Science.gov

Sample records for adipogenic differentiation medium

  1. Distinct adipogenic differentiation phenotypes of human umbilical cord mesenchymal cells dependent on adipogenic conditions

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The umbilical cord (UC) matrix is a source of multipotent mesenchymal stem cells (MSCs) that have adipogenic potential and thus can be a model to study adipogenesis. However, existing variability in adipocytic differentiation outcomes may be due to discrepancies in methods utilized for adipogenic d...

  2. Mitochondrial respiration regulates adipogenic differentiation of human mesenchymal stem cells.

    PubMed

    Zhang, Yanmin; Marsboom, Glenn; Toth, Peter T; Rehman, Jalees

    2013-01-01

    Human mesenchymal stem cells (MSCs) are adult multipotent stem cells which can be isolated from bone marrow, adipose tissue as well as other tissues and have the capacity to differentiate into a variety of mesenchymal cell types such as adipocytes, osteoblasts and chondrocytes. Differentiation of stem cells into mature cell types is guided by growth factors and hormones, but recent studies suggest that metabolic shifts occur during differentiation and can modulate the differentiation process. We therefore investigated mitochondrial biogenesis, mitochondrial respiration and the mitochondrial membrane potential during adipogenic differentiation of human MSCs. In addition, we inhibited mitochondrial function to assess its effects on adipogenic differentiation. Our data show that mitochondrial biogenesis and oxygen consumption increase markedly during adipogenic differentiation, and that reducing mitochondrial respiration by hypoxia or by inhibition of the mitochondrial electron transport chain significantly suppresses adipogenic differentiation. Furthermore, we used a novel approach to suppress mitochondrial activity using a specific siRNA-based knockdown of the mitochondrial transcription factor A (TFAM), which also resulted in an inhibition of adipogenic differentiation. Taken together, our data demonstrates that increased mitochondrial activity is a prerequisite for MSC differentiation into adipocytes. These findings suggest that metabolic modulation of adult stem cells can maintain stem cell pluripotency or direct adult stem cell differentiation.

  3. Zfp423 promotes adipogenic differentiation of bovine stromal vascular cells.

    PubMed

    Huang, Yan; Das, Arun Kr; Yang, Qi-Yuan; Zhu, Mei-Jun; Du, Min

    2012-01-01

    Intramuscular fat or marbling is critical for the palatability of beef. In mice, very recent studies show that adipocytes and fibroblasts share a common pool of progenitor cells, with Zinc finger protein 423 (Zfp423) as a key initiator of adipogenic differentiation. To evaluate the role of Zfp423 in intramuscular adipogenesis and marbling in beef cattle, we sampled beef muscle for separation of stromal vascular cells. These cells were immortalized with pCI neo-hEST2 and individual clones were selected by G418. A total of 288 clones (3×96 well plates) were isolated and induced to adipogenesis. The presence of adipocytes was assessed by Oil-Red-O staining. Three clones with high and low adipogenic potential respectively were selected for further analyses. In addition, fibro/adipogenic progenitor cells were selected using a surface marker, platelet derived growth factor receptor (PDGFR) α. The expression of Zfp423 was much higher (307.4±61.9%, P<0.05) in high adipogenic cells, while transforming growth factor (TGF)-β was higher (156.1±48.7%, P<0.05) in low adipogenic cells. Following adipogenic differentiation, the expression of peroxisome proliferator-activated receptor γ (PPARγ) and CCAAT/enhancer binding protein α (C/EBPα) were much higher (239.4±84.1% and 310.7±138.4%, respectively, P<0.05) in high adipogenic cells. Over-expression of Zfp423 in stromal vascular cells and cloned low adipogenic cells dramatically increased their adipogenic differentiation, accompanied with the inhibition of TGF-β expression. Zfp423 knockdown by shRNA in high adipogenic cells largely prevented their adipogenic differentiation. The differential regulation of Zfp423 and TGF-β between low and high adipogenic cells is associated with the DNA methylation in their promoters. In conclusion, data show that Zfp423 is a critical regulator of adipogenesis in stromal vascular cells of bovine muscle, and Zfp423 may provide a molecular target for enhancing intramuscular adipogenesis

  4. Insulin Cannot Induce Adipogenic Differentiation in Primary Cardiac Cultures.

    PubMed

    Parameswaran, Sreejit; Sharma, Rajendra K

    2016-09-01

    Cardiac tissue contains a heterogeneous population of cardiomyocytes and nonmyocyte population especially fibroblasts. Fibroblast differentiation into adipogenic lineage is important for fat accumulation around the heart which is important in cardiac pathology. The differentiation in fibroblast has been observed both spontaneously and due to increased insulin stimulation. The present study aims to observe the effect of insulin in adipogenic differentiation of cardiac cells present in primary murine cardiomyocyte cultures. Oil Red O (ORO) staining has been used for observing the lipid accumulations formed due to adipogenic differentiation in murine cardiomyocyte cultures. The accumulated lipids were quantified by ORO assay and normalized using protein estimation. The lipid accumulation in cardiac cultures did not increase in presence of insulin. However, addition of other growth factors like insulin-like growth factor 1 and epidermal growth factor promoted adipogenic differentiation even in the presence of insulin and other inhibitory molecules such as vitamins. Lipid accumulation also increased in cells grown in media without insulin after an initial exposure to insulin-containing growth media. The current study adds to the existing knowledge that the insulin by itself cannot induce adipogenic induction in the cardiac cultures. The data have significance in the understanding of cardiovascular health especially in diabetic patients. PMID:27574386

  5. Effect of cell density on adipogenic differentiation of mesenchymal stem cells

    SciTech Connect

    Lu, Hongxu; Guo, Likun; Wozniak, Michal J.; Kawazoe, Naoki; Tateishi, Tetsuya; Zhang, Xingdong; Chen, Guoping

    2009-04-10

    The effect of cell density on the adipogenic differentiation of human bone marrow-derived mesenchymal stem cells (MSCs) was investigated by using a patterning technique to induce the formation of a cell density gradient on a micropatterned surface. The adipogenic differentiation of MSCs at a density gradient from 5 x 10{sup 3} to 3 x 10{sup 4} cells/cm{sup 2} was examined. Lipid vacuoles were observed at all cell densities after 1-3 weeks of culture in adipogenic differentiation medium although the lipid vacuoles were scarce at the low cell density and abundant at the high cell density. Real-time RT-PCR analysis showed that adipogenesis marker genes encoding peroxisome proliferator-activated receptor {gamma}2 (PPAR{gamma}2), lipoprotein lipase (LPL), and fatty acid binding protein-4 (FABP4) were detected in the MSCs cultured at all cell densities. The results suggest that there was no apparent effect of cell density on the adipogenic differentiation of human MSCs.

  6. Temporal heterogeneity in single-cell gene expression and mechanical properties during adipogenic differentiation.

    PubMed

    Labriola, Nicholas R; Darling, Eric M

    2015-04-13

    Adipose-derived stem/stromal cells (ASCs) respond heterogeneously when exposed to lineage-specific induction medium. Variable responses at the single-cell level can be observed in the production of lineage-specific metabolites, expression of mRNA transcripts, and adoption of mechanical phenotypes. Understanding the relationship between the biological and mechanical characteristics for individual ASCs is crucial for interpreting how cellular heterogeneity affects the differentiation process. The goal of the current study was to monitor the gene expression of peroxisome proliferator receptor gamma (PPARG) in adipogenically differentiating ASC populations over two weeks, while also characterizing the expression-associated mechanical properties of individual cells using atomic force microscopy (AFM). Results showed that ASC mechanical properties did not change significantly over time in either adipogenic or control medium; however, cells expressing PPARG exhibited significantly greater compliance and fluidity compared to those lacking expression in both adipogenic and control media environments. The percent of PPARG+ cells in adipogenic samples increased over time but stayed relatively constant in controls. Previous reports of a slow, gradual change in cellular mechanical properties are explained by the increase in the number of positively differentiating cells in a sample rather than being reflective of actual, single-cell mechanical property changes. Cytoskeletal remodeling was more prevalent in adipogenic samples than controls, likely driving the adoption of a more compliant mechanical phenotype and upregulation of PPARG. The combined results reinforce the importance of understanding single-cell characteristics, in the context of heterogeneity, to provide more accurate interpretations of biological phenomena such as stem cell differentiation.

  7. Epigallocatechin Gallate Inhibits Mouse Mesenchymal Stem Cell Differentiation to Adipogenic Lineage

    PubMed Central

    Chani, Baldeep; Puri, Veena; Chander Sobti, Ranbir; Puri, Sanjeev

    2016-01-01

    Epigallocatechin gallate (EGCG) is a major component of green tea polyphenols having a potent anti-oxidant potential. Besides inhibiting the growth of many cancer cell types and inducing proliferation and differentiation in keratinocytes, it has been shown to promote reduction of body fat. The fact that mesenchymal stem cells (MSCs) have ability to self-renew and differentiate into the cells of mesodermal lineages, such as fat and bone, it is, thus, possible that EGCG may directly be involved in affecting fat metabolism through its effect on mesenchymal stem cells. Hence, with this aim, the present study was designed to determine the effect of EGCG on mouse mesenchymal stem cells, C3H10T1/2 cells differentiation into adipocytes. To understand this process, the cells were incubated with varying concentrations of EGCG (1 μM, 5 μM, 10 μM, 50 μM) in the presence and /or absence of adipogenic medium for 9 days. The results demonstrated that, EGCG inhibited the cells proliferation, migration and also prevented their differentiation to adipogenic lineage. These effects were analyzed through the inhibition of wound healing activity, reduction in Oil red O stained cells, together with decrease in the expression of Adipisin gene following EGCG treatment. These observations thus demonstrated anti-adipogenic effect of EGCG with a possibility of its role in the therapeutic intervention of obesity. PMID:27397998

  8. Phenamil enhances the adipogenic differentiation of hen preadipocytes.

    PubMed

    Regassa, Alemu; Park, Kye Won; Kim, Woo Kyun

    2016-10-01

    A study was conducted to examine the effect of phenamil on adipogenic differentiation and expression of key adipogenic transcripts in hen preadipocytes. Preadipocytes were isolated from 20-week old Single Comb White Leghorn hens (Gallas gallus, Lohman strain). The experiment lasted for 48 h and had six treatments. Non-treated control (C) cells, cells treated with dexamethasone, 3-isobutyl-1-methylxanthine, insulin, and oleic acid (DMIOA) (T1), DMIOA + 15 μM phenamil (T2), DMIOA + 30 μM phenamil (T3), 15 μM phenamil alone (T4), and 30 μM phenamil alone (T5). Neutral lipid accumulation and the mRNA expression of key adipogenic transcripts were measured in all treatments and compared. Lipid accumulation was detected in T1, T2, and T3 only. Expression of peroxisome proliferator receptor-activator gamma 2 (PPARγ2), the core enhancer binding protein α (C/EBPα), C/EBPβ, fatty acid binding protein 4 (FABP4), and lipoprotein lipase (LPL) as well as ETS variant 4 (ETV4) and 5 was higher (P < 0.05) in T2, T3, T4, and T5 compared to C. Expression of these transcripts was higher (P < 0.05) in T2 and T3 compared to T4 and T5. The core enhancer binding protein α, C/EBPβ, and FABP4 were highly expressed (P < 0.05) in T1 compared to C. However, the expression of PPARγ2, LPL, and ETV4 and ETV5 was not significantly different. Expression of C/EBPα, C/EBPβ, and FABP4 was higher (P < 0.05) in T2 and T3 compared to T1. Expression of sterol regulatory element binding protein 1 (SREBP1) and leptin receptor (LEPR) was not significantly different among the treatments. In conclusion, phenamil enhances DMIOA-induced adipogenic differentiation of hen preadipocytes but does not induce adipogenesis by itself. PMID:27460177

  9. Fibroblast growth factor-2 stimulates adipogenic differentiation of human adipose-derived stem cells

    SciTech Connect

    Kakudo, Natsuko . E-mail: kakudon@takii.kmu.ac.jp; Shimotsuma, Ayuko; Kusumoto, Kenji

    2007-07-27

    Adipose-derived stem cells (ASCs) have demonstrated a capacity for differentiating into a variety of lineages, including bone, cartilage, or fat, depending on the inducing stimuli and specific growth and factors. It is acknowledged that fibroblast growth factor-2 (FGF-2) promotes chondrogenic and inhibits osteogenic differentiation of ASCs, but thorough investigations of its effects on adipogenic differentiation are lacking. In this study, we demonstrate at the cellular and molecular levels the effect of FGF-2 on adipogenic differentiation of ASCs, as induced by an adipogenic hormonal cocktail consisting of 3-isobutyl-1-methylxanthine (IBMX), dexamethasone, insulin, and indomethacin. FGF-2 significantly enhances the adipogenic differentiation of human ASCs. Furthermore, in cultures receiving FGF-2 before adipogenic induction, mRNA expression of peroxisome proliferator-activated receptor {gamma}2 (PPAR{gamma}2), a key transcription factor in adipogenesis, was upregulated. The results of FGF-2 supplementation suggest the potential applications of FGF-2 and ASCs in adipose tissue regeneration.

  10. Contrasting effect of perlecan on adipogenic and osteogenic differentiation of mesenchymal stem cells in vitro.

    PubMed

    Nakamura, Ryosuke; Nakamura, Fumio; Fukunaga, Shigeharu

    2014-03-01

    Perlecan, a basement membrane component, shows diverse functions in different organs and tissues. However, the role of perlecan in differentiation of mesenchymal stem cells (MSCs) has been barely investigated. In this study, we examined the effect of perlecan on adipogenic and osteogenic differentiation of MSCs in vitro by adding extrinsic perlecan to culture media or blocking the function of intrinsic perlecan expressed into culture media by differentiating MSCs. Extrinsic perlecan suppressed adipogenic differentiation; however, it promoted osteogenic differentiation. These functions were further confirmed by a study of blocking intrinsic perlecan. Perlecan treated with heparitinase-I also showed the suppressive effect on adipogenic differentiation. In contrast, the promotive effect on osteogenic differentiation was found to be heparan sulfate-dependent. Intrinsic perlecan was suggested to be effective at the late stage of adipogenic differentiation by a study of perlecan-blocking performed at distinct periods, but was suggested to be effective at the early stage of osteogenic differentiation. Our results showed perlecan has contrasting effect on adipogenic and osteogenic differentiation of MSCs due to its diverse actions. Based on these outcomes, we recognized that employing extrinsic perlecan or blocking intrinsic perlecan is effective for regulating adipogenic and osteogenic differentiation of MSCs by restricting its direction.

  11. Extracellular matrix of adipogenically differentiated mesenchymal stem cells reveals a network of collagen filaments, mostly interwoven by hexagonal structural units.

    PubMed

    Ullah, Mujib; Sittinger, Michael; Ringe, Jochen

    2013-01-01

    Extracellular matrix (ECM) is the non-cellular component of tissues, which not only provides biological shelter but also takes part in the cellular decisions for diverse functions. Every tissue has an ECM with unique composition and topology that governs the process of determination, differentiation, proliferation, migration and regeneration of cells. Little is known about the structural organization of matrix especially of MSC-derived adipogenic ECM. Here, we particularly focus on the composition and architecture of the fat ECM to understand the cellular behavior on functional bases. Thus, mesenchymal stem cells (MSC) were adipogenically differentiated, then, were transferred to adipogenic propagation medium, whereas they started the release of lipid droplets leaving bare network of ECM. Microarray analysis was performed, to indentify the molecular machinery of matrix. Adipogenesis was verified by Oil Red O staining of lipid droplets and by qPCR of adipogenic marker genes PPARG and FABP4. Antibody staining demonstrated the presence of collagen type I, II and IV filaments, while alkaline phosphatase activity verified the ossified nature of these filaments. In the adipogenic matrix, the hexagonal structures were abundant followed by octagonal structures, whereas they interwoven in a crisscross manner. Regarding molecular machinery of adipogenic ECM, the bioinformatics analysis revealed the upregulated expression of COL4A1, ITGA7, ITGA7, SDC2, ICAM3, ADAMTS9, TIMP4, GPC1, GPC4 and downregulated expression of COL14A1, ADAMTS5, TIMP2, TIMP3, BGN, LAMA3, ITGA2, ITGA4, ITGB1, ITGB8, CLDN11. Moreover, genes associated with integrins, glycoproteins, laminins, fibronectins, cadherins, selectins and linked signaling pathways were found. Knowledge of the interactive-language between cells and matrix could be beneficial for the artificial designing of biomaterials and bioscaffolds. PMID:23851162

  12. Endocrine disrupting chemicals affect the adipogenic differentiation of mesenchymal stem cells in distinct ontogenetic windows

    SciTech Connect

    Biemann, Ronald; Navarrete Santos, Anne; Navarrete Santos, Alexander; Riemann, Dagmar; Knelangen, Julia; Blueher, Matthias; Koch, Holger; Fischer, Bernd

    2012-01-13

    Highlights: Black-Right-Pointing-Pointer Endocrine disrupting chemicals affect adipogenesis in mesenchymal stem cells (MSC). Black-Right-Pointing-Pointer The adipogenic impact depends strongly on the window of exposure. Black-Right-Pointing-Pointer Bisphenol A reduces the potential of MSC to differentiate into adipocytes. Black-Right-Pointing-Pointer DEHP and TBT trigger the adipogenic differentiation of mesenchymal stem cells. Black-Right-Pointing-Pointer BPA, DEHP and TBT did not affect adipogenesis in embryonic stem cells. -- Abstract: Endocrine disrupting chemicals (EDC) like bisphenol A (BPA), bis(2-ethylhexyl)phthalate (DEHP) and tributyltin (TBT) are ubiquitously present in the environment and in human tissues. They bind to nuclear hormone receptors and affect cellular and developmental processes. In this study, we show that BPA, DEHP and TBT affect the adipogenic differentiation of murine mesenchymal stem cells (MSC, C3H/10T1/2) in a concentration-, stage- and compound-specific manner. C3H/10T1/2 cells and embryonic stem cells (CGR8) were exposed to BPA, DEHP or TBT at different stages of cell determination and differentiation (undifferentiated growth, adipogenic induction and terminal adipogenic differentiation). The final amount of differentiated adipocytes, cellular triglyceride content and mRNA expression of adipogenic marker genes (adiponectin, FABP4, PPAR{gamma}2, LPL) were quantified and compared with corresponding unexposed cells. BPA (10 {mu}M) decreased subsequent adipogenic differentiation of MSC, when cells were exposed during undifferentiated growth. In contrast, DEHP (100 {mu}M) during the hormonal induction period, and TBT (100 nM) in all investigated stages, enhanced adipogenesis. Importantly, exposure of undifferentiated murine embryonic stem cells did not show any effect of the investigated EDC on subsequent adipogenic differentiation.

  13. Prostaglandin E2 signals white-to-brown adipogenic differentiation.

    PubMed

    García-Alonso, Verónica; Clària, Joan

    2014-01-01

    The formation of new adipocytes from precursor cells is a crucial aspect of normal adipose tissue function. During the adipogenic process, adipocytes differentiated from mesenchymal stem cells give rise to two main types of fat: white adipose tissue (WAT) characterized by the presence of adipocytes containing large unilocular lipid droplets, and brown adipose tissue (BAT) composed by multilocular brown adipocytes packed with mitochondria. WAT is not only important for energy storage but also as an endocrine organ regulating whole body homeostasis by secreting adipokines and other mediators, which directly impact metabolic functions in obesity. By contrast, BAT is specialized in dissipating energy in form of heat and has salutary effects in combating obesity and associated disorders. Unfortunately, WAT is the predominant fat type, whereas BAT is scarce and located in discrete pockets in adult humans. Luckily, another type of brown adipocytes, called beige or brite (brown-in-white) adipocytes, with similar functions to those of "classical" brown adipocytes has recently been identified in WAT. In this review, a close look is given into the role of bioactive lipid mediators in the regulation of adipogenesis, with a special emphasis on the role of the microsomal prostaglandin E (PGE) synthase-1, a terminal enzyme in PGE2 biosynthesis, as a key regulator of white-to-brown adipogenesis in WAT. PMID:26317053

  14. Endocrine disrupting chemicals affect the adipogenic differentiation of mesenchymal stem cells in distinct ontogenetic windows.

    PubMed

    Biemann, Ronald; Navarrete Santos, Anne; Navarrete Santos, Alexander; Riemann, Dagmar; Knelangen, Julia; Blüher, Matthias; Koch, Holger; Fischer, Bernd

    2012-01-13

    Endocrine disrupting chemicals (EDC) like bisphenol A (BPA), bis(2-ethylhexyl)phthalate (DEHP) and tributyltin (TBT) are ubiquitously present in the environment and in human tissues. They bind to nuclear hormone receptors and affect cellular and developmental processes. In this study, we show that BPA, DEHP and TBT affect the adipogenic differentiation of murine mesenchymal stem cells (MSC, C3H/10T1/2) in a concentration-, stage- and compound-specific manner. C3H/10T1/2 cells and embryonic stem cells (CGR8) were exposed to BPA, DEHP or TBT at different stages of cell determination and differentiation (undifferentiated growth, adipogenic induction and terminal adipogenic differentiation). The final amount of differentiated adipocytes, cellular triglyceride content and mRNA expression of adipogenic marker genes (adiponectin, FABP4, PPARγ2, LPL) were quantified and compared with corresponding unexposed cells. BPA (10 μM) decreased subsequent adipogenic differentiation of MSC, when cells were exposed during undifferentiated growth. In contrast, DEHP (100 μM) during the hormonal induction period, and TBT (100 nM) in all investigated stages, enhanced adipogenesis. Importantly, exposure of undifferentiated murine embryonic stem cells did not show any effect of the investigated EDC on subsequent adipogenic differentiation.

