphate synthase (NDPS1), in tomato (Solanum lycopersicum). Here, we searched the tomato genome and identified and characterized its entire CPT gene family, which comprises seven members (SlCPT1-7, with NDPS1 designated as SlCPT1). Six of the SlCPT genes encode proteins with N-terminal targeting sequences, which, when fused to GFP, mediated GFP transport to the plastids of Arabidopsis protoplasts. The SlCPT3-GFP fusion protein was localized to the cytosol. Enzymatic characterization of recombinant SlCPT proteins demonstrated that SlCPT6 produces Z,Z-FPP, and SlCPT2 catalyzes the formation of nerylneryl diphosphate while SlCPT4, SlCPT5 and SlCPT7 synthesize longer-chain products (C25-C55). Although no in vitro activity was demonstrated for SlCPT3, its expression in the Saccharomyces cerevisiae dolichol biosynthesis mutant (rer2) complemented the temperature-sensitive growth defect. Transcripts of SlCPT2, SlCPT4, SlCPT5 and SlCPT7 are present at low levels in multiple tissues, SlCPT6 is exclusively expressed in red fruit and roots, and SlCPT1, SlCPT3 and SlCPT7 are highly expressed in trichomes. RNAi-mediated suppression of NDPS1 led to a large decrease in β-phellandrene (which is produced from neryl diphosphate), with greater reductions achieved with the general 35S promoter compared to the trichome-specific MKS1 promoter. Phylogenetic analysis revealed CPT gene families in both eudicots and monocots, and showed that all the short-chain CPT genes from tomato (SlCPT1, SlCPT2 and SlCPT6) are closely linked to terpene synthase gene clusters.

  15. Tumor suppressor genes in familial adenomatous polyposis

    PubMed Central

    Eshghifar, Nahal; Farrokhi, Naser; Naji, Tahereh; Zali, Mohammadreza

    2017-01-01

    Colorectal cancer (CRC) is mostly due to a series of genetic alterations that are being greatly under the influence of the environmental factors. These changes, mutational or epigenetic modifications at transcriptional forefront and/or post-transcriptional effects via miRNAs, include inactivation and the conversion of proto-oncogene to oncogenes, and/or inactivation of tumor suppressor genes (TSG). Here, a thorough review was carried out on the role of TSGs with the focus on the APC as the master regulator, mutated genes and mal-/dysfunctional pathways that lead to one type of hereditary form of the CRC; namely familial adenomatous polyposis (FAP). This review provides a venue towards defining candidate genes that can be used as new PCR-based markers for early diagnosis of FAP. In addition to diagnosis, defining the modes of genetic alterations will open door towards genome editing to either suppress the disease or reduce its progression during the course of action. PMID:28331559

  16. Functional relevance of human adh polymorphism.

    PubMed

    Eriksson, C J; Fukunaga, T; Sarkola, T; Chen, W J; Chen, C C; Ju, J M; Cheng, A T; Yamamoto, H; Kohlenberg-Müller, K; Kimura, M; Murayama, M; Matsushita, S; Kashima, H; Higuchi, S; Carr, L; Viljoen, D; Brooke, L; Stewart, T; Foroud, T; Su, J; Li, T K; Whitfield, J B

    2001-05-01

    This article represents the proceedings of a symposium at the 2000 ISBRA Meeting in Yokohama, Japan. The chairs were C. J. Peter Eriksson and Tatsushige Fukunaga. The presentations were (1) 4-Methylpyrazole as a tool in the investigation of the role of ADH in the actions of alcohol in humans, by Taisto Sarkola and C. J. Peter Eriksson; (2) ADH2 polymorphism and flushing in Asian populations, by Wei J. Chen, C. C. Chen, J. M. Ju, and Andrew T. A. Cheng; (3) Role of ADH3 genotypes in the acute effects of alcohol in a Finnish population, by Hidetaka Yamamoto, Kathrin Kohlenberg-Müller, and C. J. Peter Eriksson; (4) Clinical characteristics and disease course of alcoholics with different ADH2 genotypes, by Mitsuru Kimura, Masanobu Murayama, Sachio Matsushita, Haruo Kashima, and Susumu Higuchi; (5) ADH2 polymorphism, alcohol drinking, and birth defects, by Lucinda Carr, D. Viljoen, L. Brooke, T. Stewart, T. Foroud, J. Su, and Ting-Kai Li; and (6) ADH genotypes and alcohol use in Europeans, by John B. Whitfield.

  17. The Arabidopsis Cyclophilin Gene Family1

    PubMed Central

    Romano, Patrick G.N.; Horton, Peter; Gray, Julie E.

    2004-01-01

    Database searching has allowed the identification of a number of previously unreported single and multidomain isoform members of the Arabidopsis cyclophilin gene family. In addition to the cyclophilin-like peptidyl-prolyl cis-trans isomerase domain, the latter contain a variety of other domains with characterized functions. Transcriptional analysis showed they are expressed throughout the plant, and different isoforms are present in all parts of the cell including the cytosol, nucleus, mitochondria, secretory pathway, and chloroplast. The abundance and diversity of cyclophilin isoforms suggests that, like their animal counterparts, plant cyclophilins are likely to be important proteins involved in a wide variety of cellular processes. As well as fulfilling the basic role of protein folding, they may also play important roles in mRNA processing, protein degradation, and signal transduction and thus may be crucial during both development and stress responsiveness. PMID:15051864

  18. Meta-Analyses of ALDH2 and ADH1B with Alcohol Dependence in Asians

    ERIC Educational Resources Information Center

    Luczak, Susan E.; Glatt, Stephen J.; Wall, Tamara J.

    2006-01-01

    Meta-analyses were conducted to determine the magnitude of relationships between polymorphisms in 2 genes, ALDH2 and ADH1B, with alcohol dependence in Asians. For each gene, possession of 1 variant [asterisk]2 allele was protective against alcohol dependence, and possession of a 2nd [asterisk]2 allele did not offer significant additional…

  19. Correct developmental expression of a cloned alcohol dehydrogenase gene transduced into the Drosophila germ line.

    PubMed

    Goldberg, D A; Posakony, J W; Maniatis, T

    1983-08-01

    We have used P-element-mediated transformation to introduce a cloned Drosophila alcohol dehydrogenase (Adh) gene into the germ line of ADH null flies. Six independent transformants expressing ADH were identified by their acquired resistance to ethanol. Each transformant carries a single copy of the cloned Adh gene in a different chromosomal location. Four of the six transformant lines exhibit normal Adh expression by the following criteria: quantitative levels of ADH enzyme activity in larvae and adults; qualitative tissue specificity; the size of stable Adh mRNA; and the characteristic developmental switch in utilization of two different Adh promoters. The remaining two transformants express ADH enzyme activity with the correct tissue specificity, but at a lower level than wild type. These results demonstrate that an 11.8 kb chromosomal fragment containing the Adh gene includes the cis-acting sequences necessary for its correct developmental expression, and that a variety of chromosomal sites permit proper Adh gene function.

  20. Structure and transcription of the Drosophila mulleri alcohol dehydrogenase genes.

    PubMed

    Fischer, J A; Maniatis, T

    1985-10-11

    The D. melanogaster Adh gene is transcribed from two different promoters; a proximal (larval) promoter is active during late embryonic and larval stages, and a distal (adult) promoter is active primarily in third instar larvae and in adult flies (1). Genetic analyses suggest that several species of the mulleri subgroup (distant relatives of D. melanogaster) have two closely-linked Adh genes, Adh-1 and Adh-2, each of which expresses a different ADH protein (2). The temporal pattern of expression of Adh-1 and Adh-2 is similar to the expression of D. melanogaster Adh from the proximal and distal promoters (2,3,4). We are interested in the molecular basis for the pattern of Adh expression in the mulleri subgroup species and in the mechanism of the switch in Adh promoter utilization. For these reasons, we have studied the structure and transcription of the Adh locus of D. mulleri, a species of the mulleri subgroup. We show that the ADH-1 and ADH-2 proteins are expressed from two distinct genes separated by 2 kilobase pairs, and that Adh-1 and Adh-2 are transcribed in the expected temporal pattern. In addition, we find a pseudogene 1.2 kb upstream from Adh-2, which is transcribed in a temporal pattern similar to Adh-2.

  1. Modelling the evolution of multi-gene families.

    PubMed

    Nye, Tom M W

    2009-10-01

    A number of biological processes can lead to genes being copied within the genome of some given species. Duplicate genes of this form are called paralogs and such genes share a high degree sequence similarity as well as often having closely related functions. Some genes have become widely duplicated to form multigene families in which the copies are distributed both within the genomes of individual species and across different species. Statistical modelling of gene duplication and the evolution of multi-gene families currently lags behind well-established models of DNA sequence evolution despite an increasing volume of available data, but the analysis of multi-gene families is important as part of a wider effort to understand evolution at the genomic level. This article reviews existing approaches to modelling multi-gene families and presents various challenges and possibilities for this exciting area of research.

  2. The Relationship between CmADHs and the Diversity of Volatile Organic Compounds of Three Aroma Types of Melon (Cucumis melo)

    PubMed Central

    Chen, Hao; Cao, Songxiao; Jin, Yazhong; Tang, Yufan; Qi, Hongyan

    2016-01-01

    Alcohol dehydrogenase (ADH) plays an important role in aroma volatile compounds synthesis of plants. In this paper, we tried to explore the relationship between CmADHs and the volatile organic compounds (VOCs) in oriental melon. Three different aroma types of melon were used as materials. The principle component analysis of three types of melon fruit was conducted. We also measured the CmADHs expression level and enzymatic activities of ADH and alcohol acyl-transferase (AAT) on different stages of fruit ripening. An incubation experiment was carried out to investigate the effect of substrates and inhibitor (4-MP, 4-methylpyrazole) on CmADHs expression, ADH activity, and the main compounds of oriental melon. The results illustrated that ethyl acetate, hexyl acetate (E,Z)-3,6-nonadien-1-ol and 2-ethyl-2hexen-1-ol were the four principal volatile compounds of these three types of melon. AAT activity was increasing with fruit ripening, and the AAT activity in CH were the highest, whereas ADH activity peaked on 32 DAP, 2 days before maturation, and the ADH activity in CB and CG were higher than that in CH. The expression pattern of 11 CmADH genes from 24 to 36 day after pollination (DAP) was found to vary in three melon varieties. CmADH4 was only expressed in CG and the expression levels of CmADH3 and CmADH12 in CH and CB were much higher than that in CG, and they both peaked 2 days before fruit ripening. Ethanol and 4-MP decreased the reductase activity of ADH, the expression of most CmADHs and ethyl acetate or hexyl acetate contents of CB, except for 0.1 mM 4-MP, while aldehyde improved the two acetate ester contents. In addition, we found a positive correlation between the expression of CmADH3 and CmADH12 and the key volatile compound of CB. The relationship between CmADHs and VOCs synthesis of oriental melon was discussed. PMID:27445845

  3. Evolutionary analyses of non-family genes in plants

    SciTech Connect

    Ye, Chuyu; Li, Ting; Yin, Hengfu; Weston, David; Tuskan, Gerald A; Tschaplinski, Timothy J; Yang, Xiaohan

    2013-01-01

    There are a large number of non-family (NF) genes that do not cluster into families with three or more members per genome. While gene families have been extensively studied, a systematic analysis of NF genes has not been reported. We performed comparative studies on NF genes in 14 plant species. Based on the clustering of protein sequences, we identified ~94 000 NF genes across these species that were divided into five evolutionary groups: Viridiplantae wide, angiosperm specific, monocot specific, dicot specific, and those that were species specific. Our analysis revealed that the NF genes resulted largely from less frequent gene duplications and/or a higher rate of gene loss after segmental duplication relative to genes in both lowcopy- number families (LF; 3 10 copies per genome) and high-copy-number families (HF; >10 copies). Furthermore, we identified functions enriched in the NF gene set as compared with the HF genes. We found that NF genes were involved in essential biological processes shared by all plant lineages (e.g. photosynthesis and translation), as well as gene regulation and stress responses associated with phylogenetic diversification. In particular, our analysis of an Arabidopsis protein protein interaction network revealed that hub proteins with the top 10% most connections were over-represented in the NF set relative to the HF set. This research highlights the roles that NF genes may play in evolutionary and functional genomics research.

  4. Evolutionary analyses of non-family genes in plants

    SciTech Connect

    Ye, Chuyu; Li, Ting; Yin, Hengfu; Weston, David; Tuskan, Gerald A; Tschaplinski, Timothy J; Yang, Xiaohan

    2013-03-01

    There are a large number of non-family (NF) genes that do not cluster into families with three or more members per genome. While gene families have been extensively studied, a systematic analysis of NF genes has not been reported. We performed comparative studies on NF genes in 14 plant species. Based on the clustering of protein sequences, we identified ~94,000 NF genes across these species that were divided into five evolutionary groups: Viridiplantae-wide, angiosperm-specific, monocot-specific, dicot-specific, and those that were species-specific. Our analysis revealed that the NF genes resulted largely from less frequent gene duplications and/or a higher rate of gene loss after segmental duplication relative to genes in both low-copy-number families (LF; 3 10 copies per genome) and high-copy-number families (HF; >10 copies). Furthermore, we identified functions enriched in the NF gene set as compared with the HF genes. We found that NF genes were involved in essential biological processes shared by all plant lineages (e.g., photosynthesis and translation), as well as gene regulation and stress responses associated with phylogenetic diversification. In particular, our analysis of an Arabidopsis protein-protein interaction network revealed that hub proteins with the top 10% most connections were over-represented in the NF set relative to the HF set. This research highlights the roles that NF genes may play in evolutionary and functional genomics research.

  5. The yeast ubiquitin genes: a family of natural gene fusions.

    PubMed Central

    Ozkaynak, E; Finley, D; Solomon, M J; Varshavsky, A

    1987-01-01

    Ubiquitin is a 76-residue protein highly conserved among eukaryotes. Conjugation of ubiquitin to intracellular proteins mediates their selective degradation in vivo. We describe a family of four ubiquitin-coding loci in the yeast Saccharomyces cerevisiae. UB11, UB12 and UB13 encode hybrid proteins in which ubiquitin is fused to unrelated ('tail') amino acid sequences. The ubiquitin coding elements of UB11 and UB12 are interrupted at identical positions by non-homologous introns. UB11 and UB12 encode identical 52-residue tails, whereas UB13 encodes a different 76-residue tail. The tail amino acid sequences are highly conserved between yeast and mammals. Each tail contains a putative metal-binding, nucleic acid-binding domain of the form Cys-X2-4-Cys-X2-15-Cys-X2-4-Cys, suggesting that these proteins may function by binding to DNA. The fourth gene, UB14, encodes a polyubiquitin precursor protein containing five ubiquitin repeats in a head-to-tail, spacerless arrangement. All four ubiquitin genes are expressed in exponentially growing cells, while in stationary-phase cells the expression of UB11 and UB12 is repressed. The UB14 gene, which is strongly inducible by starvation, high temperatures and other stresses, contains in its upstream region strong homologies to the consensus 'heat shock box' nucleotide sequence. Elsewhere we show that the essential function of the UB14 gene is to provide ubiquitin to cells under stress. Images Fig. 1. Fig. 7. PMID:3038523

  6. ADH1A variation predisposes to personality traits and substance dependence.

    PubMed

    Zuo, Lingjun; Gelernter, Joel; Kranzler, Henry R; Stein, Murray B; Zhang, Huiping; Wei, Feng; Sen, Srijan; Poling, James; Luo, Xingguang

    2010-03-05

    Human personality traits are strong predictors or characteristics of many psychiatric disorders including substance dependence (SD). Recently, significant associations between alcohol dehydrogenase type 1A gene (ADH1A) and SD have been reported, which led us to investigate the impact of ADH1A variation on personality traits and risk of SD. Five hundred fifty-eight subjects with SD [398 European-Americans (EAs) and 160 African-Americans (AAs)], 517 college students (384 EAs and 133 European-origin Hispanics), and 448 healthy subjects (385 EAs, 48 AAs, and 15 European-origin Hispanics) participated. Personality traits were assessed in 247 subjects with SD (179 EAs and 68 AAs), all 517 college students, and 332 healthy subjects (285 EAs, 40 AAs, and 7 European-origin Hispanics). The relationships between ADH1A and personality traits were comprehensively examined using stepwise multivariate analysis of covariance (MANCOVA), and then decomposed by stepwise analysis of covariance (ANCOVA). The relationship between ADH1A and SD was examined using stepwise logistic regression analysis. Admixture effects on analyses were considered. Overall, Agreeableness and Conscientiousness were associated with the diplotypes, haplotypes, genotypes, and/or alleles of ADH1A in three of four phenotype groups including EA SD subjects, healthy subjects, and AA SD subjects (1.7 x 10(-4) ADH1A (0.008 ADH1A variation may contribute to the genetic component of variation in personality traits and SD.

  7. Functional divergence in the Arabidopsis LOB-domain gene family

    PubMed Central

    Mangeon, Amanda; Lin, Wan-ching; Springer, Patricia S.

    2012-01-01

    The Arabidopsis LOB-domain (LBD) gene family is composed by 43 members divided in two classes based on amino acid conservation within the LOB-domain. The LOB domain is known to be responsible for DNA binding and protein-protein interactions. There is very little functional information available for most genes in the LBD family and many lbd single mutants do not exhibit conspicuous phenotypes. One plausible explanation for the limited loss-of-function phenotypes observed in this family is that LBD genes exhibit significant functional redundancy. Here we discuss an example of one phylogenetic subgroup of the LBD family, in which genes that are closely related based on phylogeny exhibit distinctly different expression patterns and do not have overlapping functions. We discuss the challenges of using phylogenetic analyses to predict redundancy in gene families. PMID:23073009

  8. Complexity of the MSG gene family of Pneumocystis carinii

    PubMed Central

    Keely, Scott P; Stringer, James R

    2009-01-01

    Background The relationship between the parasitic fungus Pneumocystis carinii and its host, the laboratory rat, presumably involves features that allow the fungus to circumvent attacks by the immune system. It is hypothesized that the major surface glycoprotein (MSG) gene family endows Pneumocystis with the capacity to vary its surface. This gene family is comprised of approximately 80 genes, which each are approximately 3 kb long. Expression of the MSG gene family is regulated by a cis-dependent mechanism that involves a unique telomeric site in the genome called the expression site. Only the MSG gene adjacent to the expression site is represented by messenger RNA. Several P. carinii MSG genes have been sequenced, which showed that genes in the family can encode distinct isoforms of MSG. The vast majority of family members have not been characterized at the sequence level. Results The first 300 basepairs of MSG genes were subjected to analysis herein. Analysis of 581 MSG sequence reads from P. carinii genomic DNA yielded 281 different sequences. However, many of the sequence reads differed from others at only one site, a degree of variation consistent with that expected to be caused by error. Accounting for error reduced the number of truly distinct sequences observed to 158, roughly twice the number expected if the gene family contains 80 members. The size of the gene family was verified by PCR. The excess of distinct sequences appeared to be due to allelic variation. Discounting alleles, there were 73 different MSG genes observed. The 73 genes differed by 19% on average. Variable regions were rich in nucleotide differences that changed the encoded protein. The genes shared three regions in which at least 16 consecutive basepairs were invariant. There were numerous cases where two different genes were identical within a region that was variable among family members as a whole, suggesting recombination among family members. Conclusion A set of sequences that

  9. Differential expression of the ras gene family in mice.

    PubMed Central

    Leon, J; Guerrero, I; Pellicer, A

    1987-01-01

    We compared the expression of the ras gene family (H-ras, K-ras, and N-ras) in adult mouse tissues and during development. We found substantial variations in expression among different organs and in the amounts of the different transcripts originating from each gene, especially for the N-ras gene. The expression patterns were consistent with the reported preferential tissue activation of ras genes and suggested different cellular functions for each of the ras genes. Images PMID:3600635

  10. Isolation and characterization of full-length putative alcohol dehydrogenase genes from polygonum minus

    NASA Astrophysics Data System (ADS)

    Hamid, Nur Athirah Abd; Ismail, Ismanizan

    2013-11-01

    Polygonum minus, locally named as Kesum is an aromatic herb which is high in secondary metabolite content. Alcohol dehydrogenase is an important enzyme that catalyzes the reversible oxidation of alcohol and aldehyde with the presence of NAD(P)(H) as co-factor. The main focus of this research is to identify the gene of ADH. The total RNA was extracted from leaves of P. minus which was treated with 150 μM Jasmonic acid. Full-length cDNA sequence of ADH was isolated via rapid amplification cDNA end (RACE). Subsequently, in silico analysis was conducted on the full-length cDNA sequence and PCR was done on genomic DNA to determine the exon and intron organization. Two sequences of ADH, designated as PmADH1 and PmADH2 were successfully isolated. Both sequences have ORF of 801 bp which encode 266 aa residues. Nucleotide sequence comparison of PmADH1 and PmADH2 indicated that both sequences are highly similar at the ORF region but divergent in the 3' untranslated regions (UTR). The amino acid is differ at the 107 residue; PmADH1 contains Gly (G) residue while PmADH2 contains Cys (C) residue. The intron-exon organization pattern of both sequences are also same, with 3 introns and 4 exons. Based on in silico analysis, both sequences contain "classical" short chain alcohol dehydrogenases/reductases ((c) SDRs) conserved domain. The results suggest that both sequences are the members of short chain alcohol dehydrogenase family.

  11. The Expansion of the PRAME Gene Family in Eutheria

    PubMed Central

    Chang, Ti-Cheng; Yang, Yang; Yasue, Hiroshi; Bharti, Arvind K.; Retzel, Ernest F.; Liu, Wan-Sheng

    2011-01-01

    The PRAME gene family belongs to the group of cancer/testis genes whose expression is restricted primarily to the testis and a variety of cancers. The expansion of this gene family as a result of gene duplication has been observed in primates and rodents. We analyzed the PRAME gene family in Eutheria and discovered a novel Y-linked PRAME gene family in bovine, PRAMEY, which underwent amplification after a lineage-specific, autosome-to-Y transposition. Phylogenetic analyses revealed two major evolutionary clades. Clade I containing the amplified PRAMEYs and the unamplified autosomal homologs in cattle and other eutherians is under stronger functional constraints; whereas, Clade II containing the amplified autosomal PRAMEs is under positive selection. Deep-sequencing analysis indicated that eight of the identified 16 PRAMEY loci are active transcriptionally. Compared to the bovine autosomal PRAME that is expressed predominantly in testis, the PRAMEY gene family is expressed exclusively in testis and is up-regulated during testicular maturation. Furthermore, the sense RNA of PRAMEY is expressed specifically whereas the antisense RNA is expressed predominantly in spermatids. This study revealed that the expansion of the PRAME family occurred in both autosomes and sex chromosomes in a lineage-dependent manner. Differential selection forces have shaped the evolution and function of the PRAME family. The positive selection observed on the autosomal PRAMEs (Clade II) may result in their functional diversification in immunity and reproduction. Conversely, selective constraints have operated on the expanded PRAMEYs to preserve their essential function in spermatogenesis. PMID:21347312

  12. [Regulatory functions of Pax gene family in Drosophila development].

    PubMed

    Li, Li; Yang, Yang; Xue, Lei

    2010-02-01

    The Pax gene family encodes a group of important transcription factors that have been evolutionary conserved from Drosophila to human. Pax genes play pivotal roles in regulating diverse signal transduction pathways and organogenesis during embryonic development through modulating cell proliferation and self-renewal, embryonic precursor cell migration, and the coordination of specific differentiation programs. Ten members of the Pax gene family, which perform crucial regulatory functions during embryonic and postembryonic development, have been identified in Drosophila. In this report, we described the protein structures, expression patterns, and main functions of Drosophila Pax genes.

  13. Evaluation of the Saccharomyces cerevisiae ADH2 promoter for protein synthesis.

    PubMed

    Lee, K Michael; DaSilva, Nancy A

    2005-04-30

    The Saccharomyces cerevisiae ADH2 promoter (P(ADH2)) is repressed several hundred-fold in the presence of glucose; transcription is initiated once the glucose in the medium is exhausted. The promoter can thus be utilized for effective regulation of recombinant gene expression in S. cerevisiae without the addition of an inducer. To evaluate this promoter in the absence of plasmid copy number and stability variations, the P(ADH2)-lacZ cassette was integrated into the yeast chromosomes. The effects of medium composition, glucose concentration and cultivation time on promoter derepression and expression level were investigated. Maximum protein activity was obtained after 48 h of growth in complex YPD medium containing 1% glucose. The widely used S. cerevisiae GAL1 and CUP1 promoters both require the addition of an inducer [galactose and copper(II) ion, respectively] before regulated genes will be expressed. The strengths of these three different promoters were compared for cells containing one copy of an integrated lacZ gene under their control. The ADH2 promoter was superior for all induction strategies investigated.

  14. Expression of ets family genes in hematopoietic-cells.

    PubMed

    Romanospica, V; Suzuki, H; Georgiou, P; Chen, S; Ascione, R; Papas, T; Bhat, N

    1994-03-01

    We have examined the expression of the ets family of transcription factors in different types of hematopoietic cells. Our results demonstrate that several members of the ets gene family are expressed differentially in hematopoietic cells. During phorbol ester induced differentiation of HL60 cells, ETS2, PEA3, as well as GABPalpha and GABPbeta mRNAs are coordinately induced. During the activation of T-cells, ETS2 proteins are induced; however, the expression of the ETS1 and ERGB gene products are reduced. These results demonstrate that the regulation of ets family of genes is complex and depends on cell type. This observation leads to the conclusion that the regulation of ets target genes, will be dependent, in part, upon the type of ets genes expressed in each particular cell type.

  15. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    NASA Astrophysics Data System (ADS)

    Yanai, Itai; Camacho, Carlos J.; Delisi, Charles

    2000-09-01

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications.

  16. T-shaped trichome-specific expression of monoterpene synthase ADH2 using promoter-β-GUS fusion in transgenic Artemisia annua L.

    PubMed

    Fu, Xueqing; Shi, Pu; Shen, Qian; Jiang, Weimin; Tang, Yueli; Lv, Zongyou; Yan, Tingxiang; Li, Ling; Wang, Guofeng; Sun, Xiaofen; Tang, Kexuan

    2016-11-01

    Artemisinin, a sesquiterpene lactone isolated from Artemisia annua L. (sweet wormwood), is extensively used in the treatment of malaria. In order to better understand the metabolism of terpenes in A. annua and the influence of terpene synthases on artemisinin yield, the expression pattern of a monoterpene alcohol dehydrogenase (ADH2) has been studied using transgenic plants expressing promoter-β-glucuronidase (GUS) fusion. ADH2 played a major role in monoterpenoid biosynthesis including carveol, borneol, and artemisia ketone through in vitro biochemical analysis. In this study, the ADH2 promoter was cloned by the genome walking method. A number of putative cis-acting elements were predicted in promoter region, suggesting that the ADH2 is driven by a complex regulation mechanism. ADH2 gene was highly expressed in old leaves, whereas the artemisinin biosynthetic genes were mainly expressed in bud and young leaves. The expression of ADH2 gene increased quickly during leaf development, revealed by qRT-PCR. GUS expression analysis in different tissues of transgenic A. annua demonstrates that ADH2 expression is exclusively located to T-shaped trichome, not glandular secretory trichome.

  17. Evolutionary History of the Cancer Immunity Antigen MAGE Gene Family

    PubMed Central

    Katsura, Yukako; Satta, Yoko

    2011-01-01

    The evolutionary mode of a multi-gene family can change over time, depending on the functional differentiation and local genomic environment of family members. In this study, we demonstrate such a change in the melanoma antigen (MAGE) gene family on the mammalian X chromosome. The MAGE gene family is composed of ten subfamilies that can be categorized into two types. Type I genes are of relatively recent origin, and they encode epitopes for human leukocyte antigen (HLA) in cancer cells. Type II genes are relatively ancient and some of their products are known to be involved in apoptosis or cell proliferation. The evolutionary history of the MAGE gene family can be divided into four phases. In phase I, a single-copy state of an ancestral gene and the evolutionarily conserved mode had lasted until the emergence of eutherian mammals. In phase II, eight subfamily ancestors, with the exception for MAGE-C and MAGE-D subfamilies, were formed via retrotransposition independently. This would coincide with a transposition burst of LINE elements at the eutherian radiation. However, MAGE-C was generated by gene duplication of MAGE-A. Phase III is characterized by extensive gene duplication within each subfamily and in particular the formation of palindromes in the MAGE-A subfamily, which occurred in an ancestor of the Catarrhini. Phase IV is characterized by the decay of a palindrome in most Catarrhini, with the exception of humans. Although the palindrome is truncated by frequent deletions in apes and Old World monkeys, it is retained in humans. Here, we argue that this human-specific retention stems from negative selection acting on MAGE-A genes encoding epitopes of cancer cells, which preserves their ability to bind to highly divergent HLA molecules. These findings are interpreted with consideration of the biological factors shaping recent human MAGE-A genes. PMID:21695252

  18. The CBF gene family in apple (malus x domestica Borkh.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Many vascular plants have evolved mechanisms for protecting themselves from freeze damage. One of the key pathways controlling higher plant responses to low temperature involves a family of genes which belong to the AP2 domain class of transcription factors. The promoters of many genes involved in...

  19. Recommended nomenclature for five mammalian carboxylesterase gene families: human, mouse, and rat genes and proteins.

    PubMed

    Holmes, Roger S; Wright, Matthew W; Laulederkind, Stanley J F; Cox, Laura A; Hosokawa, Masakiyo; Imai, Teruko; Ishibashi, Shun; Lehner, Richard; Miyazaki, Masao; Perkins, Everett J; Potter, Phillip M; Redinbo, Matthew R; Robert, Jacques; Satoh, Tetsuo; Yamashita, Tetsuro; Yan, Bingfan; Yokoi, Tsuyoshi; Zechner, Rudolf; Maltais, Lois J

    2010-10-01

    Mammalian carboxylesterase (CES or Ces) genes encode enzymes that participate in xenobiotic, drug, and lipid metabolism in the body and are members of at least five gene families. Tandem duplications have added more genes for some families, particularly for mouse and rat genomes, which has caused confusion in naming rodent Ces genes. This article describes a new nomenclature system for human, mouse, and rat carboxylesterase genes that identifies homolog gene families and allocates a unique name for each gene. The guidelines of human, mouse, and rat gene nomenclature committees were followed and "CES" (human) and "Ces" (mouse and rat) root symbols were used followed by the family number (e.g., human CES1). Where multiple genes were identified for a family or where a clash occurred with an existing gene name, a letter was added (e.g., human CES4A; mouse and rat Ces1a) that reflected gene relatedness among rodent species (e.g., mouse and rat Ces1a). Pseudogenes were named by adding "P" and a number to the human gene name (e.g., human CES1P1) or by using a new letter followed by ps for mouse and rat Ces pseudogenes (e.g., Ces2d-ps). Gene transcript isoforms were named by adding the GenBank accession ID to the gene symbol (e.g., human CES1_AB119995 or mouse Ces1e_BC019208). This nomenclature improves our understanding of human, mouse, and rat CES/Ces gene families and facilitates research into the structure, function, and evolution of these gene families. It also serves as a model for naming CES genes from other mammalian species.

  20. Mutation in δ-Sg Gene in Familial Dilated Cardiomyopathy

    PubMed Central

    Asadi, Marzieh; Foo, Roger; Salehi, Ahmad Reza; Salehi, Rasoul; Samienasab, Mohammad Reza

    2017-01-01

    Background: Mutations in different genes including dystrophin-associated glycoprotein complex caused familial dilated cardiomyopathy which is a genetically heterogeneous disease. The δ-SG gene contains nine exons spanning a 433-kb region of genomic DNA. It encodes a 35-kDa, singlepass, and type II transmembrane glycoprotein. Materials and Methods: In this study for the first time in Iran we screened 6 patients of a large family that they had positive family history of MI or sudden death by next generation sequencing method. Results: By employing NGS method we found missense mutation (p.R97Q) of δ-SG gene in 2 of 6 patients. Conclusions: The missense mutation (p.R97Q) in familial DCM patients is reported for the first time in Iranian patients with cardiac disease. Although this mutation is already known in other populations in Iran, it is not reported before.

  1. Complexity, polymorphism, and connectivity of mouse Vk gene families.

    PubMed

    Kofler, R; Duchosal, M A; Dixon, F J

    1989-01-01

    To define the polymorphism and extent of the mouse immunoglobulin kappa (Igk) gene complex, we have analyzed restriction-enzyme digested genomic DNA from 33 inbred strains of mice with labeled DNA probes corresponding to 16 Vk protein groups (1 of them previously undescribed) and the Jk/Ck region (V, variable; J, joining; C, constant). These probes detected between 1 and 25 distinct restriction enzyme fragments (REF) that appeared in up to eight polymorphic patterns, thus defining eight mouse Igk haplotypes. The investigated portion of the Vk repertoire was estimated to encompass between 60 and 120 discernable Vk gene-containing REFs. In contrast to mouse VH gene families, several Vk gene families defined by these probes appeared to overlap. This observation has implications for Vk gene analyses by nucleic acid hybridization and raises the possibility that the Vk gene complex is a continuum of related sequences.

  2. Characterizations of 9p21 candidate genes in familial melanoma

    SciTech Connect

    Walker, G.J.; Flores, J.F.; Glendening, J.M.

    1994-09-01

    We have previously collected and characterized 16 melanoma families for the inheritance of a familial melanoma predisposition gene on 9p21. Clear evidence for genetic linkage has been detected in 8 of these families with the 9p21 markers D9S126 and 1FNA, while linkage of the remaining families to this region is less certain. A candidate for the 9p21 familial melanoma gene, the cyclin kinase inhibitor gene p16 (also known as the multiple tumor suppressor 1 (MTS1) gene), has been recently indentified. Notably, a nonsense mutation within the p16 gene has been detected in the lymphoblastoid cell line DNA from a dysplastic nevus syndrome (DNS), or familial melanoma, patient. The p16 gene is also known to be frequently deleted or mutated in a variety of tumor cell lines (including melanoma) and resides within a region that has been defined as harboring the 9p21 melanoma predisposition locus. This region is delineated on the distal side by the marker D9S736 (which resides just distal to the p16 gene) and extends in a proximal direction to the marker D9S171. Overall, the entire distance between these two loci is estimated at 3-5Mb. Preliminary analysis of our two largest 9p21-linked melanoma kindreds (by direct sequencing of PCR products) has not yet revealed mutations within the coding region of the p16 gene. Others have reported that 8/11 unrelated 9p21-linked melanoma families do not appear to carry p16 mutations; thus the possibility exists that p16 is not a melanoma susceptibility gene per se, although it appears to play some role in melanoma tumor progression. Our melanoma kindred DNAs are currently being analyzed by SSCP using primers that amplify exons of other candidate genes from the 9p21 region implicated in familial melanoma. These novel genes reside within a distinct critical region of homozygous loss in melanoma which is located >2 Mb from the p16 gene on 9p21.

  3. Identification of a family of muscarinic acetylcholine receptor genes

    SciTech Connect

    Bonner, T.I.; Buckley, N.J.; Young, A.C.; Brann, M.R.

    1987-07-31

    Complementary DNAs for three different muscarinic acetylcholine receptors were isolated from a rat cerebral cortex library, and the cloned receptors were expressed in mammalian cells. Analysis of human and rat genomic clones indicates that there are at least four functional muscarinic receptor genes and that these genes lack introns in the coding sequence. This gene family provides a new basis for evaluating the diversity of muscarinic mechanisms in the nervous system.

  4. Identification and Functional Analysis of Light-Responsive Unique Genes and Gene Family Members in Rice

    PubMed Central

    Jung, Ki-Hong; Lee, Jinwon; Dardick, Chris; Seo, Young-Su; Cao, Peijian; Canlas, Patrick; Phetsom, Jirapa; Xu, Xia; Ouyang, Shu; An, Kyungsook; Cho, Yun-Ja; Lee, Geun-Cheol; Lee, Yoosook; An, Gynheung; Ronald, Pamela C.

    2008-01-01

    Functional redundancy limits detailed analysis of genes in many organisms. Here, we report a method to efficiently overcome this obstacle by combining gene expression data with analysis of gene-indexed mutants. Using a rice NSF45K oligo-microarray to compare 2-week-old light- and dark-grown rice leaf tissue, we identified 365 genes that showed significant 8-fold or greater induction in the light relative to dark conditions. We then screened collections of rice T-DNA insertional mutants to identify rice lines with mutations in the strongly light-induced genes. From this analysis, we identified 74 different lines comprising two independent mutant lines for each of 37 light-induced genes. This list was further refined by mining gene expression data to exclude genes that had potential functional redundancy due to co-expressed family members (12 genes) and genes that had inconsistent light responses across other publicly available microarray datasets (five genes). We next characterized the phenotypes of rice lines carrying mutations in ten of the remaining candidate genes and then carried out co-expression analysis associated with these genes. This analysis effectively provided candidate functions for two genes of previously unknown function and for one gene not directly linked to the tested biochemical pathways. These data demonstrate the efficiency of combining gene family-based expression profiles with analyses of insertional mutants to identify novel genes and their functions, even among members of multi-gene families. PMID:18725934

  5. Evolution of the Sox gene family within the chordate phylum.

    PubMed

    Heenan, Phoebe; Zondag, Lisa; Wilson, Megan J

    2016-01-10

    The ancient Sox gene family is a group of related transcription factors that perform a number of essential functions during embryonic development. During evolution, this family has undergone considerable expansion, particularly within the vertebrate lineage. In vertebrates SOX proteins are required for the specification, development and/or morphogenesis of most vertebrate innovations. Tunicates and lancelets are evolutionarily positioned as the closest invertebrate relatives to the vertebrate group. By identifying their Sox gene complement we can begin to reconstruct the gene set of the last common chordate ancestor before the split into invertebrates and vertebrate groups. We have identified core SOX family members from the genomes of six invertebrate chordates. Using phylogenetic analysis we determined their evolutionary relationships. We propose that the last common ancestor of chordates had at least seven Sox genes, including the core suite of SoxB, C, D, E and F as well as SoxH.

  6. Gene turnover and differential retention in the relaxin/insulin-like gene family in primates.

    PubMed

    Arroyo, José Ignacio; Hoffmann, Federico G; Opazo, Juan C

    2012-06-01

    The relaxin/insulin-like gene family is related to the insulin gene family, and includes two separate types of peptides: relaxins (RLNs) and insulin-like peptides (INSLs) that perform a variety of physiological roles including testicular descent, growth and differentiation of the mammary glands, trophoblast development, and cell differentiation. In vertebrates, these genes are found on three separate genomic loci, and in mammals, variation in the number and nature of genes in this family is mostly restricted to the Relaxin Family Locus B. For example, this locus contains a single copy of RLN in platypus and opossum, whereas it contains copies of the INSL6, INSL4, RLN2 and RLN1 genes in human and chimp. The main objective of this research is to characterize changes in the size and membership composition of the RLN/INSL gene family in primates, reconstruct the history of the RLN/INSL genes of primates, and test competing evolutionary scenarios regarding the origin of INSL4 and of the duplicated copies of the RLN gene of apes. Our results show that the relaxin/INSL-like gene family of primates has had a more dynamic evolutionary history than previously thought, including several examples of gene duplications and losses which are consistent with the predictions of the birth-and-death model of gene family evolution. In particular, we found that the differential retention of relatively old paralogs played a key role in shaping the gene complement of this family in primates. Two examples of this phenomenon are the origin of the INSL4 gene of catarrhines (the group that includes Old World monkeys and apes), and of the duplicate RLN1 and RLN2 paralogs of apes. In the case of INSL4, comparative genomics and phylogenetic analyses indicate that the origin of this gene, which was thought to represent a catarrhine-specific evolutionary innovation, is as old as the split between carnivores and primates, which took place approximately 97 million years ago. In addition, in the case

  7. The ubiquilin gene family: evolutionary patterns and functional insights

    PubMed Central

    2014-01-01

    Background Ubiquilins are proteins that function as ubiquitin receptors in eukaryotes. Mutations in two ubiquilin-encoding genes have been linked to the genesis of neurodegenerative diseases. However, ubiquilin functions are still poorly understood. Results In this study, evolutionary and functional data are combined to determine the origin and diversification of the ubiquilin gene family and to characterize novel potential roles of ubiquilins in mammalian species, including humans. The analysis of more than six hundred sequences allowed characterizing ubiquilin diversity in all the main eukaryotic groups. Many organisms (e. g. fungi, many animals) have single ubiquilin genes, but duplications in animal, plant, alveolate and excavate species are described. Seven different ubiquilins have been detected in vertebrates. Two of them, here called UBQLN5 and UBQLN6, had not been hitherto described. Significantly, marsupial and eutherian mammals have the most complex ubiquilin gene families, composed of up to 6 genes. This exceptional mammalian-specific expansion is the result of the recent emergence of four new genes, three of them (UBQLN3, UBQLN5 and UBQLNL) with precise testis-specific expression patterns that indicate roles in the postmeiotic stages of spermatogenesis. A gene with related features has independently arisen in species of the Drosophila genus. Positive selection acting on some mammalian ubiquilins has been detected. Conclusions The ubiquilin gene family is highly conserved in eukaryotes. The infrequent lineage-specific amplifications observed may be linked to the emergence of novel functions in particular tissues. PMID:24674348

  8. BranchClust: a phylogenetic algorithm for selecting gene families

    PubMed Central

    Poptsova, Maria S; Gogarten, J Peter

    2007-01-01

    Background Automated methods for assembling families of orthologous genes include those based on sequence similarity scores and those based on phylogenetic approaches. The first are easy to automate but usually they do not distinguish between paralogs and orthologs or have restriction on the number of taxa. Phylogenetic methods often are based on reconciliation of a gene tree with a known rooted species tree; a limitation of this approach, especially in case of prokaryotes, is that the species tree is often unknown, and that from the analyses of single gene families the branching order between related organisms frequently is unresolved. Results Here we describe an algorithm for the automated selection of orthologous genes that recognizes orthologous genes from different species in a phylogenetic tree for any number of taxa. The algorithm is capable of distinguishing complete (containing all taxa) and incomplete (not containing all taxa) families and recognizes in- and outparalogs. The BranchClust algorithm is implemented in Perl with the use of the BioPerl module for parsing trees and is freely available at . Conclusion BranchClust outperforms the Reciprocal Best Blast hit method in selecting more sets of putatively orthologous genes. In the test cases examined, the correctness of the selected families and of the identified in- and outparalogs was confirmed by inspection of the pertinent phylogenetic trees. PMID:17425803

  9. Identification and characterization of TIFY family genes in Brachypodium distachyon.

    PubMed

    Zhang, Lihua; You, Jun; Chan, Zhulong

    2015-11-01

    The TIFY family is a plant-specific gene family encoding proteins characterized by a conserved TIFY domain. This family encodes four subfamilies of proteins, including ZIM-like (ZML), TIFY, PPD and JASMONATE ZIM-Domain (JAZ) proteins. TIFY proteins play important roles in plant development and stress responses. In this study, 21 BdTIFYs were identified in Brachypodium distachyon through genome-wide analysis, including 15 JAZ and 6 ZML genes. Analysis of the distribution of conserved domains showed that there are three additional domains (CCT domain, GATA domain and Jas domain) in the BdTIFY proteins besides the TIFY domain. Phylogenetic analysis indicated that these 21 proteins were classified into two major groups. Expression profile of BdTIFY genes in response to abiotic stresses and phytohormones was analyzed using quantitative real-time RT-PCR. Among 21 BdTIFY genes, 12 of them were induced by JA treatment, and 4 of them were induced by ABA treatment. Most of BdTIFY genes were responsive to one or more abiotic stresses including drought, salinity, low temperature and heat. Especially, BdTIFY5, 9a, 9b, 10c and 11a were significantly up-regulated by multiple abiotic stresses. These results provided important clues for functional analysis of TIFY family genes in B. distachyon.

  10. Mutational analysis of the LDL receptor and APOB genes in Mexican individuals with autosomal dominant hypercholesterolemia.

    PubMed

    Vaca, Gerardo; Vàzquez, Alejandra; Magaña, Marìa Teresa; Ramìrez, Marìa Lourdes; Dàvalos, Ingrid P; Martìnez, Esperanza; Marìn, Bertha; Carrillo, Gabriela

    2011-10-01

    The goal of this project was to identify families with autosomal dominant hypercholesterolemia (ADH) to facilitate early detection and treatment and to provide genetic counselling as well as to approximate the mutational diversity of ADH in Mexico. Mutational analysis of the LDLR and APOB genes in 62 index cases with a clinical and/or biochemical diagnosis of ADH was performed. Twenty-five mutations (24 LDLR, 1 APOB) were identified in 38 index cases. A total of 162 individuals with ADH were identified using familial segregation analysis performed in 269 relatives of the index cases. In addition, a novel PCSK9 mutation, c.1850 C>A (p.Ala617Asp), was detected. The LDLR mutations showed the following characteristics: (1) four mutations are novel: c.695 -1G>T, c.1034_1035insA, c.1586 G>A, c.2264_2273del; (2) the most common mutations were c.682 G>A (FH-Mexico), c.1055 G>A (FH-Mexico 2), and c.1090 T>C (FH-Mexico 3); (3) five mutations were identified in 3 or more apparently unrelated probands; (4) three mutations were observed in a true homozygous state; and (5) four index cases were compound heterozygous, and one was a carrier of two mutations in the same allele. These results suggest that, in Mexico, ADH exhibits allelic heterogeneity with 5 relatively common LDLR mutations and that mutations in the APOB gene are not a common cause of ADH. This knowledge is important for the genotype-phenotype correlation and for optimising both cholesterol lowering therapies and mutational analysis protocols. In addition, these data contribute to the understanding of the molecular basis of ADH in Mexico.

  11. Evolution of the YABBY gene family in seed plants.

    PubMed

    Finet, Cédric; Floyd, Sandra K; Conway, Stephanie J; Zhong, Bojian; Scutt, Charles P; Bowman, John L

    2016-01-01

    Members of the YABBY gene family of transcription factors in angiosperms have been shown to be involved in the initiation of outgrowth of the lamina, the maintenance of polarity, and establishment of the leaf margin. Although most of the dorsal-ventral polarity genes in seed plants have homologs in non-spermatophyte lineages, the presence of YABBY genes is restricted to seed plants. To gain insight into the origin and diversification of this gene family, we reconstructed the evolutionary history of YABBY gene lineages in seed plants. Our findings suggest that either one or two YABBY genes were present in the last common ancestor of extant seed plants. We also examined the expression of YABBY genes in the gymnosperms Ephedra distachya (Gnetales), Ginkgo biloba (Ginkgoales), and Pseudotsuga menziesii (Coniferales). Our data indicate that some YABBY genes are expressed in a polar (abaxial) manner in leaves and female cones in gymnosperms. We propose that YABBY genes already acted as polarity genes in the last common ancestor of extant seed plants.

  12. The role of CCN family genes in haematological malignancies.

    PubMed

    Wells, J E; Howlett, M; Cheung, L C; Kees, Ursula R

    2015-09-01

    Haematological malignancies, although a broad range of specific disease types, continue to show considerable overlap in classification, and patients are treated using similar chemotherapy regimes. In this review we look at the role of the CCN family of matricellular proteins and indicate their role in nine haematological malignancies including both myeloid and lymphoid neoplasms. The potential for further haematological neoplasms with CCN family associations is argued by summarising the demonstrated role of CCN family genes in the differentiation of haematopoietic stem cells (HSC) and mesenchymal stem cells. The expanding field of knowledge encompassing CCN family genes and cancers of the HSC-lineage highlights the importance of extracellular matrix-interactions in both normal physiology and tumorigenesis of the blood, bone marrow and lymph nodes.

  13. Molecular Evolution of the Glycosyltransferase 6 Gene Family in Primates

    PubMed Central

    Mendonça-Mattos, Patricia Jeanne de Souza; Harada, Maria Lúcia

    2016-01-01

    Glycosyltransferase 6 gene family includes ABO, Ggta1, iGb3S, and GBGT1 genes and by three putative genes restricted to mammals, GT6m6, GTm6, and GT6m7, only the latter is found in primates. GT6 genes may encode functional and nonfunctional proteins. Ggta1 and GBGT1 genes, for instance, are pseudogenes in catarrhine primates, while iGb3S gene is only inactive in human, bonobo, and chimpanzee. Even inactivated, these genes tend to be conversed in primates. As some of the GT6 genes are related to the susceptibility or resistance to parasites, we investigated (i) the selective pressure on the GT6 paralogs genes in primates; (ii) the basis of the conservation of iGb3S in human, chimpanzee, and bonobo; and (iii) the functional potential of the GBGT1 and GT6m7 in catarrhines. We observed that the purifying selection is prevalent and these genes have a low diversity, though ABO and Ggta1 genes have some sites under positive selection. GT6m7, a putative gene associated with aggressive periodontitis, may have regulatory function, but experimental studies are needed to assess its function. The evolutionary conservation of iGb3S in humans, chimpanzee, and bonobo seems to be the result of proximity to genes with important biological functions. PMID:28044107

  14. Locus Adh of Drosophila melanogaster under selection for delayed senescence

    SciTech Connect

    Khaustova, N.D.

    1995-05-01

    Dynamics of the Adh activity and frequencies of alleles Adh{sup F} and Adh{sup S} were analyzed under selection for delayed senescence. The experiments were performed on Drosophila melanogaster. Lines Adh{sup S}cn and Adh{sup F}vg and experimental populations cn` and vg`, selected for an increased duration of reproductive period (late oviposition) were used. Analysis of fertility, longevity, viability and resistance to starvation showed that selection for late oviposition resulted in delayed senescence of flies of the experimental populations. Genetic structure of population vg` changed considerably with regard to the Adh locus. This was confirmed by parameters of activity, thermostability, and electrophoretic mobility of the enzyme isolated from flies after 30 generations of selection. Analysis of frequencies of the Adh alleles showed that in both selected populations, which initially had different genetic composition, accumulated allele Adh{sup S}, which encodes the isozyme that is less active but more resistant to inactivation. Genetic mechanism of delayed senescence in Drosophila is assumed to involve selection at vitally important enzyme loci, including Adh. 18 refs., 2 tabs., 4 figs.

  15. Exploiting Gene Families for Phylogenomic Analysis of Myzostomid Transcriptome Data

    PubMed Central

    Hartmann, Stefanie; Helm, Conrad; Nickel, Birgit; Meyer, Matthias; Struck, Torsten H.; Tiedemann, Ralph; Selbig, Joachim; Bleidorn, Christoph

    2012-01-01

    Background In trying to understand the evolutionary relationships of organisms, the current flood of sequence data offers great opportunities, but also reveals new challenges with regard to data quality, the selection of data for subsequent analysis, and the automation of steps that were once done manually for single-gene analyses. Even though genome or transcriptome data is available for representatives of most bilaterian phyla, some enigmatic taxa still have an uncertain position in the animal tree of life. This is especially true for myzostomids, a group of symbiotic (or parasitic) protostomes that are either placed with annelids or flatworms. Methodology Based on similarity criteria, Illumina-based transcriptome sequences of one myzostomid were compared to protein sequences of one additional myzostomid and 29 reference metazoa and clustered into gene families. These families were then used to investigate the phylogenetic position of Myzostomida using different approaches: Alignments of 989 sequence families were concatenated, and the resulting superalignment was analyzed under a Maximum Likelihood criterion. We also used all 1,878 gene trees with at least one myzostomid sequence for a supertree approach: the individual gene trees were computed and then reconciled into a species tree using gene tree parsimony. Conclusions Superalignments require strictly orthologous genes, and both the gene selection and the widely varying amount of data available for different taxa in our dataset may cause anomalous placements and low bootstrap support. In contrast, gene tree parsimony is designed to accommodate multilocus gene families and therefore allows a much more comprehensive data set to be analyzed. Results of this supertree approach showed a well-resolved phylogeny, in which myzostomids were part of the annelid radiation, and major bilaterian taxa were found to be monophyletic. PMID:22276131

  16. Runx Family Genes in Tissue Stem Cell Dynamics.

    PubMed

    Wang, Chelsia Qiuxia; Mok, Michelle Meng Huang; Yokomizo, Tomomasa; Tergaonkar, Vinay; Osato, Motomi

    2017-01-01

    The Runx family genes play important roles in development and cancer, largely via their regulation of tissue stem cell behavior. Their involvement in two organs, blood and skin, is well documented. This review summarizes currently known Runx functions in the stem cells of these tissues. The fundamental core mechanism(s) mediated by Runx proteins has been sought; however, it appears that there does not exist one single common machinery that governs both tissue stem cells. Instead, Runx family genes employ multiple spatiotemporal mechanisms in regulating individual tissue stem cell populations. Such specific Runx requirements have been unveiled by a series of cell type-, developmental stage- or age-specific gene targeting studies in mice. Observations from these experiments revealed that the regulation of stem cells by Runx family genes turned out to be far more complex than previously thought. For instance, although it has been reported that Runx1 is required for the endothelial-to-hematopoietic cell transition (EHT) but not thereafter, recent studies clearly demonstrated that Runx1 is also needed during the period subsequent to EHT, namely at perinatal stage. In addition, Runx1 ablation in the embryonic skin mesenchyme eventually leads to complete loss of hair follicle stem cells (HFSCs) in the adult epithelium, suggesting that Runx1 facilitates the specification of skin epithelial stem cells in a cell extrinsic manner. Further in-depth investigation into how Runx family genes are involved in stem cell regulation is warranted.

  17. Expansion of transducin subunit gene families in early vertebrate tetraploidizations.

    PubMed

    Lagman, David; Sundström, Görel; Ocampo Daza, Daniel; Abalo, Xesús M; Larhammar, Dan

    2012-10-01

    Hundreds of gene families expanded in the early vertebrate tetraploidizations including many gene families in the phototransduction cascade. We have investigated the evolution of the heterotrimeric G-proteins of photoreceptors, the transducins, in relation to these events using both phylogenetic analyses and synteny comparisons. Three alpha subunit genes were identified in amniotes and the coelacanth, GNAT1-3; two of these were identified in amphibians and teleost fish, GNAT1 and GNAT2. Most tetrapods have four beta genes, GNB1-4, and teleosts have additional duplicates. Finally, three gamma genes were identified in mammals, GNGT1, GNG11 and GNGT2. Of these, GNGT1 and GNGT2 were found in the other vertebrates. In frog and zebrafish additional duplicates of GNGT2 were identified. Our analyses show all three transducin families expanded during the early vertebrate tetraploidizations and the beta and gamma families gained additional copies in the teleost-specific genome duplication. This suggests that the tetraploidizations contributed to visual specialisations.

  18. Evolution of an expanded mannose receptor gene family.

    PubMed

    Staines, Karen; Hunt, Lawrence G; Young, John R; Butter, Colin

    2014-01-01

    Sequences of peptides from a protein specifically immunoprecipitated by an antibody, KUL01, that recognises chicken macrophages, identified a homologue of the mammalian mannose receptor, MRC1, which we called MRC1L-B. Inspection of the genomic environment of the chicken gene revealed an array of five paralogous genes, MRC1L-A to MRC1L-E, located between conserved flanking genes found either side of the single MRC1 gene in mammals. Transcripts of all five genes were detected in RNA from a macrophage cell line and other RNAs, whose sequences allowed the precise definition of spliced exons, confirming or correcting existing bioinformatic annotation. The confirmed gene structures were used to locate orthologues of all five genes in the genomes of two other avian species and of the painted turtle, all with intact coding sequences. The lizard genome had only three genes, one orthologue of MRC1L-A and two orthologues of the MRC1L-B antigen gene resulting from a recent duplication. The Xenopus genome, like that of most mammals, had only a single MRC1-like gene at the corresponding locus. MRC1L-A and MRC1L-B genes had similar cytoplasmic regions that may be indicative of similar subcellular migration and functions. Cytoplasmic regions of the other three genes were very divergent, possibly indicating the evolution of a new functional repertoire for this family of molecules, which might include novel interactions with pathogens.

  19. Genetic polymorphisms of ADH1B, ADH1C and ALDH2, alcohol consumption, and the risk of gastric cancer: the Japan Public Health Center-based prospective study.

