Science.gov

Sample records for adh gene promoter

  1. Differential interactions of promoter elements in stress responses of the Arabidopsis Adh gene.

    PubMed Central

    Dolferus, R; Jacobs, M; Peacock, W J; Dennis, E S

    1994-01-01

    The Adh (alcohol dehydrogenase, EC 1.1.1.1.) gene from Arabidopsis thaliana (L.) Heynh. can be induced by dehydration and cold, as well as by hypoxia. A 1-kb promoter fragment (CADH: -964 to +53) is sufficient to confer the stress induction and tissue-specific developmental expression characteristics of the Adh gene to a beta-glucuronidase reporter gene. Deletion mapping of the 5' end and site-specific mutagenesis identified four regions of the promoter essential for expression under the three stress conditions. Some sequence elements are important for response to all three stress treatments, whereas others are stress specific. The most critical region essential for expression of the Arabidopsis Adh promoter under all three environmental stresses (region IV: -172 to -141) contains sequences homologous to the GT motif (-160 to -152) and the GC motif (-147 to -144) of the maize Adh1 anaerobic responsive element. Region III (-235 to -172) contains two regions shown by R.J. Ferl and B.H. Laughner ([1989] Plant Mol Biol 12: 357-366) to bind regulatory proteins; mutation of the G-box-1 region (5'-CCACGTGG-3', -216 to -209) does not affect expression under uninduced or hypoxic conditions, but significantly reduces induction by cold stress and, to a lesser extent, by dehydration stress. Mutation of the other G-box-like sequence (G-box-2: 5'-CCAAGTGG-3', -193 to -182) does not change hypoxic response and affects cold and dehydration stress only slightly. G-box-2 mutations also promote high levels of expression under uninduced conditions. Deletion of region I (-964 to -510) results in increased expression under uninduced and all stress conditions, suggesting that this region contains a repressor binding site. Region II (-510 to -384) contains a positive regulatory element and is necessary for high expression levels under all treatments. PMID:7972489

  2. Efficient production of lycopene in Saccharomyces cerevisiae by expression of synthetic crt genes from a plasmid harboring the ADH2 promoter.

    PubMed

    Bahieldin, Ahmed; Gadalla, Nour O; Al-Garni, Saleh M; Almehdar, Hussein; Noor, Samah; Hassan, Sabah M; Shokry, Ahmed M; Sabir, Jamal S M; Murata, Norio

    2014-03-01

    Lycopene is an effective antioxidant proposed as a possible treatment for some cancers and other degenerative human conditions. This study aims at generation of a yeast strain (Saccharomyces cerevisiae) of efficient productivity of lycopene by overexpressing synthetic genes derived from crtE, crtB and crtI genes of Erwinia uredovora. These synthetic genes were constructed in accordance with the preferred codon usage in S. cerevisiae but with no changes in amino acid sequences of the gene products. S. cerevisiae cells were transformed with these synthetic crt genes, whose expression was regulated by the ADH2 promoter, which is de-repressed upon glucose depletion. The RT-PCR and Western blotting analyses indicated that the synthetic crt genes were efficiently transcribed and translated in crt-transformed S. cerevisiae cells. The highest level of lycopene in one of the transformed lines was 3.3mglycopene/g dry cell weight, which is higher than the previously reported levels of lycopene in other microorganisms transformed with the three genes. These results suggest the excellence of using the synthetic crt genes and the ADH2 promoter in generation of recombinant S. cerevisiae that produces a high level of lycopene. The level of ergosterol was reversely correlated to that of lycopene in crt-transformed S. cerevisiae cells, suggesting that two pathways for lycopene and ergosterol syntheses compete for the use of farnesyl diphosphate. PMID:24680933

  3. Chromatin remodeling during Saccharomyces cerevisiae ADH2 gene activation.

    PubMed

    Verdone, L; Camilloni, G; Di Mauro, E; Caserta, M

    1996-05-01

    We have analyzed at both low and high resolution the distribution of nucleosomes over the Saccharomyces cerevisiae ADH2 promoter region in its chromosomal location, both under repressing (high-glucose) conditions and during derepression. Enzymatic treatments (micrococcal nuclease and restriction endonucleases) were used to probe the in vivo chromatin structure during ADH2 gene activation. Under glucose-repressed conditions, the ADH2 promoter was bound by a precise array of nucleosomes, the principal ones positioned at the RNA initiation sites (nucleosome +1), at the TATA box (nucleosome -1), and upstream of the ADR1-binding site (UAS1) (nucleosome -2). The UAS1 sequence and the adjacent UAS2 sequence constituted a nucleosome-free region. Nucleosomes -1 and +1 were destabilized soon after depletion of glucose and had become so before the appearance of ADH2 mRNA. When the transcription rate was high, nucleosomes -2 and +2 also underwent rearrangement. When spheroplasts were prepared from cells grown in minimal medium, detection of this chromatin remodeling required the addition of a small amount of glucose. Cells lacking the ADR1 protein did not display any of these chromatin modifications upon glucose depletion. Since the UAS1 sequence to which Adr1p binds is located immediately upstream of nucleosome -1, Adr1p is presumably required for destabilization of this nucleosome and for aiding the TATA-box accessibility to the transcription machinery. PMID:8628264

  4. Effects of glucose, ethanol and acetic acid on regulation of ADH2 gene from Lachancea fermentati.

    PubMed

    Yaacob, Norhayati; Mohamad Ali, Mohd Shukuri; Salleh, Abu Bakar; Abdul Rahman, Nor Aini

    2016-01-01

    Background. Not all yeast alcohol dehydrogenase 2 (ADH2) are repressed by glucose, as reported in Saccharomyces cerevisiae. Pichia stipitis ADH2 is regulated by oxygen instead of glucose, whereas Kluyveromyces marxianus ADH2 is regulated by neither glucose nor ethanol. For this reason, ADH2 regulation of yeasts may be species dependent, leading to a different type of expression and fermentation efficiency. Lachancea fermentati is a highly efficient ethanol producer, fast-growing cells and adapted to fermentation-related stresses such as ethanol and organic acid, but the metabolic information regarding the regulation of glucose and ethanol production is still lacking. Methods. Our investigation started with the stimulation of ADH2 activity from S. cerevisiae and L. fermentati by glucose and ethanol induction in a glucose-repressed medium. The study also embarked on the retrospective analysis of ADH2 genomic and protein level through direct sequencing and sites identification. Based on the sequence generated, we demonstrated ADH2 gene expression highlighting the conserved NAD(P)-binding domain in the context of glucose fermentation and ethanol production. Results. An increase of ADH2 activity was observed in starved L. fermentati (LfeADH2) and S. cerevisiae (SceADH2) in response to 2% (w/v) glucose induction. These suggest that in the presence of glucose, ADH2 activity was activated instead of being repressed. An induction of 0.5% (v/v) ethanol also increased LfeADH2 activity, promoting ethanol resistance, whereas accumulating acetic acid at a later stage of fermentation stimulated ADH2 activity and enhanced glucose consumption rates. The lack in upper stream activating sequence (UAS) and TATA elements hindered the possibility of Adr1 binding to LfeADH2. Transcription factors such as SP1 and RAP1 observed in LfeADH2 sequence have been implicated in the regulation of many genes including ADH2. In glucose fermentation, L. fermentati exhibited a bell-shaped ADH2

  5. Effects of glucose, ethanol and acetic acid on regulation of ADH2 gene from Lachancea fermentati

    PubMed Central

    Yaacob, Norhayati; Salleh, Abu Bakar; Abdul Rahman, Nor Aini

    2016-01-01

    Background. Not all yeast alcohol dehydrogenase 2 (ADH2) are repressed by glucose, as reported in Saccharomyces cerevisiae. Pichia stipitis ADH2 is regulated by oxygen instead of glucose, whereas Kluyveromyces marxianus ADH2 is regulated by neither glucose nor ethanol. For this reason, ADH2 regulation of yeasts may be species dependent, leading to a different type of expression and fermentation efficiency. Lachancea fermentati is a highly efficient ethanol producer, fast-growing cells and adapted to fermentation-related stresses such as ethanol and organic acid, but the metabolic information regarding the regulation of glucose and ethanol production is still lacking. Methods. Our investigation started with the stimulation of ADH2 activity from S. cerevisiae and L. fermentati by glucose and ethanol induction in a glucose-repressed medium. The study also embarked on the retrospective analysis of ADH2 genomic and protein level through direct sequencing and sites identification. Based on the sequence generated, we demonstrated ADH2 gene expression highlighting the conserved NAD(P)-binding domain in the context of glucose fermentation and ethanol production. Results. An increase of ADH2 activity was observed in starved L. fermentati (LfeADH2) and S. cerevisiae (SceADH2) in response to 2% (w/v) glucose induction. These suggest that in the presence of glucose, ADH2 activity was activated instead of being repressed. An induction of 0.5% (v/v) ethanol also increased LfeADH2 activity, promoting ethanol resistance, whereas accumulating acetic acid at a later stage of fermentation stimulated ADH2 activity and enhanced glucose consumption rates. The lack in upper stream activating sequence (UAS) and TATA elements hindered the possibility of Adr1 binding to LfeADH2. Transcription factors such as SP1 and RAP1 observed in LfeADH2 sequence have been implicated in the regulation of many genes including ADH2. In glucose fermentation, L. fermentati exhibited a bell-shaped ADH2

  6. Evaluation of the Saccharomyces cerevisiae ADH2 promoter for protein synthesis.

    PubMed

    Lee, K Michael; DaSilva, Nancy A

    2005-04-30

    The Saccharomyces cerevisiae ADH2 promoter (P(ADH2)) is repressed several hundred-fold in the presence of glucose; transcription is initiated once the glucose in the medium is exhausted. The promoter can thus be utilized for effective regulation of recombinant gene expression in S. cerevisiae without the addition of an inducer. To evaluate this promoter in the absence of plasmid copy number and stability variations, the P(ADH2)-lacZ cassette was integrated into the yeast chromosomes. The effects of medium composition, glucose concentration and cultivation time on promoter derepression and expression level were investigated. Maximum protein activity was obtained after 48 h of growth in complex YPD medium containing 1% glucose. The widely used S. cerevisiae GAL1 and CUP1 promoters both require the addition of an inducer [galactose and copper(II) ion, respectively] before regulated genes will be expressed. The strengths of these three different promoters were compared for cells containing one copy of an integrated lacZ gene under their control. The ADH2 promoter was superior for all induction strategies investigated. PMID:15849781

  7. The ADH7 Promoter of Saccharomyces cerevisiae is Vanillin-Inducible and Enables mRNA Translation Under Severe Vanillin Stress.

    PubMed

    Nguyen, Trinh T M; Iwaki, Aya; Izawa, Shingo

    2015-01-01

    Vanillin is one of the major phenolic aldehyde compounds derived from lignocellulosic biomass and acts as a potent fermentation inhibitor to repress the growth and fermentative ability of yeast. Vanillin can be reduced to its less toxic form, vanillyl alcohol, by the yeast NADPH-dependent medium chain alcohol dehydrogenases, Adh6 and Adh7. However, there is little information available regarding the regulation of their gene expression upon severe vanillin stress, which has been shown to repress the bulk translation activity in yeast cells. Therefore, in this study, we investigated expression patterns of the ADH6 and ADH7 genes in the presence of high concentrations of vanillin. We found that although both genes were transcriptionally upregulated by vanillin stress, they showed different protein expression patterns in response to vanillin. Expression of Adh6 was constitutive and gradually decreased under vanillin stress, whereas expression of Adh7 was inducible, and, importantly, occurred under severe vanillin stress. The null mutants of ADH6 or ADH7 genes were hypersensitive to vanillin and reduced vanillin less efficiently than the wild type, confirming the importance of Adh6 and Adh7 in vanillin detoxification. Additionally, we demonstrate that the ADH7 promoter is vanillin-inducible and enables effective protein synthesis even under severe vanillin stress, and it may be useful for the improvement of vanillin-tolerance and biofuel production efficiency via modification of yeast gene expression in the presence of high concentrations of vanillin. PMID:26696995

  8. The ADH7 Promoter of Saccharomyces cerevisiae is Vanillin-Inducible and Enables mRNA Translation Under Severe Vanillin Stress

    PubMed Central

    Nguyen, Trinh T. M.; Iwaki, Aya; Izawa, Shingo

    2015-01-01

    Vanillin is one of the major phenolic aldehyde compounds derived from lignocellulosic biomass and acts as a potent fermentation inhibitor to repress the growth and fermentative ability of yeast. Vanillin can be reduced to its less toxic form, vanillyl alcohol, by the yeast NADPH-dependent medium chain alcohol dehydrogenases, Adh6 and Adh7. However, there is little information available regarding the regulation of their gene expression upon severe vanillin stress, which has been shown to repress the bulk translation activity in yeast cells. Therefore, in this study, we investigated expression patterns of the ADH6 and ADH7 genes in the presence of high concentrations of vanillin. We found that although both genes were transcriptionally upregulated by vanillin stress, they showed different protein expression patterns in response to vanillin. Expression of Adh6 was constitutive and gradually decreased under vanillin stress, whereas expression of Adh7 was inducible, and, importantly, occurred under severe vanillin stress. The null mutants of ADH6 or ADH7 genes were hypersensitive to vanillin and reduced vanillin less efficiently than the wild type, confirming the importance of Adh6 and Adh7 in vanillin detoxification. Additionally, we demonstrate that the ADH7 promoter is vanillin-inducible and enables effective protein synthesis even under severe vanillin stress, and it may be useful for the improvement of vanillin-tolerance and biofuel production efficiency via modification of yeast gene expression in the presence of high concentrations of vanillin. PMID:26696995

  9. The Adh-related gene of Drosophila melanogaster is expressed as a functional dicistronic messenger RNA: multigenic transcription in higher organisms.

    PubMed

    Brogna, S; Ashburner, M

    1997-04-15

    Essentially all eukaryotic cellular mRNAs are monocistronic, and are usually transcribed individually. Two tandemly arranged Drosophila genes, alcohol dehydrogenase (Adh) and Adh-related (Adhr), are transcribed as a dicistronic transcript. From transcripts initiated from the Adh promoter, two classes of mRNA are accumulated, one is monocistronic and encodes Adh alone, the other is dicistronic and includes the open reading frames of both Adh and Adhr. The dicistronic transcript is found in polysomes and the Adhr protein product is detected by antibody staining. We present evidence that the accumulation of the dicistronic mRNA is controlled at the level of the 3' end processing. PMID:9155028

  10. Transcriptional control of ADH genes in the xylose-fermenting yeast Pichia stipitis

    SciTech Connect

    Cho, J.Y.; Jeffries, T.W. |

    1999-06-01

    The authors studied the expression of the genes encoding group 1 alcohol dehydrogenases (PsADH1 and PsADH2) in the xylose-fermenting yeast Pichia stipitis CBS 6054. The cells expressed PsADH1 approximately 10 times higher under oxygen-limited conditions than under fully aerobic conditions when cultivated on xylose. Transcripts of PsADH2 were not detectable under either aeration condition. The authors used a PsADH1::lacZ fusion to monitor PsADH1 expression and found that expression increased as oxygen decreased. The level of PsADH1 transcript was expressed about 10-fold in cells grown in the presence of heme under oxygen-limited conditions. Concomitantly with the induction of PsADH1, PsCYC1 expression was regressed. These results indicate that oxygen availability regulates PsADH1 expression and that regulation may be mediated by heme. The regulation of PsADH2 expression was also examined in other genetic backgrounds. Disruption of PsADH1 dramatically increased PsADH2 expression on nonfermentable carbon sources under fully aerobic conditions, indicating that the expression of PsADH2 is subject to feedback regulation under these conditions.

  11. Evolution of the adhE gene product of Escherichia coli from a functional reductase to a dehydrogenase. Genetic and biochemical studies of the mutant proteins.

    PubMed

    Membrillo-Hernandez, J; Echave, P; Cabiscol, E; Tamarit, J; Ros, J; Lin, E C

    2000-10-27

    The multifunctional AdhE protein of Escherichia coli (encoded by the adhE gene) physiologically catalyzes the sequential reduction of acetyl-CoA to acetaldehyde and then to ethanol under fermentative conditions. The NH(2)-terminal region of the AdhE protein is highly homologous to aldehyde:NAD(+) oxidoreductases, whereas the COOH-terminal region is homologous to a family of Fe(2+)-dependent ethanol:NAD(+) oxidoreductases. This fusion protein also functions as a pyruvate formate lyase deactivase. E. coli cannot grow aerobically on ethanol as the sole carbon and energy source because of inadequate rate of adhE transcription and the vulnerability of the AdhE protein to metal-catalyzed oxidation. In this study, we characterized 16 independent two-step mutants with acquired and improved aerobic growth ability on ethanol. The AdhE proteins in these mutants catalyzed the sequential oxidation of ethanol to acetaldehyde and to acetyl-CoA. All first stage mutants grew on ethanol with a doubling time of about 240 min. Sequence analysis of a randomly chosen mutant revealed an Ala-267 --> Thr substitution in the acetaldehyde:NAD(+) oxidoreductase domain of AdhE. All second stage mutants grew on ethanol with a doubling time of about 90 min, and all of them produced an AdhE(A267T/E568K). Purified AdhE(A267T) and AdhE(A267T/E568K) showed highly elevated acetaldehyde dehydrogenase activities. It therefore appears that when AdhE catalyzes the two sequential reactions in the counter-physiological direction, acetaldehyde dehydrogenation is the rate-limiting step. Both mutant proteins were more thermosensitive than the wild-type protein, but AdhE(A267T/E568K) was more thermal stable than AdhE(A267T). Since both mutant enzymes exhibited similar kinetic properties, the second mutation probably conferred an increased growth rate on ethanol by stabilizing AdhE(A267T). PMID:10922373

  12. A human alcohol dehydrogenase gene (ADH6) encoding an additional class of isozyme.

    PubMed Central

    Yasunami, M; Chen, C S; Yoshida, A

    1991-01-01

    The human alcohol dehydrogenase (ADH; alcohol:NAD+ oxidoreductase, EC 1.1.1.1) gene family consists of five known loci (ADH1-ADH5), which have been mapped close together on chromosome 4 (4q21-25). ADH isozymes encoded by these genes are grouped in three distinct classes in terms of their enzymological properties. A moderate structural similarity is observed between the members of different classes. We isolated an additional member of the ADH gene family by means of cross-hybridization with the ADH2 (class I) cDNA probe. cDNA clones corresponding to this gene were derived from PCR-amplified libraries as well. The coding sequence of a 368-amino-acid-long open reading frame was interrupted by introns into eight exons and spanned approximately 17 kilobases on the genome. The gene contains a glucocorticoid response element at the 5' region. The transcript was detected in the stomach and liver. The deduced amino acid sequence of the open reading frame showed about 60% positional identity with known human ADHs. This extent of homology is comparable to interclass similarity in the human ADH family. Thus, the newly identified gene, which is designated ADH6, governs the synthesis of an enzyme that belongs to another class of ADHs presumably with a distinct physiological role. Images PMID:1881901

  13. Biosynthetic burden and plasmid burden limit expression of chromosomally integrated heterologous genes (pdc, adhB) in Escherichia coli

    SciTech Connect

    Martinez, A.; York, S.W.; Yomano, L.P.; Pineda, V.L.; Davis, F.C.; Shelton, J.C.; Ingram, L.O.

    1999-10-01

    Previous studies have shown an unexpectedly high nutrient requirement for efficient ethanol production by ethanologenic recombinants of Escherichia coli B such as LY01 which contain chromosomally integrated Zymomonas mobilis genes (pdc, adhB) encoding the ethanol pathway. The basis for this requirement has been identified as a media-dependent effect on the expression of the Z. mobilis genes rather than a nutritional limitation. Ethanol production was substantially increased without additional nutrients simply by increasing the level of pyruvate decarboxylase activity. This was accomplished by adding a multicopy plasmid containing pdc alone (but not adhB alone) to strain LY01, and by adding multicopy plasmids which express pdc and adhB from strong promoters. New strong promoters were isolated from random fragments of Z. mobilis DNA and characterized but were not used to construct integrated biocatalysts. These promoters contained regions resembling recognition sites for 3 different E. coli sigma factors: {sigma}{sup 70}, {sigma}{sup 38}, and {sigma}{sup 28}. The most effective plasmid-based promoters for fermentation were recognized by multiple sigma factors, expressed both pdc and adhB at high levels, and produced ethanol efficiently while allowing up to 80% reduction in complex nutrients as compared to LY01. The ability to utilize multiple sigma factors may be advantageous to maintain the high levels of PDC and ADH needed for efficient ethanol production throughout batch fermentation.

  14. Cloning of the Arabidopsis and Rice Formaldehyde Dehydrogenase Genes: Implications for the Origin of Plant Adh Enzymes

    PubMed Central

    Dolferus, R.; Osterman, J. C.; Peacock, W. J.; Dennis, E. S.

    1997-01-01

    This article reports the cloning of the genes encoding the Arabidopsis and rice class III ADH enzymes, members of the alcohol dehydrogenase or medium chain reductase/dehydrogenase superfamily of proteins with glutathione-dependent formaldehyde dehydrogenase activity (GSH-FDH). Both genes contain eight introns in exactly the same positions, and these positions are conserved in plant ethanol-active Adh genes (class P). These data provide further evidence that plant class P genes have evolved from class III genes by gene duplication and acquisition of new substrate specificities. The position of introns and similarities in the nucleic acid and amino acid sequences of the different classes of ADH enzymes in plants and humans suggest that plant and animal class III enzymes diverged before they duplicated to give rise to plant and animal ethanol-active ADH enzymes. Plant class P ADH enzymes have gained substrate specificities and evolved promoters with different expression properties, in keeping with their metabolic function as part of the alcohol fermentation pathway. PMID:9215914

  15. Improvement of Ethanol Production in Saccharomyces cerevisiae by High-Efficient Disruption of the ADH2 Gene Using a Novel Recombinant TALEN Vector.

    PubMed

    Ye, Wei; Zhang, Weimin; Liu, Taomei; Tan, Guohui; Li, Haohua; Huang, Zilei

    2016-01-01

    Bioethanol is becoming increasingly important in energy supply and economic development. However, the low yield of bioethanol and the insufficiency of high-efficient genetic manipulation approaches limit its application. In this study, a novel transcription activator-like effector nuclease (TALEN) vector containing the left and right arms of TALEN was electroporated into Saccharomyces cerevisiae strain As2.4 to sequence the alcohol dehydrogenase gene ADH2 and the hygromycin-resistant gene hyg. Western blot analysis using anti-FLAG monoclonal antibody proved the successful expression of TALE proteins in As2.4 strains. qPCR and sequencing demonstrated the accurate knockout of the 17 bp target gene with 80% efficiency. The TALEN vector and ADH2 PCR product were electroporated into ΔADH2 to complement the ADH2 gene (ADH2 (+) As2.4). LC-MS and GC were employed to detect ethanol yields in the native As2.4, ΔADH2 As2.4, and ADH2 (+) As2.4 strains. Results showed that ethanol production was improved by 52.4 ± 5.3% through the disruption of ADH2 in As2.4. The bioethanol yield of ADH2 (+) As2.4 was nearly the same as that of native As2.4. This study is the first to report on the disruption of a target gene in S. cerevisiae by employing Fast TALEN technology to improve bioethanol yield. This work provides a novel approach for the disruption of a target gene in S. cerevisiae with high efficiency and specificity, thereby promoting the improvement of bioethanol production in S. cerevisiae by metabolic engineering. PMID:27462304

  16. Improvement of Ethanol Production in Saccharomyces cerevisiae by High-Efficient Disruption of the ADH2 Gene Using a Novel Recombinant TALEN Vector

    PubMed Central

    Ye, Wei; Zhang, Weimin; Liu, Taomei; Tan, Guohui; Li, Haohua; Huang, Zilei

    2016-01-01

    Bioethanol is becoming increasingly important in energy supply and economic development. However, the low yield of bioethanol and the insufficiency of high-efficient genetic manipulation approaches limit its application. In this study, a novel transcription activator-like effector nuclease (TALEN) vector containing the left and right arms of TALEN was electroporated into Saccharomyces cerevisiae strain As2.4 to sequence the alcohol dehydrogenase gene ADH2 and the hygromycin-resistant gene hyg. Western blot analysis using anti-FLAG monoclonal antibody proved the successful expression of TALE proteins in As2.4 strains. qPCR and sequencing demonstrated the accurate knockout of the 17 bp target gene with 80% efficiency. The TALEN vector and ADH2 PCR product were electroporated into ΔADH2 to complement the ADH2 gene (ADH2+ As2.4). LC–MS and GC were employed to detect ethanol yields in the native As2.4, ΔADH2 As2.4, and ADH2+ As2.4 strains. Results showed that ethanol production was improved by 52.4 ± 5.3% through the disruption of ADH2 in As2.4. The bioethanol yield of ADH2+ As2.4 was nearly the same as that of native As2.4. This study is the first to report on the disruption of a target gene in S. cerevisiae by employing Fast TALEN technology to improve bioethanol yield. This work provides a novel approach for the disruption of a target gene in S. cerevisiae with high efficiency and specificity, thereby promoting the improvement of bioethanol production in S. cerevisiae by metabolic engineering. PMID:27462304

  17. The Adh1 gene of the fungus Metarhizium anisopliae is expressed during insect colonization and required for full virulence.

    PubMed

    Callejas-Negrete, Olga Alicia; Torres-Guzmán, Juan Carlos; Padilla-Guerrero, Israel Enrique; Esquivel-Naranjo, Ulises; Padilla-Ballesteros, Maria Fernanda; García-Tapia, Adriana; Schrank, Augusto; Salazar-Solís, Eduardo; Gutiérrez-Corona, Félix; González-Hernández, Gloria Angélica

    2015-03-01

    Zymography of alcohol dehydrogenase (ADH) activity in the entomopathogenic fungus Metarhizium anisopliae grown under various conditions revealed that micro-aerobic growth was associated with increased ADH activity. The major ADH protein, AdhIp, was purified to homogeneity by affinity chromatography and has an estimated molecular weight of 41kDa and an isoelectric point (pI) of 6.4. Peptide mass fingerprint analysis allowed the identification and cloning of the gene that encodes this protein, Adh1, as annotated in the M. anisopliae genome database. AdhIp is related to the medium-chain dehydrogenase/reductase (MDR)/zinc-dependent alcohol dehydrogenase-like family and contains conserved ADH sequence motifs, such as the zinc-containing ADH signature, the FAD/NAD binding domain and amino acid residues that are conserved in most microbial ADHs. Semi-quantitative RT-PCR analysis revealed that Adh1 gene expression occurs at low levels during early Plutella xylostella infection and that the Adh1 gene was primarily expressed at larval death and as mycelia emerge from the insect cuticle before conidiation. Antisense-RNA experiments indicated that NAD(+)-dependent ADH activity was diminished by 20-75% in the transformants, and the transformants that had lower ADH activity showed allyl alcohol resistance, which indicates that reduction in ADH activity also occurs in vivo. Bioassays performed using antisense adh1 transformants, which have lower ADH activity, showed that LC50 values were two to five times higher than the wild-type, indicating that AdhIp is required for full capability of the fungus to penetrate and/or colonize the insect. PMID:25534970

  18. Increased Variation in Adh Enzyme Activity in Drosophila Mutation-Accumulation Experiment Is Not Due to Transposable Elements at the Adh Structural Gene

    PubMed Central

    Aquadro, C. F.; Tachida, H.; Langley, C. H.; Harada, K.; Mukai, T.

    1990-01-01

    We present here a molecular analysis of the region surrounding the structural gene encoding alcohol dehydrogenase (Adh) in 47 lines of Drosophila melanogaster that have each accumulated mutations for 300 generations. While these lines show a significant increase in variation of alcohol dehydrogenase enzyme activity compared to control lines, we found no restriction map variation in a 13-kb region including the complete Adh structural gene and roughly 5 kb of both 5' and 3' sequences. Thus, the rapid accumulation of ADH activity variation after 28,200 allele generations does not appear to have been due to the mobilization of transposable elements into or out of the Adh structural gene region. PMID:1963870

  19. DNA-histone interactions are sufficient to position a single nucleosome juxtaposing Drosophila Adh adult enhancer and distal promoter.

    PubMed Central

    Jackson, J R; Benyajati, C

    1993-01-01

    The alcohol dehydrogenase gene (Adh) of Drosophila melanogaster is transcribed from two tandem promoters in distinct developmental and tissue-specific patterns. Both promoters are regulated by separate upstream enhancer regions. In its wild-type context the adult enhancer specifically stimulates only the distal promoter, approximately 400 bp downstream, and not the proximal promoter, which is approximately 700 bp further downstream. Genomic footprinting and micrococcal nuclease analyses have revealed a specifically positioned nucleosome between the distal promoter and adult enhancer. In vitro reconstitution of this nucleosome demonstrated that DNA-core histone interactions alone are sufficient to position the nucleosome. Based on this observation and sequence periodicities in the underlying DNA, the mechanism of positioning appears to involve specific DNA structural features (ie flexibility or curvature). We have observed this nucleosome positioned early during development, before tissue differentiation, and before non-histone protein-DNA interactions are established at the distal promoter or adult enhancer. This nucleosome positioning element in the Adh regulatory region could be involved in establishing a specific tertiary nucleoprotein structure that facilitates specific cis-element accessibility and/or distal promoter-adult enhancer interactions. Images PMID:8451195

  20. Fructophilic characteristics of Fructobacillus spp. may be due to the absence of an alcohol/acetaldehyde dehydrogenase gene (adhE).

    PubMed

    Endo, Akihito; Tanaka, Naoto; Oikawa, Yo; Okada, Sanae; Dicks, Leon

    2014-04-01

    Fructophilic strains of Leuconostoc spp. have recently been reclassified to a new genus, i.e., Fructobacillus. Members of the genus are differentiated from Leuconostoc spp. by their preference for fructose on growth, requirement of an electron acceptor for glucose metabolism, and the inability to produce ethanol from the fermentation of glucose. In the present study, enzyme activities and genes involved in ethanol production were studied, since this is the key pathway for NAD(+)/NADH cycling in heterofermentative lactic acid bacteria. Fructobacillus spp. has a weak alcohol dehydrogenase activity and has no acetaldehyde dehydrogenase activity, whereas both enzymes are active in Leuconostoc mesenteroides. The bifunctional alcohol/acetaldehyde dehydrogenase gene, adhE, was described in Leuconostoc spp., but not in Fructobacillus spp. These results suggested that, due to the deficiency of the adhE gene, the normal pathway for ethanol production is absent in Fructobacillus spp. This leads to a shortage of NAD(+), and the requirement for an electron acceptor in glucose metabolism. Fructophilic characteristics, as observed for Fructobacillus spp., are thus due to the absence of the adhE gene, and a phenotype that most likely evolved as a result of regressive evolution. PMID:24352296

  1. Alcohol dehydrogenase gene ADH3 activates glucose alcoholic fermentation in genetically engineered Dekkera bruxellensis yeast.

    PubMed

    Schifferdecker, Anna Judith; Siurkus, Juozas; Andersen, Mikael Rørdam; Joerck-Ramberg, Dorte; Ling, Zhihao; Zhou, Nerve; Blevins, James E; Sibirny, Andriy A; Piškur, Jure; Ishchuk, Olena P

    2016-04-01

    Dekkera bruxellensis is a non-conventional Crabtree-positive yeast with a good ethanol production capability. Compared to Saccharomyces cerevisiae, its tolerance to acidic pH and its utilization of alternative carbon sources make it a promising organism for producing biofuel. In this study, we developed an auxotrophic transformation system and an expression vector, which enabled the manipulation of D. bruxellensis, thereby improving its fermentative performance. Its gene ADH3, coding for alcohol dehydrogenase, was cloned and overexpressed under the control of the strong and constitutive promoter TEF1. Our recombinant D. bruxellensis strain displayed 1.4 and 1.7 times faster specific glucose consumption rate during aerobic and anaerobic glucose fermentations, respectively; it yielded 1.2 times and 1.5 times more ethanol than did the parental strain under aerobic and anaerobic conditions, respectively. The overexpression of ADH3 in D. bruxellensis also reduced the inhibition of fermentation by anaerobiosis, the "Custer effect". Thus, the fermentative capacity of D. bruxellensis could be further improved by metabolic engineering. PMID:26743658

  2. Isolation and Identification of Genes Activating Uas2-Dependent Adh2 Expression in Saccharomyces Cerevisiae

    PubMed Central

    Donoviel, M. S.; Young, E. T.

    1996-01-01

    Two cis-acting elements have been identified that act synergistically to regulate expression of the glucose-repressed alcohol dehydrogenase 2 (ADH2) gene. UAS1 is bound by the trans-activator Adr1p. UAS2 is thought to be the binding site for an unidentified regulatory protein. A genetic selection based on a UAS2-dependent ADH2 reporter was devised to isolate genes capable of activating UAS2-dependent transcription. One set of UAS2-dependent genes contained SPT6/CRE2/SSN20. Multicopy SPT6 caused improper expression of chromosomal ADH2. A second set of UAS2-dependent clones contained a previously uncharacterized open reading frame designated MEU1 (Multicopy Enhancer of UAS2). A frame shift mutation in MEU1 abolished its ability to activate UAS2-dependent gene expression. Multicopy MEU1 expression suppressed the constitutive ADH2 expression caused by cre2-1. Disruption of MEU1 reduced endogenous ADH2 expression about twofold but had no effect on cell viability or growth. No homologues of MEU1 were identified by low-stringency Southern hybridization of yeast genomic DNA, and no significant homologues were found in the sequence data bases. A MEU1/β-gal fusion protein was not localized to a particular region of the cell. MEU1 is linked to PPR1 on chromosome XII. PMID:8807288

  3. Primary structure and functional analysis of the lysis genes of Lactobacillus gasseri bacteriophage phi adh.

    PubMed

    Henrich, B; Binishofer, B; Bläsi, U

    1995-02-01

    The lysis genes of the Lactobacillus gasseri bacteriophage phi adh were isolated by complementation of a lambda Sam mutation in Escherichia coli. Nucleotide sequencing of a 1,735-bp DNA fragment revealed two adjacent coding regions of 342 bp (hol) and 951 bp (lys) in the same reading frame which appear to belong to a common transcriptional unit. Proteins corresponding to the predicted gene products, holin (12.9 kDa) and lysin (34.7 kDa), were identified by in vitro and in vivo expression of the cloned genes. The phi adh holin is a membrane-bound protein with structural similarity to lysis proteins of other phage, known to be required for the transit of murein hydrolases through the cytoplasmic membrane. The phi adh lysin shows homology with mureinolytic enzymes encoded by the Lactobacillus bulgaricus phage mv4, the Streptococcus pneumoniae phage Cp-1, Cp-7, and Cp-9, and the Lactococcus lactis phage phi LC3. Significant homology with the N termini of known muramidases suggests that phi adh lysin acts by a similar catalytic mechanism. In E. coli, the phi adh lysin seems to be associated with the total membrane fraction, from which it can be extracted with lauryl sarcosinate. Either one of the phi adh lysis proteins provoked lysis of E. coli when expressed along with holins or lysins of phage lambda or Bacillus subtilis phage phi 29. Concomitant expression of the combined holin and lysin functions of phi adh in E. coli, however, did not result in efficient cell lysis. PMID:7836307

  4. Molecular analysis of UAS(E), a cis element containing stress response elements responsible for ethanol induction of the KlADH4 gene of Kluyveromyces lactis.

    PubMed

    Mazzoni, C; Santori, F; Saliola, M; Falcone, C

    2000-01-01

    KlADH4 is a gene of Kluyveromyces lactis encoding a mitochondrial alcohol dehydrogenase activity, which is specifically induced by ethanol and insensitive to glucose repression. In this work, we report the molecular analysis of UAS(E), an element of the KlADH4 promoter which is essential for the induction of KlADH4 in the presence of ethanol. UAS(E) contains five stress response elements (STREs), which have been found in many genes of Saccharomyces cerevisiae involved in the response of cells to conditions of stress. Whereas KlADH4 is not responsive to stress conditions, the STREs present in UAS(E) seem to play a key role in the induction of the gene by ethanol, a situation that has not been observed in the related yeast S. cerevisiae. Gel retardation experiments showed that STREs in the KlADH4 promoter can bind factor(s) under non-inducing conditions. Moreover, we observed that the RAP1 binding site present in UAS(E) binds KlRap1p. PMID:10724480

  5. Characterization of polymorphisms of genes ADH2, ADH3, ALDH2 and CYP2E1 and relationship to the alcoholism in a Colombian population

    PubMed Central

    Méndez, Claudia

    2015-01-01

    Objective: Identify and characterize polymorphisms of genes ADH2, ADH3, ALDH2 and CYP2E1 in a Colombian population residing in the city of Bogotá and determine its possible relationship to the alcoholism. Methods: ADH2, ADH3, ALDH2, and CYP2E1 genotypes a population of 148 individuals with non-problematic alcohol and 65 individuals with alcoholism were determined with TaqMan probes and PCR-RFLP. DNA was obtained from peripheral blood white cells. Results: Significant difference was found in family history of alcoholism and use of other psychoactive substances to compare alcoholics with controls. When allelic frequencies for each category (gender) were considered, frequency of A2 allele carriers in ADH2 was found higher in male patients than controls. In women, the relative frequency for c1 allele in CYP2E1 was lower in controls than alcoholics. The ALDH2 locus is monomorphic. No significant differences in allele distributions of the loci examined to compare two populations were observed, however when stratifying the same trend was found that these differences tended to be significant. Conclusions: This study allows us to conclude the positive association between family history of alcoholism and alcoholism suggesting that there is a favourable hereditary predisposition. Since substance dependence requires interaction of multiple genes, the combination of genotypes ADH2 * 2, CYP2E1 * 1 combined with genotype homozygous ALDH2 * 1 found in this study could be leading to the population to a potential risk to alcoholism. PMID:26848198

  6. Polymorphisms in Alcohol Metabolism Genes ADH1B and ALDH2, Alcohol Consumption and Colorectal Cancer

    PubMed Central

    Crous-Bou, Marta; Rennert, Gad; Cuadras, Daniel; Salazar, Ramon; Cordero, David; Saltz Rennert, Hedy; Lejbkowicz, Flavio; Kopelovich, Levy; Monroe Lipkin, Steven; Bernard Gruber, Stephen; Moreno, Victor

    2013-01-01

    Background Colorectal cancer (CRC) is a leading cause of cancer death worldwide. Epidemiological risk factors for CRC included alcohol intake, which is mainly metabolized to acetaldehyde by alcohol dehydrogenase and further oxidized to acetate by aldehyde dehydrogenase; consequently, the role of genes in the alcohol metabolism pathways is of particular interest. The aim of this study is to analyze the association between SNPs in ADH1B and ALDH2 genes and CRC risk, and also the main effect of alcohol consumption on CRC risk in the study population. Methodology/Principal Findings SNPs from ADH1B and ALDH2 genes, included in alcohol metabolism pathway, were genotyped in 1694 CRC cases and 1851 matched controls from the Molecular Epidemiology of Colorectal Cancer study. Information on clinicopathological characteristics, lifestyle and dietary habits were also obtained. Logistic regression and association analysis were conducted. A positive association between alcohol consumption and CRC risk was observed in male participants from the Molecular Epidemiology of Colorectal Cancer study (MECC) study (OR = 1.47; 95%CI = 1.18-1.81). Moreover, the SNPs rs1229984 in ADH1B gene was found to be associated with CRC risk: under the recessive model, the OR was 1.75 for A/A genotype (95%CI = 1.21-2.52; p-value = 0.0025). A path analysis based on structural equation modeling showed a direct effect of ADH1B gene polymorphisms on colorectal carcinogenesis and also an indirect effect mediated through alcohol consumption. Conclusions/Significance Genetic polymorphisms in the alcohol metabolism pathways have a potential role in colorectal carcinogenesis, probably due to the differences in the ethanol metabolism and acetaldehyde oxidation of these enzyme variants. PMID:24282520

  7. High diversity and no significant selection signal of human ADH1B gene in Tibet

    PubMed Central

    2012-01-01

    Background ADH1B is one of the most studied human genes with many polymorphic sites. One of the single nucleotide polymorphism (SNP), rs1229984, coding for the Arg48His substitution, have been associated with many serious diseases including alcoholism and cancers of the digestive system. The derived allele, ADH1B*48His, reaches high frequency only in East Asia and Southwest Asia, and is highly associated with agriculture. Micro-evolutionary study has defined seven haplogroups for ADH1B based on seven SNPs encompassing the gene. Three of those haplogroups, H5, H6, and H7, contain the ADH1B*48His allele. H5 occurs in Southwest Asia and the other two are found in East Asia. H7 is derived from H6 by the derived allele of rs3811801. The H7 haplotype has been shown to have undergone significant positive selection in Han Chinese, Hmong, Koreans, Japanese, Khazak, Mongols, and so on. Methods In the present study, we tested whether Tibetans also showed evidence for selection by typing 23 SNPs in the region covering the ADH1B gene in 1,175 individuals from 12 Tibetan populations representing all districts of the Tibet Autonomous Region. Multiple statistics were estimated to examine the gene diversities and positive selection signals among the Tibetans and other populations in East Asia. Results The larger Tibetan populations (Qamdo, Lhasa, Nagqu, Nyingchi, Shannan, and Shigatse) comprised mostly farmers, have around 12% of H7, and 2% of H6. The smaller populations, living on hunting or recently switched to farming, have lower H7 frequencies (Tingri 9%, Gongbo 8%, Monba and Sherpa 6%). Luoba (2%) and Deng (0%) have even lower frequencies. Long-range haplotype analyses revealed very weak signals of positive selection for H7 among Tibetans. Interestingly, the haplotype diversity of H7 is higher in Tibetans than in any other populations studied, indicating a longer diversification history for that haplogroup in Tibetans. Network analysis on the long-range haplotypes revealed

  8. Regulation of human alcohol dehydrogenase gene ADH7: importance of an AP-1 site.

    PubMed

    Kotagiri, S; Edenberg, H J

    1998-07-01

    The structure and function of the human alcohol dehydrogenase 7 (ADH7) promoter were analyzed. A promoter fragment extending to bp -232 functioned well in H4IIE-C3, CV-1, and HeLa cells, whereas the region extending further upstream to bp -799 had no significant effect on activity. We identified cis-acting elements in the proximal 232 bp and examined their effect on promoter activity. Mutation of site A, where c-Jun bound, caused a drastic decrease in the promoter activity in H4IIE-C3 and CV-1 cells, suggesting that AP-1 plays an important role in the regulation of ADH7. Mutation of site B also caused a large drop in promoter activity in both cell lines; C/EBPalpha can bind to this site, but because the site affects activity approximately equally in CV-1 cells that lack C/EBPalpha and in H4IIE-C3 cells that contain low levels, other proteins are likely to play the major roles in vivo. Mutation of site C, where C/EBP bound and c-Jun bound weakly, had different effects in the two cell lines: in H4IIE-C3 cells, the site C mutation did not significantly increase promoter activity, whereas in CV-1 cells, which lack C/EBPalpha, it led to a doubling of activity. Surprisingly, cotransfection of the wild-type promoter with C/EBPa or C/EBPbeta led to a decrease in promoter activity, which might in part explain the lack of activity of ADH7 in adult liver. PMID:9703017

  9. Conserved enhancer and silencer elements responsible for differential Adh transcription in Drosophila cell lines.

    PubMed Central

    Ayer, S; Benyajati, C

    1990-01-01

    The distal promoter of Adh is differentially expressed in Drosophila tissue culture cell lines. After transfection with an exogenous Adh gene, there was a specific increase in distal alcohol dehydrogenase (ADH) transcripts in ADH-expressing (ADH+) cells above the levels observed in transfected ADH-nonexpressing (ADH-) cells. We used deletion mutations and a comparative transient-expression assay to identify the cis-acting elements responsible for enhanced Adh distal transcription in ADH+ cells. DNA sequences controlling high levels of distal transcription were localized to a 15-base-pair (bp) region nearly 500 bp upstream of the distal RNA start site. In addition, a 61-bp negative cis-acting element was found upstream from and adjacent to the enhancer. When this silencer element was deleted, distal transcription increased only in the ADH+ cell line. These distant upstream elements must interact with the promoter elements, the Adf-1-binding site and the TATA box, as they only influenced transcription when at least one of these two positive distal promoter elements was present. Internal deletions targeted to the Adf-1-binding site or the TATA box reduced transcription in both cell types but did not affect the transcription initiation site. Distal transcription in transfected ADH- cells appears to be controlled primarily through these promoter elements and does not involve the upstream regulatory elements. Evolutionary conservation in distantly related Drosophila species suggests the importance of these upstream elements in correct developmental and tissue-specific expression of ADH. Images PMID:1694013

  10. Polymorphism of Alcohol Metabolizing Gene ADH3 Predisposes to Development of Alcoholic Pancreatitis in North Indian Population

    PubMed Central

    Singh, Divya; Negi, Tajwar S.; Upadhyay, Ghanshyam; Choudhuri, Gourdas

    2015-01-01

    Background and aim: Genetic factors regulating alcohol metabolism could predispose in developing alcoholic pancreatitis (ACP). Studies revealed that alcohol could be metabolized by both ways, oxidative and non-oxidative. The main oxidative pathway includes alcohol dehydrogenase (ADH), aldehyde dehydrogenase (ALDH), and cytochrome P450 enzyme. We investigated the association of polymorphisms in these enzymes with the alcoholic pancreatitis in the north Indian population. Method: Patients with alcoholic pancreatitis (ACP; n = 72), tropical calcific pancreatitis (TCP; n = 75), alcoholic controls (AC; n = 40), and healthy controls (HC; n = 100) were included in the study. Blood samples were collected from the subjects in EDTA coated vials. DNA was extracted and genotyping for ADH3, ALDH2, and CYP2E1 was done by PCR-RFLP (polymerase chain reaction—restriction fragment length polymorphism). The products were analyzed by gel electrophoresis. Result: The frequency distribution of ADH3*1/*1 genotype was significantly higher in ACP group (59.7%) compared with TCP (38.7%), HC (42%), and AC (37.5%) and was found to be associated with increased risk of alcoholic pancreatitis. There was no statistically significant difference between the frequency distribution of ADH3*1/*1, ADH3*1/*2, and ADH3*2/*2 genotypes between TCP and HC or healthy alcoholics. ALDH2 gene was monomorphic in our population, and the frequencies for CYP2E1 intron 6 Dra I polymorphism were comparable in all the four groups. Conclusion: This study shows that carriers of ADH3*1/*1 individuals consuming alcohol are at higher risk for alcoholic pancreatitis than those with other genotypes such as ADH3*1/*2 and ADH3*2/*2. PMID:26734614

  11. Cloning and Overexpression of the als, pflA, and adhB Genes in Streptococcus thermophilus and Their Effects on Metabolite Formation.

    PubMed

    Akyol, Ismail; Ozcelik, Fatma Gul; Karakas-Sen, Asuman; Ozkose, Emin; Gezginc, Yekta; Ekinci, M Sait

    2015-10-01

    Streptococcus thermophilus is a lactic acid bacterium and used as starter culture in the dairy industry, mainly in the manufacture of yoghurt, with Lactobacillus delbrueckii subsp. bulgaricus. It produces lactic acid as a major fermentation end product and some carbonyl compounds through sugar metabolism. The level of metabolites could be improved using molecular biotechnology. The genes of als, encoding α-acetolactate synthase (Als), the pflA, encoding pyruvate-formate lyase activating enzyme (PflA), and the adhB which encodes alcohol dehydrogenase (AdhB) of S. thermophilus NCFB2393 strain were amplified by polymerase chain reaction and separately cloned into the overexpression vector pNZ276 under the control of the lacA promoter. The strains were transformed individually with the constructed plasmids. Their abilities to generate important metabolites such as pyruvate, lactate, formate, acetaldehyde, acetoin, ethanol, and 2,3-butanediol in LM17 medium were analyzed using high-performance liquid chromatography. High level of 2,3-butanediol was obtained by overexpressing the als gene. The level of formate increased slightly by overexpressing the pflA gene. The overexpression of the adhB gene, on the other hand, resulted in a significant increase in the ethanol level. PMID:26280324

  12. Comparison of ADH3 promoter with commonly used promoters for recombinant protein production in Pichia pastoris.

    PubMed

    Karaoglan, Mert; Karaoglan, Fidan Erden; Inan, Mehmet

    2016-05-01

    Recombinant protein production under the control of the PADH3 was compared with Pichia pastoris PAOX1 and PGAP. The single-copy-clones expressing Aspergillus niger xylanase (XylB) gene with the three different promoters were tested in shake flask and 5 L fed-batch fermentation processes. Recombinant protein production with PADH3, PAOX1 and PGAP were initiated by addition of ethanol, methanol and glucose, respectively in the culture medium. The fermentation process was carried out for 72 h at 30 °C, pH 5 and 30% dissolved oxygen. Extracellular protein production yield for PADH3 (3725 U/mL) was higher than for PAOX1 (2095 U/mL) and PGAP (580 U/mL) at fermentor scale under the conditions tested. These results show that the PADH3 promoter is a promising tool for large scale production of recombinant proteins and can be an alternative to the PAOX1 and PGAP. PMID:26835836

  13. The Alcohol Dehydrogenase Gene Family in Melon (Cucumis melo L.): Bioinformatic Analysis and Expression Patterns

    PubMed Central

    Jin, Yazhong; Zhang, Chong; Liu, Wei; Tang, Yufan; Qi, Hongyan; Chen, Hao; Cao, Songxiao

    2016-01-01

    Alcohol dehydrogenases (ADH), encoded by multigene family in plants, play a critical role in plant growth, development, adaptation, fruit ripening and aroma production. Thirteen ADH genes were identified in melon genome, including 12 ADHs and one formaldehyde dehydrogenease (FDH), designated CmADH1-12 and CmFDH1, in which CmADH1 and CmADH2 have been isolated in Cantaloupe. ADH genes shared a lower identity with each other at the protein level and had different intron-exon structure at nucleotide level. No typical signal peptides were found in all CmADHs, and CmADH proteins might locate in the cytoplasm. The phylogenetic tree revealed that 13 ADH genes were divided into three groups respectively, namely long-, medium-, and short-chain ADH subfamily, and CmADH1,3-11, which belongs to the medium-chain ADH subfamily, fell into six medium-chain ADH subgroups. CmADH12 may belong to the long-chain ADH subfamily, while CmFDH1 may be a Class III ADH and serve as an ancestral ADH in melon. Expression profiling revealed that CmADH1, CmADH2, CmADH10 and CmFDH1 were moderately or strongly expressed in different vegetative tissues and fruit at medium and late developmental stages, while CmADH8 and CmADH12 were highly expressed in fruit after 20 days. CmADH3 showed preferential expression in young tissues. CmADH4 only had slight expression in root. Promoter analysis revealed several motifs of CmADH genes involved in the gene expression modulated by various hormones, and the response pattern of CmADH genes to ABA, IAA and ethylene were different. These CmADHs were divided into ethylene-sensitive and –insensitive groups, and the functions of CmADHs were discussed. PMID:27242871

  14. Ethanol-Induced Alcohol Dehydrogenase E (AdhE) Potentiates Pneumolysin in Streptococcus pneumoniae

    PubMed Central

    Luong, Truc Thanh; Kim, Eun-Hye; Bak, Jong Phil; Nguyen, Cuong Thach; Choi, Sangdun; Briles, David E.; Pyo, Suhkneung

    2014-01-01

    Alcohol impairs the host immune system, rendering the host more vulnerable to infection. Therefore, alcoholics are at increased risk of acquiring serious bacterial infections caused by Streptococcus pneumoniae, including pneumonia. Nevertheless, how alcohol affects pneumococcal virulence remains unclear. Here, we showed that the S. pneumoniae type 2 D39 strain is ethanol tolerant and that alcohol upregulates alcohol dehydrogenase E (AdhE) and potentiates pneumolysin (Ply). Hemolytic activity, colonization, and virulence of S. pneumoniae, as well as host cell myeloperoxidase activity, proinflammatory cytokine secretion, and inflammation, were significantly attenuated in adhE mutant bacteria (ΔadhE strain) compared to D39 wild-type bacteria. Therefore, AdhE might act as a pneumococcal virulence factor. Moreover, in the presence of ethanol, S. pneumoniae AdhE produced acetaldehyde and NADH, which subsequently led Rex (redox-sensing transcriptional repressor) to dissociate from the adhE promoter. An increase in AdhE level under the ethanol condition conferred an increase in Ply and H2O2 levels. Consistently, S. pneumoniae D39 caused higher cytotoxicity to RAW 264.7 cells than the ΔadhE strain under the ethanol stress condition, and ethanol-fed mice (alcoholic mice) were more susceptible to infection with the D39 wild-type bacteria than with the ΔadhE strain. Taken together, these data indicate that AdhE increases Ply under the ethanol stress condition, thus potentiating pneumococcal virulence. PMID:25312953

  15. Exceptionally High Levels of Restriction Site Polymorphism in DNA near the Maize Adh1 Gene

    PubMed Central

    Johns, Mitrick A.; Strommer, Judith N.; Freeling, Michael

    1983-01-01

    Restriction maps have been prepared for the chromosomal region near seven biochemically and genetically distinct maize alcohol dehydrogenase-1 (Adh1) alleles using a small cDNA probe for Adh1. Five restriction sites spanning about 4 kb in and near the Adh1 transcription unit appear identical in all seven alleles. Outside this conserved region, variation in restriction site position is the rule. Six of the seven alleles are distinguishable, and the alleles appear to fall into four groups. The DNA flanking the 1S-type alleles seems to share no restriction site homology with the DNA near the 1F-type alleles. Several hypotheses are put forward to explain how such high levels of polymorphism could have arisen in a species that has been domesticated for only about 10,000 years. PMID:17246173

  16. Alcohol dehydrogenase 1C (ADH1C) gene polymorphism and alcoholic liver cirrhosis risk: a meta analysis

    PubMed Central

    He, Lei; Deng, Tao; Luo, He-Sheng

    2015-01-01

    The association between alcohol dehydrogenase 1C (ADH1C) gene polymorphism and alcoholic liver cirrhosis (ALC) has been analyzed in several studies, but results have been conflicting. In this study, a meta-analysis was performed to assess the associations between the ADH1C polymorphism and risk of ALC. Relevant studies were identified using PubMed, Web of Science, CNKI and Wanfang databases up to January 10, 2015. Odds ratios (ORs) and 95% confidence intervals (CIs) were used to assess the strength of the association using the fixed or random effect model. A total of 16 case-control studies, including 1375 cases and 1802 controls, were included. Overall, no significant association between the ADH1C polymorphism and ALC risk was found (dominant model: OR=0.87, 95% CI: 0.62-1.23; recessive model: OR=1.30, 95% CI: 0.84-1.99; *1/*2 vs. *1/*1: OR=0.87, 95% CI: 0.63-1.21; *2/*2 vs. *1/*1: OR=1.10, 95% CI: 0.71-1.70). In the subgroup analysis by ethnicity, we observed a significant association in Asian descent (*1/*2 vs. *1/*1: OR=1.63, 95% CI: 1.07-2.49), while a decreased risk was found among Caucasians (dominant model: OR=0.81, 95% CI: 0.66-0.99; *1/*2 vs. *1/*1: OR=0.76, 95% CI: 0.61-0.95). This meta-analysis demonstrated that the ADH1C polymorphism might increase the risk of ALC in Asians, while it may be a protective factor for ALC among Caucasians. PMID:26379912

  17. Characterization and purification of Adh distal promoter factor 2, Adf-2, a cell-specific and promoter-specific repressor in Drosophila.

    PubMed Central

    Benyajati, C; Ewel, A; McKeon, J; Chovav, M; Juan, E

    1992-01-01

    Chromatin footprinting in Drosophila tissue culture cells has detected the binding of a non-histone protein at +8 of the distal Adh RNA start site, on a 10-bp direct repeat motif abutting a nucleosome positioned over the inactive Adh distal promoter. Alternatively the active promoter is bound by a transcription initiation complex. We have characterized and purified a protein Adf-2 that binds specifically to this direct repeat motif 5'TCTCAGTGCA3', present at +8 and -202 of the distal RNA start site. DNase I footprinting, methylation interference, and UV-crosslinking analyses showed that both direct repeats interact in vitro with a nuclear protein of approximately 120 kilodaltons (kDa). We purified Adf-2 through multiple rounds of sequence-specific DNA affinity chromatography. Southwestern analysis showed that the purified 120 KDa polypeptide binds the Adf-2 motif efficiently as a monomer or homomultimer. In vivo titrations of Adf-2 activity with the Adf-2 motif by transient co-transfection competitions in different Drosophila cell lines suggested that Adf-2 is a cell-specific repressor. Adf-2 has been detected ubiquitously in vitro, but is functional in vivo as a sequence-specific DNA binding protein and repressor only in the cells that have the inactive distal promoter. We discuss the possibility that an activation process is required for Adf-2 protein to bind DNA and function in vivo. Images PMID:1408750

  18. Characterization of the Saccharomyces cerevisiae YMR318C (ADH6) gene product as a broad specificity NADPH-dependent alcohol dehydrogenase: relevance in aldehyde reduction.

    PubMed Central

    Larroy, Carol; Fernández, M Rosario; González, Eva; Parés, Xavier; Biosca, Josep A

    2002-01-01

    YMR318C represents an open reading frame from Saccharomyces cerevisiae with unknown function. It possesses a conserved sequence motif, the zinc-containing alcohol dehydrogenase (ADH) signature, specific to the medium-chain zinc-containing ADHs. In the present study, the YMR318C gene product has been purified to homogeneity from overexpressing yeast cells, and found to be a homodimeric ADH, composed of 40 kDa subunits and with a pI of 5.0-5.4. The enzyme was strictly specific for NADPH and was active with a wide variety of substrates, including aliphatic (linear and branched-chain) and aromatic primary alcohols and aldehydes. Aldehydes were processed with a 50-fold higher catalytic efficiency than that for the corresponding alcohols. The highest k(cat)/K(m) values were found with pentanal>veratraldehyde > hexanal > 3-methylbutanal >cinnamaldehyde. Taking into consideration the substrate specificity and sequence characteristics of the YMR318C gene product, we have proposed this gene to be called ADH6. The disruption of ADH6 was not lethal for the yeast under laboratory conditions. Although S. cerevisiae is considered a non lignin-degrading organism, the catalytic activity of ADHVI can direct veratraldehyde and anisaldehyde, arising from the oxidation of lignocellulose by fungal lignin peroxidases, to the lignin biodegradation pathway. ADHVI is the only S. cerevisiae enzyme able to significantly reduce veratraldehyde in vivo, and its overexpression allowed yeast to grow under toxic concentrations of this aldehyde. The enzyme may also be involved in the synthesis of fusel alcohols. To our knowledge this is the first NADPH-dependent medium-chain ADH to be characterized in S. cerevisiae. PMID:11742541

  19. A Phylogenetic Analysis of the Genus Fragaria (Strawberry) Using Intron-Containing Sequence from the ADH-1 Gene

    PubMed Central

    DiMeglio, Laura M.; Yu, Hongrun; Davis, Thomas M.

    2014-01-01

    The genus Fragaria encompasses species at ploidy levels ranging from diploid to decaploid. The cultivated strawberry, Fragaria×ananassa, and its two immediate progenitors, F. chiloensis and F. virginiana, are octoploids. To elucidate the ancestries of these octoploid species, we performed a phylogenetic analysis using intron-containing sequences of the nuclear ADH-1 gene from 39 germplasm accessions representing nineteen Fragaria species and one outgroup species, Dasiphora fruticosa. All trees from Maximum Parsimony and Maximum Likelihood analyses showed two major clades, Clade A and Clade B. Each of the sampled octoploids contributed alleles to both major clades. All octoploid-derived alleles in Clade A clustered with alleles of diploid F. vesca, with the exception of one octoploid allele that clustered with the alleles of diploid F. mandshurica. All octoploid-derived alleles in clade B clustered with the alleles of only one diploid species, F. iinumae. When gaps encoded as binary characters were included in the Maximum Parsimony analysis, tree resolution was improved with the addition of six nodes, and the bootstrap support was generally higher, rising above the 50% threshold for an additional nine branches. These results, coupled with the congruence of the sequence data and the coded gap data, validate and encourage the employment of sequence sets containing gaps for phylogenetic analysis. Our phylogenetic conclusions, based upon sequence data from the ADH-1 gene located on F. vesca linkage group II, complement and generally agree with those obtained from analyses of protein-encoding genes GBSSI-2 and DHAR located on F. vesca linkage groups V and VII, respectively, but differ from a previous study that utilized rDNA sequences and did not detect the ancestral role of F. iinumae. PMID:25078607

  20. Aldehyde dehydrogenase 2 (ALDH2) and alcohol dehydrogenase 1B (ADH1B) polymorphisms exacerbate bladder cancer risk associated with alcohol drinking: gene-environment interaction.

    PubMed

    Masaoka, Hiroyuki; Ito, Hidemi; Soga, Norihito; Hosono, Satoyo; Oze, Isao; Watanabe, Miki; Tanaka, Hideo; Yokomizo, Akira; Hayashi, Norio; Eto, Masatoshi; Matsuo, Keitaro

    2016-06-01

    Although a range of chemical exposures (cigarette smoking and occupational exposure) are recognized risk factors for the development of bladder cancer (BCa), many epidemiological studies have demonstrated that alcohol drinking is not associated with BCa risk. Aldehyde dehydrogenase 2 (ALDH2; rs671, Glu504Lys) and alcohol dehydrogenase 1B (ADH1B; rs1229984, His47Arg) polymorphisms impact the accumulation of acetaldehyde, resulting in an increased risk of various cancers. To date, however, no studies evaluating the association between BCa risk and alcohol drinking have considered these polymorphisms. Here, we conducted a matched case-control study to investigate whether ALDH2 and ADH1B polymorphisms influence BCa risk associated with alcohol drinking. Cases were 74 BCa patients and controls were 740 first-visit outpatients without cancer at Aichi Cancer Center Hospital between January 2001 and December 2005. Odds ratio (OR), 95% confidence interval (CI) and gene-environment interaction were assessed by conditional logistic regression analysis with adjustment for potential confounders. Results showed that ALDH2 Glu/Lys was associated with a significantly increased risk of BCa compared with Glu/Glu (OR 2.03, 95% CI 1.14-3.62, P = 0.017). In contrast, ALDH2 Glu/Lys showed no increase in risk among the stratum of never drinkers compared with Glu/Glu, indicating a gene-environment interaction. ADH1B His/Arg had an OR of 1.98 (1.20-3.24, P = 0.007) compared with His/His. ADH1B Arg+ showed a similar OR and 95% CI. Individuals with ALDH2 Glu/Lys and ADH1B Arg+ had the highest risk of BCa compared with ALDH2 Glu/Glu and ADH1B His/His [OR 4.00 (1.81-8.87), P = 0.001]. PMID:26992901

  1. Genetic Association and Gene-Gene Interaction Reveal Genetic Variations in ADH1B, GSTM1 and MnSOD Independently Confer Risk to Alcoholic Liver Diseases in India

    PubMed Central

    Mukhopadhyay, Indranil; Chatterjee, Ankita; Das, Kausik; Bhowmik, Pradip; Das, Soumyajit; Basu, Priyadarshi; Santra, Amal K.; Datta, Simanti; Dhali, Gopal Krishna; Chowdhury, Abhijit; Banerjee, Soma

    2016-01-01

    Genetic susceptibility is an important modifier of clinical outcome and natural history of progression in Alcoholic liver disease (ALD). While the significance of ethnicity in this evolution is very clear, subtle inter-individual genetic variant(s) might be important and thus we investigated those in an Indian population. Fourteen markers were genotyped within two alcohol metabolism genes [Alcohol dehydrogenase (ADH) gene clusters (ADH1B and ADH1C) and Aldehyde dehydrogenase (ALDH2)], one microsomal ethanol oxidizing enzyme cytochrome p450 (CYP2E1) and three oxidative stress response (OSR) genes (MnSOD, GSTT1 and GSTM1) among 490 Bengali individuals (322 ALD and 168 control) from Eastern and North-Eastern India and validation was performed in a new cohort of 150 Bengali patients including 100 ALD and 50 advanced non-alcoholic steatohepatitis (NASH). Out of 14 genetic variants, carriage of 5 genotypes (rs2066701CC in ADH1B, rs1693425TT in ADH1C, rs4880TT in MnSOD and GSTT1/GSTM1 null, p-value <0.05) were noted significantly higher among ALD patients while inter or intra group gene-gene interaction analysis revealed that addition of risk genotype of any OSR gene enhanced the possibility of ALD synergistically. Multiple logistic regression analysis showed independent association of rs2066701CC, rs4880TT and GSTM1 null genotype with ALD while lower frequencies of those genotypes in advanced NASH patients further confirmed their causal relation to ALD. Thus these findings suggest that the three variants of ADH1C, MnSOD and GSTM1 can be used to identify individuals who are at high risk to develop ALD and may be helpful in proper management of Indian alcoholics. PMID:26937962

  2. Ethanol production by Escherichia coli strains co-expressing Zymomonas PDC and ADH genes

    DOEpatents

    Ingram, Lonnie O.; Conway, Tyrrell; Alterthum, Flavio

    1991-01-01

    A novel operon and plasmids comprising genes which code for the alcohol dehydrogenase and pyruvate decarboxylase activities of Zymomonas mobilis are described. Also disclosed are methods for increasing the growth of microorganisms or eukaryotic cells and methods for reducing the accumulation of undesirable metabolic products in the growth medium of microorganisms or cells.

  3. Ectopic ADH secretion

    MedlinePlus

    ... ADH. Often, there are no symptoms from a low sodium level. When symptoms do occur, they may include ... Lab tests that can confirm and help diagnose low sodium include: Comprehensive metabolic panel (includes blood sodium) Osmolality ...

  4. ADH (Antidiuretic Hormone) Test

    MedlinePlus

    ... Also known as: Vasopressin; AVP Formal name: Antidiuretic Hormone; Arginine Vasopressin Related tests: Osmolality , BUN , Creatinine , Sodium , ... should know? How is it used? The antidiuretic hormone (ADH) test is used to help detect, diagnose, ...

  5. Cofactor Specificity of the Bifunctional Alcohol and Aldehyde Dehydrogenase (AdhE) in Wild-Type and Mutant Clostridium thermocellum and Thermoanaerobacterium saccharolyticum

    PubMed Central

    Zheng, Tianyong; Olson, Daniel G.; Tian, Liang; Bomble, Yannick J.; Himmel, Michael E.; Lo, Jonathan; Hon, Shuen; Shaw, A. Joe; van Dijken, Johannes P.

    2015-01-01

    ABSTRACT Clostridium thermocellum and Thermoanaerobacterium saccharolyticum are thermophilic bacteria that have been engineered to produce ethanol from the cellulose and hemicellulose fractions of biomass, respectively. Although engineered strains of T. saccharolyticum produce ethanol with a yield of 90% of the theoretical maximum, engineered strains of C. thermocellum produce ethanol at lower yields (∼50% of the theoretical maximum). In the course of engineering these strains, a number of mutations have been discovered in their adhE genes, which encode both alcohol dehydrogenase (ADH) and aldehyde dehydrogenase (ALDH) enzymes. To understand the effects of these mutations, the adhE genes from six strains of C. thermocellum and T. saccharolyticum were cloned and expressed in Escherichia coli, the enzymes produced were purified by affinity chromatography, and enzyme activity was measured. In wild-type strains of both organisms, NADH was the preferred cofactor for both ALDH and ADH activities. In high-ethanol-producing (ethanologen) strains of T. saccharolyticum, both ALDH and ADH activities showed increased NADPH-linked activity. Interestingly, the AdhE protein of the ethanologenic strain of C. thermocellum has acquired high NADPH-linked ADH activity while maintaining NADH-linked ALDH and ADH activities at wild-type levels. When single amino acid mutations in AdhE that caused increased NADPH-linked ADH activity were introduced into C. thermocellum and T. saccharolyticum, ethanol production increased in both organisms. Structural analysis of the wild-type and mutant AdhE proteins was performed to provide explanations for the cofactor specificity change on a molecular level. IMPORTANCE This work describes the characterization of the AdhE enzyme from different strains of C. thermocellum and T. saccharolyticum. C. thermocellum and T. saccharolyticum are thermophilic anaerobes that have been engineered to make high yields of ethanol and can solubilize components of

  6. The metabolic enzyme AdhE controls the virulence of Escherichia coli O157:H7

    PubMed Central

    Beckham, Katherine S H; Connolly, James P R; Ritchie, Jennifer M; Wang, Dai; Gawthorne, Jayde A; Tahoun, Amin; Gally, David L; Burgess, Karl; Burchmore, Richard J; Smith, Brian O; Beatson, Scott A; Byron, Olwyn; Wolfe, Alan J; Douce, Gillian R; Roe, Andrew J

    2014-01-01

    Classical studies have focused on the role that individual regulators play in controlling virulence gene expression. An emerging theme, however, is that bacterial metabolism also plays a key role in this process. Our previous work identified a series of proteins that were implicated in the regulation of virulence. One of these proteins was AdhE, a bi-functional acetaldehyde-CoA dehydrogenase and alcohol dehydrogenase. Deletion of its gene (adhE) resulted in elevated levels of extracellular acetate and a stark pleiotropic phenotype: strong suppression of the Type Three Secretion System (T3SS) and overexpression of non-functional flagella. Correspondingly, the adhE mutant bound poorly to host cells and was unable to swim. Furthermore, the mutant was significantly less virulent than its parent when tested in vivo, which supports the hypothesis that attachment and motility are central to the colonization process. The molecular basis by which AdhE affects virulence gene regulation was found to be multifactorial, involving acetate-stimulated transcription of flagella expression and post-transcriptional regulation of the T3SS through Hfq. Our study reveals fascinating insights into the links between bacterial physiology, the expression of virulence genes, and the underlying molecular mechanism mechanisms by which these processes are regulated. PMID:24846743

  7. Genetic polymorphisms of ADH1B, ADH1C and ALDH2 in Turkish alcoholics: lack of association with alcoholism and alcoholic cirrhosis

    PubMed Central

    Vatansever, Sezgin; Tekin, Fatih; Salman, Esin; Altintoprak, Ender; Coskunol, Hakan; Akarca, Ulus Salih

    2015-01-01

    No data exists regarding the alcohol dehydrogenase (ADH) and aldehyde dehydrogenase (ALDH) gene polymorphisms in Turkish alcoholic cirrhotics. We studied the polymorphisms of ADH1B, ADH1C and ALDH2 genes in alcoholic cirrhotics and compared the results with non-cirrhotic alcoholics and healthy volunteers. Overall, 237 subjects were included for the study: 156 alcoholic patients (78 cirrhotics, 78 non-cirrhotic alcoholics) and 81 healthy volunteers. Three different single-nucleotide-polymorphism genotyping methods were used. ADH1C genotyping was performed using a polymerase chain reaction-restriction fragment length polymorphism method. The identified ADH1C genotypes were named according to the presence or absence of the enzyme restriction sites. ADH1B (Arg47Hys) genotyping was performed using the allele specific primer extension method, and ALDH2 (Glu487Lys) genotyping was performed by a multiplex polymerase chain reaction using two allele-specific primer pairs. For ADH1B, the frequency of allele *1 in the cirrhotics, non-cirrhotic alcoholics and healthy volunteers was 97.4%, 94.9% and 99.4%, respectively. For ADH1C, the frequency of allele *1 in the cirrhotics, non-cirrhotic alcoholics and healthy volunteers was 47%, 36.3% and 45%, respectively. There was no statistical difference between the groups for ADH1B and ADH1C (p>0.05). All alcoholic and non-alcoholic subjects (100%) had the allele *1 for ALDH2. The obtained results for ADH1B, ADH1C, and ALDH gene polymorphisms in the present study are similar to the results of Caucasian studies. ADH1B and ADH1C genetic variations are not related to the development of alcoholism or susceptibility to alcoholic cirrhosis. ALDH2 gene has no genetic variation in the Turkish population. PMID:26042511

  8. ADH IB Expression, but Not ADH III, Is Decreased in Human Lung Cancer

    PubMed Central

    Mutka, Sarah C.; Green, Lucia H.; Verderber, Evie L.; Richards, Jane P.; Looker, Doug L.; Chlipala, Elizabeth A.; Rosenthal, Gary J.

    2012-01-01

    Endogenous S-nitrosothiols, including S-nitrosoglutathione (GSNO), mediate nitric oxide (NO)-based signaling, inflammatory responses, and smooth muscle function. Reduced GSNO levels have been implicated in several respiratory diseases, and inhibition of GSNO reductase, (GSNOR) the primary enzyme that metabolizes GSNO, represents a novel approach to treating inflammatory lung diseases. Recently, an association between decreased GSNOR expression and human lung cancer risk was proposed in part based on immunohistochemical staining using a polyclonal GSNOR antibody. GSNOR is an isozyme of the alcohol dehydrogenase (ADH) family, and we demonstrate that the antibody used in those studies cross reacts substantially with other ADH proteins and may not be an appropriate reagent. We evaluated human lung cancer tissue arrays using monoclonal antibodies highly specific for human GSNOR with minimal cross reactivity to other ADH proteins. We verified the presence of GSNOR in ≥85% of specimens examined, and extensive analysis of these samples demonstrated no difference in GSNOR protein expression between cancerous and normal lung tissues. Additionally, GSNOR and other ADH mRNA levels were evaluated quantitatively in lung cancer cDNA arrays by qPCR. Consistent with our immunohistochemical findings, GSNOR mRNA levels were not changed in lung cancer tissues, however the expression levels of other ADH genes were decreased. ADH IB mRNA levels were reduced (>10-fold) in 65% of the lung cancer cDNA specimens. We conclude that the previously reported results showed an incorrect association of GSNOR and human lung cancer risk, and a decrease in ADH IB, rather than GSNOR, correlates with human lung cancer. PMID:23285246

  9. ADH IB expression, but not ADH III, is decreased in human lung cancer.

    PubMed

    Mutka, Sarah C; Green, Lucia H; Verderber, Evie L; Richards, Jane P; Looker, Doug L; Chlipala, Elizabeth A; Rosenthal, Gary J

    2012-01-01

    Endogenous S-nitrosothiols, including S-nitrosoglutathione (GSNO), mediate nitric oxide (NO)-based signaling, inflammatory responses, and smooth muscle function. Reduced GSNO levels have been implicated in several respiratory diseases, and inhibition of GSNO reductase, (GSNOR) the primary enzyme that metabolizes GSNO, represents a novel approach to treating inflammatory lung diseases. Recently, an association between decreased GSNOR expression and human lung cancer risk was proposed in part based on immunohistochemical staining using a polyclonal GSNOR antibody. GSNOR is an isozyme of the alcohol dehydrogenase (ADH) family, and we demonstrate that the antibody used in those studies cross reacts substantially with other ADH proteins and may not be an appropriate reagent. We evaluated human lung cancer tissue arrays using monoclonal antibodies highly specific for human GSNOR with minimal cross reactivity to other ADH proteins. We verified the presence of GSNOR in ≥85% of specimens examined, and extensive analysis of these samples demonstrated no difference in GSNOR protein expression between cancerous and normal lung tissues. Additionally, GSNOR and other ADH mRNA levels were evaluated quantitatively in lung cancer cDNA arrays by qPCR. Consistent with our immunohistochemical findings, GSNOR mRNA levels were not changed in lung cancer tissues, however the expression levels of other ADH genes were decreased. ADH IB mRNA levels were reduced (>10-fold) in 65% of the lung cancer cDNA specimens. We conclude that the previously reported results showed an incorrect association of GSNOR and human lung cancer risk, and a decrease in ADH IB, rather than GSNOR, correlates with human lung cancer. PMID:23285246

  10. Transcriptomic Identification of ADH1B as a Novel Candidate Gene for Obesity and Insulin Resistance in Human Adipose Tissue in Mexican Americans from the Veterans Administration Genetic Epidemiology Study (VAGES)

    PubMed Central

    Winnier, Deidre A.; Fourcaudot, Marcel; Norton, Luke; Abdul-Ghani, Muhammad A.; Hu, Shirley L.; Farook, Vidya S.; Coletta, Dawn K.; Kumar, Satish; Puppala, Sobha; Chittoor, Geetha; Dyer, Thomas D.; Arya, Rector; Carless, Melanie; Lehman, Donna M.; Curran, Joanne E.; Cromack, Douglas T.; Tripathy, Devjit; Blangero, John; Duggirala, Ravindranath; Göring, Harald H. H.; DeFronzo, Ralph A.; Jenkinson, Christopher P.

    2015-01-01

    Type 2 diabetes (T2D) is a complex metabolic disease that is more prevalent in ethnic groups such as Mexican Americans, and is strongly associated with the risk factors obesity and insulin resistance. The goal of this study was to perform whole genome gene expression profiling in adipose tissue to detect common patterns of gene regulation associated with obesity and insulin resistance. We used phenotypic and genotypic data from 308 Mexican American participants from the Veterans Administration Genetic Epidemiology Study (VAGES). Basal fasting RNA was extracted from adipose tissue biopsies from a subset of 75 unrelated individuals, and gene expression data generated on the Illumina BeadArray platform. The number of gene probes with significant expression above baseline was approximately 31,000. We performed multiple regression analysis of all probes with 15 metabolic traits. Adipose tissue had 3,012 genes significantly associated with the traits of interest (false discovery rate, FDR ≤ 0.05). The significance of gene expression changes was used to select 52 genes with significant (FDR ≤ 10-4) gene expression changes across multiple traits. Gene sets/Pathways analysis identified one gene, alcohol dehydrogenase 1B (ADH1B) that was significantly enriched (P < 10-60) as a prime candidate for involvement in multiple relevant metabolic pathways. Illumina BeadChip derived ADH1B expression data was consistent with quantitative real time PCR data. We observed significant inverse correlations with waist circumference (2.8 x 10-9), BMI (5.4 x 10-6), and fasting plasma insulin (P < 0.001). These findings are consistent with a central role for ADH1B in obesity and insulin resistance and provide evidence for a novel genetic regulatory mechanism for human metabolic diseases related to these traits. PMID:25830378

  11. Transcriptomic identification of ADH1B as a novel candidate gene for obesity and insulin resistance in human adipose tissue in Mexican Americans from the Veterans Administration Genetic Epidemiology Study (VAGES).

