Science.gov

Sample records for adipogenic differentiation medium

  1. Current Methods of Adipogenic Differentiation of Mesenchymal Stem Cells

    PubMed Central

    Scott, Michelle A.; Nguyen, Virginia T.; Levi, Benjamin

    2011-01-01

    There has been a recent increase in our understanding in the isolation, culture, and differentiation of mesenchymal stem cells (MSCs). Concomitantly, the availability of MSCs has increased, with cells now commercially available, including human MSCs from adipose tissue and bone marrow. Despite an increased understanding of MSC biology and an increase in their availability, standardization of techniques for adipogenic differentiation of MSCs is lacking. The following review will explore the variability in adipogenic differentiation in vitro, specifically in 3T3-L1 and primary MSCs derived from both adipose tissue and bone marrow. A review of alternative methods of adipogenic induction is also presented, including the use of specific peroxisome proliferator-activated receptor-gamma agonists as well as bone morphogenetic proteins. Finally, we define a standard, commonly used adipogenic differentiation medium in the hopes that this will be adopted for the future standardization of laboratory techniques—however, we also highlight the essentially arbitrary nature of this decision. With the current, rapid pace of electronic publications, it becomes imperative for standardization of such basic techniques so that interlaboratory results may be easily compared and interpreted. PMID:21526925

  2. Current methods of adipogenic differentiation of mesenchymal stem cells.

    PubMed

    Scott, Michelle A; Nguyen, Virginia T; Levi, Benjamin; James, Aaron W

    2011-10-01

    There has been a recent increase in our understanding in the isolation, culture, and differentiation of mesenchymal stem cells (MSCs). Concomitantly, the availability of MSCs has increased, with cells now commercially available, including human MSCs from adipose tissue and bone marrow. Despite an increased understanding of MSC biology and an increase in their availability, standardization of techniques for adipogenic differentiation of MSCs is lacking. The following review will explore the variability in adipogenic differentiation in vitro, specifically in 3T3-L1 and primary MSCs derived from both adipose tissue and bone marrow. A review of alternative methods of adipogenic induction is also presented, including the use of specific peroxisome proliferator-activated receptor-gamma agonists as well as bone morphogenetic proteins. Finally, we define a standard, commonly used adipogenic differentiation medium in the hopes that this will be adopted for the future standardization of laboratory techniques--however, we also highlight the essentially arbitrary nature of this decision. With the current, rapid pace of electronic publications, it becomes imperative for standardization of such basic techniques so that interlaboratory results may be easily compared and interpreted.

  3. In vitro adipogenic differentiation of preadipocytes varies with differentiation stimulus, culture dimensionality, and scaffold composition.

    PubMed

    Stacey, D Heath; Hanson, Summer E; Lahvis, Garet; Gutowski, Karol A; Masters, Kristyn S

    2009-11-01

    Despite the rapidly growing body of work on stem cell-based adipose tissue engineering, there remains much to be learned about the role of the scaffold and culture environments in directing the adipogenic differentiation of cells. The present study examined how various culture environments and differentiation stimuli (traditional differentiation medium [DM] and coculture with mature adipocytes) impacted the adipogenic differentiation of human preadipocytes, with studies progressing from two-dimensions (2D) to three-dimensions (3D) in vitro. Assays for adipogenic markers (leptin, adiponectin, and glycerol) and Oil Red O staining were used to assess differentiation. After 16 days of 2D culture, adipogenesis was substantially greater when preadipocytes were cocultured with adipocytes rather than treated with DM. In a 3D in vitro environment, the production of adipogenic markers was significantly elevated relative to 2D conditions, and the coculture condition continued to stimulate greater adipogenesis. Alterations in 3D scaffold physical properties had only a minimal effect on the function of mature adipocytes, but significantly impacted the ability of preadipocytes to undergo adipogenic differentiation in vitro. These alterations in scaffold environment and in medium conditions, particularly the application of adipocyte/preadipocyte coculture methods in lieu of traditional DM, may provide further means for optimizing adipogenic outcomes in vitro and in vivo.

  4. CXCL3 positively regulates adipogenic differentiation.

    PubMed

    Kusuyama, Joji; Komorizono, Anna; Bandow, Kenjiro; Ohnishi, Tomokazu; Matsuguchi, Tetsuya

    2016-10-01

    Chemokines are a family of cytokines inducing cell migration and inflammation. Recent reports have implicated the roles of chemokines in cell differentiation. However, little is known about the functional roles of chemokines in adipocytes. Here, we explored gene expression levels of chemokines and chemokine receptors during adipogenic differentiation. We have found that two chemokines, chemokine (C-X-C motif) ligand 3 (CXCL3) and CXCL13, as well as CXC chemokine receptor 2 (CXCR2), a CXCL3 receptor, are highly expressed in mature adipocytes. When 3T3-L1 cells and ST2 cells were induced to differentiate, both the number of lipid droplets and the expression levels of adipogenic markers were significantly promoted by the addition of CXCL3, but not CXCL13. Conversely, gene knockdown of either CXCL3 or CXCR2 by specific siRNA effectively inhibited the course of adipogenic differentiation. CXCL3 treatment of 3T3-L1 cells significantly induced the phosphorylation of ERK and c-jun N-terminal kinase (JNK). Furthermore, CXCL3-induced CCAAT-enhancer binding protein (C/EBP)β and δ expression was suppressed by both ERK and JNK-specific inhibitors. Furthermore, chromatin immunoprecipitation assay revealed functional binding of PPARγ2 within the cxcl3 promoter region. Taken together, these results have indicated that CXCL3 is a novel adipokine that facilitates adipogenesis in an autocrine and/or a paracrine manner through induction of c/ebpb and c/ebpd.

  5. Adipogenic differentiation of mesenchymal stem cells on micropatterned polyelectrolyte surfaces.

    PubMed

    Kawazoe, Naoki; Guo, Likun; Wozniak, Michal J; Imaizumi, Yumie; Tateishi, Tetsuya; Zhang, Xingdong; Chen, Guoping

    2009-01-01

    Three kinds of photoreactive polyelectrolytes of polyallylamine (PAAm), poly(acrylic acid) (PAAc), and poly(vinyl alcohol) (PVA) were synthesized by the introduction of azidophenyl groups in the respective polymers. The photoreactive PAAm, PAAc, and PVA were micropatterned on polystyrene surfaces by photolithography. Observation with optical microscopy and scanning probe microscopy demonstrated the formation of a striped pattern of polyelectrolytes with a width of 200 microm. The micropatterned polyelectrolytes swelled in water. The micropatterned surfaces were used for cell culture of mesenchymal stem cells (MSCs) and their effects on adipogenic differentiation were investigated. The MSCs adhered to and proliferated evenly on the PAAm- and PAAc-patterned surfaces while they formed a cell pattern on the PVA-patterned surface. The PAAm-, PAAc-grafted, and polystyrene surfaces supported cell adhesion while the PVA-grafted surface did not. When cultured in adipogenic differentiation medium, the adipogenic differentiation of MSCs on the polyelectrolyte-patterned surfaces was demonstrated by the formation of lipid vacuoles and gene expression analysis. Oil Red-O-positive cells showed an even distribution on the PAAm- and PAAc-patterned surfaces, while they showed a pattern on the PVA-patterned surface. The fraction of Oil RedO-positive cells increased with culture time. The MSCs cultured on the PAAm-, PAAc-grafted, and polystyrene surfaces in adipogenic differentiation medium expressed the adipogenesis marker genes of peroxisome proliferator-activated receptor gamma2 (PPARgamma2), lipoprotein lipase (LPL), and fatty acid binding protein 4 (FABP4). These results indicate that the PAAm-, and PAAc-grafted, and polystyrene surfaces supported the adipogenesis of MSCs while a PVA-grafted surface did not.

  6. Distinct adipogenic differentiation phenotypes of human umbilical cord mesenchymal cells dependent on adipogenic conditions

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The umbilical cord (UC) matrix is a source of multipotent mesenchymal stem cells (MSCs) that have adipogenic potential and thus can be a model to study adipogenesis. However, existing variability in adipocytic differentiation outcomes may be due to discrepancies in methods utilized for adipogenic d...

  7. Effect of nanogroove geometry on adipogenic differentiation

    NASA Astrophysics Data System (ADS)

    Kim, M. S.; Kim, A. Y.; Jang, K. J.; Kim, J. H.; Kim, J. B.; Suh, K. Y.

    2011-12-01

    We present the effect of nanotopographically defined surfaces on adipocyte differentiation using various nanogroove patterns. Parallel nanogroove arrays with equal inter-groove distance (400, 550, 800 nm width) and varying distances (550 nm width with three different spacings of 550, 1100, and 2750 nm) were fabricated by UV-assisted capillary force lithography (CFL) on 18 mm diameter glass coverslips using biocompatible polyurethane (PU)-based material. After coating with fibronectin and subsequent culture of 3T3-L1 preadipocytes, the degree of adipocyte differentiation was determined by Oil Red O staining and adipogenic gene expression. We observed that adipocyte differentiation was slightly but substantially affected by culture on various nanogrooved surfaces. In particular, the cell crawling into nanogrooves contributed substantially to an enhanced level of differentiation with higher contact guidance, suggesting that cell-to-surface interactions would play a role for the adipocyte differentiation.

  8. Improved adipogenic in vitro differentiation: comparison of different adipogenic cell culture media on human fat and bone stroma cells for fat tissue engineering.

    PubMed

    Ghoniem, Amir-Alexander; Açil, Yahya; Wiltfang, Jörg; Gierloff, Matthias

    2015-06-01

    To date there is no sufficient in vitro fat tissue engineering and a protocol has not been well established for this purpose. Therefore, we evaluated the in vitro influence of two different adipogenic growth media for their stimulation potential on different cell lineages to clearly define the most potent adipogenic growth media for future in vitro tissue engineering approaches. The samples for differentiation were composed of human adipogenic-derived stroma cells (hADSCs) and human bone marrow mesenchymal stroma cells (hMSCs). A normal adipogenic medium (NAM) and a specific adipogenic medium (SAM) were tested for their adipogenic stimulation potential. After 10 days and 21 days the relative gene expression was measured for the adipogenic marker genes PPARγ2, C/EBPα, FABP4, LPL, and GLUT4 detected through real time reverse transcriptase polymease chain reaction (RT-PCR). Other study variables were the comparison between NAM and SAM and between the used cells hADSCs and hMSCs. Additionally an Oil-Red staining was performed after 21 days. Our results revealed that only SAM was significantly (P<0.05) superior in the differentiation process in contrast to NAM for 10 days and 21 days. As well was SAM superior to differentiate the used cell lineages. This was evaluated by the detected marker genes PPARγ2, C/EBPα, FABP4, LPL, and GLUT4 through real time RT-PCR and by Oil-Red staining. In addition, the hMSCs proofed to be equal donor cells for adipogenic differentiation especially when stimulated by SAM. The results suggest that the SAM should be established as a new standard medium for a more promising in vitro adipogenic differentiation.

  9. Decrease of apoptosis markers during adipogenic differentiation of mesenchymal stem cells from human adipose tissue.

    PubMed

    Lo Furno, Debora; Graziano, Adriana C E; Caggia, Silvia; Perrotta, Rosario E; Tarico, Maria Stella; Giuffrida, Rosario; Cardile, Venera

    2013-05-01

    Although the proliferation and differentiation of mesenchymal stem cells (MSCs) from adipose tissue (AT) have been widely studied, relatively little information is available on the underlying mechanism of apoptosis during the adipogenic differentiation. Thus, the aim of this study was to analyze how the expression of some apoptotic markers is affected by in vitro expansion during adipogenic differentiation of AT-MSCs. The cultures incubated or not with adipogenic medium were investigated by Western blot at 7, 14, 21, and 28 days for the production of p53, AKT, pAKT, Bax, PDCD4 and PTEN. MSCs were recognized for their immunoreactivity to MSC-specific cell types markers by immunocytochemical procedure. The effectiveness of adipogenic differentiation was assessed by staining with Sudan III and examination of adipogenic markers expression, such as PPAR-γ and FABP, at different time points by Western blot. The adipogenic differentiation medium led to the appearance, after 7 days, of larger rounded cells presenting numerous vacuoles containing lipids in which it was evident a red-orange staining, that increased in size in a time-dependent manner, parallel to an increase of the levels of expression of PPAR-γ and FABP. More than 50 % of human MSCs were fully differentiated into adipocytes within the four-week induction period. The results showed that during adipogenic differentiation of AT-MSCs the PI3K/AKT signaling pathway is activated and that p53, PTEN, PDCD4, and Bax proteins are down-regulated in time-dependent manner. Our data provide new information on the behavior of some apoptotic markers during adipogenic differentiation of AT-MSCs to apply for tissues repair and regeneration.

  10. Histone deacetylase 9 is a negative regulator of adipogenic differentiation.

    PubMed

    Chatterjee, Tapan K; Idelman, Gila; Blanco, Victor; Blomkalns, Andra L; Piegore, Mark G; Weintraub, Daniel S; Kumar, Santosh; Rajsheker, Srinivas; Manka, David; Rudich, Steven M; Tang, Yaoliang; Hui, David Y; Bassel-Duby, Rhonda; Olson, Eric N; Lingrel, Jerry B; Ho, Shuk-Mei; Weintraub, Neal L

    2011-08-05

    Differentiation of preadipocytes into mature adipocytes capable of efficiently storing lipids is an important regulatory mechanism in obesity. Here, we examined the involvement of histone deacetylases (HDACs) and histone acetyltransferases (HATs) in the regulation of adipogenesis. We find that among the various members of the HDAC and HAT families, only HDAC9 exhibited dramatic down-regulation preceding adipogenic differentiation. Preadipocytes from HDAC9 gene knock-out mice exhibited accelerated adipogenic differentiation, whereas HDAC9 overexpression in 3T3-L1 preadipocytes suppressed adipogenic differentiation, demonstrating its direct role as a negative regulator of adipogenesis. HDAC9 expression was higher in visceral as compared with subcutaneous preadipocytes, negatively correlating with their potential to undergo adipogenic differentiation in vitro. HDAC9 localized in the nucleus, and its negative regulation of adipogenesis segregates with the N-terminal nuclear targeting domain, whereas the C-terminal deacetylase domain is dispensable for this function. HDAC9 co-precipitates with USF1 and is recruited with USF1 at the E-box region of the C/EBPα gene promoter in preadipocytes. Upon induction of adipogenic differentiation, HDAC9 is down-regulated, leading to its dissociation from the USF1 complex, whereas p300 HAT is up-regulated to allow its association with USF1 and accumulation at the E-box site of the C/EBPα promoter in differentiated adipocytes. This reciprocal regulation of HDAC9 and p300 HAT in the USF1 complex is associated with increased C/EBPα expression, a master regulator of adipogenic differentiation. These findings provide new insights into mechanisms of adipogenic differentiation and document a critical regulatory role for HDAC9 in adipogenic differentiation through a deacetylase-independent mechanism.

  11. Mitochondrial respiration regulates adipogenic differentiation of human mesenchymal stem cells.

    PubMed

    Zhang, Yanmin; Marsboom, Glenn; Toth, Peter T; Rehman, Jalees

    2013-01-01

    Human mesenchymal stem cells (MSCs) are adult multipotent stem cells which can be isolated from bone marrow, adipose tissue as well as other tissues and have the capacity to differentiate into a variety of mesenchymal cell types such as adipocytes, osteoblasts and chondrocytes. Differentiation of stem cells into mature cell types is guided by growth factors and hormones, but recent studies suggest that metabolic shifts occur during differentiation and can modulate the differentiation process. We therefore investigated mitochondrial biogenesis, mitochondrial respiration and the mitochondrial membrane potential during adipogenic differentiation of human MSCs. In addition, we inhibited mitochondrial function to assess its effects on adipogenic differentiation. Our data show that mitochondrial biogenesis and oxygen consumption increase markedly during adipogenic differentiation, and that reducing mitochondrial respiration by hypoxia or by inhibition of the mitochondrial electron transport chain significantly suppresses adipogenic differentiation. Furthermore, we used a novel approach to suppress mitochondrial activity using a specific siRNA-based knockdown of the mitochondrial transcription factor A (TFAM), which also resulted in an inhibition of adipogenic differentiation. Taken together, our data demonstrates that increased mitochondrial activity is a prerequisite for MSC differentiation into adipocytes. These findings suggest that metabolic modulation of adult stem cells can maintain stem cell pluripotency or direct adult stem cell differentiation.

  12. Zfp423 promotes adipogenic differentiation of bovine stromal vascular cells.

    PubMed

    Huang, Yan; Das, Arun Kr; Yang, Qi-Yuan; Zhu, Mei-Jun; Du, Min

    2012-01-01

    Intramuscular fat or marbling is critical for the palatability of beef. In mice, very recent studies show that adipocytes and fibroblasts share a common pool of progenitor cells, with Zinc finger protein 423 (Zfp423) as a key initiator of adipogenic differentiation. To evaluate the role of Zfp423 in intramuscular adipogenesis and marbling in beef cattle, we sampled beef muscle for separation of stromal vascular cells. These cells were immortalized with pCI neo-hEST2 and individual clones were selected by G418. A total of 288 clones (3×96 well plates) were isolated and induced to adipogenesis. The presence of adipocytes was assessed by Oil-Red-O staining. Three clones with high and low adipogenic potential respectively were selected for further analyses. In addition, fibro/adipogenic progenitor cells were selected using a surface marker, platelet derived growth factor receptor (PDGFR) α. The expression of Zfp423 was much higher (307.4±61.9%, P<0.05) in high adipogenic cells, while transforming growth factor (TGF)-β was higher (156.1±48.7%, P<0.05) in low adipogenic cells. Following adipogenic differentiation, the expression of peroxisome proliferator-activated receptor γ (PPARγ) and CCAAT/enhancer binding protein α (C/EBPα) were much higher (239.4±84.1% and 310.7±138.4%, respectively, P<0.05) in high adipogenic cells. Over-expression of Zfp423 in stromal vascular cells and cloned low adipogenic cells dramatically increased their adipogenic differentiation, accompanied with the inhibition of TGF-β expression. Zfp423 knockdown by shRNA in high adipogenic cells largely prevented their adipogenic differentiation. The differential regulation of Zfp423 and TGF-β between low and high adipogenic cells is associated with the DNA methylation in their promoters. In conclusion, data show that Zfp423 is a critical regulator of adipogenesis in stromal vascular cells of bovine muscle, and Zfp423 may provide a molecular target for enhancing intramuscular adipogenesis

  13. Distinct adipogenic differentiation phenotypes of human umbilical cord mesenchymal cells dependent on adipogenic conditions.

    PubMed

    Saben, Jessica; Thakali, Keshari M; Lindsey, Forrest E; Zhong, Ying; Badger, Thomas M; Andres, Aline; Shankar, Kartik

    2014-10-01

    The umbilical cord (UC) matrix is a source of multipotent mesenchymal stem cells (MSCs) that have adipogenic potential and thus can be a model to study adipogenesis. However, existing variability in adipocytic differentiation outcomes may be due to discrepancies in methods utilized for adipogenic differentiation. Additionally, functional characterization of UCMSCs as adipocytes has not been described. We tested the potential of three well-established adipogenic cocktails containing IBMX, dexamethasone, and insulin (MDI) plus indomethacin (MDI-I) or rosiglitazone (MDI-R) to stimulate adipocyte differentiation in UCMSCs. MDI, MDI-I, and MDI-R treatment significantly increased peroxisome proliferator-activated receptor gamma (PPARγ) and CCAAT-enhancer binding protein alpha (C/EBPα) mRNA and induced lipid droplet formation. However, MDI-I had the greatest impact on mRNA expression of PPARγ, C/EBPα, FABP4, GPD1, PLIN1, PLIN2, and ADIPOQ and lipid accumulation, whereas MDI showed the least. Interestingly, there were no treatment group differences in the amount of PPARγ protein. However, MDI-I treated cells had significantly more C/EBPα protein compared to MDI or MDI-R, suggesting that indomethacin-dependent increased C/EBPα may contribute to the adipogenesis-inducing potency of MDI-I. Additionally, bone morphogenetic protein 4 (BMP4) treatment of UCMSCs did not enhance responsiveness to MDI-induced differentiation. Finally to characterize adipocyte function, differentiated UCMSCs were stimulated with insulin and downstream signaling was assessed. Differentiated UCMSCs were responsive to insulin at two weeks but showed decreased sensitivity by five weeks following differentiation, suggesting that long-term differentiation may induce insulin resistance. Together, these data indicate that UCMSCs undergo adipogenesis when differentiated in MDI, MDI-I, and MDI-R, however the presence of indomethacin greatly enhances their adipogenic potential beyond that of

  14. The role of PIN1 on odontogenic and adipogenic differentiation in human dental pulp stem cells.

    PubMed

    Lee, Young-Man; Shin, Seung-Yun; Jue, Seong-Suk; Kwon, Il-Keun; Cho, Eun-Hee; Cho, Eui-Sic; Park, Sang-Hyuk; Kim, Eun-Cheol

    2014-03-15

    Recently, the involvement of PIN1, a peptidyl-prolyl cis/trans isomerase, has been reported in age-related bone homeostasis and adipogenesis. However, the role of PIN1 during odontogenic and adipogenic differentiation remains to be fully understood, particularly regarding human dental pulp stem cells (HDPSCs). Thus, in the present study, we have investigated the role of PIN1 in odontogenic and adipogenic differentiation of HDPSCs and signaling pathways possibly involved. PIN1 mRNA and protein level were upregulated in a time-dependent manner during adipogenic differentiation, increasing until 1 day of odontogenic induction and then steadily declined during odontogenic differentiation. Treatment of a known PIN1 inhibitor, juglone, significantly increased odontogenic differentiation as confirmed by alkaline phosphatase (ALP) activity, calcium deposition, and mRNAs induction of odontogenic markers [ALP, osteopontin (OPN), osteocalcin (OCN), dentin sialophosphoprotein (DSPP), and dentin matrix protein 1 (DMP-1)]. On the contrary, adipogenic differentiation was dramatically reduced upon juglone treatment, with concomitant downregulation of lipid droplet accumulation and adipogenic marker genes [peroxisome proliferation-activated receptor gamma (PPARγ), lipoprotein lipase (LPL), and adipocyte fatty acid-binding protein (AP2)]. In contrast to PIN1 inhibition, the overexpression of PIN1 via adenoviral infection (Ad-PIN1) in HDPSCs inhibited odontogenic differentiation but increased adipogenic differentiation, in which stem cell property markers such as stage-specific embryonic antigen-4 (SSEA-4) and STRO-1 were upregulated during odontogenic differentiation but downregulated in adiopogenic differentiation. Consistently, juglone-mediated inhibition of PIN1 augmented the osteogenic medium (OM)-induced activation of bone morphogenetic protein (BMP), Wnt/β-catenin, extracellular signal-regulated kinase (ERK), c-Jun N-terminal kinase (JNK), and nuclear factor-kappa B (NF

  15. Mechanical strain regulates osteogenic and adipogenic differentiation of bone marrow mesenchymal stem cells.

    PubMed

    Li, Runguang; Liang, Liang; Dou, Yonggang; Huang, Zeping; Mo, Huiting; Wang, Yaning; Yu, Bin

    2015-01-01

    This study examined the effects of mechanical strain on osteogenic and adipogenic differentiation of cultured MSCs by stimulating MSCs cultured in general and adipogenic differentiation media using a mechanical strain device. Markers of osteogenic (Runx2, Osx, and I-collagen) and adipogenic (PPARγ-2, C/EBPα, and lipid droplets) differentiation were examined using real-time PCR, western blot, immunocytochemical, or histochemical stain analyses. Levels of Runx2 and Osx gradually increased in MSC groups in general medium subject to strain stimulation, as compared with in unstrained groups. After adding the stress signal, I-collagen protein levels of expression were obviously promoted in cells in comparison to the controls. The levels of PPARγ-2 and C/EBPα were decreased, and the emergence of lipid droplets was delayed in MSCs groups in adipogenic differentiation medium subject to strain stimulation, as compared with in unstrained groups. Mechanical strain can promote differentiation of MSCs into osteoblasts and can impede differentiation into adipocytes. These results clarify the mechanisms underlying the effects of exercise on bone repair and reconstruction and provide a more adequate scientific basis for the use of exercise therapy in the treatment of obesity and metabolic osteoporosis.

  16. Conditioned media cause increases in select osteogenic and adipogenic differentiation markers in mesenchymal stem cell cultures.

    PubMed

    Maxson, Scott; Burg, Karen J L

    2008-01-01

    The optimal mesenchymal stem cell (MSC) culture conditions that would allow clinically viable tissue-engineered devices are still yet to be determined. Most MSCs are found in the bone marrow, an area that also contains numerous osteoblasts and adipocytes. Paracrine signalling may be leveraged to modulate MSC differentiation in the preparation of a tissue-engineered device. Thus, the objectives of this study were to determine the effects of adipocyte-conditioned medium (CM) on MSC differentiation to osteoblasts and to determine the effects of osteoblast CM on MSC differentiation to adipocytes. Two groups of murine MSCs were given either an osteogenic differentiation medium or an adipogenic differentiation medium. CM was taken from one group and administered to the opposite group in concentrations of 25% or 50%. Metabolic activity, total protein and alkaline phosphatase (ALP) assays were conducted on the osteogenic group at predefined time points throughout the 21 day study, while metabolic activity, triglyceride and oil red O assays were conducted on the adipogenic group at predefined time points. Adipocyte CM administered at a concentration of 50% increased the ALP production of MSCs undergoing osteogenic differentiation. Additionally, osteoblast CM increased the triglyceride production of MSCs undergoing adipogenic differentiation and enlarged the lipid vesicles that were produced by the cells. The effects of the osteoblast CM were seen at both concentrations, but were greatest at the 50% CM level.

  17. Dimethylfumarate suppresses adipogenic differentiation in 3T3-L1 preadipocytes through inhibition of STAT3 activity.

    PubMed

    Kang, Hyeon-Ji; Seo, Hyun-Ae; Go, Younghoon; Oh, Chang Joo; Jeoung, Nam Ho; Park, Keun-Gyu; Lee, In-Kyu

    2013-01-01

    The excessive accumulation of adipocytes contributes to the development of obesity and obesity-related diseases. The interactions of several transcription factors, such as C/EBPβ, PPARγ, C/EBPα, Nrf2, and STAT3, are required for adipogenic differentiation. Dimethylfumarate (DMF), an immune modulator and antioxidant, may function as an inhibitor of STAT3 and an activator of Nrf2. This study examined whether DMF inhibits adipogenic differentiation of 3T3-L1 preadipocytes by inhibiting STAT3 or activating Nrf2. DMF suppressed 3T3-L1 preadipocyte differentiation to mature adipocytes in a dose-dependent manner as determined by Oil Red O staining. The mRNA and protein levels of adipogenic genes, including C/EBPβ, C/EBPα, PPARγ, SREBP-1c, FAS, and aP2, were significantly lower in DMF-treated 3T3-L1 preadipocytes. Suppression of adipogenic differentiation by DMF treatment resulted primarily from inhibition of the early stages of differentiation. DMF inhibits clonal expansion during adipogenic differentiation through induction of a G1 cell cycle arrest. Additionally, DMF regulates cell cycle-related proteins, such as p21, pRb, and cyclin D. DMF treatment markedly inhibited differentiation medium-induced STAT3 phosphorylation and inhibited STAT3 transcriptional activation of a reporter construct composed of four synthetic STAT3-response elements. Moreover, inhibition of endogenous Nrf2 activity using a dominant negative Nrf2 did not abolish the DMF-induced inhibition of adipogenic differentiation of 3T3-L1 preadipocytes. In summary, DMF is a negative regulator of adipogenic differentiation based on its regulation of adipogenic transcription factors and cell cycle proteins. This negative regulation by DMF is mediated by STAT3 inhibition, but is unlikely to involve Nrf2 activation.

  18. Effect of cell density on adipogenic differentiation of mesenchymal stem cells.

    PubMed

    Lu, Hongxu; Guo, Likun; Wozniak, Michal J; Kawazoe, Naoki; Tateishi, Tetsuya; Zhang, Xingdong; Chen, Guoping

    2009-04-10

    The effect of cell density on the adipogenic differentiation of human bone marrow-derived mesenchymal stem cells (MSCs) was investigated by using a patterning technique to induce the formation of a cell density gradient on a micropatterned surface. The adipogenic differentiation of MSCs at a density gradient from 5 x 10(3) to 3 x 10(4) cells/cm2 was examined. Lipid vacuoles were observed at all cell densities after 1-3 weeks of culture in adipogenic differentiation medium although the lipid vacuoles were scarce at the low cell density and abundant at the high cell density. Real-time RT-PCR analysis showed that adipogenesis marker genes encoding peroxisome proliferator-activated receptor gamma2 (PPARgamma2), lipoprotein lipase (LPL), and fatty acid binding protein-4 (FABP4) were detected in the MSCs cultured at all cell densities. The results suggest that there was no apparent effect of cell density on the adipogenic differentiation of human MSCs.

  19. Effect of cell density on adipogenic differentiation of mesenchymal stem cells

    SciTech Connect

    Lu, Hongxu; Guo, Likun; Wozniak, Michal J.; Kawazoe, Naoki; Tateishi, Tetsuya; Zhang, Xingdong; Chen, Guoping

    2009-04-10

    The effect of cell density on the adipogenic differentiation of human bone marrow-derived mesenchymal stem cells (MSCs) was investigated by using a patterning technique to induce the formation of a cell density gradient on a micropatterned surface. The adipogenic differentiation of MSCs at a density gradient from 5 x 10{sup 3} to 3 x 10{sup 4} cells/cm{sup 2} was examined. Lipid vacuoles were observed at all cell densities after 1-3 weeks of culture in adipogenic differentiation medium although the lipid vacuoles were scarce at the low cell density and abundant at the high cell density. Real-time RT-PCR analysis showed that adipogenesis marker genes encoding peroxisome proliferator-activated receptor {gamma}2 (PPAR{gamma}2), lipoprotein lipase (LPL), and fatty acid binding protein-4 (FABP4) were detected in the MSCs cultured at all cell densities. The results suggest that there was no apparent effect of cell density on the adipogenic differentiation of human MSCs.

  20. Angiotensin II directly impairs adipogenic differentiation of human preadipose cells.

    PubMed

    Palominos, Marisol M; Dünner, Natalia H; Wabitsch, Martin; Rojas, Cecilia V

    2015-10-01

    Angiotensin II reduces adipogenic differentiation of preadipose cells present in the stroma-vascular fraction of human adipose tissue, which also includes several cell types. Because of the ability of non-adipose lineage cells in the stroma-vascular fraction to respond to angiotensin II, it is not possible to unequivocally ascribe the anti-adipogenic response to a direct effect of this hormone on preadipose cells. Therefore, we used the human Simpson-Golabi-Behmel syndrome (SGBS) preadipocyte cell strain to investigate the consequences of angiotensin II treatment on adipogenic differentiation under serum-free conditions, by assessing expression of typical adipocyte markers perilipin and fatty acid-binding protein 4 (FABP4), at the transcript and protein level. Reverse transcription-polymerase chain reaction showed that perilipin and FABP4 transcripts were, respectively, reduced to 0.33 ± 0.07 (P < 0.05) and 0.41 ± 0.19-fold (P < 0.05) in SGBS cells induced to adipogenic differentiation in the presence of angiotensin II. Western Blot analysis corroborated reduction of the corresponding proteins to 0.23 ± 0.21 (P < 0.01) and 0.46 ± 0.30-fold (P < 0.01) the respective controls without angiotensin II. Angiotensin II also impaired morphological changes associated with early adipogenesis. Hence, we demonstrated that angiotensin II is able to directly reduce adipogenic differentiation of SGBS preadipose cells.

  1. Temporal heterogeneity in single-cell gene expression and mechanical properties during adipogenic differentiation.

    PubMed

    Labriola, Nicholas R; Darling, Eric M

    2015-04-13

    Adipose-derived stem/stromal cells (ASCs) respond heterogeneously when exposed to lineage-specific induction medium. Variable responses at the single-cell level can be observed in the production of lineage-specific metabolites, expression of mRNA transcripts, and adoption of mechanical phenotypes. Understanding the relationship between the biological and mechanical characteristics for individual ASCs is crucial for interpreting how cellular heterogeneity affects the differentiation process. The goal of the current study was to monitor the gene expression of peroxisome proliferator receptor gamma (PPARG) in adipogenically differentiating ASC populations over two weeks, while also characterizing the expression-associated mechanical properties of individual cells using atomic force microscopy (AFM). Results showed that ASC mechanical properties did not change significantly over time in either adipogenic or control medium; however, cells expressing PPARG exhibited significantly greater compliance and fluidity compared to those lacking expression in both adipogenic and control media environments. The percent of PPARG+ cells in adipogenic samples increased over time but stayed relatively constant in controls. Previous reports of a slow, gradual change in cellular mechanical properties are explained by the increase in the number of positively differentiating cells in a sample rather than being reflective of actual, single-cell mechanical property changes. Cytoskeletal remodeling was more prevalent in adipogenic samples than controls, likely driving the adoption of a more compliant mechanical phenotype and upregulation of PPARG. The combined results reinforce the importance of understanding single-cell characteristics, in the context of heterogeneity, to provide more accurate interpretations of biological phenomena such as stem cell differentiation.

  2. SFRP2 enhanced the adipogenic and neuronal differentiation potentials of stem cells from apical papilla.

    PubMed

    Lin, Xiao; Dong, Rui; Diao, Shu; Yu, Guoxia; Wang, Liping; Li, Jun; Fan, Zhipeng

    2017-02-28

    Dental tissue-derived mesenchymal stem cells (MSCs) are easily obtained and considered as a favorable cell source for tissue engineering, but the regulation of direct differentiation is unknown, which restricts their application. The present study investigated the effect of SFRP2, a Wnt signaling modulator, on MSC differentiation using stem cells from apical papilla (SCAPs). The cells were cultured in specific inducing medium for adipogenic, neurogenic, or chondrogenic differentiation. Over-expression of SFRP2 via retroviral infection enhanced the adipogenic and neurogenic differentiation of SCAPs. While inhibit of Wnt pathway by IWR1-endo could enhance the neurogenic differentiation potentials of SCAPs, similar with the function of SFRP2. In addition, over-expression of SFRP2 up-regulated the expression of stemness-related genes SOX2 and OCT4. Furthermore, SOX2 and OCT4 expression was significantly inhibited after lentiviral silencing of SFRP2 in SCAPs. Therefore, our results suggest that SFRP2 enhances the adipogenic and neurogenic differentiation potentials of SCAPs by up-regulating SOX2 and OCT4. Moreover, the effect of SFRP2 in neurogenic differentiation of SCAPs maybe also associated with Wnt inhibition. Our results provided useful information about the molecular mechanism underlying directed differentiation in dental tissue-derived MSCs.

  3. Low frequency mechanical stimulation inhibits adipogenic differentiation of C3H10T1/2 mesenchymal stem cells.

    PubMed

    Khayat, Ghazaleh; Rosenzweig, Derek H; Quinn, Thomas M

    2012-04-01

    Oscillatory mechanical stimulation at relatively high frequencies (0.1 Hz) has been shown to inhibit adipogenic and promote osteogenic differentiation of mesenchymal stem cells. However, for physiological interpretations and ease of implementation it is of interest to know whether different rates of mechanical stimulation can produce similar results. We hypothesized that relatively low frequency mechanical stimulation (0.01 Hz) can inhibit adipogenic differentiation of C3H10T1/2 mouse mesenchymal stem cells, even in a potent adipogenic differentiation medium. C3H10T1/2 cells were cultured in adipogenic medium under control (non-mechanically stimulated) conditions and under oscillatory surface stretch with 10% amplitude and 0.01 Hz frequency for 6h per day for up to 5 days. Cell population was assessed by counting and adipogenic differentiation was assessed by real-time quantitative PCR (qPCR) analysis of peroxisome proliferator-activated receptor gamma (PPARγ) and fatty acid binding protein 4 (FABP4) after 3 and 5 days. Involvement of the ERK signaling pathway was assessed by Western blot. Low frequency mechanical stimulation significantly decreased expression of PPARγ after 3 days and FABP4 after 3 and 5 days versus non-stimulated culture. ERK signaling was decreased in mechanically-stimulated culture, indicating a role in the inhibition of adipogenic differentiation. Application of this study: Low frequency mechanical stimulation may provide a technically simple means for control of mesenchymal stem cell differentiation in cell-based therapies, particularly for inhibition of differentiation toward undesired adipogenic lineages.

  4. Effects of serial passaging on the adipogenic and osteogenic differentiation potential of adipose-derived human mesenchymal stem cells.

    PubMed

    Wall, Michelle E; Bernacki, Susan H; Loboa, Elizabeth G

    2007-06-01

    Adipose-derived human mesenchymal stem cells (hMSCs) will be more valuable for tissue engineering applications if they can be extensively subcultured without loss of phenotype and multilineage differentiation ability. This study examined the effects of serial passaging on growth rate, gene expression, and differentiation potential of adipose-derived hMSCs. Differentiation was assessed by analyzing changes in messenger RNA (mRNA) expression of osteogenic and adipogenic marker genes and by determining production of calcium deposits and lipid vacuoles. Cells cultured in osteogenic medium for 2 weeks upregulated expression of alkaline phosphatase mRNA relative to cells in growth medium, and deposited calcium. Calcium deposition decreased in cells from passages 4 to 6 but returned to levels near or above those of primary cells by passage 10. Cells cultured in adipogenic medium upregulated expression of lipoprotein lipase and peroxisome proliferator activated receptor-gamma mRNA relative to cells in growth medium, and formed lipid vacuoles at all passages. By passage 8, however, cells in adipogenic medium also deposited calcium. Growth rate was stable through passage 5, then decreased. The results of this study indicate that adipose-derived hMSCs are capable of both adipogenic and osteogenic differentiation through 10 passages (34 population doublings) but that osteogenic differentiation may start to dominate at later passages.

  5. NCoR negatively regulates adipogenic differentiation of mesenchymal stem cells.

    PubMed

    Hong-Wei, Gao; Lan, Liu; De-Guo, Xing; Zhong-Hao, Liu; Peng, Ren; Zhi-Qiang, Li; Guo-Qiang, Shan; Ming-Zhi, Gong

    2015-08-01

    The nuclear receptor corepressor (NCoR) regulates the activities of gene transcription. Mesenchymal stem cells (MSCs) derived from bone marrow are multipotent cells which can differentiate into osteoblasts and adipocytes. This study was conducted to investigate the effects of NCoR on adipogenic differentiation of MSCs isolated from the rats. The results suggested that rat MSCs could differentiate into adipocytes successfully after cultured in adipogenic medium. NCoR protein determined by Western blot showed a lower expression in MSC-derived adipocytes, indicating that NCoR was involved in adipocyte differentiation of rat MSCs. It further proved that small interfering RNA (siRNA)-mediated knockdown of NCoR could promote cell viability and differentiation and enhance messenger RNA (mRNA) expression of lipoprotein lipase (LPL) and protein expression of CCAAT/enhancer binding protein-α (C/EBPα) and peroxisome proliferator-activated receptor-γ (PPARγ). However, over-expression of NCoR exerted its functions in contrary to NCoR knockdown. It indicated that NCoR could negatively regulate adipogenic differentiation of rat MSCs.

  6. Cisplatin impaired adipogenic differentiation of adipose mesenchymal stem cells.

    PubMed

    Chang, Yu-Hsun; Liu, Hwan-Wun; Chu, Tang-Yuan; Wen, Yao-Tseng; Ding, Dah-Ching

    2017-02-03

    Adipose mesenchymal stem cells (ASCs) were isolated from the adipose tissue and can be induced in vitro to differentiate into osteoblasts, chondroblasts, myocytes, neurons and other cell types. Cisplatin is a commonly used chemotherapy drug for cancer patients. However, the effects of cisplatin on ASC remain elusive. This study found that high-concentration cisplatin affects the viability of ASCs. First, IC50 concentration of cisplatin was evaluated. Proliferation of ASCs assessed by XTT method decreased immediately after cisplatin treatment with various concentrations. ASCs maintained mesenchymal stem cells surface markers evaluating by flow cytometry after cisplatin treatment. Upon differentiation by adding specific chemicals, a significant decrease in adipogenic differentiation (by Oil red staining) and osteogenic differentiation (by Alizarin red staining), and significant chondrogenic differentiation (by Alcian blue staining) were found after cisplatin treatment. Simultaneously, qRT-PCR was also used for evaluating the specific gene expressions after various differentiations. Finally, ASCs from one donor who had received cisplatin showed significantly decreased adipogenic differentiation but increased osteogenic differentiation compared with ASCs derived from one healthy donor. In conclusion, cisplatin affects the viability, proliferation, and differentiation of ASCs both in vitro and in vivo via certain signaling pathway such as p53 and Fas/FasL. The differentiation abilities of ASCs should be evaluated before their transplantation for repairing cisplatin-induced tissue damage.

  7. Phorbaketal A inhibits adipogenic differentiation through the suppression of PPARγ-mediated gene transcription by TAZ.

    PubMed

    Byun, Mi Ran; Lee, Cham Han; Hwang, Jun-Ha; Kim, A Rum; Moon, Sung Ah; Sung, Mi Kyung; Roh, Jung-Rae; Hwang, Eun Sook; Hong, Jeong-Ho

    2013-10-15

    Obesity causes several metabolic diseases, including diabetes. Adipogenic differentiation is an important event for fat formation in obesity. Natural compounds that inhibit adipogenic differentiation are frequently screened to develop therapeutic drugs for treating obesity. Here we investigated the effects of phorbaketal A, a natural marine compound, on adipogenic differentiation of mesenchymal stem cells. Phorbaketal A significantly inhibited adipogenic differentiation as indicated by less fat droplets and decreased expression of adipogenic marker genes. The expression of TAZ (transcriptional coactivator with PDZ-binding motif), an inhibitor of adipogenic differentiation, significantly increased during adipogenic differentiation in the presence of phorbaketal A. Phorbaketal A increased the interaction of TAZ and PPARγ to suppress PPARγ (peroxisome proliferator-activated receptor γ) target gene expression. TAZ-depleted cells showed higher adipogenic potential than that of control cells even in the presence of phorbaketal A. During cellular signaling induced by phorbaketal A, ERK (extracellular signal-regulated kinase) played an important role in adipogenic suppression; an inhibitor of ERK blocked phorbaketal A-induced adipogenic suppression. Thus, the results show that phorbaketal A inhibits adipocyte differentiation through TAZ.

  8. Epigallocatechin Gallate Inhibits Mouse Mesenchymal Stem Cell Differentiation to Adipogenic Lineage.

    PubMed

    Chani, Baldeep; Puri, Veena; Chander Sobti, Ranbir; Puri, Sanjeev

    2016-01-01

    Epigallocatechin gallate (EGCG) is a major component of green tea polyphenols having a potent anti-oxidant potential. Besides inhibiting the growth of many cancer cell types and inducing proliferation and differentiation in keratinocytes, it has been shown to promote reduction of body fat. The fact that mesenchymal stem cells (MSCs) have ability to self-renew and differentiate into the cells of mesodermal lineages, such as fat and bone, it is, thus, possible that EGCG may directly be involved in affecting fat metabolism through its effect on mesenchymal stem cells. Hence, with this aim, the present study was designed to determine the effect of EGCG on mouse mesenchymal stem cells, C3H10T1/2 cells differentiation into adipocytes. To understand this process, the cells were incubated with varying concentrations of EGCG (1 μM, 5 μM, 10 μM, 50 μM) in the presence and /or absence of adipogenic medium for 9 days. The results demonstrated that, EGCG inhibited the cells proliferation, migration and also prevented their differentiation to adipogenic lineage. These effects were analyzed through the inhibition of wound healing activity, reduction in Oil red O stained cells, together with decrease in the expression of Adipisin gene following EGCG treatment. These observations thus demonstrated anti-adipogenic effect of EGCG with a possibility of its role in the therapeutic intervention of obesity.

  9. Prostaglandin E2 impairs osteogenic and facilitates adipogenic differentiation of human bone marrow stromal cells.

    PubMed

    Noack, Carolin; Hempel, Ute; Preissler, Carolin; Dieter, Peter

    2015-03-01

    The synthetic glucocorticoid dexamethasone (dex) is a mandatory additive to induce osteogenic differentiation of bone marrow stromal cell (BMSC) in vitro; however it is also known to promote the pathogenesis of osteoporotic bone disease in vivo. In this study human (h)BMSC were cultured in osteogenic medium containing β-glycerophosphate and ascorbate (OM) and in OM containing dex (OM/D). It was seen that dex induced in human (h)BMSC both, osteogenic and adipogenic differentiation markers. Dex reveals its anti-inflammatory effect by reducing endogenous prostaglandin E2 (PGE2) formation and by suppressing the inducible enzymes cyclooxygenase 2 and microsomal PGE2 synthase 1. It was further seen that dex enhanced the expression of prostaglandin receptors, mainly EP2 and EP4 receptor subtypes. We thus hypothesized that dex enforces the susceptibility of hBMSC to respond to exogenous PGE2. Permanent exposure of hBMSC which were cultured in OM/D to PGE2, decreased osteogenic and increased adipogenic differentiation markers. The effects of PGE2 were preferentially mediated by receptor subtypes EP2 and EP4; EP1 was partially involved in pro-adipogenic effects, and EP3 was partially involved in anti-osteogenic effects. These results suggest that dex suppresses the formation of endogenous PGE2 but also enables hBMSC to respond to PGE2 due to the induction of PGE2 receptors EP2 and EP4. PGE2 then shifts in hBMSC the balance from osteogenic to adipogenic differentiation.

  10. Nuclear receptor profile in calvarial bone cells undergoing osteogenic versus adipogenic differentiation.

    PubMed

    Pirih, Flavia Q; Abayahoudian, Rosette; Elashoff, David; Parhami, Farhad; Nervina, Jeanne M; Tetradis, Sotirios

    2008-12-01

    Nuclear receptors (NRs) are key regulators of cell function and differentiation. We examined NR expression during osteogenic versus adipogenic differentiation of primary mouse calvarial osteoblasts (MOBs). MOBs were cultured for 21 days in osteogenic or adipogenic differentiation media. von Kossa and Oil Red O staining, and qRT-PCR of marker genes and 49 NRs were performed. PCR amplicons were subcloned to establish correct sequences and absolute standard curves. Forty-three NRs were detected at days 0-21. Uncentered average linkage hierarchical clustering identified four expression clusters: NRs (1) upregulated during osteogenic, but not adipogenic, differentiation, (2) upregulated in both conditions, with greater upregulation during adipogenic differentiation, (3) upregulated equally in both conditions, (4) downregulated during adipogenic, but not osteogenic, differentiation. One-way ANOVA with contrast revealed 20 NRs upregulated during osteogenic differentiation and 12 NRs upregulated during adipogenic differentiation. Two-way ANOVA demonstrated that 18 NRs were higher in osteogenic media, while 9 NRs were higher in adipogenic media. The time effect revealed 16 upregulated NRs. The interaction of condition with time revealed 6 NRs with higher expression rate during adipogenic differentiation and 3 NRs with higher expression rate during osteogenic differentiation. Relative NR abundance at days 0 and 21 were ranked. Basal ranking changed at least 5 positions for 13 NRs in osteogenic media and 9 NRs in adipogenic media. Osteogenic and adipogenic differentiation significantly altered NR expression in MOBs. These differences offer a fingerprint of cellular commitment and may provide clues to the underlying mechanisms of osteogenic versus adipogenic differentiation.

  11. Nuclear Receptor Profile in Calvarial Bone Cells Undergoing Osteogenic Versus Adipogenic Differentiation

    PubMed Central

    Pirih, Flavia Q.; Abayahoudian, Rosette; Elashoff, David; Parhami, Farhad; Nervina, Jeanne M.; Tetradis, Sotirios

    2017-01-01

    Nuclear receptors (NRs) are key regulators of cell function and differentiation. We examined NR expression during osteogenic versus adipogenic differentiation of primary mouse calvarial osteoblasts (MOBs). MOBs were cultured for 21 days in osteogenic or adipogenic differentiation media. von Kossa and Oil Red O staining, and qRT-PCR of marker genes and 49 NRs were performed. PCR amplicons were subcloned to establish correct sequences and absolute standard curves. Forty-three NRs were detected at days 0–21. Uncentered average linkage hierarchical clustering identified four expression clusters: NRs (1) upregulated during osteogenic, but not adipogenic, differentiation, (2) upregulated in both conditions, with greater upregulation during adipogenic differentiation, (3) upregulated equally in both conditions, (4) downregulated during adipogenic, but not osteogenic, differentiation. One-way ANOVA with contrast revealed 20 NRs upregulated during osteogenic differentiation and 12 NRs upregulated during adipogenic differentiation. Two-way ANOVA demonstrated that 18 NRs were higher in osteogenic media, while 9 NRs were higher in adipogenic media. The time effect revealed 16 upregulated NRs. The interaction of condition with time revealed 6 NRs with higher expression rate during adipogenic differentiation and 3 NRs with higher expression rate during osteogenic differentiation. Relative NR abundance at days 0 and 21 were ranked. Basal ranking changed at least 5 positions for 13 NRs in osteogenic media and 9 NRs in adipogenic media. Osteogenic and adipogenic differentiation significantly altered NR expression in MOBs. These differences offer a fingerprint of cellular commitment and may provide clues to the underlying mechanisms of osteogenic versus adipogenic differentiation. PMID:18810760

  12. Effects of Cimicifugae Rhizoma on the osteogenic and adipogenic differentiation of stem cells

    PubMed Central

    Lee, Ji-Eun; Kim, Bo-Bae; Ko, Youngkyung; Jeong, Su-Hyeon; Park, Jun-Beom

    2017-01-01

    Cimicifugae Rhizoma, a herb with a long history of use in traditional Oriental medicine is reported to have anti-inflammatory, antioxidant, anti-complement and anticancer effects. The aim of the present study was to evaluate the effects of Cimicifugae Rhizoma extracts on the osteogenic and adipogenic differentiation of human stem cells derived from gingiva. Stem cells derived from gingiva were grown in the presence of Cimicifugae Rhizoma at final concentrations of 0.1, 1 and 10 µg/ml. Cell proliferation analyses were performed at day 15. For osteogenic differentiation experiments, the stem cells were cultured in osteogenic media containing β-glycerophosphate, ascorbic acid-2-phosphate and dexamethasone, and osteogenic differentiation was evaluated by analysis of osteocalcin expression at 21 days. For adipogenic differentiation experiments, the stem cells were grown in adipogenic induction medium, and the adipogenic differentiation was evaluated by analysis of adipocyte fatty acid-binding protein at day 14. The cultures grown in the presence of 0.1 µg/ml Cimicifugae Rhizoma showed a significant increase in cellular proliferation at day 15 compared with the control group. The relative osteogenic differentiation in the presence of Cimicifugae Rhizoma for the 0.1, 1 and 10 µg/ml groups was 171.5±13.7, 125.6±28.7 and 150.5±9.0, respectively, when that of the untreated control group on day 21 was considered to be 100%. The relative adipogenic differentiation at day 14 of the 0.1, 1 and 10 µg/ml groups in the presence of Cimicifugae Rhizoma was 97.5±15.0, 102.9±12.8 and 87.0±6.8%, respectively when that of the untreated control group on day 14 was considered to be 100%. Within the limits of this study, Cimicifugae Rhizoma increased the proliferation of stem cells derived from the gingiva, and low concentrations of Cimicifugae Rhizoma may increase the osteogenic differentiation of stem cells. PMID:28352313

  13. Phenamil enhances the adipogenic differentiation of hen preadipocytes.

    PubMed

    Regassa, Alemu; Park, Kye Won; Kim, Woo Kyun

    2016-10-01

    A study was conducted to examine the effect of phenamil on adipogenic differentiation and expression of key adipogenic transcripts in hen preadipocytes. Preadipocytes were isolated from 20-week old Single Comb White Leghorn hens (Gallas gallus, Lohman strain). The experiment lasted for 48 h and had six treatments. Non-treated control (C) cells, cells treated with dexamethasone, 3-isobutyl-1-methylxanthine, insulin, and oleic acid (DMIOA) (T1), DMIOA + 15 μM phenamil (T2), DMIOA + 30 μM phenamil (T3), 15 μM phenamil alone (T4), and 30 μM phenamil alone (T5). Neutral lipid accumulation and the mRNA expression of key adipogenic transcripts were measured in all treatments and compared. Lipid accumulation was detected in T1, T2, and T3 only. Expression of peroxisome proliferator receptor-activator gamma 2 (PPARγ2), the core enhancer binding protein α (C/EBPα), C/EBPβ, fatty acid binding protein 4 (FABP4), and lipoprotein lipase (LPL) as well as ETS variant 4 (ETV4) and 5 was higher (P < 0.05) in T2, T3, T4, and T5 compared to C. Expression of these transcripts was higher (P < 0.05) in T2 and T3 compared to T4 and T5. The core enhancer binding protein α, C/EBPβ, and FABP4 were highly expressed (P < 0.05) in T1 compared to C. However, the expression of PPARγ2, LPL, and ETV4 and ETV5 was not significantly different. Expression of C/EBPα, C/EBPβ, and FABP4 was higher (P < 0.05) in T2 and T3 compared to T1. Expression of sterol regulatory element binding protein 1 (SREBP1) and leptin receptor (LEPR) was not significantly different among the treatments. In conclusion, phenamil enhances DMIOA-induced adipogenic differentiation of hen preadipocytes but does not induce adipogenesis by itself.

  14. Fibroblast growth factor-2 stimulates adipogenic differentiation of human adipose-derived stem cells

    SciTech Connect

    Kakudo, Natsuko . E-mail: kakudon@takii.kmu.ac.jp; Shimotsuma, Ayuko; Kusumoto, Kenji

    2007-07-27

    Adipose-derived stem cells (ASCs) have demonstrated a capacity for differentiating into a variety of lineages, including bone, cartilage, or fat, depending on the inducing stimuli and specific growth and factors. It is acknowledged that fibroblast growth factor-2 (FGF-2) promotes chondrogenic and inhibits osteogenic differentiation of ASCs, but thorough investigations of its effects on adipogenic differentiation are lacking. In this study, we demonstrate at the cellular and molecular levels the effect of FGF-2 on adipogenic differentiation of ASCs, as induced by an adipogenic hormonal cocktail consisting of 3-isobutyl-1-methylxanthine (IBMX), dexamethasone, insulin, and indomethacin. FGF-2 significantly enhances the adipogenic differentiation of human ASCs. Furthermore, in cultures receiving FGF-2 before adipogenic induction, mRNA expression of peroxisome proliferator-activated receptor {gamma}2 (PPAR{gamma}2), a key transcription factor in adipogenesis, was upregulated. The results of FGF-2 supplementation suggest the potential applications of FGF-2 and ASCs in adipose tissue regeneration.

  15. In vitro myogenic and adipogenic differentiation model of genetically engineered bovine embryonic fibroblast cell lines.

    PubMed

    Yin, Jinlong; Jin, Xun; Beck, Samuel; Kang, Dong Ho; Hong, Zhongshan; Li, Zhehu; Jin, Yongcheng; Zhang, Qiankun; Choi, Yun-Jaie; Kim, Sung-Chan; Kim, Hyunggee

    2010-02-01

    Our current understanding of muscle and adipose tissue development has been largely restricted to the study of murine myogenic and adipogenic cell lines, since attempts to establish these cell lines from other species have met with only limited success. Here we report that a spontaneously immortalized bovine embryonic fibroblast cell line (BEFS) undergoes differentiation into adipogenic or myogenic lineages when ectopically transduced with PPARgamma2 (an adipogenic lineage determinant) or MyoD (a myogenic lineage determinant) and grown in adipogenic and myogenic differentiation culture media (ADCM and MDCM, respectively). We also found that PPARgamma2-overexpressing BEFS cells (BEFS-PPARgamma2) grown in ADCM with or without the PPARgamma2 ligand, troglitazone, preferentially differentiate into adipogenic cells in the presence of ectopic MyoD expression. Ectopic expression of PPARgamma2 in the inducible MyoD-overepxressing BEFS cells (BEFS-TetOn-MyoD) completely suppresses myogenic differentiation and leads to a significant increase in adipogenic differentiation, suggesting that the adipogenic differentiation program might be dominant. Therefore, BEFS, BEFS-PPARgamma2, and BEFS-TetOn-MyoD would be a valuable biological model for understanding a fundamental principle underlying myogenic and adipogenic development, and for isolating various genetic and chemical factors that enable muscle and adipocyte differentiation.

  16. EGF and hydrocortisone as critical factors for the co-culture of adipogenic differentiated ASCs and endothelial cells.

    PubMed

    Volz, Ann-Cathrin; Huber, Birgit; Schwandt, Alina Maria; Kluger, Petra Juliane

    2017-01-20

    In vitro composed vascularized adipose tissue is and will continue to be in great demand e.g. for the treatment of extensive high-graded burns or the replacement of tissue after tumor removal. Up to date, the lack of adequate culture conditions, mainly a culture medium, decelerates further achievements. In our study, we evaluated the influence of epidermal growth factor (EGF) and hydrocortisone (HC), often supplemented in endothelial cell (EC) specific media, on the co-culture of adipogenic differentiated adipose-derived stem cells (ASCs) and microvascular endothelial cells (mvECs). In ASCs, EGF and HC are thought to inhibit adipogenic differentiation and have lipolytic activities. Our results showed that in indirect co-culture for 14 days, adipogenic differentiated ASCs further incorporated lipids and partly gained an univacuolar morphology when kept in media with low levels of EGF and HC. In media with high EGF and HC levels, cells did not incorporate further lipids, on the contrary, cells without lipid droplets appeared. Glycerol release, to measure lipolysis, also increased with elevated amounts of EGF and HC in the culture medium. Adipogenic differentiated ASCs were able to release leptin in all setups. MvECs were functional and expressed the cell specific markers, CD31 and von Willebrand factor (vWF), independent of the EGF and HC content as long as further EC specific factors were present. Taken together, our study demonstrates that adipogenic differentiated ASCs can be successfully co-cultured with mvECs in a culture medium containing low or no amounts of EGF and HC, as long as further endothelial cell and adipocyte specific factors are available.

  17. Human skeletal muscle fibroblasts, but not myogenic cells, readily undergo adipogenic differentiation.

    PubMed

    Agley, Chibeza C; Rowlerson, Anthea M; Velloso, Cristiana P; Lazarus, Norman R; Harridge, Stephen D R

    2013-12-15

    We characterised the adherent cell types isolated from human skeletal muscle by enzymatic digestion, and demonstrated that even at 72 hours after isolation these cultures consisted predominantly of myogenic cells (CD56(+), desmin(+)) and fibroblasts (TE-7(+), collagen VI(+), PDGFRα(+), vimentin(+), fibronectin(+)). To evaluate the behaviour of the cell types obtained, we optimised a double immuno-magnetic cell-sorting method for the separation of myogenic cells from fibroblasts. This procedure gave purities of >96% for myogenic (CD56(+), desmin(+)) cells. The CD56(-) fraction obtained from the first sort was highly enriched in TE-7(+) fibroblasts. Using quantitative analysis of immunofluorescent staining for lipid content, lineage markers and transcription factors, we tested if the purified cell populations could differentiate into adipocytes in response to treatment with either fatty acids or adipocyte-inducing medium. Both treatments caused the fibroblasts to differentiate into adipocytes, as shown by loss of intracellular TE-7, upregulation of the adipogenic transcription factors PPARγ and C/EBPα, and adoption of a lipid-laden adipocyte morphology. By contrast, myogenic cells did not undergo adipogenesis and showed differential regulation of PPARγ and C/EBPα in response to these adipogenic treatments. Our results show that human skeletal muscle fibroblasts are at least bipotent progenitors that can remain as extracellular-matrix-producing cells or differentiate into adipocytes.

  18. Adipogenic and osteogenic differentiation of Lin(-)CD271(+)Sca-1(+) adipose-derived stem cells.

    PubMed

    Xiao, Jingang; Yang, Xiaojuan; Jing, Wei; Guo, Weihua; Sun, Qince; Lin, Yunfeng; Liu, Lei; Meng, Wentong; Tian, Weidong

    2013-05-01

    Adipose-derived stem cells (ASCs) have been defined as cells that undergo sustained in vitro growth and have multilineage differentiation potential. However, the identity and purification of ASCs has proved elusive due to the lack of specific markers and poor understanding of their physiological roles. Here, we prospectively isolated and identified a restricted homogeneous subpopulation of ASCs (Lin(-)CD271(+)Sca-1(+)) from mouse adipose tissues on the basis of cell-surface markers. Individual ASCs generated colony-forming unit-fibroblast at a high frequency and could differentiate into adipocytes, osteoblasts, and chondrocytes in vitro. Expansion of ASCs in a large quantity was feasible in medium supplemented with fibroblast growth factor-2 and leukemia inhibitory factor, without loss of adipogenic and osteogenic differentiation capacity. Moreover, we found that the transplanted ASCs can differentiate into adipocytes in adipogenic microenvironment in vivo and osteoblasts in osteogenic microenvironment in vivo. Thus we proved that Lin, CD271, and Sca-1 could be used as the specific markers to purify ASCs from adipose tissue. The method we established to identify ASCs as defined in vivo entities will help develop ASCs transplantation as a new therapeutic strategy for bone regeneration and adipose tissue regeneration in clinic.

  19. Contrasting effect of perlecan on adipogenic and osteogenic differentiation of mesenchymal stem cells in vitro.

    PubMed

    Nakamura, Ryosuke; Nakamura, Fumio; Fukunaga, Shigeharu

    2014-03-01

    Perlecan, a basement membrane component, shows diverse functions in different organs and tissues. However, the role of perlecan in differentiation of mesenchymal stem cells (MSCs) has been barely investigated. In this study, we examined the effect of perlecan on adipogenic and osteogenic differentiation of MSCs in vitro by adding extrinsic perlecan to culture media or blocking the function of intrinsic perlecan expressed into culture media by differentiating MSCs. Extrinsic perlecan suppressed adipogenic differentiation; however, it promoted osteogenic differentiation. These functions were further confirmed by a study of blocking intrinsic perlecan. Perlecan treated with heparitinase-I also showed the suppressive effect on adipogenic differentiation. In contrast, the promotive effect on osteogenic differentiation was found to be heparan sulfate-dependent. Intrinsic perlecan was suggested to be effective at the late stage of adipogenic differentiation by a study of perlecan-blocking performed at distinct periods, but was suggested to be effective at the early stage of osteogenic differentiation. Our results showed perlecan has contrasting effect on adipogenic and osteogenic differentiation of MSCs due to its diverse actions. Based on these outcomes, we recognized that employing extrinsic perlecan or blocking intrinsic perlecan is effective for regulating adipogenic and osteogenic differentiation of MSCs by restricting its direction.

  20. Asiatic acid inhibits adipogenic differentiation of bone marrow stromal cells.

    PubMed

    Li, Zheng-Wei; Piao, Cheng-dong; Sun, Hong-hui; Ren, Xian-Sheng; Bai, Yun-Shen

    2014-03-01

    Bone marrow mesenchymal stromal cells (BMSCs) are the common precursors for both osteoblasts and adipocytes. With aging, BMSC osteoblast differentiation decreases whereas BMSC differentiation into adipocytes increases, resulting in increased adipogenesis and bone loss. In the present study, we investigated the effect of asiatic acid (AA) on adipocytic differentiation of BMSCs. AA inhibited the adipogenic induction of lipid accumulation, activity of glycerol-3-phosphate dehydrogenase, and expression of marker genes in adipogenesis: peroxisome proliferation-activated receptor (PPAR)γ, adipocyte fatty acid-binding protein (ap) 2, and adipsin. Further, we found that AA did not alter clonal expansion rate and expression of C/EBPβ, upstream key regulator of PPARγ, and binding activity of C/EBPβ to PPARγ promoter was not affected by AA as well. These findings suggest that AA may modulate differentiation of BMSCs to cause a lineage shift away from the adipocytes, and inhibition of PPARγ by AA is through C/EBPβ-independent mechanisms. Thus, AA could be a potential candidate for a novel drug against osteoporosis.

  1. Extracellular matrix of adipogenically differentiated mesenchymal stem cells reveals a network of collagen filaments, mostly interwoven by hexagonal structural units.

    PubMed

    Ullah, Mujib; Sittinger, Michael; Ringe, Jochen

    2013-01-01

    Extracellular matrix (ECM) is the non-cellular component of tissues, which not only provides biological shelter but also takes part in the cellular decisions for diverse functions. Every tissue has an ECM with unique composition and topology that governs the process of determination, differentiation, proliferation, migration and regeneration of cells. Little is known about the structural organization of matrix especially of MSC-derived adipogenic ECM. Here, we particularly focus on the composition and architecture of the fat ECM to understand the cellular behavior on functional bases. Thus, mesenchymal stem cells (MSC) were adipogenically differentiated, then, were transferred to adipogenic propagation medium, whereas they started the release of lipid droplets leaving bare network of ECM. Microarray analysis was performed, to indentify the molecular machinery of matrix. Adipogenesis was verified by Oil Red O staining of lipid droplets and by qPCR of adipogenic marker genes PPARG and FABP4. Antibody staining demonstrated the presence of collagen type I, II and IV filaments, while alkaline phosphatase activity verified the ossified nature of these filaments. In the adipogenic matrix, the hexagonal structures were abundant followed by octagonal structures, whereas they interwoven in a crisscross manner. Regarding molecular machinery of adipogenic ECM, the bioinformatics analysis revealed the upregulated expression of COL4A1, ITGA7, ITGA7, SDC2, ICAM3, ADAMTS9, TIMP4, GPC1, GPC4 and downregulated expression of COL14A1, ADAMTS5, TIMP2, TIMP3, BGN, LAMA3, ITGA2, ITGA4, ITGB1, ITGB8, CLDN11. Moreover, genes associated with integrins, glycoproteins, laminins, fibronectins, cadherins, selectins and linked signaling pathways were found. Knowledge of the interactive-language between cells and matrix could be beneficial for the artificial designing of biomaterials and bioscaffolds.

  2. Adipogenic differentiation potential of rat adipose tissue-derived subpopulations of stromal cells.

    PubMed

    Gierloff, M; Petersen, L; Oberg, H-H; Quabius, E S; Wiltfang, J; Açil, Y

    2014-10-01

    Adipose-derived stromal cells (ASCs) are mostly isolated by enzymatic digestion, centrifugation and adherent growth resulting in a very heterogeneous cell population. Therefore, other cell types in the cell culture can comprise the differentiation and proliferation potential of the ASC population. Recent studies indicated that an antibody-aided isolation of distinct ASC subpopulations provides advantages over the conventional method of ASC isolation. The aim of this study was to investigate the adipogenic differentiation potential of CD29-, CD71-, CD73- and CD90-selected ASCs in vitro. The stromal vascular fraction (SVF) was obtained from rat adipose tissue by enzymatic digestion and centrifugation. Subsequently, CD29(+)-, CD71(+)-, CD73(+)- and CD90(+) cells were isolated by magnetic activated cell sorting (MACS), seeded into culture plates and differentiated into the adipogenic lineage. ASCs isolated by adherent growth only served as controls. Adipogenic differentiation was assessed by Oil Red O staining and quantification of the adiponectin and leptin concentrations in the cell culture supernatants. Statistical analysis was carried out using one-way analysis of variance (ANOVA) followed by the Scheffe's post hoc procedure. The results showed that different subpopulations with different adipogenic differentiation potentials can be isolated by the MACS procedure. The highest adipogenic differentiation potential was determined in the CD29-selected ASC population followed by the unsorted ASC population. The CD71-, CD73- and CD90-selected cells exhibited significantly the lowest adipogenic differentiation potential. In conclusion, the CD29-selected ASCs and the unsorted ASCs exhibited a similar adipogenic differentiation potential. Therefore, we do not see a clear advantage in the application of an anti-CD29-based isolation of ASCs over the conventional technique using adherent growth. However, the research on isolation/purification methods of adipogenic ASCs should

  3. Endocrine disrupting chemicals affect the adipogenic differentiation of mesenchymal stem cells in distinct ontogenetic windows

    SciTech Connect

    Biemann, Ronald; Navarrete Santos, Anne; Navarrete Santos, Alexander; Riemann, Dagmar; Knelangen, Julia; Blueher, Matthias; Koch, Holger; Fischer, Bernd

    2012-01-13

    Highlights: Black-Right-Pointing-Pointer Endocrine disrupting chemicals affect adipogenesis in mesenchymal stem cells (MSC). Black-Right-Pointing-Pointer The adipogenic impact depends strongly on the window of exposure. Black-Right-Pointing-Pointer Bisphenol A reduces the potential of MSC to differentiate into adipocytes. Black-Right-Pointing-Pointer DEHP and TBT trigger the adipogenic differentiation of mesenchymal stem cells. Black-Right-Pointing-Pointer BPA, DEHP and TBT did not affect adipogenesis in embryonic stem cells. -- Abstract: Endocrine disrupting chemicals (EDC) like bisphenol A (BPA), bis(2-ethylhexyl)phthalate (DEHP) and tributyltin (TBT) are ubiquitously present in the environment and in human tissues. They bind to nuclear hormone receptors and affect cellular and developmental processes. In this study, we show that BPA, DEHP and TBT affect the adipogenic differentiation of murine mesenchymal stem cells (MSC, C3H/10T1/2) in a concentration-, stage- and compound-specific manner. C3H/10T1/2 cells and embryonic stem cells (CGR8) were exposed to BPA, DEHP or TBT at different stages of cell determination and differentiation (undifferentiated growth, adipogenic induction and terminal adipogenic differentiation). The final amount of differentiated adipocytes, cellular triglyceride content and mRNA expression of adipogenic marker genes (adiponectin, FABP4, PPAR{gamma}2, LPL) were quantified and compared with corresponding unexposed cells. BPA (10 {mu}M) decreased subsequent adipogenic differentiation of MSC, when cells were exposed during undifferentiated growth. In contrast, DEHP (100 {mu}M) during the hormonal induction period, and TBT (100 nM) in all investigated stages, enhanced adipogenesis. Importantly, exposure of undifferentiated murine embryonic stem cells did not show any effect of the investigated EDC on subsequent adipogenic differentiation.

  4. A new function of Nell-1 protein in repressing adipogenic differentiation.

    PubMed

    James, Aaron W; Pan, Angel; Chiang, Michael; Zara, Janette N; Zhang, Xinli; Ting, Kang; Soo, Chia

    2011-07-22

    A theoretical inverse relationship has long been postulated for osteogenic and adipogenic differentiation (bone versus adipose tissue differentiation). This inverse relationship in theory at least partially underlies the clinical entity of osteoporosis, in which marrow mesenchymal stem cells (MSCs) have a predilection for adipose differentiation that increases with age. In the present study, we assayed the potential anti-adipogenic effects of Nell-1 protein (an osteoinductive molecule). Using 3T3-L1 (a human preadipocyte cell line) cells and human adipose-derived stromal cells (ASCs), we observed that adenoviral delivered (Ad)-Nell-1 or recombinant NELL-1 protein significantly reduced adipose differentiation across all markers examined (Oil red O staining, adipogenic gene expression [Pparg, Lpl, Ap2]). In a prospective fashion, Hedgehog signaling was assayed as potentially downstream of Nell-1 signaling in regulating osteogenic over adipogenic differentiation. In comparison to Ad-LacZ control, Ad-Nell-1 increased expression of hedgehog signaling markers (Ihh, Gli1, Ptc1). These studies suggest that Nell-1 is a potent anti-adipogenic agent. Moreover, Nell-1 signaling may inhibit adipogenic differentiation via a Hedgehog dependent mechanism.

  5. Endocrine disrupting chemicals affect the adipogenic differentiation of mesenchymal stem cells in distinct ontogenetic windows.

    PubMed

    Biemann, Ronald; Navarrete Santos, Anne; Navarrete Santos, Alexander; Riemann, Dagmar; Knelangen, Julia; Blüher, Matthias; Koch, Holger; Fischer, Bernd

    2012-01-13

    Endocrine disrupting chemicals (EDC) like bisphenol A (BPA), bis(2-ethylhexyl)phthalate (DEHP) and tributyltin (TBT) are ubiquitously present in the environment and in human tissues. They bind to nuclear hormone receptors and affect cellular and developmental processes. In this study, we show that BPA, DEHP and TBT affect the adipogenic differentiation of murine mesenchymal stem cells (MSC, C3H/10T1/2) in a concentration-, stage- and compound-specific manner. C3H/10T1/2 cells and embryonic stem cells (CGR8) were exposed to BPA, DEHP or TBT at different stages of cell determination and differentiation (undifferentiated growth, adipogenic induction and terminal adipogenic differentiation). The final amount of differentiated adipocytes, cellular triglyceride content and mRNA expression of adipogenic marker genes (adiponectin, FABP4, PPARγ2, LPL) were quantified and compared with corresponding unexposed cells. BPA (10 μM) decreased subsequent adipogenic differentiation of MSC, when cells were exposed during undifferentiated growth. In contrast, DEHP (100 μM) during the hormonal induction period, and TBT (100 nM) in all investigated stages, enhanced adipogenesis. Importantly, exposure of undifferentiated murine embryonic stem cells did not show any effect of the investigated EDC on subsequent adipogenic differentiation.

  6. The Effects of High Glucose on Adipogenic and Osteogenic Differentiation of Gestational Tissue-Derived MSCs.

    PubMed

    Hankamolsiri, Weerawan; Manochantr, Sirikul; Tantrawatpan, Chairat; Tantikanlayaporn, Duangrat; Tapanadechopone, Pairath; Kheolamai, Pakpoom

    2016-01-01

    Most type 2 diabetic patients are obese who have increased number of visceral adipocytes. Those visceral adipocytes release several factors that enhance insulin resistance making diabetic treatment ineffective. It is known that significant percentages of visceral adipocytes are derived from mesenchymal stem cells and high glucose enhances adipogenic differentiation of mouse bone marrow-derived MSCs (BM-MSCs). However, the effect of high glucose on adipogenic differentiation of human bone marrow and gestational tissue-derived MSCs is still poorly characterized. This study aims to investigate the effects of high glucose on proliferation as well as adipogenic and osteogenic differentiation of human MSCs derived from bone marrow and several gestational tissues including chorion, placenta, and umbilical cord. We found that high glucose reduced proliferation but enhanced adipogenic differentiation of all MSCs examined. The expression levels of some adipogenic genes were also upregulated when MSCs were cultured in high glucose. Although high glucose transiently downregulated the expression levels of some osteogenic genes examined, its effect on the osteogenic differentiation levels of the MSCs is not clearly demonstrated. The knowledge gained from this study will increase our understanding about the effect of high glucose on adipogenic differentiation of MSCs and might lead to an improvement in the diabetic treatment in the future.

  7. Enhanced Adipogenic Differentiation of Human Adipose-Derived Stem Cells in an In Vitro Microenvironment: The Preparation of Adipose-Like Microtissues Using a Three-Dimensional Culture

    PubMed Central

    Miyamoto, Yoshitaka; Ikeuchi, Masashi; Noguchi, Hirofumi; Yagi, Tohru; Hayashi, Shuji

    2017-01-01

    The application of stem cells for cell therapy has been extensively studied in recent years. Among the various types of stem cells, human adipose tissue-derived stem cells (ASCs) can be obtained in large quantities with relatively few passages, and they possess a stable quality. ASCs can differentiate into a number of cell types, such as adipose cells and ectodermal cells. We therefore focused on the in vitro microenvironment required for such differentiation and attempted to induce the differentiation of human stem cells into microtissues using a microelectromechanical system. We first evaluated the adipogenic differentiation of human ASC spheroids in a three-dimensional (3D) culture. We then created the in vitro microenvironment using a 3D combinatorial TASCL device and attempted to induce the adipogenic differentiation of human ASCs. The differentiation of human ASC spheroids cultured in maintenance medium and those cultured in adipocyte differentiation medium was evaluated via Oil red O staining using lipid droplets based on the quantity of accumulated triglycerides. The differentiation was confirmed in both media, but the human ASCs in the 3D cultures contained higher amounts of triglycerides than those in the 2D cultures. In the short culture period, greater adipogenic differentiation was observed in the 3D cultures than in the 2D cultures. The 3D culture using the TASCL device with adipogenic differentiation medium promoted greater differentiation of human ASCs into adipogenic lineages than either a 2D culture or a culture using a maintenance medium. In summary, the TASCL device created a hospitable in vitro microenvironment and may therefore be a useful tool for the induction of differentiation in 3D culture. The resultant human ASC spheroids were “adipose-like microtissues” that formed spherical aggregation perfectly and are expected to be applicable in regenerative medicine as well as cell transplantation. PMID:28174673

  8. Enhanced Adipogenic Differentiation of Human Adipose-Derived Stem Cells in an In Vitro Microenvironment: The Preparation of Adipose-Like Microtissues Using a Three-Dimensional Culture.

    PubMed

    Miyamoto, Yoshitaka; Ikeuchi, Masashi; Noguchi, Hirofumi; Yagi, Tohru; Hayashi, Shuji

    2017-01-08

    The application of stem cells for cell therapy has been extensively studied in recent years. Among the various types of stem cells, human adipose tissue-derived stem cells (ASCs) can be obtained in large quantities with relatively few passages, and they possess a stable quality. ASCs can differentiate into a number of cell types, such as adipose cells and ectodermal cells. We therefore focused on the in vitro microenvironment required for such differentiation and attempted to induce the differentiation of human stem cells into microtissues using a microelectromechanical system. We first evaluated the adipogenic differentiation of human ASC spheroids in a three-dimensional (3D) culture. We then created the in vitro microenvironment using a 3D combinatorial TASCL device and attempted to induce the adipogenic differentiation of human ASCs. The differentiation of human ASC spheroids cultured in maintenance medium and those cultured in adipocyte differentiation medium was evaluated via Oil red O staining using lipid droplets based on the quantity of accumulated triglycerides. The differentiation was confirmed in both media, but the human ASCs in the 3D cultures contained higher amounts of triglycerides than those in the 2D cultures. In the short culture period, greater adipogenic differentiation was observed in the 3D cultures than in the 2D cultures. The 3D culture using the TASCL device with adipogenic differentiation medium promoted greater differentiation of human ASCs into adipogenic lineages than either a 2D culture or a culture using a maintenance medium. In summary, the TASCL device created a hospitable in vitro microenvironment and may therefore be a useful tool for the induction of differentiation in 3D culture. The resultant human ASC spheroids were "adipose-like microtissues" that formed spherical aggregation perfectly and are expected to be applicable in regenerative medicine as well as cell transplantation.

  9. Uric Acid Promotes Osteogenic Differentiation and Inhibits Adipogenic Differentiation of Human Bone Mesenchymal Stem Cells.

    PubMed

    Li, Hui-Zhang; Chen, Zhi; Hou, Cang-Long; Tang, Yi-Xing; Wang, Fei; Fu, Qing-Ge

    2015-08-01

    To investigate the effect of uric acid on the osteogenic and adipogenic differentiation of human bone mesenchymal stem cells (hBMSCs). The hBMSCs were isolated from bone marrow of six healthy donors. Cell morphology was observed by microscopy and cell surface markers (CD44 and CD34) of hBMSCs were analyzed by immunofluorescence. Cell morphology and immunofluorescence analysis showed that hBMSCs were successfully isolated from bone marrow. The number of hBMSCs in uric acid groups was higher than that in the control group on day 3, 4, and 5. Alizarin red staining showed that number of calcium nodules in uric acid groups was more than that of the control group. Oil red-O staining showed that the number of red fat vacuoles decreased with the increased concentration of uric acid. In summary, uric acid could promote the proliferation and osteogenic differentiation of hBMSCs while inhibit adipogenic differentiation of hBMSCs.

  10. Idesolide inhibits the adipogenic differentiation of mesenchymal cells through the suppression of nitric oxide production.

    PubMed

    Hwang, Jun-Ha; Moon, Sung Ah; Lee, Cham Han; Byun, Mi Ran; Kim, A Rum; Sung, Mi Kyung; Park, Hyun-Jin; Hwang, Eun Sook; Sung, Sang Hyun; Hong, Jeong-Ho

    2012-06-15

    Obesity is a major health problem worldwide and can increase the risk for several chronic diseases, including diabetes and cardiovascular disease. In this study, we screened small compounds isolated from natural products for the development of an anti-obesity drug. Among them, idesolide, a spiro compound isolated from the fruits of Idesia polycarpa Maxim, showed a significant suppression of the adipogenic differentiation in mesenchymal cells, as indicated by the decrease in fat droplets and expression of adipogenic marker genes such as aP2 and adiponectin. Idesolide inhibits the PPARγ-mediated gene transcription in a dose-dependent manner, revealed by luciferase reporter gene assay. During adipogenic differentiation, idesolide inhibits nitric oxide production through the suppression of iNOS expression, and the increased adipogenic differentiation by arginine, the substrate for NOS, is significantly inhibited by idesolide, suggesting that the inhibition of nitric oxide production plays a major role in idesolide-induced adipogenic suppression. Taken together, the results reveal that idesolide has anti-adipogenic activity and highlight its potential in the prevention and treatment of obesity.

  11. Roles of chondroitin sulfate proteoglycan 4 in fibrogenic/adipogenic differentiation in skeletal muscle tissues.

    PubMed

    Takeuchi, Shiho; Nakano, Shin-Ichi; Nakamura, Katsuyuki; Ozoe, Atsufumi; Chien, Peggie; Yoshihara, Hidehito; Hakuno, Fumihiko; Matsuwaki, Takashi; Saeki, Yasushi; Takahashi, Shin-Ichiro; Yamanouchi, Keitaro; Nishihara, Masugi

    2016-10-01

    Intramuscular adipose tissue and fibrous tissue are observed in some skeletal muscle pathologies such as Duchenne muscular dystrophy and sarcopenia, and affect muscle strength and myogenesis. They originate from common fibrogenic/adipogenic cells in the skeletal muscle. Thus, elucidating the regulatory mechanisms underlying fibrogenic/adipogenic cell differentiation is an important step toward the mediation of these disorders. Previously, we established a highly adipogenic progenitor clone, 2G11, from rat skeletal muscle and showed that basic fibroblast growth factor (bFGF) is pro-adipogenic in these cells. Here, we demonstrated that 2G11 cells give rise to fibroblasts upon transforming growth factor (TGF)-β1 stimulation, indicating that they possess mesenchymal progenitor cells (MPC)-like characteristics. The previously reported MPC marker PDGFRα is expressed in other cell populations. Accordingly, we produced monoclonal antibodies that specifically bind to 2G11 cell surface antigens and identified chondroitin sulfate proteoglycan 4 (CSPG4) as a potential MPC marker. Based on an RNA interference analysis, we found that CSPG4 is involved in both the pro-adipogenic effect of bFGF and in TGF-β-induced alpha smooth muscle actin expression and stress fiber formation. By establishing an additional marker for MPC detection and characterizing its role in fibrogenic/adipogenic differentiation, these results will facilitate the development of effective treatments for skeletal muscle pathologies.