    PubMed

    Hidaka, Akihisa; Sasazuki, Shizuka; Matsuo, Keitaro; Ito, Hidemi; Sawada, Norie; Shimazu, Taichi; Yamaji, Taiki; Iwasaki, Motoki; Inoue, Manami; Tsugane, Shoichiro

    2015-02-01

    The association between alcohol consumption, genetic polymorphisms of alcohol dehydrogenase (ADH) and aldehyde dehydrogenase (ALDH) and gastric cancer risk is not completely understood. We investigated the association between ADH1B (rs1229984), ADH1C (rs698) and ALDH2 (rs671) polymorphisms, alcohol consumption and the risk of gastric cancer among Japanese subjects in a population-based, nested, case-control study (1990-2004). Among 36 745 subjects who answered the baseline questionnaire and provided blood samples, 457 new gastric cancer cases matched to 457 controls were used in the analysis. The odds ratios (OR) and corresponding 95% confidence intervals (CI) were calculated using logistic regression models. No association was observed between alcohol consumption, ADH1B (rs1229984), ADH1C (rs698) and ALDH2 (rs671) polymorphisms and gastric cancer risk. However, considering gene-environmental interaction, ADH1C G allele carriers who drink ≥150 g/week of ethanol had a 2.5-fold increased risk of gastric cancer (OR = 2.54, 95% CI = 1.05-6.17) relative to AA genotype carriers who drink 0 to <150 g/week (P for interaction = 0.02). ALDH2 A allele carriers who drink ≥150 g/week also had an increased risk (OR = 2.08, 95% CI = 1.05-4.12) relative to GG genotype carriers who drink 0 to < 150 g/week (P for interaction = 0.08). To find the relation between alcohol consumption and gastric cancer risk, it is important to consider both alcohol consumption level and ADH1C and ALDH2 polymorphisms.

  20. Combination of ADH1B*2/ALDH2*2 polymorphisms alters acetaldehyde-derived DNA damage in the blood of Japanese alcoholics.

    PubMed

    Yukawa, Yoshiyuki; Muto, Manabu; Hori, Kimiko; Nagayoshi, Haruna; Yokoyama, Akira; Chiba, Tsutomu; Matsuda, Tomonari

    2012-09-01

    The acetaldehyde associated with alcoholic beverages is an evident carcinogen for the esophagus. Genetic polymorphisms of the alcohol dehydrogenase 1B (ADH1B) and aldehyde dehydrogenase 2 (ALDH2) genes are associated with the risk of esophageal cancer. However, the exact mechanism via which these genetic polymorphisms affect esophageal carcinogenesis has not been elucidated. ADH1B*2 is involved in overproduction of acetaldehyde due to increased ethanol metabolism into acetaldehyde, and ALDH2*2 is involved in accumulation of acetaldehyde due to the deficiency of acetaldehyde metabolism. Acetaldehyde can interact with DNA and form DNA adducts, resulting in DNA damage. N(2)-ethylidene-2'-deoxyguanosine (N(2)-ethylidene-dG) is the most abundant DNA adduct derived from acetaldehyde. Therefore, we quantified N(2)-ethylidene-dG levels in blood samples from 66 Japanese alcoholic patients using liquid chromatography/electrospray tandem mass spectrometry, and investigated the relationship between N(2)-ethylidene-dG levels and ADH1B and ALDH2 genotypes. The median N(2)-ethylidene-dG levels (25th percentile, 75th percentile) in patients with ADH1B*1/*1 plus ALDH2*1/*1, ADH1B*2 carrier plus ALDH2*1/*1, ADH1B*1/*1 plus ALDH2*1/*2, and ADH1B*2 carrier plus ALDH2*1/*2 were 2.14 (0.97, 2.37)/10(7) bases, 2.38 (1.18, 2.98)/10(7) bases, 5.38 (3.19, 6.52)/10(7) bases, and 21.04 (12.75, 34.80)/10(7) bases, respectively. In the ALDH2*1/*2 group, N(2)-ethylidene-dG levels were significantly higher in ADH1B*2 carriers than in the ADH1B*1/*1 group (P < 0.01). N(2)-ethylidene-dG levels were significantly higher in the ALDH2*1/*2 group than in the ALDH2*1/*1 group, regardless of ADH1B genotype (ADH1B*1/*1, P < 0.05; ADH1B*2 carriers, P < 0.01) N(2)-ethylidene-dG levels in blood DNA of the alcoholics was remarkably higher in individuals with a combination of the ADH1B*2 and ALDH2*2 alleles. These results provide a new perspective on the carcinogenicity of the acetaldehyde associated with

  1. Description of a large family with autosomal dominant hypercholesterolemia associated with the APOE p.Leu167del mutation.

    PubMed

    Marduel, Marie; Ouguerram, Khadija; Serre, Valérie; Bonnefont-Rousselot, Dominique; Marques-Pinheiro, Alice; Erik Berge, Knut; Devillers, Martine; Luc, Gérald; Lecerf, Jean-Michel; Tosolini, Laurent; Erlich, Danièle; Peloso, Gina M; Stitziel, Nathan; Nitchké, Patrick; Jaïs, Jean-Philippe; Abifadel, Marianne; Kathiresan, Sekar; Leren, Trond Paul; Rabès, Jean-Pierre; Boileau, Catherine; Varret, Mathilde

    2013-01-01

    Apolipoprotein (apo) E mutants are associated with type III hyperlipoproteinemia characterized by high cholesterol and triglycerides levels. Autosomal dominant hypercholesterolemia (ADH), due to the mutations in the LDLR, APOB, or PCSK9 genes, is characterized by an isolated elevation of cholesterol due to the high levels of low-density lipoproteins (LDLs). We now report an exceptionally large family including 14 members with ADH. Through genome-wide mapping, analysis of regional/functional candidate genes, and whole exome sequencing, we identified a mutation in the APOE gene, c.500_502delTCC/p.Leu167del, previously reported associated with sea-blue histiocytosis and familial combined hyperlipidemia. We confirmed the involvement of the APOE p.Leu167del in ADH, with (1) a predicted destabilization of an alpha-helix in the binding domain, (2) a decreased apo E level in LDLs, and (3) a decreased catabolism of LDLs. Our results show that mutations in the APOE gene can be associated with bona fide ADH.

  2. Structure and regulation of the Asr gene family in banana.

    PubMed

    Henry, Isabelle M; Carpentier, Sebastien C; Pampurova, Suzana; Van Hoylandt, Anais; Panis, Bart; Swennen, Rony; Remy, Serge

    2011-10-01

    Abscisic acid, stress, ripening proteins (ASR) are a family of plant-specific small hydrophilic proteins. Studies in various plant species have highlighted their role in increased resistance to abiotic stress, including drought, but their specific function remains unknown. As a first step toward their potential use in crop improvement, we investigated the structure and regulation of the Asr gene family in Musa species (bananas and plantains). We determined that the Musa Asr gene family contained at least four members, all of which exhibited the typical two exons, one intron structure of Asr genes and the "ABA/WDS" (abscisic acid/water deficit stress) domain characteristic of Asr genes. Phylogenetic analyses determined that the Musa Asr genes were closely related to each other, probably as the product of recent duplication events. For two of the four members, two versions corresponding to the two sub-genomes of Musa, acuminata and balbisiana were identified. Gene expression and protein analyses were performed and Asr expression could be detected in meristem cultures, root, pseudostem, leaf and cormus. In meristem cultures, mAsr1 and mAsr3 were induced by osmotic stress and wounding, while mAsr3 and mAsr4 were induced by exposure to ABA. mASR3 exhibited the most variation both in terms of amino acid sequence and expression pattern, making it the most promising candidate for further functional study and use in crop improvement.

  3. The d4 gene family in the human genome

    SciTech Connect

    Chestkov, A.V.; Baka, I.D.; Kost, M.V.

    1996-08-15

    The d4 domain, a novel zinc finger-like structural motif, was first revealed in the rat neuro-d4 protein. Here we demonstrate that the d4 domain is conserved in evolution and that three related genes form a d4 family in the human genome. The human neuro-d4 is very similar to rat neuro-d4 at both the amino acid and the nucleotide levels. Moreover, the same splice variants have been detected among rat and human neuro-d4 transcripts. This gene has been localized on chromosome 19, and two other genes, members of the d4 family isolated by screening of the human genomic library at low stringency, have been mapped to chromosomes 11 and 14. The gene on chromosome 11 is the homolog of the ubiquitously expressed mouse gene ubi-d4/requiem, which is required for cell death after deprivation of trophic factors. A gene with a conserved d4 domain has been found in the genome of the nematode Caenorhabditis elegans. The conservation of d4 proteins from nematodes to vertebrates suggests that they have a general importance, but a diversity of d4 proteins expressed in vertebrate nervous systems suggests that some family members have special functions. 11 refs., 2 figs.

  4. An evolutionary screen highlights canonical and noncanonical candidate antiviral genes within the primate TRIM gene family.

    PubMed

    Malfavon-Borja, Ray; Sawyer, Sara L; Wu, Lily I; Emerman, Michael; Malik, Harmit S

    2013-01-01

    Recurrent viral pressure has acted on host-encoded antiviral genes during primate and mammalian evolution. This selective pressure has resulted in dramatic episodes of adaptation in host antiviral genes, often detected via positive selection. These evolutionary signatures of adaptation have the potential to highlight previously unrecognized antiviral genes (also called restriction factors). Although the TRIM multigene family is recognized for encoding several bona fide restriction factors (e.g., TRIM5alpha), most members of this expansive gene family remain uncharacterized. Here, we investigated the TRIM multigene family for signatures of positive selection to identify novel candidate antiviral genes. Our analysis reveals previously undocumented signatures of positive selection in 17 TRIM genes, 10 of which represent novel candidate restriction factors. These include the unusual TRIM52 gene, which has evolved under strong positive selection despite its encoded protein lacking a putative viral recognition (B30.2) domain. We show that TRIM52 arose via gene duplication from the TRIM41 gene. Both TRIM52 and TRIM41 have dramatically expanded RING domains compared with the rest of the TRIM multigene family, yet this domain has evolved under positive selection only in primate TRIM52, suggesting that it represents a novel host-virus interaction interface. Our evolutionary-based screen not only documents positive selection in known TRIM restriction factors but also highlights candidate novel restriction factors, providing insight into the interfaces of host-pathogen interactions mediated by the TRIM multigene family.

  5. Analysis of the Prefoldin Gene Family in 14 Plant Species

    PubMed Central

    Cao, Jun

    2016-01-01

    Prefoldin is a hexameric molecular chaperone complex present in all eukaryotes and archaea. The evolution of this gene family in plants is unknown. Here, I identified 140 prefoldin genes in 14 plant species. These prefoldin proteins were divided into nine groups through phylogenetic analysis. Highly conserved gene organization and motif distribution exist in each prefoldin group, implying their functional conservation. I also observed the segmental duplication of maize prefoldin gene family. Moreover, a few functional divergence sites were identified within each group pairs. Functional network analyses identified 78 co-expressed genes, and most of them were involved in carrying, binding and kinase activity. Divergent expression profiles of the maize prefoldin genes were further investigated in different tissues and development periods and under auxin and some abiotic stresses. I also found a few cis-elements responding to abiotic stress and phytohormone in the upstream sequences of the maize prefoldin genes. The results provided a foundation for exploring the characterization of the prefoldin genes in plants and will offer insights for additional functional studies. PMID:27014333

  6. Sucrose metabolism gene families and their biological functions

    PubMed Central

    Jiang, Shu-Ye; Chi, Yun-Hua; Wang, Ji-Zhou; Zhou, Jun-Xia; Cheng, Yan-Song; Zhang, Bao-Lan; Ma, Ali; Vanitha, Jeevanandam; Ramachandran, Srinivasan

    2015-01-01

    Sucrose, as the main product of photosynthesis, plays crucial roles in plant development. Although studies on general metabolism pathway were well documented, less information is available on the genome-wide identification of these genes, their expansion and evolutionary history as well as their biological functions. We focused on four sucrose metabolism related gene families including sucrose synthase, sucrose phosphate synthase, sucrose phosphate phosphatase and UDP-glucose pyrophosphorylase. These gene families exhibited different expansion and evolutionary history as their host genomes experienced differentiated rates of the whole genome duplication, tandem and segmental duplication, or mobile element mediated gene gain and loss. They were evolutionarily conserved under purifying selection among species and expression divergence played important roles for gene survival after expansion. However, we have detected recent positive selection during intra-species divergence. Overexpression of 15 sorghum genes in Arabidopsis revealed their roles in biomass accumulation, flowering time control, seed germination and response to high salinity and sugar stresses. Our studies uncovered the molecular mechanisms of gene expansion and evolution and also provided new insight into the role of positive selection in intra-species divergence. Overexpression data revealed novel biological functions of these genes in flowering time control and seed germination under normal and stress conditions. PMID:26616172

  7. New Genes Originated via Multiple Recombinational Pathways in the β-Globin Gene Family of Rodents

    PubMed Central

    Hoffmann, Federico G.; Opazo, Juan C.; Storz, Jay F.

    2008-01-01

    Species differences in the size or membership composition of multigene families can be attributed to lineage-specific additions of new genes via duplication, losses of genes via deletion or inactivation, and the creation of chimeric genes via domain shuffling or gene fusion. In principle, it should be possible to infer the recombinational pathways responsible for each of these different types of genomic change by conducting detailed comparative analyses of genomic sequence data. Here, we report an attempt to unravel the complex evolutionary history of the β-globin gene family in a taxonomically diverse set of rodent species. The main objectives were: 1) to characterize the genomic structure of the β-globin gene cluster of rodents; 2) to assign orthologous and paralogous relationships among duplicate copies of β-like globin genes; and 3) to infer the specific recombinational pathways responsible for gene duplications, gene deletions, and the creation of chimeric fusion genes. Results of our comparative genomic analyses revealed that variation in gene family size among rodent species is mainly attributable to the differential gain and loss of later expressed β-globin genes via unequal crossing-over. However, two distinct recombinational mechanisms were implicated in the creation of chimeric fusion genes. In muroid rodents, a chimeric γ/ε fusion gene was created by unequal crossing-over between the embryonic ε- and γ-globin genes. Interestingly, this γ/ε fusion gene was generated in the same fashion as the “anti-Lepore” 5′-δ-(β/δ)-β-3′ duplication mutant in humans (the reciprocal exchange product of the pathological hemoglobin Lepore deletion mutant). By contrast, in the house mouse, Mus musculus, a chimeric β/δ fusion pseudogene was created by a β-globin → δ-globin gene conversion event. Although the γ/ε and β/δ fusion genes share a similar chimeric gene structure, they originated via completely different recombinational pathways. PMID

  8. Evolutionary Dynamics of the wnt Gene Family: A Lophotrochozoan Perspective

    PubMed Central

    Cho, Sung-Jin; Vallès, Yvonne; Giani, Vincent C.; Seaver, Elaine C.; Weisblat, David A.

    2010-01-01

    The wnt gene family encodes a set of secreted glycoproteins involved in key developmental processes, including cell fate specification and regulation of posterior growth (Cadigan KM, Nusse R. 1997. Wnt signaling: a common theme in animal development. Genes Dev. 11:3286–3305.; Martin BL, Kimelman D. 2009. Wnt signaling and the evolution of embryonic posterior development. Curr Biol. 19:R215–R219.). As for many other gene families, evidence for expansion and/or contraction of the wnt family is available from deuterostomes (e.g., echinoderms and vertebrates [Nusse R, Varmus HE. 1992. Wnt genes. Cell. 69:1073–1087.; Schubert M, Holland LZ, Holland ND, Jacobs DK. 2000. A phylogenetic tree of the Wnt genes based on all available full-length sequences, including five from the cephalochordate amphioxus. Mol Biol Evol. 17:1896–1903.; Croce JC, Wu SY, Byrum C, Xu R, Duloquin L, Wikramanayake AH, Gache C, McClay DR. 2006. A genome-wide survey of the evolutionarily conserved Wnt pathways in the sea urchin Strongylocentrotus purpuratus. Dev Biol. 300:121–131.]) and ecdysozoans (e.g., arthropods and nematodes [Eisenmann DM. 2005. Wnt signaling. WormBook. 1–17.; Bolognesi R, Farzana L, Fischer TD, Brown SJ. 2008. Multiple Wnt genes are required for segmentation in the short-germ embryo of Tribolium castaneum. Curr Biol. 18:1624–1629.]), but little is known from the third major bilaterian group, the lophotrochozoans (e.g., mollusks and annelids [Prud'homme B, Lartillot N, Balavoine G, Adoutte A, Vervoort M. 2002. Phylogenetic analysis of the Wnt gene family. Insights from lophotrochozoan members. Curr Biol. 12:1395.]). To obtain a more comprehensive scenario of the evolutionary dynamics of this gene family, we exhaustively mined wnt gene sequences from the whole genome assemblies of a mollusk (Lottia gigantea) and two annelids (Capitella teleta and Helobdella robusta) and examined them by phylogenetic, genetic linkage, intron–exon structure, and embryonic

  9. Genome-Wide Analysis of Homeobox Gene Family in Legumes: Identification, Gene Duplication and Expression Profiling

    PubMed Central

    Garg, Rohini; Jain, Mukesh

    2015-01-01

    Homeobox genes encode transcription factors that are known to play a major role in different aspects of plant growth and development. In the present study, we identified homeobox genes belonging to 14 different classes in five legume species, including chickpea, soybean, Medicago, Lotus and pigeonpea. The characteristic differences within homeodomain sequences among various classes of homeobox gene family were quite evident. Genome-wide expression analysis using publicly available datasets (RNA-seq and microarray) indicated that homeobox genes are differentially expressed in various tissues/developmental stages and under stress conditions in different legumes. We validated the differential expression of selected chickpea homeobox genes via quantitative reverse transcription polymerase chain reaction. Genome duplication analysis in soybean indicated that segmental duplication has significantly contributed in the expansion of homeobox gene family. The Ka/Ks ratio of duplicated homeobox genes in soybean showed that several members of this family have undergone purifying selection. Moreover, expression profiling indicated that duplicated genes might have been retained due to sub-functionalization. The genome-wide identification and comprehensive gene expression profiling of homeobox gene family members in legumes will provide opportunities for functional analysis to unravel their exact role in plant growth and development. PMID:25745864

  10. Genome-wide analysis of homeobox gene family in legumes: identification, gene duplication and expression profiling.

    PubMed

    Bhattacharjee, Annapurna; Ghangal, Rajesh; Garg, Rohini; Jain, Mukesh

    2015-01-01

    Homeobox genes encode transcription factors that are known to play a major role in different aspects of plant growth and development. In the present study, we identified homeobox genes belonging to 14 different classes in five legume species, including chickpea, soybean, Medicago, Lotus and pigeonpea. The characteristic differences within homeodomain sequences among various classes of homeobox gene family were quite evident. Genome-wide expression analysis using publicly available datasets (RNA-seq and microarray) indicated that homeobox genes are differentially expressed in various tissues/developmental stages and under stress conditions in different legumes. We validated the differential expression of selected chickpea homeobox genes via quantitative reverse transcription polymerase chain reaction. Genome duplication analysis in soybean indicated that segmental duplication has significantly contributed in the expansion of homeobox gene family. The Ka/Ks ratio of duplicated homeobox genes in soybean showed that several members of this family have undergone purifying selection. Moreover, expression profiling indicated that duplicated genes might have been retained due to sub-functionalization. The genome-wide identification and comprehensive gene expression profiling of homeobox gene family members in legumes will provide opportunities for functional analysis to unravel their exact role in plant growth and development.

  11. Origin and evolution of laminin gene family diversity.

    PubMed

    Fahey, Bryony; Degnan, Bernard M

    2012-07-01

    Laminins are a family of multidomain glycoproteins that are important contributors to the structure of metazoan extracellular matrices. To investigate the origin and evolution of the laminin family, we characterized the full complement of laminin-related genes in the genome of the sponge, Amphimedon queenslandica. As a representative of the Demospongiae, a group consistently placed within the earliest diverging branch of animals by molecular phylogenies, Amphimedon is uniquely placed to provide insight into early steps in the evolution of metazoan gene families. Five Amphimedon laminin-related genes possess the conserved molecular features, and most of the domains found in bilaterian laminins, but all display domain architectures distinct from those of the canonical laminin chain types known from model bilaterians. This finding prompted us to perform a comparative genomic analysis of laminins and related genes from a choanoflagellate and diverse metazoans and to conduct phylogenetic analyses using the conserved Laminin N-terminal domain in order to explore the relationships between genes with distinct architectures. Laminin-like genes appear to have originated in the holozoan lineage (choanoflagellates + metazoans + several other unicellular opisthokont taxa), with several laminin domains originating later and appearing only in metazoan (animal) or eumetazoan (placozoans + ctenophores + cnidarians + bilaterians) laminins. Typical bilaterian α, β, and γ laminin chain forms arose in the eumetazoan stem and another chain type that is conserved in Amphimedon, the cnidarian, Nematostella vectensis, and the echinoderm, Strongylocentrotus purpuratus, appears to have been lost independently from the placozoan, Trichoplax adhaerens, and from multiple bilaterians. Phylogenetic analysis did not clearly reconstruct relationships between the distinct laminin chain types (with the exception of the α chains) but did reveal how several members of the netrin family were

  12. The FT/TFL1 gene family in grapevine.

    PubMed

    Carmona, María José; Calonje, Myriam; Martínez-Zapater, José Miguel

    2007-03-01

    The FT/TFL1 gene family encodes proteins with similarity to phosphatidylethanolamine binding proteins which function as flowering promoters and repressors. We show here that the FT/TFL1 gene family in Vitis vinifera is composed of at least five genes. Sequence comparisons with homologous genes identified in other dicot species group them in three major clades, the FT, MFT and TFL1 subfamilies, the latter including three of the Vitis sequences. Gene expression patterns are in agreement with a role of VvFT and VvMFT as flowering promoters; while VvTFL1A, VvTFL1B and VvTFL1C could be associated with vegetative development and maintenance of meristem indetermination. Overexpression of VvFT in transgenic Arabidopsis plants generates early flowering phenotypes similar to those produced by FT supporting a role for this gene in flowering promotion. Overexpression of VvTFL1A does not affect flowering time but the determination of flower meristems, strongly altering inflorescence structure, which is consistent with the biological roles assigned to similar genes in other species.

  13. CHD7 Gene Polymorphisms and Familial Idiopathic Scoliosis

    PubMed Central

    Tilley, Mera K.; Justice, Cristina M.; Swindle, Kandice; Marosy, Beth; Wilson, Alexander F.; Miller, Nancy H.

    2013-01-01

    Study Design Model-independent linkage analysis and tests of association were performed for 22 single nucleotide polymorphisms (SNPs) in the CHD7 gene in 244 families of European descent with familial idiopathic scoliosis (FIS). Objective To replicate an association between FIS and the CHD7 gene on 8q12.2 in an independent sample of families of European descent. Summary of Background Data The CHD7 gene on chromosome 8, responsible for the CHARGE syndrome, was previously associated with FIS in an independent study that included 52 families of European descent. Methods Model-independent linkage analysis and intra-familial tests of association were performed on the degree of lateral curvature considered as a qualitative trait (with thresholds of ≥10°, ≥15°, ≥20° and ≥30°) and as a quantitative trait (degree of lateral curvature). Results from the tests of associations from this study and the previous study were combined in a weighted meta-analysis. Results No significant results (P< 0.01) were found for linkage analysis or tests of association between genetic variants of the CHD7 and FIS in this study sample, failing to replicate the findings from the previous study. Furthermore, no significant results (P< 0.01) were found from meta-analysis of the results from the tests of association from this sample and from the previous sample. Conclusion No association between the 22 genotyped SNPs in the CHD7 gene and FIS within this study sample was found, failing to replicate the earlier findings. Further investigation of the CHD7 gene and its potential association to FIS may be required. PMID:23883829

  14. Effects of endogenous antidiuretic hormone (ADH) on macrophage phagocytosis

    SciTech Connect

    Fernandez-Repollet, E.; Opava-Stitzer, S.; Tiffany, S.; Schwartz, A.

    1983-07-01

    Although several studies have indicated that antidiuretic hormone (ADH) enhances the phagocytic function of the reticuloendothelial system (RES) in shock syndromes, it remains unknown what influence ADH exerts upon the individual phagocytic components of this system. The present investigation was designed to evaluate the effects of endogenous ADH on the phagocytic activity of peritoneal macrophage cells. As a phagocytic stimuli, fluorescent methacrylate microbeads were injected intraperitoneally into Brattleboro (ADH deficient) and normal Long Evans rats in the presence and absence of exogenous ADH. Peritoneal cells were harvested 19-22 hr after the administration of the microbeads and the percent phagocytosis was determined in macrophage cells using a fluorescence-activated cell sorter (FACS II). Our results indicate that the percentage of peritoneal macrophages ingesting the fluorescent methacrylate microbeads was significantly reduced in the absence of ADH (Brattleboro rats: 5.4 +/- 0.6% versus Long Evans rats: 16.8 +/- 2.3%; p less than 0.001). In addition, our data demonstrate that exogenous administration of ADH significantly enhanced macrophage phagocytosis in Brattleboro (14.7 +/- 2.2%) and normal Long Evans (49.6 +/- 4.5%) rats. These data suggest, for the first time, that endogenous ADH might play a modulatory role in the phagocytic activity of a specific component of the RES, namely, the macrophage cell.

  15. Differential Gene Expression in the Laccase Gene Family from Basidiomycete I-62 (CECT 20197)

    PubMed Central

    Mansur, Mariana; Suárez, Teresa; González, Aldo E.

    1998-01-01

    A family of genes encoding laccases has recently been described for the basidiomycete I-62 (CECT 20197). Transcript levels of genes lcc1, lcc2, and lcc3 were analyzed under four different culture conditions to study their expression patterns. Two of the laccase genes were clearly inducible by veratryl alcohol: the lcc1 gene is inducible in early stages of growth, and the lcc2 gene is also inducible but only when the organism reaches the stationary phase. Transcript levels for the third gene, lcc3, were uninduced by veratryl alcohol and repressed by glucose. PMID:16349507

  16. Effects of the Family Environment: Gene-Environment Interaction and Passive Gene-Environment Correlation

    ERIC Educational Resources Information Center

    Price, Thomas S.; Jaffee, Sara R.

    2008-01-01

    The classical twin study provides a useful resource for testing hypotheses about how the family environment influences children's development, including how genes can influence sensitivity to environmental effects. However, existing statistical models do not account for the possibility that children can inherit exposure to family environments…

  17. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    SciTech Connect

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

    2000-09-18

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society.

  18. Population- and Family-Based Studies Associate the "MTHFR" Gene with Idiopathic Autism in Simplex Families

    ERIC Educational Resources Information Center

    Liu, Xudong; Solehdin, Fatima; Cohen, Ira L.; Gonzalez, Maripaz G.; Jenkins, Edmund C.; Lewis, M. E. Suzanne; Holden, Jeanette J. A.

    2011-01-01

    Two methylenetetrahydrofolate reductase gene ("MTHFR") functional polymorphisms were studied in 205 North American simplex (SPX) and 307 multiplex (MPX) families having one or more children with an autism spectrum disorder. Case-control comparisons revealed a significantly higher frequency of the low-activity 677T allele, higher prevalence of the…

  19. A Combinatorial Approach to Detecting Gene-Gene and Gene-Environment Interactions in Family Studies

    PubMed Central

    Lou, Xiang-Yang; Chen, Guo-Bo; Yan, Lei; Ma, Jennie Z.; Mangold, Jamie E.; Zhu, Jun; Elston, Robert C.; Li, Ming D.

    2008-01-01

    Widespread multifactor interactions present a significant challenge in determining risk factors of complex diseases. Several combinatorial approaches, such as the multifactor dimensionality reduction (MDR) method, have emerged as a promising tool for better detecting gene-gene (G × G) and gene-environment (G × E) interactions. We recently developed a general combinatorial approach, namely the generalized multifactor dimensionality reduction (GMDR) method, which can entertain both qualitative and quantitative phenotypes and allows for both discrete and continuous covariates to detect G × G and G × E interactions in a sample of unrelated individuals. In this article, we report the development of an algorithm that can be used to study G × G and G × E interactions for family-based designs, called pedigree-based GMDR (PGMDR). Compared to the available method, our proposed method has several major improvements, including allowing for covariate adjustments and being applicable to arbitrary phenotypes, arbitrary pedigree structures, and arbitrary patterns of missing marker genotypes. Our Monte Carlo simulations provide evidence that the PGMDR method is superior in performance to identify epistatic loci compared to the MDR-pedigree disequilibrium test (PDT). Finally, we applied our proposed approach to a genetic data set on tobacco dependence and found a significant interaction between two taste receptor genes (i.e., TAS2R16 and TAS2R38) in affecting nicotine dependence. PMID:18834969

  20. Effects of ADH2 overexpression in Saccharomyces bayanus during alcoholic fermentation.

    PubMed

    Maestre, Oscar; García-Martínez, Teresa; Peinado, Rafael A; Mauricio, Juan C

    2008-02-01

    The effect of overexpression of the gene ADH2 on metabolic and biological activity in Saccharomyces bayanus V5 during alcoholic fermentation has been evaluated. This gene is known to encode alcohol dehydrogenase II (ADH II). During the biological aging of sherry wines, where yeasts have to grow on ethanol owing to the absence of glucose, this isoenzyme plays a prominent role by converting the ethanol into acetaldehyde and producing NADH in the process. Overexpression of the gene ADH2 during alcoholic fermentation has no effect on the proteomic profile or the net production of some metabolites associated with glycolysis and alcoholic fermentation such as ethanol, acetaldehyde, and glycerol. However, it affects indirectly glucose and ammonium uptakes, cell growth, and intracellular redox potential, which lead to an altered metabolome. The increased contents in acetoin, acetic acid, and L-proline present in the fermentation medium under these conditions can be ascribed to detoxification by removal of excess acetaldehyde and the need to restore and maintain the intracellular redox potential balance.

  1. Plant Ion Channels: Gene Families, Physiology, and Functional Genomics Analyses

    PubMed Central

    Ward, John M.; Mäser, Pascal; Schroeder, Julian I.

    2016-01-01

    Distinct potassium, anion, and calcium channels in the plasma membrane and vacuolar membrane of plant cells have been identified and characterized by patch clamping. Primarily owing to advances in Arabidopsis genetics and genomics, and yeast functional complementation, many of the corresponding genes have been identified. Recent advances in our understanding of ion channel genes that mediate signal transduction and ion transport are discussed here. Some plant ion channels, for example, ALMT and SLAC anion channel subunits, are unique. The majority of plant ion channel families exhibit homology to animal genes; such families include both hyperpolarization-and depolarization-activated Shaker-type potassium channels, CLC chloride transporters/channels, cyclic nucleotide–gated channels, and ionotropic glutamate receptor homologs. These plant ion channels offer unique opportunities to analyze the structural mechanisms and functions of ion channels. Here we review gene families of selected plant ion channel classes and discuss unique structure-function aspects and their physiological roles in plant cell signaling and transport. PMID:18842100

  2. GJB2 gene mutations causing familial hereditary deafness in Turkey.

    PubMed

    Bayazit, Yildirim A; Cable, Benjamin B; Cataloluk, Osman; Kara, Cengiz; Chamberlin, Parker; Smith, Richard J H; Kanlikama, Muzaffer; Ozer, Enver; Cakmak, Ecir Ali; Mumbuc, Semih; Arslan, Ahmet

    2003-12-01

    Mutations in Connexin 26 (Cx26) play an important role in autosomal non-syndromic hereditary hearing loss. In this study, our objective was to find out the significance of Cx26 mutations in Turkish families who had hereditary deafness. Fourteen families who had at least two prelingually deaf children per family were included in the study. One affected child from each of the 14 families was selected for single-stranded conformational polymorphism SSCP analysis. Three PCR reactions were used for each subject to amplify the entire Cx26 coding region with overlap. PCR products were sequenced on an Applied Biosystems (ABI) model 3700 automated sequencer. Six of the 14 representative family members (42.9%) demonstrated shifts on SSCP and were subsequently sequenced for Exons 1 and 2 of GJB2 and were tested for the 432 kb upstream deletion. No mutations were found in Exon 1 and no 432 kb deletions were noted. Three different GJB2 mutations were found in Exon 2 of the probands, which were 35delG, 299-300delAT, and 487G > A (M163V). GJB2 mutations were detected in 21.4% of the families. Two patients were homozygous for 35delG and 299-300delAT mutations, and were given a diagnosis of DFNB1 deafness (14.3%). Two different polymorphisms, 457G > A (V153I) and 380G > AG (R127H) were also found. In conclusion, although GJB2 mutations were detected in 21.4% of the families tested, only 14.3% of subject representatives were homozygous and therefore deafness caused by Cx26 mutation segregated with DFNB1. Thus, contribution of GJB2 mutations appears less significant in familial deafness. This necessitates further assessment for the other known gene regions as well as a search for new genetic factors in familial type of genetic deafness.

  3. Early evolution of the LIM homeobox gene family

    SciTech Connect

    Srivastava, Mansi; Larroux, Claire; Lu, Daniel R; Mohanty, Kareshma; Chapman, Jarrod; Degnan, Bernard M; Rokhsar, Daniel S

    2010-01-01

    LIM homeobox (Lhx) transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons) indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In Nematostella, Lhx gene expression is correlated with neural

  4. Mutation Analysis of HTRA2 Gene in Chinese Familial Essential Tremor and Familial Parkinson's Disease.

    PubMed

    He, Ya-Chao; Huang, Pei; Li, Qiong-Qiong; Sun, Qian; Li, Dun-Hui; Wang, Tian; Shen, Jun-Yi; Du, Juan-Juan; Cui, Shi-Shuang; Gao, Chao; Fu, Rao; Chen, Sheng-Di

    2017-01-01

    Background. HTRA2 has already been nominated as PARK13 which may cause Parkinson's disease, though there are still discrepancies among these results. Recently, Gulsuner et al.'s study found that HTRA2 p.G399S is responsible for hereditary essential tremor and homozygotes of this allele develop Parkinson's disease by examining a six-generation family segregating essential tremor and essential tremor coexisting with Parkinson's disease. We performed this study to validate the condition of HTRA2 gene in Chinese familial essential tremor and familial Parkinson's disease patients, especially essential tremor. Methods. We directly sequenced all eight exons, exon-intron boundaries, and part of the introns in 101 familial essential tremor patients, 105 familial Parkinson's disease patients, and 100 healthy controls. Results. No exonic variant was identified, while one exon-intron boundary variant (rs2241028) and one intron variant (rs2241027) were detected, both with no clinical significance and uncertain function. There was no difference in allele, genotype, and haplotype between groups. Conclusions. HTRA2 exonic variant might be rare among Chinese Parkinson's disease and essential tremor patients with family history, and HTRA2 may not be the cause of familial Parkinson's disease and essential tremor in China.

  5. Mutation Analysis of HTRA2 Gene in Chinese Familial Essential Tremor and Familial Parkinson's Disease

    PubMed Central

    Li, Qiong-Qiong; Fu, Rao

    2017-01-01

    Background. HTRA2 has already been nominated as PARK13 which may cause Parkinson's disease, though there are still discrepancies among these results. Recently, Gulsuner et al.'s study found that HTRA2 p.G399S is responsible for hereditary essential tremor and homozygotes of this allele develop Parkinson's disease by examining a six-generation family segregating essential tremor and essential tremor coexisting with Parkinson's disease. We performed this study to validate the condition of HTRA2 gene in Chinese familial essential tremor and familial Parkinson's disease patients, especially essential tremor. Methods. We directly sequenced all eight exons, exon-intron boundaries, and part of the introns in 101 familial essential tremor patients, 105 familial Parkinson's disease patients, and 100 healthy controls. Results. No exonic variant was identified, while one exon-intron boundary variant (rs2241028) and one intron variant (rs2241027) were detected, both with no clinical significance and uncertain function. There was no difference in allele, genotype, and haplotype between groups. Conclusions. HTRA2 exonic variant might be rare among Chinese Parkinson's disease and essential tremor patients with family history, and HTRA2 may not be the cause of familial Parkinson's disease and essential tremor in China. PMID:28243480

  6. A Candida albicans CRISPR system permits genetic engineering of essential genes and gene families.

    PubMed

    Vyas, Valmik K; Barrasa, M Inmaculada; Fink, Gerald R

    Candida albicans is a pathogenic yeast that causes mucosal and systematic infections with high mortality. The absence of facile molecular genetics has been a major impediment to analysis of pathogenesis. The lack of meiosis coupled with the absence of plasmids makes genetic engineering cumbersome, especially for essential functions and gene families. We describe a C. albicans CRISPR system that overcomes many of the obstacles to genetic engineering in this organism. The high frequency with which CRISPR-induced mutations can be directed to target genes enables easy isolation of homozygous gene knockouts, even without selection. Moreover, the system permits the creation of strains with mutations in multiple genes, gene families, and genes that encode essential functions. This CRISPR system is also effective in a fresh clinical isolate of undetermined ploidy. Our method transforms the ability to manipulate the genome of Candida and provides a new window into the biology of this pathogen.

  7. MORC Family ATPases Required for Heterochromatin Condensation and Gene Silencing#

    PubMed Central

    Moissiard, Guillaume; Cokus, Shawn J.; Cary, Joshua; Feng, Suhua; Billi, Allison C.; Stroud, Hume; Husmann, Dylan; Zhan, Ye; Lajoie, Bryan R.; McCord, Rachel Patton; Hale, Christopher J.; Feng, Wei; Michaels, Scott D.; Frand, Alison R.; Pellegrini, Matteo; Dekker, Job; Kim, John K.; Jacobsen, Steve

    2012-01-01

    Transposable elements (TEs) and DNA repeats are commonly targeted by DNA and histone methylation to achieve epigenetic gene silencing. We isolated mutations in two Arabidopsis genes, AtMORC1 and AtMORC6, which cause de-repression of DNA-methylated genes and TEs, but no losses of DNA or histone methylation. AtMORC1 and AtMORC6 are members of the conserved Microrchidia (MORC) adenosine triphosphatase (ATPase) family, predicted to catalyze alterations in chromosome superstructure. The atmorc1 and atmorc6 mutants show decondensation of pericentromeric heterochromatin, increased interaction of pericentromeric regions with the rest of the genome, and transcriptional defects that are largely restricted to loci residing in pericentromeric regions. Knockdown of the single MORC homolog in Caenorhabditis elegans also impairs transgene silencing. We propose that the MORC ATPases are conserved regulators of gene silencing in eukaryotes. PMID:22555433

  8. Massive expansion of the calpain gene family in unicellular eukaryotes

    PubMed Central

    2012-01-01

    Background Calpains are Ca2+-dependent cysteine proteases that participate in a range of crucial cellular processes. Dysfunction of these enzymes may cause, for instance, life-threatening diseases in humans, the loss of sex determination in nematodes and embryo lethality in plants. Although the calpain family is well characterized in animal and plant model organisms, there is a great lack of knowledge about these genes in unicellular eukaryote species (i.e. protists). Here, we study the distribution and evolution of calpain genes in a wide range of eukaryote genomes from major branches in the tree of life. Results Our investigations reveal 24 types of protein domains that are combined with the calpain-specific catalytic domain CysPc. In total we identify 41 different calpain domain architectures, 28 of these domain combinations have not been previously described. Based on our phylogenetic inferences, we propose that at least four calpain variants were established in the early evolution of eukaryotes, most likely before the radiation of all the major supergroups of eukaryotes. Many domains associated with eukaryotic calpain genes can be found among eubacteria or archaebacteria but never in combination with the CysPc domain. Conclusions The analyses presented here show that ancient modules present in prokaryotes, and a few de novo eukaryote domains, have been assembled into many novel domain combinations along the evolutionary history of eukaryotes. Some of the new calpain genes show a narrow distribution in a few branches in the tree of life, likely representing lineage-specific innovations. Hence, the functionally important classical calpain genes found among humans and vertebrates make up only a tiny fraction of the calpain family. In fact, a massive expansion of the calpain family occurred by domain shuffling among unicellular eukaryotes and contributed to a wealth of functionally different genes. PMID:23020305

  9. Chromosomal evolution of the PKD1 gene family in primates

    PubMed Central

    2008-01-01

    Background The autosomal dominant polycystic kidney disease (ADPKD) is mostly caused by mutations in the PKD1 (polycystic kidney disease 1) gene located in 16p13.3. Moreover, there are six pseudogenes of PKD1 that are located proximal to the master gene in 16p13.1. In contrast, no pseudogene could be detected in the mouse genome, only a single copy gene on chromosome 17. The question arises how the human situation originated phylogenetically. To address this question we applied comparative FISH-mapping of a human PKD1-containing genomic BAC clone and a PKD1-cDNA clone to chromosomes of a variety of primate species and the dog as a non-primate outgroup species. Results Comparative FISH with the PKD1-cDNA clone clearly shows that in all primate species studied distinct single signals map in subtelomeric chromosomal positions orthologous to the short arm of human chromosome 16 harbouring the master PKD1 gene. Only in human and African great apes, but not in orangutan, FISH with both BAC and cDNA clones reveals additional signal clusters located proximal of and clearly separated from the PKD1 master genes indicating the chromosomal position of PKD1 pseudogenes in 16p of these species, respectively. Indeed, this is in accordance with sequencing data in human, chimpanzee and orangutan. Apart from the master PKD1 gene, six pseudogenes are identified in both, human and chimpanzee, while only a single-copy gene is present in the whole-genome sequence of orangutan. The phylogenetic reconstruction of the PKD1-tree reveals that all human pseudogenes are closely related to the human PKD1 gene, and all chimpanzee pseudogenes are closely related to the chimpanzee PKD1 gene. However, our statistical analyses provide strong indication that gene conversion events may have occurred within the PKD1 family members of human and chimpanzee, respectively. Conclusion PKD1 must have undergone amplification very recently in hominid evolution. Duplicative transposition of the PKD1 gene and

  10. NDP gene mutations in 14 French families with Norrie disease.

    PubMed

    Royer, Ghislaine; Hanein, Sylvain; Raclin, Valérie; Gigarel, Nadine; Rozet, Jean-Michel; Munnich, Arnold; Steffann, Julie; Dufier, Jean-Louis; Kaplan, Josseline; Bonnefont, Jean-Paul

    2003-12-01

    Norrie disease is a rare X-inked recessive condition characterized by congenital blindness and occasionally deafness and mental retardation in males. This disease has been ascribed to mutations in the NDP gene on chromosome Xp11.1. Previous investigations of the NDP gene have identified largely sixty disease-causing sequence variants. Here, we report on ten different NDP gene allelic variants in fourteen of a series of 21 families fulfilling inclusion criteria. Two alterations were intragenic deletions and eight were nucleotide substitutions or splicing variants, six of them being hitherto unreported, namely c.112C>T (p.Arg38Cys), c.129C>G (p.His43Gln), c.133G>A (p.Val45Met), c.268C>T (p.Arg90Cys), c.382T>C (p.Cys128Arg), c.23479-1G>C (unknown). No NDP gene sequence variant was found in seven of the 21 families. This observation raises the issue of misdiagnosis, phenocopies, or existence of other X-linked or autosomal genes, the mutations of which would mimic the Norrie disease phenotype.

  11. The Maize PIN Gene Family of Auxin Transporters.

    PubMed

    Forestan, Cristian; Farinati, Silvia; Varotto, Serena

    2012-01-01

    Auxin is a key regulator of plant development and its differential distribution in plant tissues, established by a polar cell to cell transport, can trigger a wide range of developmental processes. A few members of the two families of auxin efflux transport proteins, PIN-formed (PIN) and P-glycoprotein (ABCB/PGP), have so far been characterized in maize. Nine new Zea mays auxin efflux carriers PIN family members and two maize PIN-like genes have now been identified. Four members of PIN1 (named ZmPIN1a-d) cluster, one gene homologous to AtPIN2 (ZmPIN2), three orthologs of PIN5 (ZmPIN5a-c), one gene paired with AtPIN8 (ZmPIN8), and three monocot-specific PINs (ZmPIN9, ZmPIN10a, and ZmPIN10b) were cloned and the phylogenetic relationships between early-land plants, monocots, and eudicots PIN proteins investigated, including the new maize PIN proteins. Tissue-specific expression patterns of the 12 maize PIN genes, 2 PIN-like genes and ZmABCB1, an ABCB auxin efflux carrier, were analyzed together with protein localization and auxin accumulation patterns in normal conditions and in response to drug applications. ZmPIN gene transcripts have overlapping expression domains in the root apex, during male and female inflorescence differentiation and kernel development. However, some PIN family members have specific tissue localization: ZmPIN1d transcript marks the L1 layer of the shoot apical meristem and inflorescence meristem during the flowering transition and the monocot-specific ZmPIN9 is expressed in the root endodermis and pericycle. The phylogenetic and gene structure analyses together with the expression pattern of the ZmPIN gene family indicate that subfunctionalization of some maize PINs can be associated to the differentiation and development of monocot-specific organs and tissues and might have occurred after the divergence between dicots and monocots.

  12. The Maize PIN Gene Family of Auxin Transporters

    PubMed Central

    Forestan, Cristian; Farinati, Silvia; Varotto, Serena

    2012-01-01

    Auxin is a key regulator of plant development and its differential distribution in plant tissues, established by a polar cell to cell transport, can trigger a wide range of developmental processes. A few members of the two families of auxin efflux transport proteins, PIN-formed (PIN) and P-glycoprotein (ABCB/PGP), have so far been characterized in maize. Nine new Zea mays auxin efflux carriers PIN family members and two maize PIN-like genes have now been identified. Four members of PIN1 (named ZmPIN1a–d) cluster, one gene homologous to AtPIN2 (ZmPIN2), three orthologs of PIN5 (ZmPIN5a–c), one gene paired with AtPIN8 (ZmPIN8), and three monocot-specific PINs (ZmPIN9, ZmPIN10a, and ZmPIN10b) were cloned and the phylogenetic relationships between early-land plants, monocots, and eudicots PIN proteins investigated, including the new maize PIN proteins. Tissue-specific expression patterns of the 12 maize PIN genes, 2 PIN-like genes and ZmABCB1, an ABCB auxin efflux carrier, were analyzed together with protein localization and auxin accumulation patterns in normal conditions and in response to drug applications. ZmPIN gene transcripts have overlapping expression domains in the root apex, during male and female inflorescence differentiation and kernel development. However, some PIN family members have specific tissue localization: ZmPIN1d transcript marks the L1 layer of the shoot apical meristem and inflorescence meristem during the flowering transition and the monocot-specific ZmPIN9 is expressed in the root endodermis and pericycle. The phylogenetic and gene structure analyses together with the expression pattern of the ZmPIN gene family indicate that subfunctionalization of some maize PINs can be associated to the differentiation and development of monocot-specific organs and tissues and might have occurred after the divergence between dicots and monocots. PMID:22639639

  13. Clock-associated genes in Arabidopsis: a family affair.

    PubMed Central

    Somers, D E

    2001-01-01

    The identification of components of the plant circadian clock has been advanced recently with the success of two forward genetics approaches. The ZEITLUPE and TOC1 loci were cloned and each was found to be part of two separate, larger gene families with intriguing domain structures. The ZTL family of proteins contains a subclass of the PAS domain coupled to an F box and kelch motifs, suggesting that they play a role in a novel light-regulated ubiquitination mechanism. TOC1 shares similarity to the receiver domain of the well-known two-component phosphorelay signalling systems, combined with a strong similarity to a region of the CONSTANS transcription factor, which is involved in controlling flowering time. When added to the repertoire of previously identified clock-associated genes, it is clear that both similarities and differences with other circadian systems will emerge in the coming years. PMID:11710981

  14. Epigenetic balance of gene expression by Polycomb and COMPASS families.

    PubMed

    Piunti, Andrea; Shilatifard, Ali

    2016-06-03

    Epigenetic regulation of gene expression in metazoans is central for establishing cellular diversity, and its deregulation can result in pathological conditions. Although transcription factors are essential for implementing gene expression programs, they do not function in isolation and require the recruitment of various chromatin-modifying and -remodeling machineries. A classic example of developmental chromatin regulation is the balanced activities of the Polycomb group (PcG) proteins within the PRC1 and PRC2 complexes, and the Trithorax group (TrxG) proteins within the COMPASS family, which are highly mutated in a large number of human diseases. In this review, we will discuss the latest findings regarding the properties of the PcG and COMPASS families and the insight they provide into the epigenetic control of transcription under physiological and pathological settings.

  15. Variation in the RAD51 gene and familial breast cancer

    PubMed Central

    Lose, Felicity; Lovelock, Paul; Chenevix-Trench, Georgia; Mann, Graham J; Pupo, Gulietta M; Spurdle, Amanda B

    2006-01-01

    Introduction Human RAD51 is a homologue of the Escherichia coli RecA protein and is known to function in recombinational repair of double-stranded DNA breaks. Mutations in the lower eukaryotic homologues of RAD51 result in a deficiency in the repair of double-stranded DNA breaks. Loss of RAD51 function would therefore be expected to result in an elevated mutation rate, leading to accumulation of DNA damage and, hence, to increased cancer risk. RAD51 interacts directly or indirectly with a number of proteins implicated in breast cancer, such as BRCA1 and BRCA2. Similar to BRCA1 mice, RAD51-/- mice are embryonic lethal. The RAD51 gene region has been shown to exhibit loss of heterozygosity in breast tumours, and deregulated RAD51 expression in breast cancer patients has also been reported. Few studies have investigated the role of coding region variation in the RAD51 gene in familial breast cancer, with only one coding region variant – exon 6 c.449G>A (p.R150Q) – reported to date. Methods All nine coding exons of the RAD51 gene were analysed for variation in 46 well-characterised, BRCA1/2-negative breast cancer families using denaturing high-performance liquid chromatography. Genotyping of the exon 6 p.R150Q variant was performed in an additional 66 families. Additionally, lymphoblastoid cell lines from breast cancer patients were subjected to single nucleotide primer extension analysis to assess RAD51 expression. Results No coding region variation was found, and all intronic variation detected was either found in unaffected controls or was unlikely to have functional consequences. Single nucleotide primer extension analysis did not reveal any allele-specific changes in RAD51 expression in all lymphoblastoid cell lines tested. Conclusion Our study indicates that RAD51 is not a major familial breast cancer predisposition gene. PMID:16762046

  16. Leiomodins: larger members of the tropomodulin (Tmod) gene family

    NASA Technical Reports Server (NTRS)

    Conley, C. A.; Fritz-Six, K. L.; Almenar-Queralt, A.; Fowler, V. M.

    2001-01-01

    The 64-kDa autoantigen D1 or 1D, first identified as a potential autoantigen in Graves' disease, is similar to the tropomodulin (Tmod) family of actin filament pointed end-capping proteins. A novel gene with significant similarity to the 64-kDa human autoantigen D1 has been cloned from both humans and mice, and the genomic sequences of both genes have been identified. These genes form a subfamily closely related to the Tmods and are here named the Leiomodins (Lmods). Both Lmod genes display a conserved intron-exon structure, as do three Tmod genes, but the intron-exon structure of the Lmods and the Tmods is divergent. mRNA expression analysis indicates that the gene formerly known as the 64-kDa autoantigen D1 is most highly expressed in a variety of human tissues that contain smooth muscle, earning it the name smooth muscle Leiomodin (SM-Lmod; HGMW-approved symbol LMOD1). Transcripts encoding the novel Lmod gene are present exclusively in fetal and adult heart and adult skeletal muscle, and it is here named cardiac Leiomodin (C-Lmod; HGMW-approved symbol LMOD2). Human C-Lmod is located near the hypertrophic cardiomyopathy locus CMH6 on human chromosome 7q3, potentially implicating it in this disease. Our data demonstrate that the Lmods are evolutionarily related and display tissue-specific patterns of expression distinct from, but overlapping with, the expression of Tmod isoforms. Copyright 2001 Academic Press.

  17. The carboxylesterase/cholinesterase gene family in invertebrate deuterostomes.

    PubMed

    Johnson, Glynis; Moore, Samuel W

    2012-06-01

    Carboxylesterase/cholinesterase family members are responsible for controlling the nerve impulse, detoxification and various developmental functions, and are a major target of pesticides and chemical warfare agents. Comparative structural analysis of these enzymes is thus important. The invertebrate deuterostomes (phyla Echinodermata and Hemichordata and subphyla Urochordata and Cephalochordata) lie in the transition zone between invertebrates and vertebrates, and are thus of interest to the study of evolution. Here we have investigated the carboxylesterase/cholinesterase gene family in the sequenced genomes of Strongylocentrotus purpuratus (Echinodermata), Saccoglossus kowalevskii (Hemichordata), Ciona intestinalis (Urochordata) and Branchiostoma floridae (Cephalochordata), using sequence analysis of the catalytic apparatus and oligomerisation domains, and phylogenetic analysis. All four genomes show blurring of structural boundaries between cholinesterases and carboxylesterases, with many intermediate enzymes. Non-enzymatic proteins are well represented. The Saccoglossus and Branchiostoma genomes show evidence of extensive gene duplication and retention. There is also evidence of domain shuffling, resulting in multidomain proteins consisting either of multiple carboxylesterase domains, or of carboxylesterase/cholinesterase domains linked to other domains, including RING finger, chitin-binding, immunoglobulin, fibronectin type 3, CUB, cysteine-rich-Frizzled, caspase activation and 7tm-1, amongst others. Such gene duplication and domain shuffling in the carboxylesterase/cholinesterase family appears to be unique to the invertebrate deuterostomes, and we hypothesise that these factors may have contributed to the evolution of the morphological complexity, particularly of the nervous system and neural crest, of the vertebrates.

  18. Tomato ABSCISIC ACID STRESS RIPENING (ASR) gene family revisited.

    PubMed

    Golan, Ido; Dominguez, Pia Guadalupe; Konrad, Zvia; Shkolnik-Inbar, Doron; Carrari, Fernando; Bar-Zvi, Dudy

    2014-01-01

    Tomato ABSCISIC ACID RIPENING 1 (ASR1) was the first cloned plant ASR gene. ASR orthologs were then cloned from a large number of monocot, dicot and gymnosperm plants, where they are mostly involved in response to abiotic (drought and salinity) stress and fruit ripening. The tomato genome encodes five ASR genes: ASR1, 2, 3 and 5 encode low-molecular-weight proteins (ca. 110 amino acid residues each), whereas ASR4 encodes a 297-residue polypeptide. Information on the expression of the tomato ASR gene family is scarce. We used quantitative RT-PCR to assay the expression of this gene family in plant development and in response to salt and osmotic stresses. ASR1 and ASR4 were the main expressed genes in all tested organs and conditions, whereas ASR2 and ASR3/5 expression was two to three orders of magnitude lower (with the exception of cotyledons). ASR1 is expressed in all plant tissues tested whereas ASR4 expression is limited to photosynthetic organs and stamens. Essentially, ASR1 accounted for most of ASR gene expression in roots, stems and fruits at all developmental stages, whereas ASR4 was the major gene expressed in cotyledons and young and fully developed leaves. Both ASR1 and ASR4 were expressed in flower organs, with ASR1 expression dominating in stamens and pistils, ASR4 in sepals and petals. Steady-state levels of ASR1 and ASR4 were upregulated in plant vegetative organs following exposure to salt stress, osmotic stress or the plant abiotic stress hormone abscisic acid (ABA). Tomato plants overexpressing ASR1 displayed enhanced survival rates under conditions of water stress, whereas ASR1-antisense plants displayed marginal hypersensitivity to water withholding.

  19. [Effects of H2-blockers on alcohol dehydrogenase (ADH) activity].

    PubMed

    Jelski, Wojciech; Orywal, Karolina; Szmitkowski, Maciej

    2008-12-01

    First-pass metabolism (FPM) of alcohol is demonstrated by lower blood alcohol concentrations after oral than intravenous administration of the same dose. FPM occurs predominantly in the stomach and has been attributed to class IV of alcohol dehydrogenase (ADH) isoenzyme localizated in the gastric mucosa. A number of factors that influence on gastric ADH activity and thereby modulate FPM have been identified. These include age, sex, ethnicity, concentrations and amounts of alcohol consumed and drugs. Several H2-receptor antagonists, including cimetidine and ranitidine, inhibit gastric ADH activity and reduce FPM, resulting in higher blood alcohol concentrations after H2-blockers administration.