    PubMed

    Winnier, Deidre A; Fourcaudot, Marcel; Norton, Luke; Abdul-Ghani, Muhammad A; Hu, Shirley L; Farook, Vidya S; Coletta, Dawn K; Kumar, Satish; Puppala, Sobha; Chittoor, Geetha; Dyer, Thomas D; Arya, Rector; Carless, Melanie; Lehman, Donna M; Curran, Joanne E; Cromack, Douglas T; Tripathy, Devjit; Blangero, John; Duggirala, Ravindranath; Göring, Harald H H; DeFronzo, Ralph A; Jenkinson, Christopher P

    2015-01-01

    Type 2 diabetes (T2D) is a complex metabolic disease that is more prevalent in ethnic groups such as Mexican Americans, and is strongly associated with the risk factors obesity and insulin resistance. The goal of this study was to perform whole genome gene expression profiling in adipose tissue to detect common patterns of gene regulation associated with obesity and insulin resistance. We used phenotypic and genotypic data from 308 Mexican American participants from the Veterans Administration Genetic Epidemiology Study (VAGES). Basal fasting RNA was extracted from adipose tissue biopsies from a subset of 75 unrelated individuals, and gene expression data generated on the Illumina BeadArray platform. The number of gene probes with significant expression above baseline was approximately 31,000. We performed multiple regression analysis of all probes with 15 metabolic traits. Adipose tissue had 3,012 genes significantly associated with the traits of interest (false discovery rate, FDR ≤ 0.05). The significance of gene expression changes was used to select 52 genes with significant (FDR ≤ 10(-4)) gene expression changes across multiple traits. Gene sets/Pathways analysis identified one gene, alcohol dehydrogenase 1B (ADH1B) that was significantly enriched (P < 10(-60)) as a prime candidate for involvement in multiple relevant metabolic pathways. Illumina BeadChip derived ADH1B expression data was consistent with quantitative real time PCR data. We observed significant inverse correlations with waist circumference (2.8 x 10(-9)), BMI (5.4 x 10(-6)), and fasting plasma insulin (P < 0.001). These findings are consistent with a central role for ADH1B in obesity and insulin resistance and provide evidence for a novel genetic regulatory mechanism for human metabolic diseases related to these traits. PMID:25830378

  12. Bifunctional aldehyde/alcohol dehydrogenase (ADHE) in chlorophyte algal mitochondria.

    PubMed

    Atteia, Ariane; van Lis, Robert; Mendoza-Hernández, Guillermo; Henze, Katrin; Martin, William; Riveros-Rosas, Hector; González-Halphen, Diego

    2003-09-01

    Protein profiles of mitochondria isolated from the heterotrophic chlorophyte Polytomella sp. grown on ethanol at pH 6.0 and pH 3.7 were analyzed by Blue Native and denaturing polyacrylamide gel electrophoresis. Steady-state levels of oxidative phosphorylation complexes were influenced by external pH. Levels of an abundant, soluble, mitochondrial protein of 85 kDa and its corresponding mRNA increased at pH 6.0 relative to pH 3.7. N-terminal and internal sequencing of the 85 kDa mitochondrial protein together with the corresponding cDNA identified it as a bifunctional aldehyde/alcohol dehydrogenase (ADHE) with strong similarity to homologues from eubacteria and amitochondriate protists. A mitochondrial targeting sequence of 27 amino acids precedes the N-terminus of the mature mitochondrial protein. A gene encoding an ADHE homologue was also identified in the genome of Chlamydomonas reinhardtii, a photosynthetic relative of Polytomella. ADHE reveals a complex picture of sequence similarity among homologues. The lack of ADHE from archaebacteria indicates a eubacterial origin for the eukaryotic enzyme. Among eukaryotes, ADHE has hitherto been characteristic of anaerobes since it is essential to cytosolic energy metabolism of amitochondriate protists such as Giardia intestinalis and Entamoeba histolytica. Its abundance and expression pattern suggest an important role for ADHE in mitochondrial metabolism of Polytomella under the conditions studied. The current data are compatible with the view that Polytomella ADHE could be involved either in ethanol production or assimilation, or both, depending upon environmental conditions. Presence of ADHE in an oxygen-respiring algal mitochondrion and co-expression at ambient oxygen levels with respiratory chain components is unexpected with respect to the view that eukaryotes acquired ADHE genes specifically as an adaptation to an anaerobic lifestyle. PMID:14756315

  13. ADH-PGE2 interactions in cortical collecting tubule. II. inhibition of Ca and P reabsorption.

    PubMed

    Holt, W F; Lechene, C

    1981-10-01

    In the absence of ADH, microperfused cortical collecting tubules of rabbits reabsorb calcium and phosphorus. Antidiuretic hormone (ADH) (200 microunits/ml Pitressin or synthetic arginine vasopressin) inhibits the reabsorption and may promote the secretion of calcium and phosphorus. At 5 min after incubation with ADH, there was a transitory increase in the potential difference and the reabsorption of sodium. The fluxes of calcium and phosphorus, however, showed no significant change from the control values. At 30-50 min after treatment with ADH, the reabsorption of calcium and phosphorus was inhibited and in some tubules calcium and phosphorus were secreted. The removal of vasopressin from the bath or the addition of 10(-5) M meclofenamate in vitro prevented ADH from inhibiting the reabsorption of calcium and phosphorus. Treatment of tubules with 10(-5) M prostaglandin E2 (PGE2) subsequent to incubation in a medium containing ADH and meclofenamate inhibited the reabsorption or even promoted the secretin of calcium and phosphorus, as did the prolonged incubation with ADH alone. We conclude that cortical collecting tubules reabsorb calcium and phosphorus in the absence of vasopressin and that ADH inhibits calcium and phosphorus reabsorption. Endogenous synthesis of PGE2 may mediate the inhibitory action of ADH, since meclofenamate (an inhibitor of the synthesis of prostaglandins) opposes and exogenous PGE2 mimics ADH. PMID:6947697

  14. Delineation of Cis-Acting Sequences Required for Expression of Drosophila Mojavensis Adh-1

    PubMed Central

    Bayer, C. A.; Curtiss, S. W.; Weaver, J. A.; Sullivan, D. T.

    1992-01-01

    The control of expression of the Adh-1 gene of Drosophila mojavensis has been analyzed by transforming ADH null Drosophila melanogaster hosts with P element constructs which contain D. mojavensis Adh-1 having deletions of different extent in the 5' and 3' ends. Adh-1 expression in the D. melanogaster hosts is qualitatively similar to expression in D. mojavensis, although expression is quantitatively lower in transformants. Deletions of the 5' end indicate that information required for normal temporal and tissue expression in larvae is contained within 70 bp of the transcription start site. However, deletion constructs to -70 are deficient in ovarian nurse cell expression, whereas the additional upstream sequences present in constructs containing deletions to -257 do support expression in the ovary. Comparison of the nucleotide sequence in the -257 to -70 region of Adh-1 of four species: D. mojavensis and Drosophila arizona, which express Adh-1 in the ovary, and Drosophila mulleri and Drosophila navojoa, which do not, has led to the identification of regions of sequence similarity that correlate with ovary expression. One of these bears a striking similarity to a conserved sequence located upstream of the three heat shock genes that have constitutive ovarian expression and may be an ovarian control element. We have identified an aberrant aspect of Adh-1 expression. In transformants which carry an Adh-1 gene without a functional upstream Adh-2 gene Adh-1 expression continues into the adult stage instead of ceasing at the onset of metamorphosis. In transformants with a functional Adh-2 gene, Adh-1 expression ceases in the third larval instar stage and aberrant expression in the adult stage does not occur. PMID:1317314

  15. Nucleosomal promoter variation generates gene expression noise

    PubMed Central

    Brown, Christopher R.; Boeger, Hinrich

    2014-01-01

    Gene product molecule numbers fluctuate over time and between cells, confounding deterministic expectations. The molecular origins of this noise of gene expression remain unknown. Recent EM analysis of single PHO5 gene molecules of yeast indicated that promoter molecules stochastically assume alternative nucleosome configurations at steady state, including the fully nucleosomal and nucleosome-free configuration. Given that distinct configurations are unequally conducive to transcription, the nucleosomal variation of promoter molecules may constitute a source of gene expression noise. This notion, however, implies an untested conjecture, namely that the nucleosomal variation arises de novo or intrinsically (i.e., that it cannot be explained as the result of the promoter’s deterministic response to variation in its molecular surroundings). Here, we show—by microscopically analyzing the nucleosome configurations of two juxtaposed physically linked PHO5 promoter copies—that the configurational variation, indeed, is intrinsically stochastic and thus, a cause of gene expression noise rather than its effect. PMID:25468975

  16. Activity of Yeast Alcohol Dehydrogenases on Benzyl Alcohols and Benzaldehydes. Characterization of ADH1 from Saccharomyces carlsbergensis and Transition State Analysis

    PubMed Central

    Pal, Suresh; Park, Doo-Hong; Plapp, Bryce V.

    2009-01-01

    The substrate specificities of yeast alcohol dehydrogenases I and II from Saccharomyces cerevisiae (SceADH1 and SceADH2) and Saccharomyces carlsbergensis (ScbADH1) were studied. For this work, the gene for the S. carlsbergensis ADH1 was cloned, sequenced and expressed. The amino acid sequence of ScbADH1 differs at four positions as compared to SceADH1, including substitutions of two glutamine residues with glutamic acid residues, and has the same sequence as the commercial yeast enzyme, which apparently is prepared from S. carlsbergensis. The electrophoretic mobilities of ScbADH1, SceADH2 and commercial ADH are similar. The kinetics and specificities of ScbADH1 and SceADH1 acting on branched, long-chain and benzyl alcohols are very similar, but the catalytic efficiency of SceADH2 is about 10 to 100-fold higher on these substrates. A three dimensional structure of SceADH1 shows that the substrate binding pocket has Met-270, whereas SceADH2 has Leu-270, which allows larger substrates to bind. The reduction of a series of p-substituted benzaldehydes catalyzed by SceADH2 is significantly enhanced by electron-withdrawing groups, whereas the oxidation of p-substituted aromatic alcohols may be only slightly affected by the substituents. The substituent effects on catalysis generally reflect the effects on the equilibrium constant for the reaction, where electron-withdrawing substituents favor alcohol. The results are consistent with a transition state that is electronically similar to the alcohol, supporting previous results obtained with commercial yeast ADH. PMID:19022233

  17. Overexpression of the genes PDC1 and ADH1 activates glycerol conversion to ethanol in the thermotolerant yeast Ogataea (Hansenula) polymorpha.

    PubMed

    Kata, Iwona; Semkiv, Marta V; Ruchala, Justyna; Dmytruk, Kostyantyn V; Sibirny, Andriy A

    2016-08-01

    Conversion of byproduct from biodiesel production glycerol to high-value compounds is of great importance. Ethanol is considered a promising product of glycerol bioconversion. The methylotrophic thermotolerant yeast Ogataea (Hansenula) polymorpha is of great interest for this purpose as the glycerol byproduct contains methanol and heavy metals as contaminants, and this yeast utilizes methanol and is relatively resistant to heavy metals. Besides, O. polymorpha shows robust growth on glycerol and produces ethanol from various carbon sources. The thermotolerance of this yeast is an additional advantage, allowing increased fermentation temperature to 45-48 °C, leading to increased rate of the fermentation process and a fall in the cost of distillation. The wild-type strain of O. polymorpha produces insignificant amounts of ethanol from glycerol (0.8 g/l). Overexpression of PDC1 coding for pyruvate decarboxylase enhanced ethanol production up to 3.1 g/l, whereas simultaneous overexpression of PDC1 and ADH1 (coding for alcohol dehydrogenase) led to further increase in ethanol production from glycerol. Moreover, the increased temperature of fermentation up to 45 °C stimulated the production of ethanol from glycerol used as the only carbon source up to 5.0 g/l, which exceeds the data obtained by methylotrophic yeast strains reported so far. Copyright © 2016 John Wiley & Sons, Ltd. PMID:27256876

  18. Remote sensing of gene expression in Planta: transgenic plants as monitors of exogenous stress perception in extraterrestrial environments

    NASA Technical Reports Server (NTRS)

    Manak, Michael S.; Paul, Anna-Lisa; Sehnke, Paul C.; Ferl, Robert J.

    2002-01-01

    Transgenic arabidopsis plants containing the alcohol dehydrogenase (Adh) gene promoter fused to the green fluorescent protein (GFP) reporter gene were developed as biological sensors for monitoring physiological responses to unique environments. Plants were monitored in vivo during exposure to hypoxia, high salt, cold, and abcissic acid in experiments designed to characterize the utility and responses of the Adh/GFP biosensors. Plants in the presence of environmental stimuli that induced the Adh promoter responded by expressing GFP, which in turn generated a detectable fluorescent signal. The GFP signal degraded when the inducing stimulus was removed. Digital imaging of the Adh/GFP plants exposed to each of the exogenous stresses demonstrated that the stress-induced gene expression could be followed in real time. The experimental results established the feasibility of using a digital monitoring system for collecting gene expression data in real time from Transgenic Arabidopsis Gene Expression System (TAGES) biosensor plants during space exploration experiments.

  19. A genetic analysis of Adh1 regulation

    SciTech Connect

    Freeling, M.

    1992-01-01

    The overall goal of our research proposal is to understand the meaning of the various cis-acting sites responsible for AdH1 expression in the entire maize plant. Progress is reported in the following areas: Studies on the TATA box and analysis of revertants of the Adh1-3F1124 allele; screening for more different mutants that affect Adh1 expression differentially; studies on cis-acting sequences required for root-specific Adh1 expression; refinement of the use of the particle gun; and functional analysis of a non- glycolytic anaerobic protein.

  20. Excess polymorphism at the Adh locus in Drosophila melanogaster.

    PubMed

    Kreitman, M E; Aguadé, M

    1986-09-01

    The evolutionary history of a region of DNA encompassing the Adh locus is studied by comparing patterns of variation in Drosophila melanogaster and its sibling species, D. simulans. An unexpectedly high level of silent polymorphism in the Adh coding region relative to the 5' and 3' flanking regions in D. melanogaster is revealed by a populational survey of restriction polymorphism using a four-cutter filter hybridization technique as well as by direct sequence comparisons. In both of these studies, a region of the Adh gene encompassing the three coding exons exhibits a frequency of polymorphism equal to that of a 4-kb 5' flanking region. In contrast, an interspecific sequence comparison shows a two-fold higher level of divergence in the 5' flanking sequence compared to the structural locus. Analysis of the patterns of variation suggest an excess of polymorphism within the D. melanogaster Adh locus, rather than lack of polymorphism in the 5' flanking region. An approach is outlined for testing neutral theory predictions about patterns of variation within and between species. This approach indicates that the observed patterns of variation are incompatible with an infinite site neutral model. PMID:3021568

  1. Universal light-switchable gene promoter system

    DOEpatents

    Quail, Peter H.; Huq, Enamul; Tepperman, James; Sato, Sae

    2005-02-22

    An artificial promoter system that can be fused upstream of any desired gene enabling reversible induction or repression of the expression of the gene at will in any suitable host cell or organisms by light is described. The design of the system is such that a molecule of the plant photoreceptor phytochrome is targeted to the specific DNA binding site in the promoter by a protein domain that is fused to the phytochrome and that specifically recognizes this binding site. This bound phytochrome, upon activation by light, recruits a second fusion protein consisting of a protein that binds to phytochrome only upon light activation and a transcriptional activation domain that activates expression of the gene downstream of the promoter.

  2. Characterizing yeast promoters used in Kluyveromyces marxianus.

    PubMed

    Yang, Chun; Hu, Shenglin; Zhu, Songli; Wang, Dongmei; Gao, Xiaolian; Hong, Jiong

    2015-10-01

    Fermentation at higher temperatures can potentially reduce the cooling cost in large-scale fermentation and reduce the contamination risk. Thus, the thermotolerant yeast, Kluyveromyces marxianus, which can grow and ferment at elevated temperatures, is a promising biotechnological tool for future applications. However, the promoters used in K. marxianus are not well characterized, especially at elevated temperatures, which is important in efficient metabolic pathway construction. In this study, six constitutive promoters (P(TDH3), P(PGK), and P(ADH1) from both Saccharomyces cerevisiae and K. marxianus) were evaluated in K. marxianus through the heterologous expression of the KlLAC4, GUSA, and SH BLE genes at various temperatures, with various carbon sources and oxygen conditions. The expression was evaluated at the transcription and protein level using real-time PCR and protein activity determination to eliminate the effect of heterologous protein stability. While the transcription of all the promoters decreased at higher temperatures, the order of their promoting strength at various temperatures with glucose as the carbon source was P(KmPGK) > P(KmTDH3) > P(ScPGK) > P(ScTDH3) > P(KmADH1) > P(ScADH1). When glycerol or xylose was supplied as the carbon source at 42 °C, the order of promoter strength was P(KmPGK) > P(ScPGK) > P(KmADH1) > P(ScADH1) > P(ScTDH3) > P(KmTDH3). The promoter activity of P TDH3 decreased significantly, while the promoter activity of both of the P(ADH1) promoters increased. Oxygen conditions had non-significant effect. The results of this study provide important information for fine-tuned pathway construction for the metabolic engineering of K. marxianus. PMID:26164057

  3. Promoter architectures and developmental gene regulation.

    PubMed

    Haberle, Vanja; Lenhard, Boris

    2016-09-01

    Core promoters are minimal regions sufficient to direct accurate initiation of transcription and are crucial for regulation of gene expression. They are highly diverse in terms of associated core promoter motifs, underlying sequence composition and patterns of transcription initiation. Distinctive features of promoters are also seen at the chromatin level, including nucleosome positioning patterns and presence of specific histone modifications. Recent advances in identifying and characterizing promoters using next-generation sequencing-based technologies have provided the basis for their classification into functional groups and have shed light on their modes of regulation, with important implications for transcriptional regulation in development. This review discusses the methodology and the results of genome-wide studies that provided insight into the diversity of RNA polymerase II promoter architectures in vertebrates and other Metazoa, and the association of these architectures with distinct modes of regulation in embryonic development and differentiation. PMID:26783721

  4. Characterization of the temperate bacteriophage phi adh and plasmid transduction in Lactobacillus acidophilus ADH.

    PubMed Central

    Raya, R R; Kleeman, E G; Luchansky, J B; Klaenhammer, T R

    1989-01-01

    Lactobacillus acidophilus ADH is lysogenic and harbors an inducible prophage, phi adh. Bacteriophage were detected in cell lysates induced by treatment with mitomycin C or UV light. Electron microscopy of lysates revealed phage particles with a hexagonal head (62 nm) and a long, noncontractile, flexible tail (398 nm) ending in at last five short fibers. Phage phi adh was classified within Bradley's B1 phage group and the Siphoviridae family. The phi adh genome is a linear double-stranded DNA molecule of 41.7 kilobase pairs with cohesive ends: a physical map of the phi adh genome was constructed. A prophage-cured derivative of strain ADH, designated NCK102, was isolated from cells that survived UV exposure. NCK102 did not exhibit mitomycin C-induced lysis, but broth cultures lysed upon addition of phage. Phage phi adh produced clear plaques on NCK102 in media containing 10 mM CaCl2 at pH values between 5.2 and 5.5. A relysogenized derivative (NCK103) of NCK102 was isolated that exhibited mitomycin C-induced lysis and superinfection immunity to phage phi adh. Hybridization experiments showed that the phi adh genome was present in the ADH and NCK103 chromosomes, but absent in NCK102. These results demonstrated classic lytic and lysogenic cycles of replication for the temperate phage phi adh induced from L. acidophilus ADH. Phage phi adh also mediates transduction of plasmid DNA. Transductants of strain ADH containing pC194, pGK12, pGB354, and pVA797 were detected at frequencies in the range of 3.6 x 10(-8) to 8.3 x 10(-10) per PFU. Rearrangements or deletions were not detected in these plasmids as a consequence of transduction. This is the first description of plasmid transduction in the genus Lactobacillus. Images PMID:2508554

  5. [Modifications of gene expression by tumor promoters].

    PubMed

    Zhang, C; Zhao, Q; Guo, S; Zhao, M; Cheng, S

    1995-02-01

    The modifications of gene expression by tumor promoters were analyzed in vitro and in vivo. The results of slot blot hybridizations showed that tumor promoter TPA induced c-fos and c-myc expressions in mouse fibroblast cell line BALB/3T3 and rat liver, decreased the levels of Rb RNA in BALB/3T3 cell line and of alpha 1-I3 RNA in rat liver. It was also demonstrated that tumor promoter phenobarbital influenced c-fos and c-myc expressions and decreased alpha 1I3 mRNA level in rat liver during a long term experiment. Phenobarbital was found to have no effect on c-fos and c-myc expressions in rat liver during a short experiment. Tumor promoters induced the expressions of c-fos and c-myc which were positively-related to cancer formation and inhibited the expressions of Rb and alpha 1-I3 which were negatively-related to cancer formation. This implied that tumor promotion played an important role in cancer development and tumor promoters exerted their effects selectively according to the attributes of different genes. PMID:7540119

  6. Alternative promoters of gene MAGE4a

    SciTech Connect

    De Plaen, E.; Naerhuyzen, B.; De Smet, C.

    1997-03-01

    Gene MAGE-4 (HGMW-approved symbol MAGE4) is expressed in several types of tumors, but not in normal tissues, except testis and placenta. The 5{prime} end of this gene contains eight homologous exons spread over a 5.8-kb region. These exons are alternatively spliced to a unique second exon and a unique third exon, which encodes a protein of 317 amino acids. The analysis of transcripts found in testis, placenta, and a sarcoma cell line showed that each of the alternative first exons is used in at least one of these tissues. Various regions of the promoter of the fifth alternative exon (1.5) were cloned in a luciferase reporter plasmid, and the constructs were transfected in a sarcoma cell line that expresses MAGE-4. Two Ets motifs located between positions -70 and -29 relative to the transcription start site were found to drive 55% of the promoter activity. A region containing an Sp1 consensus binding site located upstream of the two Ets motifs was found to be responsible for 44% of the transcriptional activity. MAGE-4a promoters 1.4 and 1.6, which also contain the Sp1 and the two Ets binding motifs, supported a level of transcription comparable to that of promoter 1.5, whereas promoter 1.1, which contains only one Ets binding site, was sixfold less active. In line with observations made with gene MAGE-1 (HGMW-approved symbol MAGE1), we found that promoter 1.5 stimulated a high level of transcription in a melanoma cell line that does not express MAGE-4. This suggests that the tumor-specific expression of MAGE genes is not determined by the presence of specific transcription factors. 26 refs., 7 figs., 2 tabs.

  7. Transient Overexpression of adh8a Increases Allyl Alcohol Toxicity in Zebrafish Embryos

    PubMed Central

    Klüver, Nils; Ortmann, Julia; Paschke, Heidrun; Renner, Patrick; Ritter, Axel P.; Scholz, Stefan

    2014-01-01

    Fish embryos are widely used as an alternative model to study toxicity in vertebrates. Due to their complexity, embryos are believed to more resemble an adult organism than in vitro cellular models. However, concerns have been raised with respect to the embryo's metabolic capacity. We recently identified allyl alcohol, an industrial chemical, to be several orders of magnitude less toxic to zebrafish embryo than to adult zebrafish (embryo LC50 = 478 mg/L vs. fish LC50 = 0.28 mg/L). Reports on mammals have indicated that allyl alcohol requires activation by alcohol dehydrogenases (Adh) to form the highly reactive and toxic metabolite acrolein, which shows similar toxicity in zebrafish embryos and adults. To identify if a limited metabolic capacity of embryos indeed can explain the low allyl alcohol sensitivity of zebrafish embryos, we compared the mRNA expression levels of Adh isoenzymes (adh5, adh8a, adh8b and adhfe1) during embryo development to that in adult fish. The greatest difference between embryo and adult fish was found for adh8a and adh8b expression. Therefore, we hypothesized that these genes might be required for allyl alcohol activation. Microinjection of adh8a, but not adh8b mRNA led to a significant increase of allyl alcohol toxicity in embryos similar to levels reported for adults (LC50 = 0.42 mg/L in adh8a mRNA-injected embryos). Furthermore, GC/MS analysis of adh8a-injected embryos indicated a significant decline of internal allyl alcohol concentrations from 0.23-58 ng/embryo to levels below the limit of detection (< 4.6 µg/L). Injection of neither adh8b nor gfp mRNA had an impact on internal allyl alcohol levels supporting that the increased allyl alcohol toxicity was mediated by an increase in its metabolization. These results underline the necessity to critically consider metabolic activation in the zebrafish embryo. As demonstrated here, mRNA injection is one useful approach to study the role of candidate enzymes involved in

  8. Transient overexpression of adh8a increases allyl alcohol toxicity in zebrafish embryos.

    PubMed

    Klüver, Nils; Ortmann, Julia; Paschke, Heidrun; Renner, Patrick; Ritter, Axel P; Scholz, Stefan

    2014-01-01

    Fish embryos are widely used as an alternative model to study toxicity in vertebrates. Due to their complexity, embryos are believed to more resemble an adult organism than in vitro cellular models. However, concerns have been raised with respect to the embryo's metabolic capacity. We recently identified allyl alcohol, an industrial chemical, to be several orders of magnitude less toxic to zebrafish embryo than to adult zebrafish (embryo LC50 = 478 mg/L vs. fish LC50 = 0.28 mg/L). Reports on mammals have indicated that allyl alcohol requires activation by alcohol dehydrogenases (Adh) to form the highly reactive and toxic metabolite acrolein, which shows similar toxicity in zebrafish embryos and adults. To identify if a limited metabolic capacity of embryos indeed can explain the low allyl alcohol sensitivity of zebrafish embryos, we compared the mRNA expression levels of Adh isoenzymes (adh5, adh8a, adh8b and adhfe1) during embryo development to that in adult fish. The greatest difference between embryo and adult fish was found for adh8a and adh8b expression. Therefore, we hypothesized that these genes might be required for allyl alcohol activation. Microinjection of adh8a, but not adh8b mRNA led to a significant increase of allyl alcohol toxicity in embryos similar to levels reported for adults (LC50 = 0.42 mg/L in adh8a mRNA-injected embryos). Furthermore, GC/MS analysis of adh8a-injected embryos indicated a significant decline of internal allyl alcohol concentrations from 0.23-58 ng/embryo to levels below the limit of detection (< 4.6 µg/L). Injection of neither adh8b nor gfp mRNA had an impact on internal allyl alcohol levels supporting that the increased allyl alcohol toxicity was mediated by an increase in its metabolization. These results underline the necessity to critically consider metabolic activation in the zebrafish embryo. As demonstrated here, mRNA injection is one useful approach to study the role of candidate enzymes involved in

  9. ADH and ALDH polymorphisms and alcohol dependence in Mexican and Native Americans

    PubMed Central

    Ehlers, Cindy L.; Liang, Tiebing; Gizer, Ian R.

    2012-01-01

    Background Ethanol is primarily metabolized in the liver by 2 rate-limiting reactions: conversion of ethanol to acetaldehyde by alcohol dehydrogenase (ADH) and subsequent conversion of acetaldehyde to acetate by aldehyde dehydrogenase (ALDH). ADH and ALDH exist in multiple isozymes that differ in their kinetic properties. Notably, polymorphisms within the genes that encode for these isozymes vary in their allele frequencies between ethnic groups, and thus, they have been considered as candidate genes that may differentially influence risk for the development of alcohol dependence across ethnic groups. Objectives and Methods Associations between alcohol dependence and polymorphisms in ADH1B, ADH1C, and ALDH2, were compared in a community sample of Native Americans living on reservations (n=791) and Mexican Americans (n=391) living within the same county. Results Two Mexican Americans and no Native Americans possessed one ALDH2*2 allele. Presence of at least one ADH1B*2 allele was found in 7% of the Native Americans and 13% of the Mexican Americans, but was only associated with protection against alcohol dependence in the Mexican Americans. Presence of at least one ADH1B*3 allele was found in 4% if the Native Americans and 2% of the Mexican Americans, but was associated with protection against alcohol dependence only in the Native Americans. No associations between alcohol dependence and polymorphisms in ADH1C were found. Conclusions and Scientific Significance Polymorphisms in ADH1B are protective against alcoholism in these two populations; however, these findings do not explain the high prevalence of alcoholism in these populations. PMID:22931071

  10. Strong Magnetic Field Induced Changes of Gene Expression in Arabidopsis

    NASA Astrophysics Data System (ADS)

    Paul, A.-L.; Ferl, R. J.; Klingenberg, B.; Brooks, J. S.; Morgan, A. N.; Yowtak, J.; Meisel, M. W.

    2005-07-01

    We review our studies of the biological impact of magnetic field strengths of up to 30 T on transgenic arabidopsis plants engineered with a stress response gene consisting of the alcohol dehydrogenase (Adh) gene promoter driving the β-glucuronidase (GUS) gene reporter. Field strengths in excess of 15 T induce expression of the Adh/GUS transgene in the roots and leaves. Microarray analyses indicate that such field strengths have a far reaching effect on the genome. Wide spread induction of stress-related genes and transcription factors, and a depression of genes associated with cell wall metabolism are prominent examples.

  11. Live-cell Imaging of Pol II Promoter Activity to Monitor Gene expression with RNA IMAGEtag reporters

    SciTech Connect

    Shin, Ilchung; Ray, Judhajeet; Gupta, Vinayak; Ilgu, Muslum; Beasley, Jonathan; Bendickson, Lee; Mehanovic, Samir; Kraus, George A.; Nilsen-Hamilton, Marit

    2014-04-20

    We describe a ribonucleic acid (RNA) reporter system for live-cell imaging of gene expression to detect changes in polymerase II activity on individual promoters in individual cells. The reporters use strings of RNA aptamers that constitute IMAGEtags (Intracellular MultiAptamer GEnetic tags) that can be expressed from a promoter of choice. For imaging, the cells are incubated with their ligands that are separately conjugated with one of the FRET pair, Cy3 and Cy5. The IMAGEtags were expressed in yeast from the GAL1, ADH1 or ACT1 promoters. Transcription from all three promoters was imaged in live cells and transcriptional increases from the GAL1 promoter were observed with time after adding galactose. Expression of the IMAGEtags did not affect cell proliferation or endogenous gene expression. Advantages of this method are that no foreign proteins are produced in the cells that could be toxic or otherwise influence the cellular response as they accumulate, the IMAGEtags are short lived and oxygen is not required to generate their signals. The IMAGEtag RNA reporter system provides a means of tracking changes in transcriptional activity in live cells and in real time.

  12. Haplotype-Based Study of the Association of Alcohol Metabolizing Genes with Alcohol Dependence in Four Independent Populations

    PubMed Central

    Liu, Jixia; Zhou, Zhifeng; Hodgkinson, Colin A.; Yuan, Qiaoping; Shen, Pei-Hong; Mulligan, Connie J.; Wang, Alex; Gray, Rebecca R.; Roy, Alec; Virkkunen, Matti; Goldman, David; Enoch, Mary-Anne

    2010-01-01

    Background Ethanol is metabolized by two rate limiting reactions: alcohol dehydrogenases (ADH) convert ethanol to acetaldehyde, subsequently metabolized to acetate by aldehyde dehydrogenases (ALDH). Approximately 50% of East Asians have genetic variants that significantly impair this pathway and influence alcohol dependence (AD) vulnerability. We investigated whether variation in alcohol metabolism genes might alter the AD risk in four non-East Asian populations by performing systematic haplotype association analyses in order to maximize the chances of capturing functional variation. Methods Haplotype-tagging SNPs were genotyped using the Illumina GoldenGate platform. Genotypes were available for 40 SNPs across the ADH genes cluster and 24 SNPs across the two ALDH genes in four diverse samples that included cases (lifetime AD) and controls (no Axis 1 disorders). The case, control sample sizes were: Finnish Caucasians: 232, 194; African Americans: 267, 422; Plains American Indians: 226, 110; Southwestern American (SW) Indians: 317, 72. Results In all four populations, as well as HapMap populations, five haplotype blocks were identified across the ADH gene cluster: (1) ADH5-ADH4; (2) ADH6-ADH1A-ADH1B; (3) ADH1C; (4) intergenic; (5) ADH7. The ALDH1A1 gene was defined by four blocks and ALDH2 by one block. No haplotype or SNP association results were significant after correction for multiple comparisons; however several results, particularly for ALDH1A1 and ADH4, replicated earlier findings. There was an ALDH1A1 block 1 and 2 (extending from intron 5 to the 3′ UTR) yin yang haplotype (haplotypes that have opposite allelic configuration) association with AD in the Finns driven by SNPs rs3764435 and rs2303317 respectively, and an ALDH1A1 block 3 (including the promoter region) yin yang haplotype association in SW Indians driven by 5 SNPs, all in allelic identity. The ADH4 SNP rs3762894 was associated with AD in Plains Indians. Conclusions The systematic evaluation of

  13. Recommended nomenclature for the vertebrate alcohol dehydrogenase gene family.

    PubMed

    Duester, G; Farrés, J; Felder, M R; Holmes, R S; Höög, J O; Parés, X; Plapp, B V; Yin, S J; Jörnvall, H

    1999-08-01

    The alcohol dehydrogenase (ADH) gene family encodes enzymes that metabolize a wide variety of substrates, including ethanol, retinol, other aliphatic alcohols, hydroxysteroids, and lipid peroxidation products. Studies on 19 vertebrate animals have identified ADH orthologs across several species, and this has now led to questions of how best to name ADH proteins and genes. Seven distinct classes of vertebrate ADH encoded by non-orthologous genes have been defined based upon sequence homology as well as unique catalytic properties or gene expression patterns. Each class of vertebrate ADH shares <70% sequence identity with other classes of ADH in the same species. Classes may be further divided into multiple closely related isoenzymes sharing >80% sequence identity such as the case for class I ADH where humans have three class I ADH genes, horses have two, and mice have only one. Presented here is a nomenclature that uses the widely accepted vertebrate ADH class system as its basis. It follows the guidelines of human and mouse gene nomenclature committees, which recommend coordinating names across species boundaries and eliminating Roman numerals and Greek symbols. We recommend that enzyme subunits be referred to by the symbol "ADH" (alcohol dehydrogenase) followed by an Arabic number denoting the class; i.e. ADH1 for class I ADH. For genes we recommend the italicized root symbol "ADH" for human and "Adh" for mouse, followed by the appropriate Arabic number for the class; i.e. ADH1 or Adh1 for class I ADH genes. For organisms where multiple species-specific isoenzymes exist within a class, we recommend adding a capital letter after the Arabic number; i.e. ADH1A, ADH1B, and ADH1C for human alpha, beta, and gamma class I ADHs, respectively. This nomenclature will accommodate newly discovered members of the vertebrate ADH family, and will facilitate functional and evolutionary studies. PMID:10424757

  14. Neurite outgrowth resistance to rho kinase inhibitors in PC12 Adh cell.

    PubMed

    Yin, Hua; Hou, Xiaolin; Tao, Tingrui; Lv, Xiaoman; Zhang, Luyong; Duan, Weigang

    2015-05-01

    Rho kinase (ROCK) inhibitor is a promising agent for neural injury disorders, which mechanism is associated with neurite outgrowth. However, neurite outgrowth resistance occurred when PC12 Adh cell was treated with ROCK inhibitors for a longer time. PC12 Adh cells were treated with ROCK inhibitor Y27632 or NGF for different durations. Neurite outgrowth resistance occurred when PC12 Adh cell exposed to Y27632 (33 µM) for 3 or more days, but not happen when exposed to nerve growth factor (NGF, 100 ng/mL). The gene expression in the PC12 Adh cells treated with Y27632 (33 µM) or NGF (100 ng/mL) for 2 or 4 days was assayed by gene microarray, and the reliability of the results were confirmed by real-time RT-PCR. Cluster analysis proved that the gene expression profile of PC12 Adh cell treated with Y27632 for 4 days was different from that treated with Y27632 for 2 days and those treated with NGF for 2 and 4 days, respectively. Pathway analysis hinted that the neurite outgrowth resistance could be associated with up-regulation of inflammatory pathways, especially rno04610 (complement and coagulation cascades), and down-regulation of cell cycle pathways, especially rno04110. PMID:25571866

  15. Meta-Analyses of ALDH2 and ADH1B with Alcohol Dependence in Asians

    ERIC Educational Resources Information Center

    Luczak, Susan E.; Glatt, Stephen J.; Wall, Tamara J.

    2006-01-01

    Meta-analyses were conducted to determine the magnitude of relationships between polymorphisms in 2 genes, ALDH2 and ADH1B, with alcohol dependence in Asians. For each gene, possession of 1 variant [asterisk]2 allele was protective against alcohol dependence, and possession of a 2nd [asterisk]2 allele did not offer significant additional…

  16. The Relationship between CmADHs and the Diversity of Volatile Organic Compounds of Three Aroma Types of Melon (Cucumis melo).

    PubMed

    Chen, Hao; Cao, Songxiao; Jin, Yazhong; Tang, Yufan; Qi, Hongyan

    2016-01-01

    Alcohol dehydrogenase (ADH) plays an important role in aroma volatile compounds synthesis of plants. In this paper, we tried to explore the relationship between CmADHs and the volatile organic compounds (VOCs) in oriental melon. Three different aroma types of melon were used as materials. The principle component analysis of three types of melon fruit was conducted. We also measured the CmADHs expression level and enzymatic activities of ADH and alcohol acyl-transferase (AAT) on different stages of fruit ripening. An incubation experiment was carried out to investigate the effect of substrates and inhibitor (4-MP, 4-methylpyrazole) on CmADHs expression, ADH activity, and the main compounds of oriental melon. The results illustrated that ethyl acetate, hexyl acetate (E,Z)-3,6-nonadien-1-ol and 2-ethyl-2hexen-1-ol were the four principal volatile compounds of these three types of melon. AAT activity was increasing with fruit ripening, and the AAT activity in CH were the highest, whereas ADH activity peaked on 32 DAP, 2 days before maturation, and the ADH activity in CB and CG were higher than that in CH. The expression pattern of 11 CmADH genes from 24 to 36 day after pollination (DAP) was found to vary in three melon varieties. CmADH4 was only expressed in CG and the expression levels of CmADH3 and CmADH12 in CH and CB were much higher than that in CG, and they both peaked 2 days before fruit ripening. Ethanol and 4-MP decreased the reductase activity of ADH, the expression of most CmADHs and ethyl acetate or hexyl acetate contents of CB, except for 0.1 mM 4-MP, while aldehyde improved the two acetate ester contents. In addition, we found a positive correlation between the expression of CmADH3 and CmADH12 and the key volatile compound of CB. The relationship between CmADHs and VOCs synthesis of oriental melon was discussed. PMID:27445845

  17. The Relationship between CmADHs and the Diversity of Volatile Organic Compounds of Three Aroma Types of Melon (Cucumis melo)

    PubMed Central

    Chen, Hao; Cao, Songxiao; Jin, Yazhong; Tang, Yufan; Qi, Hongyan

    2016-01-01

    Alcohol dehydrogenase (ADH) plays an important role in aroma volatile compounds synthesis of plants. In this paper, we tried to explore the relationship between CmADHs and the volatile organic compounds (VOCs) in oriental melon. Three different aroma types of melon were used as materials. The principle component analysis of three types of melon fruit was conducted. We also measured the CmADHs expression level and enzymatic activities of ADH and alcohol acyl-transferase (AAT) on different stages of fruit ripening. An incubation experiment was carried out to investigate the effect of substrates and inhibitor (4-MP, 4-methylpyrazole) on CmADHs expression, ADH activity, and the main compounds of oriental melon. The results illustrated that ethyl acetate, hexyl acetate (E,Z)-3,6-nonadien-1-ol and 2-ethyl-2hexen-1-ol were the four principal volatile compounds of these three types of melon. AAT activity was increasing with fruit ripening, and the AAT activity in CH were the highest, whereas ADH activity peaked on 32 DAP, 2 days before maturation, and the ADH activity in CB and CG were higher than that in CH. The expression pattern of 11 CmADH genes from 24 to 36 day after pollination (DAP) was found to vary in three melon varieties. CmADH4 was only expressed in CG and the expression levels of CmADH3 and CmADH12 in CH and CB were much higher than that in CG, and they both peaked 2 days before fruit ripening. Ethanol and 4-MP decreased the reductase activity of ADH, the expression of most CmADHs and ethyl acetate or hexyl acetate contents of CB, except for 0.1 mM 4-MP, while aldehyde improved the two acetate ester contents. In addition, we found a positive correlation between the expression of CmADH3 and CmADH12 and the key volatile compound of CB. The relationship between CmADHs and VOCs synthesis of oriental melon was discussed. PMID:27445845

  18. Association and ancestry analysis of sequence variants in ADH and ALDH using alcohol-related phenotypes in a Native American community sample

    PubMed Central

    Peng, Qian; Gizer, Ian R.; Libiger, Ondrej; Bizon, Chris; Wilhelmsen, Kirk C.; Schork, Nicholas J.; Ehlers, Cindy L.

    2015-01-01

    Higher rates of alcohol use and other drug-dependence have been observed in some Native American populations relative to other ethnic groups in the U.S. Previous studies have shown that alcohol dehydrogenase (ADH) genes and aldehyde dehydrogenase (ALDH) genes may affect the risk of development of alcohol dependence, and that polymorphisms within these genes may differentially affect risk for the disorder depending on the ethnic group evaluated. We evaluated variations in the ADH and ALDH genes in a large study investigating risk factors for substance use in a Native American population. We assessed ancestry admixture and tested for associations between alcohol-related phenotypes in the genomic regions around the ADH1-7 and ALDH2 and ALDH1A1 genes. Seventy-two (72) ADH variants showed significant evidence of association with a severity level of alcohol drinking-related dependence symptoms phenotype. These significant variants spanned across the entire 7 ADH gene cluster regions. Two significant associations, one in ADH and one in ALDH2, were observed with alcohol dependence diagnosis. Seventeen (17) variants showed significant association with the largest number of alcohol drinks ingested during any 24-hour period. Variants in or near ADH7 were significantly negatively associated with alcohol-related phenotypes, suggesting a potential protective effect of this gene. In addition, our results suggested that a higher degree of Native American ancestry is associated with higher frequencies of potential risk variants and lower frequencies of potential protective variants for alcohol dependence phenotypes. PMID:25270064

  19. Alcohol Consumption Mediates the Relationship Between ADH1B and DSM-IV Alcohol Use Disorder and Criteria

    PubMed Central

    Kilcoyne, Bari; Shmulewitz, Dvora; Meyers, Jacquelyn L; Aharonovich, Efrat; Greenstein, Eliana; Frisch, Amos; Weizman, Abraham; Spivak, Baruch; Edenberg, Howard J; Gelernter, Joel; Hasin, Deborah S

    2014-01-01

    Objective: A single nucleotide variation in the alcohol dehydrogenase 1B (ADH1B) gene, rs1229984, produces an ADH1B enzyme with faster acetaldehyde production. This protective variant is associated with lower alcohol consumption and lower risk for alcohol use disorders (AUDs). Based on the premise that faster ADH1B kinetics decreases alcohol consumption, we formally tested if the association between ADH1B variant rs1229984 and AUDs occurs through consumption. We also tested whether the association between rs1 229984 and each of the 11 Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM-IV), AUD criteria occurs through consumption. Method: A total of 1,130 lifetime drinkers from an Israeli household sample were assessed with a structured interview and genotyped for rs1229984 (protective allele frequency = 0.28). Logistic regression evaluated the association between rs1229984 and each phenotype (AUDs, 11 individual DSM-IV criteria). For phenotypes significantly related to rs1229984, the effect through consumption was tested with logistic regression and bootstrapping. Results: ADH1B rs1229984 was significantly associated with AUDs and six criteria, with odds ratios ranging from 1.32 to 1.96. The effect through consumption was significant for these relationships, explaining 23%–74% of the total ADH1B effect. Conclusions: This is the first study to show that ADH1B rs1229984 is related to 6 of the 11 DSM-IV AUD criteria and that alcohol consumption explained a significant proportion of these associations and the association of ADH1B with AUDs. Better understanding of the relationship between ADH1B and the DSM-IV AUD criteria, including effects through consumption, will enhance our understanding of the etiologic model through which AUDs can occur. PMID:24988262

  20. Which alcohol use disorder criteria contribute to the association of ADH1B with alcohol dependence?

    PubMed

    Hart, Amy B; Lynch, Kevin G; Farrer, Lindsay; Gelernter, Joel; Kranzler, Henry R

    2016-07-01

    Although alcohol dependence (AD) is approximately 50% heritable, little is known about how specific genetic loci affect AD risk. In a genome-wide association study (GWAS), we identified highly significant associations between two population-specific functional variants in the alcohol dehydrogenase 1B gene (ADH1B) and AD in African-Americans (AAs; rs2066702) and European-Americans (EAs; rs1229984). In the current study, we determined which specific diagnostic criteria contributed to the observed associations of ADH1B SNPs with AD. Our analysis included both the DSM-IV and DSM-5 diagnostic systems. We also investigated the relationship of ADH1B variants to the maximum number of drinks consumed in a 24-hour period (MaxDrinks), a presumed intermediate phenotype of AD. We found that, although all criteria made strong individual contributions to the associations, the largest contributions came from those reflecting neuroadaptation: tolerance (rs2066702) and withdrawal (rs1229984). Overall, evidence for association with DSM-5 criteria was slightly stronger than for DSM-IV criteria. For rs2066702, results were similar for DSM-IV and DSM-5 criteria. However, the most significant DSM-5 criterion associated with rs1229984 was alcohol-related social/interpersonal problems. Both ADH1B variants were associated with MaxDrinks, a measure of innate tolerance, and MaxDrinks mediated the associations between ADH1B and alcohol outcomes. We replicated the findings for rs2066702 and tolerance in an independent sample of AAs. Taken together, these results suggest that variation in ADH1B affects the adaptation to heavy drinking, highlighting population-specific differences in genetic risk for AUD. They also suggest that the revisions reflected in DSM-5 AUD may enhance the utility of that diagnosis for gene finding. PMID:25828809

  1. CvADH1, a member of short-chain alcohol dehydrogenase family, is inducible by gibberellin and sucrose in developing watermelon seeds.

    PubMed

    Kim, Joonyul; Kang, Hong-Gyu; Jun, Sung-Hoon; Lee, Jinwon; Yim, Jieun; An, Gynheung

    2003-01-01

    To understand the molecular mechanisms that control seed formation, we selected a seed-preferential gene (CvADH1) from the ESTs of developing watermelon seeds. RNA blot analysis and in situ localization showed that CvADH1 was preferentially expressed in the nucellar tissue. The CvADH1 protein shared about 50% homology with short-chain alcohol dehydrogenase including ABA2 in Arabidopsis thaliana, stem secoisolariciresinol dehydrogenase in Forsythia intermedia, and 3beta-hydroxysterol dehydrogenase in Digitalis lanata. We investigated gene-expression levels in seeds from both normally pollinated fruits and those made parthenocarpic via N-(2-chloro-4-pyridyl)-N'-phenylurea treatment, the latter of which lack zygotic tissues. Whereas the transcripts of CvADH1 rapidly started to accumulate from about the pre-heart stage in normal seeds, they were not detectable in the parthenocarpic seeds. Treating the parthenogenic fruit with GA(3) strongly induced gene expression, up to the level accumulated in pollinated seeds. These results suggest that the CvADH1 gene is induced in maternal tissues by signals made in the zygotic tissues, and that gibberellin might be one of those signals. We also observed that CvADH1 expression was induced by sucrose in the parthenocarpic seeds. Therefore, we propose that the CvADH1 gene is inducible by gibberellin, and that sucrose plays an important role in the maternal tissues of watermelon during early seed development. PMID:12552151

  2. The role of aldehyde/alcohol dehydrogenase (AdhE) in ethanol production from glycerol by Klebsiella pneumoniae.

    PubMed

    Oh, Baek-Rock; Hong, Won-Kyung; Heo, Sun-Yeon; Joe, Min-ho; Seo, Jeong-Woo; Kim, Chul Ho

    2013-02-01

    Transcriptome analysis of a K. pneumoniae GEM167 mutant strain derived by irradiation with gamma rays, which exhibited high-level production of ethanol from glycerol, showed that the mutant expressed AdhE at a high level. Ethanol production decreased significantly, from 8.8 to 0.5 g l(-1), when an adhE-deficient derivative of that strain was grown on glycerol. Bacterial growth was also reduced under such conditions, showing that AdhE plays a critical role in maintenance of redox balance by catalyzing ethanol production. Overexpression of AdhE enhanced ethanol production, from pure or crude glycerol, to a maximal level of 31.9 g l(-1) under fed-batch fermentation conditions; this is the highest level of ethanol production from glycerol reported to date. PMID:23296976

  3. Insect and wound induced GUS gene expression from a Beta vulgaris proteinase inhibitor gene promoter

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Inducible gene promoters that are specifically activated by pathogen invasion or insect pest attack are needed for effective expression of resistance genes to control plant diseases. In the present study, a promoter from a serine proteinase inhibitor gene (BvSTI) shown to be up-regulated in resist...

  4. Chromosomal Integration and Expression of Two Bacterial α-Acetolactate Decarboxylase Genes in Brewer's Yeast

    PubMed Central

    Blomqvist, K.; Suihko, M.-L.; Knowles, J.; Penttilä, M.

    1991-01-01

    A bacterial gene encoding α-acetolactate decarboxylase, isolated from Klebsiella terrigena or Enterobacter aerogenes, was expressed in brewer's yeast. The genes were expressed under either the yeast phosphoglycerokinase (PGK1) or the alcohol dehydrogenase (ADH1) promoter and were integrated by gene replacement by using cotransformation into the PGK1 or ADH1 locus, respectively, of a brewer's yeast. The expression level of the α-acetolactate decarboxylase gene of the PGK1 integrant strains was higher than that of the ADH1 integrants. Under pilot-scale brewing conditions, the α-acetolactate decarboxylase activity of the PGK1 integrant strains was sufficient to reduce the formation of diacetyl below the taste threshold value, and no lagering was needed. The brewing properties of the recombinant yeast strains were otherwise unaltered, and the quality (most importantly, the flavor) of the trial beers produced was as good as that of the control beer. Images PMID:16348559

  5. Epigenetic regulation of transposable element derived human gene promoters.

    PubMed

    Huda, Ahsan; Bowen, Nathan J; Conley, Andrew B; Jordan, I King

    2011-04-01

    It was previously thought that epigenetic histone modifications of mammalian transposable elements (TEs) serve primarily to defend the genome against deleterious effects associated with their activity. However, we recently showed that, genome-wide, human TEs can also be epigenetically modified in a manner consistent with their ability to regulate host genes. Here, we explore the ability of TE sequences to epigenetically regulate individual human genes by focusing on the histone modifications of promoter sequences derived from TEs. We found 1520 human genes that initiate transcription from within TE-derived promoter sequences. We evaluated the distributions of eight histone modifications across these TE-promoters, within and between the GM12878 and K562 cell lines, and related their modification status with the cell-type specific expression patterns of the genes that they regulate. TE-derived promoters are significantly enriched for active histone modifications, and depleted for repressive modifications, relative to the genomic background. Active histone modifications of TE-promoters peak at transcription start sites and are positively correlated with increasing expression within cell lines. Furthermore, differential modification of TE-derived promoters between cell lines is significantly correlated with differential gene expression. LTR-retrotransposon derived promoters in particular play a prominent role in mediating cell-type specific gene regulation, and a number of these LTR-promoter genes are implicated in lineage-specific cellular functions. The regulation of human genes mediated by histone modifications targeted to TE-derived promoters is consistent with the ability of TEs to contribute to the epigenomic landscape in a way that provides functional utility to the host genome. PMID:21215797

  6. Architecture of a yeast U6 RNA gene promoter.

    PubMed Central

    Eschenlauer, J B; Kaiser, M W; Gerlach, V L; Brow, D A

    1993-01-01

    The promoters of vertebrate and yeast U6 small nuclear RNA genes are structurally dissimilar, although both are recognized by RNA polymerase III. Vertebrate U6 RNA genes have exclusively upstream promoters, while the U6 RNA gene from the yeast Saccharomyces cerevisiae (SNR6) has internal and downstream promoter elements that match the tRNA gene intragenic A- and B-block elements, respectively. Substitution of the SNR6 A or B block greatly diminished U6 RNA accumulation in vivo, and a subcellular extract competent for RNA polymerase III transcription generated nearly identical DNase I protection patterns over the SNR6 downstream B block and a tRNA gene intragenic B block. We conclude that the SNR6 promoter is functionally similar to tRNA gene promoters, although the effects of extragenic deletion mutations suggest that the downstream location of the SNR6 B block imposes unique positional constraints on its function. Both vertebrate and yeast U6 RNA genes have an upstream TATA box element not normally found in tRNA genes. Substitution of the SNR6 TATA box altered the site of transcription initiation in vivo, while substitution of sequences further upstream had no effect on SNR6 transcription. We present a model for the SNR6 transcription complex that explains these results in terms of their effects on the binding of transcription initiation factor TFIIIB. Images PMID:8474459

  7. Characterization of the human p53 gene promoter

    SciTech Connect

    Tuck, S.P.; Crawford, L.

    1989-05-01

    Transcriptional deregulation of the p53 gene may play an important part in the genesis of some tumors. The authors report here an accurate determination of the transcriptional start sites of the human p53 gene and show that the majority of p53 mRNA molecules do not contain a postulated stem-loop structure at their 5' ends. Recombinant plasmids of the human p53 promoter-leader region fused to the bacterial chloramphenicol acetyltransferase gene (cat) were constructed. After transfection into rodent or human cells, a 350-base-pair fragment spanning the promoter region conferred 4% of the CAT activity mediated by the simian virus 40 early promoter/enhancer. They monitored the efficiency with which 15 3' and 5' promoter deletion constructs initiated transcription. Their results show that an 85-base-pair fragment, previously thought to have resided in exon 1, is that is required for full promoter activity.

  8. Archaeal promoter architecture and mechanism of gene activation.

    PubMed

    Peng, Nan; Ao, Xiang; Liang, Yun Xiang; She, Qunxin

    2011-01-01

    Sulfolobus solfataricus and Sulfolobus islandicus contain several genes exhibiting D-arabinose-inducible expression and these systems are ideal for studying mechanisms of archaeal gene expression. At sequence level, only two highly conserved cis elements are present on the promoters: a regulatory element named ara box directing arabinose-inducible expression and the basal promoter element TATA, serving as the binding site for the TATA-binding protein. Strikingly, these promoters possess a modular structure that allows an essentially inactive basal promoter to be strongly activated. The invoked mechanisms include TFB (transcription factor B) recruitment by the ara-box-binding factor to activate gene expression and modulation of TFB recruitment efficiency to yield differential gene expression. PMID:21265754

  9. Locus Adh of Drosophila melanogaster under selection for delayed senescence

    SciTech Connect

    Khaustova, N.D.

    1995-05-01

    Dynamics of the Adh activity and frequencies of alleles Adh{sup F} and Adh{sup S} were analyzed under selection for delayed senescence. The experiments were performed on Drosophila melanogaster. Lines Adh{sup S}cn and Adh{sup F}vg and experimental populations cn` and vg`, selected for an increased duration of reproductive period (late oviposition) were used. Analysis of fertility, longevity, viability and resistance to starvation showed that selection for late oviposition resulted in delayed senescence of flies of the experimental populations. Genetic structure of population vg` changed considerably with regard to the Adh locus. This was confirmed by parameters of activity, thermostability, and electrophoretic mobility of the enzyme isolated from flies after 30 generations of selection. Analysis of frequencies of the Adh alleles showed that in both selected populations, which initially had different genetic composition, accumulated allele Adh{sup S}, which encodes the isozyme that is less active but more resistant to inactivation. Genetic mechanism of delayed senescence in Drosophila is assumed to involve selection at vitally important enzyme loci, including Adh. 18 refs., 2 tabs., 4 figs.

  10. Promoter region of mouse Tcrg genes

    SciTech Connect

    Ishimi, Y.; Huang, Y.Y.; Ohta, S.

    1996-06-01

    The mouse T-cell receptor (Tcr){gamma} chain is characterized by a specific expression of V gene segments in the thymus corresponding to consecutive developmental stages; i.e., the Vg5 in fetal, Vg6 in neonatal, and Vg4 and Vg7 in adult. The order of the Vg gene usage correlates with the localization of the Vg gene segment on the chromosome; i.e., the Vg5 gene, being most proximal to the Jg1, is used first, followed by the Vg segments away from the Jg1 in a sequential manner. Since they all rearrange to the same Jg1 gene segment, the sequences in the coding region and/or in the 5{prime} upstream region are responsible for the stage-specific transcription. Also, Goldman and co-workers reported the germline transcription of Vg genes preceding their rearrangement. Therefore, the stage-specific transcription may be involved in the regulation of the stage-specific rearrangement; we sequenced and analyzed the 5{prime} flanking regions of the Vg5, Vg6, Vg4, and Vg7 genes to study the transcriptional relation. 18 refs., 2 figs., 1 tab.

  11. Core Promoter Functions in the Regulation of Gene Expression of Drosophila Dorsal Target Genes*

    PubMed Central

    Zehavi, Yonathan; Kuznetsov, Olga; Ovadia-Shochat, Avital; Juven-Gershon, Tamar

    2014-01-01

    Developmental processes are highly dependent on transcriptional regulation by RNA polymerase II. The RNA polymerase II core promoter is the ultimate target of a multitude of transcription factors that control transcription initiation. Core promoters consist of core promoter motifs, e.g. the initiator, TATA box, and the downstream core promoter element (DPE), which confer specific properties to the core promoter. Here, we explored the importance of core promoter functions in the dorsal-ventral developmental gene regulatory network. This network includes multiple genes that are activated by different nuclear concentrations of Dorsal, an NFκB homolog transcription factor, along the dorsal-ventral axis. We show that over two-thirds of Dorsal target genes contain DPE sequence motifs, which is significantly higher than the proportion of DPE-containing promoters in Drosophila genes. We demonstrate that multiple Dorsal target genes are evolutionarily conserved and functionally dependent on the DPE. Furthermore, we have analyzed the activation of key Dorsal target genes by Dorsal, as well as by another Rel family transcription factor, Relish, and the dependence of their activation on the DPE motif. Using hybrid enhancer-promoter constructs in Drosophila cells and embryo extracts, we have demonstrated that the core promoter composition is an important determinant of transcriptional activity of Dorsal target genes. Taken together, our results provide evidence for the importance of core promoter composition in the regulation of Dorsal target genes. PMID:24634215

  12. Calcilytic Ameliorates Abnormalities of Mutant Calcium-Sensing Receptor (CaSR) Knock-In Mice Mimicking Autosomal Dominant Hypocalcemia (ADH).

    PubMed

    Dong, Bingzi; Endo, Itsuro; Ohnishi, Yukiyo; Kondo, Takeshi; Hasegawa, Tomoka; Amizuka, Norio; Kiyonari, Hiroshi; Shioi, Go; Abe, Masahiro; Fukumoto, Seiji; Matsumoto, Toshio

    2015-11-01

    Activating mutations of calcium-sensing receptor (CaSR) cause autosomal dominant hypocalcemia (ADH). ADH patients develop hypocalcemia, hyperphosphatemia, and hypercalciuria, similar to the clinical features of hypoparathyroidism. The current treatment of ADH is similar to the other forms of hypoparathyroidism, using active vitamin D3 or parathyroid hormone (PTH). However, these treatments aggravate hypercalciuria and renal calcification. Thus, new therapeutic strategies for ADH are needed. Calcilytics are allosteric antagonists of CaSR, and may be effective for the treatment of ADH caused by activating mutations of CaSR. In order to examine the effect of calcilytic JTT-305/MK-5442 on CaSR harboring activating mutations in the extracellular and transmembrane domains in vitro, we first transfected a mutated CaSR gene into HEK cells. JTT-305/MK-5442 suppressed the hypersensitivity to extracellular Ca(2+) of HEK cells transfected with the CaSR gene with activating mutations in the extracellular and transmembrane domains. We then selected two activating mutations locating in the extracellular (C129S) and transmembrane (A843E) domains, and generated two strains of CaSR knock-in mice to build an ADH mouse model. Both mutant mice mimicked almost all the clinical features of human ADH. JTT-305/MK-5442 treatment in vivo increased urinary cAMP excretion, improved serum and urinary calcium and phosphate levels by stimulating endogenous PTH secretion, and prevented renal calcification. In contrast, PTH(1-34) treatment normalized serum calcium and phosphate but could not reduce hypercalciuria or renal calcification. CaSR knock-in mice exhibited low bone turnover due to the deficiency of PTH, and JTT-305/MK-5442 as well as PTH(1-34) increased bone turnover and bone mineral density (BMD) in these mice. These results demonstrate that calcilytics can reverse almost all the phenotypes of ADH including hypercalciuria and renal calcification, and suggest that calcilytics can become a

  13. Limited specificity of promoter constructs for gene therapy in osteosarcoma.

    PubMed

    Pollmann, Annika; Kabisch, Hartmut; Block, Andreas; Müller, Jürgen; Hellwinkel, Olaf J C

    2004-10-01

    Osteosarcoma (OS), a malignant bone neoplasia in childhood, has poor prognosis if metastases appear in the lung. A novel therapeutic approach could consist in a gene therapeutic treatment of OS metastases. However, if promiscuous viral vectors are applied for the delivery of potentially toxic transgenes, their misdelivery into normal tissues could cause severe complications. This problem could be circumvented by application of OS-specific promoters for transgene expression control. We analysed the function of promoters described to be tumour-, osteosarcoma- or osteoblast-specific. Expression rates driven by osteoblast- specific fragments from the collagen1A1-promoter, the human Osteocalcin-promoter, the bone-sialoprotein promoter and the beta-catenin promoter depending on vitamin supplementation were analysed in five OS cell lines, in normal lung fibroblasts and in a non-osteoblastic prostate cancer cell line (LNCaP) by dual luciferase assays. In addition, an unspecific but doxycyclin-repressible promoter construct (pAd.3r-luc) was examined. We found that all constructs were active in OS cell lines to varying extents. The complete human Osteocalcin promoter and the bone-sialoprotein promoter were partially induced by vitamin D3 or C respectively while the pAd.3r-luc activity could be shut down by doxycyclin. In contrast, the human Osteocalcin-promoter was not activated by vitamin D3 in LNCaP cells; its action remained relatively low. Interestingly, excepting the beta-catenin promoter, we measured strong activities of all promoters in lung fibroblast cells. Our study demonstrates that promoter activity should be evaluated not only for the target cells of the gene therapeutic approaches, but also for neighbouring normal tissues. Unspecific but repressible promoters could represent an alternative. PMID:15375610

  14. Effects of endogenous antidiuretic hormone (ADH) on macrophage phagocytosis

    SciTech Connect

    Fernandez-Repollet, E.; Opava-Stitzer, S.; Tiffany, S.; Schwartz, A.

    1983-07-01

    Although several studies have indicated that antidiuretic hormone (ADH) enhances the phagocytic function of the reticuloendothelial system (RES) in shock syndromes, it remains unknown what influence ADH exerts upon the individual phagocytic components of this system. The present investigation was designed to evaluate the effects of endogenous ADH on the phagocytic activity of peritoneal macrophage cells. As a phagocytic stimuli, fluorescent methacrylate microbeads were injected intraperitoneally into Brattleboro (ADH deficient) and normal Long Evans rats in the presence and absence of exogenous ADH. Peritoneal cells were harvested 19-22 hr after the administration of the microbeads and the percent phagocytosis was determined in macrophage cells using a fluorescence-activated cell sorter (FACS II). Our results indicate that the percentage of peritoneal macrophages ingesting the fluorescent methacrylate microbeads was significantly reduced in the absence of ADH (Brattleboro rats: 5.4 +/- 0.6% versus Long Evans rats: 16.8 +/- 2.3%; p less than 0.001). In addition, our data demonstrate that exogenous administration of ADH significantly enhanced macrophage phagocytosis in Brattleboro (14.7 +/- 2.2%) and normal Long Evans (49.6 +/- 4.5%) rats. These data suggest, for the first time, that endogenous ADH might play a modulatory role in the phagocytic activity of a specific component of the RES, namely, the macrophage cell.

  15. Promoter methylation of candidate genes associated with familial testicular cancer.

    PubMed

    Mirabello, Lisa; Kratz, Christian P; Savage, Sharon A; Greene, Mark H

    2012-01-01

    Recent genomic studies have identified risk SNPs in or near eight genes associated with testicular germ cell tumors (TGCT). Mouse models suggest a role for Dnd1 epigenetics in TGCT susceptibility, and we have recently reported that transgenerational inheritance of epigenetic events may be associated with familial TGCT risk. We now investigate whether aberrant promoter methylation of selected candidate genes is associated with familial TGCT risk. Pyrosequencing assays were designed to evaluate CpG methylation in the promoters of selected genes in peripheral blood DNA from 153 TGCT affecteds and 116 healthy male relatives from 101 multiple-case families. Wilcoxon rank-sum tests and logistic regression models were used to investigate associations between promoter methylation and TGCT. We also quantified gene product expression of these genes, using quantitative PCR. We observed increased PDE11A, SPRY4 and BAK1 promoter methylation, and decreased KITLG promoter methylation, in familial TGCT cases versus healthy male family controls. A significant upward risk trend was observed for PDE11A when comparing the middle and highest tertiles of methylation to the lowest [odds ratio (OR) =1.55, 95% confidence intervals (CI) 0.82-2.93, and 1.94, 95% CI 1.03-3.66], respectively; P(trend)=0.042). A significant inverse association was observed for KITLG when comparing the middle and lowest tertiles to the highest (OR=2.15, 95% CI 1.12-4.11, and 2.15, 95% CI 1.12-4.14, respectively; P(trend)=0.031). There was a weak inverse correlation between promoter methylation and KITLG expression. Our results suggest that familial TGCT susceptibility may be associated with promoter methylation of previously-identified TGCT risk-modifying genes. Larger studies are warranted. PMID:23050052

  16. Sequence and regulation of the porcine FSHR gene promoter.

    PubMed

    Wu, Wangjun; Han, Jing; Cao, Rui; Zhang, Jinbi; Li, Bojiang; Liu, Zequn; Liu, Kaiqing; Li, Qifa; Pan, Zengxiang; Chen, Jie; Liu, Honglin

    2015-03-01

    Follicle-stimulating hormone (FSH) plays a crucial role in animal reproduction and exerts its physiological functions by interacting with the FSH receptor (FSHR). The FSHR is exclusively expressed in granulose cells in the ovary and its expression level is closely related to granulose cell differentiation and follicle maturation. In mammal, most of the follicles undergo atresia, while follicle atresia is mainly caused by granulosa cell apoptosis. However, knowledge on the transcriptional regulatory mechanisms of the porcine FSHR gene in granulosa cell is still limited. In this study, approximately 2.1kb of the proximal promoter sequence of the porcine FSHR gene were obtained by genome walking, and the regulatory elements and transcription factors in the porcine FSHR promoter sequence were predicted. Furthermore, the core promoter region (-1195/-598) of the porcine FSHR gene was identified using a luciferase assay. Subsequently, the relationship between expression levels of the porcine FSHR gene and histone H3K9 acetylation levels around the core promoter region (-787/-572) in vivo and invitro were analyzed. Our results showed that an increased FSHR gene expression level was accompanied with an increase in histone H3K9 acetylation levels, suggesting that histone H3K9 acetylation could regulate the expression of the porcine FSHR gene. PMID:25599592

  17. Transcriptional Silencing by Hairpin RNAs Complementary to a Gene Promoter

    PubMed Central

    Chu, Yongjun; Kalantari, Roya; Dodd, David W.

    2012-01-01

    Double-stranded RNAs can target gene promoters and inhibit transcription. To date, most research has focused on synthetic RNA duplexes. Transcriptional silencing by hairpin RNAs would facilitate a better understanding of endogenous RNA-mediated regulation of transcription within cells. Here we examine transcriptional silencing of progesterone receptor (PR) expression by hairpin RNAs. We identify the guide strand as the strand complementary to an antisense transcript at the PR promoter and that hairpin RNAs are active transcriptional silencing agents. The sequence of the hairpin loop affects activity, with the highest activity achieved when the loop has the potential for full complementarity to the antisense transcript target. Introduction of centrally mismatched bases relative to the target transcript does not prevent transcriptional silencing unless the mismatches are present on both the guide and passenger strands. These data demonstrate that hairpin RNAs can cause transcriptional silencing and offer insights into the mechanism of gene modulation by RNAs that target gene promoters. PMID:22703280

  18. Two zebrafish alcohol dehydrogenases share common ancestry with mammalian class I, II, IV, and V alcohol dehydrogenase genes but have distinct functional characteristics.

    PubMed

    Reimers, Mark J; Hahn, Mark E; Tanguay, Robert L

    2004-09-10

    Ethanol is teratogenic to many vertebrates. We are utilizing zebrafish as a model system to determine whether there is an association between ethanol metabolism and ethanol-mediated developmental toxicity. Here we report the isolation and characterization of two cDNAs encoding zebrafish alcohol dehydrogenases (ADHs). Phylogenetic analysis of these zebrafish ADHs indicates that they share a common ancestor with mammalian class I, II, IV, and V ADHs. The genes encoding these zebrafish ADHs have been named Adh8a and Adh8b by the nomenclature committee. Both genes were genetically mapped to chromosome 13. The 1450-bp Adh8a is 82, 73, 72, and 72% similar at the amino acid level to the Baltic cod ADH8 (previously named ADH1), the human ADH1B2, the mouse ADH1, and the rat ADH1, respectively. Also, the 1484-bp Adh8b is 77, 68, 67, and 66% similar at the amino acid level to the Baltic cod ADH8, the human ADH1B2, the mouse ADH1, and the rat ADH1, respectively. ADH8A and ADH8B share 86% amino acid similarity. To characterize the functional properties of ADH8A and ADH8B, recombinant proteins were purified from SF-9 insect cells. Kinetic studies demonstrate that ADH8A metabolizes ethanol, with a V(max) of 13.4 nmol/min/mg protein, whereas ADH8B does not metabolize ethanol. The ADH8A K(m) for ethanol as a substrate is 0.7 mm. 4-Methyl pyrazole, a classical competitive inhibitor of class I ADH, failed to inhibit ADH8A. ADH8B has the capacity to efficiently biotransform longer chain primary alcohols (>/=5 carbons) and S-hydroxymethlyglutathione, whereas ADH8A does not efficiently metabolize these substrates. Finally, mRNA expression studies indicate that both ADH8A and ADH8B mRNA are expressed during early development and in the adult brain, fin, gill, heart, kidney, muscle, and liver. Together these results indicate that class I-like ADH is conserved in zebrafish, albeit with mixed functional properties. PMID:15231826

  19. Cloning of a marine cyanobacterial promoter for foreign gene expression using a promoter probe vector

    SciTech Connect

    Sode, Koji; Hatano, Naoaki; Tatara, Masahiro

    1996-06-01

    A marine cyanobacterial promoter was cloned to allow efficient foreign gene expression. This was carried out using chloramphenicol acetyl transferase (CAT) as a marker protein. For rapid and simple measurement of CAT activity, a method based on a fluorescently labeled substrate was improved by utilizing HPLC equipped with a flow-through fluorescent spectrophotometer. This method was used in conjunction with a newly constructed promoter probe vector. Cyanobacterial transformants, harboring plasmid containing a cloned 2-kbp marine cyanobacterial genomic fragment, showed a 10-fold higher CAT activity, compared with that achieved using the kanamycin-resistant gene promoter. From the sequence analysis of the cloned fragment, a putative promoter region was found. 20 refs., 7 figs., 2 tabs.

  20. [Cloning and characterization of D-113 gene promoter from cotton].

    PubMed

    Luo, Ke-Ming; Guo, Yu-Long; Xiao, Yue-Hua; Hou, Lei; Pei, Yan

    2002-02-01

    To study the expression of late embryogenesis abundant gene in seeds, the 1,024 bp 5' flanking sequence of D-113 gene, a late embryogenesis abundant gene of Gossypium hirsutum cv. Coker 312, was cloned by PCR. The similarity compared with the sequence of Lea protein gene family published was 92.50%. There are three putative ABREs and one enhancer-like which riches A/T in the promoter. The promoter was fused to the beta-glucuronidase gene to form pLD II. Via a particle bombardment, pLD II was introduced into embryogenic calli of cotton and seeds of Brassica napus which were all treated with abscisic acid for 3d before bombardment, also into roots, stems and leafs of cotton. Transient expression was measured histochemically as spot number 24 h after bombardment. GUS sexpression was observed in the seeds of Brassica napus and the embryogenic calli of cotton, but not found in roots and leaves of cotton. Those results indicated that the expression of D-113 gene promoter was embryo specific. PMID:11902000

  1. Recurrent epimutations activate gene body promoters in primary glioblastoma.

    PubMed

    Nagarajan, Raman P; Zhang, Bo; Bell, Robert J A; Johnson, Brett E; Olshen, Adam B; Sundaram, Vasavi; Li, Daofeng; Graham, Ashley E; Diaz, Aaron; Fouse, Shaun D; Smirnov, Ivan; Song, Jun; Paris, Pamela L; Wang, Ting; Costello, Joseph F

    2014-05-01

    Aberrant DNA hypomethylation may play an important role in the growth rate of glioblastoma (GBM), but the functional impact on transcription remains poorly understood. We assayed the GBM methylome with MeDIP-seq and MRE-seq, adjusting for copy number differences, in a small set of non-glioma CpG island methylator phenotype (non-G-CIMP) primary tumors. Recurrent hypomethylated loci were enriched within a region of chromosome 5p15 that is specified as a cancer amplicon and also encompasses TERT, encoding telomerase reverse transcriptase, which plays a critical role in tumorigenesis. Overall, 76 gene body promoters were recurrently hypomethylated, including TERT and the oncogenes GLI3 and TP73. Recurring hypomethylation also affected previously unannotated alternative promoters, and luciferase reporter assays for three of four of these promoters confirmed strong promoter activity in GBM cells. Histone H3 lysine 4 trimethylation (H3K4me3) ChIP-seq on tissue from the GBMs uncovered peaks that coincide precisely with tumor-specific decrease of DNA methylation at 200 loci, 133 of which are in gene bodies. Detailed investigation of TP73 and TERT gene body hypomethylation demonstrated increased expression of corresponding alternate transcripts, which in TP73 encodes a truncated p73 protein with oncogenic function and in TERT encodes a putative reverse transcriptase-null protein. Our findings suggest that recurring gene body promoter hypomethylation events, along with histone H3K4 trimethylation, alter the transcriptional landscape of GBM through the activation of a limited number of normally silenced promoters within gene bodies, in at least one case leading to expression of an oncogenic protein. PMID:24709822

  2. The long-range interaction landscape of gene promoters.

    PubMed

    Sanyal, Amartya; Lajoie, Bryan R; Jain, Gaurav; Dekker, Job

    2012-09-01

    The vast non-coding portion of the human genome is full of functional elements and disease-causing regulatory variants. The principles defining the relationships between these elements and distal target genes remain unknown. Promoters and distal elements can engage in looping interactions that have been implicated in gene regulation. Here we have applied chromosome conformation capture carbon copy (5C) to interrogate comprehensively interactions between transcription start sites (TSSs) and distal elements in 1% of the human genome representing the ENCODE pilot project regions. 5C maps were generated for GM12878, K562 and HeLa-S3 cells and results were integrated with data from the ENCODE consortium. In each cell line we discovered >1,000 long-range interactions between promoters and distal sites that include elements resembling enhancers, promoters and CTCF-bound sites. We observed significant correlations between gene expression, promoter-enhancer interactions and the presence of enhancer RNAs. Long-range interactions show marked asymmetry with a bias for interactions with elements located ∼120 kilobases upstream of the TSS. Long-range interactions are often not blocked by sites bound by CTCF and cohesin, indicating that many of these sites do not demarcate physically insulated gene domains. Furthermore, only ∼7% of looping interactions are with the nearest gene, indicating that genomic proximity is not a simple predictor for long-range interactions. Finally, promoters and distal elements are engaged in multiple long-range interactions to form complex networks. Our results start to place genes and regulatory elements in three-dimensional context, revealing their functional relationships. PMID:22955621

  3. In vitro mapping of Myotonic Dystrophy (DM) gene promoter

    SciTech Connect

    Storbeck, C.J.; Sabourin, L.; Baird, S.

    1994-09-01

    The Myotonic Dystrophy Kinase (DMK) gene has been cloned and shared homology to serine/threonine protein kinases. Overexpression of this gene in stably transfected mouse myoblasts has been shown to inhibit fusion into myotubes while myoblasts stably transfected with an antisense construct show increased fusion potential. These experiments, along with data showing that the DM gene is highly expressed in muscle have highlighted the possibility of DMK being involved in myogenesis. The promoter region of the DM gene lacks a consensus TATA box and CAAT box, but harbours numerous transcription binding sites. Clones containing extended 5{prime} upstream sequences (UPS) of DMK only weakly drive the reporter gene chloramphenicol acetyl transferase (CAT) when transfected into C2C12 mouse myoblasts. However, four E-boxes are present in the first intron of the DM gene and transient assays show increased expression of the CAT gene when the first intron is present downstream of these 5{prime} UPS in an orientation dependent manner. Comparison between mouse and human sequence reveals that the regions in the first intron where the E-boxes are located are highly conserved. The mapping of the promoter and the importance of the first intron in the control of DMK expression will be presented.