  15. Roles of chondroitin sulfate proteoglycan 4 in fibrogenic/adipogenic differentiation in skeletal muscle tissues.

    PubMed

    Takeuchi, Shiho; Nakano, Shin-Ichi; Nakamura, Katsuyuki; Ozoe, Atsufumi; Chien, Peggie; Yoshihara, Hidehito; Hakuno, Fumihiko; Matsuwaki, Takashi; Saeki, Yasushi; Takahashi, Shin-Ichiro; Yamanouchi, Keitaro; Nishihara, Masugi

    2016-10-01

    Intramuscular adipose tissue and fibrous tissue are observed in some skeletal muscle pathologies such as Duchenne muscular dystrophy and sarcopenia, and affect muscle strength and myogenesis. They originate from common fibrogenic/adipogenic cells in the skeletal muscle. Thus, elucidating the regulatory mechanisms underlying fibrogenic/adipogenic cell differentiation is an important step toward the mediation of these disorders. Previously, we established a highly adipogenic progenitor clone, 2G11, from rat skeletal muscle and showed that basic fibroblast growth factor (bFGF) is pro-adipogenic in these cells. Here, we demonstrated that 2G11 cells give rise to fibroblasts upon transforming growth factor (TGF)-β1 stimulation, indicating that they possess mesenchymal progenitor cells (MPC)-like characteristics. The previously reported MPC marker PDGFRα is expressed in other cell populations. Accordingly, we produced monoclonal antibodies that specifically bind to 2G11 cell surface antigens and identified chondroitin sulfate proteoglycan 4 (CSPG4) as a potential MPC marker. Based on an RNA interference analysis, we found that CSPG4 is involved in both the pro-adipogenic effect of bFGF and in TGF-β-induced alpha smooth muscle actin expression and stress fiber formation. By establishing an additional marker for MPC detection and characterizing its role in fibrogenic/adipogenic differentiation, these results will facilitate the development of effective treatments for skeletal muscle pathologies. PMID:27582000

  16. Long non-coding RNA ADNCR suppresses adipogenic differentiation by targeting miR-204

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Adiposeness is a complex and precisely orchestrated process mediated by a network of adipogenic regulatory factors. Several studies have highlighted the relevance of lncRNAs in adipocyte differentiation, but the precise molecular mechanism has largely remained elusive. In the present study, we perfo...

  17. Heparin affects human bone marrow stromal cell fate: Promoting osteogenic and reducing adipogenic differentiation and conversion.

    PubMed

    Simann, Meike; Schneider, Verena; Le Blanc, Solange; Dotterweich, Julia; Zehe, Viola; Krug, Melanie; Jakob, Franz; Schilling, Tatjana; Schütze, Norbert

    2015-09-01

    Heparins are broadly used for the prevention and treatment of thrombosis and embolism. Yet, osteoporosis is considered to be a severe side effect in up to one third of all patients on long-term treatment. However, the mechanisms underlying this clinical problem are only partially understood. To investigate if heparin affects differentiation of skeletal precursors, we examined the effects of heparin on the osteogenic and adipogenic lineage commitment and differentiation of primary human bone marrow stromal cells (hBMSCs). Due to the known inverse relationship between adipogenesis and osteogenesis and the capacity of pre-differentiated cells to convert into the respective other lineage, we also determined heparin effects on osteogenic conversion and adipogenic differentiation/conversion. Interestingly, heparin did not only significantly increase mRNA expression and enzyme activity of the osteogenic marker alkaline phosphatase (ALP), but it also promoted mineralization during osteogenic differentiation and conversion. Furthermore, the mRNA expression of the osteogenic marker bone morphogenic protein 4 (BMP4) was enhanced. In addition, heparin administration partly prevented adipogenic differentiation and conversion demonstrated by reduced lipid droplet formation along with a decreased expression of adipogenic markers. Moreover, luciferase reporter assays, inhibitor experiments and gene expression analyses revealed that heparin had putative permissive effects on osteogenic signaling via the BMP pathway and reduced the mRNA expression of the Wnt pathway inhibitors dickkopf 1 (DKK1) and sclerostin (SOST). Taken together, our data show a rather supportive than inhibitory effect of heparin on osteogenic hBMSC differentiation and conversion in vitro. Further studies will have to investigate the net effects of heparin administration on bone formation versus bone resorption in vivo to unravel the molecular mechanisms of heparin-associated osteoporosis and reconcile

  18. Sphingosine-1-phosphate inhibits the adipogenic differentiation of 3T3-L1 preadipocytes.

    PubMed

    Moon, Myung-Hee; Jeong, Jae-Kyo; Lee, You-Jin; Seol, Jae-Won; Park, Sang-Youel

    2014-10-01

    Sphingosine-1-phosphate (S1P) is a pluripotent lipid mediator that transmits signals through G-protein-coupled receptors to control diverse biological processes. The novel biological activity of S1P in the adipogenesis of 3T3-L1 preadipocytes was identified in the present study. S1P significantly decreased lipid accumulation in maturing preadipocytes in a dose‑dependent manner. In order to understand the anti‑adipogenic effects of S1P, preadipocytes were treated with S1P, and the change in the expression of several adipogenic transcription factors and enzymes was investigated using quantitative RT-PCR. S1P downregulated the transcriptional levels of the peroxisome proliferator-activated receptor γ, CCAAT/enhancer binding proteins and adiponectin, which are markers of adipogenic differentiation. The effects of S1P on the levels of mitogen‑activated protein kinase (MAPK) signals in preadipocytes were also investigated. The activation of JNK and p38 were downregulated by S1P treatment in human preadipocytes. In conclusion, the results of this study suggest that S1P alters fat mass by directly affecting adipogenesis. This is mediated by the downregulation of adipogenic transcription factors and by inactivation of the JNK and p38 MAPK pathways. Thus, selective targeting of the S1P receptors and sphingosine kinases may have clinical applications for the treatment of obesity. PMID:25050633

  19. Mannose-binding dietary lectins induce adipogenic differentiation of the marrow-derived mesenchymal cells via an active insulin-like signaling mechanism.

    PubMed

    Bajaj, Manmohan; Hinge, Ashwini; Limaye, Lalita S; Gupta, Rajesh Kumar; Surolia, Avadhesha; Kale, Vaijayanti P

    2011-04-01

    We have recently demonstrated that the mannose-binding lectins, namely banana lectin (BL) and garlic lectin (GL), interacted with the insulin receptors on M210B4 cells--an established mesenchymal cell line of murine marrow origin--and initiate mitogen-activated protein kinase kinase (MEK)-dependent extracellular signal-regulated kinase (ERK) signaling in them. In this study, we show that this lectin-mediated active ERK signaling culminates into an adipogenic differentiation of these cells. Gene expression studies indicate that the effect takes place at the transcriptional level. Experiments carried out with pharmacological inhibitors show that MEK-dependent ERK and phosphatidylinositol 3-kinase-dependent AKT pathways are positive regulators of the lectin- and insulin-mediated adipogenic differentiation, while stress-activated kinase/c-jun N-terminal kinase pathway acts as a negative one. Since both lectins could efficiently substitute for insulin in the standard adipogenic induction medium, they may perhaps serve as molecular tools to study the mechanistic aspects of the adipogenic process that are independent of cell proliferation. Our study clearly demonstrates the ability of BL and GL to activate insulin-like signaling in the mesenchymal cells in vitro leading to their adipocytic differentiation. The dietary origin of these lectins underscores an urgent need to examine their in vivo effects on tissue homeostasis.

  20. The phytoestrogen genistein enhances osteogenesis and represses adipogenic differentiation of human primary bone marrow stromal cells.

    PubMed

    Heim, M; Frank, O; Kampmann, G; Sochocky, N; Pennimpede, T; Fuchs, P; Hunziker, W; Weber, P; Martin, I; Bendik, I

    2004-02-01

    In the present study, we investigated the role of the phytoestrogen genistein and 17beta-estradiol in human bone marrow stromal cells, undergoing induced osteogenic or adipogenic differentiation. Profiling of estrogen receptors (ERs)-alpha, -beta1, -beta2, -beta3, -beta4, -beta5, and aromatase mRNAs revealed lineage-dependent expression patterns. During osteogenic differentiation, the osteoblast-determining core binding factor-alpha1 showed a progressive increase, whereas the adipogenic regulator peroxisome proliferator-activated receptor gamma (PPARgamma) was sequentially decreased. This temporal regulation of lineage-determining marker genes was strongly enhanced by genistein during the early osteogenic phase. Moreover, genistein increased alkaline phosphatase mRNA levels and activity, the osteoprotegerin:receptor activator of nuclear factor-kappaB ligand gene expression ratio, and the expression of TGFbeta1. During adipogenic differentiation, down-regulation in the mRNA levels of PPARgamma and CCAAT/enhancer-binding protein-alpha at d 3 and decreased lipoprotein lipase and adipsin mRNA levels at d 21 were observed after genistein treatment. This led to a lower number of adipocytes and a reduction in the size of their lipid droplets. At d 3 of adipogenesis, TGFbeta1 was strongly up-regulated by genistein in an ER-dependent manner. Blocking the TGFbeta1 pathway abolished the effects of genistein on PPARgamma protein levels and led to a reduction in the proliferation rate of precursor cells. Overall, genistein enhanced the commitment and differentiation of bone marrow stromal cells to the osteoblast lineage but did not influence the late osteogenic maturation markers. Adipogenic differentiation and maturation, on the other hand, were reduced by genistein (and 17beta-estradiol) via an ER-dependent mechanism involving autocrine or paracrine TGFbeta1 signaling. PMID:14605006

  1. Mechanism of osteogenic and adipogenic differentiation of tendon stem cells induced by sirtuin 1.

    PubMed

    Liu, Junpeng; Han, Weifeng; Chen, Lei; Tang, Kanglai

    2016-08-01

    The aim of the present study was to assess the expression of sirtuin (Sirt)1 in tendon stem cells (TSCs) and to elucidate its association with osteogenic and adipogenic differentiation of TSCs. Reverse-transcription quantitative polymerase chain reaction (RT-qPCR) and western blot analyses were performed to detect Sirt1 mRNA and protein levels in TSCs, respectively. TSCs were positive for Sirt1 expression, which was elevated by Sirt1 activator SRT1720 in a time- and concentration- dependent manner, and decreased by Sirt1 inhibitor EX527. TSCs were treated with SRT1720 and EX527 for various time periods and resulting changes in osteogenic and adipogenic protein markers were analyzed using alizarin red and oil red O staining. According to RT-qPCR and western blot analyses, the associated factors β‑catenin, Runt-related transcription factor 2 (Runx2) and bone morphogenetic protein 2 were elevated following increases of Sirt1 levels, while CCAAT/enhancer binding protein (CEBP)α and peroxisome proliferator-activated receptor (PPAR)γ were decreased. These results suggested that osteogenic differentiation capacity was enhanced, while adipogenic differentiation capacity declined. Further mechanistic study revealed that phosphoinositide‑3 kinase (PI3K) and AKT were decreased following activation of Sirt1. In conclusion, the present study suggested that Sirt1 promotes the osteogenic differentiation of TSCs through upregulating β‑catenin and Runx2 and inhibits the adipogenic differentiation of TSCs through the PI3K/AKT pathway with downregulation of CEBPα and PPARγ. PMID:27357961

  2. Effects of capsaicin on adipogenic differentiation in bovine bone marrow mesenchymal stem cell.

    PubMed

    Jeong, Jin Young; Suresh, Sekar; Park, Mi Na; Jang, Mi; Park, Sungkwon; Gobianand, Kuppannan; You, Seungkwon; Yeon, Sung-Heom; Lee, Hyun-Jeong

    2014-12-01

    Capsaicin is a major constituent of hot chili peppers that influences lipid metabolism in animals. In this study, we explored the effects of capsaicin on adipogenic differentiation of bovine bone marrow mesenchymal stem cells (BMSCs) in a dose- and time-dependent manner. The BMSCs were treated with various concentrations of capsaicin (0, 0.1, 1, 5, and 10 μM) for 2, 4, and 6 days. Capsaicin suppressed fat deposition significantly during adipogenic differentiation. Peroxisome proliferator-activated receptor gamma, cytosine-cytosine-adenosine-adenosine-thymidine/enhancer binding protein alpha, fatty acid binding protein 4, and stearoyl-CoA desaturase expression decreased after capsaicin treatment. We showed that the number of apoptotic cells increased in dose- and time-dependent manners. Furthermore, we found that capsaicin increased the expression levels of apoptotic genes, such as B-cell lymphoma 2-associated X protein and caspase 3. Overall, capsaicin inhibits fat deposition by triggering apoptosis. PMID:25358373

  3. Effects of capsaicin on adipogenic differentiation in bovine bone marrow mesenchymal stem cell.

    PubMed

    Jeong, Jin Young; Suresh, Sekar; Park, Mi Na; Jang, Mi; Park, Sungkwon; Gobianand, Kuppannan; You, Seungkwon; Yeon, Sung-Heom; Lee, Hyun-Jeong

    2014-12-01

    Capsaicin is a major constituent of hot chili peppers that influences lipid metabolism in animals. In this study, we explored the effects of capsaicin on adipogenic differentiation of bovine bone marrow mesenchymal stem cells (BMSCs) in a dose- and time-dependent manner. The BMSCs were treated with various concentrations of capsaicin (0, 0.1, 1, 5, and 10 μM) for 2, 4, and 6 days. Capsaicin suppressed fat deposition significantly during adipogenic differentiation. Peroxisome proliferator-activated receptor gamma, cytosine-cytosine-adenosine-adenosine-thymidine/enhancer binding protein alpha, fatty acid binding protein 4, and stearoyl-CoA desaturase expression decreased after capsaicin treatment. We showed that the number of apoptotic cells increased in dose- and time-dependent manners. Furthermore, we found that capsaicin increased the expression levels of apoptotic genes, such as B-cell lymphoma 2-associated X protein and caspase 3. Overall, capsaicin inhibits fat deposition by triggering apoptosis.

  4. Adipogenic differentiation state-specific gene expression as related to bovine carcass adiposity.

    PubMed

    Pickworth, C L; Loerch, S C; Velleman, S G; Pate, J L; Poole, D H; Fluharty, F L

    2011-02-01

    Genetic regulation of the site of fat deposition is not well defined. The objective of this study was to investigate adipogenic differentiation state-specific gene expression in feedlot cattle (>75% Angus; <25% Simmental parentage) of varying adipose accretion patterns. Four groups of 4 steers were selected via ultrasound for the following adipose tissue characteristics: low subcutaneous-low intramuscular (LSQ-LIM), low subcutaneous-high intramuscular (LSQ-HIM), high subcutaneous-low intramuscular (HSQ-LIM), and high subcutaneous-high intramuscular (HSQ-HIM). Adipose tissue from the subcutaneous (SQ) and intramuscular (IM) depots was collected at slaughter. The relative expression of adipogenic genes was evaluated using quantitative PCR. Data were analyzed using the mixed model of SAS, and gene expression data were analyzed using covariate analysis with ribosomal protein L19 as the covariate. No interactions (P > 0.10) were observed between IM and SQ adipose tissue depots for any of the variables measured. Therefore, only the main effects of high and low accretion within a depot and the effects of depot are reported. Steers with LIM had smaller mean diameter IM adipocytes (P < 0.001) than HIM steers. Steers with HSQ had larger mean diameter SQ adipocytes (P < 0.001) than LSQ. However, there were no differences (P > 0.10) in any of the genes measured due to high or low adipose accretion. Preadipogenic delta-like kinase1 mRNA was greater in the IM than the SQ adipose tissue; conversely, differentiating and adipogenic genes, lipoprotein lipase, PPARγ, fatty acid synthetase, and fatty acid binding protein 4 were greater (P < 0.001) in the SQ than the IM depot. Intramuscular adipocytes were smaller than SQ adipocytes and had greater expression of the preadipogenic gene, indicating that more hyperplasia was occurring. Meanwhile, SQ adipose tissue contained much larger (P < 0.001) adipocytes that had a greater expression (P < 0.001) of differentiating and adipogenic

  5. Notch Signaling Rescues Loss of Satellite Cells Lacking Pax7 and Promotes Brown Adipogenic Differentiation.

    PubMed

    Pasut, Alessandra; Chang, Natasha C; Rodriguez, Uxia Gurriaran; Faulkes, Sharlene; Yin, Hang; Lacaria, Melanie; Ming, Hong; Rudnicki, Michael A

    2016-07-12

    Pax7 is a nodal transcription factor that is essential for regulating the maintenance, expansion, and myogenic identity of satellite cells during both neonatal and adult myogenesis. Deletion of Pax7 results in loss of satellite cells and impaired muscle regeneration. Here, we show that ectopic expression of the constitutively active intracellular domain of Notch1 (NICD1) rescues the loss of Pax7-deficient satellite cells and restores their proliferative potential. Strikingly NICD1-expressing satellite cells do not undergo myogenic differentiation and instead acquire a brown adipogenic fate both in vivo and in vitro. NICD-expressing Pax7(-/-) satellite cells fail to upregulate MyoD and instead express the brown adipogenic marker PRDM16. Overall, these results show that Notch1 activation compensates for the loss of Pax7 in the quiescent state and acts as a molecular switch to promote brown adipogenesis in adult skeletal muscle.

  6. Notch Signaling Rescues Loss of Satellite Cells Lacking Pax7 and Promotes Brown Adipogenic Differentiation

    PubMed Central

    Pasut, Alessandra; Chang, Natasha C.; Rodriguez, Uxia Gurriaran; Faulkes, Sharlene; Yin, Hang; Lacaria, Melanie; Ming, Hong; Rudnicki, Michael A.

    2016-01-01

    Summary Pax7 is a nodal transcription factor that is essential for regulating the maintenance, expansion, and myogenic identity of satellite cells during both neonatal and adult myogenesis. Deletion of Pax7 results in loss of satellite cells and impaired muscle regeneration. Here we show that ectopic expression of the constitutively active intracellular domain of Notch1 (NICD1) rescues the loss of Pax7-deficient satellite cells and restores their proliferative potential. Strikingly NICD1-expressing satellite cells do not undergo myogenic differentiation and instead acquire a brown adipogenic fate both in vivo and in vitro. NICD-expressing Pax7-/- satellite cells fail to upregulate MyoD and instead express the brown adipogenic marker PRDM16. Overall these results show that Notch1 activation compensates for the loss of Pax7 in the quiescent state and acts as a molecular switch to promote brown adipogenesis in adult skeletal muscle. PMID:27346341

  7. ERR{alpha} regulates osteoblastic and adipogenic differentiation of mouse bone marrow mesenchymal stem cells

    SciTech Connect

    Rajalin, Ann-Marie; Pollock, Hanna; Aarnisalo, Piia

    2010-05-28

    The orphan nuclear receptor estrogen-related receptor-{alpha} (ERR{alpha}) has been reported to have both a positive and a negative regulatory role in osteoblastic and adipocytic differentiation. We have studied the role of ERR{alpha} in osteoblastic and adipogenic differentiation of mesenchymal stem cells. Bone marrow mesenchymal stem cells were isolated from ERR{alpha} deficient mice and their differentiation capacities were compared to that of the wild-type cells. ERR{alpha} deficient cultures displayed reduced cellular proliferation, osteoblastic differentiation, and mineralization. In the complementary experiment, overexpression of ERR{alpha} in MC3T3-E1 cells increased the expression of osteoblastic markers and mineralization. Alterations in the expression of bone sialoprotein (BSP) may at least partially explain the effects on mineralization as BSP expression was reduced in ERR{alpha} deficient MSCs and enhanced upon ERR{alpha} overexpression in MC3T3-E1 cells. Furthermore, a luciferase reporter construct driven by the BSP promoter was efficiently transactivated by ERR{alpha}. Under adipogenic conditions, ERR{alpha} deficient cultures displayed reduced adipocytic differentiation. Our data thus propose a positive role for ERR{alpha} in osteoblastic and adipocytic differentiation. The variability in the results yielded in the different studies implies that ERR{alpha} may play different roles in bone under different physiological conditions.

  8. ITGAV and ITGA5 diversely regulate proliferation and adipogenic differentiation of human adipose derived stem cells

    PubMed Central

    Morandi, E. M.; Verstappen, R.; Zwierzina, M. E.; Geley, S.; Pierer, G.; Ploner, C.