  20. Organization of the human lipoprotein lipase gene and evolution of the lipase gene family.

    PubMed Central

    Kirchgessner, T G; Chuat, J C; Heinzmann, C; Etienne, J; Guilhot, S; Svenson, K; Ameis, D; Pilon, C; d'Auriol, L; Andalibi, A

    1989-01-01

    The human lipoprotein lipase gene was cloned and characterized. It is composed of 10 exons spanning approximately equal to 30 kilobases. The first exon encodes the 5'-untranslated region, the signal peptide plus the first two amino acids of the mature protein. The next eight exons encode the remaining 446 amino acids, and the tenth exon encodes the long 3'-untranslated region of 1948 nucleotides. The lipoprotein lipase transcription start site and the sequence of the 5'-flanking region were also determined. We compared the organization of genes for lipoprotein lipase, hepatic lipase, pancreatic lipase, and Drosophila yolk protein 1, which are members of a family of related genes. A model for the evolution of the lipase gene family is presented that involves multiple rounds of gene duplication plus exon-shuffling and intron-loss events. Images PMID:2602366

  1. The Evolution of Novelty in Conserved Gene Families

    PubMed Central

    Markov, Gabriel V.; Sommer, Ralf J.

    2012-01-01

    One of the major aims of contemporary evolutionary biology is the understanding of the current pattern of biological diversity. This involves, first, the description of character distribution at various nodes of the phylogenetic tree of life and, second, the functional explanation of such changes. The analysis of character distribution is a powerful tool at both the morphological and molecular levels. Recent high-throughput sequencing approaches provide new opportunities to study the genetic architecture of organisms at the genome-wide level. In eukaryotes, one overarching finding is the absence of simple correlations of gene count and biological complexity. Instead, the domain architecture of proteins is becoming a central focus for large-scale evolutionary innovations. Here, we review examples of the evolution of novelty in conserved gene families in insects and nematodes. We highlight how in the absence of whole-genome duplications molecular novelty can arise, how members of gene families have diversified at distinct mechanistic levels, and how gene expression can be maintained in the context of multiple innovations in regulatory mechanisms. PMID:22779028

  2. Evolution of the tyrosinase gene family in bivalve molluscs: independent expansion of the mantle gene repertoire.

    PubMed

    Aguilera, Felipe; McDougall, Carmel; Degnan, Bernard M

    2014-09-01

    Tyrosinase is a copper-containing enzyme that mediates the hydroxylation of monophenols and oxidation of o-diphenols to o-quinones. This enzyme is involved in a variety of biological processes, including pigment production, innate immunity, wound healing, and exoskeleton fabrication and hardening (e.g. arthropod skeleton and mollusc shell). Here we show that the tyrosinase gene family has undergone large expansions in pearl oysters (Pinctada spp.) and the Pacific oyster (Crassostrea gigas). Phylogenetic analysis reveals that pearl oysters possess at least four tyrosinase genes that are not present in the Pacific oyster. Likewise, C. gigas has multiple tyrosinase genes that are not orthologous to the Pinctada genes, indicating that this gene family has expanded independently in these bivalve lineages. Many of the tyrosinase genes in these bivalves are expressed at relatively high levels in the mantle, the organ responsible for shell fabrication. Detailed comparisons of tyrosinase gene expression in different regions of the mantle in two closely related pearl oysters, P. maxima and P. margaritifera, reveals that recently evolved orthologous tyrosinase genes can have markedly different expression profiles. The expansion of tyrosinase genes in these oysters and their co-option into the mantle's gene regulatory network is consistent with mollusc shell formation being underpinned by a rapidly evolving transcriptome.

  3. PRODH gene is associated with executive function in schizophrenic families.

    PubMed

    Li, Tao; Ma, Xiaohong; Hu, Xun; Wang, Yingcheng; Yan, Chengying; Meng, Huaqing; Liu, Xiehe; Toulopoulou, Timothea; Murray, Robin M; Collier, David A

    2008-07-05

    The aim of this study was to investigate the relationship between polymorphisms in the PRODH and COMT genes and selected neurocognitive functions. Six SNPs in PRODH and two SNPs in COMT were genotyped in 167 first-episode schizophrenic families who had been assessed by a set of 14 neuropsychological tests. Neuropsychological measures were selected as quantitative traits for association analysis. The haplotype of SNPs PRODH 1945T/C and PRODH 1852G/A was associated with impaired performance on the Tower of Hanoi, a problem-solving task mainly reflecting planning capacity. There was no significant evidence for association with any other neuropsychological traits for other SNPs or haplotypes of paired SNPs in the two genes. This study takes previous findings of association between PRODH and schizophrenia further by associating variation within the gene with performance on a neurocognitive trait characteristic of the illness. It fails to confirm previous reports of an association between COMT and cognitive function.

  4. Ethanol-Induced ADH Activity in Zebrafish: Differential Concentration-Dependent Effects on High- Versus Low-Affinity ADH Enzymes.

    PubMed

    Tran, Steven; Nowicki, Magda; Facciol, Amanda; Chatterjee, Diptendu; Gerlai, Robert

    2016-04-01

    Zebrafish express enzymes that metabolize ethanol in a manner comparable to that of mammals, including humans. We previously demonstrated that acute ethanol exposure increases alcohol dehydrogenase (ADH) activity in an inverted U-shaped dose-dependent manner. It was hypothesized that the biphasic dose-response was due to the increased activity of a high-affinity ADH isoform following exposure to low concentrations of ethanol and increased activity of a low-affinity ADH isoform following exposure to higher concentrations of ethanol. To test this hypothesis, we exposed zebrafish to different concentrations of ethanol (0%, 0.25%, 0.5%, and 1.0% v/v) for 30 min and measured the total ADH activity in the zebrafish liver. However, we also repeated this enzyme activity assay using a low concentration of the substrate (ethanol) to determine the activity of high-affinity ADH isoforms. We found that total ADH activity in response to ethanol induces an inverted U-shaped dose-response similar to our previous study. Using a lower substrate level in our enzyme assay targeting high-affinity isozymes, we found a similar dose-response. However, the difference in activity between the high and low substrate assays (high substrate activity - low substrate activity), which provide an index of activity for low-affinity ADH isoforms, revealed no significant effect of ethanol exposure. Our results suggest that the inverted U-shaped dose-response for total ADH activity in response to ethanol is driven primarily by high-affinity isoforms of ADH.

  5. Biofuel Potential of Plants Transformed Genetically with NAC Family Genes

    PubMed Central

    Singh, Sadhana; Grover, Atul; Nasim, M.

    2016-01-01

    NAC genes contribute to enhance survivability of plants under conditions of environmental stress and in secondary growth of the plants, thereby building biomass. Thus, genetic transformation of plants using NAC genes provides a possibility to tailor biofuel plants. Over-expression studies have indicated that NAC family genes can provide tolerance to various biotic and abiotic stresses, either by physiological or biochemical changes at the cellular level, or by affecting visible morphological and anatomical changes, for example, by development of lateral roots in a number of plants. Over-expression of these genes also work as triggers for development of secondary cell walls. In our laboratory, we have observed a NAC gene from Lepidium latifolium contributing to both enhanced biomass as well as cold stress tolerance of model plants tobacco. Thus, we have reviewed all the developments of genetic engineering using NAC genes which could enhance the traits required for biofuel plants, either by enhancing the stress tolerance or by enhancing the biomass of the plants. PMID:26858739

  6. Gene Turnover in the Avian Globin Gene Families and Evolutionary Changes in Hemoglobin Isoform Expression

    PubMed Central

    Opazo, Juan C.; Hoffmann, Federico G.; Natarajan, Chandrasekhar; Witt, Christopher C.; Berenbrink, Michael; Storz, Jay F.

    2015-01-01

    The apparent stasis in the evolution of avian chromosomes suggests that birds may have experienced relatively low rates of gene gain and loss in multigene families. To investigate this possibility and to explore the phenotypic consequences of variation in gene copy number, we examined evolutionary changes in the families of genes that encode the α- and β-type subunits of hemoglobin (Hb), the tetrameric α2β2 protein responsible for blood-O2 transport. A comparative genomic analysis of 52 bird species revealed that the size and membership composition of the α- and β-globin gene families have remained remarkably constant during approximately 100 My of avian evolution. Most interspecific variation in gene content is attributable to multiple independent inactivations of the αD-globin gene, which encodes the α-chain subunit of a functionally distinct Hb isoform (HbD) that is expressed in both embryonic and definitive erythrocytes. Due to consistent differences in O2-binding properties between HbD and the major adult-expressed Hb isoform, HbA (which incorporates products of the αA-globin gene), recurrent losses of αD-globin contribute to among-species variation in blood-O2 affinity. Analysis of HbA/HbD expression levels in the red blood cells of 122 bird species revealed high variability among lineages and strong phylogenetic signal. In comparison with the homologous gene clusters in mammals, the low retention rate for lineage-specific gene duplicates in the avian globin gene clusters suggests that the developmental regulation of Hb synthesis in birds may be more highly conserved, with orthologous genes having similar stage-specific expression profiles and similar functional properties in disparate taxa. PMID:25502940

  7. Gene turnover in the avian globin gene families and evolutionary changes in hemoglobin isoform expression.

    PubMed

    Opazo, Juan C; Hoffmann, Federico G; Natarajan, Chandrasekhar; Witt, Christopher C; Berenbrink, Michael; Storz, Jay F

    2015-04-01

    The apparent stasis in the evolution of avian chromosomes suggests that birds may have experienced relatively low rates of gene gain and loss in multigene families. To investigate this possibility and to explore the phenotypic consequences of variation in gene copy number, we examined evolutionary changes in the families of genes that encode the α- and β-type subunits of hemoglobin (Hb), the tetrameric α2β2 protein responsible for blood-O2 transport. A comparative genomic analysis of 52 bird species revealed that the size and membership composition of the α- and β-globin gene families have remained remarkably constant during approximately 100 My of avian evolution. Most interspecific variation in gene content is attributable to multiple independent inactivations of the α(D)-globin gene, which encodes the α-chain subunit of a functionally distinct Hb isoform (HbD) that is expressed in both embryonic and definitive erythrocytes. Due to consistent differences in O2-binding properties between HbD and the major adult-expressed Hb isoform, HbA (which incorporates products of the α(A)-globin gene), recurrent losses of α(D)-globin contribute to among-species variation in blood-O2 affinity. Analysis of HbA/HbD expression levels in the red blood cells of 122 bird species revealed high variability among lineages and strong phylogenetic signal. In comparison with the homologous gene clusters in mammals, the low retention rate for lineage-specific gene duplicates in the avian globin gene clusters suggests that the developmental regulation of Hb synthesis in birds may be more highly conserved, with orthologous genes having similar stage-specific expression profiles and similar functional properties in disparate taxa.

  8. Molecular genetics of the aip gene in familial pituitary tumorigenesis.

    PubMed

    Tahir, Asil; Chahal, Harvinder S; Korbonits, Márta

    2010-01-01

    Pituitary adenomas usually occur as sporadic tumors, but familial cases are now increasingly identified. As opposed to multiple endocrine neoplasia type 1 and Carney complex, in familial isolated pituitary adenoma (FIPA) syndrome no other disease is associated with the familial occurrence of pituitary adenomas. It is an autosomal dominant disease with incomplete variable penetrance. Approximately 20% of patients with FIPA harbour germline mutations in the aryl hydrocarbon receptor-interacting protein (AIP) gene located on 11q13. Patients with AIP mutations have an overwhelming predominance of somatotroph and lactotroph adenomas, which often present in childhood or young adulthood. AIP, originally identified as a molecular co-chaperone of several nuclear receptors, is thought to act as a tumor suppressor gene; overexpression of wild-type, but not mutant AIP, reduces cell proliferation while knockdown of AIP stimulates it. AIP is shown to bind various proteins, including the aryl hydrocarbon receptor, Hsp90, phosphodiesterases, survivin, RET and the glucocorticoid receptor, but currently it is not clear which interaction has the leading role in pituitary tumorigenesis. This chapter summarizes the available clinical and molecular data regarding the role of AIP in the pituitary gland.

  9. Evolutionary History of Chordate PAX Genes: Dynamics of Change in a Complex Gene Family

    PubMed Central

    Paixão-Côrtes, Vanessa Rodrigues; Salzano, Francisco Mauro; Bortolini, Maria Cátira

    2013-01-01

    Paired box (PAX) genes are transcription factors that play important roles in embryonic development. Although the PAX gene family occurs in animals only, it is widely distributed. Among the vertebrates, its 9 genes appear to be the product of complete duplication of an original set of 4 genes, followed by an additional partial duplication. Although some studies of PAX genes have been conducted, no comprehensive survey of these genes across the entire taxonomic unit has yet been attempted. In this study, we conducted a detailed comparison of PAX sequences from 188 chordates, which revealed restricted variation. The absence of PAX4 and PAX8 among some species of reptiles and birds was notable; however, all 9 genes were present in all 74 mammalian genomes investigated. A search for signatures of selection indicated that all genes are subject to purifying selection, with a possible constraint relaxation in PAX4, PAX7, and PAX8. This result indicates asymmetric evolution of PAX family genes, which can be associated with the emergence of adaptive novelties in the chordate evolutionary trajectory. PMID:24023886

  10. FoxO gene family evolution in vertebrates

    PubMed Central

    Wang, Minghui; Zhang, Xiangzhe; Zhao, Hongbo; Wang, Qishan; Pan, Yuchun

    2009-01-01

    Background Forkhead box, class O (FoxO) belongs to the large family of forkhead transcription factors that are characterized by a conserved forkhead box DNA-binding domain. To date, the FoxO group has four mammalian members: FoxO1, FoxO3a, FoxO4 and FoxO6, which are orthologs of DAF16, an insulin-responsive transcription factor involved in regulating longevity of worms and flies. The degree of homology between these four members is high, especially in the forkhead domain, which contains the DNA-binding interface. Yet, mouse FoxO knockouts have revealed that each FoxO gene has its unique role in the physiological process. Whether the functional divergences are primarily due to adaptive selection pressure or relaxed selective constraint remains an open question. As such, this study aims to address the evolutionary mode of FoxO, which may lead to the functional divergence. Results Sequence similarity searches have performed in genome and scaffold data to identify homologues of FoxO in vertebrates. Phylogenetic analysis was used to characterize the family evolutionary history by identifying two duplications early in vertebrate evolution. To determine the mode of evolution in vertebrates, we performed a rigorous statistical analysis with FoxO gene sequences, including relative rate ratio tests, branch-specific dN/dS ratio tests, site-specific dN/dS ratio tests, branch-site dN/dS ratio tests and clade level amino acid conservation/variation patterns analysis. Our results suggest that FoxO is constrained by strong purifying selection except four sites in FoxO6, which have undergone positive Darwinian selection. The functional divergence in this family is best explained by either relaxed purifying selection or positive selection. Conclusion We present a phylogeny describing the evolutionary history of the FoxO gene family and show that the genes have evolved through duplications followed by purifying selection except for four sites in FoxO6 fixed by positive selection lie

  11. Ethylene-responsive transcription factors interact with promoters of ADH and PDC involved in persimmon (Diospyros kaki) fruit de-astringency.

    PubMed

    Min, Ting; Yin, Xue-ren; Shi, Yan-na; Luo, Zheng-rong; Yao, Yun-cong; Grierson, Donald; Ferguson, Ian B; Chen, Kun-song

    2012-11-01

    The persimmon fruit is a particularly good model for studying fruit response to hypoxia, in particular, the hypoxia-response ERF (HRE) genes. An anaerobic environment reduces fruit astringency by converting soluble condensed tannins (SCTs) into an insoluble form. Although the physiology of de-astringency has been widely studied, its molecular control is poorly understood. Both CO(2) and ethylene treatments efficiently removed the astringency from 'Mopan' persimmon fruit, as indicated by a decrease in SCTs. Acetaldehyde, the putative agent for causing de-astringency, accumulated during these treatments, as did activities of the key enzymes of acetaldehyde synthesis, alcohol dehydrogenase (ADH), and pyruvate decarboxylase (PDC). Eight DkADH and DkPDC genes were isolated, and three candidates for a role in de-astringency, DkADH1, DkPDC1, and DkPDC2, were characterized by transcriptional analysis in different tissues. The significance of these specific isoforms was confirmed by principal component analysis. Transient expression in leaf tissue showed that DkPDC2 decreased SCTs. Interactions of six hypoxia-responsive ERF genes and target promoters were tested in transient assays. The results indicated that two hypoxia-responsive ERF genes, DkERF9 and DkERF10, were involved in separately regulating the DkPDC2 and DkADH1 promoters. It is proposed that a DkERF-DkADH/DkPDC cascade is involved in regulating persimmon de-astringency.

  12. Amelogenesis Imperfecta: 1 Family, 2 Phenotypes, and 2 Mutated Genes.

    PubMed

    Prasad, M K; Laouina, S; El Alloussi, M; Dollfus, H; Bloch-Zupan, A

    2016-12-01

    Amelogenesis imperfecta (AI) is a clinically and genetically heterogeneous group of diseases characterized by enamel defects. The authors have identified a large consanguineous Moroccan family segregating different clinical subtypes of hypoplastic and hypomineralized AI in different individuals within the family. Using targeted next-generation sequencing, the authors identified a novel heterozygous nonsense mutation in COL17A1 (c.1873C>T, p.R625*) segregating with hypoplastic AI and a novel homozygous 8-bp deletion in C4orf26 (c.39_46del, p.Cys14Glyfs*18) segregating with hypomineralized-hypoplastic AI in this family. This study highlights the phenotypic and genotypic heterogeneity of AI that can exist even within a single consanguineous family. Furthermore, the identification of novel mutations in COL17A1 and C4orf26 and their correlation with distinct AI phenotypes can contribute to a better understanding of the pathophysiology of AI and the contribution of these genes to amelogenesis.

  13. The ANKH gene and familial calcium pyrophosphate dihydrate deposition disease.

    PubMed

    Netter, Patrick; Bardin, Thomas; Bianchi, Arnaud; Richette, Pascal; Loeuille, Damien

    2004-09-01

    Familial calcium pyrophosphate dihydrate deposition (CPPD) disease is a chronic condition in which CPPD microcrystals deposit in the joint fluid, cartilage, and periarticular tissues. Two forms of familial CPPD disease have been identified: CCAL1 and CCAL2. The CCAL1 locus is located on the long arm of chromosome 8 and is associated with CPPD and severe osteoarthritis. The CCAL2 locus has been mapped to the short arm of chromosome 5 and identified in families from the Alsace region of France and the United Kingdom. The ANKH protein is involved in pyrophosphate metabolism and, more specifically, in pyrophosphate transport from the intracellular to the extracellular compartment. Numerous ANKH gene mutations cause familial CCAL2; they enhance ANKH protein activity, thereby elevating extracellular pyrophosphate levels and promoting the formation of pyrophosphate crystals, which produce the manifestations of the disease. Recent studies show that growth factors and cytokines can modify the expression of the normal ANKH protein. These results suggest a role for ANKH in sporadic CPPD disease and in CPPD associated with degenerative disease.

  14. Multiple Inter-Kingdom Horizontal Gene Transfers in the Evolution of the Phosphoenolpyruvate Carboxylase Gene Family

    PubMed Central

    Wang, Wen; Su, Bing

    2012-01-01

    Pepcase is a gene encoding phosphoenolpyruvate carboxylase that exists in bacteria, archaea and plants,playing an important role in plant metabolism and development. Most plants have two or more pepcase genes belonging to two gene sub-families, while only one gene exists in other organisms. Previous research categorized one plant pepcase gene as plant-type pepcase (PTPC) while the other as bacteria-type pepcase (BTPC) because of its similarity with the pepcase gene found in bacteria. Phylogenetic reconstruction showed that PTPC is the ancestral lineage of plant pepcase, and that all bacteria, protistpepcase and BTPC in plants are derived from a lineage of pepcase closely related with PTPC in algae. However, their phylogeny contradicts the species tree and traditional chronology of organism evolution. Because the diversification of bacteria occurred much earlier than the origin of plants, presumably all bacterialpepcase derived from the ancestral PTPC of algal plants after divergingfrom the ancestor of vascular plant PTPC. To solve this contradiction, we reconstructed the phylogeny of pepcase gene family. Our result showed that both PTPC and BTPC are derived from an ancestral lineage of gamma-proteobacteriapepcases, possibly via an ancient inter-kingdom horizontal gene transfer (HGT) from bacteria to the eukaryotic common ancestor of plants, protists and cellular slime mold. Our phylogenetic analysis also found 48other pepcase genes originated from inter-kingdom HGTs. These results imply that inter-kingdom HGTs played important roles in the evolution of the pepcase gene family and furthermore that HGTsare a more frequent evolutionary event than previouslythought. PMID:23251445

  15. Family Size Evolution in Drosophila Chemosensory Gene Families: A Comparative Analysis with a Critical Appraisal of Methods

    PubMed Central

    Almeida, Francisca C.; Sánchez-Gracia, Alejandro; Campos, Jose Luis; Rozas, Julio

    2014-01-01

    Gene turnover rates and the evolution of gene family sizes are important aspects of genome evolution. Here, we use curated sequence data of the major chemosensory gene families from Drosophila—the gustatory receptor, odorant receptor, ionotropic receptor, and odorant-binding protein families—to conduct a comparative analysis among families, exploring different methods to estimate gene birth and death rates, including an ad hoc simulation study. Remarkably, we found that the state-of-the-art methods may produce very different rate estimates, which may lead to disparate conclusions regarding the evolution of chemosensory gene family sizes in Drosophila. Among biological factors, we found that a peculiarity of D. sechellia’s gene turnover rates was a major source of bias in global estimates, whereas gene conversion had negligible effects for the families analyzed herein. Turnover rates vary considerably among families, subfamilies, and ortholog groups although all analyzed families were quite dynamic in terms of gene turnover. Computer simulations showed that the methods that use ortholog group information appear to be the most accurate for the Drosophila chemosensory families. Most importantly, these results reveal the potential of rate heterogeneity among lineages to severely bias some turnover rate estimation methods and the need of further evaluating the performance of these methods in a more diverse sampling of gene families and phylogenetic contexts. Using branch-specific codon substitution models, we find further evidence of positive selection in recently duplicated genes, which attests to a nonneutral aspect of the gene birth-and-death process. PMID:24951565

  16. Management of asymptomatic gene carriers of transthyretin familial amyloid polyneuropathy

    PubMed Central

    Barroso, Fabio; González‐Duarte, Alejandra; Conceição, Isabel; Obici, Laura; Keohane, Denis; Amass, Leslie

    2016-01-01

    ABSTRACT Transthyretin familial amyloid polyneuropathy (TTR‐FAP) is a rare, severe, and irreversible, adult‐onset, hereditary disorder caused by autosomal‐dominant mutations in the TTR gene that increase the intrinsic propensity of transthyretin protein to misfold and deposit systemically as insoluble amyloid fibrils in nerve tissues, the heart, and other organs. TTR‐FAP is characterized by relentless, progressively debilitating polyneuropathy, and leads to death, on average, within 10 years of symptom onset without treatment. With increased availability of disease‐modifying treatment options for a wider spectrum of patients with TTR‐FAP, timely detection of the disease may offer substantial clinical benefits. This review discusses mutation‐specific predictive genetic testing in first‐degree relatives of index patients diagnosed with TTR‐FAP and the structured clinical follow‐up of asymptomatic gene carriers for prompt diagnosis and early therapeutic intervention before accumulation of substantial damage. Muscle Nerve 54: 353–360, 2016 PMID:27273296

  17. Management of asymptomatic gene carriers of transthyretin familial amyloid polyneuropathy.

    PubMed

    Schmidt, Hartmut H-J; Barroso, Fabio; González-Duarte, Alejandra; Conceição, Isabel; Obici, Laura; Keohane, Denis; Amass, Leslie

    2016-09-01

    Transthyretin familial amyloid polyneuropathy (TTR-FAP) is a rare, severe, and irreversible, adult-onset, hereditary disorder caused by autosomal-dominant mutations in the TTR gene that increase the intrinsic propensity of transthyretin protein to misfold and deposit systemically as insoluble amyloid fibrils in nerve tissues, the heart, and other organs. TTR-FAP is characterized by relentless, progressively debilitating polyneuropathy, and leads to death, on average, within 10 years of symptom onset without treatment. With increased availability of disease-modifying treatment options for a wider spectrum of patients with TTR-FAP, timely detection of the disease may offer substantial clinical benefits. This review discusses mutation-specific predictive genetic testing in first-degree relatives of index patients diagnosed with TTR-FAP and the structured clinical follow-up of asymptomatic gene carriers for prompt diagnosis and early therapeutic intervention before accumulation of substantial damage. Muscle Nerve 54: 353-360, 2016.

  18. Identification and analysis of the metacaspase gene family in tomato.

    PubMed

    Liu, Hui; Liu, Jian; Wei, Yongxuan

    2016-10-21

    Metacaspases play critical roles in developmentally regulated and environmentally induced programmed cell death in plants. In this study, we systematically identified and analyzed metacaspase gene family in tomato (Solanum lycopersicum). The results illustrated that tomato possesses eight metacaspase genes (SlMC1-8) located on chromosomes 1, 3, 5, 9, and 10. SlMC1-6 belonged to type I metacaspases and had 5 exon/4 intron structures. SlMC7 and 8 were type II metacaspases and had 2 and 3 exons, respectively. Expression analysis revealed distinct expression patterns of SlMCs in various tomato tissues. Cis-regulatory element prediction showed that there were many hormone- and stress-related cis-regulatory elements in SlMCs promoter regions. Quantitative real-time PCR analysis further demonstrated that most of the SlMCs were regulated by drought, cold, salt, methyl viologen, and ethephon treatments. This study provides insights into the characteristics of SlMC genes and laid the foundation for further functional analysis of these genes in tomato.

  19. Babesia bovis expresses Bbo-6cys-E, a member of a novel gene family that is homologous to the 6-cys family of Plasmodium

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A novel Babesia bovis gene family encoding proteins with similarities to the Plasmodium 6cys protein family was identified by TBLASTN searches of the Babesia bovis genome using the sequence of the P. falciparum PFS230 protein as query, and was termed Bbo-6cys gene family. The Bbo-cys6 gene family co...

  20. Identification, Phylogeny, and Transcript of Chitinase Family Genes in Sugarcane

    PubMed Central

    Su, Yachun; Xu, Liping; Wang, Shanshan; Wang, Zhuqing; Yang, Yuting; Chen, Yun; Que, Youxiong

    2015-01-01

    Chitinases are pathogensis-related proteins, which play an important role in plant defense mechanisms. The role of the sugarcane chitinase family genes remains unclear due to the highly heterozygous and aneuploidy chromosome genetic background of sugarcane. Ten differentially expressed chitinase genes (belonging to class I~VII) were obtained from RNA-seq analysis of both incompatible and compatible sugarcane genotypes during Sporisorium scitamineum challenge. Their structural properties and expression patterns were analyzed. Seven chitinases (ScChiI1, ScChiI2, ScChiI3, ScChiIII1, ScChiIII2, ScChiIV1 and ScChiVI1) showed more positive with early response and maintained increased transcripts in the incompatible interaction than those in the compatible one. Three (ScChiII1, ScChiV1 and ScChiVII1) seemed to have no significant difference in expression patterns between incompatible and compatible interactions. The ten chitinases were expressed differentially in response to hormone treatment as well as having distinct tissue specificity. ScChiI1, ScChiIV1 and ScChiVII1 were induced by various abiotic stresses (NaCl, CuCl2, PEG and 4 °C) and their involvement in plant immunity was demonstrated by over-expression in Nicotiana benthamiana. The results suggest that sugarcane chitinase family exhibit differential responses to biotic and abiotic stress, providing new insights into their function. PMID:26035173

  1. Genomics and evolution of the TRIM gene family.

    PubMed

    Meroni, Germana

    2012-01-01

    The TRIM family comprises proteins characterized by the presence of thetripartite motifthat is composed of a RING domain, one or two B-box domains and a Coiled-coil region. These proteins are implicated in a plethora of cellular processes such as apoptosis, cell cycle regulation, muscular physiology and innate immune response. Consistently, their alteration results in several pathological conditions emphasizing their medical relevance. The TRIM members domain structure underscores a common biochemical function as E3 ligases within the ubiquitylation cascade, which is then translated into diverse biological processes. The TRIM proteins represent one of the largest families in mammals counting in human almost 70 members. TRIM proteins are metazoan-specific and have been now identified in several species although the great increase in their number was generated in vertebrate species. The important expansion of the number of TRIM genes underlie the success of the tripartite module in ubiquitylation process. Furthermore, their massive diversification among species was achieved through fast evolution of the TRIM genes implicated in pathogen response.

  2. Repeated evolution of chimeric fusion genes in the β-globin gene family of laurasiatherian mammals.

    PubMed

    Gaudry, Michael J; Storz, Jay F; Butts, Gary Tyler; Campbell, Kevin L; Hoffmann, Federico G

    2014-05-09

    The evolutionary fate of chimeric fusion genes may be strongly influenced by their recombinational mode of origin and the nature of functional divergence between the parental genes. In the β-globin gene family of placental mammals, the two postnatally expressed δ- and β-globin genes (HBD and HBB, respectively) have a propensity for recombinational exchange via gene conversion and unequal crossing-over. In the latter case, there are good reasons to expect differences in retention rates for the reciprocal HBB/HBD and HBD/HBB fusion genes due to thalassemia pathologies associated with the HBD/HBB "Lepore" deletion mutant in humans. Here, we report a comparative genomic analysis of the mammalian β-globin gene cluster, which revealed that chimeric HBB/HBD fusion genes originated independently in four separate lineages of laurasiatherian mammals: Eulipotyphlans (shrews, moles, and hedgehogs), carnivores, microchiropteran bats, and cetaceans. In cases where an independently derived "anti-Lepore" duplication mutant has become fixed, the parental HBD and/or HBB genes have typically been inactivated or deleted, so that the newly created HBB/HBD fusion gene is primarily responsible for synthesizing the β-type subunits of adult and fetal hemoglobin (Hb). Contrary to conventional wisdom that the HBD gene is a vestigial relict that is typically inactivated or expressed at negligible levels, we show that HBD-like genes often encode a substantial fraction (20-100%) of β-chain Hbs in laurasiatherian taxa. Our results indicate that the ascendancy or resuscitation of genes with HBD-like coding sequence requires the secondary acquisition of HBB-like promoter sequence via unequal crossing-over or interparalog gene conversion.

  3. The roles of gene duplication, gene conversion and positive selection in rodent Esp and Mup pheromone gene families with comparison to the Abp family.

    PubMed

    Karn, Robert C; Laukaitis, Christina M

    2012-01-01

    Three proteinaceous pheromone families, the androgen-binding proteins (ABPs), the exocrine-gland secreting peptides (ESPs) and the major urinary proteins (MUPs) are encoded by large gene families in the genomes of Mus musculus and Rattus norvegicus. We studied the evolutionary histories of the Mup and Esp genes and compared them with what is known about the Abp genes. Apparently gene conversion has played little if any role in the expansion of the mouse Class A and Class B Mup genes and pseudogenes, and the rat Mups. By contrast, we found evidence of extensive gene conversion in many Esp genes although not in all of them. Our studies of selection identified at least two amino acid sites in β-sheets as having evolved under positive selection in the mouse Class A and Class B MUPs and in rat MUPs. We show that selection may have acted on the ESPs by determining K(a)/K(s) for Exon 3 sequences with and without the converted sequence segment. While it appears that purifying selection acted on the ESP signal peptides, the secreted portions of the ESPs probably have undergone much more rapid evolution. When the inner gene converted fragment sequences were removed, eleven Esp paralogs were present in two or more pairs with K(a)/K(s) >1.0 and thus we propose that positive selection is detectable by this means in at least some mouse Esp paralogs. We compare and contrast the evolutionary histories of all three mouse pheromone gene families in light of their proposed functions in mouse communication.

  4. ADH1B and CDH1 polymorphisms predict prognosis in male patients with non-metastatic laryngeal cancer

    PubMed Central

    Jin, Tianbo; He, Na; Ren, Le; Zhang, Zhe; Zhang, Qingna; Xu, Ran; Tao, Hong; Zeng, Guang; Gao, Jing

    2016-01-01

    In this study, we assessed the association between single nucleotide polymorphisms (SNPs) in candidate genes and the prognosis of laryngeal cancer (LC) patients. Thirty-seven SNPs in 26 genes were genotyped in 170 male Han Chinese patients with LC. The effects of the candidate genes on the prognosis of LC patients were evaluated using Kaplan-Meier curves and Cox proportional hazards regression models. The GA genotype of rs1229984 (hazard ratio [HR], 0.537; 95% confidence interval [CI], 0.340–0.848; p = 0.008) in alcohol dehydrogenase 1B (ADH1B), and the AA genotype of rs9929218 (HR, 6.074; 95% CI, 1.426–25.870; p = 0.015) in CDH1 were associated with overall survival. Our data suggest that polymorphisms in ADH1B and CDH1 may be prognostic indicators in LC. PMID:27689323

  5. Recent Developments in Gene Therapy for Homozygous Familial Hypercholesterolemia.

    PubMed

    Ajufo, Ezim; Cuchel, Marina

    2016-05-01

    Homozygous familial hypercholesterolemia (HoFH) is a life-threatening Mendelian disorder with a mean life expectancy of 33 years despite maximally tolerated standard lipid-lowering therapies. This disease is an ideal candidate for gene therapy, and in the last few years, a number of exciting developments have brought this approach closer to the clinic than ever before. In this review, we discuss in detail the most advanced of these developments, a recombinant adeno-associated virus (AAV) vector carrying a low-density lipoprotein receptor (LDLR) transgene which has recently entered phase 1/2a testing. We also review ongoing development of approaches to enhance transgene expression, improve the efficiency of hepatocyte transduction, and minimize the AAV capsid-specific adaptive immune response. We include a summary of key gene therapy approaches for HoFH in pre-clinical development, including RNA silencing of the gene encoding HMG-CoA reductase (HMGCR) and induced pluripotent stem cell transplant therapy.

  6. Co-expression of TAL1 and ADH1 in recombinant xylose-fermenting Saccharomyces cerevisiae improves ethanol production from lignocellulosic hydrolysates in the presence of furfural.

    PubMed

    Hasunuma, Tomohisa; Ismail, Ku Syahidah Ku; Nambu, Yumiko; Kondo, Akihiko

    2014-02-01

    Lignocellulosic biomass dedicated to bioethanol production usually contains pentoses and inhibitory compounds such as furfural that are not well tolerated by Saccharomyces cerevisiae. Thus, S. cerevisiae strains with the capability of utilizing both glucose and xylose in the presence of inhibitors such as furfural are very important in industrial ethanol production. Under the synergistic conditions of transaldolase (TAL) and alcohol dehydrogenase (ADH) overexpression, S. cerevisiae MT8-1X/TAL-ADH was able to produce 1.3-fold and 2.3-fold more ethanol in the presence of 70 mM furfural than a TAL-expressing strain and a control strain, respectively. We also tested the strains' ability by mimicking industrial ethanol production from hemicellulosic hydrolysate containing fermentation inhibitors, and ethanol production was further improved by 16% when using MT8-1X/TAL-ADH compared to the control strain. Transcript analysis further revealed that besides the pentose phosphate pathway genes TKL1 and TAL1, ADH7 was also upregulated in response to furfural stress, which resulted in higher ethanol production compared to the TAL-expressing strain. The improved capability of our modified strain was based on its capacity to more quickly reduce furfural in situ resulting in higher ethanol production. The co-expression of TAL/ADH genes is one crucial strategy to fully utilize undetoxified lignocellulosic hydrolysate, leading to cost-competitive ethanol production.

  7. Gene expression patterns of invertase gene families and modulation of the inhibitor gene in tomato sucrose metabolism.

    PubMed

    Zhang, Y L; Zhang, A H; Jiang, J

    2013-01-24

    Patterns of gene expression in the different types of sucrose metabolism in the tomato are highly variable and heritable. This genetic variation causes considerable functional differences. We examined the patterns of expression of invertase (Inv) gene families and an invertase inhibitor (INH) gene involved in elongating roots, hypocotyls, and fruit of the tomato (Lycopersicon esculentum cv. Micro-Tom and L. chmielewskii) through a real-time quantitative PCR analysis. We found that the Lin6 gene plays an important role in the vegetative growth stage. Lin5 and Lin7 did not express in Micro-Tom, but did express in L. chmielewskii. Overall relative expression levels of sucrose Inv gene families were significantly lower in L. chmielewskii during the reproductive growth stage than in Micro-Tom, being up to hundreds of times lower. It was not expressed in the dissepiment in L. chmielewskii. We suggest that differences in sucrose accumulation in tomato fruit is mainly due to differentially expressed invertase gene families at the later fruit growth stages.

  8. Enhanced H2 gas production from bagasse using adhE inactivated Klebsiella oxytoca HP1 by sequential dark-photo fermentations.

    PubMed

    Wu, Xiaobing; Li, Qianyi; Dieudonne, Mutangana; Cong, Yibo; Zhou, Juan; Long, Minnan

    2010-12-01

    Sequential dark-photo fermentations (SDPF) was used for hydrogen production from bagasse, an acetaldehyde dehydrogenase (adhE) gene inactivated Klebsiella oxytoca HP1 (DeltaadhE HP1) mutant was used to reduce the alcohol content in dark fermentation (DF) broths and to further enhance the hydrogen yield during the photo fermentation (PF) stage. Compared with that of the wild strain, the ethanol concentration in DF broths of DeltaadhE HP1 decreased 69.4%, which resulted in a hydrogen yield in the PF stage and the total hydrogen yield over the two steps increased by 54.7% and 23.5%, respectively. The culture conditions for hydrogen production from acid pretreated bagasse by SDPF were optimized as culture temperature 37.5 degrees C, initial pH 7.0, and cellulase loading 20 FPA/g in the DF stage, with initial pH 6.5, temperature 30 degrees C and photo intensity 5,000 lux in the PF stage. Under optimum conditions, by using DeltaadhE HP1 and wild type strain, the H(2) yields were 107.8+/-5.3 mL H(2)/g-bagasse, 96.2+/-4.4 mL H(2)/g-bagasse in DF and 54.3+/-2.2 mL H(2)/g-bagasse, 35.1+/-2.0 mL H(2)/g-bagasse in PF, respectively. The special hydrogen production rate (SHPR) were 5.51+/-0.34 mL H(2)/g-bagasseh, 4.95+/-0.22 mL H(2)/g-bagasseh in DF and 0.93+/-0.12 mL H(2)/g-bagasseh, 0.59+/-0.07 mL H(2)/g-bagasseh in PF, respectively. The total hydrogen yield from bagasse over two steps was 162.1+/-7.5 mL H(2)/g-bagasse by using DeltaadhE HP1, which was 50.4% higher than that from dark fermentation only. These results indicate that reducing ethanol content during dark fermentation by using an adhE inactivated strain can significantly enhance hydrogen production from bagasse in the SDPF system. This work also proved that SDPF was an effective way to improve hydrogen production from bagasse.

  9. Crystal structure of the vertebrate NADP(H)-dependent alcohol dehydrogenase (ADH8).

    PubMed

    Rosell, Albert; Valencia, Eva; Parés, Xavier; Fita, Ignacio; Farrés, Jaume; Ochoa, Wendy F

    2003-06-27

    The amphibian enzyme ADH8, previously named class IV-like, is the only known vertebrate alcohol dehydrogenase (ADH) with specificity towards NADP(H). The three-dimensional structures of ADH8 and of the binary complex ADH8-NADP(+) have been now determined and refined to resolutions of 2.2A and 1.8A, respectively. The coenzyme and substrate specificity of ADH8, that has 50-65% sequence identity with vertebrate NAD(H)-dependent ADHs, suggest a role in aldehyde reduction probably as a retinal reductase. The large volume of the substrate-binding pocket can explain both the high catalytic efficiency of ADH8 with retinoids and the high K(m) value for ethanol. Preference of NADP(H) appears to be achieved by the presence in ADH8 of the triad Gly223-Thr224-His225 and the recruitment of conserved Lys228, which define a binding pocket for the terminal phosphate group of the cofactor. NADP(H) binds to ADH8 in an extended conformation that superimposes well with the NAD(H) molecules found in NAD(H)-dependent ADH complexes. No additional reshaping of the dinucleotide-binding site is observed which explains why NAD(H) can also be used as a cofactor by ADH8. The structural features support the classification of ADH8 as an independent ADH class.

  10. Differential loss of ancestral gene families as a source of genomic divergence in animals.

    PubMed Central

    Hughes, Austin L; Friedman, Robert

    2004-01-01

    A phylogenetic approach was used to reconstruct the pattern of an apparent loss of 2106 ancestral gene families in four animal genomes (Caenorhabditis elegans, Drosophila melanogaster, human and fugu). Substantially higher rates of loss of ancestral gene families were found in the invertebrates than in the vertebrates. These results indicate that the differential loss of ancestral gene families can be a significant factor in the evolutionary diversification of organisms. PMID:15101434

  11. Dissimilar evolutionary histories of two resistance gene families in the genus Solanum.

    PubMed

    Segura, Diana María; Masuelli, Ricardo Williams; Sanchez-Puerta, M Virginia

    2017-01-01

    Genomic analyses have shown that most genes in eukaryotic lineages belong to families. Gene families vary in terms of number of members, nucleotide similarity, gene integrity, expression, and function. Often, the members of gene families are arranged in clusters, which contribute to maintaining similarity among gene copies and also to generate duplicates through replication errors. Gene families offer us an opportunity to examine the forces involved in the evolution of the genomes and to study recombination events and genomic rearrangements. In this work, we focused on the evolution of two plant resistance gene families, Sw5 and Mi-1, and analyzed the completely sequenced nuclear genomes of potato and tomato. We first noticed that the potato genome carries larger resistance gene families than tomato, but all gene copies are pseudogenes. Second, phylogenetic analyses indicated that Sw5 and Mi-1 gene families had dissimilar evolutionary histories. In contrast to Sw5, Mi-1 homologues suffered repeated gene conversion events among the gene copies, particularly in the tomato genome.

  12. Coexpression of Lactobacillus brevis ADH with GDH or G6PDH in Arxula adeninivorans for the synthesis of 1-(R)-phenylethanol.

    PubMed

    Rauter, Marion; Prokoph, Alexandra; Kasprzak, Jakub; Becker, Karin; Baronian, Keith; Bode, Rüdiger; Kunze, Gotthard; Vorbrodt, H- Matthias

    2015-06-01

    The yeast Arxula adeninivorans was used for the overexpression of an ADH gene of Lactobacillus brevis coding for (R)-specific alcohol dehydrogenase (LbADH) to synthesise enantiomerically pure 1-(R)-phenylethanol. Glucose dehydrogenase gene from Bacillus megaterium (BmGDH) or glucose 6-phosphate dehydrogenase of Bacillus pumilus (BpG6PDH) were coexpressed in Arxula to regenerate the cofactor NADPH by oxidising glucose or glucose 6-phosphate. The yeast strain expressing LbADH and BpG6PDH produced 5200 U l(-1) ADH and 370 U l(-1) G6PDH activity, whereas the strain expressing LbADH and BmGDH produced 2700 U l(-1) ADH and 170 U l(-1) GDH activity. However, the crude extract of both strains reduced 40 mM acetophenone to pure 1-(R)-phenylethanol with an enantiomeric excess (ee) of >99 % in 60 min without detectable by-products. An increase in yield was achieved using immobilised crude extracts (IEs), Triton X-100 permeabilised cells (PCs) and permeabilised immobilised cells (PICs) with PICs being most stable with GDH regeneration over 52 cycles. Even though the activity and synthesis rate of 1-(R)-phenylethanol with the BpG6PDH and LbADH coexpressing strain was higher, the BmGDH-LbADH strain was more stable over successive reaction cycles. This, combined with its higher total turnover number (TTN) of 391 mol product per mole NADP(+), makes it the preferred strain for continuous reaction systems. The initial non-optimised semi-continuous reaction produced 9.74 g l(-1) day(-1) or 406 g kg(-1) dry cell weight (dcw) day(-1) isolated 1-(R)-phenylethanol with an ee of 100 % and a TTN of 206 mol product per mole NADP(+). In conclusion, A. adeninivorans is a promising host for LbADH and BpG6PDH or BmGDH production and offers a simple method for the production of enantiomerically pure alcohols.

  13. Gene recruitment--a common mechanism in the evolution of transfer RNA gene families.

    PubMed

    Wang, Xiujuan; Lavrov, Dennis V

    2011-04-01

    The evolution of alloacceptor transfer RNAs (tRNAs) has been traditionally thought to occur vertically and reflect the evolution of the genetic code. Yet there have been several indications that a tRNA gene could evolve horizontally, from a copy of an alloacceptor tRNA gene in the same genome. Earlier, we provided the first unambiguous evidence for the occurrence of such "tRNA gene recruitment" in nature--in the mitochondrial (mt) genome of the demosponge Axinella corrugata. Yet the extent and the pattern of this process in the evolution of tRNA gene families remained unclear. Here we analyzed tRNA genes from 21 mt genomes of demosponges as well as nuclear genomes of rhesus macaque, chimpanzee and human. We found four new cases of alloacceptor tRNA gene recruitment in mt genomes and eleven cases in the nuclear genomes. In most of these cases we observed a single nucleotide substitution at the middle position of the anticodon, which resulted in the change of not only the tRNA's amino-acid identity but also the class of the amino-acyl tRNA synthetases (aaRSs) involved in amino-acylation. We hypothesize that the switch to a different class of aaRSs may have prevented the conflict between anticodon and amino-acid identities of recruited tRNAs. Overall our results suggest that gene recruitment is a common phenomenon in tRNA multigene family evolution and should be taken into consideration when tRNA evolutionary history is reconstructed.

  14. The Family of Crumbs Genes and Human Disease

    PubMed Central

    Slavotinek, Anne M.

    2016-01-01

    The family of vertebrate Crumbs proteins, homologous to Drosophila Crumbs (Crb), share large extracellular domains with epidermal growth factor-like repeats and laminin-globular domains, a single transmembrane domain, and a short intracellular C-terminus containing a single membrane proximal 4.1/ezrin/radixin/moesin-binding domain and PSD-95/Discs large/ZO-1-binding motifs. There are 3 Crb genes in humans - Crumbs homolog-1 (CRB1), Crumbs homolog-2 (CRB2), and Crumbs homolog-3 (CRB3). Bilallelic loss-of-function mutations in CRB1 cause visual impairment, with Leber's congenital amaurosis and retinitis pigmentosa, whereas CRB2 mutations are associated with raised maternal serum and amniotic fluid alpha feto-protein levels, ventriculomegaly/hydrocephalus, and renal disease, ranging from focal segmental glomerulosclerosis to congenital Finnish nephrosis. CRB3 has not yet been associated with human disease. In this review, we summarize the phenotypic findings associated with deleterious sequence variants in CRB1 and CRB2. We discuss the mutational spectrum, animal models of loss of function for both genes and speculate on the likely mechanisms of disease. PMID:27867342

  15. Gene family encoding the major toxins of lethal Amanita mushrooms.

    PubMed

    Hallen, Heather E; Luo, Hong; Scott-Craig, John S; Walton, Jonathan D

    2007-11-27

    Amatoxins, the lethal constituents of poisonous mushrooms in the genus Amanita, are bicyclic octapeptides. Two genes in A. bisporigera, AMA1 and PHA1, directly encode alpha-amanitin, an amatoxin, and the related bicyclic heptapeptide phallacidin, a phallotoxin, indicating that these compounds are synthesized on ribosomes and not by nonribosomal peptide synthetases. alpha-Amanitin and phallacidin are synthesized as proproteins of 35 and 34 amino acids, respectively, from which they are predicted to be cleaved by a prolyl oligopeptidase. AMA1 and PHA1 are present in other toxic species of Amanita section Phalloidae but are absent from nontoxic species in other sections. The genomes of A. bisporigera and A. phalloides contain multiple sequences related to AMA1 and PHA1. The predicted protein products of this family of genes are characterized by a hypervariable "toxin" region capable of encoding a wide variety of peptides of 7-10 amino acids flanked by conserved sequences. Our results suggest that these fungi have a broad capacity to synthesize cyclic peptides on ribosomes.

  16. Cloning and characterisation of JAZ gene family in Hevea brasiliensis.

    PubMed

    Hong, H; Xiao, H; Yuan, H; Zhai, J; Huang, X

    2015-05-01

    Mechanical wounding or treatment with exogenous jasmonates (JA) induces differentiation of the laticifer in Hevea brasiliensis. JA is a key signal for latex biosynthesis and wounding response in the rubber tree. Identification of JAZ (jasmonate ZIM-domain) family of proteins that repress JA responses has facilitated rapid progress in understanding how this lipid-derived hormone controls gene expression and related physiological processes in plants. In this work, the full-length cDNAs of six JAZ genes were cloned from H. brasiliensis (termed HbJAZ). These HbJAZ have different lengths and sequence diversity, but all of them contain Jas and ZIM domains, and two of them contain an ERF-associated amphiphilic repression (EAR) motif in the N-terminal. Real-time RT-PCR analyses revealed that HbJAZ have different expression patterns and tissue specificity. Four HbJAZ were up-regulated, one was down-regulated, while two were less effected by rubber tapping treatment, suggesting that they might play distinct roles in the wounding response. A yeast two-hybrid assay revealed that HbJAZ proteins interact with each other to form homologous or heterogeneous dimer complexes, indicating that the HbJAZ proteins may expand their function through diverse JAZ-JAZ interactions. This work lays a foundation for identification of the JA signalling pathway and molecular mechanisms of latex biosynthesis in rubber trees.

  17. A Comprehensive Family-Based Replication Study of Schizophrenia Genes

    PubMed Central

    Aberg, Karolina A.; Liu, Youfang; Bukszár, Jozsef; McClay, Joseph L.; Khachane, Amit N.; Andreassen, Ole A.; Blackwood, Douglas; Corvin, Aiden; Djurovic, Srdjan; Gurling, Hugh; Ophoff, Roel; Pato, Carlos N.; Pato, Michele T.; Riley, Brien; Webb, Todd; Kendler, Kenneth; O’Donovan, Mick; Craddock, Nick; Kirov, George; Owen, Mike; Rujescu, Dan; St Clair, David; Werge, Thomas; Hultman, Christina M.; Delisi, Lynn E.; Sullivan, Patrick; van den Oord, Edwin J.

    2017-01-01

    Importance Schizophrenia (SCZ) is a devastating psychiatric condition. Identifying the specific genetic variants and pathways that increase susceptibility to SCZ is critical to improve disease understanding and address the urgent need for new drug targets. Objective To identify SCZ susceptibility genes. Design We integrated results from a meta-analysis of 18 genome-wide association studies (GWAS) involving 1 085 772 single-nucleotide polymorphisms (SNPs) and 6 databases that showed significant informativeness for SCZ. The 9380 most promising SNPs were then specifically genotyped in an independent family-based replication study that, after quality control, consisted of 8107 SNPs. Setting Linkage meta-analysis, brain transcriptome meta-analysis, candidate gene database, OMIM, relevant mouse studies, and expression quantitative trait locus databases. Patients We included 11 185 cases and 10 768 control subjects from 6 databases and, after quality control 6298 individuals (including 3286 cases) from 1811 nuclear families. Main Outcomes and Measures Case-control status for SCZ. Results Replication results showed a highly significant enrichment of SNPs with small P values. Of the SNPs with replication values of P<.01, the proportion of SNPs that had the same direction of effects as in the GWAS meta-analysis was 89% in the combined ancestry group (sign test, P<2.20×10−16) and 93% in subjects of European ancestry only (P<2.20×10−16). Our results supported the major histocompatibility complex region showing a 3.7-fold overall enrichment of replication values of P<.01 in subjects from European ancestry. We replicated SNPs in TCF4 (P=2.53×10−10) and NOTCH4 (P=3.16×10−7) that are among the most robust SCZ findings. More novel findings included POM121L2 (P=3.51×10−7), AS3MT (P=9.01×10−7), CNNM2 (P=6.07×10−7), and NT5C2 (P=4.09×10−7). To explore the many small effects, we performed pathway analyses. The most significant pathways involved neuronal function

  18. Evolution of the multifaceted eukaryotic akirin gene family

    PubMed Central

    Macqueen, Daniel J; Johnston, Ian A

    2009-01-01

    Background Akirins are nuclear proteins that form part of an innate immune response pathway conserved in Drosophila and mice. This studies aim was to characterise the evolution of akirin gene structure and protein function in the eukaryotes. Results akirin genes are present throughout the metazoa and arose before the separation of animal, plant and fungi lineages. Using comprehensive phylogenetic analysis, coupled with comparisons of conserved synteny and genomic organisation, we show that the intron-exon structure of metazoan akirin genes was established prior to the bilateria and that a single proto-orthologue duplicated in the vertebrates, before the gnathostome-agnathan separation, producing akirin1 and akirin2. Phylogenetic analyses of seven vertebrate gene families with members in chromosomal proximity to both akirin1 and akirin2 were compatible with a common duplication event affecting the genomic neighbourhood of the akirin proto-orthologue. A further duplication of akirins occurred in the teleost lineage and was followed by lineage-specific patterns of paralogue loss. Remarkably, akirins have been independently characterised by five research groups under different aliases and a comparison of the available literature revealed diverse functions, generally in regulating gene expression. For example, akirin was characterised in arthropods as subolesin, an important growth factor and in Drosophila as bhringi, which has an essential myogenic role. In vertebrates, akirin1 was named mighty in mice and was shown to regulate myogenesis, whereas akirin2 was characterised as FBI1 in rats and promoted carcinogenesis, acting as a transcriptional repressor when bound to a 14-3-3 protein. Both vertebrate Akirins have evolved under comparably strict constraints of purifying selection, although a likelihood ratio test predicted that functional divergence has occurred between paralogues. Bayesian and maximum likelihood tests identified amino-acid positions where the rate of

  19. Characterization of the multicopper oxidase gene family in Anopheles gambiae

    PubMed Central

    Gorman, Maureen J.; Dittmer, Neal T.; Marshall, Jeremy L.; Kanost, Michael R.

    2008-01-01

    The multicopper oxidase (MCO) family of enzymes includes laccases, which oxidize a broad range of substrates including diphenols, and several oxidases with specific substrates such as iron, copper or ascorbic acid. We have identified five putative MCO genes in the genome of Anopheles gambiae and have cloned cDNAs encompassing the full coding region for each gene. MCO1 mRNA was detected in all developmental stages and in all of the larval and adult tissues tested. We observed an increase in MCO1 transcript abundance in the midguts and Malphighian tubules of adult females following a blood meal and in adult abdominal carcasses in response to an immune challenge. Two alternatively spliced isoforms of MCO2 mRNA were identified. The A isoform of MCO2 was previously detected in larval and pupal cuticle where it probably catalyzes sclerotization reactions (He et al., 2007). The B isoform was transcriptionally upregulated in ovaries in response to a blood meal. MCO3 mRNA was detected in the adult midgut, Malpighian tubules, and male reproductive tissues; like MCO1, it was upregulated in response to an immune challenge or a blood meal. MCO4 and MCO5 were observed primarily in eggs and in the abdominal carcass of larvae. A phylogenetic analysis of insect MCO genes identified putative orthologs of MCO1 and MCO2 in all of the insect genomes tested, whereas MCO3, MCO4 and MCO5 were found only in the two mosquito species analyzed. MCO2 orthologs have especially high sequence similarity, suggesting that they are under strong purifying selection; the A isoforms are more conserved than the B isoforms. The mosquito specific group shares a common ancestor with MCO2. This initial study of mosquito MCOs suggests that MCO2 may be required for egg development or eggshell tanning in addition to cuticle tanning, while MCO1 and MCO3 may be involved in metal metabolism or immunity. PMID:18675911

  20. MicroSyn: a user friendly tool for detection of microsynteny in a gene family

    SciTech Connect

    Cai, Bin; Yang, Xiaohan; Tuskan, Gerald A; Cheng, Zong-Ming

    2011-01-01

    Background: The traditional phylogeny analysis within gene family is mainly based on DNA or amino acid sequence homologies. However, these phylogenetic tree analyses are not suitable for those non-traditional gene families like microRNA with very short sequences. For the normal protein-coding gene families, low bootstrap values are frequently encountered in some nodes, suggesting low confidence or likely inappropriateness of placement of those members in those nodes. Results: We introduce MicroSyn software as a means of detecting microsynteny in adjacent genomic regions surrounding genes in gene families. MicroSyn searches for conserved, flanking colinear homologous gene pairs between two genomic fragments to determine the relationship between two members in a gene family. The colinearity of homologous pairs is controlled by a statistical distance function. As a result, gene duplication history can be inferred from the output independent of gene sequences. MicroSyn was designed for both experienced and non-expert users with a user-friendly graphical-user interface. MicroSyn is available from: http://fcsb.njau.edu. cn/microsyn/. Conclusions: Case studies of the microRNA167 genes in plants and Xyloglucan ndotransglycosylase/Hydrolase family in Populus trichocarpa were presented to show the utility of the software. The easy using of MicroSyn in these examples suggests that the software is an additional valuable means to address the problem intrinsic in the computational methods and sequence qualities themselves in gene family analysis.