  4. Isolation of the promoters of Atlantic salmon MHCII genes.

    PubMed

    Syed, Mohasina; Vestrheim, Olav; Mikkelsen, Birthe; Lundin, Maria

    2003-01-01

    The major histocompatibility complex class II (MHCII) has a central role in the immune response of vertebrates with its function of presenting antigenic peptides to the T-cell receptors. We have isolated the promoters and intron 1 of MHCIIalpha and MHCIIbeta genes of Atlantic salmon. To isolate these promoters, we constructed an Atlantic salmon ( Salmo salar) promoter finder kit (analogous to the commercially available "human promoter finder kit"). By nucleotide sequence alignment of known MHCII promoter regions, we identified the 3 conserved regulatory X, X2, and Y boxes in the salmon promoters. The W box was not found. In contrast, a salmon-specific putative W box was identified. Both of the isolated Atlantic salmon MHCIIalpha and beta promoters (included in patent applications by Genomar A/S, Oslo, Norway) were found to be functional since they both gave positive yellow fluorescence protein signal when inserted as promoters in the pEYFP-1 reporter plasmid and transfected into the salmon head kidney cell line (SHK-1). PMID:14502397

  5. Gene Transfer Strategies to Promote Chondrogenesis and Cartilage Regeneration.

    PubMed

    Im, Gun-Il

    2016-04-01

    Gene transfer has been used experimentally to promote chondrogenesis and cartilage regeneration. While it is controversial to apply gene therapy for nonlethal conditions such as cartilage defect, there is a possibility that the transfer of therapeutic transgenes may dramatically increase the effectiveness of cell therapy and reduce the quantity of cells that are needed to regenerate cartilage. Single or combination of growth factors and transcription factors has been transferred to mesenchymal stem cells or articular chondrocytes using both nonviral and viral approaches. The current challenge for the clinical applications of genetically modified cells is ensuring the safety of gene therapy while guaranteeing effectiveness. Viral gene delivery methods have been mainstays currently with enhanced safety features being recently refined. On the other hand, efficiency has been greatly improved in nonviral delivery. This review summarizes the history and recent update on the gene transfer to enhance chondrogenesis from stem cells or articular chondrocytes. PMID:26414246

  6. Characterization of a barley Rubisco activase gene promoter

    SciTech Connect

    Strickland, J.A.; Rundle, S.J.; Zielinski, R. )

    1990-05-01

    Barley Rubisco Activase (Rca) is a nuclear encoded chloroplast enzyme that activates Rubisco to catalytic competence. Rca mRNA accumulation in barley is light-regulated; the 5{prime}-flanking region of a highly expressed barley Rca gene (HvRca-1) contains several sequence motifs similar to those found in the promoter of other light-regulated, nuclear genes. We have characterized the cis-acting regulatory regions of HvRca-1 by deletion analysis of the 5{prime} flanking region of a cloned gene. These constructs have been assayed in vitro by gel mobility shift assays, as well as by DNA footprinting. Putative regulatory sequences detected in vitro have also been tested in vivo by constructing chimeric genes consisting of deletion mutant promoters fused to a promoterless {beta}-glucuronidase reporter gene. Comparison of results obtained from complimentary parallel in vitro and in vivo assays of identical promoter deletions have provided information on cis-acting regulatory regions of HvRca-1.

  7. Conditional promoters for analysis of essential genes in Zymoseptoria tritici.

    PubMed

    Kilaru, S; Ma, W; Schuster, M; Courbot, M; Steinberg, G

    2015-06-01

    Development of new fungicides, needed for sustainable control of fungal plant pathogens, requires identification of novel anti-fungal targets. Essential fungal-specific proteins are good candidates, but due to their importance, gene deletion mutants are not viable. Consequently, their cellular role often remains elusive. This hindrance can be overcome by the use of conditional mutants, where expression is controlled by an inducible/repressible promoter. Here, we introduce 5 inducible/repressible promoter systems to study essential genes in the wheat pathogen Zymoseptoria tritici. We fused the gene for enhanced green-fluorescent protein (egfp) to the promoter region of Z. tritici nitrate reductase (Pnar1; induced by nitrogen and repressed by ammonium), 1,4-β-endoxylanase A (Pex1A; induced by xylose and repressed by maltodextrin), l-arabinofuranosidase B (PlaraB; induced by arabinose and repressed by glucose), galactose-1-phosphate uridylyltransferase 7 (Pgal7; induced by galactose and repressed by glucose) and isocitrate lyase (Picl1; induced by sodium acetate and repressed by glucose). This was followed by quantitative analysis of cytoplasmic reporter fluorescence under induced and repressed conditions. We show that Pnar1, PlaraB and Pex1A drive very little or no egfp expression when repressed, but induce moderate protein production when induced. In contrast, Pgal7 and Picl1 show considerable egfp expression when repressed, and were strongly induced in the presence of their inducers. Normalising the expression levels of all promoters to that of the α-tubulin promoter Ptub2 revealed that PlaraB was the weakest promoter (∼20% of Ptub2), whereas Picl1 strongly expressed the reporter (∼250% of Ptub2). The use of these tools promises a better understanding of essential genes, which will help developing novel control strategies that protect wheat from Z. tritici. PMID:26092803

  8. Epigenomic elements enriched in the promoters of autoimmunity susceptibility genes.

    PubMed

    Dozmorov, Mikhail G; Wren, Jonathan D; Alarcón-Riquelme, Marta E

    2014-02-01

    Genome-wide association studies have identified a number of autoimmune disease-susceptibility genes. Whether or not these loci share any regulatory or functional elements, however, is an open question. Finding such common regulators is of considerable research interest in order to define systemic therapeutic targets. The growing amount of experimental genomic annotations, particularly those from the ENCODE project, provide a wealth of opportunities to search for such commonalities. We hypothesized that regulatory commonalities might not only delineate a regulatory landscape predisposing to autoimmune diseases, but also define functional elements distinguishing specific diseases. We further investigated if, and how, disease-specific epigenomic elements can identify novel genes yet to be associated with the diseases. We evaluated transcription factors, histone modifications, and chromatin state data obtained from the ENCODE project for statistically significant over- or under-representation in the promoters of genes associated with Systemic Lupus Erythematosus (SLE), Rheumatoid Arthritis (RA), and Systemic Sclerosis (SSc). We identified BATF, BCL11A, IRF4, NFkB, PAX5, and PU.1 as transcription factors over-represented in SLE- and RA-susceptibility gene promoters. H3K4me1 and H3K4me2 epigenomic marks were associated with SLE susceptibility genes, and H3K9me3 was common to both SLE and RA. In contrast to a transcriptionally active signature in SLE and RA, SSc-susceptibility genes were depleted in activating epigenomic elements. Using epigenomic elements enriched in SLE and RA, we identified additional immune and B cell signaling-related genes with the same elements in their promoters. Our analysis suggests common and disease-specific epigenomic elements that may define novel therapeutic targets for controlling aberrant activation of autoimmune susceptibility genes. PMID:24213554

  9. Polymorphic core promoter GA-repeats alter gene expression of the early embryonic developmental genes.

    PubMed

    Valipour, E; Kowsari, A; Bayat, H; Banan, M; Kazeminasab, S; Mohammadparast, S; Ohadi, M

    2013-12-01

    Protein complexes that bind to 'GAGA' DNA elements are necessary to replace nucleosomes to create a local chromatin environment that facilitates a variety of site-specific regulatory responses. Three to four elements are required for the disruption of a preassembled nucleosome. We have previously identified human protein-coding gene core promoters that are composed of exceptionally long GA-repeats. The functional implication of those GA-repeats is beginning to emerge in the core promoter of the human SOX5 gene, which is involved in multiple developmental processes. In the current study, we analyze the functional implication of GA-repeats in the core promoter of two additional genes, MECOM and GABRA3, whose expression is largely limited to embryogenesis. We report a significant difference in gene expression as a result of different alleles across those core promoters in the HEK-293 cell line. Across-species homology check for the GABRA3 GA-repeats revealed that those repeats are evolutionary conserved in mouse and primates (p<1 × 10(-8)). The MECOM core promoter GA-repeats are also conserved in numerous species, of which human has the longest repeat and complexity. We propose a novel role for GA-repeat core promoters to regulate gene expression in the genes involved in development and evolution. PMID:24055488

  10. Improvement of tolerance of Saccharomyces cerevisiae to hot-compressed water-treated cellulose by expression of ADH1.

    PubMed

    Jayakody, Lahiru N; Horie, Kenta; Hayashi, Nobuyuki; Kitagaki, Hiroshi

    2012-04-01

    Hot-compressed water treatment of cellulose and hemicellulose for subsequent bioethanol production is a novel, economically feasible, and nonhazardous method for recovering sugars. However, the hot-compressed water-treated cellulose and hemicellulose inhibit subsequent ethanol fermentation by the yeast Saccharomyces cerevisiae. To overcome this problem, we engineered a yeast strain with improved tolerance to hot-compressed water-treated cellulose. We first determined that glycolaldehyde has a greater inhibitory effect than 5-HMF and furfural and a combinational effect with them. On the basis of the hypothesis that the reduction of glycolaldehyde to ethylene glycol should detoxify glycolaldehyde, we developed a strain overexpressing the alcohol dehydrogenase gene ADH1. The ADH1-overexpressing strain exhibits an improved fermentation profile in a glycolaldehyde-containing medium. The conversion ratio of glycolaldehyde to ethylene glycol is 30 ± 1.9% when the control strain is used; this ratio increases to 77 ± 3.6% in the case of the ADH1-overexpressing strain. A glycolaldehyde treatment and the overexpression of ADH1 cause changes in the fermentation products so as to balance the metabolic carbon flux and the redox status. Finally, the ADH1-overexpressing strain shows a statistically significantly improved fermentation profile in a hot-compressed water-treated cellulose-containing medium. The conversion ratio of glycolaldehyde to ethylene glycol is 33 ± 0.85% when the control strain is used but increases to 72 ± 1.7% in the case of the ADH1-overexpressing strain. These results show that the reduction of glycolaldehyde to ethylene glycol is a promising strategy to decrease the toxicity of hot-compressed water-treated cellulose. This is the first report on the improvement of yeast tolerance to hot-compressed water-treated cellulose and glycolaldehyde. PMID:22311646

  11. Simultaneous gene inactivation and promoter reporting in cyanobacteria.

    PubMed

    Chen, Kangming; Xu, Xinyi; Gu, Liping; Hildreth, Michael; Zhou, Ruanbao

    2015-02-01

    homolog, and a previously unknown function of gene all2508. Thus, gene expression and phenotypic analysis of mutants can be achieved simultaneously by targeted gene inactivation using the pZR606-based system. This combined approach for targeted gene inactivation and its promoter reporting with GFP may be broadly applicable to the study of gene function in other prokaryotic organisms. PMID:25434810

  12. Adh enhances Actinobacillus pleuropneumoniae pathogenicity by binding to OR5M11 and activating p38 which induces apoptosis of PAMs and IL-8 release

    PubMed Central

    Wang, Lei; Qin, Wanhai; Zhang, Jing; Bao, Chuntong; Zhang, Hu; Che, Yanyi; Sun, Changjiang; Gu, Jingmin; Feng, Xin; Du, Chongtao; Han, Wenyu; Richard, Paul Langford; Lei, Liancheng

    2016-01-01

    Members of the Trimeric Autotransporter Adhesin (TAA) family play a crucial role in the adhesion of Gram-negative pathogens to host cells, but the immunopathogenesis of TAAs remains unknown. Our previous studies demonstrated that Adh from Actinobacillus pleuropneumoniae (A. pleuropneumoniae) is required for full bacterial pathogenicity. Alveolar macrophages are the first line of defense against respiratory infections. This study compared the interactions between porcine alveolar macrophages (PAMs) and wild-type A. pleuropneumoniae (5b WT) or an Adh-deletion strain (5b ΔAdh) via gene microarray, immunoprecipitation and other technologies. We found that Adh was shown to interact with the PAMs membrane protein OR5M11, an olfactory receptor, resulting in the high-level secretion of IL-8 by activation of p38 MAPK signaling pathway. Subsequently, PAMs apoptosis via the activation of the Fax and Bax signaling pathways was observed, followed by activation of caspases 8, 9, and 3. The immunological pathogenic roles of Adh were also confirmed in both murine and piglets infectious models in vivo. These results identify a novel immunological strategy for TAAs to boost the pathogenicity of A. pleuropneumoniae. Together, these datas reveal the high versatility of the Adh protein as a virulence factor and provide novel insight into the immunological pathogenic role of TAAs. PMID:27046446

  13. hTERT and BIRC5 gene promoters for cancer gene therapy: A comparative study

    PubMed Central

    Shepelev, Mikhail V.; Kopantzev, Eugene P.; Vinogradova, Tatiana V.; Sverdlov, Eugene D.; Korobko, Igor V.

    2016-01-01

    Human telomerase reverse transcriptase (hTERT) and survivin (BIRC5) gene promoters are frequently used for transcriptional targeting of tumor cells, yet there is no comprehensive comparative analysis allowing rational choice of a promoter for a particular therapy. In the current study, the transcriptional activity of hTERT, human BIRC5 and mouse Birc5 promoters and their modifications were compared in 10 human cancer cell lines using the luciferase reporter gene activity assay. The results revealed that BIRC5- and hTERT-based promoters had strikingly different cell specificities with comparable activities in only 40% of cell lines. Importantly, relative hTERT and BIRC5 transcript abundance cannot be used to predict the most potent promoter. Among the hTERT-based promoters that were assessed, modification with the minimal cytomegalovirus promoter generally resulted in the most potent activity. Mouse Birc5 and modified human BIRC5 promoters were superior to the unmodified human survivin promoter; however, their tumor specificities must be investigated further. In summary, the present results emphasize the desirability for construction of more universal tumor-specific promoters to efficiently target a wide spectrum of tumor cells. PMID:27446419

  14. The regulation of gene expression in transformed maize aleurone and endosperm protoplasts. Analysis of promoter activity, intron enhancement, and mRNA untranslated regions on expression.

    PubMed Central

    Gallie, D R; Young, T E

    1994-01-01

    Gene expression in the aleurone and endosperm is highly regulated during both seed development and germination. Studies of alpha-amylase expression in the aleurone of barley (Hordeum vulgare) have generated the current paradigm for hormonal control of gene expression in germinating cereal grain. Gene expression studies in both the aleurone and endosperm tissues of maize (Zea mays) seed have been hampered because of a lack of an efficient transformation system. We report here the rapid isolation of protoplasts from maize aleurone and endosperm tissue, their transformation using polyethylene glycol or electroporation, and the regulation of gene expression in these cells. Adh1 promoter activity was reduced relative to the 35S promoter in aleurone and endosperm protoplasts compared to Black Mexican Sweet suspension cells in which it was nearly as strong as the 35S promoter. Intron-mediated stimulation of expression was substantially higher in transformed aleurone or endosperm protoplasts than in cell-suspension culture protoplasts, and the data suggest that the effect of an intron may be affected by cell type. To examine cytoplasmic regulation, the 5' and 3' untranslated regions from a barley alpha-amylase were fused to the firefly luciferase-coding region, and their effect on translation and mRNA stability was examined following the delivery of in vitro synthesized mRNA to aleurone and endosperm protoplasts. The alpha-amylase untranslated regions regulated translational efficiency in a tissue-specific manner, increasing translation in aleurone or endosperm protoplasts but not in maize or carrot cell-suspension protoplasts, in animal cells, or in in vitro translation lysates. PMID:7824660

  15. Characterization of the human 5-lipoxygenase gene promoter

    SciTech Connect

    Hoshiko, S.; Radmark, O.; Samuelsson, B. )

    1990-12-01

    Nucleotide sequences that direct transcription of the human 5-lipoxygenase gene have been examined by ligation to the chloramphenicol acetyltransferase activity in transfected HeLa and HL-60 cells. Various lengths of 5{prime}-flanking sequences up to 5.9 kilobase pairs 5{prime} of the transcriptional initiation sites were tested. Two positive and two negative apparent regulatory regions were seen. Part of the promoter sequence ({minus}179 to {minus}56 from ATG), which includes five repeated GC boxes (the putative Spl binding sequence) was essential for transcription in both HeLa and HL-60 cells. Gel-shift assays (using the DNA fragment {minus}212 to {minus}88) revealed that the transcriptional factor Spl could bind to this region of the 5-lipoxygenase promoter. Furthermore, HL-60 nuclear extracts contained specific nuclear factor(s) binding to 5-lipoxygenase promoter DNA, which could not be detected in HeLa cell nuclear extracts.

  16. Silencing of CHD5 Gene by Promoter Methylation in Leukemia

    PubMed Central

    Zhao, Rui; Meng, Fanyi; Wang, Nisha; Ma, Wenli; Yan, Qitao

    2014-01-01

    Chromodomain helicase DNA binding protein 5 (CHD5) was previously proposed to function as a potent tumor suppressor by acting as a master regulator of a tumor-suppressive network. CHD5 is down-regulated in several cancers, including leukemia and is responsible for tumor generation and progression. However, the mechanism of CHD5 down-regulation in leukemia is largely unknown. In this study, quantitative reverse-transcriptase polymerase chain reaction and western blotting analyses revealed that CHD5 was down-regulated in human leukemia cell lines and samples. Luciferase reporter assays showed that most of the baseline regulatory activity was localized from 500 to 200 bp upstream of the transcription start site. Bisulfite DNA sequencing of the identified regulatory element revealed that the CHD5 promoter was hypermethylated in human leukemia cells and samples. Thus, CHD5 expression was inversely correlated with promoter DNA methylation in these samples. Treatment with DNA methyltransferase inhibitor 5-aza-2′-deoxycytidine (DAC) activates CHD5 expression in human leukemia cell lines. In vitro luciferase reporter assays demonstrated that methylation of the CHD5 promoter repressed its promoter activity. Furthermore, a chromatin immunoprecipitation assay combined with qualitative PCR identified activating protein 2 (AP2) as a potential transcription factor involved in CHD5 expression and indicated that treatment with DAC increases the recruitment of AP2 to the CHD5 promoter. In vitro transcription-factor activity studies showed that AP2 over-expression was able to activate CHD5 promoter activity. Our findings indicate that repression of CHD5 gene expression in human leukemia is mediated in part by DNA methylation of its promoter. PMID:24454811

  17. TERT promoter mutations and gene amplification: promoting TERT expression in Merkel cell carcinoma.

    PubMed

    Xie, Hong; Liu, Tiantian; Wang, Na; Björnhagen, Viveca; Höög, Anders; Larsson, Catharina; Lui, Weng-Onn; Xu, Dawei

    2014-10-30

    Telomerase activation through the induction of its catalytic component TERT is essential in carcinogenesis. The regulatory mechanism and clinical significance underlying cancer-specific TERT expression have been extensively investigated in various human malignancies, but little is known about these in Merkel cell carcinoma (MCC), an aggressive neuroendocrine skin tumor. Here we addressed these issues by determining TERT promoter mutations, gene amplification, mRNA expression and association with clinical variables in MCC. TERT mRNA was expressed in 6/6 MCC cell lines and 41 of 43 tumors derived from 35 MCC patients. Telomerase activity was detectable in all 6 cell lines and 11 tumors analyzed. TERT promoter mutations were identified in 1/6 cell lines and 4/35 (11.4%) MCC cases. The mutation exhibited UV signature and occurred in sun-exposed areas. Increased TERT gene copy numbers were observed in 1/6 cell lines and 11/14 (79%) tumors, and highly correlated with its mRNA expression (r = 0.7419, P = 0.0024). Shorter overall survival was significantly associated with higher TERT mRNA levels in MCC patients (P = 0.032). Collectively, TERT expression and telomerase activity is widespread in MCC, and may be attributable to TERT promoter mutations and gene amplification. Higher TERT expression predicts poor patient outcomes. PMID:25301727

  18. Aberrant Gene Promoter Methylation Associated with Sporadic Multiple Colorectal Cancer

    PubMed Central

    Gonzalo, Victoria; Lozano, Juan José; Muñoz, Jenifer; Balaguer, Francesc; Pellisé, Maria; de Miguel, Cristina Rodríguez; Andreu, Montserrat; Jover, Rodrigo; Llor, Xavier; Giráldez, M. Dolores; Ocaña, Teresa; Serradesanferm, Anna; Alonso-Espinaco, Virginia; Jimeno, Mireya; Cuatrecasas, Miriam; Sendino, Oriol; Castellví-Bel, Sergi; Castells, Antoni

    2010-01-01

    Background Colorectal cancer (CRC) multiplicity has been mainly related to polyposis and non-polyposis hereditary syndromes. In sporadic CRC, aberrant gene promoter methylation has been shown to play a key role in carcinogenesis, although little is known about its involvement in multiplicity. To assess the effect of methylation in tumor multiplicity in sporadic CRC, hypermethylation of key tumor suppressor genes was evaluated in patients with both multiple and solitary tumors, as a proof-of-concept of an underlying epigenetic defect. Methodology/Principal Findings We examined a total of 47 synchronous/metachronous primary CRC from 41 patients, and 41 gender, age (5-year intervals) and tumor location-paired patients with solitary tumors. Exclusion criteria were polyposis syndromes, Lynch syndrome and inflammatory bowel disease. DNA methylation at the promoter region of the MGMT, CDKN2A, SFRP1, TMEFF2, HS3ST2 (3OST2), RASSF1A and GATA4 genes was evaluated by quantitative methylation specific PCR in both tumor and corresponding normal appearing colorectal mucosa samples. Overall, patients with multiple lesions exhibited a higher degree of methylation in tumor samples than those with solitary tumors regarding all evaluated genes. After adjusting for age and gender, binomial logistic regression analysis identified methylation of MGMT2 (OR, 1.48; 95% CI, 1.10 to 1.97; p = 0.008) and RASSF1A (OR, 2.04; 95% CI, 1.01 to 4.13; p = 0.047) as variables independently associated with tumor multiplicity, being the risk related to methylation of any of these two genes 4.57 (95% CI, 1.53 to 13.61; p = 0.006). Moreover, in six patients in whom both tumors were available, we found a correlation in the methylation levels of MGMT2 (r = 0.64, p = 0.17), SFRP1 (r = 0.83, 0.06), HPP1 (r = 0.64, p = 0.17), 3OST2 (r = 0.83, p = 0.06) and GATA4 (r = 0.6, p = 0.24). Methylation in normal appearing colorectal mucosa from patients with multiple

  19. ARID3B Directly Regulates Ovarian Cancer Promoting Genes

    PubMed Central

    Bobbs, Alexander; Gellerman, Katrina; Hallas, William Morgan; Joseph, Stancy; Yang, Chao; Kurkewich, Jeffrey; Cowden Dahl, Karen D.

    2015-01-01

    The DNA-binding protein AT-Rich Interactive Domain 3B (ARID3B) is elevated in ovarian cancer and increases tumor growth in a xenograft model of ovarian cancer. However, relatively little is known about ARID3B's function. In this study we perform the first genome wide screen for ARID3B direct target genes and ARID3B regulated pathways. We identified and confirmed numerous ARID3B target genes by chromatin immunoprecipitation (ChIP) followed by microarray and quantitative RT-PCR. Using motif-finding algorithms, we characterized a binding site for ARID3B, which is similar to the previously known site for the ARID3B paralogue ARID3A. Functionality of this predicted site was demonstrated by ChIP analysis. We next demonstrated that ARID3B induces expression of its targets in ovarian cancer cell lines. We validated that ARID3B binds to an epidermal growth factor receptor (EGFR) enhancer and increases mRNA expression. ARID3B also binds to the promoter of Wnt5A and its receptor FZD5. FZD5 is highly expressed in ovarian cancer cell lines, and is upregulated by exogenous ARID3B. Both ARID3B and FZD5 expression increase adhesion to extracellular matrix (ECM) components including collagen IV, fibronectin and vitronectin. ARID3B-increased adhesion to collagens II and IV require FZD5. This study directly demonstrates that ARID3B binds target genes in a sequence-specific manner, resulting in increased gene expression. Furthermore, our data indicate that ARID3B regulation of direct target genes in the Wnt pathway promotes adhesion of ovarian cancer cells. PMID:26121572

  20. In vivo selection for metastasis promoting genes in the mouse.

    PubMed

    Gumireddy, Kiranmai; Sun, Fangxian; Klein-Szanto, Andres J; Gibbins, Jonathan M; Gimotty, Phyllis A; Saunders, Aleister J; Schultz, Peter G; Huang, Qihong

    2007-04-17

    Here, we report the identification of a metastasis promoting factor by a forward genetic screen in mice. A retroviral cDNA library was introduced into the nonmetastatic cancer cell line 168FARN, which was then orthotopically transplanted into mouse mammary fat pads, followed by selection for cells that metastasize to the lung. The genes encoding the disulfide isomerase ERp5 and beta-catenin were found to promote breast cancer invasion and metastasis. Disulfide isomerases (thiol isomerases), which catalyze disulfide bond formation, reduction, and isomerization, have not previously been implicated in cancer cell signaling and tumor metastasis. Overexpression of ERp5 promotes both in vitro migration and invasion and in vivo metastasis of breast cancer cells. These effects were shown to involve activation of ErbB2 and phosphoinositide 3-kinase (PI3K) pathways through dimerization of ErbB2. Activation of ErbB2 and PI3K subsequently stimulates RhoA and beta-catenin, which mediate the migration and invasion of tumor cells. Inhibition of ErbB2 and PI3K reverses the phenotypes induced by ERp5. Finally, ERp5 was shown to be up-regulated in human surgical samples of invasive breast cancers. These data identify a link between disulfide isomerases and tumor development, and provide a mechanism that modulates ErbB2 and PI3K signaling in the promotion of cancer progression. PMID:17420453

  1. In vivo selection for metastasis promoting genes in the mouse

    PubMed Central

    Gumireddy, Kiranmai; Sun, Fangxian; Klein-Szanto, Andres J.; Gibbins, Jonathan M.; Gimotty, Phyllis A.; Saunders, Aleister J.; Schultz, Peter G.; Huang, Qihong

    2007-01-01

    Here, we report the identification of a metastasis promoting factor by a forward genetic screen in mice. A retroviral cDNA library was introduced into the nonmetastatic cancer cell line 168FARN, which was then orthotopically transplanted into mouse mammary fat pads, followed by selection for cells that metastasize to the lung. The genes encoding the disulfide isomerase ERp5 and β-catenin were found to promote breast cancer invasion and metastasis. Disulfide isomerases (thiol isomerases), which catalyze disulfide bond formation, reduction, and isomerization, have not previously been implicated in cancer cell signaling and tumor metastasis. Overexpression of ERp5 promotes both in vitro migration and invasion and in vivo metastasis of breast cancer cells. These effects were shown to involve activation of ErbB2 and phosphoinositide 3-kinase (PI3K) pathways through dimerization of ErbB2. Activation of ErbB2 and PI3K subsequently stimulates RhoA and β-catenin, which mediate the migration and invasion of tumor cells. Inhibition of ErbB2 and PI3K reverses the phenotypes induced by ERp5. Finally, ERp5 was shown to be up-regulated in human surgical samples of invasive breast cancers. These data identify a link between disulfide isomerases and tumor development, and provide a mechanism that modulates ErbB2 and PI3K signaling in the promotion of cancer progression. PMID:17420453

  2. Promoter DNA demethylation of Keap1 gene in diabetic cardiomyopathy

    PubMed Central

    Liu, Zhong-Zhi; Zhao, Xiang-Zhi; Zhang, Xue-Song; Zhang, Mei

    2014-01-01

    Researches have shown that the onset of diabetes is closely associated with oxidative stress and the chronic exposure leads to the development of complications such as diabetic cardiomyopathy. One of the central adaptive responses against the oxidative stresses is the activation of the nuclear transcriptional factor, NF-E2-related factor 2 (Nrf2), which then activates more than 20 different antioxidative enzymes. Kelch-like ECH associated protein 1 (Keap1) targets and binds to Nrf2 for proteosomal degradation. The aim of the present study was to investigate the status of Nrf2 mediated antioxidant system in myocardial biopsies of non-diabetic (NDM) and type-2 diabetic (DM-T2) cardiomyopathy patients. The western blot analysis of antioxidant proteins, real-time PCR analysis of Nrf2/Keap1 gene and bisulphate DNA sequencing analysis to study the methylation status of the CpG islands of Keap1 promoter DNA were performed. The immunoblot analysis showed the decreased level of antioxidant proteins other than Keap1 in the diabetic cardiopathy patients. Similarly, mRNA levels of Keap1 showed 5-fold increase in diabetic patients. Further analysis on promoter region of Keap1 gene revealed 80% demethylation in diabetic patients. Altogether, our results indicated that demethylation of the CpG islands in the Keap1 promoter will activate the expression of Keap1 protein, which then increases the targeting of Nrf2 for proteosomal degradation. Decreased Nrf2 activity represses the transcription of many antioxidant enzyme genes and alters the redox-balance up on diabetes. Thus, our study clearly demonstrates the failure of Nrf2 mediated antioxidant system revealed in biopsies of diabetic cardiomyopathy. PMID:25674242

  3. Selection variability for Arg48His in alcohol dehydrogenase ADH1B among Asian populations.

    PubMed

    Evsyukov, Alexey; Ivanov, Denis

    2013-08-01

    The variant His at codon 48 of the alcohol dehydrogenase gene (ADH1B) results in more efficient ethanol metabolism than with the "typical" codon 48Arg. In this study we introduced selection properties of Arg48His genotypes of ADH1B and estimated fitness in four ethnic-geographical clusters in Asia. Population genetics models were employed that derive observed gene frequencies from fitness relationships among genotypes, to infer the selection pattern of polymorphisms in an indirect manner. The data were analyzed using the model of "complete stationary distribution" by Wright that takes into account random genetic drift, pressure of migrations, mutations, and selection as influential factors of gene frequency. We found that the different population groups showed some variation in the types of selection for Arg48His. Han Chinese from eastern and southeastern China and the Japanese and Korean populations showed stabilizing selection, while the groups from Central Asian and Indochina showed divergent selection. However, all the groups demonstrated a strong positive selection for Arg48His. PMID:25019189

  4. Bacillus licheniformis APase I gene promoter: a strong well-regulated promoter in B. subtilis.

    PubMed

    Lee, J K; Edwards, C W; Hulett, F M

    1991-05-01

    The 5' regulatory region and the portion of the structural gene coding for the amino-terminal sequence of alkaline phosphatase I (APase I) were isolated from Bacillus licheniformis MC14 using a synthetic oligodeoxynucleotide deduced from the amino acid sequence of the enzyme. The DNA sequence analysis of this region revealed an open reading frame of 129 amino acids containing the amino-terminal sequence of the mature APase protein. The protein sequence was preceded by a putative signal sequence of 32 amino acid residues. The predicted amino acid sequence of the partial APase clone as well as the experimentally determined amino acid sequence of the enzyme indicated that B. licheniformis APase retains the important features conserved among other APases of Bacillus subtilis, Escherichia coli, Saccharomyces cerevisiae, and various human tissues. Heterologous expression studies of the promoter using a fusion with the lacZ gene indicated that it functions as a very strong inducible promoter in B. subtilis that is tightly regulated by phosphate concentration. PMID:1907637

  5. High-fidelity promoter profiling reveals widespread alternative promoter usage and transposon-driven developmental gene expression

    PubMed Central

    Batut, Philippe; Dobin, Alexander; Plessy, Charles; Carninci, Piero; Gingeras, Thomas R.

    2013-01-01

    Many eukaryotic genes possess multiple alternative promoters with distinct expression specificities. Therefore, comprehensively annotating promoters and deciphering their individual regulatory dynamics is critical for gene expression profiling applications and for our understanding of regulatory complexity. We introduce RAMPAGE, a novel promoter activity profiling approach that combines extremely specific 5′-complete cDNA sequencing with an integrated data analysis workflow, to address the limitations of current techniques. RAMPAGE features a streamlined protocol for fast and easy generation of highly multiplexed sequencing libraries, offers very high transcription start site specificity, generates accurate and reproducible promoter expression measurements, and yields extensive transcript connectivity information through paired-end cDNA sequencing. We used RAMPAGE in a genome-wide study of promoter activity throughout 36 stages of the life cycle of Drosophila melanogaster, and describe here a comprehensive data set that represents the first available developmental time-course of promoter usage. We found that >40% of developmentally expressed genes have at least two promoters and that alternative promoters generally implement distinct regulatory programs. Transposable elements, long proposed to play a central role in the evolution of their host genomes through their ability to regulate gene expression, contribute at least 1300 promoters shaping the developmental transcriptome of D. melanogaster. Hundreds of these promoters drive the expression of annotated genes, and transposons often impart their own expression specificity upon the genes they regulate. These observations provide support for the theory that transposons may drive regulatory innovation through the distribution of stereotyped cis-regulatory modules throughout their host genomes. PMID:22936248

  6. Heterologous gene expression driven by carbonic anhydrase gene promoter in Dunaliella salina

    NASA Astrophysics Data System (ADS)

    Chai, Yurong; Lu, Yumin; Wang, Tianyun; Hou, Weihong; Xue, Lexun

    2006-12-01

    Dunaliella salina, a halotolerant unicellular green alga without a rigid cell wall, can live in salinities ranging from 0.05 to 5 mol/L NaCl. These features of D. salina make it an ideal host for the production of antibodies, oral vaccine, and commercially valuable polypeptides. To produce high level of heterologous proteins from D. salina, highly efficient promoters are required to drive expression of target genes under controlled condition. In the present study, we cloned a 5' franking region of 1.4 kb from the carbonic anhydrase ( CAH) gene of D. salina by genomic walking and PCR. The fragment was ligated to the pMD18-T vector and characterized. Sequence analysis indicated that this region contained conserved motifs, including a TATA- like box and CAAT-box. Tandem (GT)n repeats that had a potential role of transcriptional control, were also found in this region. The transcription start site (TSS) of the CAH gene was determined by 5' RACE and nested PCR method. Transformation assays showed that the 1.4 kb fragment was able to drive expression of the selectable bar (bialaphos resistance) gene when the fusion was transformed into D. salina by biolistics. Northern blotting hybridizations showed that the bar transcript was most abundant in cells grown in 2 mol/L NaCl, and less abundant in 0.5 mol/L NaCl, indicating that expression of the bar gene was induced at high salinity. These results suggest the potential use of the CAH gene promoter to induce the expression of heterologous genes in D. salina under varied salt condition.

  7. Regulated Expression of Three Alcohol Dehydrogenase Genes in Barley Aleurone Layers 1

    PubMed Central

    Hanson, Andrew D.; Jacobsen, John V.; Zwar, John A.

    1984-01-01

    Three genes specify alcohol dehydrogenase (EC 1.1.1.1.; ADH) enzymes in barley (Hordeum vulgare L.) (Adh 1, Adh 2, and Adh 3). Their polypeptide products (ADH 1, ADH 2, ADH 3) dimerize to give a total of six ADH isozymes which can be resolved by native gel electrophoresis and stained for enzyme activity. Under fully aerobic conditions, aleurone layers of cv Himalaya had a high titer of a single isozyme, the homodimer containing ADH 1 monomers. This isozyme was accumulated by the aleurone tissue during the later part of seed development, and survived seed drying and rehydration. The five other possible ADH isozymes were induced by O2 deficit. The staining of these five isozymes on electrophoretic gels increased progressively in intensity as O2 levels were reduced below 5%, and were most intense at 0% O2. In vivo35S labeling and specific immunoprecipitation of ADH peptides, followed by isoelectric focusing of the ADH peptides in the presence of 8 molar urea (urea-IEF) demonstrated the following. (a) Aleurone layers incubated in air synthesized ADH 1 and a trace of ADH 2; immature layers from developing seeds behaved similarly. (b) At 5% O2, synthesis of ADH 2 increased and ADH 3 appeared. (c) At 2% and 0% O2, the synthesis of all three ADH peptides increased markedly. Cell-free translation of RNA isolated from aleurone layers, followed by immunoprecipitation and urea-IEF of in vitro synthesized ADH peptides, showed that levels of mRNA for all three ADH peptides rose sharply during 1 day of O2 deprivation. Northern hybridizations with a maize Adh 2 cDNA clone established that the clone hybridized with barley mRNA comparable in size to maize Adh 2 mRNA, and that the level of this barley mRNA increased 15- to 20-fold after 1 day at 5% or 2% O2, and about 100-fold after 1 day at 0% O2. We conclude that in aleurone layers, expression of the three barley Adh genes is maximal in the absence of O2, that regulation of mRNA level is likely to be a major controlling factor, and

  8. Keratin promoter based gene manipulation in the murine conducting airway

    PubMed Central

    Malkoski, Stephen P.; Cleaver, Timothy G.; Lu, Shi-Long; Lighthall, Jessyka G.; Wang, Xiao-Jing

    2010-01-01

    Systems capable of targeting genetic manipulations to keratin-positive airway basal cells are more poorly developed than systems targeting other airway epithelial cell populations and this has likely hindered development of animal models of diseases such as lung squamous cell carcinoma. Although keratin promoter driven-Cre recombinase constructs are potentially useful for targeting these cells, these constructs have substantially higher activity in the skin and oral epithelium than in the airways. We developed a method for delivering RU486, the conditional activator of Cre recombinase progesterone receptor (CrePR) fusion proteins to the lung and then examined the activity of three keratin-driven CrePR constructs in the conducting airways. We also developed a technique for survival bronchioalveolar lavage on non-ventilated animals to examine the effects of the acetone/oil vehicle required to deliver RU486 to the lung. K5CrePR1 and K14CrePR1 constructs differ only in the keratin promoter used to target CrePR1 expression while K5Cre*PR contains a truncated progesterone receptor designed to reduce RU486-independent Cre activity. While all three constructs demonstrate RU486-inducible Cre activity in the conducting airways, both construct activity and tightness of regulation vary considerably. K5Cre*PR is the most tightly regulated Cre driver making it ideal for targeting somatic mutations to the airway epithelia while K5CrePR1 and K14CrePR1 may be better suited to studying diseases of the conducting airways where gene targeting of keratin expressing cells and their derivatives is desired. PMID:20140084

  9. Spontaneously induced prophages in Lactobacillus gasseri contribute to horizontal gene transfer.

    PubMed

    Baugher, J L; Durmaz, E; Klaenhammer, T R

    2014-06-01

    Lactobacillus gasseri is an endogenous species of the human gastrointestinal tract and vagina. With recent advances in microbial taxonomy, phylogenetics, and genomics, L. gasseri is recognized as an important commensal and is increasingly being used in probiotic formulations. L. gasseri strain ADH is lysogenic and harbors two inducible prophages. In this study, prophage adh was found to spontaneously induce in broth cultures to populations of ∼ 10(7) PFU/ml by stationary phase. The adh prophage-cured ADH derivative NCK102 was found to harbor a new, second inducible phage, vB_Lga_jlb1 (jlb1). Phage jlb1 was sequenced and found to be highly similar to the closely related phage LgaI, which resides as two tandem prophages in the neotype strain L. gasseri ATCC 33323. The common occurrence of multiple prophages in L. gasseri genomes, their propensity for spontaneous induction, and the high degree of homology among phages within multiple species of Lactobacillus suggest that temperate bacteriophages likely contribute to horizontal gene transfer (HGT) in commensal lactobacilli. In this study, the host ranges of phages adh and jlb1 were determined against 16 L. gasseri strains. The transduction range and the rate of spontaneous transduction were investigated in coculture experiments to ascertain the degree to which prophages can promote HGT among a variety of commensal and probiotic lactobacilli. Both adh and jlb1 particles were confirmed to mediate plasmid transfer. As many as ∼10(3) spontaneous transductants/ml were obtained. HGT by transducing phages of commensal lactobacilli may have a significant impact on the evolution of bacteria within the human microbiota. PMID:24682298

  10. Arabidopsis gene expression patterns during spaceflight

    NASA Astrophysics Data System (ADS)

    Paul, A.-L.; Ferl, R. J.

    The exposure of Arabidopsis thaliana (Arabidopsis) plants to spaceflight environments resulted in the differential expression of hundreds of genes. A 5 day mission on orbiter Columbia in 1999 (STS-93) carried transgenic Arabidopsis plants engineered with a transgene composed of the alcohol dehydrogenase (Adh) gene promoter linked to the β -Glucuronidase (GUS) reporter gene. The plants were used to evaluate the effects of spaceflight on two fronts. First, expression patterns visualized with the Adh/GUS transgene were used to address specifically the possibility that spaceflight induces a hypoxic stress response, and to assess whether any spaceflight response was similar to control terrestrial hypoxia-induced gene expression patterns. (Paul et al., Plant Physiol. 2001, 126:613). Second, genome-wide patterns of native gene expression were evaluated utilizing the Affymetrix ATH1 GeneChip? array of 8,000 Arabidopsis genes. As a control for the veracity of the array analyses, a selection of genes identified with the arrays was further characterized with quantitative Real-Time RT PCR (ABI - TaqmanTM). Comparison of the patterns of expression for arrays of hybridized with RNA isolated from plants exposed to spaceflight compared to the control arrays revealed hundreds of genes that were differentially expressed in response to spaceflight, yet most genes that are hallmarks of hypoxic stress were unaffected. These results will be discussed in light of current models for plant responses to the spaceflight environment, and with regard to potential future flight opportunities.

  11. Responses of reindeer to water loading, water restriction and ADH.

    PubMed

    Valtonen, M; Eriksson, L

    1977-07-01

    Two female reindeer were hydrated by administration of (10% of b.wt.) water into the rumen. The diuretic response was very fast and strong but the urea and electrolyte excretion were little affected. Dehydration was carried out by not giving the reindeer water for 48 h. This water deprivation caused a loss of up to 20% of their body weight. The urine osmolality did not exceed 840 mosm/kg H2O, although the plasma osmolality rose from 300 to 346 and 368 mosm/kg H2O respectively. The plasma and urine urea concentrations were elevated during dehydration, while the urine urea excretion did not increase. Urine sodium concentration did not increase. When the urine flow rate, after two days of water deprivation, decreased to half of the original, the urine Na+ concentrations, instead of increasing, went down to half of the original. So did the potassium excretion. When ADH was injected intravenously into hydrated animals a dose of 30 mU of ADH was needed to induce antidiuresis or increased excretion of potassium. The resistance to ADH and the low relative thickness of the medulla confirm the limited capacity of reindeer kidney to concentrate urine or to excrete a solute load. On the other hand, reindeer is able rapidly to excrete surplus water without affecting the electrolyte or nitrogen balance. PMID:920204

  12. Identification of a promoter motif involved in Curtovirus sense-gene expression in transgenic Arabidopsis.

    PubMed

    Hur, Jingyung; Choi, Eunseok; Buckley, Kenneth J; Lee, Sukchan; Davis, Keith R

    2008-08-31

    Expression of the seven open reading frames (ORFs) of single-stranded DNA Curtoviruses such as Beet curly top virus (BCTV) and Beet severe curly top virus (BSCTV) is driven by a bi-directional promoter. To investigate this bi-directional promoter activity with respect to viral late gene expression, transgenic Arabidopsis plants expressing a GUS reporter gene under the control of either the BCTV or BSCTV bi-directional promoter were constructed. Transgenic plants harboring constructs showed higher expression levels when the promoter of the less virulent BCTV was used than when the promoter of the more virulent BSCTV was used. In transgenic seedlings, the reporter gene constructs were expressed primarily in actively dividing tissues such as root tips and apical meristems. As the transgenic plants matured, reporter gene expression diminished but viral infection of mature transgenic plants restored reporter gene expression, particularly in transgenic plants containing BCTV virion-sense gene promoter constructs. A 30 base pair conserved late element (CLE) motif was identified that was present three times in tandem in the BCTV promoter and once in that of BSCTV. Progressive deletion of these repeats from the BCTV promoter resulted in decreased reporter gene expression, but BSCTV promoters in which one or two extra copies of this motif were inserted did not exhibit increased late gene promoter activity. These results demonstrate that Curtovirus late gene expression by virion-sense promoters depends on the developmental stage of the host plant as well as on the number of CLE motifs present in the promoter. PMID:18596416

  13. ABERRANT PROMOTER METHYLATION OF MULTIPLE GENES IN SPUTUM FROM INDIVIDUALS EXPOSED TO SMOKY COAL EMISSIONS

    EPA Science Inventory

    Aberrant methylation in the promoter region of cancer-related genes leads to gene transcriptional inactivation and plays an integral role in lung tumorigenesis. Recent studies demonstrated that promoter methylation was detected not only in lung tumors from patients with lung canc...

  14. Quantitative analysis of RNA produced by slow and fast alleles of Adh in Drosophila melanogaster.

    PubMed Central

    Laurie, C C; Stam, L F

    1988-01-01

    The alcohol dehydrogenase (ADH) locus (Adh) of Drosophila melanogaster in polymorphic on a world-wide basis for two allozymes, Fast and Slow. This study was undertaken to determine whether the well-established difference in ADH protein concentration between the allozymes is due to a difference in mRNA levels. RNA gel blot hybridization and an RNase protection assay were used to quantify ADH mRNA levels. Each method used an Adh null mutant as an internal standard. Several Slow and Fast allele pairs of different geographic origins were analyzed. The results provide strong evidence that the ADH protein concentration difference is not accounted for by RNA level. Images PMID:2455893

  15. Tumor Restrictive Suicide Gene Therapy for Glioma Controlled by the FOS Promoter

    PubMed Central

    Hu, Jiliang; Song, Weijian; Luo, Jie; Jiang, Shan; Yan, Fei; Zhai, Baojin

    2015-01-01

    Effective suicide gene delivery and expression are crucial to achieving successful effects in gene therapy. An ideal tumor-specific promoter expresses therapeutic genes in tumor cells with minimal normal tissue expression. We compared the activity of the FOS (FBJ murine osteosarcoma viral oncogene homolog) promoter with five alternative tumor-specific promoters in glioma cells and non-malignant astrocytes. The FOS promoter caused significantly higher transcriptional activity in glioma cell lines than all alternative promoters with the exception of CMV. The FOS promoter showed 13.9%, 32.4%, and 70.8% of the transcriptional activity of CMV in three glioma cell lines (U87, U251, and U373). Importantly, however, the FOS promoter showed only 1.6% of the transcriptional activity of CMV in normal astrocytes. We also tested the biologic activity of recombinant adenovirus containing the suicide gene herpes simplex virus thymidine kinase (HSV-tk) driven by the FOS promoter, including selective killing efficacy in vitro and tumor inhibition rate in vivo. Adenoviral-mediated delivery of the HSV-tk gene controlled by the FOS promoter conferred a cytotoxic effect on human glioma cells in vitro and in vivo. This study suggests that use of the FOS-tk adenovirus system is a promising strategy for glioma-specific gene therapy but still much left for improvement. PMID:26571389

  16. In vivo roles of alcohol dehydrogenase (ADH), catalase and the microsomal ethanol oxidizing system (MEOS) in deermice

    SciTech Connect

    Takagi, T.; Alderman, J.; Lieber, C.S.

    1985-01-01

    The relative importance of ADH and MEOS for ethanol oxidation in the liver has yet to be elucidated. The discovery of a strain of deermice genetically lacking ADH (ADH-) which can consume ethanol at greater than 50% of the rates seen in deermice having ADH (ADH+) suggested a significant role for non-ADH pathways in vivo. To quantitate contributions of the various pathways, the authors examined first the ethanol oxidation rates with or without 4-methylpyrazole in isolated deermice hepatocytes. 4-Methylpyrazole significantly reduced the ethanol oxidation in both ADH+ and ADH- hepatocytes. The reduction seen in ADH- cells can be applied to correct for the effect of 4-methylpyrazole on non-ADH pathways of ADH+ deermouse hepatocytes. After correction, non-ADH pathways were found to contribute 28% of ethanol metabolism at 10 mM and 52% at 50 mM. When using a different approach namely measurement of the isotope effect, MEOS was calculated to account for 35% at low and about 70% at high blood ethanol concentrations. Thus, they found that two different complementary approaches yielded similar results, namely that non-ADH pathways play a significant role in ethanol oxidation even in the presence of ADH.

  17. Analysis of developmentally regulated chorion gene promoter architecture via electroporation of silk moth follicles.

    PubMed

    Tsatsarounos, S P; Rodakis, G C; Lecanidou, R

    2015-02-01

    In the silk moth Bombyx mori, chorion genes of the same developmental specificity are organized in divergently transcribed α/β gene pairs, sharing a common 5' flanking promoter region. This bidirectional promoter contains a complete set of cis-elements responsible for developmentally accurate gene expression. In the present paper, based on the observation that Bombyx chorion gene promoters contain cis-elements for the same transcription factors without concrete evidence on which of them are essential, we address the question as to how promoter architecture (number, orientation and position of common factor binding sites) facilitates developmentally accurate chorion gene regulation. To this end, we constructed several mutated promoter regions of an early-middle gene pair and cloned them upstream of a reporter gene to introduce these plasmid constructs into silk moth follicle epithelial cells via electroporation as an efficient and quick method for transient expression. This is the first time that an ex vivo method had been applied to test the impact of systematic cis-element mutations on a chorion gene promoter. Our results confirmed the importance of the HMGA factor and the role of the GATA factor as an early repressor, and led to a more detailed understanding of which C/EBP sites participate in the regulation of early-middle chorion gene expression. PMID:25256090

  18. Characterization of the human CD4 gene promoter: transcription from the CD4 gene core promoter is tissue-specific and is activated by Ets proteins.

    PubMed Central

    Salmon, P; Giovane, A; Wasylyk, B; Klatzmann, D

    1993-01-01

    We analyzed the 5' transcription control sequences of the human CD4 gene. We located the transcription initiation site and showed that the CD4 core promoter (positions -40 to +16) lacks a classical "TATA" or initiator positioning consensus sequence but directs precise and efficient transcription when coupled to the ubiquitously active simian virus 40 enhancer. The transcriptional activity of the CD4 gene promoter correlated with CD4 expression in various cell types. Interestingly, the CD4 core promoter also displayed a tissue-specific transcriptional activity. Within this fragment, three nucleic acid sequences are completely conserved in the murine CD4 gene. One of these sequences contains a perfect ETS consensus sequence. Another ETS consensus sequence is located 1060 nt upstream. Electrophoretic-mobility-shift assays showed that the core promoter ETS motif binds an Ets-related protein specifically expressed at high levels in CD4+ cells. Moreover, in CD4- cells, overexpression of Ets-1 or Ets-2 efficiently and specifically activated transcription from the CD4 promoter and core promoter. These data indicate that Ets transcription factors play a central role in controlling CD4 gene expression, by binding to both a classical remote site and an unusual proximal activator sequence. Images Fig. 2 Fig. 4 PMID:8356078

  19. Identification of Promoters for Efficient Gene Expression in Magnetospirillum gryphiswaldense▿ †

    PubMed Central

    Lang, Claus; Pollithy, Anna; Schüler, Dirk

    2009-01-01

    To develop an expression system for the magnetotactic bacterium Magnetospirillum gryphiswaldense, we compared gene expression from the widely used Escherichia coli Plac promoter with that from known and predicted genuine M. gryphiswaldense promoters. With the use of green fluorescent protein as a reporter, the highest expression level was observed with the magnetosomal PmamDC promoter. We demonstrate that this promoter can be used for the expression of modified magnetosome proteins to generate “antibody-binding” magnetosomes. PMID:19395573

  20. A genetic analysis of Adh1 regulation. Progress report, June 1991--February 1992

    SciTech Connect

    Freeling, M.

    1992-03-01

    The overall goal of our research proposal is to understand the meaning of the various cis-acting sites responsible for AdH1 expression in the entire maize plant. Progress is reported in the following areas: Studies on the TATA box and analysis of revertants of the Adh1-3F1124 allele; screening for more different mutants that affect Adh1 expression differentially; studies on cis-acting sequences required for root-specific Adh1 expression; refinement of the use of the particle gun; and functional analysis of a non- glycolytic anaerobic protein.

  1. The wheat HMW-glutenin 1Dy10 gene promoter controls endosperm expression in Brachypodium distachyon

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The grass species Brachypodium distachyon has emerged as a model system for the study of gene structure and function in temperate cereals. As a first demonstration of the utility of Brachypodium to study wheat gene promoter function, we transformed it with a T-DNA that included the GUS reporter gene...

  2. The Joint Effects of ADH1B Variants and Childhood Adversity on Alcohol-Related Phenotypes in African-American and European-American Women and Men

    PubMed Central

    Sartor, Carolyn E.; Wang, Zuoheng; Xu, Ke; Kranzler, Henry R.; Gelernter, Joel

    2015-01-01

    Background The ADH1B gene has consistently been implicated in problem drinking, but rarely incorporated into gene by environment investigations of alcohol phenotypes. This study examined the joint effects of variation in ADH1B and childhood adversity – a well-documented risk factor for alcohol problems and moderator of genetic liability to psychiatric outcomes – on maximum drinks consumed in a 24-hour period (maxdrinks) and alcohol use disorder (AUD) symptoms. Methods Data were drawn from 2,617 African-American (AA) and 1,436 European-American (EA) participants (42% female) in a multisite genetic study of substance dependence. We tested the most significant ADH1B SNPs for alcohol dependence from a genomewide association study with this sample, ADH1B-rs1229984 (Arg48His) and ADH1B-rs2066702 (Arg370Cys), in EA and AA subsamples, respectively. Results Ordinal regression analyses conducted separately by sex and population revealed significant main effects for childhood adversity both for alcohol phenotypes in AA women and men and for maxdrinks in EA women. A significant rs1229984 by childhood adversity interaction was observed for AUD symptoms in EA men. Unexposed His-allele carriers reported a mean of 3.6 AUD criteria, but adversity-exposed His-allele carriers endorsed approximately the same number (6.3) as those without the protective allele (6.3 and 7.0 for adversity-exposed and adversity-unexposed groups, respectively). Conclusions Results suggest that under conditions of childhood adversity, the His allele does not exert its protective effects in EA men (OR=0.57, CI:0.32–1.01; p=0.056). Findings highlight the robust risk effect conferred by childhood adversity and the importance of considering population and sex in genetically informative investigations of its association with alcohol outcomes. PMID:25410943

  3. Molecular cloning and characterization of the promoter region of the porcine apolipoprotein E gene.

    PubMed

    Xia, Jihan; Hu, Bingjun; Mu, Yulian; Xin, Leilei; Yang, Shulin; Li, Kui

    2014-05-01

    Apolipoprotein E (APOE), a component of lipoproteins plays an important role in the transport and metabolism of cholesterol, and is associated with hyperlipoproteinemia and Alzheimer's disease. In order to further understand the characterization of APOE gene, the promoter of APOE gene of Landrace pigs was analyzed in the present study. The genomic structure and amino acid sequence in pigs were analyzed and found to share high similarity in those of human but low similarity in promoter region. Real-time PCR revealed the APOE gene expression pattern of pigs in diverse tissues. The highest expression level was observed in liver, relatively low expression in other tissues, especially in stomach and muscle. Furthermore, the promoter expressing in Hepa 1-6 was significantly better at driving luciferase expression compared with C2C12 cell. After analysis of porcine APOE gene promoter regions, potential transcription factor binding sites were predicted and two GC signals, a TATA box were indicated. Results of promoter activity analysis indicated that one of potential regulatory elements was located in the region -669 to -259, which was essential for a high expression of the APOE gene. Promoter mutation and deletion analysis further suggested that the C/EBPA binding site within the APOE promoter was responsible for the regulation of APOE transcription. Electrophoretic mobility shift assays also showed the binding site of the transcription factor C/EBPA. This study advances our knowledge of the promoter of the porcine APOE gene. PMID:24464129

  4. Coexpression of two closely linked avian genes for purine nucleotide synthesis from a bidirectional promoter.

    PubMed Central

    Gavalas, A; Dixon, J E; Brayton, K A; Zalkin, H

    1993-01-01

    Two avian genes encoding essential steps in the purine nucleotide biosynthetic pathway are transcribed divergently from a bidirectional promoter element. The bidirectional promoter, embedded in a CpG island, directs coexpression of GPAT and AIRC genes from distinct transcriptional start sites 229 bp apart. The bidirectional promoter can be divided in half, with each half retaining partial activity towards the cognate gene. GPAT and AIRC genes encode the enzymes that catalyze step 1 and steps 6 plus 7, respectively, in the de novo purine biosynthetic pathway. This is the first report of genes coding for structurally unrelated enzymes of the same pathway that are tightly linked and transcribed divergently from a bidirectional promoter. This arrangement has the potential to provide for regulated coexpression comparable to that in a prokaryotic operon. Images PMID:8336716

  5. Polymorphisms in the promoter region of catalase gene and essential hypertension.

    PubMed

    Zhou, Xiao Feng; Cui, Jing; DeStefano, Anita L; Chazaro, Irmarie; Farrer, Lindsay A; Manolis, Athanasios J; Gavras, Haralambos; Baldwin, Clinton T

    2005-01-01

    Genetic variations that predispose individuals to complex disorders, such as essential hypertension, may be found in gene coding regions, intronic regions or in gene promoter regions. Most studies have focused on gene variations that result in amino acid substitutions because they result in different isoforms of the protein, presumably resulting in differences in protein properties. Less attention has been placed on the role of intronic or promoter mutations. In this report, we examined two single nucleotide polymorphisms (SNPs) in the catalase (CAT) gene prompter region in a cohort of hypertensive Caucasians and African Americans with a Mass Spec based Homogenous MassEXTEND assay. We found an association when a specific combination of the two promoter SNPs was examined in Caucasians. No association was observed in African Americans. Our data suggest that genetic variations in the promoter region of catalase gene influence the susceptibility to essential hypertension. In addition, the genetic factors that contribute to hypertension maybe different between ethnic groups. PMID:15735318

  6. Isolation and characterization of oil palm constitutive promoter derived from ubiquitin extension protein (uep1) gene.

    PubMed

    Masura, Subhi Siti; Parveez, Ghulam Kadir Ahmad; Ismail, Ismanizan

    2010-09-30

    The ubiquitin extension protein (uep1) gene was identified as a constitutively expressed gene in oil palm. We have isolated and characterized the 5' region of the oil palm uep1 gene, which contains an 828 bp sequence upstream of the uep1 translational start site. Construction of a pUEP1 transformation vector, which contains gusA reporter gene under the control of uep1 promoter, was carried out for functional analysis of the promoter through transient expression studies. It was found that the 5' region of uep1 functions as a constitutive promoter in oil palm and could drive GUS expression in all tissues tested, including embryogenic calli, embryoid, immature embryo, young leaflet from mature palm, green leaf, mesocarp and meristematic tissues (shoot tip). This promoter could also be used in dicot systems as it was demonstrated to be capable of driving gusA gene expression in tobacco. PMID:20123048

  7. The cauliflower mosaic virus (CaMV) 35S promoter sequence alters the level and patterns of activity of adjacent tissue- and organ-specific gene promoters.

    PubMed

    Zheng, Xuelian; Deng, Wei; Luo, Keming; Duan, Hui; Chen, Yongqin; McAvoy, Richard; Song, Shuiqing; Pei, Yan; Li, Yi

    2007-08-01

    Here we report the effect of the 35S promoter sequence on activities of the tissue- and organ-specific gene promoters in tobacco plants. In the absence of the 35S promoter sequence the AAP2 promoter is active only in vascular tissues as indicated by expression of the AAP2:GUS gene. With the 35S promoter sequence in the same T-plasmid, transgenic plants exhibit twofold to fivefold increase in AAP2 promoter activity and the promoter becomes active in all tissue types. Transgenic plants hosting the ovary-specific AGL5:iaaM gene (iaaM coding an auxin biosynthetic gene) showed a wild-type phenotype except production of seedless fruits, whereas plants hosting the AGL5:iaaM gene along with the 35S promoter sequence showed drastic morphological alterations. RT-PCR analysis confirms that the phenotype was caused by activation of the AGL5:iaaM gene in non-ovary organs including roots, stems and flowers. When the pollen-, ovule- and early embryo-specific PAB5:barnase gene (barnase coding a RNase gene) was transformed, the presence of 35S promoter sequence drastically reduced transformation efficiencies. However, the transformation efficiencies were restored in the absence of 35S promoter, indicating that the 35S promoter might activate the expression of PAB5:barnase in non-reproductive organs such as calli and shoot primordia. Furthermore, if the 35S promoter sequence was replaced with the NOS promoter sequence, no alteration in AAP2, AGL5 or PAB5 promoter activities was observed. Our results demonstrate that the 35S promoter sequence can convert an adjacent tissue- and organ-specific gene promoter into a globally active promoter. PMID:17340093

  8. Human miR223 Promoter as a Novel Myelo-Specific Promoter for Chronic Granulomatous Disease Gene Therapy

    PubMed Central

    Brendel, Christian; Hänseler, Walther; Wohlgensinger, Vital; Bianchi, Matteo; Tokmak, Serap; Chen-Wichmann, Linping; Kuzmenko, Elena; Cesarovic, Nikola; Nicholls, Flora; Reichenbach, Janine; Seger, Reinhard; Grez, Manuel

    2013-01-01

    Abstract Targeting transgene expression to specific hematopoietic cell lineages could contribute to the safety of retroviral vectors in gene therapeutic applications. Chronic granulomatous disease (CGD), a defect of phagocytic cells, can be managed by gene therapy, using retroviral vectors with targeted expression to myeloid cells. In this context, we analyzed the myelospecificity of the human miR223 promoter, which is known to be strongly upregulated during myeloid differentiation, to drive myeloid-restricted expression of p47phox and gp91phox in mouse models of CGD and in primary patient-derived cells. The miR223 promoter restricted the expression of p47phox, gp91phox, and green fluorescent protein (GFP) within self-inactivating (SIN) gamma- and lentiviral vectors to granulocytes and macrophages, with only marginal expression in lymphocytes or hematopoietic stem and progenitor cells. Furthermore, gene transfer into primary CD34+ cells derived from a p47phox patient followed by ex vivo differentiation to neutrophils resulted in restoration of Escherichia coli killing activity by miR223 promoter–mediated p47phox expression. These results indicate that the miR223 promoter as an internal promoter within SIN gene therapy vectors is able to efficiently correct the CGD phenotype with negligible activity in hematopoietic progenitors, thereby limiting the risk of insertional oncogenesis and development of clonal dominance. PMID:23489116

  9. Mutation of either G box or I box sequences profoundly affects expression from the Arabidopsis rbcS-1A promoter.

    PubMed Central

    Donald, R G; Cashmore, A R

    1990-01-01

    A deletion analysis of the Arabidopsis thaliana rbcS-1A promoter defined a 196 bp region (-320 to -125) sufficient to confer light-regulated expression on a heterologous Arabidopsis alcohol dehydrogenase (Adh) reporter gene in transgenic Nicotiana tabacum (tobacco) leaves. This region, which contains DNA sequences I, G and GT boxes, with homology to other ribulose-1,5-bisphosphate carboxylase small subunit (RBCS) gene promoter sequences, directed expression independent of orientation and relative position in the Adh promoter. Site-specific mutagenesis of these conserved sequences and subsequent expression analysis in transgenic tobacco showed that both G box and I box mutations in the context of the full (-1700 to +21) rbcS-1A promoter substantially reduced the expression of Adh and beta-glucuronidase (GUS) reporter genes. The G box has previously been shown to specifically bind in vitro a factor isolated from nuclear extracts of tomato and Arabidopsis. This factor (GBF) is distinct from the factor GT-1 which binds to adjacent GT boxes in the pea rbcS-3A promoter. Multiple mutations in putative Arabidopsis rbcS-1A promoter GT boxes had no pronounced affect on expression, possibly due to a redundancy of these sites. Experiments in which rbcS-1A promoter fragments were fused to truncated 35S CaMV (cauliflower mosaic virus) promoter--GUS reporter constructs showed that cis-acting CaMV promoter elements could partially restore expression to G-box-mutated rbcS-1A sequences. Images Fig. 1. Fig. 2. Fig. 4. Fig. 5. Fig. 6. PMID:2347304

  10. Multiobjective H2/H∞ synthetic gene network design based on promoter libraries.

    PubMed

    Wu, Chih-Hung; Zhang, Weihei; Chen, Bor-Sen

    2011-10-01

    Some current promoter libraries have been developed for synthetic gene networks. But an efficient method to engineer a synthetic gene network with some desired behaviors by selecting adequate promoters from these promoter libraries has not been presented. Thus developing a systematic method to efficiently employ promoter libraries to improve the engineering of synthetic gene networks with desired behaviors is appealing for synthetic biologists. In this study, a synthetic gene network with intrinsic parameter fluctuations and environmental disturbances in vivo is modeled by a nonlinear stochastic system. In order to engineer a synthetic gene network with a desired behavior despite intrinsic parameter fluctuations and environmental disturbances in vivo, a multiobjective H(2)/H(∞) reference tracking (H(2) optimal tracking and H(∞) noise filtering) design is introduced. The H(2) optimal tracking can make the tracking errors between the behaviors of a synthetic gene network and the desired behaviors as small as possible from the minimum mean square error point of view, and the H(∞) noise filtering can attenuate all possible noises, from the worst-case noise effect point of view, to achieve a desired noise filtering ability. If the multiobjective H(2)/H(∞) reference tracking design is satisfied, the synthetic gene network can robustly and optimally track the desired behaviors, simultaneously. First, based on the dynamic gene regulation, the existing promoter libraries are redefined by their promoter activities so that they can be efficiently selected in the design procedure. Then a systematic method is developed to select an adequate promoter set from the redefined promoter libraries to synthesize a gene network satisfying these two design objectives. But the multiobjective H(2)/H(∞) reference tracking design problem needs to solve a difficult Hamilton-Jacobi Inequality (HJI)-constrained optimization problem. Therefore, the fuzzy approximation method is

  11. Intragenic Locus in Human PIWIL2 Gene Shares Promoter and Enhancer Functions

    PubMed Central

    Zinovyeva, Marina V.; Nikolaev, Lev G.; Azhikina, Tatyana L.

    2016-01-01

    Recently, more evidence supporting common nature of promoters and enhancers has been accumulated. In this work, we present data on chromatin modifications and non-polyadenylated transcription characteristic for enhancers as well as results of in vitro luciferase reporter assays suggesting that PIWIL2 alternative promoter in exon 7 also functions as an enhancer for gene PHYHIP located 60Kb upstream. This finding of an intragenic enhancer serving as a promoter for a shorter protein isoform implies broader impact on understanding enhancer-promoter networks in regulation of gene expression. PMID:27248499

  12. Evolutionary Transition of Promoter and Gene Body DNA Methylation across Invertebrate–Vertebrate Boundary

    PubMed Central

    Keller, Thomas E.; Han, Priscilla; Yi, Soojin V.

    2016-01-01

    Genomes of invertebrates and vertebrates exhibit highly divergent patterns of DNA methylation. Invertebrate genomes tend to be sparsely methylated, and DNA methylation is mostly targeted to a subset of transcription units (gene bodies). In a drastic contrast, vertebrate genomes are generally globally and heavily methylated, punctuated by the limited local hypo-methylation of putative regulatory regions such as promoters. These genomic differences also translate into functional differences in DNA methylation and gene regulation. Although promoter DNA methylation is an important regulatory component of vertebrate gene expression, its role in invertebrate gene regulation has been little explored. Instead, gene body DNA methylation is associated with expression of invertebrate genes. However, the evolutionary steps leading to the differentiation of invertebrate and vertebrate genomic DNA methylation remain unresolved. Here we analyzed experimentally determined DNA methylation maps of several species across the invertebrate–vertebrate boundary, to elucidate how vertebrate gene methylation has evolved. We show that, in contrast to the prevailing idea, a substantial number of promoters in an invertebrate basal chordate Ciona intestinalis are methylated. Moreover, gene expression data indicate significant, epigenomic context-dependent associations between promoter methylation and expression in C. intestinalis. However, there is no evidence that promoter methylation in invertebrate chordate has been evolutionarily maintained across the invertebrate–vertebrate boundary. Rather, body-methylated invertebrate genes preferentially obtain hypo-methylated promoters among vertebrates. Conversely, promoter methylation is preferentially found in lineage- and tissue-specific vertebrate genes. These results provide important insights into the evolutionary origin of epigenetic regulation of vertebrate gene expression. PMID:26715626

  13. Reporter Gene Silencing in Targeted Mouse Mutants Is Associated with Promoter CpG Island Methylation

    PubMed Central

    Kirov, Julia V.; Adkisson, Michael; Nava, A. J.; Cipollone, Andreana; Willis, Brandon; Engelhard, Eric K.; Lloyd, K. C. Kent; de Jong, Pieter; West, David B.

    2015-01-01

    Targeted mutations in mouse disrupt local chromatin structure and may lead to unanticipated local effects. We evaluated targeted gene promoter silencing in a group of six mutants carrying the tm1a Knockout Mouse Project allele containing both a LacZ reporter gene driven by the native promoter and a neo selection cassette. Messenger RNA levels of the reporter gene and targeted gene were assessed by qRT-PCR, and methylation of the promoter CpG islands and LacZ coding sequence were evaluated by sequencing of bisulfite-treated DNA. Mutants were stratified by LacZ staining into presumed Silenced and Expressed reporter genes. Silenced mutants had reduced relative quantities LacZ mRNA and greater CpG Island methylation compared with the Expressed mutant group. Within the silenced group, LacZ coding sequence methylation was significantly and positively correlated with CpG Island methylation, while promoter CpG methylation was only weakly correlated with LacZ gene mRNA. The results support the conclusion that there is promoter silencing in a subset of mutants carrying the tm1a allele. The features of targeted genes which promote local silencing when targeted remain unknown. PMID:26275310

  14. Reporter Gene Silencing in Targeted Mouse Mutants Is Associated with Promoter CpG Island Methylation.

    PubMed

    Kirov, Julia V; Adkisson, Michael; Nava, A J; Cipollone, Andreana; Willis, Brandon; Engelhard, Eric K; Lloyd, K C Kent; de Jong, Pieter; West, David B

    2015-01-01

    Targeted mutations in mouse disrupt local chromatin structure and may lead to unanticipated local effects. We evaluated targeted gene promoter silencing in a group of six mutants carrying the tm1a Knockout Mouse Project allele containing both a LacZ reporter gene driven by the native promoter and a neo selection cassette. Messenger RNA levels of the reporter gene and targeted gene were assessed by qRT-PCR, and methylation of the promoter CpG islands and LacZ coding sequence were evaluated by sequencing of bisulfite-treated DNA. Mutants were stratified by LacZ staining into presumed Silenced and Expressed reporter genes. Silenced mutants had reduced relative quantities LacZ mRNA and greater CpG Island methylation compared with the Expressed mutant group. Within the silenced group, LacZ coding sequence methylation was significantly and positively correlated with CpG Island methylation, while promoter CpG methylation was only weakly correlated with LacZ gene mRNA. The results support the conclusion that there is promoter silencing in a subset of mutants carrying the tm1a allele. The features of targeted genes which promote local silencing when targeted remain unknown. PMID:26275310

  15. Characterization of tissue-specific transcription by the human synapsin I gene promoter

    SciTech Connect

    Thiel, G. Univ. of Texas, Dallas ); Greengard, P. ); Suedhof, T.C. )

    1991-04-15

    Synapsin Ia and synapsin Ib are abundant synaptic vesicle proteins that are derived by differential splicing from a single gene. To identify control elements directing the neuronal expression of synapsins Ia/b, the authors functionally analyzed the promoter region of the human synapsin I gene. A hybrid gene was constructed containing 2 kilobases of 5{prime} flanking sequence from the synapsin I gene fused to the bacterial gene chloramphenicol acetyltransferase and transfected into 12 different neuronal and nonneuronal cell lines. In general, expression of the chimeric reporter gene showed excellent correlation with endogenous expression of synapsin I in different neuronal cell lines, whereas transcription was low in all nonneuronal cell lines examined. The addition of the simian virus 40 enhancer promoted non-tissue-specific expression. Deletion mutagenesis of the synapsin I promoter revealed the presence of positive and negative sequence elements. A basal (constitutive) promoter that directs reporter gene expression in neuronal and nonneuronal cell lines was mapped to the region {minus}115 to +47. The promoter region from {minus}422 to {minus}22 contains positive elements that upon fusion with the herpes simplex virus thymidine kinase promoter potentiate its transcription in PC12 and neuroblastoma cells but not in Chinese hamster ovary cells.

  16. Biological Activity of the Alternative Promoters of the Dictyostelium discoideum Adenylyl Cyclase A Gene

    PubMed Central

    Rodriguez-Centeno, Javier; Sastre, Leandro

    2016-01-01

    Amoebae of the Dictyostelium discoideum species form multicellular fruiting bodies upon starvation. Cyclic adenosine monophosphate (cAMP) is used as intercellular signalling molecule in cell-aggregation, cell differentiation and morphogenesis. This molecule is synthesized by three adenylyl cyclases, one of which, ACA, is required for cell aggregation. The gene coding for ACA (acaA) is transcribed from three different promoters that are active at different developmental stages. Promoter 1 is active during cell-aggregation, promoters 2 and 3 are active in prespore and prestalk tip cells at subsequent developmental stages. The biological relevance of acaA expression from each of the promoters has been studied in this article. The acaA gene was expressed in acaA-mutant cells, that do not aggregate, under control of each of the three acaA promoters. acaA expression under promoter 1 control induced cell aggregation although subsequent development was delayed, very small fruiting bodies were formed and cell differentiation genes were expressed at very low levels. Promoter 2-driven acaA expression induced the formation of small aggregates and small fruiting bodies were formed at the same time as in wild-type strains and differentiation genes were also expressed at lower levels. Expression of acaA from promoter 3 induced aggregates and fruiting bodies formation and their size and the expression of differentiation genes were more similar to that of wild-type cells. Expression of acaA from promoters 1 and 2 in AX4 cells also produced smaller structures. In conclusion, the expression of acaA under control of the aggregation-specific Promoter 1 is able to induce cell aggregation in acaA-mutant strains. Expression from promoters 2 and 3 also recovered aggregation and development although promoter 3 induced a more complete recovery of fruiting body formation. PMID:26840347

  17. Biological Activity of the Alternative Promoters of the Dictyostelium discoideum Adenylyl Cyclase A Gene.

    PubMed

    Rodriguez-Centeno, Javier; Sastre, Leandro

    2016-01-01

    Amoebae of the Dictyostelium discoideum species form multicellular fruiting bodies upon starvation. Cyclic adenosine monophosphate (cAMP) is used as intercellular signalling molecule in cell-aggregation, cell differentiation and morphogenesis. This molecule is synthesized by three adenylyl cyclases, one of which, ACA, is required for cell aggregation. The gene coding for ACA (acaA) is transcribed from three different promoters that are active at different developmental stages. Promoter 1 is active during cell-aggregation, promoters 2 and 3 are active in prespore and prestalk tip cells at subsequent developmental stages. The biological relevance of acaA expression from each of the promoters has been studied in this article. The acaA gene was expressed in acaA-mutant cells, that do not aggregate, under control of each of the three acaA promoters. acaA expression under promoter 1 control induced cell aggregation although subsequent development was delayed, very small fruiting bodies were formed and cell differentiation genes were expressed at very low levels. Promoter 2-driven acaA expression induced the formation of small aggregates and small fruiting bodies were formed at the same time as in wild-type strains and differentiation genes were also expressed at lower levels. Expression of acaA from promoter 3 induced aggregates and fruiting bodies formation and their size and the expression of differentiation genes were more similar to that of wild-type cells. Expression of acaA from promoters 1 and 2 in AX4 cells also produced smaller structures. In conclusion, the expression of acaA under control of the aggregation-specific Promoter 1 is able to induce cell aggregation in acaA-mutant strains. Expression from promoters 2 and 3 also recovered aggregation and development although promoter 3 induced a more complete recovery of fruiting body formation. PMID:26840347

  18. A Novel Binary T-Vector with the GFP Reporter Gene for Promoter Characterization

    PubMed Central

    Jiang, Shu-Ye; Vanitha, Jeevanandam; Bai, Yanan; Ramachandran, Srinivasan

    2014-01-01

    Several strategies have been developed to clone PCR fragments into desired vectors. However, most of commercially available T-vectors are not binary vectors and cannot be directly used for Agrobacterium-mediated plant genetic transformation. In this study, a novel binary T-vector was constructed by integrating two AhdI restriction sites into the backbone vector pCAMBIA 1300. The T-vector also contains a GFP reporter gene and thus, can be used to analyze promoter activity by monitoring the reporter gene. On the other hand, identification and characterization of various promoters not only benefit the functional annotation of their genes but also provide alternative candidates to be used to drive interesting genes for plant genetic improvement by transgenesis. More than 1,000 putative pollen-specific rice genes have been identified in a genome-wide level. Among them, 67 highly expressed genes were further characterized. One of the pollen-specific genes LOC_Os10g35930 was further surveyed in its expression patterns with more details by quantitative real-time reverse-transcription PCR (qRT-PCR) analysis. Finally, its promoter activity was further investigated by analyzing transgenic rice plants carrying the promoter::GFP cassette, which was constructed from the newly developed T-vector. The reporter GFP gene expression in these transgenic plants showed that the promoter was active only in mature but not in germinated pollens. PMID:25197968

  19. Determination of the core promoter regions of the Saccharomyces cerevisiae RPS3 gene.

    PubMed

    Joo, Yoo Jin; Kim, Jin-Ha; Baek, Joung Hee; Seong, Ki Moon; Lee, Jae Yung; Kim, Joon

    2009-01-01

    Ribosomal protein genes (RPG), which are scattered throughout the genomes of all eukaryotes, are subjected to coordinated expression. In yeast, the expression of RPGs is highly regulated, mainly at the transcriptional level. Recent research has found that many ribosomal proteins (RPs) function in multiple processes in addition to protein synthesis. Therefore, detailed knowledge of promoter architecture as well as gene regulation is important in understanding the multiple cellular processes mediated by RPGs. In this study, we investigated the functional architecture of the yeast RPS3 promoter and identified many putative cis-elements. Using beta-galactosidase reporter analysis and EMSA, the core promoter of RPS3 containing UASrpg and T-rich regions was corroborated. Moreover, the promoter occupancy of RPS3 by three transcription factors was confirmed. Taken together, our results further the current understanding of the promoter architecture and trans-elements of the Saccharomyces cerevisiae RPS3 gene. PMID:19853675

  20. A Genetic Approach to Promoter Recognition during Trans Induction of Viral Gene Expression

    NASA Astrophysics Data System (ADS)

    Coen, Donald M.; Weinheimer, Steven P.; McKnight, Steven L.