    2016-01-01

    The fate of human adipose tissue stem cells (ASCs) is largely determined by biochemical and mechanical cues from the extracellular matrix (ECM), which are sensed and transmitted by integrins. It is well known that specific ECM constituents influence ASC proliferation and differentiation. Nevertheless, knowledge on how individual integrins regulate distinct processes is still limited. We performed gene profiling of 18 alpha integrins in sorted ASCs and adipocytes, identifying downregulations of RGD-motif binding integrins integrin-alpha-V (ITGAV) and integrin-alpha-5 (ITGA5), upregulation of laminin binding and leukocyte-specific integrins and individual regulations of collagen and LDV-receptors in differentiated adipocytes in-vivo. Gene function analyses in in-vitro cultured ASCs unraveled differential functions of ITGA5 and ITGAV. Knockdown of ITGAV, but not ITGA5 reduced proliferation, caused p21Cip1 induction, repression of survivin and specific regulation of Hippo pathway mediator TAZ. Gene knockdown of both integrins promoted adipogenic differentiation, while transgenic expression impaired adipogenesis. Inhibition of ITGAV using cilengitide resulted in a similar phenotype, mimicking loss of pan-ITGAV expression using RNAi. Herein we show ASC specific integrin expression patterns and demonstrate distinct regulating roles of both integrins in human ASCs and adipocyte physiology suggesting a negative impact of RDG-motif signaling on adipogenic differentiation of ASCs via ITGA5 and ITGAV. PMID:27363302

  9. 18{beta}-Glycyrrhetinic acid inhibits adipogenic differentiation and stimulates lipolysis

    SciTech Connect

    Moon, Myung-Hee; Jeong, Jae-Kyo; Lee, You-Jin; Seol, Jae-Won; Ahn, Dong-Choon; Kim, In-Shik; Park, Sang-Youel

    2012-04-20

    Highlights: Black-Right-Pointing-Pointer 18{beta}-GA inhibits adipogenic differentiation in 3T3-L1 preadipocytes and stimulates lipolysis in differentiated adipocytes. Black-Right-Pointing-Pointer Anti-adipogenic effect of 18{beta}-GA is caused by down-regulation of PPAR{gamma} and inactivation of Akt signalling. Black-Right-Pointing-Pointer Lipolytic effect of 18{beta}-GA is mediated by up-regulation of HSL, ATGL and perilipin and activation of HSL. -- Abstract: 18{beta}-Glycyrrhetinic acid (18{beta}-GA) obtained from the herb liquorice has various pharmacological properties including anti-inflammatory and anti-bacterial activities. However, potential biological anti-obesity activities are unclear. In this study, novel biological activities of 18{beta}-GA in the adipogenesis of 3T3-L1 preadipocytes and in lipolysis of differentiated adipocytes were identified. Mouse 3T3-L1 cells were used as an in vitro model of adipogenesis and lipolysis, using a mixture of insulin/dexamethasone/3-isobutyl-1-methylxanthine (IBMX) to induce differentiation. The amount of lipid droplet accumulation was determined by an AdipoRed assay. The expression of several adipogenic transcription factors and enzymes was investigated using real-time reverse transcriptase-polymerase chain reaction (RT-PCR) and Western blotting. 18{beta}-GA dose-dependently (1-40 {mu}M) significantly decreased lipid accumulation in maturing preadipocytes. In 3T3-L1 preadipocytes, 10 {mu}M of 18{beta}-GA down-regulated the transcriptional levels of the peroxisome proliferator-activated receptor {gamma}, CCAAT/enhancer-binding protein {alpha} and adiponectin, which are markers of adipogenic differentiation via Akt phosphorylation. Also, in differentiated adipocytes, 18{beta}-GA increased the level of glycerol release and up-regulated the mRNA of hormone-sensitive lipase, adipose TG lipase and perilipin, as well as the phosphorylation of hormone-sensitive lipase at Serine 563. The results indicate that 18{beta

  10. Bisphenol A enhances adipogenic differentiation of human adipose stromal/stem cells

    PubMed Central

    Ohlstein, Jason F; Strong, Amy L; McLachlan, John A; Gimble, Jeffrey M; Burow, Matthew E; Bunnell, Bruce A

    2016-01-01

    Exposure of humans to the endocrine disrupter bisphenol A (BPA) has been associated with increased weight and obesity. However, the mechanism(s) by which BPA increases adipose tissue in humans remains to be determined. The goal of this study was to determine the effects of BPA on adipogenesis of cultured human adipose stromal/stem cells (ASCs), precursors to mature adipocytes. ASCs from three donors were cultured for either 14 or 21 days in adipogenic differentiation media containing increasing concentrations of BPA (100 pM–10 μM). The extent of adipogenic differentiation in the ASCs was assessed by staining with Oil Red O to visualize adipogenic differentiation and then quantified by extraction and optical density measurement of the retained dye. BPA significantly enhanced adipogenesis at a concentration of 1 μM after 21 days of culture. Additionally, we found that BPA increased transcription of the estrogen receptor (ER (ESR1)) and that treatment with the ER antagonist ICI 182 780, blocked the effects of BPA, indicating that BPA may act via an ER-mediated pathway. The results of molecular analyses indicated that the expression of the adipogenesis-associated genes dual leucine zipper-bearing kinase (DLK (MAP3K12)), IGF1, CCAAT/enhancer-binding protein alpha (C/EBPα (CEBPA)), peroxisome proliferator-activated receptor gamma (PPARγ (PPARG)), and lipoprotein lipase (LPL) was temporally accelerated and increased by BPA. In summary, these results indicate that BPA significantly enhances adipogenesis in ASCs through an ER-mediated pathway at physiologically relevant concentrations. PMID:25143472

  11. Impact of bacteria and bacterial components on osteogenic and adipogenic differentiation of adipose-derived mesenchymal stem cells

    SciTech Connect

    Fiedler, Tomas; Salamon, Achim; Adam, Stefanie; Herzmann, Nicole; Taubenheim, Jan; Peters, Kirsten

    2013-11-01

    Adult mesenchymal stem cells (MSC) are present in several tissues, e.g. bone marrow, heart muscle, brain and subcutaneous adipose tissue. In invasive infections MSC get in contact with bacteria and bacterial components. Not much is known about how bacterial pathogens interact with MSC and how contact to bacteria influences MSC viability and differentiation potential. In this study we investigated the impact of three different wound infection relevant bacteria, Escherichia coli, Staphylococcus aureus, and Streptococcus pyogenes, and the cell wall components lipopolysaccharide (LPS; Gram-negative bacteria) and lipoteichoic acid (LTA; Gram-positive bacteria) on viability, proliferation, and osteogenic as well as adipogenic differentiation of human adipose tissue-derived mesenchymal stem cells (adMSC). We show that all three tested species were able to attach to and internalize into adMSC. The heat-inactivated Gram-negative E. coli as well as LPS were able to induce proliferation and osteogenic differentiation but reduce adipogenic differentiation of adMSC. Conspicuously, the heat-inactivated Gram-positive species showed the same effects on proliferation and adipogenic differentiation, while its cell wall component LTA exhibited no significant impact on adMSC. Therefore, our data demonstrate that osteogenic and adipogenic differentiation of adMSC is influenced in an oppositional fashion by bacterial antigens and that MSC-governed regeneration is not necessarily reduced under infectious conditions. - Highlights: • Staphylococcus aureus, Streptococcus pyogenes and Escherichia coli bind to and internalize into adMSC. • Heat-inactivated cells of these bacterial species trigger proliferation of adMSC. • Heat-inactivated E. coli and LPS induce osteogenic differentiation of adMSC. • Heat-inactivated E. coli and LPS reduce adipogenic differentiation of adMSC. • LTA does not influence adipogenic or osteogenic differentiation of adMSC.

  12. Fluoxetine Decreases the Proliferation and Adipogenic Differentiation of Human Adipose-Derived Stem Cells

    PubMed Central

    Sun, Bo Kyung; Kim, Ji Hye; Choi, Joon-Seok; Hwang, Sung-Joo; Sung, Jong-Hyuk

    2015-01-01

    Fluoxetine was originally developed as an antidepressant, but it has also been used to treat obesity. Although the anti-appetite effect of fluoxetine is well-documented, its potential effects on human adipose-derived stem cells (ASCs) or mature adipocytes have not been investigated. Therefore, we investigated the mechanisms underlying the inhibitory effects of fluoxetine on the proliferation of ASCs. We also investigated its inhibitory effect on adipogenic differentiation. Fluoxetine significantly decreased ASC proliferation, and signal transduction PCR array analysis showed that it increased expression of autophagy-related genes. In addition, fluoxetine up-regulated SQSTM1 and LC3B protein expression as detected by western blotting and immunofluorescence. The autophagy inhibitor, 3-methyladenine (3-MA), significantly attenuated fluoxetine-mediated effects on ASC proliferation and SQSTM1/LC3B expression. In addition, 3-MA decreased the mRNA expression of two autophagy-related genes, beclin-1 and Atg7, in ASCs. Fluoxetine also significantly inhibited lipid accumulation and down-regulated the levels of PPAR-γ and C/EBP-α in ASCs. Collectively, these results indicate that fluoxetine decreases ASC proliferation and adipogenic differentiation. This is the first in vitro evidence that fluoxetine can reduce fat accumulation by inhibiting ASC proliferation and differentiation. PMID:26204837

  13. Cell Models and Their Application for Studying Adipogenic Differentiation in Relation to Obesity: A Review

    PubMed Central

    Ruiz-Ojeda, Francisco Javier; Rupérez, Azahara Iris; Gomez-Llorente, Carolina; Gil, Angel; Aguilera, Concepción María

    2016-01-01

    Over the last several years, the increasing prevalence of obesity has favored an intense study of adipose tissue biology and the precise mechanisms involved in adipocyte differentiation and adipogenesis. Adipocyte commitment and differentiation are complex processes, which can be investigated thanks to the development of diverse in vitro cell models and molecular biology techniques that allow for a better understanding of adipogenesis and adipocyte dysfunction associated with obesity. The aim of the present work was to update the different animal and human cell culture models available for studying the in vitro adipogenic differentiation process related to obesity and its co-morbidities. The main characteristics, new protocols, and applications of the cell models used to study the adipogenesis in the last five years have been extensively revised. Moreover, we depict co-cultures and three-dimensional cultures, given their utility to understand the connections between adipocytes and their surrounding cells in adipose tissue. PMID:27376273

  14. Cell Models and Their Application for Studying Adipogenic Differentiation in Relation to Obesity: A Review.

    PubMed

    Ruiz-Ojeda, Francisco Javier; Rupérez, Azahara Iris; Gomez-Llorente, Carolina; Gil, Angel; Aguilera, Concepción María

    2016-01-01

    Over the last several years, the increasing prevalence of obesity has favored an intense study of adipose tissue biology and the precise mechanisms involved in adipocyte differentiation and adipogenesis. Adipocyte commitment and differentiation are complex processes, which can be investigated thanks to the development of diverse in vitro cell models and molecular biology techniques that allow for a better understanding of adipogenesis and adipocyte dysfunction associated with obesity. The aim of the present work was to update the different animal and human cell culture models available for studying the in vitro adipogenic differentiation process related to obesity and its co-morbidities. The main characteristics, new protocols, and applications of the cell models used to study the adipogenesis in the last five years have been extensively revised. Moreover, we depict co-cultures and three-dimensional cultures, given their utility to understand the connections between adipocytes and their surrounding cells in adipose tissue. PMID:27376273

  15. Mechanical stretch inhibits mesenchymal stem cell adipogenic differentiation through TGFβ1/Smad2 signaling.

    PubMed

    Li, Runguang; Liang, Liang; Dou, Yonggang; Huang, Zeping; Mo, Huiting; Wang, Yaning; Yu, Bin

    2015-10-15

    Mesenchymal stem cells (MSCs) are the common precursors of several functionally disparate cell lineages. A plethora of chemical and physical stimuli contribute to lineage decisions and guidance, including mechanical stretch concomitant with physical movement. Here, we examined how stretch regulates MSC differentiation into adipocytes and the intracellular signaling pathways involved. MSCs were cultured under adipogenic conditions and divided into a control and an experimental group. Cultures in the experimental group were subjected to a sinusoidal stretch regimen delivered via flexible culture bottoms (5% magnitude, 10 times per min, 6h/day, 3 or 5 days). Expression levels of the adipocyte markers PPARγ-2, adiponectin, and C/EBPα were measured as indices of differentiation. Compared to controls, MSCs exposed to mechanical stretch exhibited downregulated PPARγ-2, adiponectin, and C/EBPα mRNA expression. Alternatively, stretch upregulated phosphorylation of Smad2. This stretch-induced increase in Smad2 phosphorylation was suppressed by pretreatment with the TGFβ1/Smad2 pathway antagonist SB-431542. Pretreatment with the TGFβ1/Smad2 signaling agonist TGFβ1 facilitated the inhibitory effect of stretch on the expression levels of PPARγ-2, adiponectin, and C/EBPα proteins, while pretreatment with SB-431542 reversed the inhibitory effects of subsequent stretch on the expression levels of these markers. These results strongly suggest that the anti-adipogenic effects of mechanical stretch on MSCs are mediated, at least in part, by activation of the TGFβ1/Smad2 signaling pathway.

  16. The scaffold protein Tks4 is required for the differentiation of mesenchymal stromal cells (MSCs) into adipogenic and osteogenic lineages

    PubMed Central

    Dülk, Metta; Kudlik, Gyöngyi; Fekete, Anna; Ernszt, Dávid; Kvell, Krisztián; Pongrácz, Judit E.; Merő, Balázs L.; Szeder, Bálint; Radnai, László; Geiszt, Miklós; Csécsy, Dalma E.; Kovács, Tamás; Uher, Ferenc; Lányi, Árpád; Vas, Virag; Buday, László

    2016-01-01

    The commitment steps of mesenchymal stromal cells (MSCs) to adipogenic and other lineages have been widely studied but not fully understood. Therefore, it is critical to understand which molecules contribute to the conversion of stem cells into differentiated cells. The scaffold protein Tks4 plays a role in podosome formation, EGFR signaling and ROS production. Dysfunction of Tks4 causes a hereditary disease called Frank-ter Haar syndrome with a variety of defects concerning certain mesenchymal tissues (bone, fat and cartilage) throughout embryogenic and postnatal development. In this study, we aimed to analyze how the mutation of Tks4 affects the differentiation potential of multipotent bone marrow MSCs (BM-MSCs). We generated a Tks4 knock-out mouse strain on C57Bl/6 background, and characterized BM-MSCs isolated from wild type and Tks4−/− mice to evaluate their differentiation. Tks4−/− BM-MSCs had reduced ability to differentiate into osteogenic and adipogenic lineages compared to wild type. Studying the expression profile of a panel of lipid-regulated genes during adipogenic induction revealed that the expression of adipogenic transcription factors, genes responsible for lipid droplet formation, sterol and fatty acid metabolism was delayed or reduced in Tks4−/− BM-MSCs. Taken together, these results establish a novel function for Tks4 in the regulation of MSC differentiation. PMID:27711054

  17. Cell-mediated remodeling of biomimetic encapsulating hydrogels triggered by adipogenic differentiation of adipose stem cells

    PubMed Central

    Clevenger, Tracy N; Luna, Gabriel; Boctor, Daniel; Fisher, Steven K; Clegg, Dennis O

    2016-01-01

    One of the most common regenerative therapies is autologous fat grafting, which frequently suffers from unexpected volume loss. One approach is to deliver adipose stem cells encapsulated in the engineered hydrogels supportive of cell survival, differentiation, and integration after transplant. We describe an encapsulating, biomimetic poly(ethylene)-glycol hydrogel, with embedded peptides for attachment and biodegradation. Poly(ethylene)-glycol hydrogels containing an Arg–Gly–Asp attachment sequence and a matrix metalloprotease 3/10 cleavage site supported adipose stem cell survival and showed remodeling initiated by adipogenic differentiation. Arg–Gly–Asp–matrix metalloprotease 3/10 cleavage site hydrogels showed an increased number and area of lacunae or holes after adipose stem cell differentiation. Image analysis of adipose stem cells in Arg–Gly–Asp–matrix metalloprotease 3/10 cleavage site hydrogels showed larger Voronoi domains, while cell density remained unchanged. The differentiated adipocytes residing within these newly remodeled spaces express proteins and messenger RNAs indicative of adipocytic differentiation. These engineered scaffolds may provide niches for stem cell differentiation and could prove useful in soft tissue regeneration. PMID:27733898

  18. Multiphoton fluorescence lifetime imaging of metabolic status in mesenchymal stem cell during adipogenic differentiation

    NASA Astrophysics Data System (ADS)

    Meleshina, A. V.; Dudenkova, V. V.; Shirmanova, M. V.; Bystrova, A. S.; Zagaynova, E. V.

    2016-03-01

    Non-invasive imaging of cell metabolism is a valuable approach to assess the efficacy of stem cell therapy and understand the tissue development. In this study we analyzed metabolic trajectory of the mesenchymal stem cells (MCSs) during differentiation into adipocytes by measuring fluorescence lifetimes of free and bound forms of the reduced nicotinamide adenine dinucleotide (NAD(P)H) and flavine adenine dinucleotide (FAD). Undifferentiated MSCs and MSCs on the 5, 12, 19, 26 days of differentiation were imaged on a Zeiss 710 microscope with fluorescence lifetime imaging (FLIM) system B&H (Germany). Fluorescence of NAD(P)H and FAD was excited at 750 nm and 900 nm, respectively, by a femtosecond Ti:sapphire laser and detected in a range 455-500 nm and 500-550 nm, correspondingly. We observed the changes in the NAD(P)H and FAD fluorescence lifetimes and their relative contributions in the differentiated adipocytes compare to undifferentiated MSCs. Increase of fluorescence lifetimes of the free and bound forms of NAD(P)H and the contribution of protein-bound NAD(P)H was registered, that can be associated with a metabolic switch from glycolysis to oxidative phosphorylation and/or synthesis of lipids in adipogenically differentiated MSCs. We also found that the contribution of protein-bound FAD decreased during differentiation. After carrying out appropriate biochemical measurements, the observed changes in cellular metabolism can potentially serve to monitor stem cell differentiation by FLIM.

  19. Lipid Profiling of In Vitro Cell Models of Adipogenic Differentiation: Relationships With Mouse Adipose Tissues.

    PubMed

    Liaw, Lucy; Prudovsky, Igor; Koza, Robert A; Anunciado-Koza, Rea V; Siviski, Matthew E; Lindner, Volkhard; Friesel, Robert E; Rosen, Clifford J; Baker, Paul R S; Simons, Brigitte; Vary, Calvin P H

    2016-09-01

    Our objective was to characterize lipid profiles in cell models of adipocyte differentiation in comparison to mouse adipose tissues in vivo. A novel lipid extraction strategy was combined with global lipid profiling using direct infusion and sequential precursor ion fragmentation, termed MS/MS(ALL) . Perirenal and inguinal white adipose tissue and interscapular brown adipose tissues from adult C57BL/6J mice were analyzed. 3T3-L1 preadipocytes, ear mesenchymal progenitor cells, and brown adipose-derived BAT-C1 cells were also characterized. Over 3000 unique lipid species were quantified. Principal component analysis showed that perirenal versus inguinal white adipose tissues varied in lipid composition of triacyl- and diacylglycerols, sphingomyelins, glycerophospholipids and, notably, cardiolipin CL 72:3. In contrast, hexosylceramides and sphingomyelins distinguished brown from white adipose. Adipocyte differentiation models showed broad differences in lipid composition among themselves, upon adipogenic differentiation, and with adipose tissues. Palmitoyl triacylglycerides predominate in 3T3-L1 differentiation models, whereas cardiolipin CL 72:1 and SM 45:4 were abundant in brown adipose-derived cell differentiation models, respectively. MS/MS(ALL) data suggest new lipid biomarkers for tissue-specific lipid contributions to adipogenesis, thus providing a foundation for using in vitro models of adipogenesis to reflect potential changes in adipose tissues in vivo. J. Cell. Biochem. 117: 2182-2193, 2016. © 2016 Wiley Periodicals, Inc.

  20. Epidermal Wnt/β-catenin signaling regulates adipocyte differentiation via secretion of adipogenic factors

    PubMed Central

    Donati, Giacomo; Proserpio, Valentina; Lichtenberger, Beate Maria; Natsuga, Ken; Sinclair, Rodney; Fujiwara, Hironobu; Watt, Fiona M.

    2014-01-01

    It has long been recognized that the hair follicle growth cycle and oscillation in the thickness of the underlying adipocyte layer are synchronized. Although factors secreted by adipocytes are known to regulate the hair growth cycle, it is unclear whether the epidermis can regulate adipogenesis. We show that inhibition of epidermal Wnt/β-catenin signaling reduced adipocyte differentiation in developing and adult mouse dermis. Conversely, ectopic activation of epidermal Wnt signaling promoted adipocyte differentiation and hair growth. When the Wnt pathway was activated in the embryonic epidermis, there was a dramatic and premature increase in adipocytes in the absence of hair follicle formation, demonstrating that Wnt activation, rather than mature hair follicles, is required for adipocyte generation. Epidermal and dermal gene expression profiling identified keratinocyte-derived adipogenic factors that are induced by β-catenin activation. Wnt/β-catenin signaling-dependent secreted factors from keratinocytes promoted adipocyte differentiation in vitro, and we identified ligands for the bone morphogenetic protein and insulin pathways as proadipogenic factors. Our results indicate epidermal Wnt/β-catenin as a critical initiator of a signaling cascade that induces adipogenesis and highlight the role of epidermal Wnt signaling in synchronizing adipocyte differentiation with the hair growth cycle. PMID:24706781

  1. Upregulation of miR-22 Promotes Osteogenic Differentiation and Inhibits Adipogenic Differentiation of Human Adipose Tissue-Derived Mesenchymal Stem Cells by Repressing HDAC6 Protein Expression

    PubMed Central

    Huang, Shan; Wang, Shihua; Bian, Chunjing; Yang, Zhuo; Zhou, Hong; Zeng, Yang; Li, Hongling; Han, Qin

    2012-01-01

    Mesenchmal stem cells (MSCs) can be differentiated into either adipocytes or osteoblasts, and a reciprocal relationship exists between adipogenesis and osteogenesis. Multiple transcription factors and signaling pathways have been reported to regulate adipogenic or osteogenic differentiation, respectively, yet the molecular mechanism underlying the cell fate alteration between adipogenesis and osteogenesis still remains to be illustrated. MicroRNAs are important regulators in diverse biological processes by repressing protein expression of their targets. Here, miR-22 was found to regulate adipogenic and osteogenic differentiation of human adipose tissue-derived mesenchymal stem cells (hADMSCs) in opposite directions. Our data showed that miR-22 decreased during the process of adipogenic differentiation but increased during osteogenic differentiation. On one hand, overexpression of miR-22 in hADMSCs could inhibit lipid droplets accumulation and repress the expression of adipogenic transcription factors and adipogenic-specific genes. On the other hand, enhanced alkaline phosphatase activity and matrix mineralization, as well as increased expression of osteo-specific genes, indicated a positive role of miR-22 in regulating osteogenic differentiation. Target databases prediction and validation by Dual Luciferase Reporter Assay, western blot, and real-time polymerase chain reaction identified histone deacetylase 6 (HDAC6) as a direct downstream target of miR-22 in hADMSCs. Inhibition of endogenous HDAC6 by small-interfering RNAs suppressed adipogenesis and stimulated osteogenesis, consistent with the effect of miR-22 overexpression in hADMSCs. Together, our results suggested that miR-22 acted as a critical regulator of balance between adipogenic and osteogenic differentiation of hADMSCs by repressing its target HDAC6. PMID:22375943

  2. Capsaicin inhibits the adipogenic differentiation of bone marrow mesenchymal stem cells by regulating cell proliferation, apoptosis, oxidative and nitrosative stress.