  1. Recombinant industrial brewing yeast strains with ADH2 interruption using self-cloning GSH1+CUP1 cassette.

    PubMed

    Wang, Zhao-Yue; Wang, Jin-Jing; Liu, Xi-Feng; He, Xiu-Ping; Zhang, Bo-Run

    2009-06-01

    A self-cloning module for gene knock-out and knock-in in industrial brewing yeast strain was constructed that contains copper resistance and gamma-glutamylcysteine synthetase gene cassette, flanked by alcohol dehydrogenase II gene (ADH2) of Saccharomyces cerevisiae. The module was used to obtain recombined strains RY1 and RY2 by targeting the ADH2 locus of host Y1. RY1 and RY2 were genetically stable. PCR and enzyme activity analysis of RY1 and RY2 cells showed that one copy of ADH2 was deleted by GSH1+CUP1 insertion, and an additional copy of wild type was still present. The fermentation ability of the recombinants was not changed after genetic modification, and a high level of glutathione (GSH) was secreted, resulting from GSH1 overexpression, which codes for gamma-glutamylcysteine synthetase. A pilot-scale brewing test for RY1 and RY2 indicated that acetaldehyde content in fermenting liquor decreased by 21-22%, GSH content increased by 20-22% compared with the host, the antioxidizability of the recombinants was improved, and the sensorial evaluation was also better than that of the host. No heterologous DNA was harbored in the recombinants; therefore, they could be applied in the beer industry in terms of their biosafety.

  2. Genome-wide identification and expression profiling of ankyrin-repeat gene family in maize.

    PubMed

    Jiang, Haiyang; Wu, Qingqing; Jin, Jing; Sheng, Lei; Yan, Hanwei; Cheng, Beijiu; Zhu, Suwen

    2013-09-01

    Members of the ankyrin repeats (ANK) gene family encode ANK domain that are common in diverse organisms and play important roles in cell growth and development, such as cell-cell signal transduction and cell cycle regulation. Recently, genome-wide identification and evolutionary analyses of the ANK gene family have been carried out in Arabidopsis and rice. However, little is known regarding the ANK genes in the entire maize genome. In this study, we described the identification and structural characterization of 71 ANK genes in maize (ZmANK). Then, comprehensive bioinformatics analyses of ZmANK genes family were performed including phylogenetic, domain and motif analysis, chromosomal localization, intron/exon structural patterns, gene duplications and expression profiling. Domain composition analyses showed that ZmANK genes formed ten subfamilies. Five tandem duplications and 14 segmental duplications were identified in ZmANK genes. Furthermore, we took comparative analysis of the total ANK gene family in Arabidopsis, rice and maize, ZmANKs were more closely paired with OsANKs than with AtANKs. At last, expression profile analyses were performed. Forty-one members of ZmANK genes held EST sequences records. Semi-quantitative expression and microarray data analysis of these 41 ZmANK genes demonstrated that ZmANK genes exhibit a various expression pattern, suggesting that functional diversification of ZmANK genes family. The results will present significant insights to explore ANK genes expression and function in future studies in maize.

  3. Regulated Expression of Three Alcohol Dehydrogenase Genes in Barley Aleurone Layers 1

    PubMed Central

    Hanson, Andrew D.; Jacobsen, John V.; Zwar, John A.

    1984-01-01

    Three genes specify alcohol dehydrogenase (EC 1.1.1.1.; ADH) enzymes in barley (Hordeum vulgare L.) (Adh 1, Adh 2, and Adh 3). Their polypeptide products (ADH 1, ADH 2, ADH 3) dimerize to give a total of six ADH isozymes which can be resolved by native gel electrophoresis and stained for enzyme activity. Under fully aerobic conditions, aleurone layers of cv Himalaya had a high titer of a single isozyme, the homodimer containing ADH 1 monomers. This isozyme was accumulated by the aleurone tissue during the later part of seed development, and survived seed drying and rehydration. The five other possible ADH isozymes were induced by O2 deficit. The staining of these five isozymes on electrophoretic gels increased progressively in intensity as O2 levels were reduced below 5%, and were most intense at 0% O2. In vivo35S labeling and specific immunoprecipitation of ADH peptides, followed by isoelectric focusing of the ADH peptides in the presence of 8 molar urea (urea-IEF) demonstrated the following. (a) Aleurone layers incubated in air synthesized ADH 1 and a trace of ADH 2; immature layers from developing seeds behaved similarly. (b) At 5% O2, synthesis of ADH 2 increased and ADH 3 appeared. (c) At 2% and 0% O2, the synthesis of all three ADH peptides increased markedly. Cell-free translation of RNA isolated from aleurone layers, followed by immunoprecipitation and urea-IEF of in vitro synthesized ADH peptides, showed that levels of mRNA for all three ADH peptides rose sharply during 1 day of O2 deprivation. Northern hybridizations with a maize Adh 2 cDNA clone established that the clone hybridized with barley mRNA comparable in size to maize Adh 2 mRNA, and that the level of this barley mRNA increased 15- to 20-fold after 1 day at 5% or 2% O2, and about 100-fold after 1 day at 0% O2. We conclude that in aleurone layers, expression of the three barley Adh genes is maximal in the absence of O2, that regulation of mRNA level is likely to be a major controlling factor, and

  4. Divergence pattern of animal gene families and relationship with the Cambrian explosion.

    PubMed

    Miyata, T; Suga, H

    2001-11-01

    There are many gene families that are specific to multicellular animals. These have either diverged from ancestral genes that are shared with fungi and/or plants or evolved from an ancestral gene unique to animals. The evolution of gene families involved in cell-cell communication and developmental control has been studied to establish whether the number of member genes increased dramatically immediately prior to or in concert with the Cambrian explosion. A molecular phylogeny-based analysis of several animal-specific gene families has revealed that gene diversification by duplication occurred during two active periods interrupted by a long intervening quiescent period. Intriguingly, the Cambrian explosion is situated in the silent period, indicating that there is no direct link between the first burst of gene diversification and the Cambrian explosion itself. The importance of gene recruitment as a possible molecular mechanism for morphological diversity, and its possible role for the Cambrian explosion, are discussed.

  5. Characterization of the p16 gene in the mouse: Evidence for a large gene family

    SciTech Connect

    Fountain, J.W.; Giendening, J.M.; Flores, J.F.

    1994-09-01

    The p16 gene product is an inhibitor of the cyclin-dependent kinase 4 (CDK4)/cyclin D complex. When uninhibited, the CDK4/cyclin D complex participates in the phosphorylation of the retinoblastoma (RB) protein and renders it inactive. Upon inactivation of the RB protein, transition from the G{sub 1} to the S phase of mitosis occurs and results in cellular proliferation. Thus, p16 is presumed to act as a negative regulator of cell growth by preventing the phosphorylation, and thereby subsequent inactivation, of RB by CDK4/cyclin D. Recently, the p16 gene (also known as the multiple tumor suppressor 1 (MTS1) gene) has been mapped to chromosome 9p21 and found to be deleted or mutated in a number of tumor cell lines. These findings support the role of p16 as a growth inhibitor or tumor suppressor gene and suggest that the mutation of this gene may have global implications in carcinogenesis. We have chosen to test the functional significance of p16 mutations in vivo through the generation of a mouse mutant for p16. In preparation for this undertaking, eight apparently independent (as judged by restriction enzyme digestion and differential hybridization) mouse genomic embryonic stem cell clones have been identified using exon 2 from the human p16 gene as a probe. The identification of these multiple nonoverlapping clones was not entirely surprising since the reduced stringency hybridization of a zoo blot with the same probe also revealed 10-15 positive EcoRI fragments in all species tested, including human, monkey, cow, dog, cat, rabbit, hamster, mouse, chicken and D. melanogaster. Taken together, these findings suggest that the p16 gene is a member of a large gene family. The location of these genomic clones, as well as their potential expression in the mouse, is currently under investigation.

  6. Bcl-2-related protein family gene expression during oligodendroglial differentiation.

    PubMed

    Itoh, Takayuki; Itoh, Aki; Pleasure, David

    2003-06-01

    Oligodendroglial lineage cells (OLC) vary in susceptibility to both necrosis and apoptosis depending on their developmental stages, which might be regulated by differential expression of Bcl-2-related genes. As an initial step to test this hypothesis, we examined the expression of 19 Bcl-2-related genes in purified cultures of rat oligodendroglial progenitors, immature and mature oligodendrocytes. All 'multidomain' anti-apoptotic members (Bcl-x, Bcl-2, Mcl-1, Bcl-w and Bcl2l10/Diva/Boo) except Bcl2a1/A1 are expressed in OLC. Semiquantitative and real-time RT-PCR revealed that Bcl-xL and Mcl-1 mRNAs are the dominant anti-apoptotic members and increase four- and twofold, respectively, with maturation. Bcl-2 mRNA is less abundant than Bcl-xL mRNA in progenitors and falls an additional 10-fold during differentiation. Bcl-w mRNA also increases, with significant changes in its splicing pattern, as OLC mature. Transfection studies demonstrated that Bcl-xL overexpression protects against kainate-induced excitotoxicity, whereas Bcl-2 overexpression does not. As for 'multidomain' pro-apoptotic members (Bax, Bad and Bok/Mtd), Bax and Bak are highly expressed throughout differentiation. Among 'BH3 domain-only' members examined (Bim, Biklk, DP5/Hrk, Bad, Bid, Noxa, Puma/Bbc3, Bmf, BNip3 and BNip3L), BNip3 and Bmf mRNAs increase markedly during differentiation. These results provide basic information to guide further studies on the roles for Bcl-2-related family proteins in OLC death.

  7. Molecular characterization of edestin gene family in Cannabis sativa L.

    PubMed

    Docimo, Teresa; Caruso, Immacolata; Ponzoni, Elena; Mattana, Monica; Galasso, Incoronata

    2014-11-01

    Globulins are the predominant class of seed storage proteins in a wide variety of plants. In many plant species globulins are present in several isoforms encoded by gene families. The major seed storage protein of Cannabis sativa L. is the globulin edestin, widely known for its nutritional potential. In this work, we report the isolation of seven cDNAs encoding for edestin from the C. sativa variety Carmagnola. Southern blot hybridization is in agreement with the number of identified edestin genes. All seven sequences showed the characteristic globulin features, but they result to be divergent members/forms of two edestin types. According to their sequence similarity four forms named CsEde1A, CsEde1B, CsEde1C, CsEde1D have been assigned to the edestin type 1 and the three forms CsEde2A, CsEde2B, CsEde2C to the edestin type 2. Analysis of the coding sequences revealed a high percentage of similarity (98-99%) among the different forms belonging to the same type, which decreased significantly to approximately 64% between the forms belonging to different types. Quantitative RT-PCR analysis revealed that both edestin types are expressed in developing hemp seeds and the amount of CsEde1 was 4.44 ± 0.10 higher than CsEde2. Both edestin types exhibited a high percentage of arginine (11-12%), but CsEde2 resulted particularly rich in methionine residues (2.36%) respect to CsEde1 (0.82%). The amino acid composition determined in CsEde1 and CsEde2 types suggests that these seed proteins can be used to improve the nutritional quality of plant food-stuffs.

  8. Gene conversions in the growth hormone gene family of primates: stronger homogenizing effects in the Hominidae lineage.

    PubMed

    Petronella, Nicholas; Drouin, Guy

    2011-09-01

    In humans, the growth hormone/chorionic somatomammotropin gene family is composed of five highly similar genes. We characterized the gene conversions that occurred between the growth hormone genes of 11 primate species. We detected 48 conversions using GENECONV and others were only detected using phylogenetic analyses. Gene conversions were detected in all species analyzed, their average size (±standard deviation) is 197.8±230.4 nucleotides, the size of the conversions is correlated with sequence similarity and converted regions are significantly more GC-rich than non-converted regions. Gene conversions have a stronger homogenizing effect in Hominidae genes than in other primate species. They are also less frequent in conserved gene regions and towards functionally important genes. This suggests that the high degree of sequence similarity observed between the growth hormone genes of primate species is a consequence of frequent gene conversions in gene regions which are under little selective constraints.

  9. [The MDR3 gene mutation: a rare cause of progressive familial intrahepatic cholestasis (PFIC)].

    PubMed

    Maisonnette, F; Abita, T; Barriere, E; Pichon, N; Vincensini, J F; Descottes, B

    2005-10-01

    A 47-year old man complained about persistant pain and cholestasis 12-years after a cholescystectomy. In his family, all his brothers and sisters had cholecystectomy. Genetic explorations revealed a MDR3 gene mutation. All symptoms disappeared with a treatment by ursodesoxycholic acid. MDR3 gene mutation is to be researched in all cases of familial cholestasis.

  10. Diversity and linkage of genes in the self-incompatibility gene family in Arabidopsis lyrata.

    PubMed Central

    Charlesworth, Deborah; Mable, Barbara K; Schierup, Mikkel H; Bartolomé, Carolina; Awadalla, Philip

    2003-01-01

    We report studies of seven members of the S-domain gene family in Arabidopsis lyrata, a member of the Brassicaceae that has a sporophytic self-incompatibility (SI) system. Orthologs for five loci are identifiable in the self-compatible relative A. thaliana. Like the Brassica stigmatic incompatibility protein locus (SRK), some of these genes have kinase domains. We show that several of these genes are unlinked to the putative A. lyrata SRK, Aly13. These genes have much lower nonsynonymous and synonymous polymorphism than Aly13 in the S-domains within natural populations, and differentiation between populations is higher, consistent with balancing selection at the Aly13 locus. One gene (Aly8) is linked to Aly13 and has high diversity. No departures from neutrality were detected for any of the loci. Comparing different loci within A. lyrata, sites corresponding to hypervariable regions in the Brassica S-loci (SLG and SRK) and in comparable regions of Aly13 have greater replacement site divergence than the rest of the S-domain. This suggests that the high polymorphism in these regions of incompatibility loci is due to balancing selection acting on sites within or near these regions, combined with low selective constraints. PMID:12930757

  11. The Phaseolus vulgaris ZIP gene family: identification, characterization, mapping, and gene expression

    PubMed Central

    Astudillo, Carolina; Fernandez, Andrea C.; Blair, Matthew W.; Cichy, Karen A.

    2013-01-01

    Zinc is an essential mineral for humans and plants and is involved in many physiological and biochemical processes. In humans, Zn deficiency has been associated with retarded growth and reduction of immune response. In plants, Zn is an essential component of more than 300 enzymes including RNA polymerase, alkaline phosphatase, alcohol dehydrogenase, Cu/Zn superoxidase dismutase, and carbonic anhydrase. The accumulation of Zn in plants involves many genes and characterization of the role of these genes will be useful in biofortification. Here we report the identification and phlyogenetic and sequence characterization of the 23 members of the ZIP (ZRT, IRT like protein) family of metal transporters and three transcription factors of the bZIP family in Phaseolus vulgaris L. Expression patterns of seven of these genes were characterized in two bean genotypes (G19833 and DOR364) under two Zn treatments. Tissue analyzed included roots and leaves at vegetative and flowering stages, and pods at 20 days after flowering. Four of the genes, PvZIP12, PvZIP13, PvZIP16, and Pv bZIP1, showed differential expression based on tissue, Zn treatment, and/or genotype. PvZIP12 and PvZIP13 were both more highly expressed in G19833 than DOR364. PvZIP12 was most highly expressed in vegetative leaves under the Zn (−) treatment. PvZIP16 was highly expressed in leaf tissue, especially leaf tissue at flowering stage grown in the Zn (−) treatment. Pv bZIP1 was most highly expressed in leaf and pod tissue. The 23 PvZIP genes and three bZIP genes were mapped on the DOR364 × G19833 linkage map. PvZIP12, PvZIP13, and PvZIP18, Pv bZIP2, and Pv bZIP3 were located near QTLs for Zn accumulation in the seed. Based on the expression and mapping results, PvZIP12 is a good candidate gene for increasing seed Zn concentration and increase understanding of the role of ZIP genes in metal uptake, distribution, and accumulation of zinc in P. vulgaris. PMID:23908661

  12. Evolutionary diversification of the vertebrate transferrin multi-gene family.

    PubMed

    Hughes, Austin L; Friedman, Robert

    2014-11-01

    In a phylogenetic analysis of vertebrate transferrins (TFs), six major clades (subfamilies) were identified: (a) S, the mammalian serotransferrins; (b) ICA, the mammalian inhibitor of carbonic anhydrase (ICA) homologs; (c) L, the mammalian lactoferrins; (d) O, the ovotransferrins of birds and reptiles; (e) M, the melanotransferrins of bony fishes, amphibians, reptiles, birds, and mammals; and (f) M-like, a newly identified TF subfamily found in bony fishes, amphibians, reptiles, and birds. A phylogenetic tree based on the joint alignment of N-lobes and C-lobes supported the hypothesis that three separate events of internal duplication occurred in vertebrate TFs: (a) in the common ancestor of the M subfamily, (b) in the common ancestor of the M-like subfamily, and (c) in the common ancestor of other vertebrate TFs. The S, ICA, and L subfamilies were found only in placental mammals, and the phylogenetic analysis supported the hypothesis that these three subfamilies arose by gene duplication after the divergence of placental mammals from marsupials. The M-like subfamily was unusual in several respects, including the presence of a uniquely high proportion of clade-specific conserved residues, including distinctive but conserved residues in the sites homologous to those functioning in carbonate binding of human serotransferrin. The M-like family also showed an unusually high proportion of cationic residues in the positively charged region corresponding to human lactoferrampin, suggesting a distinctive role of this region in the M-like subfamily, perhaps in antimicrobial defense.

  13. Evolutionary Diversification of the Vertebrate Transferrin Multi-gene Family

    PubMed Central

    Hughes, Austin L.; Friedman, Robert

    2014-01-01

    In a phylogenetic analysis of vertebrate transferrins (TFs), six major clades (subfamilies) were identified: (1) S, the mammalian serotransferrins; (2) ICA, the mammalian inhibitor of carbonic anhydrase (ICA) homologs; (3) L, the mammalian lactoferrins; (4) O, the ovotransferrins of birds and reptiles; (4) M, the melanotransferrins of bony fishes, amphibians, reptiles, birds, and mammals; and (5) M-like, a newly identified TF subfamily found in bony fishes, amphibians, reptiles, and birds. A phylogenetic tree based on the joint alignment of N-lobes and C-lobes supported the hypothesis that three separate events of internal duplication occurred in vertebrate TFs: (1) in the common ancestor of the M subfamily; (2) in the common ancestor of the M-like subfamily; and (3) in the common ancestor of other vertebrate TFs. The S, ICA, and L subfamilies were found only in placental mammals, and the phylogenetic analysis supported the hypothesis that these three subfamilies arose by gene duplication after the divergence of placental mammals from marsupials. The M-like subfamily was unusual in several respects, including the presence of a uniquely high proportion of clade-specific conserved residues, including distinctive but conserved residues in the sites homologous to those functioning in carbonate binding of human serotransferrin. The M-like family also showed a unusually high proportion of cationic residues in the positively charged region corresponding to human lactoferrampin, suggesting a distinctive role of this region in the M-like subfamily, perhaps in antimicrobial defense. PMID:25142446

  14. Genome-wide analysis reveals diverged patterns of codon bias, gene expression, and rates of sequence evolution in picea gene families.

    PubMed

    De La Torre, Amanda R; Lin, Yao-Cheng; Van de Peer, Yves; Ingvarsson, Pär K

    2015-03-05

    The recent sequencing of several gymnosperm genomes has greatly facilitated studying the evolution of their genes and gene families. In this study, we examine the evidence for expression-mediated selection in the first two fully sequenced representatives of the gymnosperm plant clade (Picea abies and Picea glauca). We use genome-wide estimates of gene expression (>50,000 expressed genes) to study the relationship between gene expression, codon bias, rates of sequence divergence, protein length, and gene duplication. We found that gene expression is correlated with rates of sequence divergence and codon bias, suggesting that natural selection is acting on Picea protein-coding genes for translational efficiency. Gene expression, rates of sequence divergence, and codon bias are correlated with the size of gene families, with large multicopy gene families having, on average, a lower expression level and breadth, lower codon bias, and higher rates of sequence divergence than single-copy gene families. Tissue-specific patterns of gene expression were more common in large gene families with large gene expression divergence than in single-copy families. Recent family expansions combined with large gene expression variation in paralogs and increased rates of sequence evolution suggest that some Picea gene families are rapidly evolving to cope with biotic and abiotic stress. Our study highlights the importance of gene expression and natural selection in shaping the evolution of protein-coding genes in Picea species, and sets the ground for further studies investigating the evolution of individual gene families in gymnosperms.

  15. Ortho2ExpressMatrix—a web server that interprets cross-species gene expression data by gene family information

    PubMed Central

    2011-01-01

    Background The study of gene families is pivotal for the understanding of gene evolution across different organisms and such phylogenetic background is often used to infer biochemical functions of genes. Modern high-throughput experiments offer the possibility to analyze the entire transcriptome of an organism; however, it is often difficult to deduct functional information from that data. Results To improve functional interpretation of gene expression we introduce Ortho2ExpressMatrix, a novel tool that integrates complex gene family information, computed from sequence similarity, with comparative gene expression profiles of two pre-selected biological objects: gene families are displayed with two-dimensional matrices. Parameters of the tool are object type (two organisms, two individuals, two tissues, etc.), type of computational gene family inference, experimental meta-data, microarray platform, gene annotation level and genome build. Family information in Ortho2ExpressMatrix bases on computationally different protein family approaches such as EnsemblCompara, InParanoid, SYSTERS and Ensembl Family. Currently, respective all-against-all associations are available for five species: human, mouse, worm, fruit fly and yeast. Additionally, microRNA expression can be examined with respect to miRBase or TargetScan families. The visualization, which is typical for Ortho2ExpressMatrix, is performed as matrix view that displays functional traits of genes (differential expression) as well as sequence similarity of protein family members (BLAST e-values) in colour codes. Such translations are intended to facilitate the user's perception of the research object. Conclusions Ortho2ExpressMatrix integrates gene family information with genome-wide expression data in order to enhance functional interpretation of high-throughput analyses on diseases, environmental factors, or genetic modification or compound treatment experiments. The tool explores differential gene expression in

  16. Genome-wide identification and analysis of the MADS-box gene family in apple.

    PubMed

    Tian, Yi; Dong, Qinglong; Ji, Zhirui; Chi, Fumei; Cong, Peihua; Zhou, Zongshan

    2015-01-25

    The MADS-box gene family is one of the most widely studied families in plants and has diverse developmental roles in flower pattern formation, gametophyte cell division and fruit differentiation. Although the genome-wide analysis of this family has been performed in some species, little is known regarding MADS-box genes in apple (Malus domestica). In this study, 146 MADS-box genes were identified in the apple genome and were phylogenetically clustered into six subgroups (MIKC(c), MIKC*, Mα, Mβ, Mγ and Mδ) with the MADS-box genes from Arabidopsis and rice. The predicted apple MADS-box genes were distributed across all 17 chromosomes at different densities. Additionally, the MADS-box domain, exon length, gene structure and motif compositions of the apple MADS-box genes were analysed. Moreover, the expression of all of the apple MADS-box genes was analysed in the root, stem, leaf, flower tissues and five stages of fruit development. All of the apple MADS-box genes, with the exception of some genes in each group, were expressed in at least one of the tissues tested, which indicates that the MADS-box genes are involved in various aspects of the physiological and developmental processes of the apple. To the best of our knowledge, this report describes the first genome-wide analysis of the apple MADS-box gene family, and the results should provide valuable information for understanding the classification, cloning and putative functions of this family.

  17. Tandem zinc-finger gene families in mammals: insights and unanswered questions.

    PubMed

    Shannon, M; Kim, J; Ashworth, L; Branscomb, E; Stubbs, L

    1998-01-01

    Evidence for the remarkable conservation of mammalian genomes, in both content and organization of resident genes, is rapidly emerging from comparative mapping studies. The frequent occurrence of familial gene clustering, presumably reflecting a history of tandem in situ duplications starting from a single ancestral gene, is also apparent from these analyses. Genes encoding Kruppel-type zinc-finger (ZNF) proteins, including those containing Kruppel-associated box (KRAB) motifs, are particularly prone to such clustered organization. Existing data suggest that genes in KRAB-ZNF gene clusters have diverged in sequence and expression patterns, possibly yielding families of proteins with distinct, yet related, functions. Comparative mapping studies indicate that at least some of the genes within these clusters in mammals were elaborated prior to the divergence of mammalian orders and, subsequently, have been conserved. These data suggest a possible role for these tandem KRAB-ZNF gene families in mammalian evolution.

  18. Structural, functional, and evolutionary analysis of the unusually large stilbene synthase gene family in grapevine.

    PubMed

    Parage, Claire; Tavares, Raquel; Réty, Stéphane; Baltenweck-Guyot, Raymonde; Poutaraud, Anne; Renault, Lauriane; Heintz, Dimitri; Lugan, Raphaël; Marais, Gabriel A B; Aubourg, Sébastien; Hugueney, Philippe

    2012-11-01

    Stilbenes are a small family of phenylpropanoids produced in a number of unrelated plant species, including grapevine (Vitis vinifera). In addition to their participation in defense mechanisms in plants, stilbenes, such as resveratrol, display important pharmacological properties and are postulated to be involved in the health benefits associated with a moderate consumption of red wine. Stilbene synthases (STSs), which catalyze the biosynthesis of the stilbene backbone, seem to have evolved from chalcone synthases (CHSs) several times independently in stilbene-producing plants. STS genes usually form small families of two to five closely related paralogs. By contrast, the sequence of grapevine reference genome (cv PN40024) has revealed an unusually large STS gene family. Here, we combine molecular evolution and structural and functional analyses to investigate further the high number of STS genes in grapevine. Our reannotation of the STS and CHS gene families yielded 48 STS genes, including at least 32 potentially functional ones. Functional characterization of nine genes representing most of the STS gene family diversity clearly indicated that these genes do encode for proteins with STS activity. Evolutionary analysis of the STS gene family revealed that both STS and CHS evolution are dominated by purifying selection, with no evidence for strong selection for new functions among STS genes. However, we found a few sites under different selection pressures in CHS and STS sequences, whose potential functional consequences are discussed using a structural model of a typical STS from grapevine that we developed.

  19. A novel heterozygous missense mutation in uromodulin gene in an Indian family with familial juvenile hyperuricemic nephropathy

    PubMed Central

    Saxena, D.; Srivastava, P.; Phadke, S. R.

    2016-01-01

    Familial juvenile hyperuricemic nephropathy (FJHN), characterized by early-onset hyperuricemia, reduced fractional excretion of uric acid, and chronic renal failure is caused due to mutation in uromodulin (UMOD) gene. We identified a novel mutation in a family with multiple members affected with FJHN. Ten coding exons of UMOD gene in three family members with clinical and biochemical features of FJHN and one unaffected family member were sequenced, and sequence variants were analyzed for the pathogenicity by bioinformatics studies. A heterozygous novel missense mutation (c. 949 T >G) in exon 5 leading to the replacement of cysteine by glycine at position 317 was identified in all three affected family members. This mutation has not been reported earlier in Human Gene Mutation Database, Human Genome Variation, Clinvar, and 1000 Genome. The mutation lies in the cysteine-rich 2 domain of the protein, and the affected residue is evolutionary conserved in other species. To our knowledge, this is the first report of the identification of UMOD mutation in an Indian family. PMID:27795632

  20. Out of the Water: Origin and Diversification of the LBD Gene Family.

    PubMed

    Chanderbali, Andre S; He, Fengmei; Soltis, Pamela S; Soltis, Douglas E

    2015-08-01

    LBD (lateral organ boundaries domain) genes are essential to the developmental programs of many fundamental plant organs and function in some of the basic metabolic pathways of plants. However, our historical perspective on the roles of LBD genes during plant evolution has, heretofore, been fragmentary. Here, we show that the LBD gene family underwent an initial radiation that established five gene lineages in the ancestral genome of most charophyte algae and land plants. By inference, the LBD gene family originated after the emergence of the green plants (Viridiplantae), but prior to the diversification of most extant streptophytes. After this initial radiation, we find limited instances of gene family diversification in land plants until successive rounds of expansion in the ancestors of seed plants and flowering plants. The most dynamic phases of LBD gene evolution, therefore, trace to the aquatic ancestors of embryophytes followed by relatively recent lineage-specific expansions on land.

  1. Out of the Water: Origin and Diversification of the LBD Gene Family

    PubMed Central

    Chanderbali, Andre S.; He, Fengmei; Soltis, Pamela S.; Soltis, Douglas E.

    2015-01-01

    LBD (LATERAL ORGAN BOUNDARIES DOMAIN) genes are essential to the developmental programs of many fundamental plant organs and function in some of the basic metabolic pathways of plants. However, our historical perspective on the roles of LBD genes during plant evolution has, heretofore, been fragmentary. Here, we show that the LBD gene family underwent an initial radiation that established five gene lineages in the ancestral genome of most charophyte algae and land plants. By inference, the LBD gene family originated after the emergence of the green plants (Viridiplantae), but prior to the diversification of most extant streptophytes. After this initial radiation, we find limited instances of gene family diversification in land plants until successive rounds of expansion in the ancestors of seed plants and flowering plants. The most dynamic phases of LBD gene evolution, therefore, trace to the aquatic ancestors of embryophytes followed by relatively recent lineage-specific expansions on land. PMID:25839188

  2. Genomic organization of the mouse T-cell receptor beta-chain gene family.

    PubMed Central

    Lai, E; Barth, R K; Hood, L

    1987-01-01

    We have combined three different methods, deletion mapping of T-cell lines, field-inversion gel electrophoresis, and the restriction mapping of a cosmid clone, to construct a physical map of the murine T-cell receptor beta-chain gene family. We have mapped 19 variable (V beta) gene segments and the two clusters of diversity (D beta) and joining (J beta) gene segments and constant (C beta) genes. These members of the beta-chain gene family span approximately equal to 450 kilobases of DNA, excluding one potential gap in the DNA fragment alignments. Images PMID:3035555

  3. Different evolutionary histories of two cation/proton exchanger gene families in plants

    PubMed Central

    2013-01-01

    Background Gene duplication events have been proposed to be involved in the adaptation of plants to stress conditions; precisely how is unclear. To address this question, we studied the evolution of two families of antiporters. Cation/proton exchangers are important for normal cell function and in plants, Na+,K+/H+ antiporters have also been implicated in salt tolerance. Two well-known plant cation/proton antiporters are NHX1 and SOS1, which perform Na+ and K+ compartmentalization into the vacuole and Na+ efflux from the cell, respectively. However, our knowledge about the evolution of NHX and SOS1 stress responsive gene families is still limited. Results In this study we performed a comprehensive molecular evolutionary analysis of the NHX and SOS1 families. Using available sequences from a total of 33 plant species, we estimated gene family phylogenies and gene duplication histories, as well as examined heterogeneous selection pressure on amino acid sites. Our results show that, while the NHX family expanded and specialized, the SOS1 family remained a low copy gene family that appears to have undergone neofunctionalization during its evolutionary history. Additionally, we found that both families are under purifying selection although SOS1 is less constrained. Conclusions We propose that the different evolution histories are related with the proteins’ function and localization, and that the NHX and SOS1 families are examples of two different evolutionary paths through which duplication events may result in adaptive evolution of stress tolerance. PMID:23822194

  4. Identification and distribution of the NBS-LRR gene family in the cassava genome

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Plant resistance genes (R genes) exist in large families and usually contain both a nucleotide-binding site domain and a leucine-rich repeat domain, denoted NBS-LRR. The genome sequence of cassava (Manihot esculenta) is a valuable resource for analyzing the genomic organization of resistance genes i...

  5. Evolution of the chitin synthase gene family correlates with fungal morphogenesis and adaption to ecological niches

    PubMed Central

    Liu, Ran; Xu, Chuan; Zhang, Qiangqiang; Wang, Shiyi; Fang, Weiguo

    2017-01-01

    The fungal kingdom potentially has the most complex chitin synthase (CHS) gene family, but evolution of the fungal CHS gene family and its diversification to fulfill multiple functions remain to be elucidated. Here, we identified the full complement of CHSs from 231 fungal species. Using the largest dataset to date, we characterized the evolution of the fungal CHS gene family using phylogenetic and domain structure analysis. Gene duplication, domain recombination and accretion are major mechanisms underlying the diversification of the fungal CHS gene family, producing at least 7 CHS classes. Contraction of the CHS gene family is morphology-specific, with significant loss in unicellular fungi, whereas family expansion is lineage-specific with obvious expansion in early-diverging fungi. ClassV and ClassVII CHSs with the same domain structure were produced by the recruitment of domains PF00063 and PF08766 and subsequent duplications. Comparative analysis of their functions in multiple fungal species shows that the emergence of ClassV and ClassVII CHSs is important for the morphogenesis of filamentous fungi, development of pathogenicity in pathogenic fungi, and heat stress tolerance in Pezizomycotina fungi. This work reveals the evolution of the fungal CHS gene family, and its correlation with fungal morphogenesis and adaptation to ecological niches. PMID:28300148

  6. Genomewide analysis of the lateral organ boundaries domain gene family in Vitis vinifera.

    PubMed

    Cao, Hui; Liu, Cai-Yun; Liu, Chun-Xiang; Zhao, Yue-Ling; Xu, Rui-Rui

    2016-09-01

    In plants, the transcription factor families have been implicated in many important biological processes. These processes include morphogenesis, signal transduction and environmental stress responses. Proteins containing the lateral organ boundaries domain (LBD), which encodes a zinc finger-like domain are only found in plants. This finding indicates that this unique gene family regulates only plant-specific biological processes. LBD genes play crucial roles in the growth and development of plants such as Arabidopsis, Oryza sativa, Zea mays, poplar, apple and tomato. However, relatively little is known about the LBD genes in grape (Vitis vinifera). In this study, we identified 40 LBD genes in the grape genome. A complete overview of the chromosomal locations, phylogenetic relationships, structures and expression profiles of this gene family during development in grape is presented here. Phylogenetic analysis showed that the LBD genes could be divided into classes I and II, together with LBDs from Arabidopsis. We mapped the 40 LBD genes on the grape chromosomes (chr1-chr19) and found that 37 of the predicted grape LBD genes were distributed in different densities across 12 chromosomes. Grape LBDs were found to share a similar intron/exon structure and gene length within the same class. The expression profiles of grape LBD genes at different developmental stages were analysed using microarray data. Results showed that 21 grape LBD genes may be involved in grape developmental processes, including preveraison, veraison and ripening. Finally, we analysed the expression patterns of six LBD genes through quantitative real-time polymerase chain reation analysis. The six LBD genes showed differential expression patterns among the three representative grape tissues, and five of these genes were found to be involved in responses to mannitol, sodium chloride, heat stress and low temperature treatments. To our knowledge, this is the first study to analyse the LBD gene family in

  7. Extensive and continuous duplication facilitates rapid evolution and diversification of gene families.

    PubMed

    Chang, Dan; Duda, Thomas F

    2012-08-01

    The origin of novel gene functions through gene duplication, mutation, and natural selection represents one of the mechanisms by which organisms diversify and one of the possible paths leading to adaptation. Nonetheless, the extent, role, and consequences of duplications in the origins of ecological adaptations, especially in the context of species interactions, remain unclear. To explore the evolution of a gene family that is likely linked to species associations, we investigated the evolutionary history of the A-superfamily of conotoxin genes of predatory marine cone snails (Conus species). Members of this gene family are expressed in the venoms of Conus species and are presumably involved in predator-prey associations because of their utility in prey capture. We recovered sequences of this gene family from genomic DNA of four closely related species of Conus and reconstructed the evolutionary history of these genes. Our study is the first to directly recover conotoxin genes from Conus genomes to investigate the evolution of conotoxin gene families. Our results revealed a phenomenon of rapid and continuous gene turnover that is coupled with heightened rates of evolution. This continuous duplication pattern has not been observed previously, and the rate of gene turnover is at least two times higher than estimates from other multigene families. Conotoxin genes are among the most rapidly evolving protein-coding genes in metazoans, a phenomenon that may be facilitated by extensive gene duplications and have driven changes in conotoxin functions through neofunctionalization. Together these mechanisms led to dramatically divergent arrangements of A-superfamily conotoxin genes among closely related species of Conus. Our findings suggest that extensive and continuous gene duplication facilitates rapid evolution and drastic divergence in venom compositions among species, processes that may be associated with evolutionary responses to predator-prey interactions.

  8. Inferring Hypotheses on Functional Relationships of Genes: Analysis of the Arabidopsis thaliana Subtilase Gene Family

    PubMed Central

    Büssis, Dirk; Stintzi, Annick; Schaller, Andreas; Kopka, Joachim; Altmann, Thomas

    2005-01-01

    The gene family of subtilisin-like serine proteases (subtilases) in Arabidopsis thaliana comprises 56 members, divided into six distinct subfamilies. Whereas the members of five subfamilies are similar to pyrolysins, two genes share stronger similarity to animal kexins. Mutant screens confirmed 144 T-DNA insertion lines with knockouts for 55 out of the 56 subtilases. Apart from SDD1, none of the confirmed homozygous mutants revealed any obvious visible phenotypic alteration during growth under standard conditions. Apart from this specific case, forward genetics gave us no hints about the function of the individual 54 non-characterized subtilase genes. Therefore, the main objective of our work was to overcome the shortcomings of the forward genetic approach and to infer alternative experimental approaches by using an integrative bioinformatics and biological approach. Computational analyses based on transcriptional co-expression and co-response pattern revealed at least two expression networks, suggesting that functional redundancy may exist among subtilases with limited similarity. Furthermore, two hubs were identified, which may be involved in signalling or may represent higher-order regulatory factors involved in responses to environmental cues. A particular enrichment of co-regulated genes with metabolic functions was observed for four subtilases possibly representing late responsive elements of environmental stress. The kexin homologs show stronger associations with genes of transcriptional regulation context. Based on the analyses presented here and in accordance with previously characterized subtilases, we propose three main functions of subtilases: involvement in (i) control of development, (ii) protein turnover, and (iii) action as downstream components of signalling cascades. Supplemental material is available in the Plant Subtilase Database (PSDB) (http://csbdb.mpimp-golm.mpg.de/psdb.html) , as well as from the CSB.DB (http

  9. Methuselah/Methuselah-like G protein-coupled receptors constitute an ancient metazoan gene family

    PubMed Central

    de Mendoza, Alexandre; Jones, Jeffery W.; Friedrich, Markus

    2016-01-01

    Inconsistent conclusions have been drawn regarding the phylogenetic age of the Methuselah/Methuselah-like (Mth/Mthl) gene family of G protein-coupled receptors, the founding member of which regulates development and lifespan in Drosophila. Here we report the results from a targeted homolog search of 39 holozoan genomes and phylogenetic analysis of the conserved seven transmembrane domain. Our findings reveal that the Mth/Mthl gene family is ancient, has experienced numerous extinction and expansion events during metazoan evolution, and acquired the current definition of the Methuselah ectodomain during its exceptional expansion in arthropods. In addition, our findings identify Mthl1, Mthl5, Mthl14, and Mthl15 as the oldest Mth/Mthl gene family paralogs in Drosophila. Future studies of these genes have the potential to define ancestral functions of the Mth/Mthl gene family. PMID:26915348

  10. Evolution of the RH gene family in vertebrates revealed by brown hagfish (Eptatretus atami) genome sequences.

    PubMed

    Suzuki, Akinori; Komata, Hidero; Iwashita, Shogo; Seto, Shotaro; Ikeya, Hironobu; Tabata, Mitsutoshi; Kitano, Takashi

    2017-02-01

    In vertebrates, there are four major genes in the RH (Rhesus) gene family, RH, RHAG, RHBG, and RHCG. These genes are thought to have been formed by the two rounds of whole-genome duplication (2R-WGD) in the common ancestor of all vertebrates. In our previous work, where we analyzed details of the gene duplications process of this gene family, three nucleotide sequences belonging to this family were identified in Far Eastern brook lamprey (Lethenteron reissneri), and the phylogenetic positions of the genes were determined. Lampreys, along with hagfishes, are cyclostomata (jawless fishes), which is a sister group of gnathostomata (jawed vertebrates). Although those results suggested that one gene was orthologous to the gnathostome RHCG genes, we did not identify clear orthologues for other genes. In this study, therefore, we identified three novel cDNA sequences that belong to the RH gene family using de novo transcriptome analysis of another cyclostome: the brown hagfish (Eptatretus atami). We also determined the nucleotide sequences for the RHBG and RHCG genes in a red stingray (Dasyatis akajei), which belongs to the cartilaginous fishes. The phylogenetic tree showed that two brown hagfish genes, which were probably duplicated in the cyclostome lineage, formed a cluster with the gnathostome RHAG genes, whereas another brown hagfish gene formed a cluster with the gnathostome RHCG genes. We estimated that the RH genes had a higher evolutionary rate than the RHAG, RHBG, and RHCG genes. Interestingly, in the RHBG genes, only the bird lineage showed a higher rate of nonsynonymous substitutions. It is likely that this higher rate was caused by a state of relaxed functional constraints rather than positive selection nor by pseudogenization.

  11. Massive Expansion of Ubiquitination-Related Gene Families within the Chlamydiae

    PubMed Central

    Domman, Daryl; Collingro, Astrid; Lagkouvardos, Ilias; Gehre, Lena; Weinmaier, Thomas; Rattei, Thomas; Subtil, Agathe; Horn, Matthias

    2014-01-01

    Gene loss, gain, and transfer play an important role in shaping the genomes of all organisms; however, the interplay of these processes in isolated populations, such as in obligate intracellular bacteria, is less understood. Despite a general trend towards genome reduction in these microbes, our phylogenomic analysis of the phylum Chlamydiae revealed that within the family Parachlamydiaceae, gene family expansions have had pronounced effects on gene content. We discovered that the largest gene families within the phylum are the result of rapid gene birth-and-death evolution. These large gene families are comprised of members harboring eukaryotic-like ubiquitination-related domains, such as F-box and BTB-box domains, marking the largest reservoir of these proteins found among bacteria. A heterologous type III secretion system assay suggests that these proteins function as effectors manipulating the host cell. The large disparity in copy number of members in these families between closely related organisms suggests that nonadaptive processes might contribute to the evolution of these gene families. Gene birth-and-death evolution in concert with genomic drift might represent a previously undescribed mechanism by which isolated bacterial populations diversify. PMID:25069652

  12. Cloning of novel rice blast resistance genes from two rapidly evolving NBS-LRR gene families in rice.

    PubMed

    Guo, Changjiang; Sun, Xiaoguang; Chen, Xiao; Yang, Sihai; Li, Jing; Wang, Long; Zhang, Xiaohui

    2016-01-01

    Most rice blast resistance genes (R-genes) encode proteins with nucleotide-binding site (NBS) and leucine-rich repeat (LRR) domains. Our previous study has shown that more rice blast R-genes can be cloned in rapidly evolving NBS-LRR gene families. In the present study, two rapidly evolving R-gene families in rice were selected for cloning a subset of genes from their paralogs in three resistant rice lines. A total of eight functional blast R-genes were identified among nine NBS-LRR genes, and some of these showed resistance to three or more blast strains. Evolutionary analysis indicated that high nucleotide diversity of coding regions served as important parameters in the determination of gene resistance. We also observed that amino-acid variants (nonsynonymous mutations, insertions, or deletions) in essential motifs of the NBS domain contribute to the blast resistance capacity of NBS-LRR genes. These results suggested that the NBS regions might also play an important role in resistance specificity determination. On the other hand, different splicing patterns of introns were commonly observed in R-genes. The results of the present study contribute to improving the effectiveness of R-gene identification by using evolutionary analysis method and acquisition of novel blast resistance genes.

  13. Isolation of novel human and mouse genes of the recA/RAD51 recombination-repair gene family.

    PubMed Central

    Cartwright, R; Dunn, A M; Simpson, P J; Tambini, C E; Thacker, J

    1998-01-01

    Genes from the recA/RAD51 family play essential roles in homologous recombination in all organisms. Using sequence homologies from eukaryotic members of this family we have identified fragments of two additional mammalian genes with homology to RAD51. Cloning the full-length cDNAs for both human and mouse genes showed that the sequences are highly conserved, and that the predicted proteins have characteristic features of this gene family. One of the novel genes (R51H2) occurs in two forms in human cDNA, differing extensively at the 3' end, probably due to an unusual form of alternative splicing. The new genes (R51H2 and R51H3) were mapped to human chromosomes 14q23-24 and 17q1.2, respectively. Expression studies showed that R51H2 is expressed at lower levels than R51H3 , but that expression of both genes occurs at elevated levels in the testis compared with other tissues. The combination of gene structure conservation and the transcript expression patterns suggests that these new members of the recA/RAD51 family may also function in homologous recombination-repair pathways. PMID:9512535

  14. The ankyrin repeat gene family in rice: genome-wide identification, classification and expression profiling.

    PubMed

    Huang, Jianyan; Zhao, Xiaobo; Yu, Huihui; Ouyang, Yidan; Wang, Lei; Zhang, Qifa

    2009-10-01

    Ankyrin repeat (ANK) containing proteins comprise a large protein family. Although many members of this family have been implicated in plant growth, development and signal transduction, only a few ANK genes have been reported in rice. In this study, we analyzed the structures, phylogenetic relationship, genome localizations and expression profiles of 175 ankyrin repeat genes identified in rice (OsANK). Domain composition analysis suggested OsANK proteins can be classified into ten subfamilies. Chromosomal localizations of OsANK genes indicated nine segmental duplication events involving 17 genes and 65 OsANK genes were involved in tandem duplications. The expression profiles of 158 OsANK genes were analyzed in 24 tissues covering the whole life cycle of two rice genotypes, Minghui 63 and Zhenshan 97. Sixteen genes showed preferential expression in given tissues compared to all the other tissues in Minghui 63 and Zhenshan 97. Nine genes were preferentially expressed in stamen of 1 day before flowering, suggesting that these genes may play important roles in pollination and fertilization. Expression data of OsANK genes were also obtained with tissues of seedlings subjected to three phytohormone (NAA, GA3 and KT) and light/dark treatments. Eighteen genes showed differential expression with at least one phytohormone treatment while under light/dark treatments, 13 OsANK genes showed differential expression. Our data provided a very useful reference for cloning and functional analysis of members of this gene family in rice.

  15. Holding blame at bay? ‘Gene talk' in family members' accounts of schizophrenia aetiology

    PubMed Central

    Callard, Felicity; Rose, Diana; Hanif, Emma-Louise; Quigley, Jody; Greenwood, Kathryn; Wykes, Til

    2012-01-01

    We provide the first detailed analysis of how, for what purposes and with what consequences people related to someone with a diagnosis of schizophrenia use ‘gene talk'. The article analyses findings from a qualitative interview study conducted in London and involving 19 participants (mostly women). We transcribed the interviews verbatim and analysed them using grounded theory methods. We analyse how and for what purposes participants mobilized ‘gene talk' in their affectively freighted encounter with an unknown interviewer. Gene talk served to (re)position blame and guilt, and was simultaneously used imaginatively to forge family history narratives. Family members used ‘gene talk' to recruit forebears with no psychiatric diagnosis into a family history of mental illness, and presented the origins of the diagnosed family member's schizophrenia as lying temporally before, and hence beyond the agency of the immediate family. Gene talk was also used in attempts to dislodge the distressing figure of the schizophrenia-inducing mother. ‘Gene talk', however, ultimately displaced, rather than resolved, the (self-)blame of many family members, particularly mothers. Our article challenges the commonly expressed view that genetic accounts will absolve family members' sense of (self-)blame in relation to their relative's/relatives' diagnosis. PMID:23227107

  16. Retrieval of glycoside hydrolase family 9 cellulase genes from environmental DNA by metagenomic gene specific multi-primer PCR.

    PubMed

    Xiong, Xiaolong; Yin, Xiaopu; Pei, Xiaolin; Jin, Peng; Zhang, Ao; Li, Yan; Gong, Weibo; Wang, Qiuyan

    2012-05-01

    A new method, termed metagenomic gene specific multi-primer PCR (MGSM-PCR), is presented that uses multiple gene specific primers derived from an isolated gene from a constructed metagenomic library rather than degenerate primers designed based on a known enzyme family. The utility of MGSM-PCR was shown by applying it to search for homologues of the glycoside hydrolase family 9 cellulase in metagenomic DNA. The success of the multiplex PCR was verified by visualizing products on an agarose gel following gel electrophoresis. A total of 127 homologous genes were amplified with combinatorial multi-primer reactions from 34 soil DNA samples. Multiple alignments revealed extensive sequence diversity among these captured sequences with sequence identity varying from 26 to 99.7%. These results indicated that significantly diverse homologous genes were indeed readily accessible when using multiple metagenomic gene specific primers.

  17. Familial isolated pituitary adenoma caused by a Aip gene mutation not described before in a family context.

    PubMed

    García-Arnés, J A; González-Molero, I; Oriola, J; Mazuecos, N; Luque, R; Castaño, J; Arraez, M A

    2013-12-01

    The cause of familial isolated pituitary adenomas (FIPA) remains unknown in a high percentage of cases, but the AIP gene plays an important role in the etiology. The aim of the study is to describe a family with FIPA syndrome and the results of genomic studies. A 16-year-old man had a giant prolactinoma resistant tomedical treatment with delayed growth and pubertal development. His mother had been previously diagnosed with a nonfunctioning pituitary macroadenoma. Transsphenoidal endoscopic resection was performed and a genetic study revealed a heterozygous mutation in exon 6: 974G>A (p.Arg325Gln). Because the AIP gene is a tumor suppressor gene, we searched for loss of heterozygosity within the AIP gene by amplifying exon 6 from tumor tissue of the patient. In the electropherogram, only the A allele was amplified (hemizygous state), indicating loss of the normal allele. We report a Spanish family with FIPA in whom a mutation in the AIP gene previously unreported in a familiar context was identified.

  18. Genome-wide analysis of the GRAS gene family in Chinese cabbage (Brassica rapa ssp. pekinensis).

    PubMed

    Song, Xiao-Ming; Liu, Tong-Kun; Duan, Wei-Ke; Ma, Qing-Hua; Ren, Jun; Wang, Zhen; Li, Ying; Hou, Xi-Lin

    2014-01-01

    The GRAS gene family is one of the most important families of transcriptional regulators. In this study, 48 GRAS genes are identified from Chinese cabbage, and they are classified into eight groups according to the classification of Arabidopsis. The characterization, classification, gene structure and phylogenetic construction of GRAS proteins are performed. Distribution mapping shows that GRAS proteins are nonrandomly localized in 10 chromosomes. Fifty-five orthologous gene pairs are shared by Chinese cabbage and Arabidopsis, and interaction networks of these orthologous genes are constructed. The expansion of GRAS genes in Chinese cabbage results from genome triplication. Among the 17 species examined, 14 higher plants carry the GRAS genes, whereas two lower plants and one fungi species do not. Furthermore, the expression patterns of GRAS genes exhibit differences in three tissues based on RNA-seq data. Taken together, this comprehensive analysis will provide rich resources for studying GRAS protein functions in Chinese cabbage.

  19. Saltatory evolution of the ectodermal neural cortex gene family at the vertebrate origin.

    PubMed

    Feiner, Nathalie; Murakami, Yasunori; Breithut, Lisa; Mazan, Sylvie; Meyer, Axel; Kuraku, Shigehiro

    2013-01-01

    The ectodermal neural cortex (ENC) gene family, whose members are implicated in neurogenesis, is part of the kelch repeat superfamily. To date, ENC genes have been identified only in osteichthyans, although other kelch repeat-containing genes are prevalent throughout bilaterians. The lack of elaborate molecular phylogenetic analysis with exhaustive taxon sampling has obscured the possible link of the establishment of this gene family with vertebrate novelties. In this study, we identified ENC homologs in diverse vertebrates by means of database mining and polymerase chain reaction screens. Our analysis revealed that the ENC3 ortholog was lost in the basal eutherian lineage through single-gene deletion and that the triplication between ENC1, -2, and -3 occurred early in vertebrate evolution. Including our original data on the catshark and the zebrafish, our comparison revealed high conservation of the pleiotropic expression pattern of ENC1 and shuffling of expression domains between ENC1, -2, and -3. Compared with many other gene families including developmental key regulators, the ENC gene family is unique in that conventional molecular phylogenetic inference could identify no obvious invertebrate ortholog. This suggests a composite nature of the vertebrate-specific gene repertoire, consisting not only of de novo genes introduced at the vertebrate origin but also of long-standing genes with no apparent invertebrate orthologs. Some of the latter, including the ENC gene family, may be too rapidly evolving to provide sufficient phylogenetic signals marking orthology to their invertebrate counterparts. Such gene families that experienced saltatory evolution likely remain to be explored and might also have contributed to phenotypic evolution of vertebrates.

  20. Saltatory Evolution of the Ectodermal Neural Cortex Gene Family at the Vertebrate Origin

    PubMed Central

    Feiner, Nathalie; Murakami, Yasunori; Breithut, Lisa; Mazan, Sylvie; Meyer, Axel; Kuraku, Shigehiro

    2013-01-01

    The ectodermal neural cortex (ENC) gene family, whose members are implicated in neurogenesis, is part of the kelch repeat superfamily. To date, ENC genes have been identified only in osteichthyans, although other kelch repeat-containing genes are prevalent throughout bilaterians. The lack of elaborate molecular phylogenetic analysis with exhaustive taxon sampling has obscured the possible link of the establishment of this gene family with vertebrate novelties. In this study, we identified ENC homologs in diverse vertebrates by means of database mining and polymerase chain reaction screens. Our analysis revealed that the ENC3 ortholog was lost in the basal eutherian lineage through single-gene deletion and that the triplication between ENC1, -2, and -3 occurred early in vertebrate evolution. Including our original data on the catshark and the zebrafish, our comparison revealed high conservation of the pleiotropic expression pattern of ENC1 and shuffling of expression domains between ENC1, -2, and -3. Compared with many other gene families including developmental key regulators, the ENC gene family is unique in that conventional molecular phylogenetic inference could identify no obvious invertebrate ortholog. This suggests a composite nature of the vertebrate-specific gene repertoire, consisting not only of de novo genes introduced at the vertebrate origin but also of long-standing genes with no apparent invertebrate orthologs. Some of the latter, including the ENC gene family, may be too rapidly evolving to provide sufficient phylogenetic signals marking orthology to their invertebrate counterparts. Such gene families that experienced saltatory evolution likely remain to be explored and might also have contributed to phenotypic evolution of vertebrates. PMID:23843192

  1. Global identification and expression analysis of stress-responsive genes of the Argonaute family in apple.

    PubMed

    Xu, Ruirui; Liu, Caiyun; Li, Ning; Zhang, Shizhong

    2016-12-01

    Argonaute (AGO) proteins, which are found in yeast, animals, and plants, are the core molecules of the RNA-induced silencing complex. These proteins play important roles in plant growth, development, and responses to biotic stresses. The complete analysis and classification of the AGO gene family have been recently reported in different plants. Nevertheless, systematic analysis and expression profiling of these genes have not been performed in apple (Malus domestica). Approximately 15 AGO genes were identified in the apple genome. The phylogenetic tree, chromosome location, conserved protein motifs, gene structure, and expression of the AGO gene family in apple were analyzed for gene prediction. All AGO genes were phylogenetically clustered into four groups (i.e., AGO1, AGO4, MEL1/AGO5, and ZIPPY/AGO7) with the AGO genes of Arabidopsis. These groups of the AGO gene family were statistically analyzed and compared among 31 plant species. The predicted apple AGO genes are distributed across nine chromosomes at different densities and include three segment duplications. Expression studies indicated that 15 AGO genes exhibit different expression patterns in at least one of the tissues tested. Additionally, analysis of gene expression levels indicated that the genes are mostly involved in responses to NaCl, PEG, heat, and low-temperature stresses. Hence, several candidate AGO genes are involved in different aspects of physiological and developmental processes and may play an important role in abiotic stress responses in apple. To the best of our knowledge, this study is the first to report a comprehensive analysis of the apple AGO gene family. Our results provide useful information to understand the classification and putative functions of these proteins, especially for gene members that may play important roles in abiotic stress responses in M. hupehensis.