  12. Diverse effects of cyclic AMP variants on osteogenic and adipogenic differentiation of human mesenchymal stromal cells.

    PubMed

    Doorn, Joyce; Leusink, Maarten; Groen, Nathalie; van de Peppel, Jeroen; van Leeuwen, Johannes P T M; van Blitterswijk, Clemens A; de Boer, Jan

    2012-07-01

    Osteogenic differentiation of human mesenchymal stromal cells (hMSCs) may potentially be used in cell-based bone tissue-engineering applications to enhance the bone-forming potential of these cells. Osteogenic differentiation and adipogenic differentiation are thought to be mutually exclusive, and although several signaling pathways and cues that induce osteogenic or adipogenic differentiation, respectively, have been identified, there is no general consensus on how to optimally differentiate hMSCs into the osteogenic lineage. Some pathways have also been reported to be involved in both adipogenic and osteogenic differentiation, as for example, the protein kinase A (PKA) pathway, and the aim of this study was to investigate the role of cAMP/PKA signaling in differentiation of hMSCs in more detail. We show that activation of this pathway with dibutyryl-cAMP results in enhanced alkaline phosphatase expression, whereas another cAMP analog induces adipogenesis in long-term mineralization cultures. Adipogenic differentiation, induced by 8-bromo-cAMP, was accompanied by stronger PKA activity and higher expression of cAMP-responsive genes, suggesting that stronger activation correlates with adipogenic differentiation. In addition, a whole-genome expression analysis showed an increase in expression of adipogenic genes in 8-br-cAMP-treated cells. Furthermore, by means of quantitative polymerase chain reaction, we show differences in peroxisome proliferator-activated receptor-γ activation, either alone or in combination with dexamethasone, thus demonstrating differential effects of the PKA pathway, most likely depending on its mode of activation.

  13. Arsenic trioxide regulates adipogenic and osteogenic differentiation in bone marrow MSCs of aplastic anemia patients through BMP4 gene.

    PubMed

    Cheng, Huan Chen; Liu, Sheng Wei; Li, Wei; Zhao, Xue Fei; Zhao, Xu; Cheng, Mei; Qiu, Lin; Ma, Jun

    2015-09-01

    The typical pathological feature of aplastic anemia (AA) is the rise in the number of fat cells and the reduction of osteoblasts in bone marrow. However, both fat cells and osteobalsts in bone marrow are derived from the mesenchymal stem cells (MSCs). Generally, the adipogenic and osteogenic differentiation is a dynamic and balanceable process. The imbalance of the adipogenic and osteogenic differentiation may participate in the occurrence and progress of many diseases. Arsenic trioxide (ATO) could induce differentiation and apoptosis in tumor cells. In this study, Oil Red-O and Alizarin red were used to detect the adipogenic and osteogenic differentiation. The ability of adipogenic differentiation is much higher, whereas the osteogenic differentiation is much lower in the MSCs of AA patients compared with healthy controls. ATO inhibits adipogenic differentiation and promotes osteogenic differentiation in the MSC of AA patients. The expression of BMP4 is increased with ATO treatment. The ability of adipogenic differentiation is decreased, whereas the osteogenic differentiation is increased after transfection of BMP4 gene into the MSCs of AA patients. This study shows that ATO regulates the adipogenic and osteogenic differentiation balance of MSCs in AA, which provides a theoretical basis for the adjunctive therapy of ATO on AA. The BMP4 gene is involved in the ATO regulation of adipogenic and osteogenic differentiation balance, which provides a new target for the treatment of AA.

  14. Transdifferentiation of adipogenically differentiated cells into osteogenically or chondrogenically differentiated cells: phenotype switching via dedifferentiation.

    PubMed

    Ullah, Mujib; Sittinger, Michael; Ringe, Jochen

    2014-01-01

    Reprogramming is a new wave in cellular therapies to achieve the vital goals of regenerative medicine. Transdifferentiation, whereas the differentiated state of cells could be reprogrammed into other cell types, meaning cells are no more locked in their differentiated circle. Hence, cells of choice from abundant and easily available sources such as fibroblast and adipose tissue could be converted into cells of demand, to restore the diseased tissues. Before diverting this new approach into effective clinical use, transdifferentiation could not be simply overlooked, as it challenges the normal paradigms of biological laws, where mature cells transdifferentiate not only within same germ layers, but even across the lineage boundaries. How unipotent differentiated cells reprogram into another, and whether transdifferentiation proceeds via a direct cell-to-cell conversion or needs dedifferentiation. To address such questions, MSC were adipogenically differentiated followed by direct transdifferentiation, and subsequently examined by histology, immunohistochemistry, qPCR and single cell analysis. Direct cellular conversion of adipogenic lineage cells into osteogenic or chondrogenic resulted in mixed culture of both lineage cells (adipogenic and new acquiring osteogenic/chondrogenic phenotypes). On molecular level, such conversion was confirmed by significantly upregulated expression of PPARG, FABP4, SPP1 and RUNX2. Chondrogenic transdifferentiation was verified by significantly upregulated expression of PPARG, FABP4, SOX9 and COL2A1. Single cell analysis did not support the direct cell-to-cell conversion, rather described the involvement of dedifferentiation. Moreover, some differentiated single cells did not change their phenotype and were resistant to transdifferentiation, suggesting that differentiated cells behave differently during cellular conversion. An obvious characterization of differentiated cells could be helpful to understand the process of

  15. Notch signalling inhibits the adipogenic differentiation of single-cell-derived mesenchymal stem cell clones isolated from human adipose tissue.

    PubMed

    Osathanon, Thanaphum; Subbalekha, Keskanya; Sastravaha, Panunn; Pavasant, Prasit

    2012-01-01

    ADSCs (adipose-derived mesenchymal stem cells) are candidate adult stem cells for regenerative medicine. Notch signalling participates in the differentiation of a heterogeneous ADSC population. We have isolated, human adipose tissue-derived single-cell clones using a cloning ring technique and characterized for their stem cell characteristics. The role of Notch signalling in the differentiation capacity of these adipose-derived single-cell-clones has also been investigated. All 14 clones expressed embryonic and mesenchymal stem cell marker genes. These clones could differentiate into both osteogenic and adipogenic lineages. However, the differentiation potential of each clone was different. Low adipogenic clones had significantly higher mRNA expression levels of Notch 2, 3 and 4, Jagged1, as well as Delta1, compared with those of high adipogenic clones. In contrast, no changes in expression of Notch signalling component mRNA between low and high osteogenic clones was found. Notch receptor mRNA expression decreased with the adipogenic differentiation of both low and high adipogenic clones. The γ-secretase inhibitor, DAPT (N-[N-(3,5-difluorophenacetyl)-l-alanyl]-(S)-phenylglycine t-butyl ester), enhanced adipogenic differentiation. Correspondingly, cells seeded on a Notch ligand (Jagged1) bound surface showed lower intracellular lipid accumulation. These results were noted in both low and high adipogenic clones, indicating that Notch signalling inhibited the adipogenic differentiation of adipose ADSC clones, and could be used to identify an adipogenic susceptible subpopulation for soft-tissue augmentation application.

  16. NLRP3 inflammasome activation in mesenchymal stem cells inhibits osteogenic differentiation and enhances adipogenic differentiation.

    PubMed

    Wang, Linghao; Chen, Ke; Wan, Xinxing; Wang, Fang; Guo, Zi; Mo, Zhaohui

    2017-03-18

    Osteoporosis is one of the most common skeletal disease featured by osteopenia and adipose accumulation in bone tissue. NLRP3 inflammasome activation is an essential player in aging-related chronic diseases like osteoporosis, particularly due to the causal caspase-1 activation and its correlation to adipose accumulation in bone tissue. Moreover, the expression of anti-aging/senescence SIRT1 was reported to decline along with aging. As the major cellular contributor of bone formation, mesenchymal stem cells (MSCs) are multipotent stem cells processing mutually exclusive differentiatability toward osteocytes or adipocytes. Therefore, we hypothesized that NLRP3 inflammasome activation promotes adipogenesis and repress osteogenesis in MSCs via inhibiting SIRT1 expression. We activated NLRP3 inflammasome in human MSCs via lipopolysaccharide and palmitic acid (LPS/PA) treatment for self-renewal maintenance, adipogenic differentiation or osteogenic differentiation. LPS/PA treatment significantly increased NLRP3 expression, decreased SIRT1 expression and promoted caspase-1 activity in MSCs. LPS/PA treatment also boosted adipogenesis of MSCs and suppressed osteogenesis. Moreover, inhibition of caspase-1 activity repressed adipogenic differentiation and partially improved osteogenic differentiation of MSCs with LPS/PA treatment. Our study demonstrated the pivotal roles of NLRP3 inflammasome and downstream mediator caspase-1 for the progress of osteo-differentiation MSCs, and offered novel therapeutic target of treatment for osteoporosis.

  17. Biocompatible silica nanoparticles-insulin conjugates for mesenchymal stem cell adipogenic differentiation.

    PubMed

    Liu, Dan; He, Xiaoxiao; Wang, Kemin; He, Chunmei; Shi, Hui; Jian, Lixin

    2010-09-15

    There is increasing interest in developing bioconjugated carriers for the cellular delivery of bioactive molecules to stem cells, since they can allow modulation of stem cell differentiation. The present study reported biocompatible silica nanoparticle-insulin conjugates for rat mesenchymal stem cell (RMSC) adipogenic differentiation in vitro. A systematic study was first carried out on the biocompatibility of the SiNPs with RMSCs. The cell viability assay was performed to screen the SiNP concentration for creating little cytotoxicity on RMSCs. Furthermore, transmission electron microscopy (TEM) and adipogenesis and osteogenesis assays revealed that the pure SiNPs had no effect on cellular ultrastructures, adipogenic differentiation, and osteogenic differentiation. Under the optimized SiNP concentration with little cytotoxicity on RMSC and no effects on the RMSC phenotype, SiNP-insulin conjugates were prepared and used for RMSC adipogenic differentiation. Results showed that RMSCs had the ability to differentiate into adipocytes when cultured in the presence of insulin-conjugated SiNPs. This work demonstrated that the biological activity of insulin conjugated to the SiNPs was not affected and the SiNPs could be used as biocompatibile carriers of insulin for RMSC adipogenic differentiation, which would help to expand the new potential application of SiNPs in stem cell research.

  18. Effect of gold nanoparticles on adipogenic differentiation of human mesenchymal stem cells

    NASA Astrophysics Data System (ADS)

    Kohl, Yvonne; Gorjup, Erwin; Katsen-Globa, Alisa; Büchel, Claudia; von Briesen, Hagen; Thielecke, Hagen

    2011-12-01

    Gold nanoparticles are very attractive for biomedical products. However, there is a serious lack of information concerning the biological activity of nanosized gold in human tissue cells. An influence of nanoparticles on stem cells might lead to unforeseen consequences to organ and tissue functions as long as all cells arising from the initial stem cell might be subsequently damaged. Therefore the effect of negatively charged gold nanoparticles (9 and 95 nm), which are certified as reference material for preclinical biomedical research, on the adipogenic differentiation of human mesenchymal stem cells (hMSCs) is investigated here. Bone marrow hMSCs are chosen as differentiation model since bone marrow hMSCs are well characterized and their differentiation into the adipogenic lineage shows clear and easily detectable differentiation. In this study effects of gold nanoparticles on adipogenic differentiation are analyzed regarding fat storage and mitochondrial activity after different exposure times (4-21 days). Using time lapse microscopy the differentiation progress under chronically gold nanoparticle treatment is continuously investigated. In this preliminary study, chronically treatment of adipogenic differentiating hMSCs with gold nanoparticles resulted in a reduced number and size of lipid vacuoles and reduced mitochondrial activity depending on the applied concentration and the surface charge of the particles.

  19. The Influence of Tetracycline Inducible Targeting Rat PPARγ Gene Silencing on the Osteogenic and Adipogenic Differentiation of Bone Marrow Stromal Cells.

    PubMed

    Feng, Xiaobo; Liu, Xianzhe; Cai, Xianyi; Lin, Tao; Xu, Weihua; Yang, Cao; Liu, Yongwei; Yang, Shuhua; Fu, Dehao

    2016-01-01

    Peroxisome proliferator-activated receptor γ (PPARγ) has been considered as the master regulator for adipogenesis of bone marrow stromal cells (BMSCs). However, there are few reports regarding the effect of PPARγ gene silencing on osteogenic and adipogenic differentiation in rat BMSCs, and no reports about tissue targeting and conditional knockdown of PPARγ gene. In this study, we construct rat PPARγ gene shRNA Tet-on lentiviral vector, the lentiviral vector facilitated tetracycline (which has the characteristics of bone targeting)-inducible knockdown specific to PPARγ gene, and transfect it into BMSCs, the silencing effects induced by tetracycline is significant. The expression of the adipogenic factors adipocyte determination and differentiation-dependent factor 1 (ADD1) and recombinant CCAAT/enhancer binding protein alpha (C/EBPα) were decreased as measured by RT-PCR and Western blot assay following PPARγ silencing. In contrast, expression of the osteogenic genes encoding collagen I and Cbfa1/Runx2 were increased. In adipogenic medium, PPARγ-shRNA transfection reduced the lipid droplet count as measured by Oil red O staining when compared to the control groups. In osteogenic medium, PPARγ-shRNA increased the activity of alkaline phosphatase and the amount of calcium deposition as measured by Alizarin red S staining. These results suggest that the rat PPARγ gene shRNA Teton lentiviral vector decreases adipogenic differentiation and promotes osteogenic differentiation in BMSCs induced by tetracycline.

  20. Triphenyl phosphate enhances adipogenic differentiation, glucose uptake and lipolysis via endocrine and noradrenergic mechanisms.

    PubMed

    Cano-Sancho, German; Smith, Anna; La Merrill, Michele A

    2017-04-01

    The use of triphenyl phosphate (TPhP) as a flame retardant or plasticizer has increased during the last decade, resulting in widespread human exposure without commensurate toxicity assessment. The main objectives of this study were to assess the in vitro effect of TPhP and its metabolite diphenyl phosphate (DPhP) on the adipogenic differentiation of 3T3-L1 cells, as well as glucose uptake and lipolysis in differentiated 3T3-L1 adipocytes. TPhP increased pre-adipocyte proliferation and subsequent adipogenic differentiation of 3T3-L1 cells, coinciding with increased transcription in the CEBP and PPARG pathway. Treatment of mature adipocytes with TPhP increased the basal- and insulin stimulated- uptake of the glucose analog 2-[N (-7-nitrobenz-2-oxa1, 3-diazol-4-yl) amino]-2-deoxy-d-glucose (2-NBDG). This effect was ablated by inhibition of PI3K, a member of the insulin signaling pathway. DPhP had no significant effect on cell proliferation and, compared to TPhP, a weaker effect on adipogenic differentiation and on 2-NBDG uptake. Both TPhP and DPhT significantly enhanced the isoproterenol-induced lipolysis, most likely by increasing the expression of lipolytic genes during and after differentiation. This study suggests that TPhP increases adipogenic differentiation, glucose uptake, and lipolysis in 3T3-L1 cells through endocrine and noradrenergic mechanisms.

  1. Human mesenchymal stem cell differentiation to the osteogenic or adipogenic lineage is regulated by AMP-activated protein kinase.

    PubMed

    Kim, Eung-Kyun; Lim, Seyoung; Park, Ji-Man; Seo, Jeong Kon; Kim, Jae Ho; Kim, Kyong Tai; Ryu, Sung Ho; Suh, Pann-Ghill

    2012-04-01

    AMP-activated protein kinase (AMPK) is an energy-sensing kinase that has recently been shown to regulate the differentiation of preadipocytes and osteoblasts. However, the role of AMPK in stem cell differentiation is largely unknown. Using in vitro culture models, the present study demonstrates that AMPK is a critical regulatory factor for osteogenic differentiation. We observed that expression and phosphorylation of AMPK were increased during osteogenesis in human adipose tissue-derived mesenchymal stem cells (hAMSC). To elucidate the role of AMPK in osteogenic differentiation, we investigated the effect of AMPK inhibition or knockdown on mineralization of hAMSC. Compound C, an AMPK inhibitor, reduced mineralized matrix deposition and suppressed the expression of osteoblast-specific genes, including alkaline phosphatase (ALP), runt-related transcription factor 2 (RUNX2), and osteocalcin (OCN). Knockdown of AMPK by shRNA-lentivirus infection also reduced osteogenesis. In addition, inhibition or knockdown of AMPK during osteogenesis inhibited ERK phosphorylation, which is required for osteogenesis. Interestingly, inhibition of AMPK induced adipogenic differentiation of hAMSC, even in osteogenic induction medium (OIM). These results provide a potential mechanism involving AMPK activation in osteogenic differentiation of hAMSC and suggest that commitment of hAMSC to osteogenic or adipogenic lineage is governed by activation or inhibition of AMPK, respectively.

  2. Markers Are Shared Between Adipogenic and Osteogenic Differentiated Mesenchymal Stem Cells.

    PubMed

    Köllmer, Melanie; Buhrman, Jason S; Zhang, Yu; Gemeinhart, Richard A

    2013-05-01

    The stem cell differentiation paradigm is based on the progression of cells through generations of daughter cells that eventually become restricted and committed to one lineage resulting in fully differentiated cells. Herein, we report on the differentiation of adult human mesenchymal stem cells (hMSCs) towards adipogenic and osteogenic lineages using established protocols. Lineage specific geneswere evaluated by quantitative real-time PCR relative to two reference genes. The expression of osteoblast-associated genes (alkaline phosphatase, osteopontin, and osteocalcin)was detected in hMSCs that underwent adipogenesis. When normalized, the expression of adipocyte marker genes (adiponectin, fatty acid binding protein P4, and leptin) increasedin a time-dependent manner during adipogenic induction. Adiponectin and leptin were also detected in osteoblast-induced cells. Lipid vacuoles that represent the adipocyte phenotype were only present in the adipogenic induction group. Conforming to the heterogeneous nature of hMSCs and the known plasticity between osteogenic and adipogenic lineages, these data indicatea marker overlap between MSC-derived adipocytes and osteoblasts. Weproposea careful consideration of experimental conditions such as investigated timepoints, selected housekeeping genesand the evidence indicating lack of differentiation into other lineageswhen evaluating hMSC differentiation.

  3. Long non-coding RNA ADNCR suppresses adipogenic differentiation by targeting miR-204

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Adiposeness is a complex and precisely orchestrated process mediated by a network of adipogenic regulatory factors. Several studies have highlighted the relevance of lncRNAs in adipocyte differentiation, but the precise molecular mechanism has largely remained elusive. In the present study, we perfo...

  4. The E3 ubiquitin ligase TRIM23 regulates adipocyte differentiation via stabilization of the adipogenic activator PPARγ.

    PubMed

    Watanabe, Masashi; Takahashi, Hidehisa; Saeki, Yasushi; Ozaki, Takashi; Itoh, Shihori; Suzuki, Masanobu; Mizushima, Wataru; Tanaka, Keiji; Hatakeyama, Shigetsugu

    2015-04-23

    Adipocyte differentiation is a strictly controlled process regulated by a series of transcriptional activators. Adipogenic signals activate early adipogenic activators and facilitate the transient formation of early enhanceosomes at target genes. These enhancer regions are subsequently inherited by late enhanceosomes. PPARγ is one of the late adipogenic activators and is known as a master regulator of adipogenesis. However, the factors that regulate PPARγ expression remain to be elucidated. Here, we show that a novel ubiquitin E3 ligase, tripartite motif protein 23 (TRIM23), stabilizes PPARγ protein and mediates atypical polyubiquitin conjugation. TRIM23 knockdown caused a marked decrease in PPARγ protein abundance during preadipocyte differentiation, resulting in a severe defect in late adipogenic differentiation, whereas it did not affect the formation of early enhanceosomes. Our results suggest that TRIM23 plays a critical role in the switching from early to late adipogenic enhanceosomes by stabilizing PPARγ protein possibly via atypical polyubiquitin conjugation.

  5. Effects of substrate stiffness on adipogenic and osteogenic differentiation of human mesenchymal stem cells.

    PubMed

    Zhao, Wen; Li, Xiaowei; Liu, Xiaoyan; Zhang, Ning; Wen, Xuejun

    2014-07-01

    Substrate mechanical properties, in addition to biochemical signals, have been shown to modulate cell phenotype. In this study, we inspected the effects of substrate stiffness on human mesenchymal stem cells (hMSCs) derived from adult human bone marrow differentiation into adipogenic and osteogenic cells. A chemically modified extracellular matrix derived and highly biocompatible hydrogel, based on thiol functionalized hyaluronic acid (HA-SH) and thiol functionalized recombinant human gelatin (Gtn-SH), which can be crosslinked by poly (ethylene glycol) tetra-acrylate (PEGTA), was used as a model system. The stiffness of the hydrogel was controlled by adjusting the crosslinking density. Human bone marrow MSCs were cultured on the hydrogels with different stiffness under adipogenic and osteogenic conditions. Oil Red O staining and F-actin staining were applied to assess the change of cell morphologies under adipogenic and osteogenic differentiation, respectively. Gene expression of cells was determined with reverse transcription polymerase chain reaction (RT-PCR) as a function of hydrogel stiffness. Results support the hypothesis that adipogenic and osteogenic differentiation of hMSCs are inclined to occur on substrate with stiffness similar to their in vivo microenvironments.

  6. Exogenous polyamines promote osteogenic differentiation by reciprocally regulating osteogenic and adipogenic gene expression.

    PubMed

    Lee, Mon-Juan; Chen, Yuhsin; Huang, Yuan-Pin; Hsu, Yi-Chiang; Chiang, Lan-Hsin; Chen, Tzu-Yu; Wang, Gwo-Jaw

    2013-12-01

    Polyamines are naturally occurring organic polycations that are ubiquitous in all organisms, and are essential for cell proliferation and differentiation. Although polyamines are involved in various cellular processes, their roles in stem cell differentiation are relatively unexplored. In this study, we found that exogenous polyamines, putrescine, spermidine, and spermine, promoted osteogenic differentiation of human bone marrow-derived mesenchymal stem cells (hBMSCs) without inducing cell death or apoptosis. Alkaline phosphatase (ALP) activity and the mRNA level of osteogenic genes, including Runx2, ALP, osteopontin, and osteocalcin, were up-regulated by exogenous polyamines. When hBMSCs were cultured at high cell density favoring adipocyte formation, exogenous polyamines resulted in down-regulation of adipogenic genes such as PPARγ, aP2, and adipsin. Extracellular matrix mineralization, a marker for osteoblast maturation, was enhanced in the presence of exogenous polyamines, while lipid accumulation, an indication of adipogenic differentiation, was attenuated. Exogenous polyamines increased the mRNA expression of polyamine-modulated factor 1 (PMF-1) and its downstream effector, spermidine/spermine N(1)-acetyltransferase (SSAT), while that of ornithine decarboxylase (ODC), the rate-limiting enzyme in polyamine biosynthesis, was suppressed. These results lead to possible connections between polyamine metabolism and osteogenic differentiation pathways. To summarize, this study provides evidence for the involvement of polyamines in osteogenic differentiation of hBMSCs, and is the first to demonstrate that osteogenic and adipogenic differentiation are reciprocally regulated by exogenous polyamines.

  7. Coexpression of osteogenic and adipogenic differentiation markers in selected subpopulations of primary human mesenchymal progenitor cells.

    PubMed

    Ponce, M L; Koelling, S; Kluever, A; Heinemann, D E H; Miosge, N; Wulf, G; Frosch, K-H; Schütze, N; Hufner, M; Siggelkow, H

    2008-07-01

    Knowledge of the basic mechanisms controlling osteogenesis and adipogenesis might provide new insights into the prevention of osteoporosis and age-related osteopenia. With the help of magnetic cell sorting and fluorescence activated cell sorting (FACS), osteoblastic subpopulations of mesenchymal progenitor cells were characterized. Alkaline phosphatase (AP) negative cells expressed low levels of osteoblastic and adipocytic markers. AP positive cells expressed adipocytic markers more strongly than the AP negative cell populations, thus suggesting that committed osteoblasts exhibit a greater adipogenic potential. AP negative cells differentiated to the mature osteoblastic phenotype, as demonstrated by increased AP-activity and osteocalcin secretion under standard osteogenic culture conditions. Surprisingly, this was accompanied by increased expression of adipocytic gene markers such as peroxisome proliferator-activated receptor-gamma2, lipoprotein lipase and fatty acid binding protein. The induction of adipogenic markers was suppressed by transforming growth factor-beta1 (TGF-beta1) and promoted by bone morphogenetic protein 2 (BMP-2). Osteogenic culture conditions including BMP-2 induced both the formation of mineralized nodules and cytoplasmic lipid vacuoles. Upon immunogold electron microscopic analysis, osteoblastic and adipogenic marker proteins were detectable in the same cell. Our results suggest that osteogenic and adipogenic differentiation in human mesenchymal progenitor cells might not be exclusively reciprocal, but rather, a parallel event until late during osteoblast development.

  8. Mannose-binding dietary lectins induce adipogenic differentiation of the marrow-derived mesenchymal cells via an active insulin-like signaling mechanism.

    PubMed

    Bajaj, Manmohan; Hinge, Ashwini; Limaye, Lalita S; Gupta, Rajesh Kumar; Surolia, Avadhesha; Kale, Vaijayanti P

    2011-04-01

    We have recently demonstrated that the mannose-binding lectins, namely banana lectin (BL) and garlic lectin (GL), interacted with the insulin receptors on M210B4 cells--an established mesenchymal cell line of murine marrow origin--and initiate mitogen-activated protein kinase kinase (MEK)-dependent extracellular signal-regulated kinase (ERK) signaling in them. In this study, we show that this lectin-mediated active ERK signaling culminates into an adipogenic differentiation of these cells. Gene expression studies indicate that the effect takes place at the transcriptional level. Experiments carried out with pharmacological inhibitors show that MEK-dependent ERK and phosphatidylinositol 3-kinase-dependent AKT pathways are positive regulators of the lectin- and insulin-mediated adipogenic differentiation, while stress-activated kinase/c-jun N-terminal kinase pathway acts as a negative one. Since both lectins could efficiently substitute for insulin in the standard adipogenic induction medium, they may perhaps serve as molecular tools to study the mechanistic aspects of the adipogenic process that are independent of cell proliferation. Our study clearly demonstrates the ability of BL and GL to activate insulin-like signaling in the mesenchymal cells in vitro leading to their adipocytic differentiation. The dietary origin of these lectins underscores an urgent need to examine their in vivo effects on tissue homeostasis.

  9. Cytoglobin: a potential marker for adipogenic differentiation in preadipocytes in vitro.

    PubMed

    Doğan, Ayşegül; Demirci, Selami; Kıratlı, Binnur; Şahin, Fikrettin

    2017-02-01

    Obesity, mainly characterized by the excess fat storage, is a global health problem resulting in serious morbidity and mortality. Identification of molecular mechanisms in adipogenic differentiation pathway might lead to development of new strategies for diagnosis, prevention and therapy of obesity and associated diseases. Discovery of new genes and proteins in the differentiation pathway could help to understand the key specific regulators of the adipogenesis. Cytoglobin (Cygb), identified as a new globin family member protein, is expressed in various tissues. Although its interaction with oxygen and nitric oxide indicates the potential role in antioxidant pathways, the exact role remains unclear. In the current study, expression level of Cygb was determined in proliferating and differentiating 3T3-F442A cells by gene expression and protein expression analysis. Results revealed that Cygb expression up-regulated in differentiated cells in parallel with adipogenic differentiation markers; PPARγ, CEBPα and FABP4 expressions. Besides, Cygb overexpression in preadipocytes contributed to the adipogenic differentiation as verified by detection of higher lipid droplets and increased PPARγ, CEBPα and FABP4 expressions with respect to control cells. These findings will shed light on the unknown roles of Cygb in adipogenesis and obesity.

  10. The anti-adipogenic effect of macrophage-conditioned medium requires the IKKβ/NF-κB pathway.

    PubMed

    Yarmo, M N; Gagnon, A; Sorisky, A

    2010-11-01

    Macrophage-secreted factors inhibit adipogenesis, but the underlying mechanism is not well understood. Our objective was to determine if anti-adipogenic signaling pathways in human preadipocytes are activated by macrophage-conditioned medium (MacCM). Human abdominal subcutaneous stromal preadipocytes were treated with adipogenic inducers in either standard medium or medium conditioned by human THP-1 macrophages. THP-1-MacCM increased inhibitor of κB kinase β (IKKβ) phosphorylation, inhibitor of NF-κB α (IκBα) degradation, and NF-κB activity in human preadipocytes in a time-dependent manner. Concomitant treatment of human abdominal subcutaneous preadipocytes with sc-514, a selective inhibitor of IKKβ, prevented the inhibitory effect of THP-1-MacCM on lipid accumulation and expression of adipogenic markers. Our data indicate that activation of the preadipocyte IKKβ/NF-κB pathway is required for the anti-adipogenic effect of THP-1-MacCM on human adipogenesis.

  11. Sox9 modulates cell survival and adipogenic differentiation of multipotent adult rat mesenchymal stem cells.

    PubMed

    Stöckl, Sabine; Bauer, Richard J; Bosserhoff, Anja K; Göttl, Claudia; Grifka, Joachim; Grässel, Susanne

    2013-07-01

    Sox9 is a key transcription factor in early chondrogenesis with distinct roles in differentiation processes and during embryonic development. Here, we report that Sox9 modulates cell survival and contributes to the commitment of mesenchymal stem cells (MSC) to adipogenic or osteogenic differentiation lineages. We found that the Sox9 activity level affects the expression of the key transcription factor in adipogenic differentiation, C/EBPβ, and that cyclin D1 mediates the expression of the osteogenic marker osteocalcin in undifferentiated adult bone-marrow-derived rat MSC. Introducing a stable Sox9 knockdown into undifferentiated rat MSC resulted in a marked decrease in proliferation rate and an increase in apoptotic activity. This was linked to a profound upregulation of p21 and cyclin D1 gene and protein expression accompanied by an induction of caspase 3/7 activity and an inhibition of Bcl-2. We observed that Sox9 silencing provoked a delayed S-phase progression and an increased nuclear localization of p21. The protein stability of cyclin D1 was induced in the absence of Sox9 presumably as a function of altered p38 signalling. In addition, the major transcription factor for adipogenic differentiation, C/EBPβ, was repressed after silencing Sox9. The nearly complete absence of C/EBPβ protein as a result of increased destabilization of the C/EBPβ mRNA and the impact on osteocalcin gene expression and protein synthesis, suggests that a delicate balance of Sox9 level is not only imperative for proper chondrogenic differentiation of progenitor cells, but also affects the adipogenic and probably osteogenic differentiation pathways of MSC. Our results identified Sox9 as an important link between differentiation, proliferation and apoptosis in undifferentiated adult rat mesenchymal stem cells, emphasizing the importance of the delicate balance of a precisely regulated Sox9 activity in MSC not only for proper skeletal development during embryogenesis but probably also

  12. Heparin affects human bone marrow stromal cell fate: Promoting osteogenic and reducing adipogenic differentiation and conversion.

    PubMed

    Simann, Meike; Schneider, Verena; Le Blanc, Solange; Dotterweich, Julia; Zehe, Viola; Krug, Melanie; Jakob, Franz; Schilling, Tatjana; Schütze, Norbert

    2015-09-01

    Heparins are broadly used for the prevention and treatment of thrombosis and embolism. Yet, osteoporosis is considered to be a severe side effect in up to one third of all patients on long-term treatment. However, the mechanisms underlying this clinical problem are only partially understood. To investigate if heparin affects differentiation of skeletal precursors, we examined the effects of heparin on the osteogenic and adipogenic lineage commitment and differentiation of primary human bone marrow stromal cells (hBMSCs). Due to the known inverse relationship between adipogenesis and osteogenesis and the capacity of pre-differentiated cells to convert into the respective other lineage, we also determined heparin effects on osteogenic conversion and adipogenic differentiation/conversion. Interestingly, heparin did not only significantly increase mRNA expression and enzyme activity of the osteogenic marker alkaline phosphatase (ALP), but it also promoted mineralization during osteogenic differentiation and conversion. Furthermore, the mRNA expression of the osteogenic marker bone morphogenic protein 4 (BMP4) was enhanced. In addition, heparin administration partly prevented adipogenic differentiation and conversion demonstrated by reduced lipid droplet formation along with a decreased expression of adipogenic markers. Moreover, luciferase reporter assays, inhibitor experiments and gene expression analyses revealed that heparin had putative permissive effects on osteogenic signaling via the BMP pathway and reduced the mRNA expression of the Wnt pathway inhibitors dickkopf 1 (DKK1) and sclerostin (SOST). Taken together, our data show a rather supportive than inhibitory effect of heparin on osteogenic hBMSC differentiation and conversion in vitro. Further studies will have to investigate the net effects of heparin administration on bone formation versus bone resorption in vivo to unravel the molecular mechanisms of heparin-associated osteoporosis and reconcile

  13. PLD1 regulates adipogenic differentiation through mTOR - IRS-1 phosphorylation at serine 636/639

    PubMed Central

    Song, Hae-In; Yoon, Mee-Sup

    2016-01-01

    Phospholipase D1 (PLD1) plays a known role in several differentiation processes, but its role in adipogenic differentiation remains unknown. In the present study, we identified PLD1 as a negative regulator of adipogenic differentiation. We showed that PLD activity was downregulated by both 3-Isobutyl-1-methylxanthine (IBMX) and insulin upon induction of differentiation in 3T3-L1 adipogenic cells. In line with this observation, PLD activity decreased in both high fat diet (HFD)-fed mice and ob/ob mice. We also found that differentiation of 3T3-L1 preadipocytes was enhanced by the depletion of PLD1 levels or inhibition of PLD1 activity by VU0155069, a PLD1-specific inhibitor. Conversely, treatment with phosphatidic acid (PA), a PLD product, and overexpression of PLD1 both caused a decrease in adipogenic differentiation. Moreover, the elevated differentiation in PLD1-knockdown 3T3-L1 cells was reduced by either PA treatment or PLD1 expression, confirming negative roles of PLD1 and PA in adipogenic differentiation. Further investigation revealed that PA displaces DEP domain-containing mTOR-interacting protein (DEPTOR) from mTORC1, which subsequently phosphorylates insulin receptor substrate-1 (IRS-1) at serine 636/639 in 3T3-L1 cells. Taken together, our findings provide convincing evidence for a direct role of PLD1 in adipogenic differentiation by regulating IRS-1 phosphorylation at serine 636/639 through DEPTOR displacement and mTOR activation. PMID:27872488

  14. Effects of hTERT immortalization on osteogenic and adipogenic differentiation of dental pulp stem cells.

    PubMed

    Ikbale, El-Ayachi; Goorha, Sarita; Reiter, Lawrence T; Miranda-Carboni, Gustavo A

    2016-03-01

    These data relate to the differentiation of human dental pulp stem cells (DPSC) and DPSC immortalized by constitutively expressing human telomerase reverse transcriptase (hTERT) through both osteogenic and adipogenic lineages (i.e. to make bone producing and fat producing cells from these dental pulp stem cells). The data augment another study to characterize immortalized DPSC for the study of neurogenetic "Characterization of neurons from immortalized dental pulp stem cells for the study of neurogenetic disorders" [1]. Two copies of one typical control cell line (technical replicates) were used in this study. The data represent the differentiation of primary DPSC into osteoblast cells approximately 60% more effectively than hTERT immortalized DPSC. Conversely, both primary and immortalized DPSC are poorly differentiated into adipocytes. The mRNA expression levels for both early and late adipogenic and osteogenic gene markers are shown.

  15. Sphingosine-1-phosphate inhibits the adipogenic differentiation of 3T3-L1 preadipocytes.

    PubMed

    Moon, Myung-Hee; Jeong, Jae-Kyo; Lee, You-Jin; Seol, Jae-Won; Park, Sang-Youel

    2014-10-01

    Sphingosine-1-phosphate (S1P) is a pluripotent lipid mediator that transmits signals through G-protein-coupled receptors to control diverse biological processes. The novel biological activity of S1P in the adipogenesis of 3T3-L1 preadipocytes was identified in the present study. S1P significantly decreased lipid accumulation in maturing preadipocytes in a dose‑dependent manner. In order to understand the anti‑adipogenic effects of S1P, preadipocytes were treated with S1P, and the change in the expression of several adipogenic transcription factors and enzymes was investigated using quantitative RT-PCR. S1P downregulated the transcriptional levels of the peroxisome proliferator-activated receptor γ, CCAAT/enhancer binding proteins and adiponectin, which are markers of adipogenic differentiation. The effects of S1P on the levels of mitogen‑activated protein kinase (MAPK) signals in preadipocytes were also investigated. The activation of JNK and p38 were downregulated by S1P treatment in human preadipocytes. In conclusion, the results of this study suggest that S1P alters fat mass by directly affecting adipogenesis. This is mediated by the downregulation of adipogenic transcription factors and by inactivation of the JNK and p38 MAPK pathways. Thus, selective targeting of the S1P receptors and sphingosine kinases may have clinical applications for the treatment of obesity.

  16. The effect of conjugating RGD into 3D alginate hydrogels on adipogenic differentiation of human adipose-derived stromal cells.

    PubMed

    Kang, Sun-Woong; Cha, Byung-Hyun; Park, Honghyun; Park, Kwang-Sook; Lee, Kuen Yong; Lee, Soo-Hong

    2011-05-12

    The effects of RGD peptide conjugation to alginate hydrogel on the adipogenic differentiation of ASCs was investigated. After 3 d of culture, RGD-modified alginate hydrogels significantly stimulated FAK and integrin α1 gene expressions and vinculin expression in ASCs. In addition, RGD-modified alginate hydrogels significantly enhanced the adipogenic differentiation of human ASCs to exhibit higher expression levels of oil red O staining and adipogenic genes compared to those of the control group (unmodified gels). These results suggest potential applications of RGD-modified alginate gels for adipose tissue regeneration.

  17. Mechanism of osteogenic and adipogenic differentiation of tendon stem cells induced by sirtuin 1.

    PubMed

    Liu, Junpeng; Han, Weifeng; Chen, Lei; Tang, Kanglai

    2016-08-01

    The aim of the present study was to assess the expression of sirtuin (Sirt)1 in tendon stem cells (TSCs) and to elucidate its association with osteogenic and adipogenic differentiation of TSCs. Reverse-transcription quantitative polymerase chain reaction (RT-qPCR) and western blot analyses were performed to detect Sirt1 mRNA and protein levels in TSCs, respectively. TSCs were positive for Sirt1 expression, which was elevated by Sirt1 activator SRT1720 in a time- and concentration- dependent manner, and decreased by Sirt1 inhibitor EX527. TSCs were treated with SRT1720 and EX527 for various time periods and resulting changes in osteogenic and adipogenic protein markers were analyzed using alizarin red and oil red O staining. According to RT-qPCR and western blot analyses, the associated factors β‑catenin, Runt-related transcription factor 2 (Runx2) and bone morphogenetic protein 2 were elevated following increases of Sirt1 levels, while CCAAT/enhancer binding protein (CEBP)α and peroxisome proliferator-activated receptor (PPAR)γ were decreased. These results suggested that osteogenic differentiation capacity was enhanced, while adipogenic differentiation capacity declined. Further mechanistic study revealed that phosphoinositide‑3 kinase (PI3K) and AKT were decreased following activation of Sirt1. In conclusion, the present study suggested that Sirt1 promotes the osteogenic differentiation of TSCs through upregulating β‑catenin and Runx2 and inhibits the adipogenic differentiation of TSCs through the PI3K/AKT pathway with downregulation of CEBPα and PPARγ.

  18. The phytoestrogen genistein enhances osteogenesis and represses adipogenic differentiation of human primary bone marrow stromal cells.

    PubMed

    Heim, M; Frank, O; Kampmann, G; Sochocky, N; Pennimpede, T; Fuchs, P; Hunziker, W; Weber, P; Martin, I; Bendik, I

    2004-02-01

    In the present study, we investigated the role of the phytoestrogen genistein and 17beta-estradiol in human bone marrow stromal cells, undergoing induced osteogenic or adipogenic differentiation. Profiling of estrogen receptors (ERs)-alpha, -beta1, -beta2, -beta3, -beta4, -beta5, and aromatase mRNAs revealed lineage-dependent expression patterns. During osteogenic differentiation, the osteoblast-determining core binding factor-alpha1 showed a progressive increase, whereas the adipogenic regulator peroxisome proliferator-activated receptor gamma (PPARgamma) was sequentially decreased. This temporal regulation of lineage-determining marker genes was strongly enhanced by genistein during the early osteogenic phase. Moreover, genistein increased alkaline phosphatase mRNA levels and activity, the osteoprotegerin:receptor activator of nuclear factor-kappaB ligand gene expression ratio, and the expression of TGFbeta1. During adipogenic differentiation, down-regulation in the mRNA levels of PPARgamma and CCAAT/enhancer-binding protein-alpha at d 3 and decreased lipoprotein lipase and adipsin mRNA levels at d 21 were observed after genistein treatment. This led to a lower number of adipocytes and a reduction in the size of their lipid droplets. At d 3 of adipogenesis, TGFbeta1 was strongly up-regulated by genistein in an ER-dependent manner. Blocking the TGFbeta1 pathway abolished the effects of genistein on PPARgamma protein levels and led to a reduction in the proliferation rate of precursor cells. Overall, genistein enhanced the commitment and differentiation of bone marrow stromal cells to the osteoblast lineage but did not influence the late osteogenic maturation markers. Adipogenic differentiation and maturation, on the other hand, were reduced by genistein (and 17beta-estradiol) via an ER-dependent mechanism involving autocrine or paracrine TGFbeta1 signaling.

  19. In Vitro Effect of 30 nm Silver Nanoparticles on Adipogenic Differentiation of Human Mesenchymal Stem Cells.

    PubMed

    He, Wei; Kienzle, Arne; Liu, Xujie; Müller, Werner E G; Elkhooly, Tarek A; Feng, Qingling

    2016-03-01

    With the combined use of silver nanoparticles (Ag NPs) and human bone marrow derived mesenchymal stem cells (hMSCs) in bone tissue engineering, more knowledge of the effects of Ag NPs on hMSCs is required. Up to date, researches mainly focused on the cytotoxicity and genotoxicity of Ag NPs, only few studies discussed their influence on the differentiation of stem cells, especially adipogenic differentiation. In the present study, we investigated the in vitro uptake of 30 nm PVP-coated Ag NPs in hMSCs and their effects on cell viability, cell morphology and adipogenic differentiation of hMSCs. HMSCs were exposed to Ag NPs at concentrations of 25 and 50 μg/mL for 24 hours and at concentrations of 5 and 10 μg/mL throughout the whole differentiation period. Results of cell viability showed that Ag NPs caused time- and dose-dependent toxicity in hMSCs. Transmission electron microscopy (TEM) confirmed the uptake of Ag NPs into cytoplasm of hMSCs. No influence on cell morphology was observed. The 30 nm sized Ag NPs had no effects on adiponectin secretion, lipid droplet formation and the expression of adipogenic marker genes. It is concluded that under our experimental conditions, 30 nm PVP-coated Ag NPs do not influence the adipogenic differentiation of hMSCs in vitro. The present results provide a reference for the usage of 30 nm Ag NPs in the presence of hMSCs in bone tissue engineering.

  20. Protein kinase CK2 is necessary for the adipogenic differentiation of human mesenchymal stem cells.

    PubMed

    Schwind, Lisa; Wilhelm, Nadine; Kartarius, Sabine; Montenarh, Mathias; Gorjup, Erwin; Götz, Claudia

    2015-10-01

    CK2 is a serine/threonine protein kinase, which is so important for many aspects of cellular regulation that life without CK2 is impossible. Here, we analysed CK2 during adipogenic differentiation of human mesenchymal stem cells (hMSCs). With progress of the differentiation CK2 protein level and the kinase activity decreased. Whereas CK2α remained in the nucleus during differentiation, the localization of CK2β showed a dynamic shuttling in the course of differentiation. Over the last years a large number of inhibitors of CK2 kinase activity were generated with the idea to use them in cancer therapy. Our results show that two highly specific inhibitors of CK2, CX-4945 and quinalizarin, reduced its kinase activity in proliferating hMSC with a similar efficiency. CK2 inhibition by quinalizarin resulted in nearly complete inhibition of differentiation whereas, in the presence of CX-4945, differentiation proceeded similar to the controls. In this case, differentiation was accompanied by the loss of CX-4945 inhibitory function. By analysing the subcellular localization of PPARγ2, we found a shift from a nuclear localization at the beginning of differentiation to a more cytoplasmic localization in the presence of quinalizarin. Our data further show for the first time that a certain level of CK2 kinase activity is required for adipogenic stem cell differentiation and that inhibition of CK2 resulted in an altered localization of PPARγ2, an early regulator of differentiation.

  1. Surface topography enhances differentiation of mesenchymal stem cells towards osteogenic and adipogenic lineages.

    PubMed

    Abagnale, Giulio; Steger, Michael; Nguyen, Vu Hoa; Hersch, Nils; Sechi, Antonio; Joussen, Sylvia; Denecke, Bernd; Merkel, Rudolf; Hoffmann, Bernd; Dreser, Alice; Schnakenberg, Uwe; Gillner, Arnold; Wagner, Wolfgang

    2015-08-01

    Surface topography impacts on cell growth and differentiation, but it is not trivial to generate defined surface structures and to assess the relevance of specific topographic parameters. In this study, we have systematically compared in vitro differentiation of mesenchymal stem cells (MSCs) on a variety of groove/ridge structures. Micro- and nano-patterns were generated in polyimide using reactive ion etching or multi beam laser interference, respectively. These structures affected cell spreading and orientation of human MSCs, which was also reflected in focal adhesions morphology and size. Time-lapse demonstrated directed migration parallel to the nano-patterns. Overall, surface patterns clearly enhanced differentiation of MSCs towards specific lineages: 15 μm ridges increased adipogenic differentiation whereas 2 μm ridges enhanced osteogenic differentiation. Notably, nano-patterns with a periodicity of 650 nm increased differentiation towards both osteogenic and adipogenic lineages. However, in absence of differentiation media surface structures did neither induce differentiation, nor lineage-specific gene expression changes. Furthermore, nanostructures did not affect the YAP/TAZ complex, which is activated by substrate stiffness. Our results provide further insight into how structuring of tailored biomaterials and implant interfaces - e.g. by multi beam laser interference in sub-micrometer scale - do not induce differentiation of MSCs per se, but support their directed differentiation.

  2. Deletion of Alox5 gene decreases osteogenic differentiation but increases adipogenic differentiation of mouse induced pluripotent stem cells.

    PubMed

    Wu, Yanru; Sun, Hualing; Song, Fangfang; Huang, Cui; Wang, Jiawei

    2014-10-01

    Induced pluripotent stem cells (iPSCs) have great potential in bone tissue engineering to repair large bone defects. Before their clinical application, investigations are needed to discover the genes and osteoconductive scaffolds that influence their differentiation toward an osteogenic lineage. Alox5 plays controversial and complex roles in the regulation of bone and fat metabolism. To detect the effect of Alox5 on osteogenic and adipogenic differentiation of iPSCs, both Alox5 knockout mouse iPSCs (Alox5-KO-iPSCs) and wild-type mouse iPSCs (Wild-iPSCs) were developed. The mRNA levels of many osteogenic markers in Alox5-KO-iPSCs were significantly reduced, while many adipogenic markers were enhanced. Furthermore, when implanted in rat cranial critical-sized defects with collagen/chitosan/hydroxyapatite scaffolds (CCHS), Alox5-KO-iPSCs produced significantly less new bone than Wild-iPSCs and both cell-scaffold groups had no tumor formation. There was a significant difference in the expression of Cox2 during the osteogenic and adipogenic differentiation between the two kinds of iPSCs in vitro. In conclusion, firstly, Alox5 knockout reduced the osteogenic but increased the adipogenic differentiation potential of mouse iPSCs. These disorders might be related to the change of Cox2 expression. Secondly, combined with iPSCs, CCHS can serve as a potential substrate to repair critical-sized bony defects. However, more studies are required to confirm the mechanisms through which Alox5 affects the osteogenic and adipogenic abilities of iPSCs in vivo and the effect of Cox2 inhibition in this system.

  3. Adipogenic differentiation state-specific gene expression as related to bovine carcass adiposity.

    PubMed

    Pickworth, C L; Loerch, S C; Velleman, S G; Pate, J L; Poole, D H; Fluharty, F L

    2011-02-01

    Genetic regulation of the site of fat deposition is not well defined. The objective of this study was to investigate adipogenic differentiation state-specific gene expression in feedlot cattle (>75% Angus; <25% Simmental parentage) of varying adipose accretion patterns. Four groups of 4 steers were selected via ultrasound for the following adipose tissue characteristics: low subcutaneous-low intramuscular (LSQ-LIM), low subcutaneous-high intramuscular (LSQ-HIM), high subcutaneous-low intramuscular (HSQ-LIM), and high subcutaneous-high intramuscular (HSQ-HIM). Adipose tissue from the subcutaneous (SQ) and intramuscular (IM) depots was collected at slaughter. The relative expression of adipogenic genes was evaluated using quantitative PCR. Data were analyzed using the mixed model of SAS, and gene expression data were analyzed using covariate analysis with ribosomal protein L19 as the covariate. No interactions (P > 0.10) were observed between IM and SQ adipose tissue depots for any of the variables measured. Therefore, only the main effects of high and low accretion within a depot and the effects of depot are reported. Steers with LIM had smaller mean diameter IM adipocytes (P < 0.001) than HIM steers. Steers with HSQ had larger mean diameter SQ adipocytes (P < 0.001) than LSQ. However, there were no differences (P > 0.10) in any of the genes measured due to high or low adipose accretion. Preadipogenic delta-like kinase1 mRNA was greater in the IM than the SQ adipose tissue; conversely, differentiating and adipogenic genes, lipoprotein lipase, PPARγ, fatty acid synthetase, and fatty acid binding protein 4 were greater (P < 0.001) in the SQ than the IM depot. Intramuscular adipocytes were smaller than SQ adipocytes and had greater expression of the preadipogenic gene, indicating that more hyperplasia was occurring. Meanwhile, SQ adipose tissue contained much larger (P < 0.001) adipocytes that had a greater expression (P < 0.001) of differentiating and adipogenic

  4. Notch Signaling Rescues Loss of Satellite Cells Lacking Pax7 and Promotes Brown Adipogenic Differentiation

    PubMed Central

    Pasut, Alessandra; Chang, Natasha C.; Rodriguez, Uxia Gurriaran; Faulkes, Sharlene; Yin, Hang; Lacaria, Melanie; Ming, Hong; Rudnicki, Michael A.

    2016-01-01

    Summary Pax7 is a nodal transcription factor that is essential for regulating the maintenance, expansion, and myogenic identity of satellite cells during both neonatal and adult myogenesis. Deletion of Pax7 results in loss of satellite cells and impaired muscle regeneration. Here we show that ectopic expression of the constitutively active intracellular domain of Notch1 (NICD1) rescues the loss of Pax7-deficient satellite cells and restores their proliferative potential. Strikingly NICD1-expressing satellite cells do not undergo myogenic differentiation and instead acquire a brown adipogenic fate both in vivo and in vitro. NICD-expressing Pax7-/- satellite cells fail to upregulate MyoD and instead express the brown adipogenic marker PRDM16. Overall these results show that Notch1 activation compensates for the loss of Pax7 in the quiescent state and acts as a molecular switch to promote brown adipogenesis in adult skeletal muscle. PMID:27346341

  5. Notch Signaling Rescues Loss of Satellite Cells Lacking Pax7 and Promotes Brown Adipogenic Differentiation.

    PubMed

    Pasut, Alessandra; Chang, Natasha C; Rodriguez, Uxia Gurriaran; Faulkes, Sharlene; Yin, Hang; Lacaria, Melanie; Ming, Hong; Rudnicki, Michael A

    2016-07-12

    Pax7 is a nodal transcription factor that is essential for regulating the maintenance, expansion, and myogenic identity of satellite cells during both neonatal and adult myogenesis. Deletion of Pax7 results in loss of satellite cells and impaired muscle regeneration. Here, we show that ectopic expression of the constitutively active intracellular domain of Notch1 (NICD1) rescues the loss of Pax7-deficient satellite cells and restores their proliferative potential. Strikingly NICD1-expressing satellite cells do not undergo myogenic differentiation and instead acquire a brown adipogenic fate both in vivo and in vitro. NICD-expressing Pax7(-/-) satellite cells fail to upregulate MyoD and instead express the brown adipogenic marker PRDM16. Overall, these results show that Notch1 activation compensates for the loss of Pax7 in the quiescent state and acts as a molecular switch to promote brown adipogenesis in adult skeletal muscle.

  6. Maternal obesity induces epigenetic modifications to facilitate Zfp423 expression and enhance adipogenic differentiation in fetal mice.

    PubMed

    Yang, Qi-Yuan; Liang, Jun-Fang; Rogers, Carl J; Zhao, Jun-Xing; Zhu, Mei-Jun; Du, Min

    2013-11-01

    Maternal obesity (MO) predisposes offspring to obesity and type 2 diabetes despite poorly defined mechanisms. Zfp423 is the key transcription factor committing cells to the adipogenic lineage, with exceptionally dense CpG sites in its promoter. We hypothesized that MO enhances adipogenic differentiation during fetal development through inducing epigenetic changes in the Zfp423 promoter and elevating its expression. Female mice were subjected to a control (Con) or obesogenic (OB) diet for 2 months, mated, and maintained on their diets during pregnancy. Fetal tissue was harvested at embryonic day 14.5 (E14.5), when the early adipogenic commitment is initiated. The Zfp423 expression was 3.6-fold higher and DNA methylation in the Zfp423 promoter was lower in OB compared with Con. Correspondingly, repressive histone methylation (H3K27me3) was lower in the Zfp423 promoter of OB fetal tissue, accompanied by reduced binding of enhancer of zeste 2 (EZH2). Gain- and loss-of-function analysis showed that Zfp423 regulates early adipogenic differentiation in fetal progenitor cells. In summary, MO enhanced Zfp423 expression and adipogenic differentiation during fetal development, at least partially through reducing DNA methylation in the Zfp423 promoter, which is expected to durably elevate adipogenic differentiation of progenitor cells in adult tissue, programming adiposity and metabolic dysfunction later in life.

  7. Accelerated adipogenic differentiation of hMSCs in a microfluidic shear stimulation platform.

    PubMed

    Adeniran-Catlett, Adedayo E; Weinstock, Laura D; Bozal, Fazli K; Beguin, Estelle; Caraballo, Alexander T; Murthy, Shashi K

    2016-03-01

    The use of transplanted adipose tissue to repair crucial defects is clinically interesting for surgical reconstruction. Terminally differentiated adipocytes are utilized to promote the healthy regeneration of defective tissue. Use of differentiated mesenchymal stem cells, capable of differentiation into adipocytes, is advantageous because of their regenerative properties. Conventionally, the differentiation of hMSCs toward adipocytes occurs through chemical stimulation. We designed a microfluidic system, consisting of plastic tubing and a syringe pump, to create an environment of shear to accelerate this differentiation process. This system employed a flow rate equivalent to the accelerated flow rates found within the arterial system in order to promote and activate intracellular and extracellular proteins associated with the adipogenic lineage. Confirmation of sustained viability following shear exposure was obtained using a fluorescent live-dead assay. Visualization of intracellular lipid accumulation was achieved via Oil Red O staining. When placed into culture, shear stimulated hMSCs were further induced toward brown adipose tissue, as evidenced by a greater quantity of lipid triglycerides, relative to unstimulated hMSCs. qRT-PCR analysis validated the phenotypic changes observed when the hMSCs were later cultured in adipogenic differentiation media. Additionally, increased fold change for adipogenic markers such as LPL1, CFL1, and SSP1 were observed as a result of shear stimulation. The significance of this work lies in the demonstration that transient fluid shear exposure of hMSCs in suspension can influence differentiation into adipocytes. © 2015 American Institute of Chemical Engineers Biotechnol. Prog., 32:440-446, 2016.

  8. Comparative epigenetic influence of autologous versus fetal bovine serum on mesenchymal stem cells through in vitro osteogenic and adipogenic differentiation.

    PubMed

    Fani, Nesa; Ziadlou, Reihane; Shahhoseini, Maryam; Baghaban Eslaminejad, Mohamadreza

    2016-06-10

    Mesenchymal stem cells (MSCs) derived from bone marrow (BM) represents a useful source of adult stem cells for cell therapy and tissue engineering. MSCs are present at a low frequency in the BM; therefore expansion is necessary before performing clinical studies. Fetal bovine serum (FBS) as a nutritional supplement for in vitro culture of MSCs is a suitable additive for human cell culture, but not regarding subsequent use of these cells for clinical treatment of human patients due to the risk of viral and prion transmission as well as xenogeneic immune responses after transplantation. Recently, autologous serum (AS) has been as a supplement to replace FBS in culture medium. We compared the effect of FBS versus AS on the histone modification pattern of MSCs through in vitro osteogenesis and adipogenesis. Differentiation of stem cells under various serum conditions to a committed state involves global changes in epigenetic patterns that are critically determined by chromatin modifications. Chromatin immunoprecipitation (ChIP) coupled with real-time PCR showed significant changes in the acetylation and methylation patterns in lysine 9 (Lys9) of histone H3 on the regulatory regions of stemness (Nanog, Sox2, Rex1), osteogenic (Runx2, Oc, Sp7) and adipogenic (Ppar-γ, Lpl, adiponectin) marker genes in undifferentiated MSCs, FBS and AS. All epigenetic changes occurred in a serum dependent manner which resulted in higher expression level of stemness genes in undifferentiated MSCs compared to differentiated MSCs and increased expression levels of osteogenic genes in AS compared to FBS. Adipogenic genes showed greater expression in FBS compared to AS. These findings have demonstrated the epigenetic influence of serum culture conditions on differentiation potential of MSCs, which suggest that AS is possibly more efficient serum for osteogenic differentiation of MSCs in cell therapy purposes.

  9. Human mesenchymal stem cells express neuronal markers after osteogenic and adipogenic differentiation.

    PubMed

    Foudah, Dana; Redondo, Juliana; Caldara, Cristina; Carini, Fabrizio; Tredici, Giovanni; Miloso, Mariarosaria

    2013-06-01

    Mesenchymal stem cells (MSCs) are multipotent cells that are able to differentiate into mesodermal lineages (osteogenic, adipogenic, chondrogenic), but also towards non-mesodermal derivatives (e.g. neural cells). Recent in vitro studies revealed that, in the absence of any kind of differentiation stimuli, undifferentiated MSCs express neural differentiation markers, but the literature data do not all concur. Considering their promising therapeutic potential for neurodegenerative diseases, it is very important to expand our knowledge about this particular biological property of MSCs. In this study, we confirmed the spontaneous expression of neural markers (neuronal, glial and progenitor markers) by undifferentiated human MSCs (hMSCs) and in particular, we demonstrated that the neuronal markers βIII-tubulin and NeuN are expressed by a very high percentage of hMSCs, regardless of the number of culture passages and the culture conditions. Moreover, the neuronal markers βIII-tubulin and NeuN are still expressed by hMSCs after in vitro osteogenic and adipogenic differentiation. On the other hand, chondrogenically differentiated hMSCs are negative for these markers. Our findings suggest that the expression of neuronal markers could be common to a wide range of cellular types and not exclusive for neuronal lineages. Therefore, the expression of neuronal markers alone is not sufficient to demonstrate the differentiation of MSCs towards the neuronal phenotype. Functional properties analysis is also required.

  10. ERR{alpha} regulates osteoblastic and adipogenic differentiation of mouse bone marrow mesenchymal stem cells

    SciTech Connect

    Rajalin, Ann-Marie; Pollock, Hanna; Aarnisalo, Piia

    2010-05-28

    The orphan nuclear receptor estrogen-related receptor-{alpha} (ERR{alpha}) has been reported to have both a positive and a negative regulatory role in osteoblastic and adipocytic differentiation. We have studied the role of ERR{alpha} in osteoblastic and adipogenic differentiation of mesenchymal stem cells. Bone marrow mesenchymal stem cells were isolated from ERR{alpha} deficient mice and their differentiation capacities were compared to that of the wild-type cells. ERR{alpha} deficient cultures displayed reduced cellular proliferation, osteoblastic differentiation, and mineralization. In the complementary experiment, overexpression of ERR{alpha} in MC3T3-E1 cells increased the expression of osteoblastic markers and mineralization. Alterations in the expression of bone sialoprotein (BSP) may at least partially explain the effects on mineralization as BSP expression was reduced in ERR{alpha} deficient MSCs and enhanced upon ERR{alpha} overexpression in MC3T3-E1 cells. Furthermore, a luciferase reporter construct driven by the BSP promoter was efficiently transactivated by ERR{alpha}. Under adipogenic conditions, ERR{alpha} deficient cultures displayed reduced adipocytic differentiation. Our data thus propose a positive role for ERR{alpha} in osteoblastic and adipocytic differentiation. The variability in the results yielded in the different studies implies that ERR{alpha} may play different roles in bone under different physiological conditions.

  11. 18{beta}-Glycyrrhetinic acid inhibits adipogenic differentiation and stimulates lipolysis

    SciTech Connect

    Moon, Myung-Hee; Jeong, Jae-Kyo; Lee, You-Jin; Seol, Jae-Won; Ahn, Dong-Choon; Kim, In-Shik; Park, Sang-Youel

    2012-04-20

    Highlights: Black-Right-Pointing-Pointer 18{beta}-GA inhibits adipogenic differentiation in 3T3-L1 preadipocytes and stimulates lipolysis in differentiated adipocytes. Black-Right-Pointing-Pointer Anti-adipogenic effect of 18{beta}-GA is caused by down-regulation of PPAR{gamma} and inactivation of Akt signalling. Black-Right-Pointing-Pointer Lipolytic effect of 18{beta}-GA is mediated by up-regulation of HSL, ATGL and perilipin and activation of HSL. -- Abstract: 18{beta}-Glycyrrhetinic acid (18{beta}-GA) obtained from the herb liquorice has various pharmacological properties including anti-inflammatory and anti-bacterial activities. However, potential biological anti-obesity activities are unclear. In this study, novel biological activities of 18{beta}-GA in the adipogenesis of 3T3-L1 preadipocytes and in lipolysis of differentiated adipocytes were identified. Mouse 3T3-L1 cells were used as an in vitro model of adipogenesis and lipolysis, using a mixture of insulin/dexamethasone/3-isobutyl-1-methylxanthine (IBMX) to induce differentiation. The amount of lipid droplet accumulation was determined by an AdipoRed assay. The expression of several adipogenic transcription factors and enzymes was investigated using real-time reverse transcriptase-polymerase chain reaction (RT-PCR) and Western blotting. 18{beta}-GA dose-dependently (1-40 {mu}M) significantly decreased lipid accumulation in maturing preadipocytes. In 3T3-L1 preadipocytes, 10 {mu}M of 18{beta}-GA down-regulated the transcriptional levels of the peroxisome proliferator-activated receptor {gamma}, CCAAT/enhancer-binding protein {alpha} and adiponectin, which are markers of adipogenic differentiation via Akt phosphorylation. Also, in differentiated adipocytes, 18{beta}-GA increased the level of glycerol release and up-regulated the mRNA of hormone-sensitive lipase, adipose TG lipase and perilipin, as well as the phosphorylation of hormone-sensitive lipase at Serine 563. The results indicate that 18{beta

  12. Dynamic changes of epigenetic signatures during chondrogenic and adipogenic differentiation of mesenchymal stem cells.

    PubMed

    Saidi, Navid; Ghalavand, Majdedin; Hashemzadeh, Mohammad Sadegh; Dorostkar, Ruhollah; Mohammadi, Hamed; Mahdian-Shakib, Ahmad

    2017-03-05

    Extensive studies have been performed to clarify the processes during which mesenchymal stem cells (MSCs) differentiate into their lineage fates. In vitro differentiation of MSCs into distinct lineages have attracted the focus of a large number of clinical investigations. Although the gene expression profiling during differentiation of MSC toward bone, cartilage, and adipocytes is well established, the master regulators by which MSC fate can be controlled are not entirely determined. During differentiation of MSCs into a special cell fate, epigenetic mechanisms considered as the primary mediators that suppress the irrelevant genes and activate the genes required for a specific cell lineage. This review dedicated to addressing the changes of various epigenetic mechanisms, including DNA methylation, histone modifications, and micro-RNAs during chondrogenic and adipogenic differentiation of MSC.

  13. Impact of bacteria and bacterial components on osteogenic and adipogenic differentiation of adipose-derived mesenchymal stem cells

    SciTech Connect

    Fiedler, Tomas; Salamon, Achim; Adam, Stefanie; Herzmann, Nicole; Taubenheim, Jan; Peters, Kirsten

    2013-11-01

    Adult mesenchymal stem cells (MSC) are present in several tissues, e.g. bone marrow, heart muscle, brain and subcutaneous adipose tissue. In invasive infections MSC get in contact with bacteria and bacterial components. Not much is known about how bacterial pathogens interact with MSC and how contact to bacteria influences MSC viability and differentiation potential. In this study we investigated the impact of three different wound infection relevant bacteria, Escherichia coli, Staphylococcus aureus, and Streptococcus pyogenes, and the cell wall components lipopolysaccharide (LPS; Gram-negative bacteria) and lipoteichoic acid (LTA; Gram-positive bacteria) on viability, proliferation, and osteogenic as well as adipogenic differentiation of human adipose tissue-derived mesenchymal stem cells (adMSC). We show that all three tested species were able to attach to and internalize into adMSC. The heat-inactivated Gram-negative E. coli as well as LPS were able to induce proliferation and osteogenic differentiation but reduce adipogenic differentiation of adMSC. Conspicuously, the heat-inactivated Gram-positive species showed the same effects on proliferation and adipogenic differentiation, while its cell wall component LTA exhibited no significant impact on adMSC. Therefore, our data demonstrate that osteogenic and adipogenic differentiation of adMSC is influenced in an oppositional fashion by bacterial antigens and that MSC-governed regeneration is not necessarily reduced under infectious conditions. - Highlights: • Staphylococcus aureus, Streptococcus pyogenes and Escherichia coli bind to and internalize into adMSC. • Heat-inactivated cells of these bacterial species trigger proliferation of adMSC. • Heat-inactivated E. coli and LPS induce osteogenic differentiation of adMSC. • Heat-inactivated E. coli and LPS reduce adipogenic differentiation of adMSC. • LTA does not influence adipogenic or osteogenic differentiation of adMSC.

  14. Fluoxetine Decreases the Proliferation and Adipogenic Differentiation of Human Adipose-Derived Stem Cells.

    PubMed

    Sun, Bo Kyung; Kim, Ji Hye; Choi, Joon-Seok; Hwang, Sung-Joo; Sung, Jong-Hyuk

    2015-07-22

    Fluoxetine was originally developed as an antidepressant, but it has also been used to treat obesity. Although the anti-appetite effect of fluoxetine is well-documented, its potential effects on human adipose-derived stem cells (ASCs) or mature adipocytes have not been investigated. Therefore, we investigated the mechanisms underlying the inhibitory effects of fluoxetine on the proliferation of ASCs. We also investigated its inhibitory effect on adipogenic differentiation. Fluoxetine significantly decreased ASC proliferation, and signal transduction PCR array analysis showed that it increased expression of autophagy-related genes. In addition, fluoxetine up-regulated SQSTM1 and LC3B protein expression as detected by western blotting and immunofluorescence. The autophagy inhibitor, 3-methyladenine (3-MA), significantly attenuated fluoxetine-mediated effects on ASC proliferation and SQSTM1/LC3B expression. In addition, 3-MA decreased the mRNA expression of two autophagy-related genes, beclin-1 and Atg7, in ASCs. Fluoxetine also significantly inhibited lipid accumulation and down-regulated the levels of PPAR-γ and C/EBP-α in ASCs. Collectively, these results indicate that fluoxetine decreases ASC proliferation and adipogenic differentiation. This is the first in vitro evidence that fluoxetine can reduce fat accumulation by inhibiting ASC proliferation and differentiation.

  15. YAP-mediated mechanotransduction regulates osteogenic and adipogenic differentiation of BMSCs on hierarchical structure.

    PubMed

    Pan, Houhua; Xie, Youtao; Zhang, Zequan; Li, Kai; Hu, Dandan; Zheng, Xuebin; Fan, Qiming; Tang, Tingting

    2017-04-01

    Hierarchical structure mimicking the natural bone microenvironment has been considered as a promising platform to regulate cell functions. We have previously fabricated hierarchical macropore/nanowire structure and evidence has shown that it can better manipulate the cytoskeleton status and osteogenic performance of osteoblasts. However, how cues of hierarchical structure are translated and ultimately linked to BMSC lineage commitment have still remained elusive, which hinders the accurate knowledge and further development of the hierarchical structure. In this study, bone marrow-derived mesenchymal stem cells (BMSCs) fate on hierarchical structure was investigated as well as the detailed mechanisms. It was shown that well-developed cytoskeleton and focal adhesion were observed for BMSCs on hierarchical structure, which was accompanied by enhanced osteogenic and depressed adipogenic potential. Evidence of increased YAP activity and nuclear translocation were exhibited on hierarchical structure and YAP knockdown inhibited osteogenic differentiation and promoted adipogenic differentiation induced by hierarchical structure. Further remove of cytoskeleton tension inhibited YAP function, which confirmed the key role of YAP-mediated mechanotransduction in the BMSC differentiation. These results together provide information of the stem cell fate commitment on hierarchical structure and a promising approach to design advanced biomaterials by focusing on specific mechanotransduction process.

  16. Inhibition of adipogenic differentiation of bone marrow mesenchymal stem cells by erythropoietin via activating ERK and P38 MAPK.

    PubMed

    Liu, G X; Zhu, J C; Chen, X Y; Zhu, A Z; Liu, C C; Lai, Q; Chen, S T

    2015-06-26

    We examined whether erythropoietin (EPO) can inhibit adipogenic differentiation of mesenchymal stem cells (MSCs) in the mouse bone marrow and its underlying mechanism. We separated and extracted mouse bone marrow MSCs and induced adipogenic differen-tiation using 3-isobutyl-1-methylxanthine, insulin, and dexamethasone. Different concentrations of EPO were added to the cells and observed by Oil Red O staining on the 20th day to quantitatively analyze the degree of cell differentiation. mRNA expression levels of peroxysome proliferator-activated receptor γ (PPARγ), CCAAT enhancer binding protein α, and adiponectin were analyzed by real-time quantitative polymerase chain reaction, and the activity of PPARγ, extracellular sig-nal-regulated kinase (ERK), and p38 mitogen-activated protein kinase (p38 MAPK) were determined by western blotting. EPO significantly inhibited adipogenic differentiation of MSCs after 20 days and reduced absorbance values by Oil Red O staining without affecting proliferation activity. EPO downregulated the mRNA expression of PPARγ, CCAAT enhancer binding protein α, fatty acid binding protein 4, and adiponec-tin during adipogenesis and increased protein phosphorylation of ERK, p38 MAPK, and PPARγ during differentiation. EPO downregulated the mRNA expression of PPARγ, CCAAT enhancer binding protein α, fatty acid binding protein 4, and adiponectin by increasing protein phosphor-ylation of ERK, p38 MAPK, and PPARγ during differentiation, which inhibited adipogenic differentiation of MSCs.

  17. Cell Models and Their Application for Studying Adipogenic Differentiation in Relation to Obesity: A Review.

    PubMed

    Ruiz-Ojeda, Francisco Javier; Rupérez, Azahara Iris; Gomez-Llorente, Carolina; Gil, Angel; Aguilera, Concepción María

    2016-06-30

    Over the last several years, the increasing prevalence of obesity has favored an intense study of adipose tissue biology and the precise mechanisms involved in adipocyte differentiation and adipogenesis. Adipocyte commitment and differentiation are complex processes, which can be investigated thanks to the development of diverse in vitro cell models and molecular biology techniques that allow for a better understanding of adipogenesis and adipocyte dysfunction associated with obesity. The aim of the present work was to update the different animal and human cell culture models available for studying the in vitro adipogenic differentiation process related to obesity and its co-morbidities. The main characteristics, new protocols, and applications of the cell models used to study the adipogenesis in the last five years have been extensively revised. Moreover, we depict co-cultures and three-dimensional cultures, given their utility to understand the connections between adipocytes and their surrounding cells in adipose tissue.

  18. Cell Models and Their Application for Studying Adipogenic Differentiation in Relation to Obesity: A Review

    PubMed Central

    Ruiz-Ojeda, Francisco Javier; Rupérez, Azahara Iris; Gomez-Llorente, Carolina; Gil, Angel; Aguilera, Concepción María

    2016-01-01

    Over the last several years, the increasing prevalence of obesity has favored an intense study of adipose tissue biology and the precise mechanisms involved in adipocyte differentiation and adipogenesis. Adipocyte commitment and differentiation are complex processes, which can be investigated thanks to the development of diverse in vitro cell models and molecular biology techniques that allow for a better understanding of adipogenesis and adipocyte dysfunction associated with obesity. The aim of the present work was to update the different animal and human cell culture models available for studying the in vitro adipogenic differentiation process related to obesity and its co-morbidities. The main characteristics, new protocols, and applications of the cell models used to study the adipogenesis in the last five years have been extensively revised. Moreover, we depict co-cultures and three-dimensional cultures, given their utility to understand the connections between adipocytes and their surrounding cells in adipose tissue. PMID:27376273

  19. Mechanical stretch inhibits mesenchymal stem cell adipogenic differentiation through TGFβ1/Smad2 signaling.

    PubMed

    Li, Runguang; Liang, Liang; Dou, Yonggang; Huang, Zeping; Mo, Huiting; Wang, Yaning; Yu, Bin

    2015-10-15

    Mesenchymal stem cells (MSCs) are the common precursors of several functionally disparate cell lineages. A plethora of chemical and physical stimuli contribute to lineage decisions and guidance, including mechanical stretch concomitant with physical movement. Here, we examined how stretch regulates MSC differentiation into adipocytes and the intracellular signaling pathways involved. MSCs were cultured under adipogenic conditions and divided into a control and an experimental group. Cultures in the experimental group were subjected to a sinusoidal stretch regimen delivered via flexible culture bottoms (5% magnitude, 10 times per min, 6h/day, 3 or 5 days). Expression levels of the adipocyte markers PPARγ-2, adiponectin, and C/EBPα were measured as indices of differentiation. Compared to controls, MSCs exposed to mechanical stretch exhibited downregulated PPARγ-2, adiponectin, and C/EBPα mRNA expression. Alternatively, stretch upregulated phosphorylation of Smad2. This stretch-induced increase in Smad2 phosphorylation was suppressed by pretreatment with the TGFβ1/Smad2 pathway antagonist SB-431542. Pretreatment with the TGFβ1/Smad2 signaling agonist TGFβ1 facilitated the inhibitory effect of stretch on the expression levels of PPARγ-2, adiponectin, and C/EBPα proteins, while pretreatment with SB-431542 reversed the inhibitory effects of subsequent stretch on the expression levels of these markers. These results strongly suggest that the anti-adipogenic effects of mechanical stretch on MSCs are mediated, at least in part, by activation of the TGFβ1/Smad2 signaling pathway.

  20. Differentiation of human CD146-positive endometrial stem cells to adipogenic-, osteogenic-, neural progenitor-, and glial-like cells.

    PubMed

    Fayazi, Mehri; Salehnia, Mojdeh; Ziaei, Saeideh

    2015-04-01

    The aim of this study was to investigate the potential differentiation of CD146(+) endometrial stem cells to several lineages. Endometrial stromal cells were cultured using Dulbecco's modified Eagle's medium/Hams F-12 (DMEM/F-12) and were passaged every 7-10 d when cultures reached 80-100% of confluency. The immunophenotypes of single endometrial cells were analyzed using flow cytometry at fourth passage. Then the CD146(+) cells were sorted using magnetic-activated cell sorting, and they were cultured and analyzed for in vitro differentiation to several lineages. Detection of adipocyte- and osteocyte-like cells were assessed by oil red O and alizarin red staining, respectively. For detection of neural progenitor and oligodendrocyte-like cells, the cells were immunostained by neurofilament 68 and oligo2, respectively. The rates of CD90, CD105, CD146, CD31, CD34, and CD9 of cultured endometrial cells were 94.98 ± 3%, 95.77 ± 2.5%, 27.61 ± 2%, 0.79 ± 0.05%, 1.43 ± 0.1%, and 1.01 ± 0.06%, respectively. CD146(+) cells were isolated to high purity. CD146(+)-differentiated cells to adipogenic cell with typical lipid-rich vacuoles and osteogenic cells were observed and confirmed their mesenchymal origin. They also differentiated into neural progenitor and glial differentiation by retinoic acid, basic fibroblast growth factor, and epidermal growth factor signaling molecules, respectively, and confirmed by neurofilament 68 and oligo2 immunocytochemistry. The efficiency of differentiation to neural progenitor and oligodendrocyte-like cells was 90 ± 3.4% and 79 ± 2.8%, respectively. This study showed that CD146(+) cells from human endometrium after in vitro cultivation can differentiate into adipogenic-, osteogenic-, neural progenitor-, and glial-like cells. They may provide available alternative source of stem cells for future cell-based therapies and tissue engineering applications.

  1. Impact of bacteria and bacterial components on osteogenic and adipogenic differentiation of adipose-derived mesenchymal stem cells.

    PubMed

    Fiedler, Tomas; Salamon, Achim; Adam, Stefanie; Herzmann, Nicole; Taubenheim, Jan; Peters, Kirsten

    2013-11-01

    Adult mesenchymal stem cells (MSC) are present in several tissues, e.g. bone marrow, heart muscle, brain and subcutaneous adipose tissue. In invasive infections MSC get in contact with bacteria and bacterial components. Not much is known about how bacterial pathogens interact with MSC and how contact to bacteria influences MSC viability and differentiation potential. In this study we investigated the impact of three different wound infection relevant bacteria, Escherichia coli, Staphylococcus aureus, and Streptococcus pyogenes, and the cell wall components lipopolysaccharide (LPS; Gram-negative bacteria) and lipoteichoic acid (LTA; Gram-positive bacteria) on viability, proliferation, and osteogenic as well as adipogenic differentiation of human adipose tissue-derived mesenchymal stem cells (adMSC). We show that all three tested species were able to attach to and internalize into adMSC. The heat-inactivated Gram-negative E. coli as well as LPS were able to induce proliferation and osteogenic differentiation but reduce adipogenic differentiation of adMSC. Conspicuously, the heat-inactivated Gram-positive species showed the same effects on proliferation and adipogenic differentiation, while its cell wall component LTA exhibited no significant impact on adMSC. Therefore, our data demonstrate that osteogenic and adipogenic differentiation of adMSC is influenced in an oppositional fashion by bacterial antigens and that MSC-governed regeneration is not necessarily reduced under infectious conditions.

  2. [An improved differential medium, CA medium, for differentiating Shigella].

    PubMed

    Tokoro, M; Nagano, I; Goto, K; Nakamura, A

    1990-07-01

    We devised a Citrate-Acetate (CA) medium for rapidly differentiating Shigella. The medium consisted of 3.0 g of sodium citrate, 2.0 g of sodium acetate, 0.2 g of glucose, 1.0 g of dipotassium phosphate, 1.0 g of mono ammonium phosphate, 0.2 g of magnesium sulfate, 5.0 g of sodium chloride, 0.08 g of brom thymol blue, 15.0 g of agar, and 1000 ml of distilled water. An evaluation was made of the CA medium, for the rapid differentiation of 23 Shigella strains, 129 Escherichia coli strains and 130 isolates, that formed colourless colonies suspected to be Shigella on SS agar plate, from feces of healthy people. The results obtained were as follows 1) On the CA medium, all Shigella strains did not grow and there was no change in colour. 2) Positive growth rates of E. coli strains after incubation for 24 hr at 37 degrees C on CA medium, sodium acetate medium (Acet) and Christensen citrate medium (C-Cit) were 96.0%, 95.2% and 28.0%, respectively. Therefore, the positive growth rate of E. coli strains after incubation for 24 hr on CA medium was significantly higher (p less than 0.01) than that on C-Cit medium. 3) Positive growth rates of isolates after incubation for 24 hr at 37 degrees C on CA medium, Acet medium and C-Cit medium were 95.4%, 83.1% and 71.5%, respectively. Therefore, the positive growth rates of isolates after incubation for 24 hr on CA medium was significantly higher (p less than 0.01) than that on Acet medium and C-Cit medium.(ABSTRACT TRUNCATED AT 250 WORDS)

  3. The scaffold protein Tks4 is required for the differentiation of mesenchymal stromal cells (MSCs) into adipogenic and osteogenic lineages

    PubMed Central

    Dülk, Metta; Kudlik, Gyöngyi; Fekete, Anna; Ernszt, Dávid; Kvell, Krisztián; Pongrácz, Judit E.; Merő, Balázs L.; Szeder, Bálint; Radnai, László; Geiszt, Miklós; Csécsy, Dalma E.; Kovács, Tamás; Uher, Ferenc; Lányi, Árpád; Vas, Virag; Buday, László

    2016-01-01

    The commitment steps of mesenchymal stromal cells (MSCs) to adipogenic and other lineages have been widely studied but not fully understood. Therefore, it is critical to understand which molecules contribute to the conversion of stem cells into differentiated cells. The scaffold protein Tks4 plays a role in podosome formation, EGFR signaling and ROS production. Dysfunction of Tks4 causes a hereditary disease called Frank-ter Haar syndrome with a variety of defects concerning certain mesenchymal tissues (bone, fat and cartilage) throughout embryogenic and postnatal development. In this study, we aimed to analyze how the mutation of Tks4 affects the differentiation potential of multipotent bone marrow MSCs (BM-MSCs). We generated a Tks4 knock-out mouse strain on C57Bl/6 background, and characterized BM-MSCs isolated from wild type and Tks4−/− mice to evaluate their differentiation. Tks4−/− BM-MSCs had reduced ability to differentiate into osteogenic and adipogenic lineages compared to wild type. Studying the expression profile of a panel of lipid-regulated genes during adipogenic induction revealed that the expression of adipogenic transcription factors, genes responsible for lipid droplet formation, sterol and fatty acid metabolism was delayed or reduced in Tks4−/− BM-MSCs. Taken together, these results establish a novel function for Tks4 in the regulation of MSC differentiation. PMID:27711054

  4. Flow Cytometric Isolation and Differentiation of Adipogenic Progenitor Cells into Brown and Brite/Beige Adipocytes.

    PubMed

    Steinbring, Jochen; Graja, Antonia; Jank, Anne-Marie; Schulz, Tim J

    2017-01-01

    Aside from mature adipocytes, adipose tissue harbors several distinct cell populations including immune cells, endothelial cells, and adipogenic progenitor cells (AdPCs). AdPCs represent the reservoir of regenerative cells that replenishes adipocytes during normal cellular turnover and during times of increased demand for triglyceride-storage capacity. The worldwide increase in pathologies associated with the metabolic syndrome, such as obesity and type-2 diabetes, has heightened public and scientific interest in adipose tissues and the cell biological processes of adipose tissue formation and function. Two distinct types of fat cells are known: White and brown adipocytes. Especially brown adipose tissue (BAT) has received considerable attention due to its unique capacity for thermogenic energy expenditure and potential role in the treatment of adiposity. Accordingly, the cold-induced conversion of white into brown-like adipocytes has become a feasible approach in humans and a study-subject in rodents to better understand the underlying molecular processes. Fluorescence-activated cell sorting (FACS) provides a method to isolate AdPCs and other cell populations from adipose tissue by using antibodies detecting unique surface markers. We here describe an approach to isolate cells committed to the adipogenic lineage and summarize established protocols to differentiate FACS-purified primary AdPCs into UCP1-expressing brown adipocytes under in vitro conditions.