    PubMed

    Ibrahim, Muhammed; Jang, Mi; Park, Mina; Gobianand, Kuppannan; You, Seungkwon; Yeon, Sung-Heom; Park, Sungkwon; Kim, Min Ji; Lee, Hyun-Jeong

    2015-07-01

    Obesity is a global health problem that requires the utmost attention. Apart from other factors the trans-differentiation of mesenchymal stem cells (MSCs) into adipocytes is an added detrimental factor causing the intensification of obesity. The main objective of this present study is to analyse whether capsaicin is capable of inhibiting the differentiation of BMSCs to adipocytes. Bone marrow mesenchymal stem cells (BMSCs) were obtained and exposed to different concentrations of capsaicin for a period of 6 days following 2 days of adipogenic induction. The capsaicin exposed cells were collected at three different time points (2, 4 and 6 days) and subjected to various analyses. BMSCs after exposure to capsaicin showed dose and time dependent reduction in cell viability and proliferation. Interestingly, capsaicin induced cell cycle arrest at G0-G1 and increased apoptosis by increasing reactive oxygen species (ROS) and reactive nitrogen species (RNS) production. Capsaicin significantly inhibited the early adipogenic differentiation, lipogenesis and maturation of adipocytes with concomitant repression of PPARγ, C/EBPα, FABP4 and SCD-1. Taken together, the results of the present study have clearly emphasized that capsaicin potentially inhibits the adipogenic differentiation of mesenchymal stem cells via many different pathways (anti-proliferative, apoptotic and cell cycle arrest) through the stimulation of ROS and RNS production. Thus, capsaicin not only suppresses the maturation of pre-adipocytes into adipocytes but also inhibits the differentiation of mesenchymal stem cells into adipocytes.

  3. Nitric oxide controls fat deposition in dystrophic skeletal muscle by regulating fibro-adipogenic precursor differentiation.

    PubMed

    Cordani, Nicoletta; Pisa, Viviana; Pozzi, Laura; Sciorati, Clara; Clementi, Emilio

    2014-04-01

    Duchenne muscular dystrophy (DMD) is an hereditary disease characterized by loss of muscle fibers and their progressive substitution by fat and fibrous tissue. Mesenchymal fibro-adipogenic progenitors (FAPs) expressing the platelet-derived growth factor receptor alpha (PDGFRα) are an important source of fibrosis and adipogenesis in dystrophic skeletal muscle. Among the therapies suggested for dystrophy are those based on nitric oxide (NO) donating drugs, the administration of which slows disease progression. NO has been shown to act by enhancing the regenerative potential of the diseased muscle. Whether it acts also by inhibiting fibrosis and adipogenesis was not known. Here, we show in vitro that NO regulates FAP fate through inhibition of their differentiation into adipocytes. In mdx mice, an animal model of DMD, treatment with the NO donating drug molsidomine reduced the number of PDGFRα(+) cells as well as the deposition of both skeletal muscle fat and connective tissues. Inhibition of adipogenesis was due to NO-induced increased expression of miR-27b leading to downregulation of peroxisome proliferator-activated receptors gamma (Pparγ1) expression in a pathway independent of cGMP generation. These findings reveal an additional effect of NO in dystrophic muscle that conceivably synergizes with its known effects on regeneration improvement and explain why NO-based therapies appear effective in the treatment of muscular dystrophy.

  4. Depletion of histone demethylase KDM2A enhanced the adipogenic and chondrogenic differentiation potentials of stem cells from apical papilla

    SciTech Connect

    Dong, Rui; Yao, Rui; Du, Juan; Wang, Songlin; Fan, Zhipeng

    2013-11-01

    Mesenchymal stem cells (MSCs) are a reliable resource for tissue regeneration, but the molecular mechanism underlying directed differentiation remains unclear; this has restricted potential MSC applications. The histone demethylase, lysine (K)-specific demethylase 2A (KDM2A), is evolutionarily conserved and ubiquitously expressed members of the JmjC-domain-containing histone demethylase family. A previous study determined that KDM2A can regulate the cell proliferation and osteo/dentinogenic differentiation of MSCs. It is not known whether KDM2A is involved in the other cell lineages differentiation of MSCs. Here, we show that depletion of KDM2A by short hairpin RNAs can enhance adipogenic and chondrogenic differentiation potentials in human stem cells from apical papilla (SCAPs). We found that the stemness-related genes, SOX2, and the embryonic stem cell master transcription factor, NANOG were significantly increased after silence of KDM2A in SCAPs. Moreover, we found that knock-down of the KDM2A co-factor, BCOR also up-regulated the mRNA levels of SOX2 and NANOG. Furthermore, Chromatin immunoprecipitation assays demonstrate that silence of KDM2A increased the histone H3 Lysine 4 (H3K4) trimethylation in the SOX2 and NANOG locus and regulates its expression. In conclusion, our results suggested that depletion of KDM2A enhanced the adipogenic and chondrogenic differentiation potentials of SCAPs by up-regulated SOX2 and NANOG, BCOR also involved in this regulation as co-factor, and provided useful information to understand the molecular mechanism underlying directed differentiation in MSCs. - Highlights: • Depletion of KDM2A enhances adipogenic/chondrogenic differentiation in SCAPs. • Depletion of KDM2A enhances the differentiation of SCAPs by activate SOX2 and NANOG. • Silence of KDM2A increases histone H3 Lysine 4 trimethylation in SOX2 and NANOG. • BCOR is co-factor of KDM2A involved in the differentiation regulation.

  5. Extracellular Purines Promote the Differentiation of Human Bone Marrow-Derived Mesenchymal Stem Cells to the Osteogenic and Adipogenic Lineages

    PubMed Central

    Zini, Roberta; Rossi, Lara; Salvestrini, Valentina; Ferrari, Davide; Manfredini, Rossella; Lemoli, Roberto M.

    2013-01-01

    Extracellular nucleotides are potent signaling molecules mediating cell-specific biological functions, mostly within the processes of tissue damage and repair and flogosis. We previously demonstrated that adenosine 5′-triphosphate (ATP) inhibits the proliferation of human bone marrow-derived mesenchymal stem cells (BM-hMSCs), while stimulating, in vitro and in vivo, their migration. Here, we investigated the effects of ATP on BM-hMSC differentiation capacity. Molecular analysis showed that ATP treatment modulated the expression of several genes governing adipogenic and osteoblastic (ie, WNT-pathway-related genes) differentiation of MSCs. Functional studies demonstrated that ATP, under specific culture conditions, stimulated adipogenesis by significantly increasing the lipid accumulation and the expression levels of the adipogenic master gene PPARγ (peroxisome proliferator-activated receptor-gamma). In addition, ATP stimulated osteogenic differentiation by promoting mineralization and expression of the osteoblast-related gene RUNX2 (runt-related transcription factor 2). Furthermore, we demonstrated that ATP stimulated adipogenesis via its triphosphate form, while osteogenic differentiation was induced by the nucleoside adenosine, resulting from ATP degradation induced by CD39 and CD73 ectonucleotidases expressed on the MSC membrane. The pharmacological profile of P2 purinergic receptors (P2Rs) suggests that adipogenic differentiation is mainly mediated by the engagement of P2Y1 and P2Y4 receptors, while stimulation of the P1R adenosine-specific subtype A2B is involved in adenosine-induced osteogenic differentiation. Thus, we provide new insights into molecular regulation of MSC differentiation. PMID:23259837

  6. Laminin Production and Basement Membrane Deposition by Mesenchymal Stem Cells upon Adipogenic Differentiation

    PubMed Central

    Sillat, Tarvo; Virtanen, Ismo; Ingerpuu, Sulev; Bäck, Nils; Konttinen, Yrjö T.; Korhonen, Matti

    2013-01-01

    The aim was to study laminin (LM) synthesis, integration, and deposition into the basement membrane (BM) during adipogenesis. Human bone marrow-derived mesenchymal stromal cells (MSCs) were induced along the adipogenic lineage. LM chain mRNA and protein levels were followed using quantitative real-time polymerase chain reaction (qRT-PCR), immunofluorescence (IF) staining, transmission electron microscopy (TEM), and immunoprecipitation. MSCs produced low levels of LM mRNAs but were not surrounded by BM in IF and TEM imaging. LM-α4, LM-β1, and LM-γ1 mRNAs increased during adipogenesis 3.9-, 5.8-, and 2.8-fold by day 28. LM-411 was immunoprecipitated from the ECM of the differentiated cells. Immunostaining suggested deposition of LM-411 and some LM-421. BM build-up was probably organized in part by integrin (Int) α6β1. At day 28, TEM images revealed BM-like structures around fat droplet-containing cells. The first signs of BM formation and Int α6β1 were seen using IF imaging at day 14. Laminin-411 and Int α6β1 were expressed in vivo in mature human subcutaneous fat tissue. Undifferentiated human MSCs did not organize LM subunits into BM, whereas LM-411 and some LM-421 are precipitated in the BM around adipocytes. This is the first demonstration of LM-411 precipitation during hMSC adipogenesis around adipocytes as a structural scaffold and Int-regulated signaling element. PMID:23900596

  7. Isolation, Characterization, Cryopreservation of Human Amniotic Stem Cells and Differentiation to Osteogenic and Adipogenic Cells

    PubMed Central

    Gholizadeh-Ghaleh Aziz, Shiva; Pashaei-Asl, Fatima; Fardyazar, Zahra; Pashaiasl, Maryam

    2016-01-01

    Human stem cells and progenitor cells can be used to treat cancer and replace dysfunctional cells within a tissue or organ. The objective of this study was to identify the appropriate cells type in regenerative medicine and targeted therapy. As an alternative to embryonic and bone marrow stem cells, we examined human amniotic fluid stem cells (hAFSCs), one of the potential source of multipotent stem cells isolated from both cell pellet (using single-stage method), and supernatant of human amniotic fluid. Source of isolation and unique property of the cells emphasize that these cells are one of the promising new tools in therapeutic field. Double sources for isolation and availability of the left over samples in diagnostic laboratory at the same time have less legal and ethical concerns compared with embryonic stem cell studies. Cells were isolated, cultured for 18th passage for 6 months and characterized using qPCR and flow cytometry. Cells showed good proliferative ability in culture condition. The cells successfully differentiated into the adipogenic and osteogenic lineages. Based on these findings, amniotic fluid can be considered as an appropriate and convenient source of human amniotic fluid stem cells. These cells provide potential tools for therapeutic applications in the field of regenerative medicine. To get a better understanding of crosstalk between Oct4/NANOG with osteogenesis and adipogenesis, we used network analysis based on Common Targets algorithm and Common Regulators algorithm as well as subnetwork discovery based on gene set enrichment. Network analysis highlighted the possible role of MIR 302A and MIR let-7g. We demonstrated the high expression of MIR 302A and low expression of MIR let7g in hAFSCs by qPCR. PMID:27434028

  8. Adipogenic Fate Commitment of Muscle-Derived Progenitor Cells: Isolation, Culture, and Differentiation

    PubMed Central

    Lau, Anne-Marie; Tseng, Yu-Hua; Schulz, Tim J.

    2015-01-01

    Skeletal muscle harbors several types of cells, among which a population of progenitors committed to the adipogenic lineage has only recently been identified. Potential sources of white and brown adipocytes, the latter representing a potential target to treat obesity, are of considerable interest to the field. Fluorescence-activated cell sorting (FACS) provides an elegant strategy for prospective isolation of closely defined cell populations. Here we describe a flow cytometric method to isolate muscle-resident adipogenic progenitor cells with a default potential to undergo white adipogenesis. We further describe an approach to induce commitment to a lineage of brown-like adipocytes upon exposure to bone morphogenetic protein 7 (BMP7). PMID:25173387

  9. Insulin-Like Growth Factor-1 and Bone Morphogenetic Protein-2 Jointly Mediate Prostaglandin E2-Induced Adipogenic Differentiation of Rat Tendon Stem Cells

    PubMed Central

    Liu, Junpeng; Chen, Lei; zhou, You; Liu, Xiangzhou; Tang, Kanglai

    2014-01-01

    Tendinopathy is characterized histopathologically by lipid accumulation and tissue calcification. Adipogenic and osteogenic differentiation of tendon stem cells (TSCs) are believed to play key roles in these processes. The major inflammatory mediator prostaglandin E2 (PGE2) has been shown to induce osteogenic differentiation of TSCs via bone morphogenetic protein-2 (BMP-2), and BMP-2 has also been implicated in adipogenic differentiation of stem cells. We therefore examined the mechanisms responsible for PGE2-induced adipogenesis in rat TSCs in vitro. Insulin-like growth factor-1 (IGF-1) mRNA and protein were significantly up-regulated in PGE2-stimulated TSCs, measured by quantitative reverse transcription-polymerase chain reaction and enzyme-linked immunosorbent assay, respectively. Incubation with specific inhibitors of cAMP, cAMP-dependent protein kinase A (PKA), and CCAAT/enhancer binding protein-δ (CEBPδ) demonstrated that IGF-1 up-regulation occurred via a cAMP/PKA/CEBPδ pathway. Furthermore, neither IGF-1 nor BMP-2 alone was able to mediate adipogenic differentiation of TSCs, but IGF-1 together with BMP-2 significantly increased adipogenesis, indicated by Oil Red O staining. Moreover, knock-down of endogenous IGF-1 and BMP2 abolished PGE2-induced adipogenic differentiation. Phosphorylation of CREB and Smad by IGF-1 and BMP-2, respectively, were required for induction of the adipogenesis-related peroxisome proliferator-activated receptor γ2 (PPARγ2) gene and for adipogenic differentiation. In conclusion, IGF-1 and BMP-2 together mediate PGE2-induced adipogenic differentiation of TSCs in vitro via a CREB- and Smad-dependent mechanism. This improved understanding of the mechanisms responsible for tendinopathies may help the development of more effective therapies. PMID:24416413

  10. The effect of low static magnetic field on osteogenic and adipogenic differentiation potential of human adipose stromal/stem cells

    NASA Astrophysics Data System (ADS)

    Marędziak, Monika; Śmieszek, Agnieszka; Tomaszewski, Krzysztof A.; Lewandowski, Daniel; Marycz, Krzysztof

    2016-01-01

    The aim of this work was to investigate the effects of static magnetic field (SMF) on the osteogenic properties of human adipose derived mesenchymal stem cells (hASCs). In this study in seven days viability assay we examined the impact of SMF on cells proliferation rate, population doubling time, and ability to form single-cell derived colonies. We have also examined cells' morphology, ultrastructure and osteogenic properties on the protein as well as mRNA level. We established a complex approach, which enabled us to obtain information about SMF and hASCs potential in the context of differentiation into osteogenic and adipogenic lineages. We demonstrated that SMF enhances both viability and osteogenic properties of hASCs through higher proliferation factor and shorter population doubling time. We have also observed asymmetrically positioned nuclei and organelles after SMF exposition. With regards to osteogenic properties we observed increased levels of osteogenic markers i.e. osteopontin, osteocalcin and increased ability to form osteonodules with positive reaction to Alizarin Red dye. We have also shown that SMF besides enhancing osteogenic properties of hASCs, simultaneously decreases their ability to differentiate into adipogenic lineage. Our results clearly show a direct influence of SMF on the osteogenic potential of hASCs. These results provide key insights into the role of SMF on their cellular fate and properties.

  11. Chemical and genetic blockade of HDACs enhances osteogenic differentiation of human adipose tissue-derived stem cells by oppositely affecting osteogenic and adipogenic transcription factors.

    PubMed

    Maroni, Paola; Brini, Anna Teresa; Arrigoni, Elena; de Girolamo, Laura; Niada, Stefania; Matteucci, Emanuela; Bendinelli, Paola; Desiderio, Maria Alfonsina

    2012-11-16

    The human adipose-tissue derived stem/stromal cells (hASCs) are an interesting source for bone-tissue engineering applications. Our aim was to clarify in hASCs the role of acetylation in the control of Runt-related transcription factor 2 (Runx2) and Peroxisome proliferator activated receptor (PPAR) γ. These key osteogenic and adipogenic transcription factors are oppositely involved in osteo-differentiation. The hASCs, committed or not towards bone lineage with osteoinductive medium, were exposed to HDACs chemical blockade with Trichostatin A (TSA) or were genetically silenced for HDACs. Alkaline phosphatase (ALP) and collagen/calcium deposition, considered as early and late osteogenic markers, were evaluated concomitantly as index of osteo-differentiation. TSA pretreatment, useful experimental protocol to analyse pan-HDAC-chemical inhibition, and switch to osteogenic medium induced early-osteoblast maturation gene Runx2, while transiently decreased PPARγ and scarcely affected late-differentiation markers. Time-dependent effects were observed after knocking-down of HDAC1 and 3: Runx2 and ALP underwent early activation, followed by late-osteogenic markers increase and by PPARγ/ALP activity diminutions mostly after HDAC3 silencing. HDAC1 and 3 genetic blockade increased and decreased Runx2 and PPARγ target genes, respectively. Noteworthy, HDACs knocking-down favoured the commitment effect of osteogenic medium. Our results reveal a role for HDACs in orchestrating osteo-differentiation of hASCs at transcriptional level, and might provide new insights into the modulation of hASCs-based regenerative therapy. PMID:23085045

  12. A Novel Regulatory Function of Sweet Taste-Sensing Receptor in Adipogenic Differentiation of 3T3-L1 Cells

    PubMed Central

    Masubuchi, Yosuke; Nakagawa, Yuko; Ma, Jinhui; Sasaki, Tsutomu; Kitamura, Tadahiro; Yamamoto, Yoritsuna; Kurose, Hitoshi; Kojima, Itaru; Shibata, Hiroshi

    2013-01-01

    Background Sweet taste receptor is expressed not only in taste buds but also in nongustatory organs such as enteroendocrine cells and pancreatic beta-cells, and may play more extensive physiological roles in energy metabolism. Here we examined the expression and function of the sweet taste receptor in 3T3-L1 cells. Methodology/Principal Findings In undifferentiated preadipocytes, both T1R2 and T1R3 were expressed very weakly, whereas the expression of T1R3 but not T1R2 was markedly up-regulated upon induction of differentiation (by 83.0 and 3.8-fold, respectively at Day 6). The α subunits of Gs (Gαs) and G14 (Gα14) but not gustducin were expressed throughout the differentiation process. The addition of sucralose or saccharin during the first 48 hours of differentiation considerably reduced the expression of peroxisome proliferator activated receptor γ (PPARγ and CCAAT/enhancer-binding protein α (C/EBPα at Day 2, the expression of aP2 at Day 4 and triglyceride accumulation at Day 6. These anti-adipogenic effects were attenuated by short hairpin RNA-mediated gene-silencing of T1R3. In addition, overexpression of the dominant-negative mutant of Gαs but not YM-254890, an inhibitor of Gα14, impeded the effects of sweeteners, suggesting a possible coupling of Gs with the putative sweet taste-sensing receptor. In agreement, sucralose and saccharin increased the cyclic AMP concentration in differentiating 3T3-L1 cells and also in HEK293 cells heterologously expressing T1R3. Furthermore, the anti-adipogenic effects of sweeteners were mimicked by Gs activation with cholera toxin but not by adenylate cyclase activation with forskolin, whereas small interfering RNA-mediated knockdown of Gαs had the opposite effects. Conclusions 3T3-L1 cells express a functional sweet taste-sensing receptor presumably as a T1R3 homomer, which mediates the anti-adipogenic signal by a Gs-dependent but cAMP-independent mechanism. PMID:23336004

  13. Genistein induces adipogenic differentiation in human bone marrow mesenchymal stem cells and suppresses their osteogenic potential by upregulating PPARγ

    PubMed Central

    ZHANG, LI-YAN; XUE, HAO-GANG; CHEN, JI-YING; CHAI, WEI; NI, MING

    2016-01-01

    Genistein is a soy isoflavone that exists in the form of an aglycone. It is the primary active component in soy isoflavone and has a number of biological activities (anti-inflammatory and anti-oxidative). However, the specific effect of genistein on human bone marrow mesenchymal stem cells (BMSCs) remains unclear. In the present study, the mechanism underlying the effect of genistein on the suppression of BMSC adipogenic differentiation and the enhancement of osteogenic potential was investigated using an MTT assay. It was observed that genistein significantly increased BMSC cell proliferation in a time- and dose-dependent manner (P<0.01). In addition, reverse transcription-quantitative polymerase chain reaction revealed that genistein significantly inhibited the expression of runt-related transcription factor 2 (Runx2), type I collagen (Col I) and osteocalcin (OC; P<0.01). Furthermore, 20 µm genistein significantly inhibited the activity of alkaline phosphatase (ALP) and increased the activity of triglycerides (TGs) increased (P<0.01) as determined by an enzyme-linked immunosorbent assay. Finally, western blotting revealed that BMSC pretreatment with 20 µm genistein significantly increased peroxisome proliferator-activated receptor γ (PPARγ) protein expression (P<0.01). This suggests that the downregulation of PPARγ may significantly reduce the effect of genistein on cell proliferation, suppress the expression of Runx2, Col I and OC mRNA, and reduce ALP and promote TG activity in BMSCs. Thus, the results of the present study conclude that genistein induces adipogenic differentiation in human BMSCs and suppresses their osteogenic potential by upregulating the expression of PPARγ. In conclusion, genistein may be a promising candidate drug for treatment against osteogenesis. PMID:27168816

  14. Spot14/Spot14R expression may be involved in MSC adipogenic differentiation in patients with adolescent idiopathic scoliosis

    PubMed Central

    WANG, QIFEI; YANG, JUNLIN; LIN, XIANG; HUANG, ZIFANG; XIE, CHAOFAN; FAN, HENGWEI

    2016-01-01

    The aim of the present study was to evaluate the different expression levels of thyroid hormone responsive (THRSP; Spot14)/S14 related, Mig12 (S14R) during bone marrow mesenchymal stem cell (BM-MSC) adipogenesis in adolescent idiopathic scoliosis (AIS) patients. MSCs were retrospectively isolated from AIS patients and controls, and adipogenic differentiation was induced. Total RNA was extracted for Affymetrix 3′-IVT expression profiling microarrays and compared with the results from healthy controls. The results were confirmed by semiquantitative reverse transcription-polymerase chain reaction (RT-PCR) validation and the protein expression levels of Spot14 and its paralogous gene S14R by western blotting and immunohistochemistry. A total of 300 significantly altered mRNAs were detected (111 upregulated and 189 downregulated) and confirmed by RT-qPCR. The mRNA expression levels of seven genes, including Spot14, were altered by >2-fold in AIS patients. Spot14/S14R was selected for further investigation. The results of the western blotting demonstrated that mRNA and protein expression levels of Spot14/S14R were significantly higher in AIS patients than the controls (P<0.05). Immunohistochemistry demonstrated Spot14 was expressed in 85% (17/20 cases) in adipose tissue samples from AIS patients and 23.1% (3/13 cases) of adipose tissue samples from controls. The positive ratio of Spot14 in adipose tissue samples from AIS was significantly higher than the controls (P<0.001). The results of the present study indicated that Spot14/S14R were differently expressed in MSC adipogenesis in AIS patients, and they may be important in the abnormal adipogenic differentiation in AIS. PMID:27082501

  15. Transcriptomics Comparison between Porcine Adipose and Bone Marrow Mesenchymal Stem Cells during In Vitro Osteogenic and Adipogenic Differentiation

    PubMed Central

    Monaco, Elisa; Bionaz, Massimo; Rodriguez-Zas, Sandra; Hurley, Walter L.; Wheeler, Matthew B.