  2. CRDB: Database of Chemosensory Receptor Gene Families in Vertebrate

    PubMed Central

    Wu, Xiaoli; Zhong, Yang

    2012-01-01

    Chemosensory receptors (CR) are crucial for animals to sense the environmental changes and survive on earth. The emergence of whole-genome sequences provides us an opportunity to identify the entire CR gene repertoires. To completely gain more insight into the evolution of CR genes in vertebrates, we identified the nearly all CR genes in 25 vertebrates using homology-based approaches. Among these CR gene repertoires, nearly half of them were identified for the first time in those previously uncharacterized species, such as the guinea pig, giant panda and elephant, etc. Consistent with previous findings, we found that the numbers of CR genes vary extensively among different species, suggesting an extreme form of ‘birth-and-death’ evolution. For the purpose of facilitating CR gene analysis, we constructed a database with the goals to provide a resource for CR genes annotation and a web tool for exploring their evolutionary patterns. Besides a search engine for the gene extraction from a specific chromosome region, an easy-to-use phylogenetic analysis tool was also provided to facilitate online phylogeny study of CR genes. Our work can provide a rigorous platform for further study on the evolution of CR genes in vertebrates. PMID:22393364

  3. Gene Structures, Evolution and Transcriptional Profiling of the WRKY Gene Family in Castor Bean (Ricinus communis L.).

    PubMed

    Zou, Zhi; Yang, Lifu; Wang, Danhua; Huang, Qixing; Mo, Yeyong; Xie, Guishui

    2016-01-01

    WRKY proteins comprise one of the largest transcription factor families in plants and form key regulators of many plant processes. This study presents the characterization of 58 WRKY genes from the castor bean (Ricinus communis L., Euphorbiaceae) genome. Compared with the automatic genome annotation, one more WRKY-encoding locus was identified and 20 out of the 57 predicted gene models were manually corrected. All RcWRKY genes were shown to contain at least one intron in their coding sequences. According to the structural features of the present WRKY domains, the identified RcWRKY genes were assigned to three previously defined groups (I-III). Although castor bean underwent no recent whole-genome duplication event like physic nut (Jatropha curcas L., Euphorbiaceae), comparative genomics analysis indicated that one gene loss, one intron loss and one recent proximal duplication occurred in the RcWRKY gene family. The expression of all 58 RcWRKY genes was supported by ESTs and/or RNA sequencing reads derived from roots, leaves, flowers, seeds and endosperms. Further global expression profiles with RNA sequencing data revealed diverse expression patterns among various tissues. Results obtained from this study not only provide valuable information for future functional analysis and utilization of the castor bean WRKY genes, but also provide a useful reference to investigate the gene family expansion and evolution in Euphorbiaceus plants.

  4. Locus for a human hereditary cataract is closely linked to the. gamma. -crystallin gene family

    SciTech Connect

    Lubsen, N.H.; Renwick, J.H.; Tsui, L.C.; Breitman, M.L.; Schoenmakers, J.G.G.

    1987-01-01

    Within the human ..gamma..-crystallin gene cluster polymorphic Taq I sites are present. These give rise to three sets of allelic fragments from the ..gamma..-crystallin genes. Together these restriction fragment length polymorphisms define eight possible haplotypes, three of which (Q, R, and S) were found in the Dutch and English population. A fourth haplotype (P) was detected within a family in which a hereditary Coppock-like cataract of the embryonic lens nucleus occurs in heterozygotes. Haplotype P was found only in family members who suffered from cataract, and all family members who suffered from cataract had haplotype P. The absolute correlation between the presence of haplotype P and cataract within this family shows that the ..gamma..-crystallin gene cluster and the locus for the Coppock-like cataract are closely linked. This linkage provides genetic evidence that the primary cause of a cataract in humans could possibly be a lesion in a crystallin gene.

  5. Gene duplication event in family 12 glycosyl hydrolase from Phytophthora spp.

    PubMed

    Costanzo, Stefano; Ospina-Giraldo, M D; Deahl, K L; Baker, C J; Jones, Richard W

    2006-10-01

    A total of 18 paralogs of xyloglucan-specific endoglucanases (EGLs) from the glycosyl hydrolase family 12 were identified and characterized in Phytophthora sojae and Phytophthora ramorum. These genes encode predicted extracellular enzymes, with sizes ranging from 189 to 435 amino acid residues, that would be capable of hydrolyzing the xyloglucan component of the host cell wall. In two cases, four and six functional copies of these genes were found in tight succession within a region of 5 and 18 kb, respectively. The overall gene copy number and relative organization appeared well conserved between P. sojae and P. ramorum, with apparent synteny in this region of their respective genomes. Phylogenetic analyses of Phytophthora endoglucanases of family 12 and other known members of EGL 12, revealed a close relatedness with a fairly conserved gene sub-family containing, among others, sequences from the fungi Emericella desertorum and Aspergillus aculeatus. This is the first report of family 12 EGLs present in plant pathogenic eukaryotes.

  6. Exclusion of known gene for enamel development in two Brazilian families with amelogenesis imperfecta.

    PubMed

    Santos, Maria C L G; Hart, P Suzanne; Ramaswami, Mukundhan; Kanno, Cláudia M; Hart, Thomas C; Line, Sergio R P

    2007-01-31

    Amelogenesis imperfecta (AI) is a genetically heterogeneous group of diseases that result in defective development of tooth enamel. Mutations in several enamel proteins and proteinases have been associated with AI. The object of this study was to evaluate evidence of etiology for the six major candidate gene loci in two Brazilian families with AI. Genomic DNA was obtained from family members and all exons and exon-intron boundaries of the ENAM, AMBN, AMELX, MMP20, KLK4 and Amelotin gene were amplified and sequenced. Each family was also evaluated for linkage to chromosome regions known to contain genes important in enamel development. The present study indicates that the AI in these two families is not caused by any of the known loci for AI or any of the major candidate genes proposed in the literature. These findings indicate extensive genetic heterogeneity for non-syndromic AI.

  7. Ultra Large Gene Families: A Matter of Adaptation or Genomic Parasites?

    PubMed Central

    Schiffer, Philipp H.; Gravemeyer, Jan; Rauscher, Martina; Wiehe, Thomas

    2016-01-01

    Gene duplication is an important mechanism of molecular evolution. It offers a fast track to modification, diversification, redundancy or rescue of gene function. However, duplication may also be neutral or (slightly) deleterious, and often ends in pseudo-geneisation. Here, we investigate the phylogenetic distribution of ultra large gene families on long and short evolutionary time scales. In particular, we focus on a family of NACHT-domain and leucine-rich-repeat-containing (NLR)-genes, which we previously found in large numbers to occupy one chromosome arm of the zebrafish genome. We were interested to see whether such a tight clustering is characteristic for ultra large gene families. Our data reconfirm that most gene family inflations are lineage-specific, but we can only identify very few gene clusters. Based on our observations we hypothesise that, beyond a certain size threshold, ultra large gene families continue to proliferate in a mechanism we term “run-away evolution”. This process might ultimately lead to the failure of genomic integrity and drive species to extinction. PMID:27509525

  8. Developmental expression of the N-myc downstream regulated gene (Ndrg) family during Xenopus tropicalis embryogenesis.

    PubMed

    Zhong, Chao; Zhou, Yan-Kuan; Yang, Shan-Shan; Zhao, Jun-Fang; Zhu, Xiao-Long; Chen, Hen-Huang; Chen, Pei-Chao; Huang, Li-Quan; Huang, Xiao

    2015-01-01

    The N-myc downstream regulated gene (Ndrg) family consists of four main members Ndrg1, 2, 3, and 4. The Ndrg genes are involved in many vital biological events including development. However, comprehensive expression patterns of this gene family during vertebrate embryogenesis remain largely unknown. Here, we analyzed the Ndrg family from the evolutionary perspective and examined the expression patterns of the Ndrg genes during Xenopus tropicalis embryogenesis. Different Ndrg family members of vertebrates are separated into different homology clusters which can be further classified into two groups and each Ndrg family member is well conserved during evolution. The temporal and spatial expression patterns of Ndrg1, 2, 3 and 4 are different during early Xenopus tropicalis development. Ndrg1, 2 and 4 are maternally expressed genes while Ndrg3 is a zygotically expressed gene. The Ndrg genes are differentially expressed in the developing central nervous system, the developing sensory organs, and the developing excretory organs. Moreover, they also show other specific expression domains. Our results indicate that the Ndrg genes exhibit specific expression patterns and may play different roles during vertebrate embryogenesis.

  9. Mouse T-cell receptor variable gene segment families

    SciTech Connect

    Arden, B.; Kabelitz, D.; Clark, S.P.; Mak, T.W.

    1995-10-01

    All mouse T-cell receptor {alpha}/{delta}, {beta}, and {gamma} variable (Tcra/d-, b-, and g-V) gene segments were aligned to compare the sequences with one another, to group them into subfamilies, and to derive a name which complies with the standard nomenclature. it was necessary to change the names of some V gene segments because they conflicted with those of other segments. The traditional classification into subfamilies was re-evaluated using a much larger pool of sequences. In the mouse, most V gene segments can be grouped into subfamilies of closely related genes with significantly less similarity between different subfamilies. 118 refs., 11 figs., 4 tabs.

  10. MS/MS networking guided analysis of molecule and gene cluster families.

    PubMed

    Nguyen, Don Duy; Wu, Cheng-Hsuan; Moree, Wilna J; Lamsa, Anne; Medema, Marnix H; Zhao, Xiling; Gavilan, Ronnie G; Aparicio, Marystella; Atencio, Librada; Jackson, Chanaye; Ballesteros, Javier; Sanchez, Joel; Watrous, Jeramie D; Phelan, Vanessa V; van de Wiel, Corine; Kersten, Roland D; Mehnaz, Samina; De Mot, René; Shank, Elizabeth A; Charusanti, Pep; Nagarajan, Harish; Duggan, Brendan M; Moore, Bradley S; Bandeira, Nuno; Palsson, Bernhard Ø; Pogliano, Kit; Gutiérrez, Marcelino; Dorrestein, Pieter C

    2013-07-09

    The ability to correlate the production of specialized metabolites to the genetic capacity of the organism that produces such molecules has become an invaluable tool in aiding the discovery of biotechnologically applicable molecules. Here, we accomplish this task by matching molecular families with gene cluster families, making these correlations to 60 microbes at one time instead of connecting one molecule to one organism at a time, such as how it is traditionally done. We can correlate these families through the use of nanospray desorption electrospray ionization MS/MS, an ambient pressure MS technique, in conjunction with MS/MS networking and peptidogenomics. We matched the molecular families of peptide natural products produced by 42 bacilli and 18 pseudomonads through the generation of amino acid sequence tags from MS/MS data of specific clusters found in the MS/MS network. These sequence tags were then linked to biosynthetic gene clusters in publicly accessible genomes, providing us with the ability to link particular molecules with the genes that produced them. As an example of its use, this approach was applied to two unsequenced Pseudoalteromonas species, leading to the discovery of the gene cluster for a molecular family, the bromoalterochromides, in the previously sequenced strain P. piscicida JCM 20779(T). The approach itself is not limited to 60 related strains, because spectral networking can be readily adopted to look at molecular family-gene cluster families of hundreds or more diverse organisms in one single MS/MS network.

  11. Mutation analysis in F9 gene of 17 families with haemophilia B from Iran.

    PubMed

    Enayat, M S; Karimi, M; Chana, G; Farjadian, S; Theophilus, B D M; Hill, F G H

    2004-11-01

    Seventeen haemophilia B families from Iran were investigated to determine the causative mutation. All the essential regions of the F9 gene were initially screened by conformational sensitive gel electrophoresis and exons with band shift were sequenced. Seven of the 15 mutations identified in these families were novel mutations. The mutations were authenticated in nine families as other affected members or heterozygous female carriers were available for verification.

  12. Cognitive Functioning in Affected Sibling Pairs with ADHD: Familial Clustering and Dopamine Genes

    ERIC Educational Resources Information Center

    Loo, Sandra K.; Rich, Erika Carpenter; Ishii, Janeen; McGough, James; McCracken, James; Nelson, Stanley; Smalley, Susan L.

    2008-01-01

    Background: This paper examines familiality and candidate gene associations of cognitive measures as potential endophenotypes in attention-deficit/hyperactivity disorder (ADHD). Methods: The sample consists of 540 participants, aged 6 to 18, who were diagnosed with ADHD from 251 families recruited for a larger genetic study of ADHD. All members of…

  13. Genome-wide analysis of the MADS-box gene family in Brachypodium distachyon.

    PubMed

    Wei, Bo; Zhang, Rong-Zhi; Guo, Juan-Juan; Liu, Dan-Mei; Li, Ai-Li; Fan, Ren-Chun; Mao, Long; Zhang, Xiang-Qi

    2014-01-01

    MADS-box genes are important transcription factors for plant development, especially floral organogenesis. Brachypodium distachyon is a model for biofuel plants and temperate grasses such as wheat and barley, but a comprehensive analysis of MADS-box family proteins in Brachypodium is still missing. We report here a genome-wide analysis of the MADS-box gene family in Brachypodium distachyon. We identified 57 MADS-box genes and classified them into 32 MIKC(c)-type, 7 MIKC*-type, 9 Mα, 7 Mβ and 2 Mγ MADS-box genes according to their phylogenetic relationships to the Arabidopsis and rice MADS-box genes. Detailed gene structure and motif distribution were then studied. Investigation of their chromosomal localizations revealed that Brachypodium MADS-box genes distributed evenly across five chromosomes. In addition, five pairs of type II MADS-box genes were found on synteny blocks derived from whole genome duplication blocks. We then performed a systematic expression analysis of Brachypodium MADS-box genes in various tissues, particular floral organs. Further detection under salt, drought, and low-temperature conditions showed that some MADS-box genes may also be involved in abiotic stress responses, including type I genes. Comparative studies of MADS-box genes among Brachypodium, rice and Arabidopsis showed that Brachypodium had fewer gene duplication events. Taken together, this work provides useful data for further functional studies of MADS-box genes in Brachypodium distachyon.

  14. Mutational analysis of PKD1 gene in a Chinese family with autosomal dominant polycystic kidney disease

    PubMed Central

    Liu, Jingyan; Li, Lanrong; Liu, Qingmin

    2015-01-01

    Autosomal dominant polycystic kidney disease (ADPKD) is a hereditary disease and common renal disease. Mutations of PKD genes are responsible for this disease. We analyzed a large Chinese family with ADPKD using Sanger sequencing to identify the mutation responsible for this disease. The family comprised 27 individuals including 10 ADPKD patients. These ADPKD patients had severe renal disease and most of them died very young. We analyzed 6 survival patients gene and found they all had C10529T mutation in exon 35 of PKD1 gene. We did not found gene mutation in any unaffected relatives or 300 unrelated controls. These findings suggested that the C10529T mutation in PKD1 gene might be the pathogenic mutation responsible for the disease in this family. PMID:26722532

  15. Genome-wide analysis of Aux/IAA and ARF gene families in Populus trichocarpa

    SciTech Connect

    Kalluri, Udaya C; DiFazio, Stephen P; Brunner, A.; Tuskan, Gerald A

    2007-01-01

    Auxin/Indole-3-Acetic Acid (Aux/IAA) and Auxin Response Factor (ARF) transcription factors are key regulators of auxin responses in plants. A total of 35 Aux/IAA and 39 ARF genes were identified in the Populus genome. Comparative phylogenetic analysis revealed that the subgroups PoptrARF2, 6, 9 and 16 and PoptrIAA3, 16, 27 and 29 have differentially expanded in Populus relative to Arabidopsis. Activator ARFs were found to be two fold-overrepresented in the Populus genome. PoptrIAA and PoptrARF gene families appear to have expanded due to high segmental and low tandem duplication events. Furthermore, expression studies showed that genes in the expanded PoptrIAA3 subgroup display differential expression. The gene-family analysis reported here will be useful in conducting future functional genomics studies to understand how the molecular roles of these large gene families translate into a diversity of biologically meaningful auxin effects.

  16. Mutational analysis of PKD1 gene in a Chinese family with autosomal dominant polycystic kidney disease.

    PubMed

    Liu, Jingyan; Li, Lanrong; Liu, Qingmin

    2015-01-01

    Autosomal dominant polycystic kidney disease (ADPKD) is a hereditary disease and common renal disease. Mutations of PKD genes are responsible for this disease. We analyzed a large Chinese family with ADPKD using Sanger sequencing to identify the mutation responsible for this disease. The family comprised 27 individuals including 10 ADPKD patients. These ADPKD patients had severe renal disease and most of them died very young. We analyzed 6 survival patients gene and found they all had C10529T mutation in exon 35 of PKD1 gene. We did not found gene mutation in any unaffected relatives or 300 unrelated controls. These findings suggested that the C10529T mutation in PKD1 gene might be the pathogenic mutation responsible for the disease in this family.

  17. Molecular Evolution and Expression Divergence of the Aconitase (ACO) Gene Family in Land Plants

    PubMed Central

    Wang, Yi-Ming; Yang, Qi; Liu, Yan-Jing; Yang, Hai-Ling

    2016-01-01

    Aconitase (ACO) is a key enzyme that catalyzes the isomerization of citrate to isocitrate in the tricarboxylic acid (TCA) and glyoxylate cycles. The function of ACOs has been well studied in model plants, such as Arabidopsis. In contrast, the evolutionary patterns of the ACO family in land plants are poorly understood. In this study, we systematically examined the molecular evolution and expression divergence of the ACO gene family in 12 land plant species. Thirty-six ACO genes were identified from the 12 land plant species representing the four major land plant lineages: Bryophytes, lycophytes, gymnosperms, and angiosperms. All of these ACOs belong to the cytosolic isoform. Three gene duplication events contributed to the expansion of the ACO family in angiosperms. The ancestor of angiosperms may have contained only one ACO gene. One gene duplication event split angiosperm ACOs into two distinct clades. Two clades showed a divergence in selective pressure and gene expression patterns. The cis-acting elements that function in light responsiveness were most abundant in the promoter region of the ACO genes, indicating that plant ACO genes might participate in light regulatory pathways. Our findings provide comprehensive insights into the ACO gene family in land plants. PMID:28018410

  18. Genome-wide identification, characterization, and expression analysis of the MLO gene family in Cucumis sativus.

    PubMed

    Zhou, S J; Jing, Z; Shi, J L

    2013-12-11

    Mildew resistance locus o (MLO) is a plant-specific seven-transmembrane (TM) gene family. Several studies have revealed that certain members of the MLO gene family mediate powdery mildew susceptibility in three plant species, namely, Arabidopsis, barley, and tomato. The sequenced cucumber genome provides an opportunity to conduct a comprehensive overview of the MLO gene family. Fourteen genes (designated CsMLO01 through CsMLO14) have been identified within the Cucumis sativus genome by using an in silico cloning method with the MLO amino acid sequences of Arabidopsis thaliana and rice as probes. Sequence alignment revealed that numerous features of the gene family, such as TMs, a calmodulin-binding domain, peptide domains I and II, and 30 important amino acid residues for MLO function, are well conserved. Phylogenetic analysis of the MLO genes from cucumber and other plant species reveals seven different clades (I through VII). Three of these clades comprised MLO genes from A. thaliana, rice, maize, and cucumber, suggesting that these genes may have evolved after the divergence of monocots and dicots. In silico mapping showed that these CsMLOs were located on chromosomes 1, 2, 3, 4, 5, and 6 without any obvious clustering, except CsMLO01. To our knowledge, this paper is the first comprehensive report on MLO genes in C. sativus. These findings will facilitate the functional characterization of the MLOs related to powdery mildew susceptibility and assist in the development of disease resistance in cucumber.

  19. Structure of the omega-gliadin gene family

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The '-gliadins are one of the classes of wheat seed storage proteins, but are the least characterized. In this report, an analysis is made of all available '-gliadin DNA sequences including '-gliadins genes within a large genomic clone, previously reported gene sequences, and ESTs identified from th...

  20. Gene-Environment Interplay, Family Relationships, and Child Adjustment

    ERIC Educational Resources Information Center

    Horwitz, Briana N.; Neiderhiser, Jenae M.

    2011-01-01

    This paper reviews behavioral genetic research from the past decade that has moved beyond simply studying the independent influences of genes and environments. The studies considered in this review have instead focused on understanding gene-environment interplay, including genotype-environment correlation (rGE) and genotype x environment…

  1. Characterization and Functional Analysis of PEBP Family Genes in Upland Cotton (Gossypium hirsutum L.)

    PubMed Central

    Wang, Congcong; Pang, Chaoyou; Wei, Hengling; Wang, Hantao; Song, Meizhen; Fan, Shuli; Yu, Shuxun

    2016-01-01

    Upland cotton (Gossypium hirsutum L.) is a naturally occurring photoperiod-sensitive perennial plant species. However, sensitivity to the day length was lost during domestication. The phosphatidylethanolamine-binding protein (PEBP) gene family, of which three subclades have been identified in angiosperms, functions to promote and suppress flowering in photoperiod pathway. Recent evidence indicates that PEBP family genes play an important role in generating mobile flowering signals. We isolated homologues of the PEBP gene family in upland cotton and examined their regulation and function. Nine PEBP-like genes were cloned and phylogenetic analysis indicated the genes belonged to four subclades (FT, MFT, TFL1 and PEBP). Cotton PEBP-like genes showed distinct expression patterns in relation to different cotton genotypes, photoperiod responsive and cultivar maturity. The GhFT gene expression of a semi-wild race of upland cotton were strongly induced under short day condition, whereas the GhPEBP2 gene expression was induced under long days. We also elucidated that GhFT but not GhPEBP2 interacted with FD-like bZIP transcription factor GhFD and promote flowering under both long- and short-day conditions. The present result indicated that GhPEBP-like genes may perform different functions. This work corroborates the involvement of PEBP-like genes in photoperiod response and regulation of flowering time in different cotton genotypes, and contributes to an improved understanding of the function of PEBP-like genes in cotton. PMID:27552108

  2. Familial migraine: Exclusion of the susceptibility gene from the reported locus of familial hemiplegic migraine on 19p

    SciTech Connect

    Hovatta, I.; Peltonen, L.; Kallela, M.; Faerkkilae, M.

    1994-10-01

    Genetic isolates are highly useful in analyses of the molecular background of complex diseases since the enrichment of a limited number of predisposing genes can be predicted in representative families or in specific geographical regions. It has been suggested that the pathophysiology and etiology of familial hemiplegic migraine (FHM) and typical migraine with aura are most probably the same. Recent assignment of FHM locus to chromosome 19p in two French families makes it now possible to test this hypothesis. We report here linkage data on four families with multiple cases of migraine disorder originating from the genetically isolated population of Finland. We were interested to discover whether the migraine in these families would also show linkage to the markers on 19p. We could exclude a region of 50 cM, flanking the reported FHM locus, as a site of migraine locus in our four families. It seems evident that locus heterogeneity exists between different diagnostic classes of migraine spectrum of diseases and also between different ethnic groups. 10 refs., 2 figs., 1 tab.

  3. A new member of the plasma protease inhibitor gene family.

    PubMed Central

    Ragg, H

    1986-01-01

    A 2.1-kb cDNA clone representing a new member of the protease inhibitor family was isolated from a human liver cDNA library. The inhibitor, named human Leuserpin 2 (hLS2), comprises 480 amino acids and contains a leucine residue at its putative reactive center. HLS2 is about 25-28% homologous to three human members of the plasma protease inhibitor family: antithrombin III, alpha 1-antitrypsin and alpha 1-antichymotrypsin. A comparison with published partial amino acid sequences shows that hLS2 is closely related to the thrombin inhibitor heparin cofactor II. Images PMID:3003690

  4. A genetic analysis of Adh1 regulation. Progress report, June 1991--February 1992

    SciTech Connect

    Freeling, M.

    1992-03-01

    The overall goal of our research proposal is to understand the meaning of the various cis-acting sites responsible for AdH1 expression in the entire maize plant. Progress is reported in the following areas: Studies on the TATA box and analysis of revertants of the Adh1-3F1124 allele; screening for more different mutants that affect Adh1 expression differentially; studies on cis-acting sequences required for root-specific Adh1 expression; refinement of the use of the particle gun; and functional analysis of a non- glycolytic anaerobic protein.

  5. ADH and ALDH polymorphisms among Alaska Natives entering treatment for alcoholism.

    PubMed

    Segal, B

    1999-01-01

    The alcohol dehydrogenase (ADHs) and aldehyde dehydrogenases (ALDHs) involved in alcohol metabolism are polymorphic. Different alleles encode subunits of the enzymes that are related to differences in alcohol metabolism with different ethnic groups. This study examined the allele frequencies at the ADH1, ADH2, ADH3 and ALDH2 loci in Alaska Natives entering treatment for alcoholism to determine if allele frequencies at these loci differ among five distinct Alaska Native groups: Yupik and Inupiat Eskimos, Athabascan, Tlingit and Aleut. It was found that all persons were homozygous for the ADH1*1, ADH2*1 and ALDH2*1 alleles. Variations, however, were found for the allele distribution of the ADH3 genotype. Comparison with a general population sample found no differences in allele distributions for ADHs and ALDH2*1, but differences were found when comparisons were made with four Asian Groups. The study's findings suggest that the Alaska Natives are not protected from the risk of alcoholism in the same way that Asians who possess the ALDH2*2 genotype are considered to have a negative risk factor. Nor, does there appear to be any generalized differences between Alaska Native alcoholics and members of the general population with respect to the ALDH and ADH polymorphisms studied herein.

  6. Duplication of OsHAP family genes and their association with heading date in rice.

    PubMed

    Li, Qiuping; Yan, Wenhao; Chen, Huaxia; Tan, Cong; Han, Zhongmin; Yao, Wen; Li, Guangwei; Yuan, Mengqi; Xing, Yongzhong

    2016-03-01

    Heterotrimeric Heme Activator Protein (HAP) family genes are involved in the regulation of flowering in plants. It is not clear how many HAP genes regulate heading date in rice. In this study, we identified 35 HAP genes, including seven newly identified genes, and performed gene duplication and candidate gene-based association analyses. Analyses showed that segmental duplication and tandem duplication are the main mechanisms of HAP gene duplication. Expression profiling and functional identification indicated that duplication probably diversifies the functions of HAP genes. A nucleotide diversity analysis revealed that 13 HAP genes underwent selection. A candidate gene-based association analysis detected four HAP genes related to heading date. An investigation of transgenic plants or mutants of 23 HAP genes confirmed that overexpression of at least four genes delayed heading date under long-day conditions, including the previously cloned Ghd8/OsHAP3H. Our results indicate that the large number of HAP genes in rice was mainly produced by gene duplication, and a few HAP genes function to regulate heading date. Selection of HAP genes is probably caused by their diverse functions rather than regulation of heading.

  7. Evolutionary Dynamics of the Interferon-Induced Transmembrane Gene Family in Vertebrates

    PubMed Central

    Zhang, Zhao; Liu, Jun; Li, Meng; Yang, Hui; Zhang, Chiyu

    2012-01-01

    Vertebrate interferon-induced transmembrane (IFITM) genes have been demonstrated to have extensive and diverse functions, playing important roles in the evolution of vertebrates. Despite observance of their functionality, the evolutionary dynamics of this gene family are complex and currently unknown. Here, we performed detailed evolutionary analyses to unravel the evolutionary history of the vertebrate IFITM family. A total of 174 IFITM orthologous genes and 112 pseudogenes were identified from 27 vertebrate genome sequences. The vertebrate IFITM family can be divided into immunity-related IFITM (IR-IFITM), IFITM5 and IFITM10 sub-families in phylogeny, implying origins from three different progenitors. In general, vertebrate IFITM genes are located in two loci, one containing the IFITM10 gene, and the other locus containing IFITM5 and various numbers of IR-IFITM genes. Conservation of evolutionary synteny was observed in these IFITM genes. Significant functional divergence was detected among the three IFITM sub-families. No gene duplication or positive selection was found in IFITM5 sub-family, implying the functional conservation of IFITM5 in vertebrate evolution, which is involved in bone formation. No IFITM5 locus was identified in the marmoset genome, suggesting a potential association with the tiny size of this monkey. The IFITM10 sub-family was divided into two groups: aquatic and terrestrial types. Functional divergence was detected between the two groups, and five IFITM10-like genes from frog were dispersed into the two groups. Both gene duplication and positive selection were observed in aquatic vertebrate IFITM10-like genes, indicating that IFITM10 might be associated with the adaptation to aquatic environments. A large number of lineage- and species-specific gene duplications were observed in IR-IFITM sub-family and positive selection was detected in IR-IFITM of primates and rodents. Because primates have experienced a long history of viral infection

  8. Natural Killer Cell Receptor Genes in the Family Equidae: Not only Ly49

    PubMed Central

    Futas, Jan; Horin, Petr

    2013-01-01

    Natural killer (NK) cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR) and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR) represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA) and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM) domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for evolutionary biology of

  9. Natural killer cell receptor genes in the family Equidae: not only Ly49.

    PubMed

    Futas, Jan; Horin, Petr

    2013-01-01

    Natural killer (NK) cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR) and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR) represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA) and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM) domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for evolutionary biology of

  10. Genome-Wide Identification and Analysis of the TIFY Gene Family in Grape

    PubMed Central

    Zhang, Yucheng; Gao, Min; Singer, Stacy D.; Fei, Zhangjun; Wang, Hua; Wang, Xiping

    2012-01-01

    Background The TIFY gene family constitutes a plant-specific group of genes with a broad range of functions. This family encodes four subfamilies of proteins, including ZML, TIFY, PPD and JASMONATE ZIM-Domain (JAZ) proteins. JAZ proteins are targets of the SCFCOI1 complex, and function as negative regulators in the JA signaling pathway. Recently, it has been reported in both Arabidopsis and rice that TIFY genes, and especially JAZ genes, may be involved in plant defense against insect feeding, wounding, pathogens and abiotic stresses. Nonetheless, knowledge concerning the specific expression patterns and evolutionary history of plant TIFY family members is limited, especially in a woody species such as grape. Methodology/Principal Findings A total of two TIFY, four ZML, two PPD and 11 JAZ genes were identified in the Vitis vinifera genome. Phylogenetic analysis of TIFY protein sequences from grape, Arabidopsis and rice indicated that the grape TIFY proteins are more closely related to those of Arabidopsis than those of rice. Both segmental and tandem duplication events have been major contributors to the expansion of the grape TIFY family. In addition, synteny analysis between grape and Arabidopsis demonstrated that homologues of several grape TIFY genes were found in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of lineages that led to grape and Arabidopsis. Analyses of microarray and quantitative real-time RT-PCR expression data revealed that grape TIFY genes are not a major player in the defense against biotrophic pathogens or viruses. However, many of these genes were responsive to JA and ABA, but not SA or ET. Conclusion The genome-wide identification, evolutionary and expression analyses of grape TIFY genes should facilitate further research of this gene family and provide new insights regarding their evolutionary history and regulatory control. PMID:22984514

  11. Variation in the nucleotide sequence of a prolamin gene family in wild rice.

    PubMed

    Barbier, P; Ishihama, A

    1990-07-01

    Variation in the DNA sequence of the 10 kDa prolamin gene family within the wild rice species Oryza rufipogon was probed using the direct sequencing of PCR-amplified genes. A comparison of the nucleotide and deduced amino-acid sequences of eight Asian strains of O. rufipogon and one strain of the related African species O. longistaminata is presented.

  12. Genome-wide identification and phylogenetic analysis of the SBP-box gene family in melons.

    PubMed

    Ma, Y; Guo, J W; Bade, R; Men, Z H; Hasi, A

    2014-10-27

    The SBP-box gene family is specific to plants and encodes a class of zinc finger-containing transcription factors with a broad range of functions. Although SBP-box genes have been identified in numerous plants, including green algae, moss, silver birch, snapdragon, Arabidopsis, rice, and maize, there is little information concerning SBP-box genes, or the corresponding miR156/157, function in melon. Using the highly conserved sequence of the Arabidopsis thaliana SBP-box domain protein as a probe of information sequence, the genome-wide protein database of melon was explored to obtain 13 SBP-box protein sequences, which were further divided into 4 groups, based on phylogenetic analysis. A further analysis centered on the melon SBP-box genetic family's phylogenetic evolution, sequence similarities, gene structure, and miR156 target sequence was also conducted. Analysis of all the expression patterns of melon SBP-box family genes showed that the SBP-box genes were detected in 7 kinds of tissue, and fruit had the highest expression level. CmSBP11 tends to present its specific expression in melon fruit and root. CmSBP09 expression was the highest in flower. Overall, the molecular evolution and expression pattern of the melon SBP-box gene family, revealed by these results, suggest its function differentiation that followed gene duplication.

  13. Cloning and expression analysis of novel Aux/IAA family genes in Gossypium hirsutum

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Members of the auxin/indole-3-acetic acid (Aux/IAA) gene family encode proteins to mediate the responses of auxin gene expression and to regulate various aspects of plant morphological development. In this paper, we report the identification of nine cDNAs that contain complete open reading frame (OR...

  14. Comparative Genome-Wide Analysis of the Malate Dehydrogenase Gene Families in Cotton

    PubMed Central

    Imran, Muhammad; Tang, Kai; Liu, Jin-Yuan

    2016-01-01

    Malate dehydrogenases (MDHs) play crucial roles in the physiological processes of plant growth and development. In this study, 13 and 25 MDH genes were identified from Gossypium raimondii and Gossypium hirsutum, respectively. Using these and 13 previously reported Gossypium arboretum MDH genes, a comparative molecular analysis between identified MDH genes from G. raimondii, G. hirsutum, and G. arboretum was performed. Based on multiple sequence alignments, cotton MDHs were divided into five subgroups: mitochondrial MDH, peroxisomal MDH, plastidial MDH, chloroplastic MDH and cytoplasmic MDH. Almost all of the MDHs within the same subgroup shared similar gene structure, amino acid sequence, and conserved motifs in their functional domains. An analysis of chromosomal localization suggested that segmental duplication played a major role in the expansion of cotton MDH gene families. Additionally, a selective pressure analysis indicated that purifying selection acted as a vital force in the evolution of MDH gene families in cotton. Meanwhile, an expression analysis showed the distinct expression profiles of GhMDHs in different vegetative tissues and at different fiber developmental stages, suggesting the functional diversification of these genes in cotton growth and fiber development. Finally, a promoter analysis indicated redundant but typical cis-regulatory elements for the potential functions and stress activity of many MDH genes. This study provides fundamental information for a better understanding of cotton MDH gene families and aids in functional analyses of the MDH genes in cotton fiber development. PMID:27829020

  15. Evolution of the insect desaturase gene family with an emphasis on social Hymenoptera.

    PubMed

    Helmkampf, Martin; Cash, Elizabeth; Gadau, Jürgen

    2015-02-01

    Desaturase genes are essential for biological processes, including lipid metabolism, cell signaling, and membrane fluidity regulation. Insect desaturases are particularly interesting for their role in chemical communication, and potential contribution to speciation, symbioses, and sociality. Here, we describe the acyl-CoA desaturase gene families of 15 insects, with a focus on social Hymenoptera. Phylogenetic reconstruction revealed that the insect desaturases represent an ancient gene family characterized by eight subfamilies that differ strongly in their degree of conservation and frequency of gene gain and loss. Analyses of genomic organization showed that five of these subfamilies are represented in a highly microsyntenic region conserved across holometabolous insect taxa, indicating an ancestral expansion during early insect evolution. In three subfamilies, ants exhibit particularly large expansions of genes. Despite these expansions, however, selection analyses showed that desaturase genes in all insect lineages are predominantly undergoing strong purifying selection. Finally, for three expanded subfamilies, we show that ants exhibit variation in gene expression between species, and more importantly, between sexes and castes within species. This suggests functional differentiation of these genes and a role in the regulation of reproductive division of labor in ants. The dynamic pattern of gene gain and loss of acyl-CoA desaturases in ants may reflect changes in response to ecological diversification and an increased demand for chemical signal variability. This may provide an example of how gene family expansions can contribute to lineage-specific adaptations through structural and regulatory changes acting in concert to produce new adaptive phenotypes.

  16. The Classical Arabinogalactan Protein Gene Family of Arabidopsis

    PubMed Central

    Schultz, Carolyn J.; Johnson, Kim L.; Currie, Graeme; Bacic, Antony

    2000-01-01

    Arabinogalactan proteins (AGPs) are extracellular proteoglycans implicated in plant growth and development. We searched for classical AGPs in Arabidopsis by identifying expressed sequence tags based on the conserved domain structure of the predicted protein backbone. To confirm that these genes encoded bona fide AGPs, we purified native AGPs and then deglycosylated and deblocked them for N-terminal protein sequencing. In total, we identified 15 genes encoding the protein backbones of classical AGPs, including genes for AG peptides—AGPs with very short backbones (10 to 13 amino acid residues). Seven of the AGPs were verified as AGPs by protein sequencing. A gene encoding a putative cell adhesion molecule with AGP-like domains was also identified. This work provides a firm foundation for beginning functional analysis by using a genetic approach. PMID:11006345

  17. Interferon induced IFIT family genes in host antiviral defense

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Secretion of interferons (IFNs) from virus-infected cells is a hallmark of host antiviral immunity and in fact, IFNs exert their antiviral activities through the induction of antiviral proteins. The IFN-induced protein with tetratricopeptide repeats (IFITs) family is among hundreds of IF stimulated ...

  18. Cloning and high-level expression of the glutathione-independent formaldehyde dehydrogenase gene from Pseudomonas putida.

    PubMed Central

    Ito, K; Takahashi, M; Yoshimoto, T; Tsuru, D

    1994-01-01

    A DNA fragment of 485 bp was specifically amplified by PCR with primers based on the N-terminal sequence of the purified formaldehyde dehydrogenase (EC 1.2.1.46) from Pseudomonas putida and on that of a cyanogen bromide-derived peptide. With this product as a probe, a gene coding for formaldehyde dehydrogenase (fdhA) in P. putida chromosomal DNA was cloned in Escherichia coli DH5 alpha. Sequencing analysis revealed that the fdhA gene contained 1,197-bp open reading frame, encoding a protein composed of 399 amino acid residues whose calculated molecular weight was 42,082. The transformant of E. coli DH5 alpha harboring the hybrid plasmid, pFDHK3DN71, showed about 50-fold-higher formaldehyde dehydrogenase activity than P. putida. The predicted amino acid sequence contained several features characteristic of the zinc-containing medium-chain alcohol dehydrogenase (ADH) family. Most of the glycine residues strictly conserved within the family, including a Gly-Xaa-Gly-Xaa-Xaa-Gly pattern in the coenzyme binding domain, were well conserved in this enzyme. Regions around both the catalytic and the structural zinc atoms were also conserved. Analyses of structural and enzymatic characteristics indicated that P. putida FDH belongs to the medium-chain ADH family, with mixed properties of mammalian class I and III ADHs. Images PMID:8169197

  19. The Wall-associated Kinase gene family in rice genomes.

    PubMed

    de Oliveira, Luiz Felipe Valter; Christoff, Ana Paula; de Lima, Júlio Cesar; de Ross, Bruno Comparsi Feijó; Sachetto-Martins, Gilberto; Margis-Pinheiro, Marcia; Margis, Rogerio

    2014-12-01

    The environment is a dynamic system in which life forms adapt. Wall-Associated Kinases (WAK) are a subfamily of receptor-like kinases associated with the cell wall. These genes have been suggested as sensors of the extracellular environment and triggers of intracellular signals. They belong to the ePK superfamily with or without a conserved arginine before the catalytic subdomain VIB, which characterizes RD and non-RD WAKs. WAK is a large subfamily in rice. We performed an extensive comparison of WAK genes from A. thaliana (AtWAK), O. sativa japonica and indica subspecies (OsWAK). Phylogenetic studies and WAK domain characterization allowed for the identification of two distinct groups of WAK genes in Arabidopsis and rice. One group corresponds to a cluster containing only OsWAKs that most likely expanded after the monocot-dicot separation, which evolved into a non-RD kinase class. The other group comprises classical RD-kinases with both AtWAK and OsWAK representatives. Clusterization analysis using extracellular and kinase domains demonstrated putative functional redundancy for some genes, but also highlighted genes that could recognize similar extracellular stimuli and activate different cascades. The gene expression pattern of WAKs in response to cold suggests differences in the regulation of the OsWAK genes in the indica and japonica subspecies. Our results also confirm the hypothesis of functional diversification between A. thaliana and O. sativa WAK genes. Furthermore, we propose that plant WAKs constitute two evolutionarily related but independent subfamilies: WAK-RD and WAK-nonRD. Recognition of this structural division will further provide insights to understanding WAK functions and regulations.

  20. Atypical Protein Phosphatase 2A Gene Families Do Not Expand via Paleopolyploidization1[OPEN

    PubMed Central

    2017-01-01

    Protein phosphatase 2A (PP2A) presents unique opportunities for analyzing molecular mechanisms of functional divergence between gene family members. The canonical PP2A holoenzyme regulates multiple eukaryotic signaling pathways by dephosphorylating target proteins and contains a catalytic (C) subunit, a structural/scaffolding (A) subunit, and a regulatory (B) subunit. Genes encoding PP2A subunits have expanded into multigene families in both flowering plants and mammals, and the extent to which different isoform functions may overlap is not clearly understood. To gain insight into the diversification of PP2A subunits, we used phylogenetic analyses to reconstruct the evolutionary histories of PP2A gene families in Arabidopsis (Arabidopsis thaliana). Genes encoding PP2A subunits in mammals represent ancient lineages that expanded early in vertebrate evolution, while flowering plant PP2A subunit lineages evolved much more recently. Despite this temporal difference, our data indicate that the expansion of PP2A subunit gene families in both flowering plants and animals was driven by whole-genome duplications followed by nonrandom gene loss. Selection analysis suggests that the expansion of one B subunit gene family (B56/PPP2R5) was driven by functional diversification rather than by the maintenance of gene dosage. We also observed reduced expansion rates in three distinct B subunit subclades. One of these subclades plays a highly conserved role in cell division, while the distribution of a second subclade suggests a specialized function in supporting beneficial microbial associations. Thus, while whole-genome duplications have driven the expansion and diversification of most PP2A gene families, members of functionally specialized subclades quickly revert to singleton status after duplication events. PMID:28034953

  1. Receptor-like kinases from Arabidopsis form a monophyletic gene family related to animal receptor kinases

    PubMed Central

    Shiu, Shin-Han; Bleecker, Anthony B.

    2001-01-01

    Plant receptor-like kinases (RLKs) are proteins with a predicted signal sequence, single transmembrane region, and cytoplasmic kinase domain. Receptor-like kinases belong to a large gene family with at least 610 members that represent nearly 2.5% of Arabidopsis protein coding genes. We have categorized members of this family into subfamilies based on both the identity of the extracellular domains and the phylogenetic relationships between the kinase domains of subfamily members. Surprisingly, this structurally defined group of genes is monophyletic with respect to kinase domains when compared with the other eukaryotic kinase families. In an extended analysis, animal receptor kinases, Raf kinases, plant RLKs, and animal receptor tyrosine kinases form a well supported group sharing a common origin within the superfamily of serine/threonine/tyrosine kinases. Among animal kinase sequences, Drosophila Pelle and related cytoplasmic kinases fall within the plant RLK clade, which we now define as the RLK/Pelle family. A survey of expressed sequence tag records for land plants reveals that mosses, ferns, conifers, and flowering plants have similar percentages of expressed sequence tags representing RLK/Pelle homologs, suggesting that the size of this gene family may have been close to the present-day level before the diversification of land plant lineages. The distribution pattern of four RLK subfamilies on Arabidopsis chromosomes indicates that the expansion of this gene family is partly a consequence of duplication and reshuffling of the Arabidopsis genome and of the generation of tandem repeats. PMID:11526204

  2. Differential expression of a protease gene family in African Trypanosomes

    PubMed Central

    Helm, Jared R.; Wilson, Mary E.; Donelson, John E.

    2008-01-01

    During their life cycle African trypanosomes must quickly adapt to the different environments of the tsetse fly midgut and the mammalian bloodstream by modulating expression of many of their genes. One group of these differentially expressed genes encodes different forms of a major surface protease. Using a luciferase reporter gene transiently or permanently transfected into trypanosomes, we show here that the 3′-UTRs of these protease genes are responsible for their differential expression. Deletion analysis of the 389-bp 3′-UTR of one of the protease genes, MSP-B, demonstrated that it contains a U-rich regulatory region of about 23 bp (UCGUCUGUUAUUUCUUAGUCCAG), which suppresses expression of the reporter protein in bloodstream trypanosomes by as much as 25-fold, but has little effect on the reporter expression in procyclic (tsetse fly) trypanosomes. Replacing the entire 3′-UTR with just this 23-bp element mimicked most of the suppression effect of the complete 3′-UTR. Northern blots showed that the 23-bp element influences the steady state RNA level, but not enough to account for the 25-fold suppression effect. Polysome analyses showed that in procyclic trypanosomes more of the total protease mRNA is associated with intermediate-sized and large polysomes than in bloodstream trypanosomes. Thus, the 23-bp element of this protease gene affects both the level of RNA and its translation. PMID:18848586

  3. Gene Panel Testing in Epileptic Encephalopathies and Familial Epilepsies

    PubMed Central

    Møller, Rikke S.; Larsen, Line H.G.; Johannesen, Katrine M.; Talvik, Inga; Talvik, Tiina; Vaher, Ulvi; Miranda, Maria J.; Farooq, Muhammad; Nielsen, Jens E.K.; Svendsen, Lene Lavard; Kjelgaard, Ditte B.; Linnet, Karen M.; Hao, Qin; Uldall, Peter; Frangu, Mimoza; Tommerup, Niels; Baig, Shahid M.; Abdullah, Uzma; Born, Alfred P.; Gellert, Pia; Nikanorova, Marina; Olofsson, Kern; Jepsen, Birgit; Marjanovic, Dragan; Al-Zehhawi, Lana I.K.; Peñalva, Sofia J.; Krag-Olsen, Bente; Brusgaard, Klaus; Hjalgrim, Helle; Rubboli, Guido; Pal, Deb K.; Dahl, Hans A.

    2016-01-01

    In recent years, several genes have been causally associated with epilepsy. However, making a genetic diagnosis in a patient can still be difficult, since extensive phenotypic and genetic heterogeneity has been observed in many monogenic epilepsies. This study aimed to analyze the genetic basis of a wide spectrum of epilepsies with age of onset spanning from the neonatal period to adulthood. A gene panel targeting 46 epilepsy genes was used on a cohort of 216 patients consecutively referred for panel testing. The patients had a range of different epilepsies from benign neonatal seizures to epileptic encephalopathies (EEs). Potentially causative variants were evaluated by literature and database searches, submitted to bioinformatic prediction algorithms, and validated by Sanger sequencing. If possible, parents were included for segregation analysis. We identified a presumed disease-causing variant in 49 (23%) of the 216 patients. The variants were found in 19 different genes including SCN1A, STXBP1, CDKL5, SCN2A, SCN8A, GABRA1, KCNA2, and STX1B. Patients with neonatal-onset epilepsies had the highest rate of positive findings (57%). The overall yield for patients with EEs was 32%, compared to 17% among patients with generalized epilepsies and 16% in patients with focal or multifocal epilepsies. By the use of a gene panel consisting of 46 epilepsy genes, we were able to find a disease-causing genetic variation in 23% of the analyzed patients. The highest yield was found among patients with neonatal-onset epilepsies and EEs. PMID:27781031

  4. Identification of a new, unorthodox member of the MAGE gene family.

    PubMed

    Põld, M; Zhou, J; Chen, G L; Hall, J M; Vescio, R A; Berenson, J R

    1999-07-15

    Several tumor-associated antigen families, such as MAGE, GAGE/PAGE, PRAME, BAGE, and LAGE/NY-ESO-1, exist. These antigens are of particular interest in tumor immunology, because their expression, with exception of testis and fetal tissues, seems to be restricted to tumor cells only. We have identified a novel member of the MAGE gene family, MAGED1. Northern hybridization and RT-PCR demonstrated that the expression level of MAGED1 in different normal adult tissues is comparable to that in testis and fetal liver. Thus, MAGED1 does not possess an expression pattern characteristic of previously identified MAGE family genes, suggesting that the biology of the MAGE-family genes is more complex than previously thought. Chromosome mapping linked MAGED1 to marker AFM119xd6 (DXS1039) on chromosome Xp11.23.

  5. The SOD Gene Family in Tomato: Identification, Phylogenetic Relationships, and Expression Patterns.

    PubMed

    Feng, Kun; Yu, Jiahong; Cheng, Yuan; Ruan, Meiying; Wang, Rongqing; Ye, Qingjing; Zhou, Guozhi; Li, Zhimiao; Yao, Zhuping; Yang, Yuejian; Zheng, Qingsong; Wan, Hongjian

    2016-01-01

    Superoxide dismutases (SODs) are critical antioxidant enzymes that protect organisms from reactive oxygen species (ROS) caused by adverse conditions, and have been widely found in the cytoplasm, chloroplasts, and mitochondria of eukaryotic and prokaryotic cells. Tomato (Solanum lycopersicum L.) is an important economic crop and is cultivated worldwide. However, abiotic and biotic stresses severely hinder growth and development of the plant, which affects the production and quality of the crop. To reveal the potential roles of SOD genes under various stresses, we performed a systematic analysis of the tomato SOD gene family and analyzed the expression patterns of SlSOD genes in response to abiotic stresses at the whole-genome level. The characteristics of the SlSOD gene family were determined by analyzing gene structure, conserved motifs, chromosomal distribution, phylogenetic relationships, and expression patterns. We determined that there are at least nine SOD genes in tomato, including four Cu/ZnSODs, three FeSODs, and one MnSOD, and they are unevenly distributed on 12 chromosomes. Phylogenetic analyses of SOD genes from tomato and other plant species were separated into two groups with a high bootstrap value, indicating that these SOD genes were present before the monocot-dicot split. Additionally, many cis-elements that respond to different stresses were found in the promoters of nine SlSOD genes. Gene expression analysis based on RNA-seq data showed that most genes were expressed in all tested tissues, with the exception of SlSOD6 and SlSOD8, which were only expressed in young fruits. Microarray data analysis showed that most members of the SlSOD gene family were altered under salt- and drought-stress conditions. This genome-wide analysis of SlSOD genes helps to clarify the function of SlSOD genes under different stress conditions and provides information to aid in further understanding the evolutionary relationships of SOD genes in plants.

  6. The SOD Gene Family in Tomato: Identification, Phylogenetic Relationships, and Expression Patterns

    PubMed Central

    Feng, Kun; Yu, Jiahong; Cheng, Yuan; Ruan, Meiying; Wang, Rongqing; Ye, Qingjing; Zhou, Guozhi; Li, Zhimiao; Yao, Zhuping; Yang, Yuejian; Zheng, Qingsong; Wan, Hongjian

    2016-01-01

    Superoxide dismutases (SODs) are critical antioxidant enzymes that protect organisms from reactive oxygen species (ROS) caused by adverse conditions, and have been widely found in the cytoplasm, chloroplasts, and mitochondria of eukaryotic and prokaryotic cells. Tomato (Solanum lycopersicum L.) is an important economic crop and is cultivated worldwide. However, abiotic and biotic stresses severely hinder growth and development of the plant, which affects the production and quality of the crop. To reveal the potential roles of SOD genes under various stresses, we performed a systematic analysis of the tomato SOD gene family and analyzed the expression patterns of SlSOD genes in response to abiotic stresses at the whole-genome level. The characteristics of the SlSOD gene family were determined by analyzing gene structure, conserved motifs, chromosomal distribution, phylogenetic relationships, and expression patterns. We determined that there are at least nine SOD genes in tomato, including four Cu/ZnSODs, three FeSODs, and one MnSOD, and they are unevenly distributed on 12 chromosomes. Phylogenetic analyses of SOD genes from tomato and other plant species were separated into two groups with a high bootstrap value, indicating that these SOD genes were present before the monocot-dicot split. Additionally, many cis-elements that respond to different stresses were found in the promoters of nine SlSOD genes. Gene expression analysis based on RNA-seq data showed that most genes were expressed in all tested tissues, with the exception of SlSOD6 and SlSOD8, which were only expressed in young fruits. Microarray data analysis showed that most members of the SlSOD gene family were altered under salt- and drought-stress conditions. This genome-wide analysis of SlSOD genes helps to clarify the function of SlSOD genes under different stress conditions and provides information to aid in further understanding the evolutionary relationships of SOD genes in plants. PMID:27625661

  7. Characterization of three members of the ACC synthase gene family in Solanum tuberosum L.

    PubMed

    Destéfano-Beltrán, L J; van Caeneghem, W; Gielen, J; Richard, L; van Montagu, M; van der Straeten, D

    1995-02-20

    Two genomic clones corresponding to three members of the 1-aminocyclopropane-1-carboxylic acid (ACC) synthase gene family in potato (Solanum tuberosum L.) have been isolated and sequenced. Two highly homologous genes, ST-ACS1A and ST-ACS1B, transcribed in opposite directions were found in an 8.9 kb region. Their coding sequences are interrupted by two introns at identical positions. Their closest relative in tomato is the LE-ACS3 gene. The third gene in potato, ST-ACS2, was found in a 4 kb region and shows a gene structure similar to that of the tomato LE-ACS4 gene and to the mung bean VR-ACS4 and VR-ACS5 genes. Based on its lack of significant homology to the tomato gene family and its closeness to the VR-ACS4 and VR-ACS5 genes, we propose that LE-ACS7 represents an additional isoform in the tomato genome. Moreover, in a phylogenetic comparison of known ACC synthases, the ST-ACS2 isoform was grouped in a separate lineage together with the mung bean VR-ACS4 and VR-ACS5, and the moth orchid DS-ACS1A and DS-ACS1B gene products. Expression of the three potato genes was studied by reverse transcription-polymerase chain reaction on total RNA. The twin genes are positively regulated by indole-3-acetic acid in hypocotyls and expression is modulated by wounding in the leaves. The third gene is responsive to ethylene and wounding mainly in tubers. The roles of these three genes and of other members of the ACC synthase gene family in vegetative processes of potato such as tuberization, dormancy, and sprouting have yet to be determined.

  8. High Gene Family Turnover Rates and Gene Space Adaptation in the Compact Genome of the Carnivorous Plant Utricularia gibba.