    1986-10-01

    Viral infection of mammalian cells entails the regulated induction of viral gene expression. The induction of many viral genes, including the herpes simplex virus gene encoding thymidine kinase (tk), depends on viral regulatory proteins that act in trans. Because recognition of the tk promoter by cellular transcription factors is well understood, its trans induction by viral regulatory proteins may serve as a useful model for the regulation of eukaryotic gene expression. A comprehensive set of mutations was therefore introduced into the chromosome of herpes simplex virus at the tk promoter to directly analyze the effects of promoter mutations on tk transcription. The promoter domains required for efficient tk expression under conditions of trans induction corresponded to those important for recognition by cellular transcription factors. Thus, trans induction of tk expression may be catalyzed initially by the interaction of viral regulatory proteins with cellular transcription factors.

  1. Divergent MLS1 Promoters Lie on a Fitness Plateau for Gene Expression.

    PubMed

    Bergen, Andrew C; Olsen, Gerilyn M; Fay, Justin C

    2016-05-01

    Qualitative patterns of gene activation and repression are often conserved despite an abundance of quantitative variation in expression levels within and between species. A major challenge to interpreting patterns of expression divergence is knowing which changes in gene expression affect fitness. To characterize the fitness effects of gene expression divergence, we placed orthologous promoters from eight yeast species upstream of malate synthase (MLS1) in Saccharomyces cerevisiae As expected, we found these promoters varied in their expression level under activated and repressed conditions as well as in their dynamic response following loss of glucose repression. Despite these differences, only a single promoter driving near basal levels of expression caused a detectable loss of fitness. We conclude that the MLS1 promoter lies on a fitness plateau whereby even large changes in gene expression can be tolerated without a substantial loss of fitness. PMID:26782997

  2. Divergent MLS1 Promoters Lie on a Fitness Plateau for Gene Expression

    PubMed Central

    Bergen, Andrew C.; Olsen, Gerilyn M.; Fay, Justin C.

    2016-01-01

    Qualitative patterns of gene activation and repression are often conserved despite an abundance of quantitative variation in expression levels within and between species. A major challenge to interpreting patterns of expression divergence is knowing which changes in gene expression affect fitness. To characterize the fitness effects of gene expression divergence, we placed orthologous promoters from eight yeast species upstream of malate synthase (MLS1) in Saccharomyces cerevisiae. As expected, we found these promoters varied in their expression level under activated and repressed conditions as well as in their dynamic response following loss of glucose repression. Despite these differences, only a single promoter driving near basal levels of expression caused a detectable loss of fitness. We conclude that the MLS1 promoter lies on a fitness plateau whereby even large changes in gene expression can be tolerated without a substantial loss of fitness. PMID:26782997

  3. Isolation and characterization of a polyubiquitin gene and its promoter region from Mesembryanthemum crystallinum.

    PubMed

    Azad, Muhammad Abul Kalam; Morita, Kunio; Ohnishi, Jun-ichi; Kore-eda, Shin

    2013-01-01

    Transcript levels of the polyubiquitin gene McUBI1 had been reported to be constant during Crassulacean acid metabolism (CAM) induction in the facultative CAM plant, Mesembryanthemum crystallinum. Here, we report the sequences of the full-length cDNA of McUBI1 and its promoter, and validation of the McUBI1 promoter as an internal control driving constitutive expression in transient assays using the dual-luciferase system to investigate the regulation of CAM-related gene expression. The McUBI1 promoter drove strong, constitutive expression during CAM induction. We compared the activities of this promoter with those of the cauliflower mosaic virus (CaMV) 35S promoter in detached C3- and CAM-performing M. crystallinum and tobacco leaves. We confirmed stable expression of the genes controlled by the McUBI1 promoter with far less variability than under the CaMV 35S promoter in M. crystallinum, whereas both promoters worked well in tobacco. We found the McUBI1 promoter more suitable than the CaMV 35S promoter as an internal control for transient expression assays in M. crystallinum. PMID:23470760

  4. Evaluation of a novel promoter from Populus trichocarpa for mature xylem tissue specific gene delivery.

    PubMed

    Nguyen, Van Phap; Cho, Jin-Seong; Choi, Young-Im; Lee, Sang-Won; Han, Kyung-Hwan; Ko, Jae-Heung

    2016-07-01

    Wood (i.e., secondary xylem) is an important raw material for many industrial applications. Mature xylem (MX) tissue-specific genetic modification offers an effective means to improve the chemical and physical properties of the wood. Here, we describe a promoter that drives strong gene expression in a MX tissue-specific manner. Using whole-transcriptome genechip analyses of different tissue types of poplar, we identified five candidate genes that had strong expression in the MX tissue. The putative promoter sequences of the five MX-specific genes were evaluated for their promoter activity in both transgenic Arabidopsis and poplar. Among them, we found the promoter of Potri.013G007900.1 (called the PtrMX3 promoter) had the strongest activity in MX and thus was further characterized. In the stem and root tissues of transgenic Arabidopsis plants, the PtrMX3 promoter activity was found exclusively in MX tissue. MX-specific activity of the promoter was reproduced in the stem tissue of transgenic poplar plants. The PtrMX3 promoter activity was not influenced by abiotic stresses or exogenously applied growth regulators, indicating the PtrMX3 promoter is bona fide MX tissue-specific. Our study provides a strong MX-specific promoter for MX-specific modifications of woody biomass. PMID:27038601

  5. Structural Properties of Gene Promoters Highlight More than Two Phenotypes of Diabetes

    PubMed Central

    Guja, Cristian

    2015-01-01

    Genome-wide association studies (GWAS) published in the last decade raised the number of loci associated with type 1 (T1D) and type 2 diabetes (T2D) to more than 50 for each of these diabetes phenotypes. The environmental factors seem to play an important role in the expression of these genes, acting through transcription factors that bind to promoters. Using the available databases we examined the promoters of various genes classically associated with the two main diabetes phenotypes. Our comparative analyses have revealed significant architectural differences between promoters of genes classically associated with T1D and T2D. Nevertheless, five gene promoters (about 16%) belonging to T1D and six gene promoters (over 19%) belonging to T2D have shown some intermediary structural properties, suggesting a direct relationship to either LADA (Latent Autoimmune Diabetes in Adults) phenotype or to non-autoimmune type 1 phenotype. The distribution of these promoters in at least three separate classes seems to indicate specific pathogenic pathways. The image-based patterns (DNA patterns) generated by promoters of genes associated with these three phenotypes support the clinical observation of a smooth link between specific cases of typical T1D and T2D. In addition, a global distribution of these DNA patterns suggests that promoters of genes associated with T1D appear to be evolutionary more conserved than those associated with T2D. Though, the image based patterns obtained by our method might be a new useful parameter for understanding the pathogenetic mechanism and the diabetogenic gene networks. PMID:26379145

  6. Tuning Gene Expression in Yarrowia lipolytica by a Hybrid Promoter Approach▿†

    PubMed Central

    Blazeck, John; Liu, Leqian; Redden, Heidi; Alper, Hal

    2011-01-01

    The development of strong and tunable promoter elements is necessary to enable metabolic and pathway engineering applications for any host organism. Here, we have expanded and generalized a hybrid promoter approach to produce libraries of high-expressing, tunable promoters in the nonconventional yeast Yarrowia lipolytica. These synthetic promoters are comprised of two modular components: the enhancer element and the core promoter element. By exploiting this basic promoter architecture, we have overcome native expression limitations and provided a strategy for both increasing the native promoter capacity and producing libraries for tunable gene expression in a cellular system with ill-defined genetic tools. In doing so, this work has created the strongest promoters ever reported for Y. lipolytica. Furthermore, we have characterized these promoters at the single-cell level through the use of a developed fluorescence-based assay as well as at the transcriptional and whole-cell levels. The resulting promoter libraries exhibited a range of more than 400-fold in terms of mRNA levels, and the strongest promoters in this set had 8-fold-higher fluorescence levels than those of typically used endogenous promoters. These results suggest that promoters in Y. lipolytica are enhancer limited and that this limitation can be partially or fully alleviated through the addition of tandem copies of upstream activation sequences (UASs). Finally, this work illustrates that tandem copies of UAS regions can serve as synthetic transcriptional amplifiers that may be generically used to increase the expression levels of promoters. PMID:21926196

  7. Identification of potential regulatory motifs in odorant receptor genes by analysis of promoter sequences

    PubMed Central

    Michaloski, Jussara S.; Galante, Pedro A.F.

    2006-01-01

    Mouse odorant receptors (ORs) are encoded by >1000 genes dispersed throughout the genome. Each olfactory neuron expresses one single OR gene, while the rest of the genes remain silent. The mechanisms underlying OR gene expression are poorly understood. Here, we investigated if OR genes share common cis-regulatory sequences in their promoter regions. We carried out a comprehensive analysis in which the upstream regions of a large number of OR genes were compared. First, using RLM-RACE, we generated cDNAs containing the complete 5′-untranslated regions (5′-UTRs) for a total number of 198 mouse OR genes. Then, we aligned these cDNA sequences to the mouse genome so that the 5′ structure and transcription start sites (TSSs) of the OR genes could be precisely determined. Sequences upstream of the TSSs were retrieved and browsed for common elements. We found DNA sequence motifs that are overrepresented in the promoter regions of the OR genes. Most motifs resemble O/E-like sites and are preferentially localized within 200 bp upstream of the TSSs. Finally, we show that these motifs specifically interact with proteins extracted from nuclei prepared from the olfactory epithelium, but not from brain or liver. Our results show that the OR genes share common promoter elements. The present strategy should provide information on the role played by cis-regulatory sequences in OR gene regulation. PMID:16902085

  8. Cloning and partial characterization of the mouse glutamine:fructose-6-phosphate amidotransferase (GFAT) gene promoter.

    PubMed Central

    Sayeski, P P; Wang, D; Su, K; Han, I O; Kudlow, J E

    1997-01-01

    Glutamine:fructose-6-phosphate amidotransferase (GFAT) is the enzyme that is rate limiting in the synthesis of glucosamine and hexosamines. Glucosamine has been proposed to contribute to the glucotoxicity of diabetes. Evidence that the gene encoding GFAT is transcriptionally regulated prompted us to clone and characterize its promoter. The position of the mouse GFAT promoter relative to the translational start site was located by primer extension and found to be 149 bp upstream of the translational start site. A 1.9 kb SacI fragment of the GFAT gene was found to contain the promoter and 88 bp of sequence downstream of the transcriptional start site. This promoter segment could drive expression of a luciferase reporter gene, could confer correct transcriptional initiation to the reporter and could confer the EGF-responsiveness previously observed in the native gene. The mouse GFAT promoter lacks a canonical TATA box and has several GC boxes within a highly GC-rich region. Deletional analysis of the promoter indicated that a proximal element extending to -120 relative to the transcriptional start site could confer reporter expression at a level of 57% of the 1.9 kb construct. Detailed analysis of this proximal region by DNase I footprinting, electrophoretic mobility shift assays and site-directed mutagenesis indicated that Sp1 binds to three elements in this proximal promoter segment and plays a vital role in regulation of transcription from this gene. PMID:9060444

  9. High magnetic field induced changes of gene expression in arabidopsis

    PubMed Central

    Paul, Anna-Lisa; Ferl, Robert J; Meisel, Mark W

    2006-01-01

    Background High magnetic fields are becoming increasingly prevalent components of non-invasive, biomedical imaging tools (such as MRI), thus, an understanding of the molecular impacts associated with these field strengths in biological systems is of central importance. The biological impact of magnetic field strengths up to 30 Tesla were investigated in this study through the use of transgenic Arabidopsis plants engineered with a stress response gene consisting of the alcohol dehydrogenase (Adh) gene promoter driving the β-glucuronidase (GUS) gene reporter. Methods Magnetic field induced Adh/GUS activity was evaluated with histochemical staining to assess tissue specific expression and distribution, and with quantitative, spectrofluometric assays to measure degree of activation. The evaluation of global changes in the Arabidopsis genome in response to exposure to high magnetic fields was facilitated with Affymetrix Gene Chip microarrays. Quantitative analyses of gene expression were performed with quantitative real-time polymerase-chain-reaction (qRT-PCR). Results Field strengths in excess of about 15 Tesla induce expression of the Adh/GUS transgene in the roots and leaves. From the microarray analyses that surveyed 8000 genes, 114 genes were differentially expressed to a degree greater than 2.5 fold over the control. These results were quantitatively corroborated by qRT-PCR examination of 4 of the 114 genes. Conclusion The data suggest that magnetic fields in excess of 15 Tesla have far-reaching effect on the genome. The wide-spread induction of stress-related genes and transcription factors, and a depression of genes associated with cell wall metabolism, are prominent examples. The roles of magnetic field orientation of macromolecules and magnetophoretic effects are discussed as possible factors that contribute to the mounting of this response. PMID:17187667

  10. Type 1 plaminogen activator inhibitor gene: Functional analysis and glucocorticoid regulation of its promoter

    SciTech Connect

    Van Zonneveld, A.J.; Curriden, S.A.; Loskutoff, D.J. )

    1988-08-01

    Plasminogen activator inhibitor type 1 is an important component of the fibrinolytic system and its biosynthesis is subject to complex regulation. To study this regulation at the level of transcription, the authors have identified and sequenced the promoter of the human plasminogen activator inhibitor type 1 gene. Nuclease protection experiments were performed by using endothelial cell mRNA and the transcription initiation (cap) site was established. Sequence analysis of the 5{prime} flanking region of the gene revealed a perfect TATA box at position {minus}28 to position {minus}23, the conserved distance from the cap site. Comparative functional studies with the firefly luciferase gene as a reporter gene showed that fragments derived from this 5{prime} flanking region exhibited high promoter activity when transfected into bovine aortic endothelial cells and mouse Ltk{sup {minus}} fibroblasts but were inactive when introduced into HeLa cells. These studies indicate that the fragments contain the plasminogen activator inhibitor type 1 promoter and that it is expressed in a tissue-specific manner. Although the fragments were also silent in rat FTO2B hepatoma cells, their promoter activity could be induced up to 40-fold with the synthetic glucocorticoid dexamethasone. Promoter deletion mapping experiments and studies involving the fusion of promoter fragments to a heterologous gene indicated that dexamethasone induction is mediated by a glucocorticoid responsive element with enhancer-like properties located within the region between nucleotides {minus}305 and +75 of the plasminogen activator inhibitor type 1 gene.

  11. Identification and characterization of the human XIST gene promoter: implications for models of X chromosome inactivation.

    PubMed Central

    Hendrich, B D; Plenge, R M; Willard, H F

    1997-01-01

    The XIST gene in both humans and mice is expressed exclusively from the inactive X chromosome and is required for X chromosome inactivation to occur early in development. In order to understand transcriptional regulation of the XIST gene, we have identified and characterized the human XIST promoter and two repeated DNA elements that modulate promoter activity. As determined by reporter gene constructs, the XIST minimal promoter is constitutively active at high levels in human male and female cell lines and in transgenic mice. We demonstrate that this promoter activity is dependent in vitro upon binding of the common transcription factors SP1, YY1 and TBP. We further identify two cis -acting repeated DNA sequences that influence reporter gene activity. First, DNA fragments containing a set of highly conserved repeats located within the 5'-end of XIST stimulate reporter activity 3-fold in transiently transfected cell lines. Second, a 450 bp alternating purine-pyrimidine repeat located 25 kb upstream of the XIST promoter partially suppresses promoter activity by approximately 70% in transient transfection assays. These results indicate that the XIST promoter is constitutively active and that critical steps in the X inactivation process must involve silencing of XIST on the active X chromosome by factors that interact with and/or recognize sequences located outside the minimal promoter. PMID:9185579

  12. Compensation for differences in gene copy number among yeast ribosomal proteins is encoded within their promoters

    PubMed Central

    Zeevi, Danny; Sharon, Eilon; Lotan-Pompan, Maya; Lubling, Yaniv; Shipony, Zohar; Raveh-Sadka, Tali; Keren, Leeat; Levo, Michal; Weinberger, Adina; Segal, Eran

    2011-01-01

    Coordinate regulation of ribosomal protein (RP) genes is key for controlling cell growth. In yeast, it is unclear how this regulation achieves the required equimolar amounts of the different RP components, given that some RP genes exist in duplicate copies, while others have only one copy. Here, we tested whether the solution to this challenge is partly encoded within the DNA sequence of the RP promoters, by fusing 110 different RP promoters to a fluorescent gene reporter, allowing us to robustly detect differences in their promoter activities that are as small as ∼10%. We found that single-copy RP promoters have significantly higher activities, suggesting that proper RP stoichiometry is indeed partly encoded within the RP promoters. Notably, we also partially uncovered how this regulation is encoded by finding that RP promoters with higher activity have more nucleosome-disfavoring sequences and characteristic spatial organizations of these sequences and of binding sites for key RP regulators. Mutations in these elements result in a significant decrease of RP promoter activity. Thus, our results suggest that intrinsic (DNA-dependent) nucleosome organization may be a key mechanism by which genomes encode biologically meaningful promoter activities. Our approach can readily be applied to uncover how transcriptional programs of other promoters are encoded. PMID:22009988

  13. The regulation of the Oct-1 gene transcription is mediated by two promoters.

    PubMed

    Pankratova, Elizaveta V; Sytina, Elena V; Luchina, Nadejda N; Krivega, Ivan V

    2003-07-01

    The ubiquitous transcription factor Oct-1 is a member of the POU domain family of regulatory proteins. Target genes controlled by Oct-1 include housekeeping genes, e.g. the genes encoding histon H2B or snRNAs, as well as tissue-specific genes, e.g. the genes encoding the light and heavy chains of immunoglobulines, some interleukins, and others. Oct-1 pre-mRNA may be spliced in several ways, resulting in production of several protein isoforms that may differ functionally. The 5'-end of the Oct-1 gene contains two exons-exon 1U and exon 1L that alternatively present in Oct-1 mRNA. We studied regulation of transcription of the Oct-1 gene using reporter gene assays of promoter-luciferase gene-constructs. It was shown that transcription of the Oct-1 gene is regulated by two promoters located upstream of the exon 1U and upstream of the exon 1L. The promoter located upstream of the exon 1U contains G/C-rich sequences and multiple Sp1 sites, while the promoter located upstream of the exon 1L contains A/T-rich motifs and autoregulation-related cis-elements: two octamer sites ATGCAAAT, two octamer related sites and multiple TAAT-core sites. Exons 1U and 1L in the human OTF-1 locus encoding the Oct-1 gene are located at the distance of 108 kbp. In the murine locus otf-1 the distance between exons 1U and 1L is 67 kbp. We suggest that the two promoters can differ functionally. PMID:12853155

  14. [Expression of gene aiiA carrying the promoter of gene cry3Aa in Bacillus thuringiensis].

    PubMed

    Zhu, Chen-Guang; Sun, Ming; Yu, Zi-Niu

    2003-07-01

    N-acyl-homoserine lactones (AHLs), are widely conserved signal molecules present in quorum-sensing systems of many Gram-negative bacteria. AHLs molecules mediate the expression of virulence genes of a range of bacterial pathogens. Recently, it has been reported that AiiA protein, which widely exists in Bacillus species, can inactivate the AHLs by hydrolyzing the lactone bond of AHLs, thus attenuate the diseases caused by the expression of virulence genes of bacterial pathogens. Bacillus thuringiensis, a type of Gram-positive bacteria, has been used extensively as a microbial insecticide in the last few decades. However, most of important insecticidal B. thuringiensis strains have not been exploited for bacterial disease control because they usually do not produce antibiotics that are effective against bacteria and fungi. The discovery of AiiA protein in B. thuringiensis shows the application potential of B. thuringiensis on biocontrol against bacterial diseases. In this study, in order to construct the B. thuringiensis recombinant strain that has high expression of AiiA protein, the promoter of insecticidal crystal protein coding gene cry3Aa of B. thuringiensis was selected. The promoter of gene cry3Aa is a non-sporulation promoter, it promotes the transcription earlier and longer than the promoters of other cry genes. The promoter of AiiA protein coding gene aiiA was replaced with the promoter of gene cry3Aa by overlapping PCR, resulting fusion gene pro3A-aiiA. The gene pro3A-aiiA was inserted into shuttle vector pHT304 at site BamH I / Sph I , resulting recombinant plasmid pBMB686. The plasmid pBMB686 was introduced into B. thuringiensis acrystalliferous strain BMB171, the resulting strain BMB686 had a higher and more stable expression level of protein AiiA comparing with the parental strain BMB171. Furthermore, the strain BMB686 exhibited stronger ability of AHLs inactivation and much more effective restraint to the potato's soft rot disease caused by Erwinia

  15. GUS Gene Expression Driven by A Citrus Promoter in Transgenic Tobacco and 'Valencia' Sweet Orange

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The objective of this work was the transformation of tobacco and ‘Valencia’ sweet orange with the GUS gene driven by the citrus phenylalanine ammonia-lyase (PAL) gene promoter (CsPP). Transformation was accomplished by co-cultivation of tobacco and ‘Valencia’ sweet orange explants with Agrobacteriu...

  16. The Mouse Solitary Odorant Receptor Gene Promoters as Models for the Study of Odorant Receptor Gene Choice

    PubMed Central

    Degl'Innocenti, Andrea

    2016-01-01

    Background In vertebrates, several anatomical regions located within the nasal cavity mediate olfaction. Among these, the main olfactory epithelium detects most conventional odorants. Olfactory sensory neurons, provided with cilia exposed to the air, detect volatile chemicals via an extremely large family of seven-transmembrane chemoreceptors named odorant receptors. Their genes are expressed in a monogenic and monoallelic fashion: a single allele of a single odorant receptor gene is transcribed in a given mature neuron, through a still uncharacterized molecular mechanism known as odorant receptor gene choice. Aim Odorant receptor genes are typically arranged in genomic clusters, but a few are isolated (we call them solitary) from the others within a region broader than 1 Mb upstream and downstream with respect to their transcript's coordinates. The study of clustered genes is problematic, because of redundancy and ambiguities in their regulatory elements: we propose to use the solitary genes as simplified models to understand odorant receptor gene choice. Procedures Here we define number and identity of the solitary genes in the mouse genome (C57BL/6J), and assess the conservation of the solitary status in some mammalian orthologs. Furthermore, we locate their putative promoters, predict their homeodomain binding sites (commonly present in the promoters of odorant receptor genes) and compare candidate promoter sequences with those of wild-caught mice. We also provide expression data from histological sections. Results In the mouse genome there are eight intact solitary genes: Olfr19 (M12), Olfr49, Olfr266, Olfr267, Olfr370, Olfr371, Olfr466, Olfr1402; five are conserved as solitary in rat. These genes are all expressed in the main olfactory epithelium of three-day-old mice. The C57BL/6J candidate promoter of Olfr370 has considerably varied compared to its wild-type counterpart. Within the putative promoter for Olfr266 a homeodomain binding site is predicted. As a

  17. Regulation of sesquiterpene cyclase gene expression. Characterization of an elicitor- and pathogen-inducible promoter.

    PubMed Central

    Yin, S; Mei, L; Newman, J; Back, K; Chappell, J

    1997-01-01

    The promoter for a tobacco (Nicotiana tabacum) sesquiterpene cyclase gene, a key regulatory step in sesquiterpene phytoalexin biosynthesis, has been analyzed. The EAS4 promoter was fused to the beta-glucuronidase (GUS) reporter gene, and the temporal and spatial expression patterns of GUS activity were examined in stably transformed plants and in transient expression assays using electroporated protoplasts of tobacco. No GUS activity was observed in any tissues under normal growth conditions. A low level of GUS activity was detected in wounded leaf, root, and stem tissues, whereas a much higher level was observed when these tissues were challenged with elicitors or microbial pathogens. The GUS expression pattern directed by the EAS4 promoter was identical to the induction patterns observed for the endogenous sesquiterpene cyclase genes. Neither exogenous salicylic acid nor methyl jasmonate induced GUS expression; and H2O2 induced GUS expression to only a limited extent. Although the EAS4 promoter contains cis-sequences resembling previously identified transcriptional control motifs, other cis-sequences important for quantitative and qualitative gene expression were identified by deletion and gain-of-function analyses. The EAS4 promoter differs from previously described pathogen-/elicitor-inducible promoters because it only supports inducible gene expression and directs unique spatial expression patterns. PMID:9342864

  18. Regulation of the Hansenula polymorpha maltase gene promoter in H. polymorpha and Saccharomyces cerevisiae1.

    PubMed

    Alamäe, Tiina; Pärn, Pille; Viigand, Katrin; Karp, Helen

    2003-11-01

    Hansenula polymorpha is an exception among methylotrophic yeasts because it can grow on the disaccharides maltose and sucrose. We disrupted the maltase gene (HPMAL1) in H. polymorpha 201 using homologous recombination. Resulting disruptants HP201HPMAL1Delta failed to grow on maltose and sucrose, showing that maltase is essential for the growth of H. polymorpha on both disaccharides. Expression of HPMAL1 in HP201HPMAL1Delta from the truncated variants of the promoter enabled us to define the 5'-upstream region as sufficient for the induction of maltase by disaccharides and its repression by glucose. Expression of the Saccharomyces cerevisiae maltase gene MAL62 was induced by maltose and sucrose, and repressed by glucose if expressed in HP201HPMAL1Delta from its own promoter. Similarly, the HPMAL1 promoter was recognized and correctly regulated by the carbon source in a S. cerevisiae maltase-negative mutant 100-1B. Therefore we suggest that the transcriptional regulators of S. cerevisiae MAL genes (MAL activator and Mig1 repressor) can affect the expression of the H. polymorpha maltase gene, and that homologues of these proteins may exist in H. polymorpha. Using the HPMAL1 gene as a reporter in a H. polymorpha maltase disruption mutant it was shown that the strength of the HPMAL1 promoter if induced by sucrose is quite comparable to the strength of the H. polymorpha alcohol oxidase promoter under conditions of methanol induction, revealing the biotechnological potential of the HPMAL1 promoter. PMID:14613881

  19. Different promoter affinities account for specificity in MYC-dependent gene regulation

    PubMed Central

    Lorenzin, Francesca; Benary, Uwe; Baluapuri, Apoorva; Walz, Susanne; Jung, Lisa Anna; von Eyss, Björn; Kisker, Caroline; Wolf, Jana; Eilers, Martin; Wolf, Elmar

    2016-01-01

    Enhanced expression of the MYC transcription factor is observed in the majority of tumors. Two seemingly conflicting models have been proposed for its function: one proposes that MYC enhances expression of all genes, while the other model suggests gene-specific regulation. Here, we have explored the hypothesis that specific gene expression profiles arise since promoters differ in affinity for MYC and high-affinity promoters are fully occupied by physiological levels of MYC. We determined cellular MYC levels and used RNA- and ChIP-sequencing to correlate promoter occupancy with gene expression at different concentrations of MYC. Mathematical modeling showed that binding affinities for interactions of MYC with DNA and with core promoter-bound factors, such as WDR5, are sufficient to explain promoter occupancies observed in vivo. Importantly, promoter affinity stratifies different biological processes that are regulated by MYC, explaining why tumor-specific MYC levels induce specific gene expression programs and alter defined biological properties of cells. DOI: http://dx.doi.org/10.7554/eLife.15161.001 PMID:27460974

  20. The Promoter of the Cereal VERNALIZATION1 Gene Is Sufficient for Transcriptional Induction by Prolonged Cold

    PubMed Central

    Casao, M. Cristina; Greenup, Aaron A.; Trevaskis, Ben

    2011-01-01

    The VERNALIZATION1 (VRN1) gene of temperate cereals is transcriptionally activated by prolonged cold during winter (vernalization) to promote flowering. To investigate the mechanisms controlling induction of VRN1 by prolonged cold, different regions of the VRN1 gene were fused to the GREEN FLUORESCENT PROTEIN (GFP) reporter and expression of the resulting gene constructs was assayed in transgenic barley (Hordeum vulgare). A 2 kb segment of the promoter of VRN1 was sufficient for GFP expression in the leaves and shoot apex of transgenic barley plants. Fluorescence increased at the shoot apex prior to inflorescence initiation and was subsequently maintained in the developing inflorescence. The promoter was also sufficient for low-temperature induction of GFP expression. A naturally occurring insertion in the proximal promoter, which is associated with elevated VRN1 expression and early flowering in some spring wheats, did not abolish induction of VRN1 transcription by prolonged cold, however. A translational fusion of the promoter and transcribed regions of VRN1 to GFP, VRN1::GFP, was localised to nuclei of cells at the shoot apex of transgenic barley plants. The distribution of VRN1::GFP at the shoot apex was similar to the expression pattern of the VRN1 promoter-GFP reporter gene. Fluorescence from the VRN1::GFP fusion protein increased in the developing leaves after prolonged cold treatment. These observations suggest that the promoter of VRN1 is targeted by mechanisms that trigger vernalization-induced flowering in economically important temperate cereal crops. PMID:22242122

  1. The promoter of the cereal VERNALIZATION1 gene is sufficient for transcriptional induction by prolonged cold.

    PubMed

    Alonso-Peral, Maria M; Oliver, Sandra N; Casao, M Cristina; Greenup, Aaron A; Trevaskis, Ben

    2011-01-01

    The VERNALIZATION1 (VRN1) gene of temperate cereals is transcriptionally activated by prolonged cold during winter (vernalization) to promote flowering. To investigate the mechanisms controlling induction of VRN1 by prolonged cold, different regions of the VRN1 gene were fused to the GREEN FLUORESCENT PROTEIN (GFP) reporter and expression of the resulting gene constructs was assayed in transgenic barley (Hordeum vulgare). A 2 kb segment of the promoter of VRN1 was sufficient for GFP expression in the leaves and shoot apex of transgenic barley plants. Fluorescence increased at the shoot apex prior to inflorescence initiation and was subsequently maintained in the developing inflorescence. The promoter was also sufficient for low-temperature induction of GFP expression. A naturally occurring insertion in the proximal promoter, which is associated with elevated VRN1 expression and early flowering in some spring wheats, did not abolish induction of VRN1 transcription by prolonged cold, however. A translational fusion of the promoter and transcribed regions of VRN1 to GFP, VRN1::GFP, was localised to nuclei of cells at the shoot apex of transgenic barley plants. The distribution of VRN1::GFP at the shoot apex was similar to the expression pattern of the VRN1 promoter-GFP reporter gene. Fluorescence from the VRN1::GFP fusion protein increased in the developing leaves after prolonged cold treatment. These observations suggest that the promoter of VRN1 is targeted by mechanisms that trigger vernalization-induced flowering in economically important temperate cereal crops. PMID:22242122

  2. Measurement of gene regulation in individual cells reveals rapid switching between promoter states.

    PubMed

    Sepúlveda, Leonardo A; Xu, Heng; Zhang, Jing; Wang, Mengyu; Golding, Ido

    2016-03-11

    In vivo mapping of transcription-factor binding to the transcriptional output of the regulated gene is hindered by probabilistic promoter occupancy, the presence of multiple gene copies, and cell-to-cell variability. We demonstrate how to overcome these obstacles in the lysogeny maintenance promoter of bacteriophage lambda, P(RM). We simultaneously measured the concentration of the lambda repressor CI and the number of messenger RNAs (mRNAs) from P(RM) in individual Escherichia coli cells, and used a theoretical model to identify the stochastic activity corresponding to different CI binding configurations. We found that switching between promoter configurations is faster than mRNA lifetime and that individual gene copies within the same cell act independently. The simultaneous quantification of transcription factor and promoter activity, followed by stochastic theoretical analysis, provides a tool that can be applied to other genetic circuits. PMID:26965629

  3. Cancer cell specific cytotoxic gene expression mediated by ARF tumor suppressor promoter constructs.

    PubMed

    Kurayoshi, Kenta; Ozono, Eiko; Iwanaga, Ritsuko; Bradford, Andrew P; Komori, Hideyuki; Ohtani, Kiyoshi

    2014-07-18

    In current cancer treatment protocols, such as radiation and chemotherapy, side effects on normal cells are major obstacles to radical therapy. To avoid these side effects, a cancer cell-specific approach is needed. One way to specifically target cancer cells is to utilize a cancer specific promoter to express a cytotoxic gene (suicide gene therapy) or a viral gene required for viral replication (oncolytic virotherapy). For this purpose, the selected promoter should have minimal activity in normal cells to avoid side effects, and high activity in a wide variety of cancers to obtain optimal therapeutic efficacy. In contrast to the AFP, CEA and PSA promoters, which have high activity only in a limited spectrum of tumors, the E2F1 promoter exhibits high activity in wide variety of cancers. This is based on the mechanism of carcinogenesis. Defects in the RB pathway and activation of the transcription factor E2F, the main target of the RB pathway, are observed in almost all cancers. Consequently, the E2F1 promoter, which is mainly regulated by E2F, has high activity in wide variety of cancers. However, E2F is also activated by growth stimulation in normal growing cells, suggesting that the E2F1 promoter may also be highly active in normal growing cells. In contrast, we found that the tumor suppressor ARF promoter is activated by deregulated E2F activity, induced by forced inactivation of pRB, but does not respond to physiological E2F activity induced by growth stimulation. We also found that the deregulated E2F activity, which activates the ARF promoter, is detected only in cancer cell lines. These observations suggest that ARF promoter is activated by E2F only in cancer cells and therefore may be more cancer cell-specific than E2F1 promoter to drive gene expression. We show here that the ARF promoter has lower activity in normal growing fibroblasts and shows higher cancer cell-specificity compared to the E2F1 promoter. We also demonstrate that adenovirus expressing HSV

  4. Taproot promoters cause tissue specific gene expression within the storage root of sugar beet.

    PubMed

    Oltmanns, Heiko; Kloos, Dorothee U; Briess, Waltraud; Pflugmacher, Maike; Stahl, Dietmar J; Hehl, Reinhard

    2006-08-01

    The storage root (taproot) of sugar beet (Beta vulgaris L.) originates from hypocotyl and primary root and contains many different tissues such as central xylem, primary and secondary cambium, secondary xylem and phloem, and parenchyma. It was the aim of this work to characterize the promoters of three taproot-expressed genes with respect to their tissue specificity. To investigate this, promoters for the genes Tlp, His1-r, and Mll were cloned from sugar beet, linked to reporter genes and transformed into sugar beet and tobacco. Reporter gene expression analysis in transgenic sugar beet plants revealed that all three promoters are active in the storage root. Expression in storage root tissues is either restricted to the vascular zone (Tlp, His1-r) or is observed in the whole organ (Mll). The Mll gene is highly organ specific throughout different developmental stages of the sugar beet. In tobacco, the Tlp and Mll promoters drive reporter gene expression preferentially in hypocotyl and roots. The properties of the Mll promoter may be advantageous for the modification of sucrose metabolism in storage roots. PMID:16482437

  5. Gene Delivery Strategies to Promote Spinal Cord Repair

    PubMed Central

    Walthers, Christopher M; Seidlits, Stephanie K

    2015-01-01

    Gene therapies hold great promise for the treatment of many neurodegenerative disorders and traumatic injuries in the central nervous system. However, development of effective methods to deliver such therapies in a controlled manner to the spinal cord is a necessity for their translation to the clinic. Although essential progress has been made to improve efficiency of transgene delivery and reduce the immunogenicity of genetic vectors, there is still much work to be done to achieve clinical strategies capable of reversing neurodegeneration and mediating tissue regeneration. In particular, strategies to achieve localized, robust expression of therapeutic transgenes by target cell types, at controlled levels over defined time periods, will be necessary to fully regenerate functional spinal cord tissues. This review summarizes the progress over the last decade toward the development of effective gene therapies in the spinal cord, including identification of appropriate target genes, improvements to design of genetic vectors, advances in delivery methods, and strategies for delivery of multiple transgenes with synergistic actions. The potential of biomaterials to mediate gene delivery while simultaneously providing inductive scaffolding to facilitate tissue regeneration is also discussed. PMID:25922572

  6. Correlation of clinical features and methylation status of MGMT gene promoter in glioblastomas.

    PubMed

    Blanc, J L; Wager, M; Guilhot, J; Kusy, S; Bataille, B; Chantereau, T; Lapierre, F; Larsen, C J; Karayan-Tapon, L

    2004-07-01

    In an effort to extend the potential relationship between the methylation status of MGMT promoter and response to CENU therapy, we examined the methylation status of MGMT promoter in 44 patients with glioblastomas. Tumor specimens were obtained during surgery before adjuvant treatment, frozen and stored at -80 degrees C until for DNA extraction process. DNA methylation patterns in the CpG island of the MGMT gene were determined in every tumor by methylation specific PCR (MSP). These results were then related to overall survival and response to alkylating agents using statistical analysis. Methylation of the MGMT promoter was detected in 68% of tumors, and 96.7% of methylated tumors exhibited also an unmethylated status. There was no relationship between the methylation status of the MGMT promoter and overall survival and response to alkylating agents. Our observations do not lead us to consider promoter methylation of MGMT gene as a prognostic factor of responsiveness to alkylating agents in glioblastomas. PMID:15332332

  7. Aberrant promoter methylation of multiple genes in sputum from individuals exposed to smoky coal emissions

    PubMed Central

    Liu, Yang; Lan, Qing; Shen, Min; Mumford, Judy; Keohavong, Phouthone

    2010-01-01

    Summary Aberrant methylation in the promoter region of cancer-related genes leads to gene transcriptional inactivation and plays an integral role in lung tumorigenesis. Recent studies demonstrated that promoter methylation was detected not only in lung tumors from patients with lung cancer but also in sputum of smokers without the disease, suggesting the potential for aberrant gene promoter methylation in sputum as a predictive marker for lung cancer. In the present study, we investigated promoter methylation of 4 genes frequently detected in lung tumors, including p16, MGMT, RASSF1A and DAPK genes, in sputum samples obtained from 107 individuals, including 34 never-smoking females and 73 mostly smoking males, who had no evidence of lung cancer but who were exposed to smoky coal emission in Xuan Wei County, China, where lung cancer rate is more than 6 times the Chinese national average rate. Forty nine of the individuals showed evidence of chronic bronchitis while the remaining 58 individuals showed no such a symptom. Promoter methylation of p16, MGMT, RASSF1A and DAPK was detected in 51.4% (55/107), 17.8% (19/107), 29.9% (32/107), and 15.9% (17/107) of the sputum samples from these individuals, respectively. There were no differences in promoter methylation frequencies of any of these genes according to smoking status or gender of the subjects or between individuals with chronic bronchitis and those without evidence of such a symptom. Therefore, individuals exposed to smoky coal emissions in this region harbored in their sputum frequent promoter methylation of these genes that have been previously found in lung tumors and implicated in lung cancer development. PMID:18751376

  8. Preferential Repair of DNA Double-strand Break at the Active Gene in Vivo*

    PubMed Central

    Chaurasia, Priyasri; Sen, Rwik; Pandita, Tej K.; Bhaumik, Sukesh R.

    2012-01-01

    Previous studies have demonstrated transcription-coupled nucleotide/base excision repair. We report here for the first time that DNA double-strand break (DSB) repair is also coupled to transcription. We generated a yeast strain by introducing a homing (Ho) endonuclease cut site followed by a nucleotide sequence for multiple Myc epitopes at the 3′ end of the coding sequence of a highly active gene, ADH1. This yeast strain also contains the Ho cut site at the nearly silent or poorly active mating type α (MATα) locus and expresses Ho endonuclease under the galactose-inducible GAL1 promoter. Using this strain, DSBs were generated at the ADH1 and MATα loci in galactose-containing growth medium that induced HO expression. Subsequently, yeast cells were transferred to dextrose-containing growth medium to stop HO expression, and the DSB repair was monitored at the ADH1 and MATα loci by PCR, using the primer pairs flanking the Ho cut sites. Our results revealed a faster DSB repair at the highly active ADH1 than that at the nearly silent MATα locus, hence implicating a transcription-coupled DSB repair at the active gene in vivo. Subsequently, we extended this study to another gene, PHO5 (carrying the Ho cut site at its coding sequence), under transcriptionally active and inactive growth conditions. We found a fast DSB repair at the active PHO5 gene in comparison to its inactive state. Collectively, our results demonstrate a preferential DSB repair at the active gene, thus supporting transcription-coupled DSB repair in living cells. PMID:22910905

  9. Expression in fibroblasts and in live animals of Entamoeba histolytica polypeptides EhCP112 and EhADH112.

    PubMed

    Madriz, Xochil; Martínez, Máximo B; Rodríguez, Mario A; Sierra, Gustavo; Martínez-López, Carolina; Riverón, Ana M; Flores, Leopoldo; Orozco, Esther

    2004-05-01

    EhCPADH is an immunogenic, heterodimeric protein that is formed by EhCP112 (cysteine protease) and EhADH112 (adhesin), polypeptides involved in Entamoeba histolytica's cytopathic effect, target-cell adherence and phagocytosis. The EhCPADH complex is located in the plasma membrane and cytoplasmic vacuoles. Here, the independent expression of EhCP112 and EhADH112 in fibroblasts and hamsters was analysed. Also investigated was the immunological response in animals independently inoculated with plasmid pcDNA-Ehcp112, which carries the complete cysteine protease-encoding gene, or with plasmid pcDNA-Ehadh112, which carries the C terminus of the adhesin-encoding gene, or with a mixture of both. Both proteins were expressed in the plasma membranes of the transfected fibroblasts. EhCP112 was toxic for the mammalian cells. Proteins were also independently expressed in hamsters after inoculation with the plasmids. Their expression was indirectly evaluated by the presence of antibodies in the inoculated animals. Remarkably, co-immunization of the animals with the two DNA plasmids resulted in an earlier and higher anti-E. histolytica IgG induction than immunization with separate plasmids. In contrast, the cellular immune response was not noticeably improved by the plasmid mixture. Interestingly, protection against liver abscesses was detected only in animals that received the plasmid mixture and no protection was observed in hamsters independently inoculated with plasmid pcDNA-Ehcp112 or pcDNA-Ehadh112. PMID:15133088

  10. Methylation Status of Vitamin D Receptor Gene Promoter in Benign and Malignant Adrenal Tumors

    PubMed Central

    Pilon, Catia; Rebellato, Andrea; Urbanet, Riccardo; Guzzardo, Vincenza; Cappellesso, Rocco; Sasano, Hironobu; Fassina, Ambrogio

    2015-01-01

    We previously showed a decreased expression of vitamin D receptor (VDR) mRNA/protein in a small group of adrenocortical carcinoma (ACC) tissues, suggesting the loss of a protective role of VDR against malignant cell growth in this cancer type. Downregulation of VDR gene expression may result from epigenetics events, that is, methylation of cytosine nucleotide of CpG islands in VDR gene promoter. We analyzed methylation of CpG sites in the VDR gene promoter in normal adrenals and adrenocortical tumor samples. Methylation of CpG-rich 5′ regions was assessed by bisulfite sequencing PCR using bisulfite-treated DNA from archival microdissected paraffin-embedded adrenocortical tissues. Three normal adrenals and 23 various adrenocortical tumor samples (15 adenomas and 8 carcinomas) were studied. Methylation in the promoter region of VDR gene was found in 3/8 ACCs, while no VDR gene methylation was observed in normal adrenals and adrenocortical adenomas. VDR mRNA and protein levels were lower in ACCs than in benign tumors, and VDR immunostaining was weak or negative in ACCs, including all 3 methylated tissue samples. The association between VDR gene promoter methylation and reduced VDR gene expression is not a rare event in ACC, suggesting that VDR epigenetic inactivation may have a role in adrenocortical carcinogenesis. PMID:26843863

  11. Alternative promoters are used for genes within maize chloroplast polycistronic transcription units.

    PubMed

    Haley, J; Bogorad, L

    1990-04-01

    Many chloroplast genes are co-transcribed in polycistronic transcription units that give rise to numerous overlapping RNAs, but the significance of this pattern of transcript accumulation is not understood. An analysis of the transcripts of the adjacent and divergent maize psbE-psbF-psbL-ORF40 and ORF31-petE-ORF42 gene clusters indicates that transcription initiation at alternative promoters contributes to the generation of overlapping RNAs for both clusters. Furthermore, developmentally varying transcript ratios for the ORF31-petE-ORF42 gene cluster are determined at least in part by selective promoter usage. During light-induced plastid maturation, increased levels of primarily monocistronic petE transcripts accumulate from a promoter upstream of the internal petE gene. Dark-predominant and non-light-responsive bi- and tricistronic transcripts result from transcription initiation upstream of ORF31, the proximal gene of the cluster. In addition to the transcriptional overlap within gene clusters, divergent transcription units for the two gene clusters overlap and reciprocal antisense RNAs accumulate. The organization of the transcription units in this region raises the possibility of promoter interdependence or other functional interaction between transcription units. PMID:2152119

  12. Mineral exploration, Mahd adh Dhahab District, Kingdom of Saudi Arabia

    USGS Publications Warehouse

    Worl, Ronald G.

    1978-01-01

    Mahd adh Dhahab is the largest of numerous ancient gold mines scattered through the Precambrian shield of Saudi Arabia and the only one with recent production. During the period 1939-54, 765,768 fine ounces of gold and 1,002,029 ounces of silver were produced from the mines by the Saudi Arabian Mining Syndicate. Ore minerals at Mahd adh Dhahab include free gold and silver, tellurides, sphalerite, and chalcopyrite in and associated with a system of north-trending quartz veins and quartz veinlet stockworks. Pyrite is a common sulfide gangue mineral. Country rocks are a north dipping sequence of pyroclastic and transported pyroclastic rocks of the Hulayfah Group that are locally highly silicified and potassium-feldspathized. The prime target for this exploration program was a north-trending zone of quartz veins and breccias, faults, alteration, and metalization approximately 400 m wide and 1000 m long. The ancient and recent mine workings are located in the northern part of this zone. Although the quartz veins and alteration cut all lithologies, the major metalization is confined to the intersection of veins and agglomerate. Ten holes were diamond drilled to explore geochemical, geological, and geophysical targets in the area. A significant new zone of metalization was discovered 700 m south of the ancient and recent mine workings and within the same major zone of quartz veins, alteration, and faults. Metalization in this southern mineralized zone is at the intersection of the quartz veins and a distinctive and highly altered agglomerate. The total zone of vein and agglomerate intercept is potentially metalized and comprises a block of ground 40 m thick and 400 m wide along the strike of the agglomerate and projected downdip 250 m. Tonnage of this block is 17.2 million tons. The explored zone, approximately 25 percent of the potentially metalized rock, has a potential resource of 1.1 million tons containing 27 g/t gold and 73 g/t silver.

  13. A viral satellite DNA vector-induced transcriptional gene silencing via DNA methylation of gene promoter in Nicotiana benthamiana.

    PubMed

    Ju, Zheng; Wang, Lei; Cao, Dongyan; Zuo, Jinhua; Zhu, Hongliang; Fu, Daqi; Luo, Yunbo; Zhu, Benzhong

    2016-09-01

    Virus-induced gene silencing (VIGS) has been widely used for plant functional genomics study at the post-transcriptional level using various DNA or RNA viral vectors. However, while virus-induced transcriptional gene silencing (VITGS) via DNA methylation of gene promoter was achieved using several plant RNA viral vectors, it has not yet been done using a satellite DNA viral vector. In this study, a viral satellite DNA associated with tomato yellow leaf curl China virus (TYLCCNV), which has been modified as a VIGS vector in previous research, was developed as a VITGS vector. Firstly, the viral satellite DNA VIGS vector was further optimized to a more convenient p1.7A+2mβ vector with high silencing efficiency of the phytoene desaturase (PDS) gene in Nicotiana benthamiana plants. Secondly, the constructed VITGS vector (TYLCCNV:35S), which carried a portion of the cauliflower mosaic virus 35S promoter, could successfully induce heritable transcriptional gene silencing (TGS) of the green fluorescent protein (GFP) gene in the 35S-GFP transgenic N. benthamiana line 16c plants. Moreover, bisulfite sequencing results revealed higher methylated cytosine residues at CG, CHG and CHH sites of the 35S promoter sequence in TYLCCNV:35S-inoculated plants than in TYLCCNV-inoculated line 16c plants (control). Overall, these results demonstrated that the viral satellite DNA vector could be used as an effective VITGS vector to study DNA methylation in plant genomes. PMID:27422476

  14. Promoter library designed for fine-tuned gene expression in Pichia pastoris

    PubMed Central

    Hartner, Franz S.; Ruth, Claudia; Langenegger, David; Johnson, Sabrina N.; Hyka, Petr; Lin-Cereghino, Geoffrey P.; Lin-Cereghino, Joan; Kovar, Karin; Cregg, James M.; Glieder, Anton

    2008-01-01

    Although frequently used as protein production host, there is only a limited set of promoters available to drive the expression of recombinant proteins in Pichia pastoris. Fine-tuning of gene expression is often needed to maximize product yield and quality. However, for efficient knowledge-based engineering, a better understanding of promoter function is indispensable. Consequently, we created a promoter library by deletion and duplication of putative transcription factor-binding sites within the AOX1 promoter (PAOX1) sequence. This first library initially spanned an activity range between ∼6% and >160% of the wild-type promoter activity. After characterization of the promoter library employing a green fluorescent protein (GFP) variant, the new regulatory toolbox was successfully utilized in a ‘real case’, i.e. the expression of industrial enzymes. Characterization of the library under repressing, derepressing and inducing conditions displayed at least 12 cis-acting elements involved in PAOX1-driven high-level expression. Based on this deletion analysis, novel short artificial promoter variants were constructed by combining cis-acting elements with basal promoter. In addition to improving yields and quality of heterologous protein production, the new PAOX1 synthetic promoter library constitutes a basic toolbox to fine-tune gene expression in metabolic engineering and sequential induction of protein expression in synthetic biology. PMID:18539608

  15. Promoter sequence of 3-phosphoglycerate kinase gene 1 of lactic acid-producing fungus rhizopus oryzae and a method of expressing a gene of interest in fungal species

    DOEpatents

    Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR

    2002-10-15

    The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 1 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.

  16. Promoter sequence of 3-phosphoglycerate kinase gene 2 of lactic acid-producing fungus rhizopus oryzae and a method of expressing a gene of interest in fungal species

    DOEpatents

    Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR

    2003-03-04

    The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 2 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.

  17. Cancer cell specific cytotoxic gene expression mediated by ARF tumor suppressor promoter constructs

    SciTech Connect

    Kurayoshi, Kenta; Ozono, Eiko; Iwanaga, Ritsuko; Bradford, Andrew P.; Komori, Hideyuki; Ohtani, Kiyoshi

    2014-07-18

    Highlights: • ARF promoter showed higher responsiveness to deregulated E2F activity than the E2F1 promoter. • ARF promoter showed higher cancer cell-specificity than E2F1 promoter to drive gene expression. • HSV-TK driven by ARF promoter showed higher cancer cell-specific cytotoxicity than that driven by E2F1 promoter. - Abstract: In current cancer treatment protocols, such as radiation and chemotherapy, side effects on normal cells are major obstacles to radical therapy. To avoid these side effects, a cancer cell-specific approach is needed. One way to specifically target cancer cells is to utilize a cancer specific promoter to express a cytotoxic gene (suicide gene therapy) or a viral gene required for viral replication (oncolytic virotherapy). For this purpose, the selected promoter should have minimal activity in normal cells to avoid side effects, and high activity in a wide variety of cancers to obtain optimal therapeutic efficacy. In contrast to the AFP, CEA and PSA promoters, which have high activity only in a limited spectrum of tumors, the E2F1 promoter exhibits high activity in wide variety of cancers. This is based on the mechanism of carcinogenesis. Defects in the RB pathway and activation of the transcription factor E2F, the main target of the RB pathway, are observed in almost all cancers. Consequently, the E2F1 promoter, which is mainly regulated by E2F, has high activity in wide variety of cancers. However, E2F is also activated by growth stimulation in normal growing cells, suggesting that the E2F1 promoter may also be highly active in normal growing cells. In contrast, we found that the tumor suppressor ARF promoter is activated by deregulated E2F activity, induced by forced inactivation of pRB, but does not respond to physiological E2F activity induced by growth stimulation. We also found that the deregulated E2F activity, which activates the ARF promoter, is detected only in cancer cell lines. These observations suggest that ARF promoter

  18. Detection of prion gene promoter and intron1 indel polymorphisms in Anatolian water buffalo (Bubalus bubalis).

    PubMed

    Oztabak, K; Ozkan, E; Soysal, I; Paya, I; Un, C

    2009-12-01

    Bovine spongiform encephalopathy (BSE) is a fatal disease caused by miss folded prion protein. Studies in the cattle, comparing genetic data from BSE diseased and healthy animals have shown that indel polymorphisms in the promoter and intron 1 of PRNP gene were associated with disease susceptibility. Several studies were conducted to find out allele and genotypic frequencies of indel polymorphisms in promoter and intron 1 of the cattle PRNP gene. Unlike domestic cattle and bison, no indel polymorphisms of the PRNP promoter and intron 1 were examined in any population of the water buffalo (Bubalus bubalis). Aim of this study was to analyse frequencies of allele, genotype, and haplotype of the indel polymorphisms (23 bp indel in promoter and 12 bp indel in intron 1) in prion protein coding gene (PRNP) of water buffalo. Therefore a PCR based procedure, previously used in cattle to detect indel polymorphisms of PRNP promoter and intron 1 locus, was applied to 106 Anatolian water buffalo DNAs. Our results have revealed high frequency of in variants and in23/in12 haplotype for PRNP promoter and intron 1 indel polymorphisms in water buffalo. The results of the study have demonstrated that frequencies of allele, genotype, and haplotype of the indel polymorphisms in PRNP gene of the Anatolian water buffalo are significantly different those from cattle and bison PRNP indel polymorphisms. PMID:19912420

  19. The TATA-less promoter of VP1, a plant gene controlling seed germination.

    PubMed

    Carrari, F; Frankel, N; Lijavetzky, D; Benech-Arnold, R; Sánchez, R; Iusem, N D

    2001-01-01

    Vp1 is a seed-specific gene involved in the control of dormancy and germination. We here present the complete sequence of the sorghum vp1 promoter/enhancer region highlighting its main features, especially the lack of canonical TATA and CAAT boxes and the presence of elements responsive to abscisic acid and light. The region closest to the start of transcription is highly homologous to the partial proximal sequence reported for the maize vp1 promoter. This region is interrupted by a 57-nt stretch containing 14 CT microsatellite repeats. We observed a poor overall homology to the promoter from abi3 gene, the Arabidopsis counterpart bearing a similar coding sequence. However, there exists a high degree of homology (89%) between a TATA-rich 103-bp stretch of the sorghum vp1 promoter located about 700 nt upstream of the startpoint and miniature inverted transposable elements (MITEs) interspersed within the sorghum seed-specific kafirin cluster. This sorghum MITE-like element displays considerable homology (68%) to the TATA-less promoter from the sorghum NADP-malate dehydrogenase gene and lesser similarity to the Tourist, Pilgrim and Batuta MITEs previously identified within the promoter from the maize Abp1 (auxin-binding protein) gene. PMID:11761708

  20. Angelica Sinensis Polysaccharides Stimulated UDP-Sugar Synthase Genes through Promoting Gene Expression of IGF-1 and IGF1R in Chondrocytes: Promoting Anti-Osteoarthritic Activity

    PubMed Central

    Wen, Yinxian; Li, Jing; Tan, Yang; Qin, Jun; Xie, Xianfei; Wang, Linlong; Mei, Qibing; Wang, Hui; Magdalou, Jacques; Chen, Liaobin

    2014-01-01

    Background Osteoarthritis (OA) is a chronic joints disease characterized by progressive degeneration of articular cartilage due to the loss of cartilage matrix. Previously, we found, for the first time, that an acidic glycan from Angelica Sinensis Polysaccharides (APSs), namely the APS-3c, could protect rat cartilage from OA due to promoting glycosaminoglycan (GAG) synthesis in chondrocytes. In the present work, we tried to further the understanding of ASP-3c’s anti-OA activity. Methodology/Principal Findings Human primary chondrocytes were treated with APS-3c or/and recombinant human interleukin 1β (IL-1β). It turned out that APS-3c promoted synthesis of UDP-xylose and GAG, as well as the gene expression of UDP-sugar synthases (USSs), insulin like growth factor 1 (IGF1) and IGF1 receptor (IGF1R), and attenuated the degenerative phenotypes, suppressed biosynthesis of UDP-sugars and GAG, and inhibited the gene expression of USSs, IGF1 and IGF1R induced by IL-1β. Then, we induced a rat OA model with papain, and found that APS-3c also stimulated GAG synthesis and gene expression of USSs, IGF1 and IGF1R in vivo. Additionally, recombinant human IGF1 and IGF1R inhibitor NP-AEW541 were applied to figure out the correlation between stimulated gene expression of USSs, IGF1 and IGF1R induced by APS-3c. It tuned out that the promoted GAG synthesis and USSs gene expression induced by APS-3c was mediated by the stimulated IGF1 and IGF1R gene expression, but not through directly activation of IGF1R signaling pathway. Conclusions/Significances We demonstrated for the first time that APS-3c presented anti-OA activity through stimulating IGF-1 and IGF1R gene expression, but not directly activating the IGF1R signaling pathway, which consequently promoted UDP-sugars and GAG synthesis due to up-regulating gene expression of USSs. Our findings presented a better understanding of APS-3c’s anti-OA activity and suggested that APS-3c could potentially be a novel therapeutic agent

  1. Efficient expression of protein coding genes from the murine U1 small nuclear RNA promoters.

    PubMed Central

    Bartlett, J S; Sethna, M; Ramamurthy, L; Gowen, S A; Samulski, R J; Marzluff, W F

    1996-01-01

    Few promoters are active at high levels in all cells. Of these, the majority encode structural RNAs transcribed by RNA polymerases I or III and are not accessible for the expression of proteins. An exception are the small nuclear RNAs (snRNAs) transcribed by RNA polymerase II. Although snRNA biosynthesis is unique and thought not to be compatible with synthesis of functional mRNA, we have tested these promoters for their ability to express functional mRNAs. We have used the murine U1a and U1b snRNA gene promoters to express the Escherichia coli lacZ gene and the human alpha-globin gene from either episomal or integrated templates by transfection, or infection into a variety of mammalian cell types. Equivalent expression of beta-galactosidase was obtained from < 250 nucleotides of 5'-flanking sequence containing the complete promoter of either U1 snRNA gene or from the 750-nt cytomegalovirus promoter and enhancer regions. The mRNA was accurately initiated at the U1 start site, efficiently spliced and polyadenylylated, and localized to polyribosomes. Recombinant adenovirus containing the U1b-lacZ chimeric gene transduced and expressed beta-galactosidase efficiently in human 293 cells and airway epithelial cells in culture. Viral vectors containing U1 snRNA promoters may be an attractive alternative to vectors containing viral promoters for persistent high-level expression of therapeutic genes or proteins. Images Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:8799116

  2. The 14-3-3 gene expression specificity in response to stress is promoter-dependent.

    PubMed

    Aksamit, Anna; Korobczak, Alina; Skala, Jacek; Lukaszewicz, Marcin; Szopa, Jan

    2005-10-01

    Genomic clone coding for the 16R isoform of 14-3-3 proteins from potato plants has recently been described. This paper reports on 20R-gene isolation and analysis, and compares two isoforms. The northern blot analysis of mRNA of the 20R 14-3-3 isoform suggests its similarity to 16R. Vascular tissue-specific expression and age-dependent synthesis in potato leaves has been detected in both promoters. Screening of the potato genomic library using 20R cDNA isoform resulted in identification and isolation of the corresponding gene. This gene contains four exons and three introns. Inspecting the promoter sequence of the 20R isoform revealed several boxes important for the regulation of gene expression. The strongest GUS expression in transgenic potato plants transformed with the uidA reporter gene under the 20R promoter has been found in young leaf and stem vascular tissue, root tips, pollen and ovules. Mature fragments exhibit a significant decrease in GUS staining, which suggests age-dependent promoter activity. The analysis of transgenic plants transformed with 20R-GUS in contrast to 16R-GUS has revealed strong activation of the 20R promoter by metal ions and NaCl. Instead the 16R promoter is strongly affected by virus and salicylic acid treatments. The only factor, which strongly induced both promoters, was abscisic acid. It is thus suggested that promoter domain composition is the main factor differentiating the appearance of 14-3-3 isoforms. PMID:16081528

  3. Simultaneous analysis of the bidirectional African cassava mosaic virus promoter activity using two different luciferase genes.

    PubMed

    Frey, P M; Schärer-Hernández, N G; Fütterer, J; Potrykus, I; Puonti-Kaerlas, J

    2001-03-01

    The expression of geminivirus genes is controlled by bidirectional promoters which are located in the large intergenic region of the circular DNA genomes and specifically regulated by virus encoded proteins. In order to study the simultaneous regulation of both orientations of the DNA A and DNA B promoters of African cassava mosaic virus (ACMV), they were cloned between two different luciferase genes with the firefly luciferase gene in complementary-sense and the Renilla luciferase gene in virion-sense orientation. The regulation of the ACMV promoters by proteins encoded by the complete DNA A, as well as by the individually expressed transactivator (TrAP) or replication-associated (Rep) proteins was assessed in tobacco and cassava protoplasts using dual luciferase assays. In addition, the regulation of the DNA A promoter integrated into tobacco genome was also assessed. The results show that TrAP activates virion-sense expression strongly both in cassava and tobacco protoplasts, but not in transgenic tobacco plants. In contrast to this, DNA A encoded proteins activate virion-sense expression both in protoplasts and in transgenic plants. At the same time they reduce the expression of the complementary-sense Rep gene on DNA A but activate the expression of the complementary-sense movement protein (MPB) gene on DNA B. The degree of MBP activation is higher in cassava than in tobacco protoplasts, indicating that the plant host also influences the promoter strength. Transient transformation experiments using linearized DNA indicate that the different regulation of the ACMV DNA A promoter in protoplasts and transgenic plants could be due to different DNA curvature in free plasmids and in genes integrated in plant genomic DNA. PMID:11324760

  4. The influence of promoter architectures and regulatory motifs on gene expression in Escherichia coli.

    PubMed

    Rydenfelt, Mattias; Garcia, Hernan G; Cox, Robert Sidney; Phillips, Rob

    2014-01-01

    The ability to regulate gene expression is of central importance for the adaptability of living organisms to changes in their external and internal environment. At the transcriptional level, binding of transcription factors (TFs) in the promoter region can modulate the transcription rate, hence making TFs central players in gene regulation. For some model organisms, information about the locations and identities of discovered TF binding sites have been collected in continually updated databases, such as RegulonDB for the well-studied case of E. coli. In order to reveal the general principles behind the binding-site arrangement and function of these regulatory architectures we propose a random promoter architecture model that preserves the overall abundance of binding sites to identify overrepresented binding site configurations. This model is analogous to the random network model used in the study of genetic network motifs, where regulatory motifs are identified through their overrepresentation with respect to a "randomly connected" genetic network. Using our model we identify TF pairs which coregulate operons in an overrepresented fashion, or individual TFs which act at multiple binding sites per promoter by, for example, cooperative binding, DNA looping, or through multiple binding domains. We furthermore explore the relationship between promoter architecture and gene expression, using three different genome-wide protein copy number censuses. Perhaps surprisingly, we find no systematic correlation between the number of activator and repressor binding sites regulating a gene and the level of gene expression. A position-weight-matrix model used to estimate the binding affinity of RNA polymerase (RNAP) to the promoters of activated and repressed genes suggests that this lack of correlation might in part be due to differences in basal transcription levels, with repressed genes having a higher basal activity level. This quantitative catalogue relating promoter

  5. Characterization of promoter sequence of toll-like receptor genes in Vechur cattle

    PubMed Central

    Lakshmi, R.; Jayavardhanan, K. K.; Aravindakshan, T. V.

    2016-01-01

    Aim: To analyze the promoter sequence of toll-like receptor (TLR) genes in Vechur cattle, an indigenous breed of Kerala with the sequence of Bos taurus and access the differences that could be attributed to innate immune responses against bovine mastitis. Materials and Methods: Blood samples were collected from Jugular vein of Vechur cattle, maintained at Vechur cattle conservation center of Kerala Veterinary and Animal Sciences University, using an acid-citrate-dextrose anticoagulant. The genomic DNA was extracted, and polymerase chain reaction was carried out to amplify the promoter region of TLRs. The amplified product of TLR2, 4, and 9 promoter regions was sequenced by Sanger enzymatic DNA sequencing technique. Results: The sequence of promoter region of TLR2 of Vechur cattle with the B. taurus sequence present in GenBank showed 98% similarity and revealed variants for four sequence motifs. The sequence of the promoter region of TLR4 of Vechur cattle revealed 99% similarity with that of B. taurus sequence but not reveals significant variant in motifregions. However, two heterozygous loci were observed from the chromatogram. Promoter sequence of TLR9 gene also showed 99% similarity to B. taurus sequence and revealed variants for four sequence motifs. Conclusion: The results of this study indicate that significant variation in the promoter of TLR2 and 9 genes in Vechur cattle breed and may potentially link the influence the innate immunity response against mastitis diseases. PMID:27397987

  6. Enhancer activity of Helitron in sericin-1 gene promoter from Bombyx mori.

    PubMed

    Huang, Ke; Li, Chun-Feng; Wu, Jie; Wei, Jun-Hong; Zou, Yong; Han, Min-Jin; Zhou, Ze-Yang

    2016-06-01

    Sericin is a kind of water-soluble protein expressed specifically in the middle silk gland of Bombyx mori. When the sericin-1 gene promoter was cloned and a transgenic vector was constructed to express a foreign protein, a specific Helitron, Bmhel-8, was identified in the sericin-1 gene promoter sequence in some genotypes of Bombyx mori and Bombyx mandarina. Given that the Bmhel-8 Helitron transposon was present only in some genotypes, it could be the source of allelic variation in the sericin-1 promoter. The length of the sericin-1 promoter sequence is approximately 1063 or 643 bp. The larger size of the sequence or allele is ascribed to the presence of Bmhel-8. Silkworm genotypes can be homozygous for either the shorter or larger promoter sequence or heterozygous, containing both alleles. Bmhel-8 in the sericin-1 promoter exhibits enhancer activity, as demonstrated by a dual-luciferase reporter system in BmE cell lines. Furthermore, Bmhel-8 displays enhancer activity in a sericin-1 promoter-driven gene expression system but does not regulate the tissue-specific expression of sericin-1. PMID:27067405

  7. Cloning and characterizing of the murine IRF-3 gene promoter region.

    PubMed

    Xu, Hua-Guo; Liu, Lifei; Gao, Shan; Jin, Rui; Ren, Wei; Zhou, Guo-Ping

    2016-08-01

    The interferon regulatory factor 3 (IRF-3) plays essential roles in inflammation and immune response. Here, we cloned the nucleotide sequence of the 5'-flanking region of the murine IRF-3 gene (mIRF-3) and characterized the molecular mechanisms controlling the mIRF-3 transcriptional activity in NIH3T3 cells. Analyses of a series of 5' deletion constructs demonstrated that a 301 bp region (-255/+46) of the mIRF-3 gene is sufficient for full promoter activity. This region contains IK1, Egr2, Cmyb, E2F1 and YY1 putative transcription factor binding sites. Mutation of Egr2 or YY1 site led to 52-68 % decrease of the mIRF-3 promoter activity, and double Egr2 and YY1 mutation reduced the promoter activity to 20 % of the wild-type promoter activity. Furthermore, knockingdown of endogenous Egr2 or YY1 by a siRNA strategy markedly inhibited the mIRF-3 promoter activity. Chromatin immunoprecipitation assays showed that Egr2 and YY1 interact with the mIRF-3 promoter in vivo. These results suggested that the basal promoter activity of the mIRF-3 gene is regulated by transcription factors Egr2 and YY1 in NIH3T3 cells. PMID:26740329

  8. Interference in transcription of overexpressed genes by promoter-proximal downstream sequences.

    PubMed

    Turchinovich, A; Surowy, H M; Tonevitsky, A G; Burwinkel, B

    2016-01-01

    Despite a high sequence homology among four human RNAi-effectors Argonaute proteins and their coding sequences, the efficiency of ectopic overexpression of AGO3 and AGO4 coding sequences in human cells is greatly reduced as compared to AGO1 and AGO2. While investigating this phenomenon, we documented the existence of previously uncharacterized mechanism of gene expression regulation, which is manifested in greatly varying basal transcription levels from the RNApolII promoters depending on the promoter-proximal downstream sequences. Specifically, we show that distinct overexpression of Argonaute coding sequences cannot be explained by mRNA degradation in the cytoplasm or nucleus, and exhibits on transcriptional level. Furthermore, the first 1000-2000 nt located immediately downstream the promoter had the most critical influence on ectopic gene overexpression. The transcription inhibiting effect, associated with those downstream sequences, subsided with increasing distance to the promoter and positively correlated with promoter strength. We hypothesize that the same mechanism, which we named promoter proximal inhibition (PPI), could generally contribute to basal transcription levels of genes, and could be mainly responsible for the essence of difficult-to-express recombinant proteins. Finally, our data reveal that expression of recombinant proteins in human cells can be greatly enhanced by using more permissive promoter adjacent downstream sequences. PMID:27485701

  9. Interference in transcription of overexpressed genes by promoter-proximal downstream sequences

    PubMed Central

    Turchinovich, A.; Surowy, H. M.; Tonevitsky, A. G.; Burwinkel, B.

    2016-01-01

    Despite a high sequence homology among four human RNAi-effectors Argonaute proteins and their coding sequences, the efficiency of ectopic overexpression of AGO3 and AGO4 coding sequences in human cells is greatly reduced as compared to AGO1 and AGO2. While investigating this phenomenon, we documented the existence of previously uncharacterized mechanism of gene expression regulation, which is manifested in greatly varying basal transcription levels from the RNApolII promoters depending on the promoter-proximal downstream sequences. Specifically, we show that distinct overexpression of Argonaute coding sequences cannot be explained by mRNA degradation in the cytoplasm or nucleus, and exhibits on transcriptional level. Furthermore, the first 1000–2000 nt located immediately downstream the promoter had the most critical influence on ectopic gene overexpression. The transcription inhibiting effect, associated with those downstream sequences, subsided with increasing distance to the promoter and positively correlated with promoter strength. We hypothesize that the same mechanism, which we named promoter proximal inhibition (PPI), could generally contribute to basal transcription levels of genes, and could be mainly responsible for the essence of difficult-to-express recombinant proteins. Finally, our data reveal that expression of recombinant proteins in human cells can be greatly enhanced by using more permissive promoter adjacent downstream sequences. PMID:27485701

  10. Analysis of Polymorphisms in the Lactotransferrin Gene Promoter and Dental Caries

    PubMed Central

    Brancher, João Armando; Pecharki, Giovana Daniela; Doetzer, Andrea Duarte; Medeiros, Kamilla Gabriella dos Santos; Cordeiro Júnior, Carlos Alberto; Sotomaior, Vanessa Santos; Bauer, Peter; Trevilatto, Paula Cristina

    2011-01-01

    Regarding host aspects, there has been strong evidence for a genetic component in the etiology of caries. The salivary protein lactotransferrin (LTF) exhibits antibacterial activity, but there is no study investigating the association of polymorphisms in the promoter region of LTF gene with caries. The objective of this study was firstly to search the promoter region of the human LTF gene for variations and, if existent, to investigate the association of the identified polymorphisms with dental caries in 12-year-old students. From 687 unrelated, 12-year-old, both sex students, 50 individuals were selected and divided into two groups of extreme phenotypes according to caries experience: 25 students without (DMFT = 0) and 25 with caries experience (DMFT ≥ 4). The selection of individuals with extreme phenotypes augments the chances to find gene variations which could be associated with such phenotypes. LTF gene-putative promoter region (+39 to −1143) of the selected 50 individuals was analyzed by high-resolution melting technique. Fifteen students, 8 without (DMFT = 0) and 7 with caries experience (mean DMFT = 6.28), presented deviations of the pattern curve suggestive of gene variations and were sequenced. However, no polymorphisms were identified in the putative promoter region of the LTF gene. PMID:22190933

  11. Functional characterization of calliphorid cell death genes and cellularization gene promoters for controlling gene expression and cell viability in early embryos.

    PubMed

    Edman, R M; Linger, R J; Belikoff, E J; Li, F; Sze, S-H; Tarone, A M; Scott, M J

    2015-02-01

    The New World screwworm fly, Cochliomyia hominivorax, and the Australian sheep blow fly, Lucilia cuprina, are major pests of livestock. The sterile insect technique was used to eradicate C. hominivorax from North and Central America. This involved area-wide releases of male and female flies that had been sterilized by radiation. Genetic systems have been developed for making 'male-only' strains that would improve the efficiency of genetic control of insect pests. One system involves induction of female lethality in embryos through activation of a pro-apoptotic gene by the tetracycline-dependent transactivator. Sex-specific expression is achieved using an intron from the transformer gene, which we previously isolated from several calliphorids. In the present study, we report the isolation of the promoters from the C. hominivorax slam and Lucilia sericata bnk cellularization genes and show that these promoters can drive expression of a GFP reporter gene in early embryos of transgenic L. cuprina. Additionally, we report the isolation of the L. sericata pro-apoptotic hid and rpr genes, identify conserved motifs in the encoded proteins and determine the relative expression of these genes at different stages of development. We show that widespread expression of the L. sericata pro-apoptotic genes was lethal in Drosophila melanogaster. The isolated gene promoters and pro-apoptotic genes could potentially be used to build transgenic embryonic sexing strains of calliphorid livestock pests. PMID:25225046

  12. Influence of ADH1B polymorphism on alcohol use and its subjective effects in a Jewish population.

    PubMed

    Carr, Lucinda G; Foroud, Tatiana; Stewart, Trent; Castelluccio, Peter; Edenberg, Howard J; Li, Ting-Kai

    2002-10-01

    Class I alcohol dehydrogenases (ADHs) are the principal enzymes responsible for ethanol metabolism in humans. Genetic polymorphism at the ADH1B locus (old nomenclature ADH2) results in isozymes with quite different catalytic properties. The frequency of the ADH1B*2 allele varies among ethnic groups. ADH1B*2 is most often observed in Asian populations, and has been shown to be protective against alcoholism. The Jewish population has a higher frequency of the ADH1B*2 allele and lower rates of alcohol-related problems as compared to other Caucasian populations. Thus, it would be of interest to determine whether the ADH1B*2 allele is associated with alcohol consumption and its subjective effects in this group. Four groups of Jewish subjects (male and female college-age samples, and male and female general samples) were recruited from the same region of the United States. All subjects completed a questionnaire to delineate alcohol consumption and its subjective consequences. Genotype at the ADH1B locus was determined for each participant. ADH1B*2 allele frequencies were similar for the Jewish college-age and general population samples. Men in both the college-age and general population in the ADH1B*2 group reported more unpleasant reactions following alcohol consumption than men in the ADH1B*1 group. Men in the general population in the ADH1B*2 group drank alcohol less frequently than men who were homozygous ADH1B*1; there was a similar trend among the women. The ADH1B polymorphism is associated with unpleasant reactions after alcohol consumption, and frequency of alcohol consumption in these Jewish samples. PMID:12244546

  13. Targeting G-quadruplexes in gene promoters: a novel anticancer strategy?

    PubMed Central

    Balasubramanian, Shankar; Hurley, Laurence H.; Neidle, Stephen

    2011-01-01

    G-quadruplexes are four-stranded DNA structures that are over-represented in gene promoter regions and are viewed as emerging therapeutic targets in oncology, as transcriptional repression of oncogenes through stabilization of these structures could be a novel anticancer strategy. Many gene promoter G-quadruplexes have physicochemical properties and structural characteristics that might make them druggable, and their structural diversity suggests that a high degree of selectivity might be possible. Here, we describe the evidence for G-quadruplexes in gene promoters and discuss their potential as therapeutic targets, as well as progress in the development of strategies to harness this potential through intervention with small-molecule ligands. PMID:21455236

  14. Identifying Growth Conditions for Nicotiana benthimiana Resulting in Predictable Gene Expression of Promoter-Gus Fusion

    NASA Astrophysics Data System (ADS)

    Sandoval, V.; Barton, K.; Longhurst, A.

    2012-12-01

    Revoluta (Rev) is a transcription factor that establishes leaf polarity inArabidopsis thaliana. Through previous work in Dr. Barton's Lab, it is known that Revoluta binds to the ZPR3 promoter, thus activating the ZPR3 gene product inArabidopsis thaliana. Using this knowledge, two separate DNA constructs were made, one carrying revgene and in the other, the ZPR3 promoter fussed with the GUS gene. When inoculated in Nicotiana benthimiana (tobacco), the pMDC32 plasmid produces the Rev protein. Rev binds to the ZPR3 promoter thereby activating the transcription of the GUS gene, which can only be expressed in the presence of Rev. When GUS protein comes in contact with X-Gluc it produce the blue stain seen (See Figure 1). In the past, variability has been seen of GUS expression on tobacco therefore we hypothesized that changing the growing conditions and leaf age might improve how well it's expressed.

  15. Structural analysis and promoter characterization of the human collagenase-3 gene (MMP13)

    SciTech Connect

    Pendas, A.M.; Balbin, M.; Llano, E.

    1997-03-01

    Human collagenase-3 (MMP13) is a recently identified member of the matrix metalloproteinase (MMP) family that is expressed in breast carcinomas and in articular cartilage from arthritic patients. In this work we have isolated and characterized genomic clones coding for human collagenase-3. This gene is composed of 10 exons and 9 introns and spans over 12.5 kb. The overall organization of the collagenase-3 gene is similar to that of other MMP genes clustered at chromosome 11q22, including fibroblast collagenase (MMP-1), matrilysin (MMP-7), and macrophage metalloelastase (MMP-12), but is more distantly related to genes coding for stromelysin-3 (MMP-11), gelatinase-A (MMP-2), and gelatinase-B (MMP-9), which map outside of this gene cluster. Nucleotide sequence analysis of about 1 kb of the 5{prime}-flanking region of the collagenase-3 gene revealed the presence of a TATA box, an AP-1 motif, a PEA-3 consensus sequence, an osteoblast specific element (OSE-2), and a TGF-{beta} inhibitory element. Transient transfection experiments in HeLa and COS-1 cells with chloramphenicol acetyltransferase (CAT)-containing constructs showed that the AP-1 site is functional and responsible for the observed inducibility of the reporter gene by the tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA). However, and in contrast to other MMP genes, no significative synergistic effect on CAT activity between the AP-1 and PEA-3 elements found in the collagenase-3 gene promoter was found. DNA binding analysis with nuclear extracts from HeLa cells revealed the formation of specific complexes between collagenase-3 promoter sequences containing the AP-1 site and nuclear proteins. The presence of this AP-1 functional site, which is able to confer responsiveness to a variety of tumor promoters and oncogene products, may contribute to explaining the high-level expression of collagenase-3 in breast carcinomas and degenerative joint diseases. 48 refs., 5 figs., 2 tabs.