    2012-01-01

    Bone-marrow mesenchymal stem cells (BMSC) are considered the gold standard for use in tissue regeneration among mesenchymal stem cells (MSC). The abundance and ease of harvest make the adipose-derived stem cells (ASC) an attractive alternative to BMSC. The aim of the present study was to compare the transcriptome of ASC and BMSC, respectively isolated from subcutaneous adipose tissue and femur of 3 adult pigs, during in vitro osteogenic and adipogenic differentiation for up to four weeks. At 0, 2, 7, and 21 days of differentiation RNA was extracted for microarray analysis. A False Discovery Rate ≤0.05 for overall interactions effect and P<0.001 between comparisons were used to determine differentially expressed genes (DEG). Ingenuity Pathway Analysis and DAVID performed the functional analysis of the DEG. Functional analysis of highest expressed genes in MSC and genes more expressed in MSC vs. fully differentiated tissues indicated low immunity and high angiogenic capacity. Only 64 genes were differentially expressed between ASC and BMSC before differentiation. The functional analysis uncovered a potential larger angiogenic, osteogenic, migration, and neurogenic capacity in BMSC and myogenic capacity in ASC. Less than 200 DEG were uncovered between ASC and BMSC during differentiation. Functional analysis also revealed an overall greater lipid metabolism in ASC, while BMSC had a greater cell growth and proliferation. The time course transcriptomic comparison between differentiation types uncovered <500 DEG necessary to determine cell fate. The functional analysis indicated that osteogenesis had a larger cell proliferation and cytoskeleton organization with a crucial role of G-proteins. Adipogenesis was driven by PPAR signaling and had greater angiogenesis, lipid metabolism, migration, and tumorigenesis capacity. Overall the data indicated that the transcriptome of the two MSC is relatively similar across the conditions studied. In addition, functional analysis

  16. Adipogenic Differentiation of hMSCs is Mediated by Recruitment of IGF‐1r Onto the Primary Cilium Associated With Cilia Elongation

    PubMed Central

    Dalbay, Melis T.; Connelly, John T.; Chapple, J. Paul; Knight, Martin M.

    2015-01-01

    Abstract Primary cilia are single non‐motile organelles that provide a highly regulated compartment into which specific proteins are trafficked as a critical part of various signaling pathways. The absence of primary cilia has been shown to prevent differentiation of human mesenchymal stem cells (hMSCs). Changes in primary cilia length are crucial for regulating signaling events; however it is not known how alterations in cilia structure relate to differentiation. This study tested the hypothesis that changes in primary cilia structure are required for stem cell differentiation. hMSCs expressed primary cilia that were labeled with acetylated alpha tubulin and visualized by confocal microscopy. Chemically induced differentiation resulted in lineage specific changes in cilia length and prevalence which were independent of cell cycle. In particular, adipogenic differentiation resulted in cilia elongation associated with the presence of dexamethasone, while insulin had an inhibitory effect on cilia length. Over a 7‐day time course, adipogenic differentiation media resulted in cilia elongation within 2 days followed by increased nuclear PPARγ levels; an early marker of adipogenesis. Cilia elongation was associated with increased trafficking of insulin‐like growth factor‐1 receptor β (IGF‐1Rβ) into the cilium. This was reversed on inhibition of elongation by IFT‐88 siRNA transfection, which also decreased nuclear PPARγ. This is the first study to show that adipogenic differentiation requires primary cilia elongation associated with the recruitment of IGF‐1Rβ onto the cilium. This study may lead to the development of cilia‐targeted therapies for controlling adipogenic differentiation and associated conditions such as obesity. Stem Cells 2015;33:1952–1961 PMID:25693948

  17. N-Glycosylation Profile of Undifferentiated and Adipogenically Differentiated Human Bone Marrow Mesenchymal Stem Cells: Towards a Next Generation of Stem Cell Markers

    PubMed Central

    Hamouda, Houda; Ullah, Mujib; Berger, Markus; Sittinger, Michael; Tauber, Rudolf; Ringe, Jochen

    2013-01-01

    Mesenchymal stem cells (MSCs) are multipotent cells that are easy to isolate and expand, develop into several tissues, including fat, migrate to diseased organs, have immunosuppressive properties and secrete regenerative factors. This makes MSCs ideal for regenerative medicine. For application and regulatory purposes, knowledge of (bio)markers characterizing MSCs and their development stages is of paramount importance. The cell surface is coated with glycans that possess lineage-specific nature, which makes glycans to be promising candidate markers. In the context of soft tissue generation, we aimed to identify glycans that could be markers for MSCs and their adipogenically differentiated progeny. MSCs were isolated from human bone marrow, adipogenically stimulated for 15 days and adipogenesis was verified by staining the lipid droplets and quantitative real time polymerase chain reaction of the marker genes peroxisome proliferator-activated receptor gamma (PPARG) and fatty acid binding protein-4 (FABP4). Using matrix-assisted laser desorption-ionization-time of flight mass spectrometry combined with exoglycosidase digestions, we report for the first time the N-glycome of MSCs during adipogenic differentiation. We were able to detect more than 100 different N-glycans, including high-mannose, hybrid, and complex N-glycans, as well as poly-N-acetyllactosamine chains. Adipogenesis was accompanied by an increased amount of biantennary fucosylated structures, decreased amount of fucosylated, afucosylated tri- and tetraantennary structures and increased sialylation. N-glycans H6N5F1 and H7N6F1 were significantly overexpressed in undifferentiated MSCs while H3N4F1 and H5N4F3 were upregulated in adipogenically differentiated MSCs. These glycan structures are promising candidate markers to detect and distinguish MSCs and their adipogenic progeny. PMID:23829188

  18. Chemical and genetic blockade of HDACs enhances osteogenic differentiation of human adipose tissue-derived stem cells by oppositely affecting osteogenic and adipogenic transcription factors

    SciTech Connect

    Maroni, Paola; Brini, Anna Teresa; Arrigoni, Elena; Girolamo, Laura de; Niada, Stefania; Matteucci, Emanuela; Bendinelli, Paola; Desiderio, Maria Alfonsina

    2012-11-16

    Highlights: Black-Right-Pointing-Pointer Acetylation affected hASCs osteodifferentiation through Runx2-PPAR{gamma}. Black-Right-Pointing-Pointer HDACs knocking-down favoured the commitment effect of osteogenic medium. Black-Right-Pointing-Pointer HDACs silencing early activated Runx2 and ALP. Black-Right-Pointing-Pointer PPAR{gamma} reduction and calcium/collagen deposition occurred later. Black-Right-Pointing-Pointer Runx2/PPAR{gamma} target genes were modulated in line with HDACs role in osteo-commitment. -- Abstract: The human adipose-tissue derived stem/stromal cells (hASCs) are an interesting source for bone-tissue engineering applications. Our aim was to clarify in hASCs the role of acetylation in the control of Runt-related transcription factor 2 (Runx2) and Peroxisome proliferator activated receptor (PPAR) {gamma}. These key osteogenic and adipogenic transcription factors are oppositely involved in osteo-differentiation. The hASCs, committed or not towards bone lineage with osteoinductive medium, were exposed to HDACs chemical blockade with Trichostatin A (TSA) or were genetically silenced for HDACs. Alkaline phosphatase (ALP) and collagen/calcium deposition, considered as early and late osteogenic markers, were evaluated concomitantly as index of osteo-differentiation. TSA pretreatment, useful experimental protocol to analyse pan-HDAC-chemical inhibition, and switch to osteogenic medium induced early-osteoblast maturation gene Runx2, while transiently decreased PPAR{gamma} and scarcely affected late-differentiation markers. Time-dependent effects were observed after knocking-down of HDAC1 and 3: Runx2 and ALP underwent early activation, followed by late-osteogenic markers increase and by PPAR{gamma}/ALP activity diminutions mostly after HDAC3 silencing. HDAC1 and 3 genetic blockade increased and decreased Runx2 and PPAR{gamma} target genes, respectively. Noteworthy, HDACs knocking-down favoured the commitment effect of osteogenic medium. Our results reveal

  19. Molecular Characterization of Equine APRIL and its Expression Analysis During the Adipogenic Differentiation of Equine Adipose-Derived Stem Cell In Vitro.

    PubMed

    Wu, Haitao; Bi, Xiaolin; Cao, Fang; Zhu, Cuicui; Liu, Hongzhen; Song, Jinyun; Ma, Lei; Ma, Li; Zhang, Yi; Zhao, Dongwei; Liu, Hongyan; Xu, Xinzhou; Zhang, Shuangquan

    2016-10-01

    A proliferation inducing ligand (APRIL) is a member of the TNF superfamily. It shares two receptors with B-cell activating factor (BAFF), B-cell maturation antigen (BCMA), and transmembrane activator and CAML interactor (TACI). Herein, the equine APRIL was identified from equine adipose-derived stem cell (ASC), and the protein expression of APRIL and its related molecules were detected during the adipogenic differentiation of equine ASC in vitro. The equine APRIL gene was located on chromosome 11, spans 1852 base pairs (bp). Its open reading frame covers 753 bp, encoding a 250-amino acid protein with the typical TNF structure domain. During the two weeks' adipogenic differentiation of equine ASC, although the protein expression of APRIL and TACI had an insignificant change, that of BCMA increased significantly. Moreover, with the addition of recombinant protein His6-sAPRIL, a reduced differentiation of equine ASC toward adipocyte was detected. These results may provide the basis for investigating the role of APRIL in ASC adipogenic differentiation. PMID:27565870

  20. Expression of miR-31, miR-125b-5p, and miR-326 in the adipogenic differentiation process of adipose-derived stem cells.

    PubMed

    Tang, Yan-Feng; Zhang, Yong; Li, Xiao-Yu; Li, Cai; Tian, Weidong; Liu, Lei

    2009-08-01

    MicroRNAs (miRNAs) are small single-stranded RNAs of 19-22 nucleotides (nt) and are important posttranscriptional regulation of genes. A link between miRNA function and cancer was researched by the miRNAs microarray technology recently. However, during adipogenic differentiation of ADSCs process, this technology was less used to study adipogenic differentiation mechanism of ADSCs. In this study, miRNA microarray technology was used to examine the expression of miRNA that were differences between induced group and noninduced group of ADSC adipogenic differentiation. Real-time quantitative PCR (real-time qPCR) was used to quantify the miRNA expression. The TargetScan 5.0 software was used to find their target genes. Our results showed that the expression of rno-miR-31, rno-miR-125b-5p, and rno-miR-326 were downregulation in the adipogenic differentiation process. By the statistic analysis, this study showed that the expression of rno-miR-31 and rno-miR-326 were significantly deregulation. In addition, the target genes of rno-miR-31 and rno-miR-326 were correlated with the adipogenic differentiation. Our study suggested that the expression of rno-miR-31 and rno-miR-326 were involved in the adipogenic differentiation process.

  1. Heat Shock Protein Augmentation of Angelica gigas Nakai Root Hot Water Extract on Adipogenic Differentiation in Murine 3T3-L1 Preadipocytes

    PubMed Central

    Lumbera, Wenchie Marie L.; dela Cruz, Joseph; Yang, Seung-Hak; Hwang, Seong Gu

    2016-01-01

    There is a high association of heat shock on the alteration of energy and lipid metabolism. The alterations associated with thermal stress are composed of gene expression changes and adaptation through biochemical responses. Previous study showed that Angelica gigas Nakai (AGN) root extract promoted adipogenic differentiation in murine 3T3-L1 preadipocytes under the normal temperature condition. However, its effect in heat shocked 3T3-L1 cells has not been established. In this study, we investigated the effect of AGN root hot water extract in the adipogenic differentiation of murine 3T3-L1 preadipocytes following heat shock and its possible mechanism of action. Thermal stress procedure was executed within the same stage of preadipocyte confluence (G0) through incubation at 42°C for one hour and then allowed to recover at normal incubation temperature of 37°C for another hour before AGN treatment for both cell viability assay and Oil Red O. Cell viability assay showed that AGN was able to dose dependently (0 to 400 μg/mL) increase cell proliferation under normal incubation temperature and also was able to prevent cytotoxicity due to heat shock accompanied by cell proliferation. Confluent preadipocytes were subjected into heat shock procedure, recovery and then AGN treatment prior to stimulation with the differentiation solution. Heat shocked preadipocytes exhibited reduced differentiation as supported by decreased amount of lipid accumulation in Oil Red O staining and triglyceride measurement. However, those heat shocked preadipocytes that then were given AGN extract showed a dose dependent increase in lipid accumulation as shown by both evaluation procedures. In line with these results, real-time polymerase chain reaction (RT-PCR) and Western blot analysis showed that AGN increased adipogenic differentiation by upregulating heat shock protection related genes and proteins together with the adipogenic markers. These findings imply the potential of AGN in heat

  2. Heat Shock Protein Augmentation of Angelica gigas Nakai Root Hot Water Extract on Adipogenic Differentiation in Murine 3T3-L1 Preadipocytes.

    PubMed

    Lumbera, Wenchie Marie L; Dela Cruz, Joseph; Yang, Seung-Hak; Hwang, Seong Gu

    2016-03-01

    There is a high association of heat shock on the alteration of energy and lipid metabolism. The alterations associated with thermal stress are composed of gene expression changes and adaptation through biochemical responses. Previous study showed that Angelica gigas Nakai (AGN) root extract promoted adipogenic differentiation in murine 3T3-L1 preadipocytes under the normal temperature condition. However, its effect in heat shocked 3T3-L1 cells has not been established. In this study, we investigated the effect of AGN root hot water extract in the adipogenic differentiation of murine 3T3-L1 preadipocytes following heat shock and its possible mechanism of action. Thermal stress procedure was executed within the same stage of preadipocyte confluence (G0) through incubation at 42°C for one hour and then allowed to recover at normal incubation temperature of 37°C for another hour before AGN treatment for both cell viability assay and Oil Red O. Cell viability assay showed that AGN was able to dose dependently (0 to 400 μg/mL) increase cell proliferation under normal incubation temperature and also was able to prevent cytotoxicity due to heat shock accompanied by cell proliferation. Confluent preadipocytes were subjected into heat shock procedure, recovery and then AGN treatment prior to stimulation with the differentiation solution. Heat shocked preadipocytes exhibited reduced differentiation as supported by decreased amount of lipid accumulation in Oil Red O staining and triglyceride measurement. However, those heat shocked preadipocytes that then were given AGN extract showed a dose dependent increase in lipid accumulation as shown by both evaluation procedures. In line with these results, real-time polymerase chain reaction (RT-PCR) and Western blot analysis showed that AGN increased adipogenic differentiation by upregulating heat shock protection related genes and proteins together with the adipogenic markers. These findings imply the potential of AGN in heat

  3. Heat Shock Protein Augmentation of Angelica gigas Nakai Root Hot Water Extract on Adipogenic Differentiation in Murine 3T3-L1 Preadipocytes.

    PubMed

    Lumbera, Wenchie Marie L; Dela Cruz, Joseph; Yang, Seung-Hak; Hwang, Seong Gu

    2016-03-01

    There is a high association of heat shock on the alteration of energy and lipid metabolism. The alterations associated with thermal stress are composed of gene expression changes and adaptation through biochemical responses. Previous study showed that Angelica gigas Nakai (AGN) root extract promoted adipogenic differentiation in murine 3T3-L1 preadipocytes under the normal temperature condition. However, its effect in heat shocked 3T3-L1 cells has not been established. In this study, we investigated the effect of AGN root hot water extract in the adipogenic differentiation of murine 3T3-L1 preadipocytes following heat shock and its possible mechanism of action. Thermal stress procedure was executed within the same stage of preadipocyte confluence (G0) through incubation at 42°C for one hour and then allowed to recover at normal incubation temperature of 37°C for another hour before AGN treatment for both cell viability assay and Oil Red O. Cell viability assay showed that AGN was able to dose dependently (0 to 400 μg/mL) increase cell proliferation under normal incubation temperature and also was able to prevent cytotoxicity due to heat shock accompanied by cell proliferation. Confluent preadipocytes were subjected into heat shock procedure, recovery and then AGN treatment prior to stimulation with the differentiation solution. Heat shocked preadipocytes exhibited reduced differentiation as supported by decreased amount of lipid accumulation in Oil Red O staining and triglyceride measurement. However, those heat shocked preadipocytes that then were given AGN extract showed a dose dependent increase in lipid accumulation as shown by both evaluation procedures. In line with these results, real-time polymerase chain reaction (RT-PCR) and Western blot analysis showed that AGN increased adipogenic differentiation by upregulating heat shock protection related genes and proteins together with the adipogenic markers. These findings imply the potential of AGN in heat

  4. Time-lapse microscopy and classification of 2D human mesenchymal stem cells based on cell shape picks up myogenic from osteogenic and adipogenic differentiation.

    PubMed

    Seiler, Christof; Gazdhar, Amiq; Reyes, Mauricio; Benneker, Lorin M; Geiser, Thomas; Siebenrock, Klaus A; Gantenbein-Ritter, Benjamin

    2014-09-01

    Current methods to characterize mesenchymal stem cells (MSCs) are limited to CD marker expression, plastic adherence and their ability to differentiate into adipogenic, osteogenic and chondrogenic precursors. It seems evident that stem cells undergoing differentiation should differ in many aspects, such as morphology and possibly also behaviour; however, such a correlation has not yet been exploited for fate prediction of MSCs. Primary human MSCs from bone marrow were expanded and pelleted to form high-density cultures and were then randomly divided into four groups to differentiate into adipogenic, osteogenic chondrogenic and myogenic progenitor cells. The cells were expanded as heterogeneous and tracked with time-lapse microscopy to record cell shape, using phase-contrast microscopy. The cells were segmented using a custom-made image-processing pipeline. Seven morphological features were extracted for each of the segmented cells. Statistical analysis was performed on the seven-dimensional feature vectors, using a tree-like classification method. Differentiation of cells was monitored with key marker genes and histology. Cells in differentiation media were expressing the key genes for each of the three pathways after 21 days, i.e. adipogenic, osteogenic and chondrogenic, which was also confirmed by histological staining. Time-lapse microscopy data were obtained and contained new evidence that two cell shape features, eccentricity and filopodia (= 'fingers') are highly informative to classify myogenic differentiation from all others. However, no robust classifiers could be identified for the other cell differentiation paths. The results suggest that non-invasive automated time-lapse microscopy could potentially be used to predict the stem cell fate of hMSCs for clinical application, based on morphology for earlier time-points. The classification is challenged by cell density, proliferation and possible unknown donor-specific factors, which affect the performance of

  5. Enhanced adipogenic differentiation of bovine bone marrow-derived mesenchymal stem cells

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Until now, the isolation and characterization of bovine bone marrow-derived mesenchymal stem cells (bBM-MSCs) have not been established, which prompted us to optimize the differentiation protocol for bBM-MSCs. In this study, bBM-MSCs were freshly isolated from three 6-month-old cattle and used for p...