    PubMed

    Carretero-Paulet, Lorenzo; Librado, Pablo; Chang, Tien-Hao; Ibarra-Laclette, Enrique; Herrera-Estrella, Luis; Rozas, Julio; Albert, Victor A

    2015-05-01

    Utricularia gibba is an aquatic carnivorous plant with highly specialized morphology, featuring fibrous floating networks of branches and leaf-like organs, no recognizable roots, and bladder traps that capture and digest prey. We recently described the compressed genome of U. gibba as sufficient to control the development and reproduction of a complex organism. We hypothesized intense deletion pressure as a mechanism whereby most noncoding DNA was deleted, despite evidence for three independent whole-genome duplications (WGDs). Here, we explore the impact of intense genome fractionation in the evolutionary dynamics of U. gibba's functional gene space. We analyze U. gibba gene family turnover by modeling gene gain/death rates under a maximum-likelihood statistical framework. In accord with our deletion pressure hypothesis, we show that the U. gibba gene death rate is significantly higher than those of four other eudicot species. Interestingly, the gene gain rate is also significantly higher, likely reflecting the occurrence of multiple WGDs and possibly also small-scale genome duplications. Gene ontology enrichment analyses of U. gibba-specific two-gene orthogroups, multigene orthogroups, and singletons highlight functions that may represent adaptations in an aquatic carnivorous plant. We further discuss two homeodomain transcription factor gene families (WOX and HDG/HDZIP-IV) showing conspicuous differential expansions and contractions in U. gibba. Our results 1) reconcile the compactness of the U. gibba genome with its accommodation of a typical number of genes for a plant genome, and 2) highlight the role of high gene family turnover in the evolutionary diversification of U. gibba's functional gene space and adaptations to its unique lifestyle and highly specialized body plan.

  9. The ZIC gene family encodes multi-functional proteins essential for patterning and morphogenesis.

    PubMed

    Houtmeyers, Rob; Souopgui, Jacob; Tejpar, Sabine; Arkell, Ruth

    2013-10-01

    The zinc finger of the cerebellum gene (ZIC) discovered in Drosophila melanogaster (odd-paired) has five homologs in Xenopus, chicken, mice, and humans, and seven in zebrafish. This pattern of gene copy expansion is accompanied by a divergence in gene and protein structure, suggesting that Zic family members share some, but not all, functions. ZIC genes are implicated in neuroectodermal development and neural crest cell induction. All share conserved regions encoding zinc finger domains, however their heterogeneity and specification remain unexplained. In this review, the evolution, structure, and expression patterns of the ZIC homologs are described; specific functions attributable to individual family members are supported. A review of data from functional studies in Xenopus and murine models suggest that ZIC genes encode multifunctional proteins operating in a context-specific manner to drive critical events during embryogenesis. The identification of ZIC mutations in congenital syndromes highlights the relevance of these genes in human development.

  10. Polymorphism and selection in the major histocompatibility complex DRA and DQA genes in the family Equidae.

    PubMed

    Janova, Eva; Matiasovic, Jan; Vahala, Jiri; Vodicka, Roman; Van Dyk, Enette; Horin, Petr

    2009-07-01

    The major histocompatibility complex genes coding for antigen binding and presenting molecules are the most polymorphic genes in the vertebrate genome. We studied the DRA and DQA gene polymorphism of the family Equidae. In addition to 11 previously reported DRA and 24 DQA alleles, six new DRA sequences and 13 new DQA alleles were identified in the genus Equus. Phylogenetic analysis of both DRA and DQA sequences provided evidence for trans-species polymorphism in the family Equidae. The phylogenetic trees differed from species relationships defined by standard taxonomy of Equidae and from trees based on mitochondrial or neutral gene sequence data. Analysis of selection showed differences between the less variable DRA and more variable DQA genes. DRA alleles were more often shared by more species. The DQA sequences analysed showed strong amongst-species positive selection; the selected amino acid positions mostly corresponded to selected positions in rodent and human DQA genes.

  11. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

    PubMed

    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

  12. From manual curation to visualization of gene families and networks across Solanaceae plant species.

    PubMed

    Pujar, Anuradha; Menda, Naama; Bombarely, Aureliano; Edwards, Jeremy D; Strickler, Susan R; Mueller, Lukas A

    2013-01-01

    High-quality manual annotation methods and practices need to be scaled to the increased rate of genomic data production. Curation based on gene families and gene networks is one approach that can significantly increase both curation efficiency and quality. The Sol Genomics Network (SGN; http://solgenomics.net) is a comparative genomics platform, with genetic, genomic and phenotypic information of the Solanaceae family and its closely related species that incorporates a community-based gene and phenotype curation system. In this article, we describe a manual curation system for gene families aimed at facilitating curation, querying and visualization of gene interaction patterns underlying complex biological processes, including an interface for efficiently capturing information from experiments with large data sets reported in the literature. Well-annotated multigene families are useful for further exploration of genome organization and gene evolution across species. As an example, we illustrate the system with the multigene transcription factor families, WRKY and Small Auxin Up-regulated RNA (SAUR), which both play important roles in responding to abiotic stresses in plants. Database URL: http://solgenomics.net/

  13. Duplications and losses in gene families of rust pathogens highlight putative effectors

    PubMed Central

    Pendleton, Amanda L.; Smith, Katherine E.; Feau, Nicolas; Martin, Francis M.; Grigoriev, Igor V.; Hamelin, Richard; Nelson, C. Dana; Burleigh, J. Gordon; Davis, John M.

    2014-01-01

    Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity. PMID:25018762

  14. Conservation and diversity of gene families explored using the CODEHOP strategy in higher plants

    PubMed Central

    Morant, Marc; Hehn, Alain; Werck-Reichhart, Danièle

    2002-01-01

    Background Availability of genomewide information on an increasing but still limited number of plants offers the possibility of identifying orthologues, or related genes, in species with major economical impact and complex genomes. In this paper we exploit the recently described CODEHOP primer design and PCR strategy for targeted isolation of homologues in large gene families. Results The method was tested with two different objectives. The first was to analyze the evolution of the CYP98 family of cytochrome P450 genes involved in 3-hydroxylation of phenolic compounds and lignification in a broad range of plant species. The second was to isolate an orthologue of the sorghum glucosyl transferase UGT85B1 and to determine the complexity of the UGT85 family in wheat. P450s of the CYP98 family or closely related sequences were found in all vascular plants. No related sequence was found in moss. Neither extensive duplication of the CYP98 genes nor an orthologue of UGT85B1 were found in wheat. The UGT85A subfamily was however found to be highly variable in wheat. Conclusions Our data are in agreement with the implication of CYP98s in lignification and the evolution of 3-hydroxylation of lignin precursors with vascular plants. High conservation of the CYP98 family strongly argues in favour of an essential function in plant development. Conversely, high duplication and diversification of the UGT85A gene family in wheat suggests its involvement in adaptative response and provides a valuable pool of genes for biotechnological applications. This work demonstrates the high potential of the CODEHOP strategy for the exploration of large gene families in plants. PMID:12153706

  15. Identification and expression of nor efflux family genes in Staphylococcus epidermidis that act against gatifloxacin.

    PubMed

    Juárez-Verdayes, Marco A; Parra-Ortega, Berenice; Hernández-Rodríguez, César; Betanzos-Cabrera, Gabriel; Rodríguez-Martínez, Sandra; Cancino-Diaz, Mario E; Cancino-Diaz, Juan C

    2012-06-01

    NorA, NorB, and NorC are efflux proteins in the Nor family that regulate the secretion of fluoroquinolones, and MgrA/NorR is a transcription factor of the Nor family. Overexpression of Nor family proteins provides fluoroquinolone resistance in Staphylococcus aureus. However, in coagulase-negative staphylococci (CNS), members of the Nor family had not been identified. In this work, the presence of Nor family proteins in Staphylococcus spp. and the expression of Nor family in gatifloxacin resistant S. epidermidis strains obtained from ocular infections (OI) were identified and analyzed. S. epidermidis strains from OIs (n = 44) and healthy skin (HS; n = 52) were isolated. The nor family genes were identified in CNS using PCR, sequencing and phylogenetic approaches. Nor family expression was determined by RT-PCR. NorA efflux activity was determined using the automated ethidium bromide method. In-silico analysis showed that norA, mgrA/norR, and "norB-like" and "norC-like" (norB/norC) genes are present in CNS. The nor family genes were distributed and constitutively expressed in all S. epidermidis strains studied. In one gatifloxacin resistant strain isolated from the endophthalmitis, treatment with gatifloxacin induced overexpression of the norA gene and resulted in high activity of NorA efflux. These results indicate that the Nor family of proteins is present in CNS, and the NorA efflux mechanism for gatifloxacin response occurs in at least one strain of S. epidermidis, contributing to gatifloxacin resistance.

  16. Comparative genome analysis of lignin biosynthesis gene families across the plant kingdom

    PubMed Central

    2009-01-01

    Background As a major component of plant cell wall, lignin plays important roles in mechanical support, water transport, and stress responses. As the main cause for the recalcitrance of plant cell wall, lignin modification has been a major task for bioenergy feedstock improvement. The study of the evolution and function of lignin biosynthesis genes thus has two-fold implications. First, the lignin biosynthesis pathway provides an excellent model to study the coordinative evolution of a biochemical pathway in plants. Second, understanding the function and evolution of lignin biosynthesis genes will guide us to develop better strategies for bioenergy feedstock improvement. Results We analyzed lignin biosynthesis genes from fourteen plant species and one symbiotic fungal species. Comprehensive comparative genome analysis was carried out to study the distribution, relatedness, and family expansion of the lignin biosynthesis genes across the plant kingdom. In addition, we also analyzed the comparative synteny map between rice and sorghum to study the evolution of lignin biosynthesis genes within the Poaceae family and the chromosome evolution between the two species. Comprehensive lignin biosynthesis gene expression analysis was performed in rice, poplar and Arabidopsis. The representative data from rice indicates that different fates of gene duplications exist for lignin biosynthesis genes. In addition, we also carried out the biomass composition analysis of nine Arabidopsis mutants with both MBMS analysis and traditional wet chemistry methods. The results were analyzed together with the genomics analysis. Conclusion The research revealed that, among the species analyzed, the complete lignin biosynthesis pathway first appeared in moss; the pathway is absent in green algae. The expansion of lignin biosynthesis gene families correlates with substrate diversity. In addition, we found that the expansion of the gene families mostly occurred after the divergence of monocots

  17. Evidence for Retrogene Origins of the Prion Gene Family

    PubMed Central

    Ehsani, Sepehr; Tao, Renzhu; Pocanschi, Cosmin L.; Ren, Hezhen; Harrison, Paul M.; Schmitt-Ulms, Gerold

    2011-01-01

    The evolutionary origin of prion genes, only known to exist in the vertebrate lineage, had remained elusive until recently. Following a lead from interactome investigations of the murine prion protein, our previous bioinformatic analyses revealed the evolutionary descent of prion genes from an ancestral ZIP metal ion transporter. However, the molecular mechanism of evolution remained unexplored. Here we present a computational investigation of this question based on sequence, intron-exon, synteny and pseudogene analyses. Our data suggest that during the emergence of metazoa, a cysteine-flanked core domain was modularly inserted, or arose de novo, in a preexisting ZIP ancestor gene to generate a prion-like ectodomain in a subbranch of ZIP genes. Approximately a half-billion years later, a genomic insertion of a spliced transcript coding for such a prion-like ZIP ectodomain may have created the prion founder gene. We document that similar genomic insertions involving ZIP transcripts, and probably relying on retropositional elements, have indeed occurred more than once throughout evolution. PMID:22046361

  18. Human T-cell receptor variable gene segment families

    SciTech Connect

    Arden, B.; Kabelitz, D.; Clark, S.P.; Mak, T.W.

    1995-10-01

    Multiple DNA and protein sequence alignments have been constructed for the human T-cell receptor {alpha}/{delta}, {beta}, and {gamma} (TCRA/D, B, and G) variable (V) gene segments. The traditional classification into subfamilies was confirmed using a much larger pool of sequences. For each sequence, a name was derived which complies with the standard nomenclature. The traditional numbering of V gene segments in the order of their discovery was continued and changed when in conflict with names of other segments. By discriminating between alleles at the same locus versus genes from different loci, we were able to reduce the number of more than 150 different TCRBV sequences in the database to a repertoire of only 47 functional TCRBV gene segments. An extension of this analysis to the over 100 TCRAV sequences results in a predicted repertoire of 42 functional TCRAV gene segments. Our alignment revealed two residues that distinguish between the highly homologous V{delta} and V{alpha}, one at a site that in V{sub H} contacts the constant region, the other at the interface between immunoglobulin V{sub H} and V{sub L}. This site may be responsible for restricted pairing between certain V{delta} and V{gamma} chains. On the other hand, V{beta} and V{gamma} appear to be related by the fact that their CDR2 length is increased by four residues as compared with that of V{alpha}/{delta} peptides. 150 refs., 12 figs., 5 tabs.

  19. Tandem repeat distribution of gene transcripts in three plant families

    PubMed Central

    2009-01-01

    Tandem repeats (microsatellites or SSRs) are molecular markers with great potential for plant genetic studies. Modern strategies include the transfer of these markers among widely studied and orphan species. In silico analyses allow for studying distribution patterns of microsatellites and predicting which motifs would be more amenable to interspecies transfer. Transcribed sequences (Unigene) from ten species of three plant families were surveyed for the occurrence of micro and minisatellites. Transcripts from different species displayed different rates of tandem repeat occurrence, ranging from 1.47% to 11.28%. Both similar and different patterns were found within and among plant families. The results also indicate a lack of association between genome size and tandem repeat fractions in expressed regions. The conservation of motifs among species and its implication on genome evolution and dynamics are discussed. PMID:21637460

  20. Human alcohol dehydrogenase: structural differences between the beta and gamma subunits suggest parallel duplications in isoenzyme evolution and predominant expression of separate gene descendants in livers of different mammals.

    PubMed Central

    Bühler, R; Hempel, J; Kaiser, R; von Wartburg, J P; Vallee, B L; Jörnvall, H

    1984-01-01

    Human alcohol dehydrogenase (ADH; alcohol:NAD+ oxidoreductase, EC 1.1.1.1) occurs in multiple forms, which exhibit distinct electrophoretic mobilities and enzymatic properties. The homogeneous isoenzymes beta 1 beta 1 and gamma 1 gamma 1 were isolated from livers of Caucasians with "typical" ADH phenotype by double ternary complex affinity chromatography and ion exchange chromatography. The differences between the beta 1 and gamma 1 subunits were determined by structural analysis of all tryptic peptides from the carboxymethylated proteins. The human beta 1 and gamma 1 chains differ at 21 of the 373 positions (5.6%). Ten tryptic peptides account for the differences. All residue substitutions are compatible with one-base mutations and result in largely unaltered properties, but five lead to charge differences. Sixteen substitutions are at positions corresponding to the catalytic domain of the well-known horse enzyme; five correspond to the coenzyme-binding domain. Substitutions adjacent to important regions may correlate with differences in coenzyme binding, substrate specificities, and active-site relationships. The residue replacements between the beta 1 and gamma 1 subunits of human ADH are not identical to the known substitutions between ethanol-active (E) and steroid-active (S) subunits of horse ADH. Thus, the duplication leading to human beta 1 and gamma 1 subunits is separate and different from that leading to equine E and S subunits. Both duplications are likely to have occurred after the ancestral separation of human and equine ADH. Of the 21 residues that are different between beta 1/gamma 1, 13 in gamma 1 but only 6 in beta 1 are identical to those of the horse E chain. This suggests a closer relationship between gamma 1 and E, although beta 1 in man and E in the horse are the subunits recovered in highest yield from liver ADH preparations. Consequently, in these two mammalian species, relative activities of genes for an isoenzyme family appear to be

  1. The Vertebrate RCAN Gene Family: Novel Insights into Evolution, Structure and Regulation

    PubMed Central

    Serrano-Candelas, Eva; Farré, Domènec; Aranguren-Ibáñez, Álvaro; Martínez-Høyer, Sergio; Pérez-Riba, Mercè

    2014-01-01

    Recently there has been much interest in the Regulators of Calcineurin (RCAN) proteins which are important endogenous modulators of the calcineurin-NFATc signalling pathway. They have been shown to have a crucial role in cellular programmes such as the immune response, muscle fibre remodelling and memory, but also in pathological processes such as cardiac hypertrophy and neurodegenerative diseases. In vertebrates, the RCAN family form a functional subfamily of three members RCAN1, RCAN2 and RCAN3 whereas only one RCAN is present in the rest of Eukarya. In addition, RCAN genes have been shown to collocate with RUNX and CLIC genes in ACD clusters (ACD21, ACD6 and ACD1). How the RCAN genes and their clustering in ACDs evolved is still unknown. After analysing RCAN gene family evolution using bioinformatic tools, we propose that the three RCAN vertebrate genes within the ACD clusters, which evolved from single copy genes present in invertebrates and lower eukaryotes, are the result of two rounds of whole genome duplication, followed by a segmental duplication. This evolutionary scenario involves the loss or gain of some RCAN genes during evolution. In addition, we have analysed RCAN gene structure and identified the existence of several characteristic features that can be involved in RCAN evolution and gene expression regulation. These included: several transposable elements, CpG islands in the 5′ region of the genes, the existence of antisense transcripts (NAT) associated with the three human genes, and considerable evidence for bidirectional promoters that regulate RCAN gene expression. Furthermore, we show that the CpG island associated with the RCAN3 gene promoter is unmethylated and transcriptionally active. All these results provide timely new insights into the molecular mechanisms underlying RCAN function and a more in depth knowledge of this gene family whose members are obvious candidates for the development of future therapies. PMID:24465593

  2. The banana E2 gene family: Genomic identification, characterization, expression profiling analysis.

    PubMed

    Dong, Chen; Hu, Huigang; Jue, Dengwei; Zhao, Qiufang; Chen, Hongliang; Xie, Jianghui; Jia, Liqiang

    2016-04-01

    The E2 is at the center of a cascade of Ub1 transfers, and it links activation of the Ub1 by E1 to its eventual E3-catalyzed attachment to substrate. Although the genome-wide analysis of this family has been performed in some species, little is known about analysis of E2 genes in banana. In this study, 74 E2 genes of banana were identified and phylogenetically clustered into thirteen subgroups. The predicted banana E2 genes were distributed across all 11 chromosomes at different densities. Additionally, the E2 domain, gene structure and motif compositions were analyzed. The expression of all of the banana E2 genes was analyzed in the root, stem, leaf, flower organs, five stages of fruit development and under abiotic stresses. All of the banana E2 genes, with the exception of few genes in each group, were expressed in at least one of the organs and fruit developments, which indicated that the E2 genes might involve in various aspects of the physiological and developmental processes of the banana. Quantitative RT-PCR (qRT-PCR) analysis identified that 45 E2s under drought and 33 E2s under salt were induced. To the best of our knowledge, this report describes the first genome-wide analysis of the banana E2 gene family, and the results should provide valuable information for understanding the classification, cloning and putative functions of this family.

  3. Analysis of the arabidopsis REM gene family predicts functions during flower development

    PubMed Central

    Mantegazza, Otho; Gregis, Veronica; Mendes, Marta Adelina; Morandini, Piero; Alves-Ferreira, Márcio; Patreze, Camila M.; Nardeli, Sarah M.; Kater, Martin M.; Colombo, Lucia

    2014-01-01

    Background and Aims The REM (Reproductive Meristem) gene family of Arabidopsis thaliana is part of the B3 DNA-binding domain superfamily. Despite the fact that several groups have worked on the REM genes for many years, little is known about the function of this transcription factor family. This study aims to identify a set of REM genes involved in flower development and to characterize their function. Methods In order to provide an overview of the REM gene family, a detailed expression analysis for all REM genes of A. thaliana was performed and combined with a meta-analysis of ChIP-sequencing and microarray experiments. Key Results Two sets of phylogenetically closely related REM genes, namely REM23, REM24 and REM25, and REM34, REM35 and REM36, were identified as possibly being involved in the early stages of flower development. Single- and double-mutant combinations were analysed for these genes, and no phenotypic effects were detected during flower development. Conclusions The data suggest that the REM34, REM35 and REM36 group is the most interesting one, as REM34 is co-expressed with the floral meristem identity (FMI) genes, they are bound by AP1, SVP, AP3 and PI, and they are expressed in the floral meristem and during the earliest stages of flower development. However, it appears that high levels of functional redundancy may conceal the exact function of these transcription factor genes. PMID:25002525

  4. Characterization of the laminin gene family and evolution in zebrafish.

    PubMed

    Sztal, Tamar; Berger, Silke; Currie, Peter D; Hall, Thomas E

    2011-02-01

    Laminins are essential components of all basement membranes and are fundamental to tissue development and homeostasis. Humans possess at least 16 different heterotrimeric laminin complexes formed through different combinations of alpha, beta, and gamma chains. Individual chains appear to exhibit unique expression patterns, leading to the notion that overlap between expression domains governs the constitution of complexes found within particular tissues. However, the spatial and temporal expression of laminin genes has not been comprehensively analyzed in any vertebrate model to date. Here, we describe the tissue-specific expression patterns of all laminin genes in the zebrafish, throughout embryonic development and into the "post-juvenile" period, which is representative of the adult body form. In addition, we present phylogenetic and microsynteny analyses, which demonstrate that the majority of our zebrafish sequences are orthologous to human laminin genes. Together, these data represent a fundamental resource for the study of vertebrate laminins.

  5. Metabolite Profiling of adh1 Mutant Response to Cold Stress in Arabidopsis

    PubMed Central

    Song, Yuan; Liu, Lijun; Wei, Yunzhu; Li, Gaopeng; Yue, Xiule; An, Lizhe

    2017-01-01

    As a result of global warming, vegetation suffers from repeated freeze-thaw cycles caused by more frequent short-term low temperatures induced by hail, snow, or night frost. Therefore, short-term freezing stress of plants should be investigated particularly in light of the current climatic conditions. Alcohol dehydrogenase (ADH) plays a central role in the metabolism of alcohols and aldehydes and it is a key enzyme in anaerobic fermentation. ADH1 responds to plant growth and environmental stress; however, the function of ADH1 in the response to short-term freezing stress remains unknown. Using real-time quantitative fluorescence PCR, the expression level of ADH1 was analyzed at low temperature (4°C). The lethal temperature was calculated based on the electrolyte leakage tests for both ADH1 deletion mutants (adh1) and wild type (WT) plants. To further investigate the relationship between ADH1 and cold tolerance in plants, low-Mr polar metabolite analyses of Arabidopsis adh1 and WT were performed at cold temperatures using gas chromatography-mass spectrometry. This investigation focused on freezing treatments (cold acclimation group: −6°C for 2 h with prior 4°C for 7 d, cold shock group: −6°C for 2 h without cold acclimation) and recovery (23°C for 24 h) with respect to seedling growth at optimum temperature. The experimental results revealed a significant increase in ADH1 expression during low temperature treatment (4°C) and at a higher lethal temperature in adh1 compared to that in the WT. Retention time indices and specific mass fragments were used to monitor 263 variables and annotate 78 identified metabolites. From these analyses, differences in the degree of metabolite accumulation between adh1 and WT were detected, including soluble sugars (e.g., sucrose) and amino acids (e.g., asparagine). In addition, the correlation-based network analysis highlighted some metabolites, e.g., melibiose, fumaric acid, succinic acid, glycolic acid, and xylose, which

  6. Metabolite Profiling of adh1 Mutant Response to Cold Stress in Arabidopsis.

    PubMed

    Song, Yuan; Liu, Lijun; Wei, Yunzhu; Li, Gaopeng; Yue, Xiule; An, Lizhe

    2016-01-01

    As a result of global warming, vegetation suffers from repeated freeze-thaw cycles caused by more frequent short-term low temperatures induced by hail, snow, or night frost. Therefore, short-term freezing stress of plants should be investigated particularly in light of the current climatic conditions. Alcohol dehydrogenase (ADH) plays a central role in the metabolism of alcohols and aldehydes and it is a key enzyme in anaerobic fermentation. ADH1 responds to plant growth and environmental stress; however, the function of ADH1 in the response to short-term freezing stress remains unknown. Using real-time quantitative fluorescence PCR, the expression level of ADH1 was analyzed at low temperature (4°C). The lethal temperature was calculated based on the electrolyte leakage tests for both ADH1 deletion mutants (adh1) and wild type (WT) plants. To further investigate the relationship between ADH1 and cold tolerance in plants, low-Mr polar metabolite analyses of Arabidopsis adh1 and WT were performed at cold temperatures using gas chromatography-mass spectrometry. This investigation focused on freezing treatments (cold acclimation group: -6°C for 2 h with prior 4°C for 7 d, cold shock group: -6°C for 2 h without cold acclimation) and recovery (23°C for 24 h) with respect to seedling growth at optimum temperature. The experimental results revealed a significant increase in ADH1 expression during low temperature treatment (4°C) and at a higher lethal temperature in adh1 compared to that in the WT. Retention time indices and specific mass fragments were used to monitor 263 variables and annotate 78 identified metabolites. From these analyses, differences in the degree of metabolite accumulation between adh1 and WT were detected, including soluble sugars (e.g., sucrose) and amino acids (e.g., asparagine). In addition, the correlation-based network analysis highlighted some metabolites, e.g., melibiose, fumaric acid, succinic acid, glycolic acid, and xylose, which

  7. Fifteen million years of evolution in the Oryza genus shows extensive gene family expansion.

    PubMed

    Jacquemin, Julie; Ammiraju, Jetty S S; Haberer, Georg; Billheimer, Dean D; Yu, Yeisoo; Liu, Liana C; Rivera, Luis F; Mayer, Klaus; Chen, Mingsheng; Wing, Rod A

    2014-04-01

    In analyzing gene families in the whole-genome sequences available for O. sativa (AA), O. glaberrima (AA), and O. brachyantha (FF), we observed large size expansions in the AA genomes compared to FF genomes for the super-families F-box and NB-ARC, and five additional families: the Aspartic proteases, BTB/POZ proteins (BTB), Glutaredoxins, Trypsin α-amylase inhibitor proteins, and Zf-Dof proteins. Their evolutionary dynamic was investigated to understand how and why such important size variations are observed between these closely related species. We show that expansions resulted from both amplification, largely by tandem duplications, and contraction by gene losses. For the F-box and NB-ARC gene families, the genes conserved in all species were under strong purifying selection while expanded orthologous genes were under more relaxed purifying selection. In F-box, NB-ARC, and BTB, the expanded groups were enriched in genes with little evidence of expression, in comparison with conserved groups. We also detected 87 loci under positive selection in the expanded groups. These results show that most of the duplicated copies in the expanded groups evolve neutrally after duplication because of functional redundancy but a fraction of these genes were preserved following neofunctionalization. Hence, the lineage-specific expansions observed between Oryza species were partly driven by directional selection.

  8. Genome-Wide Identification of the Invertase Gene Family in Populus.

    PubMed

    Chen, Zhong; Gao, Kai; Su, Xiaoxing; Rao, Pian; An, Xinmin

    2015-01-01

    Invertase plays a crucial role in carbohydrate partitioning and plant development as it catalyses the irreversible hydrolysis of sucrose into glucose and fructose. The invertase family in plants is composed of two sub-families: acid invertases, which are targeted to the cell wall and vacuole; and neutral/alkaline invertases, which function in the cytosol. In this study, 5 cell wall invertase genes (PtCWINV1-5), 3 vacuolar invertase genes (PtVINV1-3) and 16 neutral/alkaline invertase genes (PtNINV1-16) were identified in the Populus genome and found to be distributed on 14 chromosomes. A comprehensive analysis of poplar invertase genes was performed, including structures, chromosome location, phylogeny, evolutionary pattern and expression profiles. Phylogenetic analysis indicated that the two sub-families were both divided into two clades. Segmental duplication is contributed to neutral/alkaline sub-family expansion. Furthermore, the Populus invertase genes displayed differential expression in roots, stems, leaves, leaf buds and in response to salt/cold stress and pathogen infection. In addition, the analysis of enzyme activity and sugar content revealed that invertase genes play key roles in the sucrose metabolism of various tissues and organs in poplar. This work lays the foundation for future functional analysis of the invertase genes in Populus and other woody perennials.

  9. Genome-Wide Identification of the Invertase Gene Family in Populus

    PubMed Central

    Su, Xiaoxing; Rao, Pian; An, Xinmin

    2015-01-01

    Invertase plays a crucial role in carbohydrate partitioning and plant development as it catalyses the irreversible hydrolysis of sucrose into glucose and fructose. The invertase family in plants is composed of two sub-families: acid invertases, which are targeted to the cell wall and vacuole; and neutral/alkaline invertases, which function in the cytosol. In this study, 5 cell wall invertase genes (PtCWINV1-5), 3 vacuolar invertase genes (PtVINV1-3) and 16 neutral/alkaline invertase genes (PtNINV1-16) were identified in the Populus genome and found to be distributed on 14 chromosomes. A comprehensive analysis of poplar invertase genes was performed, including structures, chromosome location, phylogeny, evolutionary pattern and expression profiles. Phylogenetic analysis indicated that the two sub-families were both divided into two clades. Segmental duplication is contributed to neutral/alkaline sub-family expansion. Furthermore, the Populus invertase genes displayed differential expression in roots, stems, leaves, leaf buds and in response to salt/cold stress and pathogen infection. In addition, the analysis of enzyme activity and sugar content revealed that invertase genes play key roles in the sucrose metabolism of various tissues and organs in poplar. This work lays the foundation for future functional analysis of the invertase genes in Populus and other woody perennials. PMID:26393355

  10. Use of a modified alcohol dehydrogenase, ADH1, promoter in construction of diacetyl non-producing brewer's yeast.

    PubMed

    Onnela, M L; Suihko, M L; Penttilä, M; Keränen, S

    1996-08-20

    The bacterial gene, encoding alpha-acetolactate decarboxylase (alpha-ALDC), was expressed in a bottom-fermenting brewer's yeast under the control of a modified Saccharomyces cerevisiae alcohol dehydrogenase (ADH1) promoter which lacks the upstream regions from -800 bp to -1500 bp. In pilot scale brewing conditions, the level of alpha-ALDC produced was high enough to reduce the concentration of diacetyl so that lagering was not required. alpha-ALDC active brewer's yeast strains were also shown to be suitable for high gravity brewing.

  11. Mimiviridae: clusters of orthologous genes, reconstruction of gene repertoire evolution and proposed expansion of the giant virus family

    PubMed Central

    2013-01-01

    Background The family Mimiviridae belongs to the large monophyletic group of Nucleo-Cytoplasmic Large DNA Viruses (NCLDV; proposed order Megavirales) and encompasses giant viruses infecting amoeba and probably other unicellular eukaryotes. The recent discovery of the Cafeteria roenbergensis virus (CroV), a distant relative of the prototype mimiviruses, led to a substantial expansion of the genetic variance within the family Mimiviridae. In the light of these findings, a reassessment of the relationships between the mimiviruses and other NCLDV and reconstruction of the evolution of giant virus genomes emerge as interesting and timely goals. Results Database searches for the protein sequences encoded in the genomes of several viruses originally classified as members of the family Phycodnaviridae, in particular Organic Lake phycodnaviruses and Phaeocystis globosa viruses (OLPG), revealed a greater number of highly similar homologs in members of the Mimiviridae than in phycodnaviruses. We constructed a collection of 898 Clusters of Orthologous Genes for the putative expanded family Mimiviridae (MimiCOGs) and used these clusters for a comprehensive phylogenetic analysis of the genes that are conserved in most of the NCLDV. The topologies of the phylogenetic trees for these conserved viral genes strongly support the monophyly of the OLPG and the mimiviruses. The same tree topology was obtained by analysis of the phyletic patterns of conserved viral genes. We further employed the mimiCOGs to obtain a maximum likelihood reconstruction of the history of genes losses and gains among the giant viruses. The results reveal massive gene gain in the mimivirus branch and modest gene gain in the OLPG branch. Conclusions These phylogenomic results reported here suggest a substantial expansion of the family Mimiviridae. The proposed expanded family encompasses a greater diversity of viruses including a group of viruses with much smaller genomes than those of the original members of

  12. Eleven ancestral gene families lost in mammals and vertebrates while otherwise universally conserved in animals

    PubMed Central

    Danchin, Etienne GJ; Gouret, Philippe; Pontarotti, Pierre

    2006-01-01

    Background Gene losses played a role which may have been as important as gene and genome duplications and rearrangements, in modelling today species' genomes from a common ancestral set of genes. The set and diversity of protein-coding genes in a species has direct output at the functional level. While gene losses have been reported in all the major lineages of the metazoan tree of life, none have proposed a focus on specific losses in the vertebrates and mammals lineages. In contrast, genes lost in protostomes (i.e. arthropods and nematodes) but still present in vertebrates have been reported and extensively detailed. This probable over-anthropocentric way of comparing genomes does not consider as an important phenomena, gene losses in species that are usually described as "higher". However reporting universally conserved genes throughout evolution that have recently been lost in vertebrates and mammals could reveal interesting features about the evolution of our genome, particularly if these losses can be related to losses of capability. Results We report 11 gene families conserved throughout eukaryotes from yeasts (such as Saccharomyces cerevisiae) to bilaterian animals (such as Drosophila melanogaster or Caenorhabditis elegans). This evolutionarily wide conservation suggests they were present in the last common ancestors of fungi and metazoan animals. None of these 11 gene families are found in human nor mouse genomes, and their absence generally extends to all vertebrates. A total of 8 out of these 11 gene families have orthologs in plants, suggesting they were present in the Last Eukaryotic Common Ancestor (LECA). We investigated known functional information for these 11 gene families. This allowed us to correlate some of the lost gene families to loss of capabilities. Conclusion Mammalian and vertebrate genomes lost evolutionary conserved ancestral genes that are probably otherwise not dispensable in eukaryotes. Hence, the human genome, which is generally

  13. Systematic analysis and identification of stress-responsive genes of the NAC gene family in Brachypodium distachyon.

    PubMed

    You, Jun; Zhang, Lihua; Song, Bo; Qi, Xiaoquan; Chan, Zhulong

    2015-01-01

    Plant-specific NAC proteins are one of the largest families of transcription factors in plants, and members of this family have been characterized with roles in the regulation of diverse biological processes, including development and stress responses. In the present study, we identified 101 putative NAC domain-encoding genes (BdNACs) through systematic sequence analysis in Brachypodium distachyon, a new model plant of family Poaceae. BdNAC proteins were phylogenetically clustered into 13 groups, and each group possesses similar motif compositions. Phylogenetic analysis using known stress-related NACs from Arabidopsis and rice as query sequences identified 18 BdNACs as putative stress-responsive genes. In silico promoter analysis showed that almost all BdNAC genes contain putative stress-related cis-elements in their promoter regions. Expression profile of BdNAC genes in response to abiotic stresses and phytohormones was analyzed by quantitative real-time RT-PCR. Several putative stress-responsive BdNAC genes, including BdNAC003 and BdNAC044 which is ortholog of known stress-responsive rice gene SNAC1 and SNAC2, respectively, were highly regulated by multiple abiotic stresses and stress-related phytohormone treatments. Taken together, our results presented here would be helpful in laying the foundation for understanding of the complex mechanisms of NAC mediated abiotic stress signaling transduction pathways in B. distachyon.

  14. The phylogeny and evolutionary history of the Lesion Simulating Disease (LSD) gene family in Viridiplantae.

    PubMed

    Cabreira, Caroline; Cagliari, Alexandro; Bücker-Neto, Lauro; Margis-Pinheiro, Márcia; de Freitas, Loreta B; Bodanese-Zanettini, Maria Helena

    2015-12-01

    The Lesion Simulating Disease (LSD) genes encode a family of zinc finger proteins that play a role in programmed cell death (PCD) and other biological processes, such as plant growth and photosynthesis. In the present study, we report the reconstruction of the evolutionary history of the LSD gene family in Viridiplantae. Phylogenetic analysis revealed that the monocot and eudicot genes were distributed along the phylogeny, indicating that the expansion of the family occurred prior to the diversification between these clades. Sequences encoding proteins that present one, two, or three LSD domains formed separate groups. The secondary structure of these different LSD proteins presented a similar composition, with the β-sheets being their main component. The evolution by gene duplication was identified only to the genes that contain three LSD domains, which generated proteins with equal structure. Moreover, genes encoding proteins with one or two LSD domains evolved as single-copy genes and did not result from loss or gain in LSD domains. These results were corroborated by synteny analysis among regions containing paralogous/orthologous genes in Glycine max and Populus trichocarpa. The Ka/Ks ratio between paralogous/orthologous genes revealed that a subfunctionalization process possibly could be occurring with the LSD genes, explaining the involvement of LSD members in different biological processes, in addition to the negative regulation of PCD. This study presents important novelty in the evolutionary history of the LSD family and provides a basis for future research on individual LSD genes and their involvement in important pathway networks in plants.

  15. Evolutionary analysis of the jacalin-related lectin family genes in 11 fishes.

    PubMed

    Cao, Jun; Lv, Yueqing

    2016-09-01

    Jacalin-related lectins are a type of carbohydrate-binding proteins, which are distributed across a wide variety of organisms and involved in some important biological processes. The evolution of this gene family in fishes is unknown. Here, 47 putative jacalin genes in 11 fish species were identified and divided into 4 groups through phylogenetic analysis. Conserved gene organization and motif distribution existed in each group, suggesting their functional conservation. Some fishes have eleven jacalin genes, while others have only one or zero gene in their genomes, suggesting dynamic changes in the number of jacalin genes during the evolution of fishes. Intragenic recombination played a key role in the evolution of jacalin genes. Synteny analyses of jacalin genes in some fishes implied conserved and dynamic evolution characteristics of this gene family and related genome segments. Moreover, a few functional divergence sites were identified within each group pairs. Divergent expression profiles of the zebra fish jacalin genes were further investigated in different stresses. The results provided a foundation for exploring the characterization of the jacalin genes in fishes and will offer insights for additional functional studies.

  16. Genome-wide identification of the TIFY gene family in three cultivated Gossypium species and the expression of JAZ genes

    PubMed Central

    Sun, Quan; Wang, Guanghao; Zhang, Xiao; Zhang, Xiangrui; Qiao, Peng; Long, Lu; Yuan, Youlu; Cai, Yingfan

    2017-01-01

    TIFY proteins are plant-specific proteins containing TIFY, JAZ, PPD and ZML subfamilies. A total of 50, 54 and 28 members of the TIFY gene family in three cultivated cotton species—Gossypium hirsutum, Gossypium barbadense and Gossypium arboretum—were identified, respectively. The results of phylogenetic analysis showed that these TIFY genes were divided into eight clusters. The different clusters of gene family members often have similar gene structures, including the number of exons. The results of quantitative reverse transcription polymerase chain reaction (qRT-PCR) showed that different JAZ genes displayed distinct expression patterns in the leaves of upland cotton under treatment with Gibberellin (GA), methyl jasmonate (MeJA), Jasmonic acid (JA) and abscisic acid (ABA). Different groups of JAZ genes exhibited different expression patterns in cotton leaves infected with Verticillium dahliae. The results of the comparative analysis of TIFY genes in the three cultivated species will be useful for understanding the involvement of these genes in development and stress resistance in cotton. PMID:28186193

  17. Organisation and structural evolution of the rice glutathione S-transferase gene family.

    PubMed

    Soranzo, N; Sari Gorla, M; Mizzi, L; De Toma, G; Frova, C

    2004-06-01

    Glutathione S-transferases (GSTs) comprise a large family of key defence enzymes against xenobiotic toxicity. Here we describe the comprehensive characterisation of this important multigene family in the model monocot species rice [ Oryza sativa(L.)]. Furthermore, we investigate the molecular evolution of the family based on the analysis of (1) the patterns of within-genome duplication, and (2) the phylogenetic relationships and evolutionary divergence among rice, Arabidopsis, maize and soybean GSTs. By in-silico screening of the EST and genome divisions of the Genbank/EMBL/DDBJ database we have isolated 59 putative genes and two pseudogenes, making this the largest plant GST family characterised to date. Of these, 38 (62%) are represented by genomic and EST sequences and 23 (38%) are known only from their genomic sequences. A preliminary survey of EST collections shows a large degree of variability in gene expression between different tissues and environmental conditions, with a small number of genes (13) accounting for 80% of all ESTs. Rice GSTs are organised in four main phylogenetic classes, with 91% of all rice genes belonging to the two plant-specific classes Tau (40 genes) and Phi (16 genes). Pairwise identity scores range between 17 and 98% for proteins of the same class, and 7 and 21% for interclass comparisons. Rapid evolution by gene duplication is suggested by the discovery of two large clusters of 7 and 23 closely related genes on chromosomes 1 and 10, respectively. A comparison of the complete GST families in two monocot and two dicot species suggests a monophyletic origin for all Theta and Zeta GSTs, and no more than three common ancestors for all Phi and Tau genes.

  18. Genome-wide analysis of the MADS-box gene family in Brassica rapa (Chinese cabbage).

    PubMed

    Duan, Weike; Song, Xiaoming; Liu, Tongkun; Huang, Zhinan; Ren, Jun; Hou, Xilin; Li, Ying

    2015-02-01

    The MADS-box gene family is an ancient and well-studied transcription factor family that functions in almost every developmental process in plants. There are a number of reports about the MADS-box family in different plant species, but systematic analysis of the MADS-box transcription factor family in Brassica rapa (Chinese cabbage) is still lacking. In this study, 160 MADS-box transcription factors were identified from the entire Chinese cabbage genome and compared with the MADS-box factors from 21 other representative plant species. A detailed list of MADS proteins from these 22 species was sorted. Phylogenetic analysis of the BrMADS genes, together with their Arabidopsis and rice counterparts, showed that the BrMADS genes were categorised into type I (Mα, Mβ, Mγ) and type II (MIKC(C), MIKC*) groups, and the MIKC(C) proteins were further divided into 13 subfamilies. The Chinese cabbage type II group has 95 members, which is twice as much as the Arabidopsis type II group, indicating that the Chinese cabbage type II genes have been retained more frequently than the type I genes. Finally, RNA-seq transcriptome data and quantitative real-time PCR analysis revealed that BrMADS genes are expressed in a tissue-specific manner similar to Arabidopsis. Interestingly, a number of BrMIKC genes showed responses to different abiotic stress treatments, suggesting a function for some of the genes in these processes as well. Taken together, the characterization of the B. rapa MADS-box family presented here, will certainly help in the selection of appropriate candidate genes and further facilitate functional studies in Chinese cabbage.

  19. The interplay between alcohol consumption, oral hygiene, ALDH2 and ADH1B in the risk of head and neck cancer.

    PubMed

    Tsai, Sen-Tien; Wong, Tung-Yiu; Ou, Chun-Yen; Fang, Sheen-Yie; Chen, Ken-Chung; Hsiao, Jenn-Ren; Huang, Cheng-Chih; Lee, Wei-Ting; Lo, Hung-I; Huang, Jehn-Shyun; Wu, Jiunn-Liang; Yen, Chia-Jui; Hsueh, Wei-Ting; Wu, Yuan-Hua; Yang, Ming-Wei; Lin, Forn-Chia; Chang, Jang-Yang; Chang, Kwang-Yu; Wu, Shang-Yin; Liao, Hsiao-Chen; Lin, Chen-Lin; Wang, Yi-Hui; Weng, Ya-Ling; Yang, Han-Chien; Chang, Jeffrey S

    2014-11-15

    Alcohol consumption is an established risk factor for head and neck cancer (HNC). The major carcinogen from alcohol is acetaldehyde, which may be produced by humans or by oral microorganisms through the metabolism of ethanol. To account for the different sources of acetaldehyde production, the current study examined the interplay between alcohol consumption, oral hygiene (as a proxy measure for the growth of oral microorganisms), and alcohol-metabolizing genes (ADH1B and ALDH2) in the risk of HNC. We found that both the fast (*2/*2) and the slow (*1/*1+ *1/*2) ADH1B genotypes increased the risk of HNC due to alcohol consumption, and this association differed according to the slow/non-functional ALDH2 genotypes (*1/*2+ *2/*2) or poor oral hygiene. In persons with the fast ADH1B genotype, the HNC risk associated with alcohol drinking was increased for those with the slow/non-functional ALDH2 genotypes. For those with the slow ADH1B genotypes, oral hygiene appeared to play an important role; the highest magnitude of an increased HNC risk in alcohol drinkers occurred among those with the worst oral hygiene. This is the first study to show that the association between alcohol drinking and HNC risk may be modified by the interplay between genetic polymorphisms of ADH1B and ALDH2 and oral hygiene. Although it is important to promote abstinence from or reduction of alcohol drinking to decrease the occurrence of HNC, improving oral hygiene practices may provide additional benefit.

  20. The zebrafish progranulin gene family and antisense transcripts

    PubMed Central

    Cadieux, Benoît; Chitramuthu, Babykumari P; Baranowski, David; Bennett, Hugh PJ

    2005-01-01

    Background Progranulin is an epithelial tissue growth factor (also known as proepithelin, acrogranin and PC-cell-derived growth factor) that has been implicated in development, wound healing and in the progression of many cancers. The single mammalian progranulin gene encodes a glycoprotein precursor consisting of seven and one half tandemly repeated non-identical copies of the cystine-rich granulin motif. A genome-wide duplication event hypothesized to have occurred at the base of the teleost radiation predicts that mammalian progranulin may be represented by two co-orthologues in zebrafish. Results The cDNAs encoding two zebrafish granulin precursors, progranulins-A and -B, were characterized and found to contain 10 and 9 copies of the granulin motif respectively. The cDNAs and genes encoding the two forms of granulin, progranulins-1 and -2, were also cloned and sequenced. Both latter peptides were found to be encoded by precursors with a simplified architecture consisting of one and one half copies of the granulin motif. A cDNA encoding a chimeric progranulin which likely arises through the mechanism of trans-splicing between grn1 and grn2 was also characterized. A non-coding RNA gene with antisense complementarity to both grn1 and grn2 was identified which may have functional implications with respect to gene dosage, as well as in restricting the formation of the chimeric form of progranulin. Chromosomal localization of the four progranulin (grn) genes reveals syntenic conservation for grna only, suggesting that it is the true orthologue of mammalian grn. RT-PCR and whole-mount in situ hybridization analysis of zebrafish grns during development reveals that combined expression of grna and grnb, but not grn1 and grn2, recapitulate many of the expression patterns observed for the murine counterpart. This includes maternal deposition, widespread central nervous system distribution and specific localization within the epithelial compartments of various organs

  1. Multi-gene panel testing for hereditary cancer susceptibility in a rural Familial Cancer Program.

    PubMed

    Hermel, David J; McKinnon, Wendy C; Wood, Marie E; Greenblatt, Marc S

    2017-01-01

    This study explores our Familial Cancer Program's experience implementing multi-gene panel testing in a largely rural patient population. We conducted a retrospective review of patients undergoing panel testing between May 2011 and August 2015. Our goal was to evaluate factors that might be predictors of identifying variants (pathogenic or uncertain significance) and to assess clinical management changes due to testing. We utilized a structured family history tool to determine the significance of patient's family histories with respect to identification of genetic variants. A total of 227 patients underwent panel testing at our center and 67 patients (29.5 %) had variants identified, with 8 (3.5 %) having multiple variants. Overall, 44 patients (19.4 %) had a variant of uncertain significance (VUS) and 28 patients (12.3 %) had a pathogenic variant detected, with 10 (4.4 %) having pathogenic variants in highly penetrant genes. We found no statistical difference in patient familial and personal cancer history, age, rural status, Ashkenazi Jewish ancestry, insurance coverage and prior single-gene testing among those with pathogenic, VUS and negative panel testing results. There were no predictors of pathogenic variants on regression analysis. Panel testing changed cancer screening and management guidelines from that expected based on family history alone in 13.2 % of patients. Ultimately, cancer panel testing does yield critical information not identified by traditional single gene testing but maximal utility through a broad range of personal and family histories requires improved interpretation of variants.

  2. The GLI-Kruppel family of human genes

    SciTech Connect

    Ruppert, J.M.; Kinzler, K.W.; Wong, A.J.; Bigner, S.H.; Kao, F.T.; Law, M.L.; Seuanez, H.N.; O'Brien, S.J.; Vogelstein, B.

    1988-08-01

    Previous characterization of GLI, a gene found to be amplified and expressed in a subset of human brain tumors, revealed the presence of five tandem fingers related to those of Kruppel (Kr), a Drosophila segmentation gene of the gap class. The authors have used the GLI cDNA as a molecular probe to isolate related sequences from the human genome. Partial characterization of six related loci, including sequence determination, expression studies, and chromosome localization, revealed that each locus could encode a separate finger protein. The predicted proteins all had similar H-C links, i.e., a conserved stretch of 9 amino acids connecting the C-terminal histidine of one finger to the N-terminal cysteine of the next. On the basis of amino acid sequence and intron-exon organization, the genes could be placed into one of two subgroups: the GLI subgroup (with the consensus finger amino acid sequence (Y/F)XCX/sub 3/GCX/sub 3/(F/Y)X/sub 5/LX/sub 2/HX/sub 3-4/H(T/X)GEKP) or the Kr subgroup (with the consensus finger amino acid sequence (Y/F)XCX/sub 2/CX/sub 3/FX/sub 5/LX/sub 2/HXRXHTGEKP). Unlike GLI or Kr, most of the newly isolated genes were expressed in many adult tissues. The predicted proteins probably control the expression of other genes and, by analogy with Kr and GLI, may be important in human development, tissue-specific differentiation, or neoplasia.

  3. Cross-species gene-family fluctuations reveal the dynamics of horizontal transfers.

    PubMed

    Grilli, Jacopo; Romano, Mariacristina; Bassetti, Federico; Cosentino Lagomarsino, Marco

    2014-06-01

    Prokaryotes vary their protein repertoire mainly through horizontal transfer and gene loss. To elucidate the links between these processes and the cross-species gene-family statistics, we perform a large-scale data analysis of the cross-species variability of gene-family abundance (the number of members of the family found on a given genome). We find that abundance fluctuations are related to the rate of horizontal transfers. This is rationalized by a minimal theoretical model, which predicts this link. The families that are not captured by the model show abundance profiles that are markedly peaked around a mean value, possibly because of specific abundance selection. Based on these results, we define an abundance variability index that captures a family's evolutionary behavior (and thus some of its relevant functional properties) purely based on its cross-species abundance fluctuations. Analysis and model, combined, show a quantitative link between cross-species family abundance statistics and horizontal transfer dynamics, which can be used to analyze genome 'flux'. Groups of families with different values of the abundance variability index correspond to genome sub-parts having different plasticity in terms of the level of horizontal exchange allowed by natural selection.

  4. Unique Loss of the PYHIN Gene Family in Bats Amongst Mammals: Implications for Inflammasome Sensing

    PubMed Central

    Ahn, Matae; Cui, Jie; Irving, Aaron T.; Wang, Lin-Fa

    2016-01-01

    Recent genomic analysis of two bat species (Pteropus alecto and Myotis davidii) revealed the absence of the PYHIN gene family. This family is recognized as important immune sensors of intracellular self and foreign DNA and activators of the inflammasome and/or interferon pathways. Further assessment of a wider range of bat genomes was necessary to determine if this is a universal pattern for this large mammalian group. Here we expanded genomic analysis of this gene family to include ten bat species. We confirmed the complete loss of this gene family, with only a truncated AIM2 remaining in one species (Pteronotus parnellii). Divergence of the PYHIN gene loci between the bat lineages infers different loss-of-function histories during bat evolution. While all other major groups of placental mammals have at least one gene member, only bats have lost the entire family. This removal of inflammasome DNA sensors may indicate an important adaptation that is flight-induced and related, at least in part, to pathogen-host co-existence. PMID:26906452

  5. A family of Turandot-related genes in the humoral stress response of Drosophila.

    PubMed

    Ekengren, S; Hultmark, D

    2001-06-22

    The Drosophila Turandot A (TotA) gene was recently shown to encode a stress-induced humoral factor which gives increased resistance to the lethal effects of high temperature. Here we show that TotA belongs to a family of eight Tot genes distributed at three different sites in the Drosophila genome. All Tot genes are induced under stressful conditions such as bacterial infection, heat shock, paraquat feeding or exposure to ultraviolet light, suggesting that all members of this family play a role in Drosophila stress tolerance. The induction of the Tot genes differs in important respects from the heat shock response, such as the strong but delayed response to bacterial infection seen for several of the genes.

  6. Sessile snails, dynamic genomes: gene rearrangements within the mitochondrial genome of a family of caenogastropod molluscs

    PubMed Central

    2010-01-01

    Background Widespread sampling of vertebrates, which comprise the majority of published animal mitochondrial genomes, has led to the view that mitochondrial gene rearrangements are relatively rare, and that gene orders are typically stable across major taxonomic groups. In contrast, more limited sampling within the Phylum Mollusca has revealed an unusually high number of gene order arrangements. Here we provide evidence that the lability of the molluscan mitochondrial genome extends to the family level by describing extensive gene order changes that have occurred within the Vermetidae, a family of sessile marine gastropods that radiated from a basal caenogastropod stock during the Cenozoic Era. Results Major mitochondrial gene rearrangements have occurred within this family at a scale unexpected for such an evolutionarily young group and unprecedented for any caenogastropod examined to date. We determined the complete mitochondrial genomes of four species (Dendropoma maximum, D. gregarium, Eualetes tulipa, and Thylacodes squamigerus) and the partial mitochondrial genomes of two others (Vermetus erectus and Thylaeodus sp.). Each of the six vermetid gastropods assayed possessed a unique gene order. In addition to the typical mitochondrial genome complement of 37 genes, additional tRNA genes were evident in D. gregarium (trnK) and Thylacodes squamigerus (trnV, trnLUUR). Three pseudogenes and additional tRNAs found within the genome of Thylacodes squamigerus provide evidence of a past duplication event in this taxon. Likewise, high sequence similarities between isoaccepting leucine tRNAs in Thylacodes, Eualetes, and Thylaeodus suggest that tRNA remolding has been rife within this family. While vermetids exhibit gene arrangements diagnostic of this family, they also share arrangements with littorinimorph caenogastropods, with which they have been linked based on sperm morphology and primary sequence-based phylogenies. Conclusions We have uncovered major changes in gene

  7. Real-Time Evolution of a Subtelomeric Gene Family in Candida albicans

    PubMed Central

    Anderson, Matthew Z.; Wigen, Lauren J.; Burrack, Laura S.; Berman, Judith

    2015-01-01

    Subtelomeric regions of the genome are notable for high rates of sequence evolution and rapid gene turnover. Evidence of subtelomeric evolution has relied heavily on comparisons of historical evolutionary patterns to infer trends and frequencies of these events. Here, we describe evolution of the subtelomeric TLO gene family in Candida albicans during laboratory passaging for over 4000 generations. C. albicans is a commensal and opportunistic pathogen of humans and the TLO gene family encodes a subunit of the Mediator complex that regulates transcription and affects a range of virulence factors. We identified 16 distinct subtelomeric recombination events that altered the TLO repertoire. Ectopic recombination between subtelomeres on different chromosome ends occurred approximately once per 5000 generations and was often followed by loss of heterozygosity, resulting in the complete loss of one TLO gene sequence with expansion of another. In one case, recombination within TLO genes produced a novel TLO gene sequence. TLO copy number changes were biased, with some TLOs preferentially being copied to novel chromosome arms and other TLO genes being frequently lost. The majority of these nonreciprocal recombination events occurred either within the 3′ end of the TLO coding sequence or within a conserved 50-bp sequence element centromere-proximal to TLO coding sequence. Thus, subtelomeric recombination is a rapid mechanism of generating genotypic diversity through alterations in the number and sequence of related gene family members. PMID:25956943

  8. Multispecies Analysis of Expression Pattern Diversification in the Recently Expanded Insect Ly6 Gene Family

    PubMed Central

    Tanaka, Kohtaro; Hazbun, Alexis; Hijazi, Assia; Vreede, Barbara; Sucena, Élio

    2015-01-01

    Gene families often consist of members with diverse expression domains reflecting their functions in a wide variety of tissues. However, how the expression of individual members, and thus their tissue-specific functions, diversified during the course of gene family expansion is not well understood. In this study, we approached this question through the analysis of the duplication history and transcriptional evolution of a rapidly expanding subfamily of insect Ly6 genes. We analyzed different insect genomes and identified seven Ly6 genes that have originated from a single ancestor through sequential duplication within the higher Diptera. We then determined how the original embryonic expression pattern of the founding gene diversified by characterizing its tissue-specific expression in the beetle Tribolium castaneum, the butterfly Bicyclus anynana, and the mosquito Anopheles stephensi and those of its duplicates in three higher dipteran species, representing various stages of the duplication history (Megaselia abdita, Ceratitis capitata, and Drosophila melanogaster). Our results revealed that frequent neofunctionalization episodes contributed to the increased expression breadth of this subfamily and that these events occurred after duplication and speciation events at comparable frequencies. In addition, at each duplication node, we consistently found asymmetric expression divergence. One paralog inherited most of the tissue-specificities of the founder gene, whereas the other paralog evolved drastically reduced expression domains. Our approach attests to the power of combining a well-established duplication history with a comprehensive coverage of representative species in acquiring unequivocal information about the dynamics of gene expression evolution in gene families. PMID:25743545

  9. Genome-wide evolutionary characterization and expression analyses of WRKY family genes in Brachypodium distachyon.

    PubMed

    Wen, Feng; Zhu, Hong; Li, Peng; Jiang, Min; Mao, Wenqing; Ong, Chermaine; Chu, Zhaoqing

    2014-06-01

    Members of plant WRKY gene family are ancient transcription factors that function in plant growth and development and respond to biotic and abiotic stresses. In our present study, we have investigated WRKY family genes in Brachypodium distachyon, a new model plant of family Poaceae. We identified a total of 86 WRKY genes from B. distachyon and explored their chromosomal distribution and evolution, domain alignment, promoter cis-elements, and expression profiles. Combining the analysis of phylogenetic tree of BdWRKY genes and the result of expression profiling, results showed that most of clustered gene pairs had higher similarities in the WRKY domain, suggesting that they might be functionally redundant. Neighbour-joining analysis of 301 WRKY domains from Oryza sativa, Arabidopsis thaliana, and B. distachyon suggested that BdWRKY domains are evolutionarily more closely related to O. sativa WRKY domains than those of A. thaliana. Moreover, tissue-specific expression profile of BdWRKY genes and their responses to phytohormones and several biotic or abiotic stresses were analysed by quantitative real-time PCR. The results showed that the expression of BdWRKY genes was rapidly regulated by stresses and phytohormones, and there was a strong correlation between promoter cis-elements and the phytohormones-induced BdWRKY gene expression.