  5. Hypoxia increases Sca-1/CD44 co-expression in murine mesenchymal stem cells and enhances their adipogenic differentiation potential.

    PubMed

    Valorani, M G; Germani, A; Otto, W R; Harper, L; Biddle, A; Khoo, C P; Lin, W R; Hawa, M I; Tropel, P; Patrizi, M P; Pozzilli, P; Alison, M R

    2010-07-01

    Mesenchymal stem cells (MSCs) are usually cultured under normoxic conditions (21% oxygen). However, in vivo, the physiological "niches" for MSCs have a much lower oxygen tension. Because of their plasticity, stem cells are particularly sensitive to their environments, and oxygen tension is one developmentally important stimulus in stem cell biology and plays a role in the intricate balance between cellular proliferation and commitment towards differentiation. Therefore, we investigated here the effect of hypoxia (2% oxygen) on murine adipose tissue (AT) MSC proliferation and adipogenic differentiation. AT cells were obtained from the omental fat and AT-MSCs were selected for their ability to attach to the plastic dishes, and were grown under normoxic and hypoxic conditions. Prior exposure of MSCs to hypoxia led to a significant reduction of ex vivo expansion time, with significantly increased numbers of Sca-1(+) as well as Sca-1(+)/CD44(+)double-positive cells. Under low oxygen culture conditions, the AT-MSC number markedly increased and their adipogenic differentiation potential was reduced. Notably, the hypoxia-mediated inhibition of adipogenic differentiation was reversible: AT-MSCs pre-exposed to hypoxia when switched to normoxic conditions exhibited significantly higher adipogenic differentiation capacity compared to their pre-exposed normoxic-cultured counterparts. Accordingly, the expression of adipocyte-specific genes, peroxisome proliferator activated receptor gamma (Ppargamma), lipoprotein lipase (Lpl) and fatty acid binding protein 4 (Fabp4) were significantly enhanced in hypoxia pre-exposed AT-MSCs. In conclusion, pre-culturing MSCs under hypoxic culture conditions may represent a strategy to enhance MSC production, enrichment and adipogenic differentiation.

  6. Distal-less homeobox 5 inhibits adipogenic differentiation through the down-regulation of peroxisome proliferator-activated receptor γ expression.

    PubMed

    Lee, Hye-Lim; Woo, Kyung Mi; Ryoo, Hyun-Mo; Baek, Jeong-Hwa

    2013-01-01

    Distal-less homeobox 5 (Dlx5) is a positive regulator of osteoblast differentiation that contains a homeobox domain. Because there are possible reciprocal relationships between osteogenic and adipogenic differentiation of bone marrow mesenchymal stem cells (MSCs), we examined the regulatory role of Dlx5 in adipogenic differentiation in this study. Adipogenic stimuli suppressed the expression levels of Dlx5 mRNA in mouse bone marrow stromal cells. Over-expression of Dlx5 inhibited adipogenic differentiation in human bone marrow MSCs and 3T3-L1 preadipocytic cells whereas knockdown of Dlx5 enhanced adipogenic differentiation in 3T3-L1 cells. Over-expression of Dlx5 suppressed the expression of adipogenic marker genes, including CCAAT/enhancer-binding protein α (C/EBPα) and peroxisome proliferator-activated receptor γ (PPARγ). Dlx5-mediated suppression of adipogenic differentiation was overcome by over-expression of PPARγ but not by that of cAMP response element binding protein (CREB) or C/EBPα. Dlx5 decreased the transcriptional activity of CREB and C/EBPα in a dose-dependent manner. Dlx5 directly bound to CREB and C/EBPα and prevented them from binding to and subsequently transactivating the PPARγ promoter. These results suggest that Dlx5 plays an important regulatory role in fate determination of bone marrow MSCs toward the osteoblast lineage through the inhibition of adipocyte differentiation as well as the direct stimulation of osteoblast differentiation.

  7. Multiphoton fluorescence lifetime imaging of metabolic status in mesenchymal stem cell during adipogenic differentiation

    NASA Astrophysics Data System (ADS)

    Meleshina, A. V.; Dudenkova, V. V.; Shirmanova, M. V.; Bystrova, A. S.; Zagaynova, E. V.

    2016-03-01

    Non-invasive imaging of cell metabolism is a valuable approach to assess the efficacy of stem cell therapy and understand the tissue development. In this study we analyzed metabolic trajectory of the mesenchymal stem cells (MCSs) during differentiation into adipocytes by measuring fluorescence lifetimes of free and bound forms of the reduced nicotinamide adenine dinucleotide (NAD(P)H) and flavine adenine dinucleotide (FAD). Undifferentiated MSCs and MSCs on the 5, 12, 19, 26 days of differentiation were imaged on a Zeiss 710 microscope with fluorescence lifetime imaging (FLIM) system B&H (Germany). Fluorescence of NAD(P)H and FAD was excited at 750 nm and 900 nm, respectively, by a femtosecond Ti:sapphire laser and detected in a range 455-500 nm and 500-550 nm, correspondingly. We observed the changes in the NAD(P)H and FAD fluorescence lifetimes and their relative contributions in the differentiated adipocytes compare to undifferentiated MSCs. Increase of fluorescence lifetimes of the free and bound forms of NAD(P)H and the contribution of protein-bound NAD(P)H was registered, that can be associated with a metabolic switch from glycolysis to oxidative phosphorylation and/or synthesis of lipids in adipogenically differentiated MSCs. We also found that the contribution of protein-bound FAD decreased during differentiation. After carrying out appropriate biochemical measurements, the observed changes in cellular metabolism can potentially serve to monitor stem cell differentiation by FLIM.

  8. Cell-mediated remodeling of biomimetic encapsulating hydrogels triggered by adipogenic differentiation of adipose stem cells

    PubMed Central

    Clevenger, Tracy N; Luna, Gabriel; Boctor, Daniel; Fisher, Steven K; Clegg, Dennis O

    2016-01-01

    One of the most common regenerative therapies is autologous fat grafting, which frequently suffers from unexpected volume loss. One approach is to deliver adipose stem cells encapsulated in the engineered hydrogels supportive of cell survival, differentiation, and integration after transplant. We describe an encapsulating, biomimetic poly(ethylene)-glycol hydrogel, with embedded peptides for attachment and biodegradation. Poly(ethylene)-glycol hydrogels containing an Arg–Gly–Asp attachment sequence and a matrix metalloprotease 3/10 cleavage site supported adipose stem cell survival and showed remodeling initiated by adipogenic differentiation. Arg–Gly–Asp–matrix metalloprotease 3/10 cleavage site hydrogels showed an increased number and area of lacunae or holes after adipose stem cell differentiation. Image analysis of adipose stem cells in Arg–Gly–Asp–matrix metalloprotease 3/10 cleavage site hydrogels showed larger Voronoi domains, while cell density remained unchanged. The differentiated adipocytes residing within these newly remodeled spaces express proteins and messenger RNAs indicative of adipocytic differentiation. These engineered scaffolds may provide niches for stem cell differentiation and could prove useful in soft tissue regeneration. PMID:27733898

  9. The role of reactive oxygen species in mesenchymal stem cell adipogenic and osteogenic differentiation: a review.

    PubMed

    Atashi, Fatemeh; Modarressi, Ali; Pepper, Michael S

    2015-05-15

    Mesenchymal stromal cells (MSCs) are promising candidates for tissue engineering and regenerative medicine. The multipotent stem cell component of MSC isolates is able to differentiate into derivatives of the mesodermal lineage including adipocytes, osteocytes, chondrocytes, and myocytes. Many common pathways have been described in the regulation of adipogenesis and osteogenesis. However, stimulation of osteogenesis appears to suppress adipogenesis and vice-versa. Increasing evidence implicates a tight regulation of these processes by reactive oxygen species (ROS). ROS are short-lived oxygen-containing molecules that display high chemical reactivity toward DNA, RNA, proteins, and lipids. Mitochondrial complexes I and III, and the NADPH oxidase isoform NOX4 are major sources of ROS production during MSC differentiation. ROS are thought to interact with several pathways that affect the transcription machinery required for MSC differentiation including the Wnt, Hedgehog, and FOXO signaling cascades. On the other hand, elevated levels of ROS, defined as oxidative stress, lead to arrest of the MSC cell cycle and apoptosis. Tightly regulated levels of ROS are therefore critical for MSC terminal differentiation, although the precise sources, localization, levels and the exact species of ROS implicated remain to be determined. This review provides a detailed overview of the influence of ROS on adipogenic and osteogenic differentiation in MSCs.

  10. Zinc finger factor 521 enhances adipogenic differentiation of mouse multipotent cells and human bone marrow mesenchymal stem cells.

    PubMed

    Tseng, Kuo-Yun; Lin, Shankung

    2015-06-20

    Previously, we found that ZNF521 expression was up-regulated with advancing age in human bone marrow mesenchymal stem cells (bmMSCs). Here, we investigated the regulatory role of ZNF521 in the differentiation of mouse C3H10T1/2 cells and human bmMSCs. Our data show that ZNF521 overexpression repressed osteoblastic differentiation of C3H10T1/2 cells, accompanied by a decrease in Runx2 expression and an increase in PPARγ2 expression. In contrast, ZNF521 overexpression enhanced adipogenic differentiation of C3H10T1/2 cells, concomitant with increased expression of PPARγ2, aP2, adiponectin and C/EBPδ. Chromatin immunoprecipitation followed by quantitative PCR analyses and luciferase reporter assays suggested that ZNF521 overexpression enhances PPARγ2 expression at the transcriptional level. The enhancing effect of ZNF521 overexpression on the adipogenic differentiation of C3H10T1/2 cells was also observed ex vivo. Finally, similar to those noted in C3H10T1/2 cells, ZNF521 overexpression in human bmMSCs was found to promote adipogenic differentiation in vitro and ex vivo, but repressed osteoblastic differentiation in vitro. ZNF521 knockdown significantly repressed adipogenic differentiation in vitro and ex vivo, but promoted osteoblastic differentiation in vitro. We propose that ZNF521 can function as a repressor of osteoblastic differentiation of bmMSCs while promoting adipogenesis, and that elevated ZNF521 expression might play a role in the age-related bone loss.

  11. Upregulation of miR-22 promotes osteogenic differentiation and inhibits adipogenic differentiation of human adipose tissue-derived mesenchymal stem cells by repressing HDAC6 protein expression.

    PubMed

    Huang, Shan; Wang, Shihua; Bian, Chunjing; Yang, Zhuo; Zhou, Hong; Zeng, Yang; Li, Hongling; Han, Qin; Zhao, Robert Chunhua

    2012-09-01

    Mesenchmal stem cells (MSCs) can be differentiated into either adipocytes or osteoblasts, and a reciprocal relationship exists between adipogenesis and osteogenesis. Multiple transcription factors and signaling pathways have been reported to regulate adipogenic or osteogenic differentiation, respectively, yet the molecular mechanism underlying the cell fate alteration between adipogenesis and osteogenesis still remains to be illustrated. MicroRNAs are important regulators in diverse biological processes by repressing protein expression of their targets. Here, miR-22 was found to regulate adipogenic and osteogenic differentiation of human adipose tissue-derived mesenchymal stem cells (hADMSCs) in opposite directions. Our data showed that miR-22 decreased during the process of adipogenic differentiation but increased during osteogenic differentiation. On one hand, overexpression of miR-22 in hADMSCs could inhibit lipid droplets accumulation and repress the expression of adipogenic transcription factors and adipogenic-specific genes. On the other hand, enhanced alkaline phosphatase activity and matrix mineralization, as well as increased expression of osteo-specific genes, indicated a positive role of miR-22 in regulating osteogenic differentiation. Target databases prediction and validation by Dual Luciferase Reporter Assay, western blot, and real-time polymerase chain reaction identified histone deacetylase 6 (HDAC6) as a direct downstream target of miR-22 in hADMSCs. Inhibition of endogenous HDAC6 by small-interfering RNAs suppressed adipogenesis and stimulated osteogenesis, consistent with the effect of miR-22 overexpression in hADMSCs. Together, our results suggested that miR-22 acted as a critical regulator of balance between adipogenic and osteogenic differentiation of hADMSCs by repressing its target HDAC6.

  12. Nucleoredoxin promotes adipogenic differentiation through regulation of Wnt/β-catenin signaling.

    PubMed

    Bahn, Young Jae; Lee, Kwang-Pyo; Lee, Seung-Min; Choi, Jeong Yi; Seo, Yeon-Soo; Kwon, Ki-Sun

    2015-02-01

    Nucleoredoxin (NRX) is a member of the thioredoxin family of proteins that controls redox homeostasis in cell. Redox homeostasis is a well-known regulator of cell differentiation into various tissue types. We found that NRX expression levels were higher in white adipose tissue of obese ob/ob mice and increased in the early adipogenic stage of 3T3-L1 preadipocyte differentiation. Knockdown of NRX decreased differentiation of 3T3-L1 cells, whereas overexpression increased differentiation. Adipose tissue-specific NRX transgenic mice showed increases in adipocyte size as well as number compared with WT mice. We further confirmed that the Wingless/int-1 class (Wnt)/β-catenin pathway was also involved in NRX-promoted adipogenesis, consistent with a previous report showing NRX regulation of this pathway. Genes involved in lipid metabolism were downregulated, whereas inflammatory genes, including those encoding macrophage markers, were significantly upregulated, likely contributing to the obesity in Adipo-NRX mice. Our results therefore suggest that NRX acts as a novel proadipogenic factor and controls obesity in vivo.

  13. Effects of Cerium Oxide Nanoparticles on the Proliferation, Osteogenic Differentiation and Adipogenic Differentiation of Primary Mouse Bone Marrow Stromal Cells In Vitro.

    PubMed

    Zhang, Qun; Ge, Kun; Ren, Huihui; Zhang, Cuimiao; Zhang, Jinchao

    2015-09-01

    The effects of cerium oxide nanoparticles (nanoceria) on the proliferation, osteogenic and adipogenic differentiation of primary mouse bone marrow stromal cells (BMSCs) were studied by employing 3-(4,5-dimethylthiazol-2-yl)-2,5-dipheny tetrazolium bromide (MTT), alkaline phosphatase (ALP) activity, collagen production, alizarin red-S (ARS) and oil red o stain assays. The results indicated that nanoceria increased the viability of BMSCs at all tested concentrations with evident dose dependence for 24 and 72 h. On day 14, nanoceria inhibited the osteogenic differentiation of BMSCs at all tested concentrations. On day 19 and 24, nanoceria inhibited the formation of mineralized matrix nodules of BMSCs at all tested concentrations. On day 17, nanoceria inhibited the adipogenic differentiation of BMSCs at all tested concentrations. This suggests that the effects of nanoceria on the proliferation, osteogenic differentiation and adipogenic differentiation of BMSCs are very complicated. Both the concentration and culture time have significant influence on the proliferation, osteogenic differentiation and adipogenic differentiation of BMSCs. These results will be helpful for rational applications of nanoceria in the future.

  14. All-trans retinoic acid shifts rosiglitazone-induced adipogenic differentiation to osteogenic differentiation in mouse embryonic fibroblasts.

    PubMed

    Shao, Ying; Chen, Qian-Zhao; Zeng, Yu-Hua; Li, Yang; Ren, Wen-Yan; Zhou, Lin-Yun; Liu, Rong-Xin; Wu, Ke; Yang, Jun-Qing; Deng, Zhong-Liang; Yu, Yu; Sun, Wen-Juan; He, Bai-Cheng

    2016-12-01

    Rosiglitazone (RSG) is a potent drug used in the treatment of insulin resistance; however, it is associated with marked skeletal toxicity. RSG-induced osteoporosis may contribute to the promotion of adipogenic differentiation at the expense of osteogenic differentiation in bone marrow stromal cells. The aim of this study was to investigate whether RSG-induced bone toxicity can be reversed by combined treatment with all-trans retinoic acid (ATRA). We examined different osteogenic markers in mouse embryonic fibroblasts (MEFs) following treatment with RSG, ATRA, or RSG and ATRA in combination. We examined the effects of RSG and/or ATRA on ectopic bone formation, and dissected the possible molecular mechanisms underlying this process. We found that ATRA or RSG both induced alkaline phosphatase (ALP) activity in the MEFs, and that the ATRA-induced ALP activity was enhanced by RSG and vice versa. However, only the combination of RSG and ATRA increased the expression of osteopontin and osteocalcin, promoted matrix mineralization, and induced ectopic ossification in MEFs. Mechanistically, we found that the osteogenic differentiation induced by the combination of RSG and ATRA may be mediated partly by suppressing RSG-induced adipogenic differentiation and activating bone morphogenetic protein (BMP)/Smad signaling. On the whole, our findings demonstrate that RSG in combination with ATRA promotes the commitment of MEFs to the osteoblast lineage. Thus, the combination of these two agents may prove to be a promising and novel therapeutic regimen for insulin resistance without skeletal toxicity. It may also be a better strategy with which to prevent RSG-induced osteoporosis.

  15. All-trans retinoic acid shifts rosiglitazone-induced adipogenic differentiation to osteogenic differentiation in mouse embryonic fibroblasts

    PubMed Central

    Shao, Ying; Chen, Qian-Zhao; Zeng, Yu-Hua; Li, Yang; Ren, Wen-Yan; Zhou, Lin-Yun; Liu, Rong-Xin; Wu, Ke; Yang, Jun-Qing; Deng, Zhong-Liang; Yu, Yu; Sun, Wen-Juan; He, Bai-Cheng

    2016-01-01

    Rosiglitazone (RSG) is a potent drug used in the treatment of insulin resistance; however, it is associated with marked skeletal toxicity. RSG-induced osteoporosis may contribute to the promotion of adipogenic differentiation at the expense of osteogenic differentiation in bone marrow stromal cells. The aim of this study was to investigate whether RSG-induced bone toxicity can be reversed by combined treatment with all-trans retinoic acid (ATRA). We examined different osteogenic markers in mouse embryonic fibroblasts (MEFs) following treatment with RSG, ATRA, or RSG and ATRA in combination. We examined the effects of RSG and/or ATRA on ectopic bone formation, and dissected the possible molecular mechanisms underlying this process. We found that ATRA or RSG both induced alkaline phosphatase (ALP) activity in the MEFs, and that the ATRA-induced ALP activity was enhanced by RSG and vice versa. However, only the combination of RSG and ATRA increased the expression of osteopontin and osteocalcin, promoted matrix mineralization, and induced ectopic ossification in MEFs. Mechanistically, we found that the osteogenic differentiation induced by the combination of RSG and ATRA may be mediated partly by suppressing RSG-induced adipogenic differentiation and activating bone morphogenetic protein (BMP)/Smad signaling. On the whole, our findings demonstrate that RSG in combination with ATRA promotes the commitment of MEFs to the osteoblast lineage. Thus, the combination of these two agents may prove to be a promising and novel therapeutic regimen for insulin resistance without skeletal toxicity. It may also be a better strategy with which to prevent RSG-induced osteoporosis. PMID:27779644

  16. SHARP1/DEC2 inhibits adipogenic differentiation by regulating the activity of C/EBP.

    PubMed

    Gulbagci, Neriman Tuba; Li, Li; Ling, Belinda; Gopinadhan, Suma; Walsh, Martin; Rossner, Moritz; Nave, Klaus-Armin; Taneja, Reshma

    2009-01-01

    SHARP1, a basic helix-loop-helix transcription factor, is expressed in many cell types; however, the mechanisms by which it regulates cellular differentiation remain largely unknown. Here, we show that SHARP1 negatively regulates adipogenesis. Although expression of the early marker CCAAT/enhancer binding protein beta (C/EBPbeta) is not altered, its crucial downstream targets C/EBPalpha and peroxisome proliferator-activated receptor gamma (PPARgamma) are downregulated by SHARP1. Protein interaction studies confirm that SHARP1 interacts with and inhibits the transcriptional activity of both C/EBPbeta and C/EBPalpha, and enhances the association of C/EBPbeta with histone deacetylase 1 (HDAC1). Consistently, in SHARP1-expressing cells, HDAC1 and the histone methyltransferase G9a are retained at the C/EBP regulatory sites on the C/EBPalpha and PPARgamma2 promoters during differentiation, resulting in inhibition of their expression. Interestingly, treatment with troglitazone results in displacement of HDAC1 and G9a, and rescues the differentiation defect of SHARP1-overexpressing cells. Our data indicate that SHARP1 inhibits adipogenesis through the regulation of C/EBP activity, which is essential for PPARgamma-ligand-dependent displacement of co-repressors from adipogenic promoters.

  17. Biochanin a promotes osteogenic but inhibits adipogenic differentiation: evidence with primary adipose-derived stem cells.

    PubMed

    Su, Shu-Jem; Yeh, Yao-Tsung; Su, Shu-Hui; Chang, Kee-Lung; Shyu, Huey-Wen; Chen, Kuan-Ming; Yeh, Hua

    2013-01-01

    Biochanin A has promising effects on bone formation in vivo, although the underlying mechanism remains unclear yet. This study therefore aimed to investigate whether biochanin A regulates osteogenic and adipogenic differentiation using primary adipose-derived stem cells. The effects of biochanin A (at a physiologically relevant concentration of 0.1-1 μM) were assessed in vitro using various approaches, including Oil red O staining, Nile red staining, alizarin red S staining, alkaline phosphatase (ALP) activity, flow cytometry, RT-PCR, and western blotting. The results showed that biochanin A significantly suppressed adipocyte differentiation, as demonstrated by the inhibition of cytoplasmic lipid droplet accumulation, along with the inhibition of peroxisome proliferator-activated receptor gamma (PPAR γ ), lipoprotein lipase (LPL), and leptin and osteopontin (OPN) mRNA expression, in a dose-dependent manner. On the other hand, treatment of cells with 0.3 μM biochanin A increased the mineralization and ALP activity, and stimulated the expression of the osteogenic marker genes ALP and osteocalcin (OCN). Furthermore, biochanin A induced the expression of runt-related transcription factor 2 (Runx2), osteoprotegerin (OPG), and Ras homolog gene family, member A (RhoA) proteins. These observations suggest that biochanin A prevents adipogenesis, enhances osteoblast differentiation in mesenchymal stem cells, and has beneficial regulatory effects in bone formation.

  18. Capsaicin inhibits the adipogenic differentiation of bone marrow mesenchymal stem cells by regulating cell proliferation, apoptosis, oxidative and nitrosative stress.

    PubMed

    Ibrahim, Muhammed; Jang, Mi; Park, Mina; Gobianand, Kuppannan; You, Seungkwon; Yeon, Sung-Heom; Park, Sungkwon; Kim, Min Ji; Lee, Hyun-Jeong

    2015-07-01

    Obesity is a global health problem that requires the utmost attention. Apart from other factors the trans-differentiation of mesenchymal stem cells (MSCs) into adipocytes is an added detrimental factor causing the intensification of obesity. The main objective of this present study is to analyse whether capsaicin is capable of inhibiting the differentiation of BMSCs to adipocytes. Bone marrow mesenchymal stem cells (BMSCs) were obtained and exposed to different concentrations of capsaicin for a period of 6 days following 2 days of adipogenic induction. The capsaicin exposed cells were collected at three different time points (2, 4 and 6 days) and subjected to various analyses. BMSCs after exposure to capsaicin showed dose and time dependent reduction in cell viability and proliferation. Interestingly, capsaicin induced cell cycle arrest at G0-G1 and increased apoptosis by increasing reactive oxygen species (ROS) and reactive nitrogen species (RNS) production. Capsaicin significantly inhibited the early adipogenic differentiation, lipogenesis and maturation of adipocytes with concomitant repression of PPARγ, C/EBPα, FABP4 and SCD-1. Taken together, the results of the present study have clearly emphasized that capsaicin potentially inhibits the adipogenic differentiation of mesenchymal stem cells via many different pathways (anti-proliferative, apoptotic and cell cycle arrest) through the stimulation of ROS and RNS production. Thus, capsaicin not only suppresses the maturation of pre-adipocytes into adipocytes but also inhibits the differentiation of mesenchymal stem cells into adipocytes.

  19. Depletion of mitoferrins leads to mitochondrial dysfunction and impairment of adipogenic differentiation in 3T3-L1 preadipocytes.

    PubMed

    Chen, Y-C; Wu, Y-T; Wei, Y-H

    2015-01-01

    Dysregulation of iron homeostasis is a potential risk factor for type 2 diabetes mellitus (T2DM) and insulin resistance. Iron transported into mitochondria by mitoferrins is mainly utilized for the biosynthesis of iron-sulfur clusters, heme, and other cofactors. Recent studies revealed that mitochondrial dysfunction leads to impaired adipogenesis and insulin insensitivity in adipocytes. However, it is unknown whether mitochondrial iron import and iron status affect the biogenesis and function of mitochondria during adipogenic differentiation. In this study, we used double knockdown of mitoferrin 1 and mitoferrin 2 (Mfrn1/2) to investigate the role of mitochondrial iron homeostasis in mitochondrial bioenergetic function and adipogenic differentiation. The results showed that depletion of Mfrn1/2 in 3T3-L1 preadipocytes impaired the biosynthesis of iron-sulfur proteins in mitochondria due to a decrease in mitochondrial iron content. This was associated with a decrease in mitochondrial oxygen consumption rate and intracellular ATP level in adipocytes with Mfrn1/2 knockdown. Remarkably, Mfrn1/2 deficiency reduced the expression of adipogenic genes and lipid production during adipogenic differentiation. Moreover, insulin-induced glucose uptake and Akt phosphorylation at the Ser473 residue were decreased concurrently in adipocytes differentiated from 3T3-L1 preadipocytes after knockdown of Mfrn1/2. These findings suggest that dysregulation of mitochondrial iron metabolism elicited by knockdown of Mfrn1/2 results in mitochondrial dysfunction, which culminates in the compromise of differentiation and insulin insensitivity of adipocytes. This scenario may explain the recent findings that iron deficiency or alterations in iron metabolism are associated with the pathogenesis of T2DM.

  20. Adipogenic differentiation of stem cells in three-dimensional porous bacterial nanocellulose scaffolds.

    PubMed

    Krontiras, Panagiotis; Gatenholm, Paul; Hägg, Daniel A

    2015-01-01

    There is an increased interest in developing adipose tissue for in vitro and in vivo applications. Current two-dimensional (2D) cell-culture systems of adipocytes are limited, and new methods to culture adipocytes in three-dimensional (3D) are warranted as a more life-like model to study metabolic diseases such as obesity and diabetes. In this study, we have evaluated different porous bacterial nanocellulose scaffolds for 3D adipose tissue. In an initial pilot study, we compared adipogenic differentiation of mice mesenchymal stem cells from a cell line on 2D and 3D scaffolds of bacterial nanocellulose. The 3D scaffolds were engineered by crosslinking homogenized cellulose fibrils using alginate and freeze drying the mixture to obtain a porous structure. Quenching the scaffolds in liquid nitrogen resulted in smaller pores compared to slower freezing using isopropanol. We found that on 2D surfaces, the cells were scarcely distributed and showed limited formation of lipid droplets, whereas cells grown in macroporous 3D scaffolds contained more cells growing in clusters, containing large lipid droplets. All four types of scaffolds contained a lot of adipocytes, but scaffolds with smaller pores contained larger cell clusters than scaffolds with bigger pores, with viable adipocytes present even 4 weeks after differentiation. Scaffolds with lower alginate fractions retained their pore integrity better. We conclude that 3D culturing of adipocytes in bacterial nanocellulose macroporous scaffolds is a promising method for fabrication of adipose tissue as an in vitro model for adipose biology and metabolic disease.

  1. The effect of mechanical stress on the proliferation, adipogenic differentiation and gene expression of human adipose-derived stem cells.

    PubMed

    Paul, Nora E; Denecke, Bernd; Kim, Bong-Sung; Dreser, Alice; Bernhagen, Jürgen; Pallua, Norbert

    2017-01-17

    To allow for a better implementation of external volume expansion to clinical applications for soft tissue regeneration, it is necessary to comprehensively understand the underlying mechanisms. Since human adipose-derived stem cells (hASCs) play a crucial role in soft tissue enlargement, we investigated the impact of cyclic stretch on gene expression, proliferation rate, and adipogenic differentiation of these cells. After cyclic stretching, RNA was extracted and subjected to DNA microarray analysis and RT-qPCR. Also, the expression of FABP4 mRNA was analysed by RT-qPCR to test whether mechanical stretch affected adipogenic differentiation of hASCs. Proliferation rate was assessed by alamarBlue assay and Ki-67 staining. Cell cycle analysis was performed with flow cytometry and Western blot. We found that cyclic stretch significantly induced the expression of CYP1B1 mRNA. Further, the adipogenic differentiation of hASCs was impaired as was the proliferation. This was partly due to a decrease in extracellular signal-regulated kinase (ERK) 1/2 and histone H3 phosphorylation, suggesting a growth arrest in the G2 /M phase of the cell cycle. Enrichment analyses demonstrated that stretch-regulated genes were over-represented in pathways and biological processes involved in extracellular matrix organisation, vascular remodelling, and responses to cell stress. Taken together, mechanical stress impaired both the proliferation and adipogenic differentiation, but led to a tissue-remodelling phenotype of hASCs. These data suggest that extracellular matrix remodelling and neoangiogenesis may play a more important role in external volume expansion than proliferation and adipogenesis of hASCs.

  2. Novel markers of osteogenic and adipogenic differentiation of human bone marrow stromal cells identified using a quantitative proteomics approach.

    PubMed

    Granéli, Cecilia; Thorfve, Anna; Ruetschi, Ulla; Brisby, Helena; Thomsen, Peter; Lindahl, Anders; Karlsson, Camilla

    2014-01-01

    Today, the tool that is most commonly used to evaluate the osteogenic differentiation of bone marrow stromal cells (BMSCs) in vitro is the demonstration of the expression of multiple relevant markers, such as ALP, RUNX2 and OCN. However, as yet, there is no single surface marker or panel of markers which clearly defines human BMSCs (hBMSCs) differentiating towards the osteogenic lineage. The aim of this study was therefore to examine this issue. Stable isotope labeling by amino acids in cell culture (SILAC)-based quantitative proteomics was utilized to investigate differently expressed surface markers in osteogenically differentiated and undifferentiated hBMSCs. Labeled membrane proteins were analyzed by mass spectrometry (MS) and 52 proteins with an expression ratio above 2, between osteogenically differentiated and undifferentiated cells, were identified. Subsequent validation, by flow cytometry and ELISA, of the SILAC expression ratios for a number of these proteins and investigations of the lineage specificity of three candidate markers were performed. The surface markers, CD10 and CD92, demonstrated significantly increased expression in hBMSCs differentiated towards the osteogenic and adipogenic lineages. In addition, there was a slight increase in CD10 expression during chondrogenic differentiation. Furthermore, the expression of the intracellular protein, crystalline-αB (CRYaB), was only significantly increased in osteogenically differentiated hBMSCs and not affected during differentiation towards the chondrogenic or adipogenic lineages. It has been concluded from the present results that CD10 and CD92 are potential markers of osteogenic and adipogenic differentiation and that CRYaB is a potential novel osteogenic marker specifically expressed during the osteogenic differentiation of hBMSCs in vitro.

  3. Suppression of Evi1 promotes the osteogenic differentiation and inhibits the adipogenic differentiation of bone marrow-derived mesenchymal stem cells in vitro.

    PubMed

    An, Qijun; Wu, Dou; Ma, Yuehong; Zhou, Biao; Liu, Qiang

    2015-12-01

    Osteoporosis (OP) is considered a complex disease with a strong genetic impact, mainly affecting post-menopausal women and is also a common cause of fracture. Elucidating the molecular mechanisms that regulate the osteogenic differentiation of bone marrow-derived mesenchymal stem cells (BMSCs) is crucial to developing treatment strategies to combat OP. In the present study, we found that ectopic viral integration site‑1 (Evi1) was highly expressed during the process of adipogenesis of rat BMSCs. Notably, Evi1 levels markedly increased on day 3 of adipogenic differentiation following the addition of adipogenic induction supplements. In addition, we interfered with the expression of the Evi1 gene in the adipogenesis of BMSCs by supplementing adenoviral plasmids and measured the expression levels of bone sialoprotein (BSP), osteocalcin (OCN), osteopontin (OPN), peroxisome proliferator‑activated receptor γ2 (PPARγ2) and lipoprotein lipase (LPL) by RT-qPCR and western blot analysis. The mRNA and protein levels of osteogenic and adipogenic markers in the BMSCs were up‑ and downregulated, respectively following the silencing of siEvi1. Our experimental results substantiate that the suppression of Evi1 in BMSCs by RNA interference inhibits adipogenic differentiation, while it promotes osteogenic differentiation. The results from our study demonstrated that the Evi1 gene may be targeted as a therapeutic strategy for promoting bone formation.

  4. Depletion of histone demethylase KDM2A enhanced the adipogenic and chondrogenic differentiation potentials of stem cells from apical papilla

    SciTech Connect

    Dong, Rui; Yao, Rui; Du, Juan; Wang, Songlin; Fan, Zhipeng

    2013-11-01

    Mesenchymal stem cells (MSCs) are a reliable resource for tissue regeneration, but the molecular mechanism underlying directed differentiation remains unclear; this has restricted potential MSC applications. The histone demethylase, lysine (K)-specific demethylase 2A (KDM2A), is evolutionarily conserved and ubiquitously expressed members of the JmjC-domain-containing histone demethylase family. A previous study determined that KDM2A can regulate the cell proliferation and osteo/dentinogenic differentiation of MSCs. It is not known whether KDM2A is involved in the other cell lineages differentiation of MSCs. Here, we show that depletion of KDM2A by short hairpin RNAs can enhance adipogenic and chondrogenic differentiation potentials in human stem cells from apical papilla (SCAPs). We found that the stemness-related genes, SOX2, and the embryonic stem cell master transcription factor, NANOG were significantly increased after silence of KDM2A in SCAPs. Moreover, we found that knock-down of the KDM2A co-factor, BCOR also up-regulated the mRNA levels of SOX2 and NANOG. Furthermore, Chromatin immunoprecipitation assays demonstrate that silence of KDM2A increased the histone H3 Lysine 4 (H3K4) trimethylation in the SOX2 and NANOG locus and regulates its expression. In conclusion, our results suggested that depletion of KDM2A enhanced the adipogenic and chondrogenic differentiation potentials of SCAPs by up-regulated SOX2 and NANOG, BCOR also involved in this regulation as co-factor, and provided useful information to understand the molecular mechanism underlying directed differentiation in MSCs. - Highlights: • Depletion of KDM2A enhances adipogenic/chondrogenic differentiation in SCAPs. • Depletion of KDM2A enhances the differentiation of SCAPs by activate SOX2 and NANOG. • Silence of KDM2A increases histone H3 Lysine 4 trimethylation in SOX2 and NANOG. • BCOR is co-factor of KDM2A involved in the differentiation regulation.

  5. Nitric oxide controls fat deposition in dystrophic skeletal muscle by regulating fibro-adipogenic precursor differentiation.

    PubMed

    Cordani, Nicoletta; Pisa, Viviana; Pozzi, Laura; Sciorati, Clara; Clementi, Emilio

    2014-04-01

    Duchenne muscular dystrophy (DMD) is an hereditary disease characterized by loss of muscle fibers and their progressive substitution by fat and fibrous tissue. Mesenchymal fibro-adipogenic progenitors (FAPs) expressing the platelet-derived growth factor receptor alpha (PDGFRα) are an important source of fibrosis and adipogenesis in dystrophic skeletal muscle. Among the therapies suggested for dystrophy are those based on nitric oxide (NO) donating drugs, the administration of which slows disease progression. NO has been shown to act by enhancing the regenerative potential of the diseased muscle. Whether it acts also by inhibiting fibrosis and adipogenesis was not known. Here, we show in vitro that NO regulates FAP fate through inhibition of their differentiation into adipocytes. In mdx mice, an animal model of DMD, treatment with the NO donating drug molsidomine reduced the number of PDGFRα(+) cells as well as the deposition of both skeletal muscle fat and connective tissues. Inhibition of adipogenesis was due to NO-induced increased expression of miR-27b leading to downregulation of peroxisome proliferator-activated receptors gamma (Pparγ1) expression in a pathway independent of cGMP generation. These findings reveal an additional effect of NO in dystrophic muscle that conceivably synergizes with its known effects on regeneration improvement and explain why NO-based therapies appear effective in the treatment of muscular dystrophy.

  6. Diverse effects of type II collagen on osteogenic and adipogenic differentiation of mesenchymal stem cells.

    PubMed

    Chiu, Li-Hsuan; Yeh, Tien-Shun; Huang, Huei-Mei; Leu, Sy-Jye; Yang, Charng-Bin; Tsai, Yu-Hui

    2012-06-01

    Type II collagen is known to modulate chondrogenesis of mesenchymal stem cells (MSCs). In this study, MSCs from human bone marrow aspirates were used to study the modulating effects of type II collagen on MSC differentiation during the early stages of osteogenesis and adipogenesis. With osteogenic induction, MSCs cultured on the type II collagen-coated surface showed an enhanced calcium deposition level with increasing mRNA expressions of RUNX2, osteocalcin, and alkaline phosphatase. A synthetic integrin binding peptide, which specifically interacts with the I-domain of α(1)β(1)/α(2)β(1) integrins significantly blocks the mineralization-enhancing effect of type II collagen. MSCs attached on the type II collagen-coated plates exhibited expanded cell morphology with increasing spreading area, and the pretreatment of cells with integrin α(1)β(1) or α(2)β(1)-blocking antibody reduced the effect. The phosphorylation levels of FAK, ERK, and JNK significantly increased in the MSCs that attached on the type II collagen-coated plates. On the contrary, the mineralization-enhancing effect of type II collagen was diminished by JNK and MEK inhibitors. Furthermore, type II collagen blocked the adipogenic differentiation of MSCs, and this effect is rescued by JNK and MEK inhibitors. In conclusion, type II collagen facilitates osteogenesis and suppresses adipogenesis during early stage MSC differentiation. Such effects are integrin binding-mediated and conducted through FAK-JNK and/or FAK-ERK signaling cascades. These results inspire a novel strategy encompassing type II collagen in bone tissue engineering.

  7. Beta-mecaptoethanol suppresses inflammation and induces adipogenic differentiation in 3T3-F442A murine preadipocytes.

    PubMed

    Guo, Wen; Li, Yahui; Liang, Wentao; Wong, Siu; Apovian, Caroline; Kirkland, James L; Corkey, Barbara E

    2012-01-01

    Preadipocytes are present in adipose tissues throughout adult life that can proliferate and differentiate into mature adipocytes in response to environmental cues. Abnormal increase in adipocyte number or size leads to fat tissue expansion. However, it is now recognized that adipocyte hypertrophy is a greater risk factor for metabolic syndrome whereas fat tissue that continues to produce newer and smaller fat cells through preadipocyte differentiation is "metabolically healthy". Because adipocyte hypertrophy is often associated with increased oxidant stress and low grade inflammation, both are linked to disturbed cellular redox, we tested how preadipocyte differentiation may be regulated by beta-mercaptoethanol (BME), a pharmacological redox regulator and radical scavenger, using murine 3T3-F442A preadipocytes as the cell model. Effects of BME on adipogenesis were measured by microphotography, real-time PCR, and Western analysis. Our data demonstrated that preadipocyte differentiation could be regulated by extracellular BME. At an optimal concentration, BME enhanced expression of adipogenic gene markers and lipid accumulation. This effect was associated with BME-mediated down-regulation of inflammatory cytokine expression during early differentiation. BME also attenuated TNFalpha-induced activation of NFkappaB in differentiating preadipocytes and partially restored TNFalpha-mediated suppression on adipogenesis. Using a non-adipogenic HEK293 cell line transfected with luciferase reporter genes, we demonstrated that BME reduced basal and TNFalpha-induced NFkappaB activity and increased basal and ciglitazone-induced PPARgamma activity; both may contribute to the pro-adipogenic effect of BME in differentiating F442A preadipocytes.

  8. Myeloid Elf-1-like factor stimulates adipogenic differentiation through the induction of peroxisome proliferator-activated receptor γ expression in bone marrow.

    PubMed

    Baek, Kyunghwa; Cho, Je-Yoel; Hwang, Hyo Rin; Kwon, Arang; Lee, Hye-Lim; Park, Hyun-Jung; Qadir, Abdul S; Ryoo, Hyun-Mo; Woo, Kyung Mi; Baek, Jeong-Hwa

    2012-11-01

    Myeloid Elf-1 like factor (MEF) is one of the Ets transcription factors known to regulate cell proliferation and differentiation. A previous report has shown that osteoblast-specific MEF transgenic mice (Col1a1-MEF TG mice) have low bone mass but high bone marrow adiposity. In the present study, we explored a previously unappreciated mechanism whereby MEF promotes adipogenesis in bone marrow. An adipogenic colony-forming unit assay showed that bone marrow cells derived from Col1a1-MEF TG mice had a higher adipogenic differentiation potential compared to those from wild-type. The levels of adipogenic marker genes expression in 3T3L1 cells were higher when co-cultured with Col1a1-MEF TG bone marrow cells than with wild-type cells. MC3T3-E1 preosteoblasts transfected with MEF secreted higher levels of 15-deoxy-delta (12, 14)-prostaglandin J(2), a potent endogenous ligand of peroxisome proliferator-activated receptor γ (PPARγ), under adipogenic conditions. MEF overexpression increased the adipogenic marker genes expression including PPARγ and lipid droplet accumulation in MC3T3-E1 preosteoblasts and 3T3L1 preadipocytes. Endogenous MEF expression levels increased as adipocyte differentiation proceeded. Knockdown of MEF by siRNA suppressed expression levels of adipogenic marker genes including PPARγ. MEF directly bound to the MEF binding element on the mouse PPARγ promoter, transactivating promoter activity. Immunohistochemical staining of tibia sections demonstrated that bone lining cells and bone marrow cells express higher levels of PPARγ protein in Col1a1-MEF TG mice than in wild-type mice. These results suggest that MEF transactivates PPARγ expression, which, in turn, enhances adipogenic differentiation. Furthermore, MEF overexpressing osteoblasts secrete higher levels of adipogenic factors, creating a marrow microenvironment that favors adipogenesis.

  9. Platelet lysate suppresses the expression of lipocalin-type prostaglandin D2 synthase that positively controls adipogenic differentiation of human mesenchymal stromal cells.

    PubMed

    Lange, Claudia; Brunswig-Spickenheier, Bärbel; Eissing, Leah; Scheja, Ludger

    2012-11-01

    Mesenchymal stromal cells (MSCs) have been shown to display a considerable therapeutic potential in cellular therapies. However, harmful adipogenic maldifferentiation of transplanted MSCs may seriously threaten the success of this therapeutic approach. We have previously demonstrated that using platelet lysate (PL) instead of widely used fetal calf serum (FCS) diminished lipid accumulation in adipogenically stimulated human MSCs and identified, among others, lipocalin-type prostaglandin D2 synthase (L-PGDS) as a gene suppressed in PL-supplemented MSCs. Here, we investigated the role of PL and putatively pro-adipogenic L-PGDS in human MSC adipogenesis. Next to strongly reduced levels of L-PGDS we show that PL-supplemented MSCs display markedly decreased expression of adipogenic master regulators and differentiation markers, both before and after induction of adipocyte differentiation. The low adipogenic differentiation capability of PL-supplemented MSCs could be partially restored by exogenous addition of L-PGDS protein. Conversely, siRNA-mediated downregulation of L-PGDS in FCS-supplemented MSCs profoundly reduced adipocyte differentiation. In contrast, inhibiting endogenous prostaglandin synthesis by aspirin did not reduce differentiation, suggesting that a mechanism such as lipid shuttling but not the prostaglandin D2 synthase activity of L-PGDS is critical for adipogenesis. Our data demonstrate that L-PGDS is a novel pro-adipogenic factor in human MSCs which might be of relevance in adipocyte metabolism and disease. L-PGDS gene expression is a potential quality marker for human MSCs, as it might predict unwanted adipogenic differentiation after MSC transplantation.

  10. Laminin production and basement membrane deposition by mesenchymal stem cells upon adipogenic differentiation.

    PubMed

    Noro, Ariel; Sillat, Tarvo; Virtanen, Ismo; Ingerpuu, Sulev; Bäck, Nils; Konttinen, Yrjö T; Korhonen, Matti

    2013-10-01

    The aim was to study laminin (LM) synthesis, integration, and deposition into the basement membrane (BM) during adipogenesis. Human bone marrow-derived mesenchymal stromal cells (MSCs) were induced along the adipogenic lineage. LM chain mRNA and protein levels were followed using quantitative real-time polymerase chain reaction (qRT-PCR), immunofluorescence (IF) staining, transmission electron microscopy (TEM), and immunoprecipitation. MSCs produced low levels of LM mRNAs but were not surrounded by BM in IF and TEM imaging. LM-α4, LM-β1, and LM-γ1 mRNAs increased during adipogenesis 3.9-, 5.8-, and 2.8-fold by day 28. LM-411 was immunoprecipitated from the ECM of the differentiated cells. Immunostaining suggested deposition of LM-411 and some LM-421. BM build-up was probably organized in part by integrin (Int) α6β1. At day 28, TEM images revealed BM-like structures around fat droplet-containing cells. The first signs of BM formation and Int α6β1 were seen using IF imaging at day 14. Laminin-411 and Int α6β1 were expressed in vivo in mature human subcutaneous fat tissue. Undifferentiated human MSCs did not organize LM subunits into BM, whereas LM-411 and some LM-421 are precipitated in the BM around adipocytes. This is the first demonstration of LM-411 precipitation during hMSC adipogenesis around adipocytes as a structural scaffold and Int-regulated signaling element.

  11. Isolation, Characterization, Cryopreservation of Human Amniotic Stem Cells and Differentiation to Osteogenic and Adipogenic Cells

    PubMed Central

    Gholizadeh-Ghaleh Aziz, Shiva; Pashaei-Asl, Fatima; Fardyazar, Zahra; Pashaiasl, Maryam

    2016-01-01

    Human stem cells and progenitor cells can be used to treat cancer and replace dysfunctional cells within a tissue or organ. The objective of this study was to identify the appropriate cells type in regenerative medicine and targeted therapy. As an alternative to embryonic and bone marrow stem cells, we examined human amniotic fluid stem cells (hAFSCs), one of the potential source of multipotent stem cells isolated from both cell pellet (using single-stage method), and supernatant of human amniotic fluid. Source of isolation and unique property of the cells emphasize that these cells are one of the promising new tools in therapeutic field. Double sources for isolation and availability of the left over samples in diagnostic laboratory at the same time have less legal and ethical concerns compared with embryonic stem cell studies. Cells were isolated, cultured for 18th passage for 6 months and characterized using qPCR and flow cytometry. Cells showed good proliferative ability in culture condition. The cells successfully differentiated into the adipogenic and osteogenic lineages. Based on these findings, amniotic fluid can be considered as an appropriate and convenient source of human amniotic fluid stem cells. These cells provide potential tools for therapeutic applications in the field of regenerative medicine. To get a better understanding of crosstalk between Oct4/NANOG with osteogenesis and adipogenesis, we used network analysis based on Common Targets algorithm and Common Regulators algorithm as well as subnetwork discovery based on gene set enrichment. Network analysis highlighted the possible role of MIR 302A and MIR let-7g. We demonstrated the high expression of MIR 302A and low expression of MIR let7g in hAFSCs by qPCR. PMID:27434028

  12. Effects of canola proteins and hydrolysates on adipogenic differentiation of C3H10T/2 mesenchymal stem cells.

    PubMed

    Alashi, Adeola M; Blanchard, Christopher L; Mailer, Rodney J; Agboola, Samson O; Mawson, A John; Aluko, Rotimi E; Strappe, Padraig

    2015-10-15

    This study assessed the ability of canola protein isolate (CPI) and enzymatic hydrolysates (CPHs) to inhibit adipogenic differentiation of C3H10T1/2 murine mesenchymal stem cells in vitro. Cell viability was maintained at concentrations of 60 μg/ml of sample. Cells treated with Alcalase hydrolysate demonstrated a higher reduction in anti-adipogenic differentiation through quantitation by oil-red O staining. qPCR analysis showed that CPI and CPH-treated cells significantly inhibited PPARγ expression, a key transcription factor involved in adipocyte differentiation, as evident in an ∼ 60-80% fold reduction of PPARγ mRNA. Immunofluorescence staining for PPARγ protein also showed a reduced expression in some treated cells when compared to differentiated untreated cells. The 50% inhibition concentration (IC50) of CPI, CPHs and their membrane ultrafiltration fractions on pancreatic lipase (PL) activity ranged between 0.75 and 2.5 mg/ml, (p < 0.05) for the hydrolysed and unhydrolysed samples. These findings demonstrate that CPI and CPHs contain bioactive components which can modulate in vitro adipocyte differentiation.

  13. A comparative study of metabolic state of stem cells during osteogenic and adipogenic differentiations via fluorescence lifetime imaging microscopy

    NASA Astrophysics Data System (ADS)

    Chakraborty, Sandeep; Ou, Meng-Hsin; Kuo, Jean-Cheng; Chiou, Arthur

    2016-10-01

    Cellular metabolic state can serve as a biomarker to indicate the differentiation potential of stem cells into other specialized cell lineages. In this study, two-photon fluorescence lifetime imaging microscopy (2P-FLIM) was applied to determine the fluorescence lifetime and the amounts of the auto-fluorescent metabolic co-factor reduced nicotinamide adenine dinucleotide (NADH) to elucidate the cellular metabolism of human mesenchymal stem cells (hMSCs) in osteogenic and adipogenic differentiation processes. 2P-FLIM provides the free to protein-bound NADH ratio which can serve as the indicator of cellular metabolic state. We measured NADH fluorescence lifetime at 0, 7, and 14 days after hMSCs were induced for either osteogenesis or adipogenesis. In both cases, the average fluorescence lifetime increased significantly at day 14 (P < 0.001), while the ratio of free to protein-bound NADH ratio decreased significantly in 7- days (P < 0.001) and 14-days (P < 0.001). Thus, our results indicated a higher metabolic rate in both osteogenic and adipogenic differentiation processes when compared with undifferentiated hMSCs. This approach may be further utilized to study proliferation efficiency and differentiation potential of stem cells into other specialized cell lineages.

  14. Insulin-like growth factor-1 and bone morphogenetic protein-2 jointly mediate prostaglandin E2-induced adipogenic differentiation of rat tendon stem cells.

    PubMed

    Liu, Junpeng; Chen, Lei; zhou, You; Liu, Xiangzhou; Tang, Kanglai

    2014-01-01

    Tendinopathy is characterized histopathologically by lipid accumulation and tissue calcification. Adipogenic and osteogenic differentiation of tendon stem cells (TSCs) are believed to play key roles in these processes. The major inflammatory mediator prostaglandin E2 (PGE2) has been shown to induce osteogenic differentiation of TSCs via bone morphogenetic protein-2 (BMP-2), and BMP-2 has also been implicated in adipogenic differentiation of stem cells. We therefore examined the mechanisms responsible for PGE2-induced adipogenesis in rat TSCs in vitro. Insulin-like growth factor-1 (IGF-1) mRNA and protein were significantly up-regulated in PGE2-stimulated TSCs, measured by quantitative reverse transcription-polymerase chain reaction and enzyme-linked immunosorbent assay, respectively. Incubation with specific inhibitors of cAMP, cAMP-dependent protein kinase A (PKA), and CCAAT/enhancer binding protein-δ (CEBPδ) demonstrated that IGF-1 up-regulation occurred via a cAMP/PKA/CEBPδ pathway. Furthermore, neither IGF-1 nor BMP-2 alone was able to mediate adipogenic differentiation of TSCs, but IGF-1 together with BMP-2 significantly increased adipogenesis, indicated by Oil Red O staining. Moreover, knock-down of endogenous IGF-1 and BMP2 abolished PGE2-induced adipogenic differentiation. Phosphorylation of CREB and Smad by IGF-1 and BMP-2, respectively, were required for induction of the adipogenesis-related peroxisome proliferator-activated receptor γ2 (PPARγ2) gene and for adipogenic differentiation. In conclusion, IGF-1 and BMP-2 together mediate PGE2-induced adipogenic differentiation of TSCs in vitro via a CREB- and Smad-dependent mechanism. This improved understanding of the mechanisms responsible for tendinopathies may help the development of more effective therapies.

  15. Horse serum reduces expression of membrane-bound and soluble isoforms of the preadipocyte marker Delta-like 1 homolog (Dlk1), but is inefficient for adipogenic differentiation of mouse preadipocytes.

    PubMed

    Andersen, Ditte C; Nielsen, Charlotte; Jensen, Charlotte H; Sheikh, Søren P

    2013-05-01

    Downregulation of the preadipocyte marker Delta-like 1 homologue (Dlk1), an inhibitor of adipogenesis, has been suggested to be a prerequisite for adipogenic differentiation to occur, and low Dlk1 levels are often used to verify adipogenesis. Mouse preadipocytic cell lines such as 3T3-L1, as well as primary derived preadipocytes, are important models to study adipogenic differentiation and obesity. However, in vitro adipogenic differentiation of primary derived preadipocytes remains incomplete, and identification of factors that will improve the adipogenic differentiation process is thus of high value. In this study we show that horse serum fails to improve adipogenic differentiation of mouse preadipocytes (both 3T3-L1 cells and primary derived mouse preadipocytes) as otherwise reported for bone marrow derived adipogenic precursors. Unexpectedly, while Dlk1 levels were indeed decreased using horse serum, this did not correlate with a high degree of adipogenic differentiation. In conclusion, our novel results thus reveal that horse serum clearly is insufficient for adipogenic differentiation of mouse preadipocytes and that low levels of Dlk1 alone are a poor marker of mouse in vitro adipogenesis. We would also like to emphasize that it is very important for the field of cellular differentiation that researchers thoroughly investigate the effect of individual reagents in their protocols. Such data will increase understanding of the limitations and possibilities of individual systems.

  16. Matrix-mediated retention of adipogenic differentiation potential by human adult bone marrow-derived mesenchymal stem cells during ex vivo expansion.

    PubMed

    Mauney, Joshua R; Volloch, Vladimir; Kaplan, David L

    2005-11-01

    Recently, cell-based approaches utilizing adipogenic progenitor cells for fat tissue engineering have been developed and reported to have success in promoting in vivo adipogenesis and the repair of defect sites. For autologous applications, human bone marrow-derived mesenchymal stem cells (MSCs) have been suggested as a potential cell source for adipose tissue engineering applications due to their ability to be isolated and ex vivo expanded from adult bone marrow aspirates and their versatility for pluripotent differentiation into various mesenchymal lineages including adipogenic. Due to the relatively low frequency of MSCs present within bone marrow, extensive ex vivo expansion of these cells is necessary to obtain therapeutic cell populations for tissue engineering strategies. Currently, utilization of MSCs for adipose tissue engineering is limited due to the attenuation of their adipogenic differentiation potential following extensive ex vivo expansion on conventional tissue culture plastic (TCP) substrates. In the present study, the ability of a denatured collagen type I (DC) matrix to preserve MSC adipogenic potential during ex vivo expansion was examined. Adipocyte-related markers and functions were examined in vitro in response to adipogenic culture conditions for 21 days in comparison to early passage MSCs and late passage MSCs ex vivo expanded on TCP. The results demonstrated significant preservation of the ability of late passage MSCs ex vivo expanded on the DC matrix to express adipogenic markers (fatty acid-binding protein-4, lipoprotein lipase, acyl-CoA synthetase, adipsin, facilitative glucose transporter-4, and accumulation of lipids) similar to the early passage cells and in contrast to late passage MSCs expanded on TCP. The ability of the DC matrix to preserve adipocyte-related markers and functions of MSCs following extensive ex vivo expansion represents a novel culture technique to expand functional adipogenic progenitors for tissue engineering

  17. The effect of low static magnetic field on osteogenic and adipogenic differentiation potential of human adipose stromal/stem cells

    NASA Astrophysics Data System (ADS)

    Marędziak, Monika; Śmieszek, Agnieszka; Tomaszewski, Krzysztof A.; Lewandowski, Daniel; Marycz, Krzysztof

    2016-01-01

    The aim of this work was to investigate the effects of static magnetic field (SMF) on the osteogenic properties of human adipose derived mesenchymal stem cells (hASCs). In this study in seven days viability assay we examined the impact of SMF on cells proliferation rate, population doubling time, and ability to form single-cell derived colonies. We have also examined cells' morphology, ultrastructure and osteogenic properties on the protein as well as mRNA level. We established a complex approach, which enabled us to obtain information about SMF and hASCs potential in the context of differentiation into osteogenic and adipogenic lineages. We demonstrated that SMF enhances both viability and osteogenic properties of hASCs through higher proliferation factor and shorter population doubling time. We have also observed asymmetrically positioned nuclei and organelles after SMF exposition. With regards to osteogenic properties we observed increased levels of osteogenic markers i.e. osteopontin, osteocalcin and increased ability to form osteonodules with positive reaction to Alizarin Red dye. We have also shown that SMF besides enhancing osteogenic properties of hASCs, simultaneously decreases their ability to differentiate into adipogenic lineage. Our results clearly show a direct influence of SMF on the osteogenic potential of hASCs. These results provide key insights into the role of SMF on their cellular fate and properties.

  18. Fetal muscle contains different CD34+ cell subsets that distinctly differentiate into adipogenic, angiogenic and myogenic lineages.

    PubMed

    Dupas, Tanaelle; Rouaud, Thierry; Rouger, Karl; Lieubeau, Blandine; Cario-Toumaniantz, Chrystelle; Fontaine-Pérus, Josiane; Gardahaut, Marie-France; Auda-Boucher, Gwenola

    2011-11-01

    We have previously demonstrated that CD34(+) cells isolated from fetal mouse muscles are an interesting source of myogenic progenitors. In the present work, we pinpoint the tissue location of these CD34(+) cells using cell surface and phenotype markers. In order to identify the myogenic population, we next purified different CD34(+) subsets, determined their expression of relevant lineage-related genes, and analyzed their differentiation capacities in vitro and in vivo. The CD34(+) population comprised a CD31(+)/CD45(-) cell subset exhibiting endothelial characteristics and only capable of forming microvessels in vivo. The CD34(+)/CD31(-)/CD45(-)/Sca1(+) subpopulation, which is restricted to the muscle epimysium, displayed adipogenic differentiation both in vitro and in vivo. CD34(+)/CD31(-)/CD45(-)/Sca1(-) cells, localized in the muscle interstitium, transcribed myogenic genes, but did not display the characteristics of adult satellite cells. These cells were distinct from pericytes and fibroblasts. They were myogenic in vitro, and efficiently contributed to skeletal muscle regeneration in vivo, although their myogenic potential was lower than that of the unfractionated CD34(+) cell population. Our results indicate that angiogenic and adipogenic cells grafted with myogenic cells enhance their contribution to myogenic regeneration, highlighting the fundamental role of the microenvironment on the fate of transplanted cells.

  19. Epigallocatechin-3-gallate-induced free-radical production upon adipogenic differentiation in bovine bone-marrow mesenchymal stem cells.

    PubMed

    Jeong, Jin Young; Park, Mi Na; Cho, Eun Seok; Jang, Hyun-Jun; Park, Sungkwon; Lee, Hyun-Jeong

    2015-10-01

    Epigallocatechin-3-gallate (EGCG), a major component of catechin in green tea, has known effects on cancer, diabetes and obesity. We recently reported that the expression levels of various genes and proteins involved in adipogenesis decreases following EGCG treatment. We also assessed apoptosis in EGCG-exposed cells. Here, we explore the variability in free-radical production in bovine bone-marrow mesenchymal stem cells (BMSCs) treated with EGCG. Upon adipogenic differentiation, BMSCs were exposed to various EGCG concentrations (0, 0.1, 1, 5, or 10 μM) for 2, 4, or 6 days. We found that EGCG reduced cell viability and arrested the cell cycle at the gap 2/mitosis phase and that EGCG potentially enhanced the production of free radicals, including reactive oxygen species and reactive nitrogen species, in a concentration- and time-dependent manner. Immunostaining revealed that the expression of genes encoding CCAAT/enhancer-binding protein alpha and stearoyl-CoA desaturase were diminished by EGCG treatment. These findings suggest that EGCG alters free-radical production activity during adipogenic differentiation in BMSCs.

  20. Depletion of histone demethylase KDM2A enhanced the adipogenic and chondrogenic differentiation potentials of stem cells from apical papilla.

    PubMed

    Dong, Rui; Yao, Rui; Du, Juan; Wang, Songlin; Fan, Zhipeng

    2013-11-01

    Mesenchymal stem cells (MSCs) are a reliable resource for tissue regeneration, but the molecular mechanism underlying directed differentiation remains unclear; this has restricted potential MSC applications. The histone demethylase, lysine (K)-specific demethylase 2A (KDM2A), is evolutionarily conserved and ubiquitously expressed members of the JmjC-domain-containing histone demethylase family. A previous study determined that KDM2A can regulate the cell proliferation and osteo/dentinogenic differentiation of MSCs. It is not known whether KDM2A is involved in the other cell lineages differentiation of MSCs. Here, we show that depletion of KDM2A by short hairpin RNAs can enhance adipogenic and chondrogenic differentiation potentials in human stem cells from apical papilla (SCAPs). We found that the stemness-related genes, SOX2, and the embryonic stem cell master transcription factor, NANOG were significantly increased after silence of KDM2A in SCAPs. Moreover, we found that knock-down of the KDM2A co-factor, BCOR also up-regulated the mRNA levels of SOX2 and NANOG. Furthermore, Chromatin immunoprecipitation assays demonstrate that silence of KDM2A increased the histone H3 Lysine 4 (H3K4) trimethylation in the SOX2 and NANOG locus and regulates its expression. In conclusion, our results suggested that depletion of KDM2A enhanced the adipogenic and chondrogenic differentiation potentials of SCAPs by up-regulated SOX2 and NANOG, BCOR also involved in this regulation as co-factor, and provided useful information to understand the molecular mechanism underlying directed differentiation in MSCs.

  1. MicroRNA hsa-miR-138 inhibits adipogenic differentiation of human adipose tissue-derived mesenchymal stem cells through adenovirus EID-1.

    PubMed

    Yang, Zhuo; Bian, Chunjing; Zhou, Hong; Huang, Shan; Wang, Shihua; Liao, Lianming; Zhao, Robert Chunhua

    2011-02-01

    A better understanding of the molecular mechanisms underlying the differentiation of human adipose tissue-derived mesenchymal stem cells (hAD-MSCs) could provide new insights into the pathogenesis of a number of diseases, such as obesity and diabetes, and broaden the spectrum of potential hAD-MSCs-based cell therapy. In this study, we reported that a human microRNA, hsa-miR-138, could inhibit the adipogenic differentiation of hAD-MSCs. Our results showed that miR-138 was significantly down-regulated during adipogenic differentiation. Overexpression of miR-138 in hAD-MSCs could effectively reduce lipid droplets accumulation, inhibit expression of key adipogenic transcription factors cytidine-cytidine-adenosine-adenosine-thymidine (CCAAT) enhancer binding protein alpha and peroxisome proliferator-activated receptor gamma 2 as well as several other adipogenic marker genes, such as fatty acid binding protein 4 and lipoprotein lipase. Further studies showed that the expression of adenovirus early region 1-A-like inhibitor of differentiation 1 (EID-1), a nuclear receptor coregulator, was inversely correlated with that of miR-138 when hAD-MSCs were differentiated into adipocytes. Knockdown of EID-1 by RNA interference inhibited adipocyte differentiation of hAD-MSCs. In addition, luciferase reporter assays demonstrated that miR-138 directly targeted the 3' untranslated region of EID-1, implying that the negative role of miR-138 in the adipocyte differentiation of hAD-MSCs is at least partially mediated via repressing EID-1. Taken together, this study shows that miR-138 plays a negative role in adipogenic differentiation and sheds light on the role of miRNAs during differentiation of hAD-MSCs toward adipocytes.

  2. A Novel Regulatory Function of Sweet Taste-Sensing Receptor in Adipogenic Differentiation of 3T3-L1 Cells

    PubMed Central

    Masubuchi, Yosuke; Nakagawa, Yuko; Ma, Jinhui; Sasaki, Tsutomu; Kitamura, Tadahiro; Yamamoto, Yoritsuna; Kurose, Hitoshi; Kojima, Itaru; Shibata, Hiroshi

    2013-01-01

    Background Sweet taste receptor is expressed not only in taste buds but also in nongustatory organs such as enteroendocrine cells and pancreatic beta-cells, and may play more extensive physiological roles in energy metabolism. Here we examined the expression and function of the sweet taste receptor in 3T3-L1 cells. Methodology/Principal Findings In undifferentiated preadipocytes, both T1R2 and T1R3 were expressed very weakly, whereas the expression of T1R3 but not T1R2 was markedly up-regulated upon induction of differentiation (by 83.0 and 3.8-fold, respectively at Day 6). The α subunits of Gs (Gαs) and G14 (Gα14) but not gustducin were expressed throughout the differentiation process. The addition of sucralose or saccharin during the first 48 hours of differentiation considerably reduced the expression of peroxisome proliferator activated receptor γ (PPARγ and CCAAT/enhancer-binding protein α (C/EBPα at Day 2, the expression of aP2 at Day 4 and triglyceride accumulation at Day 6. These anti-adipogenic effects were attenuated by short hairpin RNA-mediated gene-silencing of T1R3. In addition, overexpression of the dominant-negative mutant of Gαs but not YM-254890, an inhibitor of Gα14, impeded the effects of sweeteners, suggesting a possible coupling of Gs with the putative sweet taste-sensing receptor. In agreement, sucralose and saccharin increased the cyclic AMP concentration in differentiating 3T3-L1 cells and also in HEK293 cells heterologously expressing T1R3. Furthermore, the anti-adipogenic effects of sweeteners were mimicked by Gs activation with cholera toxin but not by adenylate cyclase activation with forskolin, whereas small interfering RNA-mediated knockdown of Gαs had the opposite effects. Conclusions 3T3-L1 cells express a functional sweet taste-sensing receptor presumably as a T1R3 homomer, which mediates the anti-adipogenic signal by a Gs-dependent but cAMP-independent mechanism. PMID:23336004

  3. Differential expression of CCN-family members in primary human bone marrow-derived mesenchymal stem cells during osteogenic, chondrogenic and adipogenic differentiation

    PubMed Central

    Schutze, Norbert; Noth, Ulrich; Schneidereit, Jutta; Hendrich, Christian; Jakob, Franz

    2005-01-01

    Background The human cysteine rich protein 61 (CYR61, CCN1) as well as the other members of the CCN family of genes play important roles in cellular processes such as proliferation, adhesion, migration and survival. These cellular events are of special importance within the complex cellular interactions ongoing in bone remodeling. Previously, we analyzed the role of CYR61/CCN1 as an extracellular signaling molecule in human osteoblasts. Since mesenchymal stem cells of bone marrow are important progenitors for various differentiation pathways in bone and possess increasing potential for regenerative medicine, here we aimed to analyze the expression of CCN family members in bone marrow-derived human mesenchymal stem cells and along the osteogenic, the adipogenic and the chondrogenic differentiation. Results Primary cultures of human mesenchymal stem cells were obtained from the femoral head of patients undergoing total hip arthroplasty. Differentiation into adipocytes and osteoblasts was done in monolayer culture, differentiation into chondrocytes was induced in high density cell pellet cultures. For either pathway, established differentiation markers and CCN-members were analyzed at the mRNA level by RT-PCR and the CYR61/CCN1 protein was analyzed by immunocytochemistry. RT-PCR and histochemical analysis revealed the appropriate phenotype of differentiated cells (Alizarin-red S, Oil Red O, Alcian blue, alkaline phosphatase; osteocalcin, collagen types I, II, IX, X, cbfa1, PPARγ, aggrecan). Mesenchymal stem cells expressed CYR61/CCN1, CTGF/CCN2, CTGF-L/WISP2/CCN5 and WISP3/CCN6. The CYR61/CCN1 expression decreased markedly during osteogenic differentiation, adipogenic differentiation and chondrogenic differentiation. These results were confirmed by immuncytochemical analyses. WISP2/CCN5 RNA expression declined during adipogenic differentiation and WISP3/CCN6 RNA expression was markedly reduced in chondrogenic differentiation. Conclusion The decrease in CYR61/CCN1

  4. Activation of the PI3K/Akt pathway by oxidative stress mediates high glucose-induced increase of adipogenic differentiation in primary rat osteoblasts.

    PubMed

    Zhang, Yu; Yang, Jian-Hong

    2013-11-01

    Diabetes mellitus is associated with increased risk of osteopenia and bone fracture that may be related to hyperglycemia. However, the mechanisms accounting for diabetic bone disorder are unclear. Here, we showed that high glucose significantly promoted the production of reactive oxygen species (ROS) in rat primary osteoblasts. Most importantly, we reported for the first time that ROS induced by high glucose increased alkaline phosphatase activity, inhibited type I collagen (collagen I) protein level and cell mineralization, as well as gene expression of osteogenic markers including runt-related transcription factor 2 (Runx2), collagen I, and osteocalcin, but promoted lipid droplet formation and gene expression of adipogenic markers including peroxisome proliferator-activated receptor gamma, adipocyte fatty acid binding protein (aP2), and adipsin, which were restored by pretreatment with N-acetyl-L-cysteine (NAC), a ROS scavenger. Moreover, high glucose-induced oxidative stress activated PI3K/Akt pathway to inhibited osteogenic differentiation but stimulated adipogenic differentiation. In contrast, NAC and a PI3K inhibitor, LY-294002, reversed the down-regulation of osteogenic markers and the up-regulation of adipogenic markers as well as the activation of Akt under high glucose. These results indicated that oxidative stress played a key role in high glucose-induced increase of adipogenic differentiation, which contributed to the inhibition of osteogenic differentiation. This process was mediated by PI3K/Akt pathway in rat primary osteoblasts. Hence, suppression of oxidative stress could be a potential therapeutic approach for diabetic osteopenia.

  5. Gluteal and abdominal subcutaneous adipose tissue depots as stroma cell source: gluteal cells display increased adipogenic and osteogenic differentiation potentials.

    PubMed

    Iwen, Karl Alexander; Priewe, Anna-Christin; Winnefeld, Marc; Rose, Christian; Siemers, Frank; Rohwedel, Jürgen; Cakiroglu, Figen; Lehnert, Hendrik; Schepky, Andreas; Klein, Johannes; Kramer, Jan

    2014-06-01

    Human adipose-derived stroma cells (ADSCs) have successfully been employed in explorative therapeutic studies. Current evidence suggests that ADSCs are unevenly distributed in subcutaneous adipose tissue; therefore, the anatomical origin of ADSCs may influence clinical outcomes. This study was designed to investigate proliferation and differentiation capacities of ADSCs from the gluteal and abdominal depot of 8 females. All had normal BMI (22.01 ± 0.39 kg/m(2) ) and waist circumference (81.13 ± 2.33 cm). Examination by physicians and analysis of 31 laboratory parameters did not reveal possibly confounding medical disorders. Gluteal and abdominal adipose tissue was sampled by en bloc resection on day 7 (±1) after the last menses. Histological examination did not reveal significant depot-specific differences. As assessed by BrdU assay, proliferation of cells from both depots was similar after 24 h and analysis of 15 cell surface markers by flow cytometry identified the isolated cells as ADSCs, again without depot-specific differences. ADSCs from both depots differentiated poorly to chondroblasts. Gluteal ADSCs displayed significantly higher adipogenic differentiation potential than abdominal cells. Osteogenic differentiation was most pronounced in gluteal cells, whereas differentiation of abdominal ADSCs was severely impaired. Our data demonstrate a depot-specific difference in ADSC differentiation potential with abdominal cells failing to meet the criteria of multipotent ADSCs. This finding should be taken into account in future explorations of ADSC-derived therapeutic strategies.

  6. PDGF, TGF-beta, and FGF signaling is important for differentiation and growth of mesenchymal stem cells (MSCs): transcriptional profiling can identify markers and signaling pathways important in differentiation of MSCs into adipogenic, chondrogenic, and osteogenic lineages.

    PubMed

    Ng, Felicia; Boucher, Shayne; Koh, Susie; Sastry, Konduru S R; Chase, Lucas; Lakshmipathy, Uma; Choong, Cleo; Yang, Zheng; Vemuri, Mohan C; Rao, Mahendra S; Tanavde, Vivek

    2008-07-15

    We compared the transcriptomes of marrow-derived mesenchymal stem cells (MSCs) with differentiated adipocytes, osteocytes, and chondrocytes derived from these MSCs. Using global gene-expression profiling arrays to detect RNA transcripts, we have identified markers that are specific for MSCs and their differentiated progeny. Further, we have also identified pathways that MSCs use to differentiate into adipogenic, chondrogenic, and osteogenic lineages. We identified activin-mediated transforming growth factor (TGF)-beta signaling, platelet-derived growth factor (PDGF) signaling and fibroblast growth factor (FGF) signaling as the key pathways involved in MSC differentiation. The differentiation of MSCs into these lineages is affected when these pathways are perturbed by inhibitors of cell surface receptor function. Since growth and differentiation are tightly linked processes, we also examined the importance of these 3 pathways in MSC growth. These 3 pathways were necessary and sufficient for MSC growth. Inhibiting any of these pathways slowed MSC growth, whereas a combination of TGF-beta, PDGF, and beta-FGF was sufficient to grow MSCs in a serum-free medium up to 5 passages. Thus, this study illustrates it is possible to predict signaling pathways active in cellular differentiation and growth using microarray data and experimentally verify these predictions.

  7. The effect of electromagnetic fields on the proliferation and the osteogenic or adipogenic differentiation of mesenchymal stem cells modulated by dexamethasone.

    PubMed

    Song, Mingyu; Zhao, Dongming; Wei, Sheng; Liu, Chaoxu; Liu, Yang; Wang, Bo; Zhao, Wenchun; Yang, Kaixiang; Yang, Yong; Wu, Hua

    2014-10-01

    Although glucocorticoids provide benefits for inflammation or autoimmune disorders, high-dose and long-term use could cause osteonecrosis or osteoporosis as adverse effect for patients. Electromagnetic field (EMF) treatments have been clinically used for many years to promote fracture healing, but whether EMF can attenuate the deleterious effects of glucocorticoids is not clear. In this study, the effects of different concentrations of dexamethasone (DEX) on proliferation and adipogenic or osteogenic differentiation of bone marrow mesenchymal stem cells (BMSCs) were detected and compared, and the effects of EMF treatment (15 Hz, 1 mT, 4 h/day) on 0.1 µM DEX-modulated BMSCs' proliferation and adipogenic or osteogenic differentiation were investigated. Higher concentrations of DEX (0.1 and 1 µM) inhibited proliferation of BMSCs but promoted expression of adipogenic-related genes, increasing the number of lipid droplets. In the early stage of differentiation, DEX restrained expression of RUNX2 and alkaline phosphatase (ALP), but amplified expression of ALP and osteopontin (OPN) in the late stage. EMF treatment of BMSCs influenced by 0.1 µM DEX inhibited the high expression of adipogenic-related genes, stimulated the expression of RUNX2, ALP, OPN, and osteocalcin, and increased the activity of ALP. EMF exposure augmented the expression of p-ERK, which DEX reduced. After using mitogen-activated protein/extracellular signal-regulated kinase (ERK) kinase (MEK)/ERK signaling pathway inhibitor, U0126, the effect of EMF was reduced. In conclusion, EMF exposure accelerates BMSCs proliferation, inhibits adipogenic differentiation, and promotes osteogenic differentiation of BMSCs modulated by DEX, and these effects are mediated at least in part by MEK/ERK signaling pathway.

  8. Retinoic acid exacerbates chlorpyrifos action in ensuing adipogenic differentiation of C3H10T½ cells in a GSK3β dependent pathway.

    PubMed

    Sandhu, Harkirat Singh; Bhanwer, A J S; Puri, Sanjeev

    2017-01-01

    The cell differentiation can be exploited as a paradigm to evaluate the effects of noxious chemicals, on human health, either alone or in combinations. In this regard, the effect of a known cell differentiation agent, retinoic acid (RA) was analyzed in the presence of a noxious chemical chlorpyrifos (CPF), an organophosphate (OP), the receptors of which have recently been localized to mesenchymal stem cells (MSCs). The observed imbalance of adipogenic to skeletal differentiation by CPF together with conundrum about adipogenic potential of RA prompted us to delineate their combinatorial effects on C3H10T½MSC-like undifferentiated cells. Based on MTT assay, the cellular viability was retained by CPF at concentrations ranging from 0.01-50μM, beyond which it caused cytotoxicity. These non-toxic concentrations also mildly interfered with adipogenesis of C3H10T½ cells following exposure to adipogenic cocktail. However, upon exposure to RA alone, these MSCs adopted elongated morphology and accumulated lipid vesicles, by day 20, as discerned by phase-contrast and transmission electron microscopy (TEM), in concert with enhanced Oil Red O stained cells. This effect got strongly augmented upon exposure to combination of CPF and RA in a dose-dependent manner. Simultaneous up-regulation in perilipin-1 (PLIN1) and adipsin (ADN) genes, additionally reiterated the adipogenic differentiation. Mechanistically, GSK3β pathway was found to be a major player, whereby inhibiting it with lithium chloride (LiCl) resulted in complete blockage of lipid accumulation, accompanied by complete down regulation of PLIN1 and ADN gene expression. In conclusion, these observations for the first time, lend evidence that exposure of CPF accompanied by RA directs commitment of C3H10T½ cells to adipogenic differentiation through a process involving a crosstalk at GSK3β signaling.

  9. Retinoic acid exacerbates chlorpyrifos action in ensuing adipogenic differentiation of C3H10T½ cells in a GSK3β dependent pathway

    PubMed Central

    Sandhu, Harkirat Singh; Bhanwer, A. J. S.; Puri, Sanjeev

    2017-01-01

    The cell differentiation can be exploited as a paradigm to evaluate the effects of noxious chemicals, on human health, either alone or in combinations. In this regard, the effect of a known cell differentiation agent, retinoic acid (RA) was analyzed in the presence of a noxious chemical chlorpyrifos (CPF), an organophosphate (OP), the receptors of which have recently been localized to mesenchymal stem cells (MSCs). The observed imbalance of adipogenic to skeletal differentiation by CPF together with conundrum about adipogenic potential of RA prompted us to delineate their combinatorial effects on C3H10T½MSC-like undifferentiated cells. Based on MTT assay, the cellular viability was retained by CPF at concentrations ranging from 0.01–50μM, beyond which it caused cytotoxicity. These non-toxic concentrations also mildly interfered with adipogenesis of C3H10T½ cells following exposure to adipogenic cocktail. However, upon exposure to RA alone, these MSCs adopted elongated morphology and accumulated lipid vesicles, by day 20, as discerned by phase-contrast and transmission electron microscopy (TEM), in concert with enhanced Oil Red O stained cells. This effect got strongly augmented upon exposure to combination of CPF and RA in a dose-dependent manner. Simultaneous up-regulation in perilipin-1 (PLIN1) and adipsin (ADN) genes, additionally reiterated the adipogenic differentiation. Mechanistically, GSK3β pathway was found to be a major player, whereby inhibiting it with lithium chloride (LiCl) resulted in complete blockage of lipid accumulation, accompanied by complete down regulation of PLIN1 and ADN gene expression. In conclusion, these observations for the first time, lend evidence that exposure of CPF accompanied by RA directs commitment of C3H10T½ cells to adipogenic differentiation through a process involving a crosstalk at GSK3β signaling. PMID:28291828

  10. Crif1 Promotes Adipogenic Differentiation of Bone Marrow Mesenchymal Stem Cells After Irradiation by Modulating the PKA/CREB Signaling Pathway.

    PubMed

    Zhang, Xi; Xiang, Lixin; Ran, Qian; Liu, Yao; Xiang, Yang; Xiao, Yanni; Chen, Li; Li, Fengjie; Zhong, Jiang F; Li, Zhongjun

    2015-06-01

    Dysfunction of the hematopoietic microenvironment is the main obstacle encountered during hematopoiesis reconstruction in patients with acute hematopoietic radiation syndrome. Bone marrow mesenchymal stem cells (BM-MSCs) play a crucial supporting role in hematopoiesis by maintaining the balance between adipogenic and osteogenic differentiation. In this study, we found that irradiation decreased the colony-forming efficiency of BM-MSCs and impaired the balance between adipogenic and osteogenic differentiation. Following irradiation, BM-MCSs became strongly predisposed to adipogenesis, as evidenced by increased oil red O staining and elevated mRNA and protein levels of the adipogenic markers and transcription factors PPARγ and AP2. Overexpression of the essential adipogenesis regulator Crif1 in BM-MSCs promoted adipogenesis after irradiation exposure by upregulating adipogenesis-related genes, including C/EBPβ, PPARγ, and AP2. We found that Crif1 promoted the phosphorylation of cAMP response element binding protein (CREB) through direct interaction with protein kinase A (PKA)-α. Phosphorylation of CREB was inhibited in Crif1-knockdown BM-MSCs even in the presence of a PKA agonist (db-cAMP) and could be suppressed in Crif1-overexpressing BM-MSCs by a PKAα inhibitor (H-89). These results suggest that Crif1 is an indispensable regulator of PKAα cat that modulates the PKA/CREB signaling pathway to promote adipogenic differentiation of BM-MSCs after irradiation.

  11. Suppression of adipogenic differentiation by muscle cell-induced decrease in genes related to lipogenesis in muscle and fat co-culture system.