  16. Glyceraldehyde-3-phosphate dehydrogenase gene from Zymomonas mobilis: cloning, sequencing, and identification of promoter region

    SciTech Connect

    Conway, T.; Sewell, G.W.; Ingram, L.O.

    1987-12-01

    The gene encoding glyceraldehyde-3-phosphate dehydrogenase was isolated from a library of Zymomonas mobilis DNA fragments by complementing a deficient strain of Escherichia coli. It contained tandem promoters which were recognized by E. coli but appeared to function less efficiently than the enteric lac promoter in E. coli. The open reading frame for this gene encoded 337 amino acids with an aggregate molecular weight of 36,099 (including the N-terminal methionine). The primary amino acid sequence for this gene had considerable functional homology and amino acid identity with other eukaryotic and bacterial genes. Based on this comparison, the gap gene from Z. mobilis appeared to be most closely related to that of the thermophilic bacteria and to the chloroplast isozymes. Comparison of this gene with other glycolytic enzymes from Z. mobilis revealed a conserved pattern of codon bias and several common features of gene structure. A tentative transcriptional consensus sequence is proposed for Z. mobilis based on comparison of the five known promoters for three glycolytic enzymes.

  17. Ovine HSP90AA1 gene promoter: functional study and epigenetic modifications.

    PubMed

    Salces-Ortiz, Judit; González, Carmen; Bolado-Carrancio, Alfonso; Rodríguez-Rey, Jose Carlos; Calvo, Jorge H; Muñoz, Rubén; Serrano, M Magdalena

    2015-11-01

    When environmental temperatures exceed a certain threshold, the upregulation of the ovine HSP90AA1 gene is produced to cope with cellular injuries caused by heat stress. It has been previously pointed out that several polymorphisms located at the promoter region of this gene seem to be the main responsible for the differences in the heat stress response observed among alternative genotypes in terms of gene expression rate. The present study, focused on the functional study of those candidate polymorphisms by electrophoretic mobility shift assay (EMSA) and in vitro luciferase expression assays, has revealed that the observed differences in the transcriptional activity of the HSP90AA1 gene as response to heat stress are caused by the presence of a cytosine insertion (rs397514115) and a C to G transversion (rs397514116) at the promoter region. Next, we discovered the presence of epigenetic marks at the promoter and along the gene body founding an allele-specific methylation of the rs397514116 mutation in DNA extracted from blood samples. This regulatory mechanism interacts synergistically to modulate gene expression depending on environmental circumstances. Taking into account the results obtained, it is suggested that the transcription of the HSP90AA1 ovine gene is regulated by a cooperative action of transcription factors (TFs) whose binding sites are polymorphic and where the influence of epigenetic events should be also taken into account. PMID:26253285

  18. Transcriptional promoter of the human alpha 1(V) collagen gene (COL5A1).

    PubMed Central

    Lee, S; Greenspan, D S

    1995-01-01

    We have characterized the 5' region of the human alpha 1(V) collagen gene (COL5A1). The transcriptional promoter is shown to have a number of features characteristic of the promoters of 'housekeeping' and growth-control-related genes. It lacks obvious TATA and CAAT boxes, has multiple transcription start sites, has a high GC content, lies within a well-defined CpG island and has a number of consensus sites for the potential binding of transcription factor Sp1. This type of promoter structure, while unusual for a collagen gene, is consistent with the broad distribution of expression of COL5A1 and is reminiscent of the promoter structures of the genes encoding type VI collagen, which has a similarly broad distribution of expression. Stepwise deletion of COL5A1 5' sequences, placed upstream of a heterologous reporter gene, yielded a gradual decrease in promoter activity, indicating that the COL5A1 promoter is composed of an array of cis-acting elements. A minimal promoter region contained within the 212 bp immediately upstream of the major transcription start site contained no consensus sequences for the binding of known transcription factors, but gel mobility shift assays showed this region to bind nuclear factors, including Sp1, at a number of sites. The major transcription start site is flanked by an upstream 34-bp oligopurine/oligopyrimidine stretch, or 'GAGA' box, and a downstream 56-bp GAGA box which contains a 10-bp mirror repeat and is sensitive to cleavage with S1 nuclease. Images Figure 1 Figure 3 Figure 4 Figure 6 PMID:7646438

  19. Photoregulation of a phytochrome gene promoter from oat transferred into rice by particle bombardment.

    PubMed Central

    Bruce, W B; Christensen, A H; Klein, T; Fromm, M; Quail, P H

    1989-01-01

    The regulatory photoreceptor phytochrome controls the transcription of its own phy genes in a negative feedback fashion. We have exploited microprojectile-mediated gene transfer to develop a rapid transient expression assay system for the study of DNA sequences involved in the phytochrome-regulated expression of these genes. The 5'-flanking sequence and part of the structural region of an oat phy gene have been fused to a reporter coding sequence (chloramphenicol acetyltransferase, CAT) and introduced into intact darkgrown seedlings by using high-velocity microprojectiles. Expression is assayable in less than 24 hr from bombardment. The introduced oat phy-CAT fusion gene is expressed and down-regulated by white light in barley, rice, and oat, whereas no expression is detected in three dicots tested, tobacco, cucumber, and Arabidopsis thaliana. In bombarded rice shoots, red/far-red light-reversible repression of expression of the heterologous oat phy-CAT gene shows that it is regulated by phytochrome in a manner parallel to that of the endogenous rice phy genes. These data indicate that the transduction pathway components and promoter sequences involved in autoregulation of phy expression have been evolutionarily conserved between oat and rice. The experiments show the feasibility of using high-velocity microprojectile-mediated gene transfer for the rapid analysis of light-controlled monocot gene promoters in monocot tissues that until now have been recalcitrant to such studies. Images PMID:2602370

  20. Base J represses genes at the end of polycistronic gene clusters in Leishmania major by promoting RNAP II termination.

    PubMed

    Reynolds, David L; Hofmeister, Brigitte T; Cliffe, Laura; Siegel, T Nicolai; Anderson, Britta A; Beverley, Stephen M; Schmitz, Robert J; Sabatini, Robert

    2016-08-01

    The genomes of kinetoplastids are organized into polycistronic gene clusters that are flanked by the modified DNA base J. Previous work has established a role of base J in promoting RNA polymerase II termination in Leishmania spp. where the loss of J leads to termination defects and transcription into adjacent gene clusters. It remains unclear whether these termination defects affect gene expression and whether read through transcription is detrimental to cell growth, thus explaining the essential nature of J. We now demonstrate that reduction of base J at specific sites within polycistronic gene clusters in L. major leads to read through transcription and increased expression of downstream genes in the cluster. Interestingly, subsequent transcription into the opposing polycistronic gene cluster does not lead to downregulation of sense mRNAs. These findings indicate a conserved role for J regulating transcription termination and expression of genes within polycistronic gene clusters in trypanosomatids. In contrast to the expectations often attributed to opposing transcription, the essential nature of J in Leishmania spp. is related to its role in gene repression rather than preventing transcriptional interference resulting from read through and dual strand transcription. PMID:27125778

  1. Relationship between promoter methylation & tissue expression of MGMT gene in ovarian cancer

    PubMed Central

    Shilpa, V.; Bhagat, Rahul; Premalata, C.S.; Pallavi, V.R.; Ramesh, G.; Krishnamoorthy, Lakshmi

    2014-01-01

    Background & objectives: Epigenetic alterations, in addition to multiple gene abnormalities, are involved in the genesis and progression of human cancers. Aberrant methylation of CpG islands within promoter regions is associated with transcriptional inactivation of various tumour suppressor genes. O6-methyguanine-DNA methyltransferase (MGMT) is a DNA repair gene that removes mutagenic and cytotoxic adducts from the O6-position of guanine induced by alkylating agents. MGMT promoter hypermethylation and reduced expression has been found in some primary human carcinomas. We studied DNA methylation of CpG islands of the MGMT gene and its relation with MGMT protein expression in human epithelial ovarian carcinoma. Methods: A total of 88 epithelial ovarian cancer (EOC) tissue samples, 14 low malignant potential (LMP) tumours and 20 benign ovarian tissue samples were analysed for MGMT promoter methylation by nested methylation-specific polymerase chain reaction (MSP) after bisulphite modification of DNA. A subset of 64 EOC samples, 10 LMP and benign tumours and five normal ovarian tissue samples were analysed for protein expression by immunohistochemistry. Results: The methylation frequencies of the MGMT gene promoter were found to be 29.5, 28.6 and 20 per cent for EOC samples, LMP tumours and benign cases, respectively. Positive protein expression was observed in 93.8 per cent of EOC and 100 per cent in LMP, benign tumours and normal ovarian tissue samples. Promoter hypermethylation with loss of protein expression was seen only in one case of EOC. Interpretation & conclusions: Our results suggest that MGMT promoter hypermethylation does not always reflect gene expression. PMID:25579142

  2. Cysteine Dioxygenase 1 Is a Tumor Suppressor Gene Silenced by Promoter Methylation in Multiple Human Cancers

    PubMed Central

    Brait, Mariana; Ling, Shizhang; Nagpal, Jatin K.; Chang, Xiaofei; Park, Hannah Lui; Lee, Juna; Okamura, Jun; Yamashita, Keishi; Sidransky, David; Kim, Myoung Sook

    2012-01-01

    The human cysteine dioxygenase 1 (CDO1) gene is a non-heme structured, iron-containing metalloenzyme involved in the conversion of cysteine to cysteine sulfinate, and plays a key role in taurine biosynthesis. In our search for novel methylated gene promoters, we have analyzed differential RNA expression profiles of colorectal cancer (CRC) cell lines with or without treatment of 5-aza-2′-deoxycytidine. Among the genes identified, the CDO1 promoter was found to be differentially methylated in primary CRC tissues with high frequency compared to normal colon tissues. In addition, a statistically significant difference in the frequency of CDO1 promoter methylation was observed between primary normal and tumor tissues derived from breast, esophagus, lung, bladder and stomach. Downregulation of CDO1 mRNA and protein levels were observed in cancer cell lines and tumors derived from these tissue types. Expression of CDO1 was tightly controlled by promoter methylation, suggesting that promoter methylation and silencing of CDO1 may be a common event in human carcinogenesis. Moreover, forced expression of full-length CDO1 in human cancer cells markedly decreased the tumor cell growth in an in vitro cell culture and/or an in vivo mouse model, whereas knockdown of CDO1 increased cell growth in culture. Our data implicate CDO1 as a novel tumor suppressor gene and a potentially valuable molecular marker for human cancer. PMID:23028699

  3. Activation of the cytotactin promoter by the homeobox-containing gene Evx-1.

    PubMed Central

    Jones, F S; Chalepakis, G; Gruss, P; Edelman, G M

    1992-01-01

    Cytotactin is a morphoregulatory molecule of the extracellular matrix affecting cell shape, division, and migration that appears in a characteristic and complex site-restricted pattern during embryogenesis. The promoter region of the gene that encodes chicken cytotactin contains a variety of potential regulatory sequences. These include putative binding sites for homeodomain proteins and a phorbol 12-O-tetradecanoate 13-acetate response element (TRE)/AP-1 element, a potential target for transcription factors thought to be involved in growth-factor signal transduction. To determine the effects of homeobox-containing genes on cytotactin promoter activity, we conducted a series of cotransfection experiments on NIH 3T3 cells using cytotactin promoter-chloramphenicol acetyltransferase (CAT) reporter gene constructs and plasmids driving the expression of mouse homeobox genes Evx-1 and Hox-1.3. cotransfection with Evx-1 stimulated cytotactin promoter activity whereas cotransfection in control experiments with Hox-1.3 had no effect. To localize the sequences required for Evx-1 activation, we tested a series of deletions in the cytotactin promoter. An 89-base-pair region containing a consensus TRE/AP-1 element was found to be required for activation. An oligonucleotide segment containing this TRE/AP-1 site was found to confer Evx-1 inducibility on a simian virus 40 minimal promoter; mutation of the TRE/AP-1 site abolished this activity. To explore the potential role of growth factors in cytotactin promoter activation, chicken embryo fibroblasts, which are known to synthesize cytotactin, were first transfected with cytotactin promoter constructs and cultured under minimal conditions in 1% fetal bovine serum. Although the cells exhibited only low levels of CAT activity under these conditions, cells exposed for 12 h to 10% (vol/vol) fetal bovine serum showed a marked increase in CAT activity. Cotransfection with Evx-1 and cytotactin promoter constructs of cells cultured in 1

  4. Quantitative Analyses of Core Promoters Enable Precise Engineering of Regulated Gene Expression in Mammalian Cells.

    PubMed

    Ede, Christopher; Chen, Ximin; Lin, Meng-Yin; Chen, Yvonne Y

    2016-05-20

    Inducible transcription systems play a crucial role in a wide array of synthetic biology circuits. However, the majority of inducible promoters are constructed from a limited set of tried-and-true promoter parts, which are susceptible to common shortcomings such as high basal expression levels (i.e., leakiness). To expand the toolbox for regulated mammalian gene expression and facilitate the construction of mammalian genetic circuits with precise functionality, we quantitatively characterized a panel of eight core promoters, including sequences with mammalian, viral, and synthetic origins. We demonstrate that this selection of core promoters can provide a wide range of basal gene expression levels and achieve a gradient of fold-inductions spanning 2 orders of magnitude. Furthermore, commonly used parts such as minimal CMV and minimal SV40 promoters were shown to achieve robust gene expression upon induction, but also suffer from high levels of leakiness. In contrast, a synthetic promoter, YB_TATA, was shown to combine low basal expression with high transcription rate in the induced state to achieve significantly higher fold-induction ratios compared to all other promoters tested. These behaviors remain consistent when the promoters are coupled to different genetic outputs and different response elements, as well as across different host-cell types and DNA copy numbers. We apply this quantitative understanding of core promoter properties to the successful engineering of human T cells that respond to antigen stimulation via chimeric antigen receptor signaling specifically under hypoxic environments. Results presented in this study can facilitate the design and calibration of future mammalian synthetic biology systems capable of precisely programmed functionality. PMID:26883397

  5. Cloning and Characterization of the Human Trefoil Factor 3 Gene Promoter

    PubMed Central

    Zhou, Yifang; Mao, Xuefei; Deng, Xiangdong

    2014-01-01

    Human trefoil factor 3 (hTFF3) is a small-molecule peptide with potential medicinal value. Its main pharmacological function is to alleviate gastrointestinal mucosal injuries caused by various factors and promote the repair of damaged mucosa. However, how its transcription is regulated is not yet known. The aim of this study was to clone the hTFF3 gene promoter region, identify the core promoter and any transcription factors that bind to the promoter, and begin to clarify the regulation of its expression. The 5′ flanking sequence of the hTFF3 gene was cloned from human whole blood genomic DNA by PCR. Truncated promoter fragments with different were cloned and inserted into the pGL3-Basic vector to determine the position of the core hTFF3 promoter. Transcription element maintaining basic transcriptional activity was assessed by mutation techniques. Protein-DNA interactions were analyzed by chromatin immunoprecipitation (ChIP). RNA interference and gene over-expression were performed to assay the effect of transcription factor on the hTFF3 expression. The results showed that approximately 1,826 bp of the fragment upstream of hTFF3 was successfully amplified, and its core promoter region was determined to be from −300 bp to −280 bp through analysis of truncated mutants. Mutation analysis confirmed that the sequence required to maintain basic transcriptional activity was accurately positioned from −300 bp to −296 bp. Bioinformatic analysis indicated that this area contained a Sp1 binding site. Sp1 binding to the hTFF3 promoter was confirmed by ChIP experiments. Sp1 over-expression and interference experiments showed that Sp1 enhanced the transcriptional activity of the hTFF3 promoter and increased hTFF3 expression. This study demonstrated that Sp1 plays an important role in maintaining the transcription of hTFF3. PMID:24743382

  6. Regulation of the promoter of rat apolipoprotein A-I gene in cultured cells

    SciTech Connect

    Chao, Y.; Pan, T.; Wu, T.; Hao, Q.; Yamin, T.; Kroon, P.A.

    1987-05-01

    In order to study the regulation of the promoter of apolipoprotein (apo) A-I gene, they joined the 5' end of rat apo A-I gene (1.9 Kb) to the coding region of bacterial chloramphenicol acetyltransferase (CAT) gene. The chimeric gene produced high levels of CAT activity in both mouse L cells and Hep G2 cells in transient expression assays. Ethanol increased the levels of rat apo A-I promoter activity in both cells. However, dexamethasone increased rat apo A-I promoter activity only in Hep G2 cells. Similar results were obtained in stable expression cell lines. Nucleotide deletion experiments showed DNA sequences between -149 and -469 base pairs upstream from the rat apo A-I transcription site are required for the high level of expression and that the regulatory sequences are located further upstream. These data demonstrated that the 5' end of rat apo A-I gene contains sequences which are responsible for the regulation of apo A-I expression by ethanol and dexamethasone and that the expression and regulation of rat apo A-I promoter are cell specific.

  7. Polymorphisms in the Promoter Region of the Chinese Bovine PPARGC1A Gene

    PubMed Central

    Li, M. J.; Liu, M.; Liu, D.; Lan, X. Y.; Lei, C. Z.; Yang, D. Y.; Chen, H.

    2013-01-01

    The peroxisome proliferator-activated receptor gamma coactivator-1 alpha protein, encoded by the PPARGC1A gene, plays an important role in energy homeostasis. The genetic variations within the PPARGC1A gene promoter region were scanned in 808 Chinese native bovines belonging to three cattle breeds and yaks. A total of 6 SNPs and one 4 bp insertion variation in the promoter region of the bovine PPARGC1A gene were identified: SNP -259 T>A, -301_-298insCTTT, -915 A>G, -1175 T>G, -1590 C>T, -1665 C>T and -1690 G>A, which are in the binding sites of some important transcription factors: sex-determining region Y (SRY), myeloid-specific zinc finger-1 (MZF-1) and octamer factor 1(Oct-1). It is expected that these polymorphisms may regulate PPARGC1A gene transcription and might have consequences at a regulatory level. PMID:25049813

  8. Transcription factor assembly on the nicotinic receptor beta4 subunit gene promoter.

    PubMed

    Scofield, Michael D; Brüschweiler-Li, Lei; Mou, Zhongming; Gardner, Paul D

    2008-04-16

    Nicotinic acetylcholine receptors are involved in a plethora of fundamental biological processes ranging from muscle contraction to formation of memories. The receptors are pentameric proteins whose subunits are encoded by distinct genes. Subunit composition of a mature nicotinic receptor is governed in part by the transcriptional regulation of each subunit gene. Here, using chromatin immunoprecipitation assays, we report the interaction of the transcription factors Sp1, Sp3, c-Jun and Sox10 with the beta4 subunit gene promoter in neuronal-like cell lines and rodent brain tissue. Our results corroborate previous in-vitro data demonstrating that these transcription factors interact with the beta4 promoter. Taken together, these data suggest that Sp1, Sp3, c-Jun and Sox10 regulate expression of the beta4 subunit gene in the mammalian brain. PMID:18382288

  9. In Silico Promoter Analysis can Predict Genes of Functional Relevance in Cell Proliferation: Validation in a Colon Cancer Model

    PubMed Central

    Moss, Alan C.; Doran, Peter P.; MacMathuna, Padraic

    2007-01-01

    Specific combinations of transcription-factor binding sites in the promoter regions of genes regulate gene expression, and thus key functional processes in cells. Analysis of such promoter regions in specific functional contexts can be used to delineate novel disease-associated genes based on shared phenotypic properties. The aim of this study was to utilize promoter analysis to predict cell proliferation-associated genes and to test this method in colon cancer cell lines. We used freely-available bioinformatic techniques to identify cell-proliferation-associated genes expressed in colon cancer, extract a shared promoter module, and identify novel genes that also contain this module in the human genome. An EGRF/ETSF promoter module was identified as prevalent in proliferation-associated genes from a colon cancer cDNA library. We detected 30 other genes, from the known promoters of the human genome, which contained this proliferation-associated module. This group included known proliferation-associated genes, such as HERG1 and MCM7, and a number of genes not previously implicated in cell proliferation in cancer, such as TSPAN3, Necdin and APLP2. Suppression of TSPAN3 and APLP2 by siRNA was performed and confirmed by RT-PCR. Inhibition of these genes significantly inhibited cell proliferation in colon cancer cell lines. This study demonstrates that promoter analysis can be used to identify novel cancer-associated genes based on shared functional processes. PMID:23641142

  10. Localisation of cis elements in the promoter of a wheat alpha-Amy2 gene.

    PubMed

    Huttly, A K; Phillips, A L; Tregear, J W

    1992-09-01

    A functional analysis of the promoter from the wheat alpha-amylase gene alpha-Amy2/54 is described. Mutant alpha-Amy2/54 promoters containing replacements or deletions were constructed and their ability to direct expression of the reporter gene beta-glucuronidase (GUS) in gibberellin-responsive oat aleurone protoplasts analysed. Chimaeric promoters using regions of the cauliflower mosaic virus (CaMV) 35S and alpha-Amy2/54 promoters were also analysed. The results suggest that at least three regions within the alpha-Amy2/54 promoter contain cis elements that are necessary for high-level gibberellin-regulated transcription. Fusion of 1.8 kb of promoter sequence upstream from -117 bp to a minimal (-55 CaMV 35S) promoter gave rise to hormone-independent expression implying that the region 3' to -117 bp contains an element which represses transcription in the absence of gibberellin or presence of abscisic acid. PMID:1511136

  11. Functional analysis and nucleotide sequence of the promoter region of the murine hck gene.

    PubMed Central

    Lock, P; Stanley, E; Holtzman, D A; Dunn, A R

    1990-01-01

    The structure and function of the promoter region and exon 1 of the murine hck gene have been characterized in detail. RNase protection analysis has established that hck transcripts initiate from heterogeneous start sites located within the hck gene. Fusion gene constructs containing hck 5'-flanking sequences and the bacterial Neor gene have been introduced into the hematopoietic cell lines FDC-P1 and WEHI-265 by using a self-inactivating retroviral vector. The transcriptional start sites of the fusion gene are essentially identical to those of the endogenous hck gene. Analysis of infected WEHI-265 cell lines treated with bacterial lipopolysaccharide (LPS) reveals a 3- to 5-fold elevation in the levels of endogenous hck mRNA and a 1.4- to 2.6-fold increase in the level of Neor fusion gene transcripts, indicating that hck 5'-flanking sequences are capable of conferring LPS responsiveness on the Neor gene. The 5'-flanking region of the hck gene contains sequences similar to an element which is thought to be involved in the LPS responsiveness of the class II major histocompatibility gene A alpha k. A subset of these sequences are also found in the 5'-flanking regions of other LPS-responsive genes. Moreover, this motif is related to the consensus binding sequence of NF-kappa B, a transcription factor which is known to be regulated by LPS. Images PMID:2388619

  12. Genomic organization and promoter analysis of the Trichomonas vaginalis core histone gene families.

    PubMed

    Cong, Peikuan; Luo, Yingfeng; Bao, Weidong; Hu, Songnian

    2010-03-01

    Core histone gene is a well-established model to study eukaryote gene transcription regulation mechanism. However, the protozoan core histone gene regulation mechanism remains largely unknown. In this study, we observed almost all protozoan Trichomonas vaginalis core histone genes (60/74) organize as gene pairs in a head-to-head manner, thus facilitating the divergent transcription of both partners. Additionally, the majority of both T. vaginalis core histone genes pairs (50/60) and solitary genes (10/14), contain three over-represented motifs with conserved positional architecture at their promoter regions. Notably of the three motifs, Motif I is highly similar to the Inr which mediates the transcription start site selection in T. vaginalis. Motif II and Motif III preferably locate at the promoter regions of the T. vaginalis genome. Those findings reveal that both genomic organization and cis-acting transcription elements facilitate these large number of T. vaginalis core histone genes under the control of the same transcription machine. PMID:19744576

  13. An Oomycete CRN Effector Reprograms Expression of Plant HSP Genes by Targeting their Promoters.

    PubMed

    Song, Tianqiao; Ma, Zhenchuan; Shen, Danyu; Li, Qi; Li, Wanlin; Su, Liming; Ye, Tingyue; Zhang, Meixiang; Wang, Yuanchao; Dou, Daolong

    2015-12-01

    Oomycete pathogens produce a large number of CRN effectors to manipulate plant immune responses and promote infection. However, their functional mechanisms are largely unknown. Here, we identified a Phytophthora sojae CRN effector PsCRN108 which contains a putative DNA-binding helix-hairpin-helix (HhH) motif and acts in the plant cell nucleus. Silencing of the PsCRN108 gene reduced P. sojae virulence to soybean, while expression of the gene in Nicotiana benthamiana and Arabidopsis thaliana enhanced plant susceptibility to P. capsici. Moreover, PsCRN108 could inhibit expression of HSP genes in A. thaliana, N. benthamiana and soybean. Both the HhH motif and nuclear localization signal of this effector were required for its contribution to virulence and its suppression of HSP gene expression. Furthermore, we found that PsCRN108 targeted HSP promoters in an HSE- and HhH motif-dependent manner. PsCRN108 could inhibit the association of the HSE with the plant heat shock transcription factor AtHsfA1a, which initializes HSP gene expression in response to stress. Therefore, our data support a role for PsCRN108 as a nucleomodulin in down-regulating the expression of plant defense-related genes by directly targeting specific plant promoters. PMID:26714171

  14. An Oomycete CRN Effector Reprograms Expression of Plant HSP Genes by Targeting their Promoters

    PubMed Central

    Song, Tianqiao; Ma, Zhenchuan; Shen, Danyu; Li, Qi; Li, Wanlin; Su, Liming; Ye, Tingyue; Zhang, Meixiang; Wang, Yuanchao; Dou, Daolong

    2015-01-01

    Oomycete pathogens produce a large number of CRN effectors to manipulate plant immune responses and promote infection. However, their functional mechanisms are largely unknown. Here, we identified a Phytophthora sojae CRN effector PsCRN108 which contains a putative DNA-binding helix-hairpin-helix (HhH) motif and acts in the plant cell nucleus. Silencing of the PsCRN108 gene reduced P. sojae virulence to soybean, while expression of the gene in Nicotiana benthamiana and Arabidopsis thaliana enhanced plant susceptibility to P. capsici. Moreover, PsCRN108 could inhibit expression of HSP genes in A. thaliana, N. benthamiana and soybean. Both the HhH motif and nuclear localization signal of this effector were required for its contribution to virulence and its suppression of HSP gene expression. Furthermore, we found that PsCRN108 targeted HSP promoters in an HSE- and HhH motif-dependent manner. PsCRN108 could inhibit the association of the HSE with the plant heat shock transcription factor AtHsfA1a, which initializes HSP gene expression in response to stress. Therefore, our data support a role for PsCRN108 as a nucleomodulin in down-regulating the expression of plant defense-related genes by directly targeting specific plant promoters. PMID:26714171

  15. Repression of the Drosophila proliferating-cell nuclear antigen gene promoter by zerknuellt protein

    SciTech Connect

    Yamaguchi, Masamitsu; Hirose, Fumiko; Nishida, Yasuyoshi; Matsukage, Akio )

    1991-10-01

    A 631-bp fragment containing the 5{prime}-flanking region of the Drosophila melanogaster proliferating-cell nuclear antigen (PCNA) gene was placed upstream of the chloramphenicol acetyltransferase (CAT) gene of a CAT vector. A transient expression assay of CAT activity in Drosophila Kc cells transfected with this plasmid and a set of 5{prime}-deletion derivatives revealed that the promoter function resided within a 192-bp region. Cotransfection with a zerknuellt (zen)-expressing plasmid specifically repressed CAT expression. However, cotransfection with expression plasmids for a nonfunctional zen mutation, even skipped, or bicoid showed no significant effect on CAT expression. RNase protection analysis revealed that the repression by zen was at the transcription step. The target sequence of zen was mapped within the 34-bp region of the PCNA gene promoter, even though it lacked zen protein-binding sites. Transgenic flies carrying the PCNA gene regulatory region fused with lacZ were established. These results indicate that zen indirectly represses PCNA gene expression, probably by regulating the expression of some transcription factor(s) that binds to the PCNA gene promoter.

  16. Promoter region of the human platelet-derived growth factor A-chain gene

    SciTech Connect

    Takimoto, Yasuo; Wang, Zhao Yi; Kobler, K.; Deuel, T.F. )

    1991-03-01

    The platelet-derived growth factor (PDGF) A- and B-chain genes are widely expressed in mammalian tissues and their homodimeric gene products appear to regulate the autocrine growth of both normal and transformed cells. In this study, we analyzed the 5{prime} flanking sequences of the human PDGF A-chain gene to seek elements important to regulating its transcription. The promoter reigon was exceptionally G + C-rich and contained a TATA box but no CAAT box. The transcription start site was identified 845 base pairs 5{prime} to the translation initiation site by S1 nuclease mapping and by primer extension. Both in vitro transcription and transient expression of the chloramphenicol acetyltransferase gene linked to the PDGF A-chain 5{prime} flanking sequences established that the putative promoter region was active, and RNase H mapping established that the three characteristic mRNAs used the same transcription start site, which was used in normal endothelial cells and in two human tumor cell lines that express high levels of A-chain transcripts. The results extablished an exceptionally G + C-rich promoter region and a single transcription start site active for each of the three mRNAs of the PDGF A-chain gene. DNA sites of potential importance in mediating the activation of the PDGF A-chain gene in normal cells and in transformed cell lines expressing high levels of PDGF A-chain were identified.

  17. Novel strong tissue specific promoter for gene expression in human germ cells

    PubMed Central

    2010-01-01

    Background Tissue specific promoters may be utilized for a variety of applications, including programmed gene expression in cell types, tissues and organs of interest, for developing different cell culture models or for use in gene therapy. We report a novel, tissue-specific promoter that was identified and engineered from the native upstream regulatory region of the human gene NDUFV1 containing an endogenous retroviral sequence. Results Among seven established human cell lines and five primary cultures, this modified NDUFV1 upstream sequence (mNUS) was active only in human undifferentiated germ-derived cells (lines Tera-1 and EP2102), where it demonstrated high promoter activity (~twice greater than that of the SV40 early promoter, and comparable to the routinely used cytomegaloviral promoter). To investigate the potential applicability of the mNUS promoter for biotechnological needs, a construct carrying a recombinant cytosine deaminase (RCD) suicide gene under the control of mNUS was tested in cell lines of different tissue origin. High cytotoxic effect of RCD with a cell-death rate ~60% was observed only in germ-derived cells (Tera-1), whereas no effect was seen in a somatic, kidney-derived control cell line (HEK293). In further experiments, we tested mNUS-driven expression of a hyperactive Sleeping Beauty transposase (SB100X). The mNUS-SB100X construct mediated stable transgene insertions exclusively in germ-derived cells, thereby providing further evidence of tissue-specificity of the mNUS promoter. Conclusions We conclude that mNUS may be used as an efficient promoter for tissue-specific gene expression in human germ-derived cells in many applications. Our data also suggest that the 91 bp-long sequence located exactly upstream NDUFV1 transcriptional start site plays a crucial role in the activity of this gene promoter in vitro in the majority of tested cell types (10/12), and an important role - in the rest two cell lines. PMID:20716342

  18. Variation in Rubisco activase (RCAβ) gene promoters and expression in soybean [Glycine max (L.) Merr].

    PubMed

    Chao, Maoni; Yin, Zhitong; Hao, Derong; Zhang, Jinyu; Song, Haina; Ning, Ailing; Xu, Xiaoming; Yu, Deyue

    2014-01-01

    Understanding the genetic basis of Rubisco activase (RCA) gene regulation and altering its expression levels to optimize Rubisco activation may provide an approach to enhance plant productivity. However, the genetic mechanisms and the effect of RCA expression on phenotype are still unknown in soybean. This work analysed the expression of RCA genes and demonstrated that two RCA isoforms presented different expression patterns. Compared with GmRCAα, GmRCAβ was expressed at higher mRNA and protein levels. In addition, GmRCAα and GmRCAβ were positively correlated with chlorophyll fluorescence parameters and seed yield, suggesting that changes in expression of RCA has a potential applicability in breeding for enhanced soybean productivity. To identify the genetic factors that cause expression level variation of GmRCAβ, expression quantitative trait loci (eQTL) mapping was combined with allele mining in a natural population including 219 landraces. The eQTL mapping showed that a combination of both cis- and trans-acting eQTLs might control GmRCAβ expression. As promoters can affect both cis- and trans-acting eQTLs by altering cis-acting regulatory elements or transcription factor binding sites, this work subsequently focused on the promoter region of GmRCAβ. Single-nucleotide polymorphisms in the GmRCAβ promoter were identified and shown to correlate with expression level diversity. These SNPs were classified into two groups, A and B. Further transient expression showed that GUS expression driven by the group A promoter was stronger than that by the group B promoter, suggesting that promoter sequence types could influence gene expression levels. These results would improve understanding how variation within promoters affects gene expression and, ultimately, phenotypic diversity in natural populations. PMID:24170743

  19. [Changes in antidiuretic hormone (ADH) in liver cirrhosis with resistant ascites].

    PubMed

    Marenco, G; Giudici Cipriani, A; Folco, U; Colombo, P; Menardo, G; Cattana, A; Barbetti, V; Rembado, R

    1989-09-01

    The pathogenetic role of ADH in determining hyponatremia in patients with liver cirrhosis is still much debated. Osmotic stimuli are not able to inhibit secretion of ADH in refractory ascites and under such conditions the reduction in effective plasma volume has been put forward as the main cause. Twenty patients with liver cirrhosis and refractory ascites were studied before and during extraction-concentration-reinfusion (ECR) of ascitic fluid by means of Rhodiascit. ADH, renin, aldosterone, blood and urine osmolarity, plasma and urinary concentration of sodium, potassium, chlorine, and the clearance of free water were evaluated. All patients presented high renin values (15.4 +/- 11.7 ng/ml), aldosterone (341 +/- 172 ng/ml), ADH (6.3 +/- 5.2 pg/ml). During ECR, a significant drop was observed in renin (p less than 0.001), aldosterone (p less than 0.001) urinary osmolarity (p less than 0.001) and an equality significant increase in diuresis (p less than 0.001), natriuria (p less than 0.005), kaliuria (p less than 0.001) while ADH presented an irregular course: in 11 cases it remained unchanged, in 3 it fell and in 6 it presented a constant increase. To conclude, data suggest that the diminished filtrate reaching the distal tubule constitutes the greatest cause of the inability to dilute urine in many patients with cirrhosis and that ADH is a permissive rather than a primary factor. PMID:2682381

  20. Effect of ADH on rubidium transport in isolated perfused rat cortical collecting tubules

    SciTech Connect

    Schafer, J.A.; Troutman, S.L.

    1986-06-01

    Unidirectional fluxes of 86Rb+ were measured as an indicator of potassium transport in isolated rat cortical collecting tubules perfused and bathed at 38 degrees C with isotonic solutions in which Rb+ replaced K+. Under control conditions the lumen-to-bath flux (Jl----b) was significantly less than the bath-to-lumen flux (Jb----l), indicating net Rb+ secretion. Net secretion increased approximately 180% after addition of 100 microU/ml of arginine vasopressin (ADH) to the bathing solution, due to a rapid and reversible increase in Jb----l from 4.6 +/- 0.8 to 9.0 +/- 1.9 pmol X min-1 X mm-1 with no significant change in Jl----b. The ADH effect was completely inhibited by 2 mM luminal Ba2+. The average transepithelial voltage (Ve) was not significantly different from zero in the control period but became lumen negative (-5 to -10 mV) after ADH. With 10(-5) M amiloride in the lumen Ve was lumen positive (+2 to +4 mV) and was unaltered by ADH or Ba2+, yet ADH produced a significant but attentuated increase in Jb----l with no change in Jl----b. The results indicate that ADH augments net K+ secretion either by an increase in the Ba2+-sensitive conductance of the apical membrane or by an increase in the electrochemical potential driving force for net Rb+ secretion through this pathway.

  1. Promotion

    PubMed Central

    Alam, Hasan B.

    2013-01-01

    This article gives an overview of the promotion process in an academic medical center. A description of different promotional tracks, tenure and endowed chairs, and the process of submitting an application is provided. Finally, some practical advice about developing skills and attributes that can help with academic growth and promotion is dispensed. PMID:24436683

  2. Three alcohol dehydrogenase genes and one acetyl-CoA synthetase gene are responsible for ethanol utilization in Yarrowia lipolytica.

    PubMed

    Gatter, Michael; Ottlik, Stephanie; Kövesi, Zsolt; Bauer, Benjamin; Matthäus, Falk; Barth, Gerold

    2016-10-01

    The non-conventional yeast Yarrowia lipolytica is able to utilize a wide range of different substrates like glucose, glycerol, ethanol, acetate, proteins and various hydrophobic molecules. Although most metabolic pathways for the utilization of these substrates have been clarified by now, it was not clear whether ethanol is oxidized by alcohol dehydrogenases or by an alternative oxidation system inside the cell. In order to detect the genes that are required for ethanol utilization in Y. lipolytica, eight alcohol dehydrogenase (ADH) genes and one alcohol oxidase gene (FAO1) have been identified and respective deletion strains were tested for their ability to metabolize ethanol. As a result of this, we found that the availability of ADH1, ADH2 or ADH3 is required for ethanol utilization in Y. lipolytica. A strain with deletions in all three genes is lacking the ability to utilize ethanol as sole carbon source. Although Adh2p showed by far the highest enzyme activity in an in vitro assay, the availability of any of the three genes was sufficient to enable a decent growth. In addition to ADH1, ADH2 and ADH3, an acetyl-CoA synthetase encoding gene (ACS1) was found to be essential for ethanol utilization. As Y. lipolytica is a non-fermenting yeast, it is neither able to grow under anaerobic conditions nor to produce ethanol. To investigate whether Y. lipolytica may produce ethanol, the key genes of alcoholic fermentation in S. cerevisiae, ScADH1 and ScPDC1, were overexpressed in an ADH and an ACS1 deletion strain. However, instead of producing ethanol, the respective strains regained the ability to use ethanol as single carbon source and were still not able to grow under anaerobic conditions. PMID:27486067

  3. Multiple Mechanisms Influence Regulation of the Cystic Fibrosis Transmembrane Conductance Regulator Gene Promoter

    PubMed Central

    Lewandowska, Marzena A.; Costa, Fabricio F.; Bischof, Jared M.; Williams, Sarah H.; Soares, Marcelo B.; Harris, Ann

    2010-01-01

    The cystic fibrosis transmembrane conductance regulator (CFTR) gene is driven by a promoter that cannot alone account for the temporal and tissue-specific regulation of the gene. This has led to the search for additional regulatory elements that cooperate with the basal promoter to achieve coordinated expression. We previously identified two alternative upstream exons of the gene that were mutually exclusive of the first exon, and one of which showed temporal regulation in the human and sheep lung. We now demonstrate that this alternative splice product generates a stable protein, which initiates translation at an ATG in exon 4, and thus lacks the N terminus of CFTR. The other splice variant inhibits translation of the protein. In a search for the promoter used by the upstream exons, we identified a novel element that contributes to the activity of the basal CFTR promoter in airway epithelial cells, but does not function independently. Finally, we demonstrate that, in primary airway cells, skin fibroblasts, and both airway and intestinal cell lines, the CFTR promoter is unmethylated, irrespective of CFTR expression status. Thus, methylation is not the main cause of inactivation of CFTR transcription. PMID:19855085

  4. Engineering the esaR promoter for tunable quorum sensing- dependent gene expression.

    PubMed

    Shong, Jasmine; Collins, Cynthia H

    2013-10-18

    Quorum sensing (QS) systems enable bacteria to coordinate their behavior as a function of local population density and are often used in synthetic systems that require cell−cell communication. We have engineered the esaR promoter, P(esaR), which is repressed by the QS regulator E(saR). E(saR)-dependent gene expression from P(esaR) is induced by 3-oxo-hexanoyl-homoserine lactone (3OC6HSL). Here, we report a set of modified P(esaR) promoters that contain a second E(saR) binding site. We observed changes in gene expression levels, regulatory range, 3OC6HSL sensitivity, and the regulatory role of E(saR) that are dependent on the position of the second binding site. Combining the new promoters with endogenous 3OC6HSL production led to QS-dependent systems that exhibit a range of expression levels and timing. These promoters represent a new set of tools for modulating QS-dependent gene expression and may be used to tune the regulation of multiple genes in response to a single QS signal. PMID:23879176

  5. Site-specific methylation of the rat prolactin and growth hormone promoters correlates with gene expression.

    PubMed Central

    Ngô, V; Gourdji, D; Laverrière, J N

    1996-01-01

    The methylation patterns of the rat prolactin (rPRL) (positions -440 to -20) and growth hormone (rGH) (positions -360 to -110) promoters were analyzed by bisulfite genomic sequencing. Two normal tissues, the anterior pituitary and the liver, and three rat pituitary GH3 cell lines that differ considerably in their abilities to express both genes were tested. High levels of rPRL gene expression were correlated with hypomethylation of the CpG dinucleotides located at positions -277 and -97, near or within positive cis-acting regulatory elements. For the nine CpG sites analyzed in the rGH promoter, an overall hypomethylation-expression coupling was also observed for the anterior pituitary, the liver, and two of the cell lines. The effect of DNA methylation was tested by measuring the transient expression of the chloramphenicol acetyltransferase reporter gene driven by a regionally methylated rPRL promoter. CpG methylation resulted in a decrease in the activity of the rPRL promoter which was proportional to the number of modified CpG sites. The extent of the inhibition was also found to be dependent on the position of methylated sites. Taken together, these data suggest that site-specific methylation may modulate the action of transcription factors that dictate the tissue-specific expression of the rPRL and rGH genes in vivo. PMID:8668139

  6. Monoamine Oxidase a Promoter Gene Associated with Problem Behavior in Adults with Intellectual/Developmental Disabilities

    ERIC Educational Resources Information Center

    May, Michael E.; Srour, Ali; Hedges, Lora K.; Lightfoot, David A.; Phillips, John A., III; Blakely, Randy D.; Kennedy, Craig H.

    2009-01-01

    A functional polymorphism in the promoter of the gene encoding monoamine oxidase A has been associated with problem behavior in various populations. We examined the association of MAOA alleles in adult males with intellectual/developmental disabilities with and without established histories of problem behavior. These data were compared with a…

  7. A novel piscine vitellogenin gene: structural and functional analyses of estrogen-inducible promoter.

    PubMed

    Teo, B Y; Tan, N S; Lim, E H; Lam, T J; Ding, J L

    1998-11-25

    The Oreochromis aureus vitellogenin, OaVtg, gene spans 9 kb and contains 34 exons. Its transcription start site is located 15 bp upstream of the translational start codon. Although the OaVtg promoter has a nonconsensus TATA, transient transfection assay showed that this promoter is capable of driving basal transcription. Two imperfect estrogen response elements: EREp (proximal) and EREd (distal) are located in the promoter at - 532 and - 1352, respectively. In competition gel mobility-shift assays, only EREp exhibited specific binding of the recombinant estrogen receptor protein, GST-C/D OaER. Another imperfect ERE (EREexon2) was detected within exon 2 of the OaVtg gene. This is a novel finding for a vitellogenin (Vtg) gene. EREexon2 similarly showed specific recognition of GST-C/D OaER. Both EREp and EREexon2 showed comparable binding affinities as consensus ERE. In transient transfections, the OaVtg promoter, EREp and EREd elicited significant increase in estrogen-dependent synthesis of CAT protein. Hence, we propose that the non-consensus OaVtg EREs contribute to the estrogen-dependent regulation of the OaVtg gene in vivo. PMID:10022768

  8. Sumoylation of Rap1 mediates the recruitment of TFIID to promote transcription of ribosomal protein genes.

    PubMed

    Chymkowitch, Pierre; Nguéa, Aurélie P; Aanes, Håvard; Koehler, Christian J; Thiede, Bernd; Lorenz, Susanne; Meza-Zepeda, Leonardo A; Klungland, Arne; Enserink, Jorrit M

    2015-06-01

    Transcription factors are abundant Sumo targets, yet the global distribution of Sumo along the chromatin and its physiological relevance in transcription are poorly understood. Using Saccharomyces cerevisiae, we determined the genome-wide localization of Sumo along the chromatin. We discovered that Sumo-enriched genes are almost exclusively involved in translation, such as tRNA genes and ribosomal protein genes (RPGs). Genome-wide expression analysis showed that Sumo positively regulates their transcription. We also discovered that the Sumo consensus motif at RPG promoters is identical to the DNA binding motif of the transcription factor Rap1. We demonstrate that Rap1 is a molecular target of Sumo and that sumoylation of Rap1 is important for cell viability. Furthermore, Rap1 sumoylation promotes recruitment of the basal transcription machinery, and sumoylation of Rap1 cooperates with the target of rapamycin kinase complex 1 (TORC1) pathway to promote RPG transcription. Strikingly, our data reveal that sumoylation of Rap1 functions in a homeostatic feedback loop that sustains RPG transcription during translational stress. Taken together, Sumo regulates the cellular translational capacity by promoting transcription of tRNA genes and RPGs. PMID:25800674

  9. Understanding the Pathogenicity of Noncoding Mismatch Repair Gene Promoter Variants in Lynch Syndrome.

    PubMed

    Liu, Qing; Thompson, Bryony A; Ward, Robyn L; Hesson, Luke B; Sloane, Mathew A

    2016-05-01

    Lynch syndrome is the most common familial cancer condition that mainly predisposes to tumors of the colon and endometrium. Cancer susceptibility is caused by the autosomal dominant inheritance of a loss-of-function mutation or epimutation in one of the DNA mismatch repair (MMR) genes. Cancer risk assessment is often possible with nonsynonymous coding region mutations, but in many cases patients present with DNA sequence changes within noncoding regions, including the promoters, of MMR genes. The pathogenic role of promoter variants, and hence clinical significance, is unclear and this hinders the clinical management of carriers. In this review, we provide an overview of the classification of MMR gene variants, outline the laboratory assays and online resources that can be used to assess the causality of promoter variants in Lynch syndrome, and highlight some of the practical challenges of demonstrating the pathogenicity of these variants. In conclusion, we propose a guide that could be integrated into the current InSiGHT classification scheme to help determine if a MMR gene promoter variant is pathogenic. PMID:26888055

  10. Transcriptional regulation of teleost aicda genes. Pt 1 suppressors of promiscuous promoters

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In order to better understand antibody affinity maturation in fishes we sought to identify gene regulatory elements that could drive expression of activated B-cell specific fluorescent reporter transgenes in zebrafish. Specifically the promoter and several non-coding regions of the channel catfish (...

  11. Highly specific expression of luciferase gene in lungs of naive nude mice directed by prostate-specific antigen promoter

    SciTech Connect

    Li Hongwei; Li Jinzhong; Helm, Gregory A.; Pan Dongfeng . E-mail: Dongfeng_pan@yahoo.com

    2005-09-09

    PSA promoter has been demonstrated the utility for tissue-specific toxic gene therapy in prostate cancer models. Characterization of foreign gene overexpression in normal animals elicited by PSA promoter should help evaluate therapy safety. Here we constructed an adenovirus vector (AdPSA-Luc), containing firefly luciferase gene under the control of the 5837 bp long prostate-specific antigen promoter. A charge coupled device video camera was used to non-invasively image expression of firefly luciferase in nude mice on days 3, 7, 11 after injection of 2 x 10{sup 9} PFU of AdPSA-Luc virus via tail vein. The result showed highly specific expression of the luciferase gene in lungs of mice from day 7. The finding indicates the potential limitations of the suicide gene therapy of prostate cancer based on selectivity of PSA promoter. By contrary, it has encouraging implications for further development of vectors via PSA promoter to enable gene therapy for pulmonary diseases.

  12. Concomitant promoter methylation of multiple genes in lung adenocarcinomas from current, former and never smokers

    PubMed Central

    Tessema, Mathewos; Yu, Yang Y.; Stidley, Christine A.; Machida, Emi O.; Schuebel, Kornel E.; Baylin, Stephen B.; Belinsky, Steven A.

    2009-01-01

    Aberrant promoter hypermethylation is one of the major mechanisms in carcinogenesis and some critical growth regulatory genes have shown commonality in methylation across solid tumors. Twenty-six genes, 14 identified through methylation in colon and breast cancers, were evaluated using primary lung adenocarcinomas (n = 175) from current, former and never smokers. Tumor specificity of methylation was validated through comparison of 14 lung cancer cell lines to normal human bronchial epithelial cells derived from bronchoscopy of 20 cancer-free smokers. Twenty-five genes were methylated in 11–81% of primary tumors. Prevalence for methylation of TNFRSF10C, BHLHB5 and BOLL was significantly higher in adenocarcinomas from never smokers than smokers. The relation between methylation of individual genes was examined using pairwise comparisons. A significant association was seen between 138 (42%) of the possible 325 pairwise comparisons. Most notably, methylation of MMP2, BHLHB4 or p16 was significantly associated with methylation of 16–19 other genes, thus predicting for a widespread methylation phenotype. Kaplan–Meier log-rank test and proportional hazard models identified a significant association between methylation of SULF2 (a pro-growth, -angiogenesis and -migration gene) and better patient survival (hazard ratio = 0.23). These results demonstrate a high degree of commonality for targeted silencing of genes between lung and other solid tumors and suggest that promoter hypermethylation in cancer is a highly co-ordinated event. PMID:19435948

  13. Multiple Mobile Promoter Regions for the Rare Carbapenem Resistance Gene of Bacteroides fragilis

    PubMed Central

    Podglajen, I.; Breuil, J.; Rohaut, A.; Monsempes, C.; Collatz, E.

    2001-01-01

    Two novel insertion sequences (IS), IS1187 and IS1188, are described upstream from the carbapenem resistance gene cfiA in strains of Bacteroides fragilis. Mapping, with the RACE procedure, of transcription start sites of cfiA in these and two other previously reported IS showed that transcription of this rarely encountered gene is initiated close to a variety of B. fragilis consensus promoter sequences, as recently defined (D. P. Bayley, E. R. Rocha, and C. J. Smith, FEMS Microbiol. Lett. 193:149–154, 2000). In the cases of IS1186 and IS1188, these sequences overlap with putative Eς70 promoter sequences, while in IS942 and IS1187 such sequences can be observed either upstream or downstream of the B. fragilis promoters. PMID:11344163

  14. Motif discovery in promoters of genes co-localized and co-expressed during myeloid cells differentiation

    PubMed Central

    Coppe, Alessandro; Ferrari, Francesco; Bisognin, Andrea; Danieli, Gian Antonio; Ferrari, Sergio; Bicciato, Silvio; Bortoluzzi, Stefania

    2009-01-01

    Genes co-expressed may be under similar promoter-based and/or position-based regulation. Although data on expression, position and function of human genes are available, their true integration still represents a challenge for computational biology, hampering the identification of regulatory mechanisms. We carried out an integrative analysis of genomic position, functional annotation and promoters of genes expressed in myeloid cells. Promoter analysis was conducted by a novel multi-step method for discovering putative regulatory elements, i.e. over-represented motifs, in a selected set of promoters, as compared with a background model. The combination of transcriptional, structural and functional data allowed the identification of sets of promoters pertaining to groups of genes co-expressed and co-localized in regions of the human genome. The application of motif discovery to 26 groups of genes co-expressed in myeloid cells differentiation and co-localized in the genome showed that there are more over-represented motifs in promoters of co-expressed and co-localized genes than in promoters of simply co-expressed genes (CEG). Motifs, which are similar to the binding sequences of known transcription factors, non-uniformly distributed along promoter sequences and/or occurring in highly co-expressed subset of genes were identified. Co-expressed and co-localized gene sets were grouped in two co-expressed genomic meta-regions, putatively representing functional domains of a high-level expression regulation. PMID:19059999

  15. Assembly PCR synthesis of optimally designed, compact, multi-responsive promoters suited to gene therapy application

    PubMed Central

    Mohamed, H.; Chernajovsky, Y.; Gould, D.

    2016-01-01

    Gene therapy has the potential to provide innovative treatments for genetic and non-genetic diseases, with the ability to auto-regulate expression levels of therapeutic molecules so that they are produced locally and in direct response to disease activity. Generating disease responsive gene therapy vectors requires knowledge of the activation profile of transcription factors (TFs) during active disease, in order to assemble binding sites for these TFs into synthetic promoters, which can be appropriately activated by the disease process. In this study, we optimised a PCR random assembly approach to generate promoters with optimal spacing between TF binding sites (TFBSs) and their distance from the TATA box. In promoters with optimal spacing, it was possible to demonstrate activation by individual transcription pathways and either additive or synergistic promoter activation when transfected cells were treated with combined stimuli. The kinetics and sensitivity of promoter activation was further explored in transduced cells and when lentivirus was directly delivered to mouse paws a synthetic promoter demonstrated excellent activation by real-time imaging in response to local inflammation. PMID:27387837

  16. Characterization of 5' promoter and exon 1-3 polymorphism of the RAET1E gene.

    PubMed

    Cox, Steven T; Pearson, Hayley; Laza-Briviesca, Raquel; Pesoa, Susanna; Vullo, Carlos; Madrigal, J Alejandro; Saudemont, Aurore

    2016-01-01

    NKG2D is an activating receptor utilized by natural killer (NK) cells that recognizes upregulated ligands on infected, tumorigenic and damaged cells, leading to their cytolysis. However, the NKG2D ligand (NKG2DL) system is very complex with eight known gene loci encoding slightly different molecules. Furthermore, most NKG2DL gene loci such as MICA and MICB are highly polymorphic with potential for functional differences. NKG2DL expression on tumors varies depending on the malignancy and tumors can also release soluble NKG2DL that exert anergic effects on NK cells when engagement with NKG2D occurs, allowing escape from NK cell immunosurveillance. We carried out RAET1E typing of IHW cell line DNA, including a 580 bp proximal promoter fragment and exons 1-3 identifying 13 of 15 known RAET1E alleles. We determined 7 polymorphisms within the promoter region, including 2 already known that contributed to 9 promoter types. RAET1E alleles with variability in the extracellular region also differed with respect to promoter type and one allele, RAET1E(∗)003, associated with 5 promoter types. We then identified putative transcription factor binding sites for RAET1E, and found 5 of the 7 promoter polymorphisms may disrupt these sites, abrogating binding of transcription factors and varying the potential level of expression. PMID:26519211

  17. Conserved distal promoter of the agouti signaling protein (ASIP) gene controls sexual dichromatism in chickens.

    PubMed

    Oribe, Eri; Fukao, Ayaka; Yoshihara, Chihiro; Mendori, Misa; Rosal, Karen G; Takahashi, Sumio; Takeuchi, Sakae

    2012-06-01

    Brilliant plumage is typical of male birds, thus sexual plumage dichromatism is seen in many avian species; however, the molecular mechanism underlying this remains unclear. The agouti signaling protein (ASIP) is a paracrine factor that stimulates yellow/red pigment (pheomelanin) synthesis and inhibits black/brown pigment (eumelanin) synthesis in follicular melanocytes. In mammals, the distal promoter of the ASIP gene acts exclusively on the ventral side of the body to create a countershading pigmentation pattern by stimulating pheomelanin synthesis in the ventrum. Here, we examined the role of the distal ASIP promoter in controlling estrogen-dependent sexual dichromatism in chickens. Reverse-transcription polymerase chain reaction analyses revealed that ASIP class 1 mRNAs transcribed by the distal promoter were expressed exclusively on the ventral side of chicks and adult females displaying countershading. In showy adult males, the ASIP class 1 mRNAs were expressed in gold-colored ornamental feathers grown on the back. In the presence of estrogen, males molted into female-like plumage and ASIP class 1 mRNAs expression was altered to female patterns. These results suggest that the distal ASIP promoter produces countershading in chicks and adult females, similar to the ventral-specific ASIP promoter in mammals. In addition, the class 1 promoter plays an important role for creating sexual plumage dichromatism controlled by estrogen. This is the first evidence for a pigmentation gene having been modified in its expression during evolution to develop phenotypic diversity between individuals of different sexes. PMID:22554923

  18. Assembly PCR synthesis of optimally designed, compact, multi-responsive promoters suited to gene therapy application.

    PubMed

    Mohamed, H; Chernajovsky, Y; Gould, D

    2016-01-01

    Gene therapy has the potential to provide innovative treatments for genetic and non-genetic diseases, with the ability to auto-regulate expression levels of therapeutic molecules so that they are produced locally and in direct response to disease activity. Generating disease responsive gene therapy vectors requires knowledge of the activation profile of transcription factors (TFs) during active disease, in order to assemble binding sites for these TFs into synthetic promoters, which can be appropriately activated by the disease process. In this study, we optimised a PCR random assembly approach to generate promoters with optimal spacing between TF binding sites (TFBSs) and their distance from the TATA box. In promoters with optimal spacing, it was possible to demonstrate activation by individual transcription pathways and either additive or synergistic promoter activation when transfected cells were treated with combined stimuli. The kinetics and sensitivity of promoter activation was further explored in transduced cells and when lentivirus was directly delivered to mouse paws a synthetic promoter demonstrated excellent activation by real-time imaging in response to local inflammation. PMID:27387837

  19. Glutathione and fungal elicitor regulation of a plant defense gene promoter in electroporated protoplasts

    PubMed Central

    Dron, Michel; Clouse, Steven D.; Dixon, Richard A.; Lawton, Michael A.; Lamb, Christopher J.

    1988-01-01

    To investigate the mechanisms underlying activation of plant defenses against microbial attack we have studied elicitor regulation of a chimeric gene comprising the 5′ flanking region of a defense gene encoding the phytoalexin biosynthetic enzyme chalcone synthase fused to a bacterial chloramphenicol acetyltransferase gene. Glutathione or fungal elicitor caused a rapid, marked but transient expression of the chimeric gene electroporated into soybean protoplasts. The response closely resembled that of endogenous chalcone synthase genes in suspension cultured cells. Functional analysis of 5′ deletions suggests that promoter activity is determined by an elicitor-regulated activator located between the “TATA box” and nucleotide position -173 and an upstream silencer between -173 and -326. These cis-acting elements function in the transduction of the elicitation signal to initiate elaboration of an inducible defense response. Images PMID:16593981

  20. Genetic analysis of the TBX3 gene promoter in ventricular septal defects.

    PubMed

    Chen, Dongfeng; Qiao, Yanli; Meng, Haihong; Pang, Shuchao; Huang, Wenhui; Zhang, Hongyu; Yan, Bo

    2013-01-10

    Congenital heart disease (CHD) is the most common birth defect in humans. Genetic causes and underlying molecular mechanisms for CHD remain largely unknown. T-box transcription factor 3 (TBX3) plays a critical role in the developing heart in a dose-dependent manner. TBX3 represses chamber myocardial gene expression. Mutations in TBX3 gene have been associated to ulnar-mammary syndrome with multiple developmental defects, including cardiac defects. We hypothesized that the sequence variants within TBX3 gene promoter that change TBX3 levels may mediate CHD development. In this study, TBX3 gene promoter was genetically analyzed in large cohorts of patients with ventricular septal defect (VSD) (n=325) and ethnic-matched healthy controls (n=359). Seven sequence variants, including two single-nucleotide polymorphisms (g.3863 C>T and g.4095G>T), three novel deletions (g.4433_4435del, g.4672_4675del and g.4820_4821del) and two novel insertions (g.3913_3914ins and g.4735_4736ins), were identified. Five of the seven variants were identified in VSD patients and controls with similar frequencies. Two other variants were found only in controls. These variants, which were observed in high frequencies, did not modify or interrupt the critical binding site for basic transcription factors. Taken together, these results suggested that the sequence variants within the TBX3 gene promoter did not contribute to VSD etiology. PMID:23116943

  1. Activity analysis and preliminary inducer screening of the chicken DAZL gene promoter.

    PubMed

    Zhang, Lei; Zhu, Rui; Zuo, Qisheng; Li, Dong; Lian, Chao; Tang, Beibei; Xiao, Tianrong; Zhang, Yani; Li, Bichun

    2015-01-01

    This study was aimed at identifying the active control area of chicken DAZL gene core promoter, to screen optimum inducers of the DAZL gene, thus to enhance the differentiation of embryonic stem cells into spermatogonial stem cells. Fragments of chicken DAZL gene promoter were cloned into fluorescent reporter plasmids and transfected into DF-1 cells. Then Dual-Luciferase® Reporter Assay System was used to identify the activity of the DAZL gene under different inducers. Our studies showed that the DAZL core promoter region for the Suqin yellow chicken was -383 to -39 bp. The dual-luciferase® reporter showed that all-trans retinoic acid (ATRA), a retinoic acid receptor alpha agonist (tamibarotene/Am80), or estradiol (E2) could significantly enhance DAZL transcription. The in vitro inductive culture of chicken ESCs demonstrated that, with ATRA treatment, DAZL transcription peaked at 6 days and then decreased slowly; whereas, DAZL transcription was continuous and peaked at 10 days with Am80 treatment. E2 treatment significantly increased DAZL expression after 8 days. All three treatments were associated with the appearance of male germ cell (MGC)-like cells on day 10. These results provide the optimum inducer screening of the DAZL gene and lay the foundation for further screening of compounds that can induce the differentiation of ESCs into MGCs in vitro. PMID:25807265

  2. Activity Analysis and Preliminary Inducer Screening of the Chicken DAZL Gene Promoter

    PubMed Central

    Zhang, Lei; Zhu, Rui; Zuo, Qisheng; Li, Dong; Lian, Chao; Tang, Beibei; Xiao, Tianrong; Zhang, Yani; Li, Bichun

    2015-01-01

    This study was aimed at identifying the active control area of chicken DAZL gene core promoter, to screen optimum inducers of the DAZL gene, thus to enhance the differentiation of embryonic stem cells into spermatogonial stem cells. Fragments of chicken DAZL gene promoter were cloned into fluorescent reporter plasmids and transfected into DF-1 cells. Then Dual-Luciferase® Reporter Assay System was used to identify the activity of the DAZL gene under different inducers. Our studies showed that the DAZL core promoter region for the Suqin yellow chicken was −383 to −39 bp. The dual-luciferase® reporter showed that all-trans retinoic acid (ATRA), a retinoic acid receptor alpha agonist (tamibarotene/Am80), or estradiol (E2) could significantly enhance DAZL transcription. The in vitro inductive culture of chicken ESCs demonstrated that, with ATRA treatment, DAZL transcription peaked at 6 days and then decreased slowly; whereas, DAZL transcription was continuous and peaked at 10 days with Am80 treatment. E2 treatment significantly increased DAZL expression after 8 days. All three treatments were associated with the appearance of male germ cell (MGC)-like cells on day 10. These results provide the optimum inducer screening of the DAZL gene and lay the foundation for further screening of compounds that can induce the differentiation of ESCs into MGCs in vitro. PMID:25807265

  3. Genetic and functional analysis of the TBX3 gene promoter in indirect inguinal hernia.

    PubMed

    Zhao, Zhongqing; Tian, Wenjun; Wang, Lin; Wang, Haihua; Qin, Xianyun; Xing, Qining; Pang, Shuchao; Yan, Bo

    2015-01-01

    Inguinal hernia is a common developmental disease in children and most cases are indirect inguinal hernia (IIH). Genetic factors have been suggested to play important roles in IIH. Although IIH has been observed in several human syndromes, genetic causes and molecular mechanisms for IIH remain unknown. TBX3 is a member of the T-box family of transcription factors that are essential to the embryonic development. Human studies and animal experiments have demonstrated that TBX3 is required for the development of the heart, limbs, mammary glands and other tissues and organs. TBX3 gene expression has been detected in human fibroblast and tissues of abdominal wall. We speculated that TBX3 may be involved in the IIH formation. Since TBX3 activity is highly dosage-sensitive, a TBX3 gene promoter was genetically and functionally analyzed in IIH patients and ethnic-matched controls in this study. One heterozygous deletion variant (g.4820_4821del) was identified in one IIH patient, but in none of controls. The variant significantly decreased TBX3 gene promoter activities, likely by creating a binding site for sex-determining region Y (SRY), mobility group transcription factor. One heterozygous insertion variant (g.3913_3914ins) was only found in one control, which did not affect TBX3 gene promoter activities. Taken together, TBX3 gene variants may contribute to IIH as a rare risk factor by reducing TBX3 levels. PMID:25455105

  4. Lentiviral gene therapy using cellular promoters cures type 1 Gaucher disease in mice.

    PubMed

    Dahl, Maria; Doyle, Alexander; Olsson, Karin; Månsson, Jan-Eric; Marques, André R A; Mirzaian, Mina; Aerts, Johannes M; Ehinger, Mats; Rothe, Michael; Modlich, Ute; Schambach, Axel; Karlsson, Stefan

    2015-05-01

    Gaucher disease is caused by an inherited deficiency of the enzyme glucosylceramidase. Due to the lack of a fully functional enzyme, there is progressive build-up of the lipid component glucosylceramide. Insufficient glucosylceramidase activity results in hepatosplenomegaly, cytopenias, and bone disease in patients. Gene therapy represents a future therapeutic option for patients unresponsive to enzyme replacement therapy and lacking a suitable bone marrow donor. By proof-of-principle experiments, we have previously demonstrated a reversal of symptoms in a murine disease model of type 1 Gaucher disease, using gammaretroviral vectors harboring strong viral promoters to drive glucosidase β-acid (GBA) gene expression. To investigate whether safer vectors can correct the enzyme deficiency, we utilized self-inactivating lentiviral vectors (SIN LVs) with the GBA gene under the control of human phosphoglycerate kinase (PGK) and CD68 promoter, respectively. Here, we report prevention of, as well as reversal of, manifest disease symptoms after lentiviral gene transfer. Glucosylceramidase activity above levels required for clearance of glucosylceramide from tissues resulted in reversal of splenomegaly, reduced Gaucher cell infiltration and a restoration of hematological parameters. These findings support the use of SIN-LVs with cellular promoters in future clinical gene therapy protocols for type 1 Gaucher disease. PMID:25655314

  5. Lentiviral Gene Therapy Using Cellular Promoters Cures Type 1 Gaucher Disease in Mice

    PubMed Central

    Dahl, Maria; Doyle, Alexander; Olsson, Karin; Månsson, Jan-Eric; Marques, André R A; Mirzaian, Mina; Aerts, Johannes M; Ehinger, Mats; Rothe, Michael; Modlich, Ute; Schambach, Axel; Karlsson, Stefan

    2015-01-01

    Gaucher disease is caused by an inherited deficiency of the enzyme glucosylceramidase. Due to the lack of a fully functional enzyme, there is progressive build-up of the lipid component glucosylceramide. Insufficient glucosylceramidase activity results in hepatosplenomegaly, cytopenias, and bone disease in patients. Gene therapy represents a future therapeutic option for patients unresponsive to enzyme replacement therapy and lacking a suitable bone marrow donor. By proof-of-principle experiments, we have previously demonstrated a reversal of symptoms in a murine disease model of type 1 Gaucher disease, using gammaretroviral vectors harboring strong viral promoters to drive glucosidase β-acid (GBA) gene expression. To investigate whether safer vectors can correct the enzyme deficiency, we utilized self-inactivating lentiviral vectors (SIN LVs) with the GBA gene under the control of human phosphoglycerate kinase (PGK) and CD68 promoter, respectively. Here, we report prevention of, as well as reversal of, manifest disease symptoms after lentiviral gene transfer. Glucosylceramidase activity above levels required for clearance of glucosylceramide from tissues resulted in reversal of splenomegaly, reduced Gaucher cell infiltration and a restoration of hematological parameters. These findings support the use of SIN-LVs with cellular promoters in future clinical gene therapy protocols for type 1 Gaucher disease. PMID:25655314

  6. Functional elements of the promoter region of the Aspergillus oryzae glaA gene encoding glucoamylase.

    PubMed

    Hata, Y; Kitamoto, K; Gomi, K; Kumagai, C; Tamura, G

    1992-08-01

    Analysis was made of the promoter region of the Aspergillus oryzae glaA gene encoding glucoamylase. Northern blots using a glucoamylase cDNA as a probe indicated that the amount of mRNA corresponding to the glaA gene increased when expression was induced by starch or maltose. The promoter region of the glaA gene was fused to the Escherichia coli uidA gene, encoding beta-glucuronidase (GUS), and the resultant plasmid was introduced into A. oryzae. Expression of GUS protein in the A. oryzae transformants was induced by maltose, indicating that the glaA-GUS gene was regulated at the level of transcription in the presence of maltose. The nucleotide sequence 1.1 kb upstream of the glaA coding region was determined. A comparison of the nucleotide sequence of the A. oryzae glaA promoter with those of A. oryzae amyB, encoding alpha-amylase, and A. niger glaA showed two regions with similar sequences. Deletion and site-specific mutation analysis of these homologous regions indicated that both are essential for direct high-level expression when grown on maltose. PMID:1339327

  7. Identification of distal silencing elements in the murine interferon-A11 gene promoter.

    PubMed Central

    Roffet, P; Lopez, S; Navarro, S; Bandu, M T; Coulombel, C; Vignal, M; Doly, J; Vodjdani, G

    1996-01-01

    The murine interferon-A11 (Mu IFN-A11) gene is a member of the IFN-A multigenic family. In mouse L929 cells, the weak response of the gene's promoter to viral induction is due to a combination of both a point mutation in the virus responsive element (VRE) and the presence of negatively regulating sequences surrounding the VRE. In the distal part of the promoter, the negatively acting E1E2 sequence was delimited. This sequence displays an inhibitory effect in either orientation or position on the inducibility of a virus-responsive heterologous promoter. It selectively represses VRE-dependent transcription but is not able to reduce the transcriptional activity of a VRE-lacking promoter. In a transient transfection assay, an E1E2-containing DNA competitor was able to derepress the native Mu IFN-A11 promoter. Specific nuclear factors bind to this sequence; thus the binding of trans-regulators participates in the repression of the Mu IFN-A11 gene. The E1E2 sequence contains an IFN regulatory factor (IRF)-binding site. Recombinant IRF2 binds this sequence and anti-IRF2 antibodies supershift a major complex formed with nuclear extracts. The protein composing the complex is 50 kDa in size, indicating the presence of IRF2 or antigenically related proteins in the complex. The Mu IFN-A11 gene is the first example within the murine IFN-A family, in which a distal promoter element has been identified that can negatively modulate the transcriptional response to viral induction. PMID:8760352

  8. Validation study of genes with hypermethylated promoter regions associated with prostate cancer recurrence

    PubMed Central

    Stott-Miller, Marni; Zhao, Shanshan; Wright, Jonathan L.; Kolb, Suzanne; Bibikova, Marina; Klotzle, Brandy; Ostrander, Elaine A.; Fan, Jian-Bing; Feng, Ziding; Stanford, Janet L.

    2014-01-01

    Background One challenge in prostate cancer (PCa) is distinguishing indolent from aggressive disease at diagnosis. DNA promoter hypermethylation is a frequent epigenetic event in PCa, but few studies of DNA methylation in relation to features of more aggressive tumors or PCa recurrence have been completed. Methods We used the Infinium® HumanMethylation450 BeadChip to assess DNA methylation in tumor tissue from 407 patients with clinically localized PCa who underwent radical prostatectomy. Recurrence status was determined by follow-up patient surveys, medical record review, and linkage with the SEER registry. The methylation status of 14 genes for which promoter hypermethylation was previously correlated with advanced disease or biochemical recurrence was evaluated. Average methylation level for promoter region CpGs in patients who recurred compared to those with no evidence of recurrence was analyzed. For two genes with differential methylation, time to recurrence was examined. Results During an average follow-up of 11.7 years, 104 (26%) patients recurred. Significant promoter hypermethylation in at least 50% of CpG sites in two genes, ABHD9 and HOXD3, was found in tumors from patients who recurred compared to those without recurrence. Evidence was strongest for HOXD3 (lowest P = 9.46x10−6), with higher average methylation across promoter region CpGs associated with reduced recurrence-free survival (P = 2×10−4). DNA methylation profiles did not differ by recurrence status for the other genes. Conclusions These results validate the association between promoter hypermethylation of ADHB9 and HOXD3 and PCa recurrence. Impact Tumor DNA methylation profiling may help distinguish PCa patients at higher risk for disease recurrence. PMID:24718283

  9. Promoter architecture dictates cell-to-cell variability in gene expression

    PubMed Central

    Jones, Daniel L.; Brewster, Robert C.; Phillips, Rob

    2015-01-01

    Variability in gene expression among genetically identical cells has emerged as a central preoccupation in the study of gene regulation; however, a divide exists between the predictions of molecular models of prokaryotic transcriptional regulation and genome-wide experimental studies suggesting that this variability is indifferent to the underlying regulatory architecture. We constructed a set of promoters in Escherichia coli in which promoter strength, transcription factor binding strength, and transcription factor copy numbers are systematically varied, and used messenger RNA (mRNA) fluorescence in situ hybridization to observe how these changes affected variability in gene expression. Our parameter-free models predicted the observed variability; hence, the molecular details of transcription dictate variability in mRNA expression, and transcriptional noise is specifically tunable and thus represents an evolutionarily accessible phenotypic parameter. PMID:25525251

  10. Hydroxymethylcytosine and demethylation of the γ-globin gene promoter during erythroid differentiation.

    PubMed

    Ruiz, Maria Armila; Rivers, Angela; Ibanez, Vinzon; Vaitkus, Kestis; Mahmud, Nadim; DeSimone, Joseph; Lavelle, Donald

    2015-01-01

    The mechanism responsible for developmental stage-specific regulation of γ-globin gene expression involves DNA methylation. Previous results have shown that the γ-globin promoter is nearly fully demethylated during fetal liver erythroid differentiation and partially demethylated during adult bone marrow erythroid differentiation. The hypothesis that 5-hydroxymethylcytosine (5 hmC), a known intermediate in DNA demethylation pathways, is involved in demethylation of the γ-globin gene promoter during erythroid differentiation was investigated by analyzing levels of 5-methylcytosine (5 mC) and 5 hmC at a CCGG site within the 5' γ-globin gene promoter region in FACS-purified cells from baboon bone marrow and fetal liver enriched for different stages of erythroid differentiation. Our results show that 5 mC and 5 hmC levels at the γ-globin promoter are dynamically modulated during erythroid differentiation with peak levels of 5 hmC preceding and/or coinciding with demethylation. The Tet2 and Tet3 dioxygenases that catalyze formation of 5 hmC are expressed during early stages of erythroid differentiation and Tet3 expression increases as differentiation proceeds. In baboon CD34+ bone marrow-derived erythroid progenitor cell cultures, γ-globin expression was positively correlated with 5 hmC and negatively correlated with 5 mC at the γ-globin promoter. Supplementation of culture media with Vitamin C, a cofactor of the Tet dioxygenases, reduced γ-globin promoter DNA methylation and increased γ-globin expression when added alone and in an additive manner in combination with either DNA methyltransferase or LSD1 inhibitors. These results strongly support the hypothesis that the Tet-mediated 5 hmC pathway is involved in developmental stage-specific regulation of γ-globin expression by mediating demethylation of the γ-globin promoter. PMID:25932923

  11. [Cloning and regulation of pig estrogen related receptor β gene (ESRRB) promoter].

    PubMed

    Yang, Yang; Wang, Yaxian; Du, Lixia; Wang, Huayan

    2015-04-01

    The estrogen related receptor family member Esrrb (Estrogen related receptor β) is a gene that expresses in the early stage of embryo and plays an important role in the core pluripotent network. Its function has been analyzed in human and mouse, although no report so far related to pig. Therefore, to explore its mechanism of transcriptional regulation and expression pattern, we cloned a 3.3 kb pig ESRRB promoter by PCR and constructed the green fluorescence protein (GFP) reporter vector pE3.3. We used these vectors to study the ESRRB expression pattern in 293T, Hela and C2C12. Sequence was analyzed for regulatory elements that share homology to known transcription factor binding sites by TFSEARCH and JASPER program. Some pluripotency related genes such as SMAD, STAT3, MYC, KLF4 and ESRRB have been found within the 3.3 kb sequence by co-transfected pig ESRRB promoter and these potential regulators. We found that ESRRB only expressed in 293T and SMAD could activate ESRRB expression obviously. To determine the core promoter region, a series of ESRRB promoter fragments with gradually truncated 5'-end were produced by PCR and inserted into pGL3-Basic vector. After transient transfection into 293T, dual luciferase assay was used to measure these promoter activities. The result suggested that the core promoter of pig ESRRB located within -25 bp to -269 bp region. These results suggest that these transcription factor binding sites and the core promoter region may be essential for transcriptional regulation of pig ESRRB gene. PMID:26380406

  12. Hydroxymethylcytosine and demethylation of the γ-globin gene promoter during erythroid differentiation

    PubMed Central

    Ruiz, Maria Armila; Rivers, Angela; Ibanez, Vinzon; Vaitkus, Kestis; Mahmud, Nadim; DeSimone, Joseph; Lavelle, Donald

    2015-01-01

    The mechanism responsible for developmental stage-specific regulation of γ-globin gene expression involves DNA methylation. Previous results have shown that the γ-globin promoter is nearly fully demethylated during fetal liver erythroid differentiation and partially demethylated during adult bone marrow erythroid differentiation. The hypothesis that 5-hydroxymethylcytosine (5hmC), a known intermediate in DNA demethylation pathways, is involved in demethylation of the γ-globin gene promoter during erythroid differentiation was investigated by analyzing levels of 5-methylcytosine (5mC) and 5hmC at a CCGG site within the 5′ γ-globin gene promoter region in FACS-purified cells from baboon bone marrow and fetal liver enriched for different stages of erythroid differentiation. Our results show that 5mC and 5hmC levels at the γ-globin promoter are dynamically modulated during erythroid differentiation with peak levels of 5hmC preceding and/or coinciding with demethylation. The Tet2 and Tet3 dioxygenases that catalyze formation of 5hmC are expressed during early stages of erythroid differentiation and Tet3 expression increases as differentiation proceeds. In baboon CD34+ bone marrow-derived erythroid progenitor cell cultures, γ-globin expression was positively correlated with 5hmC and negatively correlated with 5mC at the γ-globin promoter. Supplementation of culture media with Vitamin C, a cofactor of the Tet dioxygenases, reduced γ-globin promoter DNA methylation and increased γ-globin expression when added alone and in an additive manner in combination with either DNA methyltransferase or LSD1 inhibitors. These results strongly support the hypothesis that the Tet-mediated 5hmC pathway is involved in developmental stage-specific regulation of γ-globin expression by mediating demethylation of the γ-globin promoter. PMID:25932923

  13. Over-represented localized sequence motifs in ribosomal protein gene promoters of basal metazoans.

    PubMed

    Perina, Drago; Korolija, Marina; Roller, Maša; Harcet, Matija; Jeličić, Branka; Mikoč, Andreja; Cetković, Helena

    2011-07-01

    Equimolecular presence of ribosomal proteins (RPs) in the cell is needed for ribosome assembly and is achieved by synchronized expression of ribosomal protein genes (RPGs) with promoters of similar strengths. Over-represented motifs of RPG promoter regions are identified as targets for specific transcription factors. Unlike RPs, those motifs are not conserved between mammals, drosophila, and yeast. We analyzed RPGs proximal promoter regions of three basal metazoans with sequenced genomes: sponge, cnidarian, and placozoan and found common features, such as 5'-terminal oligopyrimidine tracts and TATA-boxes. Furthermore, we identified over-represented motifs, some of which displayed the highest similarity to motifs abundant in human RPG promoters and not present in Drosophila or yeast. Our results indicate that humans over-represented motifs, as well as corresponding domains of transcription factors, were established very early in metazoan evolution. The fast evolving nature of RPGs regulatory network leads to formation of other, lineage specific, over-represented motifs. PMID:21457775

  14. Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori

    SciTech Connect

    Liu Yan; Yu Lian; Guo Xiuyang; Guo Tingqing; Wang Shengpeng; Lu Changde . E-mail: cdlu@sibs.ac.cn

    2006-03-31

    The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat body nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.