  10. Dichotomy in the NRT Gene Families of Dicots and Grass Species

    PubMed Central

    Plett, Darren; Toubia, John; Garnett, Trevor; Tester, Mark; Kaiser, Brent N.; Baumann, Ute

    2010-01-01

    A large proportion of the nitrate (NO3−) acquired by plants from soil is actively transported via members of the NRT families of NO3− transporters. In Arabidopsis, the NRT1 family has eight functionally characterised members and predominantly comprises low-affinity transporters; the NRT2 family contains seven members which appear to be high-affinity transporters; and there are two NRT3 (NAR2) family members which are known to participate in high-affinity transport. A modified reciprocal best hit (RBH) approach was used to identify putative orthologues of the Arabidopsis NRT genes in the four fully sequenced grass genomes (maize, rice, sorghum, Brachypodium). We also included the poplar genome in our analysis to establish whether differences between Arabidopsis and the grasses may be generally applicable to monocots and dicots. Our analysis reveals fundamental differences between Arabidopsis and the grass species in the gene number and family structure of all three families of NRT transporters. All grass species possessed additional NRT1.1 orthologues and appear to lack NRT1.6/NRT1.7 orthologues. There is significant separation in the NRT2 phylogenetic tree between NRT2 genes from dicots and grass species. This indicates that determination of function of NRT2 genes in grass species will not be possible in cereals based simply on sequence homology to functionally characterised Arabidopsis NRT2 genes and that proper functional analysis will be required. Arabidopsis has a unique NRT3.2 gene which may be a fusion of the NRT3.1 and NRT3.2 genes present in all other species examined here. This work provides a framework for future analysis of NO3− transporters and NO3− transport in grass crop species. PMID:21151904

  11. Clade classification of monolignol biosynthesis gene family members reveals target genes to decrease lignin in Lolium perenne.

    PubMed

    van Parijs, F R D; Ruttink, T; Boerjan, W; Haesaert, G; Byrne, S L; Asp, T; Roldán-Ruiz, I; Muylle, H

    2015-07-01

    In monocots, lignin content has a strong impact on the digestibility of the cell wall fraction. Engineering lignin biosynthesis requires a profound knowledge of the role of paralogues in the multigene families that constitute the monolignol biosynthesis pathway. We applied a bioinformatics approach for genome-wide identification of candidate genes in Lolium perenne that are likely to be involved in the biosynthesis of monolignols. More specifically, we performed functional subtyping of phylogenetic clades in four multigene families: 4CL, COMT, CAD and CCR. Essential residues were considered for functional clade delineation within these families. This classification was complemented with previously published experimental evidence on gene expression, gene function and enzymatic activity in closely related crops and model species. This allowed us to assign functions to novel identified L. perenne genes, and to assess functional redundancy among paralogues. We found that two 4CL paralogues, two COMT paralogues, three CCR paralogues and one CAD gene are prime targets for genetic studies to engineer developmentally regulated lignin in this species. Based on the delineation of sequence conservation between paralogues and a first analysis of allelic diversity, we discuss possibilities to further study the roles of these paralogues in lignin biosynthesis, including expression analysis, reverse genetics and forward genetics, such as association mapping. We propose criteria to prioritise paralogues within multigene families and certain SNPs within these genes for developing genotyping assays or increasing power in association mapping studies. Although L. perenne was the target of the analyses presented here, this functional subtyping of phylogenetic clades represents a valuable tool for studies investigating monolignol biosynthesis genes in other monocot species.

  12. Genome-Wide Analysis of the Aquaporin Gene Family in Chickpea (Cicer arietinum L.).

    PubMed

    Deokar, Amit A; Tar'an, Bunyamin

    2016-01-01

    Aquaporins (AQPs) are essential membrane proteins that play critical role in the transport of water and many other solutes across cell membranes. In this study, a comprehensive genome-wide analysis identified 40 AQP genes in chickpea (Cicer arietinum L.). A complete overview of the chickpea AQP (CaAQP) gene family is presented, including their chromosomal locations, gene structure, phylogeny, gene duplication, conserved functional motifs, gene expression, and conserved promoter motifs. To understand AQP's evolution, a comparative analysis of chickpea AQPs with AQP orthologs from soybean, Medicago, common bean, and Arabidopsis was performed. The chickpea AQP genes were found on all of the chickpea chromosomes, except chromosome 7, with a maximum of six genes on chromosome 6, and a minimum of one gene on chromosome 5. Gene duplication analysis indicated that the expansion of chickpea AQP gene family might have been due to segmental and tandem duplications. CaAQPs were grouped into four subfamilies including 15 NOD26-like intrinsic proteins (NIPs), 13 tonoplast intrinsic proteins (TIPs), eight plasma membrane intrinsic proteins (PIPs), and four small basic intrinsic proteins (SIPs) based on sequence similarities and phylogenetic position. Gene structure analysis revealed a highly conserved exon-intron pattern within CaAQP subfamilies supporting the CaAQP family classification. Functional prediction based on conserved Ar/R selectivity filters, Froger's residues, and specificity-determining positions suggested wide differences in substrate specificity among the subfamilies of CaAQPs. Expression analysis of the AQP genes indicated that some of the genes are tissue-specific, whereas few other AQP genes showed differential expression in response to biotic and abiotic stresses. Promoter profiling of CaAQP genes for conserved cis-acting regulatory elements revealed enrichment of cis-elements involved in circadian control, light response, defense and stress responsiveness

  13. Genome-Wide Analysis of the Aquaporin Gene Family in Chickpea (Cicer arietinum L.)

    PubMed Central

    Deokar, Amit A.; Tar'an, Bunyamin

    2016-01-01

    Aquaporins (AQPs) are essential membrane proteins that play critical role in the transport of water and many other solutes across cell membranes. In this study, a comprehensive genome-wide analysis identified 40 AQP genes in chickpea (Cicer arietinum L.). A complete overview of the chickpea AQP (CaAQP) gene family is presented, including their chromosomal locations, gene structure, phylogeny, gene duplication, conserved functional motifs, gene expression, and conserved promoter motifs. To understand AQP's evolution, a comparative analysis of chickpea AQPs with AQP orthologs from soybean, Medicago, common bean, and Arabidopsis was performed. The chickpea AQP genes were found on all of the chickpea chromosomes, except chromosome 7, with a maximum of six genes on chromosome 6, and a minimum of one gene on chromosome 5. Gene duplication analysis indicated that the expansion of chickpea AQP gene family might have been due to segmental and tandem duplications. CaAQPs were grouped into four subfamilies including 15 NOD26-like intrinsic proteins (NIPs), 13 tonoplast intrinsic proteins (TIPs), eight plasma membrane intrinsic proteins (PIPs), and four small basic intrinsic proteins (SIPs) based on sequence similarities and phylogenetic position. Gene structure analysis revealed a highly conserved exon-intron pattern within CaAQP subfamilies supporting the CaAQP family classification. Functional prediction based on conserved Ar/R selectivity filters, Froger's residues, and specificity-determining positions suggested wide differences in substrate specificity among the subfamilies of CaAQPs. Expression analysis of the AQP genes indicated that some of the genes are tissue-specific, whereas few other AQP genes showed differential expression in response to biotic and abiotic stresses. Promoter profiling of CaAQP genes for conserved cis-acting regulatory elements revealed enrichment of cis-elements involved in circadian control, light response, defense and stress responsiveness

  14. Characterization of resistance gene analogues (RGAs) in Apple (Malus 6domestica Borkh.) and their evolutionary history of the Rosaceae family

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The family of resistance gene analogues (RGAs) with a nucleotide-binding site (NBS) domain accounts for the largest number of disease resistance genes and is one of the largest gene families in plants. We have identified 868 RGAs in the genome of the apple (Malus × domestica Borkh.) cultivar ‘Golden...

  15. Distribution of mutations in the PEX gene in families with X-linked hypophosphataemic rickets (HYP).

    PubMed

    Rowe, P S; Oudet, C L; Francis, F; Sinding, C; Pannetier, S; Econs, M J; Strom, T M; Meitinger, T; Garabedian, M; David, A; Macher, M A; Questiaux, E; Popowska, E; Pronicka, E; Read, A P; Mokrzycki, A; Glorieux, F H; Drezner, M K; Hanauer, A; Lehrach, H; Goulding, J N; O'Riordan, J L

    1997-04-01

    Mutations in the PEX gene at Xp22.1 (phosphate-regulating gene with homologies to endopeptidases, on the X-chromosome), are responsible for X-linked hypophosphataemic rickets (HYP). Homology of PEX to the M13 family of Zn2+ metallopeptidases which include neprilysin (NEP) as prototype, has raised important questions regarding PEX function at the molecular level. The aim of this study was to analyse 99 HYP families for PEX gene mutations, and to correlate predicted changes in the protein structure with Zn2+ metallopeptidase gene function. Primers flanking 22 characterised exons were used to amplify DNA by PCR, and SSCP was then used to screen for mutations. Deletions, insertions, nonsense mutations, stop codons and splice mutations occurred in 83% of families screened for in all 22 exons, and 51% of a separate set of families screened in 17 PEX gene exons. Missense mutations in four regions of the gene were informative regarding function, with one mutation in the Zn2+-binding site predicted to alter substrate enzyme interaction and catalysis. Computer analysis of the remaining mutations predicted changes in secondary structure, N-glycosylation, protein phosphorylation and catalytic site molecular structure. The wide range of mutations that align with regions required for protease activity in NEP suggests that PEX also functions as a protease, and may act by processing factor(s) involved in bone mineral metabolism.

  16. Adaptation to drought in two wild tomato species: the evolution of the Asr gene family.

    PubMed

    Fischer, Iris; Camus-Kulandaivelu, Létizia; Allal, François; Stephan, Wolfgang

    2011-06-01

    Wild tomato species are a valuable system in which to study local adaptation to drought: they grow in diverse environments ranging from mesic to extremely arid conditions. Here, we investigate the evolution of members of the Asr (ABA/water stress/ripening induced) gene family, which have been reported to be involved in the water stress response. We analysed molecular variation in the Asr gene family in populations of two closely related species, Solanum chilense and Solanum peruvianum. We concluded that Asr1 has evolved under strong purifying selection. In contrast to previous reports, we did not detect evidence for positive selection at Asr2. However, Asr4 shows patterns consistent with local adaptation in an S. chilense population that lives in an extremely dry environment. We also discovered a new member of the gene family, Asr5. Our results show that the Asr genes constitute a dynamic gene family and provide an excellent example of tandemly arrayed genes that are of importance in adaptation. Taking the potential distribution of the species into account, it appears that S. peruvianum can cope with a great variety of environmental conditions without undergoing local adaptation, whereas S. chilense undergoes local adaptation more frequently.

  17. Challenges and solutions for gene identification in the presence of familial locus heterogeneity

    PubMed Central

    Rehman, Atteeq U; Santos-Cortez, Regie Lyn P; Drummond, Meghan C; Shahzad, Mohsin; Lee, Kwanghyuk; Morell, Robert J; Ansar, Muhammad; Jan, Abid; Wang, Xin; Aziz, Abdul; Riazuddin, Saima; Smith, Joshua D; Wang, Gao T; Ahmed, Zubair M; Gul, Khitab; Shearer, A Eliot; Smith, Richard J H; Shendure, Jay; Bamshad, Michael J; Nickerson, Deborah A; Hinnant, John; Khan, Shaheen N; Fisher, Rachel A; Ahmad, Wasim; Friderici, Karen H; Riazuddin, Sheikh; Friedman, Thomas B; Wilch, Ellen S; Leal, Suzanne M

    2015-01-01

    Next-generation sequencing (NGS) of exomes and genomes has accelerated the identification of genes involved in Mendelian phenotypes. However, many NGS studies fall short of identifying causal variants, with estimates for success rates as low as 25% for uncovering the pathological variant underlying disease etiology. An important reason for such failures is familial locus heterogeneity, where within a single pedigree causal variants in two or more genes underlie Mendelian trait etiology. As examples of intra- and inter-sibship familial locus heterogeneity, we present 10 consanguineous Pakistani families segregating hearing impairment due to homozygous variants in two different hearing impairment genes and a European-American pedigree in which hearing impairment is caused by four variants in three different genes. We have identified 41 additional pedigrees with syndromic and nonsyndromic hearing impairment for which a single previously reported hearing impairment gene has been identified but only segregates with the phenotype in a subset of affected pedigree members. We estimate that locus heterogeneity occurs in 15.3% (95% confidence interval: 11.9%, 19.9%) of the families in our collection. We demonstrate novel approaches to apply linkage analysis and homozygosity mapping (for autosomal recessive consanguineous pedigrees), which can be used to detect locus heterogeneity using either NGS or SNP array data. Results from linkage analysis and homozygosity mapping can also be used to group sibships or individuals most likely to be segregating the same causal variants and thereby increase the success rate of gene identification. PMID:25491636

  18. Analysis of factor VIII gene inversions in 164 unrelated hemophilia A families

    SciTech Connect

    Vnencak-Jones, L.; Phillips, J.A. III; Janco, R.L.

    1994-09-01

    Hemophilia A is an X-linked recessive disease with variable phenotype and both heterogeneous and wide spread mutations in the factor VIII (F8) gene. As a result, diagnostic carrier or prenatal testing often relies upon laborious DNA linkage analysis. Recently, inversion mutations resulting from an intrachromosomal recombination between DNA sequences in one of two A genes {approximately}500 kb upstream from the F8 gene and a homologous A gene in intron 22 of the F8 gene were identified and found in 45% of severe hemophiliacs. We have analyzed banked DNA collected since 1986 from affected males or obligate carrier females representing 164 unrelated hemophilia A families. The disease was sporadic in 37%, familial in 54% and in 10% of families incomplete information was given. A unique deletion was identified in 1/164, a normal pattern was observed in 110/164 (67%), and 53/164 (32%) families had inversion mutations with 43/53 (81%) involving the distal A gene (R3 pattern) and 10/53 (19%) involving the proximal A gene (R2 pattern). While 19% of all rearrangements were R2, in 35 families with severe disease (< 1% VIII:C activity) all 16 rearrangements seen were R3. In 18 families with the R3 pattern and known activities, 16 (89%) had levels < 1%, with the remaining 2 families having {le} 2.4% activity. Further, 18 referrals specifically noted the production of inhibitors and 8/18 (45%) had the R3 pattern. Our findings demonstrate that the R3 inversion mutation patterns is (1) only seen with VIII:C activity levels of {le} 2.4%, (2) seen in 46% of families with severe hemophilia, (3) seen in 45% of hemophiliacs known to have inhibitors, (4) not correlated with sporadic or familial disease and (5) not in disequilibrium with the Bcl I or Taq I intron 18 or ST14 polymorphisms. Finally, in families positive for an inversion mutation, direct testing offers a highly accurate and less expensive alternative to DNA linkage analysis.

  19. Genome-wide investigation and transcriptome analysis of the WRKY gene family in Gossypium.

    PubMed

    Ding, Mingquan; Chen, Jiadong; Jiang, Yurong; Lin, Lifeng; Cao, YueFen; Wang, Minhua; Zhang, Yuting; Rong, Junkang; Ye, Wuwei

    2015-02-01

    WRKY transcription factors play important roles in various stress responses in diverse plant species. In cotton, this family has not been well studied, especially in relation to fiber development. Here, the genomes and transcriptomes of Gossypium raimondii and Gossypium arboreum were investigated to identify fiber development related WRKY genes. This represents the first comprehensive comparative study of WRKY transcription factors in both diploid A and D cotton species. In total, 112 G. raimondii and 109 G. arboreum WRKY genes were identified. No significant gene structure or domain alterations were detected between the two species, but many SNPs distributed unequally in exon and intron regions. Physical mapping revealed that the WRKY genes in G. arboreum were not located in the corresponding chromosomes of G. raimondii, suggesting great chromosome rearrangement in the diploid cotton genomes. The cotton WRKY genes, especially subgroups I and II, have expanded through multiple whole genome duplications and tandem duplications compared with other plant species. Sequence comparison showed many functionally divergent sites between WRKY subgroups, while the genes within each group are under strong purifying selection. Transcriptome analysis suggested that many WRKY genes participate in specific fiber development processes such as fiber initiation, elongation and maturation with different expression patterns between species. Complex WRKY gene expression such as differential Dt and At allelic gene expression in G. hirsutum and alternative splicing events were also observed in both diploid and tetraploid cottons during fiber development process. In conclusion, this study provides important information on the evolution and function of WRKY gene family in cotton species.

  20. Genome-wide analysis of the WRKY gene family in physic nut (Jatropha curcas L.).

    PubMed

    Xiong, Wangdan; Xu, Xueqin; Zhang, Lin; Wu, Pingzhi; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang

    2013-07-25

    The WRKY proteins, which contain highly conserved WRKYGQK amino acid sequences and zinc-finger-like motifs, constitute a large family of transcription factors in plants. They participate in diverse physiological and developmental processes. WRKY genes have been identified and characterized in a number of plant species. We identified a total of 58 WRKY genes (JcWRKY) in the genome of the physic nut (Jatropha curcas L.). On the basis of their conserved WRKY domain sequences, all of the JcWRKY proteins could be assigned to one of the previously defined groups, I-III. Phylogenetic analysis of JcWRKY genes with Arabidopsis and rice WRKY genes, and separately with castor bean WRKY genes, revealed no evidence of recent gene duplication in JcWRKY gene family. Analysis of transcript abundance of JcWRKY gene products were tested in different tissues under normal growth condition. In addition, 47 WRKY genes responded to at least one abiotic stress (drought, salinity, phosphate starvation and nitrogen starvation) in individual tissues (leaf, root and/or shoot cortex). Our study provides a useful reference data set as the basis for cloning and functional analysis of physic nut WRKY genes.

  1. Genome-Wide Analysis of the NADK Gene Family in Plants

    PubMed Central

    Li, Wen-Yan; Wang, Xiang; Li, Ri; Li, Wen-Qiang; Chen, Kun-Ming

    2014-01-01

    Background NAD(H) kinase (NADK) is the key enzyme that catalyzes de novo synthesis of NADP(H) from NAD(H) for NADP(H)-based metabolic pathways. In plants, NADKs form functional subfamilies. Studies of these families in Arabidopsis thaliana indicate that they have undergone considerable evolutionary selection; however, the detailed evolutionary history and functions of the various NADKs in plants are not clearly understood. Principal Findings We performed a comparative genomic analysis that identified 74 NADK gene homologs from 24 species representing the eight major plant lineages within the supergroup Plantae: glaucophytes, rhodophytes, chlorophytes, bryophytes, lycophytes, gymnosperms, monocots and eudicots. Phylogenetic and structural analysis classified these NADK genes into four well-conserved subfamilies with considerable variety in the domain organization and gene structure among subfamily members. In addition to the typical NAD_kinase domain, additional domains, such as adenylate kinase, dual-specificity phosphatase, and protein tyrosine phosphatase catalytic domains, were found in subfamily II. Interestingly, NADKs in subfamily III exhibited low sequence similarity (∼30%) in the kinase domain within the subfamily and with the other subfamilies. These observations suggest that gene fusion and exon shuffling may have occurred after gene duplication, leading to specific domain organization seen in subfamilies II and III, respectively. Further analysis of the exon/intron structures showed that single intron loss and gain had occurred, yielding the diversified gene structures, during the process of structural evolution of NADK family genes. Finally, both available global microarray data analysis and qRT-RCR experiments revealed that the NADK genes in Arabidopsis and Oryza sativa show different expression patterns in different developmental stages and under several different abiotic/biotic stresses and hormone treatments, underscoring the functional diversity

  2. OAS Gene Family Expression Is Associated with HIV-Related Neurocognitive Disorders.

    PubMed

    Sanfilippo, C; Pinzone, M R; Cambria, D; Longo, A; Palumbo, M; Di Marco, R; Condorelli, F; Nunnari, G; Malaguarnera, L; Di Rosa, M

    2017-02-24

    HIV-associated neurocognitive disorders are common in HIV-infected individuals, even in the combination antiretroviral therapy (c-ART) era. Several mechanisms are involved in neuronal damage, including chronic inflammation immune activation. Mammalian 2'-5'-oligoadenylate synthetase (OAS) genes are produced in response to interferon (IFN), mainly by monocytes, and exert their antiviral functions by activation of RNase L that degrades viral and cellular RNAs. In this study, we aimed at exploring OAS gene family RNA expression in simian immunodeficiency virus encephalitis (SIVE), in HIV-associated neurocognitive disorders (HAND), and in HIV-associate dementia (HAD). We analyzed three microarray datasets obtained from the NCBI in order to assess the expression levels of OAS gene family network in brain biopsies of macaques with SIVE vs uninfected animals, as well as post-mortem brain of individuals with HAND (on or off ART) vs uninfected controls and three brain regions of HIV-infected individuals with both neurocognitive impairment (HAD) and encephalitis (HIVE). All OAS genes were upregulated both in SIVE and in HAND. OAS expression was significantly higher in high-viremic individuals; increased expression levels persisted in cART subjects when compared to healthy controls. OAS gene network analysis showed that several genes belonging to the type I IFN pathway, especially CXCL10 and IFIT3, were similarly upregulated in SIVE/HAND. Furthermore, we identified a significant upregulation of OAS gene family RNA expression in basal ganglia, white matter, and frontal cortex of HIV-1, HAD, and HAD/HIVE patients compared to healthy subjects. OAS gene family expression is increased in brain sections from individuals with HAND, HAD, and HIVE as well as macaques with SIVE. OAS family expression is likely to be induced by IFN as a consequence of viral replication in the CNS. Its long-term upregulation may contribute to the chronic inflammatory status and neurocognitive impairment

  3. Genome-wide identification and analysis of the MADS-box gene family in sesame.

    PubMed

    Wei, Xin; Wang, Linhai; Yu, Jingyin; Zhang, Yanxin; Li, Donghua; Zhang, Xiurong

    2015-09-10

    MADS-box genes encode transcription factors that play crucial roles in plant growth and development. Sesame (Sesamum indicum L.) is an oil crop that contributes to the daily oil and protein requirements of almost half of the world's population; therefore, a genome-wide analysis of the MADS-box gene family is needed. Fifty-seven MADS-box genes were identified from 14 linkage groups of the sesame genome. Analysis of phylogenetic relationships with Arabidopsis thaliana, Utricularia gibba and Solanum lycopersicum MADS-box genes was performed. Sesame MADS-box genes were clustered into four groups: 28 MIKC(c)-type, 5 MIKC(⁎)-type, 14 Mα-type and 10 Mγ-type. Gene structure analysis revealed from 1 to 22 exons of sesame MADS-box genes. The number of exons in type II MADS-box genes greatly exceeded the number in type I genes. Motif distribution analysis of sesame MADS-box genes also indicated that type II MADS-box genes contained more motifs than type I genes. These results suggested that type II sesame MADS-box genes had more complex structures. By analyzing expression profiles of MADS-box genes in seven sesame transcriptomes, we determined that MIKC(C)-type MADS-box genes played significant roles in sesame flower and seed development. Although most MADS-box genes in the same clade showed similar expression features, some gene functions were diversified from the orthologous Arabidopsis genes. This research will contribute to uncovering the role of MADS-box genes in sesame development.

  4. Novel mutation of the NOTCH3 gene in a Polish family with CADASIL.

    PubMed

    Buczek, Julia; Błażejewska-Hyżorek, Beata; Cudna, Agnieszka; Lusawa, Małgorzata; Lewandowska, Eliza; Kurkowska-Jastrzębska, Iwona; Członkowska, Anna

    2016-01-01

    Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL) is an inherited small blood vessels disease caused by mutations in the gene encoding the neurogenic locus notch homolog protein 3 (NOTCH 3). We present a Polish family with a previously unreported novel mutation in exon 12 c.1851C>C/G of the NOTCH3 gene and varying disease expression. One of the two family members with the confirmed mutation presented with all the main CADASIL symptoms; while, his affected father was nearly asymptomatic. Both family members had epilepsy, coronary artery disease, and abdominal aorta aneurysm. Our observation confirms there is phenotypic variability in CADASIL not only between, but also within, families carrying the same mutation.

  5. Phylogenetic conservation and physical mapping of members of the H6 homeobox gene family.

    PubMed

    Stadler, H S; Murray, J C; Leysens, N J; Goodfellow, P J; Solursh, M

    1995-06-01

    Homeobox genes represent a class of transcription factors that play key roles in the regulation of embryogenesis and development. Here we report the identification of a homeobox-containing gene family that is highly conserved at both the nucleotide and amino acid levels in a diverse number of species. These species encompass both vertebrate and invertebrate phylogenies, ranging from Homo sapiens to Drosophila melanogaster. In humans, at least two homeobox sequences from this family were identified representing a previously reported member of this family as well as a novel homeobox sequence that we physically mapped to the 10q25.2-q26.3 region of human Chromosome (Chr) 10. Multiple members of this family were also detected in three additional vertebrate species including Equus caballus (horse), Gallus gallus (Chicken), and Mus musculus (mouse), whereas only single members were detected in Tripneustes gratilla (sea urchin), Petromyzon marinus (lamprey), Salmo salar (salmon), Ovis aries (sheep), and D. melanogaster (fruit fly).

  6. A nonsense mutation in the LDL receptor gene leads to familial hypercholesterolemia in the Druze sect

    SciTech Connect

    Landsberger, D.; Meiner, V.; Reshef, A.; Leitersdorf, E. ); Levy, Yishai ); Westhytzen, D.R. van der; Coetzee, G.A. )

    1992-02-01

    Familial hypercholesterolemia (FH) is an autosomal dominant disease caused by mutations in the LDL receptor gene. Here the authors characterize and LDL receptor mutation that is associated with a distinct haplotype and causes FH in the Druze, a small Middle Eastern Islamic sect with a high degree of inbreeding. The mutation was found in FH families from two distinct Druze villages from the Golan Heights (northern Israel). It was not found either in another Druze FH family residing in a different geographical area nor in eight Arab and four Jewish FH heterozygote index cases whose hypercholesterolemia cosegregates with an identical LDL receptor gene haplotype. The mutation, a single-base substitution, results in a termination codon in exon 4 of the LDL receptor gene that encodes for the fourth repeat of the binding domain of the mature receptor. It can be diagnosed by allele-specific oligonucleotide hybridization of PCR-amplified DNA from FH patients.

  7. Cross-Family Transcription Factor Interactions: An Additional Layer of Gene Regulation.

    PubMed

    Bemer, Marian; van Dijk, Aalt D J; Immink, Richard G H; Angenent, Gerco C

    2017-01-01

    Specific and dynamic gene expression strongly depends on transcription factor (TF) activity and most plant TFs function in a combinatorial fashion. They can bind to DNA and control the expression of the corresponding gene in an additive fashion or cooperate by physical interactions, forming larger protein complexes. The importance of protein-protein interactions between members of a particular plant TF family has long been recognised; however, a significant number of interfamily TF interactions has recently been reported. The biological implications and the molecular mechanisms involved in cross-family interactions have now started to be elucidated and the examples illustrate potential roles in the bridging of biological processes. Hence, cross-family TF interactions expand the molecular toolbox for plants with additional mechanisms to control and fine-tune robust gene expression patterns and to adapt to their continuously changing environment.

  8. The inhibitory effect of the cerebellar fastigial stimulation on ADH secretion.

    PubMed

    Hata, N; Miura, M

    1974-11-01

    1. Both cardiovascular and antidiuretic hormone (ADH) responses to some neural inputs were examined in paralysed anaesthetized cats.2. Carotid occlusion elicited cardiovascular responses and increased ADH secretion. When the electrical stimulation of discrete loci of the cerebellar fastigial nucleus (fastigial pressor area) was superimposed on carotid occlusion, cardiovascular responses were further facilitated, while ADH secretion was inhibited.3. The fastigial stimulation alone elicited facilitory cardiovascular responses composed of hypertension and tachycardia, and the fastigial pressor response (FPR), but did not evoke any consistent ADH response.4. These facts indicate that cerebellar modulation of ADH secretion occurs not directly via the hypothalamo-hypophysial system but through the lower brain stem to which both carotid sinus nerves and outflows from the fastigial pressor area project.5. We conclude that the fastigial pressor area is specific for not only cardiovascular and other autonomic responses but pituitary hormonal response.

  9. The ABC transporter gene family of Daphnia pulex

    PubMed Central

    Sturm, Armin; Cunningham, Phil; Dean, Michael

    2009-01-01

    Background The large gene superfamily of ABC (ATP-binding cassette) transporters encodes membrane proteins involved in trafficking processes across biological membranes and further essential cell biological functions. ABC transporters are evolutionary ancient and involved in the biochemical defence against toxicants. We report here a genome-wide survey of ABC proteins of Daphnia pulex, providing for the first time information on ABC proteins in crustacea, a primarily aquatic arthropod subphylum of high ecological and economical importance. Results We identified 64 ABC proteins in the Daphnia genome, which possesses members of all current ABC subfamilies A to H. To unravel phylogenetic relationships, ABC proteins of Daphnia were compared to those from yeast, worm, fruit fly and human. A high conservation of Daphnia of ABC transporters was observed for proteins involved in fundamental cellular processes, including the mitochondrial half transporters of the ABCB subfamily, which function in iron metabolism and transport of Fe/S protein precursors, and the members of subfamilies ABCD, ABCE and ABCF, which have roles in very long chain fatty acid transport, initiation of gene transcription and protein translation, respectively. A number of Daphnia proteins showed one-to-one orthologous relationships to Drosophila ABC proteins including the sulfonyl urea receptor (SUR), the ecdysone transporter ET23, and the eye pigment precursor transporter scarlet. As the fruit fly, Daphnia lacked homologues to the TAP protein, which plays a role in antigene processing, and the cystic fibrosis transmembrane conductance regulator (CFTR), which functions as a chloride channel. Daphnia showed two proteins homologous to MDR (multidrug resistance) P-glycoproteins (ABCB subfamily) and six proteins homologous to MRPs (multidrug resistance-associated proteins) (ABCC subfamily). However, lineage specific gene duplications in the ABCB and ABCC subfamilies complicated the inference of function. A

  10. Cloning and characterization of a second member of the mouse mdr gene family.

    PubMed Central

    Gros, P; Raymond, M; Bell, J; Housman, D

    1988-01-01

    The mammalian mdr gene family comprises a small number of closely related genes. Previously, we have shown that one member, mdr1, has the capacity to convey multidrug resistance to drug-sensitive recipient cells in a gene transfer protocol. However, the functional characteristics of other members of this gene family have not been examined. In this report, we characterize a second member of the mdr gene family which we designated mdr2. We determined the nucleotide sequence corresponding to the complete coding region of this mdr2 transcript. The predicted amino acid sequence of this protein (1,276 amino acids) showed that it is a membrane glycoprotein highly homologous to mdr1 (85%), strongly suggesting that both genes originate from a common ancestor. Regions of divergence between mdr1 and mdr2 proteins are concentrated in two discrete segments of the predicted polypeptides, each approximately 100 residues in length. The mdr2 protein appears to be formed by the duplication of a structural unit which encodes three putative transmembrane loops and a predicted nucleotide-binding fold and is highly homologous to bacterial transport proteins such as hlyB. This strong homology suggests that mdr2 also participates in an energy-dependent membrane transport process. However, the direct relationship, if any, of this new member of the mdr family to multidrug resistance remains to be established. Knowledge of the complete nucleotide sequence and predicted amino acid sequence of the mdr2 gene product will enable the preparation of gene-specific probes and antibodies necessary to study the functional role of this gene in multidrug resistance and normal physiological processes. PMID:3405218

  11. Evolutionary mechanisms driving the evolution of a large polydnavirus gene family coding for protein tyrosine phosphatases

    PubMed Central

    2012-01-01

    Background Gene duplications have been proposed to be the main mechanism involved in genome evolution and in acquisition of new functions. Polydnaviruses (PDVs), symbiotic viruses associated with parasitoid wasps, are ideal model systems to study mechanisms of gene duplications given that PDV genomes consist of virulence genes organized into multigene families. In these systems the viral genome is integrated in a wasp chromosome as a provirus and virus particles containing circular double-stranded DNA are injected into the parasitoids’ hosts and are essential for parasitism success. The viral virulence factors, organized in gene families, are required collectively to induce host immune suppression and developmental arrest. The gene family which encodes protein tyrosine phosphatases (PTPs) has undergone spectacular expansion in several PDV genomes with up to 42 genes. Results Here, we present strong indications that PTP gene family expansion occurred via classical mechanisms: by duplication of large segments of the chromosomally integrated form of the virus sequences (segmental duplication), by tandem duplications within this form and by dispersed duplications. We also propose a novel duplication mechanism specific to PDVs that involves viral circle reintegration into the wasp genome. The PTP copies produced were shown to undergo conservative evolution along with episodes of adaptive evolution. In particular recently produced copies have undergone positive selection in sites most likely involved in defining substrate selectivity. Conclusion The results provide evidence about the dynamic nature of polydnavirus proviral genomes. Classical and PDV-specific duplication mechanisms have been involved in the production of new gene copies. Selection pressures associated with antagonistic interactions with parasitized hosts have shaped these genes used to manipulate lepidopteran physiology with evidence for positive selection involved in adaptation to host targets. PMID

  12. Evolutionary Pattern and Regulation Analysis to Support Why Diversity Functions Existed within PPAR Gene Family Members

    PubMed Central

    Yan, Xiping; Wang, Guosong; Liu, Hehe; Gan, Xiang; Zhang, Tao; Wang, Jiwen; Li, Liang

    2015-01-01

    Peroxisome proliferators-activated receptor (PPAR) gene family members exhibit distinct patterns of distribution in tissues and differ in functions. The purpose of this study is to investigate the evolutionary impacts on diversity functions of PPAR members and the regulatory differences on gene expression patterns. 63 homology sequences of PPAR genes from 31 species were collected and analyzed. The results showed that three isolated types of PPAR gene family may emerge from twice times of gene duplication events. The conserved domains of HOLI (ligand binding domain of hormone receptors) domain and ZnF_C4 (C4 zinc finger in nuclear in hormone receptors) are essential for keeping basic roles of PPAR gene family, and the variant domains of LCRs may be responsible for their divergence in functions. The positive selection sites in HOLI domain are benefit for PPARs to evolve towards diversity functions. The evolutionary variants in the promoter regions and 3′ UTR regions of PPARs result into differential transcription factors and miRNAs involved in regulating PPAR members, which may eventually affect their expressions and tissues distributions. These results indicate that gene duplication event, selection pressure on HOLI domain, and the variants on promoter and 3′ UTR are essential for PPARs evolution and diversity functions acquired. PMID:25961030

  13. Distinct patterns of expression of the RB gene family in mouse and human retina.

    PubMed

    Spencer, Clarellen; Pajovic, Sanja; Devlin, Hollie; Dinh, Quynh-Dao; Corson, Timothy W; Gallie, Brenda L

    2005-06-01

    Although RB1 function is disrupted in the majority of human cancers, an undefined cell of developing human retina is uniquely sensitive to cancer induction when the RB1 tumor suppressor gene is lost. Murine retinoblastoma is initiated only when two of the RB family of genes, RB1 and p107 or p130, are inactivated. Although whole embryonic retina shows RB family gene expression by several techniques, when E14 developing retina was depleted of the earliest differentiating cells, ganglion cells, the remaining proliferating murine embryonic retinal progenitor cells clearly did not express RB1 or p130, while the longer splice form of p107 was expressed. Each retinal cell type expressed some member of the RB family at some stage of differentiation. Rod photoreceptors stained for the RB1 protein product, pRB, and p107 in only a brief window of postnatal murine development, with no detectable staining for any of the RB family proteins in adult human and mouse rod photoreceptors. Adult mouse and human Muller glia, ganglion and rare horizontal cells, and adult human, but not adult mouse, cone photoreceptors stained for pRB. The RB gene family is dynamically and variably expressed through retinal development in specific retinal cells.

  14. Evolutionary History of Cathepsin L (L-like) Family Genes in Vertebrates

    PubMed Central

    Zhou, Jin; Zhang, Yao-Yang; Li, Qing-Yun; Cai, Zhong-Hua

    2015-01-01

    Cathepsin L family, an important cysteine protease found in lysosomes, is categorized into cathepsins B, F, H, K, L, S, and W in vertebrates. This categorization is based on their sequence alignment and traditional functional classification, but the evolutionary relationship of family members is unclear. This study determined the evolutionary relationship of cathepsin L family genes in vertebrates through phylogenetic construction. Results showed that cathepsins F, H, S and K, and L and V were chronologically diverged. Tandem-repeat duplication was found to occur in the evolutionary history of cathepsin L family. Cathepsin L in zebrafish, cathepsins S and K in xenopus, and cathepsin L in mice and rats underwent evident tandem-repeat events. Positive selection was detected in cathepsin L-like members in mice and rats, and amino acid sites under positive selection pressure were calculated. Most of these sites appeared at the connection of secondary structures, suggesting that the sites may slightly change spatial structure. Severe positive selection was also observed in cathepsin V (L2) of primates, indicating that this enzyme had some special functions. Our work provided a brief evolutionary history of cathepsin L family and differentiated cathepsins S and K from cathepsin L based on vertebrate appearance. Positive selection was the specific cause of differentiation of cathepsin L family genes, confirming that gene function variation after expansion events was related to interactions with the environment and adaptability. PMID:26221069

  15. Evolutionary History of Cathepsin L (L-like) Family Genes in Vertebrates.

    PubMed

    Zhou, Jin; Zhang, Yao-Yang; Li, Qing-Yun; Cai, Zhong-Hua

    2015-01-01

    Cathepsin L family, an important cysteine protease found in lysosomes, is categorized into cathepsins B, F, H, K, L, S, and W in vertebrates. This categorization is based on their sequence alignment and traditional functional classification, but the evolutionary relationship of family members is unclear. This study determined the evolutionary relationship of cathepsin L family genes in vertebrates through phylogenetic construction. Results showed that cathepsins F, H, S and K, and L and V were chronologically diverged. Tandem-repeat duplication was found to occur in the evolutionary history of cathepsin L family. Cathepsin L in zebrafish, cathepsins S and K in xenopus, and cathepsin L in mice and rats underwent evident tandem-repeat events. Positive selection was detected in cathepsin L-like members in mice and rats, and amino acid sites under positive selection pressure were calculated. Most of these sites appeared at the connection of secondary structures, suggesting that the sites may slightly change spatial structure. Severe positive selection was also observed in cathepsin V (L2) of primates, indicating that this enzyme had some special functions. Our work provided a brief evolutionary history of cathepsin L family and differentiated cathepsins S and K from cathepsin L based on vertebrate appearance. Positive selection was the specific cause of differentiation of cathepsin L family genes, confirming that gene function variation after expansion events was related to interactions with the environment and adaptability.

  16. Different RET gene mutation-induced multiple endocrine neoplasia type 2A in 3 Chinese families

    PubMed Central

    Liu, Qiuli; Tong, Dali; Yuan, Wenqiang; Liu, Gaolei; Yuan, Gang; Lan, Weihua; Zhang, Dianzheng; Zhang, Jun; Huang, Zaoming; Zhang, Yao; Jiang, Jun

    2017-01-01

    Abstract Backgroud: Multiple endocrine neoplasia type 2A (MEN2A) is a condition with inherited autosomal dominant mutations in RET (rearranged during transfection) gene that predisposes the carrier to extremely high risk of medullary thyroid cancer (MTC) and other MEN2A-associated tumors such as parathyroid cancer and/or pheochromocytoma. Little is reported about MEN2A syndrome in the Chinese population. Methods: All members of the 3 families along with specific probands of MEN2A were analyzed for their clinical, laboratory, and genetic characteristics. Exome sequencing was performed on the 3 probands, and specific mutation in RET was further screened on each of the family members. Results: Different mutations in the RET gene were identified: C634S in Family 1, C611Y in Family 2, and C634Y in Family 3. Proband 1 mainly showed pheochromocytoma with MTC, both medullary thyroid carcinoma and pheochromocytoma were seen in proband 2, and proband 3 showed medullary thyroid carcinoma. Conclusion: The genetic evaluation is strongly recommended for patients with a positive family history, early onset of age, or multiple sites of masses. If the results verified the mutations of RET gene, thyroidectomy should be undertaken as the guide for better prognosis. PMID:28099363

  17. Genome-wide analysis of the omega-3 fatty acid desaturase gene family in Gossypium

    DOE PAGES

    Yurchenko, Olga P.; Park, Sunjung; Ilut, Daniel C.; ...

    2014-11-18

    The majority of commercial cotton varieties planted worldwide are derived from Gossypium hirsutum, which is a naturally occurring allotetraploid produced by interspecific hybridization of A- and D-genome diploid progenitor species. While most cotton species are adapted to warm, semi-arid tropical and subtropical regions, and thus perform well in these geographical areas, cotton seedlings are sensitive to cold temperature, which can significantly reduce crop yields. One of the common biochemical responses of plants to cold temperatures is an increase in omega-3 fatty acids, which protects cellular function by maintaining membrane integrity. The purpose of our study was to identify and characterizemore » the omega-3 fatty acid desaturase (FAD) gene family in G. hirsutum, with an emphasis on identifying omega-3 FADs involved in cold temperature adaptation. Results: Eleven omega-3 FAD genes were identified in G. hirsutum, and characterization of the gene family in extant A and D diploid species (G. herbaceum and G. raimondii, respectively) allowed for unambiguous genome assignment of all homoeologs in tetraploid G. hirsutum. The omega-3 FAD family of cotton includes five distinct genes, two of which encode endoplasmic reticulum-type enzymes (FAD3-1 and FAD3-2) and three that encode chloroplast-type enzymes (FAD7/8-1, FAD7/8-2, and FAD7/8-3). The FAD3-2 gene was duplicated in the A genome progenitor species after the evolutionary split from the D progenitor, but before the interspecific hybridization event that gave rise to modern tetraploid cotton. RNA-seq analysis revealed conserved, gene-specific expression patterns in various organs and cell types and semi-quantitative RT-PCR further revealed that FAD7/8-1 was specifically induced during cold temperature treatment of G. hirsutum seedlings. Conclusions: The omega-3 FAD gene family in cotton was characterized at the genome-wide level in three species, showing relatively ancient establishment of the gene family prior

  18. Genome-Wide Identification, Evolution and Expression Analysis of mTERF Gene Family in Maize

    PubMed Central

    Zhao, Yanxin; Cai, Manjun; Zhang, Xiaobo; Li, Yurong; Zhang, Jianhua; Zhao, Hailiang; Kong, Fei; Zheng, Yonglian; Qiu, Fazhan

    2014-01-01

    Plant mitochondrial transcription termination factor (mTERF) genes comprise a large family with important roles in regulating organelle gene expression. In this study, a comprehensive database search yielded 31 potential mTERF genes in maize (Zea mays L.) and most of them were targeted to mitochondria or chloroplasts. Maize mTERF were divided into nine main groups based on phylogenetic analysis, and group IX represented the mitochondria and species-specific clade that diverged from other groups. Tandem and segmental duplication both contributed to the expansion of the mTERF gene family in the maize genome. Comprehensive expression analysis of these genes, using microarray data and RNA-seq data, revealed that these genes exhibit a variety of expression patterns. Environmental stimulus experiments revealed differential up or down-regulation expression of maize mTERF genes in seedlings exposed to light/dark, salts and plant hormones, respectively, suggesting various important roles of maize mTERF genes in light acclimation and stress-related responses. These results will be useful for elucidating the roles of mTERF genes in the growth, development and stress response of maize. PMID:24718683

  19. Genome-wide identification and characterization of the Dof gene family in Medicago truncatula.

    PubMed

    Shu, Y J; Song, L L; Zhang, J; Liu, Y; Guo, C H

    2015-09-09

    The DNA-binding one zinc finger (Dof) family is a classic plant-specific zinc-finger transcription factor family, which is involved in many important processes, including seed maturation and germination, plant growth and development, and light responses. Investigation of the Medicago truncatula genome revealed 42 putative Dof genes, each of which holds one Dof domain. These genes were classified into four groups based on phylogenetic analysis, which are similar to the groups reported for Arabidopsis and rice. Based on genome duplication analysis, it was found that the MtDof genes were distributed on all chromosomes and had expanded through tandem gene duplication and segmental duplication events. Two main duplication regions were identified, one from tandem duplication and another from segmental duplication. By analyzing high-throughput sequencing data from M. truncatula, we found that most of the MtDof genes showed specific expression patterns in different tissues. According to cis-regulatory element analysis, these MtDof genes are regulated by different cis-acting motifs, which are important for the functional divergence of the MtDof genes in different processes. Thus, using genome-wide identification, evolution, and expression pattern analysis of the Dof genes in M. truncatula, our study provides valuable information for understanding the potential function of the Dof genes in regulating the growth and development of M. truncatula.

  20. Expression Pattern of ERF Gene Family under Multiple Abiotic Stresses in Populus simonii × P. nigra.

    PubMed

    Yao, Wenjing; Zhang, Xuemei; Zhou, Boru; Zhao, Kai; Li, Renhua; Jiang, Tingbo

    2017-01-01

    Identification of gene expression patterns of key genes across multiple abiotic stresses is critical for mechanistic understanding of stress resistance in plant. In the present study, we identified differentially expressed genes (DEGs) in di-haploid Populus simonii × P. nigra under respective stresses of NaCl, KCl, CdCl2, and PEG. On the basis of RNA-Seq, we detected 247 DEGs that are shared by the four stresses in wild type poplar, and mRNA abundance of the DEGs were validated in transgenic poplar overexpressing ERF76 gene by RNA-Seq and RT-qPCR. Results from gene ontology analysis indicated that these genes are enriched in significant pathways, such as phenylpropanoid biosynthesis, phenylalanine metabolism, starch and sucrose metabolism, and plant hormone signal transduction. Ethylene response factor (ERF) gene family plays significant role in plant abiotic stress responses. We also investigated expression pattern of ERF gene family under the four stresses. The ERFs and DEGs share similar expression pattern across the four stresses. The transgenic poplar is superior to WT in morphologic, physiological and biochemical traits, which demonstrated the ERF76 gene plays a significant role in stress resistance. These studies will give a rise in understanding the stress response mechanisms in poplar.

  1. Expression Pattern of ERF Gene Family under Multiple Abiotic Stresses in Populus simonii × P. nigra

    PubMed Central

    Yao, Wenjing; Zhang, Xuemei; Zhou, Boru; Zhao, Kai; Li, Renhua; Jiang, Tingbo

    2017-01-01

    Identification of gene expression patterns of key genes across multiple abiotic stresses is critical for mechanistic understanding of stress resistance in plant. In the present study, we identified differentially expressed genes (DEGs) in di-haploid Populus simonii × P. nigra under respective stresses of NaCl, KCl, CdCl2, and PEG. On the basis of RNA-Seq, we detected 247 DEGs that are shared by the four stresses in wild type poplar, and mRNA abundance of the DEGs were validated in transgenic poplar overexpressing ERF76 gene by RNA-Seq and RT-qPCR. Results from gene ontology analysis indicated that these genes are enriched in significant pathways, such as phenylpropanoid biosynthesis, phenylalanine metabolism, starch and sucrose metabolism, and plant hormone signal transduction. Ethylene response factor (ERF) gene family plays significant role in plant abiotic stress responses. We also investigated expression pattern of ERF gene family under the four stresses. The ERFs and DEGs share similar expression pattern across the four stresses. The transgenic poplar is superior to WT in morphologic, physiological and biochemical traits, which demonstrated the ERF76 gene plays a significant role in stress resistance. These studies will give a rise in understanding the stress response mechanisms in poplar. PMID:28265277

  2. Genome-wide analysis of WOX gene family in rice, sorghum, maize, Arabidopsis and poplar.

    PubMed

    Zhang, Xin; Zong, Jie; Liu, Jianhua; Yin, Jinyuan; Zhang, Dabing

    2010-11-01

    WUSCHEL-related homeobox (WOX) genes form a large gene family specifically expressed in plants. They are known to play important roles in regulating the development of plant tissues and organs by determining cell fate. Recent available whole genome sequences allow us to do more comprehensive phylogenetic analysis of the WOX genes in plants. In the present study, we identified 11 and 21 WOXs from sorghum (Sorghum bicolor) and maize (Zea mays), respectively. The 72 WOX genes from rice (Oryza sativa), sorghum, maize, Arabidopsis (Arabidopsis thaliana) and poplar (Populus trichocarpa) were grouped into three well supported clades with nine subgroups according to the amino acid sequences of their homodomains. Their phylogenetic relationship was also supported by the observation of the motifs outside the homodomain. We observed the variation of duplication events among the nine sub-groups between monocots and eudicots, for instance, more gene duplication events of WOXs within subgroup A for monocots, while, less for dicots in this subgroup. Furthermore, we observed the conserved intron/exon structural patterns of WOX genes in rice, sorghum and Arabidopsis. In addition, WUS (Wuschel)-box and EAR (the ERF-associated amphiphilic repression)-like motif were observed to be conserved among several WOX subgroups in these five plants. Comparative analysis of expression patterns of WOX genes in rice and Arabidopsis suggest that the WOX genes play conserved and various roles in plants. This work provides insights into the evolution of the WOX gene family and is useful for future research.

  3. Isolation, structural analysis, and expression characteristics of the maize TIFY gene family.

    PubMed

    Zhang, Zhongbao; Li, Xianglong; Yu, Rong; Han, Meng; Wu, Zhongyi

    2015-10-01

    TIFY, previously known as ZIM, comprises a plant-specific family annotated as transcription factors that might play important roles in stress response. Despite TIFY proteins have been reported in Arabidopsis and rice, a comprehensive and systematic survey of ZmTIFY genes has not yet been conducted. To investigate the functions of ZmTIFY genes in this family, we isolated and characterized 30 ZmTIFY (1 TIFY, 3 ZML, and 26 JAZ) genes in an analysis of the maize (Zea mays L.) genome in this study. The 30 ZmTIFY genes were distributed over eight chromosomes. Multiple alignment and motif display results indicated that all ZmTIFY proteins share two conserved TIFY and Jas domains. Phylogenetic analysis revealed that the ZmTIFY family could be divided into two groups. Putative cis-elements, involved in abiotic stress response, phytohormones, pollen grain, and seed development, were detected in the promoters of maize TIFY genes. Microarray data showed that the ZmTIFY genes had tissue-specific expression patterns in various maize developmental stages and in response to biotic and abiotic stresses. The results indicated that ZmTIFY4, 5, 8, 26, and 28 were induced, while ZmTIFY16, 13, 24, 27, 18, and 30 were suppressed, by drought stress in the maize inbred lines Han21 and Ye478. ZmTIFY1, 19, and 28 were upregulated after infection by three pathogens, whereas ZmTIFY4, 13, 21, 23, 24, and 26 were suppressed. These results indicate that the ZmTIFY family may have vital roles in response to abiotic and biotic stresses. The data presented in this work provide vital clues for further investigating the functions of the genes in the ZmTIFY family.

  4. Molecular analysis of the PAX6 gene for aniridia and congenital cataracts in Tunisian families

    PubMed Central

    Chograni, Manèl; Derouiche, Kaouther; Chaabouni, Myriam; Lariani, Imen; Bouhamed, Habiba Chaabouni

    2014-01-01

    The aim of this study was to identify the genetic defect that is responsible for aniridia and congenital cataracts in two Tunisian families. Sequencing of the PAX6 gene in family F1 detected a novel c.265C>T transition in exon 6. In family F2, the previously described c.718C>T mutation in PAX6 was detected in the four affected members. This study adds new mutation to those previously reported in PAX6, providing further evidence for the genetic and phenotypic heterogeneity in individuals with aniridia ocular malformations. PMID:27081502

  5. Rapid Expansion and Functional Divergence of Subtelomeric Gene Families in Yeasts

    PubMed Central

    Brown, Chris A.; Murray, Andrew W.; Verstrepen, Kevin J.

    2010-01-01

    Summary Background Subtelomeres, regions proximal to telomeres, exhibit characteristics unique to eukaryotic genomes. Genes residing in these loci are subject to epigenetic regulation and elevated rates of both meiotic and mitotic recombination. However, most genome sequences do not contain assembled subtelomeric sequences, and, as a result, subtelomeres are often overlooked in comparative genomics. Results We study the evolution and functional divergence of subtelomeric gene families in the yeast lineage. Our computational results show that subtelomeric families are evolving and expanding much faster than families that do not contain subtelomeric genes. Focusing on three related subtelomeric MAL gene families involved in disaccharide metabolism that show typical patterns of rapid expansion and evolution, we show experimentally how frequent duplication events followed by functional divergence yields novel alleles that allow metabolism of different carbohydrates. Conclusions Taken together, our computational and experimental analyses show that the extraordinary instability of eukaryotic subtelomeres supports rapid adaptation to novel niches by promoting gene recombination and duplication followed by functional divergence of the alleles. PMID:20471265

  6. Phylogenetic analysis of the expansion of the MATH-BTB gene family in the grasses.

    PubMed

    Juranić, Martina; Dresselhaus, Thomas

    2014-01-01

    MATH-BTB proteins are known to act as substrate-specific adaptors of cullin3 (CUL3)-based ubiquitin E3 ligases to target protein for ubiquitination. In a previous study we reported the presence of 31 MATH-BTB genes in the maize genome and determined the regulatory role of the MATH-BTB protein MAB1 during meiosis to mitosis transition. In contrast to maize, there are only 6 homologous genes in the model plant Arabidopsis, while this family has largely expanded in grasses. Here, we report a phylogenetic analysis of the MATH-BTB gene family in 9 land plant species including various mosses, eudicots, and grasses. We extend a previous classification of the plant MATH-BTB family and additionally arrange the expanded group into 5 grass-specific clades. Synteny studies indicate that expansion occurred to a large extent due to local gene duplications. Expression studies of 3 closely related MATH-BTB genes in maize (MAB1-3) indicate highly specific expression pattern. In summary, this work provides a solid base for further studies comparing genetic and functional information of the MATH-BTB family especially in the grasses.