    PubMed

    Park, Sungkwon; Baek, Kyunghoon; Choi, Changbon

    2013-09-01

    Intercellular signalling communication between adipose and muscle tissue has been investigated. To test the effect of muscle cells on adipogenic gene expression, we utilised an in vitro co-culture system, in which fat (3T3-L1) and muscle (L-6) cells were physically separated but chemically exposed each other via insert with 0.4 µm porous membrane. When 3T3-L1 and L-6 cells reached at 80 and 40% confluence, respectively in separate wells, L-6 cells grown in insert were transferred onto 6-well plates where 3T3-L1 cells were being grown. When both cells were fully differentiated in co-culture plates, morphology of 3T3-L1 was examined by staining with Oil-red-O. Activity of glycerol-3-phosphate dehydrogenase (GPDH) and adipogenic gene expression including lipoprotein lipase (LPL), adipsin, GPDH, peroxisome proliferator-activated receptor-γ (PPARγ) and CCAAT/enhancer binding protein (C/EBPα) were analysed. The presence of muscle cells during preadipocyte differentiation inhibited (P < 0.05) lipogenesis by suppressing lipogenic gene expression including LPL, adipsin and GPDH. Furthermore, GPDH activity was also decreased (P < 0.05) in 3T3-L1 cells by the presence of L-6 cells. These results suggest that presence of muscle cells suppresses adipogenic differentiation by inhibiting the adipogenic gene expression and GPDH activity in the muscle and fat cell co-culture system.

  12. "The preadipocyte factor" DLK1 marks adult mouse adipose tissue residing vascular cells that lack in vitro adipogenic differentiation potential.

    PubMed

    Andersen, Ditte Caroline; Jensen, Line; Schrøder, Henrik Daa; Jensen, Charlotte Harken

    2009-09-03

    Delta-like 1 (Dlk1) is expressed in 3T3-L1 preadipocytes and has frequently been referred to as "the" preadipocyte marker, yet the phenotype of DLK1(+) cells in adipose tissue remains undetermined. Herein, we demonstrate that DLK1(+) cells encompass around 1-2% of the adult mouse adipose stromal vascular fraction (SVF). Unexpectedly, the DLK1(+)SVF population was enriched for cells expressing genes generally ascribed to the vascular lineage and did not possess any adipogenic differentiation potential in vitro. Instead, DLK1(+) cells comprised an immediate ability for cobblestone formation, generation of tube-like structures on matrigel, and uptake of Acetylated Low Density-Lipoprotein, all characteristics of endothelial cells. We therefore suggest that DLK1(+)SVF cells are of a vascular origin and not them-selves committed preadipocytes as assumed hitherto.

  13. Modulation of keratin in adhesion, proliferation, adipogenic, and osteogenic differentiation of porcine adipose-derived stem cells.

    PubMed

    Wu, Yen-Lin; Lin, Che-Wei; Cheng, Nai-Chen; Yang, Kai-Chiang; Yu, Jiashing

    2017-01-01

    Recently, keratin attracts tremendous interest because of its intrinsic ability to interact with different cells. It has the potential to serve as a controllable extracellular matrix protein that can be used to demonstrate cell mechanism and cell-matrix interaction. However, there have been relatively few studies on the effects of keratin on stem cells. In the present work, we study the effects of human keratin on porcine adipose-derived stem cells (pASCs) and a series of selective cell lines: 3T3 fibroblasts, Madin-Darby canine kidney (MDCK) cells, and MG63 osteoblasts. Relative to un-treated culture plate, our results showed that keratin coating substrates promote cell adhesion and proliferation to above cell lines. Keratin also improved pASCs adhesion, proliferation, and enhanced cell viability. Evaluation of genetic markers showed that adipogenic and osteogenic differentiations of pASCs can be successfully induced, thus demonstrating that keratin did not influence the stemness of pASCs. Furthermore, keratin improved adipogenic differentiations of pASCs in terms of up-regulations in lipoprotein lipase, peroxisome proliferator-activated receptor gamma, and CCAAT-enhancer-binding protein alpha. The osteogenic markers type I collagen, runt-related transcription factor 2, and vitamin D receptor were also upregulated when pASCs cultured on keratin substrates. Therefore, keratin can serve as a biological derived material for surface modification and scaffold fabrication for biomedical purpose. The combination of keratin with stem cells may be a potential candidate for tissue repair in the field of regenerative medicine. © 2015 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 105B: 180-192, 2017.

  14. Genistein induces adipogenic differentiation in human bone marrow mesenchymal stem cells and suppresses their osteogenic potential by upregulating PPARγ

    PubMed Central

    ZHANG, LI-YAN; XUE, HAO-GANG; CHEN, JI-YING; CHAI, WEI; NI, MING

    2016-01-01

    Genistein is a soy isoflavone that exists in the form of an aglycone. It is the primary active component in soy isoflavone and has a number of biological activities (anti-inflammatory and anti-oxidative). However, the specific effect of genistein on human bone marrow mesenchymal stem cells (BMSCs) remains unclear. In the present study, the mechanism underlying the effect of genistein on the suppression of BMSC adipogenic differentiation and the enhancement of osteogenic potential was investigated using an MTT assay. It was observed that genistein significantly increased BMSC cell proliferation in a time- and dose-dependent manner (P<0.01). In addition, reverse transcription-quantitative polymerase chain reaction revealed that genistein significantly inhibited the expression of runt-related transcription factor 2 (Runx2), type I collagen (Col I) and osteocalcin (OC; P<0.01). Furthermore, 20 µm genistein significantly inhibited the activity of alkaline phosphatase (ALP) and increased the activity of triglycerides (TGs) increased (P<0.01) as determined by an enzyme-linked immunosorbent assay. Finally, western blotting revealed that BMSC pretreatment with 20 µm genistein significantly increased peroxisome proliferator-activated receptor γ (PPARγ) protein expression (P<0.01). This suggests that the downregulation of PPARγ may significantly reduce the effect of genistein on cell proliferation, suppress the expression of Runx2, Col I and OC mRNA, and reduce ALP and promote TG activity in BMSCs. Thus, the results of the present study conclude that genistein induces adipogenic differentiation in human BMSCs and suppresses their osteogenic potential by upregulating the expression of PPARγ. In conclusion, genistein may be a promising candidate drug for treatment against osteogenesis. PMID:27168816

  15. Spot14/Spot14R expression may be involved in MSC adipogenic differentiation in patients with adolescent idiopathic scoliosis

    PubMed Central

    WANG, QIFEI; YANG, JUNLIN; LIN, XIANG; HUANG, ZIFANG; XIE, CHAOFAN; FAN, HENGWEI

    2016-01-01

    The aim of the present study was to evaluate the different expression levels of thyroid hormone responsive (THRSP; Spot14)/S14 related, Mig12 (S14R) during bone marrow mesenchymal stem cell (BM-MSC) adipogenesis in adolescent idiopathic scoliosis (AIS) patients. MSCs were retrospectively isolated from AIS patients and controls, and adipogenic differentiation was induced. Total RNA was extracted for Affymetrix 3′-IVT expression profiling microarrays and compared with the results from healthy controls. The results were confirmed by semiquantitative reverse transcription-polymerase chain reaction (RT-PCR) validation and the protein expression levels of Spot14 and its paralogous gene S14R by western blotting and immunohistochemistry. A total of 300 significantly altered mRNAs were detected (111 upregulated and 189 downregulated) and confirmed by RT-qPCR. The mRNA expression levels of seven genes, including Spot14, were altered by >2-fold in AIS patients. Spot14/S14R was selected for further investigation. The results of the western blotting demonstrated that mRNA and protein expression levels of Spot14/S14R were significantly higher in AIS patients than the controls (P<0.05). Immunohistochemistry demonstrated Spot14 was expressed in 85% (17/20 cases) in adipose tissue samples from AIS patients and 23.1% (3/13 cases) of adipose tissue samples from controls. The positive ratio of Spot14 in adipose tissue samples from AIS was significantly higher than the controls (P<0.001). The results of the present study indicated that Spot14/S14R were differently expressed in MSC adipogenesis in AIS patients, and they may be important in the abnormal adipogenic differentiation in AIS. PMID:27082501

  16. Maraviroc reduces cytokine expression and secretion in human adipose cells without altering adipogenic differentiation.

    PubMed

    Díaz-Delfín, Julieta; Domingo, Pere; Giralt, Marta; Villarroya, Francesc

    2013-03-01

    Maraviroc (MVC) is a drug approved for use as part of HAART in treatment-experienced HIV-1 patients with CCR5-tropic virus. Despite the current concerns on the alterations in adipose tissue that frequently appear in HIV-infected patients under HAART, there is no information available on the effects of MVC on adipose tissue. Here we studied the effects of MVC during and after the differentiation of human adipocytes in culture, and compared the results with the effects of efavirenz (EFV). We measured the acquisition of adipocyte morphology; the gene expression levels of markers for mitochondrial toxicity, adipogenesis and inflammation; and the release of adipokines and cytokines to the medium. Additionally, we determined the effects of MVC on lipopolysaccharide (LPS)-induced pro-inflammatory cytokine expression in adipocytes. Unlike EFV-treated pre-adipocytes, MVC-treated pre-adipocytes showed no alterations in the capacity to differentiate into adipocytes and accumulated lipids normally. Consistent with this, there were no changes in the mRNA levels of PPARγ or SREBP-1c, two master regulators of adipogenesis. In addition, MVC caused a significant decrease in the gene expression and release of pro-inflammatory cytokines, whereas EFV had the opposite effect. Moreover, MVC lowered inflammation-related gene expression and inhibited the LPS-induced expression of pro-inflammatory genes in differentiated adipocytes. We conclude that MVC does not alter adipocyte differentiation but rather shows anti-inflammatory properties by inhibiting the expression and secretion of pro-inflammatory cytokines. Collectively, our results suggest that MVC may minimize adverse effects on adipose tissue development, metabolism, and inflammation, and thus could be a potentially beneficial component of antiretroviral therapy.

  17. miR-17, miR-21, and miR-143 Enhance Adipogenic Differentiation from Porcine Bone Marrow-Derived Mesenchymal Stem Cells.

    PubMed

    An, Xinglan; Ma, Kuiying; Zhang, Zhiren; Zhao, Tianchuang; Zhang, Xueming; Tang, Bo; Li, Ziyi

    2016-08-01

    Bone marrow-derived mesenchymal stem cells (BMSCs) have multilineage differentiation abilities toward adipocytes and osteoblasts. Recently, numerous studies have focused on the roles of microRNAs (miRNAs) in the process of adipogenic differentiation of human and mouse cells. However, the role of miRNAs in adipogenic differentiation process of porcine BMSCs (pBMSCs) remains unclear. In this study, pBMSCs were induced to differentiate into adipocytes using a chemical approach, and the roles of miR-17, miR-21, and miR-143 in this process were investigated. Our results showed that pBMSCs could be chemically induced to differentiate into adipocytes and that the expression of miR-17, miR-21, and miR-143 increased during differentiation. Then, overexpression of mimics of miR-17, miR-21, and miR-143 increased the number of oil red O-positive cells of adipocyte differentiation. The expression levels of CCAAT/enhancer-binding protein alpha (C/EBPα) mRNA showed increases of 1.8-, 1.5-, and 1.2-fold in the groups expressing mimics of miR-21, miR-17, and miR-143, respectively, at day 20. These results demonstrate that miR-17, miR-21, and miR-143 are involved in and promote the adipogenic differentiation of pBMSCs. This study provides an experimental basis for establishing a stable and efficient adipogenic differentiation model for applications in cell therapy and tissue engineering.

  18. Adipogenic Differentiation of hMSCs is Mediated by Recruitment of IGF-1r Onto the Primary Cilium Associated With Cilia Elongation.

    PubMed

    Dalbay, Melis T; Thorpe, Stephen D; Connelly, John T; Chapple, J Paul; Knight, Martin M

    2015-06-01

    Primary cilia are single non-motile organelles that provide a highly regulated compartment into which specific proteins are trafficked as a critical part of various signaling pathways. The absence of primary cilia has been shown to prevent differentiation of human mesenchymal stem cells (hMSCs). Changes in primary cilia length are crucial for regulating signaling events; however it is not known how alterations in cilia structure relate to differentiation. This study tested the hypothesis that changes in primary cilia structure are required for stem cell differentiation. hMSCs expressed primary cilia that were labeled with acetylated alpha tubulin and visualized by confocal microscopy. Chemically induced differentiation resulted in lineage specific changes in cilia length and prevalence which were independent of cell cycle. In particular, adipogenic differentiation resulted in cilia elongation associated with the presence of dexamethasone, while insulin had an inhibitory effect on cilia length. Over a 7-day time course, adipogenic differentiation media resulted in cilia elongation within 2 days followed by increased nuclear PPARγ levels; an early marker of adipogenesis. Cilia elongation was associated with increased trafficking of insulin-like growth factor-1 receptor β (IGF-1Rβ) into the cilium. This was reversed on inhibition of elongation by IFT-88 siRNA transfection, which also decreased nuclear PPARγ. This is the first study to show that adipogenic differentiation requires primary cilia elongation associated with the recruitment of IGF-1Rβ onto the cilium. This study may lead to the development of cilia-targeted therapies for controlling adipogenic differentiation and associated conditions such as obesity.

  19. N-Glycosylation Profile of Undifferentiated and Adipogenically Differentiated Human Bone Marrow Mesenchymal Stem Cells: Towards a Next Generation of Stem Cell Markers

    PubMed Central

    Hamouda, Houda; Ullah, Mujib; Berger, Markus; Sittinger, Michael; Tauber, Rudolf; Ringe, Jochen

    2013-01-01

    Mesenchymal stem cells (MSCs) are multipotent cells that are easy to isolate and expand, develop into several tissues, including fat, migrate to diseased organs, have immunosuppressive properties and secrete regenerative factors. This makes MSCs ideal for regenerative medicine. For application and regulatory purposes, knowledge of (bio)markers characterizing MSCs and their development stages is of paramount importance. The cell surface is coated with glycans that possess lineage-specific nature, which makes glycans to be promising candidate markers. In the context of soft tissue generation, we aimed to identify glycans that could be markers for MSCs and their adipogenically differentiated progeny. MSCs were isolated from human bone marrow, adipogenically stimulated for 15 days and adipogenesis was verified by staining the lipid droplets and quantitative real time polymerase chain reaction of the marker genes peroxisome proliferator-activated receptor gamma (PPARG) and fatty acid binding protein-4 (FABP4). Using matrix-assisted laser desorption-ionization-time of flight mass spectrometry combined with exoglycosidase digestions, we report for the first time the N-glycome of MSCs during adipogenic differentiation. We were able to detect more than 100 different N-glycans, including high-mannose, hybrid, and complex N-glycans, as well as poly-N-acetyllactosamine chains. Adipogenesis was accompanied by an increased amount of biantennary fucosylated structures, decreased amount of fucosylated, afucosylated tri- and tetraantennary structures and increased sialylation. N-glycans H6N5F1 and H7N6F1 were significantly overexpressed in undifferentiated MSCs while H3N4F1 and H5N4F3 were upregulated in adipogenically differentiated MSCs. These glycan structures are promising candidate markers to detect and distinguish MSCs and their adipogenic progeny. PMID:23829188

  20. Transcriptomics comparison between porcine adipose and bone marrow mesenchymal stem cells during in vitro osteogenic and adipogenic differentiation.

    PubMed

    Monaco, Elisa; Bionaz, Massimo; Rodriguez-Zas, Sandra; Hurley, Walter L; Wheeler, Matthew B

    2012-01-01

    Bone-marrow mesenchymal stem cells (BMSC) are considered the gold standard for use in tissue regeneration among mesenchymal stem cells (MSC). The abundance and ease of harvest make the adipose-derived stem cells (ASC) an attractive alternative to BMSC. The aim of the present study was to compare the transcriptome of ASC and BMSC, respectively isolated from subcutaneous adipose tissue and femur of 3 adult pigs, during in vitro osteogenic and adipogenic differentiation for up to four weeks. At 0, 2, 7, and 21 days of differentiation RNA was extracted for microarray analysis. A False Discovery Rate ≤0.05 for overall interactions effect and P<0.001 between comparisons were used to determine differentially expressed genes (DEG). Ingenuity Pathway Analysis and DAVID performed the functional analysis of the DEG. Functional analysis of highest expressed genes in MSC and genes more expressed in MSC vs. fully differentiated tissues indicated low immunity and high angiogenic capacity. Only 64 genes were differentially expressed between ASC and BMSC before differentiation. The functional analysis uncovered a potential larger angiogenic, osteogenic, migration, and neurogenic capacity in BMSC and myogenic capacity in ASC. Less than 200 DEG were uncovered between ASC and BMSC during differentiation. Functional analysis also revealed an overall greater lipid metabolism in ASC, while BMSC had a greater cell growth and proliferation. The time course transcriptomic comparison between differentiation types uncovered <500 DEG necessary to determine cell fate. The functional analysis indicated that osteogenesis had a larger cell proliferation and cytoskeleton organization with a crucial role of G-proteins. Adipogenesis was driven by PPAR signaling and had greater angiogenesis, lipid metabolism, migration, and tumorigenesis capacity. Overall the data indicated that the transcriptome of the two MSC is relatively similar across the conditions studied. In addition, functional analysis

  1. Chemical and genetic blockade of HDACs enhances osteogenic differentiation of human adipose tissue-derived stem cells by oppositely affecting osteogenic and adipogenic transcription factors

    SciTech Connect

    Maroni, Paola; Brini, Anna Teresa; Arrigoni, Elena; Girolamo, Laura de; Niada, Stefania; Matteucci, Emanuela; Bendinelli, Paola; Desiderio, Maria Alfonsina

    2012-11-16

    Highlights: Black-Right-Pointing-Pointer Acetylation affected hASCs osteodifferentiation through Runx2-PPAR{gamma}. Black-Right-Pointing-Pointer HDACs knocking-down favoured the commitment effect of osteogenic medium. Black-Right-Pointing-Pointer HDACs silencing early activated Runx2 and ALP. Black-Right-Pointing-Pointer PPAR{gamma} reduction and calcium/collagen deposition occurred later. Black-Right-Pointing-Pointer Runx2/PPAR{gamma} target genes were modulated in line with HDACs role in osteo-commitment. -- Abstract: The human adipose-tissue derived stem/stromal cells (hASCs) are an interesting source for bone-tissue engineering applications. Our aim was to clarify in hASCs the role of acetylation in the control of Runt-related transcription factor 2 (Runx2) and Peroxisome proliferator activated receptor (PPAR) {gamma}. These key osteogenic and adipogenic transcription factors are oppositely involved in osteo-differentiation. The hASCs, committed or not towards bone lineage with osteoinductive medium, were exposed to HDACs chemical blockade with Trichostatin A (TSA) or were genetically silenced for HDACs. Alkaline phosphatase (ALP) and collagen/calcium deposition, considered as early and late osteogenic markers, were evaluated concomitantly as index of osteo-differentiation. TSA pretreatment, useful experimental protocol to analyse pan-HDAC-chemical inhibition, and switch to osteogenic medium induced early-osteoblast maturation gene Runx2, while transiently decreased PPAR{gamma} and scarcely affected late-differentiation markers. Time-dependent effects were observed after knocking-down of HDAC1 and 3: Runx2 and ALP underwent early activation, followed by late-osteogenic markers increase and by PPAR{gamma}/ALP activity diminutions mostly after HDAC3 silencing. HDAC1 and 3 genetic blockade increased and decreased Runx2 and PPAR{gamma} target genes, respectively. Noteworthy, HDACs knocking-down favoured the commitment effect of osteogenic medium. Our results reveal

  2. Adipogenic differentiation of human mesenchymal stromal cells is down-regulated by microRNA-369-5p and up-regulated by microRNA-371.

    PubMed

    Bork, Simone; Horn, Patrick; Castoldi, Mirco; Hellwig, Isabelle; Ho, Anthony D; Wagner, Wolfgang

    2011-09-01

    Long-term culture of human mesenchymal stromal cells (MSC) has implications on their proliferation and differentiation potential and we have demonstrated that this is associated with up-regulation of the five microRNAs miR-29c, miR-369-5p, miR-371, miR-499, and let-7f. In this study, we examined the role of these senescence-associated microRNAs for cellular aging and differentiation of MSC. Proliferation was reduced upon transfection with miR-369-5p, miR-371, and miR-499. Adipogenic differentiation was impaired by miR-369-5p whereas it was highly increased by miR-371. This was accompanied by respective gene expression changes of some adipogenic key molecules (adiponectin and fatty acid-binding protein 4 [FABP4]). Furthermore luciferase reporter assay indicated that FABP4 is a direct target of miR-369-5p. Microarray analysis upon adipogenic or osteogenic differentiation revealed down-regulation of several microRNAs albeit miR-369-5p and miR-371 were not affected. Expression of the de novo DNA methyltransferases DNMT3A and DNMT3B was up-regulated by transfection of miR-371 whereas expression of DNMT3A was down-regulated by miR-369-5p. In summary, we identified miR-369-5p and miR-371 as antagonistic up-stream regulators of adipogenic differentiation and this might be indirectly mediated by epigenetic modifications.

  3. Molecular Characterization of Equine APRIL and its Expression Analysis During the Adipogenic Differentiation of Equine Adipose-Derived Stem Cell In Vitro.

    PubMed

    Wu, Haitao; Bi, Xiaolin; Cao, Fang; Zhu, Cuicui; Liu, Hongzhen; Song, Jinyun; Ma, Lei; Ma, Li; Zhang, Yi; Zhao, Dongwei; Liu, Hongyan; Xu, Xinzhou; Zhang, Shuangquan

    2016-10-01

    A proliferation inducing ligand (APRIL) is a member of the TNF superfamily. It shares two receptors with B-cell activating factor (BAFF), B-cell maturation antigen (BCMA), and transmembrane activator and CAML interactor (TACI). Herein, the equine APRIL was identified from equine adipose-derived stem cell (ASC), and the protein expression of APRIL and its related molecules were detected during the adipogenic differentiation of equine ASC in vitro. The equine APRIL gene was located on chromosome 11, spans 1852 base pairs (bp). Its open reading frame covers 753 bp, encoding a 250-amino acid protein with the typical TNF structure domain. During the two weeks' adipogenic differentiation of equine ASC, although the protein expression of APRIL and TACI had an insignificant change, that of BCMA increased significantly. Moreover, with the addition of recombinant protein His6-sAPRIL, a reduced differentiation of equine ASC toward adipocyte was detected. These results may provide the basis for investigating the role of APRIL in ASC adipogenic differentiation.

  4. Non-invasive characterization of the adipogenic differentiation of human bone marrow-derived mesenchymal stromal cells by HS-SPME/GC-MS

    PubMed Central

    Lee, Dong-Kyu; Yi, TacGhee; Park, Kyung-Eun; Lee, Hyun-Joo; Cho, Yun-Kyoung; Lee, Seul Ji; Lee, Jeongmi; Park, Jeong Hill; Lee, Mi-Young; Song, Sun U.; Kwon, Sung Won

    2014-01-01

    A non-invasive method to characterize human mesenchymal stromal cells during adipogenic differentiation was developed for the first time. Seven fatty acid methyl esters (FAMEs), including methyl laurate, methyl myristate, methyl palmitate, methyl linoleate, methyl oleate, methyl elaidate and methyl stearate, were used for characterizing adipogenic differentiation using headspace solid-phase microextraction (HS-SPME) which is a very simple and non-invasive method for the extraction of volatile compounds. Glassware was used for culturing mesenchymal stromal cells rather than the common plasticware to minimize contamination by volatile impurities. The optimal SPME fiber was selected by comparing diverse fibers containing two pure liquid polymers (PDMS and PA) and two porous solids (PDMS/DVB and CAR/PDMS). Using optimized procedures, we discovered that seven FAMEs were only detected in adipogenic differentiated mesenchymal stromal cells and not in the mesenchymal stromal cells before differentiation. These data could support the quality control of clinical mesenchymal stromal cell culture in the pharmaceutical industry in addition to the development of many clinical applications using mesenchymal stromal cells. PMID:25298091

  5. Mechanism of Butyrate Stimulation of Triglyceride Storage and Adipokine Expression during Adipogenic Differentiation of Porcine Stromovascular Cells

    PubMed Central

    Yan, Hui; Ajuwon, Kolapo M.

    2015-01-01

    Short chain fatty acids (SCFA), products of microbial fermentation of dietary fiber, exert multiple metabolic effects in cells. Previously, we had demonstrated that soluble fiber influenced fat mass accumulation, gut microbial community structure and SCFA production in pigs. The current study was designed to identify effects of SCFA treatment during adipogenic differentiation of porcine stromovascular cells on lipid metabolism and adipokine expression. Differentiating cells were treated with varying concentrations of butyrate. Results show that butyrate treatment enhanced adipogenesis and lipid accumulation, perhaps through upregulation of glucose uptake and de novo lipogenesis and other mechanisms that include induction of SREBP-1c, C/EBPα/β, GLUT4, LPL, PPARγ, GPAT4, DGAT1 and DGAT2 expression. In addition, butyrate induced adiponectin expression, resulting in activation of downstream target genes, such as AMPK and AKT. Activation of AMPK by butyrate led to phosphorylation of ACC. Although increased ACO gene expression was seen with butyrate treatment, experiments with the peroxisomal fatty acid inhibitor, thioridazine, suggest that butyrate may have an inhibitory effect on peroxisomal fatty acid oxidation. Our studies also provide evidence that butyrate may inhibit lipolysis, perhaps in an FFAR3-dependent manner. Therefore, this study presents a novel paradigm for butyrate action in adipocytes and shows that adipocytes are capable of utilizing butyrate, leading to increased expression of adiponectin for enhanced glucose uptake and improved insulin sensitivity. PMID:26713737

  6. MicroRNA-125b-5p inhibits proliferation and promotes adipogenic differentiation in 3T3-L1 preadipocytes.

    PubMed

    Ouyang, Dan; Ye, Yaqiong; Guo, Dongguang; Yu, Xiaofang; Chen, Jian; Qi, Junjie; Tan, Xiaotong; Zhang, Yuan; Ma, Yongjiang; Li, Yugu

    2015-05-01

    Previous evidence has indicated that the microRNA-125b (miR-125b) family plays important roles in the regulation of cancer cell growth, development, differentiation, and apoptosis. However, whether they contribute to the process of adipocyte differentiation remains unclear. In the present study, we revealed that the expression level of miR-125b-5p, a member of miR-125b family, was dramatically up-regulated during differentiation of 3T3-L1 preadipocyte into mature adipocyte. Supplement of miR-125b-5p into 3T3-L1 cells promoted adipogenic differentiation as evidenced by increased lipid droplets and mRNA levels of adipocyte-specific molecular markers, including peroxisome proliferators-activated receptor γ, CCAAT/enhancer-binding protein α, fatty acid-binding protein 4, and lipoprotein lipase, and by triglyceride accumulation. CCK-8 assay showed that miR-125b-5p supplementation significantly inhibited cell proliferation. Flow cytometry analysis showed that miR-125b-5p impaired G1/S phase transition as well as the mRNA and protein expression of G1/S-related genes, such as Cyclin D2, Cyclin D3, and CDK4. Nevertheless, it had no effect on apoptosis. Additionally, by target gene prediction, we demonstrated that smad4 may be a potential target of miR-125b-5p in mouse 3T3-L1 preadipocytes, accounting for some of miR-125b-5p's functions. Taken together, these data indicated that miR-125b-5p may serve as an important positive regulator in adipocyte differentiation, at least partially through down-regulating smad4.

  7. Lupenone isolated from Adenophora triphylla var. japonica extract inhibits adipogenic differentiation through the downregulation of PPARγ in 3T3-L1 cells.

    PubMed

    Ahn, Eun-Kyung; Oh, Joa Sub

    2013-05-01

    Adenophora triphylla var. japonica (Campanulaceae) is known to have anti-inflammatory and anti-tussive effects. Dysfunction of adipocytes and adipose tissue in obesity is related to various inflammatory cytokines or adipokines. In this study, we investigated whether lupenone isolated from A. triphylla var. japonica extract inhibits adipocyte differentiation and expression of adipogenic marker genes in 3T3-L1 preadipocytes. We demonstrated that lupenone resulted in a significant reduction in lipid accumulation and expression of adipogenic marker genes in a dose-dependent manner. In addition, lupenone decreased the transcriptional activity of peroxisome proliferator-activated receptor γ (PPARγ) induced by troglitazone, and we also demonstrated that lupenone suppressed the PPARγ and CCAAT-enhancer-binding protein α (C/EBPα) protein levels. These findings demonstrated that lupenone isolated from A. triphylla var. japonica extract effectively inhibited adipocyte differentiation through downregulation of related transcription factor, particularly the PPARγ gene.

  8. Transdifferentiation of mesenchymal stem cells-derived adipogenic-differentiated cells into osteogenic- or chondrogenic-differentiated cells proceeds via dedifferentiation and have a correlation with cell cycle arresting and driving genes.

    PubMed

    Ullah, Mujib; Stich, Stefan; Notter, Michael; Eucker, Jan; Sittinger, Michael; Ringe, Jochen

    2013-02-01

    It is generally accepted that after differentiation bone marrow mesenchymal stem cells (MSC) become lineage restricted and unipotent in an irreversible manner. However, current results imply that even terminally differentiated cells transdifferentiate across lineage boundaries and therefore act as a progenitor cells for other lineages. This leads to the questions that whether transdifferentiation occurs via direct cell-to-cell conversion or dedifferentiation to a progenitor cells and subsequent differentiation, and whether MSC potency decreases or increases during differentiation. To address these questions, MSC were differentiated into adipogenic lineage cells, followed by dedifferentiation. The process of dedifferentiation was also confirmed by single cell clonal analysis. Finally the dedifferentiated cells were used for adipogenesis, osteogenesis and chondrogenesis. Histology, FACS, qPCR and GeneChip analyses of undifferentiated MSC, adipogenic-differentiated and dedifferentiated cells were performed. Interestingly, gene profiling and bioinformatics demonstrated that upregulation (DHCR24, G0S2, MAP2K6, SESN3) and downregulation (DST, KAT2, MLL5, RB1, SMAD3, ZAK) of distinct genes have an association with cell cycle arrest in adipogenic-differentiated cells and perhaps narrow down the lineage potency. However, the upregulation (CCND1, CHEK, HGF, HMGA2, SMAD3) and downregulation (CCPG1, RASSF4, RGS2) of these genes have an association with cell cycle progression and maybe motivate dedifferentiation of adipogenic-differentiated cells. We found that dedifferentiated cells have a multilineage potency comparable to MSC, and also observed the associative role of proliferation genes with cell cycle arrest and progression. Concluded, our results indicate that transdifferentiation of adipogenic-differentiated cells into osteogenic- or chondrogenic-differentiated cells proceeds via dedifferentiation and correlates with cell cycle arresting and deriving genes. Regarding

  9. Bisphenol A Diglycidyl Ether Induces Adipogenic Differentiation of Multipotent Stromal Stem Cells through a Peroxisome Proliferator–Activated Receptor Gamma-Independent Mechanism

    PubMed Central

    Chamorro-García, Raquel; Kirchner, Séverine; Li, Xia; Janesick, Amanda; Casey, Stephanie C.; Chow, Connie

    2012-01-01

    Background: Bisphenol A (BPA) and bisphenol A diglycidyl ether (BADGE), used in manufacturing coatings and resins, leach from packaging materials into food. Numerous studies suggested that BPA and BADGE may have adverse effects on human health, including the possibility that exposure to such chemicals can be superimposed on traditional risk factors to initiate or exacerbate the development of obesity. BPA is a suspected obesogen, whereas BADGE, described as a peroxisome proliferator–activated receptor gamma (PPARγ) antagonist, could reduce weight gain. Objectives: We sought to test the adipogenic effects of BADGE in a biologically relevant cell culture model. Methods: We used multipotent mesenchymal stromal stem cells (MSCs) to study the adipogenic capacity of BADGE and BPA and evaluated their effects on adipogenesis, osteogenesis, gene expression, and nuclear receptor activation. Discussion: BADGE induced adipogenesis in human and mouse MSCs, as well as in mouse 3T3-L1 preadipocytes. In contrast, BPA failed to promote adipogenesis in MSCs, but induced adipogenesis in 3T3-L1 cells. BADGE exposure elicited an adipogenic gene expression profile, and its ability to induce adipogenesis and the expression of adipogenic genes was not blocked by known PPARγ antagonists. Neither BADGE nor BPA activated or antagonized retinoid “X” receptor (RXR) or PPARγ in transient transfection assays. Conclusions: BADGE can induce adipogenic differentiation in both MSCs and in preadipocytes at low nanomolar concentrations comparable to those that have been observed in limited human biomonitoring. BADGE probably acts through a mechanism that is downstream of, or parallel to, PPARγ. PMID:22763116

  10. Macrophage-conditioned medium inhibits differentiation-induced Rb phosphorylation in 3T3-L1 preadipocytes

    SciTech Connect

    Yarmo, Michelle N.; Landry, Anne; Molgat, Andre S.D.; Gagnon, AnneMarie; Sorisky, Alexander

    2009-02-01

    This study examines the mechanisms underlying the anti-adipogenic effect of macrophage-secreted products. 3T3-L1 preadipocytes were induced to differentiate over 8 days in medium conditioned by murine J774 macrophages (MacCM). The inhibitory effect on lipid accumulation and expression of adipogenic markers was diminished when addition of MacCM was delayed to day 2 of differentiation. Clonal expansion, an early event required for 3T3-L1 adipogenesis, was reduced in the presence of MacCM (89%; n = 3; p < 0.001), and BrdU incorporation was impaired by 55% (n = 3; p < 0.01). Activation of ERK1/2 was not affected by MacCM, and neither was the expression of p27{sup kip1}, a cyclin-dependent kinase inhibitor. However, phosphorylation of the retinoblastoma protein (Rb), required for cell cycle progression, was impaired by MacCM (94% inhibition; n = 3; p < 0.01). Differentiation-dependent expression, nuclear localization, and DNA binding ability of C/EBP{beta} were not inhibited by MacCM. Alterations in cell cycle-associated proteins may be important with respect to the anti-adipogenic action of MacCM.

  11. Heat Shock Protein Augmentation of Angelica gigas Nakai Root Hot Water Extract on Adipogenic Differentiation in Murine 3T3-L1 Preadipocytes.

    PubMed

    Lumbera, Wenchie Marie L; Dela Cruz, Joseph; Yang, Seung-Hak; Hwang, Seong Gu

    2016-03-01

    There is a high association of heat shock on the alteration of energy and lipid metabolism. The alterations associated with thermal stress are composed of gene expression changes and adaptation through biochemical responses. Previous study showed that Angelica gigas Nakai (AGN) root extract promoted adipogenic differentiation in murine 3T3-L1 preadipocytes under the normal temperature condition. However, its effect in heat shocked 3T3-L1 cells has not been established. In this study, we investigated the effect of AGN root hot water extract in the adipogenic differentiation of murine 3T3-L1 preadipocytes following heat shock and its possible mechanism of action. Thermal stress procedure was executed within the same stage of preadipocyte confluence (G0) through incubation at 42°C for one hour and then allowed to recover at normal incubation temperature of 37°C for another hour before AGN treatment for both cell viability assay and Oil Red O. Cell viability assay showed that AGN was able to dose dependently (0 to 400 μg/mL) increase cell proliferation under normal incubation temperature and also was able to prevent cytotoxicity due to heat shock accompanied by cell proliferation. Confluent preadipocytes were subjected into heat shock procedure, recovery and then AGN treatment prior to stimulation with the differentiation solution. Heat shocked preadipocytes exhibited reduced differentiation as supported by decreased amount of lipid accumulation in Oil Red O staining and triglyceride measurement. However, those heat shocked preadipocytes that then were given AGN extract showed a dose dependent increase in lipid accumulation as shown by both evaluation procedures. In line with these results, real-time polymerase chain reaction (RT-PCR) and Western blot analysis showed that AGN increased adipogenic differentiation by upregulating heat shock protection related genes and proteins together with the adipogenic markers. These findings imply the potential of AGN in heat

  12. High glucose stimulates adipogenic and inhibits osteogenic differentiation in MG-63 cells through cAMP/protein kinase A/extracellular signal-regulated kinase pathway.

    PubMed

    Wang, Weiwei; Zhang, Xiaolin; Zheng, Jiaqiang; Yang, Jianhong

    2010-05-01

    Patients with diabetes tend to have an increased incidence of osteoporosis that may be related to hyperglycemia. In this study, we investigated the effects of high glucose on differentiation of human osteoblastic MG-63 cells and involved intracellular signal transduction pathways. Here, we showed that high glucose suppressed the cell growth, mineralization, and expression of osteogenic markers including Runx2, collagen I, osteocalcin, osteonectin, but inversely promoted expression of adipogenic markers including PPARgamma, aP2, resistin, and adipsin. Moreover, high glucose significantly increased the intracellular cAMP level in a time-dependent manner and induced ERK1/2 activation. Meanwhile, supplementation of H89, a specific inhibitor of PKA, and PD98059, a specific inhibitor of MAPK/ERK kinase, reversed the cell growth inhibition, the down-regulation of osteogenic markers and the up-regulation of adipogenic markers as well as the activation of ERK under high glucose. These results indicate that high glucose can increase adipogenic and inhibit osteogenic differentiation by activating cAMP/PKA/ERK pathway in MG-63 cells, thereby providing further insight into the molecular mechanism of diabetic osteoporosis.

  13. Composite System of Graphene Oxide and Polypeptide Thermogel As an Injectable 3D Scaffold for Adipogenic Differentiation of Tonsil-Derived Mesenchymal Stem Cells.

    PubMed

    Patel, Madhumita; Moon, Hyo Jung; Ko, Du Young; Jeong, Byeongmoon

    2016-03-02

    As two-dimensional (2D) nanomaterials, graphene (G) and graphene oxide (GO) have evolved into new platforms for biomedical research as biosensors, imaging agents, and drug delivery carriers. In particular, the unique surface properties of GO can be an important tool in modulating cellular behavior and various biological sequences. Here, we report that a composite system of graphene oxide/polypeptide thermogel (GO/P), prepared by temperature-sensitive sol-to-gel transition of a GO-suspended poly(ethylene glycol)-poly(L-alanine) (PEG-PA) aqueous solution significantly enhances the expression of adipogenic biomarkers, including PPAR-γ, CEBP-α, LPL, AP2, ELOVL3, and HSL, compared to both a pure hydrogel system and a composite system of G/P, graphene-incorporated hydrogel. We prove that insulin, an adipogenic differentiation factor, preferentially adhered to GO, is supplied to the incorporated stem cells in a sustained manner over the three-dimensional (3D) cell culture period. On the other hand, insulin is partially denatured in the presence of G and interferes with the adipogenic differentiation of the stem cells. The study suggests that a 2D/3D composite system is a promising platform as a 3D cell culture matrix, where the surface properties of 2D materials in modulating the fates of the stem cells are effectively transcribed in a 3D culture system.

  14. Time-lapse microscopy and classification of 2D human mesenchymal stem cells based on cell shape picks up myogenic from osteogenic and adipogenic differentiation.

    PubMed

    Seiler, Christof; Gazdhar, Amiq; Reyes, Mauricio; Benneker, Lorin M; Geiser, Thomas; Siebenrock, Klaus A; Gantenbein-Ritter, Benjamin

    2014-09-01

    Current methods to characterize mesenchymal stem cells (MSCs) are limited to CD marker expression, plastic adherence and their ability to differentiate into adipogenic, osteogenic and chondrogenic precursors. It seems evident that stem cells undergoing differentiation should differ in many aspects, such as morphology and possibly also behaviour; however, such a correlation has not yet been exploited for fate prediction of MSCs. Primary human MSCs from bone marrow were expanded and pelleted to form high-density cultures and were then randomly divided into four groups to differentiate into adipogenic, osteogenic chondrogenic and myogenic progenitor cells. The cells were expanded as heterogeneous and tracked with time-lapse microscopy to record cell shape, using phase-contrast microscopy. The cells were segmented using a custom-made image-processing pipeline. Seven morphological features were extracted for each of the segmented cells. Statistical analysis was performed on the seven-dimensional feature vectors, using a tree-like classification method. Differentiation of cells was monitored with key marker genes and histology. Cells in differentiation media were expressing the key genes for each of the three pathways after 21 days, i.e. adipogenic, osteogenic and chondrogenic, which was also confirmed by histological staining. Time-lapse microscopy data were obtained and contained new evidence that two cell shape features, eccentricity and filopodia (= 'fingers') are highly informative to classify myogenic differentiation from all others. However, no robust classifiers could be identified for the other cell differentiation paths. The results suggest that non-invasive automated time-lapse microscopy could potentially be used to predict the stem cell fate of hMSCs for clinical application, based on morphology for earlier time-points. The classification is challenged by cell density, proliferation and possible unknown donor-specific factors, which affect the performance of

  15. Amentoflavone protects against high fat-induced metabolic dysfunction: Possible role of the regulation of adipogenic differentiation.

    PubMed

    Chen, Guangyong; Han, Yangdong; He, Wang; Liang, Feng

    2016-12-01

    In the present study, we evaluated the protective effects of amentoflavone (AMF) against high-fat (HF) diet-induced metabolic dysfunction and focused on the influence of AMF on adipogenic differentiation during 3T3-L1 adipocyte differentiation. For this purpose, male Wistar rats were fed a HF diet or a HF diet with AMF (10 or 50 mg/kg). We found that AMF protected against HF diet-induced metabolic dysfunction in a dose-dependent manner, as evidenced by a decrease in the fasting blood glucose levels, fasting insulin levels and the homeostatic model assessment-insulin resistance index (HOMA‑IR), as well as by a decrease in the glucose level, as shown by the intraperitoneal glucose tolerance test and intraperitoneal insulin tolerance test. Moreover, the results revealed that AMF significantly inhibited the increase in body weight, the weight of perirenal adipose tissues and the serum triglyceride (TG) content of the rats fed the HF diet in a dose-dependent manner. AMF also inhibited the accumulation of oil droplets in differentiated 3T3-L1 adipocytes in a concentration-dependent manner. The incubation of the cells with AMF for 0-8, 0-2, 2-4, or 4-8 days markedly inhibited adipogenesis. During the early phase of the adipocyte differentiation of 3T3-L1 cells, AMF decreased CCAAT/enhancer-binding protein (C/EBP) β expression in a concentration-dependent manner, leading to the inhibition of mitotic clonal expansion (MCE). Moreover, our results demonstrated that AMF significantly increased reactive oxygen species (ROS) generation in the cells and the antioxidant, N-acetylcysteine (NAC), markedly attenuated the inhibitory effects of AMF on adipogenesis. AMF also inhibited the expression of peroxisome proliferator-activated receptor γ (PPARγ) and C/EBPα and the expression of downstream targets in a concentration-dependent manner. The overexpression of PPARγ and C/EBPα  (by transfection with respective overexpression plasmids) attentuated the

  16. Amentoflavone protects against high fat-induced metabolic dysfunction: Possible role of the regulation of adipogenic differentiation

    PubMed Central

    Chen, Guangyong; Han, Yangdong; He, Wang; Liang, Feng

    2016-01-01

    In the present study, we evaluated the protective effects of amentoflavone (AMF) against high-fat (HF) diet-induced metabolic dysfunction and focused on the influence of AMF on adipogenic differentiation during 3T3-L1 adipocyte differentiation. For this purpose, male Wistar rats were fed a HF diet or a HF diet with AMF (10 or 50 mg/kg). We found that AMF protected against HF diet-induced metabolic dysfunction in a dose-dependent manner, as evidenced by a decrease in the fasting blood glucose levels, fasting insulin levels and the homeostatic model assessment-insulin resistance index (HOMA-IR), as well as by a decrease in the glucose level, as shown by the intraperitoneal glucose tolerance test and intraperitoneal insulin tolerance test. Moreover, the results revealed that AMF significantly inhibited the increase in body weight, the weight of perirenal adipose tissues and the serum triglyceride (TG) content of the rats fed the HF diet in a dose-dependent manner. AMF also inhibited the accumulation of oil droplets in differentiated 3T3-L1 adipocytes in a concentration-dependent manner. The incubation of the cells with AMF for 0–8, 0–2, 2–4, or 4–8 days markedly inhibited adipogenesis. During the early phase of the adipocyte differentiation of 3T3-L1 cells, AMF decreased CCAAT/enhancer-binding protein (C/EBP) β expression in a concentration-dependent manner, leading to the inhibition of mitotic clonal expansion (MCE). Moreover, our results demonstrated that AMF significantly increased reactive oxygen species (ROS) generation in the cells and the antioxidant, N-acetylcysteine (NAC), markedly attenuated the inhibitory effects of AMF on adipogenesis. AMF also inhibited the expression of peroxisome proliferator-activated receptor γ (PPARγ) and C/EBPα and the expression of downstream targets in a concentration-dependent manner. The overexpression of PPARγ and C/EBPα (by transfection with respective overexpression plasmids) attentuated the inhibitory effects

  17. Arsenic trioxide and microRNA-204 display contrary effects on regulating adipogenic and osteogenic differentiation of mesenchymal stem cells in aplastic anemia.

    PubMed

    Zhao, Junmei; Wang, Chao; Song, Yongping; Fang, Baijun

    2014-10-01

    Our previous studies have demonstrated that arsenic trioxide (ATO) had the clinical efficacy in treating patients with aplastic anemia (AA). However, the mechanisms remain to be elucidated. The important components of the bone marrow hematopoietic microenvironment, bone marrow mesenchymal stem cells (BMSCs), are often altered in AA patients. In this study, it was found that AA BMSCs were prone to be induced into adipocytes rather than osteoblasts. ATO treatment can at least partially restore the differentiation imbalance of AA BMSCs. We further identified miR-204 as a key regulator in AA BMSC differentiation. Luciferase reporter assay showed that miR-204 could directly bind to the 3'-untranslated region of Runx2 mRNA, a key transcription factor regulating osteogenesis. Moreover, adipogenic differentiation was promoted and osteogenic differentiation was inhibited in miR-204 over-expressed cells, whereas osteogenesis was enhanced and adipocyte formation was inhibited in cells that lost miR-204 function, which suggested its endogenous function. Together we showed that ATO could inhibit adipogenic differentiation, but promote osteogenic differentiation in AA BMSCs, providing a possible explanation for ATO clinical efficacy in AA patients. MiR-204 plays a key role in regulating BMSCs differentiation, and down-regulating miR-204 expression might be a novel strategy to treat AA.

  18. Low magnitude high frequency vibration promotes adipogenic differentiation of bone marrow stem cells via P38 MAPK signal

    PubMed Central

    Yu, Haiyang; Gan, Xueqi

    2017-01-01

    Low magnitude high frequency vibration (LMHFV) has been mainly reported for its influence on the musculoskeletal system, particularly the bone tissue. In the bone structure, osteogenic activity is the main focus of study with regards to LMHFV. However, adipogenesis, another important mode of differentiation in the bone marrow cavity that might be affected by LMHFV, is much less researched. Furthermore, the molecular mechanism of how LMHFV influences adipogenesis still needs to be understood. Here, we tested the effect of LMHFV (0.3g, 40 Hz, amplitude: 50μm), 15min/d, on multipotent stem cells (MSCs), which are the common progenitors of osteogenic, chondrogenic, adipogenic and myogenic cells. It is previously shown that LMHFV promotes osteogenesis of MSCs. In this study, we further revealed its effect on adipo-differentiation of bone marrow stem cells (BMSCs) and studied the underlying signaling pathway. We found that when treated with LMHFV, the cells showed a higher expression of PPARγ, C/EBPα, adiponectin and showed more oil droplets. After vibration, the protein expression of PPARγ increased, and the phosphorylation of p38 MAPK was enhanced. After treating cells with SB203580, a specific p38 inhibitor, both the protein level of PPARγ illustrated by immunofluorescent staining and the oil droplets number, were decreased. Altogether, this indicates that p38 MAPK is activated during adipogenesis of BMSCs, and this is promoted by LMHFV. Our results demonstrating that specific parameters of LMHFV promotes adipogenesis of MSCs and enhances osteogenesis, highlights an unbeneficial side effect of vibration therapy used for preventing obesity and osteoporosis. PMID:28253368

  19. Cultured human periosteal-derived cells have inducible adipogenic activity and can also differentiate into osteoblasts in a perioxisome proliferator-activated receptor-mediated fashion.

    PubMed

    Hah, Young-Sool; Joo, Hyun-Ho; Kang, Young-Hoon; Park, Bong-Wook; Hwang, Sun-Chul; Kim, Jong-Woo; Sung, Iel-Yong; Rho, Gyu-Jin; Woo, Dong Kyun; Byun, June-Ho

    2014-01-01

    We investigated the adipogenic activity of cultured human periosteal-derived cells and studied perioxisome proliferator-activated receptor (PPAR) ligand-mediated differentiation of cultured human periosteal-derived cells into osteoblasts. Periosteal-derived cells expressed adipogenic markers, including CCAAT/enhancer binding protein α (C/EBP- α), C/EBP-δ, aP2, leptin, LPL, and PPARγ. Lipid vesicles were formed in the cytoplasm of periosteal-derived cells. Thus, periosteal-derived cells have potential adipogenic activity. The PPARα and PPARγ agonists, WY14643 and pioglitazone, respectively, did not modulate alkaline phosphatase (ALP) activity in periosteal-derived cells during induced osteoblastic differentiation, however, the PPARα and PPARγ antagonists, GW6471 and T0070907, respectively, both decreased ALP activity in these cells. WY14643 did not affect, whereas pioglitazone enhanced, alizarin red-positive mineralization and calcium content in the periosteal-derived cells. GW6471 and T0070907 both decreased mineralization and calcium content. By RT-PCR, pioglitazone significantly increased ALP expression in periosteal-derived cells between culture day 3 and 2 weeks. Pioglitazone increased Runx2 expression after 3 days, which declined thereafter, but did not alter osteocalcin expression. Both of GW6471 and T0070907 decreased ALP mRNA expression. These results suggest that pioglitazone enhances osteoblastic differentiation of periosteal-derived cells by increasing Runx2 and ALP mRNA expression, and increasing mineralization. GW6471 and T0070907 inhibit osteoblastic differentiation of the periosteal-derived cells by decreasing ALP expression and mineralization in the periosteal-derived cells. In conclusion, although further study will be needed to clarify the mechanisms of PPAR-regulated osteogenesis, our results suggest that PPARγ agonist stimulates osteoblastic differentiation of cultured human periosteal-derived cells and PPARα and PPARγ antagonists

  20. A one step/one pot synthesis of N,N-bis(phosphonomethyl)amino acids and their effects on adipogenic and osteogenic differentiation of human mesenchymal stem cells.

    PubMed

    Kasser, Johanna; Nazarov, Alexey A; Hartinger, Christian G; Wdziekonski, Brigitte; Dani, Christian; Kuznetsov, Maxim L; Arion, Vladimir B; Keppler, Bernhard K

    2009-05-01

    The one pot reaction of amino acids with diethylphosphite and formaldehyde yielded N,N-bis(phosphonomethyl)amino acids. This synthetic route does not require harsh reagents to cleave the ester group. The molecular structures of the new compounds were determined by X-ray diffraction methods. By employing DFT calculations the hydrolysis of the intermediate phosphonic esters to the respective acids could be explained by the decreasing P-OEt bond strength for C(alpha)-bisalkylated amino acids. Biological evaluation on the adipogenic and osteogenic differentiation of mesenchymal stem cells revealed no modification of the adipocyte differentiation, but inhibition of osteoblast formation at concentrations without detectable cytotoxicity.

  1. Inhibition of Protein Kinase CK2 Prevents Adipogenic Differentiation of Mesenchymal Stem Cells Like C3H/10T1/2 Cells

    PubMed Central

    Schwind, Lisa; Schetting, Sarah; Montenarh, Mathias

    2017-01-01

    Protein kinase CK2 as a holoenzyme is composed of two catalytic α- or α’-subunits and two non-catalytic β-subunits. Knock-out experiments revealed that CK2α and CK2β are required for embryonic development. Little is known about the role of CK2 during differentiation of stem cells. Mesenchymal stem cells (MSCs) are multipotent cells which can be differentiated into adipocytes in vitro. Thus, MSCs and in particular C3H/10T1/2 cells are excellent tools to study a possible role of CK2 in adipogenesis. We found downregulation of the CK2 catalytic subunits as well as a decrease in CK2 kinase activity with progression of differentiation. Inhibition of CK2 using the potent inhibitor CX-4945 impeded differentiation of C3H/10T1/2 cells into adipocytes. The inhibited cells lacked the observed decrease in CK2 expression, but showed a constant expression of all three CK2 subunits. Furthermore, inhibition of CK2 resulted in decreased cell proliferation in the early differentiation phase. Analysis of the main signaling cascade revealed an elevated expression of C/EBPβ and C/EBPδ and reduced expression of the adipogenic master regulators C/EBPα and PPARγ2. Thus, CK2 seems to be implicated in the regulation of different steps early in the adipogenic differentiation of MSC. PMID:28208768

  2. Differential adipogenic and inflammatory properties of small adipocytes in Zucker Obese and Lean rats.

    PubMed

    Liu, Alice; Sonmez, Alper; Yee, Gail; Bazuine, Merlijn; Arroyo, Matilde; Sherman, Arthur; McLaughlin, Tracey; Reaven, Gerald; Cushman, Samuel; Tsao, Philip

    2010-10-01

    We recently reported that a preponderance of small adipose cells, decreased expression of cell differentiation markers, and enhanced inflammatory activity in human subcutaneous whole adipose tissue were associated with insulin resistance. To test the hypothesis that small adipocytes exhibited these differential properties, we characterised small adipocytes from epididymal adipose tissue of Zucker Obese (ZO) and Lean (ZL) rats. Rat epididymal fat pads were removed and adipocytes isolated by collagenase digestion. Small adipocytes were separated by sequential filtration through nylon meshes. Adipocytes were fixed in osmium tetroxide for cell size distribution analysis via Beckman Coulter Multisizer. Quantitative real-time PCR for cell differentiation and inflammatory genes was performed. Small adipocytes represented a markedly greater percentage of the total adipocyte population in ZO than ZL rats (58±4% vs. 12±3%, p<0.001). In ZO rats, small as compared with total adipocytes had 4-fold decreased adiponectin, and 4-fold increased visfatin and IL-6 levels. Comparison of small adipocytes in ZO versus ZL rats revealed 3-fold decreased adiponectin and PPARγ levels, and 2.5-fold increased IL-6. In conclusion, ZO rat adipose tissue harbours a large proportion of small adipocytes that manifest impaired cell differentiation and pro-inflammatory activity, two mechanisms by which small adipocytes may contribute to insulin resistance.

  3. Enhanced adipogenic differentiation of bovine bone marrow-derived mesenchymal stem cells

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Until now, the isolation and characterization of bovine bone marrow-derived mesenchymal stem cells (bBM-MSCs) have not been established, which prompted us to optimize the differentiation protocol for bBM-MSCs. In this study, bBM-MSCs were freshly isolated from three 6-month-old cattle and used for p...

  4. BMP7 promotes adipogenic but not osteo-/chondrogenic differentiation of adult human bone marrow-derived stem cells in high-density micro-mass culture.

    PubMed

    Neumann, Katja; Endres, Michaela; Ringe, Jochen; Flath, Bernd; Manz, Rudi; Häupl, Thomas; Sittinger, Michael; Kaps, Christian

    2007-10-15

    The objective of our study was to elucidate the potential of bone morphogenetic protein-7 (BMP7) to initiate distinct mesenchymal lineage development of human adult mesenchymal stem cells (MSC) in three-dimensional micro-mass culture. Expanded MSC were cultured in high-density micro-masses under serum-free conditions that favor chondrogenic differentiation and were stimulated with 50-200 ng/ml BMP7 or 10 ng/ml transforming growth factor-beta3 (TGFbeta3) as control. Histological staining of proteoglycan with alcian blue, mineralized matrix according to von Kossa, and lipids with Oil Red O, immunostaining of type II collagen as well as real-time gene expression analysis of typical chondrogenic, adipogenic, and osteogenic marker genes showed that BMP7 promoted adipogenic differentiation of MSC. Micro-masses stimulated with BMP7 developed adipocytic cells filled with lipid droplets and showed an enhanced expression of the adipocyte marker genes fatty acid binding protein 4 (FABP4) and the adipose most abundant transcript 1 (apM1). Development along the chondrogenic lineage or stimulation of osteogenic differentiation were not evident upon stimulation with BMP7 in different concentrations. In contrast, TGFbeta3 directed MSC to form a cartilaginous matrix that is rich in proteoglycan and type II collagen. Gene expression analysis of typical chondrocyte marker genes like cartilage oligomeric matrix protein (COMP), link protein, aggrecan, and types IIalpha1 and IXalpha3 collagen confirmed chondrogenic differentiation of MSC treated with TGFbeta3. These results suggest that BMP7 promotes the adipogenic and not the osteogenic or chondrogenic lineage development of human stem cells when assembled three-dimensionally in micro-masses.

  5. A generalized differential effective medium theory

    NASA Astrophysics Data System (ADS)

    Norris, A. N.; Callegari, A. J.; Sheng, P.

    A GENERALIZATION of the Differential Effective Medium approximation (DEM) is discussed. The new scheme is applied to the estimation of the effective permittivity of a two phase dielectric composite. Ordinary DEM corresponds to a realizable microgeometry in which the composite is built up incrementally through a process of homogenization, with one phase always in dilute suspension and the other phase associated with the percolating backbone. The generalization of DEM assumes a third phase which acts as a backbone. The other two phases are progressively added to the backbone such that each addition is in an effectively homogeneous medium. A canonical ordinary differential equation is derived which describes the change in material properties as a function of the volume concentration φ of the added phases in the composite. As φ→ 1, the Effective Medium Approximation (EMA) is obtained. For φ < 1, the result depends upon the backbone and the mixture path that is followed. The approach to EMA for φ ≊ 1 is analysed and a generalization of Archie's law for conductor-insulator composites is described. The conductivity mimics EMA above the percolation threshold and DEM as the conducting phase vanishes.

  6. Interferon-stimulated gene ISG12b1 inhibits adipogenic differentiation and mitochondrial biogenesis in 3T3-L1 cells.

    PubMed

    Li, Bing; Shin, Jonghyun; Lee, Kichoon

    2009-03-01

    Microarray analysis was performed to find a new group of genes or pathways that might be important in adipocyte development and metabolism. Among them, a mouse interferon-stimulated gene 12b1 (ISG12b1) is expressed at a 400-fold higher level in adipocytes compared with stromal-vascular cells. It is predominantly expressed in adipose tissue among other tissues we tested. Developmentally, ISG12b1 mRNA expression was initially inhibited followed by a dramatic induction during both in vivo and in vitro adipogenic differentiation. Adenovirus-mediated overexpression of ISG12b1 inhibited adipogenic differentiation in 3T3-L1 cells as shown by decreased lipid staining with Oil-Red-O and reduction in adipogenic marker proteins including peroxisome proliferator-activated receptor-gamma (PPARgamma), and CCAAT/enhancer-binding protein-alpha (C/EBPalpha). Our bioinformatics analysis for the predicted localization of ISG12b1 protein suggested the mitochondrial localization, which was confirmed by the colocalization of hemagglutinin-tagged ISG12b1 protein with mitochondrial marker MitoTracker. In addition, ISG12b1 protein was exclusively detected in protein extract from the fractionated mitochondria by Western blot analysis. Furthermore, overexpression of ISG12b1 in adipocytes reduced mitochondrial DNA content and gene expression of mitochondrial transcription factor A (mtTFA), nuclear respiratory factor 1 (NRF1), and cytochrome oxidase II, suggesting an inhibitory role of ISG12b1 in mitochondrial biogenesis and function. Activation of mitochondrial biogenesis and function by treatment with PPARgamma and PPARalpha agonists in 3T3-L1 cells and cold exposure in mice induced mitochondrial transcription factors and reduced ISG12 expression. These data demonstrated that mitochondrial-localized ISG12b1 protein inhibits adipocyte differentiation and mitochondrial biogenesis and function, implying the important role of mitochondrial function in adipocyte development and associated

  7. Adipogenic Differentiation of Thyroid Cancer Cells Through the Pax8-PPARγ Fusion Protein Is Regulated by Thyroid Transcription Factor 1 (TTF-1).

    PubMed

    Xu, Bin; O'Donnell, Michael; O'Donnell, Jeffrey; Yu, Jingcheng; Zhang, Yanxiao; Sartor, Maureen A; Koenig, Ronald J

    2016-09-09

    A subset of thyroid carcinomas contains a t(2;3)(q13;p25) chromosomal translocation that fuses paired box gene 8 (PAX8) with the peroxisome proliferator-activated receptor γ gene (PPARG), resulting in expression of a PAX8-PPARγ fusion protein, PPFP. We previously generated a transgenic mouse model of PPFP thyroid carcinoma and showed that feeding the PPARγ agonist pioglitazone greatly decreased the size of the primary tumor and prevented metastatic disease in vivo The antitumor effect correlates with the fact that pioglitazone turns PPFP into a strongly PPARγ-like molecule, resulting in trans-differentiation of the thyroid cancer cells into adipocyte-like cells that lose malignant character as they become more differentiated. To further study this process, we performed cell culture experiments with thyrocytes from the PPFP mouse thyroid cancers. Our data show that pioglitazone induced cellular lipid accumulation and the expression of adipocyte marker genes in the cultured cells, and shRNA knockdown of PPFP eliminated this pioglitazone effect. In addition, we found that PPFP and thyroid transcription factor 1 (TTF-1) physically interact, and that these transcription factors bind near each other on numerous target genes. TTF-1 knockdown and overexpression studies showed that TTF-1 inhibits PPFP target gene expression and impairs adipogenic trans-differentiation. Surprisingly, pioglitazone repressed TTF-1 expression in PPFP-expressing thyrocytes. Our data indicate that TTF-1 interacts with PPFP to inhibit the pro-adipogenic response to pioglitazone, and that the ability of pioglitazone to decrease TTF-1 expression contributes to its pro-adipogenic action.

  8. Lithium chloride attenuates the abnormal osteogenic/adipogenic differentiation of bone marrow-derived mesenchymal stem cells obtained from rats with steroid-related osteonecrosis by activating the β-catenin pathway.

    PubMed

    Yu, Zefeng; Fan, Lihong; Li, Jia; Ge, Zhaogang; Dang, Xiaoqian; Wang, Kunzheng

    2015-11-01

    Steroid-related osteonecrosis of the femoral head (ONFH) may be a disease that results from the abnormal osteogenic/adipogenic differentiation of bone marrow-derived mesenchymal stem cells (BMMSCs). In the present study, we examined the possible use of lithium in an aim to reverse the abnormal osteogenic/adipogenic differentiation of BMMSCs isolated from rats with steroid-related ONFH (termed ONFH-BMMSCs). BMMSCs obtained from steroid‑related ONFH rat femurs were cultured with or without lithium chloride (LiCl). BMMSCs obtained from normal rat femurs were cultured as controls. LiCl significantly increased the expression of osteocalcin and Runx2 in the ONFH-BMMSCs during osteogenic induction. The mineralization of ONFH-BMMSCs following osteogenic induction was also enhanced. Furthermore, LiCl exerted anti-adipogenic effects on the ONFH-BMMSCs by inhibiting the expression of peroxisome proliferator-activated receptor γ (PPARγ) and fatty acid binding protein 4 (Fabp4) during adipogenic induction, and decreasing lipid droplet formation at the end of adipogenic induction. These effects of LiCl on the ONFH-BMMSCs were associated with an increased expression of β-catenin and a decreased expression of phosphorylated GSK-3β at Tyr-216, and these effects were abolished by treatment with quercetin, an antagonist of the β-catenin pathway. The normal osteogenic/adipogenic activity of BMMSCs may be impaired in steroid-related ONFH. However, as demonstrated by our findings, LiCl reduces abnormal adipogenic activity and simultaneously increases the osteogenic differentiation of ONFH-BMMSCs by activating the β-catenin pathway.

  9. 21 CFR 866.2320 - Differential culture medium.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Differential culture medium. 866.2320 Section 866...) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2320 Differential culture medium. (a) Identification. A differential culture medium is a device that consists primarily of...

  10. 21 CFR 866.2320 - Differential culture medium.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Differential culture medium. 866.2320 Section 866...) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2320 Differential culture medium. (a) Identification. A differential culture medium is a device that consists primarily of...

  11. 21 CFR 866.2320 - Differential culture medium.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Differential culture medium. 866.2320 Section 866...) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2320 Differential culture medium. (a) Identification. A differential culture medium is a device that consists primarily of...

  12. 21 CFR 866.2320 - Differential culture medium.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Differential culture medium. 866.2320 Section 866...) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2320 Differential culture medium. (a) Identification. A differential culture medium is a device that consists primarily of...

  13. 21 CFR 866.2320 - Differential culture medium.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Differential culture medium. 866.2320 Section 866...) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2320 Differential culture medium. (a) Identification. A differential culture medium is a device that consists primarily of...

  14. Caveolin-1, Caveolin-2 and Cavin-1 are strong predictors of adipogenic differentiation in human tumors and cell lines of liposarcoma.

    PubMed

    Codenotti, Silvia; Vezzoli, Marika; Poliani, Pietro Luigi; Cominelli, Manuela; Bono, Federica; Kabbout, Hadi; Faggi, Fiorella; Chiarelli, Nicola; Colombi, Marina; Zanella, Isabella; Biasiotto, Giorgio; Montanelli, Alessandro; Caimi, Luigi; Monti, Eugenio; Fanzani, Alessandro

    2016-08-01

    Caveolins (Cav-1, -2 and -3) and Cavins (Cavin-1, -2, -3 and -4) are two protein families controlling the biogenesis and function of caveolae, plasma membrane omega-like invaginations representing the primary site of important cellular processes like endocytosis, cholesterol homeostasis and signal transduction. Caveolae are especially abundant in fat tissue, playing a consistent role in a number of processes, such as the insulin-dependent glucose uptake and transmembrane transport of lipids underlying differentiation, maintenance and adaptive hypertrophy of adipocytes. Based on this premise, in this work we have investigated the expression of caveolar protein components in liposarcoma (LPS), an adipocytic soft tissue sarcoma affecting adults categorized in well-differentiated, dedifferentiated, myxoid and pleomorphic histotypes. By performing an extensive microarray data analysis followed by immunohistochemistry on human LPS tumors, we demonstrated that Cav-1, Cav-2 and Cavin-1 always cluster in all the histotypes, reaching the highest expression in well-differentiated LPS, the least aggressive of the malignant forms composed by tumor cells with a morphology resembling mature adipocytes. In vitro experiments carried out using two human LPS cell lines showed that the expression levels of Cav-1, Cav-2 and Cavin-1 proteins were faintly detectable during cell growth, becoming consistently increased during the accumulation of intracellular lipid droplets characterizing the adipogenic differentiation. Moreover, in differentiated LPS cells the three proteins were also found to co-localize and form molecular aggregates at the plasma membrane, as shown via immunofluorescence and immunoprecipitation analysis. Overall, these data indicate that Cav-1, Cav-2 and Cavin-1 may be considered as reliable markers for identification of LPS tumors characterized by consistent adipogenic differentiation.

  15. [Regulatory effect of As₂O₃on imbalance between adipogenic and osteogenic differentiation of BM-MSC from patients with aplastic anemia].

    PubMed

    Lin, Quan-De; Fang, Bai-Jun; Zhou, Jian; Zhang, Yan-Li; Liu, Yang; Wang, Chao; Zhao, Jun-Mei; Song, Yong-Ping

    2014-12-01

    This study was aimed to explore the regulation of arsenic trioxide (As₂O₃) on imbalance between adipogenic and osteogenic differentiation of BM-MSC from patients with aplastic anemia(AA). The BM-MSC from AA patients were separated and purified, placed into the adipogenic and osteogenic differentiation culture system, then added the As₂O₃, CsA, As₂O₃combined with CsA were added to corresponding differentiation culture system, the concentration of As₂O₃and CsA were set at 0.001 µmol/ml and 2.5 mmol/ml respectively, the cells were divided into As₂O₃group, the CsA group, combined group and control group (no drug). The cell morphological observation, oil red 'O' staining, Von-Kossa staining, and RT-PCR were used to detect corresponding differentiation marks. The results indicated that in respect to adipogenic differentiation, cellular morphology observing and oil red 'O' staining showed that the rate of adipocyte differentiation in As₂O₃group was (18.3 ± 1.9)%, which was lower than the (91.8 ± 2.7)% in the CsA group and (92.1 ± 1.2)% in control group (P < 0.05), there was no significant difference in comparison with (8.3 ± 1.9)% in the combined group (P > 0.05), but the rate of differentiation in CsA group was higher than that in combined group (P < 0.05), and there was no significant difference in comparison wtih control group. RT-PCR showed that the LPL-mRNA expression level in As₂O₃group were significantly lower than that in the CsA group and the control group (P < 0.05), no difference was observed while compared with the combined group (P > 0.05), but the LPL-mRNA expression level in CsA group was significantly higher than that in the combined group (P < 0.05). In terms of osteogenetic differentiation, the calcium deposition in As₂O₃group and combined group was obviously observed while rarely in the CsA group and the control group when detected by the Von-Kossa staining. OST-mRNA expression level in As₂O₃group were higher

  16. Molecular cloning, expression pattern analysis of porcine Rb1 gene and its regulatory roles during primary dedifferentiated fat cells adipogenic differentiation.

    PubMed

    Hu, Xiaoming; Luo, Pei; Peng, Xuewu; Song, Tongxing; Zhou, Yuanfei; Wei, Hongkui; Peng, Jian; Jiang, Siwen

    2015-04-01

    Adipocytes are the main constituent of adipose tissue and are considered to be a corner stone in the homeostatic control of whole body metabolism. Recent reports evidenced that retinoblastoma 1 (Rb1) gene plays an important role in fat development and adipogenesis in mice. Here, we cloned the partial cDNA sequences of the porcine Rb1 gene which contains the complete coding sequences (CDS) of 2820bp encoding a protein of 939 amino acids. Bioinformatic analysis revealed that the CDS of porcine Rb1 was highly identical with those of cattle, human and mice. The porcine Rb1 has three typical conserved structural domains, including Rb-A pocket domain, CYCLIN domain and C-terminus domain, and the phylogenetic tree indicates a closer genetic relationship with cattle and human. Tissue distribution analysis showed that Rb1 expression appeared to be ubiquitously in various tissues, being higher in heart, liver, muscle, and stomach. Furthermore, significant downregulation of Rb1 was found at the initial stage of dedifferentiated fat (DFAT) cells adipogenic differentiation. With the knockdown of the Rb1 expression by siRNA, the number of DFAT cells recruited to white rather than brown adipogenesis was promoted, and mRNA levels of adipogenic markers, such as PPARγ, aP2, LPL and adiponectin and protein expression of PPARγ and adiponectin were increased after hormone stimulation. The underlying mechanisms may be that knockdown of Rb1 promotes the mitotic clonal expansion and PPARγ expression by derepressing the transcriptional activity of E2F so as to facilitate the first steps of adipogenesis. In summary, we cloned and characterized an important negative regulator in adipogenic commitment of porcine DFAT cells.

  17. Development of a chemically defined serum-free medium for differentiation of rat adipose precursor cells

    SciTech Connect

    Deslex, S.; Negrel, R.; Ailhaud, G.

    1987-01-01

    Stromal-vascular cells from the epididymal fat pad of 4-week-old rats, when cultured in a medium containing insulin or insulin-like growth factor, IFG-I, triiodothyronine and transferrin, were able to undergo adipose conversion. Over ninety percent of the cells accumulated lipid droplets and this proportion was reduced in serum-supplemented medium. The adipose conversion was assessed by the development of lipoprotein lipase (LPL) and glycerol-3-phosphate dehydrogenase (GPDH) activities, (/sup 14/)glucose incorporation into polar and neutral lipids, triacylglycerol accumulation and lipolysis in response to isoproterenol. Similar results were obtained with stromal-vascular cells from rat subcutaneous and retroperitoneal adipose tissues. Stromal-vascular cells required no adipogenic factors in addition to the components of the serum-free medium. Insulin was required within a physiological range of concentrations for the emergence of LPL and at higher concentrations for that of GPDH. When present at concentrations ranging from 2 to 50 nM, IGF-I was able to replace insulin for the expression of both LPL and and GPDH. The development of a serum free, chemically defined medium for the differentiation of diploid adiopose precursor cells opens up the possibility of characterizing inhibitors or activators of the adipose conversion process.

  18. Isolation of adipose and bone marrow mesenchymal stem cells using CD29 and CD90 modifies their capacity for osteogenic and adipogenic differentiation.

    PubMed

    Davies, Owen G; Cooper, Paul R; Shelton, Richard M; Smith, Anthony J; Scheven, Ben A

    2015-01-01

    Mesenchymal stem cells isolated from rats are frequently used for tissue engineering research. However, considerable differences have been identified between rat mesenchymal stem cells and those derived from humans, and no defined panel of markers currently exists for the isolation of these cells. The aim of this study was to examine the effects of cell sorting for CD29(+)/CD90(+) cells from rat adipose and bone marrow tissues on their differentiation and expression of stem cell-associated genes. Flow cytometry showed 66% and 78% CD29(+)/CD90(+) positivity within passage 1 of adipose and bone marrow cultures, respectively. CD29(+)/CD90(+) cells showed a reduction in both osteogenic and adipogenic differentiation when compared with unsorted cells, as determined by alizarin red and Oil Red-O staining, respectively. These findings could not entirely be explained by fluorescence-activated cell sorting-induced cell injury as sort recovery was only modestly affected in adipose-derived cells. Maintaining cells in fluorescence-activated cell sorting buffer did not affect adipose-derived cell viability, but a significant (p < 0.05) reduction was found in bone marrow-derived cell viability. Additionally, CD29(+)/CD90(+) selection was associated with a significant decrease in the expression of Lin28, Sox2, Nanog and CD73 in adipose-derived cell cultures, whereas differences in stem cell-associated gene expression were not observed in sorted bone marrow-derived cell cultures. In summary, this study demonstrated that fluorescence-activated cell sorting had differential effects on adipose-derived cells and bone marrow-derived cells, and both CD29(+)/CD90(+) cells displayed a significantly reduced capacity for osteogenic/adipogenic differentiation. In conclusion, we identify that maintaining heterogeneity within the mesenchymal stem cell population may be important for optimal differentiation.

  19. TRAIL (TNF-related apoptosis-inducing ligand) inhibits human adipocyte differentiation via caspase-mediated downregulation of adipogenic transcription factors

    PubMed Central

    Zoller, Verena; Funcke, Jan-Bernd; Keuper, Michaela; Abd El Hay, Muad; Debatin, Klaus-Michael; Wabitsch, Martin; Fischer-Posovszky, Pamela

    2016-01-01

    Tumor necrosis factor-α (TNFα) and other ligands of the TNF superfamily are potent regulators of adipose tissue metabolism and play a crucial role in the obesity-induced inflammation of adipose tissue. Adipose tissue expression levels of TRAIL (TNF-related apoptosis-inducing ligand) and its receptor were shown to be upregulated by overfeeding and decreased by fasting in mice. In the present study we aimed to elucidate the impact of TRAIL on adipogenesis. To this end, human Simpson-Golabi-Behmel syndrome (SGBS) preadipocytes as well as stromal-vascular cells isolated from human white adipose tissue were used as model systems. Human recombinant TRAIL inhibited adipogenic differentiation in a dose-dependent manner. It activated the cleavage of caspase-8 and -3, which in turn resulted in a downregulation of the key adipogenic transcription factors C/EBPα, C/EBPδ, and PPARγ. The effect was completely blocked by pharmacological or genetic inhibition of caspases. Taken together we discovered a so far unrecognized function of TRAIL in the regulation of adipogenesis. Targeting the TRAIL/TRAIL receptor system might provide a novel strategy to interfere with adipose tissue homeostasis. PMID:27735943

  20. Selenium promotes adipogenic determination and differentiation of chicken embryonic fibroblasts with regulation of genes involved in fatty acid uptake, triacylglycerol synthesis and lipolysis.

    PubMed

    Hassan, Aishlin; Ahn, Jinsoo; Suh, Yeunsu; Choi, Young Min; Chen, Paula; Lee, Kichoon

    2014-08-01

    Selenium (Se) has been utilized in the differentiation of primary pig and rat preadipocytes, indicating that it may have proadipogenic potential; however, some studies have also demonstrated that Se has antiadipogenic activity. In this study, chicken embryonic fibroblasts (CEFs) were used to investigate the role of Se in adipogenesis in vitro and in ovo. Se supplementation increased lipid droplet accumulation and inhibited proliferation of cultured CEFs isolated from 6-day-old embryos dose-dependently. This suggests that Se may play a role in cell cycle inhibition, thereby promoting the differentiation of fibroblasts to adipocytes. Se did not stimulate adipogenic differentiation of CEFs isolated from 9- to 12-day-old embryos, implying a permissive stage of adipogenic determination by Se at earlier embryonic ages. Microarray analysis comparing control and Se treatments on CEFs from 6-day-old embryos and confirmatory analysis by quantitative real-time polymerase chain reaction revealed that genes involved in adipocyte determination and differentiation, fatty acid uptake and triacylglycerol synthesis were up-regulated. In addition, up-regulation of an anti-lipolytic G0/G1 switch gene 2 and down-regulation of a prolipolytic monoglyceride lipase may lead to inhibition of lipolysis by Se. Both osteogenic and myogenic genes were down-regulated, and several genes related to oxidative stress response during adipogenesis were up-regulated. In ovo injection of Se at embryonic day 8 increased adipose tissue mass by 30% and caused adipocyte hypertrophy in 17-day-old chicken embryos, further supporting the proadipogenic role of Se during the embryonic development of chickens. These results suggest that Se plays a significant role in several mechanisms related to adipogenesis.

  1. Curcumin represses mouse 3T3-L1 cell adipogenic differentiation via inhibiting miR-17-5p and stimulating the Wnt signalling pathway effector Tcf7l2.

    PubMed

    Tian, Lili; Song, Zhuolun; Shao, Weijuan; Du, William W; Zhao, Lisa R; Zeng, Kejing; Yang, Burton B; Jin, Tianru

    2017-01-19

    Understanding mechanisms underlying adipogenic differentiation may lead to the discovery of novel therapeutic targets for obesity. Wnt signalling pathway activation leads to repressed adipogenic differentiation while certain microRNAs may regulate pre-adipocyte proliferation and differentiation. We show here that in mouse white adipose tissue, miR-17-5p level is elevated after high fat diet consumption. miR-17-5p upregulates adipogenic differentiation, as its over-expression increased while its inhibition repressed 3T3-L1 differentiation. The Tcf7l2 gene encodes a key Wnt signalling pathway effector, and its human homologue TCF7L2 is a highly regarded diabetes risk gene. We found that Tcf7l2 is an miR-17-5p target and confirmed the repressive effect of Tcf7l2 on 3T3-L1 adipogenic differentiation. The natural plant polyphenol compound curcumin possesses the body weight lowering effect. We observed that curcumin attenuated miR-17-5p expression and stimulated Tcf7l2 expression in 3T3-L1 cells. These, along with the elevation of miR-17-5p expression in mouse epididymal fat tissue in response to high fat diet consumption, allowed us to suggest that miR-17-5p is among central switches of adipogenic differentiation. It activates adipogenesis via repressing the Wnt signalling pathway effector Tcf7l2, and its own expression is likely nutritionally regulated in health and disease.

  2. Effect of decellularized adipose tissue particle size and cell density on adipose-derived stem cell proliferation and adipogenic differentiation in composite methacrylated chondroitin sulphate hydrogels.

    PubMed

    Brown, Cody F C; Yan, Jing; Han, Tim Tian Y; Marecak, Dale M; Amsden, Brian G; Flynn, Lauren E

    2015-07-30

    An injectable composite scaffold incorporating decellularized adipose tissue (DAT) as a bioactive matrix within a hydrogel phase capable of in situ polymerization would be advantageous for adipose-derived stem cell (ASC) delivery in the filling of small or irregular soft tissue defects. Building on previous work, the current study investigates DAT milling methods and the effects of DAT particle size and cell seeding density on the response of human ASCs encapsulated in photo-cross-linkable methacrylated chondroitin sulphate (MCS)-DAT composite hydrogels. DAT particles were generated by milling lyophilized DAT and the particle size was controlled through the processing conditions with the goal of developing composite scaffolds with a tissue-specific 3D microenvironment tuned to enhance adipogenesis. ASC proliferation and adipogenic differentiation were assessed in vitro in scaffolds incorporating small (average diameter of 38   ±   6 μm) or large (average diameter of 278   ±   3 μm) DAT particles in comparison to MCS controls over a period of up to 21 d. Adipogenic differentiation was enhanced in the composites incorporating the smaller DAT particles and seeded at the higher density of 5   ×   10(5) ASCs/scaffold, as measured by glycerol-3-phosphate dehydrogenase (GPDH) enzyme activity, semi-quantitative analysis of perilipin expression and oil red O staining of intracellular lipid accumulation. Overall, this study demonstrates that decellularized tissue particle size can impact stem cell differentiation through cell-cell and cell-matrix interactions, providing relevant insight towards the rational design of composite biomaterial scaffolds for adipose tissue engineering.

  3. Age-related alterations in mesenchymal stem cells related to shift in differentiation from osteogenic to adipogenic potential: implication to age-associated bone diseases and defects.

    PubMed

    Kim, MiJung; Kim, ChanWha; Choi, Yu Suk; Kim, MinHwan; Park, ChanJeoung; Suh, Yousin

    2012-05-01

    Mesenchymal stem cells (MSC) have attracted considerable attention in the fields of cell and gene therapy due to their intrinsic ability to differentiate into multiple lineages. The various therapeutic applications involving MSC require initial expansion and/or differentiation in vitro prior to clinical use. However, serial passages of MSC in culture lead to decreased differentiation potential and stem cell characteristics, eventually inducing cellular aging which will limit the success of cell-based therapeutic interventions. Here we review the age-related changes that occur in MSC with a special focus on the shift of differentiation potential from osteogenic to adipogenic lineage during the MSC aging processes and how aging causes this preferential shift by oxidative stress and/or energy metabolism defect. Oxidative stress-related signals and some microRNAs affect the differentiation potential shift of MSC by directly targeting key regulatory factors such as Runx-2 or PPAR-γ, and energy metabolism pathway is involved as well. All information described here including transcription factors, microRNAs and FoxOs could be used towards development of treatment regimens for age-related bone diseases and related defects based on mutually exclusive lineage fate determination of MSC.

  4. Efficient delivery of C/EBP beta gene into human mesenchymal stem cells via polyethylenimine-coated gold nanoparticles enhances adipogenic differentiation.