  15. Polymorphic tandem repeats within gene promoters act as modifiers of gene expression and DNA methylation in humans.

    PubMed

    Quilez, Javier; Guilmatre, Audrey; Garg, Paras; Highnam, Gareth; Gymrek, Melissa; Erlich, Yaniv; Joshi, Ricky S; Mittelman, David; Sharp, Andrew J

    2016-05-01

    Despite representing an important source of genetic variation, tandem repeats (TRs) remain poorly studied due to technical difficulties. We hypothesized that TRs can operate as expression (eQTLs) and methylation (mQTLs) quantitative trait loci. To test this we analyzed the effect of variation at 4849 promoter-associated TRs, genotyped in 120 individuals, on neighboring gene expression and DNA methylation. Polymorphic promoter TRs were associated with increased variance in local gene expression and DNA methylation, suggesting functional consequences related to TR variation. We identified >100 TRs associated with expression/methylation levels of adjacent genes. These potential eQTL/mQTL TRs were enriched for overlaps with transcription factor binding and DNaseI hypersensitivity sites, providing a rationale for their effects. Moreover, we showed that most TR variants are poorly tagged by nearby single nucleotide polymorphisms (SNPs) markers, indicating that many functional TR variants are not effectively assayed by SNP-based approaches. Our study assigns biological significance to TR variations in the human genome, and suggests that a significant fraction of TR variations exert functional effects via alterations of local gene expression or epigenetics. We conclude that targeted studies that focus on genotyping TR variants are required to fully ascertain functional variation in the genome. PMID:27060133

  16. Polymorphic tandem repeats within gene promoters act as modifiers of gene expression and DNA methylation in humans

    PubMed Central

    Quilez, Javier; Guilmatre, Audrey; Garg, Paras; Highnam, Gareth; Gymrek, Melissa; Erlich, Yaniv; Joshi, Ricky S.; Mittelman, David; Sharp, Andrew J.

    2016-01-01

    Despite representing an important source of genetic variation, tandem repeats (TRs) remain poorly studied due to technical difficulties. We hypothesized that TRs can operate as expression (eQTLs) and methylation (mQTLs) quantitative trait loci. To test this we analyzed the effect of variation at 4849 promoter-associated TRs, genotyped in 120 individuals, on neighboring gene expression and DNA methylation. Polymorphic promoter TRs were associated with increased variance in local gene expression and DNA methylation, suggesting functional consequences related to TR variation. We identified >100 TRs associated with expression/methylation levels of adjacent genes. These potential eQTL/mQTL TRs were enriched for overlaps with transcription factor binding and DNaseI hypersensitivity sites, providing a rationale for their effects. Moreover, we showed that most TR variants are poorly tagged by nearby single nucleotide polymorphisms (SNPs) markers, indicating that many functional TR variants are not effectively assayed by SNP-based approaches. Our study assigns biological significance to TR variations in the human genome, and suggests that a significant fraction of TR variations exert functional effects via alterations of local gene expression or epigenetics. We conclude that targeted studies that focus on genotyping TR variants are required to fully ascertain functional variation in the genome. PMID:27060133

  17. The insertion of a novel retrotransposon in the promoter of a vernalization gene resulted in early flowering in tetraploid wheat

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Previous reports showed allelic variation in wheat vernalization gene VRN1 was due to deletions either in the promoter or the first intron. Here, we identified a novel Vrn-B1 allele that has a retrotransposon in its promoter conferring spring growth habit. The VRN-B1 gene was mapped in a doubled hap...

  18. Nanoalumina promotes the horizontal transfer of multiresistance genes mediated by plasmids across genera

    PubMed Central

    Qiu, Zhigang; Yu, Yunmei; Chen, Zhaoli; Jin, Min; Yang, Dong; Zhao, Zuguo; Wang, Jingfeng; Shen, Zhiqiang; Wang, Xinwei; Qian, Di; Huang, Aihua; Zhang, Buchang; Li, Jun-Wen

    2012-01-01

    Antibiotic resistance is a worldwide public health concern. Conjugative transfer between closely related strains or species of bacteria is an important method for the horizontal transfer of multidrug-resistance genes. The extent to which nanomaterials are able to cause an increase in antibiotic resistance by the regulation of the conjugative transfer of antibiotic-resistance genes in bacteria, especially across genera, is still unknown. Here we show that nanomaterials in water can significantly promote the horizontal conjugative transfer of multidrug-resistance genes mediated by the RP4, RK2, and pCF10 plasmids. Nanoalumina can promote the conjugative transfer of the RP4 plasmid from Escherichia coli to Salmonella spp. by up to 200-fold compared with untreated cells. We also explored the mechanisms behind this phenomenon and demonstrate that nanoalumina is able to induce oxidative stress, damage bacterial cell membranes, enhance the expression of mating pair formation genes and DNA transfer and replication genes, and depress the expression of global regulatory genes that regulate the conjugative transfer of RP4. These findings are important in assessing the risk of nanomaterials to the environment, particularly from water and wastewater treatment systems, and in the estimation of the effect of manufacture and use of nanomaterials on the environment. PMID:22411796

  19. A gene-specific non-enhancer sequence is critical for expression from the promoter of the small heat shock protein gene αB-crystallin

    PubMed Central

    2014-01-01

    Background Deciphering of the information content of eukaryotic promoters has remained confined to universal landmarks and conserved sequence elements such as enhancers and transcription factor binding motifs, which are considered sufficient for gene activation and regulation. Gene-specific sequences, interspersed between the canonical transacting factor binding sites or adjoining them within a promoter, are generally taken to be devoid of any regulatory information and have therefore been largely ignored. An unanswered question therefore is, do gene-specific sequences within a eukaryotic promoter have a role in gene activation? Here, we present an exhaustive experimental analysis of a gene-specific sequence adjoining the heat shock element (HSE) in the proximal promoter of the small heat shock protein gene, αB-crystallin (cryab). These sequences are highly conserved between the rodents and the humans. Results Using human retinal pigment epithelial cells in culture as the host, we have identified a 10-bp gene-specific promoter sequence (GPS), which, unlike an enhancer, controls expression from the promoter of this gene, only when in appropriate position and orientation. Notably, the data suggests that GPS in comparison with the HSE works in a context-independent fashion. Additionally, when moved upstream, about a nucleosome length of DNA (−154 bp) from the transcription start site (TSS), the activity of the promoter is markedly inhibited, suggesting its involvement in local promoter access. Importantly, we demonstrate that deletion of the GPS results in complete loss of cryab promoter activity in transgenic mice. Conclusions These data suggest that gene-specific sequences such as the GPS, identified here, may have critical roles in regulating gene-specific activity from eukaryotic promoters. PMID:24589182

  20. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

    PubMed

    Xin, Shan; Tao, Chengcheng; Li, Hongbin

    2016-01-01

    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a

  1. Isolation and characterization of "GmScream" promoters that regulate highly expressing soybean (Glycine max Merr.) genes.

    PubMed

    Zhang, Ning; McHale, Leah K; Finer, John J

    2015-12-01

    To increase our understanding of the regulatory components that control gene expression, it is important to identify, isolate and characterize new promoters. In this study, a group of highly expressed soybean (Glycine max Merr.) genes, which we have named "GmScream", were first identified from RNA-Seq data. The promoter regions were then identified, cloned and fused with the coding region of the green fluorescent protein (gfp) gene, for introduction and analysis in different tissues using 3 tools for validation. Approximately half of the GmScream promoters identified showed levels of GFP expression comparable to or higher than the Cauliflower Mosaic Virus 35S (35S) promoter. Using transient expression in lima bean cotyledonary tissues, the strongest GmScream promoters gave over 6-fold higher expression than the 35S promoter while several other GmScream promoters showed 2- to 3-fold higher expression. The two highest expressing promoters, GmScreamM4 and GmScreamM8, regulated two different elongation factor 1A genes in soybean. In stably transformed soybean tissues, GFP driven by the GmScreamM4 or GmScreamM8 promoter exhibited constitutive high expression in most tissues with preferentially higher expression in proliferative embryogenic tissues, procambium, vascular tissues, root tips and young embryos. Using deletion analysis of the promoter, two proximal regions of the GmScreamM8 promoter were identified as contributing significantly to high levels of gene expression. PMID:26706070

  2. Conserved cis-regulatory modules in promoters of genes encoding wheat high-molecular-weight glutenin subunits

    PubMed Central

    Ravel, Catherine; Fiquet, Samuel; Boudet, Julie; Dardevet, Mireille; Vincent, Jonathan; Merlino, Marielle; Michard, Robin; Martre, Pierre

    2014-01-01

    The concentration and composition of the gliadin and glutenin seed storage proteins (SSPs) in wheat flour are the most important determinants of its end-use value. In cereals, the synthesis of SSPs is predominantly regulated at the transcriptional level by a complex network involving at least five cis-elements in gene promoters. The high-molecular-weight glutenin subunits (HMW-GS) are encoded by two tightly linked genes located on the long arms of group 1 chromosomes. Here, we sequenced and annotated the HMW-GS gene promoters of 22 electrophoretic wheat alleles to identify putative cis-regulatory motifs. We focused on 24 motifs known to be involved in SSP gene regulation. Most of them were identified in at least one HMW-GS gene promoter sequence. A common regulatory framework was observed in all the HMW-GS gene promoters, as they shared conserved cis-regulatory modules (CCRMs) including all the five motifs known to regulate the transcription of SSP genes. This common regulatory framework comprises a composite box made of the GATA motifs and GCN4-like Motifs (GLMs) and was shown to be functional as the GLMs are able to bind a bZIP transcriptional factor SPA (Storage Protein Activator). In addition to this regulatory framework, each HMW-GS gene promoter had additional motifs organized differently. The promoters of most highly expressed x-type HMW-GS genes contain an additional box predicted to bind R2R3-MYB transcriptional factors. However, the differences in annotation between promoter alleles could not be related to their level of expression. In summary, we identified a common modular organization of HMW-GS gene promoters but the lack of correlation between the cis-motifs of each HMW-GS gene promoter and their level of expression suggests that other cis-elements or other mechanisms regulate HMW-GS gene expression. PMID:25429295

  3. ADH1A variation predisposes to personality traits and substance dependence

    PubMed Central

    Zuo, Lingjun; Gelernter, Joel; Kranzler, Henry R.; Stein, Murray B.; Zhang, Huiping; Wei, Feng; Sen, Srijan; Poling, James; Luo, Xingguang

    2010-01-01

    Background Human personality traits are strong predictors or characteristics of many psychiatric disorders including substance dependence (SD). Recently, significant associations between ADH1A and SD have been reported, which led us to investigate the impact of ADH1A variation on personality traits and risk of SD. Methods Five hundred fifty-eight subjects with SD [398 European-Americans (EAs) and 160 African-Americans (AAs)], 517 college students (384 EAs and 133 European-origin Hispanics) and 448 healthy subjects (385 EAs, 48 AAs and 15 European-origin Hispanics) participated. Personality traits were assessed in 247 subjects with SD (179 EAs and 68 AAs), all 517 college students, and 332 healthy subjects (285 EAs, 40 AAs and 7 European-origin Hispanics). The relationships between ADH1A and personality traits were comprehensively examined using stepwise multivariate analysis of covariance (MANCOVA), and then decomposed by stepwise analysis of covariance (ANCOVA). The relationship between ADH1A and SD was examined using stepwise logistic regression analysis. Admixture effects on analyses were considered. Results Overall, Agreeableness and Conscientiousness were associated with the diplotypes, haplotypes, genotypes and/or alleles of ADH1A in three of four phenotype groups including European-American SD subjects, healthy subjects, and African-American SD subjects (1.7×10-4≤p≤0.055), but not college students. Neuroticism was associated with diplotype, haplotypes and genotypes in African-American SD subjects (0.001≤p≤0.031). In addition, SD was associated with diplotypes, haplotypes, genotypes and/or alleles of ADH1A (0.008≤p≤0.060). Conclusions The present study demonstrates that the ADH1A variation may contribute to the genetic component of variation in personality traits and SD. PMID:19526455

  4. Targeted expression of suicide gene by tissue-specific promoter and microRNA regulation for cancer gene therapy.

    PubMed

    Danda, Ravikanth; Krishnan, Gopinath; Ganapathy, Kalaivani; Krishnan, Uma Maheswari; Vikas, Khetan; Elchuri, Sailaja; Chatterjee, Nivedita; Krishnakumar, Subramanian

    2013-01-01

    In order to realise the full potential of cancer suicide gene therapy that allows the precise expression of suicide gene in cancer cells, we used a tissue specific Epithelial cell adhesion molecule (EpCAM) promoter (EGP-2) that directs transgene Herpes simplex virus-thymidine kinase (HSV-TK) expression preferentially in EpCAM over expressing cancer cells. EpCAM levels are considerably higher in retinoblastoma (RB), a childhood eye cancer with limited expression in normal cells. Use of miRNA regulation, adjacent to the use of the tissue-specific promoter, would provide the second layer of control to the transgene expression only in the tumor cells while sparing the normal cells. To test this hypothesis we cloned let-7b miRNA targets in the 3'UTR region of HSV-TK suicide gene driven by EpCAM promoter because let-7 family miRNAs, including let-7b, were found to be down regulated in the RB tumors and cell lines. We used EpCAM over expressing and let-7 down regulated RB cell lines Y79, WERI-Rb1 (EpCAM (+ve)/let-7b(down-regulated)), EpCAM down regulated, let-7 over expressing normal retinal Müller glial cell line MIO-M1(EpCAM (-ve)/let-7b(up-regulated)), and EpCAM up regulated, let-7b up-regulated normal thyroid cell line N-Thy-Ori-3.1(EpCAM (+ve)/let-7b(up-regulated)) in the study. The cell proliferation was measured by MTT assay, apoptosis was measured by probing cleaved Caspase3, EpCAM and TK expression were quantified by Western blot. Our results showed that the EGP2-promoter HSV-TK (EGP2-TK) construct with 2 or 4 copies of let-7b miRNA targets expressed TK gene only in Y79, WERI-Rb-1, while the TK gene did not express in MIO-M1. In summary, we have developed a tissue-specific, miRNA-regulated dual control vector, which selectively expresses the suicide gene in EpCAM over expressing cells. PMID:24391761

  5. Binding of a liver-specific factor to the human albumin gene promoter and enhancer

    SciTech Connect

    Frain, M.; Hardon, E.; Ciliberto, G. ); Sala-Trepat, J.M. )

    1990-03-01

    A segment of 1,022 base pairs (bp) of the 5{prime}-flanking region of the human albumin gene, fused to a reporter gene, directs hepatoma-specific transcription. Three functionally distinct regions have been defined by deletion analysis: a negative element located between bp {minus}673 and {minus}486, an enhancer essential for efficient albumin transcription located between bp {minus}486 and {minus}221, and a promoter spanning a region highly conserved throughout evolution. Protein-binding studies have demonstrated that a liver {ital trans}-acting factor which interacts with the enhancer region is the well-characterized transcription factor LF-B1, which binds to promoters of several liver-specific genes. A synthetic oligodeoxynucleotide containing the LF-B1-binding site is sufficient to act as a tissue-specific transcriptional enhancer when placed in front of the albumin promoter. The fact that the same binding site functions in both an enhancer and a promoter suggests that these two elements influence the initiation of transcription through similar mechanisms.

  6. A characterization of the elements comprising the promoter of the mouse ribosomal protein gene RPS16.

    PubMed

    Hariharan, N; Perry, R P

    1989-07-11

    The elements comprising the mouse rpS16 promoter were characterized by transfection experiments with mutant genes in which various portions of the 5' flanking region and exon I were removed or substituted with extraneous DNA sequence. These experiments were carried out with otherwise intact rpS16 genes transfected into monkey kidney (COS) cells and also with chimeric rpS16-CAT gene constructs transfected into mouse plasmacytoma cells and COS cells. The locations of the functionally important elements were generally correlated with the locations of binding sites for specific nuclear factors, which were identified by gel-mobility shift analyses and methylation interference footprints. The most upstream element, which is located approximately 165 bp from the cap site, binds the Sp1 transcription factor and augments the promoter activity by 2 to 2.5-fold. In addition, there is a complex bipartite element in the -83 to -59 region, an element in the -37 to -12 region and an element in the +9 to +29 region of exon I, all of which are essential for rpS16 expression. The rpS16 promoter has a general architecture that resembles other mouse rp promoters; however, it also possesses some distinctive characteristics. PMID:2762128

  7. Transactivation of the proximal promoter of human oxytocin gene by TR4 orphan receptor

    SciTech Connect

    Wang, C.-P.; Lee, Y.-F.; Chang, C.; Lee, H.-J. . E-mail: hjlee@mail.ndhu.edu.tw

    2006-12-08

    The human testicular receptor 4 (TR4) shares structural homology with members of the nuclear receptor superfamily. Some other members of this superfamily were able to regulate the transcriptional activity of the human oxytocin (OXT) promoter by binding to the first DR0 regulatory site. However, little investigation was conducted systematically in the study of the second dDR4 site of OXT proximal promoter, and the relationship between the first and the second sites of OXT promoter. Here, we demonstrated for the first time that TR4 could increase the proximal promoter activity of the human OXT gene via DR0, dDR4, and OXT (both DR0 and dDR4) elements, respectively. TR4 might induce OXT gene expression through the OXT element in a dose-dependent manner. However, there is no synergistic effect between DR0 and dDR4 elements during TR4 transactivation. Taken together, these results suggested that TR4 should be one of important regulators of OXT gene expression.

  8. A Novel Protein Isoform of the Multicopy Human NAIP Gene Derives from Intragenic Alu SINE Promoters

    PubMed Central

    Romanish, Mark T.; Nakamura, Hisae; Lai, C. Benjamin; Wang, Yuzhuo; Mager, Dixie L.

    2009-01-01

    The human neuronal apoptosis inhibitory protein (NAIP) gene is no longer principally considered a member of the Inhibitor of Apoptosis Protein (IAP) family, as its domain structure and functions in innate immunity also warrant inclusion in the Nod-Like Receptor (NLR) superfamily. NAIP is located in a region of copy number variation, with one full length and four partly deleted copies in the reference human genome. We demonstrate that several of the NAIP paralogues are expressed, and that novel transcripts arise from both internal and upstream transcription start sites. Remarkably, two internal start sites initiate within Alu short interspersed element (SINE) retrotransposons, and a third novel transcription start site exists within the final intron of the GUSBP1 gene, upstream of only two NAIP copies. One Alu functions alone as a promoter in transient assays, while the other likely combines with upstream L1 sequences to form a composite promoter. The novel transcripts encode shortened open reading frames and we show that corresponding proteins are translated in a number of cell lines and primary tissues, in some cases above the level of full length NAIP. Interestingly, some NAIP isoforms lack their caspase-sequestering motifs, suggesting that they have novel functions. Moreover, given that human and mouse NAIP have previously been shown to employ endogenous retroviral long terminal repeats as promoters, exaptation of Alu repeats as additional promoters provides a fascinating illustration of regulatory innovations adopted by a single gene. PMID:19488400

  9. Characterization of type IV pilus genes in plant growth-promoting Pseudomonas putida WCS358.

    PubMed Central

    de Groot, A; Heijnen, I; de Cock, H; Filloux, A; Tommassen, J

    1994-01-01

    In a search for factors that could contribute to the ability of the plant growth-stimulating Pseudomonas putida WCS358 to colonize plant roots, the organism was analyzed for the presence of genes required for pilus biosynthesis. The pilD gene of Pseudomonas aeruginosa, which has also been designated xcpA, is involved in protein secretion and in the biogenesis of type IV pili. It encodes a peptidase that processes the precursors of the pilin subunits and of several components of the secretion apparatus. Prepilin processing activity could be demonstrated in P. putida WCS358, suggesting that this nonpathogenic strain may contain type IV pili as well. A DNA fragment containing the pilD (xcpA) gene of P. putida was cloned and found to complement a pilD (xcpA) mutation in P. aeruginosa. Nucleotide sequencing revealed, next to the pilD (xcpA) gene, the presence of two additional genes, pilA and pilC, that are highly homologous to genes involved in the biogenesis of type IV pili. The pilA gene encodes the pilin subunit, and pilC is an accessory gene, required for the assembly of the subunits into pili. In comparison with the pil gene cluster in P. aeruginosa, a gene homologous to pilB is lacking in the P. putida gene cluster. Pili were not detected on the cell surface of P. putida itself, not even when pilA was expressed from the tac promoter on a plasmid, indicating that not all the genes required for pilus biogenesis were expressed under the conditions tested. Expression of pilA of P. putida in P. aeruginosa resulted in the production of pili containing P. putida PilA subunits. Images PMID:7905475

  10. Expression of multi-functional cellulase gene mfc in Coprinus cinereus under control of different basidiomycete promoters.

    PubMed

    Cheng, Shujie; Yang, Peizhou; Guo, Liqiong; Lin, Junfang; Lou, Nannan

    2009-10-01

    Multi-functional cellulase gene mfc was expressed in Coprinus cinereus under naturally non-inductive conditions using three heterologous promoters. Endo-beta-1,4-glucanase expression was achieved in solid and liquid media with promoter sequences from the Lentinula edodesgpd gene, the Flammulina velutipes gpd gene and the Volvariella volvaceagpd gene. As measured by enzyme activity in liquid cultures, a 613-bp gpd promoter fragment from L. edodes was most efficient, followed by a 752-bp gpd fragment from F. velutipes. The V. volvacea gpd promoter sequence was less active, in comparison. Irrespective of the promoter used, enzymatic activities increase 34-fold for highly active transformants and 29-fold for less active one by using cellulase-inducing medium. The highest activities of endo-beta-1,4-glucanase (34.234 U/ml) and endo-beta-1,4-xylanase (263.695 U/ml) were reached by using the L. edodesgpd promoter. PMID:19442518

  11. Tissue-specific regulation of the mouse Pkhd1 (ARPKD) gene promoter

    PubMed Central

    Williams, Scott S.; Cobo-Stark, Patricia; Hajarnis, Sachin; Aboudehen, Karam; Shao, Xinli; Richardson, James A.; Patel, Vishal

    2014-01-01

    Autosomal recessive polycystic kidney disease, an inherited disorder characterized by the formation of cysts in renal collecting ducts and biliary dysgenesis, is caused by mutations of the polycystic kidney and hepatic disease 1 (PKHD1) gene. Expression of PKHD1 is tissue specific and developmentally regulated. Here, we show that a 2.0-kb genomic fragment containing the proximal promoter of mouse Pkhd1 directs tissue-specific expression of a lacZ reporter gene in transgenic mice. LacZ is expressed in renal collecting ducts beginning during embryonic development but is not expressed in extrarenal tissues. The Pkhd1 promoter contains a binding site for the transcription factor hepatocyte nuclear factor (HNF)-1β, which is required for activity in transfected cells. Mutation of the HNF-1β-binding site abolishes the expression of the lacZ reporter gene in renal collecting ducts. Transgenes containing the 2.0-kb promoter and 2.7 kb of additional genomic sequence extending downstream to the second exon are expressed in the kidney, intrahepatic bile ducts, and male reproductive tract. This pattern overlaps with the endogenous expression of Pkhd1 and coincides with sites of expression of HNF-1β. We conclude that the proximal 2.0-kb promoter is sufficient for tissue-specific expression of Pkhd1 in renal collecting ducts in vivo and that HNF-1β is required for Pkhd1 promoter activity in collecting ducts. Additional genomic sequences located from exons 1-2 or elsewhere in the gene locus are required for expression in extrarenal tissues. PMID:24899057

  12. Characterization of the Human Insulin-induced Gene 2 (INSIG2) Promoter

    PubMed Central

    Fernández-Alvarez, Ana; Soledad Alvarez, María; Cucarella, Carme; Casado, Marta

    2010-01-01

    Insulin-induced gene 2 (INSIG2) and its homolog INSIG1 encode closely related endoplasmic reticulum proteins that regulate the proteolytic activation of sterol regulatory element-binding proteins, transcription factors that activate the synthesis of cholesterol and fatty acids in animal cells. Several studies have been carried out to identify INSIG2 genetic variants associated with metabolic diseases. However, few data have been published regarding the regulation of INSIG2 gene expression. Two Insig2 transcripts have been described in rodents through the use of different promoters that produce different noncoding first exons that splice into a common second exon. Herein we report the cloning and characterization of the human INSIG2 promoter and the detection of an INSIG2-specific transcript homologous to the Insig2b mouse variant in human liver. Deletion analyses on 3 kb of 5′-flanking DNA of the human INSIG2 gene revealed the functional importance of a 350-bp region upstream of the transcription start site. Mutated analyses, chromatin immunoprecipitation assays, and RNA interference analyses unveiled the significance of an Ets-consensus motif in the proximal region and the interaction of the Ets family member SAP1a (serum response factor (SRF) accessory protein-1a) with this region of the human INSIG2 promoter. Moreover, our findings suggest that insulin activated the human INSIG2 promoter in a process mediated by phosphorylated SAP1a. Overall, these results map the functional elements in the human INSIG2 promoter sequence and suggest an unexpected regulation of INSIG2 gene expression in human liver. PMID:20145255

  13. Signatures of accelerated somatic evolution in gene promoters in multiple cancer types

    PubMed Central

    Smith, Kyle S.; Yadav, Vinod K.; Pedersen, Brent S.; Shaknovich, Rita; Geraci, Mark W.; Pollard, Katherine S.; De, Subhajyoti

    2015-01-01

    Cancer-associated somatic mutations outside protein-coding regions remain largely unexplored. Analyses of the TERT locus have indicated that non-coding regulatory mutations can be more frequent than previously suspected and play important roles in oncogenesis. Using a computational method called SASE-hunter, developed here, we identified a novel signature of accelerated somatic evolution (SASE) marked by a significant excess of somatic mutations localized in a genomic locus, and prioritized those loci that carried the signature in multiple cancer patients. Interestingly, even when an affected locus carried the signature in multiple individuals, the mutations contributing to SASE themselves were rarely recurrent at the base-pair resolution. In a pan-cancer analysis of 906 samples from 12 tumor types, we detected SASE in the promoters of several genes, including known cancer genes such as MYC, BCL2, RBM5 and WWOX. Nucleotide substitution patterns consistent with oxidative DNA damage and local somatic hypermutation appeared to contribute to this signature in selected gene promoters (e.g. MYC). SASEs in selected cancer gene promoters were associated with over-expression, and also correlated with the age of onset of cancer, aggressiveness of the disease and survival. Taken together, our work detects a hitherto under-appreciated and clinically important class of regulatory changes in cancer genomes. PMID:25934800

  14. Promoter regulatory domain identification of cassava starch synthase IIb gene in transgenic tobacco.

    PubMed

    Guan, Zhihui; Chen, Xin; Xie, Hairong; Wang, Wenquan

    2016-05-01

    Soluble starch synthase is a key enzyme in the starch biosynthesis pathway, and its enzyme activity significantly influences starch components in cassava storage root. However, studies on the regulation mechanism of soluble starch synthase gene are rare. In this study, we cloned the 5' flanking sequence of the MeSSIIb gene and predicted the distribution of cis-elements. The region from -453 to -1 was considered the primary core promoter by the quantitative detection of GUS activity in transgenic tobacco plants containing 5' truncated promoters fused with the GUS gene. Analysis results clarified that the region from -531 to -454 significantly repressed promoter activity. The region from -453 to -388 was a repressive domain of ethylene, and some unknown drought responsive cis-elements were located in the region from -387 to -1. These findings will provide useful information on the functional assay and transcriptional regulation mechanisms of the MeSSIIb gene. PMID:26919397

  15. A multistep bioinformatic approach detects putative regulatory elements in gene promoters

    PubMed Central

    Bortoluzzi, Stefania; Coppe, Alessandro; Bisognin, Andrea; Pizzi, Cinzia; Danieli, Gian Antonio

    2005-01-01

    Background Searching for approximate patterns in large promoter sequences frequently produces an exceedingly high numbers of results. Our aim was to exploit biological knowledge for definition of a sheltered search space and of appropriate search parameters, in order to develop a method for identification of a tractable number of sequence motifs. Results Novel software (COOP) was developed for extraction of sequence motifs, based on clustering of exact or approximate patterns according to the frequency of their overlapping occurrences. Genomic sequences of 1 Kb upstream of 91 genes differentially expressed and/or encoding proteins with relevant function in adult human retina were analyzed. Methodology and results were tested by analysing 1,000 groups of putatively unrelated sequences, randomly selected among 17,156 human gene promoters. When applied to a sample of human promoters, the method identified 279 putative motifs frequently occurring in retina promoters sequences. Most of them are localized in the proximal portion of promoters, less variable in central region than in lateral regions and similar to known regulatory sequences. COOP software and reference manual are freely available upon request to the Authors. Conclusion The approach described in this paper seems effective for identifying a tractable number of sequence motifs with putative regulatory role. PMID:15904489

  16. Matrix metalloproteinase-3 gene promoter polymorphisms: A potential risk factor for pelvic organ prolapse

    PubMed Central

    Karachalios, Charalampos; Bakas, Panagiotis; Kaparos, Georgios; Demeridou, Styliani; Liapis, Ilias; Grigoriadis, Charalampos; Liapis, Aggelos

    2016-01-01

    Pelvic organ prolapse (POP) is a common multifactorial condition. Matrix metalloproteinases (MMPs) are enzymes capable of breaking down various connective tissue elements. Single-nucleotide polymorphisms (SNPs) in regulatory areas of MMP-encoding genes can alter their transcription rate, and therefore the possible effect on pelvic floor supporting structures. The insertion of an adenine (A) base in the promoter of the MMP-3 gene at position −1612/−1617 produces a sequence of six adenines (6A), whereas the other allele has five (5A). The aim of the present study was to investigate the possible association of MMP-3 gene promoter SNPs with the risk of POP. The patient group comprised 80 women with clinically significant POP [Stage II, III or IV; POP quantification (POP-Q) system]. The control group consisted of 80 females without any or important pelvic floor support defects (Stages 0 or I; POP-Q system). All the participants underwent the same preoperative evaluation. SNP detection was determined with whole blood sample DNA analysis by quantitative polymerase chain reaction (PCR) in LightCycler® PCR platforms, using the technique of sequence-specific hybridization probe-binding assays and melting temperature curve analysis. The results showed there was no statistically significant difference between 5A/5A, 5A/6A and 6A/6A MMP-3 gene promoter variants in the two study groups (P=0.4758). Therefore, MMP-3 gene promoter SNPs alone is insufficient to increase the genetic susceptibility to POP development. PMID:27588175

  17. Ets transcription factors bind and transactivate the core promoter of the von Willebrand factor gene.

    PubMed

    Schwachtgen, J L; Janel, N; Barek, L; Duterque-Coquillaud, M; Ghysdael, J; Meyer, D; Kerbiriou-Nabias, D

    1997-12-18

    von Willebrand factor (vWF) gene expression is restricted to endothelial cells and megakaryocytes. Previous results demonstrated that basal transcription of the human vWF gene is mediated through a promoter located between base pairs -89 and +19 (cap site: +1) which is functional in endothelial and non endothelial cells. Two DNA repeats TTTCCTTT correlating with inverted consensus binding sites for the Ets family of transcription factors are present in the -56/-36 sequence. In order to analyse whether these DNA elements are involved in transcription, human umbilical vein endothelial cells (HUVEC), bovine calf pulmonary endothelial cell line (CPAE), HeLa and COS cells were transfected with constructs containing deletions of the -89/+19 fragment, linked to the chloramphenicol acetyl transferase (CAT) reporter gene. The -60/+19 region exhibits significant promoter activity in HUVEC and CPAE cells only. The -42/+19 fragment is not active. Mutations of the -60/+19 promoter fragment in the 5' (-56/-49) Ets binding site abolish transcription in endothelial cells whereas mutations in the 3' (-43/-36) site does not. The -60/-33 fragment forms three complexes with proteins from HUVEC nuclear extracts in electrophoretic mobility shift assay which are dependent on the presence of the 5' Ets binding site. Binding of recombinant Ets-1 protein to the -60/-33 fragment gives a complex which also depends on the 5' site. The -60/+19 vWF gene core promoter is transactivated in HeLa cells by cotransfecting with Ets-1 or Erg (Ets-related gene) expression plasmids. In contrast to the wild type construct, transcription of the 5' site mutants is not increased by these expressed proteins. The results indicate that the promoter activity of the -60/+19 region of the vWF gene depends on transcription factors of the Ets family of which several members like Ets-1, Ets-2 and Erg are expressed in endothelium. Cotransfection of Ets-1 and Erg expression plasmids is sufficient to induce the -60/+19 v

  18. Cloning of mouse telomerase reverse transcriptase gene promoter and identification of proximal core promoter sequences essential for the expression of transgenes in cancer cells.

    PubMed

    Si, Shao-Yan; Song, Shu-Jun; Zhang, Jian-Zhong; Liu, Jun-Li; Liang, Shuang; Feng, Kai; Zhao, Gang; Tan, Xiao-Qing

    2011-08-01

    Telomerase is a ribonucleoprotein complex, whose function is to add motif-specific nucleotides to the end of chromosomes. Telomerase consists of three major subunits, the telomerase RNA template (hTR), the telomerase-associated protein (TEP1) and telomerase reverse transcriptase (TERT). TERT is the most important component responsible for the catalytic activity of telomerase and a rate-limiting determinant of the activity. Telomerase activities were at high levels in approximately 90% of mouse cancers or tumor-derived cell lines through TERT transcriptional up-regulation. Unlike human telomerase, telomerase activity exists in colon, liver, ovary and testis but not in brain, heart, stomach and muscle in normal mouse tissues. In this study, we prepared 5' truncations of 1086 bp fragments upstream of the initiating ATG codon of the mTERT gene to construct luciferase reporter gene plasmids, and transfected these plasmids into a normal mouse cell line and several cancer lines to identify the core promoter region essential for transcriptional activation in cancer cells by a luciferase assay. We constructed a eukaryotic expression vector of membrane-expressing staphylococcal endotoxin A (SEA) gene driven by the core promoter region of the mTERT gene and observed if the core promoter region could express the SEA gene in these cancer cells, but not in normal cells following transfection with the construct. The results showed that the transcriptional activities of each fragment of the mTERT gene promoter in the cancer cell lines Hepa1-6, B16 and CT26 were higher than those in NIH3T3 cells, and the proximal 333-bp fragment was the core promoter of the mTERT gene in the cancer cells. The proximal 333-bp fragment was able to make the SEA express on the surface of the cancer cells, but not in NIH3T3 cells. It provides a foundation for cancer targeting gene therapy by using the mTERT gene promoter. PMID:21567104

  19. Modular organization and development activity of an Arabidopsis thaliana EF-1 alpha gene promoter.

    PubMed

    Curie, C; Axelos, M; Bardet, C; Atanassova, R; Chaubet, N; Lescure, B

    1993-04-01

    The activity of the Arabidopsis thalana A1 EF-1 alpha gene promoter was analyzed in transgenic Arabidopsis plants. The 5' upstream sequence of the A1 gene and several promoter deletions were fused to the beta-glucuronidase (GUS) coding region. Promoter activity was monitored by quantitative and histochemical assays of GUS activity. The results show that the A1 promoter exhibits a modular organization. Sequences both upstream and downstream relative to the transcription initiation site are involved in quantitative and tissue-specific expression during vegetative growth. One upstream element may be involved in the activation of expression in meristematic tissues; the downstream region, corresponding to an intron within the 5' non-coding region (5'IVS), is important for expression in roots; both upstream and downstream sequences are required for expression in leaves, suggesting combinatorial properties of EF-1 alpha cis-regulatory elements. This notion of specific combinatorial regulation is reinforced by the results of transient expression experiments in transfected Arabidopsis protoplasts. The deletion of the 5'IVS has much more effect on expression when the promoter activity is under the control of A1 EF-1 alpha upstream sequences than when these upstream sequences were replaced by the 35S enhancer. Similarly, a synthetic oligonucleotide corresponding to an A1 EF-1 alpha upstream cis-acting element (the TEF1 box), is able to restore partially the original activity when fused to a TEF1-less EF1-alpha promoter but has no significant effect when fused to an enhancer-less 35S promoter. PMID:8492811

  20. MGMT, GATA6, CD81, DR4, and CASP8 gene promoter methylation in glioblastoma

    PubMed Central

    2012-01-01

    Background Methylation of promoter region is the major mechanism affecting gene expression in tumors. Recent methylome studies of brain tumors revealed a list of new epigenetically modified genes. Our aim was to study promoter methylation of newly identified epigenetically silenced genes together with already known epigenetic markers and evaluate its separate and concomitant role in glioblastoma genesis and patient outcome. Methods The methylation status of MGMT, CD81, GATA6, DR4, and CASP8 in 76 patients with primary glioblastomas was investigated. Methylation-specific PCR reaction was performed using bisulfite treated DNA. Evaluating glioblastoma patient survival time after operation, patient data and gene methylation effect on survival was estimated using survival analysis. Results The overwhelming majority (97.3%) of tumors were methylated in at least one of five genes tested. In glioblastoma specimens gene methylation was observed as follows: MGMT in 51.3%, GATA6 in 68.4%, CD81 in 46.1%, DR4 in 41.3% and CASP8 in 56.8% of tumors. Methylation of MGMT was associated with younger patient age (p < 0.05), while CASP8 with older (p < 0.01). MGMT methylation was significantly more frequent event in patient group who survived longer than 36 months after operation (p < 0.05), while methylation of CASP8 was more frequent in patients who survived shorter than 36 months (p < 0.05). Cox regression analysis showed patient age, treatment, MGMT, GATA6 and CASP8 as independent predictors for glioblastoma patient outcome (p < 0.05). MGMT and GATA6 were independent predictors for patient survival in younger patients’ group, while there were no significant associations observed in older patients’ group when adjusted for therapy. Conclusions High methylation frequency of tested genes shows heterogeneity of glioblastoma epigenome and the importance of MGMT, GATA6 and CASP8 genes methylation in glioblastoma patient outcome. PMID:22672670

  1. Kinetic profiling of the c-Myc transcriptome and bioinformatic analysis of repressed gene promoters

    PubMed Central

    Yap, Chui-Sun; Peterson, Abigail L; Castellani, Gastone

    2011-01-01

    Mammalian c-Myc is a member of a small family of three related proto-oncogenic transcription factors. c-Myc has an unusually broad array of regulatory functions, which include roles in cell cycle and apoptosis, a variety of metabolic functions, cell differentiation, senescence and stem cell maintenance. c-Myc modulates the expression of a very large number of genes, but the magnitude of the majority of the regulatory effects is only two-fold or less. c-Myc can both activate and repress the promoters of its target genes. Identification of genes directly regulated by c-Myc has been an enduring question in the field. We report here microarray expression profiling of a high resolution time course of c-Myc induction, using fibroblast cells in which c-Myc activity can be modulated from null to physiological. The c-Myc transcriptome data set presented is the largest reported to date with 4,186 differentially regulated genes (1,826 upregulated, 2,360 downregulated, 1% FDR). The gene expression patterns fit well with the known biological functions of c-Myc. We describe several novel findings and present tools for further data mining. Although the mechanisms of transcriptional activation by c-Myc are well understood, how c-Myc represses an even greater number of genes remains incompletely described. One mechanism involves the binding of c-Myc to other, positively acting transcription factors and interfering with their activities. We identified rapid-response genes likely to be direct c-Myc targets and analyzed the promoters of the repressed genes to identify transcription factors that could be targets of c-Myc repression. PMID:21623162

  2. A novel DNA replication origin identified in the human heat shock protein 70 gene promoter.

    PubMed Central

    Taira, T; Iguchi-Ariga, S M; Ariga, H

    1994-01-01

    A general and sensitive method for the mapping of initiation sites of DNA replication in vivo, developed by Vassilev and Johnson, has revealed replication origins in the region of simian virus 40 ori, in the regions upstream from the human c-myc gene and downstream from the Chinese hamster dihydrofolate reductase gene, and in the enhancer region of the mouse immunoglobulin heavy-chain gene. Here we report that the region containing the promoter of the human heat shock protein 70 (hsp70) gene was identified as a DNA replication origin in HeLa cells by this method. Several segments of the region were cloned into pUC19 and examined for autonomously replicating sequence (ARS) activity. The plasmids carrying the segments replicated episomally and semiconservatively when transfected into HeLa cells. The segments of ARS activity contained the sequences previously identified as binding sequences for a c-myc protein complex (T. Taira, Y. Negishi, F. Kihara, S. M. M. Iguchi-Ariga, and H. Ariga, Biochem. Biophys. Acta 1130:166-174, 1992). Mutations introduced within the c-myc protein complex binding sequences abolished the ARS activity. Moreover, the ARS plasmids stably replicated at episomal state for a long time in established cell lines. The results suggest that the promoter region of the human hsp70 gene plays a role in DNA replication as well as in transcription. Images PMID:8065368

  3. The chromatin remodelling factor Brg-1 interacts with β-catenin to promote target gene activation

    PubMed Central

    Barker, Nick; Hurlstone, Adam; Musisi, Hannah; Miles, Antony; Bienz, Mariann; Clevers, Hans

    2001-01-01

    Wnt-induced formation of nuclear Tcf–β-catenin complexes promotes transcriptional activation of target genes involved in cell fate decisions. Inappropriate expression of Tcf target genes resulting from mutational activation of this pathway is also implicated in tumorigenesis. The C-terminus of β-catenin is indispensable for the transactivation function, which probably reflects the presence of binding sites for essential transcriptional coactivators such as p300/CBP. However, the precise mechanism of transactivation remains unclear. Here we demonstrate an interaction between β-catenin and Brg-1, a component of mammalian SWI/SNF and Rsc chromatin-remodelling complexes. A functional consequence of reintroduction of Brg-1 into Brg-1-deficient cells is enhanced activity of a Tcf-responsive reporter gene. Consistent with this, stable expression of inactive forms of Brg-1 in colon carcinoma cell lines specifically inhibits expression of endogenous Tcf target genes. In addition, we observe genetic interactions between the Brg-1 and β-catenin homologues in flies. We conclude that β-catenin recruits Brg-1 to Tcf target gene promoters, facilitating chromatin remodelling as a prerequisite for transcriptional activation. PMID:11532957

  4. Novel polymorphisms of the APOA2 gene and its promoter region affect body traits in cattle.

    PubMed

    Zhou, Yang; Li, Caixia; Cai, Hanfang; Xu, Yao; Lan, Xianyong; Lei, Chuzhao; Chen, Hong

    2013-12-01

    Apolipoprotein A-II (APOA2) is one of the major constituents of high-density lipoprotein and plays a critical role in lipid metabolism and obesity. However, similar research for the bovine APOA2 gene is lacking. In this study, polymorphisms of the bovine APOA2 gene and its promoter region were detected in 1021 cows from four breeds by sequencing and PCR-RFLP methods. Totally, we detected six novel mutations which included one mutation in the promoter region, two mutations in the exons and three mutations in the introns. There were four polymorphisms within APOA2 gene were analyzed. The allele A, T, T and G frequencies of the four loci were predominant in the four breeds when in separate or combinations analysis which suggested cows with those alleles to be more adapted to the steppe environment. The association analysis indicated three SVs in Nangyang cows, two SVs in Qinchun cows and the 9 haplotypes in Nangyang cows were significantly associated with body traits (P<0.05 or P<0.01). The results of this study suggested the bovine APOA2 gene may be a strong candidate gene for body traits in the cattle breeding program. PMID:24004543

  5. Repressive BMP2 gene regulatory elements near the BMP2 promoter

    SciTech Connect

    Jiang, Shan; Chandler, Ronald L.; Fritz, David T.; Mortlock, Douglas P.; Rogers, Melissa B.

    2010-02-05

    The level of bone morphogenetic protein 2 (BMP2) profoundly influences essential cell behaviors such as proliferation, differentiation, apoptosis, and migration. The spatial and temporal pattern of BMP2 synthesis, particular in diverse embryonic cells, is highly varied and dynamic. We have identified GC-rich sequences within the BMP2 promoter region that strongly repress gene expression. These elements block the activity of a highly conserved, osteoblast enhancer in response to FGF2 treatment. Both positive and negative gene regulatory elements control BMP2 synthesis. Detecting and mapping the repressive motifs is essential because they impede the identification of developmentally regulated enhancers necessary for normal BMP2 patterns and concentration.

  6. Cloning and characterization of the promoter regions from the parent and paralogous creatine transporter genes.

    PubMed

    Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S

    2014-01-10

    Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first

  7. Promoter analysis and expression of a phospholipase D gene from castor bean.

    PubMed Central

    Xu, L; Zheng, S; Zheng, L; Wang, X

    1997-01-01

    The expression of a castor bean (Ricinus communis L.) phospholipase D (PLD; EC 3.1.4.4) gene has been studied by examining its promoter activity in transgenic tobacco (Nicotiana tabacum) carrying a PLD promoter-glucuronidase transgene and by monitoring the levels of PLD mRNA in castor bean. Sequence and the 5' truncation analyses revealed that the 5' flanking region from nucleotide -1200 to -730 is required for the regulation and basal function of the PLD promoter. The PLD promoter in vegetative tissues is highly active in the rapidly growing regions such as the shoot apex and the secondary meristem producing axillary buds and vascular tissues of young leaves and stems. The PLD promoter activity in floral tissues was high in stigma, ovary, and pollen grains, but low in petals, sepals, the epidermis of anthers, styles, and filaments. The PLD promoter activity was enhanced by abscisic acid. Northern-blot analysis of PLD in castor bean showed that the PLD mRNA levels were high in young and metabolically more active tissues such as expanding leaves, hypocotyl hooks, developing seeds, and young seedlings, and they decreased in mature tissues such as fully expanded leaves and developed seeds. These patterns of expression suggest a role of PLD in rapid cell growth, proliferation, and reproduction. PMID:9342861

  8. Maximal Expression of the Evolutionarily Conserved Slit2 Gene Promoter Requires Sp1.

    PubMed

    Saunders, Jacquelyn; Wisidagama, D Roonalika; Morford, Travis; Malone, Cindy S

    2016-08-01

    Slit2 is a neural axon guidance and chemorepellent protein that stimulates motility in a variety of cell types. The role of Slit2 in neural development and neoplastic growth and migration has been well established, while the genetic mechanisms underlying regulation of the Slit2 gene have not. We identified the core and proximal promoter of Slit2 by mapping multiple transcriptional start sites, analyzing transcriptional activity, and confirming sequence homology for the Slit2 proximal promoter among a number of species. Deletion series and transient transfection identified the Slit2 proximal promoter as within 399 base pairs upstream of the start of transcription. A crucial region for full expression of the Slit2 proximal promoter lies between 399 base pairs and 296 base pairs upstream of the start of transcription. Computer modeling identified three transcription factor-binding consensus sites within this region, of which only site-directed mutagenesis of one of the two identified Sp1 consensus sites inhibited transcriptional activity of the Slit2 proximal promoter (-399 to +253). Bioinformatics analysis of the Slit2 proximal promoter -399 base pair to -296 base pair region shows high sequence conservation over twenty-two species, and that this region follows an expected pattern of sequence divergence through evolution. PMID:26456684

  9. Single-nucleotide polymorphisms and activity analysis of the promoter and enhancer of the pig lactase gene.

    PubMed

    Du, Hai-Ting; Zhu, Hong-Yan; Wang, Jia-Mei; Zhao, Wei; Tao, Xiao-Li; Ba, Cai-Feng; Tian, Yu-Min; Su, Yu-Hong

    2014-07-15

    Lactose intolerance in northern Europeans is strongly associated with a single-nucleotide polymorphism (SNP) located 14 kb upstream of the human lactase gene: -13,910 C/T. We examined whether SNPs in the 5' flanking region of the pig lactase gene are similar to those in the human gene and whether these polymorphisms play a functional role in regulating pig lactase gene expression. The 5' flanking region of the lactase gene from several different breeds of pigs was cloned and analyzed for gene regulatory activity of a luciferase reporter gene. One SNP was found in the enhancer region (-797 G/A) and two were found in the promoter region (-308G/C and -301 A/G). The promoter C-308,G-301(Pro-CG) strongly promotes the expression of the lactase gene, but the promoter G-308,A-301(Pro-GA) does not. The enhancer A-797(Enh-A) genotype for Pro-GA can significantly enhance promoter activity, but has an inhibitory effect on Pro-CG. The Enhancer G-797(Enh-G) has a significant inhibitory effect on both promoters. In conclusion, the order of effectiveness on the pig lactase gene is Enh-A+Pro-GA>Enh-A/G+Pro-CG>Enh-G+Pro-GA. PMID:24809963

  10. A global profile of gene promoter methylation in treatment-naïve urothelial cancer

    PubMed Central

    Ibragimova, Ilsiya; Dulaimi, Essel; Slifker, Michael J; Chen, David DY; Uzzo, Robert G; Cairns, Paul

    2014-01-01

    The epigenetic alteration of aberrant hypermethylation in the promoter CpG island of a gene is associated with repression of transcription. In neoplastic cells, aberrant hypermethylation is well described as a mechanism of allele inactivation of particular genes with a tumor suppressor function. To investigate the role of aberrant hypermethylation in the biology and progression of urothelial cancer, we examined 101 urothelial (transitional cell) carcinomas (UC), broadly representative of the disease at presentation, with no prior immunotherapy, chemotherapy or radiotherapy, by Infinium HM27 containing 14,495 genes. The genome-wide signature of aberrant promoter hypermethylation in UC consisted of 729 genes significant by a Wilcoxon test, hypermethylated in a CpG island within 1 kb of the transcriptional start site and unmethylated in normal urothelium from aged individuals. We examined differences in gene methylation between the two main groups of UC: the 75% that are superficial, which often recur but rarely progress, and the 25% with muscle invasion and poor prognosis. We further examined pairwise comparisons of the pathologic subgroups of high or low grade, invasive or non-invasive (pTa), and high grade superficial or low grade superficial UC. Pathways analysis indicated over-representation of genes involved in cell adhesion or metabolism in muscle-invasive UC. Notably, the TET2 epigenetic regulator was one of only two genes more frequently methylated in superficial tumors and the sole gene in low grade UC. Other chromatin remodeling genes, MLL3 and ACTL6B, also showed aberrant hypermethylation. The Infinium methylation value for representative genes was verified by pyrosequencing. An available mRNA expression data set indicated many of the hypermethylated genes of interest to be downregulated in UC. Unsupervised clustering of the most differentially methylated genes distinguished muscle invasive from superficial UC. After filtering, cluster analysis showed a Cp

  11. Characterization and regulation of the bovine stearoyl-CoA desaturase gene promoter

    SciTech Connect

    Keating, Aileen F.; Kennelly, John J.; Zhao Fengqi . E-mail: fzhao@uvm.edu

    2006-05-26

    The bovine stearoyl-CoA desaturase (Scd) gene plays an important role in the bovine mammary gland where substrates such as stearic and vaccenic acids are converted to oleic acid and conjugated linoleic acid (CLA), respectively. Up to 90% of the CLA in bovine milk is formed due to the action of this enzyme in the mammary gland. The areas of the bovine promoter of importance in regulating this key enzyme were examined and an area of 36 bp in length was identified as having a critical role in transcriptional activation and is designated the Scd transcriptional enhancer element (STE). Electrophoretic mobility shift assay detected three binding complexes on this area in Mac-T cell nuclear extracts. Treatment of cells with CLA caused a significant reduction in transcriptional activity, with this effect being mediated through the STE region. The bovine Scd gene promoter was up-regulated by insulin and down-regulated by oleic acid.

  12. Precise nucleosome positioning in the promoter of the chicken beta A globin gene.

    PubMed

    Kefalas, P; Gray, F C; Allan, J

    1988-01-25

    Histone octamers were reconstituted onto 5' end-labelled DNA fragments derived from the promoter region of the chicken beta A globin gene. The location of the reconstituted histone octamer with respect to the DNA sequence of each fragment was assessed by Exonuclease III digestion of purified nucleosome monomers. By this approach we have found a strong preference for histone octamers to be positioned over nucleotides -206 to -62 relative to the gene cap site. This stretch of DNA contains all those 5' beta globin sequences which, by DNase footprinting, bind specific protein factors and incorporates three promoter consensus sequence motifs. The upstream terminal 32 base pairs of this DNA segment contains the binding sites for the erythrocyte specific G-string binding protein and transcription factor Spl and appears to be relatively weakly bound to the histone octamer. PMID:3340546

  13. Precise nucleosome positioning in the promoter of the chicken beta A globin gene.

    PubMed Central

    Kefalas, P; Gray, F C; Allan, J

    1988-01-01

    Histone octamers were reconstituted onto 5' end-labelled DNA fragments derived from the promoter region of the chicken beta A globin gene. The location of the reconstituted histone octamer with respect to the DNA sequence of each fragment was assessed by Exonuclease III digestion of purified nucleosome monomers. By this approach we have found a strong preference for histone octamers to be positioned over nucleotides -206 to -62 relative to the gene cap site. This stretch of DNA contains all those 5' beta globin sequences which, by DNase footprinting, bind specific protein factors and incorporates three promoter consensus sequence motifs. The upstream terminal 32 base pairs of this DNA segment contains the binding sites for the erythrocyte specific G-string binding protein and transcription factor Spl and appears to be relatively weakly bound to the histone octamer. Images PMID:3340546

  14. Regulation of Gene Expression in Neurospora crassa with a Copper Responsive Promoter

    PubMed Central

    Lamb, Teresa M.; Vickery, Justin; Bell-Pedersen, Deborah

    2013-01-01

    Precise control of gene expression is a powerful method to elucidate biological function, and protein overexpression is an important tool for industry and biochemistry. Expression of the Neurospora crassa tcu-1 gene (NCU00830), encoding a high-affinity copper transporter, is tightly controlled by copper availability. Excess copper represses, and copper depletion, via the use of a copper chelator, activates expression. The kinetics of induction and repression of tcu-1 are rapid, and the effects are long lived. We constructed a plasmid carrying the bar gene (for glufosinate selection) fused to the tcu-1 promoter. This plasmid permits the generation of DNA fragments that can direct integration of Ptcu-1 into any desired locus. We use this strategy to integrate Ptcu-1 in front of wc-1, a circadian oscillator and photoreceptor gene. The addition of excess copper to the Ptcu-1::wc-1 strain phenocopies a Δwc-1 strain, and the addition of the copper chelator, bathocuproinedisulfonic acid, phenocopies a wc-1 overexpression strain. To test whether copper repression can recapitulate the loss of viability that an essential gene knockout causes, we placed Ptcu-1 upstream of the essential gene, hpt-1. The addition of excess copper drastically reduced the growth rate as expected. Thus, this strategy will be useful to probe the biological function of any N. crassa gene through controlled expression. PMID:24142928

  15. Sox3 binds to 11β-hydroxysteroid dehydrogenase gene promoter suggesting transcriptional interaction in catfish.

    PubMed

    Rajakumar, Anbazhagan; Senthilkumaran, Balasubramanian

    2016-04-01

    In fishes, the expression of steroidogenic enzyme genes and their related transcription factors (TFs) are critical for the regulation of steroidogenesis and gonadal development. 11-KT is the potent androgen and hence, 11β-hsd, enzyme involved in 11-KT production is important. Regulation of 11β-hsd gene was never studied in any fishes. At first 11β-hsd was cloned and recombinant protein was tested for enzyme activity prior to expression and promoter motif analysis. Expression changes revealed stage- and sex-dependent increase in the ontogenic studies. Further, 11β-hsd expression was higher during spawning phase of reproductive cycle and was found to be gonadotropin inducible both in vivo and in vitro. ∼2kb of 5' upstream region of 11β-hsd, was cloned from catfish genomic DNA library and in silico promoter analysis revealed putative TF binding sites such as Sox3, Wt1, Pax2, Dmrt1 and Ad4BP/SF-1. Luciferase reporter assay using the sequential deletion constructs in human embryonic kidney and Chinese hamster ovary cells revealed considerable promoter activity of the constructs containing Sox3, but not with other motifs largely. Site-directed mutagenesis, Sox3 over expression, electrophoretic mobility shift and chromatin immunoprecipitation assays further substantiated the binding of Sox3 to its corresponding cis-acting element in the upstream promoter motif of 11β-hsd. This is the first report to show that Sox3 binds to the 11β-hsd gene promoter and transactivates to regulate male reproduction in a teleost. PMID:26772480

  16. Arabidopsis gene expression patterns are altered during spaceflight

    NASA Astrophysics Data System (ADS)

    Paul, Anna-Lisa; Popp, Michael P.; Gurley, William B.; Guy, Charles; Norwood, Kelly L.; Ferl, Robert J.

    The exposure of Arabidopsis thaliana (Arabidopsis) plants to spaceflight environments results in differential gene expression. A 5-day mission on orbiter Columbia in 1999 (STS-93) carried transgenic Arabidopsis plants engineered with a transgene composed of the alcohol dehydrogenase (Adh) gene promoter linked to the β-Glucuronidase (GUS) reporter gene. The plants were used to evaluate the effects of spaceflight on gene expression patterns initially by using the Adh/GUS transgene to address specifically the possibility that spaceflight induces a hypoxic stress response (Paul, A.L., Daugherty, C.J., Bihn, E.A., Chapman, D.K., Norwood, K.L., Ferl, R.J., 2001. Transgene expression patterns indicate that spaceflight affects stress signal perception and transduction in arabidopsis, Plant Physiol. 126, 613-621). As a follow-on to the reporter gene analysis, we report here the evaluation of genome-wide patterns of native gene expression within Arabidopsis shoots utilizing the Agilent DNA array of 21,000 Arabidopsis genes. As a control for the veracity of the array analyses, a selection of genes was further characterized with quantitative Real-Time RT PCR (ABI - Taqman®). Comparison of the patterns of expression for arrays probed with RNA isolated from plants exposed to spaceflight compared to RNA isolated from ground control plants revealed 182 genes that were differentially expressed in response to the spaceflight mission by more than 4-fold, and of those only 50 genes were expressed at levels chosen to support a conservative change call. None of the genes that are hallmarks of hypoxic stress were induced to this level. However, genes related to heat shock were dramatically induced - but in a pattern and under growth conditions that are not easily explained by elevated temperatures. These gene expression data are discussed in light of current models for plant responses to the spaceflight environment and with regard to potential future spaceflight experiment

  17. A short upstream promoter region mediates transcriptional regulation of the mouse doublecortin gene in differentiating neurons

    PubMed Central

    2010-01-01

    Background Doublecortin (Dcx), a MAP (Microtubule-Associated Protein), is transiently expressed in migrating and differentiating neurons and thereby characterizes neuronal precursors and neurogenesis in developing and adult neurogenesis. In addition, reduced Dcx expression during development has been related to appearance of brain pathologies. Here, we attempt to unveil the molecular mechanisms controlling Dcx gene expression by studying its transcriptional regulation during neuronal differentiation. Results To determine and analyze important regulatory sequences of the Dcx promoter, we studied a putative regulatory region upstream from the mouse Dcx coding region (pdcx2kb) and several deletions thereof. These different fragments were used in vitro and in vivo to drive reporter gene expression. We demonstrated, using transient expression experiments, that pdcx2kb is sufficient to control specific reporter gene expression in cerebellar cells and in the developing brain (E14.5). We determined the temporal profile of Dcx promoter activity during neuronal differentiation of mouse embryonic stem cells (mESC) and found that transcriptional activation of the Dcx gene varies along with neuronal differentiation of mESC. Deletion experiments and sequence comparison of Dcx promoters across rodents, human and chicken revealed the importance of a highly conserved sequence in the proximal region of the promoter required for specific and strong expression in neuronal precursors and young neuronal cells. Further analyses revealed the presence in this short sequence of several conserved, putative transcription factor binding sites: LEF/TCF (Lymphoid Enhancer Factor/T-Cell Factor) which are effectors of the canonical Wnt pathway; HNF6/OC2 (Hepatocyte Nuclear Factor-6/Oncecut-2) members of the ONECUT family and NF-Y/CAAT (Nuclear Factor-Y). Conclusions Studies of Dcx gene regulatory sequences using native, deleted and mutated constructs suggest that fragments located upstream of the

  18. Alternative promoter usage and differential expression of multiple transcripts of mouse Prkar1a gene.

    PubMed

    Banday, Abdul Rouf; Azim, Shafquat; Tabish, Mohammad

    2011-11-01

    Prkar1a gene encodes regulatory type 1 alpha subunit (RIα) of cAMP-dependent protein kinase (PKA) in mouse. The role of this gene has been implicated in Carney complex and many cancer types that suggest its involvement in physiological processes like cell cycle regulation, growth and/or proliferation. We have identified and sequenced partial cDNA clones encoding four alternatively spliced transcripts of mouse Prkar1a gene. These transcripts have alternate 5' UTR structure which results from splicing of three exons (designated as E1a, E1b, and E1c) to canonical exon 2. The designated transcripts T1, T2, T3, and T4 contain 5' UTR exons as E1c, E1a + E1b, E1a, and E1b, respectively. The transcript T1 corresponded to earlier reported transcript in GenBank. In silico study of genomic DNA sequence revealed three distinct promoter regions namely, P1, P2, and P3 upstream of the exons E1a, E1b, and E1c, respectively. P1 is non-CpG-related promoter but P2 and P3 are CpG-related promoters; however, all three are TATA less. RT-PCR analysis demonstrated the expression of all four transcripts in late postnatal stages; however, these were differentially regulated in early postnatal stages of 0.5 day, 3 day, and 15 day mice in different tissue types. Variations in expression of Prkar1a gene transcripts suggest their regulation from multiple promoters that respond to a variety of signals arising in or out of the cell in tissue and developmental stage-specific manner. PMID:21638026

  19. Division genes in Escherichia coli are expressed coordinately to cell septum requirements by gearbox promoters.

    PubMed

    Aldea, M; Garrido, T; Pla, J; Vicente, M

    1990-11-01

    The cell division ftsQAZ cluster and the ftsZ-dependent bolA morphogene of Escherichia coli are found to be driven by gearboxes, a distinct class of promoters characterized by showing an activity that is inversely dependent on growth rate. These promoters contain specific sequences upstream from the mRNA start point, and their -10 region is essential for the inverse growth rate dependence. Gearbox promoters are essential for driving ftsQAZ and bolA gene expression so that the encoded products are synthesized at constant amounts per cell independently of cell size. This mode of regulation would be expected for the expression of proteins that either play a regulatory role in cell division or form a stoichiometric component of the septum, a structure that, independently of cell size and growth rate, is produced once per cell cycle. PMID:1698623

  20. Regulation of a bovine nonclassical major histocompatibility complex class I gene promoter.

    PubMed

    O'Gorman, Grace M; Al Naib, Abdullah; Naib, Abdullah Al; Ellis, Shirley A; Mamo, Solomon; O'Doherty, Alan M; Lonergan, Pat; Fair, Trudee

    2010-08-01

    Studies have shown in humans and other species that the major histocompatibility complex class I (MHC-I) region is involved at a number of levels in the establishment and maintenance of pregnancy. The aim of this study was to characterize how a bovine nonclassical MHC-I gene (NC1) is regulated. Initial serial deletion experiments of a 2-kb fragment of the NC1 promoter identified regions with positive regulatory elements in the proximal promoter and evidence for a silencer module(s) further upstream that cooperatively contributed to constitutive NC1 expression. The cytokines interferon tau (IFNT), interferon gamma (IFNG), and interleukin 4 (IL4) significantly increased luciferase expression in NC1 promoter reporter constructs and endogenous NC1 mRNA levels in a bovine endometrial cell line. In addition, IFNG, IL3, IL4, and progesterone significantly increased Day 7 bovine blastocyst NC1 mRNA expression when supplemented during in vitro embryo culture. Site-directed mutagenesis analysis identified a STAT6 binding site that conferred IL4 responsiveness in the NC1 proximal promoter. Furthermore, methylation treatment of the proximal promoter, which contains a CpG island, completely abrogated constitutive NC1 expression. Overall, the findings presented here suggest that constitutive NC1 expression is regulated positively by elements in the proximal promoter, which are further controlled by upstream silencer modules. The promoter is responsive to IFNT, IFNG, and IL4, suggesting possible roles for these cytokines in bovine preimplantation embryo survival and/or maternal-fetal tolerance. Our studies also suggest that methylation of the proximal promoter, in particular, could play a significant role in regulating NC1 expression. PMID:20427761

  1. Control of gene conversion and somatic hypermutation by immunoglobulin promoter and enhancer sequences.

    PubMed

    Yang, Shu Yuan; Fugmann, Sebastian D; Schatz, David G

    2006-12-25

    It is thought that gene conversion (GCV) and somatic hypermutation (SHM) of immunoglobulin (Ig) genes occur in two steps: the generation of uracils in DNA by activation-induced cytidine deaminase, followed by their subsequent repair by various DNA repair pathways to generate sequence-diversified products. It is not known how either of the two steps is targeted specifically to Ig loci. Because of the tight link between transcription and SHM, we have investigated the role of endogenous Ig light chain (IgL) transcriptional control elements in GCV/SHM in the chicken B cell line DT40. Promoter substitution experiments led to identification of a strong RNA polymerase II promoter incapable of supporting efficient GCV/SHM. This surprising finding indicates that high levels of transcription are not sufficient for robust GCV/SHM in Ig loci. Deletion of the IgL enhancer in a context in which high-level transcription was not compromised showed that the enhancer is not necessary for GCV/SHM. Our results indicate that cis-acting elements are important for Ig gene diversification, and we propose that targeting specificity is achieved through the combined action of several Ig locus elements that include the promoter. PMID:17178919

  2. Two closely linked but separable promoters for human neuronal nitric oxide synthase gene transcription.

    PubMed Central

    Xie, J; Roddy, P; Rife, T K; Murad, F; Young, A P

    1995-01-01

    In this report we demonstrate that the human cerebellum contains neuronal nitric oxide synthase (nNOS) mRNAs with two distinct 5'-untranslated regions that are encoded through use of closely linked but separate promoters. nNOS cDNA clones were shown to contain different 5' terminal exons spliced to a common exon 2. Genomic cloning and sequence analysis demonstrate that the unique exons are positioned within 300 bp of each other but separated from exon 2 by an intron that is at least 20 kb in length. A CpG island engulfs the downstream 5'-terminal exon. In contrast, most of the upstream exon resides outside of this CpG island. Interestingly, the upstream exon includes a GT dinucleotide repeat. A fusion gene with a 414-bp nNOS genomic fragment that includes a portion of the upstream 5'-terminal exon and its immediate 5'-flanking DNA is expressed in transfected HeLa cells. Also expressed is a fusion gene that contains the luciferase reporter under transcriptional control by a 308-bp genomic fragment that includes the region separating both 5'-terminal exons. These results indicate that expression of these exons is subject to transcriptional control by separate promoters. However, the proximity of these promoters raise the possibility that complex interactions may be involved in regulating nNOS gene expression at these sites. Images Fig. 1 Fig. 4 PMID:7532307

  3. The role of PAQR3 gene promoter hypermethylation in breast cancer and prognosis.

    PubMed

    Chen, Jinpeng; Wang, Feiran; Xu, Junfei; He, Zhixian; Lu, Yuhua; Wang, Zhiwei

    2016-09-01

    PAQR3 is a tumor suppressor in breast cancer and its expression regulation mechanism has not been well elucidated. In this study, we found that PAQR3 expression was downregulated in breast cancer tissues, and the downregulation of PAQR3 expression was found to be significantly associated with aberrant methylation of the gene promoter. Methylation‑specific PCR showed that hypermethylation of the PAQR3 gene was observed in 71.8% of the breast cancers, whereas it was found in only 28.2% of the corresponding non‑tumor tissues. Moreover, we found that the PAQR3 promoter methylation status was related to lymph node metastasis (P=0.01). In addition, overexpression of PAQR3 inhibited breast cancer cell invasion and growth. Furthermore, PAQR3 expression was restored in MCF‑7 cells after treatment with the demethylating agent, 5-aza-2'-deoxycytidine, and the effect of demethylation induced invasion and proliferation suppression of MCF‑7 cells. Collectively, our results suggested that the aberrant methylation of PAQR3 underlies its downregulation in breast cancer and our data indicated that epigenetic silencing of PAQR3 gene expression by promoter hypermethylation may play an important role in breast cancer. PMID:27461225

  4. Promoter analysis of the membrane protein gp64 gene of the cellular slime mold Polysphondylium pallidum.

    PubMed

    Takaoka, N; Fukuzawa, M; Saito, T; Sakaitani, T; Ochiai, H

    1999-10-28

    We cloned a genomic fragment of the membrane protein gp64 gene of the cellular slime mold Polysphondylium pallidum by inverse PCR. Primer extension analysis identified a major transcription start site 65 bp upstream of the translation start codon. The promoter region of the gp64 gene contains sequences homologous to a TATA box at position -47 to -37 and to an initiator (Inr, PyPyCAPyPyPyPy) at position -3 to +5 from the transcription start site. Successively truncated segments of the promoter were tested for their ability to drive expression of the beta-galactosidase reporter gene in transformed cells; also the difference in activity between growth conditions was compared. The results indicated that there are two positive vegetative regulatory elements extending between -187 and -62 bp from the transcription start site of the gp64 promoter; also their activity was two to three times higher in the cells grown with bacteria in shaken suspension than in the cells grown in an axenic medium. PMID:10542319

  5. REGULATABLE PROMOTERS AND GENE THERAPY FOR PARKINSON'S DISEASE: IS THE ONLY THING TO FEAR, FEAR ITSELF?

    PubMed Central

    H.Kordower, Jeffrey; Olanow, C. Warren

    2013-01-01

    Gene therapy for Parkinson's disease has become a clinical reality with three different approaches currently being tested in patients. All three trials employ an adeno-associated virus with a type two serotype (AAV2). To date, no serious adverse events related to the injections of therapeutic vectors have been reported in any patient. This safety profile was predicted based upon, in some cases, exhaustive preclinical testing in both rodent and primate species. Still some argue that regulatable promoters are required so that expression of the transgene can be halted should untoward side effects arise. We argue that given the current empirical data base of AAV2, the lack of regulatable promoters that have been proven to safe and effective, and the pressing clinical needs of PD patients, the mandatory use of regulatable vectors is not only unnecessary but, in some instances, misguided and potentially dangerous. This commentary will outline the issues related to the use of regulatable promoters for gene therapy for PD and express our opinion as to why mandating the use of such promoters might result in outcomes that are unsafe, unproductive, and counter to the progress of scientifically sound, clinical research. PMID:17888424

  6. Gene Expression of Axon Growth Promoting Factors in the Deer Antler

    PubMed Central

    Pita-Thomas, Wolfgang; Fernández-Martos, Carmen; Yunta, Mónica; Maza, Rodrigo M.; Navarro-Ruiz, Rosa; Lopez-Rodríguez, Marcos Javier; Reigada, David; Nieto-Sampedro, Manuel; Nieto-Diaz, Manuel

    2010-01-01

    The annual regeneration cycle of deer (Cervidae, Artiodactyla) antlers represents a unique model of epimorphic regeneration and rapid growth in adult mammals. Regenerating antlers are innervated by trigeminal sensory axons growing through the velvet, the modified form of skin that envelopes the antler, at elongation velocities that reach one centimetre per day in the common deer (Cervus elaphus). Several axon growth promoters like NT-3, NGF or IGF-1 have been described in the antler. To increase the knowledge on the axon growth environment, we have combined different gene-expression techniques to identify and characterize the expression of promoting molecules not previously described in the antler velvet. Cross-species microarray analyses of deer samples on human arrays allowed us to build up a list of 90 extracellular or membrane molecules involved in axon growth that were potentially being expressed in the antler. Fifteen of these genes were analysed using PCR and sequencing techniques to confirm their expression in the velvet and to compare it with the expression in other antler and skin samples. Expression of 8 axon growth promoters was confirmed in the velvet, 5 of them not previously described in the antler. In conclusion, our work shows that antler velvet provides growing axons with a variety of promoters of axon growth, sharing many of them with deer's normal and pedicle skin. PMID:21187928

  7. Regulatable promoters and gene therapy for Parkinson's disease: is the only thing to fear, fear itself?

    PubMed

    Kordower, Jeffrey H; Olanow, C Warren

    2008-01-01

    Gene therapy for Parkinson's disease has become a clinical reality with three different approaches currently being tested in patients. All three trials employ an adeno-associated virus with a type two serotype (AAV2). To date, no serious adverse events related to the injections of therapeutic vectors have been reported in any patient. This safety profile was predicted based upon, in some cases, exhaustive preclinical testing in both rodent and primate species. Still some argue that regulatable promoters are required so that expression of the transgene can be halted should untoward side effects arise. We argue that given the current empirical data base of AAV2, the lack of regulatable promoters that have been proven to be safe and effective, and the pressing clinical needs of PD patients, the mandatory use of regulatable vectors is not only unnecessary but, in some instances, misguided and potentially dangerous. This commentary will outline the issues related to the use of regulatable promoters for gene therapy for PD and express our opinion as to why mandating the use of such promoters might result in outcomes that are unsafe, unproductive, and counter to the progress of scientifically sound, clinical research. PMID:17888424

  8. Activation of a muscle-specific actin gene promoter in serum-stimulated fibroblasts.

    PubMed Central

    Stoflet, E S; Schmidt, L J; Elder, P K; Korf, G M; Foster, D N; Strauch, A R; Getz, M J

    1992-01-01

    Treatment of AKR-2B mouse fibroblasts with serum growth factors or inhibitors of protein synthesis, such as cycloheximide, results in a stimulation of cytoskeletal beta-actin transcription but has no effect on transcription of muscle-specific isotypes, such as the vascular smooth muscle (VSM) alpha-actin gene. Deletion mapping and site-specific mutagenesis studies demonstrated that a single "CArG" element of the general form CC(A/T)6GG was necessary and possibly sufficient to impart serum and cycloheximide-inducibility to the beta-actin promoter. Although the VSM alpha-actin promoter exhibits at least three similar sequence elements, it remained refractory to serum and cycloheximide induction. However, deletion of a 33 base pair sequence between -191 and -224 relative to the transcription start site resulted in the transcriptional activation of this muscle-specific promoter in rapidly growing or serum-stimulated fibroblasts. Although the activity of this truncated promoter was potentiated by cycloheximide in a manner indistinguishable from that of the beta-actin promoter, this was dependent on a more complex array of interacting elements. These included at least one CArG box and a putative upstream activating element closely associated with the -191 to -224 inhibitory sequences. These results demonstrate that the expression of a muscle-specific actin gene in fibroblasts is suppressed by a cis-acting negative control element and that in the absence of this element, the promoter is responsive to growth factor-induced signal transduction pathways. Images PMID:1421567

  9. c-Ha-ras gene bidirectional promoter expressed in vitro: location and regulation.