  6. Protein Malnutrition Induces Bone Marrow Mesenchymal Stem Cells Commitment to Adipogenic Differentiation Leading to Hematopoietic Failure

    PubMed Central

    Cunha, Mayara Caldas Ramos; Lima, Fabiana da Silva; Vinolo, Marco Aurélio Ramirez; Hastreiter, Araceli; Curi, Rui; Borelli, Primavera; Fock, Ricardo Ambrósio

    2013-01-01

    Protein malnutrition (PM) results in pathological changes that are associated with peripheral leukopenia, bone marrow (BM) hypoplasia and alterations in the BM microenvironment leading to hematopoietic failure; however, the mechanisms involved are poorly understood. In this context, the BM mesenchymal stem cells (MSCs) are cells intimately related to the formation of the BM microenvironment, and their differentiation into adipocytes is important because adipocytes are cells that have the capability to negatively modulate hematopoiesis. Two-month-old male Balb/c mice were subjected to protein-energy malnutrition with a low-protein diet containing 2% protein, whereas control animals were fed a diet containing 12% protein. The hematopoietic parameters and the expression of CD45 and CD117 positive cells in the BM were evaluated. MSCs were isolated from BM, and their capability to produce SCF, IL-3, G-CSF and GM-CSF were analyzed. The expression of PPAR-γ and C/EBP-α as well as the expression of PPAR-γ and SREBP mRNAs were evaluated in MSCs together with their capability to differentiate into adipocytes in vitro. The malnourished animals had anemia and leukopenia as well as spleen and bone marrow hypoplasia and a reduction in the expression of CD45 and CD117 positive cells from BM. The MSCs of the malnourished mice presented an increased capability to produce SCF and reduced production of G-CSF and GM-CSF. The MSCs from the malnourished animals showed increased expression of PPAR-γ protein and PPAR-γ mRNA associated with an increased capability to differentiate into adipocytes. The alterations found in the malnourished animals allowed us to conclude that malnutrition committed MSC differentiation leading to adipocyte decision and compromised their capacity for cytokine production, contributing to an impaired hematopoietic microenvironment and inducing the bone marrow failure commonly observed in protein malnutrition states. PMID:23516566

  7. Ramie Leaf Extracts Suppresses Adipogenic Differentiation in 3T3-L1 Cells and Pig Preadipocytes

    PubMed Central

    Lee, Joomin; Kim, Ah-Ra; Lee, Jae-Joon

    2016-01-01

    The present study was carried out to evaluate the anti-obesity effect of different concentrations of extracts of hot air-dried ramie leaf (HR) and freeze-dried ramie leaf (FR) in 3T3-L1 cells and pig preadipocytes. To analyze the effect on cell proliferation, cells were treated with 25 μg/mL or 100 μg/mL HR or FR extract for 2 days. Cell differentiation was evaluated by measuring glycerol-3-phosphate dehydrogenase and lipoprotein lipase (LPL) activities and intracellular triglyceride content. Treatment with either HR or FR extracts inhibited the proliferation of 3T3-L1 cells and pig preadipocytes in a dose-dependent manner. HR extract treatment inhibited the differentiation of both cell types more effectively than FR treatment. The extent of triglyceride accumulation decreased significantly in both cells following either HR or FR treatment. Furthermore, LPL activity significantly decreased after treatment with HR or FR extract. These results indicated that HR and FR extracts may inhibit proliferation and differentiation of 3T3-L1 cells and pig preadipocytes. Further studies are needed to explore the anti-obesity effect of HR and FR extracts. PMID:26954122

  8. Effects of an AMP-activated protein kinase inhibitor, compound C, on adipogenic differentiation of 3T3-L1 cells.

    PubMed

    Gao, Ye; Zhou, Yi; Xu, Aimin; Wu, Donghai

    2008-09-01

    The role of AMP-activated protein kinase (AMPK) in adipocyte differentiation is not completely understood. Here we reported that an AMPK inhibitor, compound C, significantly inhibited adipogenic differentiation of 3T3-L1 cells in a dose dependent manner, and this inhibitory effect was primarily effective in the initial stage of differentiation. Compound C prevented the mitotic clonal expansion (MCE) of preadipocytes, probably by inhibiting expression of CCAAT/enhancer-binding protein (C/EBP)beta and delta, and subsequently blocked the expression of C/EBPalpha and peroxisome proliferator-activated receptor (PPAR)gamma and transcriptional activation of genes that produce the adipocyte phenotype. AMPK activity was also suppressed by compound C treatment during the early phase of adipogenic differentiation, which indicated that suppressed activation of AMPK by compound C may inhibit the MCE process of preadipocytes. Our results suggest that compound C might serve as a useful molecule in both basic and clinical research on adipogenesis and as a potential lead compound for the treatment of obesity. PMID:18758065

  9. Macrophage-conditioned medium inhibits differentiation-induced Rb phosphorylation in 3T3-L1 preadipocytes

    SciTech Connect

    Yarmo, Michelle N.; Landry, Anne; Molgat, Andre S.D.; Gagnon, AnneMarie; Sorisky, Alexander

    2009-02-01

    This study examines the mechanisms underlying the anti-adipogenic effect of macrophage-secreted products. 3T3-L1 preadipocytes were induced to differentiate over 8 days in medium conditioned by murine J774 macrophages (MacCM). The inhibitory effect on lipid accumulation and expression of adipogenic markers was diminished when addition of MacCM was delayed to day 2 of differentiation. Clonal expansion, an early event required for 3T3-L1 adipogenesis, was reduced in the presence of MacCM (89%; n = 3; p < 0.001), and BrdU incorporation was impaired by 55% (n = 3; p < 0.01). Activation of ERK1/2 was not affected by MacCM, and neither was the expression of p27{sup kip1}, a cyclin-dependent kinase inhibitor. However, phosphorylation of the retinoblastoma protein (Rb), required for cell cycle progression, was impaired by MacCM (94% inhibition; n = 3; p < 0.01). Differentiation-dependent expression, nuclear localization, and DNA binding ability of C/EBP{beta} were not inhibited by MacCM. Alterations in cell cycle-associated proteins may be important with respect to the anti-adipogenic action of MacCM.

  10. TM-25659 enhances osteogenic differentiation and suppresses adipogenic differentiation by modulating the transcriptional co-activator TAZ

    PubMed Central

    Jang, EJ; Jeong, H; Kang, JO; Kim, NJ; Kim, MS; Choi, SH; Yoo, SE; Hong, JH; Bae, MA; Hwang, ES

    2012-01-01

    BACKGROUND AND PURPOSE The transcriptional co-activator with PDZ-binding motif (TAZ) is characterized as a transcriptional modulator of mesenchymal stem cell differentiation into osteoblasts and adipocytes. Moreover, increased TAZ activity in the nucleus enhances osteoblast differentiation and suppresses adipocyte development by interacting with runt-related transcription factor 2 (RUNX2) and PPARγ, respectively. Therefore, it would be of interest to identify low MW compounds that modulate nuclear TAZ activity. EXPERIMENTAL APPROACH High-throughput screening was performed using a library of low MW compounds in order to identify TAZ modulators that enhance nuclear TAZ localization. The effects and molecular mechanisms of a TAZ modulator have been characterized in osteoblast and adipocyte differentiation. KEY RESULTS We identified 2-butyl-5-methyl-6-(pyridine-3-yl)-3-[2′-(1H-tetrazole-5-yl)-biphenyl-4-ylmethyl]-3H-imidazo[4,5-b]pyridine] (TM-25659) as a TAZ modulator. TM-25659 enhanced nuclear TAZ localization in a dose-dependent manner and attenuated PPARγ-mediated adipocyte differentiation by facilitating PPARγ suppression activity of TAZ. In addition, TAZ-induced RUNX2 activity activation was further increased in osteoblasts, causing increased osteoblast differentiation. Accordingly, TM-25659 suppressed bone loss in vivo and decreased weight gain in an obesity model. After oral administration, TM-25659 had a favourable pharmacokinetic profile. CONCLUSION AND IMPLICATIONS TM-25659 stimulated nuclear TAZ localization and thus caused TAZ to suppress PPARγ-dependent adipogenesis and enhance RUNX2-induced osteoblast differentiation in vitro and in vivo. Our data suggest that TM-25659 could be beneficial in the control of obesity and bone loss. PMID:21913895

  11. Effect of decellularized adipose tissue particle size and cell density on adipose-derived stem cell proliferation and adipogenic differentiation in composite methacrylated chondroitin sulphate hydrogels.

    PubMed

    Brown, Cody F C; Yan, Jing; Han, Tim Tian Y; Marecak, Dale M; Amsden, Brian G; Flynn, Lauren E

    2015-07-30

    An injectable composite scaffold incorporating decellularized adipose tissue (DAT) as a bioactive matrix within a hydrogel phase capable of in situ polymerization would be advantageous for adipose-derived stem cell (ASC) delivery in the filling of small or irregular soft tissue defects. Building on previous work, the current study investigates DAT milling methods and the effects of DAT particle size and cell seeding density on the response of human ASCs encapsulated in photo-cross-linkable methacrylated chondroitin sulphate (MCS)-DAT composite hydrogels. DAT particles were generated by milling lyophilized DAT and the particle size was controlled through the processing conditions with the goal of developing composite scaffolds with a tissue-specific 3D microenvironment tuned to enhance adipogenesis. ASC proliferation and adipogenic differentiation were assessed in vitro in scaffolds incorporating small (average diameter of 38   ±   6 μm) or large (average diameter of 278   ±   3 μm) DAT particles in comparison to MCS controls over a period of up to 21 d. Adipogenic differentiation was enhanced in the composites incorporating the smaller DAT particles and seeded at the higher density of 5   ×   10(5) ASCs/scaffold, as measured by glycerol-3-phosphate dehydrogenase (GPDH) enzyme activity, semi-quantitative analysis of perilipin expression and oil red O staining of intracellular lipid accumulation. Overall, this study demonstrates that decellularized tissue particle size can impact stem cell differentiation through cell-cell and cell-matrix interactions, providing relevant insight towards the rational design of composite biomaterial scaffolds for adipose tissue engineering.

  12. Effect of decellularized adipose tissue particle size and cell density on adipose-derived stem cell proliferation and adipogenic differentiation in composite methacrylated chondroitin sulphate hydrogels.

    PubMed

    Brown, Cody F C; Yan, Jing; Han, Tim Tian Y; Marecak, Dale M; Amsden, Brian G; Flynn, Lauren E

    2015-08-01

    An injectable composite scaffold incorporating decellularized adipose tissue (DAT) as a bioactive matrix within a hydrogel phase capable of in situ polymerization would be advantageous for adipose-derived stem cell (ASC) delivery in the filling of small or irregular soft tissue defects. Building on previous work, the current study investigates DAT milling methods and the effects of DAT particle size and cell seeding density on the response of human ASCs encapsulated in photo-cross-linkable methacrylated chondroitin sulphate (MCS)-DAT composite hydrogels. DAT particles were generated by milling lyophilized DAT and the particle size was controlled through the processing conditions with the goal of developing composite scaffolds with a tissue-specific 3D microenvironment tuned to enhance adipogenesis. ASC proliferation and adipogenic differentiation were assessed in vitro in scaffolds incorporating small (average diameter of 38   ±   6 μm) or large (average diameter of 278   ±   3 μm) DAT particles in comparison to MCS controls over a period of up to 21 d. Adipogenic differentiation was enhanced in the composites incorporating the smaller DAT particles and seeded at the higher density of 5   ×   10(5) ASCs/scaffold, as measured by glycerol-3-phosphate dehydrogenase (GPDH) enzyme activity, semi-quantitative analysis of perilipin expression and oil red O staining of intracellular lipid accumulation. Overall, this study demonstrates that decellularized tissue particle size can impact stem cell differentiation through cell-cell and cell-matrix interactions, providing relevant insight towards the rational design of composite biomaterial scaffolds for adipose tissue engineering. PMID:26225549

  13. 21 CFR 866.2320 - Differential culture medium.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Differential culture medium. 866.2320 Section 866... medium. (a) Identification. A differential culture medium is a device that consists primarily of liquid... biochemical component(s) to the medium. Microorganisms are identified by a visible change (e.g., a...

  14. 21 CFR 866.2320 - Differential culture medium.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Differential culture medium. 866.2320 Section 866... medium. (a) Identification. A differential culture medium is a device that consists primarily of liquid... biochemical component(s) to the medium. Microorganisms are identified by a visible change (e.g., a...

  15. 21 CFR 866.2320 - Differential culture medium.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Differential culture medium. 866.2320 Section 866... medium. (a) Identification. A differential culture medium is a device that consists primarily of liquid... biochemical component(s) to the medium. Microorganisms are identified by a visible change (e.g., a...

  16. 21 CFR 866.2320 - Differential culture medium.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Differential culture medium. 866.2320 Section 866... medium. (a) Identification. A differential culture medium is a device that consists primarily of liquid... biochemical component(s) to the medium. Microorganisms are identified by a visible change (e.g., a...

  17. 21 CFR 866.2320 - Differential culture medium.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Differential culture medium. 866.2320 Section 866... medium. (a) Identification. A differential culture medium is a device that consists primarily of liquid... biochemical component(s) to the medium. Microorganisms are identified by a visible change (e.g., a...

  18. Efficient delivery of C/EBP beta gene into human mesenchymal stem cells via polyethylenimine-coated gold nanoparticles enhances adipogenic differentiation

    PubMed Central

    Joydeep, Das; Choi, Yun-Jung; Yasuda, Hideyo; Han, Jae Woong; Park, Chankyu; Song, Hyuk; Bae, Hojae; Kim, Jin-Hoi

    2016-01-01

    The controlled differentiation of stem cells via the delivery of specific genes encoding appropriate differentiation factors may provide useful models for regenerative medicine and aid in developing therapies for human patients. However, the majority of non-viral vectors are not efficient enough to manipulate difficult-to-transfect adult human stem cells in vitro. Herein, we report the first use of 25 kDa branched polyethylenimine-entrapped gold nanoparticles (AuPEINPs) and covalently bound polyethylenimine-gold nanoparticles (AuMUAPEINPs) as carriers for efficient gene delivery into human mesenchymal stem cells (hMSCs). We determined a functional application of these nanoparticles by transfecting hMSCs with the C/EBP beta gene, fused to EGFP, to induce adipogenic differentiation. Transfection efficacy with AuPEINPs and AuMUAPEINPs was 52.3% and 40.7%, respectively, which was 2.48 and 1.93 times higher than that by using Lipofectamine 2000. Luciferase assay results also demonstrated improved gene transfection efficiency of AuPEINPs/AuMUAPEINPs over Lipofectamine 2000 and polyethylenimine. Overexpression of exogenous C/EBP beta significantly enhanced adipogenesis in hMSCs as indicated by both of Oil Red O staining and mRNA expression analyses. Nanoparticle/DNA complexes exhibited favorable cytocompatibility in hMSCs. Taken together, AuPEINPs and AuMUAPEINPs potentially represent safe and highly efficient vehicles for gene delivery to control hMSC differentiation and for therapeutic gene delivery applications. PMID:27677463

  19. Role of C/EBPβ-LAP and C/EBPβ-LIP in early adipogenic differentiation of human white adipose-derived progenitors and at later stages in immature adipocytes.

    PubMed

    Lechner, Stefan; Mitterberger, Maria C; Mattesich, Monika; Zwerschke, Werner

    2013-01-01

    We investigated the role of the major isoforms of CCAAT enhancer binding protein β (C/EBPβ), C/EBPβ-LAP and C/EBPβ-LIP, in adipogenesis of human white adipose-derived stromal/progenitor cells (ASC). C/EBPβ gene expression was transiently induced early in adipogenesis. At later stages, in immature adipocytes, the C/EBPβ mRNA and protein levels declined. The C/EBPβ-LIP protein steady-state level decreased considerably stronger than the C/EBPβ-LAP level and the C/EBPβ-LIP half-life was significantly shorter than the C/EBPβ-LAP half-life. The turn-over of both C/EBPβ-isoforms was regulated by ubiquitin/proteasome-dependent degradation. These data suggest that the protein stability of the C/EBPβ-isoforms is differentially regulated in the course of adipogenesis and in immature adipocytes. Constitutive overexpression of C/EBPβ-LIP had antiadipogenic activity in human ASC. C/EBPβ-LAP, which promotes adipogenesis in mouse 3T3-L1 preadipocytes by directly activating expression of the adipogenic keyregulator PPARγ2, induced the expression of PPARγ2 and of the adipocyte differentiation gene product FABP4 in confluent ASC in the absence of adipogenic hormones. At later stages after hormone cocktail-induced adipogenesis, in immature adipocytes, constitutive overexpression of C/EBPβ-LAP led to reduced expression of PPARγ2 and FABP4, C/EBPα expression was downregulated and the expression of the adipocyte differentiation gene products adiponectin and leptin was impaired. These findings suggest that constitutive overexpression of C/EBPβ-LAP induces adipogenesis in human ASC and negatively regulates the expression of adipogenic regulators and certain adipocyte differentiation gene products in immature adipocytes. We conclude the regulation of both C/EBPβ gene expression and C/EBPβ-LIP and C/EBPβ-LAP protein turn-over plays an important role for the expression of adipogenic regulators and/or adipocyte differentiation genes in early adipogenic differentiation of

  20. Shp2 suppresses the adipogenic differentiation of preadipocyte 3T3-L1 cells at an early stage

    PubMed Central

    Tao, J; Zheng, L; Meng, M; Li, Y; Lu, Z

    2016-01-01

    Tyrosine phosphatase protein Shp2 is a potential therapeutic target for obesity. However, the mechanism of Shp2 during adipogenesis is not fully understood. The present study investigated the role of Shp2 in the terminal differentiation of preadipocytes. The results showed that Shp2 suppressed adipocyte differentiation in 3T3-L1 cells; overexpression of Shp2 reduced lipid droplet production in 3T3-L1 cells, whereas Shp2 knockdown increased lipid droplet production in 3T3-L1 cells. Furthermore, inhibition of Shp2 activity also enhanced adipocyte differentiation. Interestingly, Shp2 expression was specifically decreased early during differentiation in response to stimulation with the dexamethasone–methylisobutylxanthine–insulin (DMI) hormone cocktail. During the first 2 days of differentiation, Shp2 overexpression impaired the DMI-induced phosphorylation of signal transducer and activator of transcription 3 (STAT3) in 3T3-L1 cells and blocked the peak expression of CCAAT/enhancer-binding proteins β and δ during preadipocyte differentiation. In conclusion, Shp2 downregulated the early stages of hormone-induced differentiation of 3T3-L1 cells and inhibited the expression of the first wave of transcription factors by suppressing the DMI-induced STAT3 signaling pathway. These discoveries point to a novel role of Shp2 during adipogenesis and support the hypothesis that Shp2 could be a therapeutic target for the control of obesity. PMID:27551539

  1. Synchrotron FTIR microspectroscopy reveals early adipogenic differentiation of human mesenchymal stem cells at single-cell level.

    PubMed

    Liu, Zhixiao; Tang, Yuzhao; Chen, Feng; Liu, Xia; Liu, Zhaojian; Zhong, Jiajia; Hu, Jun; Lü, Junhong

    2016-09-23

    Human mesenchymal stem cells (hMSCs) have been used as an ideal in vitro model to study human adipogenesis. However, little knowledge of the early stage differentiation greatly hinders our understanding on the mechanism of the adipogenesis processes. In this study, synchrotron radiation-based Fourier transform infrared (SR-FTIR) microspectroscopy was applied to track the global structural and compositional changes of lipids, proteins and nucleic acids inside individual hMSCs along the time course. The multivariate analysis of the SR-FTIR spectra distinguished the dynamic and significant changes of the lipids and nucleic acid at early differentiation stage. Importantly, changes of lipid structure during early days (Day 1-3) of differentiation might serve as a potential biomarker in identifying the state in early differentiation at single cell level. These results proved that SR-FTIR is a powerful tool to study the stem cell fate determination and early lipogenesis events. PMID:27553281

  2. Inhibition of Viability, Proliferation, Cytokines Secretion, Surface Antigen Expression, and Adipogenic and Osteogenic Differentiation of Adipose-Derived Stem Cells by Seven-Day Exposure to 0.5 T Static Magnetic Fields.

    PubMed

    Wang, Jian; Xiang, Bo; Deng, Jixian; Freed, Darren H; Arora, Rakesh C; Tian, Ganghong

    2016-01-01

    After seven-day exposure to 0.5-Tesla Static Magnetic Field (SMF), Adipose-derived Stem Cells (ASCs) and those labeled by superparamagnetic iron oxide (SPIO) nanoparticles were examined for viability by methyl thiazol tetrazolium (MTT) assay, proliferation by cell counting and bromodeoxyuridine (BrdU) incorporation, DNA integrity by single cell gel electrophoresis, surface antigen by flow cytometry analysis, and the expression of cytokines and genetic markers by reverse transcription-PCR and underwent adipogenic and osteogenic differentiation assessed by quantifying related specific genes expression. The SMF slightly reduced cell viability and proliferation and inhibited the expression of CD49d, CD54, and CD73 but did not damage DNA integrity. The SMF slightly downregulated the expression of cytokines including Vascular Endothelial Growth Factor (VEGF), Insulin-like Growth Factor-1 (IGF-1), Transforming Growth Factor Beta 1 (TGF-β1), genetic markers comprising Stem Cell Antigen-1 (Sca1), Octamer-4 (Oct-4), ATP-binding Cassette Subfamily B Member 1 (ABCB1), adipogenic marker genes containing Lipoprotein Lipase (LPL), Peroxisome Proliferator-Activated Receptor Gamma (PPAR-γ), and osteogenic marker genes including Secreted Phosphor-protein 1 (SPP1) and Osterix (OSX). Exposure to 0.5 T SMF for seven days inhibited viability, proliferation, surface antigen expression, cytokine secretion, stem cell genetic marker expression, and adipogenic and osteogenic differentiation but did not affect the DNA integrity in ASCs with or without SPIO labeling. PMID:26880984

  3. Inhibition of Viability, Proliferation, Cytokines Secretion, Surface Antigen Expression, and Adipogenic and Osteogenic Differentiation of Adipose-Derived Stem Cells by Seven-Day Exposure to 0.5 T Static Magnetic Fields

    PubMed Central

    Wang, Jian; Xiang, Bo; Deng, Jixian; Freed, Darren H.; Arora, Rakesh C.; Tian, Ganghong

    2016-01-01

    After seven-day exposure to 0.5-Tesla Static Magnetic Field (SMF), Adipose-derived Stem Cells (ASCs) and those labeled by superparamagnetic iron oxide (SPIO) nanoparticles were examined for viability by methyl thiazol tetrazolium (MTT) assay, proliferation by cell counting and bromodeoxyuridine (BrdU) incorporation, DNA integrity by single cell gel electrophoresis, surface antigen by flow cytometry analysis, and the expression of cytokines and genetic markers by reverse transcription-PCR and underwent adipogenic and osteogenic differentiation assessed by quantifying related specific genes expression. The SMF slightly reduced cell viability and proliferation and inhibited the expression of CD49d, CD54, and CD73 but did not damage DNA integrity. The SMF slightly downregulated the expression of cytokines including Vascular Endothelial Growth Factor (VEGF), Insulin-like Growth Factor-1 (IGF-1), Transforming Growth Factor Beta 1 (TGF-β1), genetic markers comprising Stem Cell Antigen-1 (Sca1), Octamer-4 (Oct-4), ATP-binding Cassette Subfamily B Member 1 (ABCB1), adipogenic marker genes containing Lipoprotein Lipase (LPL), Peroxisome Proliferator-Activated Receptor Gamma (PPAR-γ), and osteogenic marker genes including Secreted Phosphor-protein 1 (SPP1) and Osterix (OSX). Exposure to 0.5 T SMF for seven days inhibited viability, proliferation, surface antigen expression, cytokine secretion, stem cell genetic marker expression, and adipogenic and osteogenic differentiation but did not affect the DNA integrity in ASCs with or without SPIO labeling. PMID:26880984

  4. PPARγ agonists enhance ET-743-induced adipogenic differentiation in a transgenic mouse model of myxoid round cell liposarcoma.