    PubMed

    Joydeep, Das; Choi, Yun-Jung; Yasuda, Hideyo; Han, Jae Woong; Park, Chankyu; Song, Hyuk; Bae, Hojae; Kim, Jin-Hoi

    2016-09-28

    The controlled differentiation of stem cells via the delivery of specific genes encoding appropriate differentiation factors may provide useful models for regenerative medicine and aid in developing therapies for human patients. However, the majority of non-viral vectors are not efficient enough to manipulate difficult-to-transfect adult human stem cells in vitro. Herein, we report the first use of 25 kDa branched polyethylenimine-entrapped gold nanoparticles (AuPEINPs) and covalently bound polyethylenimine-gold nanoparticles (AuMUAPEINPs) as carriers for efficient gene delivery into human mesenchymal stem cells (hMSCs). We determined a functional application of these nanoparticles by transfecting hMSCs with the C/EBP beta gene, fused to EGFP, to induce adipogenic differentiation. Transfection efficacy with AuPEINPs and AuMUAPEINPs was 52.3% and 40.7%, respectively, which was 2.48 and 1.93 times higher than that by using Lipofectamine 2000. Luciferase assay results also demonstrated improved gene transfection efficiency of AuPEINPs/AuMUAPEINPs over Lipofectamine 2000 and polyethylenimine. Overexpression of exogenous C/EBP beta significantly enhanced adipogenesis in hMSCs as indicated by both of Oil Red O staining and mRNA expression analyses. Nanoparticle/DNA complexes exhibited favorable cytocompatibility in hMSCs. Taken together, AuPEINPs and AuMUAPEINPs potentially represent safe and highly efficient vehicles for gene delivery to control hMSC differentiation and for therapeutic gene delivery applications.

  5. Efficient delivery of C/EBP beta gene into human mesenchymal stem cells via polyethylenimine-coated gold nanoparticles enhances adipogenic differentiation

    PubMed Central

    Joydeep, Das; Choi, Yun-Jung; Yasuda, Hideyo; Han, Jae Woong; Park, Chankyu; Song, Hyuk; Bae, Hojae; Kim, Jin-Hoi

    2016-01-01

    The controlled differentiation of stem cells via the delivery of specific genes encoding appropriate differentiation factors may provide useful models for regenerative medicine and aid in developing therapies for human patients. However, the majority of non-viral vectors are not efficient enough to manipulate difficult-to-transfect adult human stem cells in vitro. Herein, we report the first use of 25 kDa branched polyethylenimine-entrapped gold nanoparticles (AuPEINPs) and covalently bound polyethylenimine-gold nanoparticles (AuMUAPEINPs) as carriers for efficient gene delivery into human mesenchymal stem cells (hMSCs). We determined a functional application of these nanoparticles by transfecting hMSCs with the C/EBP beta gene, fused to EGFP, to induce adipogenic differentiation. Transfection efficacy with AuPEINPs and AuMUAPEINPs was 52.3% and 40.7%, respectively, which was 2.48 and 1.93 times higher than that by using Lipofectamine 2000. Luciferase assay results also demonstrated improved gene transfection efficiency of AuPEINPs/AuMUAPEINPs over Lipofectamine 2000 and polyethylenimine. Overexpression of exogenous C/EBP beta significantly enhanced adipogenesis in hMSCs as indicated by both of Oil Red O staining and mRNA expression analyses. Nanoparticle/DNA complexes exhibited favorable cytocompatibility in hMSCs. Taken together, AuPEINPs and AuMUAPEINPs potentially represent safe and highly efficient vehicles for gene delivery to control hMSC differentiation and for therapeutic gene delivery applications. PMID:27677463

  6. The effect of combined regulation of the expression of peroxisome proliferator-activated receptor-γ and calcitonin gene-related peptide on alcohol-induced adipogenic differentiation of bone marrow mesenchymal stem cells.

    PubMed

    Li, Jinfeng; Wang, Yisheng; Li, Yuebai; Sun, Junkui; Zhao, Guoqiang

    2014-07-01

    Studies have shown that alcohol can upregulate the expression of peroxisome proliferator-activated receptor-γ (PPARγ) gene in bone marrow mesenchymal stem cells (BMSCs). High expression of PPARγ can promote adipogenic differentiation of BMSCs, and reduce their osteogenic differentiation. Abnormal proliferation of adipocytes and fatty accumulation in osteocytes can result in high intraosseous pressure and disturbance of blood circulation in the femoral head, which induces osteonecrosis of the femoral head (ONFH). Downregulation of PPARγ is efficient in inhibiting adipogenesis and maintaining osteogenesis of BMSCs, which might potentially reduce the incidence of ONFH. Calcitonin gene-related peptide (CGRP) is a neuropeptide gene which has been closely associated with bone regeneration. In this study, we aimed to observe the effect of combined regulation of the expression of PPARγ and CGRP genes on alcohol-induced adipogenic differentiation of BMSCs. Our results demonstrated that simultaneous downregulation of PPARγ and upregulation of CGRP was efficient in suppressing adipogenic differentiation of BMSCs and promoting their osteogenic differentiation. These findings might enlighten a novel approach for the prevention of ONFH.

  7. A selective and differential medium for Vibrio harveyi.

    PubMed Central

    Harris, L; Owens, L; Smith, S

    1996-01-01

    A new medium, termed Vibrio harveyi agar, has been developed for the isolation and enumeration of V. harveyi. It is possible to differentiate V. harveyi colonies from the colonies of strains representing 15 other Vibrio species with this medium. This medium has been shown to inhibit the growth of two strains of marine Pseudomonas spp. and two strains of marine Flavobacterium spp. but to allow the growth of Photobacterium strains. Colonies displaying typical V. harveyi morphology were isolated from the larval rearing water of a commercial prawn hatchery with V. harveyi agar as a primary isolation medium and were positively identified, by conventional tests, as V. harveyi. This agar displays great potential as a primary isolation medium and offers significant advantages over thiosulfate-citrate-bile salts-sucrose agar as a medium for differentiating V. harveyi from other marine and estuarine Vibrio species. PMID:8795252

  8. Regulation of the osteogenic and adipogenic differentiation of bone marrow-derived stromal cells by extracellular uridine triphosphate: The role of P2Y2 receptor and ERK1/2 signaling

    PubMed Central

    LI, WENKAI; WEI, SHENG; LIU, CHAOXU; SONG, MINGYU; WU, HUA; YANG, YONG

    2016-01-01

    An imbalance in the osteogenesis and adipogenesis of bone marrow-derived stromal cells (BMSCs) is a crucial pathological factor in the development of osteoporosis. Growing evidence suggests that extracellular nucleotide signaling involving the P2 receptors plays a significant role in bone metabolism. The aim of the present study was to investigate the effects of uridine triphosphate (UTP) on the osteogenic and adipogenic differentiation of BMSCs, and to elucidate the underlying mechanisms. The differentiation of the BMSCs was determined by measuring the mRNA and protein expression levels of osteogenic- and adipogenic-related markers, alkaline phosphatase (ALP) staining, alizarin red staining and Oil Red O staining. The effects of UTP on BMSC differentiation were assayed using selective P2Y receptor antagonists, small interfering RNA (siRNA) and an intracellular signaling inhibitor. The incubation of the BMSCs with UTP resulted in a dose-dependent decrease in osteogenesis and an increase in adipogenesis, without affecting cell proliferation. Significantly, siRNA targeting the P2Y2 receptor prevented the effects of UTP, whereas the P2Y6 receptor antagonist (MRS2578) and siRNA targeting the P2Y4 receptor had little effect. The activation of P2Y receptors by UTP transduced to the extracellular signal-regulated kinase 1/2 (ERK1/2) signaling pathway. This transduction was prevented by the mitogen-activated protein kinase inhibitor (U0126) and siRNA targeting the P2Y2 receptor. U0126 prevented the effects of UTP on osteogenic- and adipogenic-related gene expression after 24 h of culture, as opposed to 3 to 7 days of culture. Thus, our data suggest that UTP suppresses the osteogenic and enhances the adipogenic differentiation of BMSCs by activating the P2Y2 receptor. The ERK1/2 signaling pathway mediates the early stages of this process. PMID:26531757

  9. Role of C/EBPβ-LAP and C/EBPβ-LIP in early adipogenic differentiation of human white adipose-derived progenitors and at later stages in immature adipocytes.

    PubMed

    Lechner, Stefan; Mitterberger, Maria C; Mattesich, Monika; Zwerschke, Werner

    2013-01-01

    We investigated the role of the major isoforms of CCAAT enhancer binding protein β (C/EBPβ), C/EBPβ-LAP and C/EBPβ-LIP, in adipogenesis of human white adipose-derived stromal/progenitor cells (ASC). C/EBPβ gene expression was transiently induced early in adipogenesis. At later stages, in immature adipocytes, the C/EBPβ mRNA and protein levels declined. The C/EBPβ-LIP protein steady-state level decreased considerably stronger than the C/EBPβ-LAP level and the C/EBPβ-LIP half-life was significantly shorter than the C/EBPβ-LAP half-life. The turn-over of both C/EBPβ-isoforms was regulated by ubiquitin/proteasome-dependent degradation. These data suggest that the protein stability of the C/EBPβ-isoforms is differentially regulated in the course of adipogenesis and in immature adipocytes. Constitutive overexpression of C/EBPβ-LIP had antiadipogenic activity in human ASC. C/EBPβ-LAP, which promotes adipogenesis in mouse 3T3-L1 preadipocytes by directly activating expression of the adipogenic keyregulator PPARγ2, induced the expression of PPARγ2 and of the adipocyte differentiation gene product FABP4 in confluent ASC in the absence of adipogenic hormones. At later stages after hormone cocktail-induced adipogenesis, in immature adipocytes, constitutive overexpression of C/EBPβ-LAP led to reduced expression of PPARγ2 and FABP4, C/EBPα expression was downregulated and the expression of the adipocyte differentiation gene products adiponectin and leptin was impaired. These findings suggest that constitutive overexpression of C/EBPβ-LAP induces adipogenesis in human ASC and negatively regulates the expression of adipogenic regulators and certain adipocyte differentiation gene products in immature adipocytes. We conclude the regulation of both C/EBPβ gene expression and C/EBPβ-LIP and C/EBPβ-LAP protein turn-over plays an important role for the expression of adipogenic regulators and/or adipocyte differentiation genes in early adipogenic differentiation of

  10. Exchange protein activated by cyclic AMP is involved in the regulation of adipogenic genes during 3T3-L1 fibroblasts differentiation.

    PubMed

    Gabrielli, Matías; Martini, Claudia N; Brandani, Javier N; Iustman, Laura J R; Romero, Damián G; del C Vila, María

    2014-02-01

    Adipogenesis is stimulated in 3T3-L1 fibroblasts by a combination of insulin, dexamethasone and isobutylmethylxanthine, IBMX, (I+D+M). Two transcription factors are important for the acquisition of the adipocyte phenotype, C/EBP beta (CCAT enhancer-binding protein beta) and PPAR gamma (peroxisome proliferator-activated receptor gamma). IBMX increases cAMP content, which can activate protein kinase A (PKA) and/or EPAC (exchange protein activated by cAMP). To investigate the importance of IBMX in the differentiation mixture, we first evaluated the effect of the addition of IBMX on the increase of C/EBP beta and PPAR gamma and found an enhancement of the amount of both proteins. IBMX addition (I+D+M) or its replacement with a cAMP analogue, dibutyryl-cAMP or 8-(4-chlorophenylthio)-2-O'-methyl-cAMP (8CPT-2-Me-cAMP), the latter activates EPAC and not PKA, remarkably increased PPAR gamma mRNA. However, neither I+D nor any of the inducers alone, increased PPAR gamma mRNA to a similar extent, suggesting the importance of the presence of both IBMX and I+D. It was also found that the addition of IBMX or 8CPT-2-Me-cAMP was able to increase the content of C/EBP beta with respect to I+D. In agreement with these findings, a microarray analysis showed that the presence of either 8CPT-2-Me-cAMP or IBMX in the differentiation mixture was able to upregulate PPAR gamma and PPAR gamma-activated genes as well as other genes involved in lipid metabolism. Our results prove the involvement of IBMX-cAMP-EPAC in the regulation of adipogenic genes during differentiation of 3T3-L1 fibroblasts and therfore contributes to elucidate the role of cyclic AMP in this process.

  11. Differentiation of purified astrocytes in a chemically defined medium

    SciTech Connect

    Morrison, R.S.; de Vellis, J.

    1981-01-01

    Homogeneous cultures of astrocytes and oligodendrocytes provide an excellent model system for studying the regulation of glial structure and function. Recently, a chemically defined (CD) medium was developed for purified cultures of astrocytes, thus eliminating the requirement for serum and providing a controlled system for the study of astroglial properties. Due to the widespread use of astrocyte cultures and the potential benefits to be gained from using a defined medium, astrocyte cultures raised in CD medium were analyzed for purity as well as morphological and biochemical properties. Purity was assessed using immunocytochemical staining for glial fibrillary acidic protein (GFAP) and fibronectin. Astrocytes raised in CD medium are 95% pure using the expression of GFAP as a criterion. Fewer than 1% of the cells in CD medium stained positive for fibronectin eliminating the possibility that CD medium is selective for meningeal or endothelial cells. Astrocytes raised in CD medium exhibit a striking degree of morphological differentiation as seen in scanning electron micrographs. They also exhibit a high degree of biochemical differentiation illustrated by increases in the specific activity of S-100 protein and the induction of glutamine synthetase by glucocorticoids. A defined medium that supports the proliferation of rat astrocytes and enhances numerous morphological and biochemical properties should greatly facilitate the study of factors controlling glial proliferation and differentiation.

  12. miR-223 Regulates Adipogenic and Osteogenic Differentiation of Mesenchymal Stem Cells Through a C/EBPs/miR-223/FGFR2 Regulatory Feedback Loop.

    PubMed

    Guan, Xiaohui; Gao, Yifei; Zhou, Jie; Wang, Jun; Zheng, Fang; Guo, Fei; Chang, Ailing; Li, Xiaoxia; Wang, Baoli

    2015-05-01

    Several miRNAs have recently been identified to regulate adipocyte or osteoblast differentiation or both. In this study, miR-223 was found to be involved in the reciprocal regulation of adipocyte and osteoblast differentiation. miR-223 was induced in primary cultured mouse marrow stromal cell, mesenchymal line C3H10T1/2 and stromal line ST2 after adipogenic treatment. Conversely, it was reduced in preosteoblast MC3T3-E1 after osteogenic treatment. Supplementing miR-223 levels using synthetic miR-223 mimics significantly suppressed the growth of the C3H10T1/2 and ST2 cells and induced the progenitor cells to fully differentiate into adipocytes, along with induction of adipocyte-specific transcription factors peroxisome proliferator-activated receptor γ, CCAAT/enhancer binding protein-α (C/EBPα), and marker genes aP2 and adipsin. By contrast, depletion of the endogenous miR-223 using synthetic miR-223 inhibitor repressed the progenitor cells to differentiate. The effects of miR-223 on adipocyte formation from ST2 cells were also demonstrated by using lentivirus that overexpresses miR-223. Conversely, supplementing miR-223 blocked ST2 to differentiate into osteoblasts. Fibroblast growth factor receptor 2 (Fgfr2), a critical regulator of osteoblast, was shown to be a direct target of miR-223 by using dual luciferase reporter assay. Knockdown of Fgfr2 in C3H10T1/2 downregulated phosphorylation of ERK1/2 and upregulated expression of C/EBPα and dramatically enhanced the differentiation of the cells into adipocytes. Further investigation of mechanisms that control miR-223 expression demonstrated that C/EBPs induced miR-223 expression through binding to the promoter regions of the miR-223. Taken together, our study provides evidences that miR-223 regulates adipocyte and osteoblast differentiation through a novel C/EBPs/miR-223/FGFR2 regulatory feedback loop.

  13. Inhibition of Viability, Proliferation, Cytokines Secretion, Surface Antigen Expression, and Adipogenic and Osteogenic Differentiation of Adipose-Derived Stem Cells by Seven-Day Exposure to 0.5 T Static Magnetic Fields.

    PubMed

    Wang, Jian; Xiang, Bo; Deng, Jixian; Freed, Darren H; Arora, Rakesh C; Tian, Ganghong

    2016-01-01

    After seven-day exposure to 0.5-Tesla Static Magnetic Field (SMF), Adipose-derived Stem Cells (ASCs) and those labeled by superparamagnetic iron oxide (SPIO) nanoparticles were examined for viability by methyl thiazol tetrazolium (MTT) assay, proliferation by cell counting and bromodeoxyuridine (BrdU) incorporation, DNA integrity by single cell gel electrophoresis, surface antigen by flow cytometry analysis, and the expression of cytokines and genetic markers by reverse transcription-PCR and underwent adipogenic and osteogenic differentiation assessed by quantifying related specific genes expression. The SMF slightly reduced cell viability and proliferation and inhibited the expression of CD49d, CD54, and CD73 but did not damage DNA integrity. The SMF slightly downregulated the expression of cytokines including Vascular Endothelial Growth Factor (VEGF), Insulin-like Growth Factor-1 (IGF-1), Transforming Growth Factor Beta 1 (TGF-β1), genetic markers comprising Stem Cell Antigen-1 (Sca1), Octamer-4 (Oct-4), ATP-binding Cassette Subfamily B Member 1 (ABCB1), adipogenic marker genes containing Lipoprotein Lipase (LPL), Peroxisome Proliferator-Activated Receptor Gamma (PPAR-γ), and osteogenic marker genes including Secreted Phosphor-protein 1 (SPP1) and Osterix (OSX). Exposure to 0.5 T SMF for seven days inhibited viability, proliferation, surface antigen expression, cytokine secretion, stem cell genetic marker expression, and adipogenic and osteogenic differentiation but did not affect the DNA integrity in ASCs with or without SPIO labeling.

  14. Inhibition of Viability, Proliferation, Cytokines Secretion, Surface Antigen Expression, and Adipogenic and Osteogenic Differentiation of Adipose-Derived Stem Cells by Seven-Day Exposure to 0.5 T Static Magnetic Fields

    PubMed Central

    Wang, Jian; Xiang, Bo; Deng, Jixian; Freed, Darren H.; Arora, Rakesh C.; Tian, Ganghong

    2016-01-01

    After seven-day exposure to 0.5-Tesla Static Magnetic Field (SMF), Adipose-derived Stem Cells (ASCs) and those labeled by superparamagnetic iron oxide (SPIO) nanoparticles were examined for viability by methyl thiazol tetrazolium (MTT) assay, proliferation by cell counting and bromodeoxyuridine (BrdU) incorporation, DNA integrity by single cell gel electrophoresis, surface antigen by flow cytometry analysis, and the expression of cytokines and genetic markers by reverse transcription-PCR and underwent adipogenic and osteogenic differentiation assessed by quantifying related specific genes expression. The SMF slightly reduced cell viability and proliferation and inhibited the expression of CD49d, CD54, and CD73 but did not damage DNA integrity. The SMF slightly downregulated the expression of cytokines including Vascular Endothelial Growth Factor (VEGF), Insulin-like Growth Factor-1 (IGF-1), Transforming Growth Factor Beta 1 (TGF-β1), genetic markers comprising Stem Cell Antigen-1 (Sca1), Octamer-4 (Oct-4), ATP-binding Cassette Subfamily B Member 1 (ABCB1), adipogenic marker genes containing Lipoprotein Lipase (LPL), Peroxisome Proliferator-Activated Receptor Gamma (PPAR-γ), and osteogenic marker genes including Secreted Phosphor-protein 1 (SPP1) and Osterix (OSX). Exposure to 0.5 T SMF for seven days inhibited viability, proliferation, surface antigen expression, cytokine secretion, stem cell genetic marker expression, and adipogenic and osteogenic differentiation but did not affect the DNA integrity in ASCs with or without SPIO labeling. PMID:26880984

  15. [Molecular Mechanisms of Early-stage Adipocyte Differentiation and Multi-functional Roles of Newly Isolated Adipogenic Factors].

    PubMed

    Imagawa, Masayoshi

    2016-01-01

    Obesity is a major risk factor for diabetes, hypertension, hyperlipidemia, and arteriosclerosis. Although the middle and late stages of adipocyte differentiation are well characterized, the earliest step in the differentiation process has remained largely unknown. We isolated 102 genes expressed at the beginning of the differentiation of a mouse preadipocyte cell line, 3T3-L1 cells. Because approximately half of these genes were unknown, we named them factor for adipocyte differentiation (fad) genes. I first show how these genes regulate the early stage of adipocyte differentiation. We next generated fad104-deficient mice, and demonstrated that fad104-deficient mice died due to cyanosis-associated lung dysplasia with atelectasis. We also found that fad104 positively regulated adipocyte differentiation and negatively regulated osteoblast differentiation. We then demonstrated that fad24-knockdown inhibited mitotic clonal expansion (MCE) and that FAD24 contributed to the regulation of DNA replication by recruiting histone acetyltransferase binding to ORC1 (HBO1) to DNA replication origins. In vitro culture experiments revealed that fad24-null embryos developed normally to the morula stage, but acquired growth defects in subsequent stages. These results strongly suggest that fad24 is essential for pre-implantation in embryonic development, particularly for progression to the blastocyst stage. These findings together indicate that both fad104 and fad24 contribute not only to adipogenesis but also to other physiological events. The multi-functional roles of these genes are discussed.

  16. DNA aneuploidy in porcine bone marrow-derived mesenchymal stem cells undergoing osteogenic and adipogenic in vitro differentiation.

    PubMed

    Opiela, Jolanta; Samiec, Marcin; Bochenek, Michał; Lipiński, Daniel; Romanek, Joanna; Wilczek, Piotr

    2013-10-01

    In this study, we estimated the distribution of DNA diploidy and aneuploidy in porcine mesenchymal stem cells (pMSCs) that were subjected to osteoblast/osteocyte and adipocyte differentiation to determine the impact of long-term in vitro culture and differentiation on the cell cycle distribution and nuclear DNA profile. This determination could be helpful to confirm or exclude the suitability of physico-chemical culture conditions for the purposes of both the maintenance of an undifferentiated state and to promote differentiation in pMSCs. Flow cytometry was applied to analyze the cell cycle and occurrence of aneuploidy/diploidy, and real-time PCR was used to quantify aP2 and osteocalcin, markers of adipocytes and osteocytes, respectively. The chi-squared test was used to compare the total rates of G0/G1-, S-, and G2/M-phase cell fractions with diploid and aneuploid DNA and the DNA index ratios between three experimental groups of pMSCs. Five weeks of in vitro culture under differentiating conditions resulted in a considerable reduction of DNA stability and a remarkable increase in the rate of cells exhibiting an aneuploid DNA stem line; however, a similar dependence was not found in the nondifferentiated MSCs. Furthermore, the cell fraction rates in each phase of the mitotic cycle and the DNA index (DI) were calculated. The results of real-time PCR for aP2 and osteocalcin proved positive MSC differentiation toward adipocytes and osteocytes. In terms of the possible use of differentiated MSC lines in tissue engineering and regenerative medicine, we propose cytokinetic diagnostics using flow cytometry as an objective and useful method for screening the tumor-forming capacity and malignancy potential of both in vitro long-term cultured MSCs and MSCs subjected to ectopic differentiation.

  17. Cytotoxicity and inhibitory effects of low-concentration triclosan on adipogenic differentiation of human mesenchymal stem cells

    SciTech Connect

    Guo, Li-Wu; Wu, Qiangen; Green, Bridgett; Nolen, Greg; Shi, Leming; LoSurdo, Jessica; Deng, Helen; Bauer, Steven; Fang, Jia-Long; Ning, Baitang

    2012-07-15

    Humans at all ages are continually exposed to triclosan (TCS), a widely used antimicrobial agent that can be found in many daily hygiene products, such as toothpastes and shampoos; however, the toxicological and biological effects of TCS in the human body after long-term and low-concentration exposure are far from being well understood. In the current study, we investigated the effects of TCS on the differentiation of human mesenchymal stem cells (hMSCs) by measuring the cytotoxicity, morphological changes, lipid accumulation, and the expression of adipocyte differentiation biomarkers during 21-day adipogenesis. Significant cytotoxicity was observed in un-induced hMSCs treated with high-concentration TCS (≥ 5.0 μM TCS), but not with low-concentration treatments (≤ 2.5 μM TCS). TCS inhibited adipocyte differentiation of hMSCs in a concentration-dependent manner in the 0.156 to 2.5 μM range as indicated by morphological changes with Oil Red O staining, which is an index of lipid accumulation. The inhibitory effect was confirmed by a decrease in gene expression of specific adipocyte differentiation biomarkers including adipocyte protein 2, lipoprotein lipase, and adiponectin. Our study demonstrates that TCS inhibits adipocyte differentiation of hMSCs under concentrations that are not cytotoxic and in the range observed in human blood. -- Highlights: ► TCS is cytotoxic to un-induced hMSCs at concentrations ≥ 5.0 μM. ► TCS at concentrations ≤ 2.5 μM is not cytotoxic to induced hMSCs. ► TCS at non-cytotoxic concentrations inhibits lipid formation in induced hMSCs. ► TCS decreases the expression of specific biomarkers of adipocyte differentiation. ► TCS at concentrations observed in human blood inhibits adipogenesis of hMSCs.

  18. The combination of DHEA, histamine, and insulin increases adipogenic differentiation and enhances tissue transplantation outcome in mice.

    PubMed

    Park, Yoorim; Jung, Min Kyung; Yoon, Sun Young; Lee, Ha-Reum; Hur, Dae Young; Kim, Daejin; Yang, Yoolhee; Kim, Tae Sung; Kim, Seonghan; Yoon, Suk Ran; Park, Hyun Jeong; Bang, Sa Ik; Cho, Dae Ho

    2013-01-01

    Adipose stem cells (ASCs) are pluripotent cells that can generate pure fat tissue for regeneration. Differentiated adipose cells have been generated by a common inducer cocktail composed of dexamethasone, insulin, and isobutylmethylxanthine (DIM). The major drawbacks of adipose cells are their tendency to float on the culture media and their cost. To overcome some of these disadvantages, a new inducer cocktail that includes insulin, dehydroepiandrosterone, and histamine (DH IH) was tested. As a result, lipid accumulation was elevated more than twofold with DH IH than with DIM. Cell adhesion and viability, which are important factors for stable differentiation, were increased with DH IH and were proven through measurement of mRNA expression levels of adhesion marker genes, N-cadherin and vascular cell adhesion molecule, as well as through an alamar blue assay. The expression of adipogenesis-related genes, adiponectin, and glucose transporter type 4 lasted for a long time. To improve the efficiency of grafting, cell adhesion and neovascularization need to be increased. Neovascularization was observed around the transplanted adipose cells, which showed a higher number of vessel formation in DH IH than in DIM. The above results suggest that DH IH can produce pure differentiated adipose cells effectively and enhance their adhesion onto the target location when these differentiated adipose cells were applied as a clinical resource.

  19. Adipogenic cascade can be induced without adipogenic media by a human adenovirus.

    PubMed

    Rathod, Miloni A; Rogers, Pamela M; Vangipuram, Sharada D; McAllister, Emily J; Dhurandhar, Nikhil V

    2009-04-01

    Several metabolic abnormalities are associated with relative excess or deficiency of adipose tissue. Identifying the regulators of adipogenic differentiation is critical for its successful manipulation. Ad36, a human adenovirus, is a novel factor that promotes adipogenesis. We exploited the adipogenic potential of Ad36 to reveal exogenous modifiers of adipogenesis in rodent preadipocyte cell line in the presence or absence of differentiation inducers methyl-isobutyl-xanthine, dexamethasone, and insulin (M, D, and I; MDI). A nonadipogenic human adenovirus Ad2 was used as a negative control for viral infection. First, we confirmed that, Ad36, but not Ad2, increases lipid accumulation in the presence or absence of MDI. Time-course studies for expression of key genes of adipogenic cascade showed that it is Ad36, but not Ad2, which downregulated preadipocyte marker gene Wnt10b, and upregulated expression of early (C/EBPDelta and C/EBPbeta), intermediate (PPARgamma2), and late genes (aP2 and G3PDH) of adipogenic cascade even in the absence of MDI. In the presence of MDI, onset of expression of adipogenic genes coincided for Ad36 and control groups, but the expressions were significantly greater for the Ad36 group. Next, we observed that attenuation of Ad36 mRNA expression by an antiadenoviral agent reduced 3T3-L1 differentiation, indicating that viral mRNA expression is required for the process. Furthermore, with or without MDI or its components, Ad36 significantly increased lipid accumulation in 3T3-L1 cells. Cell confluency at the time of Ad36 infection positively influenced lipid accumulation. The results reveal that Ad36 is an MDI-independent exogenous regulator of the adipogenic process. Elucidating the molecular pathways involved may reveal novel regulatory controls of adipogenesis.

  20. Regulation of the osteogenic and adipogenic differentiation of bone marrow-derived stromal cells by extracellular uridine triphosphate: The role of P2Y2 receptor and ERK1/2 signaling.

    PubMed

    Li, Wenkai; Wei, Sheng; Liu, Chaoxu; Song, Mingyu; Wu, Hua; Yang, Yong

    2016-01-01

    An imbalance in the osteogenesis and adipogenesis of bone marrow-derived stromal cells (BMSCs) is a crucial pathological factor in the development of osteoporosis. Growing evidence suggests that extracellular nucleotide signaling involving the P2 receptors plays a significant role in bone metabolism. The aim of the present study was to investigate the effects of uridine triphosphate (UTP) on the osteogenic and adipogenic differentiation of BMSCs, and to elucidate the underlying mechanisms. The differentiation of the BMSCs was determined by measuring the mRNA and protein expression levels of osteogenic- and adipogenic-related markers, alkaline phosphatase (ALP) staining, alizarin red staining and Oil Red O staining. The effects of UTP on BMSC differentiation were assayed using selective P2Y receptor antagonists, small interfering RNA (siRNA) and an intracellular signaling inhibitor. The incubation of the BMSCs with UTP resulted in a dose-dependent decrease in osteogenesis and an increase in adipogenesis, without affecting cell proliferation. Significantly, siRNA targeting the P2Y2 receptor prevented the effects of UTP, whereas the P2Y6 receptor antagonist (MRS2578) and siRNA targeting the P2Y4 receptor had little effect. The activation of P2Y receptors by UTP transduced to the extracellular signal-regulated kinase 1/2 (ERK1/2) signaling pathway. This transduction was prevented by the mitogen-activated protein kinase inhibitor (U0126) and siRNA targeting the P2Y2 receptor. U0126 prevented the effects of UTP on osteogenic- and adipogenic-related gene expression after 24 h of culture, as opposed to 3 to 7 days of culture. Thus, our data suggest that UTP suppresses the osteogenic and enhances the adipogenic differentiation of BMSCs by activating the P2Y2 receptor. The ERK1/2 signaling pathway mediates the early stages of this process.

  1. Differentiation-Promoting Medium Additives for Hepatocyte Cultivation and Cryopreservation.

    PubMed

    Gouliarmou, Varvara; Pelkonen, Olavi; Coecke, Sandra

    2015-01-01

    Isolated primary hepatocytes are considered as the reference system for in vitro hepatic methods. Following the isolation of primary hepatocytes from liver tissue, an unfavorable process named dedifferentiation is initiated leading to the attenuation of the hepatocellular phenotype both at the morphological and functional level. Freshly isolated hepatocytes can be used immediately or can be cryopreserved for future purposes. Currently, a number of antidedifferentiation strategies exist to extend the life span of isolated hepatocytes. The addition of differentiation-promoting compounds to the hepatocyte culture medium is the oldest and simplest antidedifferentiation approach applied. In the present chapter, the most commonly used medium additives for cultivation and cryopreservation of primary hepatocytes are reviewed.

  2. The Antiaging Gene Klotho Regulates Proliferation and Differentiation of Adipose-Derived Stem Cells

    PubMed Central

    Fan, Jun; Sun, Zhongjie

    2017-01-01

    Klotho was originally discovered as an aging-suppressor gene. The purpose of this study was to investigate whether secreted Klotho (SKL) affects the proliferation and differentiation of adipose-derived stem cells (ADSCs). RT-PCR and Western blot analysis showed that short-form Klotho was expressed in mouse ADSCs. The Klotho gene mutation KL(−/−) significantly decreased proliferation of ADSCs and expression of pluripotent transcription factors (Nanog, Sox-2, and Oct-4) in mice. The adipogenic differentiation of ADSCs was also decreased in KL(−/−) mice. Incubation with Klotho-deficient medium decreased ADSC proliferation, pluripotent transcription factor levels, and adipogenic differentiation, which is similar to what was found in KL(−/−) mice. These results indicate that Klotho deficiency suppresses ADSC proliferation and differentiation. Interestingly, treatment with recombinant SKL protein rescued the Klotho deficiency-induced impairment in ADSC proliferation and adipogenic differentiation. SKL also regulated ADSCs’ differentiation to other cell lineages (osteoblasts, myofibroblasts), indicating that SKL maintains stemness of ADSCs. It is intriguing that overexpression of SKL significantly increased PPAR-γ expression and lipid formation in ADSCs following adipogenic induction, indicating enhanced adipogenic differentiation. Overexpression of SKL inhibited expression of TGFβ1 and its downstream signaling mediator Smad2/3. This study demonstrates, for the first time, that SKL is essential to the maintenance of normal proliferation and differentiation in ADSCs. Klotho regulates adipogenic differentiation in ADSCs, likely via inhibition of TGFβ1 and activation of PPAR-γ. PMID:26865060

  3. Butein is a novel anti-adipogenic compound.

    PubMed

    Song, No-Joon; Yoon, Hyang-Jin; Kim, Ki Hyun; Jung, So-Ra; Jang, Woo-Seok; Seo, Cho-Rong; Lee, Young Min; Kweon, Dae-Hyuk; Hong, Joung-Woo; Lee, Jeong-Soo; Park, Ki-Moon; Lee, Kang Ro; Park, Kye Won

    2013-05-01

    Rhus verniciflua Stokes (RVS) has been used as a traditional herbal medicine for its various biological activities including anti-adipogenic effects. Activity-guided separation led to the identification of the anti-adipogenic functions of butein. Butein, a novel anti-adipogenic compound, robustly suppressed lipid accumulation and inhibited expression of adipogenic markers. Molecular studies showed that activated transforming growth factor-β (TGF-β) and suppressed signal transducer and activator of transcription 3 (STAT3) signaling pathways were mediated by butein. Analysis of the temporal expression profiles suggests that TGF-β signaling precedes the STAT3 in the butein-mediated anti-adipogenic cascade. Small interfering RNA-mediated silencing of STAT3 or SMAD2/3 blunted the inhibitory effects of butein on adipogenesis indicating that an interaction between two signaling pathways is required for the action of butein. Upon butein treatments, stimulation of TGF-β signaling was still preserved in STAT3 silenced cells, whereas regulation of STAT3 signaling by butein was significantly impaired in SMAD2/3 silenced cells, further showing that TGF-β acts upstream of STAT3 in the butein-mediated anti-adipogenesis. Taken together, the present study shows that butein, a novel anti-adipogenic compound from RVS, inhibits adipocyte differentiation through the TGF-β pathway followed by STAT3 and peroxisome proliferator-activated receptor γ signaling, further implicating potential roles of butein in TGF-β- and STAT3-dysregulated diseases.

  4. The differentiation potential of gingival mesenchymal stem cells induced by apical tooth germ cell-conditioned medium

    PubMed Central

    Chen, Yan; Liu, Hongwei

    2016-01-01

    Gingival-derived mesenchymal stem cells (GMSCs) have recently been harvested; however, the use of GMSCs in periodontal tissue engineering requires further study. The present study established an indirect co-culture system between rat apical tooth germ-conditioned medium (APTG-CM) and GMSCs, in order to determine the effects on periodontal tissue differentiation in vitro and in vivo. Using the limiting dilution technique, single-colony derived human GMSCs and periodontal ligament stem cells (PDLSCs) were isolated and expanded to obtain homogeneous populations. PDLSCs were used as a positive control group. Cell cycle distribution, alkaline phosphatase (ALP) activity, mineralization behavior, expression of genes associated with a cementoblast phenotype (osteocalcin, bone sialoprotein, ALP, type I collagen, cementum-derived protein 23), and in vivo differentiation capacities of GMSCs/PDLSCs co-cultured with APTG-CM were evaluated. Flow cytometry indicated that GMSCs and PDLSCs were positive for STRO-1 and CD105, whereas CD45 expression was negative. The cell types were capable of forming colonies, and of osteogenic and adipogenic differentiation in response to appropriate stimuli. The induced GMSCs and PDLSCs exhibited numerous characteristics associated with cementoblast lineages, as indicated by increased proliferation and ALP activity, and upregulated expression of cementum-associated genes in vitro. In vivo, cementum/periodontal ligament-like structures were shown to form along the dentin surface and ceramic bovine bone in GMSCs and PDLSCs induced by APTG-CM group. Conversely, vertical fibers could not insert in the control group, which was not co-cultured with APTG-CM. In conclusion, GMSCs are likely to have a role in periodontal tissue regeneration. In addition, APTG-CM was able to provide a cementogenic microenvironment and promote differentiation of GMSCs along the cementoblastic lineage. PMID:27600358

  5. Fluorogenic selective and differential medium for isolation of fecal streptococci.

    PubMed Central

    Littel, K J; Hartman, P A

    1983-01-01

    Of 44 fluorogenic substrates tested for their ability to differentiate species of fecal streptococci, four yielded species-differentiating reactions. The remaining substrates either yielded uniformly positive, negative, or variable strain-dependent reactions. One substrate, 4-methylumbelliferone-alpha-D-galactoside, was hydrolyzed by Streptococcus bovis and S. faecium and its biotypes. 4-Methylumbelliferone-alpha-D-galactoside and a colorimetric starch substrate were incorporated into the fecal streptococcal selective medium of Donnelly and Hartman (Appl. Environ. Microbiol. 35:576-581, 1978). Three phenotypic groups were identifiable on the new fluorescent gentamicin-thallous-carbonate agar: (i) starch hydrolysis and fluorescence (S. bovis), (ii) no starch hydrolysis but fluorescence (S. faecium and its biotypes), and (iii) no starch hydrolysis or fluorescence (S. faecalis, S. avium, S. equinus, S. mitis, and S. salivarius). Of the presumptive identifications from sewage, swine, and bovine samples, 86% were confirmed as being correct. The new medium has potential application in water, food, environmental, and possibly clinical microbiology. Images PMID:6830220

  6. IFATS collection: Stem cell antigen-1-positive ear mesenchymal stem cells display enhanced adipogenic potential.

    PubMed

    Staszkiewicz, Jaroslaw; Gimble, Jeffrey M; Manuel, Jessica A; Gawronska-Kozak, Barbara

    2008-10-01

    Hyperplasia is a major contributor to the increase in adipose tissue mass that is characteristic of obesity. However, the identity and characteristics of cells that can be committed into adipocyte lineage remain unclear. Stem cell antigen 1 (Sca-1) has been used recently as a candidate marker in the search for tissue-resident stem cells. In our quest for biomarkers of cells that can become adipocytes, we analyzed ear mesenchymal stem cells (EMSC), which can differentiate into adipocytes, osteocytes, chondrocytes, and myocytes. Our previous studies have demonstrated that EMSC abundantly expressed Sca-1. In the present study, we have analyzed the expression of adipogenic transcription factors and adipocyte-specific genes in Sca-1-enriched and Sca-1-depleted EMSC fractions. Sca-1-enriched EMSC accumulated more lipid droplets during adipogenic differentiation than Sca-1-depleted. Similarly, EMSC isolated from Sca-1(-/-) mice displayed reduced lipid accumulation relative to EMSC from wild-type controls (p < .01). Comparative analysis of the adipogenic differentiation process between Sca-1-enriched and Sca-1-depleted populations of EMSC revealed substantial differences in the gene expression. Preadipocyte factor 1, CCAAT enhancer-binding protein (C/EBP) beta, C/EBPalpha, peroxisome proliferator-activated receptor gamma2, lipoprotein lipase, and adipocyte fatty acid binding protein were expressed at significantly higher levels in the Sca-1-enriched EMSC fraction. However, the most striking observation was that leptin was detected only in the conditioned medium of Sca-1-enriched EMSC. In addition, we performed loss-of-function (Sca-1 morpholino oligonucleotide) experiments. The data presented here suggest that Sca-1 is a biomarker for EMSC with the potential to become functionally active adipocytes. Disclosure of potential conflicts of interest is found at the end of this article.

  7. Adipocyte membrane glycerol permeability is involved in the anti-adipogenic effect of conjugated linoleic acid.

    PubMed

    Martins, Susana V; Madeira, Ana; Lopes, Paula A; Pires, Virgínia M R; Alfaia, Cristina M; Prates, José A M; Moura, Teresa; Soveral, Graça

    2015-03-06

    Conjugated linoleic acid (CLA), a group of minor fatty acids from ruminant origin, has long been recognized as a body fat lowering agent. Given the trans(t)10,cis(c)12-CLA well documented interference on lipolysis, we hypothesized for adipocytes altered permeation to glycerol when supplemented with this isomer. 3T3-L1 murine differentiated adipocytes were medium supplemented with linoleic acid (LA) and individual or combined c9,t11 and t10,c12-CLA isomers. Adipocytes treated with the t10,c12-CLA isomer and CLA mixture showed reduced triacylglycerols content (p < 0.001), re-enforcing the t10,c12-CLA as the anti-adipogenic CLA isomer. This finding was supported by decreased Δ9-desaturase index and adipocyte differentiation markers for the t10,c12-CLA group (p < 0.001), which suggest reduced lipogenesis and differentiation, respectively. The glycerol permeability was higher in all CLA treated cells compared to control and LA groups (p < 0.05). The increase in glycerol permeability agrees with both reduced triacylglycerols and non-osmotic cellular volume in the t10,c12-CLA and CLA mixture groups. Taken together, our data suggest that the increased adipocyte plasma membrane glycerol fluxes may be part of the anti-adipogenic response to CLA treatments.

  8. Hierarchization of myogenic and adipogenic progenitors within human skeletal muscle.

    PubMed

    Pisani, Didier F; Clement, Noémie; Loubat, Agnès; Plaisant, Magali; Sacconi, Sabrina; Kurzenne, Jean-Yves; Desnuelle, Claude; Dani, Christian; Dechesne, Claude A

    2010-12-01

    Skeletal muscle cells constitute a heterogeneous population that maintains muscle integrity through a high myogenic regenerative capacity. More unexpectedly, this population is also endowed with an adipogenic potential, even in humans, and intramuscular adipocytes have been found to be present in several disorders. We tested the distribution of myogenic and adipogenic commitments in human muscle-derived cells to decipher the cellular basis of the myoadipogenic balance. Clonal analysis showed that adipogenic progenitors can be separated from myogenic progenitors and, interestingly, from myoadipogenic bipotent progenitors. These progenitors were isolated in the CD34(+) population on the basis of the expression of CD56 and CD15 cell surface markers. In vivo, these different cell types have been found in the interstitial compartment of human muscle. In vitro, we show that the proliferation of bipotent myoadipogenic CD56(+)CD15(+) progenitors gives rise to myogenic CD56(+)CD15(-) progenitors and adipogenic CD56(-)CD15(+) progenitors. A cellular hierarchy of muscle and fat progenitors thus occurs within human muscle. These results provide cellular bases for adipogenic differentiation in human skeletal muscle, which may explain the fat development encountered in different muscle pathological situations.

  9. Differentiation of Cryptococcus neoformans serotypes A and D using creatinine dextrose bromothymol blue thymine medium.

    PubMed

    Irokanulo, E A; Akueshi, C O; Makinde, A A

    1994-06-01

    A serotype differentiation of the encapsulated yeast Cryptococcus neoformans is described using creatinine dextrose bromothymol blue thymine (CDBT) medium. On CDBT medium C. neoformans serotype D grew as bright red colonies, turning the medium a bright orange after five days incubation at 28 degrees C. C. neoformans serotype A grew as pale colonies with no apparent colour effect on the medium. Serotypes B and C caused a slight greening of the medium. The reaction of the four serotypes of C. neoformans on CDBT medium is considered useful in the differentiation of the closely related serotype A and D.

  10. Repressor transcription factor 7-like 1 promotes adipogenic competency in precursor cells.

    PubMed

    Cristancho, Ana G; Schupp, Michael; Lefterova, Martina I; Cao, Shengya; Cohen, Daniel M; Chen, Christopher S; Steger, David J; Lazar, Mitchell A

    2011-09-27

    The identification of factors that define adipocyte precursor potential has important implications for obesity. Preadipocytes are fibroblastoid cells committed to becoming round lipid-laden adipocytes. In vitro, this differentiation process is facilitated by confluency, followed by adipogenic stimuli. During adipogenesis, a large number of cytostructural genes are repressed before adipocyte gene induction. Here we report that the transcriptional repressor transcription factor 7-like 1 (TCF7L1) binds and directly regulates the expression of cell structure genes. Depletion of TCF7L1 inhibits differentiation, because TCF7L1 indirectly induces the adipogenic transcription factor peroxisome proliferator-activated receptor γ in a manner that can be replaced by inhibition of myosin II activity. TCF7L1 is induced by cell contact in adipogenic cell lines, and ectopic expression of TCF7L1 alleviates the confluency requirement for adipocytic differentiation of precursor cells. In contrast, TCF7L1 is not induced during confluency of non-adipogenic fibroblasts, and, remarkably, forced expression of TCF7L1 is sufficient to commit non-adipogenic fibroblasts to an adipogenic fate. These results establish TCF7L1 as a transcriptional hub coordinating cell-cell contact with the transcriptional repression required for adipogenic competency.

  11. Connective tissue cells expressing fibro/adipogenic progenitor markers increase under chronic damage: relevance in fibroblast-myofibroblast differentiation and skeletal muscle fibrosis.

    PubMed

    Contreras, Osvaldo; Rebolledo, Daniela L; Oyarzún, Juan Esteban; Olguín, Hugo C; Brandan, Enrique

    2016-06-01

    Fibrosis occurs in skeletal muscle under various pathophysiological conditions such as Duchenne muscular dystrophy (DMD), a devastating disease characterized by fiber degeneration that results in progressive loss of muscle mass, weakness and increased extracellular matrix (ECM) accumulation. Fibrosis is also observed after skeletal muscle denervation and repeated cycles of damage followed by regeneration. The ECM is synthesized largely by fibroblasts in the muscle connective tissue under normal conditions. Myofibroblasts, cells that express α-smooth muscle actin (α-SMA), play a role in many tissues affected by fibrosis. In skeletal muscle, fibro/adipogenic progenitors (FAPs) that express cell-surface platelet-derived growth factor receptor-α (PDGFR-α) and the transcription factor Tcf4 seem to be responsible for connective tissue synthesis and are good candidates for the origin of myofibroblasts. We show that cells positive for Tcf4 and PDGFR-α are expressed in skeletal muscle under normal conditions and are increased in various skeletal muscles of mdx mice, a murine model for DMD, wild type muscle after sciatic denervation and muscle subjected to chronic damage. These cells co-label with the myofibroblast marker α-SMA in dystrophic muscle but not in normal tissue. The Tcf4-positive cells lie near macrophages mainly concentrated in dystrophic necrotic-regenerating foci. The close proximity of Tcf4-positive cells to inflammatory cells and their previously described role in muscle regeneration might reflect an active interaction between these cell types and growth factors, possibly resulting in a muscular regenerative or fibrotic condition.

  12. A potential regulatory network underlying distinct fate commitment of myogenic and adipogenic cells in skeletal muscle

    PubMed Central

    Sun, Wenjuan; He, Ting; Qin, Chunfu; Qiu, Kai; Zhang, Xin; Luo, Yanhong; Li, Defa; Yin, Jingdong

    2017-01-01

    Mechanism controlling myo-adipogenic balance in skeletal muscle is of great significance for human skeletal muscle dysfunction and myopathies as well as livestock meat quality. In the present study, two cell subpopulations with particular potency of adipogenic or myogenic differentiation were isolated from neonatal porcine longissimus dorsi using the preplate method to detect mechanisms underlying distinct fate commitment of myogenic and adipogenic cells in skeletal muscle. Both cells share a common surface expression profile of CD29+CD31−CD34−CD90+CD105+, verifying their mesenchymal origin. A total of 448 differentially expressed genes (DEGs) (FDR < 0.05 and |log2 FC| ≥ 1) between two distinct cells were identified via RNA-seq, including 358 up-regulated and 90 down-regulated genes in myogenic cells compared with adipogenic cells. The results of functional annotation and enrichment showed that 42 DEGs were implicated in cell differentiation, among them PDGFRα, ITGA3, ITGB6, MLCK and MLC acted as hubs between environment information processing and cellular process, indicating that the interaction of the two categories exerts an important role in distinct fate commitment of myogenic and adipogenic cells. Particularly, we are first to show that up-regulation of intracellular Ca2+-MLCK and Rho-DMPK, and subsequently elevated MLC, may contribute to the distinct commitment of myogenic and adipogenic lineages via mediating cytoskeleton dynamics. PMID:28276486

  13. A potential regulatory network underlying distinct fate commitment of myogenic and adipogenic cells in skeletal muscle.

    PubMed

    Sun, Wenjuan; He, Ting; Qin, Chunfu; Qiu, Kai; Zhang, Xin; Luo, Yanhong; Li, Defa; Yin, Jingdong

    2017-03-09

    Mechanism controlling myo-adipogenic balance in skeletal muscle is of great significance for human skeletal muscle dysfunction and myopathies as well as livestock meat quality. In the present study, two cell subpopulations with particular potency of adipogenic or myogenic differentiation were isolated from neonatal porcine longissimus dorsi using the preplate method to detect mechanisms underlying distinct fate commitment of myogenic and adipogenic cells in skeletal muscle. Both cells share a common surface expression profile of CD29(+)CD31(-)CD34(-)CD90(+)CD105(+), verifying their mesenchymal origin. A total of 448 differentially expressed genes (DEGs) (FDR < 0.05 and |log2 FC| ≥ 1) between two distinct cells were identified via RNA-seq, including 358 up-regulated and 90 down-regulated genes in myogenic cells compared with adipogenic cells. The results of functional annotation and enrichment showed that 42 DEGs were implicated in cell differentiation, among them PDGFRα, ITGA3, ITGB6, MLCK and MLC acted as hubs between environment information processing and cellular process, indicating that the interaction of the two categories exerts an important role in distinct fate commitment of myogenic and adipogenic cells. Particularly, we are first to show that up-regulation of intracellular Ca(2+)-MLCK and Rho-DMPK, and subsequently elevated MLC, may contribute to the distinct commitment of myogenic and adipogenic lineages via mediating cytoskeleton dynamics.

  14. Differentiation of dental pulp stem cells into neuron-like cells in serum-free medium.

    PubMed

    Zainal Ariffin, Shahrul Hisham; Kermani, Shabnam; Zainol Abidin, Intan Zarina; Megat Abdul Wahab, Rohaya; Yamamoto, Zulham; Senafi, Sahidan; Zainal Ariffin, Zaidah; Abdul Razak, Mohamad

    2013-01-01

    Dental pulp tissue contains dental pulp stem cells (DPSCs). Dental pulp cells (also known as dental pulp-derived mesenchymal stem cells) are capable of differentiating into multilineage cells including neuron-like cells. The aim of this study was to examine the capability of DPSCs to differentiate into neuron-like cells without using any reagents or growth factors. DPSCs were isolated from teeth extracted from 6- to 8-week-old mice and maintained in complete medium. The cells from the fourth passage were induced to differentiate by culturing in medium without serum or growth factors. RT-PCR molecular analysis showed characteristics of Cd146(+) , Cd166(+) , and Cd31(-) in DPSCs, indicating that these cells are mesenchymal stem cells rather than hematopoietic stem cells. After 5 days of neuronal differentiation, the cells showed neuron-like morphological changes and expressed MAP2 protein. The activation of Nestin was observed at low level prior to differentiation and increased after 5 days of culture in differentiation medium, whereas Tub3 was activated only after 5 days of neuronal differentiation. The proliferation of the differentiated cells decreased in comparison to that of the control cells. Dental pulp stem cells are induced to differentiate into neuron-like cells when cultured in serum- and growth factor-free medium.

  15. Activation of an adipogenic program in adult myoblasts with age.

    PubMed

    Taylor-Jones, Jane M; McGehee, Robert E; Rando, Thomas A; Lecka-Czernik, Beata; Lipschitz, David A; Peterson, Charlotte A

    2002-03-31

    Myoblasts isolated from mouse hindlimb skeletal muscle demonstrated increased adipogenic potential as a function of age. Whereas myoblasts from 8-month-old adult mice did not significantly accumulate terminal markers of adipogenesis regardless of culture conditions, myoblasts from 23-month-old mice accumulated fat and expressed genes characteristic of differentiated adipocytes, such as the fatty acid binding protein aP2. This change in differentiation potential was associated with a change in the abundance of the mRNA encoding the transcription factor C/EBPalpha, and in the relative abundance of PPARgamma2 to PPARgamma1 mRNAs. Furthermore, PPARgamma activity appeared to be regulated at the level of phosphorylation, being more highly phosphorylated in myoblasts isolated from younger animals. Although adipogenic gene expression in myoblasts from aged animals was activated, presumably in response to PPARgamma and C/EBPalpha, unexpectedly, myogenic gene expression was not effectively repressed. The Wnt signaling pathway may also alter differentiation potential in muscle with age. Wnt-10b mRNA was more abundantly expressed in muscle tissue and cultured myoblasts from adult compared with aged mice, resulting in stabilization of cytosolic beta-catenin, that may potentially contribute to inhibition of adipogenic gene expression in adult myoblasts. The changes reported here, together with those reported in bone marrow stroma with age, suggest that a default program may be activated in mesenchymal cells with increasing age resulting in a more adipogenic-like phenotype. Whether this change in differentiation potential contributes to the increased adiposity in muscle with age remains to be determined.

  16. Transgelin is a TGFβ-inducible gene that regulates osteoblastic and adipogenic differentiation of human skeletal stem cells through actin cytoskeleston organization.

    PubMed

    Elsafadi, M; Manikandan, M; Dawud, R A; Alajez, N M; Hamam, R; Alfayez, M; Kassem, M; Aldahmash, A; Mahmood, A

    2016-08-04

    Regenerative medicine is a novel approach for treating conditions in which enhanced bone regeneration is required. We identified transgelin (TAGLN), a transforming growth factor beta (TGFβ)-inducible gene, as an upregulated gene during in vitro osteoblastic and adipocytic differentiation of human bone marrow-derived stromal (skeletal) stem cells (hMSC). siRNA-mediated gene silencing of TAGLN impaired lineage differentiation into osteoblasts and adipocytes but enhanced cell proliferation. Additional functional studies revealed that TAGLN deficiency impaired hMSC cell motility and in vitro transwell cell migration. On the other hand, TAGLN overexpression reduced hMSC cell proliferation, but enhanced cell migration, osteoblastic and adipocytic differentiation, and in vivo bone formation. In addition, deficiency or overexpression of TAGLN in hMSC was associated with significant changes in cellular and nuclear morphology and cytoplasmic organelle composition as demonstrated by high content imaging and transmission electron microscopy that revealed pronounced alterations in the distribution of the actin filament and changes in cytoskeletal organization. Molecular signature of TAGLN-deficient hMSC showed that several genes and genetic pathways associated with cell differentiation, including regulation of actin cytoskeleton and focal adhesion pathways, were downregulated. Our data demonstrate that TAGLN has a role in generating committed progenitor cells from undifferentiated hMSC by regulating cytoskeleton organization. Targeting TAGLN is a plausible approach to enrich for committed hMSC cells needed for regenerative medicine application.

  17. Verification of suitable and reliable reference genes for quantitative real-time PCR during adipogenic differentiation in porcine intramuscular stromal-vascular cells.

    PubMed

    Li, X; Huang, K; Chen, F; Li, W; Sun, S; Shi, X-E; Yang, G

    2016-06-01

    Intramuscular fat (IMF) is an important trait influencing meat quality, and intramuscular stromal-vascular cell (MSVC) differentiation is a key factor affecting IMF deposition. Quantitative real-time PCR (qPCR) is often used to screen the differentially expressed genes during differentiation of MSVCs, where proper reference genes are essential. In this study, we assessed 31 of previously reported reference genes for their expression suitability in porcine MSVCs derived form longissimus dorsi with qPCR. The expression stability of these genes was evaluated using NormFinder, geNorm and BestKeeper algorithms. NormFinder and geNorm uncovered ACTB, ALDOA and RPS18 as the most three stable genes. BestKeeper identified RPL13A, SSU72 and DAK as the most three stable genes. GAPDH was found to be the least stable gene by all of the three software packages, indicating it is not an appropriate reference gene in qPCR assay. These results might be helpful for further studies in pigs that explore the molecular mechanism underlying IMF deposition.

  18. Serum miRNA Signatures Are Indicative of Skeletal Fractures in Postmenopausal Women With and Without Type 2 Diabetes and Influence Osteogenic and Adipogenic Differentiation of Adipose Tissue-Derived Mesenchymal Stem Cells In Vitro.

    PubMed

    Heilmeier, Ursula; Hackl, Matthias; Skalicky, Susanna; Weilner, Sylvia; Schroeder, Fabian; Vierlinger, Klemens; Patsch, Janina M; Baum, Thomas; Oberbauer, Eleni; Lobach, Iryna; Burghardt, Andrew J; Schwartz, Ann V; Grillari, Johannes; Link, Thomas M

    2016-12-01

    Standard DXA measurements, including Fracture Risk Assessment Tool (FRAX) scores, have shown limitations in assessing fracture risk in Type 2 Diabetes (T2D), underscoring the need for novel biomarkers and suggesting that other pathomechanisms may drive diabetic bone fragility. MicroRNAs (miRNAs) are secreted into the circulation from cells of various tissues proportional to local disease severity and were recently found to be crucial to bone homeostasis and T2D. Here, we studied, if and which circulating miRNAs or combinations of miRNAs can discriminate best fracture status in a well-characterized study of diabetic bone disease and postmenopausal osteoporosis (n = 80 postmenopausal women). We then tested the most discriminative and most frequent miRNAs in vitro. Using miRNA-qPCR-arrays, we showed that 48 miRNAs can differentiate fracture status in T2D women and that several combinations of four miRNAs can discriminate diabetes-related fractures with high specificity and sensitivity (area under the receiver-operating characteristic curve values [AUCs], 0.92 to 0.96; 95% CI, 0.88 to 0.98). For the osteoporotic study arm, 23 miRNAs were fracture-indicative and potential combinations of four miRNAs showed AUCs from 0.97 to 1.00 (95% CI, 0.93 to 1.00). Because a role in bone homeostasis for those miRNAs that were most discriminative and most present among all miRNA combinations had not been described, we performed in vitro functional studies in human adipose tissue-derived mesenchymal stem cells to investigate the effect of miR-550a-5p, miR-188-3p, and miR-382-3p on osteogenesis, adipogenesis, and cell proliferation. We found that miR-382-3p significantly enhanced osteogenic differentiation (p < 0.001), whereas miR-550a-5p inhibited this process (p < 0.001). Both miRNAs, miR-382-3p and miR-550a-5p, impaired adipogenic differentiation, whereas miR-188-3p did not exert an effect on adipogenesis. None of the miRNAs affected significantly cell proliferation. Our

  19. Isolation and multiple differentiation potential assessment of human gingival mesenchymal stem cells.

    PubMed

    Gao, Yuan; Zhao, Guizhi; Li, Dongxia; Chen, Xin; Pang, Jianliang; Ke, Jie

    2014-11-14

    The aim of this study was to isolate human mesenchymal stem cells (MSCs) from the gingiva (GMSCs) and confirm their multiple differentiation potentials, including the odontogenic lineage. GMSCs, periodontal ligament stem cells (PDLSCs) and dermal stem cells (DSCs) cultures were analyzed for cell shape, cell cycle, colony-forming unit-fibroblast (CFU-F) and stem cell markers. Cells were then induced for osteogenic and adipogenic differentiation and analyzed for differentiation markers (alkaline phosphatase (ALP) activity, mineralization nodule formation and Runx2, ALP, osteocalcin (OCN) and collagen I expressions for the osteogenic differentiation, and lipid vacuole formation and PPARγ-2 expression for the adipogenic differentiation). Besides, the odontogenic differentiation potential of GMSCs induced with embryonic tooth germ cell-conditioned medium (ETGC-CM) was observed. GMSCs, PDLSCs and DSCs were all stromal origin. PDLSCs showed much higher osteogenic differentiation ability but lower adipogenic differentiation potential than DSCs. GMSCs showed the medial osteogenic and adipogenic differentiation potentials between those of PDLSCs and DSCs. GMSCs were capable of expressing the odontogenic genes after ETGC-CM induction. This study provides evidence that GMSCs can be used in tissue engineering/regeneration protocols as an approachable stem cell source.

  20. Anti-adipogenic activity of berberine is not mediated by the WNT/β-catenin pathway.

    PubMed

    Bae, Sungmin; Yoon, Yoosik

    2013-06-01

    Adipogenesis is a differentiation process from preadipocytes to adipocytes, accompanied by the inductions of adipogenic transcription factors and lipid metabolizing enzymes. Among cellular pathways regulating adipogenesis, the WNT/β-catenin pathway is well-known as a suppressor of adipogenesis. Berberine (BBR) is an isoquinoline alkaloid component of the medicinal plants including Coptis chinensis and Coptis japonica with diverse biological activities. This study was conducted to elucidate whether the anti-adipogenic effect of BBR is mediated by the WNT/β-catenin pathway. The results of the present study confirmed that BBR efficiently inhibited adipogenesis of 3T3-L1 cells. However, the anti-adipogenic effects of BBR were not accompanied by the modulations of the WNT/β-catenin pathway members including WNT10B, LRP6, DVL2, GSK3β and β-catenin. When β-catenin was knocked down by its siRNA transfection, the anti-adipogenic effects of BBR including the expression of adipogenic transcription factors and lipid metabolizing enzymes as well as the intracellular fat accumulation were not affected at all. The results of this study showed that the anti-adipogenic effect of BBR is not mediated by the WNT/β-catenin pathway.

  1. A differential medium for the enumeration of the spoilage yeast Zygosaccharomyces bailii in wine.

    PubMed

    Schuller, D; Côrte-Real, M; Leão, C

    2000-11-01

    A collection of yeasts, isolated mostly from spoiled wines, was used in order to develop a differential medium for Zygosaccharomyces bailii. The 118 selected strains of 21 species differed in their origin and resistance to preservatives and belonged to the genera Pichia, Torulaspora, Dekkera, Debaryomyces, Saccharomycodes, Issatchenkia, Kluyveromyces, Kloeckera, Lodderomyces, Schizosaccharomyces, Rhodotorula, Saccharomyces, and Zygosaccharomyces. The design of the culture medium was based on the different ability of the various yeast species to grow in a mineral medium with glucose and formic acid (mixed-substrate medium) as the only carbon and energy sources and supplemented with an acid-base indicator. By manipulating the concentration of the acid and the sugar it was possible to select conditions where only Z. bailii strains gave rise to alkalinization, associated with a color change of the medium (positive response). The final composition of the mixed medium was adjusted as a compromise between the percentage of recovery and selectivity for Z. bailii. This was accomplished by the use of pure or mixed cultures of the yeast strains and applying the membrane filtration methodology. The microbiological analysis of two samples of contaminated Vinho Verde showed that the new medium can be considered as a differential medium to distinguish Z. bailii from other contaminating yeasts, having potential application in the microbiological control of wines and probably other beverages and foods.

  2. Characterization of human adipose tissue-derived stem cells with enhanced angiogenic and adipogenic properties.

    PubMed

    Lauvrud, Anne Therese; Kelk, Peyman; Wiberg, Mikael; Kingham, Paul J

    2016-02-02

    Autologous fat grafting is a popular method for soft tissue reconstructions but graft survival remains highly unpredictable. Supplementation of the graft with the stromal vascular fraction (SVF) or cultured adipose tissue-derived stem cells (ASCs) can enhance graft viability. In this study we have examined the phenotypic properties of a selected population of cells isolated from ASCs, with a view to determining their suitability for transplantation into grafts. ASCs were isolated from the SVF of human abdominal fat (n = 8 female patients) and CD146(+) cells were selected using immunomagnetic beads. The angiogenic and adipogenic properties of the positively selected cells were compared with the negative fraction. CD146(+) cells expressed the immunophenotypic characteristics of pericytes. With prolonged in vitro expansion, CD146(-) cells exhibited increased population doubling times and morphological signs of senescence, whereas CD146(+) cells did not. CD146(+) cells expressed higher levels of the angiogenic molecules VEGF-A, angiopoietin-1 and FGF-1. Conditioned medium taken from CD146(+) cells significantly increased formation of in vitro endothelial cell tube networks, whereas CD146(-) cells did not. CD146(+) cells could be differentiated into adipocytes in greater numbers than CD146(-) cells. Consistent with this, differentiated CD146(+) cells expressed higher levels of the adipocyte markers adiponectin and leptin. These results suggest that CD146(+) cells selected from a heterogeneous mix of ASCs have more favourable angiogenic and adipogenic properties, which might provide significant benefits for reconstructive and tissue-engineering applications. Copyright © 2016 John Wiley & Sons, Ltd.

  3. Modulation of Adipogenic Conditions for Prospective Use of hADSCs in Adipose Tissue Engineering

    PubMed Central

    Galateanu, Bianca; Dinescu, Sorina; Cimpean, Anisoara; Dinischiotu, Anca; Costache, Marieta

    2012-01-01

    Modern strategies in adipose tissue engineering (ATE) take advantage of the easy harvest, abundance and differentiation potential towards mesenchymal lineages of hADSCs. The controlled conversion of hADSCs to committed adipogenic precursors and further mature adipocytes formation is important for good long-term results in soft tissue regeneration. Thus, in this study, we report: (i) the isolation of the processed lipoaspirate (PLA) cells from adipose tissue and sanguine fractions; (ii) the phenotypic characterization of the PLA descendants; (iii) the design of a novel protocol for the modulation of adipogenic conditions in the perspectives of ATE applications. To modulate the differentiation rate through our protocol, we propose to selectively modify the formulation of the adipogenic media in accordance with the evolution of the process. Therefore, we aimed to ensure the long-term proliferation of the precursor cells and to delay the late adipogenic events. The status of differentiation was characterized in terms of intracellular lipid accumulation and reorganization of the cytoskeleton simultaneously with perilipin protein expression. Moreover, we studied the sequential activation of PPARγ2, FAS, aP2 and perilipin genes which influence the kinetics of the adipogenic process. The strategies developed in this work are the prerequisites for prospective 3D regenerative systems. PMID:23443100

  4. Participation of TNF-α in Inhibitory Effects of Adipocytes on Osteoblast Differentiation.

    PubMed

    Abuna, Robrigo P F; De Oliveira, Fabiola S; Santos, Thiago De S; Guerra, Thais R; Rosa, Adalberto L; Beloti, Marcio M

    2016-01-01

    Mesenchymal stem cells from bone marrow (BM-MSCs) and adipose tissue (AT-MSCs) are attractive tools for cell-based therapies to repair bone tissue. In this study, we investigated the osteogenic and adipogenic potential of BM-MSCs and AT-MSCs as well as the effect of crosstalk between osteoblasts and adipocytes on cell phenotype expression. Rat BM-MSCs and AT-MSCs were cultured either in growth, osteogenic, or adipogenic medium to evaluate osteoblast and adipocyte differentiation. Additionally, osteoblasts and adipocytes were indirectly co-cultured to investigate the effect of adipocytes on osteoblast differentiation and vice versa. BM-MSCs and AT-MSCs exhibit osteogenic and adipogenic potential under non-differentiation-inducing conditions. When exposed to osteogenic medium, BM-MSCs exhibited higher expression of bone markers compared with AT-MSCs. Conversely, under adipogenic conditions, AT-MSCs displayed higher expression of adipose tissue markers compared with BM-MSCs. The presence of adipocytes as indirect co-culture repressed the expression of the osteoblast phenotype, whereas osteoblasts did not exert remarkable effect on adipocytes. The inhibitory effect of adipocytes on osteoblasts was due to the release of tumor necrosis factor alpha (TNF-α) in culture medium by adipocytes. Indeed, the addition of exogenous TNF-α in culture medium repressed the differentiation of BM-MSCs into osteoblasts mimicking the indirect co-culture effect. In conclusion, our study showed that BM-MSCs are more osteogenic while AT-MSCs are more adipogenic. Additionally, we demonstrated the key role of TNF-α secreted by adipocytes on the inhibition of osteoblast differentiation. Thus, we postulate that the higher osteogenic potential of BM-MSCs makes them the first choice for inducing bone repair in cell-based therapies.

  5. Development of an Improved Selective and Differential Medium for Isolation of Salmonella spp.

    PubMed Central

    Park, Sang-Hyun; Ryu, Sangryeol

    2012-01-01

    We describe an improved selective, differential, and cost-effective medium, XA medium, which contains d-arabinose, to facilitate the selective isolation of Salmonella spp. The sensitivity and the specificity of XA medium were compared to those of xylose lysine desoxycholate agar (XLD) using stock cultures and naturally contaminated food samples. XA medium and XLD were evaluated with a total of 82 Salmonella and 69 non-Salmonella stock cultures. Of 82 strains of Salmonella spp. tested, 76 produced a characteristic black colony on XA medium and XLD. The remaining 6 strains belonged to Salmonella enterica serovars Berta (n = 1), Paratyphi A (n = 1), Gallinarum (n = 2), and Pullorum (n = 2). The sensitivities of XA medium and XLD were identical (92.7%). Citrobacter freundii (n = 21) and Proteus mirabilis (n = 21) stock cultures produced black colonies on XLD, whereas only 4 strains of P. mirabilis appeared as black colonies on XA medium. In the second phase of the study, a total of 180 food samples were cultured onto XA medium and XLD after selective enrichment. The sensitivities of XA medium and XLD were equal (100%), and a total of 6 Salmonella strains were isolated from the 180 food samples. The specificity of XA medium (92.0%) was superior to that of XLD (73.0%), with a total of 14 and 47 false-positive results found on XA medium and XLD, respectively. On the basis of its good specificity, XA medium is useful for the isolation of Salmonella spp. from food samples. PMID:22814469

  6. Berberine reduces the expression of adipogenic enzymes and inflammatory molecules of 3T3-L1 adipocyte.

    PubMed

    Choi, Bong-Hyuk; Ahn, In-Sook; Kim, Yu-Hee; Park, Ji-Won; Lee, So-Young; Hyun, Chang-Kee; Do, Myoung-Sool

    2006-12-31

    Berberine (BBR), an isoquinoline alkaloid, has a wide range of pharmacological effects, yet its exact mechanism is unknown. In order to understand the anti-adipogenic effect of BBR, we studied the change of expression of several adipogenic enzymes of 3T3-L1 cells by BBR treatment. First, we measured the change of leptin and glycerol in the medium of 3T3-L1 cells treated with 1 micrometer, 5 micrometer and 10 micrometer concentrations of BBR. We also measured the changes of adipogenic and lipolytic factors of 3T3-L1. In 3T3-L1 cells, both leptin and adipogenic factors (SREBP-1c, C/EBP-alpha, PPAR-gamma, fatty acid synthase, acetyl-CoA carboxylase, acyl-CoA synthase and lipoprotein lipase) were reduced by BBR treatment. Glycerol secretion was increased, whereas expression of lipolytic enzymes (hormone-sensitive lipase and perilipin) mRNA was slightly decreased. Next, we measured the change of inflammation markers of 3T3-L1 cells by BBR treatment. This resulted in the down-regulation of mRNA level of inflammation markers such as TNF-alpha, IL-6, C- reactive protein and haptoglobin. Taken together, our data shows that BBR has both anti-adipogenic and anti-inflammatory effects on 3T3-L1 adipocytes, and the anti-adipogenic effect seems to be due to the down-regulation of adipogenic enzymes and transcription factors.

  7. Osteogenic and Adipogenic Cell Fractions Isolated from Postnatal Mouse Calvaria

    PubMed Central

    Steenhuis, P.; Carr, K.M.; Pettway, G.J.; Ignelzi, M.A.

    2009-01-01

    The use of stem/progenitor cells represents a promising approach to treat craniofacial bone defects, but successful treatments will rely on the availability of cells that can be expanded in vitroand which will differentiate appropriately in vivo. The calvaria may represent a source of autologous cells for such purposes. We demonstrate expression of stem cell antigen-1 (Sca-1) in mouse calvaria. We isolated Sca-1+ and Sca-1– cells at high purity and tested the ability of these cells to differentiate into adipose and bone. We show that the Sca-1+ cell fraction has adipogenic differentiation potential and that the cell Sca-1– fraction has osteogenic differentiation potential. The Sca-1+ cell fraction partially retains its adipogenic differentiation potential and the Sca-1– cell fraction partially retains its osteogenic differentiation potential after in vitroexpansion. These data suggest that the calvaria may be used as a source of stem/progenitor cells that can be expanded in vitroand transplanted in vivofor craniofacial tissue regeneration. PMID:19088466

  8. Epigallocatechin-3-gallate suppresses the lipid deposition through the apoptosis during differentiation in bovine bone marrow mesenchymal stem cells

    PubMed Central

    Jeong, Jin Young; Suresh, Sekar; Jang, Mi; Park, Mi Na; Gobianand, Kuppannan; You, Seungkwon; Yeon, Sung-Heom; Lee, Hyun-Jeong

    2015-01-01

    Epigallocatechin gallate (EGCG), a major component of tea, has known effects on obesity, fatty liver, and obesity-related cancer. We explored the effects of EGCG on the differentiation of bovine mesenchymal stem cells (BMSCs, which are multipotent) in a dose- and time-dependent manner. Differentiating BMSCs were exposed to various concentrations of EGCG (0, 10, 50, 100, and 200 µM) for 2, 4, and 6 days. BMSCs were cultured in Dulbecco's modified Eagle's medium (DMEM)/high-glucose medium with adipogenic inducers for 6 days, and the expression levels of various genes involved in adipogenesis were measured using real-time polymerase chain reaction (PCR) and Western blotting. We assessed apoptosis by flow cytometry and terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) staining of control and EGCG-exposed cells. We found that EGCG significantly suppressed fat deposition and cell viability (P < 0.05). The mRNA and protein levels of various adipogenic factors were measured. Expression of the genes encoding peroxisome proliferator-activated receptor gamma (PPARG), CCAAT/enhancer-binding protein alpha (CEBPA), fatty acid-binding protein 4 (FABP4), and stearoyl-CoA desaturase (SCD) were diminished by EGCG during adipogenic differentiation (P < 0.05). We also found that EGCG lowered the expression levels of the adipogenic proteins encoded by these genes (P < 0.05). EGCG induced apoptosis during adipogenic differentiation (P < 0.05). Thus, exposure to EGCG potentially inhibits adipogenesis by triggering apoptosis; the data suggest that EGCG inhibits adipogenic differentiation in BMSCs. PMID:25044539

  9. Conditioned medium as a strategy for human stem cells chondrogenic differentiation.

    PubMed

    Alves da Silva, M L; Costa-Pinto, A R; Martins, A; Correlo, V M; Sol, P; Bhattacharya, M; Faria, S; Reis, R L; Neves, Nuno M

    2015-06-01

    Paracrine signalling from chondrocytes has been reported to increase the synthesis and expression of cartilage extracellular matrix (ECM) by stem cells. The use of conditioned medium obtained from chondrocytes for stimulating stem cells chondrogenic differentiation may be a very interesting alternative for moving into the clinical application of these cells, as chondrocytes could be partially replaced by stem cells for this type of application. In the present study we aimed to achieve chondrogenic differentiation of two different sources of stem cells using conditioned medium, without adding growth factors. We tested both human bone marrow-derived mesenchymal stem cells (hBSMCs) and human Wharton's jelly-derived stem cells (hWJSCs). Conditioned medium obtained from a culture of human articular chondrocytes was used to feed the cells during the experiment. Cultures were performed in previously produced three-dimensional (3D) scaffolds, composed of a blend of 50:50 chitosan:poly(butylene succinate). Both types of stem cells were able to undergo chondrogenic differentiation without the addition of growth factors. Cultures using hWJSCs showed significantly higher GAGs accumulation and expression of cartilage-related genes (aggrecan, Sox9 and collagen type II) when compared to hBMSCs cultures. Conditioned medium obtained from articular chondrocytes induced the chondrogenic differentiation of MSCs and ECM formation. Obtained results showed that this new strategy is very interesting and should be further explored for clinical applications.

  10. Genes that integrate multiple adipogenic signaling pathways in human mesenchymal stem cells.

    PubMed

    Ito, Tomoya; Tsuruta, So; Tomita, Koki; Kikuchi, Kunio; Yokoi, Takahide; Aizawa, Yasunori

    2011-06-17

    Adipogenesis is a well-characterized cell differentiation process. A large body of evidence has revealed the core transcription factors and signaling pathways that govern adipogenesis, but cross-talks between these cellular signals and its functional consequences have not been thoroughly investigated. We, therefore, sought to identify genes that are regulated by multiple signaling pathways during adipogenesis of human mesenchymal stem cells. Focusing on the early stage of adipogenesis, microarray analysis and quantitative RT-PCR identified 12 genes whose transcription levels were dramatically affected by the complete adipogenic induction cocktail but not by the cocktail's individual components. Expression kinetics of these genes indicate diverse mechanisms of transcriptional regulation during adipogenesis. Functional relationships between these genes and adipogenic differentiation were frequently unknown. This study thus provided novel adipogenic gene candidates that likely mediate communications among multiple signaling pathways within human mesenchymal stem cells.

  11. Molecular Regulation of Adipogenesis and Potential Anti-Adipogenic Bioactive Molecules

    PubMed Central

    Moseti, Dorothy; Regassa, Alemu; Kim, Woo-Kyun

    2016-01-01

    Adipogenesis is the process by which precursor stem cells differentiate into lipid laden adipocytes. Adipogenesis is regulated by a complex and highly orchestrated gene expression program. In mammalian cells, the peroxisome proliferator-activated receptor γ (PPARγ), and the CCAAT/enhancer binding proteins (C/EBPs) such as C/EBPα, β and δ are considered the key early regulators of adipogenesis, while fatty acid binding protein 4 (FABP4), adiponectin, and fatty acid synthase (FAS) are responsible for the formation of mature adipocytes. Excess accumulation of lipids in the adipose tissue leads to obesity, which is associated with cardiovascular diseases, type II diabetes and other pathologies. Thus, investigating adipose tissue development and the underlying molecular mechanisms is vital to develop therapeutic agents capable of curbing the increasing incidence of obesity and related pathologies. In this review, we address the process of adipogenic differentiation, key transcription factors and proteins involved, adipogenic regulators and potential anti-adipogenic bioactive molecules. PMID:26797605

  12. Differentiation of mouse induced pluripotent stem cells into neurons using conditioned medium of dorsal root ganglia.

    PubMed

    Kitazawa, Ayako; Shimizu, Norio

    2011-07-01

    Mouse induced pluripotent stem (iPS) cells are known to have the ability to differentiate into various cell lineages including neurons in vitro. We have reported that chick dorsal root ganglion (DRG)-conditioned medium (CM) promoted the differentiation of mouse embryonic stem (ES) cells into motor neurons. We investigated the formation of undifferentiated iPS cell colonies and the differentiation of iPS cells into neurons using DRG-CM. When iPS cells were cultured in DMEM containing leukemia inhibitory factor (LIF), the iPS cells appeared to be maintained in an undifferentiated state for 19 passages. The number of iPS cell colonies (200 μm in diameter) was maximal at six days of cultivation and the colonies were maintained in an undifferentiated state, but the iPS cell colonies at ten days of cultivation had hollows inside the colonies and were differentiated. By contrast, the number of ES cell colonies (200 μm in diameter) was maximal at ten days of cultivation. The iPS cells were able to proliferate and differentiate easily into various cell lineages, compared to ES cells. When iPS cell colonies were cultured in a manner similar to ES cells with DMEM/F-12K medium supplemented with DRG-CM, the iPS cells mainly differentiated into motor and sensory neurons. These results suggested that the differentiation properties of iPS cells differ from those of ES cells.

  13. [The comparative evaluation of differential diagnostic characteristics of Endo growth medium of different manufacturers].

    PubMed

    Shepelin, A P; Martchikhina, I I; Polosenko, O V; Skladan, G Ye

    2013-05-01

    The article deals with the results of comparative study of differential diagnostic characteristics of Endo growth medium of different foreign manufacturers permitted to be applied in the Russian Federation and the national Endo agar. The enhanced kit of museum test-strains and clinical material from patients were used. It is established that morphology, size and number of clumps of most enterobacteria growing in Tndo medium manufactured by Merck, Pronadisa, HiMedia and the state research center of applied microbiology and biotechnology have minor morphological differences and match the characteristics declared by manufacturers. The indicator of degree of detection (degree of inoculation) of pathogenic enterobacteria from clinical material onto Endo medium manufactured by the state research center of applied microbiology and biotechnology matched the indicators of media from foreign manufacturers. It is demonstrated that Endo growth medium manufactured by the state research center of applied microbiology and biotechnology not only is equal to import analogues but in particular cases even excels them.

  14. Post-natal myogenic and adipogenic developmental

    PubMed Central

    Konings, Gonda; van Weeghel, Michel; van den Hoogenhof, Maarten MG; Gijbels, Marion; van Erk, Arie; Schoonderwoerd, Kees; van den Bosch, Bianca; Dahlmans, Vivian; Calis, Chantal; Houten, Sander M; Misteli, Tom

    2011-01-01

    A-type lamins are a major component of the nuclear lamina. Mutations in the LMNA gene, which encodes the A-type lamins A and C, cause a set of phenotypically diverse diseases collectively called laminopathies. While adult LMNA null mice show various symptoms typically associated with laminopathies, the effect of loss of lamin A/C on early post-natal development is poorly understood. Here we developed a novel LMNA null mouse (LMNAGT−/−) based on genetrap technology and analyzed its early post-natal development. We detect LMNA transcripts in heart, the outflow tract, dorsal aorta, liver and somites during early embryonic development. Loss of A-type lamins results in severe growth retardation and developmental defects of the heart, including impaired myocyte hypertrophy, skeletal muscle hypotrophy, decreased amounts of subcutaneous adipose tissue and impaired ex vivo adipogenic differentiation. These defects cause death at 2 to 3 weeks post partum associated with muscle weakness and metabolic complications, but without the occurrence of dilated cardiomyopathy or an obvious progeroid phenotype. Our results indicate that defective early post-natal development critically contributes to the disease phenotypes in adult laminopathies. PMID:21818413

  15. Hypoxia induces adipogenic differentitation of myoblastic cell lines

    SciTech Connect

    Itoigawa, Yoshiaki; Kishimoto, Koshi N.; Okuno, Hiroshi; Sano, Hirotaka; Kaneko, Kazuo; Itoi, Eiji

    2010-09-03

    Research highlights: {yields} C2C12 and G8 myogenic cell lines treated by hypoxia differentiate into adipocytes. {yields} The expression of C/EBP{beta}, {alpha} and PPAR{gamma} were increased under hypoxia. {yields} Myogenic differentiation of C2C12 was inhibited under hypoxia. -- Abstract: Muscle atrophy usually accompanies fat accumulation in the muscle. In such atrophic conditions as back muscles of kyphotic spine and the rotator cuff muscles with torn tendons, blood flow might be diminished. It is known that hypoxia causes trans-differentiation of mesenchymal stem cells derived from bone marrow into adipocytes. However, it has not been elucidated yet if hypoxia turned myoblasts into adipocytes. We investigated adipogenesis in C2C12 and G8 murine myogenic cell line treated by hypoxia. Cells were also treated with the cocktail of insulin, dexamethasone and IBMX (MDI), which has been known to inhibit Wnt signaling and promote adipogenesis. Adipogenic differentiation was seen in both hypoxia and MDI. Adipogenic marker gene expression was assessed in C2C12. CCAAT/enhancer-binding protein (C/EBP) {beta}, {alpha} and peroxisome proliferator activating receptor (PPAR) {gamma} were increased by both hypoxia and MDI. The expression profile of Wnt10b was different between hypoxia and MDI. The mechanism for adipogenesis of myoblasts in hypoxia might be regulated by different mechanism than the modification of Wnt signaling.