    PubMed Central

    Lowndes, N F; Paul, J; Wu, J; Allan, M

    1989-01-01

    Increased transcriptional activity of the c-Ha-ras gene product is correlated with induction of several important human tumor types. For this reason, we have investigated the nature of the c-Ha-ras promoter and the factors that regulate its expression. Using S1 and primer extension analysis of c-Ha-ras RNA from EJ cells, we have identified 18 initiation sites within an upstream exon (exon -1) whose 3' end (the donor splice site [D]) is located 1,105 base pairs (bp) upstream of the ATG codon. The furthest-upstream initiation site is located -191 bp relative to D, and the furthest downstream is located -16 bp relative to D. Transient expression assays, in which a series of mutants spanning this region were ligated to a promoterless chloramphenicol acetyltransferase vector, functionally confirmed the position and extent of this promoter. Mutational analysis further located a 47-bp element located between -243 and -196 relative to D that up-regulated transcriptional activity of the promoter region by 20- to 40-fold. This region contained both a GC box known to bind SP1 and a CCAAT box. Insertion of a simian virus 40 enhancer 5' to the promoter up-regulated transcription from each initiation site by approximately 10- to 20-fold. We have also localized, both by chloramphenicol acetyltransferase assay and by S1 analysis, a strong promoter operating in the direction opposite that of the gene and originating immediately 5' to the 47-bp regulatory region. The reverse promoter was found to have nine initiation sites between -248 and -278 relative to D. Images PMID:2674682

  10. Analysis of Hypothetical Promoter Domains of DKFZp564A1164, NPHS1 and HSPOX1 Genes

    SciTech Connect

    Hammond, S S

    2003-11-29

    For this study, a high throughput method for identifying and testing regulatory elements was examined. In addition, the validity of promoters predicted by FirstEF was tested. It was found that by combining computer based promoter and first exon predictions from FirstEF (Davuluri et al., 2001) with PCR-based cloning to generate luciferase reporter constructs, and by testing reporter activity in cultured mammalian cells plated in a 96 well format one could identify promoter activity in a relatively high throughput manner. The data generated in this study suggest that FirstEF predictions are sometimes incorrect. Therefore, having a strategy for defining which FirstEF predicted promoters to test first may accelerate the process. Initially testing promoters that are at a confirmed transcription start site for a gene, at a possible alternate transcription start site or in a region of conserved sequence would be the best candidates, while promoters predicted in gene desert regions may not be as easy to confirm. The luciferase assay lent itself very well to the high throughput search, however the subcloning did not always go smoothly. The numerous steps that this traditional subcloning method requires were time consuming and increased the opportunities for errors. A faster method that skips many of the traditional subcloning steps, such as the Creator{trademark} system by Clontech is currently being investigated by our lab. The development and testing of substantially larger enhancer/silencer regulatory elements may not be possible at this time using these high throughput methods. These regulatory elements are generally GC rich making them more difficult to PCR and subclone. Additionally, confirming upstream untranslated first exons was not possible within this time scale using the SMART RACE protocol. It will be necessary to further explore the limitations within these procedures in order to confirm these and future regulatory elements. Alterations and modifications to

  11. Characterization of the promoter region of the gene for the rat neutral and basic amino acid transporter and chromosomal localization of the human gene.

    PubMed Central

    Yan, N; Mosckovitz, R; Gerber, L D; Mathew, S; Murty, V V; Tate, S S; Udenfriend, S

    1994-01-01

    The promoter region of the rat kidney neutral and basic amino acid transporter (NBAT) gene has been isolated and sequenced. The major transcription initiation site was mapped by primer extension. The entire promoter region and a set of 5' deletions within it were expressed at a high level in LLC-PK1 cells using the luciferase indicator gene. Positive and negative regulatory elements in the promoter region were observed. A human genomic clone of the transporter was also obtained and was used to localize the NBAT gene at the p21 region of chromosome 2. Images PMID:8052618

  12. Nonlinear Dynamics in Gene Regulation Promote Robustness and Evolvability of Gene Expression Levels

    PubMed Central

    Steinacher, Arno; Bates, Declan G.; Akman, Ozgur E.; Soyer, Orkun S.

    2016-01-01

    Cellular phenotypes underpinned by regulatory networks need to respond to evolutionary pressures to allow adaptation, but at the same time be robust to perturbations. This creates a conflict in which mutations affecting regulatory networks must both generate variance but also be tolerated at the phenotype level. Here, we perform mathematical analyses and simulations of regulatory networks to better understand the potential trade-off between robustness and evolvability. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics, through the creation of regions presenting sudden changes in phenotype with small changes in genotype. For genotypes embedding low levels of nonlinearity, robustness and evolvability correlate negatively and almost perfectly. By contrast, genotypes embedding nonlinear dynamics allow expression levels to be robust to small perturbations, while generating high diversity (evolvability) under larger perturbations. Thus, nonlinearity breaks the robustness-evolvability trade-off in gene expression levels by allowing disparate responses to different mutations. Using analytical derivations of robustness and system sensitivity, we show that these findings extend to a large class of gene regulatory network architectures and also hold for experimentally observed parameter regimes. Further, the effect of nonlinearity on the robustness-evolvability trade-off is ensured as long as key parameters of the system display specific relations irrespective of their absolute values. We find that within this parameter regime genotypes display low and noisy expression levels. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics. Our results provide a possible solution to the robustness-evolvability trade-off, suggest an explanation for

  13. Nonlinear Dynamics in Gene Regulation Promote Robustness and Evolvability of Gene Expression Levels.

    PubMed

    Steinacher, Arno; Bates, Declan G; Akman, Ozgur E; Soyer, Orkun S

    2016-01-01

    Cellular phenotypes underpinned by regulatory networks need to respond to evolutionary pressures to allow adaptation, but at the same time be robust to perturbations. This creates a conflict in which mutations affecting regulatory networks must both generate variance but also be tolerated at the phenotype level. Here, we perform mathematical analyses and simulations of regulatory networks to better understand the potential trade-off between robustness and evolvability. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics, through the creation of regions presenting sudden changes in phenotype with small changes in genotype. For genotypes embedding low levels of nonlinearity, robustness and evolvability correlate negatively and almost perfectly. By contrast, genotypes embedding nonlinear dynamics allow expression levels to be robust to small perturbations, while generating high diversity (evolvability) under larger perturbations. Thus, nonlinearity breaks the robustness-evolvability trade-off in gene expression levels by allowing disparate responses to different mutations. Using analytical derivations of robustness and system sensitivity, we show that these findings extend to a large class of gene regulatory network architectures and also hold for experimentally observed parameter regimes. Further, the effect of nonlinearity on the robustness-evolvability trade-off is ensured as long as key parameters of the system display specific relations irrespective of their absolute values. We find that within this parameter regime genotypes display low and noisy expression levels. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics. Our results provide a possible solution to the robustness-evolvability trade-off, suggest an explanation for

  14. Transcriptional regulation of the human Wilms' tumor gene (WT1). Cell type-specific enhancer and promiscuous promoter.

    PubMed

    Fraizer, G C; Wu, Y J; Hewitt, S M; Maity, T; Ton, C C; Huff, V; Saunders, G F

    1994-03-25

    The Wilms' tumor gene, WT1, is expressed in few tissues, mainly the developing kidney, genitourinary system, and mesothelium, and in immature hematopoietic cells. To develop an understanding of the role of WT1 in development and tumorigenesis, we have identified transcriptional regulatory elements that function in transient reporter gene constructs transfected into kidney and hematopoietic cell lines. We found three transcription start sites of the WT1 gene and have identified an essential promoter region by deletion analysis. The WT1 promoter is a member of the GC-rich, TATA-less, and CCAAT-less class of polymerase II promoters. Whereas the WT1 promoter is similar to other tumor suppressor gene promoters, the WT1 expression pattern (unlike Rb and p53) is tissue-restricted. The WT1 GC-rich promoter is promiscuous, functioning in all cell lines tested, independent of WT1 expression. This finding suggests that the promoter is not tissue-specific, but that tissue-specific expression of WT1 is modulated by additional regulatory elements. Indeed, we have identified a transcriptional enhancer located 3' of the WT1 gene > 50 kilobases downstream from the promoter. This orientation-independent enhancer increases the basal transcription rate of the WT1 promoter in the human erythroleukemia cell line K562, but not in any of the other cell lines tested. PMID:8132626

  15. Identification of a novel first exon in the human dystrophin gene and of a new promoter located more than 500 kb upstream of the nearest known promoter

    SciTech Connect

    Yanagawa, H.; Nishio, H.; Takeshima, Y.

    1994-09-01

    The dystrophin gene, which is muted in patients with Duchenne and Becker muscular dystrophies, is the largest known human gene. Five alternative promoters have been characterized until now. Here we show that a novel dystrophin isoform with a different first exon can be produced through transcription initiation at a previously-unidentified alternative promoter. The case study presented is that of patient with Duchenne muscular dystrophy who had a deletion extending from 5{prime} end of the dystrophin gene to exon 2, including all promoters previously mapped in the 5{prime} part of the gene. Transcripts from lymphoblastoid cells were found to contain sequences corresponding to exon 3, indicating the presence of new promoter upstream of this exon. The nucleotide sequence of amplified cDNA corresponding to the 5{prime} end of the new transcript indicated that the 5{prime} end of exon 3 was extended by 9 codons, only the last (most 3{prime}) of which codes for methionine. The genomic nucleotide sequence upstream from the new exon, as determined using inverse polymerase chain reaction, revealed the presence of sequences similar to a TATA box, an octamer motif and an MEF-2 element. The identified promoter/exon did not map to intron 2, as might have been expected, but to a position more than 500 kb upstream of the most 5{prime} of the previously-identified promoters, thereby adding 500 kb to the dystrophin gene. The sequence of part of the new promoter region is very similar to that of certain medium reiteration frequency repetitive sequences. These findings may help us understand the molecular evolution of the dystrophin gene.

  16. Nurses’ perceptions of medication adherence in schizophrenia: results of the ADHES cross-sectional questionnaire survey

    PubMed Central

    Emsley, Robin; Alptekin, Koksal; Azorin, Jean-Michel; Cañas, Fernando; Dubois, Vincent; Gorwood, Philip; Haddad, Peter M.; Naber, Dieter; Olivares, José Manuel; Papageorgiou, Georgios; Roca, Miguel; Thomas, Pierre; Hargarter, Ludger; Schreiner, Andreas

    2015-01-01

    Objectives: Poor adherence to antipsychotic treatment is a widespread problem within schizophrenia therapy with serious consequences including increased risks of relapse and rehospitalization. Mounting evidence supports the key roles that nurses play in monitoring patient progress and facilitating long-term treatment adherence. The Adherencia Terapéutica en la Esquizofrenia (ADHES) nurses’ survey was designed to assess the opinions of nurses on the causes and management of partial/nonadherence to antipsychotic medication. Methods: A questionnaire-based cross-sectional survey of 4120 nurses from Europe, the Middle East and Africa. Interpretation of results was based on a descriptive comparison of responses. Results: Nurses perceived 54% of patients seen in the preceding month to be partially/nonadherent to treatment. Most nurses (90%) reported some level of experience with administration of long-acting injectable (LAI) antipsychotics, with 24% of nurses administering >10 injections per month. The majority (85%) of nurses surveyed believed that improving adherence would improve patient outcomes. Nearly half (49%) reported that most of their patients depend on a family member or other nonprofessional carer to remind them to take their medication as prescribed. A similar proportion of nurses (43%) reported that most of their patients relied on a professional to remind them to take medication. Most nurses (92%) felt that ensuring continuous medication with LAI antipsychotics would yield long-term benefits for patients, but their opinion was that over a third of patients were unaware of LAI antipsychotic treatments. In a series of forced options, the strategy used most often by respondents (89%) to promote medication adherence was to build trusting relationships with patients while listening to and interpreting their needs and concerns. Respondents also rated this as the most effective strategy that they used (48%). Conclusion: Nurses are highly aware of adherence

  17. Glial cell-specific expression of the serotonin 2 receptor gene: selective reactivation of a repressed promoter.

    PubMed

    Ding, D; Toth, M; Zhou, Y; Parks, C; Hoffman, B J; Shenk, T

    1993-11-01

    The 5' flanking region of the 5-HT2 receptor gene has been cloned, sequenced and its transcriptional regulatory functions analyzed. The promoter lacks an identifiable TATA motif, and utilizes at least 11 clustered start sites. Promoter function was analyzed by transient assays in rat C6 glioma cells, which were shown to express the endogenous 5-HT2 receptor gene, as well as in rat CREF and human HeLa cells which do not express the endogenous gene. The basal promoter functioned equally well in all three cell lines; and a repression domain, located upstream of the basal promoter, inhibited activity of the promoter in all three cell lines. A far upstream cell specific activator domain restored promoter activity in C6 glioma cells, but did not reactivate the silenced promoter in CREF or HeLa cells. The upstream activator domain, repressor domain and basal promoter functioned in concert to achieve cell type specific expression. The activator domain did not direct C6 glioma cell specific expression in the absence of the repressor domain or in constructs carrying a heterologous basal promoter. These results indicate that glial cell expression of the 5-HT2 receptor gene is achieved through a cell type specific reactivation of a repressed promoter. PMID:8302156

  18. Effect of TNF{alpha} on activities of different promoters of human apolipoprotein A-I gene

    SciTech Connect

    Orlov, Sergey V.; Mogilenko, Denis A.; Shavva, Vladimir S.; Dizhe, Ella B.; Ignatovich, Irina A.; Perevozchikov, Andrej P.

    2010-07-23

    Research highlights: {yields} TNF{alpha} stimulates the distal alternative promoter of human apoA-I gene. {yields} TNF{alpha} acts by weakening of promoter competition within apoA-I gene (promoter switching). {yields} MEK1/2 and nuclear receptors PPAR{alpha} and LXRs take part in apoA-I promoter switching. -- Abstract: Human apolipoprotein A-I (ApoA-I) is a major structural and functional protein component of high-density lipoproteins. The expression of the apolipoprotein A-I gene (apoA-I) in hepatocytes is repressed by pro-inflammatory cytokines such as IL-1{beta} and TNF{alpha}. Recently, two novel additional (alternative) promoters for human apoA-I gene have been identified. Nothing is known about the role of alternative promoters in TNF{alpha}-mediated downregulation of apoA-I gene. In this article we report for the first time about the different effects of TNF{alpha} on two alternative promoters of human apoA-I gene. Stimulation of HepG2 cells by TNF{alpha} leads to activation of the distal alternative apoA-I promoter and downregulation of the proximal alternative and the canonical apoA-I promoters. This effect is mediated by weakening of the promoter competition within human apoA-I 5'-regulatory region (apoA-I promoter switching) in the cells treated by TNF{alpha}. The MEK1/2-ERK1/2 cascade and nuclear receptors PPAR{alpha} and LXRs are important for TNF{alpha}-mediated apoA-I promoter switching.

  19. Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

    NASA Astrophysics Data System (ADS)

    Li, Shengjie; Bai, Junjie; Wang, Lin

    2008-08-01

    Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

  20. Promotion of growth by Coenzyme Q10 is linked to gene expression in C. elegans.

    PubMed

    Fischer, Alexandra; Niklowitz, Petra; Menke, Thomas; Döring, Frank

    2014-10-01

    Coenzyme Q (CoQ, ubiquinone) is an essential component of the respiratory chain, a cofactor of pyrimidine biosynthesis and acts as an antioxidant in extra mitochondrial membranes. More recently CoQ has been identified as a modulator of apoptosis, inflammation and gene expression. CoQ deficient Caenorhabditis elegans clk-1 mutants show several phenotypes including a delayed postembryonic growth. Using wild type and two clk-1 mutants, here we established an experimental set-up to study the consequences of endogenous CoQ deficiency or exogenous CoQ supply on gene expression and growth. We found that a deficiency of endogenous CoQ synthesis down-regulates a cluster of genes that are important for growth (i.e., RNA polymerase II, eukaryotic initiation factor) and up-regulates oxidation reactions (i.e., cytochrome P450, superoxide dismutase) and protein interactions (i.e., F-Box proteins). Exogenous CoQ supply partially restores the expression of these genes as well as the growth retardation of CoQ deficient clk-1 mutants. On the other hand exogenous CoQ supply does not alter the expression of a further sub-set of genes. These genes are involved in metabolism (i.e., succinate dehydrogenase complex), cell signalling or synthesis of lectins. Thus, our work provides a comprehensive overview of genes which can be modulated in their expression by endogenous or exogenous CoQ. As growth retardation in CoQ deficiency is linked to the gene expression profile we suggest that CoQ promotes growth via gene expression. PMID:25234594

  1. Analysis of the sexual development-promoting region of Schizophyllum commune TRP1 gene.

    PubMed

    Sen, Kikuo; Kinoshita, Hideki; Tazuke, Kazuyuki; Maki, Yoshinori; Yoshiura, Yumi; Yakushi, Toshiharu; Shibai, Hiroshiro; Kurosawa, Shin-Ichi

    2016-10-01

    This study aims to elucidate the mechanism of sexual development of basidiomycetous mushrooms from mating to fruit body formation. Sequencing analysis showed the TRP1 gene of basidiomycete Schizophyllum commune encoded an enzyme with three catalytic regions of GAT (glutamine amidotransferase), IGPS (indole-3-glycerol phosphate synthase), and PRAI (5-phosphoribosyl anthranilate isomerase); among these three regions, the trp1 mutant (Trp(-)) had a missense mutation (L→F) of a 338th amino acid residue of the TRP1 protein within the IGPS region. To investigate the function of IGPS region related to sexual development, dikaryons with high, usual, and no expression of the IGPS region of TRP1 gene were made. The dikaryotic mycelia with high expression of the IGPS formed mature fruit bodies earlier than those with usual and no expression of the IGPS. These results showed that the IGPS region in TRP1 gene promoted sexual development of S. commune. PMID:27296855

  2. Multiple octamer binding sites in the promoter region of the bovine alpha s2-casein gene.

    PubMed Central

    Groenen, M A; Dijkhof, R J; van der Poel, J J; van Diggelen, R; Verstege, E

    1992-01-01

    Using a set of overlapping oligonucleotides from the promoter region of the bovine alpha s2-casein gene we have identified two nuclear factors which probably are involved in expression of this gene and the related calcium sensitive alpha s1- and beta-casein genes. One of these factors which was present in extracts of all tissues that have been tested including Hela cells turned out to be the octamer binding protein OCT-1. Oct-1 binds with different affinity to 4 sites at positions centred around -480, -260, -210 and -50. The strongest of these 4 binding sites, the one around position -50, is highly conserved in all calcium sensitive caseins of mouse, rat, rabbit and cattle. The other nuclear factor (MGF, mammary gland factor) which is specifically expressed in the mammary gland, binds to a site around position -90. This binding site is also highly conserved in all calcium sensitive caseins of mouse, rat, rabbit and cattle. Images PMID:1508722

  3. Suppressors of Mutations in the rII Gene of Bacteriophage T4 Affect Promoter Utilization

    PubMed Central

    Hall, Dwight H.; Snyder, Ronald D.

    1981-01-01

    Homyk, Rodriguez and Weil (1976) have described T4 mutants, called sip, that partially suppress the inability of T4rII mutants to grow in λ lysogens. We have found that mutants sip1 and sip2 are resistant to folate analogs and overproduce FH2 reductase. The results of recombination and complementation studies indicate that sip mutations are in the mot gene. Like other mot mutations (Mattson, Richardson and Goodin 1974; Chace and Hall 1975; Sauerbier, Hercules and Hall 1976), the sip2 mutation affects the expression of many genes and appears to affect promoter utilization. The mot gene function is not required for T4 growth on most hosts, but we have found that it is required for good growth on E. coli CTr5X. Homyk, Rodriguez and Weil (1976) also described L mutations that reverse the effects of sip mutations. L2 decreases the folate analog resistance and the inability of sip2 to grow on CTr5X. L2 itself is partially resistant to a folate analog, and appears to reverse the effects of sip2 on gene expression. These results suggest that L2 affects another regulatory gene related to the mot gene. PMID:7262547

  4. An efficient promoter trap for detection of patterned gene expression and subsequent functional analysis in Drosophila

    PubMed Central

    Larsen, Camilla; Franch-Marro, Xavier; Hartenstein, Volker; Alexandre, Cyrille; Vincent, Jean-Paul

    2006-01-01

    Transposable elements have been used in Drosophila to detect gene expression, inactivate gene function, and induce ectopic expression or overexpression. We have combined all of these features in a single construct. A promoterless GAL4 cDNA is expressed when the construct inserts within a transcriptional unit, and GAL4 activates a GFP-encoding gene present in the same transposon. In a primary screen, patterned gene expression is detected as GFP fluorescence in the live progeny of dysgenic males. Many animals expressing GFP in distinct patterns can be recovered with relatively little effort. As expected, many insertions cause loss of function. After insertion at a genomic location, specific parts of the transposon can be excised by FLP recombinase, thus allowing it to induce conditional misexpression of the tagged gene. Therefore, both gain- and loss-of-function studies can be carried out with a single insertion in a gene identified by virtue of its expression pattern. Using this promoter trap approach, we have identified a group of cells that innervate the calyx of the mushroom body and could thus define a previously unrecognized memory circuit. PMID:17093046

  5. Promoter Methylation and mRNA Expression of Response Gene to Complement 32 in Breast Carcinoma

    PubMed Central

    Eskandari-Nasab, Ebrahim; Hashemi, Mohammad; Rafighdoost, Firoozeh

    2016-01-01

    Background. Response gene to complement 32 (RGC32), induced by activation of complements, has been characterized as a cell cycle regulator; however, its role in carcinogenesis is still controversial. In the present study we compared RGC32 promoter methylation patterns and mRNA expression in breast cancerous tissues and adjacent normal tissues. Materials and Methods. Sixty-three breast cancer tissues and 63 adjacent nonneoplastic tissues were included in our study. Design. Nested methylation-specific polymerase chain reaction (Nested-MSP) and quantitative PCR (qPCR) were used to determine RGC32 promoter methylation status and its mRNA expression levels, respectively. Results. RGC32 methylation pattern was not different between breast cancerous tissue and adjacent nonneoplastic tissue (OR = 2.30, 95% CI = 0.95–5.54). However, qPCR analysis displayed higher levels of RGC32 mRNA in breast cancerous tissues than in noncancerous tissues (1.073 versus 0.959; P = 0.001), irrespective of the promoter methylation status. The expression levels and promoter methylation of RGC32 were not correlated with any of patients' clinical characteristics (P > 0.05). Conclusion. Our findings confirmed upregulation of RGC32 in breast cancerous tumors, but it was not associated with promoter methylation patterns. PMID:27118972

  6. New single nucleotide variation in the promoter region of androgen receptor (AR) gene in hypospadic patients

    PubMed Central

    Borhani, Nasim; Ghaffari Novin, Marefat; Manoochehri, Mehdi; Rouzrokh, Mohsen; Kazemi, Bahram; Koochaki, Ameneh; Hosseini, Ahmad; Masteri Farahani, Reza; Omrani, Mir Davood

    2014-01-01

    Background: Hypospadias is one of the most common congenital abnormalities in the male which is characterized by altered development of urethra, foreskin and ventral surface of the penis. Androgen receptor gene plays a critical role in the development of the male genital system by mediating the androgens effects. Objective: In present study, we looked for new variations in androgen receptor promoter and screened its exon 1 for five single nucleotide polymorphisms (SNP) in healthy and hypospadias Iranian men. Materials and Methods: In our study, at first DNA was extracted from patients (n=100) and controls (n=100) blood samples. Desired fragments of promoter and exon 1 were amplified using polymerase chain reaction. The promoter region was sequenced for the new variation and exone 1 screened for five SNPs (rs139767835, rs78686797, rs62636528, rs62636529, rs145326748) using restriction fragment length polymorphism technique. Results: The results showed a new single nucleotide variation (C→T) at -480 of two patients’ promoter region (2%). None of the mentioned SNPs were detected in patients and controls groups (0%). Conclusion: This finding indicates that new single nucleotide polymorphism in androgen receptor promoter may have role in etiology of hypospadias and development of this anomaly. This article extracted from Ph.D. thesis. (Nasim Borhani) PMID:24799883

  7. Two distinct promoter architectures centered on dynamic nucleosomes control ribosomal protein gene transcription.

    PubMed

    Knight, Britta; Kubik, Slawomir; Ghosh, Bhaswar; Bruzzone, Maria Jessica; Geertz, Marcel; Martin, Victoria; Dénervaud, Nicolas; Jacquet, Philippe; Ozkan, Burak; Rougemont, Jacques; Maerkl, Sebastian J; Naef, Félix; Shore, David

    2014-08-01

    In yeast, ribosome production is controlled transcriptionally by tight coregulation of the 138 ribosomal protein genes (RPGs). RPG promoters display limited sequence homology, and the molecular basis for their coregulation remains largely unknown. Here we identify two prevalent RPG promoter types, both characterized by upstream binding of the general transcription factor (TF) Rap1 followed by the RPG-specific Fhl1/Ifh1 pair, with one type also binding the HMG-B protein Hmo1. We show that the regulatory properties of the two promoter types are remarkably similar, suggesting that they are determined to a large extent by Rap1 and the Fhl1/Ifh1 pair. Rapid depletion experiments allowed us to define a hierarchy of TF binding in which Rap1 acts as a pioneer factor required for binding of all other TFs. We also uncovered unexpected features underlying recruitment of Fhl1, whose forkhead DNA-binding domain is not required for binding at most promoters, and Hmo1, whose binding is supported by repeated motifs. Finally, we describe unusually micrococcal nuclease (MNase)-sensitive nucleosomes at all RPG promoters, located between the canonical +1 and -1 nucleosomes, which coincide with sites of Fhl1/Ifh1 and Hmo1 binding. We speculate that these "fragile" nucleosomes play an important role in regulating RPG transcriptional output. PMID:25085421

  8. [Morphological features of transgenic tobacco plants expressing the AINTEGUMENTA gene of rape under control of the Dahlia mosaic virus promoter].

    PubMed

    Kuluev, B R; Kniazev, A V; Cheremis, A V; Vakhitov, V A

    2013-01-01

    Transgenic tobacco plants expressing the AINTEGUMENTA gene of rape under control of the 35S promoter and the promoter of dahlia mosaic virus were obtained. The transgenic plants were characterized by increase in the length of the leaves, flower sizes, stem height, and weight of seeds; at the same time, the degree of increase was greater in the case of use of the dahlia mosaic virus promoter as a regulator of transcription. Ectopic expression of the AINTEGUMENTA gene promoted prolongation of leaf growth, while sizes of epidermal cells of the leaves remained unchanged. PMID:23785848

  9. Human Serum Promotes Candida albicans Biofilm Growth and Virulence Gene Expression on Silicone Biomaterial

    PubMed Central

    Samaranayake, Yuthika Hemamala; Cheung, Becky P. K.; Yau, Joyce Y. Y.; Yeung, Shadow K. W.; Samaranayake, Lakshman P.

    2013-01-01

    Objectives Systemic candidal infections are a common problem in hospitalized patients due to central venous catheters fabricated using silicone biomaterial (SB). We therefore evaluated the effect of human serum on C. albicans biofilm morphology, growth, and the expression of virulence-related genes on SB in vitro. Methods We cultivated C. albicans SC5314 (wild-type strain, WT) and its derivative HLC54 (hyphal mutant, HM) for 48 h in various conditions, including the presence or absence of SB discs, and human serum. The growth of planktonic and biofilm cells of both strains was monitored at three time points by a tetrazolium salt reduction assay and by scanning electron microscopy. We also analyzed by RT-PCR its expression of the virulence-related genes ALS3, HWP1, EAP1, ECE1, SAP1 - SAP10, PLB1, PLB2, PLC and PLD. Results At each time point, planktonic cells of WT strain cultured in yeast nitrogen base displayed a much higher expression of EAP1 and HWP1, and a moderately higher ALS3 expression, than HM cells. In planktonic cells, expression of the ten SAP genes was higher in the WT strain initially, but were highly expressed in the HM strain by 48 h. Biofilm growth of both strains on SB was promoted in the presence of human serum than in its absence. Significant upregulation of ALS3, HWP1, EAP1, ECE1, SAP1, SAP4, SAP6 - SAP10, PLB1, PLB2 and PLC was observed for WT biofilms grown on serum-treated SB discs for at least one time point, compared with biofilms on serum-free SB discs. Conclusions Human serum stimulates C. albicans biofilm growth on SB discs and upregulates the expression of virulence genes, particularly adhesion genes ALS3 and HWP1, and hydrolase-encoding genes SAP, PLB1 and PLB2. This response is likely to promote the colonization of this versatile pathogen within the human host. PMID:23704884

  10. EhADH112 Is a Bro1 Domain-Containing Protein Involved in the Entamoeba histolytica Multivesicular Bodies Pathway

    PubMed Central

    Bañuelos, Cecilia; García-Rivera, Guillermina; López-Reyes, Israel; Mendoza, Leobardo; González-Robles, Arturo; Herranz, Silvia; Vincent, Olivier; Orozco, Esther

    2012-01-01

    EhADH112 is an Entamoeba histolytica Bro1 domain-containing protein, structurally related to mammalian ALIX and yeast BRO1, both involved in the Endosomal Sorting Complexes Required for Transport (ESCRT)-mediated multivesicular bodies (MVB) biogenesis. Here, we investigated an alternative role for EhADH112 in the MVB protein trafficking pathway by overexpressing 166 amino acids of its N-terminal Bro1 domain in trophozoites. Trophozoites displayed diminished phagocytosis rates and accumulated exogenous Bro1 at cytoplasmic vesicles which aggregated into aberrant complexes at late stages of phagocytosis, probably preventing EhADH112 function. Additionally, the existence of a putative E. histolytica ESCRT-III subunit (EhVps32) presumably interacting with EhADH112, led us to perform pull-down experiments with GST-EhVps32 and [35S]-labeled EhADH112 or EhADH112 derivatives, confirming EhVps32 binding to EhADH112 through its Bro1 domain. Our overall results define EhADH112 as a novel member of ESCRT-accessory proteins transiently present at cellular surface and endosomal compartments, probably contributing to MVB formation during phagocytosis. PMID:22500103

  11. COX-2 gene expression in colon cancer tissue related to regulating factors and promoter methylation status

    PubMed Central

    2011-01-01

    Background Increased cyclooxygenase activity promotes progression of colorectal cancer, but the mechanisms behind COX-2 induction remain elusive. This study was therefore aimed to define external cell signaling and transcription factors relating to high COX-2 expression in colon cancer tissue. Method Tumor and normal colon tissue were collected at primary curative operation in 48 unselected patients. COX-2 expression in tumor and normal colon tissue was quantified including microarray analyses on tumor mRNA accounting for high and low tumor COX-2 expression. Cross hybridization was performed between tumor and normal colon tissue. Methylation status of up-stream COX-2 promoter region was evaluated. Results Tumors with high COX-2 expression displayed large differences in gene expression compared to normal colon. Numerous genes with altered expression appeared in tumors of high COX-2 expression compared to tumors of low COX-2. COX-2 expression in normal colon was increased in patients with tumors of high COX-2 compared to normal colon from patients with tumors of low COX-2. IL1β, IL6 and iNOS transcripts were up-regulated among external cell signaling factors; nine transcription factors (ATF3, C/EBP, c-Fos, Fos-B, JDP2, JunB, c-Maf, NF-κB, TCF4) showed increased expression and 5 (AP-2, CBP, Elk-1, p53, PEA3) were decreased in tumors with high COX-2. The promoter region of COX-2 gene did not show consistent methylation in tumor or normal colon tissue. Conclusions Transcription and external cell signaling factors are altered as covariates to COX-2 expression in colon cancer tissue, but DNA methylation of the COX-2 promoter region was not a significant factor behind COX-2 expression in tumor and normal colon tissue. PMID:21668942

  12. Association of a Human FABP1 Gene Promoter Region Polymorphism with Altered Serum Triglyceride Levels

    PubMed Central

    Zhu, Yi-bing; Huang, Rong-dong; Lu, Qing-Qing; Lin, Xu

    2015-01-01

    Liver fatty acid-binding protein (L-FABP), also known as fatty acid-binding protein 1 (FABP1), is a key regulator of hepatic lipid metabolism. Elevated FABP1 levels are associated with an increased risk of cardiovascular disease (CVD) and metabolic syndromes. In this study, we examine the association of FABP1 gene promoter variants with serum FABP1 and lipid levels in a Chinese population. Four promoter single-nucleotide polymorphisms (SNPs) of FABP1 gene were genotyped in a cross-sectional survey of healthy volunteers (n = 1,182) from Fuzhou city of China. Results showed that only the rs2919872 G>A variant was significantly associated with serum TG concentration(P = 0.032).Compared with the rs2919872 G allele, rs2919872 A allele contributed significantly to reduced serum TG concentration, and this allele dramatically decreased the FABP1 promoter activity(P < 0.05). The rs2919872 A allele carriers had considerably lower serum FABP1 levels than G allele carriers (P < 0.01). In the multivariable linear regression analysis, the rs2919872 A allele was negatively associated with serum FABP1 levels (β = —0.320, P = 0.003), while serum TG levels were positively associated with serum FABP1 levels (β = 0.487, P = 0.014). Our data suggest that compared with the rs2919872 G allele, the rs2919872 A allele reduces the transcriptional activity of FABP1 promoter, and thereby may link FABP1 gene variation to TG level in humans. PMID:26439934

  13. Association of a Human FABP1 Gene Promoter Region Polymorphism with Altered Serum Triglyceride Levels.

    PubMed

    Peng, Xian-E; Wu, Yun-Li; Zhu, Yi-Bing; Huang, Rong-Dong; Lu, Qing-Qing; Lin, Xu

    2015-01-01

    Liver fatty acid-binding protein (L-FABP), also known as fatty acid-binding protein 1 (FABP1), is a key regulator of hepatic lipid metabolism. Elevated FABP1 levels are associated with an increased risk of cardiovascular disease (CVD) and metabolic syndromes. In this study, we examine the association of FABP1 gene promoter variants with serum FABP1 and lipid levels in a Chinese population. Four promoter single-nucleotide polymorphisms (SNPs) of FABP1 gene were genotyped in a cross-sectional survey of healthy volunteers (n = 1,182) from Fuzhou city of China. Results showed that only the rs2919872 G>A variant was significantly associated with serum TG concentration(P = 0.032).Compared with the rs2919872 G allele, rs2919872 A allele contributed significantly to reduced serum TG concentration, and this allele dramatically decreased the FABP1 promoter activity(P < 0.05). The rs2919872 A allele carriers had considerably lower serum FABP1 levels than G allele carriers (P < 0.01). In the multivariable linear regression analysis, the rs2919872 A allele was negatively associated with serum FABP1 levels (β = -0.320, P = 0.003), while serum TG levels were positively associated with serum FABP1 levels (β = 0.487, P = 0.014). Our data suggest that compared with the rs2919872 G allele, the rs2919872 A allele reduces the transcriptional activity of FABP1 promoter, and thereby may link FABP1 gene variation to TG level in humans. PMID:26439934

  14. Comparisons of Ribosomal Protein Gene Promoters Indicate Superiority of Heterologous Regulatory Sequences for Expressing Transgenes in Phytophthora infestans

    PubMed Central

    Khachatoorian, Careen; Judelson, Howard S.

    2015-01-01

    Molecular genetics approaches in Phytophthora research can be hampered by the limited number of known constitutive promoters for expressing transgenes and the instability of transgene activity. We have therefore characterized genes encoding the cytoplasmic ribosomal proteins of Phytophthora and studied their suitability for expressing transgenes in P. infestans. Phytophthora spp. encode a standard complement of 79 cytoplasmic ribosomal proteins. Several genes are duplicated, and two appear to be pseudogenes. Half of the genes are expressed at similar levels during all stages of asexual development, and we discovered that the majority share a novel promoter motif named the PhRiboBox. This sequence is enriched in genes associated with transcription, translation, and DNA replication, including tRNA and rRNA biogenesis. Promoters from the three P. infestans genes encoding ribosomal proteins S9, L10, and L23 and their orthologs from P. capsici were tested for their ability to drive transgenes in stable transformants of P. infestans. Five of the six promoters yielded strong expression of a GUS reporter, but the stability of expression was higher using the P. capsici promoters. With the RPS9 and RPL10 promoters of P. infestans, about half of transformants stopped making GUS over two years of culture, while their P. capsici orthologs conferred stable expression. Since cross-talk between native and transgene loci may trigger gene silencing, we encourage the use of heterologous promoters in transformation studies. PMID:26716454

  15. Genetic and Functional Sequence Variants of the SIRT3 Gene Promoter in Myocardial Infarction

    PubMed Central

    Yin, Xiaoyun; Pang, Shuchao; Huang, Jian; Cui, Yinghua; Yan, Bo

    2016-01-01

    Coronary artery disease (CAD), including myocardial infarction (MI), is a common complex disease that is caused by atherosclerosis. Although a large number of genetic variants have been associated with CAD, only 10% of CAD cases could be explained. It has been proposed that low frequent and rare genetic variants may be main causes for CAD. SIRT3, a mitochondrial deacetylase, plays important roles in mitochondrial function and metabolism. Lack of SIRT3 in experimental animal leads to several age-related diseases, including cardiovascular diseases. Therefore, SIRT3 gene variants may contribute to the MI development. In this study, SIRT3 gene promoter was genetically and functionally analyzed in large cohorts of MI patients (n = 319) and ethnic-matched controls (n = 322). Total twenty-three DNA sequence variants (DSVs) were identified, including 10 single-nucleotide polymorphisms (SNPs). Six novel heterozygous DSVs, g.237307A>G, g.237270G>A, g.237023_25del, g.236653C>A, g.236628G>C, g.236557T>C, and two SNPs g.237030C>T (rs12293349) and g.237022C>G (rs369344513), were identified in nine MI patients, but in none of controls. Three SNPs, g.236473C>T (rs11246029), g.236380_81ins (rs71019893) and g.236370C>G (rs185277566), were more significantly frequent in MI patients than controls (P<0.05). These DSVs and SNPs, except g.236557T>C, significantly decreased the transcriptional activity of the SIRT3 gene promoter in cultured HEK-293 cells and H9c2 cells. Therefore, these DSVs identified in MI patients may change SIRT3 level by affecting the transcriptional activity of SIRT3 gene promoter, contributing to the MI development as a risk factor. PMID:27078640

  16. P07.04PROMOTER METHYLATION OF THE LATS1 AND LATS2 GENES IN SCHWANNOMAS

    PubMed Central

    Ohta, T.; Oh, J.; Mittelbronn, M.; Paulus, W.; Ohgaki, H.

    2014-01-01

    Schwannoma is a benign nerve sheath tumor that is typically encapsulated and composed of well-differentiated Schwann cellswhich comprises 5-10% of all intracranial tumors in adults. Approximately 90% of schwannomas are solitary and sporadic, whereas ∼4% are considered to arise in the setting of neurofibromatosis type 2 (NF2) syndrome by NF2 germline mutations. The molecular basis of sporadic schwannomas is not fully understood, other than frequent NF2 mutations (∼60%). LATS1 and the related LATS2 are downstream molecules of NF2 and negative regulators of the YAP oncogene in the Salvador/Warts/Hippo (SWH) signaling pathway. Expression of these genes is reduced due to promoter methylation in a variety of neoplasms including gliomas. In the present study, methylation-specific PCR revealed promoter methylation of the LATS1 and LATS2 in 15 of 91 (16%) and 32 of 91 (35%) schwannomas, respectively. These alterations were significantly more frequent in spinal than in peripheral schwannomas (23% vs 3% for LATS1, P = 0.0171; 42% vs 21% for LATS2, P = 0.0386). LATS1 methylation was also detected in 3 of 4 schwannomatosis cases. Furthermore, neurofibroma / schwannoma hybrid tumors showed promoter methylation in LATS1 (3/14; 21%) and LATS2 (8/14; 57%). LATS1 and LATS2 promoter methylation were largely mutually exclusive, and there was a significant negative correlation (P = 0.003); only 10 cases had methylation in both genes. These results suggest that LATS1 and LATS2 promoter methylation may be additional molecular mechanisms resulting in an abnormal SWH pathway in schwannomas and related tumors.

  17. Functional characterization of the Ginkgo biloba chalcone synthase gene promoter in transgenic tobacco.

    PubMed

    Li, L L; Cheng, H; Yuan, H H; Xu, F; Cheng, S Y; Cao, F L

    2014-01-01

    The regulative sequence (2273 bp) of the chalcone synthase gene promoter of biloba was cloned by genomic walking. A 2273-bp promoter 5' upstream translation start site of GbCHS was cloned and designated as GbCHSP. pBI121+CHSP:GUS and pBI121-35S:GUS were constructed and transformed into tobacco by LBA4404. We found that GbCHSP could drive transient expression of GUS in tobacco and differentially expressed in root, stem and leaf tissues of this plant. GUS activity regulated by the CHSP promoter were located in tissues (apical meristems) at the growing points of roots and stems. pBI121+CHSP:GUS could be induced by wounding, copper, UV-B, abscisic acid, and ethephon treatments of transgenic seedlings. This activity was weakly inhibited by gibberellin. Deletion analysis of the CHSP promoter in transgenic tobacco showed that CHSP1 complete promoter conferred a GUS expression and activity similar to that of 35 S(CaMV). GUS activity dropped dramatically when there were CHSP4, CHSP5 constructs and was almost totally absent when the CHSP6 construct was present. We conclude that the upstream sequence -1548 to -306 of GbCHSP is the main region for transcriptional regulation of the CHS gene and that it is activated by hormone and stress factors in G. biloba. These results will help us to understand the transcriptional regulatory mechanisms involved in GbCHS expression and flavonoid accumulation in G. biloba. PMID:24841790

  18. Gene promoter methylation in colorectal cancer and healthy adjacent mucosa specimens

    PubMed Central

    Coppedè, Fabio; Migheli, Francesca; Lopomo, Angela; Failli, Alessandra; Legitimo, Annalisa; Consolini, Rita; Fontanini, Gabriella; Sensi, Elisa; Servadio, Adele; Seccia, Massimo; Zocco, Giuseppe; Chiarugi, Massimo; Spisni, Roberto; Migliore, Lucia

    2014-01-01

    We evaluated the promoter methylation levels of the APC, MGMT, hMLH1, RASSF1A and CDKN2A genes in 107 colorectal cancer (CRC) samples and 80 healthy adjacent tissues. We searched for correlation with both physical and pathological features, polymorphisms of folate metabolism pathway genes (MTHFR, MTRR, MTR, RFC1, TYMS, and DNMT3B), and data on circulating folate, vitamin B12 and homocysteine, which were available in a subgroup of the CRC patients. An increased number of methylated samples were found in CRC respect to adjacent healthy tissues, with the exception of APC, which was also frequently methylated in healthy colonic mucosa. Statistically significant associations were found between RASSF1A promoter methylation and tumor stage, and between hMLH1 promoter methylation and tumor location. Increasing age positively correlated with both hMLH1 and MGMT methylation levels in CRC tissues, and with APC methylation levels in the adjacent healthy mucosa. Concerning gender, females showed higher hMLH1 promoter methylation levels with respect to males. In CRC samples, the MTR 2756AG genotype correlated with higher methylation levels of RASSF1A, and the TYMS 1494 6bp ins/del polymorphism correlated with the methylation levels of both APC and hMLH1. In adjacent healthy tissues, MTR 2756AG and TYMS 1494 6bp del/del genotypes correlated with APC and MGMT promoter methylation, respectively. Low folate levels were associated with hMLH1 hypermethylation. Present results support the hypothesis that DNA methylation in CRC depends from both physiological and environmental factors, with one-carbon metabolism largely involved in this process. PMID:24500500

  19. Application of Gene Expression Trajectories Initiated from ErbB Receptor Activation Highlights the Dynamics of Divergent Promoter Usage

    PubMed Central

    Carbajo, Daniel; Magi, Shigeyuki; Itoh, Masayoshi; Kawaji, Hideya; Lassmann, Timo; Arner, Erik; Forrest, Alistair R. R.; Carninci, Piero; Hayashizaki, Yoshihide; Daub, Carsten O.; Okada-Hatakeyama, Mariko; Mar, Jessica C.

    2015-01-01

    Understanding how cells use complex transcriptional programs to alter their fate in response to specific stimuli is an important question in biology. For the MCF-7 human breast cancer cell line, we applied gene expression trajectory models to identify the genes involved in driving cell fate transitions. We modified trajectory models to account for the scenario where cells were exposed to different stimuli, in this case epidermal growth factor and heregulin, to arrive at different cell fates, i.e. proliferation and differentiation respectively. Using genome-wide CAGE time series data collected from the FANTOM5 consortium, we identified the sets of promoters that were involved in the transition of MCF-7 cells to their specific fates versus those with expression changes that were generic to both stimuli. Of the 1,552 promoters identified, 1,091 had stimulus-specific expression while 461 promoters had generic expression profiles over the time course surveyed. Many of these stimulus-specific promoters mapped to key regulators of the ERK (extracellular signal-regulated kinases) signaling pathway such as FHL2 (four and a half LIM domains 2). We observed that in general, generic promoters peaked in their expression early on in the time course, while stimulus-specific promoters tended to show activation of their expression at a later stage. The genes that mapped to stimulus-specific promoters were enriched for pathways that control focal adhesion, p53 signaling and MAPK signaling while generic promoters were enriched for cell death, transcription and the cell cycle. We identified 162 genes that were controlled by an alternative promoter during the time course where a subset of 37 genes had separate promoters that were classified as stimulus-specific and generic. The results of our study highlighted the degree of complexity involved in regulating a cell fate transition where multiple promoters mapping to the same gene can demonstrate quite divergent expression profiles. PMID

  20. Cloning and functional analysis of human acyl coenzyme A: Cholesterol acyltransferase1 gene P1 promoter.

    PubMed

    Ge, Jing; Cheng, Bei; Qi, Benling; Peng, Wen; Wen, Hui; Bai, Lijuan; Liu, Yun; Zhai, Wei

    2016-07-01

    Acyl-coenzyme A: cholesterol acyltransferase 1 (ACAT1) catalyzes the conversion of free cholesterol (FC) to cholesterol ester. The human ACAT1 gene P1 promoter has been cloned. However, the activity and specificity of the ACAT1 gene P1 promoter in diverse cell types remains unclear. The P1 promoter fragment was digested with KpnI/XhoI from a P1 promoter cloning vector, and was subcloned into the multiple cloning site of the Firefly luciferase vector pGL3‑Enhancer to obtain the construct P1E‑1. According to the analysis of biological information, the P1E‑1 plasmid was used to generate deletions of the ACAT1 gene P1 promoter with varying 5' ends and an identical 3' end at +65 by polymerase chain reaction (PCR). All the 5'‑deletion constructs of the P1 promoter were identified by PCR, restriction enzyme digestion mapping and DNA sequencing. The transcriptional activity of each construct was detected after transient transfection into THP‑1, HepG2, HEK293 and Hela cells using DEAE‑dextran and Lipofectamine 2000 liposome transfection reagent. Results showed that the transcriptional activity of the ACAT1 gene P1 promoter and deletions of P1 promoter in THP‑1 and HepG2 cells was higher than that in HEK293 and HeLa cells. Moreover, the transcriptional activity of P1E‑9 was higher compared with those of other deletions in THP‑1, HepG2, HEK293 and HeLa cells. These findings indicate that the transcriptional activity of the P1 promoter and the effects of deletions vary with different cell lines. Thus, the P1 promoter may drive ACAT1 gene expression with cell‑type specificity. In addition, the core sequence of ACAT1 gene P1 promoter was suggested to be between -125 and +65 bp. PMID:27220725

  1. Integration of molecular biology tools for identifying promoters and genes abundantly expressed in flowers of Oncidium Gower Ramsey

    PubMed Central

    2011-01-01

    Background Orchids comprise one of the largest families of flowering plants and generate commercially important flowers. However, model plants, such as Arabidopsis thaliana do not contain all plant genes, and agronomic and horticulturally important genera and species must be individually studied. Results Several molecular biology tools were used to isolate flower-specific gene promoters from Oncidium 'Gower Ramsey' (Onc. GR). A cDNA library of reproductive tissues was used to construct a microarray in order to compare gene expression in flowers and leaves. Five genes were highly expressed in flower tissues, and the subcellular locations of the corresponding proteins were identified using lip transient transformation with fluorescent protein-fusion constructs. BAC clones of the 5 genes, together with 7 previously published flower- and reproductive growth-specific genes in Onc. GR, were identified for cloning of their promoter regions. Interestingly, 3 of the 5 novel flower-abundant genes were putative trypsin inhibitor (TI) genes (OnTI1, OnTI2 and OnTI3), which were tandemly duplicated in the same BAC clone. Their promoters were identified using transient GUS reporter gene transformation and stable A. thaliana transformation analyses. Conclusions By combining cDNA microarray, BAC library, and bombardment assay techniques, we successfully identified flower-directed orchid genes and promoters. PMID:21473751

  2. Molecular cloning and analysis of a receptor-like promoter of Gbvdr3 gene in sea island cotton.

    PubMed

    Zhang, B-J; Zhang, H-P; Chen, Q-Z; Tang, N; Wang, L-K; Wang, R-F; Zhang, B-L

    2016-01-01

    Verticillium wilt caused by soil borne fungus Verticillium dahliae could significantly reduce cotton yield. The Ve1 homologous gene Gbvdr3 is resistant to Verticillium wilt. In order to understand of the function of the promoter Gbvdr3 in Gossypium barbadense, the promoter region of the receptor-like gene Gbvdr3 was obtained by genome walking, and the cis-element in the promoter was identified using the PLACE software in this study. The sequence analysis showed that the promoter contained elements related to stress resistance and light regulation. The cloned promoter was fused to the GUS reporter gene and transformed into Arabidopsis. GUS expression was specifically detected in roots, flowers, and seeds, suggesting that the expression of Gbvdr3 is tissue-specific. Separation and characterization analysis of the promoter of Gbvdr3 provides a platform for further research and application of this gene. Thorough understanding of the function of the Gbvdr3 promoter is important for better understanding of Gbvdr3 function. These results indicated that the promoter of Gbvdr3 was a tissue-specific promoter. PMID:27323087

  3. Promoter activity and regulation of the corneal CYP4B1 gene by hypoxia.

    PubMed

    Mastyugin, Vladimir; Mezentsev, Alexandre; Zhang, Wen-Xiang; Ashkar, Silvia; Dunn, Michael W; Laniado-Schwartzman, Michal

    2004-04-15

    Hypoxic injury to the ocular surface provokes an inflammatory response that is mediated, in part, by corneal epithelial-derived 12-hydroxyeicosanoids. Recent studies indicate that a cytochrome P450 (CYP) monooxygenase, identified as CYP4B1, is involved in the production of these eicosanoids which exhibit potent inflammatory and angiogenic properties. We have isolated and cloned a corneal epithelial CYP4B1 full-length cDNA and demonstrated that the CYP4B1 mRNA is induced by hypoxia in vitro and in vivo. To further understand the molecular regulation that underlies the synthesis of these potent inflammatory eicosanoids in response to hypoxic injury, we isolated and cloned the CYP4B1 promoter region. GenomeWalker libraries constructed from rabbit corneal epithelial genomic DNA were used as templates for primary and nested PCR amplifications with gene- and adaptor-specific primers. A 3.41-kb DNA fragment of the 5'-flanking region of the CYP4B1 promoter was isolated, cloned, sequenced, and analyzed by computer software for the presence of known cis-acting elements. Analysis of the promoter sequence revealed the presence of consensus DNA binding sequences for factors known to activate gene transcription in response to hypoxia including HIF-1, NFkappaB, and AP-1. Transient transfection of luciferase reporter (pGL3-Basic) vectors containing different lengths of the CYP4B1 promoter fragment demonstrated hypoxia-induced transcription in rabbit corneal epithelial (RCE) cells. Electrophoretic mobility shift assay (EMSA) revealed a marked induction of nuclear binding activity for the labeled HIF-1 probe from the CYP4B1 promoter in nuclear extracts of cells exposed to hypoxia. This binding activity was due to sequence-specific binding to the HIF-1 oligonucleotide probe as shown by competition with excess unlabeled probe for the HIF-1 but not with unlabeled NFkappaB probe. The nuclear binding activity of AP-1 and NFkappaB probes from the CYP4B1 promoter was also enhanced in

  4. ADAM33 gene silencing by promoter hypermethylation as a molecular marker in breast invasive lobular carcinoma

    PubMed Central

    2009-01-01

    Background ADAM33 protein is a member of the family of transmembrane glycoproteins composed of multidomains. ADAM family members have different activities, such as proteolysis and adhesion, making them good candidates to mediate the extracellular matrix remodelling and changes in cellular adhesion that characterise certain pathologies and cancer development. It was reported that one family member, ADAM23, is down-regulated by promoter hypermethylation. This seems to correlate with tumour progression and metastasis in breast cancer. In this study, we explored the involvement of ADAM33, another ADAM family member, in breast cancer. Methods First, we analysed ADAM33 expression in breast tumour cell lines by RT-PCR and western blotting. We also used 5-aza-2'-deoxycytidine (5azadCR) treatment and DNA bisulphite sequencing to study the promoter methylation of ADAM33 in breast tumour cell lines. We evaluated ADAM33 methylation in primary tumour samples by methylation specific PCR (MSP). Finally, ADAM33 promoter hypermethylation was correlated with clinicopathological data using the chi-square test and Fisher's exact test. Results The expression analysis of ADAM33 in breast tumour cell lines by RT-PCR revealed gene silencing in 65% of tumour cell lines. The corresponding lack of ADAM33 protein was confirmed by western blotting. We also used 5-aza-2'-deoxycytidine (5-aza-dCR) demethylation and bisulphite sequencing methodologies to confirm that gene silencing is due to ADAM33 promoter hypermethylation. Using MSP, we detected ADAM33 promoter hypermethylation in 40% of primary breast tumour samples. The correlation between methylation pattern and patient's clinicopathological data was not significantly associated with histological grade; tumour stage (TNM); tumour size; ER, PR or ERBB2 status; lymph node status; metastasis or recurrence. Methylation frequency in invasive lobular carcinoma (ILC) was 76.2% compared with 25.5% in invasive ductal carcinoma (IDC), and this

  5. How mechanisms of habitat preference evolve and promote divergence with gene flow

    PubMed Central

    Berner, Daniel

    2015-01-01

    Habitat preference may promote adaptive divergence and speciation, yet the conditions under which this is likely are insufficiently explored. We use individual-based simulations to study the evolution and consequence of habitat preference during divergence with gene flow, considering four different underlying genetically-based behavioral mechanisms: natal habitat imprinting, phenotype-dependent, competition-dependent, and direct genetic habitat preference. We find that the evolution of habitat preference generally requires initially high dispersal, is facilitated by asymmetry in population sizes between habitats, and is hindered by an increasing number of underlying genetic loci. Moreover, the probability of habitat preference to emerge and promote divergence differs greatly among the underlying mechanisms. Natal habitat imprinting evolves most easily and can allow full divergence in parameter ranges where no divergence is possible in the absence of habitat preference. The reason is that imprinting represents a one-allele mechanism of assortative mating linking dispersal behavior very effectively to local selection. At the other extreme, direct genetic habitat preference, a two-allele mechanism, evolves under restricted conditions only, and even then facilitates divergence weakly. Overall, our results indicate that habitat preference can be a strong reproductive barrier promoting divergence with gene flow, but that this is highly contingent on the underlying preference mechanism. PMID:26119841

  6. Transgenic Studies with a Keratin Promoter-Driven Growth Hormone Transgene: Prospects for Gene Therapy

    NASA Astrophysics Data System (ADS)

    Wang, Xiaoming; Zinkel, Sandra; Polonsky, Kenneth; Fuchs, Elaine

    1997-01-01

    Keratinocytes are potentially appealing vehicles for the delivery of secreted gene products because they can be transferred to human skin by the relatively simple procedure of grafting. Adult human keratinocytes can be efficiently propagated in culture with sufficient proliferative capacity to produce enough epidermis to cover the body surface of an average adult. However, the feasibility of delivering secreted proteins through skin grafting rests upon (i) the strength of the promoter in keratinocytes and (ii) the efficiency of protein transport through the basement membrane of the stratified epithelium and into the bloodstream. In this paper, we use transgenic technology to demonstrate that the activity of the human keratin 14 promoter remains high in adult skin and that keratinocyte-derived human growth hormone (hGH) can be produced, secreted, and transported to the bloodstream of mice with efficiency that is sufficient to exceed by an order of magnitude the circulating hGH concentration in growing children. Transgenic skin grafts from these adults continue to produce and secrete hGH stably, at ≈ 1/10 physiological levels in the bloodstream of nontransgenic recipient mice. These studies underscore the utility of the keratin 14 promoter for expressing foreign transgenes in keratinocytes and demonstrate that keratinocytes can be used as effective vehicles for transporting factors to the bloodstream and for eliciting metabolic changes. These findings have important implications for considering the keratinocyte as a possible vehicle for gene therapy.

  7. Genomic structure, gene expression, and promoter analysis of human multidrug resistance-associated protein 7

    SciTech Connect

    Kao, Hsin-Hsin; Chang, Ming-Shi; Cheng, Jan-Fang; Huang, Jin-Ding

    2002-03-15

    The multidrug resistance-associated protein (MRP) subfamily transporters associated with anticancer drug efflux are attributed to the multidrug-resistance of cancer cells. The genomic organization of human multidrug resistance-associated protein 7 (MRP7) was identified. The human MRP7 gene, consisting of 22 exons and 21 introns, greatly differs from other members of the human MRP subfamily. A splicing variant of human MRP7, MRP7A, expressed in most human tissues, was also characterized. The 1.93-kb promoter region of MRP7 was isolated and shown to support luciferase activity at a level 4- to 5-fold greater than that of the SV40 promoter. Basal MRP7 gene expression was regulated by 2 regions in the 5-flanking region at 1,780 1,287 bp, and at 611 to 208 bp. In Madin-Darby canine kidney (MDCK) cells, MRP7 promoter activity was increased by 226 percent by genotoxic 2-acetylaminofluorene and 347 percent by the histone deacetylase inhibitor, trichostatin A. The protein was expressed in the membrane fraction of transfected MDCK cells.

  8. Isolation and Analysis of the Cppsy Gene and Promoter from Chlorella protothecoides CS-41

    PubMed Central

    Li, Meiya; Cui, Yan; Gan, Zhibing; Shi, Chunlei; Shi, Xianming

    2015-01-01

    Phytoene synthase (PSY) catalyzes the condensation of two molecules of geranylgeranyl pyrophosphate to form phytoene, the first colorless carotene in the carotenoid biosynthesis pathway. So it is regarded as the crucial enzyme for carotenoid production, and has unsurprisingly been involved in genetic engineering studies of carotenoid production. In this study, the psy gene from Chlorella protothecoides CS-41, designated Cppsy, was cloned using rapid amplification of cDNA ends. The full-length DNA was 2488 bp, and the corresponding cDNA was 1143 bp, which encoded 380 amino acids. Computational analysis suggested that this protein belongs to the Isoprenoid_Biosyn_C1 superfamily. It contained the consensus sequence, including three predicted substrate-Mg2+ binding sites. The Cppsy gene promoter was also cloned and characterized. Analysis revealed several candidate motifs for the promoter, which exhibited light- and methyl jasmonate (MeJA)-responsive characteristics, as well as some typical domains universally discovered in promoter sequences, such as the TATA-box and CAAT-box. Light- and MeJA treatment showed that the Cppsy expression level was significantly enhanced by light and MeJA. These results provide a basis for genetically modifying the carotenoid biosynthesis pathway in C. protothecoides. PMID:26516871

  9. Isolation and Analysis of the Cppsy Gene and Promoter from Chlorella protothecoides CS-41.

    PubMed

    Li, Meiya; Cui, Yan; Gan, Zhibing; Shi, Chunlei; Shi, Xianming

    2015-11-01

    Phytoene synthase (PSY) catalyzes the condensation of two molecules of geranylgeranyl pyrophosphate to form phytoene, the first colorless carotene in the carotenoid biosynthesis pathway. So it is regarded as the crucial enzyme for carotenoid production, and has unsurprisingly been involved in genetic engineering studies of carotenoid production. In this study, the psy gene from Chlorella protothecoides CS-41, designated Cppsy, was cloned using rapid amplification of cDNA ends. The full-length DNA was 2488 bp, and the corresponding cDNA was 1143 bp, which encoded 380 amino acids. Computational analysis suggested that this protein belongs to the Isoprenoid_Biosyn_C1 superfamily. It contained the consensus sequence, including three predicted substrate-Mg(2+) binding sites. The Cppsy gene promoter was also cloned and characterized. Analysis revealed several candidate motifs for the promoter, which exhibited light- and methyl jasmonate (MeJA)-responsive characteristics, as well as some typical domains universally discovered in promoter sequences, such as the TATA-box and CAAT-box. Light- and MeJA treatment showed that the Cppsy expression level was significantly enhanced by light and MeJA. These results provide a basis for genetically modifying the carotenoid biosynthesis pathway in C. protothecoides. PMID:26516871

  10. GLUCOSE METABOLISM IN PIGS EXPRESSING HUMAN GENES UNDER AN INSULIN PROMOTER

    PubMed Central

    Wijkstrom, M.; Bottino, R.; Iwase, H.; Hara, H.; Ekser, B.; van der Windt, D.J.; Long, C.; Toledo, F.; Phelps, C.; Trucco, M.; Cooper, D.K.C.; Ayares, D.

    2014-01-01

    Background Xenotransplantation of porcine islets can reverse diabetes in nonhuman primates. The remaining hurdles for clinical application include safe and effective T-cell directed immunosuppression, but protection against the innate immune system and coagulation dysfunction may be more difficult to achieve. Islet-targeted genetic manipulation of islet-source pigs represents a powerful tool to protect against graft loss. However, whether these genetic alterations would impair islet function is unknown. Methods On a background of α1,3-galactosyltransferase gene-knockout (GTKO)/human (h) CD46, additional genes (hCD39, human tissue factor pathway inhibitor, porcine CTLA4-Ig) were inserted in different combinations under an insulin promoter to promote expression in islets (confirmed by immunofluorescence). Seven pigs were tested for baseline and glucose/arginine-challenged levels of glucose, insulin, C-peptide, and glucagon. Results This preliminary study did not show definite evidence of β-cell deficiencies, even when 3 transgenes were expressed under the insulin promoter. Of 7 animals, all were normoglycemic at fasting, and 5 of 7 had normal glucose disposal rates after challenge. All animals exhibited insulin, C-peptide, and glucagon responses to both glucose and arginine challenge; however, significant interindividual variation was observed. Conclusions Multiple islet-targeted transgenic expression was not associated with an overtly detrimental effect on islet function, suggesting that complex genetic constructs designed for islet protection warrants further testing in islet xenotransplantation models. PMID:25382150

  11. Amplification of TGFβ Induced ITGB6 Gene Transcription May Promote Pulmonary Fibrosis

    PubMed Central

    Tatler, Amanda L.; Goodwin, Amanda T.; Gbolahan, Olumide; Saini, Gauri; Porte, Joanne; John, Alison E.; Clifford, Rachel L.; Violette, Shelia M.; Weinreb, Paul H.; Parfrey, Helen; Wolters, Paul J.; Gauldie, Jack; Kolb, Martin; Jenkins, Gisli

    2016-01-01

    Idiopathic pulmonary fibrosis (IPF) is a devastating, progressive disease with poor survival rates and limited treatment options. Upregulation of αvβ6 integrins within the alveolar epithelial cells is a characteristic feature of IPF and correlates with poor patient survival. The pro-fibrotic cytokine TGFβ1 can upregulate αvβ6 integrin expression but the molecular mechanisms driving this effect have not previously been elucidated. We confirm that stimulation with exogenous TGFβ1 increases expression of the integrin β6 subunit gene (ITGB6) and αvβ6 integrin cell surface expression in a time- and concentration-dependent manner. TGFβ1-induced ITGB6 expression occurs via transcriptional activation of the ITGB6 gene, but does not result from effects on ITGB6 mRNA stability. Basal expression of ITGB6 in, and αvβ6 integrins on, lung epithelial cells occurs via homeostatic αvβ6-mediated TGFβ1 activation in the absence of exogenous stimulation, and can be amplified by TGFβ1 activation. Fundamentally, we show for the first time that TGFβ1-induced ITGB6 expression occurs via canonical Smad signalling since dominant negative constructs directed against Smad3 and 4 inhibit ITGB6 transcriptional activity. Furthermore, disruption of a Smad binding site at -798 in the ITGB6 promoter abolishes TGFβ1-induced ITGB6 transcriptional activity. Using chromatin immunoprecipitation we demonstrate that TGFβ1 stimulation of lung epithelial cells results in direct binding of Smad3, and Smad4, to the ITGB6 gene promoter within this region. Finally, using an adenoviral TGFβ1 over-expression model of pulmonary fibrosis we demonstrate that Smad3 is crucial for TGFβ1-induced αvβ6 integrin expression within the alveolar epithelium in vivo. Together, these data confirm that a homeostatic, autocrine loop of αvβ6 integrin activated TGFβ1-induced ITGB6 gene expression regulates epithelial basal αvβ6 integrin expression, and demonstrates that this occurs via Smad

  12. Ubiquitously expressed genes participate in cell-specific functions via alternative promoter usage.

    PubMed

    Feng, Guihai; Tong, Man; Xia, Baolong; Luo, Guan-Zheng; Wang, Meng; Xie, Dongfang; Wan, Haifeng; Zhang, Ying; Zhou, Qi; Wang, Xiu-Jie

    2016-09-01

    How do different cell types acquire their specific identities and functions is a fundamental question of biology. Previously significant efforts have been devoted to search for cell-type-specifically expressed genes, especially transcription factors, yet how do ubiquitously expressed genes participate in the formation or maintenance of cell-type-specific features remains largely unknown. Here, we have identified 110 mouse embryonic stem cell (mESC) specifically expressed transcripts with cell-stage-specific alternative transcription start sites (SATS isoforms) from 104 ubiquitously expressed genes, majority of which have active epigenetic modification- or stem cell-related functions. These SATS isoforms are specifically expressed in mESCs, and tend to be transcriptionally regulated by key pluripotency factors through direct promoter binding. Knocking down the SATS isoforms of Nmnat2 or Usp7 leads to differentiation-related phenotype in mESCs. These results demonstrate that cell-type-specific transcription factors are capable to produce cell-type-specific transcripts with alternative transcription start sites from ubiquitously expressed genes, which confer ubiquitously expressed genes novel functions involved in the establishment or maintenance of cell-type-specific features. PMID:27466324

  13. Promoter CpG methylation of multiple genes in pituitary adenomas: frequent involvement of caspase-8.

    PubMed

    Bello, M Josefa; De Campos, Jose M; Isla, Alberto; Casartelli, Cacilda; Rey, Juan A

    2006-02-01

    The epigenetic changes in pituitary adenomas were identified by evaluating the methylation status of nine genes (RB1, p14(ARF), p16(INK4a), p73, TIMP-3, MGMT, DAPK, THBS1 and caspase-8) in a series of 35 tumours using methylation-specific PCR analysis plus sequencing. The series included non-functional adenomas (n=23), prolactinomas (n=6), prolactinoma plus thyroid-stimulating hormone adenoma (n=1), growth hormone adenomas (n=4), and adrenocorticotropic adenoma (n=1). All of the tumours had methylation of at least one of these genes and 40% of samples (14 of 35) displayed concurrent methylation of at least three genes. The frequencies of aberrant methylation were: 20% for RB1, 17% for p14(ARF), 34% for p16(INK4a), 29% for p73, 11% for TIMP-3, 23% for MGMT, 6% for DAPK, 43% for THBS1 and 54% for caspase-8. No aberrant methylation was observed in two non-malignant pituitary samples from healthy controls. Although some differences in the frequency of gene methylation between functional and non-functional adenomas were detected, these differences did not reach statistical significance. Our results suggest that promoter methylation is a frequent event in pituitary adenoma tumourigenesis, a process in which inactivation of apoptosis-related genes (DAPK, caspase-8) might play a key role. PMID:16391867

  14. Cooperative demethylation by JMJD2C and LSD1 promotes androgen receptor-dependent gene expression.

    PubMed

    Wissmann, Melanie; Yin, Na; Müller, Judith M; Greschik, Holger; Fodor, Barna D; Jenuwein, Thomas; Vogler, Christine; Schneider, Robert; Günther, Thomas; Buettner, Reinhard; Metzger, Eric; Schüle, Roland

    2007-03-01

    Posttranslational modifications of histones, such as methylation, regulate chromatin structure and gene expression. Recently, lysine-specific demethylase 1 (LSD1), the first histone demethylase, was identified. LSD1 interacts with the androgen receptor and promotes androgen-dependent transcription of target genes by ligand-induced demethylation of mono- and dimethylated histone H3 at Lys 9 (H3K9) only. Here, we identify the Jumonji C (JMJC) domain-containing protein JMJD2C as the first histone tridemethylase regulating androgen receptor function. JMJD2C interacts with androgen receptor in vitro and in vivo. Assembly of ligand-bound androgen receptor and JMJD2C on androgen receptor-target genes results in demethylation of trimethyl H3K9 and in stimulation of androgen receptor-dependent transcription. Conversely, knockdown of JMJD2C inhibits androgen-induced removal of trimethyl H3K9, transcriptional activation and tumour cell proliferation. Importantly, JMJD2C colocalizes with androgen receptor and LSD1 in normal prostate and in prostate carcinomas. JMJD2C and LSD1 interact and both demethylases cooperatively stimulate androgen receptor-dependent gene transcription. In addition, androgen receptor, JMJD2C and LSD1 assemble on chromatin to remove methyl groups from mono, di and trimethylated H3K9. Thus, our data suggest that specific gene regulation requires the assembly and coordinate action of demethylases with distinct substrate specificities. PMID:17277772

  15. Identification of a p53-response element in the promoter of the proline oxidase gene

    SciTech Connect

    Maxwell, Steve A. Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.

  16. Structural and functional analysis of the mouse mdr1b gene promoter.

    PubMed

    Cohen, D; Piekarz, R L; Hsu, S I; DePinho, R A; Carrasco, N; Horwitz, S B

    1991-02-01

    The overproduction of P-glycoprotein, an integral membrane protein thought to function as a drug efflux pump, is the hallmark of the multidrug resistance phenotype. In murine multidrug resistant J774.2 cell lines, distinct mdr genes, mdr1a and mdr1b, encode unique P-glycoprotein isoforms. To examine the transcriptional regulation of the mdr1b gene, its promoter was isolated and characterized. The transcription initiation site was mapped by primer extension, and the 5'-flanking region was sequenced. Several potential regulatory elements were identified in this region. A transient expression vector was constructed by fusion of 540 base pairs of 5'-flanking sequence and part of the first untranslated exon to the chloramphenicol acetyltransferase (CAT) gene. When transfected into monkey kidney COS-1, rat pituitary GH3 or T47D human breast cells, the mdr1b 5'-flanking sequences were capable of driving CAT expression. Transient transfection studies using deletion subclones of the mdr1b-CAT construct were done to locate potential cis-acting sequences. The studies indicate the presence of cis-acting elements in the 5'-flanking region of the mdr1b gene. The implications of these findings for expression and regulation of the mdr1b gene are discussed. PMID:1671222

  17. Transcriptional Factor DLX3 Promotes the Gene Expression of Enamel Matrix Proteins during Amelogenesis

    PubMed Central

    Zhang, Zhichun; Tian, Hua; Lv, Ping; Wang, Weiping; Jia, Zhuqing; Wang, Sainan; Zhou, Chunyan; Gao, Xuejun

    2015-01-01

    Mutation of distal-less homeobox 3 (DLX3) is responsible for human tricho-dento-osseous syndrome (TDO) with amelogenesis imperfecta, indicating a crucial role of DLX3 in amelogenesis. However, the expression pattern of DLX3 and its specific function in amelogenesis remain largely unknown. The aim of this study was to investigate the effects of DLX3 on enamel matrix protein (EMP) genes. By immunohistochemistry assays of mouse tooth germs, stronger immunostaining of DLX3 protein was identified in ameloblasts in the secretory stage than in the pre-secretory and maturation stages, and the same pattern was found for Dlx3 mRNA using Realtime PCR. In a mouse ameloblast cell lineage, forced expression of DLX3 up-regulated the expression of the EMP genes Amelx, Enam, Klk4, and Odam, whereas knockdown of DLX3 down-regulated these four EMP genes. Further, bioinformatics, chromatin immunoprecipitation, and luciferase assays revealed that DLX3 transactivated Enam, Amelx, and Odam through direct binding to their enhancer regions. Particularly, over-expression of mutant-DLX3 (c.571_574delGGGG, responsible for TDO) inhibited the activation function of DLX3 on expression levels and promoter activities of the Enam, Amelx, and Odam genes. Together, our data show that DLX3 promotes the expression of the EMP genes Amelx, Enam, Klk4, and Odam in amelogenesis, while mutant-DLX3 disrupts this regulatory function, thus providing insights into the molecular mechanisms underlying the enamel defects of TDO disease. PMID:25815730

  18. Transcriptional factor DLX3 promotes the gene expression of enamel matrix proteins during amelogenesis.

    PubMed

    Zhang, Zhichun; Tian, Hua; Lv, Ping; Wang, Weiping; Jia, Zhuqing; Wang, Sainan; Zhou, Chunyan; Gao, Xuejun

    2015-01-01

    Mutation of distal-less homeobox 3 (DLX3) is responsible for human tricho-dento-osseous syndrome (TDO) with amelogenesis imperfecta, indicating a crucial role of DLX3 in amelogenesis. However, the expression pattern of DLX3 and its specific function in amelogenesis remain largely unknown. The aim of this study was to investigate the effects of DLX3 on enamel matrix protein (EMP) genes. By immunohistochemistry assays of mouse tooth germs, stronger immunostaining of DLX3 protein was identified in ameloblasts in the secretory stage than in the pre-secretory and maturation stages, and the same pattern was found for Dlx3 mRNA using Realtime PCR. In a mouse ameloblast cell lineage, forced expression of DLX3 up-regulated the expression of the EMP genes Amelx, Enam, Klk4, and Odam, whereas knockdown of DLX3 down-regulated these four EMP genes. Further, bioinformatics, chromatin immunoprecipitation, and luciferase assays revealed that DLX3 transactivated Enam, Amelx, and Odam through direct binding to their enhancer regions. Particularly, over-expression of mutant-DLX3 (c.571_574delGGGG, responsible for TDO) inhibited the activation function of DLX3 on expression levels and promoter activities of the Enam, Amelx, and Odam genes. Together, our data show that DLX3 promotes the expression of the EMP genes Amelx, Enam, Klk4, and Odam in amelogenesis, while mutant-DLX3 disrupts this regulatory function, thus providing insights into the molecular mechanisms underlying the enamel defects of TDO disease. PMID:25815730

  19. Monoallelic Loss of the Imprinted Gene Grb10 Promotes Tumor Formation in Irradiated Nf1+/- Mice

    PubMed Central

    Mroue, Rana; Huang, Brian; Braunstein, Steve; Firestone, Ari J.; Nakamura, Jean L.

    2015-01-01

    Imprinted genes are expressed from only one parental allele and heterozygous loss involving the expressed allele is sufficient to produce complete loss of protein expression. Genetic alterations are common in tumorigenesis but the role of imprinted genes in this process is not well understood. In earlier work we mutagenized mice heterozygous for the Neurofibromatosis I tumor suppressor gene (NF1) to model radiotherapy-associated second malignant neoplasms that arise in irradiated NF1 patients. Expression analysis of tumor cell lines established from our mouse models identified Grb10 expression as widely absent. Grb10 is an imprinted gene and polymorphism analysis of cell lines and primary tumors demonstrates that the expressed allele is commonly lost in diverse Nf1 mutant tumors arising in our mouse models. We performed functional studies to test whether Grb10 restoration or loss alter fundamental features of the tumor growth. Restoring Grb10 in Nf1 mutant tumors decreases proliferation, decreases soft agar colony formation and downregulates Ras signaling. Conversely, Grb10 silencing in untransformed mouse embryo fibroblasts significantly increased cell proliferation and increased Ras-GTP levels. Expression of a constitutively activated MEK rescued tumor cells from Grb10-mediated reduction in colony formation. These studies reveal that Grb10 loss can occur during in vivo tumorigenesis, with a functional consequence in untransformed primary cells. In tumors, Grb10 loss independently promotes Ras pathway hyperactivation, which promotes hyperproliferation, an early feature of tumor development. In the context of a robust Nf1 mutant mouse model of cancer this work identifies a novel role for an imprinted gene in tumorigenesis. PMID:26000738

  20. Indirect Fitness Benefits Enable the Spread of Host Genes Promoting Costly Transfer of Beneficial Plasmids

    PubMed Central

    Dimitriu, Tatiana; Misevic, Dusan; Lotton, Chantal; Brown, Sam P.; Lindner, Ariel B.; Taddei, François

    2016-01-01

    Bacterial genes that confer crucial phenotypes, such as antibiotic resistance, can spread horizontally by residing on mobile genetic elements (MGEs). Although many mobile genes provide strong benefits to their hosts, the fitness consequences of the process of transfer itself are less clear. In previous studies, transfer has been interpreted as a parasitic trait of the MGEs because of its costs to the host but also as a trait benefiting host populations through the sharing of a common gene pool. Here, we show that costly donation is an altruistic act when it spreads beneficial MGEs favoured when it increases the inclusive fitness of donor ability alleles. We show mathematically that donor ability can be selected when relatedness at the locus modulating transfer is sufficiently high between donor and recipients, ensuring high frequency of transfer between cells sharing donor alleles. We further experimentally demonstrate that either population structure or discrimination in transfer can increase relatedness to a level selecting for chromosomal transfer alleles. Both mechanisms are likely to occur in natural environments. The simple process of strong dilution can create sufficient population structure to select for donor ability. Another mechanism observed in natural isolates, discrimination in transfer, can emerge through coselection of transfer and discrimination alleles. Our work shows that horizontal gene transfer in bacteria can be promoted by bacterial hosts themselves and not only by MGEs. In the longer term, the success of cells bearing beneficial MGEs combined with biased transfer leads to an association between high donor ability, discrimination, and mobile beneficial genes. However, in conditions that do not select for altruism, host bacteria promoting transfer are outcompeted by hosts with lower transfer rate, an aspect that could be relevant in the fight against the spread of antibiotic resistance. PMID:27270455

  1. Primary characterization and basal promoter activity of two hexamerin genes of Musca domestica.

    PubMed

    Moreira, C K; Capurro, M de L; Walter, M; Pavlova, E; Biessmann, H; James, A A; deBianchi, A G; Marinotti, O

    2004-01-01

    Hexamerins are high molecular-weight proteins found in the hemolymph of insects and have been proposed to function as storage proteins. In previous studies, two Musca domestica hexamerins, designated Hex-L and Hex-F were characterized. Hex-L is synthesized exclusively by the larval fat bodies, is secreted into the hemolymph and likely provides a source of amino acids and energy during metamorphosis. Hex-F synthesis is induced by a proteinaceous meal and occurs only in the adult insect fat bodies. Hex-F also is secreted into the hemolymph and it has been suggested that in females it may be an amino acid reservoir to be used during the final stages of egg formation. Genomic clones containing full-length copies of the genes MdHexL1 and MdHexF1, encoding subunits of the larval and the adult female hexamerin, respectively, were isolated. Complete nucleotide sequences, including the 5'-end untranscribed regions, were determined and analyzed for each of the genes. Comparisons of the conceptual translation products of the cloned genes indicated that MdHexL1 and MdHexF1 are related to the larval serum proteins (LSP) 1 and 2 of Calliphora vicina and Drosophila melanogaster. DNA fragments containing the putative promoters of the two hexamerin genes were compared and cloned into a plasmid vector so as to drive the expression of the GFP reporter gene. The constructs were assayed in vitro in transfected S2 Drosophila melanogaster cells demonstrating that the cloned M. domestica DNA fragments exhibit promoter activity. PMID:15861218

  2. cis-Acting sequences required for expression of the divergently transcribed Drosophila melanogaster Sgs-7 and Sgs-8 glue protein genes

    SciTech Connect

    Hofmann, A.; Garfinkel, M.D.; Meyerowitz, E.M. )

    1991-06-01

    The Sgs-7 and Sgs-8 glue genes at 68C are divergently transcribed and are separated by 475 bp. Fusion genes with Adh or lacZ coding sequences were constructed, and the expression of these genes, with different amounts of upstream sequences present, was tested by a transient expression procedure and by germ line transformation. A cis-acting element for both genes is located asymmetrically in the intergenic region between {minus}211 and {minus}43 bp relative to Sgs-7. It is required for correct expression of both genes. This element can confer the stage- and tissue-specific expression pattern of glue genes on a heterologous promoter. An 86-bp portion of the element, from {minus}133 to {minus}48 bp relative to Sgs-7, is shown to be capable of enhancing the expression of a truncated and therefore weakly expressed Sgs-3 fusion gene. Recently described common sequence motifs of glue gene regulatory elements.