    PubMed

    Charytonowicz, Elizabeth; Terry, Melissa; Coakley, Katherine; Telis, Leonid; Remotti, Fabrizio; Cordon-Cardo, Carlos; Taub, Robert N; Matushansky, Igor

    2012-03-01

    Myxoid round cell liposarcoma (MRCLS) is a common liposarcoma subtype characterized by a translocation that results in the fusion protein TLS:CHOP as well as by mixed adipocytic histopathology. Both the etiology of MRCLS and the mechanism of action of TLS:CHOP remain poorly understood. It was previously shown that ET-743, an antitumor compound with an unclear mechanism of action, is highly effective in patients with MRCLS. To identify the cellular origin of MRCLS, we engineered a mouse model in which TLS:CHOP was expressed under the control of a mesodermally restricted promoter (Prx1) in a p53-depleted background. This model resembled MRCLS histologically as well as functionally in terms of its specific adipocytic differentiation-based response to ET-743. Specifically, endogenous mesenchymal stem cells (MSCs) expressing TLS:CHOP developed into MRCLS in vivo. Gene expression and microRNA analysis of these MSCs showed that they were committed to adipocytic differentiation, but unable to terminally differentiate. We also explored the method of action of ET-743. ET-743 downregulated TLS:CHOP expression, which correlated with CEBPα expression and adipocytic differentiation. Furthermore, PPARγ agonists enhanced the differentiation process initiated by ET-743. Our work highlights how clinical observations can lead to the generation of a mouse model that recapitulates human disease and may be used to develop rational treatment combinations, such as ET-743 plus PPARγ agonists, for the treatment of MRCLS.

  5. Cytotoxicity and inhibitory effects of low-concentration triclosan on adipogenic differentiation of human mesenchymal stem cells

    SciTech Connect

    Guo, Li-Wu; Wu, Qiangen; Green, Bridgett; Nolen, Greg; Shi, Leming; LoSurdo, Jessica; Deng, Helen; Bauer, Steven; Fang, Jia-Long; Ning, Baitang

    2012-07-15

    Humans at all ages are continually exposed to triclosan (TCS), a widely used antimicrobial agent that can be found in many daily hygiene products, such as toothpastes and shampoos; however, the toxicological and biological effects of TCS in the human body after long-term and low-concentration exposure are far from being well understood. In the current study, we investigated the effects of TCS on the differentiation of human mesenchymal stem cells (hMSCs) by measuring the cytotoxicity, morphological changes, lipid accumulation, and the expression of adipocyte differentiation biomarkers during 21-day adipogenesis. Significant cytotoxicity was observed in un-induced hMSCs treated with high-concentration TCS (≥ 5.0 μM TCS), but not with low-concentration treatments (≤ 2.5 μM TCS). TCS inhibited adipocyte differentiation of hMSCs in a concentration-dependent manner in the 0.156 to 2.5 μM range as indicated by morphological changes with Oil Red O staining, which is an index of lipid accumulation. The inhibitory effect was confirmed by a decrease in gene expression of specific adipocyte differentiation biomarkers including adipocyte protein 2, lipoprotein lipase, and adiponectin. Our study demonstrates that TCS inhibits adipocyte differentiation of hMSCs under concentrations that are not cytotoxic and in the range observed in human blood. -- Highlights: ► TCS is cytotoxic to un-induced hMSCs at concentrations ≥ 5.0 μM. ► TCS at concentrations ≤ 2.5 μM is not cytotoxic to induced hMSCs. ► TCS at non-cytotoxic concentrations inhibits lipid formation in induced hMSCs. ► TCS decreases the expression of specific biomarkers of adipocyte differentiation. ► TCS at concentrations observed in human blood inhibits adipogenesis of hMSCs.

  6. Structure-specific adipogenic capacity of novel, well-defined ternary Zn(II)-Schiff base materials. Biomolecular correlations in zinc-induced differentiation of 3T3-L1 pre-adipocytes to adipocytes.

    PubMed

    Tsave, O; Halevas, E; Yavropoulou, M P; Kosmidis Papadimitriou, A; Yovos, J G; Hatzidimitriou, A; Gabriel, C; Psycharis, V; Salifoglou, A

    2015-11-01

    Among the various roles of zinc discovered to date, its exogenous activity as an insulin mimetic agent stands as a contemporary challenge currently under investigation and a goal to pursue in the form of a metallodrug against type 2 Diabetes Mellitus. Poised to investigate the adipogenic potential of Zn(II) and appropriately configure its coordination sphere into well-defined anti-diabetic forms, (a) a series of new well-defined ternary dinuclear Zn(II)-L (L=Schiff base ligands with a variable number of alcoholic moieties) compounds were synthesized and physicochemically characterized, (b) their cytotoxicity and migration effect(s) in both pre- and mature adipocytes were assessed, (c) their ability to effectively induce cell differentiation of 3T3-L1 pre-adipocytes into mature adipocytes was established, and (d) closely linked molecular targets involving or influenced by the specific Zn(II) forms were perused through molecular biological techniques, cumulatively delineating factors involved in Zn(II)-induced adipogenesis. Collectively, the results (a) reveal the significance of key structural features of Schiff ligands coordinated to Zn(II), thereby influencing its (a)toxicity behavior and insulin-like activity, (b) project molecular targets influenced by the specific forms of Zn(II) formulating its adipogenic potential, and (c) exemplify the interwoven relationship between Zn(II)-L structural speciation and insulin mimetic biological activity, thereby suggesting ways of fine tuning structure-specific zinc-induced adipogenicity in future efficient antidiabetic drugs.

  7. A selective and differential medium for Vibrio harveyi.

    PubMed Central

    Harris, L; Owens, L; Smith, S

    1996-01-01

    A new medium, termed Vibrio harveyi agar, has been developed for the isolation and enumeration of V. harveyi. It is possible to differentiate V. harveyi colonies from the colonies of strains representing 15 other Vibrio species with this medium. This medium has been shown to inhibit the growth of two strains of marine Pseudomonas spp. and two strains of marine Flavobacterium spp. but to allow the growth of Photobacterium strains. Colonies displaying typical V. harveyi morphology were isolated from the larval rearing water of a commercial prawn hatchery with V. harveyi agar as a primary isolation medium and were positively identified, by conventional tests, as V. harveyi. This agar displays great potential as a primary isolation medium and offers significant advantages over thiosulfate-citrate-bile salts-sucrose agar as a medium for differentiating V. harveyi from other marine and estuarine Vibrio species. PMID:8795252

  8. A selective-differential medium for detection of Streptococcus agalactiae.

    PubMed

    Guthrie, R K; Brunson, K W; Stiles, J C

    1968-01-01

    A practical culture medium which allows direct plating of milk samples for detection and differentiation of Streptococcus agalactiae within 48 hours is described. Most other micro-organisms likely to be present in these samples are inhibited. Although some strains of Staphylococcus species and ofStreptococcus faecalis are able to grow, they may be differentiated on the basis of reaction in the medium surrounding the colonies.

  9. Differentiation of purified astrocytes in a chemically defined medium

    SciTech Connect

    Morrison, R.S.; de Vellis, J.

    1981-01-01

    Homogeneous cultures of astrocytes and oligodendrocytes provide an excellent model system for studying the regulation of glial structure and function. Recently, a chemically defined (CD) medium was developed for purified cultures of astrocytes, thus eliminating the requirement for serum and providing a controlled system for the study of astroglial properties. Due to the widespread use of astrocyte cultures and the potential benefits to be gained from using a defined medium, astrocyte cultures raised in CD medium were analyzed for purity as well as morphological and biochemical properties. Purity was assessed using immunocytochemical staining for glial fibrillary acidic protein (GFAP) and fibronectin. Astrocytes raised in CD medium are 95% pure using the expression of GFAP as a criterion. Fewer than 1% of the cells in CD medium stained positive for fibronectin eliminating the possibility that CD medium is selective for meningeal or endothelial cells. Astrocytes raised in CD medium exhibit a striking degree of morphological differentiation as seen in scanning electron micrographs. They also exhibit a high degree of biochemical differentiation illustrated by increases in the specific activity of S-100 protein and the induction of glutamine synthetase by glucocorticoids. A defined medium that supports the proliferation of rat astrocytes and enhances numerous morphological and biochemical properties should greatly facilitate the study of factors controlling glial proliferation and differentiation.

  10. The Effect of Age on Osteogenic and Adipogenic Differentiation Potential of Human Adipose Derived Stromal Stem Cells (hASCs) and the Impact of Stress Factors in the Course of the Differentiation Process.

    PubMed

    Kornicka, Katarzyna; Marycz, Krzysztof; Tomaszewski, Krzysztof Andrzej; Marędziak, Monika; Śmieszek, Agnieszka

    2015-01-01

    Human adipose tissue is a great source of autologous mesenchymal stem cells (hASCs), which are recognized for their vast therapeutic applications. Their ability to self-renew and differentiate into several lineages makes them a promising tool for cell-based therapies in different types of degenerative diseases. Thus it is crucial to evaluate age-related changes in hASCs, as the elderly are a group that will benefit most from their considerable potential. In this study we investigated the effect of donor age on growth kinetics, cellular senescence marker levels, and osteogenic and adipogenic potential of hASCs. It also has been known that, during life, organisms accumulate oxidative damage that negatively affects cell metabolism. Taking this into consideration, we evaluated the levels of nitric oxide, reactive oxygen species, and superoxide dismutase activity. We observed that ROS and NO increase with aging, while SOD activity is significantly reduced. Moreover cells obtained from older patients displayed senescence associated features, for example, β-galactosidase activity, enlarged morphology, and p53 protein upregulation. All of those characteristics seem to contribute to decreased proliferation potential of those cells. Our results suggest that due to aging some cellular modification may be required before applying aged cells efficiently in therapies such as tissue engineering and regenerative medicine. PMID:26246868

  11. Butein is a novel anti-adipogenic compound[S

    PubMed Central

    Song, No-Joon; Yoon, Hyang-Jin; Kim, Ki Hyun; Jung, So-Ra; Jang, Woo-Seok; Seo, Cho-Rong; Lee, Young Min; Kweon, Dae-Hyuk; Hong, Joung-Woo; Lee, Jeong-Soo; Park, Ki-Moon; Lee, Kang Ro; Park, Kye Won

    2013-01-01

    Rhus verniciflua Stokes (RVS) has been used as a traditional herbal medicine for its various biological activities including anti-adipogenic effects. Activity-guided separation led to the identification of the anti-adipogenic functions of butein. Butein, a novel anti-adipogenic compound, robustly suppressed lipid accumulation and inhibited expression of adipogenic markers. Molecular studies showed that activated transforming growth factor-β (TGF-β) and suppressed signal transducer and activator of transcription 3 (STAT3) signaling pathways were mediated by butein. Analysis of the temporal expression profiles suggests that TGF-β signaling precedes the STAT3 in the butein-mediated anti-adipogenic cascade. Small interfering RNA-mediated silencing of STAT3 or SMAD2/3 blunted the inhibitory effects of butein on adipogenesis indicating that an interaction between two signaling pathways is required for the action of butein. Upon butein treatments, stimulation of TGF-β signaling was still preserved in STAT3 silenced cells, whereas regulation of STAT3 signaling by butein was significantly impaired in SMAD2/3 silenced cells, further showing that TGF-β acts upstream of STAT3 in the butein-mediated anti-adipogenesis. Taken together, the present study shows that butein, a novel anti-adipogenic compound from RVS, inhibits adipocyte differentiation through the TGF-β pathway followed by STAT3 and peroxisome proliferator-activated receptor γ signaling, further implicating potential roles of butein in TGF-β- and STAT3-dysregulated diseases. PMID:23468131

  12. The Antiaging Gene Klotho Regulates Proliferation and Differentiation of Adipose-Derived Stem Cells.

    PubMed

    Fan, Jun; Sun, Zhongjie

    2016-06-01

    Klotho was originally discovered as an aging-suppressor gene. The purpose of this study was to investigate whether secreted Klotho (SKL) affects the proliferation and differentiation of adipose-derived stem cells (ADSCs). RT-PCR and Western blot analysis showed that short-form Klotho was expressed in mouse ADSCs. The Klotho gene mutation KL(-/-) significantly decreased proliferation of ADSCs and expression of pluripotent transcription factors (Nanog, Sox-2, and Oct-4) in mice. The adipogenic differentiation of ADSCs was also decreased in KL(-/-) mice. Incubation with Klotho-deficient medium decreased ADSC proliferation, pluripotent transcription factor levels, and adipogenic differentiation, which is similar to what was found in KL(-/-) mice. These results indicate that Klotho deficiency suppresses ADSC proliferation and differentiation. Interestingly, treatment with recombinant SKL protein rescued the Klotho deficiency-induced impairment in ADSC proliferation and adipogenic differentiation. SKL also regulated ADSCs' differentiation to other cell lineages (osteoblasts, myofibroblasts), indicating that SKL maintains stemness of ADSCs. It is intriguing that overexpression of SKL significantly increased PPAR-γ expression and lipid formation in ADSCs following adipogenic induction, indicating enhanced adipogenic differentiation. Overexpression of SKL inhibited expression of TGFβ1 and its downstream signaling mediator Smad2/3. This study demonstrates, for the first time, that SKL is essential to the maintenance of normal proliferation and differentiation in ADSCs. Klotho regulates adipogenic differentiation in ADSCs, likely via inhibition of TGFβ1 and activation of PPAR-γ. Stem Cells 2016;34:1615-1625. PMID:26865060

  13. Agar Medium for Differential Enumeration of Lactic Streptococci1

    PubMed Central

    Reddy, M. S.; Vedamuthu, E. R.; Washam, C. J.; Reinbold, G. W.

    1972-01-01

    An agar medium containing arginine and calcium citrate as specific substrates, diffusible (K2HPO4) and undiffusible (CaCO3) buffer systems, and bromocresol purple as the pH indicator was developed to differentiate among lactic streptococci in pure and mixed cultures. Milk was added as the sole source of carbohydrate (lactose) and to provide growth-stimulating factors. Production of acid from lactose caused developing bacterial colonies to seem yellow. Subsequent arginine utilization by Streptococcus lactis and S. diacetilactis liberated ammonia, resulting in a localized pH shift back toward neutrality and a return of the original purple indicator hue. The effects of production of acid from lactose and ammonia were fixed around individual colonies by the buffering capacity of CaCO3. After 36 hr at 32 C in a candle oats jar, colonies of S. cremoris were yellow, whereas colonies of S. lactis and S. diacetilactis were white. S. diacetilactis, on further incubation, utilized suspended calcium citrate, and, after 6 days, the citrate-degrading colonies exhibited clear zoning against a turbid background, making them easily distinguishable from the colonies of the other two species. The medium proved suitable for quantitative differential enumeration when compared with another widely used general agar medium for lactic streptococci. Images PMID:16349952

  14. The differentiation potential of gingival mesenchymal stem cells induced by apical tooth germ cell-conditioned medium

    PubMed Central

    Chen, Yan; Liu, Hongwei

    2016-01-01

    Gingival-derived mesenchymal stem cells (GMSCs) have recently been harvested; however, the use of GMSCs in periodontal tissue engineering requires further study. The present study established an indirect co-culture system between rat apical tooth germ-conditioned medium (APTG-CM) and GMSCs, in order to determine the effects on periodontal tissue differentiation in vitro and in vivo. Using the limiting dilution technique, single-colony derived human GMSCs and periodontal ligament stem cells (PDLSCs) were isolated and expanded to obtain homogeneous populations. PDLSCs were used as a positive control group. Cell cycle distribution, alkaline phosphatase (ALP) activity, mineralization behavior, expression of genes associated with a cementoblast phenotype (osteocalcin, bone sialoprotein, ALP, type I collagen, cementum-derived protein 23), and in vivo differentiation capacities of GMSCs/PDLSCs co-cultured with APTG-CM were evaluated. Flow cytometry indicated that GMSCs and PDLSCs were positive for STRO-1 and CD105, whereas CD45 expression was negative. The cell types were capable of forming colonies, and of osteogenic and adipogenic differentiation in response to appropriate stimuli. The induced GMSCs and PDLSCs exhibited numerous characteristics associated with cementoblast lineages, as indicated by increased proliferation and ALP activity, and upregulated expression of cementum-associated genes in vitro. In vivo, cementum/periodontal ligament-like structures were shown to form along the dentin surface and ceramic bovine bone in GMSCs and PDLSCs induced by APTG-CM group. Conversely, vertical fibers could not insert in the control group, which was not co-cultured with APTG-CM. In conclusion, GMSCs are likely to have a role in periodontal tissue regeneration. In addition, APTG-CM was able to provide a cementogenic microenvironment and promote differentiation of GMSCs along the cementoblastic lineage. PMID:27600358

  15. Verification of suitable and reliable reference genes for quantitative real-time PCR during adipogenic differentiation in porcine intramuscular stromal-vascular cells.

    PubMed

    Li, X; Huang, K; Chen, F; Li, W; Sun, S; Shi, X-E; Yang, G

    2016-06-01

    Intramuscular fat (IMF) is an important trait influencing meat quality, and intramuscular stromal-vascular cell (MSVC) differentiation is a key factor affecting IMF deposition. Quantitative real-time PCR (qPCR) is often used to screen the differentially expressed genes during differentiation of MSVCs, where proper reference genes are essential. In this study, we assessed 31 of previously reported reference genes for their expression suitability in porcine MSVCs derived form longissimus dorsi with qPCR. The expression stability of these genes was evaluated using NormFinder, geNorm and BestKeeper algorithms. NormFinder and geNorm uncovered ACTB, ALDOA and RPS18 as the most three stable genes. BestKeeper identified RPL13A, SSU72 and DAK as the most three stable genes. GAPDH was found to be the least stable gene by all of the three software packages, indicating it is not an appropriate reference gene in qPCR assay. These results might be helpful for further studies in pigs that explore the molecular mechanism underlying IMF deposition.

  16. Modulation of Adipogenic Conditions for Prospective Use of hADSCs in Adipose Tissue Engineering

    PubMed Central

    Galateanu, Bianca; Dinescu, Sorina; Cimpean, Anisoara; Dinischiotu, Anca; Costache, Marieta

    2012-01-01

    Modern strategies in adipose tissue engineering (ATE) take advantage of the easy harvest, abundance and differentiation potential towards mesenchymal lineages of hADSCs. The controlled conversion of hADSCs to committed adipogenic precursors and further mature adipocytes formation is important for good long-term results in soft tissue regeneration. Thus, in this study, we report: (i) the isolation of the processed lipoaspirate (PLA) cells from adipose tissue and sanguine fractions; (ii) the phenotypic characterization of the PLA descendants; (iii) the design of a novel protocol for the modulation of adipogenic conditions in the perspectives of ATE applications. To modulate the differentiation rate through our protocol, we propose to selectively modify the formulation of the adipogenic media in accordance with the evolution of the process. Therefore, we aimed to ensure the long-term proliferation of the precursor cells and to delay the late adipogenic events. The status of differentiation was characterized in terms of intracellular lipid accumulation and reorganization of the cytoskeleton simultaneously with perilipin protein expression. Moreover, we studied the sequential activation of PPARγ2, FAS, aP2 and perilipin genes which influence the kinetics of the adipogenic process. The strategies developed in this work are the prerequisites for prospective 3D regenerative systems. PMID:23443100

  17. Post-natal myogenic and adipogenic developmental

    PubMed Central

    Konings, Gonda; van Weeghel, Michel; van den Hoogenhof, Maarten MG; Gijbels, Marion; van Erk, Arie; Schoonderwoerd, Kees; van den Bosch, Bianca; Dahlmans, Vivian; Calis, Chantal; Houten, Sander M; Misteli, Tom

    2011-01-01

    A-type lamins are a major component of the nuclear lamina. Mutations in the LMNA gene, which encodes the A-type lamins A and C, cause a set of phenotypically diverse diseases collectively called laminopathies. While adult LMNA null mice show various symptoms typically associated with laminopathies, the effect of loss of lamin A/C on early post-natal development is poorly understood. Here we developed a novel LMNA null mouse (LMNAGT−/−) based on genetrap technology and analyzed its early post-natal development. We detect LMNA transcripts in heart, the outflow tract, dorsal aorta, liver and somites during early embryonic development. Loss of A-type lamins results in severe growth retardation and developmental defects of the heart, including impaired myocyte hypertrophy, skeletal muscle hypotrophy, decreased amounts of subcutaneous adipose tissue and impaired ex vivo adipogenic differentiation. These defects cause death at 2 to 3 weeks post partum associated with muscle weakness and metabolic complications, but without the occurrence of dilated cardiomyopathy or an obvious progeroid phenotype. Our results indicate that defective early post-natal development critically contributes to the disease phenotypes in adult laminopathies. PMID:21818413

  18. Cardiomyocyte differentiation induced in cardiac progenitor cells by cardiac fibroblast-conditioned medium.

    PubMed

    Zhang, Xi; Shen, Man-Ru; Xu, Zhen-Dong; Hu, Zhe; Chen, Chao; Chi, Ya-Li; Kong, Zhen-Dong; Li, Zi-Fu; Li, Xiao-Tong; Guo, Shi-Lei; Xiong, Shao-Hu; Zhang, Chuan-Sen

    2014-05-01

    Our previous study showed that after being treated with 5-azacytidine, Nkx2.5(+) human cardiac progenitor cells (CPCs) derived from embryonic heart tubes could differentiate into cardiomyocytes. Although 5-azacytidine is a classical agent that induces myogenic differentiation in various types of cells, the drug is toxic and unspecific for myogenic differentiation. To investigate the possibility of inducing CPCs to differentiate into cardiomyocytes by a specific and non-toxic method, CPCs of passage 15 and mesenchymal stem cells (MSCs) were treated with cardiac ventricular fibroblast-conditioned medium (CVF-conditioned medium). Following this treatment, the Nkx2.5(+) CPCs underwent cardiomyogenic differentiation. Phase-contrast microscopy showed that the morphology of the treated CPCs gradually changed. Ultrastructural observation confirmed that the cells contained typical sarcomeres. The expression of cardiomyocyte-associated genes, such as alpha-cardiac actin, cardiac troponin T, and beta-myosin heavy chain (MHC), was increased in the CPCs that had undergone cardiomyogenic differentiation compared with untreated cells. In contrast, the MSCs did not exhibit changes in morphology or molecular expression after being treated with CVF-conditioned medium. The results indicated that Nkx2.5(+) CPCs treated with CVF-conditioned medium were capable of differentiating into a cardiac phenotype, whereas treated MSCs did not appear to undergo cardiomyogenic differentiation. Subsequently, following the addition of Dkk1 and the blocking of Wnt signaling pathway, CVF-conditioned medium-induced morphological changes and expression of cardiomyocyte-associated genes of Nkx2.5(+) CPCs were inhibited, which indicates that CVF-conditioned medium-induced cardiomyogenic differentiation of Nkx2.5(+) CPCs is associated with Wnt signaling pathway. In addition, we also found that the activation of Wnt signaling pathway was accompanied by higher expression of GATA-4 and the blocking of the

  19. Molecular Regulation of Adipogenesis and Potential Anti-Adipogenic Bioactive Molecules

    PubMed Central

    Moseti, Dorothy; Regassa, Alemu; Kim, Woo-Kyun

    2016-01-01

    Adipogenesis is the process by which precursor stem cells differentiate into lipid laden adipocytes. Adipogenesis is regulated by a complex and highly orchestrated gene expression program. In mammalian cells, the peroxisome proliferator-activated receptor γ (PPARγ), and the CCAAT/enhancer binding proteins (C/EBPs) such as C/EBPα, β and δ are considered the key early regulators of adipogenesis, while fatty acid binding protein 4 (FABP4), adiponectin, and fatty acid synthase (FAS) are responsible for the formation of mature adipocytes. Excess accumulation of lipids in the adipose tissue leads to obesity, which is associated with cardiovascular diseases, type II diabetes and other pathologies. Thus, investigating adipose tissue development and the underlying molecular mechanisms is vital to develop therapeutic agents capable of curbing the increasing incidence of obesity and related pathologies. In this review, we address the process of adipogenic differentiation, key transcription factors and proteins involved, adipogenic regulators and potential anti-adipogenic bioactive molecules. PMID:26797605

  20. Hypoxia induces adipogenic differentitation of myoblastic cell lines

    SciTech Connect

    Itoigawa, Yoshiaki; Kishimoto, Koshi N.; Okuno, Hiroshi; Sano, Hirotaka; Kaneko, Kazuo; Itoi, Eiji

    2010-09-03

    Research highlights: {yields} C2C12 and G8 myogenic cell lines treated by hypoxia differentiate into adipocytes. {yields} The expression of C/EBP{beta}, {alpha} and PPAR{gamma} were increased under hypoxia. {yields} Myogenic differentiation of C2C12 was inhibited under hypoxia. -- Abstract: Muscle atrophy usually accompanies fat accumulation in the muscle. In such atrophic conditions as back muscles of kyphotic spine and the rotator cuff muscles with torn tendons, blood flow might be diminished. It is known that hypoxia causes trans-differentiation of mesenchymal stem cells derived from bone marrow into adipocytes. However, it has not been elucidated yet if hypoxia turned myoblasts into adipocytes. We investigated adipogenesis in C2C12 and G8 murine myogenic cell line treated by hypoxia. Cells were also treated with the cocktail of insulin, dexamethasone and IBMX (MDI), which has been known to inhibit Wnt signaling and promote adipogenesis. Adipogenic differentiation was seen in both hypoxia and MDI. Adipogenic marker gene expression was assessed in C2C12. CCAAT/enhancer-binding protein (C/EBP) {beta}, {alpha} and peroxisome proliferator activating receptor (PPAR) {gamma} were increased by both hypoxia and MDI. The expression profile of Wnt10b was different between hypoxia and MDI. The mechanism for adipogenesis of myoblasts in hypoxia might be regulated by different mechanism than the modification of Wnt signaling.