  16. Characterization of adipocytes derived from fibro/adipogenic progenitors resident in human skeletal muscle

    PubMed Central

    Arrighi, N; Moratal, C; Clément, N; Giorgetti-Peraldi, S; Peraldi, P; Loubat, A; Kurzenne, J-Y; Dani, C; Chopard, A; Dechesne, C A

    2015-01-01

    A population of fibro/adipogenic but non-myogenic progenitors located between skeletal muscle fibers was recently discovered. The aim of this study was to determine the extent to which these progenitors differentiate into fully functional adipocytes. The characterization of muscle progenitor-derived adipocytes is a central issue in understanding muscle homeostasis. They are considered as being the cellular origin of intermuscular adipose tissue that develops in several pathophysiological situations. Here fibro/adipogenic progenitors were isolated from a panel of 15 human muscle biopsies on the basis of the specific cell-surface immunophenotype CD15+/PDGFRα+CD56−. This allowed investigations of their differentiation into adipocytes and the cellular functions of terminally differentiated adipocytes. Adipogenic differentiation was found to be regulated by the same effectors as those regulating differentiation of progenitors derived from white subcutaneous adipose tissue. Similarly, basic adipocyte functions, such as triglyceride synthesis and lipolysis occurred at levels similar to those observed with subcutaneous adipose tissue progenitor-derived adipocytes. However, muscle progenitor-derived adipocytes were found to be insensitive to insulin-induced glucose uptake, in association with the impairment of phosphorylation of key insulin-signaling effectors. Our findings indicate that muscle adipogenic progenitors give rise to bona fide white adipocytes that have the unexpected feature of being insulin-resistant. PMID:25906156

  17. Potential role of culture mediums for successful isolation and neuronal differentiation of amniotic fluid stem cells.

    PubMed

    Orciani, M; Emanuelli, M; Martino, C; Pugnaloni, A; Tranquilli, A L; Di Primio, R

    2008-01-01

    In recent years, the use of stem cells has generated increasing interest in regenerative medicine and cancer therapies. The most potent stem cells derive from the inner cell mass during embryonic development and their use yields serious ethical and methodological problems. Recently, a number of reports suggests that another suitable source of multipotent stem cells may be the amniotic fluid. Amniotic fluid mesenchymal stem cells (AFMSCs) are capable of extensive self-renewal, able to differentiate in specialized cells representative of all three germ layers, do not show ethical restriction, and display minimal risks of teratomas and a very low immunogenity. For all these reasons, amniotic fluid appears as a promising alternative source for stem cell therapy. Their recent discovery implies a lack of knowledge of their specific features as well as the existence of a protocol universally recognized as the most suitable for their isolation, growth and long-term conservation. In this study, we isolated stem cells from six amniotic fluids; these cells were cultured with three different culture mediums (Mesenchymal Stem Cell Medium (MSCGM), PC-1 and RPMI-1640), characterized by cytofluorimetric analysis, and then either frozen or induced to neuronal differentiation. Even if the immunophenotype seemed not to be influenced by culture medium (all six samples cultured in the above-mentioned mediums expressed surface antigens commonly found on stem cells), cells showed different abilities to differentiate into neuron-like cells and to re-start the culture after short/long-term storage. Cells isolated and cultured in MSCGM showed the highest proliferation rate, and formed neuron-like cells when sub-plated with neuronal differentiation medium. Cells from PC-1, on the contrary, displayed an increased ability to re-start culture after short/long term storage. Finally, cells from RPMI-1640, even if expressing stem cells markers, were not able to differentiate in neuron-like cells

  18. Ceiling culture-derived proliferative adipocytes retain high adipogenic potential suitable for use as a vehicle for gene transduction therapy.

    PubMed

    Asada, Sakiyo; Kuroda, Masayuki; Aoyagi, Yasuyuki; Fukaya, Yoshitaka; Tanaka, Shigeaki; Konno, Shunichi; Tanio, Masami; Aso, Masayuki; Satoh, Kaneshige; Okamoto, Yoshitaka; Nakayama, Toshinori; Saito, Yasushi; Bujo, Hideaki

    2011-07-01

    Adipose tissue is expected to provide a source of proliferative cells for regenerative medicine and cell-transplantation therapies using gene transfer manipulation. We have recently identified ceiling culture-derived proliferative adipocytes (ccdPAs) from the mature adipocyte fraction as cells suitable as a therapeutic gene vehicle because of their stable proliferative capacity. In this study, we examined the capability of adipogenic differentiation of the ccdPAs compared with stromal vascular fraction (SVF)-derived progenitor cells (adipose-derived stem cells, ASCs) with regard to their multipotential ability to be converted to another lineage and therefore their potential to be used for regenerative medicine research. After in vitro passaging, the surface antigen profile and the basal levels of adipogenic marker genes of the ccdPAs were not obviously different from those of the ASCs. However, the ccdPAs showed increased lipid-droplet accumulation accompanied with higher adipogenic marker gene expression after stimulation of differentiation compared with the ASCs. The higher adipogenic potential of the ccdPAs than the ASCs from the SVF was maintained for 42 days in culture. Furthermore, the difference in the adipogenic response was enhanced after partial stimulation without indomethacin. These results indicate that the ccdPAs retain a high adipogenic potential even after in vitro passaging, thus suggesting the commitment of ccdPAs to stable mature adipocytes after autotransplantation, indicating that they may have potential for use in regenerative and gene-manipulated medicine.

  19. Identification of Vibrio proteolyticus with a differential medium and a specific probe.

    PubMed

    Muniesa-Pérez, M; Jofre, J; Blanch, A R

    1996-07-01

    A differential medium (VP8) and a specific probe, based on the variable region V3 of the 16S rRNA gene, for the detection of Vibrio proteolyticus are defined. The medium contains 8% NaCl, which allows selective growth of moderately halophilic Vibrio strains. D-Sorbitol, as the main carbon source, differentiates the species that can ferment it by the pH indicators cresol red and bromothymol blue. V. proteolyticus and 8 of 418 strains studied grew on the medium and used the D-sorbitol, forming bright yellow colonies. An oligonucleotide, based on the variable region V3 of the 16S rRNA gene (5'CGCTAACGTCAAATAATGCATCTA3'), was used as the specific probe (V3VPR). Only three strains of Vibrio sp. and one strain identified as V. natriegens cross-hybridized with the probe. However, unlike V. proteolyticus, none of the strains grew on VP8. The combined use of VP8 medium and the probe allowed an unequivocal identification of V. proteolyticus.

  20. Anti-adipogenic activity of the edible brown alga Ecklonia stolonifera and its constituent fucosterol in 3T3-L1 adipocytes.

    PubMed

    Jung, Hyun Ah; Jung, Hee Jin; Jeong, Hyun Young; Kwon, Hyun Ju; Kim, Min-Sun; Choi, Jae Sue

    2014-06-01

    Fucosterol is a sterol metabolite of brown algae and regulates genes involved with cholesterol homeostasis. As a part of our continuous search for anti-obesity agents from natural marine sources, the anti-adipogenic activities of Ecklonia stolonifera and its sterol, fucosterol, were evaluated for the inhibition of adipocyte differentiation and lipid formation. Oil Red O staining was used to evaluate triglyceride contents in 3T3-L1 pre-adipocytes primed by differentiation medium (DM) I and DM II. The methanolic extract of E. stolonifera showed strong anti-adipogenic activity, and was thus fractionated with several solvents. Among the tested fractions, the dichloromethane (CH2Cl2) fraction was found to be the most active fraction, with significant inhibition (40.5 %) of intracellular lipid accumulation at a non-toxic concentration, followed by the ethyl acetate fraction (30.2 %) at the same concentration, while the n-butanol and water fractions did not show inhibitory activity within the tested concentrations. The strong anti-adipogenic CH2Cl2-soluble fraction was further purified by a repeated chromatography to yield fucosterol. Fucosterol reduced lipid contents in a concentration-dependent manner without showing any cytotoxicity. Fucosterol treatment also yielded a decrease in the expression of the adipocyte marker proteins peroxisome proliferator-activated receptor γ (PPARγ) and CCAAT/enhancer-binding protein α (C/EBPα) in a concentration-dependent manner. Taken together, these results suggest that fucosterol inhibits expression of PPARγ and C/EBPα, resulting in a decrease of lipid accumulation in 3T3-L1 pre-adipocytes, indicating that the potential use of E. stolonifera and its bioactive fucosterol as an anti-obesity agent.

  1. Identification of the transcription factor ZEB1 as a central component of the adipogenic gene regulatory network.

    PubMed

    Gubelmann, Carine; Schwalie, Petra C; Raghav, Sunil K; Röder, Eva; Delessa, Tenagne; Kiehlmann, Elke; Waszak, Sebastian M; Corsinotti, Andrea; Udin, Gilles; Holcombe, Wiebke; Rudofsky, Gottfried; Trono, Didier; Wolfrum, Christian; Deplancke, Bart

    2014-08-27

    Adipose tissue is a key determinant of whole body metabolism and energy homeostasis. Unraveling the regulatory mechanisms underlying adipogenesis is therefore highly relevant from a biomedical perspective. Our current understanding of fat cell differentiation is centered on the transcriptional cascades driven by the C/EBP protein family and the master regulator PPARγ. To elucidate further components of the adipogenic gene regulatory network, we performed a large-scale transcription factor (TF) screen overexpressing 734 TFs in mouse pre-adipocytes and probed their effect on differentiation. We identified 22 novel pro-adipogenic TFs and characterized the top ranking TF, ZEB1, as being essential for adipogenesis both in vitro and in vivo. Moreover, its expression levels correlate with fat cell differentiation potential in humans. Genomic profiling further revealed that this TF directly targets and controls the expression of most early and late adipogenic regulators, identifying ZEB1 as a central transcriptional component of fat cell differentiation.

  2. Tributyltin affects adipogenic cell fate commitment in mesenchymal stem cells by a PPARγ independent mechanism.

    PubMed

    Biemann, Ronald; Fischer, Bernd; Blüher, Matthias; Navarrete Santos, Anne

    2014-05-05

    The food contaminant tributyltin (TBT) is an endocrine disrupting compound (EDC) promoting adipogenic differentiation in vitro and in vivo. Although prenatal TBT exposure has been shown to induce obesity, the underlying mechanisms and the role of the transcription factor PPARγ are not clarified yet. At different stages of adipogenesis, multipotent murine mesenchymal stem cells (MSC), C3H10T1/2, were exposed to TBT and analyzed for adipogenic differentiation, PPARγ promoter activation and PPARγ1, PPARγ2, Pref-1 and SOX9 expression. Depending on the exposure window, TBT promoted subsequent adipogenesis independently and dependently from PPARγ. In undifferentiated MSC, TBT exposure induced a transcriptional PPARγ-independent repression of Pref-1 and SOX9, which are both suppressors of adipogenic cell fate commitment. During hormonal induction TBT additionally enhanced adipogenic differentiation by PPARγ signaling. The impact of TBT on early cell fate development documents a novel mechanistic insight in the development of adipocytes derived from MSC and its susceptibility to EDC.

  3. Supplementation of strontium to a chondrogenic medium promotes chondrogenic differentiation of human dedifferentiated fat cells.

    PubMed

    Okita, Naoya; Honda, Yoshitomo; Kishimoto, Naotaka; Liao, Wen; Azumi, Eiko; Hashimoto, Yoshiya; Matsumoto, Naoyuki

    2015-05-01

    Dedifferentiated fat cells (DFAT cells) isolated from adipose tissue have been demonstrated to differentiate into chondrogenic cells in vitro. Nevertheless, an efficient method to facilitate its chondrogenic differentiation is still unexplored, hampering the extensive application of these cells in cartilage regeneration therapies. Here we provide the evidence that supplementation of strontium ions (Sr) in a chondrogenic medium (CM) significantly promotes early chondrogenic differentiation of DFAT cells. Human DFAT cells and the mesenchymal stem cell line (RCB2153) were subjected to the CM supplemented with/without Sr. After 14 days, alcian blue staining intensity significantly increased in DFAT cells, but not in RCB2153, subjected to CM with Sr. mRNA expression analysis revealed that the CM with 1.5 mM Sr increased the expression of chondrogenic marker, collagen type 2 alpha 1, whereas there was no significant change in osteogenic markers, collagen type 1 alpha 1, runt-related transcription factor 2, and osteocalcin, and hypertrophic chondrogenic marker, collagen type 10 alpha 1. Inhibitors for extracellular signal-regulated kinase 1/2 (ERK1/2), Akt, and calcium-sensing receptor (CaSR) pathways significantly diminished the alcian blue staining intensity, providing the first evidence that these signal pathways are associated with chondrogenic differentiation of DFAT cells. CaSR and ERK1/2 pathways independently induced Sr-mediated early chondrogenic differentiation. These results suggest that Sr supplementation into the CM may provide a powerful platform for preparing chondrogenically differentiated DFAT cells for cartilage regeneration.

  4. Development and evaluation of a selective and differential medium for the primary isolation of Peptostreptococcus micros.

    PubMed

    Turng, B F; Guthmiller, J M; Minah, G E; Falkler, W A

    1996-10-01

    Peptostreptococcus micros, an anaerobic gram-positive coccus, has been associated with periodontal and endodontic lesions, including those refractory to treatment, as well as many human polymicrobial infections in other body locations. A selective and differential medium for the primary isolation of P. micros was developed and evaluated. Columbia CNA agar, a selective medium for gram-positive cocci, was supplemented with glutathione and lead acetate (P. micros medium: PMM). P. micros has a characteristic of rapidly utilizing the reduced form of glutathione to form hydrogen sulfide, which reacts with lead acetate producing a black precipitate in the medium. When grown on PMM, P. micros can be easily identified by its typical colonial morphology and the presence of a black precipitate directly under the colony. PMM was compared for the growth of P. micros with phenylethyl alcohol agar (PEA) and Columbia base medium (CBM) with 80 strains of P. micros and 30 strains of other gram-positive cocci. All P. micros isolates tested grew and showed the typical morphology of P. micros on PMM. Using colony counts on CBM as controls, there was an average 81.8% recovery in the number of P. micros colonies on PMM, in contrast to an average 6.1% recovery on PEA. Subgingival plaque and tongue samples from 12 adult periodontitis and 6 early-onset periodontitis patients were cultured onto PMM for the isolation of P. micros. P. micros was isolated on PMM and identified biochemically and enzymatically from both adult periodontitis and early-onset periodontitis patients with higher percentages isolated from the diseased periodontal pockets of adult periodontitis patients; furthermore, this is the first isolation of P. micros from tongue samples taken from periodontally diseased patients. This medium in cultural studies will further our understanding and assist future investigations of P. micros involved in disease processes.

  5. p130/p107 expression distinguishes adipogenic potential in primary myoblasts based on age.

    PubMed

    Guan, Yu; Taylor-Jones, Jane M; Peterson, Charlotte A; McGehee, Robert E

    2002-09-06

    Recent investigations have provided significant evidence that many mesodermally derived tissues contain stem cell-like precursors capable of being stimulated to undergo differentiation into a variety of cellular lineages. We have recently reported that primary myoblasts isolated from 23-month-old mice have an increased adipogenic potential when compared to their 8-month-old counterparts. To further characterize the degree of adipocyte differentiation in these myoblasts, we examined early and late markers of adipocyte differentiation. Within the first 24h of adipocyte differentiation, expression of p130 and p107, two members of the retinoblastoma tumor suppressor gene family, are regulated and this event is an important one early in adipogenesis. Consistent with the increased adipogenic potential of the older myoblasts and in contrast to the younger cells, the p130:p107 pattern of expression is very similar to that observed in adipogenesis where there is a transient increase in p107 expression accompanied by a decrease in p130 expression. Interestingly, while these older cells accumulated lipid and expressed genes associated with lipid metabolism, they failed to express adipsin and leptin, two well-established markers of terminal adipocyte differentiation. These results suggest that older myoblasts are capable of initiating and progressing through the adipogenic program to a point where they express genes associated with lipid metabolism, but do not reach a terminally differentiated state. This finding may have important metabolic implications in the aging population.

  6. Optical scatter patterns facilitate rapid differentiation of Enterobacteriaceae on CHROMagar™ Orientation medium.

    PubMed

    Singh, Atul K; Bhunia, Arun K

    2016-01-01

    Enterobacteriaceae family comprised pathogens and commensals and has a significant impact on food safety and public health. Enterobacteriaceae is often enumerated and presumptively identified on chromogenic media, such as CHROMagar(TM) Orientation medium based on colony profile; however, classification is highly arbitrary, and some could not be differentiated due to similar chromogen production. Here, we investigated the ability of the laser optical sensor, BARDOT (bacterial rapid detection using optical scattering technology) for rapid screening and differentiation of colonies of the major bacterial genera from Enterobacteriaceae on CHROMagar(TM) Orientation. A total of 36 strains representing 12 genera and 15 species were used to generate colony scatter image library that comprised 1683 scatter images. This library was used to differentiate mixed cultures of Enterobacteriaceae family - Klebsiella pneumoniae, Enterobacter spp., Citrobacter freundii and Serratia marcescens (KECS group); Proteus mirabilis, Morganella morganii and Providencia rettgeri (PMP group); and non-Enterobacteriaceae family: Pseudomonas aeruginosa, Acinetobacter spp. and Staphylococcus aureus (PAS group) - and data show high accuracy (83-100%) for intra-group classification of colonies in 10-22 h or even before visible production of chromogens. BARDOT successfully differentiated the major genera, including the ones that do not produce visually distinguishable chromogens on CHROMagar(TM) Orientation, providing a label-free, real-time on-plate colony screening tool for Enterobacteriaceae.

  7. Polychlorinated biphenyl 153 in lipid medium modulates differentiation of human adipocytes.

    PubMed

    Mullerova, D; Pesta, M; Dvorakova, J; Cedikova, M; Kulda, V; Dvorak, P; Bouchalová, V; Kralickova, M; Babuska, V; Kuncova, J; Langmajerova, J; Muller, L

    2017-04-12

    Emerging evidence indicates that polychlorinated biphenyls (PCBs) are involved in the development of diabetes mellitus in the obese. The purpose of this study was to determine mechanisms by which PCB 153 (2,2´,4,4´,5,5´-hexachlorobiphenyl) could influence diet-induced obesity and insulin resistance during adipogenesis. Lineage of h-ADMSCs was differentiated either as control (differentiation medium only), or with lipid vehicle modelling high fat nutrition (NuTRIflex) or lipid free vehicle (dimethylsulfoxide) for 28 days with or without PCB 153 daily co-exposure (in three concentrations 0.1, 1, and 10 microM). Gene expression analyses were performed using RT-qPCR at days 4, 10, 21, 24, 28; protein levels Akt and phosphorylated Akt (Phospho-Akt) by Western blot at days 4, and 21. PCB 153 treatment of h-ADMSCs only in lipid vehicle was associated with down regulation of key master genes of adipogenesis: PPARgamma, SREBP-1, PPARGC1B, and PLIN2 during the whole process of differentiation; and with increased Akt and decreased Phospho-Akt protein level at day 21. We have shown that PCB 153, in concentration 0.1 microM, has a potential in lipid rich environment to modulate differentiation of adipocytes. Because European and U.S. adults have been exposed to PCB 153, this particular nutrient-toxicant interaction potentially impacts human obesity and insulin sensitivity.

  8. Development of a differential medium for bile salt hydrolase-active Lactobacillus spp.

    PubMed Central

    Dashkevicz, M P; Feighner, S D

    1989-01-01

    An agar plate assay was developed to detect bile salt hydrolase activity in lactobacilli. On Lactobacillus-selective MRS or Rogosa SL medium supplemented with taurodeoxycholic, taurocholic, or taurochenodeoxycholic acids, bile salt hydrolysis was manifested at two intensities: (i) the formation of precipitate halos around colonies or (ii) the formation of opaque granular white colonies. Sixty-six lactobacilli were tested for bile salt hydrolase activity by both the plate assay and a sensitive radiochemical assay. No false-positive or false-negative results were detected by the plate assay. Based on results of experiments with Eubacterium lentum and Bacteroides species, the plate assay was dependent on two factors: (i) the presence of bile salt hydrolytic activity and (ii) the ability of the organism to sufficiently acidify the medium to protonate free bile acids. The availability of a differential medium for determination of bile salt hydrolase activity will provide a rapid method for determining shifts in a specific functional activity of intestinal Lactobacillus species and provide a rapid screening capability for identifying bile salt hydrolase-deficient mutants. The latter application should allow bile salt hydrolase activity to be used as a marker enzyme in genetic experiments. Images PMID:2705765

  9. Potentiation of osteoclastogenesis by adipogenic conversion of bone marrow-derived mesenchymal stem cells.

    PubMed

    Mori, Keisuke; Suzuki, Keiji; Hozumi, Akira; Goto, Hisataka; Tomita, Masato; Koseki, Hironobu; Yamashita, Shunichi; Osaki, Makoto

    2014-01-01

    Bone marrow-derived mesenchymal stem cells (BMSCs) are the indispensable component of the bone marrow, being the common precursors for adipocytes and osteoblasts. We show here that adipogenic differentiation resulted in increase in the production of adipocyte markers, such as adiponectin,fatty-acid binding proteins (FABP4), peroxisome proliferator-activated receptor γ (PPARγ), as well as the receptor activator of nuclear-κB ligand (RANKL). Co-culture of osteoclast precursors (OCPs) with BMSCs-derived adipocytes significantly enhanced osteoclast differentiation with low-dose RANKL, whose levels alone could not promote osteoclastogenesis. These results demonstrate for the first time that adipogenic differentiation of BMSCs plays a pivotal role in maintaining bone homeostasis.

  10. Porcine tooth germ cell conditioned medium can induce odontogenic differentiation of human dental pulp stem cells.

    PubMed

    Wang, Yin-Xiong; Ma, Zhao-Feng; Huo, Na; Tang, Liang; Han, Chun; Duan, Yin-Zhong; Jin, Yan

    2011-05-01

    It is suggested that the differentiation of tooth-derived stem cells is modulated by the local microenvironment in which they reside. Previous studies have indicated that tooth germ cell-conditioned medium (TGC-CM) holds the potential to induce dental pulp stem cells (DPSCs) to differentiate into the odontogenic lineage. Nevertheless, human TGC-CM (hTGC-CM) is not feasible in practical application, so we conjectured that xenogenic TGC-CM might exert a similar influence on human dental stem cells. In this study, we chose swine as the xenogenic origin and compared the effect of porcine tooth germ cell-conditioned medium (pTGC-CM) with its human counterpart on human DPSCs. Morphological appearance, colony-forming assay, in vitro multipotential ability, protein and gene expression of the odontogenic phenotype and the in vivo differentiation capacity of DPSCs were evaluated. The results showed that pTGC-CM exerted a similar effect to hTGC-CM in inducing human DPSCs to present odontogenic changes, which were indicated by remarkable morphological changes, higher multipotential capability and the expression of some odontogenic markers in gene and protein levels. Besides, the in vivo results showed that pTGC-CM-treated DPSCs, similar to hTGC-CM-treated DPSCs, could form a more regular dentine-pulp complex. Our data provided the first evidence that pTGC-CM is able to exert almost the same effect on DPSCs with hTGC-CM. The observations suggest that the application of xenogenic TGC-CM may facilitate generating bioengineered teeth from tooth-derived stem cells in future.

  11. CHROMagar Candida, a new differential isolation medium for presumptive identification of clinically important Candida species.

    PubMed Central

    Odds, F C; Bernaerts, R

    1994-01-01

    CHROMagar Candida is a novel, differential culture medium that is claimed to facilitate the isolation and presumptive identification of some clinically important yeast species. We evaluated the use of this medium with 726 yeast isolates, including 82 isolated directly on the medium from clinical material. After 2 days of incubation at 37 degrees C, 285 C. albicans isolates gave distinctive green colonies that were not seen with any of 441 other yeast isolates representing 21 different species. A total of 54 C. tropicalis isolates also developed distinctive dark blue-gray colonies with a halo of dark brownish purple in the surrounding agar. C. krusei isolates (n = 43) also formed highly characteristic rough, spreading colonies with pale pink centers and a white edge that was otherwise encountered only rarely with isolates of C. norvegensis. Trichosporon spp. (n = 34) formed small, pale colonies that became larger and characteristically rough with prolonged incubation. Most of the other 310 yeasts studied formed colonies with a color that ranged from white to pink to purple with a brownish tint. The only exceptions were found among isolates identified as Geotrichum sp. or Pichia sp., some of which formed colonies with a gray to blue color and which in two instances formed a green pigment or a dark halo in the agar. The specificity and sensitivity of the new medium for the presumptive identification of C. albicans, C. krusei, and C. tropicalis exceeded 99% for all three species. A blinded reading test involving four personnel and 57 yeast isolates representing nine clinically important species confirmed that colonial appearance after 48 h of incubation on CHROMagar Candida afforded the correct presumptive recognition of C. albicans, C. tropicalis, C, krusei, and Trichosporon spp. None of nine bacterial isolates grew on CHROMagar Candida within 72 h, and bacteria (Escherichia coli) grew from only 4 of 104 vaginal, 100 oral, and 99 anorectal swabs. The new medium

  12. The anti-adipogenic effect of angiotensin II on human preadipose cells involves ERK1,2 activation and PPARG phosphorylation.

    PubMed

    Fuentes, Paula; Acuña, María José; Cifuentes, Mariana; Rojas, Cecilia V

    2010-07-01

    Despite the importance of adipocyte formation for adipose tissue physiology, current knowledge about the mechanisms that regulate the recruitment of progenitor cells to undergo adipogenic differentiation is limited. A role for locally generated angiotensin II emerged from studies with human and murine cells. Preadipose cells from different human fat depots show reduced response to adipogenic stimuli when exposed to angiotensin II. This investigation sought to gain an insight into the intracellular mechanisms involved in the anti-adipogenic response of human preadipose cells from omental fat to angiotensin II. Its effect was evaluated on cells stimulated to adipogenic differentiation in vitro, by assessment of glycerol-3-phosphate dehydrogenase activity and expression of early markers of adipogenesis. Extracellular signal-regulated kinase(1,2) (ERK(1,2)) pathway activation was inferred from the phosphorylated to total ERK(1,2) ratio determined by western blot. Exposure to angiotensin II throughout the 10-day differentiation period resulted in a reduced adipogenic response. A similar anti-adipogenic effect was observed when this hormone was present during the first 48 h of induction to differentiation. Angiotensin II treatment had no consequences on CCAAT/enhancer-binding protein beta and peroxisome proliferator-activated receptor gamma (PPARG) induction, but increased the phosphorylated form of the key adipogenic regulator PPARG. Upon angiotensin II exposure, a raise of phosphorylated ERK(1,2) was determined, which was more prominent 8-20 h after induction of adipogenesis (when controls reached negligible values). Chemical inhibition of ERK(1,2) phosphorylation prevented angiotensin II-dependent reduction in adipogenesis. These results support the participation of the mitogen-activated protein kinase/ERK(1,2) pathway in the anti-adipogenic effect of angiotensin II on preadipose cells from human omental adipose tissue.

  13. Nutritional milieu of isolated stromal vascular cells determines their proliferative, adipogenic, and lipogenic capacity in vitro

    PubMed Central

    Kadegowda, Anil K G; Wright, Asher; Duckett, Susan K

    2014-01-01

    The objective was to determine the effect of nutritional milieu of isolated stromal vascular (SV) cells on proliferative capacity of preadipocytes, and adipogenic and lipogenic capacity in adipocytes in vitro. Proliferation of the preadipocytes increased over time with 48 and 72 h being greater than 24 h; however, preadipocytes from steers supplemented with corn (LC) had lower proliferation rates compared with those without corn grain supplementation (L) at 72 h. Adipocyte cultures isolated from LC group had higher mean diameter on d 4 and 6, and higher mean volume on d 0, 4, 6, and 12 of culture. Adipocytes from steers supplemented with corn grain (LC) had lower expression of key adipogenic genes during extended days in culture. The results show that prior nutritional treatment of the donor animal used to isolate SV cultures alters their proliferative, adipogenic, and lipogenic capacity in culture. These differences may be related to lower induction/expression of AP2 gene in the adipose cultures from corn supplemented group. Corn grain supplementation to steers grazing legumes could have stimulated more active adipogenic progenitor cells to differentiate, which would leave fewer behind in the SV pool for subsequent isolation. PMID:26317055

  14. The effects of retinoic acid on reversing the adipocyte differentiation into an osteoblastic tendency in ST2 cells, a murine bone marrow-derived stromal cell line.

    PubMed

    Ding, J; Woo, J T; Nagai, K

    2001-07-01

    Although the mouse bone marrow stromal cell line ST2 has been known to be differentiated into osteoblasts, the differentiation characteristics of the cell into adipocyte and the concerned relationship between its adipogenesis and osteogenesis remains unknown. The adipogenic induction medium which is made up of insulin, dexamethasone (DEX) and 3-isobutyl-1-methylxanthine(IBMX), stimulated the expression of n early adipogenic marker PPAR gamma and a late marker GPDH in ST2 cells. The triglyceride accumulation and lipid stain level generated by the induction medium in ST2 cells was inhibited by RA with IC(50) at about 1 nM. The induction medium up-regulated expression of PPARgamma and GPDH was also inhibited by RA whereas RA (30 nM) exterted no effect on the cell growth. Interestingly, treatment of the cells with induction medium in the presense of RA caused a 3- or 10-fold higher in ALP activity respectively as compared to those treated with RA or the induction medium alone. RT-PCR analysis showed that such a synergistic effect of RA and the induction medium paralleled the process of inhibition on adipogenesis. Additional experiments showed that IBMX played a key role in increasing the effect of RA and ALP activity. Our results suggested that the relationship between adipogenesis and osteogenesis in ST2 cells was reciprocally interrelated and the process of adipogenesis could be potentially reversed into an osteoblastogenic tendency. This is the first report demonstrating that RA transforms adipogenic potential into an osteoblastic tendency.

  15. Antiadipogenic effects of subthermal electric stimulation at 448 kHz on differentiating human mesenchymal stem cells

    PubMed Central

    HERNÁNDEZ-BULE, MARÍA LUISA; MARTÍNEZ-BOTAS, JAVIER; TRILLO, MARÍA ÁNGELES; PAÍNO, CARLOS L; ÚBEDA, ALEJANDRO

    2016-01-01

    The 448 kHz capacitive-resistive electric transfer (CRET) is an electrothermal therapy currently applied in anticellulite and antiobesity treatments. The aim of the present study was to determine whether exposure to the CRET electric signal at subthermal doses affected early adipogenic processes in adipose-derived stem cells (ADSC) from human donors. ADSC were incubated for 2 or 9 days in the presence of adipogenic medium, and exposed or sham-exposed to 5 min pulses of 448 kHz electric signal at 50 µA/mm2 during the last 48 h of the incubation. Colorimetric, immunofluorescence, western blotting and reverse transcription-quantitative polymerase chain reaction assays were performed to assess adipogenic differentiation of the ADSC. Electric stimulation significantly decreased cytoplasmic lipid content, after both 2 and 9 days of differentiation. The antiadipogenic response in the 9 day samples was accompanied by activation of mitogen-activated protein kinase kinase 1/2, decreased expression and partial inactivation of peroxisome proliferator-activated receptor (PPAR) γ, which was translocated from the nucleus to the cytoplasm, together with a significant decrease in the expression levels of the PPARG1 gene, perilipin, angiopoietin-like protein 4 and fatty acid synthase. These results demonstrated that subthermal stimulation with CRET interferes with the early adipogenic differentiation in ADSC, indicating that the electric stimulus itself can modulate processes controlling the synthesis and mobilization of fat, even in the absence of the concomitant thermal and mechanical components of the thermoelectric therapy CRET. PMID:27035334

  16. Macromolecular crowding amplifies adipogenesis of human bone marrow-derived mesenchymal stem cells by enhancing the pro-adipogenic microenvironment.

    PubMed

    Ang, Xiu Min; Lee, Michelle H C; Blocki, Anna; Chen, Clarice; Ong, L L Sharon; Asada, H Harry; Sheppard, Allan; Raghunath, Michael

    2014-03-01

    The microenvironment plays a vital role in both the maintenance of stem cells in their undifferentiated state (niche) and their differentiation after homing into new locations outside this niche. Contrary to conventional in-vitro culture practices, the in-vivo stem cell microenvironment is physiologically crowded. We demonstrate here that re-introducing macromolecular crowding (MMC) at biologically relevant fractional volume occupancy during chemically induced adipogenesis substantially enhances the adipogenic differentiation response of human bone marrow-derived mesenchymal stem cells (MSCs). Both early and late adipogenic markers were significantly up-regulated and cells accumulated 25-40% more lipid content under MMC relative to standard induction cocktails. MMC significantly enhanced deposition of extracellular matrix (ECM), notably collagen IV and perlecan, a heparan sulfate proteoglycan. As a novel observation, MMC also increased the presence of matrix metalloproteinase -2 in the deposited ECM, which was concomitant with geometrical ECM remodeling typical of adipogenesis. This suggested a microenvironment that was richer in both matrix components and associated ligands and was conducive to adipocyte maturation. This assumption was confirmed by seeding undifferentiated MSCs on decellularized ECM deposited by adipogenically differentiated MSCs, Adipo-ECM. On Adipo-ECM generated under crowding, MSCs differentiated much faster under a classical differentiation protocol. This was evidenced throughout the induction time course, by a significant up-regulation of both early and late adipogenic markers and a 60% higher lipid content on MMC-generated Adipo-ECM in comparison to standard induction on tissue culture plastic. This suggests that MMC helps build and endow the nascent microenvironment with adipogenic cues. Therefore, MMC initiates a positive feedback loop between cells and their microenvironment as soon as progenitor cells are empowered to build and shape it

  17. Enamel Matrix Derivative has No Effect on the Chondrogenic Differentiation of Mesenchymal Stem Cells

    PubMed Central

    Groeneveldt, Lisanne C.; Knuth, Callie; Witte-Bouma, Janneke; O’Brien, Fergal J.; Wolvius, Eppo B.; Farrell, Eric

    2014-01-01

    Background: Treatment of large bone defects due to trauma, tumor resection, or congenital abnormalities is challenging. Bone tissue engineering using mesenchymal stem cells (MSCs) represents a promising treatment option. However, the quantity and quality of engineered bone tissue are not sufficient to fill large bone defects. The aim of this study was to determine if the addition of enamel matrix derivative (EMD) improves in vitro chondrogenic priming of MSCs to ultimately improve in vivo MSC mediated endochondral bone formation. Methods: MSCs were chondrogenically differentiated in 2.0 × 105 cell pellets in medium supplemented with TGFβ3 in the absence or presence of 1, 10, or 100 μg/mL EMD. Samples were analyzed for gene expression of RUNX2, Col II, Col X, and Sox9. Protein and glycoaminoglycan (GAG) production were also investigated via DMB assays, histology, and immunohistochemistry. Osteogenic and adipogenic differentiation capacity were also assessed. Results: The addition of EMD did not negatively affect chondrogenic differentiation of adult human MSCs. EMD did not appear to alter GAG production or expression of chondrogenic genes. Osteogenic and adipogenic differentiation were also unaffected though a trend toward decreased adipogenic gene expression was observed. Conclusion: EMD does not affect chondrogenic differentiation of adult human MSCs. As such the use of EMD in combination with chondrogenically primed MSCs for periodontal bone tissue repair is unlikely to have negative effects on MSC differentiation. PMID:25229057

  18. Regulation of Adipogenesis and Key Adipogenic Gene Expression by 1, 25-Dihydroxyvitamin D in 3T3-L1 Cells.

    PubMed

    Ji, Shuhan; Doumit, Matthew E; Hill, Rodney A

    2015-01-01

    The functions of 1, 25-dihydroxyvitamin D (1, 25-(OH)2D3) in regulating adipogenesis, adipocyte differentiation and key adipogenic gene expression were studied in 3T3-L1 preadipocytes. Five concentrations (0.01, 0.1, 1, 10, 100 nM) of 1, 25-(OH)2D3 were studied and lipid accumulation measured by Oil Red O staining and expression of adipogenic genes quantified using quantitative real-time PCR. Adipogenic responses to 1, 25-(OH)2D3 were determined on 6, and 12 h, and days 1-10 after induction of adipogenesis by a hormonal cocktail with or without 1, 25-(OH)2D3. In response to 1, 25-(OH)2D3 (1, 10, and 100 nM), lipid accumulation and the expression of PPARγ, C/EBPα, FABP4 and SCD-1 were inhibited through day 10, and vitamin D receptor expression was inhibited in the early time points. The greatest inhibitory effect was upon expression of FABP4. Expression of SREBP-1c was only affected on day 2. The lowest concentrations of 1, 25-(OH)2D3 tested did not affect adipocyte differentiation or adipogenic gene expression. The C/EBPα promoter activity response to 1, 25-(OH)2D3 was also tested, with no effect detected. These results indicate that 1, 25-(OH)2D3 inhibited adipogenesis via suppressing adipogenic-specific genes, and is invoked either during PPARγ activation or immediately up-stream thereof. Gene expression down-stream of PPARγ especially FABP4 was strongly inhibited, and we suggest that the role of 1, 25-(OH)2D3 in regulating adipogenesis will be informed by further studies of adipogenic-specific gene promoter activity.

  19. Dissecting the brown adipogenic regulatory network using integrative genomics

    PubMed Central

    Pradhan, Rachana N.; Bues, Johannes J.; Gardeux, Vincent; Schwalie, Petra C.; Alpern, Daniel; Chen, Wanze; Russeil, Julie; Raghav, Sunil K.; Deplancke, Bart

    2017-01-01

    Brown adipocytes regulate energy expenditure via mitochondrial uncoupling, which makes them attractive therapeutic targets to tackle obesity. However, the regulatory mechanisms underlying brown adipogenesis are still poorly understood. To address this, we profiled the transcriptome and chromatin state during mouse brown fat cell differentiation, revealing extensive gene expression changes and chromatin remodeling, especially during the first day post-differentiation. To identify putatively causal regulators, we performed transcription factor binding site overrepresentation analyses in active chromatin regions and prioritized factors based on their expression correlation with the bona-fide brown adipogenic marker Ucp1 across multiple mouse and human datasets. Using loss-of-function assays, we evaluated both the phenotypic effect as well as the transcriptomic impact of several putative regulators on the differentiation process, uncovering ZFP467, HOXA4 and Nuclear Factor I A (NFIA) as novel transcriptional regulators. Of these, NFIA emerged as the regulator yielding the strongest molecular and cellular phenotypes. To examine its regulatory function, we profiled the genomic localization of NFIA, identifying it as a key early regulator of terminal brown fat cell differentiation. PMID:28181539

  20. Osteogenic and adipogenic potential of porcine adipose mesenchymal stem cells.

    PubMed

    Qu, Chang-qing; Zhang, Guo-hua; Zhang, Li-jie; Yang, Gong-she

    2007-02-01

    Human, rat, and mouse studies have demonstrated the existence of a population of adipose mesenchymal stem cells (AMSCs) that can undergo multilineage differentiation in vitro. Understanding the clinical potential of AMSCs may require their use in preclinical large-animal models such as pigs. Thus, the objectives of this study were to establish a protocol for the isolation of porcine AMSCs from adipose tissue and to examine their ex vivo differentiation potential to adipocytes and osteoblast. The porcine AMSCs from passage 4 were selected for differentiation analysis. The adipocytes were identified morphologically by staining with Oil Red O, and the adipogenic marker genes were examined by RT-PCR technique. Osteogenic lineage was documented by deposition of calcium stained with Alzarin Red S, visualization of alkaline phosphatase activity, and expression of marker gene. Our result indicates that porcine AMSCs have been successfully isolated and induced differentiation into adipocytes and osteoblasts. This study suggested that porcine AMSCs are also a valuable model system for the study on the mesenchymal lineages for basic research and tissue engineering.

  1. Renal differentiation of Mesenchymal stem cells seeded on nanofibrous scaffolds improved by Human renal tubular cell lines conditioned medium.

    PubMed

    Ardeshirylajimi, Abdolreza; Vakilian, Saeid; Salehi, Mohammad

    2016-11-09

    Kidney injuries and renal dysfunctions are one of the most important clinical problems and tissue engineering could be a valuable method for solving it. The objective of this study was to investigate the synergistic effect of renal cell line conditioned medium and Polycaprolactone nanofibers on renal differentiation of human mesenchymal stem cells. In the present study, after stem cells isolation and characterization, Polycaprolactone nanofibrous scaffold was fabricated using electrospinning methods and characterized morphologically, mechanically and biocompatibility. And then the renal differentiation of seeded mesenchymal stem cells on the surface of Polycaprolactone nanofibers with and without human renal tubular cell lines conditioned medium was investigated by evaluation of eight important renal related genes expression by Real-time RT-PCR and immunocytochemistry. Fabricated nanofibrous scaffolds were good in all characterized items. Almost highest expression of all genes was detected in stem cells seeded on Polycaprolactone under conditioned media in comparison with the stem cells seeded on Polycaprolactone, tissue culture polystyrene under renal induction medium and tissue culture polystyrene under conditioned medium. According to the results, Polycaprolactone nanofibers in contribution with conditioned medium can provide the optimal conditions for renal differentiation of mesenchymal stem cells and could be a promising candidate for renal tissue engineering application.

  2. Sporothrix schenckii Sensu Lato identification in fragments of skin lesion cultured in NNN medium for differential diagnosis of cutaneous leishmaniasis.

    PubMed

    Antonio, Liliane de Fátima; Pimentel, Maria Inês Fernandes; Lyra, Marcelo Rosandiski; Madeira, Maria de Fátima; Miranda, Luciana de Freitas Campos; Paes, Rodrigo Almeida; Brito-Santos, Fábio; Carvalho, Maria Helena Galdino Figueredo; Schubach, Armando de Oliveira

    2017-02-01

    Eighty-nine patients with clinical suspicion of leishmaniasis were referred for differential diagnosis. Sporothrix schenckii sensu lato was isolated in Novy-MacNeal-Nicolle + Schneider media in 98% of 64 patients with final diagnosis of sporotrichosis. This medium may be suitable for diagnosis of sporotrichosis in areas where cutaneous leishmaniasis is also endemic.

  3. Differentiation of human CD14+ monocytes: an experimental investigation of the optimal culture medium and evidence of a lack of differentiation along the endothelial line

    PubMed Central

    Safi, Wajima; Kuehnl, Andreas; Nüssler, Andreas; Eckstein, Hans-Henning; Pelisek, Jaroslav

    2016-01-01

    The aim of this study was to determine the optimal culturing media for human CD14+ monocytes and to evaluate whether these cells are capable of differentiating into vascular endothelial cells. Human monocytes isolated from peripheral blood were cultured for 1, 3, 7, 10 or 14 days in different media containing either 10% fetal bovine serum (FBS), 10% autologous donor serum (Auto), 10% FBS with interleukin-3 and macrophage colony stimulating factor (FBS-WF) or 10% Auto and the same growth factors (AU-WF). The cells were differentiated using endothelial cell conditioning medium (EC). Viability was measured using the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay, and the cells were characterized by histology, immunohistochemistry and western blot analysis. Monocytes treated with Auto, FBS-WF or AU-WF medium generated a significant higher yield of vital cells after 7 days in culture compared with FBS-only medium (mean difference (MD)=0.318, P=0.01; MD=1.83, P=0.04; or MD=0.271, P=0.01 and MD=0.318, P=0.102). All tested media led to the differentiation of monocytes into macrophages, identified by CD68, especially in the FBS-WF medium (MD=+18.3% P=0.04). Differentiation into ECs caused a significant decrease in cell viability in all media. Endothelial cell markers, including CD31, CD144, VEGF, VEGF-R2 and CD34, could not be detected. Autologous serum significantly increases the yield of monocyte-derived cells with a higher effectiveness than commonly used FBS-only serum. There is no further benefit in culturing monocytes longer than 7 days. The cultivation of monocytes in the tested media leads preferentially to differentiation into macrophages. Differentiation into endothelial cells did not take place. PMID:27080367

  4. Maternal Plane of Nutrition During Late-Gestation and Weaning Age Alter Steer Calf Longissimus Muscle Adipogenic MicroRNA and Target Gene Expression.

    PubMed

    Moisá, Sonia J; Shike, Daniel W; Shoup, Lindsay; Loor, Juan J

    2016-01-01

    The main objective was to evaluate if different planes of maternal nutrition during late gestation and weaning age alter microRNA (miRNA) and target gene expression in offspring longissimus muscle (LM). Early (EW) and normal weaned (NW) Angus × Simmental calves (n = 30) born to cows that were grazing endophyte-infected tall fescue and red clover pastures with no supplement [low plane of nutrition (LPN)], or supplemented with 2.3 and 9.1 kg of dried distiller's grains with solubles and soy hulls [medium and high plane of nutrition (MPN, HPN), respectively] during the last 105 ± 11 days of gestation were used. Biopsies of LM were harvested at 78 (early weaning), 187 (normal weaning) and 354 days of age. Results indicate a role of pro-adipogenic miRNA in the control of adipogenesis in LM of NW-MPN steers between 78 and 187 days of age through upregulation of (1) miR-103 which inhibits CAV1, a protein that destabilizes INSR and leads to insulin resistance; (2) miR-143 which inhibits DLK1, a protein that inhibits adipocyte differentiation; and (3) miR-21 which impairs TGFBR2-induced inhibition of adipocyte differentiation. Among the studied anti-adipogenic miRNA, cow plane of nutrition resulted in downregulation of miR-34a expression in MPN steers compared with HPN and LPN at 78 days of age. Data for miR-34a provided a potential sign of epigenetic regulation of LM in beef offspring due to the cow plane of nutrition during late gestation.

  5. The Polymyxin Ceftazidime Oxford Medium as an alternative selective and differential medium for isolation of Listeria monocytogenes from raw or unpasteurized food.

    PubMed

    Martínez-Gonzáles, N E; Martínez-Chávez, L; Martínez-Cárdenas, C; Cabrera-Díaz, E; Castillo, A

    2014-04-01

    The Polymyxin Ceftazidime Oxford Medium (PCOM) was developed to recover Listeria monocytogenes from raw or unpasteurized foods. It contains esculin-ferric ammonium citrate as indicator system for Listeria growth, and ceftazidime and polymyxin B as selective agents, which are available in several Latin American countries. Comparison of PCOM, Modified Oxford Medium (MOX) and Tryptic Soy agar with 0.6% yeast extract (TSAYE) indicated that both selective media were equally effective at recovering four individual strains of L. monocytogenes (Scott A, V7, California and broccoli), and a mixture of these strains (LMM) (P > 0.05). The ability of PCOM, MOX, TSAYE and TSAYE supplemented with 4% NaCl to recover heat, acid and freeze-damaged LMM was similar for all media (P > 0.05). The PCOM proved to be effective at isolating colonies of LMM from inoculated raw beef chunks, unpasteurized orange juice, cabbage, and Mexican-style cheese by direct plating and by the US Department of Agriculture's Food Safety and Inspection Service enrichment method. Differentiation of L. monocytogenes colonies was easier on PCOM than on MOX for foods with high levels of background microbiota. Based on the evaluations performed on foods naturally contaminated with L. monocytogenes, PCOM was a more economical alternative than MOX for selective and differential isolation of Listeria from raw or unpasteurized foods.

  6. Ensheathing cell-conditioned medium directs the differentiation of human umbilical cord blood cells into aldynoglial phenotype cells.

    PubMed

    Ponce-Regalado, María Dolores; Ortuño-Sahagún, Daniel; Zarate, Carlos Beas; Gudiño-Cabrera, Graciela

    2012-06-01

    Despite their similarities to bone marrow precursor cells (PC), human umbilical cord blood (HUCB) PCs are more immature and, thus, they exhibit greater plasticity. This plasticity is evident by their ability to proliferate and spontaneously differentiate into almost any cell type, depending on their environment. Moreover, HUCB-PCs yield an accessible cell population that can be grown in culture and differentiated into glial, neuronal and other cell phenotypes. HUCB-PCs offer many potential therapeutic benefits, particularly in the area of neural replacement. We sought to induce the differentiation of HUCB-PCs into glial cells, known as aldynoglia. These cells can promote neuronal regeneration after lesion and they can be transplanted into areas affected by several pathologies, which represents an important therapeutic strategy to treat central nervous system damage. To induce differentiation to the aldynoglia phenotype, HUCB-PCs were exposed to different culture media. Mononuclear cells from HUCB were isolated and purified by identification of CD34 and CD133 antigens, and after 12 days in culture, differentiation of CD34+ HUCB-PCs to an aldynoglia phenotypic, but not that of CD133+ cells, was induced in ensheathing cell (EC)-conditioned medium. Thus, we demonstrate that the differentiation of HUCB-PCs into aldynoglia cells in EC-conditioned medium can provide a new source of aldynoglial cells for use in transplants to treat injuries or neurodegenerative diseases.

  7. Investigating the neuroglial differentiation effect of neuroblastoma conditioned medium in human endometrial stem cells cultured on 3D nanofibrous scaffold.

    PubMed

    Ebrahimi-Barough, Somayeh; Hoveizi, Elham; Norouzi Javidan, Abbas; Ai, Jafar

    2015-08-01

    Neural tissue engineering is an important area of research in the field of tissue-engineering especially for neurodegenerative disease such as spinal cord injury. The differentiation capacity of human endometrial stem cells (hEnSCs) into neuronal cells has yet to be elucidated. Here, the major aim of the present study was to investigate the differentiation ability of hEnSCs cultured on polylactic acid/chitosan (PLA/CS) nanofibrous scaffold into neuroglial cells in response to conditioned medium of BE(2)-C human neuroblastoma cells and growth factors. Here we investigated the use PLA/CS scaffold as a three dimensional (3D) system that increased neuro-glial cells differentiation. Human EnSCs after three passages were differentiated in neuro-glial like cells under neuroblastoma conditioned medium with FGF2/PDGF-AA on PLA/CS scaffold. By day 18, differentiated cells were analyzed for expression of neuroglial markers by qRT-PCR and immunofluorescence. The results revealed that hEnSCs attach, grow and differentiation on the nanofibrous PLA/CS scaffold. Additionally, our study showed the expression of neural and glial lineage markers such as Nestin, NF-L, MAP2, PDGFRa, CNP, Olig2, MBP, and GFAP in the level of mRNA and MAP2, Tuj-1, and NF-L in the protein level after 18 days. Our results demonstrate that hEnSCs cultured on PLA/CS nanofibrous scaffold have the potential to differentiate in neuronal and glial cells in presence of neuroblastoma conditioned medium on PLA/CS scaffold. The result of this study may have impact in tissue engineering and cells-base therapy of neurodegenerative diseases and have a great potential for wide application.

  8. A differential medium for the isolation and rapid identification of a plant soft rot pathogen, Erwinia chrysanthemi.

    PubMed

    Lee, Yung-An; Yu, Cheng-Pin

    2006-02-01

    A medium was developed for the isolation and differentiation of Erwinia chrysanthemi from other Erwinia spp. based on the production of blue-pigmented indigoidine. The medium, named NGM, consists of nutrient agar supplemented with 1% glycerol, that induces pigment production, and 2 mM MnCl2*4H2O, that further enhances color development. More than fifty E. chrysanthemi strains from six different plant hosts were tested. All tested strains of E. chrysanthemi grew well on the NGM medium, developing dark brownish to blue colonies easily distinguishable from other Erwinia spp. The results indicate that pigment production on the NGM medium is a very stable property and can be used as a phenotypic property to differentiate E. chrysanthemi from other Erwinia spp. In addition, a specific oligonucleotide primer set was designed for the detection of indC, which is involved in indigoidine biosynthesis. All E. chrysanthemi strains tested contained indC as determined by PCR amplification. No amplification was observed with other Erwinia spp. Thus, pigment production of E. chrysanthemi on the NGM medium is consistent with the existence of indC. The NGM medium was used to isolate and identify the causal agent of soft rot lesions of diseased Phalaenopsis orchids from three orchid cultivation areas in Taiwan. The causal agents of Phalaenopsis soft rot were all identified as E. chrysanthemi. The results indicate that the NGM medium is efficient in isolation and identification of E. chrysanthemi from plants with soft rot symptoms and can also be used for epidemiological studies.

  9. Platelet-rich concentrate in serum free medium enhances osteogenic differentiation of bone marrow-derived human mesenchymal stromal cells

    PubMed Central

    Ramasamy, Thamil Selvee; Karunanithi, Puvanan; Naveen, Sangeetha Vasudevaraj; Murali, Malliga Raman; Abbas, Azlina A.; Kamarul, Tunku

    2016-01-01

    Previous studies have shown that platelet concentrates used in conjunction with appropriate growth media enhance osteogenic differentiation of human mesenchymal stromal cells (hMSCs). However, their potential in inducing osteogenesis of hMSCs when cultured in serum free medium has not been explored. Furthermore, the resulting osteogenic molecular signatures of the hMSCs have not been compared to standard osteogenic medium. We studied the effect of infrequent supplementation (8-day interval) of 15% non-activated platelet-rich concentrate (PRC) in serum free medium on hMSCs proliferation and differentiation throughout a course of 24 days, and compared the effect with those cultured in a standard osteogenic medium (OM). Cell proliferation was analyzed by alamar blue assay. Gene expression of osteogenic markers (Runx2, Collagen1, Alkaline Phosphatase, Bone morphogenetic protein 2, Osteopontin, Osteocalcin, Osteonectin) were analyzed using Q-PCR. Immunocytochemical staining for osteocalcin, osteopontin and transcription factor Runx2 were done at 8, 16 and 24 days. Biochemical assays for the expression of ALP and osteocalcin were also performed at these time-points. Osteogenic differentiation was further confirmed qualitatively by Alizarin Red S staining that was quantified using cetylpyridinium chloride. Results showed that PRC supplemented in serum free medium enhanced hMSC proliferation, which peaked at day 16. The temporal pattern of gene expression of hMSCs under the influence of PRC was comparable to that of the osteogenic media, but at a greater extent at specific time points. Immunocytochemical staining revealed stronger staining for Runx2 in the PRC-treated group compared to OM, while the staining for Osteocalcin and Osteopontin were comparable in both groups. ALP activity and Osteocalcin/DNA level were higher in the PRC group. Cells in the PRC group had similar level of bone mineralization as those cultured in OM, as reflected by the intensity of Alizarin red

  10. Identification of Mouse Mesenteric and Subcutaneous in vitro Adipogenic Cells.

    PubMed

    Miyata, Yugo; Otsuki, Michio; Kita, Shunbun; Shimomura, Iichiro

    2016-02-17

    Fat accumulation and the dysfunction of visceral white adipose tissue (WAT), but not subcutaneous WAT, cause abnormalities in whole body metabolic homeostasis. However, no current drugs specifically target visceral WAT. The primary reason for this is that a practical in vitro culture system for mesenteric adipocytes has not been established. To resolve this issue, we sought to identify in vitro adipogenic cells in mesenteric and subcutaneous WATs. First, we examined the expression pattern of surface antigens in stromal-vascular fraction (SVF) cells from mouse mesenteric and subcutaneous WATs, and found the expression of 30 stem cell-related surface antigens. Then, to evaluate the adipogenic ability of each fraction, we performed in vitro screening, and identified five candidate markers for mesenteric adipogenic cells and one candidate marker for subcutaneous adipogenic cells. To investigate whether in vitro adipogenic ability accurately reflects the conditions in vivo, we performed transplantation experiments, and identified CD9(-) CD201(+) Sca-1(-) cells and CD90(+) cells as mesenteric and subcutaneous in vitro adipogenic cells, respectively. Furthermore, mature adipocytes derived from mesenteric and subcutaneous adipogenic cells maintained each characteristic phenotype in vitro. Thus, our study should contribute to the development of a useful culture system for visceral adipocytes.

  11. Identification of Mouse Mesenteric and Subcutaneous in vitro Adipogenic Cells

    PubMed Central

    Miyata, Yugo; Otsuki, Michio; Kita, Shunbun; Shimomura, Iichiro

    2016-01-01

    Fat accumulation and the dysfunction of visceral white adipose tissue (WAT), but not subcutaneous WAT, cause abnormalities in whole body metabolic homeostasis. However, no current drugs specifically target visceral WAT. The primary reason for this is that a practical in vitro culture system for mesenteric adipocytes has not been established. To resolve this issue, we sought to identify in vitro adipogenic cells in mesenteric and subcutaneous WATs. First, we examined the expression pattern of surface antigens in stromal-vascular fraction (SVF) cells from mouse mesenteric and subcutaneous WATs, and found the expression of 30 stem cell-related surface antigens. Then, to evaluate the adipogenic ability of each fraction, we performed in vitro screening, and identified five candidate markers for mesenteric adipogenic cells and one candidate marker for subcutaneous adipogenic cells. To investigate whether in vitro adipogenic ability accurately reflects the conditions in vivo, we performed transplantation experiments, and identified CD9− CD201+ Sca-1− cells and CD90+ cells as mesenteric and subcutaneous in vitro adipogenic cells, respectively. Furthermore, mature adipocytes derived from mesenteric and subcutaneous adipogenic cells maintained each characteristic phenotype in vitro. Thus, our study should contribute to the development of a useful culture system for visceral adipocytes. PMID:26884347

  12. Protein inhibitor of activated STAT3 inhibits adipogenic gene expression

    SciTech Connect

    Deng Jianbei; Hua Kunjie; Caveney, Erica J.; Takahashi, Nobuyuki; Harp, Joyce B. . E-mail: jharp@unc.edu

    2006-01-20

    Protein inhibitor of activated STAT3 (PIAS3), a cytokine-induced repressor of signal transducer and activator of transcription 3 (STAT3) and a modulator of a broad array of nuclear proteins, is expressed in white adipose tissue, but its role in adipogenesis is not known. Here, we determined that PIAS3 was constitutively expressed in 3T3-L1 cells at all stages of adipogenesis. However, it translocated from the nucleus to the cytoplasm 4 days after induction of differentiation by isobutylmethylxanthine, dexamethasone, and insulin (MDI). In ob/ob mice, PIAS3 expression was increased in white adipose tissue depots compared to lean mice and was found in the cytoplasm of adipocytes. Overexpression of PIAS3 in differentiating preadipocytes, which localized primarily to the nucleus, inhibited mRNA level gene expression of adipogenic transcription factors C/EBP{alpha} and PPAR{gamma}, as well as their downstream target genes aP2 and adiponectin. PIAS3 also inhibited C/EBP{alpha} promoter activation mediated specifically by insulin, but not dexamethasone or isobutylmethylxanthine. Taken together, these data suggest that PIAS3 may play an inhibitory role in adipogenesis by modulating insulin-activated transcriptional activation events. Increased PIAS3 expression in adipose tissue may play a role in the metabolic disturbances of obesity.

  13. ARN: analysis and prediction by adipogenic professional database.

    PubMed

    Huang, Yan; Wang, Li; Zan, And Lin-Sen

    2016-08-08

    Adipogenesis is the process of cell differentiation by which mesenchymal stem cells become adipocytes. Extensive research is ongoing to identify genes, their protein products, and microRNAs that correlate with fat cell development. The existing databases have focused on certain types of regulatory factors and interactions. However, there is no relationship between the results of the experimental studies on adipogenesis and these databases because of the lack of an information center. This information fragmentation hampers the identification of key regulatory genes and pathways. Thus, it is necessary to provide an information center that is quickly and easily accessible to researchers in this field. We selected and integrated data from eight external databases based on the results of text-mining, and constructed a publicly available database and web interface (URL: http://210.27.80.93/arn/ ), which contained 30873 records related to adipogenic differentiation. Then, we designed an online analysis tool to analyze the experimental data or form a scientific hypothesis about adipogenesis through Swanson's literature-based discovery process. Furthermore, we calculated the "Impact Factor" ("IF") value that reflects the importance of each node by counting the numbers of relation records, expression records, and prediction records for each node. This platform can support ongoing adipogenesis research and contribute to the discovery of key regulatory genes and pathways.

  14. Evaluation of Urea-motility-indole medium for recognition and differentiation of Salmonella and Shigella species in stool cultures.

    PubMed

    Rosa Fraile, M; Vega Aleman, D; Fernandez Gutierrez, C

    1980-09-01

    A semisolid urea-motility-indole medium designed for detection in Enterobacteriaceae of urease activity, motility, and indole production in one tube was prepared and evaluated. The formulation of the medium was similar to that of Christensen urea agar, but the agar concentration was 0.2%, and 1% tryptone was added. Results with 687 strains of Enterobacteriaceae were the same as those obtained with standard test media (98% overall agreement). The urea-motility-indole medium was also used in combination with Kligler iron agar for the recognition and differentiation of Salmonella and Shigella species from colonies picked from plating media in fecal cultures. This combination was compared with the combination of Kligler iron agar and lysine iron agar with 507 strains of non-lactose-fermenting Enterobacteriaceae. Although both combinations enabled the presumptive recognition and differentiation of Salmonella and Shigella species, an analysis of data indicated that the combination of Kligler iron agar and urea-motility-indole medium performed better than the combination of Kligler iron agar and lysine iron agar in detecting Salmonella and Shigella species.

  15. Red yeast rice extracts suppress adipogenesis by down-regulating adipogenic transcription factors and gene expression in 3T3-L1 cells.

    PubMed

    Jeon, Taeil; Hwang, Seong Gu; Hirai, Shizuka; Matsui, Tohru; Yano, Hideo; Kawada, Teruo; Lim, Beoung Ou; Park, Dong Ki

    2004-11-12

    The effects of red yeast rice extracts (RE) on adipocyte differentiation of 3T3-L1 cells were studied. RE were extracted from embryonic rice fermented with red yeast (Monascus ruber). These extracts significantly decreased glycerol-3-phosphate dehydrogenase (GPDH) activity and lipid accumulation, a marker of adipogenesis, in a dose-dependent manner. Moreover, mRNA expression levels of both CCAAT/enhancer-binding protein (C/EBP) alpha and peroxisome proliferator-activated receptor (PPAR) gamma, the key adipogenic transcription factors, were markedly decreased by RE. RE also inhibited the expression of PPARgamma at protein levels. RE decreased significantly gene expression of adipocyte fatty acid binding protein (aP2) and leptin, which are adipogenic marker proteins and C/EBPalpha and PPARgamma target genes. These results suggest that the inhibitory effect of RE on adipocyte differentiation might be mediated through the down-regulated expression of adipogenic transcription factors and other specific genes.

  16. The anti-adipogenic effect of PGRN on porcine preadipocytes involves ERK1,2 mediated PPARγ phosphorylation.

    PubMed

    Yang, Hao; Cheng, Jia; Song, Ziyi; Li, Xinjian; Zhang, Zhenyu; Mai, Yin; Pang, Weijun; Shi, Xin'e; Yang, Gongshe

    2013-12-01

    Recent researches indicate that PGRN is closely related to diabetes and is regarded as a novel adipokine associated with obesity development, affecting adipocyte biology. In the present study, we investigated the effects and mechanisms of PGRN on porcine preadipocytes differentiation. Porcine preadipocytes were induced to differentiation with the addition of lentivirius-expressed PGRN shRNA at the early or late stage of induction period, and in the presence or absence of recombinant PGRN protein. The effects of PGRN on adipogenic genes expression and ERK activation were investigated. At the early stage of induction, knockdown of PGRN promoted differentiation, evidenced by enhanced lipid accumulation, upregulation of adipocyte markers, as well as master adipogenic transcription factors, PPARγ and C/EBPα. While, decreasing PGRN expression at the late stage of induction (day 3) had no effect on differentiation. These results suggested that PGRN functions in the early adipogenic events. Conversely, porcine preadipocytes differentiation was impaired by MDI and recombinant PGRN protein induction, the expressions of adipocyte markers were decreased. Further studies revealed that PGRN can specifically facilitate ERK1,2 activation, and this activation can be abolished by U0126. Moreover, PPARγ phosphorylation at serine 112 site was increased by PGRN treatment, which could reduce the transcriptional activity of PPARγ. We conclude that PGRN inhibits adipogenesis in porcine preadipocytes partially through ERK activation mediated PPARγ phosphorylation.

  17. Development of selective and differential medium for Shigella sonnei using three carbohydrates (lactose, sorbitol, and xylose) and X-Gal.

    PubMed

    Na, G N; Kim, S A; Kwon, O C; Rhee, M S

    2015-08-01

    The aim of this study was to develop a new selective and differential medium for isolating Shigella sonnei (designated 3SD medium). The new medium was based on three carbohydrates (lactose, sorbitol, and xylose) and a chromogenic substrate (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside, X-Gal). S. sonnei cannot ferment lactose, sorbitol, or xylose, but can ferment X-Gal, which generates turquoise-blue colonies with rough edges. Other bacteria (54 strains of foodborne pathogens and spoilage bacteria) produced visually distinct colonies on 3SD medium (colorless or pink-violet colonies), or their growth was inhibited on 3SD medium. The optimum concentration of 50 mg/L X-Gal was selected because it yielded the highest level of morphological discrimination between S. sonnei and other bacteria, and this concentration was cost-effective. Bile salt concentration optimization was performed using healthy, heat-injured, and acid-injured S. sonnei. The recovery rate differed significantly depending on the bile salt concentration; media containing >1.0 g/L bile salt showed significantly lower recovery of stress-injured cells than medium containing 0.5 g/L bile salt (P<0.05). Growth of all Gram-positive bacteria was inhibited on medium containing 0.5 g/L bile salt; therefore, this concentration was used as the optimal concentration. Previous media used to isolate Shigella spp. (MacConkey, xylose lysine desoxycholate, and Salmonella-Shigella agar) showed poor performance when used to support the growth of injured S. sonnei cells, whereas 3SD medium supported a high growth rate of injured and healthy cells (equivalent to that obtained with nutrient-rich tryptic soy agar). To validate the performance of 3SD medium with real specimens, S. sonnei and other bacteria were spiked into samples such as untreated water, carrot, salad, and oyster. 3SD medium showed superior specificity (100%) and sensitivity (100%) for S. sonnei, and yielded no false-positive or false-negative results

  18. Precursor cells from Atlantic salmon (Salmo salar) visceral fat holds the plasticity to differentiate into the osteogenic lineage

    PubMed Central

    Ytteborg, Elisabeth; Todorcevic, Marijana; Krasnov, Aleksei; Takle, Harald; Kristiansen, Inger Øien; Ruyter, Bente

    2015-01-01

    ABSTRACT In order to study the potential plasticity of Atlantic salmon (Salmo salar) precursor cells (aSPCs) from the adipogenic mesenchyme cell lineage to differentiate to the osteogenic lineage, aSPCs were isolated and cultivated under either osteogenic or adipogenic promoting conditions. The results strengthen the hypothesis that aSPCs most likely are predestined to the adipogenic lineage, but they also hold the flexibility to turn into other lineages given the right stimuli. This assumption is supported by the fact that the transcription factor pparγ , important for regulation of adiopogenesis, was silent in aSPCs grown in osteogenic media, while runx2, important for osteogenic differentiation, was not expressed in aSPCs cultivated in adipogenic media. After 2 weeks in osteogenic promoting conditions the cells started to deposit extracellular matrix and after 4 weeks, the cells started mineralizing secreted matrix. Microarray analyses revealed large-scale transcriptome responses to osteogenic medium after 2 days, changes remained stable at day 15 and decreased by magnitude at day 30. Induction was observed in many genes involved in osteogenic differentiation, growth factors, regulators of development, transporters and production of extracellular matrix. Transcriptome profile in differentiating adipocytes was markedly different from differentiating osteoblasts with far fewer genes changing activity. The number of regulated genes slowly increased at the mature stage, when adipocytes increased in size and accumulated lipids. This is the first report on in vitro differentiation of aSPCs from Atlantic salmon to mineralizing osteogenic cells. This cell model system provides a new valuable tool for studying osteoblastogenesis in fish. PMID:25948755

  19. Growth factors and medium hyperglycemia induce Sox9+ ductal cell differentiation into β cells in mice with reversal of diabetes.

    PubMed

    Zhang, Mingfeng; Lin, Qing; Qi, Tong; Wang, Tiankun; Chen, Ching-Cheng; Riggs, Arthur D; Zeng, Defu

    2016-01-19

    We previously reported that long-term administration of a low dose of gastrin and epidermal growth factor (GE) augments β-cell neogenesis in late-stage diabetic autoimmune mice after eliminating insulitis by induction of mixed chimerism. However, the source of β-cell neogenesis is still unknown. SRY (sex-determining region Y)-box 9(+) (Sox9(+)) ductal cells in the adult pancreas are clonogenic and can give rise to insulin-producing β cells in an in vitro culture. Whether Sox9(+) ductal cells in the adult pancreas can give rise to β cells in vivo remains controversial. Here, using lineage-tracing with genetic labeling of Insulin- or Sox9-expressing cells, we show that hyperglycemia (>300 mg/dL) is required for inducing Sox9(+) ductal cell differentiation into insulin-producing β cells, and medium hyperglycemia (300-450 mg/dL) in combination with long-term administration of low-dose GE synergistically augments differentiation and is associated with normalization of blood glucose in nonautoimmune diabetic C57BL/6 mice. Short-term administration of high-dose GE cannot augment differentiation, although it can augment preexisting β-cell replication. These results indicate that medium hyperglycemia combined with long-term administration of low-dose GE represents one way to induce Sox9(+) ductal cell differentiation into β cells in adult mice.

  20. Identification of the transcription factor ZEB1 as a central component of the adipogenic gene regulatory network

    PubMed Central

    Gubelmann, Carine; Schwalie, Petra C; Raghav, Sunil K; Röder, Eva; Delessa, Tenagne; Kiehlmann, Elke; Waszak, Sebastian M; Corsinotti, Andrea; Udin, Gilles; Holcombe, Wiebke; Rudofsky, Gottfried; Trono, Didier; Wolfrum, Christian; Deplancke, Bart

    2014-01-01

    Adipose tissue is a key determinant of whole body metabolism and energy homeostasis. Unraveling the regulatory mechanisms underlying adipogenesis is therefore highly relevant from a biomedical perspective. Our current understanding of fat cell differentiation is centered on the transcriptional cascades driven by the C/EBP protein family and the master regulator PPARγ. To elucidate further components of the adipogenic gene regulatory network, we performed a large-scale transcription factor (TF) screen overexpressing 734 TFs in mouse pre-adipocytes and probed their effect on differentiation. We identified 22 novel pro-adipogenic TFs and characterized the top ranking TF, ZEB1, as being essential for adipogenesis both in vitro and in vivo. Moreover, its expression levels correlate with fat cell differentiation potential in humans. Genomic profiling further revealed that this TF directly targets and controls the expression of most early and late adipogenic regulators, identifying ZEB1 as a central transcriptional component of fat cell differentiation. DOI: http://dx.doi.org/10.7554/eLife.03346.001 PMID:25163748

  1. Cytosolic aconitase activity sustains adipogenic capacity of adipose tissue connecting iron metabolism and adipogenesis.

    PubMed

    Moreno, María; Ortega, Francisco; Xifra, Gemma; Ricart, Wifredo; Fernández-Real, José Manuel; Moreno-Navarrete, José María

    2015-04-01

    To gain insight into the regulation of intracellular iron homeostasis in adipose tissue, we investigated the role of iron regulatory protein 1/cytosolic aconitase 1 (ACO1). ACO1 gene expression and activity increased in parallel to expression of adipogenic genes during differentiation of both murine 3T3-L1 cells and human preadipocytes. Lentiviral knockdown (KD) of Aco1 in 3T3-L1 preadipocytes led to diminished cytosolic aconitase activity and isocitrate dehydrogenase 1 (NADP(+)), soluble (Idh1) mRNA levels, decreased intracellular NADPH:NADP ratio, and impaired adipogenesis during adipocyte differentiation. In addition, Aco1 KD in fully differentiated 3T3-L1 adipocytes decreased lipogenic, Idh1, Adipoq, and Glut4 gene expression. A bidirectional cross-talk was found between intracellular iron levels and ACO1 gene expression and protein activity. Although iron in excess, known to increase reactive oxygen species production, and iron depletion both resulted in decreased ACO1 mRNA levels and activity, Aco1 KD led to reduced gene expression of transferrin receptor (Tfrc) and transferrin, disrupting intracellular iron uptake. In agreement with these findings, in 2 human independent cohorts (n = 85 and n = 38), ACO1 gene expression was positively associated with adipogenic markers in subcutaneous and visceral adipose tissue. ACO1 gene expression was also positively associated with the gene expression of TFRC while negatively linked to ferroportin (solute carrier family 40 (iron-regulated transporter), member 1) mRNA levels. Altogether, these results suggest that ACO1 activity is required for the normal adipogenic capacity of adipose tissue by connecting iron, energy metabolism, and adipogenesis.

  2. Differential foraging preferences on seed size by rodents result in higher dispersal success of medium-sized seeds.

    PubMed

    Cao, Lin; Wang, Zhenyu; Yan, Chuan; Chen, Jin; Guo, Cong; Zhang, Zhibin

    2016-11-01

    Rodent preference for scatter-hoarding large seeds has been widely considered to favor the evolution of large seeds. Previous studies supporting this conclusion were primarily based on observations at earlier stages of seed dispersal, or on a limited sample of successfully established seedlings. Because seed dispersal comprises multiple dispersal stages, we hypothesized that differential foraging preference on seed size by animal dispersers at different dispersal stages would ultimately result in medium-sized seeds having the highest dispersal success rates. In this study, by tracking a large number of seeds for 5 yr, we investigated the effects of seed size on seed fates from seed removal to seedling establishment of a dominant plant Pittosporopsis kerrii (Icacinaceae) dispersed by scatter-hoarding rodents in tropical forest in southwest China. We found that small seeds had a lower survival rate at the early dispersal stage where more small seeds were predated at seed stations and after removal; large seeds had a lower survival rate at the late dispersal stage, more large seeds were recovered, predated after being cached, or larder-hoarded. Medium-sized seeds experienced the highest dispersal success. Our study suggests that differential foraging preferences by scatter-hoarding rodents at different stages of seed dispersal could result in conflicting selective pressures on seed size and higher dispersal success of medium-sized seeds.

  3. Second malignancies in patients with differentiated thyroid carcinoma treated with low and medium activities of radioactive I-131

    PubMed Central

    PICIU, DOINA; PESTEAN, CLAUDIU; BARBUS, ELENA; LARG, MARIA IULIA; PICIU, ANDRA

    2016-01-01

    Background and aim This study aimed at determining whether there is a risk regarding the development of second primary malignancies after patient exposure to the low and medium radioiodine activity used during the treatment of differentiated thyroid cancers (DTC). Methods Second primary malignancies that occurred after DTC were detected in 1,990 patients treated between 1970 and 2003. The mean long-term follow-up period was 182 months. Results Radioiodine I-131was administrated at a mean dose of 63.2 mCi. There were 93 patients with at least one second primary malignancy. The relative risk of development of second malignancy in DTC patients was increased (p<0.0001) for breast, uterine and ovarian cancers compared with the general population. Conclusions The overall risk concerning the development of second primary malignancies was related to the presence of DTC, but not to exposure to the low and medium activities of radioiodine administered as adjuvant therapy. PMID:27547058

  4. Adipogenic potentials of mesenchymal stem cells from human bone marrow, umbilical cord and adipose tissue are different.

    PubMed

    Chi, Ying; Han, Zhi-Bo; Xu, Fang-Yun; Wang, You-Wei; Feng, Xiao-Ming; Chen, Fang; Ma, Feng-Xia; Du, Wen-Jing; Han, Zhong-Chao

    2014-06-01

    Mesenchymal stem cells (MSCs) could be obtained from many sources, and there are differences between them. This study was purposed to compare and analyze the basic biological characteristics of umbilical cord, adipose tissue-and bone marrow-derived MSC (UC-MSCs, AD-MSCs and BM-MSCs). The MSCs were isolated from umbilical cord, adipose tissue and bone marrow were cultured; the morphology of UC-MSCs, AD-MSCs and BM-MSCs was observed by using microscopy; the immunophenotype, differentiation potential and expression of peroxisome proliferation-activated receptor-γ (PPAR-γ) mRNA were detected by using flow cytometry, differentiation test (von kossais and 0:1 red O staining) and quantitative fluorescent PCR, respectively. The results showed that the UC-MSCs, AD-MSCs and BM-MSCs displayed similar morphology under confocal microscope after being stained with rhodamine phalloidin and DAPL. The immunophenotypes of these three originated cells conform to coincide with identification criterion for MSCs, and showed similar expression level. During adipogenic induction the adipogenic potential of these MSCs was different, AD-MSCs exhibited the highest adipogenic potential, UC-MSCs displayed the lowest, while potential of BM-MSCs get between; however, the osteogenic differentiation potential of UC-MSCs, AD-MSCs and BM-MSCs was similar. The PCR detection showed that the expression level of PPAR-γ mRNA was the highest in AD-MSCs and the lowest in UC-MSCs, while expression level in BM-MSCs get between, these results were identical with the adipogenic potential, suggest that the difference of adipogenic potential in 3 kinds of MSCs was associated with basic expression level of PPAR-γ mRNA. It is concluded that UC-MSCs, AD-MSCs and BM-MSCs exhibit similar morphology, the immunophenotypes of these MSCs coincide with identification criterion for MSCs, the osteogenic potential of these MSCs is similar, while the adipogenic potential and the expression level of PPAR-γ mRNA are

  5. Adipogenic signaling in rat white adipose tissue: modulation by aging and calorie restriction.

    PubMed

    Zhu, Min; Lee, Garrick D; Ding, Liusong; Hu, Jingping; Qiu, Guang; de Cabo, Rafa; Bernier, Michel; Ingram, Donald K; Zou, Sige

    2007-08-01

    Alterations in adipogenesis could have significant impact on several aging processes. We previously reported that calorie restriction (CR) in rats significantly increases the level of circulating adiponectin, a distinctive marker of differentiated adipocytes, leading to a concerted modulation in the expression of key transcription target genes and, as a result, to increased fatty acid oxidation and reduced deleterious lipid accumulation in other tissues. These findings led us to investigate further the effects of aging on adipocytes and to determine how CR modulates adipogenic signaling in vivo. CR for 2 and 25 months, significantly increased the expression of PPARgamma, C/EBPbeta and Cdk-4, and partially attenuated age-related decline in C/EBPalpha expression relative to rats fed ad libitum (AL). As a result, adiponectin was upregulated at both mRNA and protein levels, resulting in activation of target genes involved in fatty acid oxidation and fatty acid synthesis, and greater responsiveness of adipose tissue to insulin. Moreover, CR significantly decreased the ratio of C/EBPbeta isoforms LAP/LIP, suggesting the suppression of gene transcription associated with terminal differentiation while facilitating preadipocytes proliferation. Morphometric analysis revealed a greater number of small adipocytes in CR relative to AL feeding. Immunostaining confirmed that small adipocytes were more strongly positive for adiponectin than the large ones. Overall these results suggest that CR increased the expression of adipogenic factors, and maintained the differentiated state of adipocytes, which is critically important for adiponectin biosynthesis and insulin sensitivity.

  6. Macromolecular Crowding Amplifies Adipogenesis of Human Bone Marrow-Derived Mesenchymal Stem Cells by Enhancing the Pro-Adipogenic Microenvironment

    PubMed Central

    Ang, Xiu Min; Lee, Michelle H.C.; Blocki, Anna; Chen, Clarice; Ong, L.L. Sharon; Asada, H. Harry; Sheppard, Allan

    2014-01-01

    The microenvironment plays a vital role in both the maintenance of stem cells in their undifferentiated state (niche) and their differentiation after homing into new locations outside this niche. Contrary to conventional in-vitro culture practices, the in-vivo stem cell microenvironment is physiologically crowded. We demonstrate here that re-introducing macromolecular crowding (MMC) at biologically relevant fractional volume occupancy during chemically induced adipogenesis substantially enhances the adipogenic differentiation response of human bone marrow-derived mesenchymal stem cells (MSCs). Both early and late adipogenic markers were significantly up-regulated and cells accumulated 25–40% more lipid content under MMC relative to standard induction cocktails. MMC significantly enhanced deposition of extracellular matrix (ECM), notably collagen IV and perlecan, a heparan sulfate proteoglycan. As a novel observation, MMC also increased the presence of matrix metalloproteinase −2 in the deposited ECM, which was concomitant with geometrical ECM remodeling typical of adipogenesis. This suggested a microenvironment that was richer in both matrix components and associated ligands and was conducive to adipocyte maturation. This assumption was confirmed by seeding undifferentiated MSCs on decellularized ECM deposited by adipogenically differentiated MSCs, Adipo-ECM. On Adipo-ECM generated under crowding, MSCs differentiated much faster under a classical differentiation protocol. This was evidenced throughout the induction time course, by a significant up-regulation of both early and late adipogenic markers and a 60% higher lipid content on MMC-generated Adipo-ECM in comparison to standard induction on tissue culture plastic. This suggests that MMC helps build and endow the nascent microenvironment with adipogenic cues. Therefore, MMC initiates a positive feedback loop between cells and their microenvironment as soon as progenitor cells are empowered to build and shape

  7. Characterization of Adipogenic Chemicals in Three Different Cell Culture Systems: Implications for Reproducibility Based on Cell Source and Handling.

    PubMed

    Kassotis, Christopher D; Masse, Lauren; Kim, Stephanie; Schlezinger, Jennifer J; Webster, Thomas F; Stapleton, Heather M

    2017-02-08

    The potential for chemical exposures to exacerbate the development and/or prevalence of metabolic disorders, such as obesity, is currently of great societal concern. Various in vitro assays are available to assess adipocyte differentiation, though little work has been done to standardize protocols and compare models effectively. This study compares several adipogenic cell culture systems under a variety of conditions to assess variability in responses. Two sources of 3T3-L1 preadipocytes as well as OP9 preadipocytes were assessed for cell proliferation and triglyceride accumulation following different induction periods and using various tissue culture plates. Both cell line and cell source had a significant impact on potencies and efficacies of adipogenic chemicals. Gene expression analyses suggested that differential expression of nuclear receptors involved in adipogenesis underlie the differences between OP9 and 3T3-L1 cells; however, there were also differences based on 3T3-L1 cell source. Induction period modulated potency and efficacy of response depending on cell line and test chemical, and large variations were observed in triglyceride accumulation and cell proliferation between brands of tissue culture plates. Our results suggest that the selection of a cell system and differentiation protocol significantly impacts the detection of adipogenic chemicals, and therefore, influences reproducibility of these studies.