  3. EP400 Deposits H3.3 into Promoters and Enhancers during Gene Activation.

    PubMed

    Pradhan, Suman K; Su, Trent; Yen, Linda; Jacquet, Karine; Huang, Chengyang; Côté, Jacques; Kurdistani, Siavash K; Carey, Michael F

    2016-01-01

    Gene activation in metazoans is accompanied by the presence of histone variants H2AZ and H3.3 within promoters and enhancers. It is not known, however, what protein deposits H3.3 into chromatin or whether variant chromatin plays a direct role in gene activation. Here we show that chromatin containing acetylated H2AZ and H3.3 stimulates transcription in vitro. Analysis of the Pol II pre-initiation complex on immobilized chromatin templates revealed that the E1A binding protein p400 (EP400) was bound preferentially to and required for transcription stimulation by acetylated double-variant chromatin. EP400 also stimulated H2AZ/H3.3 deposition into promoters and enhancers and influenced transcription in vivo at a step downstream of the Mediator complex. EP400 efficiently exchanged recombinant histones H2A and H3.1 with H2AZ and H3.3, respectively, in a chromatin- and ATP-stimulated manner in vitro. Our data reveal that EP400 deposits H3.3 into chromatin alongside H2AZ and contributes to gene regulation after PIC assembly. PMID:26669263

  4. Expression patterns and promoter activity of the cold-regulated gene ci21A of potato.

    PubMed Central

    Schneider, A; Salamini, F; Gebhardt, C

    1997-01-01

    Storage of potato (Solanum tuberosum) tubers at 4 degrees C is associated with the accumulation of several transcripts. DNA sequence analysis of cDNA clone CI21, which corresponds to one of the cold-induced transcripts, revealed high homology to transcripts of tomato (Lycopersicon esculentum) and wild potato (Solanum chacoense) induced by ripening and water stress. Two homologous, nonallelic genes, ci21A and ci21B, were isolated and sequenced. Northern blot analysis showed that CI21 transcripts were present at the highest levels in cold-stored tubers, at lower levels in stems and roots, and at the lowest levels in leaves and tubers stored at room temperature. Treatment with abscisic acid, heat, and a high concentration of salt had no marked effect on CI21 transcript levels in tubers and leaves. Drought was the only stress treatment that induced CI21 transcripts in leaves, but it did not do so in tubers. Western blot analysis detected CI21 protein only in tubers. Chimeric gene constructs between the putative ci21A promoter region and the uidA reporter gene were tested in transgenic potato plants for induction of beta-glucuronidase activity by low temperature. A 2-fold increase of beta-glucuronidase activity in response to tuber storage at 4 degrees C was observed for fragments between 380 and 2000 bp of the ci21A promoter region. PMID:9046587

  5. Bhlhe40 Represses PGC-1α Activity on Metabolic Gene Promoters in Myogenic Cells

    PubMed Central

    Chung, Shih Ying; Kao, Chien Han; Villarroya, Francesc; Chang, Hsin Yu; Chang, Hsuan Chia; Hsiao, Sheng Pin; Liou, Gunn-Guang

    2015-01-01

    PGC-1α is a transcriptional coactivator promoting oxidative metabolism in many tissues. Its expression in skeletal muscle (SKM) is induced by hypoxia and reactive oxidative species (ROS) generated during exercise, suggesting that PGC-1α might mediate the cross talk between oxidative metabolism and cellular responses to hypoxia and ROS. Here we found that PGC-1α directly interacted with Bhlhe40, a basic helix-loop-helix (bHLH) transcriptional repressor induced by hypoxia, and protects SKM from ROS damage, and they cooccupied PGC-1α-targeted gene promoters/enhancers, which in turn repressed PGC-1α transactivational activity. Bhlhe40 repressed PGC-1α activity through recruiting histone deacetylases (HDACs) and preventing the relief of PGC-1α intramolecular repression caused by its own intrinsic suppressor domain. Knockdown of Bhlhe40 mRNA increased levels of ROS, fatty acid oxidation, mitochondrial DNA, and expression of PGC-1α target genes. Similar effects were also observed when the Bhlhe40-mediated repression was rescued by a dominantly active form of the PGC-1α-interacting domain (PID) from Bhlhe40. We further found that Bhlhe40-mediated repression can be largely relieved by exercise, in which its recruitment to PGC-1α-targeted cis elements was significantly reduced. These observations suggest that Bhlhe40 is a novel regulator of PGC-1α activity repressing oxidative metabolism gene expression and mitochondrion biogenesis in sedentary SKM. PMID:25963661

  6. Genome-wide discovery of cis-elements in promoter sequences using gene expression.

    PubMed

    Troukhan, Maxim; Tatarinova, Tatiana; Bouck, John; Flavell, Richard B; Alexandrov, Nickolai N

    2009-04-01

    The availability of complete or nearly complete genome sequences, a large number of 5' expressed sequence tags, and significant public expression data allow for a more accurate identification of cis-elements regulating gene expression. We have implemented a global approach that takes advantage of available expression data, genomic sequences, and transcript information to predict cis-elements associated with specific expression patterns. The key components of our approach are: (1) precise identification of transcription start sites, (2) specific locations of cis-elements relative to the transcription start site, and (3) assessment of statistical significance for all sequence motifs. By applying our method to promoters of Arabidopsis thaliana and Mus musculus, we have identified motifs that affect gene expression under specific environmental conditions or in certain tissues. We also found that the presence of the TATA box is associated with increased variability of gene expression. Strong correlation between our results and experimentally determined motifs shows that the method is capable of predicting new functionally important cis-elements in promoter sequences. PMID:19231992

  7. Defining the cutoff value of MGMT gene promoter methylation and its predictive capacity in glioblastoma.

    PubMed

    Brigliadori, Giovanni; Foca, Flavia; Dall'Agata, Monia; Rengucci, Claudia; Melegari, Elisabetta; Cerasoli, Serenella; Amadori, Dino; Calistri, Daniele; Faedi, Marina

    2016-06-01

    Despite advances in the treatment of glioblastoma (GBM), median survival is 12-15 months. O6-methylguanine-DNA methyltransferase (MGMT) gene promoter methylation status is acknowledged as a predictive marker for temozolomide (TMZ) treatment. When MGMT promoter values fall into a "methylated" range, a better response to chemotherapy is expected. However, a cutoff that discriminates between "methylated" and "unmethylated" status has yet to be defined. We aimed to identify the best cutoff value and to find out whether variability in methylation profiles influences the predictive capacity of MGMT promoter methylation. Data from 105 GBM patients treated between 2008 and 2013 were analyzed. MGMT promoter methylation status was determined by analyzing 10 CpG islands by pyrosequencing. Patients were treated with radiotherapy followed by TMZ. MGMT promoter methylation status was classified into unmethylated 0-9 %, methylated 10-29 % and methylated 30-100 %. Statistical analysis showed that an assumed methylation cutoff of 9 % led to an overestimation of responders. All patients in the 10-29 % methylation group relapsed before the 18-month evaluation. Patients with a methylation status ≥30 % showed a median overall survival of 25.2 months compared to 15.2 months in all other patients, confirming this value as the best methylation cutoff. Despite wide variability among individual profiles, single CpG island analysis did not reveal any correlation between single CpG island methylation values and relapse or death. Specific CpG island methylation status did not influence the predictive value of MGMT. The predictive role of MGMT promoter methylation was maintained only with a cutoff value ≥30 %. PMID:27029617

  8. Effects of dietary intake and genetic factors on hypermethylation of the hMLH1 gene promoter in gastric cancer

    PubMed Central

    Nan, Hong-Mei; Song, Young-Jin; Yun, Hyo-Yung; Park, Joo-Seung; Kim, Heon

    2005-01-01

    AIM: Hypermethylation of the promoter of the hMLH1 gene, which plays an important role in mismatch repair during DNA replication, occurs in more than 30% of human gastric cancer tissues. The purpose of this study was to investigate the effects of environmental factors, genetic polymorphisms of major metabolic enzymes, and microsatellite instability on hypermethylation of the promoter of the hMLH1 gene in gastric cancer. METHODS: Data were obtained from a hospital-based, case-control study of gastric cancer. One hundred and ten gastric cancer patients and 220 age- and sex-matched control patients completed a structured questionnaire regarding their exposure to environmental risk factors. Hypermethylation of the hMLH1 gene promoter, polymorphisms of the GSTM1, GSTT1, CYP1A1, CYP2E1, ALDH2 and L-myc genes, microsatellite instability and mutations of p53 and Ki-ras genes were investigated. RESULTS: Both smoking and alcohol consumption were associated with a higher risk of gastric cancer with hypermethylation of the hMLH1 gene promoter. High intake of vegetables and low intake of potato were associated with increased likelihood of gastric cancer with hypermethylation of the hMLH1 gene promoter. Genetic polymorphisms of the GSTM1, GSTT1, CYP1A1, CYP2E1, ALDH2, and L-myc genes were not significantly associated with the risk of gastric cancer either with or without hypermethylation in the promoter of the hMLH1 gene. Hypermethylation of the hMLH1 promoter was significantly associated with microsatellite instability (MSI): 10 of the 14 (71.4%) MSI-positive tumors showed hypermethylation, whereas 28 of 94 (29.8%) the MSI-negative tumors were hypermethylated at the hMLH1 promoter region. Hypermethylation of the hMLH1 gene promoter was significantly inversely correlated with mutation of the p53 gene. CONCLUSION: These results suggest that cigarette smoking and alcohol consumption may influence the development of hMLH1-positive gastric cancer. Most dietary factors and

  9. Distinct promoter activation mechanisms modulate noise-driven HIV gene expression

    PubMed Central

    Chavali, Arvind K.; Wong, Victor C.; Miller-Jensen, Kathryn

    2015-01-01

    Latent human immunodeficiency virus (HIV) infections occur when the virus occupies a transcriptionally silent but reversible state, presenting a major obstacle to cure. There is experimental evidence that random fluctuations in gene expression, when coupled to the strong positive feedback encoded by the HIV genetic circuit, act as a ‘molecular switch’ controlling cell fate, i.e., viral replication versus latency. Here, we implemented a stochastic computational modeling approach to explore how different promoter activation mechanisms in the presence of positive feedback would affect noise-driven activation from latency. We modeled the HIV promoter as existing in one, two, or three states that are representative of increasingly complex mechanisms of promoter repression underlying latency. We demonstrate that two-state and three-state models are associated with greater variability in noisy activation behaviors, and we find that Fano factor (defined as variance over mean) proves to be a useful noise metric to compare variability across model structures and parameter values. Finally, we show how three-state promoter models can be used to qualitatively describe complex reactivation phenotypes in response to therapeutic perturbations that we observe experimentally. Ultimately, our analysis suggests that multi-state models more accurately reflect observed heterogeneous reactivation and may be better suited to evaluate how noise affects viral clearance. PMID:26666681

  10. Distinct promoter activation mechanisms modulate noise-driven HIV gene expression.

    PubMed

    Chavali, Arvind K; Wong, Victor C; Miller-Jensen, Kathryn

    2015-01-01

    Latent human immunodeficiency virus (HIV) infections occur when the virus occupies a transcriptionally silent but reversible state, presenting a major obstacle to cure. There is experimental evidence that random fluctuations in gene expression, when coupled to the strong positive feedback encoded by the HIV genetic circuit, act as a 'molecular switch' controlling cell fate, i.e., viral replication versus latency. Here, we implemented a stochastic computational modeling approach to explore how different promoter activation mechanisms in the presence of positive feedback would affect noise-driven activation from latency. We modeled the HIV promoter as existing in one, two, or three states that are representative of increasingly complex mechanisms of promoter repression underlying latency. We demonstrate that two-state and three-state models are associated with greater variability in noisy activation behaviors, and we find that Fano factor (defined as variance over mean) proves to be a useful noise metric to compare variability across model structures and parameter values. Finally, we show how three-state promoter models can be used to qualitatively describe complex reactivation phenotypes in response to therapeutic perturbations that we observe experimentally. Ultimately, our analysis suggests that multi-state models more accurately reflect observed heterogeneous reactivation and may be better suited to evaluate how noise affects viral clearance. PMID:26666681

  11. Distinct promoter activation mechanisms modulate noise-driven HIV gene expression

    NASA Astrophysics Data System (ADS)

    Chavali, Arvind K.; Wong, Victor C.; Miller-Jensen, Kathryn

    2015-12-01

    Latent human immunodeficiency virus (HIV) infections occur when the virus occupies a transcriptionally silent but reversible state, presenting a major obstacle to cure. There is experimental evidence that random fluctuations in gene expression, when coupled to the strong positive feedback encoded by the HIV genetic circuit, act as a ‘molecular switch’ controlling cell fate, i.e., viral replication versus latency. Here, we implemented a stochastic computational modeling approach to explore how different promoter activation mechanisms in the presence of positive feedback would affect noise-driven activation from latency. We modeled the HIV promoter as existing in one, two, or three states that are representative of increasingly complex mechanisms of promoter repression underlying latency. We demonstrate that two-state and three-state models are associated with greater variability in noisy activation behaviors, and we find that Fano factor (defined as variance over mean) proves to be a useful noise metric to compare variability across model structures and parameter values. Finally, we show how three-state promoter models can be used to qualitatively describe complex reactivation phenotypes in response to therapeutic perturbations that we observe experimentally. Ultimately, our analysis suggests that multi-state models more accurately reflect observed heterogeneous reactivation and may be better suited to evaluate how noise affects viral clearance.

  12. CypA, a Gene Downstream of HIF-1α, Promotes the Development of PDAC

    PubMed Central

    Gao, Chuntao; Wang, Xiuchao; Zhao, Tiansuo; Liu, Jingcheng; Gao, Song; Zhao, Xiao; Ren, He; Hao, Jihui

    2014-01-01

    Hypoxia-inducible factor-1α (HIF-1α) is a highly important transcription factor involved in cell metabolism. HIF-1α promotes glycolysis and inhibits of mitochondrial respiration in pancreatic ductal adenocarcinoma (PDAC). In response to tumor hypoxia, cyclophilin A (CypA) is over-expressed in various cancer types, and is associated with cell apoptosis, tumor invasion, metastasis, and chemoresistance in PDAC. In this study, we showed that both HIF-1α and CypA expression were significantly associated with lymph node metastasis and tumor stage. The expression of CypA was correlated with HIF-1α. Moreover, the mRNA and protein expression of CypA markedly decreased or increased following the suppression or over-expression of HIF-1α in vitro. Chromatin immunoprecipitation analysis showed that HIF-1α could directly bind to the hypoxia response element (HRE) in the CypA promoter regions and regulated CypA expression. Consistent with other studies, HIF-1α and CypA promoted PDAC cell proliferation and invasion, and suppressed apoptosis in vitro. Furthermore, we proved the combination effect of 2-methoxyestradiol and cyclosporin A both in vitro and in vivo. These results suggested that,CypA, a gene downstream of HIF-1α, could promote the development of PDAC. Thus, CypA might serve as a potential therapeutic target for PDAC. PMID:24662981

  13. Characterization of a putative cis-regulatory element that controls transcriptional activity of the pig uroplakin II gene promoter

    SciTech Connect

    Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi; Cho, Ssang-Goo; Park, Chankyu; Oh, Jae-Wook; Song, Hyuk; Kim, Jae-Hwan; Kim, Jin-Hoi

    2011-07-01

    Highlights: {yields} The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. {yields} The core promoter was located in the 5F-1. {yields} Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. {yields} These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, but little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.

  14. Characterization of the highly active fragment of glyceraldehyde-3-phosphate dehydrogenase gene promoter for recombinant protein expression in Pleurotus ostreatus.

    PubMed

    Yin, Chaomin; Zheng, Liesheng; Zhu, Jihong; Chen, Liguo; Ma, Aimin

    2015-03-01

    Developing efficient native promoters is important for improving recombinant protein expression by fungal genetic engineering. The promoter region of glyceraldehyde-3-phosphate dehydrogenase gene in Pleurotus ostreatus (Pogpd) was isolated and optimized by upstream truncation. The activities of these promoters with different lengths were further confirmed by fluorescence, quantitative real-time PCR and Western blot analysis. A truncated Pogpd-P2 fragment (795 bp) drove enhanced green fluorescence protein (egfp) gene expression in P. ostreatus much more efficiently than full-length Pogpd-P1. Further truncating Pogpd-P2 to 603, 403 and 231 bp reduced the eGFP expression significantly. However, the 403-bp fragment between -356 bp and the start codon was the minimal but sufficient promoter element for eGFP expression. Compact native promoters for genetic engineering of P. ostreatus were successfully developed and validated in this study. This will broaden the preexisting repertoire of fungal promoters for biotechnology application. PMID:25743073

  15. Polymorphisms of the ELANE Gene Promoter Region in End-Stage Chronic Kidney Disease Patients

    PubMed Central

    Fernandes, Rafael; Freitas, Bruno; Miranda, Vasco; Costa, Elísio; Santos-Silva, Alice; Bronze-da-Rocha, Elsa

    2016-01-01

    End-stage renal disease (ESRD) patients have a high mortality rate that exceeds that of non-ESRD population. The hemodialysis procedure induces neutrophil activation and elastase release, which might have a role in the inflammatory process and in the development of oxidative stress. The ELANE gene encodes the neutrophil elastase. We analyzed the effect of ELANE promoter region polymorphisms and its relation with the circulating levels of elastase, as well as several clinical, biochemical and inflammatory markers in 123 ESRD patients. We found two duplications in heterozygosity in the promoter region and a new polymorphism, the c.-801G>A. ESRD patients heterozygous for the c.-903T>G polymorphism had no changes in the circulating levels of elastase or other evaluated variables, and those homozygous for the c.-741G>A polymorphism showed significant effects on neutrophils count, as well as in neutrophils/lymphocytes ratio, which might be associated with an increased inflammatory process. PMID:27136588

  16. Functional analysis of the promoter region of amphioxus β-actin gene: a useful tool for driving gene expression in vivo.

    PubMed

    Feng, Jun; Li, Guang; Liu, Xin; Wang, Jing; Wang, Yi-Quan

    2014-10-01

    Amphioxus is a promising new animal model for developmental biology. To develop molecular tools for this model, we characterized the promoter region of a cytoplasmic β-actin gene (Bb-actin-6-2) from the Chinese amphioxus Branchiostoma belcheri. In situ hybridization and real time-quantitative PCR analyses showed that this gene is expressed in many tissues throughout embryonic development. Cloning of cDNA revealed two isoforms with distinct transcription start sites. Isoform #1 exhibits a similar exon/intron and regulatory element organization to that of vertebrate β-actin, whereas isoform #2 lacks the first exon of isoform #1 and recruits its first intron as a promoter. The activities of upstream promoter regions in the two isoforms were examined using the lacZ reporter system in amphioxus embryos. The proximal promoter of isoform #1 drove reporter gene expression broadly in 58.6 % of injected embryos. That of isoform #2 exhibited much higher activity (91.5 %) than that of isoform #1 or the human EF-1-α gene (38.2 %). We determined the minimal promoter regions of the two isoforms via functional analysis. These two regions, alone or inserted a random DNA fragment upstream, had no detectable activity, but when an upstream enhancer was inserted, the promoters directed reporter gene expression in 61.0 and 93.8 %, respectively, of injected embryos in a tissue-specific manner. Our study not only provides insight into the regulatory mechanism underlying amphioxus Bb-actin-6-2 gene expression, but also identifies two sets of efficient proximal and minimal promoters. These promoters could be used to construct gene expression vectors for transgenic studies using amphioxus as a model. PMID:25078982

  17. Promoter activity of the 5'-flanking regions of medaka fish soluble guanylate cyclase alpha1 and beta1 subunit genes.

    PubMed Central

    Yamamoto, Takehiro; Suzuki, Norio

    2002-01-01

    We examined the spatial expression pattern of medaka fish (Oryzias latipes) soluble guanylate cyclase alpha(1) and beta(1) subunit genes, OlGCS-alpha(1) and OlGCS-beta(1), and characterized the 5'-flanking region required for expression of both genes by introducing various promoter-luciferase fusion-gene constructs into COS-1 cells and medaka fish embryos. The OlGCS-alpha(1) and OlGCS-beta(1) gene transcripts were detected in whole brain and kidney in 7-day and 9-day embryos. Primer-extension analysis demonstrated that there were no differences among various adult organs (brain, eye, kidney, ovary and testis) in the transcription start site of the OlGCS-alpha(1) and OlGCS-beta(1) genes. Neither gene contained the functional TATA box within its 5'-flanking region, and the basal promoter activity was found between nucleotides +33 and +42 in the OlGCS-alpha(1) gene and between nucleotides +146 and +155 in the OlGCS-beta(1) gene. In the assay of medaka fish embryos, the 5'-flanking region of the OlGCS-beta(1) gene exhibited lower promoter activity than that of the OlGCS-alpha(1) gene. In the experiments on dual-luciferase fusion-gene constructs, the 5'-flanking region of the OlGCS-alpha(1) gene connected to the 5'-flanking region of the OlGCS-beta(1) gene was introduced into medaka fish embryos, and the 5'-flanking regions of both subunit genes were shown to mutually influence each other's promoter activity. PMID:11772405

  18. Chymotrypsin protease inhibitor gene family in rice: Genomic organization and evidence for the presence of a bidirectional promoter shared between two chymotrypsin protease inhibitor genes.

    PubMed

    Singh, Amanjot; Sahi, Chandan; Grover, Anil

    2009-01-01

    Protease inhibitors play important roles in stress and developmental responses of plants. Rice genome contains 17 putative members in chymotrypsin protease inhibitor (ranging in size from 7.21 to 11.9 kDa) gene family with different predicted localization sites. Full-length cDNA encoding for a putative subtilisin-chymotrypsin protease inhibitor (OCPI2) was obtained from Pusa basmati 1 (indica) rice seedlings. 620 bp-long OCPI2 cDNA contained 219 bp-long ORF, coding for 72 amino acid-long 7.7 kDa subtilisin-chymotrypsin protease inhibitor (CPI) cytoplasmic protein. Expression analysis by semi-quantitative RT-PCR analysis showed that OCPI2 transcript is induced by varied stresses including salt, ABA, low temperature and mechanical injury in both root and shoot tissues of the seedlings. Transgenic rice plants produced with OCPI2 promoter-gus reporter gene showed that this promoter directs high salt- and ABA-regulated expression of the GUS gene. Another CPI gene (OCPI1) upstream to OCPI2 (with 1126 bp distance between the transcription initiation sites of the two genes; transcription in the reverse orientation) was noted in genome sequence of rice genome. A vector that had GFP and GUS reporter genes in opposite orientations driven by 1881 bp intergenic sequence between the OCPI2 and OCPI1 (encompassing the region between the translation initiation sites of the two genes) was constructed and shot in onion epidermal cells by particle bombardment. Expression of both GFP and GUS from the same epidermal cell showed that this sequence represents a bidirectional promoter. Examples illustrating gene pairs showing co-expression of two divergent neighboring genes sharing a bidirectional promoter have recently been extensively worked out in yeast and human systems. We provide an example of a gene pair constituted of two homologous genes showing co-expression governed by a bidirectional promoter in rice. PMID:18952157

  19. Two target sites for protein binding in the promoter region of a cell cycle regulated human H1 histone gene.

    PubMed Central

    van Wijnen, A J; Wright, K L; Massung, R F; Gerretsen, M; Stein, J L; Stein, G S

    1988-01-01

    The 5' region of a cell cycle regulated human H1 histone gene appears to contain at least six promoter DNA elements that are shared with some, but not all human core (H2A, H2B, H3 and H4) histone genes. We show that two of these elements represent separate binding sites for two distinct, partially purified factors. The first promoter domain contains A/T rich repeats and is involved in the binding of HiNF-A, a nuclear factor previously found to bind to A/T rich direct repeats in the promoters of human H4 and H3 histone genes. The second domain, containing the general promoter element 5' dACCAAT, acts as a binding site for a two component mosaic factor we have designated HiNF-B. These data suggest that coordinate transcriptional regulation of human H1 and core histone genes may involve two classes of trans-acting factors: those specific for histone gene promoters and those that act on a broad spectrum of human gene promoters. Images PMID:2829131

  20. Functional analysis of the promoter region of the human phosphotyrosine phosphatase activator gene: Yin Yang 1 is essential for core promoter activity.

    PubMed Central

    Janssens, V; Van Hoof, C; De Baere, I; Merlevede, W; Goris, J

    1999-01-01

    The phosphotyrosine phosphatase activator (PTPA) has been isolated as an in vitro regulator of protein phosphatase 2A. Human PTPA is encoded by a single gene, the structure and chromosomal localization of which have been determined in our previous work. Here we describe the further isolation, sequencing and functional characterization of the PTPA promoter region. In agreement with its ubiquitous expression, the PTPA promoter displays several characteristics of housekeeping genes: it lacks both a TATA-box and a CAAT-box, it is very GC-rich and it contains an unmethylated CpG island surrounding the transcription initiation site. Transient transfection experiments in different cell types with several truncated chimaeric luciferase reporter gene plasmids revealed the importance of the region between positions -67 and -39 for basal promoter activity. This region coincides remarkably well with the determined CpG island. Further analysis of this region demonstrated the presence of a Yin Yang 1 (YY1) binding motif at positions -52 to -44. Binding of YY1 to this sequence is demonstrated in bandshift and DNase I footprinting experiments. Another YY1 binding motif is found in the 5' untranslated region, at positions +27 to +35. Mutations in either of these sites, abolishing YY1 binding in vitro, have differential effects on promoter activity. Point mutations in both sites completely abolish promoter activity. Moreover, induction of promoter activity by co-transfection with a YY1 expression plasmid is fully dependent upon the presence of both intact YY1 binding sites. Thus YY1 apparently mediates basal transcription of the human PTPA gene through two binding sites within its proximal promoter. PMID:10585862

  1. Case of inappropriate ADH syndrome: hyponatremia due to polyethylene glycol bowel preparation.

    PubMed

    Ko, Sun-Hye; Lim, Chul-Hyun; Kim, Jae-Young; Kang, Seung Hun; Baeg, Myong Ki; Oh, Hyun Jin

    2014-09-14

    Colonoscopic screening has been reported to reduce deaths from colorectal cancer. Adequate bowel preparation is essential for this and safety is an important issue in choosing the methods. Polyethylene glycol (PEG) is regarded as a safe method for cleansing, especially compared with oral sodium phosphate. Here, we present a case of hyponatremia caused by the syndrome of inappropriate antidiuretic hormone (ADH) syndrome after PEG precolonoscopic cleansing resulting in generalized tonic-clonic seizures. A 62-year-old women had ingested PEG for precolonoscopic bowel cleansing. While waiting for the colonoscopy, she developed a stuporous mentality and generalized tonic-clonic seizures, which did not correlate with brain magnetic resonance imaging. Her serum sodium level was 113 mEq per liter and laboratory analyses were consistent with inappropriate ADH syndrome. Her thyroid and adrenal functions were normal. There were no malignancies, infections, respiratory disorders or central nervous disorders and she had no history of taking either diuretics or other medications, which might have caused inappropriate ADH syndrome. She was treated with 3% hypertonic saline and showed a complete neurological recovery as her sodium levels recovered. Follow-up visits showed the patient to have a normal sodium level without neurologic deficits. This case shows that inappropriate ADH syndrome can be caused by PEG preparation, which implies that physicians have to be aware of the possible side effects of this colonic cleansing approach and mindful of the possible ensuing symptoms. PMID:25232272

  2. The influence of Adh function on ethanol preference and tolerance in adult Drosophila melanogaster.

    PubMed

    Ogueta, Maite; Cibik, Osman; Eltrop, Rouven; Schneider, Andrea; Scholz, Henrike

    2010-11-01

    Preference determines behavioral choices such as choosing among food sources and mates. One preference-affecting chemical is ethanol, which guides insects to fermenting fruits or leaves. Here, we show that adult Drosophila melanogaster prefer food containing up to 5% ethanol over food without ethanol and avoid food with high levels (23%) of ethanol. Although female and male flies behaved differently at ethanol-containing food sources, there was no sexual dimorphism in the preference for food containing modest ethanol levels. We also investigated whether Drosophila preference, sensitivity and tolerance to ethanol was related to the activity of alcohol dehydrogenase (Adh), the primary ethanol-metabolizing enzyme in D. melanogaster. Impaired Adh function reduced ethanol preference in both D. melanogaster and a related species, D. sechellia. Adh-impaired flies also displayed reduced aversion to high ethanol concentrations, increased sensitivity to the effects of ethanol on postural control, and negative tolerance/sensitization (i.e., a reduction of the increased resistance to ethanol's effects that normally occurs upon repeated exposure). These data strongly indicate a linkage between ethanol-induced behavior and ethanol metabolism in adult fruit flies: Adh deficiency resulted in reduced preference to low ethanol concentrations and reduced aversion to high ones, despite recovery from ethanol being strongly impaired. PMID:20739429

  3. Hemodynamic and ADH responses to central blood volume shifts in cardiac-denervated humans

    NASA Technical Reports Server (NTRS)

    Convertino, V. A.; Thompson, C. A.; Benjamin, B. A.; Keil, L. C.; Savin, W. M.; Gordon, E. P.; Haskell, W. L.; Schroeder, J. S.; Sandler, H.

    1990-01-01

    Hemodynamic responses and antidiuretic hormone (ADH) were measured during body position changes designed to induce blood volume shifts in ten cardiac transplant recipients to assess the contribution of cardiac and vascular volume receptors in the control of ADH secretion. Each subject underwent 15 min of a control period in the seated posture, then assumed a lying posture for 30 min at 6 deg head down tilt (HDT) followed by 20 min of seated recovery. Venous blood samples and cardiac dimensions (echocardiography) were taken at 0 and 15 min before HDT, 5, 15, and 30 min of HDT, and 5, 15, and 30 min of seated recovery. Blood samples were analyzed for hematocrit, plasma osmolality, plasma renin activity (PRA), and ADH. Resting plasma volume (PV) was measured by Evans blue dye and percent changes in PV during posture changes were calculated from changes in hematocrit. Heart rate (HR) and blood pressure (BP) were recorded every 2 min. Results indicate that cardiac volume receptors are not the only mechanism for the control of ADH release during acute blood volume shifts in man.

  4. Effects of ADH on the apical and basolateral membranes of toad urinary bladder epithelial cells.

    PubMed

    Donaldson, P J; Leader, J P

    1993-11-01

    Short-circuited urinary bladders from Bufo marinus were supported on their apical surface by an agar mounting method and impaled with microelectrodes via their basolateral membrane. This arrangement provided stable and long-lasting impalements of epithelial cells and yielded reliable membrane potentials and voltage divider ratios (Ra/Rb), where Ra and Rb are apical and basolateral membrane resistances respectively. The membrane potential under short-circuit conditions (Vsc) was -51.4 +/- 2.2 mV (n = 59), while under open-circuit conditions apical membrane potential (Va) and basolateral membrane potential (Vb) were -31.0 +/- 2.4 and 59.5 +/- 2.4 mV, respectively. This yields a "well-shaped" potential profile across the toad urinary bladder, where Va is inversely related to the rate of transport, Isc. Antidiuretic hormone (ADH) produced a hyperpolarisation of Vsc and Vb but had no significant effect on Va. In addition, Ra/Rb was significantly increased by ADH (4.6 +/- 0.5 to 10.2 +/- 3.6). Calculation of individual membrane resistances following the addition of amiloride showed that ADH produced a parallel decrease in Ra and Rb membrane resistance, with the observed increase in Ra/Rb being due to a greater percentage decrease in Rb than in Ra. The ability of ADH to effect parallel changes in apical and basolateral membrane conductance helps to maintain a constant cellular volume despite an increase in transepithelial transport. PMID:8309781

  5. Interactions between ADH and prostaglandins in isolated erythrocyte-perfused rat kidney

    SciTech Connect

    Lieberthal, W.; Vasilevsky, M.L.; Valeri, C.R.; Levinsky, N.G.

    1987-02-01

    Interactions between antidiuretic hormone (ADH) and renal prostaglandins in the regulation of sodium reabsorption and urinary concentrating ability were studied in isolated erythrocyte-perfused rat kidneys (IEPK). In this model, hemodynamic characteristics are comparable to those found in vivo, and tubular morphology is preserved throughout the period of perfusion. (Deamino)-D-arginine vasopressin (dDAVP) markedly reduced fractional sodium excretion (FE/sub Na/) in the IEPK. After indomethacin, FE/sub Na/ fell still further. In the absence of dDAVP indomethacin had no effect on sodium excretion. dDAVP increased urine osmolality in the IEPK. When prostaglandin synthesis was blocked with indomethacin, urinary osmolality increased further. In isolated kidneys perfused without erythrocytes (IPK), dDAVP decreased FE/sub Na/ from 14.5 +/- 1.8% to 9.6 +/- 1.2%. dDAVP increased urine osmolality only modestly in the IPK and indomethacin did not increase concentrating ability further. Thus the IEPK (unlike the IPK) can excrete markedly hypertonic urine in response to ADH. ADH also enhances tubular reabsorption of sodium in the IEPK. Prostaglandins inhibit both these actions of ADH but do not directly affect sodium excretion in the absence of the hormone. Prostaglandius were measured by radioimmunoassay.

  6. Suppression of ADH during water immersion in normal man. [antidiuretic hormone

    NASA Technical Reports Server (NTRS)

    Epstein, M.; Pins, D. S.; Miller, M.

    1975-01-01

    A study was undertaken to ascertain whether diuresis induced by immersion is medicated by an inhibition of ADH. Immersion resulted in a progressive decrease in ADH excretion from 80.1 + or - 7 (SEM) to 37.3 + or - 6.3 microU/min (P less than 0.025). Cessation of immersion was associated with a marked increase in ADH from 37.3 + or - 6.3 microU/min to 176.6 + or - 72.6 microU/min during the recovery hour (P less than 0.05). Concomitant with these changes, urine osmolality decreased significantly beginning as early as the initial hour of immersion from 1044 + or - 36 to 542 + or - 66 mosmol/kg H2O during the final hour of immersion (P less than 0.001). These findings are consistent with the earlier suggestion that suppression of ADH release contributes to enhanced free water clearance in hydrated subjects undergoing immersion.

  7. Structure and Promoter Characterization of Aldo-Keto Reductase Family 1 B10 Gene

    PubMed Central

    Liu, Ziwen; Zhong, Linlin; Krishack, Paulette A; Robbins, Sarah; Cao, Julia X; Zhao, Yupei; Chung, Stephen; Cao, Deliang

    2009-01-01

    Aldo-keto reductase family 1 member B10 (AKR1B10) is overexpressed in human hepatocellular carcinoma, lung squamous carcinoma, and lung adenocarcinoma in smokers. Our recent studies have showed that AKR1B10 plays a critical role in the growth and proliferation of cancer cells by detoxifying reactive carbonyls and regulating fatty acid biosynthesis. However, little is known about the regulatory mechanisms of AKR1B10 expression. In this study, we determined the structure of AKR1B10 gene and characterized its promoter. The results demonstrated that AKR1B10 consists of 10 exons and 9 introns, stretching approximately 13.8 kb. A 5′-RACE study determined the transcriptional start site of AKR1B10 at 320 bp upstream of the ATG translational start codon. A TATA-like (TAATAA) and a CAAT box are present from −145 to −140 bp and −193 to −190 bp upstream of the transcriptional start site, respectively. Motif analysis recognized multiple putative oncogenic and tumor suppressor protein binding sites in the AKR1B10 promoter, including c-Ets-1, C/EBP, AP-1, and p53, but osmolytic response elements were not found. A -4,091 bp of the 5′-flanking fragment of the AKR1B10 gene was capable of driving GFP and luciferase reporter gene expression in HepG2 cells derived from human hepatocellular carcinoma; progressive 5′-deletions revealed that a −255 bp fragment possesses full promoter activity. PMID:19236911

  8. Binding motifs in bacterial gene promoters modulate transcriptional effect of global regulators

    SciTech Connect

    Leuze, Michael Rex; Karpinets, Tatiana V; Syed, Mustafa H; Beliaev, Alexander S; Uberbacher, Edward C

    2012-01-01

    Bacterial gene regulation involves transcription factors (TFs) that influence the expression of many genes. Global regulators, including CRP (cAMP Receptor Protein), ArcA, and FNR, can modulate the transcriptional activity of multiple operons. The similarity of a regulatory element s sequence to a TF s consensus binding site (BS) and the position of the regulatory element in an operon promoter are considered the most important determinants of this TF s regulatory influence. In this study we explore the hypothesis that the number of TFBS half-sites (where a half-site is one half of the palindromic BS consensus sequence, which we shall refer to as a binding motif or a BM) of a global regulator in an operon s promoter plays an important role in the operon s transcriptional regulation. We examine empirical data from transcriptional profiling of the CRP regulon in Shewanella oneidenses MR 1 and Escherichia coli, and of the ArcA regulon in S. oneidenses MR 1. We compare the power of CRP BM counts and of full, symmetrical CRP TFBS characteristics, namely similarity to consensus and location, to predict CRP-induced transcriptional activity. We find that CRP BM counts have a nonlinear effect on CRP-dependent transcriptional activity and predict this activity better than full-length TFBS quality or location. Regression analysis indicates that IHF (Integration Host Factor) and ArcA have synergistic effects on CRP-induced gene transcription, positive and negative, respectively. Based on these results, we propose that the fine-tuning of bacterial transcriptional activity by CRP may involves not only the bending of the operon promoter, facilitated by CRP in cooperation with the histone-like protein IHF, but also the cumulative binding affinity of multiple weak BMs.

  9. MGMT-B gene promoter hypermethylation in patients with inflammatory bowel disease - a novel finding.

    PubMed

    Mokarram, Pooneh; Kavousipour, Soudabeh; Sarabi, Mostafa Moradi; Mehrabani, Golnosh; Fahmidehkar, Mohammad Ali; Shamsdin, Seyedeh Azra; Alipour, Abbas; Naini, Mahvash Alizade

    2015-01-01

    Inflammatory bowel disease (IBD) is a disease strongly associated with colorectal cancer (CRC) as a well-known precancerous condition. Alterations in DNA methylation and mutation in K-ras are believed to play an early etiopathogenic role in CRC and may also an initiating event through deregulation of molecular signaling. Epigenetic silencing of APC and SFRP2 in the WNT signaling pathway may also be involved in IBD-CRC. The role of aberrant DNA methylation in precancerous state of colorectal cancer (CRC) is under intensive investigation worldwide. The aim of this study was to investigate the status of promoter methylation of MGMT-B, APC1A and SFRP2 genes, in inflamed and normal colon tissues of patients with IBD compared with control normal tissues. A total of 52 IBD tissues as well as corresponding normal tissues and 30 samples from healthy participants were obtained. We determined promoter methylation status of MGMT-B, SFRP2 and APC1A genes by chemical treatment with sodium bisulfite and subsequent MSP. The most frequently methylated locus was MGMT-B (71%; 34 of 48), followed by SFRP2 (66.6 %; 32 of 48), and APC1A (43.7%; 21 of 48). Our study demonstrated for the first time that hypermethylation of the MGMT-B and the SFRP2 gene promoter regions might be involved in IBD development. Methylation of MGMT-B and SFRP2 in IBD patients may provide a method for early detection of IBD-associated neoplasia. PMID:25773792

  10. Association Between Promoter Methylation of Serotonin Transporter Gene and Depressive Symptoms: A Monozygotic Twin Study

    PubMed Central

    Zhao, Jinying; Goldberg, Jack; Bremner, James D.; Vaccarino, Viola

    2013-01-01

    Objective Epigenetic mechanisms have been implicated in the pathogenesis of psychiatric disorders. The serotonin transporter gene (SLC6A4) is a key candidate gene for depression. We examined the association between SLC6A4 promoter methylation variation and depressive symptoms using 84 monozygotic twin pairs. Methods DNA methylation level in the SLC6A4 promoter region was quantified by bisulfite pyrosequencing using genomic DNA isolated from peripheral blood leukocytes. The number of current depressive symptoms was assessed using the Beck Depressive Inventory II (BDI-II). The association between methylation variation and depressive symptoms was examined using matched twin-pair analyses, adjusting for body mass index, smoking, physical activity, and alcohol consumption. Multiple testing was controlled by adjusted false discovery rate (q value). Results Intrapair difference in DNA methylation variation at 10 of the 20 studied CpG sites is significantly correlated with intrapair difference in BDI scores. Linear regression using intrapair differences demonstrates that intrapair difference in BDI score was significantly associated with intrapair differences in DNA methylation variation after adjusting for potential confounders and correction for multiple testing. On average, a 10% increase in the difference in mean DNA methylation level was associated with 4.4 increase in the difference in BDI score (95% confidence interval = 0.9–7.9, p = .01). Conclusions This study provides evidence that variation in methylation level within the promoter region of the serotonin transporter gene is associated with variation in depressive symptoms in a large sample of monozygotic twin pairs. This relationship is not confounded by genetic and shared environment. The 5-HTTLPR genotype also does not modulate this association. PMID:23766378

  11. Structure and expression of the nuclear gene coding for the chloroplast ribosomal protein L21: developmental regulation of a housekeeping gene by alternative promoters.

    PubMed Central

    Lagrange, T; Franzetti, B; Axelos, M; Mache, R; Lerbs-Mache, S

    1993-01-01

    We have cloned and sequenced the nuclear gene of the chloroplast ribosomal protein L21 (rpl21) of Spinacia oleracea. The gene consists of five exons and four introns. All introns are located in the sequence which corresponds to the Escherichia coli-like central core of the protein. L21 mRNA is present in photosynthetic (leaves) and nonphotosynthetic (roots and seeds) plant organs, although large quantitative differences exist. Primer extension and S1 nuclease mapping experiments revealed the existence of two types of transcripts in leaves. The two corresponding start sites were defined as P1 and P2. In roots and seeds, we found only the shorter of the two transcripts (initiated at P2). The nucleotide sequence surrounding P2 resembles promoters for housekeeping and vertebrate r-protein genes. Analysis of several promoter constructions by transient expression confirmed that both transcripts originate from transcription initiation. Results are interpreted to mean that the expression of the rpl21 gene is regulated by alternative promoters. One of the promoters (P2) is constitutive, and the other one (P1) is specifically induced in leaves, i.e., its activation should be related to the transformation of amyloplasts or proplastids to chloroplasts. The gene thus represents the first example of a housekeeping gene which is regulated by the organ-specific usage of alternative promoters. Primer extension analysis and S1 nuclease mapping of another nucleus-encoded chloroplast ribosomal protein gene (rps1) give evidence that the same type of regulation by two-promoter usage might be a more general phenomenon of plant chloroplast-related ribosomal protein genes. Preliminary results indicate that presence of conserved sequences within the rpl21 and rps1 promoter regions which compete for the same DNA binding activities. Images PMID:8455634

  12. Adr1 and Cat8 Mediate Coactivator Recruitment and Chromatin Remodeling at Glucose-Regulated Genes

    PubMed Central

    Biddick, Rhiannon K.; Law, G. Lynn; Young, Elton T.

    2008-01-01

    Background Adr1 and Cat8 co-regulate numerous glucose-repressed genes in S. cerevisiae, presenting a unique opportunity to explore their individual roles in coactivator recruitment, chromatin remodeling, and transcription. Methodology/Principal Findings We determined the individual contributions of Cat8 and Adr1 on the expression of a cohort of glucose-repressed genes and found three broad categories: genes that need both activators for full derepression, genes that rely mostly on Cat8 and genes that require only Adr1. Through combined expression and recruitment data, along with analysis of chromatin remodeling at two of these genes, ADH2 and FBP1, we clarified how these activators achieve this wide range of co-regulation. We find that Adr1 and Cat8 are not intrinsically different in their abilities to recruit coactivators but rather, promoter context appears to dictate which activator is responsible for recruitment to specific genes. These promoter-specific contributions are also apparent in the chromatin remodeling that accompanies derepression: ADH2 requires both Adr1 and Cat8, whereas, at FBP1, significant remodeling occurs with Cat8 alone. Although over-expression of Adr1 can compensate for loss of Cat8 at many genes in terms of both activation and chromatin remodeling, this over-expression cannot complement all of the cat8Δ phenotypes. Conclusions/Significance Thus, at many of the glucose-repressed genes, Cat8 and Adr1 appear to have interchangeable roles and promoter architecture may dictate the roles of these activators. PMID:18197247

  13. Promoter for the human ferritin heavy chain-encoding gene (FERH): structural and functional characterization.

    PubMed

    Bevilacqua, M A; Giordano, M; D'Agostino, P; Santoro, C; Cimino, F; Costanzo, F

    1992-02-15

    We conducted a functional analysis of the promoter for the human ferritin heavy chain-encoding gene (pFERH) in HepG2 and HeLa cells. The activity of pFERH is equivalent in both cell types, despite their different ferritin (Fer) isotypes. Transfections of a series of 5'-deletion mutants indicate that pFERH activity is essentially dependent on two motifs. One of them, accounting for about 50% of the total transcriptional activity, is recognized by the RNA polymerase II transcription factor, Sp1, and the other by a low-affinity factor present in both the cell types analyzed. PMID:1541403

  14. Comparative mutational analysis of wild-type and stretched tRNA3(Leu) gene promoters.

    PubMed Central

    Fabrizio, P; Coppo, A; Fruscoloni, P; Benedetti, P; Di Segni, G; Tocchini-Valentini, G P

    1987-01-01

    We demonstrate that, when the yeast tRNA(3Leu) gene is stretched so that the distance between the two portions of the intragenic promoter is increased to 365 base pairs, the A and B blocks remain functional. Mutations in the A block, which show a weak phenotype when inserted in the wild type, exert a dramatic effect when inserted into the stretched gene. Experiments with extensively purified transcription factor tau indicate that the tau B-B block interaction is not influenced by A-B distance; only the ability of tau A to interact with A block sequences is affected, possibly because of the additional free-energy cost of forming a large loop of the intervening DNA. Images PMID:3321052

  15. Promoter polymorphism of the erythropoietin gene in severe diabetic eye and kidney complications

    PubMed Central

    Tong, Zongzhong; Yang, Zhenglin; Patel, Shrena; Chen, Haoyu; Gibbs, Daniel; Yang, Xian; Hau, Vincent S.; Kaminoh, Yuuki; Harmon, Jennifer; Pearson, Erik; Buehler, Jeanette; Chen, Yuhong; Yu, Baifeng; Tinkham, Nicholas H.; Zabriskie, Norman A.; Zeng, Jiexi; Luo, Ling; Sun, Jennifer K.; Prakash, Manvi; Hamam, Rola N.; Tonna, Stephen; Constantine, Ryan; Ronquillo, Cecinio C.; Sadda, SriniVas; Avery, Robert L.; Brand, John M.; London, Nyall; Anduze, Alfred L.; King, George L.; Bernstein, Paul S.; Watkins, Scott; Jorde, Lynn B.; Li, Dean Y.; Aiello, Lloyd Paul; Pollak, Martin R.; Zhang, Kang

    2008-01-01

    Significant morbidity and mortality among patients with diabetes mellitus result largely from a greatly increased incidence of microvascular complications. Proliferative diabetic retinopathy (PDR) and end stage renal disease (ESRD) are two of the most common and severe microvascular complications of diabetes. A high concordance exists in the development of PDR and ESRD in diabetic patients, as well as strong familial aggregation of these complications, suggesting a common underlying genetic mechanism. However, the precise gene(s) and genetic variant(s) involved remain largely unknown. Erythropoietin (EPO) is a potent angiogenic factor observed in the diabetic human and mouse eye. By a combination of case–control association and functional studies, we demonstrate that the T allele of SNP rs1617640 in the promoter of the EPO gene is significantly associated with PDR and ESRD in three European-American cohorts [Utah: P = 1.91 × 10−3; Genetics of Kidneys in Diabetes (GoKinD) Study: P = 2.66 × 10−8; and Boston: P = 2.1 × 10−2]. The EPO concentration in human vitreous body was 7.5-fold higher in normal subjects with the TT risk genotype than in those with the GG genotype. Computational analysis suggests that the risk allele (T) of rs1617640 creates a matrix match with the EVI1/MEL1 or AP1 binding site, accounting for an observed 25-fold enhancement of luciferase reporter expression as compared with the G allele. These results suggest that rs1617640 in the EPO promoter is significantly associated with PDR and ESRD. This study identifies a disease risk-associated gene and potential pathway mediating severe diabetic microvascular complications. PMID:18458324

  16. Mammalian Glutaminase Gls2 Gene Encodes Two Functional Alternative Transcripts by a Surrogate Promoter Usage Mechanism

    PubMed Central

    Campos-Sandoval, José A.; Manzanares, Elisa; Lobo, Carolina; Segura, J. A.; Alonso, Francisco J.; Matés, José M.; Márquez, Javier

    2012-01-01

    Background Glutaminase is expressed in most mammalian tissues and cancer cells, but the regulation of its expression is poorly understood. An essential step to accomplish this goal is the characterization of its species- and cell-specific isoenzyme pattern of expression. Our aim was to identify and characterize transcript variants of the mammalian glutaminase Gls2 gene. Methodology/Principal Findings We demonstrate for the first time simultaneous expression of two transcript variants from the Gls2 gene in human, rat and mouse. A combination of RT-PCR, primer-extension analysis, bioinformatics, real-time PCR, in vitro transcription and translation and immunoblot analysis was applied to investigate GLS2 transcripts in mammalian tissues. Short (LGA) and long (GAB) transcript forms were isolated in brain and liver tissue of human, rat and mouse. The short LGA transcript arises by a combination of two mechanisms of transcriptional modulation: alternative transcription initiation and alternative promoter. The LGA variant contains both the transcription start site (TSS) and the alternative promoter in the first intron of the Gls2 gene. The full human LGA transcript has two in-frame ATGs in the first exon, which are missing in orthologous rat and mouse transcripts. In vitro transcription and translation of human LGA yielded two polypeptides of the predicted size, but only the canonical full-length protein displayed catalytic activity. Relative abundance of GAB and LGA transcripts showed marked variations depending on species and tissues analyzed. Conclusions/Significance This is the first report demonstrating expression of alternative transcripts of the mammalian Gls2 gene. Transcriptional mechanisms giving rise to GLS2 variants and isolation of novel GLS2 transcripts in human, rat and mouse are presented. Results were also confirmed at the protein level, where catalytic activity was demonstrated for the human LGA protein. Relative abundance of GAB and LGA transcripts was

  17. The MuvB complex sequentially recruits B-Myb and FoxM1 to promote mitotic gene expression

    PubMed Central

    Sadasivam, Subhashini; Duan, Shenghua; DeCaprio, James A.

    2012-01-01

    Cell cycle progression is dependent on two major waves of gene expression. Early cell cycle gene expression occurs during G1/S to generate factors required for DNA replication, while late cell cycle gene expression begins during G2 to prepare for mitosis. Here we demonstrate that the MuvB complex—comprised of LIN9, LIN37, LIN52, LIN54, and RBBP4—serves an essential role in three distinct transcription complexes to regulate cell cycle gene expression. The MuvB complex, together with the Rb-like protein p130, E2F4, and DP1, forms the DREAM complex during quiescence and represses expression of both early and late genes. Upon cell cycle entry, the MuvB complex dissociates from p130/DREAM, binds to B-Myb, and reassociates with the promoters of late genes during S phase. MuvB and B-Myb are required for the subsequent recruitment of FoxM1 to late gene promoters during G2. The MuvB complex remains bound to FoxM1 during peak late cell cycle gene expression, while B-Myb binding is lost when it undergoes phosphorylation-dependent, proteasome-mediated degradation during late S phase. Our results reveal a novel role for the MuvB complex in recruiting B-Myb and FoxM1 to promote late cell cycle gene expression and in regulating cell cycle gene expression from quiescence through mitosis. PMID:22391450

  18. The MuvB complex sequentially recruits B-Myb and FoxM1 to promote mitotic gene expression.

    PubMed

    Sadasivam, Subhashini; Duan, Shenghua; DeCaprio, James A

    2012-03-01

    Cell cycle progression is dependent on two major waves of gene expression. Early cell cycle gene expression occurs during G1/S to generate factors required for DNA replication, while late cell cycle gene expression begins during G2 to prepare for mitosis. Here we demonstrate that the MuvB complex-comprised of LIN9, LIN37, LIN52, LIN54, and RBBP4-serves an essential role in three distinct transcription complexes to regulate cell cycle gene expression. The MuvB complex, together with the Rb-like protein p130, E2F4, and DP1, forms the DREAM complex during quiescence and represses expression of both early and late genes. Upon cell cycle entry, the MuvB complex dissociates from p130/DREAM, binds to B-Myb, and reassociates with the promoters of late genes during S phase. MuvB and B-Myb are required for the subsequent recruitment of FoxM1 to late gene promoters during G2. The MuvB complex remains bound to FoxM1 during peak late cell cycle gene expression, while B-Myb binding is lost when it undergoes phosphorylation-dependent, proteasome-mediated degradation during late S phase. Our results reveal a novel role for the MuvB complex in recruiting B-Myb and FoxM1 to promote late cell cycle gene expression and in regulating cell cycle gene expression from quiescence through mitosis. PMID:22391450

  19. Cloning and promoter identification of the iron-regulated cir gene of Escherichia coli.

    PubMed Central

    Griggs, D W; Tharp, B B; Konisky, J

    1987-01-01

    The cir gene, which encodes the colicin I receptor protein and is regulated by both cellular iron content and growth temperature, was cloned into a multicopy-number plasmid. Physical mapping and complementation analysis established the position of cir between mgl and nfo on the Escherichia coli chromosome. A gene encoding a 32,000-dalton polypeptide was located downstream of and adjacent to cir, but did not appear to be part of the same transcriptional unit. A 525-base-pair fragment from the 5' end of the 1.8-kilobase-pair receptor-coding region directed iron-regulated transcription and translation of a hybrid cir-lacZ gene. Two overlapping promoters were identified by determination of the transcriptional start sites and by sequence analysis. A small open reading frame (120 nucleotides) of unknown significance preceded the receptor-coding sequence. Examination of the amino acid sequence of the receptor purified from the outer membrane revealed that the gene product was processed by removal of a signal peptide and that the mature form had an amino acid sequence near its amino terminus which closely resembled that of several other TonB-dependent proteins. Images PMID:3316180

  20. Isolation and characterization of a chalcone isomerase gene promoter from potato cultivars.

    PubMed

    Chen, M; Zhu, W J; You, X; Liu, Y D; Kaleri, G M; Yang, Q

    2015-01-01

    Chalcone isomerase (CHI) is a key enzyme involved in anthocyanin metabolism. Previous research on CHI has mainly focused on cDNA cloning and gene expression. In the current study, the 1425-bp potato CHI promoter (PCP) was isolated from four potato cultivars (Heijingang, Zhongshu 7, Désirée, and Favorita) using PCR and DNA sequencing. The PCP contained many cis-regulatory elements (CREs) related to anthocyanin metabolism, tissue specificity, light response, stress, and hormone induction. Of the PCP CREs identified, 19 were common to those found in the higher plants examined, based on plant CRE databases. Multiple sequence alignment showed six single nucleotide variation sites in PCP among the potato cultivars examined, resulting in changes in the number of CREs connected with tissue specificity, anthocyanin metabolism, and light response. The 665-bp PCP fragments from Favorita and 1425-bp PCP fragments from Heijingang were used to construct plant expression vectors, which may be a useful tool for biological engineering. A transient expression assay demonstrated that the two PCP fragments from Heijingang could direct the expression of a green fluorescent protein gene in onion epidermis and a β-glucuronidase gene in all potato tuber tissues with different colors, suggesting that the single nucleotide variation in the PCP did not affect its activity, and that silencing of the CHI gene in Favorita may be attributed to other regulatory factors. PMID:26782538

  1. CASSIS and SMIPS: promoter-based prediction of secondary metabolite gene clusters in eukaryotic genomes

    PubMed Central

    Wolf, Thomas; Shelest, Vladimir; Nath, Neetika; Shelest, Ekaterina

    2016-01-01

    Motivation: Secondary metabolites (SM) are structurally diverse natural products of high pharmaceutical importance. Genes involved in their biosynthesis are often organized in clusters, i.e., are co-localized and co-expressed. In silico cluster prediction in eukaryotic genomes remains problematic mainly due to the high variability of the clusters’ content and lack of other distinguishing sequence features. Results: We present Cluster Assignment by Islands of Sites (CASSIS), a method for SM cluster prediction in eukaryotic genomes, and Secondary Metabolites by InterProScan (SMIPS), a tool for genome-wide detection of SM key enzymes (‘anchor’ genes): polyketide synthases, non-ribosomal peptide synthetases and dimethylallyl tryptophan synthases. Unlike other tools based on protein similarity, CASSIS exploits the idea of co-regulation of the cluster genes, which assumes the existence of common regulatory patterns in the cluster promoters. The method searches for ‘islands’ of enriched cluster-specific motifs in the vicinity of anchor genes. It was validated in a series of cross-validation experiments and showed high sensitivity and specificity. Availability and implementation: CASSIS and SMIPS are freely available at https://sbi.hki-jena.de/cassis. Contact: thomas.wolf@leibniz-hki.de or ekaterina.shelest@leibniz-hki.de Supplementary information: Supplementary data are available at Bioinformatics online. PMID:26656005

  2. Promoters Architecture-Based Mechanism for Noise-Induced Oscillations in a Single-Gene Circuit

    PubMed Central

    Guisoni, N.; Monteoliva, D.; Diambra, L.

    2016-01-01

    It is well known that single-gene circuits with negative feedback loop can lead to oscillatory gene expression when they operate with time delay. In order to generate these oscillations many processes can contribute to properly timing such delay. Here we show that the time delay coming from the transitions between internal states of the cis-regulatory system (CRS) can drive sustained oscillations in an auto-repressive single-gene circuit operating in a small volume like a cell. We found that the cooperative binding of repressor molecules is not mandatory for a oscillatory behavior if there are enough binding sites in the CRS. These oscillations depend on an adequate balance between the CRS kinetic, and the synthesis/degradation rates of repressor molecules. This finding suggest that the multi-site CRS architecture can play a key role for oscillatory behavior of gene expression. Finally, our results can also help to synthetic biologists on the design of the promoters architecture for new genetic oscillatory circuits. PMID:26958852

  3. Argonautes promote male fertility and provide a paternal memory of germline gene expression in C. elegans

    PubMed Central

    Conine, Colin C.; Moresco, James J.; Gu, Weifeng; Shirayama, Masaki; Conte, Darryl; Yates, John R.; Mello, Craig C.

    2014-01-01

    SUMMARY During each life cycle germ cells preserve and pass on both genetic and epigenetic information. In C. elegans, the ALG-3/4 Argonaute proteins are expressed during male gametogenesis and promote male fertility. Here we show that the CSR-1 Argonaute functions with ALG-3/4 to positively regulate target genes required for spermiogenesis. Our findings suggest that ALG-3/4 functions during spermatogenesis to amplify a small-RNA signal that represents an epigenetic memory of male-specific gene expression. CSR-1, which is abundant in mature sperm, appears to transmit this memory to offspring. Surprisingly, in addition to small RNAs targeting male-specific genes, we show that males also harbor an extensive repertoire of CSR-1 small RNAs targeting oogenesis-specific mRNAs. Together these findings suggest that C. elegans sperm transmit not only the genome but also epigenetic binary signals in the form of Argonaute/small-RNA complexes that constitute a memory of gene expression in preceding generations. PMID:24360276

  4. Effects of gene dosage, promoters, and substrates on unfolded protein stress of recombinant Pichia pastoris.

    PubMed

    Hohenblum, Hubertus; Gasser, Brigitte; Maurer, Michael; Borth, Nicole; Mattanovich, Diethard

    2004-02-20

    The expression of heterologous proteins may exert severe stress on the host cells at different levels. Depending on the specific features of the product, different steps may be rate-limiting. For the secretion of recombinant proteins from yeast cells, folding and disulfide bond formation were identified as rate-limiting in several cases and the induction of the chaperone BiP (binding protein) is described. During the development of Pichia pastoris strains secreting human trypsinogen, a severe limitation of the amount of secreted product was identified. Strains using either the AOX1 or the GAP promoter were compared at different gene copy numbers. With the constitutive GAP promoter, no effect on the expression level was observed, whereas with the inducible AOX1 promoter an increase of the copy number above two resulted in a decrease of expression. To identify whether part of the product remained in the cells, lysates were fractionated and significant amounts of the product were identified in the insoluble fraction containing the endoplasmic reticulum, while the soluble cytosolic fraction contained product only in clones using the GAP promoter. An increase of BiP was observed upon induction of expression, indicating that the intracellular product fraction exerts an unfolded protein response in the host cells. A strain using the GAP promoter was grown both on glucose and methanol and trypsinogen was identified in the insoluble fractions of both cultures, but only in the soluble fraction of the glucose grown cultures, indicating that the amounts and distribution of intracellularly retained product depends on the culture conditions, especially the carbon source. PMID:14755554

  5. Structure of two solanum tuberosum steroidal glycoalkaloid glycosyltransferase genes and expression of their promoters in transgenic potatoes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The Sgt2 gene in potato encodes a solanidine glucosyltransferase and is present as two distinct alleles expressed in cultivated potatoes. Promoter regions upstream from both steroidal glycoalkaloid biosynthetic gene alleles, Sgt2.1 and Sgt2.2, were isolated from Solanum tuberosum cv. Russet Burbank ...

  6. Gene Expression in Archaea: Studies of Transcriptional Promoters, Messenger RNA Processing, and Five Prime Untranslated Regions in "Methanocaldococcus Jannashchii"

    ERIC Educational Resources Information Center

    Zhang, Jian

    2009-01-01

    Gene expression in Archaea is less understood than those in Bacteria and Eucarya. In general, three steps are involved in gene expression--transcription, RNA processing, and translation. To expand our knowledge of these processes in Archaea, I have studied transcriptional promoters, messenger RNA processing, and 5'-untranslated regions in…

  7. The Rhodobacter capsulatus glnB gene is regulated by NtrC at tandem rpoN-independent promoters.

    PubMed Central

    Foster-Hartnett, D; Kranz, R G

    1994-01-01

    The protein encoded by glnB of Rhodobacter capsulatus is part of a nitrogen-sensing cascade which regulates the expression of nitrogen fixation genes (nif). The expression of glnB was studied by using lacZ fusions, primer extension analysis, and in vitro DNase I footprinting. Our results suggest that glnB is transcribed from two promoters, one of which requires the R. capsulatus ntrC gene but is rpoN independent. Another promoter upstream of glnB is repressed by NtrC; purified R. capsulatus NtrC binds to sites that overlap this distal promoter region. Images PMID:8051036

  8. Sequences contained within the promoter of the human thymidine kinase gene can direct cell-cycle regulation of heterologous fusion genes.

    PubMed Central

    Kim, Y K; Wells, S; Lau, Y F; Lee, A S

    1988-01-01

    Recent evidence on the transcriptional regulation of the human thymidine kinase (TK) gene raises the possibility that cell-cycle regulatory sequences may be localized within its promoter. A hybrid gene that combines the TK 5' flanking sequence and the coding region of the bacterial neomycin-resistance gene (neo) has been constructed. Upon transfection into a hamster fibroblast cell line K12, the hybrid gene exhibits cell-cycle-dependent expression. Deletion analysis reveals that the region important for cell-cycle regulation is within -441 to -63 nucleotides from the transcriptional initiation site. This region (-441 to -63) also confers cell-cycle regulation to the herpes simplex virus thymidine kinase (HSVtk) promoter, which is not expressed in a cell-cycle manner. We conclude that the -441 to -63 sequence within the human TK promoter is important for cell-cycle-dependent expression. Images PMID:3413063

  9. RpoE may promote flagellar gene expression in Salmonella enterica serovar typhi under hyperosmotic stress.

    PubMed

    Du, Hong; Sheng, Xiumei; Zhang, Haifang; Zou, Xin; Ni, Bin; Xu, Shungao; Zhu, Xueming; Xu, Huaxi; Huang, Xinxiang

    2011-02-01

    Salmonella enterica serovar Typhi z66 positive strain contains a fljBA-like operon on a linear plasmid. The operon contains the gene fljB:z66 which encodes the z66 antigen. RpoE is a sigma factor σ(E) that initiates transcription of a series of genes in Escherichia and Salmonella under environmental stresses. To investigate whether the gene fljB:z66 is regulated by RpoE (σ(E)), a rpoE deletion mutant of S. enterica serovar Typhi (ΔrpoE) was prepared in this study. The defective motility of the ΔrpoE was confirmed firstly. Transcriptional expression of flagellar genes was screened using a genomic DNA microarray. Some class-2 and most class-3 flagellar genes were downregulated in the ΔrpoE after 30 min of hyperosmotic stress. The expression of fliA and fljB:z66, a class-2 flagellar gene and a class-3 flagellar gene, obviously decreased; however, expression of the class-1 flagellar genes flhDC did not change obviously in the ΔrpoE compared to the wild-type strain in the same conditions. Results of quantitative real-time PCR (qRT-PCR) showed that the expression levels of fliA and fljB:z66 in the ΔrpoE after 30 min of hyperosmotic stress decreased about five and eightfold, respectively, compared to the wild-type strain. Similar results were observed at 120 min of hyperosmotic stress. Western blotting and qRT-PCR analysis showed that expression of fliA and fljB:z66 was significantly increased after supplemental expression of rpoE with a recombinant plasmid pBADrpoE in the ΔrpoE strain. These results demonstrated that RpoE promoted the expression of class-3 flagellar genes and it might be performed by initiating the expression of fliA in S. enterica serovar Typhi under hyperosmotic stress. PMID:20717675

  10. The EhADH112 recombinant polypeptide inhibits cell destruction and liver abscess formation by Entamoeba histolytica trophozoites.

    PubMed

    Martínez-López, Carolina; Orozco, Esther; Sánchez, Tomás; García-Pérez, Rosa María; Hernández-Hernández, Fidel; Rodríguez, Mario A

    2004-04-01

    The Entamoeba histolytica EhCPADH complex, formed by a cysteine proteinase (EhCP112) and an adhesin (EhADH112), is involved in adherence, phagocytosis and cytolysis. This makes this complex an attractive candidate as a vaccine against amoebiasis. Here, we produced the recombinant polypeptide EhADH243, which includes the adherence epitope detected by a monoclonal antibody against the EhCPADH complex. EhADH243 was purified, and the effect of the polypeptide on in vitro and in vivo virulence was studied. Antibodies against EhADH243 reacted with the EhCPADH complex and with the recombinant polypeptide. EhADH243 and antibodies against this polypeptide inhibited adherence, phagocytosis and destruction of cell monolayers by live trophozoites, but had little effect on cell monolayer destruction by trophozoite extracts. EhADH243 recognized a 97 kDa protein in the MDCK membrane fraction that could be a putative receptor for E. histolytica trophozoites. Hamsters immunized with EhADH243 developed humoral response against EhCPADH, and animals were partially protected from amoebic liver abscess. PMID:15009028

  11. Transcriptional Bursting from the HIV-1 Promoter is a Significant Source of Stochastic Noise in HIV-1 Gene Expression

    SciTech Connect

    Singh, A; Razooky, B; Cox, Chris D.; Simpson, Michael L; Weinberger, Leor S.

    2010-01-01

    Analysis of noise in gene expression has proven a powerful approach for analyzing gene regulatory architecture. To probe the regulatory mechanisms controlling expression of HIV-1, we analyze noise in gene-expression from HIV-1 s long terminal repeat (LTR) promoter at different HIV-1 integration sites across the human genome. Flow cytometry analysis of GFP expression from the HIV-1 LTR shows high variability (noise) at each integration site. Notably, the measured noise levels are inconsistent with constitutive gene expression models. Instead, quantification of expression noise indicates that HIV-1 gene expression occurs through randomly timed bursts of activity from the LTR and that each burst generates an average of 2 10 mRNA transcripts before the promoter returns to an inactive state. These data indicate that transcriptional bursting can generate high variability in HIV-1 early gene products, which may critically influence the viral fate-decision between active replication and proviral latency.

  12. RNA Activation of the Vascular Endothelial Growth Factor Gene (VEGF) Promoter by Double-Stranded RNA and Hypoxia: Role of Noncoding VEGF Promoter Transcripts.

    PubMed

    Lopez, Pascal; Wagner, Kay-Dietrich; Hofman, Paul; Van Obberghen, Emmanuel

    2016-05-15

    RNA activation (RNAa) is a gene regulation process in which promoter-targeted short double-stranded RNAs (dsRNAs) or microRNAs (miRs) induce target gene expression at the transcriptional level. Here, we investigate the presence of cryptic promoter transcripts within the VEGF promoter. Single-strand sense and antisense noncoding vascular endothelial growth factor (NcVEGF) promoter transcripts are identified, and their respective expression is studied in cells transfected with a VEGF promoter targeted dsRNA, namely, dsVEGF706, in hypoxic cells and in human malignant lung tissues. Interestingly, in dsVEGF706-transfected, as well as in hypoxic cells, NcVEGF expression levels increase coordinately with coding VEGF expression. Ago2 interaction with both sense and antisense NcVEGFs is increased in hypoxic cells, whereas in dsVEGF706-transfected cells, Ago2 and the antisense strand of the dsRNA interact specifically with the sense NcVEGF transcript. Furthermore, both dsVEGF706 and ectopic NcVEGF transcripts are able to activate the VEGF promoter endogenously present or in a reporter construct. Finally, using small interfering RNA targeting Ago2, we show that RNAa plays a role in the maintenance of increased VEGF and NcVEGF expression after hypoxia. Given the central role of VEGF in major human diseases, including cancer, this novel molecular mechanism is poised to reveal promising possibilities for therapeutic interventions. PMID:26976645

  13. Chimeric smooth muscle-specific enhancer/promoters: valuable tools for adenovirus-mediated cardiovascular gene therapy.

    PubMed

    Ribault, S; Neuville, P; Méchine-Neuville, A; Augé, F; Parlakian, A; Gabbiani, G; Paulin, D; Calenda, V

    2001-03-16

    Gene transfer with adenoviral vectors is an attractive approach for the treatment of atherosclerosis and restenosis. However, because expression of a therapeutic gene in nontarget tissues may have deleterious effects, artery-specific expression is desirable. Although expression vectors containing transcriptional regulatory elements of genes expressed solely in smooth muscle cells (SMCs) have proved efficient to restrict expression of the transgene, their use in the clinical setting can be limited by their reduced strength. In the present study, we show that low levels of transgene expression are obtained with the smooth muscle (SM)-specific SM22alpha promoter compared with the viral cytomegalovirus (CMV) enhancer/promoter. We have generated chimeric transcriptional cassettes containing either a SM (SM-myosin heavy chain) or a skeletal muscle (creatine kinase) enhancer combined with the SM22alpha promoter. With both constructs we observed significantly stronger expression that remains SM-specific. In vivo, reporter gene expression was restricted to arterial SMCs with no detectable signal at remote sites. Moreover, when interferon-gamma expression was driven by one of these two chimeras, SMC growth was inhibited as efficiently as with the CMV promoter. Finally, we demonstrate that neointima formation in the rat carotid balloon injury model was reduced to the same extent by adenoviral gene transfer of interferon-gamma driven either by the SM-myosin heavy chain enhancer/SM22alpha promoter or the CMV promoter. These results indicate that such vectors can be useful for the treatment of hyperproliferative vascular disorders. PMID:11249869

  14. The CHR promoter element controls cell cycle-dependent gene transcription and binds the DREAM and MMB complexes

    PubMed Central

    Müller, Gerd A.; Quaas, Marianne; Schümann, Michael; Krause, Eberhard; Padi, Megha; Fischer, Martin; Litovchick, Larisa; DeCaprio, James A.; Engeland, Kurt

    2012-01-01

    Cell cycle-dependent gene expression is often controlled on the transcriptional level. Genes like cyclin B, CDC2 and CDC25C are regulated by cell cycle-dependent element (CDE) and cell cycle genes homology region (CHR) promoter elements mainly through repression in G0/G1. It had been suggested that E2F4 binding to CDE sites is central to transcriptional regulation. However, some promoters are only controlled by a CHR. We identify the DREAM complex binding to the CHR of mouse and human cyclin B2 promoters in G0. Association of DREAM and cell cycle-dependent regulation is abrogated when the CHR is mutated. Although E2f4 is part of the complex, a CDE is not essential but can enhance binding of DREAM. We show that the CHR element is not only necessary for repression of gene transcription in G0/G1, but also for activation in S, G2 and M phases. In proliferating cells, the B-myb-containing MMB complex binds the CHR of both promoters independently of the CDE. Bioinformatic analyses identify many genes which contain conserved CHR elements in promoters binding the DREAM complex. With Ube2c as an example from that screen, we show that inverse CHR sites are functional promoter elements that can bind DREAM and MMB. Our findings indicate that the CHR is central to DREAM/MMB-dependent transcriptional control during the cell cycle. PMID:22064854

  15. The CHR promoter element controls cell cycle-dependent gene transcription and binds the DREAM and MMB complexes.

    PubMed

    Müller, Gerd A; Quaas, Marianne; Schümann, Michael; Krause, Eberhard; Padi, Megha; Fischer, Martin; Litovchick, Larisa; DeCaprio, James A; Engeland, Kurt

    2012-02-01

    Cell cycle-dependent gene expression is often controlled on the transcriptional level. Genes like cyclin B, CDC2 and CDC25C are regulated by cell cycle-dependent element (CDE) and cell cycle genes homology region (CHR) promoter elements mainly through repression in G(0)/G(1). It had been suggested that E2F4 binding to CDE sites is central to transcriptional regulation. However, some promoters are only controlled by a CHR. We identify the DREAM complex binding to the CHR of mouse and human cyclin B2 promoters in G(0). Association of DREAM and cell cycle-dependent regulation is abrogated when the CHR is mutated. Although E2f4 is part of the complex, a CDE is not essential but can enhance binding of DREAM. We show that the CHR element is not only necessary for repression of gene transcription in G(0)/G(1), but also for activation in S, G(2) and M phases. In proliferating cells, the B-myb-containing MMB complex binds the CHR of both promoters independently of the CDE. Bioinformatic analyses identify many genes which contain conserved CHR elements in promoters binding the DREAM complex. With Ube2c as an example from that screen, we show that inverse CHR sites are functional promoter elements that can bind DREAM and MMB. Our findings indicate that the CHR is central to DREAM/MMB-dependent transcriptional control during the cell cycle. PMID:22064854

  16. Screening of Tissue-Specific Genes and Promoters in Tomato by Comparing Genome Wide Expression Profiles of Arabidopsis Orthologues

    PubMed Central

    Lim, Chan Ju; Lee, Ha Yeon; Kim, Woong Bom; Lee, Bok-Sim; Kim, Jungeun; Ahmad, Raza; Kim, Hyun A; Yi, So Young; Hur, Cheol-Goo; Kwon, Suk-Yoon

    2012-01-01

    Constitutive overexpression of transgenes occasionally interferes with normal growth and developmental processes in plants. Thus, the development of tissue-specific promoters that drive transgene expression has become agriculturally important. To identify tomato tissue-specific promoters, tissue-specific genes were screened using a series of in silico-based and experimental procedures, including genome-wide orthologue searches of tomato and Arabidopsis databases, isolation of tissue-specific candidates using an Arabidopsis microarray database, and validation of tissue specificity by reverse transcription-polymerase chain reaction (RT-PCR) analysis and promoter assay. Using these procedures, we found 311 tissue-specific candidate genes and validated 10 tissue-specific genes by RT-PCR. Among these identified genes, histochemical analysis of five isolated promoter::GUS transgenic tomato and Arabidopsis plants revealed that their promoters have different but distinct tissue-specific activities in anther, fruit, and root, respectively. Therefore, it appears these in silico-based screening approaches in addition to the identification of new tissue-specific genes and promoters will be helpful for the further development of tailored crop development. PMID:22699756

  17. The construction of a synthetic Escherichia coli trp promoter and its use in the expression of a synthetic interferon gene.

    PubMed Central

    Windass, J D; Newton, C R; De Maeyer-Guignard, J; Moore, V E; Markham, A F; Edge, M D

    1982-01-01

    An 82 base pair DNA fragment has been synthesised which contains the E. coli trp promoter and operator sequences and also encodes the first Shine Dalgarno sequence of the trp operon. This DNA fragment is flanked by EcoRI and ClaI/TaqI cohesive ends and is thus easy to clone, transfer between vector systems and couple to genes to drive their expression. It has been cloned into plasmid pAT153, producing a convenient trp promoter vector