  7. Phylogenetic analysis of the expansion of the MATH-BTB gene family in the grasses

    PubMed Central

    Juranić, Martina; Dresselhaus, Thomas

    2014-01-01

    MATH-BTB proteins are known to act as substrate-specific adaptors of cullin3 (CUL3)-based ubiquitin E3 ligases to target protein for ubiquitination. In a previous study we reported the presence of 31 MATH-BTB genes in the maize genome and determined the regulatory role of the MATH-BTB protein MAB1 during meiosis to mitosis transition. In contrast to maize, there are only 6 homologous genes in the model plant Arabidopsis, while this family has largely expanded in grasses. Here, we report a phylogenetic analysis of the MATH-BTB gene family in 9 land plant species including various mosses, eudicots, and grasses. We extend a previous classification of the plant MATH-BTB family and additionally arrange the expanded group into 5 grass-specific clades. Synteny studies indicate that expansion occurred to a large extent due to local gene duplications. Expression studies of 3 closely related MATH-BTB genes in maize (MAB1–3) indicate highly specific expression pattern. In summary, this work provides a solid base for further studies comparing genetic and functional information of the MATH-BTB family especially in the grasses. PMID:24614623

  8. Functional divergence of the glutathione S-transferase supergene family in Physcomitrella patens reveals complex patterns of large gene family evolution in land plants.

    PubMed

    Liu, Yan-Jing; Han, Xue-Min; Ren, Lin-Ling; Yang, Hai-Ling; Zeng, Qing-Yin

    2013-02-01

    Plant glutathione S-transferases (GSTs) are multifunctional proteins encoded by a large gene family that play major roles in the detoxification of xenobiotics and oxidative stress metabolism. To date, studies on the GST gene family have focused mainly on vascular plants (particularly agricultural plants). In contrast, little information is available on the molecular characteristics of this large gene family in nonvascular plants. In addition, the evolutionary patterns of this family in land plants remain unclear. In this study, we identified 37 GST genes from the whole genome of the moss Physcomitrella patens, a nonvascular representative of early land plants. The 37 P. patens GSTs were divided into 10 classes, including two new classes (hemerythrin and iota). However, no tau GSTs were identified, which represent the largest class among vascular plants. P. patens GST gene family members showed extensive functional divergence in their gene structures, gene expression responses to abiotic stressors, enzymatic characteristics, and the subcellular locations of the encoded proteins. A joint phylogenetic analysis of GSTs from P. patens and other higher vascular plants showed that different class GSTs had distinct duplication patterns during the evolution of land plants. By examining multiple characteristics, this study revealed complex patterns of evolutionary divergence among the GST gene family in land plants.

  9. Evolutionary analysis of multidrug resistance genes in fungi - impact of gene duplication and family conservation.

    PubMed

    Gossani, Cristiani; Bellieny-Rabelo, Daniel; Venancio, Thiago M

    2014-11-01

    Although the emergence of bacterial drug resistance is of great concern to the scientific community, few studies have evaluated this phenomenon systematically in fungi by using genome-wide datasets. In the present study, we assembled a large compendium of Saccharomyces cerevisiae chemical genetic data to study the evolution of multidrug resistance genes (MDRs) in the fungal lineage. We found that MDRs typically emerge in widely conserved families, most of which containing homologs from pathogenic fungi, such as Candida albicans and Coccidioides immitis, which could favor the evolution of drug resistance in those species. By integrating data from chemical genetics with protein family conservation, genetic and protein interactions, we found that gene families rarely have more than one MDR, indicating that paralogs evolve asymmetrically with regard to multidrug resistance roles. Furthermore, MDRs have more genetic and protein interaction partners than non-MDRs, supporting their participation in complex biochemical systems underlying the tolerance to multiple bioactive molecules. MDRs share more chemical genetic interactions with other MDRs than with non-MDRs, regardless of their evolutionary affinity. These results suggest the existence of an intricate system involved in the global drug tolerance phenotypes. Finally, MDRs are more likely to be hit repeatedly by mutations in laboratory evolution experiments, indicating that they have great adaptive potential. The results presented here not only reveal the main genomic features underlying the evolution of MDRs, but also shed light on the gene families from which drug resistance is more likely to emerge in fungi.

  10. Isolation and partial characterization of the Drosophila alcohol dehydrogenase gene.

    PubMed Central

    Goldberg, D A

    1980-01-01

    The alcohol dehydrogenase (ADH; alcohol: NAD+ oxidoreductase, EC 1.1.1.1) gene (Adh) of Drosophila melanogaster was isolated by utilizing a mutant strain in which the Adh locus is deleted. Adult RNA from wild-type flies was enriched in ADH sequences by gel electrophoresis and then used to prepare labeled cDNA for screening a bacteriophage lambda library of genomic Drosophila DNA. Of the clones that hybridized in the initial screen, one clone was identified that hybridized with labeled cDNA prepared from a wild-type Drosophila strain but did not hybridize with cDNA prepared from an Adh deletion strain. This clone was shown to contain ADH structural gene sequences by three criteria: in situ hybridization, in vitro translation of mRNA selected by hybridization to the cloned DNA, and comparison of the ADH protein sequence with a nucleotide sequence derived from the cloned DNA. Comparison of the restriction site maps from clones of three different wild-type Drosophila strains revealed the presence of a 200-nucleotide sequence in one strain that was absent from the other two strains. The ADH mRNA sequences were located within the cloned DNA by hybridization mapping experiments. Two intervening sequences were identified within Adh by S1 nuclease mapping experiments. Images PMID:6777776

  11. Evolutionary Relationship and Structural Characterization of the EPF/EPFL Gene Family

    PubMed Central

    Takata, Naoki; Yokota, Kiyonobu; Ohki, Shinya; Mori, Masashi; Taniguchi, Toru; Kurita, Manabu

    2013-01-01

    EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that AtEPF1/EPF2-like peptides form an additional disulfide bond in their loop regions and show greater flexibility in these regions than AtEPFL9/Stomagen-like peptides. This study uncovered the evolutionary relationship and the conformational divergence of proteins encoded by the EPF/EPFL family genes. PMID:23755192

  12. Genome-Wide Identification, Characterization and Expression Analysis of the TCP Gene Family in Prunus mume.

    PubMed

    Zhou, Yuzhen; Xu, Zongda; Zhao, Kai; Yang, Weiru; Cheng, Tangren; Wang, Jia; Zhang, Qixiang

    2016-01-01

    TCP proteins, belonging to a plant-specific transcription factors family, are known to have great functions in plant development, especially flower and leaf development. However, there is little information about this gene family in Prunus mume, which is widely cultivated in China as an ornamental and fruit tree. Here a genome-wide analysis of TCP genes was performed to explore their evolution in P. mume. Nineteen PmTCPs were identified and three of them contained putative miR319 target sites. Phylogenetic and comprehensive bioinformatics analyses of these genes revealed that different types of TCP genes had undergone different evolutionary processes and the genes in the same clade had similar chromosomal location, gene structure, and conserved domains. Expression analysis of these PmTCPs indicated that there were diverse expression patterns among different clades. Most TCP genes were predominantly expressed in flower, leaf, and stem, and showed high expression levels in the different stages of flower bud differentiation, especially in petal formation stage and gametophyte development. Genes in TCP-P subfamily had main roles in both flower development and gametophyte development. The CIN genes in double petal cultivars might have key roles in the formation of petal, while they were correlated with gametophyte development in the single petal cultivar. The CYC/TB1 type genes were highly detected in the formation of petal and pistil. The less-complex flower types of P. mume might result from the fact that there were only two CYC type genes present in P. mume and a lack of CYC2 genes to control the identity of flower types. These results lay the foundation for further study on the functions of TCP genes during flower development.

  13. Genome-Wide Identification, Characterization and Expression Analysis of the TCP Gene Family in Prunus mume

    PubMed Central

    Zhou, Yuzhen; Xu, Zongda; Zhao, Kai; Yang, Weiru; Cheng, Tangren; Wang, Jia; Zhang, Qixiang

    2016-01-01

    TCP proteins, belonging to a plant-specific transcription factors family, are known to have great functions in plant development, especially flower and leaf development. However, there is little information about this gene family in Prunus mume, which is widely cultivated in China as an ornamental and fruit tree. Here a genome-wide analysis of TCP genes was performed to explore their evolution in P. mume. Nineteen PmTCPs were identified and three of them contained putative miR319 target sites. Phylogenetic and comprehensive bioinformatics analyses of these genes revealed that different types of TCP genes had undergone different evolutionary processes and the genes in the same clade had similar chromosomal location, gene structure, and conserved domains. Expression analysis of these PmTCPs indicated that there were diverse expression patterns among different clades. Most TCP genes were predominantly expressed in flower, leaf, and stem, and showed high expression levels in the different stages of flower bud differentiation, especially in petal formation stage and gametophyte development. Genes in TCP-P subfamily had main roles in both flower development and gametophyte development. The CIN genes in double petal cultivars might have key roles in the formation of petal, while they were correlated with gametophyte development in the single petal cultivar. The CYC/TB1 type genes were highly detected in the formation of petal and pistil. The less-complex flower types of P. mume might result from the fact that there were only two CYC type genes present in P. mume and a lack of CYC2 genes to control the identity of flower types. These results lay the foundation for further study on the functions of TCP genes during flower development. PMID:27630648

  14. Pyrin gene and mutants thereof, which cause familial Mediterranean fever

    DOEpatents

    Kastner, Daniel L.; Aksentijevichh, Ivona; Centola, Michael; Deng, Zuoming; Sood, Ramen; Collins, Francis S.; Blake, Trevor; Liu, P. Paul; Fischel-Ghodsian, Nathan; Gumucio, Deborah L.; Richards, Robert I.; Ricke, Darrell O.; Doggett, Norman A.; Pras, Mordechai

    2003-09-30

    The invention provides the nucleic acid sequence encoding the protein associated with familial Mediterranean fever (FMF). The cDNA sequence is designated as MEFV. The invention is also directed towards fragments of the DNA sequence, as well as the corresponding sequence for the RNA transcript and fragments thereof. Another aspect of the invention provides the amino acid sequence for a protein (pyrin) associated with FMF. The invention is directed towards both the full length amino acid sequence, fusion proteins containing the amino acid sequence and fragments thereof. The invention is also directed towards mutants of the nucleic acid and amino acid sequences associated with FMF. In particular, the invention discloses three missense mutations, clustered in within about 40 to 50 amino acids, in the highly conserved rfp (B30.2) domain at the C-terminal of the protein. These mutants include M6801, M694V, K695R, and V726A. Additionally, the invention includes methods for diagnosing a patient at risk for having FMF and kits therefor.

  15. Severe Gardner Syndrome in Families with Mutations Restricted to a Specific Region of the APC Gene

    PubMed Central

    Davies, D. Rhodri; Armstrong, John G.; Thakker, Nalin; Horner, Keith; Guy, Simon P.; Clancy, Tara; Sloan, Phil; Blair, Val; Dodd, Chris; Warnes, Tom W.; Harris, Rodney; Evans, D. Gareth R.

    1995-01-01

    Familial adenomatous polyposis (FAP) is associated with a number of extraintestinal manifestations, which include osteomas, epidermoid cysts, and desmoid tumors, often referred to as “Gardner syndrome.” Recent studies have suggested that some of the phenotypic features of FAP are dependent on the position of the mutation within the APC gene. In particular, the correlation between congenital hypertrophy of the retinal pigment epithelium (CHRPE) and APC genotype indicates that affected families may be divided into distinct groups. We have investigated the association between the dento-osseous features of GS on dental panoramic radiographs (DPRs) and APC genotype in a regional cohort of FAP families. DPRs were performed on 84 affected individuals from 36 families, and the dento-osseous features of FAP were quantified by a weighted scoring system. Significant DPR abnormalities were present in 69% of affected individuals. The APC gene mutation was identified in 27 of these families, and for statistical analysis these were subdivided into three groups. Group 1 comprised 18 affected individuals from seven families with mutations 5' of exon 9; these families (except one) did not express CHRPE. Groups 2 comprised 38 individuals from 16 families with mutations between exon 9 and codon 1444, all of whom expressed CHRPE. Group 3 comprised 11 individuals from four families with mutations 3' of codon 1444, none of whom expressed CHRPE. Families with mutations 3' of codon 1444 had significantly more lesions on DPRs (P < .001) and appeared to have a higher incidence of desmoid tumors. These results suggest that the severity of some of the features of Gardner syndrome may correlate with genotype in FAP. ImagesFigure 2 PMID:7485167

  16. Genome-wide identification and characterization of WRKY gene family in Salix suchowensis

    PubMed Central

    Ye, Qiaolin; Yin, Tongming

    2016-01-01

    WRKY proteins are the zinc finger transcription factors that were first identified in plants. They can specifically interact with the W-box, which can be found in the promoter region of a large number of plant target genes, to regulate the expressions of downstream target genes. They also participate in diverse physiological and growing processes in plants. Prior to this study, a plenty of WRKY genes have been identified and characterized in herbaceous species, but there is no large-scale study of WRKY genes in willow. With the whole genome sequencing of Salix suchowensis, we have the opportunity to conduct the genome-wide research for willow WRKY gene family. In this study, we identified 85 WRKY genes in the willow genome and renamed them from SsWRKY1 to SsWRKY85 on the basis of their specific distributions on chromosomes. Due to their diverse structural features, the 85 willow WRKY genes could be further classified into three main groups (group I–III), with five subgroups (IIa–IIe) in group II. With the multiple sequence alignment and the manual search, we found three variations of the WRKYGQK heptapeptide: WRKYGRK, WKKYGQK and WRKYGKK, and four variations of the normal zinc finger motif, which might execute some new biological functions. In addition, the SsWRKY genes from the same subgroup share the similar exon–intron structures and conserved motif domains. Further studies of SsWRKY genes revealed that segmental duplication events (SDs) played a more prominent role in the expansion of SsWRKY genes. Distinct expression profiles of SsWRKY genes with RNA sequencing data revealed that diverse expression patterns among five tissues, including tender roots, young leaves, vegetative buds, non-lignified stems and barks. With the analyses of WRKY gene family in willow, it is not only beneficial to complete the functional and annotation information of WRKY genes family in woody plants, but also provide important references to investigate the expansion and evolution

  17. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes.

    PubMed

    Hu, H; Haas, S A; Chelly, J; Van Esch, H; Raynaud, M; de Brouwer, A P M; Weinert, S; Froyen, G; Frints, S G M; Laumonnier, F; Zemojtel, T; Love, M I; Richard, H; Emde, A-K; Bienek, M; Jensen, C; Hambrock, M; Fischer, U; Langnick, C; Feldkamp, M; Wissink-Lindhout, W; Lebrun, N; Castelnau, L; Rucci, J; Montjean, R; Dorseuil, O; Billuart, P; Stuhlmann, T; Shaw, M; Corbett, M A; Gardner, A; Willis-Owen, S; Tan, C; Friend, K L; Belet, S; van Roozendaal, K E P; Jimenez-Pocquet, M; Moizard, M-P; Ronce, N; Sun, R; O'Keeffe, S; Chenna, R; van Bömmel, A; Göke, J; Hackett, A; Field, M; Christie, L; Boyle, J; Haan, E; Nelson, J; Turner, G; Baynam, G; Gillessen-Kaesbach, G; Müller, U; Steinberger, D; Budny, B; Badura-Stronka, M; Latos-Bieleńska, A; Ousager, L B; Wieacker, P; Rodríguez Criado, G; Bondeson, M-L; Annerén, G; Dufke, A; Cohen, M; Van Maldergem, L; Vincent-Delorme, C; Echenne, B; Simon-Bouy, B; Kleefstra, T; Willemsen, M; Fryns, J-P; Devriendt, K; Ullmann, R; Vingron, M; Wrogemann, K; Wienker, T F; Tzschach, A; van Bokhoven, H; Gecz, J; Jentsch, T J; Chen, W; Ropers, H-H; Kalscheuer, V M

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of these males were previously tested negative for copy number variations and for mutations in a subset of known XLID genes by Sanger sequencing. In total, 745 X-chromosomal genes were screened. After stringent filtering, a total of 1297 non-recurrent exonic variants remained for prioritization. Co-segregation analysis of potential clinically relevant changes revealed that 80 families (20%) carried pathogenic variants in established XLID genes. In 19 families, we detected likely causative protein truncating and missense variants in 7 novel and validated XLID genes (CLCN4, CNKSR2, FRMPD4, KLHL15, LAS1L, RLIM and USP27X) and potentially deleterious variants in 2 novel candidate XLID genes (CDK16 and TAF1). We show that the CLCN4 and CNKSR2 variants impair protein functions as indicated by electrophysiological studies and altered differentiation of cultured primary neurons from Clcn4(-/-) mice or after mRNA knock-down. The newly identified and candidate XLID proteins belong to pathways and networks with established roles in cognitive function and intellectual disability in particular. We suggest that systematic sequencing of all X-chromosomal genes in a cohort of patients with genetic evidence for X-chromosome locus involvement may resolve up to 58% of Fragile X-negative cases.

  18. Expansion, diversification, and expression of T-box family genes in Porifera.

    PubMed

    Holstien, Kay; Rivera, Ajna; Windsor, Pam; Ding, Siyu; Leys, Sally P; Hill, Malcolm; Hill, April

    2010-12-01

    Sponges are among the earliest diverging lineage within the metazoan phyla. Although their adult morphology is distinctive, at several stages of development, they possess characteristics found in more complex animals. The T-box family of transcription factors is an evolutionarily ancient gene family known to be involved in the development of structures derived from all germ layers in the bilaterian animals. There is an incomplete understanding of the role that T-box transcription factors play in normal sponge development or whether developmental pathways using the T-box family share similarities between parazoan and eumetazoan animals. To address these questions, we present data that identify several important T-box genes in marine and freshwater sponges, place these genes in a phylogenetic context, and reveal patterns in how these genes are expressed in developing sponges. Phylogenetic analyses demonstrate that sponges have members of at least two of the five T-box subfamilies (Brachyury and Tbx2/3/4/5) and that the T-box genes expanded and diverged in the poriferan lineage. Our analysis of signature residues in the sponge T-box genes calls into question whether "true" Brachyury genes are found in the Porifera. Expression for a subset of the T-box genes was elucidated in larvae from the marine demosponge, Halichondria bowerbanki. Our results show that sponges regulate the timing and specificity of gene expression for T-box orthologs across larval developmental stages. In situ hybridization reveals distinct, yet sometimes overlapping expression of particular T-box genes in free-swimming larvae. Our results provide a comparative framework from which we can gain insights into the evolution of developmentally important pathways.

  19. Mutations in the hairless gene underlie APL in three families of Pakistani origin

    PubMed Central

    Kraemer, Liv; Wajid, Muhammad; Shimomura, Yutaka; Christiano, Angela M.

    2009-01-01

    Summary Background Atrichia with papular lesions (APL) (OMIM#209500) is a rare autosomal recessively inherited form of irreversible alopecia characterized by papular lesions of keratin-filled cysts on various regions of the body. Males and females are equally affected and present with a distinct pattern of total hair loss on scalp, axilla and body. It begins shortly after birth with the development of hair loss, and patients are normally devoid of eyelashes and eyebrows. Mutations in the hairless (HR) gene have been previously shown to be responsible for APL. Objective In this study, we studied the molecular basis of APL in three unrelated families of Pakistani origin. Method Molecular analysis of the HR genes was performed on genomic DNA from probands and family members. Results DNA sequencing of the HR gene in family A revealed a novel homozygous 2 bp deletion in exon 6 leading to a frameshift and a downstream premature termination codon in exon 8 (1782-83delAG). In family B, we identified a novel homozygous deletion of a G nucleotide at the exon 15–intron 15 boundary, termed 3097delG. Family C carries a previously reported missense mutation consisting of an A-to-G transition at nucleotide 276 resulting in the mutation N970S in exon 14. Conclusion Two mutations identified in this study are novel mutations in the HR gene and extend the body of evidence implicating the hairless gene family in the pathogenesis of human skin disorders. The one previously reported mutation suggests it may represent a recurrent mutation, or alternatively, an allele that is widely dispersed around the world. PMID:18164595

  20. The genome and transcriptome of the zoonotic hookworm Ancylostoma ceylanicum identify infection-specific gene families.

    PubMed

    Schwarz, Erich M; Hu, Yan; Antoshechkin, Igor; Miller, Melanie M; Sternberg, Paul W; Aroian, Raffi V

    2015-04-01

    Hookworms infect over 400 million people, stunting and impoverishing them. Sequencing hookworm genomes and finding which genes they express during infection should help in devising new drugs or vaccines against hookworms. Unlike other hookworms, Ancylostoma ceylanicum infects both humans and other mammals, providing a laboratory model for hookworm disease. We determined an A. ceylanicum genome sequence of 313 Mb, with transcriptomic data throughout infection showing expression of 30,738 genes. Approximately 900 genes were upregulated during early infection in vivo, including ASPRs, a cryptic subfamily of activation-associated secreted proteins (ASPs). Genes downregulated during early infection included ion channels and G protein-coupled receptors; this downregulation was observed in both parasitic and free-living nematodes. Later, at the onset of heavy blood feeding, C-lectin genes were upregulated along with genes for secreted clade V proteins (SCVPs), encoding a previously undescribed protein family. These findings provide new drug and vaccine targets and should help elucidate hookworm pathogenesis.

  1. Characterization of the 11S globulin gene family in the castor plant Ricinus communis L.

    PubMed

    Chileh, Tarik; Esteban-García, Belén; Alonso, Diego López; García-Maroto, Federico

    2010-01-13

    The 11S globulin (legumin) gene family has been characterized in the castor plant Ricinus communis L. Phylogenetic analysis reveals the presence of two diverged subfamilies (RcLEG1 and RcLEG2) comprising a total of nine genes and two putative pseudogenes. The expression of castor legumin genes has been studied, indicating that it is seed specific and developmentally regulated, with a maximum at the stage when cellular endosperm reaches its full expansion (around 40-45 DAP). However, conspicuous differences are appreciated in the expression timing of individual genes. A characterization of the 5'-proximal regulatory regions for two genes, RcLEG1-1 and RcLEG2-1, representative of the two legumin subfamilies, has also been performed by fusion to the GUS reporter gene. The results obtained from heterologous expression in tobacco and transient expression in castor, indicating seed-specific regulation, support the possible utility of these promoters for biotechnological purposes.

  2. Identification and expression pattern of the chemosensory protein gene family in the silkworm, Bombyx mori.

    PubMed

    Gong, Da-Ping; Zhang, Hui-Jie; Zhao, Ping; Lin, Ying; Xia, Qing-You; Xiang, Zhong-Huai

    2007-03-01

    Insect chemosensory proteins (CSPs) as well as odorant-binding proteins (OBPs) have been supposed to transport hydrophobic chemicals to receptors on sensory neurons. Compared with OBPs, CSPs are expressed more broadly in various insect tissues. We performed a genome-wide analysis of the candidate CSP gene family in the silkworm. A total of 20 candidate CSPs, including 3 gene fragments and 2 pseudogenes, were characterized based on their conserved cysteine residues and their similarity to CSPs in other insects. Some of these genes were clustered in the silkworm genome. The gene expression pattern of these candidates was investigated using RT-PCR and microarray, and the results showed that these genes were expressed primarily in mature larvae and the adult moth, suggesting silkworm CSPs may be involved in development. The majority of silkworm CSP genes are expressed broadly in tissues including the antennae, head, thorax, legs, wings, epithelium, testes, ovaries, pheromone glands, wing disks, and compound eyes.

  3. Embryonic Expression of the Chicken Krüppel-like (KLF) Transcription Factor Gene Family

    PubMed Central

    Antin, Parker B.; Pier, Maricela; Sesepasara, Terry; Yatskievych, Tatiana A; Darnell, Diana K.

    2010-01-01

    The Krüppel-like transcription factors are zinc finger proteins that activate and suppress target gene transcription. Although KLF factors have been implicated in regulating many developmental processes, a comprehensive gene expression analysis has not been reported. Here we present the chicken KLF gene family and expression during the first five days of embryonic development. Fourteen chicken KLF genes or expressed sequences have been previously identified. Through synteny analysis and cDNA mapping we have identified the KLF9 gene and determined that the gene presently named KLF1 is the true ortholog of KLF17 in other species. In situ hybridization expression analyses show that in general KLFs are broadly expressed in multiple cell and tissue types. Expression of KLFs 3, 7, 8, and 9, is widespread at all stages examined. KLFs 2, 4, 5, 6, 10, 11, 15 and 17 show more restricted patterns that suggest multiple functions during early stages of embryonic development. PMID:20503383

  4. [Genome-wide identification and bioinformatic analysis of PPR gene family in tomato].

    PubMed

    Ding, Anming; Li, Ling; Qu, Xu; Sun, Tingting; Chen, Yaqiong; Zong, Peng; Li, Zunqiang; Gong, Daping; Sun, Yuhe

    2014-01-01

    Pentatricopeptide repeats (PPRs) genes constitute one of the largest gene families in plants, which play a broad and essential role in plant growth and development. In this study, the protein sequences annotated by the tomato (S. lycopersicum L.) genome project were screened with the Pfam PPR sequences. A total of 471 putative PPR-encoding genes were identified. Based on the motifs defined in A. thaliana L., protein structure and conserved sequences for each tomato motif were analyzed. We also analyzed phylogenetic relationship, subcellular localization, expression and GO analysis of the identified gene sequences. Our results demonstrate that tomato PPR gene family contains two subfamilies, P and PLS, each accounting for half of the family. PLS subfamily can be divided into four subclasses i.e., PLS, E, E+ and DYW. Each subclass of sequences forms a clade in the phylogenetic tree. The PPR motifs were found highly conserved among plants. The tomato PPR genes were distributed over 12 chromosomes and most of them lack introns. The majority of PPR proteins harbor mitochondrial or chloroplast localization sequences, whereas GO analysis showed that most PPR proteins participate in RNA-related biological processes.

  5. Evolution of the cutinase gene family: evidence for lateral gene transfer of a candidate Phytophthora virulence factor.

    PubMed

    Belbahri, Lassaad; Calmin, Gautier; Mauch, Felix; Andersson, Jan O

    2008-01-31

    Lateral gene transfer (LGT) can facilitate the acquisition of new functions in recipient lineages, which may enable them to colonize new environments. Several recent publications have shown that gene transfer between prokaryotes and eukaryotes occurs with appreciable frequency. Here we present a study of interdomain gene transfer of cutinases -- well documented virulence factors in fungi -- between eukaryotic plant pathogens Phytophthora species and prokaryotic bacterial lineages. Two putative cutinase genes were cloned from Phytophthora brassicae and Northern blotting experiments showed that these genes are expressed early during the infection of the host Arabidopsis thaliana and induced during cyst germination of the pathogen. Analysis of the gene organisation of this gene family in Phytophthora ramorum and P. sojae showed three and ten copies in tight succession within a region of 5 and 25 kb, respectively, probably indicating a recent expansion in Phytophthora lineages by gene duplications. Bioinformatic analyses identified orthologues only in three genera of Actinobacteria, and in two distantly related eukaryotic groups: oomycetes and fungi. Together with phylogenetic analyses this limited distribution of the gene in the tree of life strongly support a scenario where cutinase genes originated after the origin of land plants in a microbial lineage living in proximity of plants and subsequently were transferred between distantly related plant-degrading microbes. More precisely, a cutinase gene was likely acquired by an ancestor of P. brassicae, P. sojae, P. infestans and P. ramorum, possibly from an actinobacterial source, suggesting that gene transfer might be an important mechanism in the evolution of their virulence. These findings could indeed provide an interesting model system to study acquisition of virulence factors in these important plant pathogens.

  6. SVM-based generalized multifactor dimensionality reduction approaches for detecting gene-gene interactions in family studies.

    PubMed

    Fang, Yao-Hwei; Chiu, Yen-Feng

    2012-02-01

    Gene-gene interaction plays an important role in the etiology of complex diseases, which may exist without a genetic main effect. Most current statistical approaches, however, focus on assessing an interaction effect in the presence of the gene's main effects. It would be very helpful to develop methods that can detect not only the gene's main effects but also gene-gene interaction effects regardless of the existence of the gene's main effects while adjusting for confounding factors. In addition, when a disease variant is rare or when the sample size is quite limited, the statistical asymptotic properties are not applicable; therefore, approaches based on a reasonable and applicable computational framework would be practical and frequently applied. In this study, we have developed an extended support vector machine (SVM) method and an SVM-based pedigree-based generalized multifactor dimensionality reduction (PGMDR) method to study interactions in the presence or absence of main effects of genes with an adjustment for covariates using limited samples of families. A new test statistic is proposed for classifying the affected and the unaffected in the SVM-based PGMDR approach to improve performance in detecting gene-gene interactions. Simulation studies under various scenarios have been performed to compare the performances of the proposed and the original methods. The proposed and original approaches have been applied to a real data example for illustration and comparison. Both the simulation and real data studies show that the proposed SVM and SVM-based PGMDR methods have great prediction accuracies, consistencies, and power in detecting gene-gene interactions.

  7. Function and cancer genomics of FAT family genes

    PubMed Central

    KATOH, MASARU

    2012-01-01

    FAT1, FAT2, FAT3 and FAT4 are human homologs of Drosophila Fat, which is involved in tumor suppression and planar cell polarity (PCP). FAT1 and FAT4 undergo the first proteolytic cleavage by Furin and are predicted to undergo the second cleavage by γ-secretase to release intracellular domain (ICD). Ena/VAPS-binding to FAT1 induces actin polymerization at lamellipodia and filopodia to promote cell migration, while Scribble-binding to FAT1 induces phosphorylation and functional inhibition of YAP1 to suppress cell growth. FAT1 is repressed in oral cancer owing to homozygous deletion or epigenetic silencing and is preferentially downregulated in invasive breast cancer. On the other hand, FAT1 is upregulated in leukemia and prognosis of preB-ALL patients with FAT1 upregulation is poor. FAT4 directly interacts with MPDZ/MUPP1 to recruit membrane-associated guanylate kinase MPP5/PALS1. FAT4 is involved in the maintenance of PCP and inhibition of cell proliferation. FAT4 mRNA is repressed in breast cancer and lung cancer due to promoter hypermethylation. FAT4 gene is recurrently mutated in several types of human cancers, such as melanoma, pancreatic cancer, gastric cancer and hepatocellular carcinoma. FAT1 and FAT4 suppress tumor growth via activation of Hippo signaling, whereas FAT1 promotes tumor migration via induction of actin polymerization. FAT1 is tumor suppressive or oncogenic in a context-dependent manner, while FAT4 is tumor suppressive. Copy number aberration, translocation and point mutation of FAT1, FAT2, FAT3, FAT4, FRMD1, FRMD6, NF2, WWC1, WWC2, SAV1, STK3, STK4, MOB1A, MOB1B, LATS1, LATS2, YAP1 and WWTR1/TAZ genes should be comprehensively investigated in various types of human cancers to elucidate the mutation landscape of the FAT-Hippo signaling cascades. Because YAP1 and WWTR1 are located at the crossroads of adhesion, GPCR, RTK and stem-cell signaling network, cancer genomics of the FAT signaling cascades could be applied for diagnostics, prognostics

  8. A novel homozygous mutation in the solute carrier family 12 member 3 gene in a Chinese family with Gitelman syndrome

    PubMed Central

    Zhang, Y.; Zhang, F.; Chen, D.; Lü, Q.; Tang, L.; Yang, C.; Lei, M.; Tong, N.

    2016-01-01

    Loss of function of mutated solute carrier family 12 member 3 (SLC12A3) gene is the most frequent etiology for Gitelman syndrome (GS), which is mainly manifested by hypokalemia, hypomagnesemia and hypocalciuria. We report the genetic characteristics of one suspicious Chinese GS pedigree by gene sequencing. Complete sequencing analysis of the SLC12A3 gene revealed that both the proband and his elder sister had a novel homozygous SLC12A3 mutation: c.2099T>C and p.Leu700Pro. Moreover, the SLC12A3 genes of his mother and daughter encoded the same mutated heterozygote. It was noted that in this pedigree, only the proband complained about recurrent episodes of bilateral lower limb weakness over 8 years, while his elder sister, mother and daughter did not present symptoms. The inconsistent clinical features of this pedigree implied that besides diverse phenotypes possibly originated from the same genotype, gender difference may also dominate the variant GS phenotypes. Further genetic and proteomic research are needed to investigate the precise mechanisms of GS, including the study of specific ethnicities. PMID:27783806

  9. Genome-wide identification and analysis of FK506-binding protein family gene family in strawberry (Fragaria × ananassa).

    PubMed

    Leng, Xiangpeng; Liu, Dan; Zhao, Mizhen; Sun, Xin; Li, Yu; Mu, Qian; Zhu, Xudong; Li, Pengyu; Fang, Jinggui

    2014-01-25

    The FK506 binding proteins (FKBPs) are abundant and ubiquitous proteins belonging to the large peptidyl-prolylcis-trans isomerase superfamily. FKBPs are known to be involved in many biological processes including hormone signaling, plant growth, and stress responses through a chaperone or an isomerization of proline residues during protein folding. The availability of complete strawberry genome sequences allowed the identification of 23 FKBP genes by HMMER and blast analysis. Chromosome scaffold locations of these FKBP genes in the strawberry genome were determined and the protein domain and motif organization of FaFKBPs analyzed. The phylogenetic relationships between strawberry FKBPs were also assessed. The expression profiles of FaFKBPs genes results revealed that most FaFKBPs were expressed in all tissues, while a few FaFKBPs were specifically expressed in some of the tissues. These data not only contribute to some better understanding of the complex regulation of the strawberry FKBP gene family, but also provide valuable information for further research in strawberry functional genomics.

  10. Three novel PHEX gene mutations in four Chinese families with X-linked dominant hypophosphatemic rickets

    SciTech Connect

    Kang, Qing-lin; Xu, Jia; Zhang, Zeng; He, Jin-wei; Lu, Lian-song; Fu, Wen-zhen; Zhang, Zhen-lin

    2012-07-13

    Highlights: Black-Right-Pointing-Pointer In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. Black-Right-Pointing-Pointer We identified three novel PHEX gene mutations in four unrelated families with XLH. Black-Right-Pointing-Pointer We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. Black-Right-Pointing-Pointer We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.

  11. Comparative analysis of genome-wide Mlo gene family in Cajanus cajan and Phaseolus vulgaris.

    PubMed

    Deshmukh, Reena; Singh, V K; Singh, B D

    2016-04-01

    The Mlo gene was discovered in barley because the mutant 'mlo' allele conferred broad-spectrum, non-race-specific resistance to powdery mildew caused by Blumeria graminis f. sp. hordei. The Mlo genes also play important roles in growth and development of plants, and in responses to biotic and abiotic stresses. The Mlo gene family has been characterized in several crop species, but only a single legume species, soybean (Glycine max L.), has been investigated so far. The present report describes in silico identification of 18 CcMlo and 20 PvMlo genes in the important legume crops Cajanus cajan (L.) Millsp. and Phaseolus vulgaris L., respectively. In silico analysis of gene organization, protein properties and conserved domains revealed that the C. cajan and P. vulgaris Mlo gene paralogs are more divergent from each other than from their orthologous pairs. The comparative phylogenetic analysis classified CcMlo and PvMlo genes into three major clades. A comparative analysis of CcMlo and PvMlo proteins with the G. max Mlo proteins indicated close association of one CcMlo, one PvMlo with two GmMlo genes, indicating that there was no further expansion of the Mlo gene family after the separation of these species. Thus, most of the diploid species of eudicots might be expected to contain 15-20 Mlo genes. The genes CcMlo12 and 14, and PvMlo11 and 12 are predicted to participate in powdery mildew resistance. If this prediction were verified, these genes could be targeted by TILLING or CRISPR to isolate powdery mildew resistant mutants.

  12. Genomewide survey and characterization of metacaspase gene family in rice (Oryza sativa).

    PubMed

    Wang, Likai; Zhang, Hua

    2014-04-01

    Metacaspases (MCs), which are cysteine-dependent proteases found in plants, fungi, and protozoa, may be involved in programmed cell death processes, being distant relatives of metazoan caspases. In this study, we analysed the structures, phylogenetic relationship, genome localizations, expression patterns and domestic selections of eight MC genes identified in rice (OsMC). Alignment analysis of the corresponding protein sequences suggested OsMC proteins can be classified into two subtypes. The expression profiles of eight OsMC genes were analysed in 27 tissues covering the whole life cycle of rice. There are four OsMC genes uniquely expressed in mature tissues, indicating that these genes might play certain roles in senescence. Under abiotic and biotic stresses, four OsMC genes were expressed with treatments of one or more of Magnaporthe oryzae (M. oryzae) infected, pest damaged, cold stress and drought stress, indicating they might be involved in plant defense. In addition, gene trees and genetic diversity (π) were performed to measure whether candidate genes were selected during rice domestication. The results suggested that all the type I genes could not be domestication genes. However, two of five type II OsMC genes showed strong evidence for selective sweep, suggesting that these genes might be involved in cultivated rice domestication. These results provide a foundation for future functional genomic studies of this family in rice.

  13. Comprehensive identification and expression analysis of Hsp90s gene family in Solanum lycopersicum.

    PubMed

    Zai, W S; Miao, L X; Xiong, Z L; Zhang, H L; Ma, Y R; Li, Y L; Chen, Y B; Ye, S G

    2015-07-14

    Heat shock protein 90 (Hsp90) is a protein produced by plants in response to adverse environmental stresses. In this study, we identified and analyzed Hsp90 gene family members using a bioinformatic method based on genomic data from tomato (Solanum lycopersicum L.). The results illustrated that tomato contains at least 7 Hsp90 genes distributed on 6 chromosomes; protein lengths ranged from 267-794 amino acids. Intron numbers ranged from 2-19 in the genes. The phylogenetic tree revealed that Hsp90 genes in tomato (Solanum lycopersicum L.), rice (Oryza sativa L.), and Arabidopsis (Arabidopsis thaliana L.) could be divided into 5 groups, which included 3 pairs of orthologous genes and 4 pairs of paralogous genes. Expression analysis of RNA-sequence data showed that the Hsp90-1 gene was specifically expressed in mature fruits, while Hsp90-5 and Hsp90-6 showed opposite expression patterns in various tissues of cultivated and wild tomatoes. The expression levels of the Hsp90-1, Hsp90-2, and Hsp90- 3 genes in various tissues of cultivated tomatoes were high, while both the expression levels of genes Hsp90-3 and Hsp90-4 were low. Additionally, quantitative real-time polymerase chain reaction showed that these genes were involved in the responses to yellow leaf curl virus in tomato plant leaves. Our results provide a foundation for identifying the function of the Hsp90 gene in tomato.

  14. Avirulence gene mapping in the Hessian fly (Mayetiola destructor) reveals a protein phosphatase 2C effector gene family.

    PubMed

    Zhao, Chaoyang; Shukle, Richard; Navarro-Escalante, Lucio; Chen, Mingshun; Richards, Stephen; Stuart, Jeffrey J

    2016-01-01

    The genetic tractability of the Hessian fly (HF, Mayetiola destructor) provides an opportunity to investigate the mechanisms insects use to induce plant gall formation. Here we demonstrate that capacity using the newly sequenced HF genome by identifying the gene (vH24) that elicits effector-triggered immunity in wheat (Triticum spp.) seedlings carrying HF resistance gene H24. vH24 was mapped within a 230-kb genomic fragment near the telomere of HF chromosome X1. That fragment contains only 21 putative genes. The best candidate vH24 gene in this region encodes a protein containing a secretion signal and a type-2 serine/threonine protein phosphatase (PP2C) domain. This gene has an H24-virulence associated insertion in its promoter that appears to silence transcription of the gene in H24-virulent larvae. Candidate vH24 is a member of a small family of genes that encode secretion signals and PP2C domains. It belongs to the fraction of genes in the HF genome previously predicted to encode effector proteins. Because PP2C proteins are not normally secreted, our results suggest that these are PP2C effectors that HF larvae inject into wheat cells to redirect, or interfere, with wheat signal transduction pathways.

  15. Familial Dilated Cardiomyopathy Caused by a Novel Frameshift in the BAG3 Gene

    PubMed Central

    Moncayo-Arlandi, Javier; Allegue, Catarina; Iglesias, Anna; Mangas, Alipio; Brugada, Ramon

    2016-01-01

    Background Dilated cardiomyopathy, a major cause of chronic heart failure and cardiac transplantation, is characterized by left ventricular or biventricular heart dilatation. In nearly 50% of cases the pathology is inherited, and more than 60 genes have been reported as disease-causing. However, in 30% of familial cases the mutation remains unidentified even after comprehensive genetic analysis. This study clinically and genetically assessed a large Spanish family affected by dilated cardiomyopathy to search for novel variations. Methods and Results Our study included a total of 100 family members. Clinical assessment was performed in alive, and genetic analysis was also performed in alive and 1 deceased relative. Genetic screening included resequencing of 55 genes associated with sudden cardiac death, and Sanger sequencing of main disease-associated genes. Genetic analysis identified a frame-shift variation in BAG3 (p.H243Tfr*64) in 32 patients. Genotype-phenotype correlation identified substantial heterogeneity in disease expression. Of 32 genetic carriers (one deceased), 21 relatives were clinically affected, and 10 were asymptomatic. Seventeen of the symptomatic genetic carriers exhibited proto-diastolic septal knock by echocardiographic assessment. Conclusions We report p.H243Tfr*64_BAG3 as a novel pathogenic variation responsible for familial dilated cardiomyopathy. This variation correlates with a more severe phenotype of the disease, mainly in younger individuals. Genetic analysis in families, even asymptomatic individuals, enables early identification of individuals at risk and allows implementation of preventive measures. PMID:27391596

  16. Analysis of the KRT9 gene in a Mexican family with epidermolytic palmoplantar keratoderma.

    PubMed

    Lopez-Valdez, Jaime; Rivera-Vega, Maria Refugio; Gonzalez-Huerta, Luz Maria; Cazarin, Jorge; Cuevas-Covarrubias, Sergio

    2013-01-01

    Epidermolytic palmoplantar keratoderma (EPPK), an autosomal-dominant genodermatosis, is the most frequently occurring hereditary palmoplantar keratoderma. EPPK is characterized by hyperkeratosis of the palms and soles. Approximately 90% of patients present with mutations in the KRT9 gene, which encodes for keratin 9. Many of these mutations are located within the highly conserved coil 1A region of the alpha-helical rod domain of keratin 9, an important domain for keratin heterodimerization. The objective was to assess the clinical and molecular characteristics of a Mexican family with EPPK. The clinical characteristics of members of this family were analyzed. The KRT9 gene of affected members was polymerase chain reaction amplified from genomic DNA and sequenced. All affected members of the family had hyperkeratosis of the palms and soles with knuckle pads. The R163W mutation in the KRT9 gene was present in all affected individuals who were tested. Although R163W is the most frequent KRT9 mutation in patients with EPPK, only two families have been reported with knuckle pads associated with this mutation. Our findings indicate that knuckle pads can be associated with EPPK and the R163W mutation in a family with a genetic background different from that described here.

  17. Gene Family Expansions in Aphids Maintained by Endosymbiotic and Nonsymbiotic Traits

    PubMed Central

    Duncan, Rebecca P.; Feng, Honglin; Nguyen, Douglas M.; Wilson, Alex C. C.

    2016-01-01

    Facilitating the evolution of new gene functions, gene duplication is a major mechanism driving evolutionary innovation. Gene family expansions relevant to host/symbiont interactions are increasingly being discovered in eukaryotes that host endosymbiotic microbes. Such discoveries entice speculation that gene duplication facilitates the evolution of novel, endosymbiotic relationships. Here, using a comparative transcriptomic approach combined with differential gene expression analysis, we investigate the importance of endosymbiosis in retention of amino acid transporter paralogs in aphid genomes. To pinpoint the timing of amino acid transporter duplications we inferred gene phylogenies for five aphid species and three outgroups. We found that while some duplications arose in the aphid common ancestor concurrent with endosymbiont acquisition, others predate aphid divergence from related insects without intracellular symbionts, and still others appeared during aphid diversification. Interestingly, several aphid-specific paralogs have conserved enriched expression in bacteriocytes, the insect cells that host primary symbionts. Conserved bacteriocyte enrichment suggests that the transporters were recruited to the aphid/endosymbiont interface in the aphid common ancestor, consistent with a role for gene duplication in facilitating the evolution of endosymbiosis in aphids. In contrast, the temporal variability of amino acid transporter duplication indicates that endosymbiosis is not the only trait driving selection for retention of amino acid transporter paralogs in sap-feeding insects. This study cautions against simplistic interpretations of the role of gene family expansion in the evolution of novel host/symbiont interactions by further highlighting that multiple complex factors maintain gene family paralogs in the genomes of eukaryotes that host endosymbiotic microbes. PMID:26878871

  18. Genome-Wide Identification and Expression Analysis of the WRKY Gene Family in Cassava

    PubMed Central

    Wei, Yunxie; Shi, Haitao; Xia, Zhiqiang; Tie, Weiwei; Ding, Zehong; Yan, Yan; Wang, Wenquan; Hu, Wei; Li, Kaimian

    2016-01-01

    The WRKY family, a large family of transcription factors (TFs) found in higher plants, plays central roles in many aspects of physiological processes and adaption to environment. However, little information is available regarding the WRKY family in cassava (Manihot esculenta). In the present study, 85 WRKY genes were identified from the cassava genome and classified into three groups according to conserved WRKY domains and zinc-finger structure. Conserved motif analysis showed that all of the identified MeWRKYs had the conserved WRKY domain. Gene structure analysis suggested that the number of introns in MeWRKY genes varied from 1 to 5, with the majority of MeWRKY genes containing three exons. Expression profiles of MeWRKY genes in different tissues and in response to drought stress were analyzed using the RNA-seq technique. The results showed that 72 MeWRKY genes had differential expression in their transcript abundance and 78 MeWRKY genes were differentially expressed in response to drought stresses in different accessions, indicating their contribution to plant developmental processes and drought stress resistance in cassava. Finally, the expression of 9 WRKY genes was analyzed by qRT-PCR under osmotic, salt, ABA, H2O2, and cold treatments, indicating that MeWRKYs may be involved in different signaling pathways. Taken together, this systematic analysis identifies some tissue-specific and abiotic stress-responsive candidate MeWRKY genes for further functional assays in planta, and provides a solid foundation for understanding of abiotic stress responses and signal transduction mediated by WRKYs in cassava. PMID:26904033

  19. Gene Family Expansions in Aphids Maintained by Endosymbiotic and Nonsymbiotic Traits.

    PubMed

    Duncan, Rebecca P; Feng, Honglin; Nguyen, Douglas M; Wilson, Alex C C

    2016-02-15

    Facilitating the evolution of new gene functions, gene duplication is a major mechanism driving evolutionary innovation. Gene family expansions relevant to host/symbiont interactions are increasingly being discovered in eukaryotes that host endosymbiotic microbes. Such discoveries entice speculation that gene duplication facilitates the evolution of novel, endosymbiotic relationships. Here, using a comparative transcriptomic approach combined with differential gene expression analysis, we investigate the importance of endosymbiosis in retention of amino acid transporter paralogs in aphid genomes. To pinpoint the timing of amino acid transporter duplications we inferred gene phylogenies for five aphid species and three outgroups. We found that while some duplications arose in the aphid common ancestor concurrent with endosymbiont acquisition, others predate aphid divergence from related insects without intracellular symbionts, and still others appeared during aphid diversification. Interestingly, several aphid-specific paralogs have conserved enriched expression in bacteriocytes, the insect cells that host primary symbionts. Conserved bacteriocyte enrichment suggests that the transporters were recruited to the aphid/endosymbiont interface in the aphid common ancestor, consistent with a role for gene duplication in facilitating the evolution of endosymbiosis in aphids. In contrast, the temporal variability of amino acid transporter duplication indicates that endosymbiosis is not the only trait driving selection for retention of amino acid transporter paralogs in sap-feeding insects. This study cautions against simplistic interpretations of the role of gene family expansion in the evolution of novel host/symbiont interactions by further highlighting that multiple complex factors maintain gene family paralogs in the genomes of eukaryotes that host endosymbiotic microbes.

  20. History of a prolific family: the Hes/Hey-related genes of the annelid Platynereis

    PubMed Central

    2014-01-01

    Background The Hes superfamily or Hes/Hey-related genes encompass a variety of metazoan-specific bHLH genes, with somewhat fuzzy phylogenetic relationships. Hes superfamily members are involved in a variety of major developmental mechanisms in metazoans, notably in neurogenesis and segmentation processes, in which they often act as direct effector genes of the Notch signaling pathway. Results We have investigated the molecular and functional evolution of the Hes superfamily in metazoans using the lophotrochozoan Platynereis dumerilii as model. Our phylogenetic analyses of more than 200 Metazoan Hes/Hey-related genes revealed the presence of five families, three of them (Hes, Hey and Helt) being pan-metazoan. Those families were likely composed of a unique representative in the last common metazoan ancestor. The evolution of the Hes family was shaped by many independent lineage specific tandem duplication events. The expression patterns of 13 of the 15 Hes/Hey-related genes in Platynereis indicate a broad functional diversification. Nevertheless, a majority of these genes are involved in two crucial developmental processes in annelids: neurogenesis and segmentation, resembling functions highlighted in other animal models. Conclusions Combining phylogenetic and expression data, our study suggests an unusual evolutionary history for the Hes superfamily. An ancestral multifunctional annelid Hes gene may have undergone multiples rounds of duplication-degeneration-complementation processes in the lineage leading to Platynereis, each gene copies ensuring their maintenance in the genome by subfunctionalisation. Similar but independent waves of duplications are at the origin of the multiplicity of Hes genes in other metazoan lineages. PMID:25250171

  1. Caspases in plants: metacaspase gene family in plant stress responses.

    PubMed

    Fagundes, David; Bohn, Bianca; Cabreira, Caroline; Leipelt, Fábio; Dias, Nathalia; Bodanese-Zanettini, Maria H; Cagliari, Alexandro

    2015-11-01

    Programmed cell death (PCD) is an ordered cell suicide that removes unwanted or damaged cells, playing a role in defense to environmental stresses and pathogen invasion. PCD is component of the life cycle of plants, occurring throughout development from embryogenesis to the death. Metacaspases are cysteine proteases present in plants, fungi, and protists. In certain plant-pathogen interactions, the PCD seems to be mediated by metacaspases. We adopted a comparative genomic approach to identify genes coding for the metacaspases in Viridiplantae. We observed that the metacaspase was divided into types I and II, based on their protein structure. The type I has a metacaspase domain at the C-terminus region, presenting or not a zinc finger motif in the N-terminus region and a prodomain rich in proline. Metacaspase type II does not feature the prodomain and the zinc finger, but has a linker between caspase-like catalytic domains of 20 kDa (p20) and 10 kDa (p10). A high conservation was observed in the zinc finger domain (type I proteins) and in p20 and p10 subunits (types I and II proteins). The phylogeny showed that the metacaspases are divided into three principal groups: type I with and without zinc finger domain and type II metacaspases. The algae and moss are presented as outgroup, suggesting that these three classes of metacaspases originated in the early stages of Viridiplantae, being the absence of the zinc finger domain the ancient condition. The study of metacaspase can clarify their assignment and involvement in plant PCD mechanisms.

  2. Exome sequencing of Pakistani consanguineous families identifies 30 novel candidate genes for recessive intellectual disability.

    PubMed

    Riazuddin, S; Hussain, M; Razzaq, A; Iqbal, Z; Shahzad, M; Polla, D L; Song, Y; van Beusekom, E; Khan, A A; Tomas-Roca, L; Rashid, M; Zahoor, M Y; Wissink-Lindhout, W M; Basra, M A R; Ansar, M; Agha, Z; van Heeswijk, K; Rasheed, F; Van de Vorst, M; Veltman, J A; Gilissen, C; Akram, J; Kleefstra, T; Assir, M Z; Grozeva, D; Carss, K; Raymond, F L; O'Connor, T D; Riazuddin, S A; Khan, S N; Ahmed, Z M; de Brouwer, A P M; van Bokhoven, H; Riazuddin, S

    2016-07-26

    Intellectual disability (ID) is a clinically and genetically heterogeneous disorder, affecting 1-3% of the general population. Although research into the genetic causes of ID has recently gained momentum, identification of pathogenic mutations that cause autosomal recessive ID (ARID) has lagged behind, predominantly due to non-availability of sizeable families. Here we present the results of exome sequencing in 121 large consanguineous Pakistani ID families. In 60 families, we identified homozygous or compound heterozygous DNA variants in a single gene, 30 affecting reported ID genes and 30 affecting novel candidate ID genes. Potential pathogenicity of these alleles was supported by co-segregation with the phenotype, low frequency in control populations and the application of stringent bioinformatics analyses. In another eight families segregation of multiple pathogenic variants was observed, affecting 19 genes that were either known or are novel candidates for ID. Transcriptome profiles of normal human brain tissues showed that the novel candidate ID genes formed a network significantly enriched for transcriptional co-expression (P<0.0001) in the frontal cortex during fetal development and in the temporal-parietal and sub-cortex during infancy through adulthood. In addition, proteins encoded by 12 novel ID genes directly interact with previously reported ID proteins in six known pathways essential for cognitive function (P<0.0001). These results suggest that disruptions of temporal parietal and sub-cortical neurogenesis during infancy are critical to the pathophysiology of ID. These findings further expand the existing repertoire of genes involved in ARID, and provide new insights into the molecular mechanisms and the transcriptome map of ID.Molecular Psychiatry advance online publication, 26 July 2016; doi:10.1038/mp.2016.109.

  3. Genome structure drives patterns of gene family evolution in ciliates, a case study using Chilodonella uncinata (Protista, Ciliophora, Phyllopharyngea).

    PubMed

    Gao, Feng; Song, Weibo; Katz, Laura A

    2014-08-01

    In most lineages, diversity among gene family members results from gene duplication followed by sequence divergence. Because of the genome rearrangements during the development of somatic nuclei, gene family evolution in ciliates involves more complex processes. Previous work on the ciliate Chilodonella uncinata revealed that macronuclear β-tubulin gene family members are generated by alternative processing, in which germline regions are alternatively used in multiple macronuclear chromosomes. To further study genome evolution in this ciliate, we analyzed its transcriptome and found that (1) alternative processing is extensive among gene families; and (2) such gene families are likely to be C. uncinata specific. We characterized additional macronuclear and micronuclear copies of one candidate alternatively processed gene family-a protein kinase domain containing protein (PKc)-from two C. uncinata strains. Analysis of the PKc sequences reveals that (1) multiple PKc gene family members in the macronucleus share some identical regions flanked by divergent regions; and (2) the shared identical regions are processed from a single micronuclear chromosome. We discuss analogous processes in lineages across the eukaryotic tree of life to provide further insights on the impact of genome structure on gene family evolution in eukaryotes.

  4. Identification and expression analysis of BMP signaling inhibitors genes of the DAN family in amphioxus.

    PubMed

    Le Petillon, Yann; Oulion, Silvan; Escande, Marie-Line; Escriva, Hector; Bertrand, Stephanie

    2013-12-01

    Bone morphogenetic proteins (BMPs) are members of the Transforming Growth Factor-β (TGF-β) family implicated in many developmental processes in metazoans such as embryo axes specification. Their wide variety of actions is in part controlled by inhibitors that impede the interaction of BMPs with their specific receptors. Here, we focused our attention on the Differential screening-selected gene Aberrative in Neuroblastoma (DAN) family of inhibitors. Although they are well-characterized in vertebrates, few data are available for this family in other metazoan species. In order to understand the evolution of potential developmental roles of these inhibitors in chordates, we identified the members of this family in the cephalochordate amphioxus, and characterized their expression patterns during embryonic development. Our data suggest that the function of Cerberus/Dand5 subfamily genes is conserved among chordates, whereas Gremlin1/2 and NBL1 subfamily genes seem t