  8. Characterization of Adipogenic Chemicals in Three Different Cell Culture Systems: Implications for Reproducibility Based on Cell Source and Handling

    PubMed Central

    Kassotis, Christopher D.; Masse, Lauren; Kim, Stephanie; Schlezinger, Jennifer J.; Webster, Thomas F.; Stapleton, Heather M.

    2017-01-01

    The potential for chemical exposures to exacerbate the development and/or prevalence of metabolic disorders, such as obesity, is currently of great societal concern. Various in vitro assays are available to assess adipocyte differentiation, though little work has been done to standardize protocols and compare models effectively. This study compares several adipogenic cell culture systems under a variety of conditions to assess variability in responses. Two sources of 3T3-L1 preadipocytes as well as OP9 preadipocytes were assessed for cell proliferation and triglyceride accumulation following different induction periods and using various tissue culture plates. Both cell line and cell source had a significant impact on potencies and efficacies of adipogenic chemicals. Gene expression analyses suggested that differential expression of nuclear receptors involved in adipogenesis underlie the differences between OP9 and 3T3-L1 cells; however, there were also differences based on 3T3-L1 cell source. Induction period modulated potency and efficacy of response depending on cell line and test chemical, and large variations were observed in triglyceride accumulation and cell proliferation between brands of tissue culture plates. Our results suggest that the selection of a cell system and differentiation protocol significantly impacts the detection of adipogenic chemicals, and therefore, influences reproducibility of these studies. PMID:28176856

  9. Selective stimulatory action of olfactory ensheathing glia-conditioned medium on oligodendroglial differentiation, with additional reference to signaling mechanisms.

    PubMed

    Carvalho, Litia A; Vitorino, Louise C; Guimarães, Roberta P M; Allodi, Silvana; de Melo Reis, Ricardo A; Cavalcante, Leny A

    2014-07-04

    We examined the effects of conditioned medium from olfactory ensheathing glia (OEGCM) on the differentiation of oligodendrocytes in mixed cultures of early postnatal hippocampi. Differentiation was judged from the numerical density (ND) of cells immunoreactive to 2'3' cyclic nucleotide 3'phosphodiesterase (CNPase) and O4 antibodies. NDs increased according to inverted-U dose-response curves, particularly for CNPase+ cells (9-fold at optimal dilution) and these changes were blocked by inhibitors of ERK1, p38-MAPK, and PI3K. Our results raise the possibility that OEG secreted factor(s) may counteract demyelination induced by trauma, neurodegenerative diseases, and advanced age, and should stimulate novel methods to deliver these factors and/or potentiating chemicals.

  10. Stem cells from human exfoliated deciduous teeth differentiate toward neural cells in a medium dynamically cultured with Schwann cells in a series of polydimethylsiloxanes scaffolds

    NASA Astrophysics Data System (ADS)

    Su, Wen-Ta; Pan, Yu-Jing

    2016-08-01

    Objective. Schwann cells (SCs) are primary structural and functional cells in the peripheral nervous system. These cells play a crucial role in peripheral nerve regeneration by releasing neurotrophic factors. This study evaluated the neural differentiation potential effects of stem cells from human exfoliated deciduous teeth (SHEDs) in a rat Schwann cell (RSC) culture medium. Approach. SHEDs and RSCs were individually cultured on a polydimethylsiloxane (PDMS) scaffold, and the effects of the RSC medium on the SHEDs differentiation between static and dynamic cultures were compared. Main results. Results demonstrated that the SHED cells differentiated by the RSC cultured medium in the static culture formed neurospheres after 7 days at the earliest, and SHED cells formed neurospheres within 3 days in the dynamic culture. These results confirm that the RSC culture medium can induce neurospheres formation, the speed of formation and the number of neurospheres (19.16 folds high) in a dynamic culture was superior to the static culture for 3 days culture. The SHED-derived spheres were further incubated in the RSCs culture medium, these neurospheres continuously differentiated into neurons and neuroglial cells. Immunofluorescent staining and RT-PCR revealed nestin, β-III tubulin, GFAP, and γ-enolase of neural markers on the differentiated cells. Significance. These results indicated that the RSC culture medium can induce the neural differentiation of SHED cells, and can be used as a new therapeutic tool to repair nerve damage.

  11. Quantitative approaches to detect donor and passage differences in adipogenic potential and clonogenicity in human bone marrow-derived mesenchymal stem cells.

    PubMed

    Lo Surdo, Jessica; Bauer, Steven R

    2012-11-01

    Bone marrow-derived multipotent stromal cells (MSCs), also known as mesenchymal stem cells, have great promise due to their capacity for tri-lineage differentiation and immunosuppressive properties, which allows for their allogeneic use and ultimately may allow for treatment of many diseases. MSCs will require extensive expansion and passaging to obtain cells in sufficient numbers necessary for cell therapies. MSCs from many donors could potentially be used. Because of this, there is a need to understand the role of passaging and donor differences on differentiation capacity using quantitative approaches. Here, we evaluated MSCs from two donors (noted as PCBM1632 and PCBM1641 by the manufacturer) at tissue culture passages 3, 5, and 7. We used a colony forming unit (CFU) assay and limiting dilution to quantify clonogenicity and precursor frequency during adipogenesis, and quantitative real-time-polymerase chain reaction for adipogenic markers to evaluate changes on a gene expression level. Further, we observed changes in cell size, and we sorted small and large populations to evaluate size-related adipogenic potential. While the adipogenic precursor frequency of ∼1 in 76 cells remained similar through passages for cells from PCBM1641, we found a large decrease in the adipogenic potential of MSCs from PCBM1632, with 1 in 2035 cells being capable of differentiating into an adipocyte at passage 7. MSCs from both donors showed an increase in cell diameter with increasing passage, which correlates with a decrease in clonogenicity by CFU analysis. We also measured adipose lineage gene expression following induction of adipocyte differentiation. Expression of these genes decreased with passage number for MSCs from PCBM1632 and correlated with the decrease in adipogenic potential by passage 7. In contrast, MSCs from PCBM1641 showed increased expression of these genes with increasing passage. We have shown that several quantitative assays can detect differences in MSC

  12. Longevity of U cells of differentiated yeast colonies grown on respiratory medium depends on active glycolysis.

    PubMed

    Čáp, Michal; Váchová, Libuše; Palková, Zdena

    2015-01-01

    Colonies of Saccharomyces cerevisiae laboratory strains pass through specific developmental phases when growing on solid respiratory medium. During entry into the so-called alkali phase, in which ammonia signaling is initiated, 2 prominent cell types are formed within the colonies: U cells in upper colony regions, which have a longevity phenotype and activate the expression of a large number of metabolic genes, and L cells in lower regions, which die more quickly and exhibit a starvation phenotype. Here, we performed a detailed analysis of the activities of enzymes of central carbon metabolism in lysates of both cell types and determined several fermentation end products, showing that previously reported expression differences are reflected in the different enzymatic capabilities of each cell type. Hence, U cells, despite being grown on respiratory medium, behave as fermenting cells, whereas L cells rely on respiratory metabolism and possess active gluconeogenesis. Using a spectrum of different inhibitors, we showed that glycolysis is essential for the formation, and particularly, the survival of U cells. We also showed that β-1,3-glucans that are released from the cell walls of L cells are the most likely source of carbohydrates for U cells.

  13. Differentially transcribed regions of Haloferax volcanii genome depending on the medium salinity.

    PubMed Central

    Ferrer, C; Mojica, F J; Juez, G; Rodríguez-Valera, F

    1996-01-01

    To identify genomic regions involved in osmoregulation in the extremely halophilic archaeon Haloferax volcanii, we used a technique which involves hybridization of cDNAs obtained at different salinities against a cosmid library of the organism. Both low and high salt concentrations trigger differential expression; however, adaptation to low salinities seems to elicit a wider response. The presence of a large domain within the largest of the megaplasmids with a strong response to low salt concentrations is noteworthy. PMID:8550436

  14. Berberine exerts anti-adipogenic activity through up-regulation of C/EBP inhibitors, CHOP and DEC2.

    PubMed

    Pham, Truc P T; Kwon, Jeongho; Shin, Jaekyoon

    2011-09-23

    Berberine exerts an anti-adipogenic activity that is associated with the down-regulation of C/EBPα and PPARγ. Stimulation of AMP-activated kinase (AMPK) caused by inhibition of mitochondrial respiration has been suggested to underlie such molecular regulation. In the present study, we show that berberine up-regulated the expression of two different sets of C/EBP inhibitors, CHOP and DEC2, while down-modulating C/EBPα, PPARγ and other adipogenic markers and effectors in differentiating 3T3-L1 preadipocytes and mature adipocytes. Data also suggested that the berberine-induced up-regulation of CHOP and DEC2 was attributable to selective activation of an unfolded protein response (UPR) and modified extracellular environment, respectively. As a result, the anti-adipogenic activity of berberine was diminished remarkably by adjusting the differentiation culture media and limitedly but consistently by knockdown of CHOP expression. Together, up-regulation of C/EBP inhibitors appears to underlie the berberine-induced repression of C/EBPα and PPARγ and, so, the inhibition of adipogenesis.

  15. Recovery and differentiation of long ripened cheese microflora through a new cheese-based cultural medium.

    PubMed

    Neviani, Erasmo; De Dea Lindner, Juliano; Bernini, Valentina; Gatti, Monica

    2009-05-01

    A partial picture of the typical microflora of PDO Parmigiano Reggiano cheese was achieved by studying the cultivability of lactic acid bacteria associated with its manufacturing and ripening. A comprehensive sampling design allowed for the analysis of the cheese microflora during its production over 20 months of ripening. An innovative cheese agar medium (CAM) was prepared after testing 18 formulations all based on grated Parmigiano Reggiano ripened cheese. During cheese manufacturing and ripening, different samples were sampled and their microflora was recovered using CAM in comparison with other traditional media. Colonies which formed units from the different agar media tested were picked and isolated; the phylogenetic positions of 154 isolated strains were studied at level of species by 16S-rRNA gene sequencing. CAM seems to be able to recover the minority population coming from milk and whey starter, hardly estimable, during the first hours of production, on traditional media.

  16. Medium effects in K+ nucleus interaction from consistent analysis of integral and differential cross sections

    NASA Astrophysics Data System (ADS)

    Friedman, E.; Gal, A.; Mareš, J.

    1997-02-01

    Self-consistency in the analysis of transmission measurements for K+ on several nuclei in the momentum range of 500-700 MeV/c is achieved with a `teff(ρ)ρ' potential and new results are derived for total cross sections. The imaginary part of the teff amplitude is found to increase linearly with the average nuclear density in excess of a threshold value of 0.088+/-0.004 fm-3. This phenomenological density dependence of the K+ nucleus optical potential also gives rise to good agreement with recent measurements of differential cross sections for elastic scattering of 715 MeV/c K+ by 6Li and C.

  17. Effect of coculturing on the myogenic and adipogenic marker gene expression.

    PubMed

    Muthuraman, Pandurangan

    2014-05-01

    The present experiment was carried out to evaluate the effect of coculturing on myogenic and adipogenic marker gene expressions with the use of C2C12 and 3 T3-L1 preadipocyte cells under the coculture system. C2C12 and 3 T3-L1 cells were cocultured using transwell inserts with a 0.4-μm porous membrane to separate C2C12 and 3 T3-L1 cells. Each cell type was grown independently on the transwell plates. Following cell differentiation, inserts containing 3 T3-L1 cells were transferred to C2C12 plates, and inserts containing C2C12 cells were transferred to 3 T3-L1 plates. After coculture of the C2C12 and 3 T3-L1 cells for 48 and 72 h, the cells in the lower well were harvested for analysis, and this process was carried out for both cells. Myogenic markers such as myogenin, MyoD, Myf5, PAX3, and PAX7 mRNA expressions were analyzed in the cocultured C2C12 cells. Adipogenic markers such as fatty acid-binding protein 4 (FABP4), peroxisome proliferator-activating receptor (PPARγ), CCAAT/enhancer-binding protein (CEBPA), adiponectin, lipoprotein lipase, and fatty acid synthase mRNA expressions were analyzed in the cocultured 3 T3-L1 cells. Myogenic and adipogenic marker gene mRNA expressions were significantly altered in the cocultured C2C12 and 3 T3-L1 cells when compared with the monocultured C2C12 and 3 T3-L1 cells.

  18. Developmentally coordinated extrinsic signals drive human pluripotent stem cell differentiation toward authentic DARPP-32+ medium-sized spiny neurons.

    PubMed

    Delli Carri, Alessia; Onorati, Marco; Lelos, Mariah J; Castiglioni, Valentina; Faedo, Andrea; Menon, Ramesh; Camnasio, Stefano; Vuono, Romina; Spaiardi, Paolo; Talpo, Francesca; Toselli, Mauro; Martino, Gianvito; Barker, Roger A; Dunnett, Stephen B; Biella, Gerardo; Cattaneo, Elena

    2013-01-15

    Medium-sized spiny neurons (MSNs) are the only neostriatum projection neurons, and their degeneration underlies some of the clinical features of Huntington's disease. Using knowledge of human developmental biology and exposure to key neurodevelopmental molecules, human pluripotent stem (hPS) cells were induced to differentiate into MSNs. In a feeder-free adherent culture, ventral telencephalic specification is induced by BMP/TGFβ inhibition and subsequent SHH/DKK1 treatment. The emerging FOXG1(+)/GSX2(+) telencephalic progenitors are then terminally differentiated, resulting in the systematic line-independent generation of FOXP1(+)/FOXP2(+)/CTIP2(+)/calbindin(+)/DARPP-32(+) MSNs. Similar to mature MSNs, these neurons carry dopamine and A2a receptors, elicit a typical firing pattern and show inhibitory postsynaptic currents, as well as dopamine neuromodulation and synaptic integration ability in vivo. When transplanted into the striatum of quinolinic acid-lesioned rats, hPS-derived neurons survive and differentiate into DARPP-32(+) neurons, leading to a restoration of apomorphine-induced rotation behavior. In summary, hPS cells can be efficiently driven to acquire a functional striatal fate using an ontogeny-recapitulating stepwise method that represents a platform for in vitro human developmental neurobiology studies and drug screening approaches.

  19. Antiadipogenic effects of subthermal electric stimulation at 448 kHz on differentiating human mesenchymal stem cells.

    PubMed

    Hernández-Bule, María Luisa; Martínez-Botas, Javier; Trillo, María Ángeles; Paíno, Carlos L; Úbeda, Alejandro

    2016-05-01

    The 448 kHz capacitive‑resistive electric transfer (CRET) is an electrothermal therapy currently applied in anticellulite and antiobesity treatments. The aim of the present study was to determine whether exposure to the CRET electric signal at subthermal doses affected early adipogenic processes in adipose‑derived stem cells (ADSC) from human donors. ADSC were incubated for 2 or 9 days in the presence of adipogenic medium, and exposed or sham‑exposed to 5 min pulses of 448 kHz electric signal at 50 µA/mm2 during the last 48 h of the incubation. Colorimetric, immunofluorescence, western blotting and reverse transcription‑quantitative polymerase chain reaction assays were performed to assess adipogenic differentiation of the ADSC. Electric stimulation significantly decreased cytoplasmic lipid content, after both 2 and 9 days of differentiation. The antiadipogenic response in the 9 day samples was accompanied by activation of mitogen‑activated protein kinase kinase 1/2, decreased expression and partial inactivation of peroxisome proliferator‑activated receptor (PPAR) γ, which was translocated from the nucleus to the cytoplasm, together with a significant decrease in the expression levels of the PPARG1 gene, perilipin, angiopoietin‑like protein 4 and fatty acid synthase. These results demonstrated that subthermal stimulation with CRET interferes with the early adipogenic differentiation in ADSC, indicating that the electric stimulus itself can modulate processes controlling the synthesis and mobilization of fat, even in the absence of the concomitant thermal and mechanical components of the thermoelectric therapy CRET.

  20. Rigidity of silicone substrates controls cell spreading and stem cell differentiation

    NASA Astrophysics Data System (ADS)

    Vertelov, Grigory; Gutierrez, Edgar; Lee, Sin-Ae; Ronan, Edward; Groisman, Alex; Tkachenko, Eugene

    2016-09-01

    The dependences of spreading and differentiation of stem cells plated on hydrogel and silicone gel substrates on the rigidity and porosity of the substrates have recently been a subject of some controversy. In experiments on human mesenchymal stem cells plated on soft, medium rigidity, and hard silicone gels we show that harder gels are more osteogenic, softer gels are more adipogenic, and cell spreading areas increase with the silicone gel substrate rigidity. The results of our study indicate that substrate rigidity induces some universal cellular responses independently of the porosity or topography of the substrate.

  1. Hospital morbidity in a medium-sized city: differentials between men and women

    PubMed Central

    de Arruda, Guilherme Oliveira; Molena-Fernandes, Carlos Alexandre; Mathias, Thais Aidar de Freitas; Marcon, Sonia Silva

    2014-01-01

    Objective characterize the hospital morbidity of adults living in the city of Maringá, PR, Brazil, between 2000 and 2011, focusing on the differential between men and women. Method this descriptive study was developed based on data from the Hospital Information System of the Unified Health System in order to investigate the association between groups of hospitalization causes and the average length of hospitalization per gender, in three-year periods. Results the main groups of hospitalization causes for men were: mental disorders, lesions and circulatory diseases; and, among women: tumors, circulatory and genitourinary diseases. Mental disorders and lesions, tumors, circulatory and genitourinary diseases were significantly associated with the female and male genders across the study period. Although not significant, the mean length of hospitalization dropped across the four three-year periods, and only showed a significant difference between men and women in the second triennium. Conclusion differences in the hospital morbidity profile between men and women underline the need for specific health and nursing actions, especially in primary health care, with a view to reducing hospitalizations due to the main groups of causes in the city. PMID:24553699

  2. Human osteoblasts derived from mesenchymal stem cells express adipogenic markers upon coculture with bone marrow adipocytes.

    PubMed

    Clabaut, Aline; Delplace, Séverine; Chauveau, Christophe; Hardouin, Pierre; Broux, Odile

    2010-07-01

    In osteoporosis, bone loss is accompanied by greater adiposity in the marrow. Given the cellular proximity within the bone marrow, we wondered whether adipocytes might have a paracrine impact on osteoblast differentiation. To test this hypothesis, we cocultured adipocytes with osteoblasts derived from mesenchymal stem cells (MSCs) in the absence of direct cell contact and then analyzed gene expression changes in the osteoblastic population by using real-time reverse transcription polymerase chain reaction. We found that, upon coculture, MSC-derived osteoblasts showed appearance of adipogenic (lipoprotein lipase, leptin) and decrease of osteogenic (osteocalcin) mRNA markers. Our results indicate that in vitro, MSC-derived adipocytes are capable of inducing MSC-derived osteoblasts to differentiate to an adipocyte phenotype. These new data suggest that (i) transdifferentiation of committed osteoblasts into adipocytes may contribute to the increase in marrow fat content at the expense of bone-forming cells and (ii) this switch might be initiated by the adipocytes themselves.

  3. Transcriptomic analyses of the anti-adipogenic effects of oleuropein in human mesenchymal stem cells.

    PubMed

    Casado-Díaz, Antonio; Anter, Jaouad; Müller, Sören; Winter, Peter; Quesada-Gómez, José Manuel; Dorado, Gabriel

    2017-03-22

    Extra virgin olive oil has positive effects on health. Oleuropein is a polyphenolic compound present in olive-tree leaves, fruits (olives) and olive oil. It is responsible for the relevant organoleptic and biological properties of olive oil, including antiadipogenic properties. Thus, the effects of oleuropein on the adipogenesis of human bone-marrow mesenchymal stem cells were studied by transcriptomics and differential gene-expression analyses. Oleuropein could upregulate expression of 60% of adipogenesis-repressed genes. Besides, it could activate signaling pathways such as Rho and β-catenin, maintaining cells at an undifferentiated stage. Our data suggest that mitochondrial activity is reduced by oleuropein, mostly during adipogenic differentiation. These results shed light on oleuropein activity on cells, with potential application as a "nutraceutical" for the prevention and treatment of diseases such as obesity and osteoporosis.

  4. Increased lipid accumulation and adipogenic gene expression of adipocytes in 3D bioprinted nanocellulose scaffolds.

    PubMed

    Henriksson, I; Gatenholm, P; Hägg, D A

    2017-02-21

    Compared to standard 2D culture systems, new methods for 3D cell culture of adipocytes could provide more physiologically accurate data and a deeper understanding of metabolic diseases such as diabetes. By resuspending living cells in a bioink of nanocellulose and hyaluronic acid, we were able to print 3D scaffolds with uniform cell distribution. After one week in culture, cell viability was 95%, and after two weeks the cells displayed a more mature phenotype with larger lipid droplets than standard 2D cultured cells. Unlike cells in 2D culture, the 3D bioprinted cells did not detach upon lipid accumulation. After two weeks, the gene expression of the adipogenic marker genes PPARγ and FABP4 was increased 2.0- and 2.2-fold, respectively, for cells in 3D bioprinted constructs compared with 2D cultured cells. Our 3D bioprinted culture system produces better adipogenic differentiation of mesenchymal stem cells and a more mature cell phenotype than conventional 2D culture systems.

  5. Murine keratinocyte cultures grown at the air/medium interface synthesize stratum corneum lipids and recycle linoleate during differentiation

    SciTech Connect

    Madison, K.C.; Swartzendruber, D.C.; Wertz, P.W.; Downing, D.T.

    1989-07-01

    In a recent investigation we showed that murine keratinocyte cultures grown at the air/medium interface in the presence of dermis exhibit morphologic differentiation comparable to that seen in vivo, including the formation of lamellar granules and stratum corneum intercellular lipid lamellae. In the present study, lifted cultures were found to more closely reproduce the lipid composition of the parent epidermal tissue than submerged cultures grown on plastic. In addition, the specific fatty acid profile of individual lipid classes in lifted cultures was, in general, remarkably well maintained in vitro. Acylceramides, which are highly enriched in linoleic acid in vivo, remained enriched in vitro; however, the linoleic acid content of the cultures was substantially lower than that in vivo, confirming previous reports of the relative essential fatty acid deficiency of standard culture media. As the lifted cultures differentiated over time, the lipid composition changed to reflect the formation of a stratum corneum with its different complement of lipids. Label from (U-/sup 14/C)linoleic acid was specifically incorporated into linoleate-containing lipids during short pulses in both submerged and lifted cultures. Changes in label distribution over a long chase period in lifted cultures indicated that linoleate was transferred from phospholipids to ceramides, providing evidence for the ''recycling'' of essential fatty acids in epidermis.

  6. Murine keratinocyte cultures grown at the air/medium interface synthesize stratum corneum lipids and "recycle" linoleate during differentiation.

    PubMed

    Madison, K C; Swartzendruber, D C; Wertz, P W; Downing, D T

    1989-07-01

    In a recent investigation we showed that murine keratinocyte cultures grown at the air/medium interface in the presence of dermis exhibit morphologic differentiation comparable to that seen in vivo, including the formation of lamellar granules and stratum corneum intercellular lipid lamellae. In the present study, lifted cultures were found to more closely reproduce the lipid composition of the parent epidermal tissue than submerged cultures grown on plastic. In addition, the specific fatty acid profile of individual lipid classes in lifted cultures was, in general, remarkably well maintained in vitro. Acylceramides, which are highly enriched in linoleic acid in vivo, remained enriched in vitro; however, the linoleic acid content of the cultures was substantially lower than that in vivo, confirming previous reports of the relative essential fatty acid deficiency of standard culture media. As the lifted cultures differentiated over time, the lipid composition changed to reflect the formation of a stratum corneum with its different complement of lipids. Label from [U-14C]linoleic acid was specifically incorporated into linoleate-containing lipids during short pulses in both submerged and lifted cultures. Changes in label distribution over a long chase period in lifted cultures indicated that linoleate was transferred from phospholipids to ceramides, providing evidence for the "recycling" of essential fatty acids in epidermis.

  7. An endothelial cultured condition medium embedded porous PLGA scaffold for the enhancement of mouse embryonic stem cell differentiation.

    PubMed

    Li, Ching-Wen; Pan, Wei-Ting; Ju, Jyh-Cherng; Wang, Gou-Jen

    2016-04-12

    In this study, we have developed a microporous poly(lactic-co-glycolic acid) (PLGA) scaffold that combines a continuous release property and a three-dimensional (3D) scaffolding technique for the precise and efficient formation of endothelial cell lineage from embryonic stem cells (ESCs). Eight PLGA scaffolds (14.29%, 16.67%, 20% and 25% concentrations of PLGA solutions) mixed with two crystal sizes of sodium chloride (NaCl) were fabricated by leaching. Then, vascular endothelial cell conditioned medium (ECCM) mixed with gelatin was embedded into the scaffold for culturing of mouse embryonic stem cells (mESCs). The 14.29% PLGA scaffolds fabricated using non-ground NaCl particles (NG-PLGA) and the 25% PLGA containing scaffolds fabricated using ground NaCl particles (G-PLGA) possessed minimum and maximum moisture content and bovine serum albumin (BSA) content properties, respectively. These two groups of scaffolds were used for future experiments in this study. Cell culture results demonstrated that the proposed porous scaffolds without growth factors were sufficient to induce mouse ESCs to differentiate into endothelial-like cells in the early culture stages, and combined with embedded ECCM could provide a long-term inducing system for ESC differentiation.

  8. A new experimental culture medium for cultivation of Leishmania amazonensis: its efficacy for the continuous in vitro growth and differentiation of infective promastigote forms.

    PubMed

    Rodrigues, Igor de Almeida; da Silva, Bianca Alcântara; dos Santos, André Luis Souza; Vermelho, Alane Beatriz; Alviano, Celuta Sales; Dutra, Patrícia Maria Lourenço; Rosa, Maria do Socorro Santos

    2010-04-01

    Parasites from the genus Leishmania cause a variety of disease states in humans and other mammals in tropical and subtropical regions, which include cutaneous, mucocutaneous and visceral leishmaniasis. The elaboration of a culture medium for the in vitro cultivation of Leishmania spp., which promotes the growth and differentiation of the parasites, is an important tool for diagnosis, biochemical, biological and immunological studies in the genus. Herein, we have reported the development of a rapid, inexpensive and reliable monophasic culture medium. The novel medium, designated PBHIL, promoted an excellent parasite growth, generating high quantities of promastigotes with long-term viability, and was able to induce cellular differentiation of L. amazonensis promastigotes to the amastigote-like forms (93%). Additionally, we reported the influence of this novel medium on the biochemical characteristics of L. amazonensis and on the interaction of this parasite parasites with mammalian macrophages.

  9. Determination of osteogenic or adipogenic lineages in muscle-derived stem cells (MDSCs) by a collagen-binding peptide (CBP) derived from bone sialoprotein (BSP)

    SciTech Connect

    Choi, Yoon Jung; Lee, Jue Yeon; Lee, Seung Jin; Chung, Chong-Pyoung; Park, Yoon Jeong

    2012-03-09

    Highlights: Black-Right-Pointing-Pointer CBP sequence is identified from BSP and has collagen binding activity. Black-Right-Pointing-Pointer CBP directly activates the MAPK signaling, especially ERK1/2. Black-Right-Pointing-Pointer CBP increase osteoblastic differentiation by the activation of Runx2. Black-Right-Pointing-Pointer CBP decrease adipogenic differentiation by the inhibition of PPAR{gamma}. -- Abstract: Bone sialoprotein (BSP) is a mineralized, tissue-specific, non-collagenous protein that is normally expressed only in mineralized tissues such as bone, dentin, cementum, and calcified cartilage, and at sites of new mineral formation. The binding of BSP to collagen is thought to be important for initiating bone mineralization and bone cell adhesion to the mineralized matrix. Several recent studies have isolated stem cells from muscle tissue, but their functional properties are still unclear. In this study, we examined the effects of a synthetic collagen-binding peptide (CBP) on the differentiation efficiency of muscle-derived stem cells (MDSCs). The CBP sequence (NGVFKYRPRYYLYKHAYFYPHLKRFPVQ) corresponds to residues 35-62 of bone sialoprotein (BSP), which are located within the collagen-binding domain in BSP. Interestingly, this synthetic CBP inhibited adipogenic differentiation but increased osteogenic differentiation in MDSCs. The CBP also induced expression of osteoblastic marker proteins, including alkaline phosphatase (ALP), type I collagen, Runt-related transcription factor 2 (Runx2), and osteocalcin; prevented adipogenic differentiation in MDSCs; and down-regulated adipose-specific mRNAs, such as adipocyte protein 2 (aP2) and peroxisome proliferator-activated receptor {gamma}. The CBP increased Extracellular signal-regulated kinases (ERK) 1/2 protein phosphorylation, which is important in lineage determination. These observations suggest that this CBP determines the osteogenic or adipogenic lineage in MDSCs by activating ERK1/2. Taken together, a

  10. Germinated brown rice extract inhibits adipogenesis through the down-regulation of adipogenic genes in 3T3-L1 adipocytes.

    PubMed

    Ho, Jin-Nyoung; Son, Mi-Eun; Lim, Won-Chul; Lim, Seung-Taik; Cho, Hong-Yon

    2013-09-01

    The aim of this study was to examine the anti-adipogenic effect of germinated brown rice methanol extract (GBR) in 3T3-L1 adipocytes. The GBR inhibited adipocyte differentiation was measured by Oil Red O staining and glycerol-3-phosphate dehydrogenase (GPDH) activity in a dose-dependent manner without initiating any cytotoxicity. The mRNA levels of adipogenic transcription factors such as CCAAT/enhancer binding protein (C/EBPα), proliferator-activated receptorγ (PPARγ), and sterol regulatory element-binding protein-1c (SREBP-1c), and adipogenic genes, such as fatty acid synthase (FAS), adipocyte fatty acid-binding protein (aP2), and lipoprotein lipase (LPL), were significantly down-regulated by treatment with GBR when compared to that of untreated control cells. Moreover, tumor necrosis factor-α (TNF-α) and interlukin-6 (IL-6) mRNA expressions were attenuated by GBR in mature adipocytes. These data suggest that GBR exhibits an anti-adipogenic effect through the suppression of adipogenesis in 3T3-L1 adipocytes.

  11. Effect of lipopolysaccharides on adipogenic potential and premature senescence of adipocyte progenitors.

    PubMed

    Zhao, Ming; Chen, Xiaoli

    2015-08-15

    The elevation of circulating LPS has been associated with obesity and aging. However, whether and how LPS contributes to adipose tissue dysfunction is unclear. In this study, we investigated the effect of LPS on the adipogenic capacity and cellular senescence of adipocyte progenitors. Stromal-vascular cells were isolated from inguinal adipose tissue of C57BL/6 mice and treated with LPS during the different time periods of adipocyte differentiation. We found that LPS treatment for 24 h prior to the induction of differentiation led to the most profound effect on the inhibition of adipogenesis, as evidenced by the morphological changes and the decreased mRNA expression of adipocyte marker genes. In addition, LPS induced features of premature senescence of SV cells, including the activation of p53, the elevation of SA-β-gal activity, and increased hydrogen peroxide production, but not telomere length. Upon LPS treatment, SV cells also developed senescence-associated secretory phenotype (SASP), as demonstrated by the increased expression of TNFα, IL-1β, IL-6, MCP-1, and VEGFα. Blocking LPS-induced NF-κB activation and cytokine production by Bay 11-7082 failed to rescue the impaired adipogenesis and the reduction in PPARγ and Zfp423 expression. On the contrary, rosiglitazone had little effect on cytokine production but corrected the defective adipogenic potential. In conclusion, we demonstrate that LPS inhibits adipogenesis by disrupting the differentiation of adipocyte progenitors in a NF-κB-independent manner; LPS also induces premature senescence of adipocyte progenitors. Our data suggest that LPS could be a potential contributor to the defective adipogenesis and the development of cellular senescence in adipose tissue during obesity and aging.

  12. Effects of strontium on proliferation and differentiation of rat bone marrow mesenchymal stem cells

    SciTech Connect

    Li, Yunfeng; Li, Jihua; Zhu, Songsong; Luo, En; Feng, Ge; Chen, Qianming; Hu, Jing

    2012-02-24

    Highlights: Black-Right-Pointing-Pointer Strontium ranelate (SrR) inhibits proliferation of BMMSCs. Black-Right-Pointing-Pointer SrR increases osteoblastic but decreases adipocytic differentiation of BMMSCs. Black-Right-Pointing-Pointer SrR increases expression of Runx2, BSP and OCN by BMMSCs in osteogenic medium. Black-Right-Pointing-Pointer SrR decreases expression of PPAR{gamma}, aP2/ALBP and LPL by BMMSCs in adipogenic medium. -- Abstract: Strontium ranelate (SrR) was an effective anti-osteoporotic drug to increase bone formation and decrease bone resorption. However, reports about the effect of SR on osteoblastic and adipocytic differentiation from bone marrow mesenchymal stem cells (BMMSCs) are limited. The purpose of this study is to evaluate whether SrR affects the ability of BMMSCs to differentiate into osteoblasts or adipocytes. Rat BMMSCs were identified by flow cytometry and exposed to SR (0.1 and 1.0 mM Sr{sup 2+}) under osteogenic or adipogenic medium for 1 and 2 weeks. The proliferation and differentiation of BMMSCs were analyzed by MTT, alkaline phosphatase (ALP), Oil red O staining, quantitative real-time RT-PCR and Western blot assays. SrR significantly inhibited the proliferation, increased osteoblastic but decreased adipocytic differentiation of rat BMMSCs dose-dependently. In osteogenic medium, SrR increased the expression of ALP, the mRNA levels of Cbfa1/Runx2, bone sialoprotein, and osteocalcin by RT-PCR, and the protein levels of Cbfa1/Runx2 by Western blot. In adipogenic medium, SrR decreased the mRNA levels of PPAR{gamma}2, adipocyte lipid-binding protein 2 (aP2/ALBP), and lipoprotein lipase (LPL) by RT-PCR, and the protein expression of PPAR{gamma} in Western blot analysis. These results indicated that the effects of SrR to promote osteoblastic but inhibit adipocytic differentiation of BMMSCs might contribute to its effect on osteoporosis treatment.

  13. PDGFR-β (+) perivascular cells from infantile hemangioma display the features of mesenchymal stem cells and show stronger adipogenic potential in vitro and in vivo.

    PubMed

    Yuan, Si-Ming; Guo, Yao; Zhou, Xiao-Jun; Shen, Wei-Min; Chen, Hai-Ni

    2014-01-01

    Infantile hemangioma, a common benign tumor of infancy, grows quickly in the first year of life, and then regresses slowly to fibrofatty tissue in childhood. The accumulation of fibrofatty tissue in hemangioma involution indicates adipogenesis during this period. Perivascular cells (PCs) from multiple organs display multi-lineage differentiation, including adipogenesis. So we supposed that PCs in hemangioma may contribute to the adipogenesis in the involution. In this study, PDGFR-β (+) PCs was isolated from hemangioma tissue (hemangioma-derived perivascular cells, Hem-PCs) by fluorescence-activated cell sorter. In vitro, Hem-PCs showed fibroblast-like morphology. Immunofluorescence staining and flow cytometry showed Hem-PCs expressed MSCs markers CD105, CD90, CD29 and vimentin, pericyte markers α-SMA and PDGFR-β, stem cell marker CD133, and the adipogenic transcription factor PPAR-γ, but not hematopoietic/endothelial markers CD45, CD34, CD31, and flt-1. In vitro inductions confirmed multi-lineage differentiation of Hem-PCs, especially strong adipogenic potential. Then a murine model was established to observe in vivo differentiation of Hem-PCs by subcutaneous injection of cells/Matrigel compound into nude mice. The results showed Hem-PCs differentiated into adipocytes in vivo. To the best of our knowledge, this is the first study reporting the isolation of multipotential PDGFR-β (+) PCs from hemangioma, and observing their adipogenic differentiation in vivo. PCs may be the cellular basis of adipogenesis in hemangioma involution, and may be the target cells of adipogenic induction to promote hemangioma involution.

  14. Acute exercise regulates adipogenic gene expression in white adipose tissue.

    PubMed

    Shen, Y; Zhou, H; Jin, W; Lee, H J

    2016-12-01

    White adipose tissue expansion is associated with both hypertrophy and hyperplasia of adipocytes. Exercise training results in adipocyte hypotrophy by activating lipolysis, but it is poorly understood whether exercise regulates adipogenesis by altering adipogenic gene expression. The purpose of this study was to evaluate the effect of a single bout of swimming exercise on adipogenic gene expression in white adipose tissue (WAT). Male C57BL/6J mice were divided into two groups: a sedentary control group and a 120-minute swimming exercise group. Immediately after acute exercise, adipogenic gene expression in WAT was analysed by RT-PCR, and tdTomato positive cells in WAT from UCP1-cre-tdTomato mice were observed under a confocal microscope. In epididymal white adipose tissue (eWAT), PPARγ2 and C/EBPα expression at the mRNA level was significantly decreased with high induction of Wnt10b and KLFs (KLF2, KLF3, KLF7, KLF6, KLF9 and KLF15), whereas PPARγ2, not C/EBPα, was decreased with high induction of Wnt6 and KLFs (KLF2, KLF3, KLF7, KLF6 and KLF9) in inguinal white adipose tissue (iWAT) after acute exercise. The expression of C/EBPβ and C/EBPδ was upregulated in both WATs with a high level of PGC-1α expression. Expression level of UCP1 was increased only in adipocytes of eWAT, while beige cell specific gene expression was comparable between groups and tdTomato positive cells were not found in WAT of UCP1-cre-tdTomato reporter mouse immediately after acute exercise. These results suggest that acute exercise suppresses adipogenic gene expression and may regulate thermogenesis by activating C/EBPβ, PGC-1α and UCP1 in WAT.

  15. [The analysis of the low and medium molecular weight substances for differential diagnostics of deaths from acute small-focal myocardial infarction and other forms of cardiac pathology].

    PubMed

    Edelev, N S; Obuhova, L M; Edelev, I S; Katirkina, A A

    2017-01-01

    The objective of the present study was to analyze the possibilities for the use of the low and medium molecular weight substances for differential diagnostics of deaths from acute small-focal myocardial infarction and other forms of cardiac pathology. We determined the amount of the low and medium molecular weight substances in the urine obtained from the subjects who had died as a result of chronic coronary heart disease, acute myocardial infarction, and alcoholic cardiomyopathy. The levels of the low and medium molecular weight substances in the urine were measured by the method of N.Ya. Malakhov in the modification of T.V. Kopytova [5]. The study has demonstrated the appearance of the products of cardiomyocyte degradation (giving rise to a peak at a wavelength of 278 nm) in the fraction of the low and medium molecular weight substances of the urine from the patients suffering from acute small-focal myocardial infarction and some other forms of cardiac pathology.

  16. Estrogen-related receptor alpha modulates the expression of adipogenesis-related genes during adipocyte differentiation.

    PubMed

    Ijichi, Nobuhiro; Ikeda, Kazuhiro; Horie-Inoue, Kuniko; Yagi, Ken; Okazaki, Yasushi; Inoue, Satoshi

    2007-07-06

    Estrogen-related receptor alpha (ERRalpha) is an orphan nuclear receptor that regulates cellular energy metabolism by modulating gene expression involved in fatty acid oxidation and mitochondrial biogenesis in brown adipose tissue. However, the physiological role of ERRalpha in adipogenesis and white adipose tissue development has not been well studied. Here, we show that ERRalpha and ERRalpha-related transcriptional coactivators, peroxisome proliferator-activated receptor gamma (PPARgamma) coactivator-1alpha (PGC-1alpha) and PGC-1beta, can be up-regulated in 3T3-L1 preadipocytes at mRNA levels under the adipogenic differentiation condition including the inducer of cAMP, glucocorticoid, and insulin. Gene knockdown by ERRalpha-specific siRNA results in mRNA down-regulation of fatty acid binding protein 4, PPARgamma, and PGC-1alpha in 3T3-L1 cells in the adipogenesis medium. ERRalpha and PGC-1beta mRNA expression can be also up-regulated in another preadipocyte lineage DFAT-D1 cells and a pluripotent mesenchymal cell line C3H10T1/2 under the differentiation condition. Furthermore, stable expression of ERRalpha in 3T3-L1 cells up-regulates adipogenic marker genes and promotes triglyceride accumulation during 3T3-L1 differentiation. These results suggest that ERRalpha may play a critical role in adipocyte differentiation by modulating the expression of various adipogenesis-related genes.

  17. Modulation of early human preadipocyte differentiation by glucocorticoids.

    PubMed

    Tomlinson, Julianna J; Boudreau, Adèle; Wu, Dongmei; Atlas, Ella; Haché, Robert J G

    2006-11-01

    Glucocorticoids provide an adipogenic stimulus that is most obvious in the truncal obesity of patients with Cushing's syndrome. Glucocorticoid treatment also strongly potentiates the differentiation of human preadipocytes in culture. However, the molecular basis of these stimulatory effects remains to be defined. In this study, we provide a detailed analysis of the specific contribution of glucocorticoid treatment to the differentiation of primary human preadipocytes cultured in chemically defined medium. Contrary to previous descriptions of glucocorticoids being required throughout the course of differentiation, our results show that glucocorticoid treatment is stimulatory only during the first 48 h of differentiation. Furthermore, stimulation by glucocorticoids and the peroxisome proliferator activator receptor-gamma agonist troglitazone is mediated sequentially. Several details of the early events in the differentiation of human preadipocytes and the contribution of steroid to these events differ from the responses observed previously in murine preadipocyte models. First, glucocorticoid treatment stimulated the early accumulation of CCAAT enhancer binding protein-beta (C/EBPbeta) in primary human preadipocytes. Second, induction of C/EBPalpha in primary human preadipocytes was noted within 4 h of adipogenic stimulus, whereas C/EBPalpha induction is not detected until 24-48 h in the murine 3T3 L1 preadipocyte model. Remarkably, by contrast to human primary preadipocytes, which do not undergo postconfluent mitosis, 3T3 L1 murine preadipocytes stimulated to differentiate under chemically defined conditions required glucocorticoids to survive the clonal expansion that precedes terminal differentiation, revealing a novel signal imparted by glucocorticoids in this immortalized murine cell system.

  18. Anti-adipogenic effect of epiberberine is mediated by regulation of the Raf/MEK1/2/ERK1/2 and AMPKα/Akt pathways.

    PubMed

    Choi, Jae Sue; Kim, Ji-Hye; Ali, Md Yousof; Jung, Hee Jin; Min, Byung-Sun; Choi, Ran Joo; Kim, Gun-Do; Jung, Hyun Ah

    2015-12-01

    It has been reported that alkaloids derived from Coptis chinensis exert anti-adipogenic activity on 3T3-L1 adipocytes by downregulating peroxisome proliferation-activity receptor-γ (PPAR-γ) and CCAAT/enhancer binding protein-α (C/EBP-α). However, the signaling-based mechanism of the inhibitory role of epiberberine in the early stages of 3T3-L1 adipocyte differentiation is uncharacterized. Here, we show that epiberberine had inhibitory effects on adipocyte differentiation and significantly decreased lipid accumulation by downregulating an adipocyte-specific transcription factor, sterol regulatory element-binding protein-1 (SREBP-1). Furthermore, we observed that epiberberine markedly suppressed the differentiation-mediated phosphorylation of components of both the Raf/mitogen-activated protein kinase 1 (MEK1)/extracellular signal-regulated protein kinase 1/2 (ERK1/2) and AMP-activated protein kinase-α1 (AMPKα)/Akt pathways. In addition, gene expression of fatty acid synthase (FAS) was significantly inhibited by treatment with epiberberine during adipogenesis. These results indicate that the anti-adipogenic mechanism of epiberberine is associated with inhibition of phosphorylation of Raf/MEK1/ERK1/2 and AMPKα/Akt, followed by downregulation of the major transcription factors of adipogenesis, such as PPAR-γ, C/EBP-α, and SREBP-1, and FAS. Taken together, this study suggests that the anti-adipogenic effect of epiberberine is mediated by downregulation of the Raf/MEK1/ERK1/2 and AMPKα/Akt pathways during 3T3-L1 adipocyte differentiation. Moreover, the anti-adipogenic effects of epiberberine were not accompanied by modulation of β-catenin.

  19. Sertoli cell condition medium can induce germ like cells from bone marrow derived mesenchymal stem cells

    PubMed Central

    Monfared, Mahdieh Hajian; Minaee, Bagher; Rastegar, Tayebeh; Khrazinejad, Ebrahim; Barbarestani, Mohammad

    2016-01-01

    Objective(s): Although many researchers have confirmed induction of germ cells from bone marrow mesenchymal stem cells (BMMSCs), there are no reports that confirm spontaneous differentiation of germ cells from BMMSCs. In this study, we have evaluated the effect of adult Sertoli cell condition medium (SCCM) as a mutative factor in the induction of germ cells from BMMSCs. Materials and Methods: BMMSCs were collected from the bone marrow of 6-8-week old NMRI mice and their mesenchymal entities were proven using superficial markers (expression of CD44 and CD73 and non-expresion of CD45 and CD11b) by fow cytometry. Their multi-potential entities were proved with differentiation to osteogenic and adipogenic cells for 21 days. Also isolated Sertoli cells were enriched using lectin coated plates and Sertoli cell condition medium (SCCM) was collected. Sertoli cells were identified by immunocytochemistry and Vimentin marker. The cells were then differentiated into germ cells with SCCM for 2 weeks. Finally induced cells were evaluated by RT-PCR and immunocytochemistry. Results: Differentiation of mesenchymal stem cells to osteoblast and adipocyte showed their multi-potential property. Expression of CD44 and CD73 and non-expression of CD45 and CD11b confirmed mesenchyme cells. Immunocytochemistry and RT-PCR results showed expression of germ cells specific marker (Mvh). Conclusion: This study confirmed the effect of SCCM as a motivational factor that can used for differentiation of germ cells from BMMSCs. PMID:27917274

  20. Brown-like adipose progenitors derived from human induced pluripotent stem cells: Identification of critical pathways governing their adipogenic capacity.

    PubMed

    Hafner, Anne-Laure; Contet, Julian; Ravaud, Christophe; Yao, Xi; Villageois, Phi; Suknuntha, Kran; Annab, Karima; Peraldi, Pascal; Binetruy, Bernard; Slukvin, Igor I; Ladoux, Annie; Dani, Christian

    2016-08-31

    Human induced pluripotent stem cells (hiPSCs) show great promise for obesity treatment as they represent an unlimited source of brown/brite adipose progenitors (BAPs). However, hiPSC-BAPs display a low adipogenic capacity compared to adult-BAPs when maintained in a traditional adipogenic cocktail. The reasons of this feature are unknown and hamper their use both in cell-based therapy and basic research. Here we show that treatment with TGFβ pathway inhibitor SB431542 together with ascorbic acid and EGF were required to promote hiPSCs-BAP differentiation at a level similar to adult-BAP differentiation. hiPSC-BAPs expressed the molecular identity of adult-UCP1 expressing cells (PAX3, CIDEA, DIO2) with both brown (ZIC1) and brite (CD137) adipocyte markers. Altogether, these data highlighted the critical role of TGFβ pathway in switching off hiPSC-brown adipogenesis and revealed novel factors to unlock their differentiation. As hiPSC-BAPs display similarities with adult-BAPs, it opens new opportunities to develop alternative strategies to counteract obesity.

  1. Brown-like adipose progenitors derived from human induced pluripotent stem cells: Identification of critical pathways governing their adipogenic capacity

    PubMed Central

    Hafner, Anne-Laure; Contet, Julian; Ravaud, Christophe; Yao, Xi; Villageois, Phi; Suknuntha, Kran; Annab, Karima; Peraldi, Pascal; Binetruy, Bernard; Slukvin, Igor I.; Ladoux, Annie; Dani, Christian

    2016-01-01

    Human induced pluripotent stem cells (hiPSCs) show great promise for obesity treatment as they represent an unlimited source of brown/brite adipose progenitors (BAPs). However, hiPSC-BAPs display a low adipogenic capacity compared to adult-BAPs when maintained in a traditional adipogenic cocktail. The reasons of this feature are unknown and hamper their use both in cell-based therapy and basic research. Here we show that treatment with TGFβ pathway inhibitor SB431542 together with ascorbic acid and EGF were required to promote hiPSCs-BAP differentiation at a level similar to adult-BAP differentiation. hiPSC-BAPs expressed the molecular identity of adult-UCP1 expressing cells (PAX3, CIDEA, DIO2) with both brown (ZIC1) and brite (CD137) adipocyte markers. Altogether, these data highlighted the critical role of TGFβ pathway in switching off hiPSC-brown adipogenesis and revealed novel factors to unlock their differentiation. As hiPSC-BAPs display similarities with adult-BAPs, it opens new opportunities to develop alternative strategies to counteract obesity. PMID:27577850

  2. The Wnt-target gene Dlk-1 is regulated by the Prmt5-associated factor Copr5 during adipogenic conversion

    PubMed Central

    Paul, Conception; Sardet, Claude; Fabbrizio, Eric

    2015-01-01

    ABSTRACT Protein arginine methyl transferase 5 (Prmt5) regulates various differentiation processes, including adipogenesis. Here, we investigated adipogenic conversion in cells and mice in which Copr5, a Prmt5- and histone-binding protein, was genetically invalidated. Compared to control littermates, the retroperitoneal white adipose tissue (WAT) of Copr5 KO mice was slightly but significantly reduced between 8 and 16 week/old and contained fewer and larger adipocytes. Moreover, the adipogenic conversion of Copr5 KO embryoid bodies (EB) and of primary embryo fibroblasts (Mefs) was markedly delayed. Differential transcriptomic analysis identified Copr5 as a negative regulator of the Dlk-1 gene, a Wnt target gene involved in the control of adipocyte progenitors cell fate. Dlk-1 expression was upregulated in Copr5 KO Mefs and the Vascular Stromal Fraction (VSF) of Copr5 KO WAT. Chromatin immunoprecipitation (ChIP) show that the ablation of Copr5 has impaired both the recruitment of Prmt5 and β-catenin at the Dlk-1 promoter. Overall, our data suggest that Copr5 is involved in the transcriptional control exerted by the Wnt pathway on early steps of adipogenesis. PMID:25681392

  3. Aging alters bone-fat reciprocity by shifting in vivo mesenchymal precursor cell fate towards an adipogenic lineage.

    PubMed

    Singh, Lakshman; Brennan, Tracy A; Russell, Elizabeth; Kim, Jung-Hoon; Chen, Qijun; Brad Johnson, F; Pignolo, Robert J

    2016-04-01

    Bone marrow derived mesenchymal progenitor cells (MPCs) play an important role in bone homeostasis. Age-related changes occur in bone resulting in a decrease in bone density and a relative increase in adipocity. Although in vitro studies suggest the existence of an age-related lineage switch between osteogenic and adipogenic fates, stem cell and microenvironmental contributions to this process have not been elucidated in vivo. In order to study the effects of MPC and microenvironmental aging on functional engraftment and lineage switching, transplantation studies were performed under non-myeloablative conditions in old recipients, with donor MPCs derived from young and old green fluorescent protein (GFP) transgenic mice. Robust engraftment by young MPCs or their progeny was observed in the marrow, bone-lining region and in the matrix of young recipients; however, significantly lower engraftment was seen at the same sites in old recipients transplanted with old MPCs. Differentiation of transplanted MPCs strongly favored adipogenesis over osteogenesis in old recipients irrespective of MPC donor age, suggesting that microenvironmental alterations that occur with in vivo aging are predominately responsible for MPC lineage switching. These data indicate that aging alters bone-fat reciprocity and differentiation of mesenchymal progenitors towards an adipogenic fate.

  4. Use of MRSD medium and the hydrophobic grid membrane filter technique to differentiate between pediococci and lactobacilli in fermented meat and starter cultures.

    PubMed

    Holley, R A; Millard, G E

    1988-10-01

    Modifications of MRS medium were made by incorporation of 0.1 M L-arginine-HCl, 0.0025% phenol red, 100 IU polymyxin B sulfate, by deletion of meat extract, use of only 1.2% (w/v) glucose and increase of Mn2+ to 1000 ppm. In addition, adoption of the hydrophobic grid membrane filter (HGMF) system with 0.025% Fast Green FCF dye and adjustment of the agar medium to pH 5.5 gave MRSD (differential) medium. Incubation at 25 degrees C anaerobically under N2 or CO2 followed by a post-growth staining procedure involving use of 0.4% (w/v) bromocresol purple yielded conditions under which pediococci colonies were blue whereas homo- and heterofermentative lactobacilli were green in color. Under these conditions, 7 pediococci, 16 lactobacilli, and 18 commercial meat starter cultures were successfully analyzed by plate count to yield a differential assessment of the lactobacilli and pediococci present without interference from the 9 other genera tested. Streptococcus lactis and Leuconostoc spp. produced blue and green colonies, respectively, at 25 degrees C which might interference but these organisms are not present in significant numbers in fermented meats. Pediococcus parvulus and Streptococcus faecalis produced green and blue colonies, respectively, but their very poor growth at 25 degrees C prevented their interference. Use of the developed MRSD medium was described for enumeration of both pediococci and lactobacilli in starter cultures and in fermenting dry sausages to enable documentation of starter culture performance.

  5. Different origin of adipogenic stem cells influences the response to antiretroviral drugs

    SciTech Connect

    Gibellini, Lara; De Biasi, Sara; Nasi, Milena; Carnevale, Gianluca; Pisciotta, Alessandra; Bianchini, Elena; Bartolomeo, Regina; Polo, Miriam; De Pol, Anto; Pinti, Marcello; Cossarizza, Andrea

    2015-10-01

    Lipodystrophy (LD) is a main side effect of antiretroviral therapy for HIV infection, and can be provoked by nucleoside reverse transcriptase inhibitors (NRTIs) and protease inhibitors (PIs). LD exists in different forms, characterized by fat loss, accumulation, or both, but its pathogenesis is still unclear. In particular, few data exist concerning the effects of antiretroviral drugs on adipocyte differentiation. Adipose tissue can arise either from mesenchymal stem cells (MSCs), that include bone marrow-derived MSCs (hBM-MSCs), or from ectodermal stem cells, that include dental pulp stem cells (hDPSCs). To analyze whether the embryonal origin of adipocytes might impact the occurrence of different phenotypes in LD, we quantified the effects of several antiretroviral drugs on the adipogenic differentiation of hBM-MSCs and hDPSCs. hBM-MSCs and hDPSCs were isolated from healthy donors. Cells were treated with 10 and 50 μM stavudine (d4T), efavirenz (EFV), atazanavir (ATV), ritonavir (RTV), and ATV-boosted RTV. Viability and adipogenesis were evaluated by staining with propidium iodide, oil red, and adipoRed; mRNA levels of genes involved in adipocyte differentiation, i.e. CCAAT/enhancer-binding protein alpha (CEBPα) and peroxisome proliferator-activated receptor gamma (PPARγ), and in adipocyte functions, i.e. fatty acid synthase (FASN), fatty acid binding protein-4 (FABP4), perilipin-1 (PLIN1) and 1-acylglycerol-3-phosphate O-acyltransferase-2 (AGPAT2), were quantified by real time PCR. We found that ATV, RTV, EFV, and ATV-boosted RTV, but not d4T, caused massive cell death in both cell types. EFV and d4T affected the accumulation of lipid droplets and induced changes in mRNA levels of genes involved in adipocyte functions in hBM-MSCs, while RTV and ATV had little effects. All drugs stimulated the accumulation of lipid droplets in hDPSCs. Thus, the adipogenic differentiation of human stem cells can be influenced by antiretroviral drugs, and depends, at least in

  6. LT175 Is a Novel PPARα/γ Ligand with Potent Insulin-sensitizing Effects and Reduced Adipogenic Properties*

    PubMed Central

    Gilardi, Federica; Giudici, Marco; Mitro, Nico; Maschi, Omar; Guerrini, Uliano; Rando, Gianpaolo; Maggi, Adriana; Cermenati, Gaia; Laghezza, Antonio; Loiodice, Fulvio; Pochetti, Giorgio; Lavecchia, Antonio; Caruso, Donatella; De Fabiani, Emma; Bamberg, Krister; Crestani, Maurizio

    2014-01-01

    Peroxisome proliferator-activated receptors (PPARs) are ligand-dependent transcription factors regulating lipid and glucose metabolism. Ongoing drug discovery programs aim to develop dual PPARα/γ agonists devoid of the side effects of the marketed antidiabetic agents thiazolidinediones and the dual agonists glitazars. Recently, we described a new dual PPARα/γ ligand, LT175, with a partial agonist profile against PPARγ and interacting with a newly identified region of the PPARγ-ligand binding domain (1). Here we show that LT175 differentially activated PPARγ target genes involved in fatty acid esterification and storage in 3T3-L1-derived adipocytes. This resulted in a less severe lipid accumulation compared with that triggered by rosiglitazone, suggesting that LT175 may have a lower adipogenic activity. Consistent with this hypothesis, in vivo administration of LT175 to mice fed a high-fat diet decreased body weight, adipocyte size, and white adipose tissue mass, as assessed by magnetic resonance imaging. Furthermore, LT175 significantly reduced plasma glucose, insulin, non-esterified fatty acids, triglycerides, and cholesterol and increased circulating adiponectin and fibroblast growth factor 21 levels. Oral glucose and insulin tolerance tests showed that the compound improves glucose homeostasis and insulin sensitivity. Moreover, we demonstrate that the peculiar interaction of LT175 with PPARγ affected the recruitment of the coregulators cyclic-AMP response element-binding protein-binding protein and nuclear corepressor 1 (NCoR1), fundamentals for the PPARγ-mediated adipogenic program. In conclusion, our results describe a new PPAR ligand, modulating lipid and glucose metabolism with reduced adipogenic activity, that may be used as a model for a series of novel molecules with an improved pharmacological profile for the treatment of dyslipidemia and type 2 diabetes. PMID:24451380

  7. Anti-adipogenic effect of mulberry leaf ethanol extract in 3T3-L1 adipocytes

    PubMed Central

    Yang, Soo Jin; Park, Na-Young

    2014-01-01

    BACKGROUND/OBJECTIVES Adipogenesis is part of the cell differentiation process in which undifferentiated fibroblasts (pre-adipocytes) become mature adipocytes with the accumulation of lipid droplets and subsequent cell morphological changes. Several transcription factors and food components have been suggested to be involved in adipogenesis. The aim of this study was to determine whether mulberry leaf ethanol extract (MLEE) affects adipogenesis in 3T3-L1 adipocytes. MATERIALS/METHODS The 3T3-L1 adipocytes were treated with different doses of MLEE for 8 days starting 2 days post-confluence. Cell viability, fat accumulation, and adipogenesis-related factors including CCAAT-enhancer-binding protein alpha (C/EBPα), peroxisome proliferator-activated receptor gamma (PPARγ), PPARγ coactivator 1 alpha (PGC-1α), fatty acid synthase (FAS), and adiponectin were analyzed. RESULTS Results showed that MLEE treatments at 10, 25, 50, and 100 µg/ml had no effect on cell morphology and viability. Without evident toxicity, all MLEE treated cells had lower fat accumulation compared with control as shown by lower absorbances of Oil Red O stain. MLEE at 50 and 100 µg/ml significantly reduced protein levels of PPARγ, PGC-1α, FAS, and adiponectin in differentiated adipocytes. Furthermore, protein level of C/EBPα was significantly decreased by the treatment of 100 µg/ml MLEE. CONCLUSION These results demonstrate that MLEE treatment has an anti-adipogenic effect in differentiated adipocytes without toxicity, suggesting its potential as an anti-obesity therapeutic. PMID:25489399

  8. Effects of fattening periods on the expression of adipogenic transcription factors in Wagyu beef cattle.

    PubMed

    Yamada, T; Kawakami, S-I; Nakanishi, N

    2007-06-01

    In this experiment, we studied the effects of fattening periods (at 19, 24, and 29 months of age) on the expression of the C/EBP family (C/EBPα, C/EBPβ, and C/EBPδ) and PPARγ protein levels by Western blot analysis from different fat depots (subcutaneous, intermuscular, and mesenteric fat tissue) of Japanese Black steers. The expressions of C/EBPβ-liver-enriched activator protein (LAP), which activates preadipocyte differentiation, in subcutaneous, intermuscular, and mesenteric fat tissue at 29 months of age were significantly lower than those at 19 months. On the other hand, the expressions of C/EBPβ-liver-enriched inhibitory protein (LIP), which represses preadipocyte differentiation, in subcutaneous and intermuscular fat tissue in 29 months of age were significantly higher than those at 19 months. The expressions of C/EBPα, which activates adipocyte terminal differentiation, in intermuscular fat tissue at 29 months of age were significantly higher than those at 19 months. No significant differences in the C/EBPδ and PPAR γ levels were observed in the fattening periods for any fat depots. These results suggest that adipogenic transcription factors, especially C/EBPβ and C/EBPα, play an important role in regulating adipogenesis during the fattening periods of Japanese Black cattle.

  9. Reverse Differentiation as a Gene Filtering Tool in Genome Expression Profiling of Adipogenesis for Fat Marker Gene Selection and Their Analysis

    PubMed Central

    Ullah, Mujib; Stich, Stefan; Häupl, Thomas; Eucker, Jan; Sittinger, Michael; Ringe, Jochen

    2013-01-01

    Background During mesenchymal stem cell (MSC) conversion into adipocytes, the adipogenic cocktail consisting of insulin, dexamethasone, indomethacin and 3-isobutyl-1-methylxanthine not only induces adipogenic-specific but also genes for non-adipogenic processes. Therefore, not all significantly expressed genes represent adipogenic-specific marker genes. So, our aim was to filter only adipogenic-specific out of all expressed genes. We hypothesize that exclusively adipogenic-specific genes change their expression during adipogenesis, and reverse during dedifferentiation. Thus, MSC were adipogenic differentiated and dedifferentiated. Results Adipogenesis and reverse adipogenesis was verified by Oil Red O staining and expression of PPARG and FABP4. Based on GeneChips, 991 genes were differentially expressed during adipogenesis and grouped in 4 clusters. According to bioinformatic analysis the relevance of genes with adipogenic-linked biological annotations, expression sites, molecular functions, signaling pathways and transcription factor binding sites was high in cluster 1, including all prominent adipogenic genes like ADIPOQ, C/EBPA, LPL, PPARG and FABP4, moderate in clusters 2–3, and negligible in cluster 4. During reversed adipogenesis, only 782 expressed genes (clusters 1–3) were reverted, including 597 genes not reported for adipogenesis before. We identified APCDD1, CHI3L1, RARRES1 and SEMA3G as potential adipogenic-specific genes. Conclusion The model system of adipogenesis linked to reverse adipogenesis allowed the filtration of 782 adipogenic-specific genes out of total 991 significantly expressed genes. Database analysis of adipogenic-specific biological annotations, transcription factors and signaling pathways further validated and valued our concept, because most of the filtered 782 genes showed affiliation to adipogenesis. Based on this approach, the selected and filtered genes would be potentially important for characterization of adipogenesis and

  10. Different anti-adipogenic effects of bio-compounds on primary visceral pre-adipocytes and adipocytes

    PubMed Central

    Colitti, Monica; Stefanon, Bruno

    2016-01-01

    Several natural compounds exhibit strong capacity for decreasing triglyceride accumulation, enhancing lipolysis and inducing apoptosis. The present study reports the anti-adipogenic effects of Silybum marianum (SL), Citrus aurantium (CA), Taraxacum officinale (TO), resveratrol (RE), Curcuma longa (CU), caffeine (CF), oleuropein (OL) and docosahexaenoic acid (DHA) in reducing differentiation and increasing lipolysis and apoptosis. Analyses were performed on human primary visceral pre-adipocytes after 10 (P10) and 20 (P20) days of treatment during differentiation and on mature adipocytes after 7 days of treatment (A7). The percentage of apoptosis induced by TO extract in P10 and P20 cells was significantly higher than that induced by all other compounds and in CTRL cells. Triglyceride accumulation was significantly lower in cells treated with DHA, CF, RE in comparison to cells treated with OL and in CTRL cells. Treatments with CF, DHA and OL significantly incremented lipolysis in P20 cells in comparison to other compounds and in CTRL cells. On the contrary, the treatment of A7 cells with OL, CA and TO compounds significantly increased cell lipolysis. The addition of CF in differentiating P20 pre-adipocytes significantly increased the expression of genes involved in inhibition of adipogenesis, such as GATA2, GATA3, WNT1, WNT3A, SFRP5, and DLK1. Genes involved in promoting adipogenesis such as CCND1, CEBPB and SREBF1 were significantly down-regulated by the treatment. The screening of bioactive compounds for anti-adipogenic effects showed that in differentiating cells TO extract was the most effective in inducing apoptosis and CF and DHA extracts were more efficient in inhibition of differentiation and in induction of cell lipolysis. PMID:27540349

  11. Function Clustering Self-Organization Maps (FCSOMs) for mining differentially expressed genes in Drosophila and its correlation with the growth medium.

    PubMed

    Liu, L L; Liu, M J; Ma, M

    2015-09-28

    The central task of this study was to mine the gene-to-medium relationship. Adequate knowledge of this relationship could potentially improve the accuracy of differentially expressed gene mining. One of the approaches to differentially expressed gene mining uses conventional clustering algorithms to identify the gene-to-medium relationship. Compared to conventional clustering algorithms, self-organization maps (SOMs) identify the nonlinear aspects of the gene-to-medium relationships by mapping the input space into another higher dimensional feature space. However, SOMs are not suitable for huge datasets consisting of millions of samples. Therefore, a new computational model, the Function Clustering Self-Organization Maps (FCSOMs), was developed. FCSOMs take advantage of the theory of granular computing as well as advanced statistical learning methodologies, and are built specifically for each information granule (a function cluster of genes), which are intelligently partitioned by the clustering algorithm provided by the DAVID_6.7 software platform. However, only the gene functions, and not their expression values, are considered in the fuzzy clustering algorithm of DAVID. Compared to the clustering algorithm of DAVID, these experimental results show a marked improvement in the accuracy of classification with the application of FCSOMs. FCSOMs can handle huge datasets and their complex classification problems, as each FCSOM (modeled for each function cluster) can be easily parallelized.

  12. Ebf2 is a selective marker of brown and beige adipogenic precursor cells.

    PubMed

    Wang, Wenshan; Kissig, Megan; Rajakumari, Sona; Huang, Li; Lim, Hee-Woong; Won, Kyoung-Jae; Seale, Patrick

    2014-10-07

    Brown adipocytes and muscle and dorsal dermis descend from precursor cells in the dermomyotome, but the factors that regulate commitment to the brown adipose lineage are unknown. Here, we prospectively isolated and determined the molecular profile of embryonic brown preadipose cells. Brown adipogenic precursor activity in embryos was confined to platelet-derived growth factor α(+), myogenic factor 5(Cre)-lineage-marked cells. RNA-sequence analysis identified early B-cell factor 2 (Ebf2) as one of the most selectively expressed genes in this cell fraction. Importantly, Ebf2-expressing cells purified from Ebf2(GFP) embryos or brown fat tissue did not express myoblast or dermal cell markers and uniformly differentiated into brown adipocytes. Interestingly, Ebf2-expressing cells from white fat tissue in adult animals differentiated into brown-like (or beige) adipocytes. Loss of Ebf2 in brown preadipose cells reduced the expression levels of brown preadipose-signature genes, whereas ectopic Ebf2 expression in myoblasts activated brown preadipose-specific genes. Altogether, these results indicate that Ebf2 specifically marks and regulates the molecular profile of brown preadipose cells.

  13. Adipogenic role of alternatively activated macrophages in β-adrenergic remodeling of white adipose tissue.

    PubMed

    Lee, Yun-Hee; Kim, Sang-Nam; Kwon, Hyun-Jung; Maddipati, Krishna Rao; Granneman, James G

    2016-01-01

    De novo brown adipogenesis involves the proliferation and differentiation of progenitors, yet the mechanisms that guide these events in vivo are poorly understood. We previously demonstrated that treatment with a β3-adrenergic receptor (ADRB3) agonist triggers brown/beige adipogenesis in gonadal white adipose tissue following adipocyte death and clearance by tissue macrophages. The close physical relationship between adipocyte progenitors and tissue macrophages suggested that the macrophages that clear dying adipocytes might generate proadipogenic factors. Flow cytometric analysis of macrophages from mice treated with CL 316,243 identified a subpopulation that contained elevated lipid and expressed CD44. Lipidomic analysis of fluorescence-activated cell sorting-isolated macrophages demonstrated that CD44+ macrophages contained four- to five-fold higher levels of the endogenous peroxisome-proliferator activated receptor gamma (PPARγ) ligands 9-hydroxyoctadecadienoic acid (HODE), and 13-HODE compared with CD44- macrophages. Gene expression profiling and immunohistochemistry demonstrated that ADRB3 agonist treatment upregulated expression of ALOX15, the lipoxygenase responsible for generating 9-HODE and 13-HODE. Using an in vitro model of adipocyte efferocytosis, we found that IL-4-primed tissue macrophages accumulated lipid from dying fat cells and upregulated expression of Alox15. Furthermore, treatment of differentiating adipocytes with 9-HODE and 13-HODE potentiated brown/beige adipogenesis. Collectively, these data indicate that noninflammatory removal of adipocyte remnants and coordinated generation of PPARγ ligands by M2 macrophages provides localized adipogenic signals to support de novo brown/beige adipogenesis.

  14. Conversion of adipogenic to osteogenic phenotype using crystalline porous biomatrices of marine origin.

    PubMed

    Birk, Ruth Z; Abramovitch-Gottlib, Liat; Margalit, Iris; Aviv, Moran; Forti, Efrat; Geresh, Shimona; Vago, Razi

    2006-01-01

    Adipogenic and osteogenic cells share part of the early differentiation cascade of mesenchymal stem cells (MSCs). The choice of a mesenchymal precursor cell to differentiate into a particular cell type is dictated by many spatial and temporal cues, including growth factors, neighboring mature cells, and the extracellular matrix (ECM), which plays an important role in bone formation. Whether adipocytes that have initiated differentiation along one lineage can convert into osteogenic lineage by merely interacting with materials having specific surface parameters is unknown. Using crystalline three-dimensional (3D) biomatrices of marine origin (CaCO(3)), we explored whether preadipocytes can convert into osteoblasts. Cells (3T3F442A) were seeded on 3D biomatrices of marine origin (Porites lutea). Analyses were made at different time intervals-1, 2, 5, 7, 14, 21, and 28 days post-seeding. Cell characterizations were done using morphological (light microscopy and scanning electron microscopy), histological (Alizarin red, von Kossa and Oil red O staining), enzymatic (alkaline phosphatase activity, and quantitative PCR testing transcript levels of osteocalcin, alkaline phosphatase, core binding factor- 1 (Cbfa1), and fatty acid binding protein (aP2). We demonstrated 3T3F442A preadipocyte modulation and differentiation into bone-forming cells when grown on biomatrix of marine origin without addition of other bone morphogenesis inducers. We found an active ossification process typical of osteogenic phenotype as early as 2 days after seeding. It is suggested that this crystalline biomatrix having a particular 3D topology or surface parameters supports fast cellular adhesion, proliferation, and differentiation of preadipocytes to osteogenic phenotype.

  15. Use of small interfering ribonucleic acids to inhibit the adipogenic effect of alcohol on human bone marrow-derived mesenchymal cells.

    PubMed

    Huang, Qiang; Zhang, Hui; Pei, Fu-xing; Chen, Zhi-yu; Wang, Guang-lin; Shen, Bin; Yang, Jing; Zhou, Zong-ke; Kong, Qing-quan

    2010-10-01

    This study tested the potential of small interfering RNAs (siRNA) targeting human peroxisome proliferator activated receptor gamma (PPARγ) to repress the adipogenic effect of alcohol on human bone marrow-derived mesenchymal cells (hBMSCs). hBMSCs were cultured from hip replacement surgery patients (n = 10). PPARγ-siRNA was transiently transfected into hBMSCs cultured in ostogenic media containing 50 mM alcohol by using a liposome-based strategy. Oil red O staining was used to test the development of differentiated adipocytes, and Alizarin red staining was used to test mineral deposition. Marker genes of adipogenesis (PPARγ2 and aP2) and osteogenesis (Osf2/Cbfa1) were examined through real time RT-PCR and Western blot, respectively. Collagen type I, alkaline phosphatase and osteocalcin protein synthesis of cultures were also assayed. Data were presented as mean ± SD. Differences between the means of the treatment groups were determined with ANOVA. PPARγ-siRNA transfection resulted in significantly lower adipocyte number, increased matrix mineralisation, repressed adipogenic gene markers, up-regulated osteogenic gene marker and bone matrix protein synthesis in the PPARγ-siRNA group compared to controls (P < 0.05). PPARγ-siRNA is a useful strategy to inhibit the adipogenic effect and the osteogenic repression of alcohol on hBMSCs. This may be a novel therapeutic intervention for osteopenic disorders in alcoholism and other conditions.

  16. Bone Marrow Mesenchymal Stem Cells Enhance the Differentiation of Human Switched Memory B Lymphocytes into Plasma Cells in Serum-Free Medium

    PubMed Central

    Gervais-St-Amour, Catherine

    2016-01-01

    The differentiation of human B lymphocytes into plasma cells is one of the most stirring questions with regard to adaptive immunity. However, the terminal differentiation and survival of plasma cells are still topics with much to be discovered, especially when targeting switched memory B lymphocytes. Plasma cells can migrate to the bone marrow in response to a CXCL12 gradient and survive for several years while secreting antibodies. In this study, we aimed to get closer to niches favoring plasma cell survival. We tested low oxygen concentrations and coculture with mesenchymal stem cells (MSC) from human bone marrow. Besides, all cultures were performed using an animal protein-free medium. Overall, our model enables the generation of high proportions of CD38+CD138+CD31+ plasma cells (≥50%) when CD40-activated switched memory B lymphocytes were cultured in direct contact with mesenchymal stem cells. In these cultures, the secretion of CXCL12 and TGF-β, usually found in the bone marrow, was linked to the presence of MSC. The level of oxygen appeared less impactful than the contact with MSC. This study shows for the first time that expanded switched memory B lymphocytes can be differentiated into plasma cells using exclusively a serum-free medium. PMID:27872867

  17. In vitro cementoblast-like differentiation of postmigratory neural crest-derived p75{sup +} stem cells with dental follicle cell conditioned medium

    SciTech Connect

    Wen, Xiujie; Liu, Luchuan; Deng, Manjing; Liu, Rui; Zhang, Li; Nie, Xin

    2015-09-10

    Cranial neural crest-derived cells (CNCCs) play important role in epithelial–mesenchymal interactions during tooth morphogenesis. However, the heterogeneity of CNCCs and their tendency to spontaneously differentiate along smooth muscle or osteoblast lineages in vitro limit further understanding of their biological properties. We studied the differentiation properties of isolated rat embryonic postmigratory CNCCs, expressing p75 neurotrophin receptor (p75NTR). These p75NTR positive (p75{sup +}) CNCCs, isolated using fluorescence activated cell sorter, exhibited fibroblast-like morphology and characteristics of mesenchymal stem cells. Incubation of p75{sup +} CNCCs in dental follicle cell conditioned medium (DFCCM) combined with dentin non-collagenous proteins (dNCPs), altered their morphological features to cementoblast-like appearance. These cells also showed low proliferative activity, high ALP activity and significantly increased calcified nodule formation. Markers related to mineralization or specific to cementoblast lineage were highly expressed in dNCPs/DFCCM-treated p75{sup +} cells, suggesting their differentiation along cementoblast-like lineage. p75{sup +} stem cells selected from postmigratory CNCCs represent a pure stem cell population and could be used as a stem cell model for in vitro studies due to their intrinsic ability to differentiate to neuronal cells and transform from neuroectoderm to ectomesenchyme. They can provide a potential stem cell resource for tooth engineering studies and help to further investigate mechanisms of epithelial–mesenchymal interactions in tooth morphogenesis. - Highlights: • Cranial neural crest-derived cells (CNCCs) take part in tooth morphogenesis. • positive (p75{sup +}) CNCCs are fibroblast-like and resemble mesenchymal stem cells. • p75{sup +} CNCCs in dental follicle cell medium (DFCCM/dNCP) appear like cementoblasts. • DFCCM/dNCP-treated p75{sup +} cells express cementoblast specific mineralization

  18. Cryopreservation of stromal vascular fraction of adipose tissue in a serum-free freezing medium

    PubMed Central

    Thirumala, Sreedhar; Gimble, Jeffrey M.; Devireddy, Ram V.

    2015-01-01

    DMSO and serum (HS or FCS), i.e. ~54 ± 14% and ~63 ± 10%, respectively. Adipogenic and osteogenic differentiation behaviour of the frozen thawed cells was also assessed, using histochemical staining. Our results suggest that post-thaw SVF cell viability and adipogenic and osteogenic differentiability can be maintained even when they are frozen in the absence of serum and DMSO but with 10% PVP in DMEM. PMID:19967746

  19. New medium used in the differentiation of human pluripotent stem cells to retinal cells is comparable to fetal human eye tissue.

    PubMed

    Wang, Xiaobing; Xiong, Kai; Lin, Cong; Lv, Lei; Chen, Jing; Xu, Chongchong; Wang, Songtao; Gu, Dandan; Zheng, Hua; Yu, Hurong; Li, Yan; Xiao, Honglei; Zhou, Guomin

    2015-06-01

    Human pluripotent stem cells (hPSCs) have the potential to differentiate along the retinal lineage. However, most induction systems are dependent on multiple small molecular compounds such as Dkk-1, Lefty-A, and retinoic acid. In the present study, we efficiently differentiated hPSCs into retinal cells using a retinal differentiation medium (RDM) without the use of small molecular compounds. This novel differentiation system recapitulates retinal morphogenesis in humans, i.e. hPSCs gradually differentiate into optic vesicle-shaped spheres, followed by optic cup-shaped spheres and, lastly, retinal progenitor cells. Furthermore, at different stages, hPSC-derived retinal cells mirror the transcription factor expression profiles seen in their counterparts during human embryogenesis. Most importantly, hinge epithelium was found between the hPSC-derived neural retina (NR) and retinal pigment epithelium (RPE). These data suggest that our culture system provides a new method for generating hPSC-derived retinal cells that, for the first time, might be used in human transplantation.

  20. Human adipocytes from the subcutaneous superficial layer have greater adipogenic potential and lower PPAR-γ DNA methylation levels than deep layer adipocytes.

    PubMed

    Kosaka, Kentaro; Kubota, Yoshitaka; Adachi, Naoki; Akita, Shinsuke; Sasahara, Yoshitaro; Kira, Tomoe; Kuroda, Masayuki; Mitsukawa, Nobuyuki; Bujo, Hideaki; Satoh, Kaneshige

    2016-08-01

    Human subcutaneous fat tissue consists of two layers, superficial adipose tissue (SAT) and deep adipose tissue (DAT). Some recent reports suggest that a disproportionate accumulation of DAT is related to obesity-associated metabolic complications. However, the differences in adipocyte function between SAT and DAT are unclear. To clarify the differences in human adipocyte characteristics between SAT and DAT, human ceiling culture-derived proliferative adipocytes (ccdPAs) were primary cultured from SAT and DAT of three lean female patients. Differences in adipogenic differentiation potential and sensitivity to exogenous adipogenic factors were examined. Epigenetic modification of the CpG island DNA methylation levels of genes related to adipogenesis was measured. In histological analyses, the mean adipocyte size in SAT was significantly larger than that in DAT (8,741 ± 416 vs. 7,732 ± 213 μm(2), P < 0.05). Primary cultured adipocytes from SAT showed significantly greater adipogenesis than did those of DAT. Sensitivity to partial adipogenic stimulation was significantly different between ccdPAs of SAT and DAT. Peroxisome proliferator-activated receptor-γ (PPAR-γ) protein expression and leptin protein secretion from ccdPAs were significantly higher in SAT than DAT. DNA methylation levels of PPAR-γ were significantly lower in ccdPAs of SAT than DAT. Adipocyte size was larger in SAT than DAT in vivo. This is consistent with the findings of an in vitro study that, compared with ccdPAs in DAT, ccdPAs in SAT have higher adipogenic potential and lower DNA methylation levels of PPAR-γ.

  1. Role of PRDM16 and its PR domain in the epigenetic regulation of myogenic and adipogenic genes during transdifferentiation of C2C12 cells.

    PubMed

    Li, Xiao; Wang, Jinquan; Jiang, Zheng; Guo, Feng; Soloway, Paul D; Zhao, Ruqian

    2015-10-10

    The positive regulatory domain containing 16 (PRDM16) is commonly regarded as a "switch" controlling the transdifferentiation of myoblasts to brown adipocytes. The N-positive regulatory (PR) domain, which is highly homologous to SET domain, is a characteristic structure for the PRDM family. Many SET domain containing proteins and several PRDM members have been found to possess histone methyltransferase activity, yet the role of PRDM16 and its PR domain in the epigenetic regulation of myogenic and adipogenic genes during myoblasts/adipocytes transdifferentiation remains unexplored. In this study, we transfected C2C12 myoblasts to stably express PRDM16 and observed the repression of myogenic genes and activation of adipogenic genes at both proliferation and differentiation stages. Ectopic PRDM16-induced reprogramming of myogenic and adipogenic genes was associated with the hypermethylation on some CpG sites in the enhancer or promoter of MyoD and myogenin, but the methylation status of PPARγ promoter was not affected. C2C12 cells expressing truncated PRDM16 lacking PR domain (ΔPR-PRDM16) demonstrated attenuation of both adipogenic and myogenic potentials, indicated by PPARγ inactivation and decreased triglyceride deposition, as well as a downregulation of MyoD, MyHC and MCK genes, as compared with C2C12 cells expressing intact PRDM16. Furthermore, C2C12 cells expressing ΔPR-PRDM16 exhibited significant differences in histone modifications on the promoters of MyoD and PPARγ genes. Taken together, PRDM16-induced C2C12 transdifferentiation is associated with alterations in CpG methylation of myogenic factors, and PR domain affects both myogenesis and adipogenesis with modified histone methylation marks on MyoD and PPARγ promoters.

  2. Atypical antipsychotics induce both proinflammatory and adipogenic gene expression in human adipocytes in vitro

    SciTech Connect

    Sárvári, Anitta K.; Veréb, Zoltán; Uray, Iván P.; Fésüs, László; Balajthy, Zoltán

    2014-08-08

    Highlights: • Antipsychotics modulate the expression of adipogenic genes in human adipocytes. • Secretion of proinflammatory cytokine IL8 and MCP-1 is induced by antipsychotics. • Adipocyte-dependent inflammatory abnormality could develop during chronic treatment. • Infiltrated macrophages would further enhance proinflammatory cytokine production. - Abstract: Schizophrenia requires lifelong treatment, potentially causing systemic changes in metabolic homeostasis. In the clinical setting, antipsychotic treatment may differentially lead to weight gain among individual patients, although the molecular determinants of such adverse effects are currently unknown. In this study, we investigated changes in the expression levels of critical regulatory genes of adipogenesis, lipid metabolism and proinflammatory genes during the differentiation of primary human adipose-derived stem cells (ADSCs). These cells were isolated from patients with body mass indices <25 and treated with the second-generation antipsychotics olanzapine, ziprasidone, clozapine, quetiapine, aripiprazole and risperidone and the first-generation antipsychotic haloperidol. We found that antipsychotics exhibited a marked effect on key genes involved in the regulation of cell cycle, signal transduction, transcription factors, nuclear receptors, differentiation markers and metabolic enzymes. In particular, we observed an induction of the transcription factor NF-KB1 and NF-KB1 target genes in adipocytes in response to these drugs, including the proinflammatory cytokines TNF-α, IL-1β, IL-8 and MCP-1. In addition, enhanced secretion of both IL8 and MCP-1 was observed in the supernatant of these cell cultures. In addition to their remarkable stimulatory effects on proinflammatory gene transcription, three of the most frequently prescribed antipsychotic drugs, clozapine, quetiapine and aripiprazole, also induced the expression of essential adipocyte differentiation genes and the adipocyte hormones leptin

  3. Association of adipogenic genes with SC-35 domains during porcine adipogenesis.

    PubMed

    Szczerbal, Izabela; Bridger, Joanna M

    2010-12-01

    Spatial organization of the genome within interphase nuclei is non-random. It has been shown that not only whole chromosomes but also individual genes occupy specific nuclear locations and these locations can be changed during different processes like differentiation or disease. Using a porcine in vitro adipogenesis stem cell differentiation system as a model to study nuclear organization, it was demonstrated that nuclear position of selected genes involved in porcine adipogenesis was altered with the up-regulation of gene expression, correlating with these genes becoming more internally located within nuclei, without whole territory relocation. Here, we investigated whether the gene relocation observed during porcine adipogenesis is related to spatial co-association with SC-35 domains. These domains are nuclear speckles enriched in numerous splicing and RNA metabolic factors. Using a DNA immuno-FISH approach we investigated the localisation of three adipogenic genes (PPARG, SREBF1, and FABP4) with SC-35 domains in porcine mesenchymal stem cells and after they were differentiated into adipocytes. We found that the location of these genes relative to SC-35 domains was non-random and correlated with the up-regulation of gene expression. In addition, we observed more frequent clustering of the studied genes located on different chromosomes around the same nuclear speckle in differentiated adipocytes than in mesenchymal stem cells. However, the choice of the domain was more random. This study adds to the evidence that SC-35 domains are hubs of gene activity and gene-domain association may be considered as a common mechanism to enhance gene expression.

  4. Muscle side population cells from dystrophic or injured muscle adopt a fibro-adipogenic fate.

    PubMed

    Penton, Christopher M; Thomas-Ahner, Jennifer M; Johnson, Eric K; McAllister, Cynthia; Montanaro, Federica

    2013-01-01

    Muscle side population (SP) cells are rare multipotent stem cells that can participate in myogenesis and muscle regeneration upon transplantation. While they have been primarily studied for the development of cell-based therapies for Duchenne muscular dystrophy, little is known regarding their non-muscle lineage choices or whether the dystrophic muscle environment affects their ability to repair muscle. Unfortunately, the study of muscle SP cells has been challenged by their low abundance and the absence of specific SP cell markers. To address these issues, we developed culture conditions for the propagation and spontaneous multi-lineage differentiation of muscle SP cells. Using this approach, we show that SP cells from wild type muscle robustly differentiate into satellite cells and form myotubes without requiring co-culture with myogenic cells. Furthermore, this myogenic activity is associated with SP cells negative for immune (CD45) and vascular (CD31) markers but positive for Pax7, Sca1, and the mesenchymal progenitor marker PDGFRα. Additionally, our studies revealed that SP cells isolated from dystrophic or cardiotoxin-injured muscle fail to undergo myogenesis. Instead, these SP cells rapidly expand giving rise to fibroblast and adipocyte progenitors (FAPs) and to their differentiated progeny, fibroblasts and adipocytes. Our findings indicate that muscle damage affects the lineage choices of muscle SP cells, promoting their differentiation along fibro-adipogenic lineages while inhibiting myogenesis. These results have implications for a possible role of muscle SP cells in fibrosis and fat deposition in muscular dystrophy. In addition, our studies provide a useful in vitro system to analyze SP cell biology in both normal and pathological conditions.

  5. Fibro/Adipogenic Progenitors (FAPs): Isolation by FACS and Culture.

    PubMed

    Low, Marcela; Eisner, Christine; Rossi, Fabio

    2017-01-01

    Fibro/adipogenic progenitors (FAPs ) are tissue-resident mesenchymal stromal cells (MSCs). Current literature supports a role for these cells in the homeostasis and repair of multiple tissues suggesting that FAPs may have extensive therapeutic potential in the treatment of numerous diseases. In this context, it is crucial to establish efficient and reproducible procedures to purify FAP populations from various tissues. Here, we describe a protocol for the isolation and cell culture of FAPs from murine skeletal muscle using fluorescence -activated cell sorting (FACS), which is particularly useful for experiments where high cell purity is an essential requirement. Identification, isolation, and cell culture of FAPs represent powerful tools that will help us to understand the role of these cells in different conditions and facilitate the development of safe and effective new treatments for diseases.

  6. In vitro cementoblast-like differentiation of postmigratory neural crest-derived p75(+) stem cells with dental follicle cell conditioned medium.

    PubMed

    Wen, Xiujie; Liu, Luchuan; Deng, Manjing; Liu, Rui; Zhang, Li; Nie, Xin

    2015-09-10

    Cranial neural crest-derived cells (CNCCs) play important role in epithelial-mesenchymal interactions during tooth morphogenesis. However, the heterogeneity of CNCCs and their tendency to spontaneously differentiate along smooth muscle or osteoblast lineages in vitro limit further understanding of their biological properties. We studied the differentiation properties of isolated rat embryonic postmigratory CNCCs, expressing p75 neurotrophin receptor (p75NTR). These p75NTR positive (p75(+)) CNCCs, isolated using fluorescence activated cell sorter, exhibited fibroblast-like morphology and characteristics of mesenchymal stem cells. Incubation of p75(+) CNCCs in dental follicle cell conditioned medium (DFCCM) combined with dentin non-collagenous proteins (dNCPs), altered their morphological features to cementoblast-like appearance. These cells also showed low proliferative activity, high ALP activity and significantly increased calcified nodule formation. Markers related to mineralization or specific to cementoblast lineage were highly expressed in dNCPs/DFCCM-treated p75(+) cells, suggesting their differentiation along cementoblast-like lineage. p75(+) stem cells selected from postmigratory CNCCs represent a pure stem cell population and could be used as a stem cell model for in vitro studies due to their intrinsic ability to differentiate to neuronal cells and transform from neuroectoderm to ectomesenchyme. They can provide a potential stem cell resource for tooth engineering studies and help to further investigate mechanisms of epithelial-mesenchymal interactions in tooth morphogenesis.

  7. Improved Survival and Initiation of Differentiation of Human Induced Pluripotent Stem Cells to Hepatocyte-Like Cells upon Culture in William’s E Medium followed by Hepatocyte Differentiation Inducer Treatment

    PubMed Central

    Tomizawa, Minoru; Shinozaki, Fuminobu; Motoyoshi, Yasufumi; Sugiyama, Takao; Yamamoto, Shigenori; Ishige, Naoki

    2016-01-01

    Background Hepatocyte differentiation inducer (HDI) lacks both glucose and arginine, but is supplemented with galactose and ornithine, and is added together with other reagents such as apoptosis inhibitor and oncostatin M. Although human induced pluripotent stem (iPS) cells initiate hepatocyte differentiation, most die within 7 days. In this study, we investigated both HDI and conventional media for their potential to improve cell survival. Materials and Methods 201B7 iPS cells were cultured in conventional media. This consisted of three cycles of 5-day culture in William’s E (WE) medium, followed by a 2-day culture in HDI. Results Expression levels of α-feto protein (AFP) were higher in cells cultured in WE and in Dulbecco’s Modified Eagle’s Medium/Nutrient F-12 Ham (DF12). 201B7 cells expressed the highest AFP and albumin (ALB) when cultured in HDI for 2 days following 7-day culture in WE. After three cycles of 5-day culture in WE followed by 2 days in HDI, 201B7 cells expressed AFP and ALB 54 ± 2.3 (average ± standard deviation) and 73 ± 15.1 times higher, respectively, than those cultured in ReproFF (feeder-free condition). Conclusion 201B7 cells survived culture in WE for 7 days followed HDI for 2 days. After three cycles of culture under these conditions, hepatocyte differentiation was enhanced, as evidenced by increased AFP and ALB expression. PMID:27073925

  8. Nitrogen Source and External Medium pH Interaction Differentially Affects Root and Shoot Metabolism in Arabidopsis

    PubMed Central

    Sarasketa, Asier; González-Moro, M. Begoña; González-Murua, Carmen; Marino, Daniel

    2016-01-01

    Ammonium nutrition often represents an important growth-limiting stress in plants. Some of the symptoms that plants present under ammonium nutrition have been associated with pH deregulation, in fact external medium pH control is known to improve plants ammonium tolerance. However, the way plant cell metabolism adjusts to these changes is not completely understood. Thus, in this work we focused on how Arabidopsis thaliana shoot and root respond to different nutritional regimes by varying the nitrogen source (NO3- and NH4+), concentration (2 and 10 mM) and pH of the external medium (5.7 and 6.7) to gain a deeper understanding of cell metabolic adaptation upon altering these environmental factors. The results obtained evidence changes in the response of ammonium assimilation machinery and of the anaplerotic enzymes associated to Tricarboxylic Acids (TCA) cycle in function of the plant organ, the nitrogen source and the degree of ammonium stress. A greater stress severity at pH 5.7 was related to NH4+ accumulation; this could not be circumvented in spite of the stimulation of glutamine synthetase, glutamate dehydrogenase, and TCA cycle anaplerotic enzymes. Moreover, this study suggests specific functions for different gln and gdh isoforms based on the nutritional regime. Overall, NH4+ accumulation triggering ammonium stress appears to bear no relation to nitrogen assimilation impairment. PMID:26870054

  9. Accelerated and safe proliferation of human adipose-derived stem cells in medium supplemented with human serum.

    PubMed

    Josh, Fonny; Kobe, Kyoko; Tobita, Morikuni; Tanaka, Rica; Suzuki, Koji; Ono, Kasumi; Hyakusoku, Hiko; Mizuno, Hiroshi

    2012-01-01

    Adipose-derived stem cells (ASCs) are a promising cell source and are being investigated for a variety of therapeutic applications. However, standard expansion protocols use fetal bovine serum (FBS) as a growth factor supplement, which is a potential source of undesirable xenogeneic pathogens. For clinical safety, autologous human serum (HS) would be more appropriate. This study compared FBS-supplemented and HS-supplemented media for their enhancement of the proliferation and differentiation potential of human ASCs (hASCs). HS was obtained from the blood of 8 healthy volunteers using collection devices specially designed to derive growth factors from platelets. Growth factors in HS or FBS were measured with enzyme-linked immunosorbent assays. The hASCs were isolated with an established protocol from discarded human fat tissues obtained during a medical procedure and cultured in a medium supplemented with either 10% HS or 10% FBS. The hASCs were collected at several time points for the proliferation assays. The capacity for differentiation into the osteogenic, chondrogenic and adipogenic lineages was assessed qualitatively with the histochemical stains von Kossa, Alcian blue, and Oil red O, respectively, and quantitatively with the qualitative reverse transcriptase polymerase chain reaction. Differences in cell surface marker expression between the HS-supplemented and FBS-supplemented cultures were examined with flow cytometric analysis. Proliferation assays showed that the growth of hASCs was more rapid in HS-supplemented medium than in FBS-supplemented medium. All cells grown in each medium expressed similar patterns of cell surface markers. The ASCs cultured in the HS-supplemented medium proliferated more rapidly than those cultured in the FBS-supplemented medium and retained their differentiation capacity and immunophenotype. These results support the establishment of a safe and rapid expansion protocol with autologous serum for cell-based therapies, such as

  10. Validation of immature adipogenic status and identification of prognostic biomarkers in myxoid liposarcoma using tissue microarrays.

    PubMed

    Cheng, Hongwei; Dodge, Jim; Mehl, Erika; Liu, Shuzhen; Poulin, Neal; van de Rijn, Matt; Nielsen, Torsten O

    2009-09-01

    Myxoid liposarcoma displays variably aggressive behavior and responds poorly to available systemic therapies. Expression profiling followed by tissue microarray validation linked to patient outcome is a powerful approach for validating biological mechanisms and identifying prognostic biomarkers. We applied these techniques to independent series of primary myxoid liposarcomas in an effort to assess markers of adipose differentiation in myxoid liposarcoma and to identify prognostic markers that can be efficiently assessed by immunohistochemistry. Candidate genes were selected based on analysis of expression profiles from 9 primary myxoid/round liposarcomas and 45 other soft tissue tumors, and by reference to publicly available data sets. Protein products were validated on an adipose neoplasm tissue microarray, including 32 myxoid liposarcomas linked to patient outcome. Results were scored visually and correlated with clinical outcome by Kaplan-Meier and Cox regression analyses. In the study, by examining expression patterns of several lipogenic regulatory gene products, an immature adipogenic status was verified in myxoid liposarcomas. We also found that expression levels of the ret proto-oncogene, insulin-like growth factor 1 receptor, and insulin-like growth factor 2 correlate with poor metastasis-free survival, supporting a role for ERK/MAPK and PI3K/AKT pathways in clinically aggressive myxoid liposarcomas.

  11. Sequence analysis of bovine C/EBPδ gene and its adipogenic effects on fibroblasts.

    PubMed

    Wang, Hong; Cheng, Gong; Fu, Changzhen; Wang, Hongbao; Yang, Wucai; Wang, Hongcheng; Zan, Linsen

    2014-01-01

    CCAAT/enhancer binding protein delta (C/EBPδ), an important transcriptional factor, regulates cell growth, differentiation and adipogenesis in humans and mice. However, we lack of directive information on the effects of C/EBPδ gene in bovine cells. In the present study, we cloned the CDS areas of bovine C/EBPδ gene and predicted its sequence characteristics. Moreover, we constructed the recombinant adenovirus plasmids of bovine C/EBPδ gene and harvested the subsequent adenoviruses to infect bovine primary fibroblasts. Oil Red O staining results showed lipid droplets accumulated gradually in the adenoviruses treated fibroblasts. Time course real-time PCR results indicated that over-expression of exogenous C/EBPδ regulated the mRNA expression levels of some key adipogenic genes, herein, activated the C/EBPα expression, increased lipoprotein lipase and fatty acid binding protein 4 mRNA expression levels, whereas inhibited leptin receptor gene. In conclusion, the present study demonstrates that the elevated C/EBPδ can induce the adipogenesis in the fibroblasts of cattle.

  12. Evaluation of a novel chromogenic agar medium for isolation and differentiation of vancomycin-resistant Enterococcus faecium and Enterococcus faecalis isolates.

    PubMed

    Ledeboer, Nathan A; Das, Kingshuk; Eveland, Michael; Roger-Dalbert, Céline; Mailler, Sandrine; Chatellier, Sonia; Dunne, William Michael

    2007-05-01

    The development of reliable and rapid methods for the identification of patients colonized with vancomycin-resistant enterococci (VRE) is central to the containment of this agent within a hospital environment. To this end, we evaluated a prototype chromogenic agar medium (VRE-BMX; bioMérieux, Marcy l'Etoile, France) used to recover VRE from clinical specimens. This medium can also identify isolated colonies as either vancomycin-resistant Enterococcus faecium or Enterococcus faecalis, based on distinct colony colors. We compared the performance of VRE-BMX with bile esculin azide agar supplemented with vancomycin (BEAV). For this study, 147 stool samples were plated on each test medium and examined after 24 and 48 h of incubation. At 24 h, the sensitivity and specificity of each medium were as follows: BEAV, 90.9% and 89.9%, respectively; VRE-BMX, 96.4% and 96.6%, respectively. The positive predictive values (PPV) of VRE-BMX and BEAV at 24 h were 89.8% and 80.7%, respectively. VRE-BMX provided the identification of 10 isolates of vancomycin-resistant E. faecalis and 4 isolates of vancomycin-resistant E. faecium that were not recovered by BEAV. Further, VRE-BMX was capable of identifying patients colonized with both E. faecium and E. faecalis, a feature useful for infection control purposes that is not a function of BEAV. In terms of the recovery of vancomycin-resistant E. faecium and E. faecalis, the sensitivity and PPV were as follows: BEAV, 75.7% and 74.6%, respectively; VRE-BMX, 95.5% and 91.3%, respectively. In this initial evaluation, we found that VRE-BMX provided improved recovery of VRE from stool specimens, with the added advantage of being able to differentiate between vancomycin-resistant E. faecalis and E. faecium. Extending the incubation period beyond 24 h did not significantly improve the recovery of VRE and resulted in decreased specificity.

  13. Testicular cell-conditioned medium supports embryonic stem cell differentiation toward germ lineage and to spermatocyte- and oocyte-like cells.

    PubMed

    Shah, Syed M; Saini, Neha; Singh, Manoj K; Manik, Radheysham; Singla, Suresh K; Palta, Prabhat; Chauhan, Manmohan S

    2016-08-01

    Testicular cells are believed to secrete various growth factors that activate signaling pathways finally leading to gametogenesis. In vitro gametogenesis is an obscure but paramountly important task primarily because of paucity of the precursor cells and first trimester gonadal tissues. To overcome these limitations for development of in vitro gametes, the present study was designed to induce differentiation of buffalo embryonic stem (ES) cells into germ lineage cells on stimulation by testicular cell-conditioned medium (TCM), on the basis of the assumption that ES cells have the intrinsic property to differentiate into any cell type and TCM would provide the necessary growth factors for differentiation toward germ cell lineage. For this purpose, buffalo ES cells were differentiated as embryoid bodies (EB) in floating cultures and as monolayer adherent cultures in different doses (10%, 20%, and 40%) of TCM for different culture intervals (4, 8, and 14 days), to identify the optimum dose-and-time period. We observed that 40% TCM dose induces highest expression of primordial germ cell-specific (DAZL, VASA, and PLZF), meiotic (SYCP3, MLH1, TNP1/2, and PRM2), spermatocyte-specific (BOULE and TEKT1), and oocyte-specific genes (GDF9 and ZP2/3) for a culture period of 14 days under both floating and adherent differentiation. Immunocytochemical analysis of EBs and adherent cultures revealed presence of primordial germ cell markers (c-KIT, DAZL, and VASA), meiotic markers (SYCP3, MLH1 and PROTAMINE1), spermatocyte markers (ACROSIN and HAPRIN), and oocyte markers (GDF9 and ZP4), indicating progression into post-meiotic gametogenesis. The detection of germ cell-specific proteins in Day 14 EBs like VASA, GDF9, and ZP4 by Western blotting further confirmed germ lineage differentiation. The significantly lower (P < 0.05) concentration of 5-methyl-2-deoxycytidine in optimally differentiated EBs is suggestive of the process of methylation erasure. Oocyte-like structures

  14. The environmental chemical tributyltin chloride (TBT) shows both estrogenic and adipogenic activities in mice which might depend on the exposure dose

    SciTech Connect

    Penza, M.; Jeremic, M.; Marrazzo, E.; Maggi, A.; Ciana, P.; Rando, G.; Grigolato, P.G.; Di Lorenzo, D.

    2011-08-15

    Exposure during early development to chemicals with hormonal action may be associated with weight gain during adulthood because of altered body homeostasis. It is known that organotins affect adipose mass when exposure occurs during fetal development, although no knowledge of effects are available for exposures after birth. Here we show that the environmental organotin tributyltin chloride (TBT) exerts adipogenic action when peripubertal and sexually mature mice are exposed to the chemical. The duration and extent of these effects depend on the sex and on the dose of the compound, and the effects are relevant at doses close to the estimated human intake (0.5 {mu}g/kg). At higher doses (50-500 {mu}g/kg), TBT also activated estrogen receptors (ERs) in adipose cells in vitro and in vivo, based on results from acute and longitudinal studies in ERE/luciferase reporter mice. In 3T3-L1 cells (which have no ERs), transiently transfected with the ERE-dependent reporter plus or minus ER{alpha} or ER{beta}, TBT (in a dose range of 1-100 nM) directly targets each ER subtype in a receptor-specific manner through a direct mechanism mediated by ER{alpha} in undifferentiated preadipocytic cells and by ER{beta} in differentiating adipocytes. The ER antagonist ICI-182,780 inhibits this effect. In summary, the results of this work suggest that TBT is adipogenic at all ages and in both sexes and that it might be an ER activator in fat cells. These findings might help to resolve the apparent paradox of an adipogenic chemical being also an estrogen receptor activator by showing that the two apparently opposite actions are separated by the different doses to which the organism is exposed. - Research Highlights: > The environmental organotin tributyltin chloride shows dose-dependent estrogenic and adipogenic activities in mice. > The duration and extent of these effects depend on the sex and the dose of the compound. > The estrogenic and adipogenic effects of TBT occur at doses closed to

  15. ErbB2 activation contributes to de-differentiation of astrocytes into radial glial cells following induction of scratch-insulted astrocyte conditioned medium.

    PubMed

    Yang, Hao; Ling, Weng; Vitale, Angela; Olivera, Cathy; Min, Yan; You, Siwei

    2011-12-01

    Radial glial cells play a significant role in the repair of spinal cord injuries as they exert critical role in the neurogenesis and act as a scaffold for neuronal migration. Our previous study showed that mature astrocytes of spinal cord can undergo a de-differentiation process and further transform into pluripotential neural precursors; the occurrence of these complex events arise directly from the induction of diffusible factors released from scratch-insulted astrocytes. However, it is unclear whether astrocytes can also undergo rejuvenation to revert to a radial glial progenitor phenotype after the induction of scratch-insulted astrocytes conditioned medium (ACM). Furthermore, the mechanism of astrocyte de-differentiation to the progenitor cells is still unclear. Here we demonstrate that upon treating mature astrocytes with ACM for 10 days, the astrocytes exhibit progressive morphological and functional conversion to radial glial cells. These changes include the appearance of radial glial progenitor cells, changes in the immunophenotypical profiles, characterized by the co-expression of nestin, paired homeobox protein (Pax6) and RC2 as well as enhanced capability of multipotential differentiation. Concomitantly, ErbB2 protein level was progressively up-regulated. Thereby these results provide a potential mechanism by which ACM could induce mature astrocytes to regain the profile of radial glial progenitors due to activating the ErbB2 signaling pathways.

  16. Medium-sized icy satellites in the outer solar system - differentiation due to radiogenic heating in Charon or the moons of Uranus?

    NASA Astrophysics Data System (ADS)

    Multhaup, K.; Spohn, T.

    2007-08-01

    A thermal history model developed for medium-sized icy satellites containing silicate rock at low volume fractions is applied to Charon and five satellites of Uranus. The model assumes stagnant lid convection in homogeneously accreted bodies either confined to a spherical shell or encompassing the whole interior below the immobile surface layer. We employ a simple model for accretion assuming that infalling planetesimals deposit a fraction of their kinetic energy as heat at the instantaneous surface of the growing moon. Rheology parameters are chosen to match those of ice I, although the satellites under consideration likely contain admixtures of lighter constituents. Consequences thereof are discussed. Thermal evolution calculations considering radiogenic heating by long-lived isotopes suggest that Ariel, Umbriel, Titania, Oberon and Charon may have started to differentiate after a few hundred million years of evolution. Results for Miranda - the smallest satellite of Uranus - however, indicate that it never convected or differentiated. Miranda's interior temperature was found to be not even close to the melting temperatures of reasonable mixtures of water and ammonia. This finding is in contrast to its heavily modified surface and supports theories that propose alternative heating mechanisms such as early tidal heating. Except for Miranda, our results lend support to differentiated icy satellite models. We also point out parallels to previously published results obtained for several of Saturn's icy satellites (Multhaup and Spohn, 2007). The predicted early histories of Ariel, Umbriel and Charon are evocative of Dione's and Rhea's, while Miranda's resembles that of Mimas.

  17. Ligninolytic peroxidase gene expression by Pleurotus ostreatus: differential regulation in lignocellulose medium and effect of temperature and pH.

    PubMed

    Fernández-Fueyo, Elena; Castanera, Raul; Ruiz-Dueñas, Francisco J; López-Lucendo, María F; Ramírez, Lucía; Pisabarro, Antonio G; Martínez, Angel T

    2014-11-01

    Pleurotus ostreatus is an important edible mushroom and a model lignin degrading organism, whose genome contains nine genes of ligninolytic peroxidases, characteristic of white-rot fungi. These genes encode six manganese peroxidase (MnP) and three versatile peroxidase (VP) isoenzymes. Using liquid chromatography coupled to tandem mass spectrometry, secretion of four of these peroxidase isoenzymes (VP1, VP2, MnP2 and MnP6) was confirmed when P. ostreatus grows in a lignocellulose medium at 25°C (three more isoenzymes were identified by only one unique peptide). Then, the effect of environmental parameters on the expression of the above nine genes was studied by reverse transcription-quantitative PCR by changing the incubation temperature and medium pH of P. ostreatus cultures pre-grown under the above conditions (using specific primers and two reference genes for result normalization). The cultures maintained at 25°C (without pH adjustment) provided the highest levels of peroxidase transcripts and the highest total activity on Mn(2+) (a substrate of both MnP and VP) and Reactive Black 5 (a VP specific substrate). The global analysis of the expression patterns divides peroxidase genes into three main groups according to the level of expression at optimal conditions (vp1/mnp3>vp2/vp3/mnp1/mnp2/mnp6>mnp4/mnp5). Decreasing or increasing the incubation temperature (to 10°C or 37°C) and adjusting the culture pH to acidic or alkaline conditions (pH 3 and 8) generally led to downregulation of most of the peroxidase genes (and decrease of the enzymatic activity), as shown when the transcription levels were referred to those found in the cultures maintained at the initial conditions. Temperature modification produced less dramatic effects than pH modification, with most genes being downregulated during the whole 10°C treatment, while many of them were alternatively upregulated (often 6h after the thermal shock) and downregulated (12h) at 37°C. Interestingly, mnp4 and

  18. Differential equations governing slip-induced pore-pressure fluctuations in a water-saturated granular medium

    USGS Publications Warehouse

    Iverson, R.M.

    1993-01-01

    Macroscopic frictional slip in water-saturated granular media occurs commonly during landsliding, surface faulting, and intense bedload transport. A mathematical model of dynamic pore-pressure fluctuations that accompany and influence such sliding is derived here by both inductive and deductive methods. The inductive derivation shows how the governing differential equations represent the physics of the steadily sliding array of cylindrical fiberglass rods investigated experimentally by Iverson and LaHusen (1989). The deductive derivation shows how the same equations result from a novel application of Biot's (1956) dynamic mixture theory to macroscopic deformation. The model consists of two linear differential equations and five initial and boundary conditions that govern solid displacements and pore-water pressures. Solid displacements and water pressures are strongly coupled, in part through a boundary condition that ensures mass conservation during irreversible pore deformation that occurs along the bumpy slip surface. Feedback between this deformation and the pore-pressure field may yield complex system responses. The dual derivations of the model help explicate key assumptions. For example, the model requires that the dimensionless parameter B, defined here through normalization of Biot's equations, is much larger than one. This indicates that solid-fluid coupling forces are dominated by viscous rather than inertial effects. A tabulation of physical and kinematic variables for the rod-array experiments of Iverson and LaHusen and for various geologic phenomena shows that the model assumptions commonly are satisfied. A subsequent paper will describe model tests against experimental data. ?? 1993 International Association for Mathematical Geology.

  19. The differentiation of amniotic fluid stem cells into sweat glandlike cells is enhanced by the presence of Sonic hedgehog in the conditioned medium.

    PubMed

    Liang, Hansi; Sun, Qing; Zhen, Yunfang; Li, Fang; Xu, YunYun; Liu, Yao; Zhang, Xueguang; Qin, Mingde

    2016-09-01

    After patients suffer severe full-thickness burn injuries, the current treatments cannot lead to the complete self-regeneration of the sweat gland structure and function. Therefore, it is important to identify new methods for acquiring sufficient functional sweat gland cells to restore skin function. In this study, we induced CD117+ human amniotic fluid stem (hAFS) cells to differentiate into sweat glandlike (hAFS-SG) cells based on the use of conditioned medium (CM) from the human sweat gland (hSG) cells. Real-time PCR and immunofluorescent staining were used to confirm the expression of the sweat gland-related genes Ectodysplasin-A (EDA), Ectodysplasin-A receptor (EDAR), keratin 8 (K8) and carcino-embryonic antigen (CEA). Transmission electron microscopy analysis shows that microvilli, the cellular structures that are typical for hSG cells, can also be observed on the membrane of the hAFS-SG cells. Our test for the calcium response to acetylcholine (Ach) proved that hAFS-SG cells have the potential to respond to Ach in a manner similar to normal sweat glands. A three-dimensional culture is an effective approach that stimulates the hAFS-SG cells to form tubular structures and drives hAFS-SG cells to mature into higher stage. We also found that epidermal growth factor enhances the efficiency of differentiation and that Sonic hedgehog is an important factor of the CM that influences sweat gland differentiation. Our study provides the basis for further investigations into novel methods of inducing stem cells to differentiate into sweat glandlike cells.

  20. CLA reduces inflammatory mediators from A427 human lung cancer cells and A427 conditioned medium promotes differentiation of C2C12 murine muscle cells.

    PubMed

    Oraldi, Manuela; Maggiora, Marina; Paiuzzi, Elena; Canuto, Rosa A; Muzio, Giuliana

    2013-01-01

    Conjugated linoleic acid (CLA) is thought to have anti-proliferative and anti-inflammatory properties, but its effect on cancer cachexia is unknown. Two effects were here investigated: that of CLA on inflammatory mediator production in human lung cancer cells, and that of reduced mediators on the myogenic differentiation of murine muscle C2C12 cells. The latter cells were grown in medium conditioned by human lung cancer A427 cells, with or without CLA, to mimic only the effect of molecules released from the tumor "in vivo", excluding the effect of host-produced cachectic factors. The results obtained show that CLA was found to reduce the production of tumor necrosis factor-α, interleukin (IL)-1β and prostaglandin E2 (PGE2), but had no effect on IL-6 production. The mechanisms underlying the effect of CLA on cytokine or PGE2 release in A427 cells are probably mediated by activation of peroxisome proliferator-activated receptor (PPAR)α, which increased at 24 h CLA treatment. In turn, the reduced content of inflammatory mediators in medium conditioned by A427 cells, in the presence of CLA, allowed muscle cells to proliferate, again by inducing PPAR. The involvement of PPARα was demonstrated by treatment with the antagonist MK-886. The findings demonstrate the anti-inflammatory and myogenic action of CLA and point to its possible application as a novel dietary supplement and therapeutic agent in inflammatory disease states, such as cachexia.

  1. Heat pump without particle transport or external work on the medium achieved by differential thermostatting of the phase space.

    PubMed

    Patra, Puneet Kumar; Bhattacharya, Baidurya

    2016-03-01

    We propose a mechanism that enables heat flow from a colder region to a hotter region without necessitating either particle transport or external work on the conductor, thereby bypassing the compressor part of a classical heat pump cycle. Our mechanism relies on thermostatting the kinetic and configurational temperatures of the same particle differently. We keep the two ends of a conductor, which in the present study is a single dimensional ϕ(4) chain, at the same kinetic temperature T(0), but at different configurational temperatures--one end hotter and the other end colder than T(0). While external energy is needed within the thermostatted regions to achieve this differential thermostatting, no external work is performed on the system itself. We show that the mechanism satisfies the statistical form of the second law of thermodynamics (the fluctuation theorem). The proposed mechanism reveals two interesting findings: (i) contrary to traditional thermodynamics where only the kinetic temperature is thought to govern heat conduction, configurational temperature can also play an important role, and (ii) the relative temperature difference between the kinetic and configurational variables governs the direction of heat flow. The challenge, however, is in developing experimental techniques to thermostat the kinetic and configurational variables of the same particle at different values.

  2. Amplification of Adipogenic Commitment by VSTM2A.

    PubMed

    Secco, Blandine; Camiré, Étienne; Brière, Marc-Antoine; Caron, Alexandre; Billong, Armande; Gélinas, Yves; Lemay, Anne-Marie; Tharp, Kevin M; Lee, Peter L; Gobeil, Stéphane; Guimond, Jean V; Patey, Natacha; Guertin, David A; Stahl, Andreas; Haddad, Élie; Marsolais, David; Bossé, Yohan; Birsoy, Kivanc; Laplante, Mathieu

    2017-01-03

    Despite progress in our comprehension of the mechanisms regulating adipose tissue development, the nature of the factors that functionally characterize adipose precursors is still elusive. Defining the early steps regulating adipocyte development is needed for the generation of tools to control adipose tissue size and function. Here, we report the discovery of V-set and transmembrane domain containing 2A (VSTM2A) as a protein expressed and secreted by committed preadipocytes. VSTM2A expression is elevated in the early phases of adipogenesis in vitro and adipose tissue development in vivo. We show that VSTM2A-producing cells associate with the vasculature and express the common surface markers of adipocyte progenitors. Overexpression of VSTM2A induces adipogenesis, whereas its depletion impairs this process. VSTM2A controls preadipocyte determination at least in part by modulating BMP signaling and PPARγ2 activation. We propose a model in which VSTM2A is produced to preserve and amplify the adipogenic capability of adipose precursors.

  3. Differential optical absorption spectroscopy (DOAS) and air mass factor concept for a multiply scattering vertically inhomogeneous medium: theoretical consideration

    NASA Astrophysics Data System (ADS)

    Rozanov, V. V.; Rozanov, A. V.

    2010-06-01

    The Differential Optical Absorption Spectroscopy (DOAS) technique is widely used to retrieve amounts of atmospheric species from measurements of the direct solar light transmitted through the Earth's atmosphere as well as of the solar light scattered in the atmosphere or reflected from the Earth's surface. For the transmitted direct solar light the theoretical basis of the DOAS technique represented by the Beer-Lambert law is well studied. In contrast, scarcely investigated is the theoretical basis and validity range of the DOAS method for those cases where the contribution of the multiple scattering processes is not negligible. Our study is intended to fill this gap by means of a theoretical investigation of the applicability of the DOAS technique for the retrieval of amounts of atmospheric species from observations of the scattered solar light with a non-negligible contribution of the multiple scattering. Starting from the expansion of the intensity logarithm in the functional Taylor series we formulate the general form of the DOAS equation. The thereby introduced variational derivative of the intensity logarithm with respect to the variation of the gaseous absorption coefficient, which is often referred to as the weighting function, is demonstrated to be closely related to the air mass factor. Employing some approximations we show that the general DOAS equation can be rewritten in the form of the weighting function (WFDOAS), the modified (MDOAS), and the standard DOAS equations. For each of these forms a specific equation for the air mass factor follows which, in general, is not suitable for other forms of the DOAS equation. Furthermore, the validity range of the standard DOAS equation is quantitatively investigated using a suggested criterion of a weak absorption. The results presented in this study are intended to provide a basis for a better understanding of the applicability range of different forms of the DOAS equation as well as of the relationship between

  4. Differential optical absorption spectroscopy (DOAS) and air mass factor concept for a multiply scattering vertically inhomogeneous medium: theoretical consideration

    NASA Astrophysics Data System (ADS)

    Rozanov, V. V.; Rozanov, A. V.

    2010-02-01

    The Differential Optical Absorption Spectroscopy (DOAS) technique is widely used to retrieve amounts of atmospheric species from measurements of the direct solar light transmitted through the Earth's atmosphere as well as of the solar light scattered in the atmosphere or reflected from the Earth's surface. For the transmitted direct solar light the theoretical basis of the DOAS technique represented by the Beer-Lambert law is well studied. In contrast, scarcely investigated is the theoretical basis and validity range of the DOAS method for those cases where the contribution of the multiple scattering processes is not negligible. Our study is intended to fill this gap by means of a theoretical investigation of the applicability of the DOAS technique for the retrieval of amounts of atmospheric species from observations of the scattered solar light with a non-negligible contribution of the multiple scattering. Starting from the expansion of the intensity logarithm in the functional Taylor series we formulate the general form of the DOAS equation. The thereby introduced variational derivative of the intensity logarithm with respect to the variation of the gaseous absorption coefficient, which is often referred to as the weighting function, is demonstrated to be closely related to the air mass factor. Employing some approximations we show that the general DOAS equation can be rewritten in the form of the weighting function (WFDOAS), the modified (MDOAS), and the standard DOAS equations. For each of these forms a specific equation for the air mass factor follows which, in general, is not suitable for other forms of the DOAS equation. Furthermore, the validity range of the standard DOAS equation is quantitatively investigated using a suggested criterion of a weak absorption. The results presented in this study are intended to provide a basis for a better understanding of the applicability range of different forms of the DOAS equation as well as of the relationship between

  5. Anti-adipogenic Effects and Mechanisms of Ginsenoside Rg3 in Pre-adipocytes and Obese Mice.

    PubMed

    Zhang, Longyun; Zhang, Lijuan; Wang, Xiaoyong; Si, Hongwei

    2017-01-01

    Red or black ginseng has been reported more powerful than white/fresh ginseng in dealing with various diseases/conditions including obesity. The major reason is that heating/steaming, the process of making red or black ginseng, produces large amount of bioactive compounds including ginsenoside Rg3 (Rg3), which are trace in fresh or white ginseng. In the present study, Rg3 was applied both in pre-adipocytes and obese mice to investigate the anti-adipogenic effects and relevant mechanisms. Our results show that Rg3 dose-dependently inhibited cell differentiation both in 3T3-L1 cells (30, 50, and 100 μM) and human primary pre-adipocytes (10, 20, and 30 μM). This inhibitory effect is accompanied by the attenuation of the expressions of adipogenic markers including peroxisome proliferator-activated receptor gamma (PPAR-γ), CCAAT/enhancer binding protein alpha (C/EBP-α), fatty acid synthase (FAS), fatty acid binding protein 4 (FABP4) and perilipin. Although dietary intake of Rg3 (0.1 mg Rg3/kg diet, 8 weeks) did not significantly affect body weight gain, fat pads and food intake as well as of PPAR-γ expression in fat tissues, we found that hepatic PPAR-γ and C/EBP-α protein expressions and hepatic glutathione reductase and glutathione S-transferase, two major antioxidants molecules were significantly reduced by Rg3. These results suggest that ginsenoside Rg3 may be a potential agent in reducing/preventing obesity.

  6. Disruption of the Fgf2 Gene Activates the Adipogenic and Suppresses the Osteogenic Program in Mesenchymal Marrow Stromal Stem Cells

    PubMed Central

    Xiao, Liping; Sobue, Takanori; Eisliger, Alycia; Kronenberg, Mark. S; Coffin, J. Douglas; Doetschman, Thomas; Hurley, Marja M.

    2010-01-01

    Here we determine the Fibroblast Growth Factor-2 (FGF2) dependency of the time course of changes in bone mass in female mice. This study extends our earlier reports that knockout of the FGF2 gene (Fgf2) caused low turnover bone loss in Fgf2−/− male mice by examining bone loss with age in Fgf2−/− female mice, and by assessing whether reduced bone formation is associated with differentiation of bone marrow stromal cells (BMSCs) towards the adipocyte lineage. Bone mineral density (BMD) was similar in 3 month old female Fgf2+/+ and Fgf2−/− mice but was significantly reduced as early as 5 months of age in Fgf2−/− mice. In vivo studies showed that there was a greater accumulation of marrow fat in long bones of 14 and 20 month old Fgf2−/− mice compared with Fgf2+/+ littermates. To study the effect of disruption of FGF2 on osteoblastogenesis and adipogenesis, BMSCs from both genotypes were cultured in osteogenic or adipogenic media. Reduced alkaline phosphatase positive (ALP), mineralized colonies and a marked increase in adipocytes were observed in Fgf2−/− BMSC cultures. These cultures also showed an increase in the mRNA of the adipogenic transcription factor PPARγ2 as well as the downstream target genes aP2 and adiponectin. Treatment with exogenous FGF2 blocked adipocyte formation and increased ALP colony formation and ALP activity in BMSC cultures of both genotypes. These results support an important role for endogenous FGF2 in osteoblast (OB) lineage determination. Alteration in FGF2 signaling may contribute to impaired OB bone formation capacity and to increased bone marrow fat accumulation both of which are characteristics of aged bone. PMID:20510392

  7. Anti-adipogenic Effects and Mechanisms of Ginsenoside Rg3 in Pre-adipocytes and Obese Mice

    PubMed Central

    Zhang, Longyun; Zhang, Lijuan; Wang, Xiaoyong; Si, Hongwei

    2017-01-01

    Red or black ginseng has been reported more powerful than white/fresh ginseng in dealing with various diseases/conditions including obesity. The major reason is that heating/steaming, the process of making red or black ginseng, produces large amount of bioactive compounds including ginsenoside Rg3 (Rg3), which are trace in fresh or white ginseng. In the present study, Rg3 was applied both in pre-adipocytes and obese mice to investigate the anti-adipogenic effects and relevant mechanisms. Our results show that Rg3 dose-dependently inhibited cell differentiation both in 3T3-L1 cells (30, 50, and 100 μM) and human primary pre-adipocytes (10, 20, and 30 μM). This inhibitory effect is accompanied by the attenuation of the expressions of adipogenic markers including peroxisome proliferator-activated receptor gamma (PPAR-γ), CCAAT/enhancer binding protein alpha (C/EBP-α), fatty acid synthase (FAS), fatty acid binding protein 4 (FABP4) and perilipin. Although dietary intake of Rg3 (0.1 mg Rg3/kg diet, 8 weeks) did not significantly affect body weight gain, fat pads and food intake as well as of PPAR-γ expression in fat tissues, we found that hepatic PPAR-γ and C/EBP-α protein expressions and hepatic glutathione reductase and glutathione S-transferase, two major antioxidants molecules were significantly reduced by Rg3. These results suggest that ginsenoside Rg3 may be a potential agent in reducing/preventing obesity. PMID:28337143

  8. Extracorporeal shockwaves (ESWs) enhance the osteogenic medium-induced differentiation of adipose-derived stem cells into osteoblast-like cells.

    PubMed

    Catalano, Maria Graziella; Marano, Francesca; Rinella, Letizia; de Girolamo, Laura; Bosco, Ornella; Fortunati, Nicoletta; Berta, Laura; Frairia, Roberto

    2017-02-01

    Human adipose-derived stem cells (hASCs) are a promising cell type for bone tissue engineering, given their potential to differentiate into osteoblast-like cells. Interactions among biochemical and mechanical signals result in bone formation and repair. In this process stem cells have a crucial role. Extracorporeal shockwaves (ESWs) are acoustic waves capable of enhancing bone regeneration, suggesting that ESWs may induce some signals for mesenchymal progenitor maturation. The aim of the present work is to investigate the effects of ESW treatment on the differentiation of hASCs into osteoblast-like cells and to better clarify the mechanisms involved. The hASCs were treated with ESWs and osteogenic medium, and the effects in terms of gene expression, alkaline phosphatase (ALP) activity and calcium deposition were then evaluated. Moreover, to investigate the mechanisms of ESW action, reactive oxygen species (ROS) production, extracellular-signal-regulated kinase (ERK) and small 'mothers against' decapentaplegic (Smad) phosphorylation, and bone morphogenetic protein 2 (BMP2) expression were assessed. The ESW treatment increased Runt-related transcription factor 2 (Runx2), ALP and BMP2 expression, as well as ALP activity and calcium deposits with respect to untreated cells. Moreover ESWs induced ROS formation, and both ERK and Smad phosphorylation. The present study shows the effects of ESWs on osteogenic differentiation in an in vitro model using hASCs and defines the mechanisms involved in this process. The observations suggest that the combination of autologous hASCs and ESW treatment may improve bone tissue repair in tissue engineering procedures. Copyright © 2014 John Wiley & Sons, Ltd.

  9. Wnt/β-Catenin Pathway Regulates Cementogenic Differentiation of Adipose Tissue-Deprived Stem Cells in Dental Follicle Cell-Conditioned Medium

    PubMed Central

    Nie, Xin; Zhang, Bo; Zhou, Xia; Deng, Manjing

    2014-01-01

    The formation and attachment of new cementum is crucial for periodontium regeneration. Tissue engineering is currently explored to achieve complete, reliable and reproducible regeneration of the periodontium. The capacity of multipotency and self-renewal makes adipose tissue-deprived stem cells (ADSCs) an excellent cell source for tissue regeneration and repair. After rat ADSCs were cultured in dental follicle cell-conditioned medium (DFC-CM) supplemented with DKK-1, an inhibitor of the Wnt pathway, followed by 7 days of induction, they exhibited several phenotypic characteristics of cementoblast lineages, as indicated by upregulated expression levels of CAP, ALP, BSP and OPN mRNA, and accelerated expression of BSP and CAP proteins. The Wnt/β-catenin signaling pathway controls differentiation of stem cells by regulating the expression of target genes. Cementoblasts share phenotypical features with osteoblasts. In this study, we demonstrated that culturing ADSCs in DFC-CM supplemented with DKK-1 results in inhibition of β-catenin nuclear translocation and down-regulates TCF-4 and LEF-1 mRNA expression levels. We also found that DKK-1 could promote cementogenic differentiation of ADSCs, which was evident by the up-regulation of CAP, ALP, BSP and OPN gene expressions. On the other hand, culturing ADSCs in DFC-CM supplemented with 100 ng/mL Wnt3a, which activates the Wnt/β-catenin pathway, abrogated this effect. Taken together, our study indicates that the Wnt/β-catenin signaling pathway plays an important role in regulating cementogenic differentiation of ADSCs cultured in DFC-CM. These results raise the possibility of using ADSCs for periodontal regeneration by modifying the Wnt/β-catenin pathway. PMID:24806734

  10. Wnt/β-catenin pathway regulates cementogenic differentiation of adipose tissue-deprived stem cells in dental follicle cell-conditioned medium.

    PubMed

    Liu, Na; Gu, Bin; Liu, Ning; Nie, Xin; Zhang, Bo; Zhou, Xia; Deng, Manjing

    2014-01-01

    The formation and attachment of new cementum is crucial for periodontium regeneration. Tissue engineering is currently explored to achieve complete, reliable and reproducible regeneration of the periodontium. The capacity of multipotency and self-renewal makes adipose tissue-deprived stem cells (ADSCs) an excellent cell source for tissue regeneration and repair. After rat ADSCs were cultured in dental follicle cell-conditioned medium (DFC-CM) supplemented with DKK-1, an inhibitor of the Wnt pathway, followed by 7 days of induction, they exhibited several phenotypic characteristics of cementoblast lineages, as indicated by upregulated expression levels of CAP, ALP, BSP and OPN mRNA, and accelerated expression of BSP and CAP proteins. The Wnt/β-catenin signaling pathway controls differentiation of stem cells by regulating the expression of target genes. Cementoblasts share phenotypical features with osteoblasts. In this study, we demonstrated that culturing ADSCs in DFC-CM supplemented with DKK-1 results in inhibition of β-catenin nuclear translocation and down-regulates TCF-4 and LEF-1 mRNA expression levels. We also found that DKK-1 could promote cementogenic differentiation of ADSCs, which was evident by the up-regulation of CAP, ALP, BSP and OPN gene expressions. On the other hand, culturing ADSCs in DFC-CM supplemented with 100 ng/mL Wnt3a, which activates the Wnt/β-catenin pathway, abrogated this effect. Taken together, our study indicates that the Wnt/β-catenin signaling pathway plays an important role in regulating cementogenic differentiation of ADSCs cultured in DFC-CM. These results raise the possibility of using ADSCs for periodontal regeneration by modifying the Wnt/β-catenin pathway.

  11. Conditioned medium from human amniotic epithelial cells may induce the differentiation of human umbilical cord blood mesenchymal stem cells into dopaminergic neuron-like cells.

    PubMed

    Yang, Shu; Sun, Hai-Mei; Yan, Ji-Hong; Xue, Hong; Wu, Bo; Dong, Fang; Li, Wen-Shuai; Ji, Feng-Qing; Zhou, De-Shan

    2013-07-01

    Dopaminergic (DA) neuron therapy has been established as a new clinical tool for treating Parkinson's disease (PD). Prior to cell transplantation, there are two primary issues that must be resolved: one is the appropriate seed cell origin, and the other is the efficient inducing technique. In the present study, human umbilical cord blood-derived mesenchymal stem cells (hUCB-MSCs) were used as the available seed cells, and conditioned medium from human amniotic epithelial cells (ACM) was used as the inducing reagent. Results showed that the proportion of DA neuron-like cells from hUCB-MSCs was significantly increased after cultured in ACM, suggested by the upregulation of DAT, TH, Nurr1, and Pitx3. To identify the process by which ACM induces DA neuron differentiation, we pretreated hUCB-MSCs with k252a, the Trk receptor inhibitor of brain-derived neurotrophic factor (BDNF) and nerve growth factor (NGF), and found that the proportion of DA neuron-like cells was significantly decreased compared with ACM-treated hUCB-MSCs, suggesting that NGF and BDNF in ACM were involved in the differentiation process. However, we could not rule out the involvement of other unidentified factors in the ACM, because ACM + k252a treatment does not fully block DA neuron-like cell differentiation compared with control. The transplantation of ACM-induced hUCB-MSCs could ameliorate behavioral deficits in PD rats, which may be associated with the survival of engrafted DA neuron-like cells. In conclusion, we propose that hUCB-MSCs are a good source of DA neuron-like cells and that ACM is a potential inducer to obtain DA neuron-like cells from hUCB-MSCs in vitro for an ethical and legal cell therapy for PD.

  12. Estrogen-related receptor {alpha} modulates the expression of adipogenesis-related genes during adipocyte differentiation

    SciTech Connect

    Ijichi, Nobuhiro; Ikeda, Kazuhiro; Horie-Inoue, Kuniko; Yagi, Ken; Okazaki, Yasushi; Inoue, Satoshi . E-mail: INOUE-GER@h.u-tokyo.ac.jp

    2007-07-06

    Estrogen-related receptor {alpha} (ERR{alpha}) is an orphan nuclear receptor that regulates cellular energy metabolism by modulating gene expression involved in fatty acid oxidation and mitochondrial biogenesis in brown adipose tissue. However, the physiological role of ERR{alpha} in adipogenesis and white adipose tissue development has not been well studied. Here, we show that ERR{alpha} and ERR{alpha}-related transcriptional coactivators, peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) coactivator-1{alpha} (PGC-1{alpha}) and PGC-1{beta}, can be up-regulated in 3T3-L1 preadipocytes at mRNA levels under the adipogenic differentiation condition including the inducer of cAMP, glucocorticoid, and insulin. Gene knockdown by ERR{alpha}-specific siRNA results in mRNA down-regulation of fatty acid binding protein 4, PPAR{gamma}, and PGC-1{alpha} in 3T3-L1 cells in the adipogenesis medium. ERR{alpha} and PGC-1{beta} mRNA expression can be also up-regulated in another preadipocyte lineage DFAT-D1 cells and a pluripotent mesenchymal cell line C3H10T1/2 under the differentiation condition. Furthermore, stable expression of ERR{alpha} in 3T3-L1 cells up-regulates adipogenic marker genes and promotes triglyceride accumulation during 3T3-L1 differentiation. These results suggest that ERR{alpha} may play a critical role in adipocyte differentiation by modulating the expression of various adipogenesis-related genes.

  13. Effect of Endothelial Differentiated Adipose-Derived Stem Cells on Vascularity and Osteogenesis in Poly (D, L-Lactide) Scaffolds In Vivo

    DTIC Science & Technology

    2012-05-01

    lineage when placed in adipogenic media.10 Given the relative plasticity and heterogeneity of the SVF, endothelial differ entiated ASCs may have multiple...bone formation.19 Endothelial cell and osteoblast coculture models reveal cell contact dependent changes in gene expression pattern in both cell lines...A, et al. Plasticity of human adipose stem cells to perform adipogenic and endothelial differentiation. Differentiation 2007;75:12 11. Oswald J

  14. Adipogenic Gene Expression in Gilthead Sea Bream Mesenchymal Stem Cells from Different Origin.

    PubMed

    Salmerón, Cristina; Riera-Heredia, Natàlia; Gutiérrez, Joaquim; Navarro, Isabel; Capilla, Encarnación

    2016-01-01

    During the last decades, adipogenesis has become an emerging field of study in aquaculture due to the relevance of the adipose tissue in many physiological processes and its connection with the endocrine system. In this sense, recent studies have translated into the establishment of preadipocyte culture models from several fish species, sometimes lacking information on the mRNA levels of adipogenic genes. Thus, the aim of this study was to determine the gene expression profile of gilthead sea bream (Sparus aurata) primary cultured mesenchymal stem cells (MSCs) from different origin (adipose tissue and vertebra bone) during adipogenesis. Both cell types differentiated into adipocyte-like cells, accumulating lipids inside their cytoplasm. Adipocyte differentiation of MSCs from adipose tissue resulted in downregulation of several adipocyte-related genes (such as lpl, hsl, pparα, pparγ and gapdh2) at day 4, gapdh1 at day 8, and fas and pparβ at day 12. In contrast, differences in lxrα mRNA expression were not observed, while g6pdh levels increased during adipocyte maturation. Gapdh and Pparγ protein levels were also detected in preadipocyte cultures; however, only the former increased its expression during adipogenesis. Moreover, differentiation of bone-derived cells into adipocytes also resulted in the downregulation of several adipocyte gene markers, such as fas and g6pdh at day 10 and hsl, pparβ, and lxrα at day 15. On the other hand, the osteogenic genes fib1a, mgp, and op remained stable, but an increase in runx2 expression at day 20 was observed. In summary, the present study demonstrates that gilthead sea bream MSCs, from both adipose tissue and bone, differentiate into adipocyte-like cells, although revealed some kind of species- and cell lineage-specific regulation with regards to gene expression. Present data also provide novel insights into some of the potential key genes controlling adipogenesis in gilthead sea bream that can help to better

  15. Adipogenic Gene Expression in Gilthead Sea Bream Mesenchymal Stem Cells from Different Origin

    PubMed Central

    Salmerón, Cristina; Riera-Heredia, Natàlia; Gutiérrez, Joaquim; Navarro, Isabel; Capilla, Encarnación

    2016-01-01

    During the last decades, adipogenesis has become an emerging field of study in aquaculture due to the relevance of the adipose tissue in many physiological processes and its connection with the endocrine system. In this sense, recent studies have translated into the establishment of preadipocyte culture models from several fish species, sometimes lacking information on the mRNA levels of adipogenic genes. Thus, the aim of this study was to determine the gene expression profile of gilthead sea bream (Sparus aurata) primary cultured mesenchymal stem cells (MSCs) from different origin (adipose tissue and vertebra bone) during adipogenesis. Both cell types differentiated into adipocyte-like cells, accumulating lipids inside their cytoplasm. Adipocyte differentiation of MSCs from adipose tissue resulted in downregulation of several adipocyte-related genes (such as lpl, hsl, pparα, pparγ and gapdh2) at day 4, gapdh1 at day 8, and fas and pparβ at day 12. In contrast, differences in lxrα mRNA expression were not observed, while g6pdh levels increased during adipocyte maturation. Gapdh and Pparγ protein levels were also detected in preadipocyte cultures; however, only the former increased its expression during adipogenesis. Moreover, differentiation of bone-derived cells into adipocytes also resulted in the downregulation of several adipocyte gene markers, such as fas and g6pdh at day 10 and hsl, pparβ, and lxrα at day 15. On the other hand, the osteogenic genes fib1a, mgp, and op remained stable, but an increase in runx2 expression at day 20 was observed. In summary, the present study demonstrates that gilthead sea bream MSCs, from both adipose tissue and bone, differentiate into adipocyte-like cells, although revealed some kind of species- and cell lineage-specific regulation with regards to gene expression. Present data also provide novel insights into some of the potential key genes controlling adipogenesis in gilthead sea bream that can help to better

  16. Poly(ADP-ribose)polymerase-1 (PARP1) controls adipogenic gene expression and adipocyte function.

    PubMed

    Erener, Süheda; Hesse, Mareike; Kostadinova, Radina; Hottiger, Michael O

    2012-01-01

    Poly(ADP-ribose)polymerase-1 (PARP1) is a chromatin-associated enzyme that was described to affect chromatin compaction. Previous reports suggested a dynamic modulation of the chromatin landscape during adipocyte differentiation. We thus hypothesized that PARP1 plays an important transcriptional role in adipogenesis and metabolism and therefore used adipocyte development and function as a model to elucidate the molecular action of PARP1 in obesity-related diseases. Our results show that PARP1-dependent ADP-ribose polymer (PAR) formation increases during adipocyte development and, at late time points of adipogenesis, is involved in the sustained expression of PPARγ2 and of PPARγ2 target genes. During adipogenesis, PARP1 was recruited to PPARγ2 target genes such as CD36 or aP2 in a PAR-dependent manner. Our results also reveal a PAR-dependent decrease in repressory histone marks (e.g. H3K9me3) and an increase in stimulatory marks (e.g. H3K4me3) at the PPARγ2 promoter, suggesting that PARP1 may exert its regulatory function during adipogenesis by altering histone marks. Interestingly, activation of PARP1 enzymatic activity was prevented with a topoisomerase II inhibitor. These data hint at topoisomerase II-dependent, transient, site-specific double-strand DNA breaks as the cause for poly(ADP)-ribose formation, adipogenic gene expression, and adipocyte function. Together, our study identifies PARP1 as a critical regulator of PPARγ2-dependent gene expression with implications in adipocyte function and obesity-related disease models.

  17. The environmental chemical tributyltin chloride (TBT) shows both estrogenic and adipogenic activities in mice which might depend on the exposure dose.

    PubMed

    Penza, M; Jeremic, M; Marrazzo, E; Maggi, A; Ciana, P; Rando, G; Grigolato, P G; Di Lorenzo, D

    2011-08-15

    Exposure during early development to chemicals with hormonal action may be associated with weight gain during adulthood because of altered body homeostasis. It is known that organotins affect adipose mass when exposure occurs during fetal development, although no knowledge of effects are available for exposures after birth. Here we show that the environmental organotin tributyltin chloride (TBT) exerts adipogenic action when peripubertal and sexually mature mice are exposed to the chemical. The duration and extent of these effects depend on the sex and on the dose of the compound, and the effects are relevant at doses close to the estimated human intake (0.5μg/kg). At higher doses (50-500μg/kg), TBT also activated estrogen receptors (ERs) in adipose cells in vitro and in vivo, based on results from acute and longitudinal studies in ERE/luciferase reporter mice. In 3T3-L1 cells (which have no ERs), transiently transfected with the ERE-dependent reporter plus or minus ERα or ERβ, TBT (in a dose range of 1-100nM) directly targets each ER subtype in a receptor-specific manner through a direct mechanism mediated by ERα in undifferentiated preadipocytic cells and by ERβ in differentiating adipocytes. The ER antagonist ICI-182,780 inhibits this effect. In summary, the results of this work suggest that TBT is adipogenic at all ages and in both sexes and that it might be an ER activator in fat cells. These findings might help to resolve the apparent paradox of an adipogenic chemical being also an estrogen receptor activator by showing that the two apparently opposite actions are separated by the different doses to which the organism is exposed.

  18. HDAC-regulated myomiRs control BAF60 variant exchange and direct the functional phenotype of fibro-adipogenic progenitors in dystrophic muscles.

    PubMed

    Saccone, Valentina; Consalvi, Silvia; Giordani, Lorenzo; Mozzetta, Chiara; Barozzi, Iros; Sandoná, Martina; Ryan, Tammy; Rojas-Muñoz, Agustin; Madaro, Luca; Fasanaro, Pasquale; Borsellino, Giovanna; De Bardi, Marco; Frigè, Gianmaria; Termanini, Alberto; Sun, Xin; Rossant, Janet; Bruneau, Benoit G; Mercola, Mark; Minucci, Saverio; Puri, Pier Lorenzo

    2014-04-15

    Fibro-adipogenic progenitors (FAPs) are important components of the skeletal muscle regenerative environment. Whether FAPs support muscle regeneration or promote fibro-adipogenic degeneration is emerging as a key determinant in the pathogenesis of muscular diseases, including Duchenne muscular dystrophy (DMD). However, the molecular mechanism that controls FAP lineage commitment and activity is currently unknown. We show here that an HDAC-myomiR-BAF60 variant network regulates the fate of FAPs in dystrophic muscles of mdx mice. Combinatorial analysis of gene expression microarray, genome-wide chromatin remodeling by nuclease accessibility (NA) combined with next-generation sequencing (NA-seq), small RNA sequencing (RNA-seq), and microRNA (miR) high-throughput screening (HTS) against SWI/SNF BAF60 variants revealed that HDAC inhibitors (HDACis) derepress a "latent" myogenic program in FAPs from dystrophic muscles at early stages of disease. Specifically, HDAC inhibition induces two core components of the myogenic transcriptional machinery, MYOD and BAF60C, and up-regulates the myogenic miRs (myomiRs) (miR-1.2, miR-133, and miR-206), which target the alternative BAF60 variants BAF60A and BAF60B, ultimately directing promyogenic differentiation while suppressing the fibro-adipogenic phenotype. In contrast, FAPs from late stage dystrophic muscles are resistant to HDACi-induced chromatin remodeling at myogenic loci and fail to activate the promyogenic phenotype. These results reveal a previously unappreciated disease stage-specific bipotency of mesenchimal cells within the regenerative environment of dystrophic muscles. Resolution of such bipotency by epigenetic intervention with HDACis provides a molecular rationale for the in situ reprogramming of target cells to promote therapeutic regeneration of dystrophic muscles.

  19. Hyperglycemia diverts dividing osteoblastic precursor cells to an adipogenic pathway and induces synthesis of a hyaluronan matrix that is adhesive for monocytes.

    PubMed

    Wang, Aimin; Midura, Ronald J; Vasanji, Amit; Wang, Andrew J; Hascall, Vincent C

    2014-04-18

    Isolated rat bone marrow stromal cells cultured in osteogenic medium in which the normal 5.6 mm glucose is changed to hyperglycemic 25.6 mm glucose greatly increase lipid formation between 21-31 days of culture that is associated with decreased biomineralization, up-regulate expression of cyclin D3 and two adipogenic markers (CCAAT/enhancer binding protein α and peroxisome proliferator-activated receptor γ) within 5 days of culture, increase neutral and polar lipid synthesis within 5 days of culture, and form a monocyte-adhesive hyaluronan matrix through an endoplasmic reticulum stress-induced autophagic mechanism. Evidence is also provided that, by 4 weeks after diabetes onset in the streptozotocin-induced diabetic rat model, there is a large loss of trabecular bone mineral density without apparent proportional changes in underlying collagen matrices, a large accumulation of a hyaluronan matrix within the trabecular bone marrow, and adipocytes and macrophages embedded in this hyaluronan matrix. These results support the hypothesis that hyperglycemia in bone marrow diverts dividing osteoblastic precursor cells (bone marrow stromal cells) to a metabolically stressed adipogenic pathway that induces synthesis of a hyaluronan matrix that recruits inflammatory cells and establishes a chronic inflammatory process that demineralizes trabecular cancellous bone.

  20. Identification of suitable reference genes for quantitative gene expression analysis in rat adipose stromal cells induced to trilineage differentiation.

    PubMed

    Santos, Bruno Paiva Dos; da Costa Diesel, Luciana Fraga; da Silva Meirelles, Lindolfo; Nardi, Nance Beyer; Camassola, Melissa

    2016-12-15

    This study was designed to (i) identify stable reference genes for the analysis of gene expression during in vitro differentiation of rat adipose stromal cells (rASCs), (ii) recommend stable genes for individual treatment conditions, and (iii) validate these genes by comparison with normalization results from stable and unstable reference genes. On the basis of a literature review, eight genes were selected: Actb, B2m, Hprt1, Ppia, Rplp0, Rpl13a, Rpl5, and Ywhaz. Genes were ranked according to their stability under different culture conditions as assessed using GenNorm, NormFinder, and RefFinder algorithms. Although the employed algorithms returned different rankings, the most frequently top-ranked genes were: B2m and/or Ppia for all 28day treatments (ALL28); Ppia and Hprt1 (adipogenic differentiation; A28), B2m (chondrogenic differentiation; C28), Rpl5 (controls maintained in complete culture medium; CCM), Rplp0 (osteogenic differentiation for 3days; O3), Rpl13a and Actb (osteogenic differentiation for 7days; O7), Rplp0 and Ppia (osteogenic differentiation for 14days; O14), Hprt1 and Ppia (osteogenic differentiation for 28days; O28), as well as Actb (all osteogenesis time points combined; ALLOSTEO). The obtained results indicate that the performance of reference genes depends on the differentiation protocol and on the analysis time, thus providing valuable information for the design of RT-PCR experiments.

  1. Proliferation and differentiation of bone marrow stromal cells under hypoxic conditions

    SciTech Connect

    Ren Hongying; Cai Huiguo; Han Zhongchao; Yang Renchi; Zhao, Qinjun; Cao Ying; Li Jing; Zhou Cixiang; Liao Lianming; Jia Mingyue; Zhao Qian; Chen Guoqiang . E-mail: chengq@shsmu.edu.cn; Zhao, R.C. |. E-mail: chunhuaz@public.tpt.tj.cn

    2006-08-18

    Low oxygen tension is a potent differentiation inducer of numerous cell types and an effective stimulus of many gene expressions. Here, we described that under 8% O{sub 2}, bone marrow stromal cells (MSCs) exhibited proliferative and morphologic changes. The level of differentiated antigen H-2Dd and the number of G{sub 2}/S/M phase cells increased evidently under 8% O{sub 2} condition. Also, the proportion of wide, flattened, and epithelial-like cells (which were alkaline phosphatase staining positive) in MSCs increased significantly. When cultured in adipogenic medium, there was a 5- to 6-fold increase in the number of lipid droplets under hypoxic conditions compared with that in normoxic culture. We also demonstrated the existence of MSC differentiation under hypoxic conditions by electron microscopy. Expression of Oct4 was inhibited under 8% O{sub 2} condition, but after adipocyte differentiation in normoxic culture and hypoxia-mimicking agents cobalt chloride (CoCl{sub 2}) and deferoxamine mesylate (DFX) treatments, Oct4 was still expressed in MSCs. These results indicate hypoxia accelerates MSC differentiation and hypoxia and hypoxia-mimicking agents exert different effects on MSC differentiation.

  2. Articular cartilage-derived cells hold a strong osteogenic differentiation potential in comparison to mesenchymal stem cells in vitro

    SciTech Connect

    Salamon, Achim; Jonitz-Heincke, Anika; Adam, Stefanie; Rychly, Joachim; Müller-Hilke, Brigitte; Bader, Rainer; Lochner, Katrin; Peters, Kirsten

    2013-11-01

    Cartilaginous matrix-degenerative diseases like osteoarthritis (OA) are characterized by gradual cartilage erosion, and also by increased presence of cells with mesenchymal stem cell (MSC) character within the affected tissues. Moreover, primary chondrocytes long since are known to de-differentiate in vitro and to be chondrogenically re-differentiable. Since both findings appear to conflict with each other, we quantitatively assessed the mesenchymal differentiation potential of OA patient cartilage-derived cells (CDC) towards the osteogenic and adipogenic lineage in vitro and compared it to that of MSC isolated from adipose tissue (adMSC) of healthy donors. We analyzed expression of MSC markers CD29, CD44, CD105, and CD166, and, following osteogenic and adipogenic induction in vitro, quantified their expression of osteogenic and adipogenic differentiation markers. Furthermore, CDC phenotype and proliferation were monitored. We found that CDC exhibit an MSC CD marker expression pattern similar to adMSC and a similar increase in proliferation rate during osteogenic differentiation. In contrast, the marked reduction of proliferation observed during adipogenic differentiation of adMSC was absent in CDC. Quantification of differentiation markers revealed a strong osteogenic differentiation potential for CDC, however almost no capacity for adipogenic differentiation. Since in the pathogenesis of OA, cartilage degeneration coincides with high bone turnover rates, the high osteogenic differentiation potential of OA patient-derived CDC may affect clinical therapeutic regimens aiming at autologous cartilage regeneration in these patients. - Highlights: • We analyze the mesenchymal differentiation capacity of cartilage-derived cells (CDC). • CDC express mesenchymal stem cell (MSC) markers CD29, CD44, CD105, and CD166. • CDC and MSC proliferation is reduced in adipogenesis and increased in osteogenesis. • Adipogenic differentiation is virtually absent in CDC, but

  3. [Adipogenic function and other biologic effects of insulin].

    PubMed

    Pankov, Y A

    2016-01-01

    adipocytes during inhibition of glucose transformation into triglyceride in adipose tissue. Knockout of the Insr gene in muscles blocked glucose uptake by myocytes, but it did not induce hyperglycemia, probably due to the increase in glucose uptake by other organs, which retained the insulin receptor, and induced some increase in fat resources in adipose tissue. Similar results were obtained in mice with knockout the glucose transporter 4 GLUT4 in muscle and/or adipose tissue. Insulin microinjections in the brain, in the cerebral ventricle 4 (ICV) and mediobasal hypothalamus (MBH) did not affect the insulin levels in the general circulation, but effectively activated lipogenesis and inhibited lipolysis in adipose tissue. They induced obesity, similar to conventional obesity when the insulin levels increased. These results may serve as additional evidence for importance of the adipogenic insulin function in mechanisms of regulation of general metabolism.

  4. Disruption of cell-matrix interactions by heparin enhances mesenchymal progenitor adipocyte differentiation

    SciTech Connect

    Luo Weijun; Shitaye, Hailu; Friedman, Michael; Bennett, Christina N.; Miller, Joshua; MacDougald, Ormond A.; Hankenson, Kurt D.

    2008-11-01

    Differentiation of marrow-derived mesenchymal progenitors to either the osteoblast or adipocyte lineage is reciprocally regulated. Factors that promote osteoblastogenesis inhibit adipogenesis, while adipogenic factors are inhibitory to osteoblast differentiation. Heparin, a soluble glycosaminoglycan, inhibits bone formation in vivo and osteoblast cell differentiation and function in vitro, and has been shown to promote adipocyte differentiation. To elucidate the role that heparin plays in the adipogenic induction of murine mesenchymal progenitors, we studied immortalized marrow stromal cells (IM-MSC), the MSC cell line, ST2, and 3T3L1 pre-adipocytes. Heparin alone was not sufficient to induce adipogenesis, but enhanced the induction under a variety of adipogenic cocktails. This effect was both dose- and time-dependent. Heparin showed a positive effect at concentrations > 0. 1 {mu}g/ml when applied before day 3 during the induction course. Heparin's effect on adipogenesis was independent of cell proliferation, cell density, and extracellular lipid. This effect is likely related to the unique structure of heparin because another polyanionic glycosaminoglycan, dextran sulfate, did not promote adipogenic differentiation. Heparin treatment altered morphology and adhesion characteristics of progenitor cells, resulting in cell rounding and aggregation. As well, heparin counteracted the known inhibitory effect of fibronectin on adipogenesis and decreased basal focal adhesion kinase and paxillin phosphorylation. We conclude that heparin-mediated disruption of cell-matrix adhesion enhances adipogenic potential.

  5. Fibro/adipogenic progenitors safeguard themselves: a novel mechanism to reduce fibrosis is discovered.

    PubMed

    Contreras, Osvaldo; Brandan, Enrique

    2016-12-20

    PDGFRα regulates several cellular processes, and exacerbated PDGF signaling cause fibrosis in different tissues. Different research groups have shown that fibro/adipogenic progenitors (FAPs) are responsible for pathological fibrosis found in skeletal muscle disorders. Rando's Lab describes that an intronic polyadenylation of Pdgfra regulates FAPs activity, and therefore fibrosis. This discovery opens a new potential target for treating fibrosis.

  6. Phosphoprotein phosphatase 1CB (PPP1CB), a novel adipogenic activator, promotes 3T3-L1 adipogenesis.

    PubMed

    Cho, Young-Lai; Min, Jeong-Ki; Roh, Kyung Min; Kim, Won Kon; Han, Baek Soo; Bae, Kwang-Hee; Lee, Sang Chul; Chung, Sang J; Kang, Hyo Jin

    2015-11-13

    Understanding the molecular networks that regulate adipogenesis is crucial for gaining insight into obesity and identifying medicinal targets thereof is necessary for pharmacological interventions. However, the identity and molecular actions of activators that promote the early development of adipocytes are still largely unknown. Here, we demonstrate a novel role for phosphoprotein phosphatase 1CB (PPP1CB) as a potent adipogenic activator that promotes adipocyte differentiation. PPP1CB expression increased in vitro during the early phase of 3T3-L1 adipogenesis and in the murine model of high-fat diet-induced obesity. Depletion of PPP1CB dramatically suppressed the differentiation of 3T3-L1 cells into mature adipocytes, with a concomitant change in adipocyte marker genes and significantly inhibited clonal expansion. We also showed that knockdown of PPP1CB caused a significant decrease in C/EBPδ expression, which in turn resulted in attenuation of PPARγ, C/EBPα, adiponectin, and aP2. In addition, we elucidated the functional significance of PPP1CB by linking p38 activation to C/EBPδ expression in early adipogenesis. Overall, our findings demonstrate a novel function of PPP1CB in promoting adipogenesis and suggest that PPP1CB may be a promising therapeutic target for treatment of obesity and obesity-related diseases.

  7. Yin yang 1 and adipogenic gene network expression in longissimus muscle of beef cattle in response to nutritional management.

    PubMed

    Moisá, Sonia J; Shike, Daniel W; Meteer, William T; Keisler, Duane; Faulkner, Dan B; Loor, Juan J

    2013-01-01

    Among 36 differentially-expressed genes during growth in longissimus muscle (LM) of Angus steers, Yin Yang 1 (YY1) had the most relationships with other genes including some associated with adipocyte differentiation. The objective of this study was to examine the effect of nutritional management on mRNA expression of YY1 along with its targets genes PPARG, GTF2B, KAT2B, IGFBP5 and STAT5B. Longissimus from Angus and Angus × Simmental steers (7 total/treatment) on early weaning plus high-starch (EWS), normal weaning plus starch creep feeding (NWS), or normal weaning without starch creep feeding (NWN) was biopsied at 0, 96, and 240 days on treatments. Results suggest that YY1 does not exert control of adipogenesis in LM, and its expression is not sensitive to weaning age. Among the YY1-related genes, EWS led to greater IGFBP5 during growing and finishing phases. Pro-adipogenic transcriptional regulation was detected in EWS due to greater PPARG and VDR at 96 and 240 d vs. 0 d. GTF2B and KAT2B expression was lower in response to NWS and EWS than NWN, and was most pronounced at 240 d. The increase in PPARG and GTF2B expression between 96 and 240 d underscored the existence of a molecular programming mechanism that was sensitive to age and dietary starch. Such response partly explains the greater carcass fat deposition observed in response to NWS.

  8. In vitro differentiation of human umbilical cord Wharton’s jelly mesenchymal stromal cells to insulin producing clusters

    PubMed Central

    Nekoei, Seideh Masoomeh; Azarpira, Negar; Sadeghi, Ladan; Kamalifar, Sulmaz

    2015-01-01

    AIM: To investigate the differentiation of human Wharton’s jelly derived mesenchymal stromal cells (WJ-MSCs) to insulin producing clusters (IPC) this study was conducted. METHODS: The umbilical cords samples were collected from full term caesarian section mothers and the WJ-MSCS were cultured from tissue explants in High glucose-Dulbecco’s Modified Eagle Medium (H-DMEM); H-DMEM supplemented with 10% fetal bovine serum (FBS) and antibiotics. The expression of CD90, CD44, CD105, CD34 and CD133 as well as osteogenic and adipogenic differentiation of cells in appropriate medium were also evaluated. The cells were differentiated toward IPC with changing the culture medium and adding the small molecules such as nicotinic acid, epidermal growth factor, and exendin-4 during 3 wk period. The gene expression of PDX1, NGN3, Glut2, insulin was monitored by reveres transcription polymerase chain reaction method. The differentiated clusters were stained with Dithizone (DTZ) which confirms the presence of insulin granules. The insulin challenge test (low and high glucose concentration in Krebs-Ringer HEPES buffer) was also used to evaluate the functional properties of differentiated clusters. RESULTS: WJ-MSCS were positive for mesenchymal surface markers (CD90, CD44, CD105), and negative for CD34 and CD133. The accumulation of lipid vacuoles and deposition of calcium mineral in cells were considered as adipogenic and osteogenic potential of WJ-MSCS. The cells also expressed the transcriptional factors such as Nanog and OCT4. During this three step differentiation, the WJ-MSCS morphology was gradually changed from spindle shaped cells in to epithelioid cells and eventually to three dimensional clusters. The clusters expressed PDX1, NGN3, Glut2, and insulin. The cells became bright red color when stained with DTZ and the insulin secretion was also confirmed. In glucose challenge test a significant increase in insulin secretion from 0.91 ± 0.04 μIu/mL (2.8 mmol/L glucose) to

  9. Adipogenic placenta-derived mesenchymal stem cells are not lineage restricted by withdrawing extrinsic factors: developing a novel visual angle in stem cell biology

    PubMed Central

    Hu, C; Cao, H; Pan, X; Li, J; He, J; Pan, Q; Xin, J; Yu, X; Li, J; Wang, Y; Zhu, D; Li, L

    2016-01-01

    Current evidence implies that differentiated bone marrow mesenchymal stem cells (BMMSCs) can act as progenitor cells and transdifferentiate across lineage boundaries. However, whether this unrestricted lineage has specificities depending on the stem cell type is unknown. Placental-derived mesenchymal stem cells (PDMSCs), an easily accessible and less invasive source, are extremely useful materials in current stem cell therapies. No studies have comprehensively analyzed the transition in morphology, surface antigens, metabolism and multilineage potency of differentiated PDMSCs after their dedifferentiation. In this study, we showed that after withdrawing extrinsic factors, adipogenic PDMSCs reverted to a primitive cell population and retained stem cell characteristics. The mitochondrial network during differentiation and dedifferentiation may serve as a marker of absent or acquired pluripotency in various stem cell models. The new population proliferated faster than unmanipulated PDMSCs and could be differentiated into adipocytes, osteocytes and hepatocytes. The cell adhesion molecules (CAMs) signaling pathway and extracellular matrix (ECM) components modulate cell behavior and enable the cells to proliferate or differentiate during the differentiation, dedifferentiation and redifferentiation processes in our study. These observations indicate that the dedifferentiated PDMSCs are distinguishable from the original PDMSCs and may serve as a novel source in stem cell biology and cell-based therapeutic strategies. Furthermore, whether PDMSCs differentiated into other lineages can be dedifferentiated to a primitive cell population needs to be investigated. PMID:26986509

  10. Adipogenic placenta-derived mesenchymal stem cells are not lineage restricted by withdrawing extrinsic factors: developing a novel visual angle in stem cell biology.

    PubMed

    Hu, C; Cao, H; Pan, X; Li, J; He, J; Pan, Q; Xin, J; Yu, X; Li, J; Wang, Y; Zhu, D; Li, L

    2016-03-17

    Current evidence implies that differentiated bone marrow mesenchymal stem cells (BMMSCs) can act as progenitor cells and transdifferentiate across lineage boundaries. However, whether this unrestricted lineage has specificities depending on the stem cell type is unknown. Placental-derived mesenchymal stem cells (PDMSCs), an easily accessible and less invasive source, are extremely useful materials in current stem cell therapies. No studies have comprehensively analyzed the transition in morphology, surface antigens, metabolism and multilineage potency of differentiated PDMSCs after their dedifferentiation. In this study, we showed that after withdrawing extrinsic factors, adipogenic PDMSCs reverted to a primitive cell population and retained stem cell characteristics. The mitochondrial network during differentiation and dedifferentiation may serve as a marker of absent or acquired pluripotency in various stem cell models. The new population proliferated faster than unmanipulated PDMSCs and could be differentiated into adipocytes, osteocytes and hepatocytes. The cell adhesion molecules (CAMs) signaling pathway and extracellular matrix (ECM) components modulate cell behavior and enable the cells to proliferate or differentiate during the differentiation, dedifferentiation and redifferentiation processes in our study. These observations indicate that the dedifferentiated PDMSCs are distinguishable from the original PDMSCs and may serve as a novel source in stem cell biology and cell-based therapeutic strategies. Furthermore, whether PDMSCs differentiated into other lineages can be dedifferentiated to a primitive cell population needs to be investigated.

  11. Novel genes of visceral adiposity: identification of mouse and human mesenteric estrogen-dependent adipose (MEDA)-4 gene and its adipogenic function.

    PubMed

    Zhang, H; Chen, X; Sairam, M R

    2012-06-01

    Visceral adiposity represents a high risk factor for type 2 diabetes, metabolic syndrome, and cardiovascular disease as well as various cancers. While studying sex hormone imbalance-induced early obesity and late onset of insulin resistance in FSH receptor knock out female mice, we identified a novel mesenteric estrogen-dependent adipose gene (MEDA-4) selectively up-regulated in a depot-specific manner in mesenteric adipose tissue. Meda-4 cloned from both mouse and human adipose tissue codes for a 34-kDa cytosolic protein with 91% homology. Mouse Meda-4 mRNA is expressed highest in visceral adipose tissue and localizes predominantly in the adipocyte fraction. Human MEDA-4 is also more abundant in omental fat than sc depot in obese patients. In 3T3-L1 cells endogenous Meda-4 expression increases early during differentiation, and its overexpression promotes differentiation of preadipocytes into adipocytes and enhances glucose uptake. Conversely, short hairpin RNA-mediated knockdown of Meda-4 reduces both adipogenic and glucose uptake potential. In promoting adipogenesis, Meda-4 up-regulates transcription factor peroxisome proliferator-activated receptor-γ2. Meda-4 promotes lipid accumulation in adipocytes, regulating adipocyte fatty acid-binding protein 2, CD36, lipoprotein lipase, hormone-sensitive lipase, acyl-Coenzyme A oxidase-1, perilipin-1, and fatty acid synthase expression. 17β-Estradiol reduced Meda-4 expression in mesenteric adipose tissue of ovariectomized mice and in 3T3-L1 adipocytes. Thus our study identifies Meda-4 as a novel adipogenic gene, capable of promoting differentiation of preadipocytes into adipocytes, increasing lipid content and glucose uptake in adipocytes. Therefore it might play an important role in adipose tissue expansion in normal and aberrant hormonal conditions and pathophysiological states.

  12. Isopsoralen-mediated suppression of bone marrow adiposity and attenuation of the adipogenic commitment of bone marrow-derived mesenchymal stem cells

    PubMed Central

    Wang, Jian; Li, Sheng-Fa; Wang, Ting; Sun, Chun-Han; Wang, Liang; Huang, Min-Jun; Chen, Jian; Zheng, Shao-Wei; Wang, Nan; Zhang, Ying-Ju