  1. Adipogenic action of vanadium: a new dimension in treating diabetes.

    PubMed

    Shukla, Ruchi; Bhonde, Ramesh R

    2008-04-01

    Vanadium is a well known anti-diabetic agent which mimics most of the actions of insulin on mature adipocytes. We report here the effect of vanadium on proliferation and differentiation of 3T3-L1 preadipocytes. Like insulin, vanadium treatment leads to increased proliferation as evidenced by H(3)thymidine uptake studies and differentiation of 3T3-L1 cells into adipocytes as evidenced by oil-red-O staining. Adipogenic potential of vanadium can be attributed to CREB activation, as documented by phospho-CREB antibody staining. This adipogenic potential is of significance in an in vivo scenario as the new adipocytes are likely to be insulin sensitive as against resistant existing mature adipocytes and thus indirectly may help in reduction of insulin resistance. Till today decrease in insulin resistance by vanadium treatment has been mainly attributed to its potential to inhibit PTP-1B, however the present study opens a new dimension in vanadium treatment for diabetes due to its novel role in adipogenesis.

  2. Honokiol: A non-adipogenic PPARγ agonist from nature☆

    PubMed Central

    Atanasov, Atanas G.; Wang, Jian N.; Gu, Shi P.; Bu, Jing; Kramer, Matthias P.; Baumgartner, Lisa; Fakhrudin, Nanang; Ladurner, Angela; Malainer, Clemens; Vuorinen, Anna; Noha, Stefan M.; Schwaiger, Stefan; Rollinger, Judith M.; Schuster, Daniela; Stuppner, Hermann; Dirsch, Verena M.; Heiss, Elke H.

    2013-01-01

    Background Peroxisome proliferator-activated receptor gamma (PPARγ) agonists are clinically used to counteract hyperglycemia. However, so far experienced unwanted side effects, such as weight gain, promote the search for new PPARγ activators. Methods We used a combination of in silico, in vitro, cell-based and in vivo models to identify and validate natural products as promising leads for partial novel PPARγ agonists. Results The natural product honokiol from the traditional Chinese herbal drug Magnolia bark was in silico predicted to bind into the PPARγ ligand binding pocket as dimer. Honokiol indeed directly bound to purified PPARγ ligand-binding domain (LBD) and acted as partial agonist in a PPARγ-mediated luciferase reporter assay. Honokiol was then directly compared to the clinically used full agonist pioglitazone with regard to stimulation of glucose uptake in adipocytes as well as adipogenic differentiation in 3T3-L1 pre-adipocytes and mouse embryonic fibroblasts. While honokiol stimulated basal glucose uptake to a similar extent as pioglitazone, it did not induce adipogenesis in contrast to pioglitazone. In diabetic KKAy mice oral application of honokiol prevented hyperglycemia and suppressed weight gain. Conclusion We identified honokiol as a partial non-adipogenic PPARγ agonist in vitro which prevented hyperglycemia and weight gain in vivo. General significance This observed activity profile suggests honokiol as promising new pharmaceutical lead or dietary supplement to combat metabolic disease, and provides a molecular explanation for the use of Magnolia in traditional medicine. PMID:23811337

  3. Medium modification with bone morphogenetic protein 2 addition for odontogenic differentiation.

    PubMed

    Atalayin, Cigdem; Tezel, Huseyin; Dagci, Taner; Yavasoglu, Nefise Ulku Karabay; Oktem, Gulperi

    2016-01-01

    The aim of this study was to evaluate whether medium modification improves the odontogenic differentiation of human dental pulp stem cells (DPSC) in vitro and in vivo. DPSC isolated from human impacted third molar teeth were analysed for clusters of differentiation with flow cytometry. Odontogenic differentiation was stimulated by medium modification with the addition of bone morphogenetic protein 2 (BMP2). The expression of dentin sialophosphoprotein, dentin matrix protein 1, enamelysin/matrix metalloproteinase 20 and the phosphate-regulating gene with homologies to endopeptidases on the X chromosome of the cells were analysed with RT-PCR at 7, 14 and 21 days. Then, DPSC were transplanted on the back of immunocompromised mice via a hydroxyapatite tricalcium phosphate scaffold, and the structure of the formed tissue was investigated. The cells were identified as mesenchymal stem cells with a 98.3% CD73 and CD90 double-positive cell rate. The increase in mineralization capacity and expression of human enamel-dentin specific transcripts proportional to the culture period were determined after differentiation. Six weeks after transplantation, an osteo-dentin matrix was formed in the group in which odontogenic differentiation was stimulated, and the odontogenic characteristics of the matrix were confirmed by histological examination and RT-PCR analysis. Odontogenic differentiation of the isolated and characterized human DPSC was improved with medium modification by the addition of BMP2 in vitro and in vivo. The defined medium and applied technique have a potential use for forming reparative dentin in the future, but the effects of the method should be investigated in long-term studies. PMID:26981753

  4. The Effect of Matrix Stiffness on the Differentiation of Mesenchymal Stem Cells in Response to TGF-β

    PubMed Central

    Park, Jennifer S.; Chu, Julia S.; Tsou, Anchi D.; Diop, Rokhaya; Tang, Zhenyu; Wang, Aijun; Li, Song

    2011-01-01

    Bone marrow mesenchymal stem cells (MSCs) are a valuable cell source for tissue engineering and regenerative medicine. Transforming growth factor β (TGF-β) can promote MSC differentiation into either smooth muscle cells (SMCs) or chondrogenic cells. Here we showed that matrix stiffness modulated these differential effects. MSCs on soft substrates had less spreading, fewer stress fibers and lower proliferation rate than MSCs on stiff substrates. MSCs on stiff substrates had higher expression of SMC markers α-actin and calponin-1; in contrast, MSCs on soft substrates had a higher expression of chondrogenic marker collagen-II and adipogenic marker lipoprotein lipase (LPL). TGF-β increased SMC marker expression on stiff substrates. However, TGF-β increased chondrogenic marker and suppressed adipogenic marker on the soft substrates, while adipogenic medium and soft substrates induced adipogenic differentiation effectively. Rho GTPase was involved in the expression of all aforementioned lineage markers, but did not account for the differential effects of matrix stiffness. In addition, soft substrates did not significantly affect Rho activity, but inhibited Rho-induced stress fiber formation and α-actin assembly. Further analysis showed that MSCs on soft matrices had weaker cell adhesion, and that the suppression of cell adhesion strength mimicked the effects of soft substrates on the lineage marker expression. These results provide insights of how matrix stiffness differentially regulates stem cell differentiation, and have significant implications for the design of biomaterials with appropriate mechanical property for tissue regeneration. PMID:21397942

  5. Improved selective and differential medium for isolation of Escherichia coli O157:H7.

    PubMed

    Park, Sang-Hyun; Ryu, Sangryeol; Kang, Dong-Hyun

    2011-01-01

    GMAC, a modified version of Sorbitol MacConkey medium (SMAC), was produced with a reduced quantity of selective agents and incorporated gentiobiose. GMAC supported a higher recovery rate of heat- or acid-injured Escherichia coli O157:H7 cells than SMAC with cefixime and tellurite (CT-SMAC), while differentiating E. coli O157:H7 from sorbitol-nonfermenting Hafnia alvei. PMID:20980579

  6. Improved Selective and Differential Medium for Isolation of Escherichia coli O157:H7▿

    PubMed Central

    Park, Sang-Hyun; Ryu, Sangryeol; Kang, Dong-Hyun

    2011-01-01

    GMAC, a modified version of Sorbitol MacConkey medium (SMAC), was produced with a reduced quantity of selective agents and incorporated gentiobiose. GMAC supported a higher recovery rate of heat- or acid-injured Escherichia coli O157:H7 cells than SMAC with cefixime and tellurite (CT-SMAC), while differentiating E. coli O157:H7 from sorbitol-nonfermenting Hafnia alvei. PMID:20980579

  7. Identification of Vibrio proteolyticus with a differential medium and a specific probe.

    PubMed Central

    Muniesa-Pérez, M; Jofre, J; Blanch, A R

    1996-01-01

    A differential medium (VP8) and a specific probe, based on the variable region V3 of the 16S rRNA gene, for the detection of Vibrio proteolyticus are defined. The medium contains 8% NaCl, which allows selective growth of moderately halophilic Vibrio strains. D-Sorbitol, as the main carbon source, differentiates the species that can ferment it by the pH indicators cresol red and bromothymol blue. V. proteolyticus and 8 of 418 strains studied grew on the medium and used the D-sorbitol, forming bright yellow colonies. An oligonucleotide, based on the variable region V3 of the 16S rRNA gene (5'CGCTAACGTCAAATAATGCATCTA3'), was used as the specific probe (V3VPR). Only three strains of Vibrio sp. and one strain identified as V. natriegens cross-hybridized with the probe. However, unlike V. proteolyticus, none of the strains grew on VP8. The combined use of VP8 medium and the probe allowed an unequivocal identification of V. proteolyticus. PMID:8779607

  8. Supplementation of strontium to a chondrogenic medium promotes chondrogenic differentiation of human dedifferentiated fat cells.

    PubMed

    Okita, Naoya; Honda, Yoshitomo; Kishimoto, Naotaka; Liao, Wen; Azumi, Eiko; Hashimoto, Yoshiya; Matsumoto, Naoyuki

    2015-05-01

    Dedifferentiated fat cells (DFAT cells) isolated from adipose tissue have been demonstrated to differentiate into chondrogenic cells in vitro. Nevertheless, an efficient method to facilitate its chondrogenic differentiation is still unexplored, hampering the extensive application of these cells in cartilage regeneration therapies. Here we provide the evidence that supplementation of strontium ions (Sr) in a chondrogenic medium (CM) significantly promotes early chondrogenic differentiation of DFAT cells. Human DFAT cells and the mesenchymal stem cell line (RCB2153) were subjected to the CM supplemented with/without Sr. After 14 days, alcian blue staining intensity significantly increased in DFAT cells, but not in RCB2153, subjected to CM with Sr. mRNA expression analysis revealed that the CM with 1.5 mM Sr increased the expression of chondrogenic marker, collagen type 2 alpha 1, whereas there was no significant change in osteogenic markers, collagen type 1 alpha 1, runt-related transcription factor 2, and osteocalcin, and hypertrophic chondrogenic marker, collagen type 10 alpha 1. Inhibitors for extracellular signal-regulated kinase 1/2 (ERK1/2), Akt, and calcium-sensing receptor (CaSR) pathways significantly diminished the alcian blue staining intensity, providing the first evidence that these signal pathways are associated with chondrogenic differentiation of DFAT cells. CaSR and ERK1/2 pathways independently induced Sr-mediated early chondrogenic differentiation. These results suggest that Sr supplementation into the CM may provide a powerful platform for preparing chondrogenically differentiated DFAT cells for cartilage regeneration.

  9. Osteogenic and adipogenic potential of porcine adipose mesenchymal stem cells.

    PubMed

    Qu, Chang-qing; Zhang, Guo-hua; Zhang, Li-jie; Yang, Gong-she

    2007-02-01

    Human, rat, and mouse studies have demonstrated the existence of a population of adipose mesenchymal stem cells (AMSCs) that can undergo multilineage differentiation in vitro. Understanding the clinical potential of AMSCs may require their use in preclinical large-animal models such as pigs. Thus, the objectives of this study were to establish a protocol for the isolation of porcine AMSCs from adipose tissue and to examine their ex vivo differentiation potential to adipocytes and osteoblast. The porcine AMSCs from passage 4 were selected for differentiation analysis. The adipocytes were identified morphologically by staining with Oil Red O, and the adipogenic marker genes were examined by RT-PCR technique. Osteogenic lineage was documented by deposition of calcium stained with Alzarin Red S, visualization of alkaline phosphatase activity, and expression of marker gene. Our result indicates that porcine AMSCs have been successfully isolated and induced differentiation into adipocytes and osteoblasts. This study suggested that porcine AMSCs are also a valuable model system for the study on the mesenchymal lineages for basic research and tissue engineering. PMID:17570023

  10. Osteogenic and adipogenic potential of porcine adipose mesenchymal stem cells.

    PubMed

    Qu, Chang-qing; Zhang, Guo-hua; Zhang, Li-jie; Yang, Gong-she

    2007-02-01

    Human, rat, and mouse studies have demonstrated the existence of a population of adipose mesenchymal stem cells (AMSCs) that can undergo multilineage differentiation in vitro. Understanding the clinical potential of AMSCs may require their use in preclinical large-animal models such as pigs. Thus, the objectives of this study were to establish a protocol for the isolation of porcine AMSCs from adipose tissue and to examine their ex vivo differentiation potential to adipocytes and osteoblast. The porcine AMSCs from passage 4 were selected for differentiation analysis. The adipocytes were identified morphologically by staining with Oil Red O, and the adipogenic marker genes were examined by RT-PCR technique. Osteogenic lineage was documented by deposition of calcium stained with Alzarin Red S, visualization of alkaline phosphatase activity, and expression of marker gene. Our result indicates that porcine AMSCs have been successfully isolated and induced differentiation into adipocytes and osteoblasts. This study suggested that porcine AMSCs are also a valuable model system for the study on the mesenchymal lineages for basic research and tissue engineering.

  11. Genistein mediates the anti-adipogenic actions of Sophora japonica L. extracts.

    PubMed

    Jung, So-Ra; Kim, Young-Jun; Gwon, A-Ryeong; Lee, Jina; Jo, Dong-Gyu; Jeon, Tae-Joon; Hong, Joung-Woo; Park, Ki-Moon; Park, Kye Won

    2011-04-01

    Previous studies showed that feeding diets containing the mature fruits of Sophora japonica L. prevented body weight gain and reduced fat mass in high-fat diet-induced obese mice. This observation has led to the hypothesis that extracts from S. japonica L. may inhibit adipocyte differentiation of preadipocytes. To elucidate the possible mechanisms for the anti-obesity action of S. japonica L., its effects on adipocyte differentiation were investigated in C3H10T1/2 mesenchymal stem cells and 3T3-L1 preadipocyte cells. The mature fruit of S. japonica L. was partitioned with ethanol, hexane, dichloromethane, ethyl acetate (EtOAc), and butanol to identify the active fractions. The EtOAc fraction extracts inhibited morphological differentiation and lipid accumulation in the C3H10T1/2 and 3T3-L1 preadipocytes. Molecular studies indicated that the EtOAc fraction extracts also reduced the expression of peroxisome proliferator-activated receptor γ and other adipocyte markers. Furthermore, among the fractions, the EtOAc fraction extracts had the highest total phenolic contents, suggesting that the polyphenols in the EtOAc fractions mediated the anti-adipogenic effects. Finally, high-performance liquid chromatography identified genistein, a known anti-adipogenic compound, as the probable mediator of the anti-adipogenic effects of the EtOAc fractions. This work validates the beneficial roles of S. japonica L. in controlling body weight and obesity-related metabolic diseases. PMID:21303259

  12. Selection and reliability of internal reference genes for quantitative PCR verification of transcriptomics during the differentiation process of porcine adult mesenchymal stem cells

    PubMed Central

    2010-01-01

    Introduction The objective of this study was to find highly reliable internal-control genes (ICGs) for normalization of qPCR data from porcine adult mesenchymal stem cells induced to differentiate toward adipogenic and osteogenic lineages. Methods Stem cells were acquired from subcutaneous back fat and bone marrow of three castrated Yorkshire crossbred male pigs. Adipose and bone marrow-derived stem cells (ADSCs and BMSCs) were cultured in vitro with specific osteogenic or adipogenic differentiation medium for 4 weeks. Total RNA was extract for microarray (13,000 oligonucleotides) and qPCR analyses. Microarray data were used to uncover the most stably expressed genes (that is, potential ICGs). Co-regulation among potential ICGs was evaluated with Ingenuity Pathway Analysis. qPCR was performed on the non-coregulated ICGs candidates and on specific osteogenic (COL1A1) and adipogenic (DBI) genes. geNorm was used to uncover the most reliable ICGs by using qPCR data and the optimal number of ICGs to be used to calculate the normalization factor. Results Microarray data analysis revealed 27 potential ICGs. Among those, 10 genes without known co-regulation were selected to perform qPCR. geNorm performed on qPCR data uncovered high stability in expression ratio among the selected ICGs. However, especially reliable normalization was obtained by geometric mean of NSUN5, TIMM17B, and VPS4A. The effect of normalization, assessed on specific osteogenic (COL1A1) and adipogenic (DBI) genes, was apparent for the adipogenic and less apparent for the osteogenic differentiation. Conclusions The combination of microarray data and pairwise gene analysis allowed identification of novel and highly reliable ICGs for qPCR data normalization of adult porcine stem cells induced to differentiate to adipogenic and osteogenic lineages. PMID:20504288

  13. Regulation of Adipogenesis and Key Adipogenic Gene Expression by 1, 25-Dihydroxyvitamin D in 3T3-L1 Cells

    PubMed Central

    Ji, Shuhan; Doumit, Matthew E.; Hill, Rodney A.

    2015-01-01

    The functions of 1, 25-dihydroxyvitamin D (1, 25-(OH)2D3) in regulating adipogenesis, adipocyte differentiation and key adipogenic gene expression were studied in 3T3-L1 preadipocytes. Five concentrations (0.01, 0.1, 1, 10, 100nM) of 1, 25-(OH)2D3 were studied and lipid accumulation measured by Oil Red O staining and expression of adipogenic genes quantified using quantitative real-time PCR. Adipogenic responses to 1, 25-(OH)2D3 were determined on 6, and 12 h, and days 1-10 after induction of adipogenesis by a hormonal cocktail with or without 1, 25-(OH)2D3. In response to 1, 25-(OH)2D3 (1, 10, and 100 nM), lipid accumulation and the expression of PPARγ, C/EBPα, FABP4 and SCD-1 were inhibited through day 10, and vitamin D receptor expression was inhibited in the early time points. The greatest inhibitory effect was upon expression of FABP4. Expression of SREBP-1c was only affected on day 2. The lowest concentrations of 1, 25-(OH)2D3 tested did not affect adipocyte differentiation or adipogenic gene expression. The C/EBPα promoter activity response to 1, 25-(OH)2D3 was also tested, with no effect detected. These results indicate that 1, 25-(OH)2D3 inhibited adipogenesis via suppressing adipogenic-specific genes, and is invoked either during PPARγ activation or immediately up-stream thereof. Gene expression down-stream of PPARγ especially FABP4 was strongly inhibited, and we suggest that the role of 1, 25-(OH)2D3 in regulating adipogenesis will be informed by further studies of adipogenic-specific gene promoter activity. PMID:26030589

  14. Optical scatter patterns facilitate rapid differentiation of Enterobacteriaceae on CHROMagar™ Orientation medium.

    PubMed

    Singh, Atul K; Bhunia, Arun K

    2016-01-01

    Enterobacteriaceae family comprised pathogens and commensals and has a significant impact on food safety and public health. Enterobacteriaceae is often enumerated and presumptively identified on chromogenic media, such as CHROMagar(TM) Orientation medium based on colony profile; however, classification is highly arbitrary, and some could not be differentiated due to similar chromogen production. Here, we investigated the ability of the laser optical sensor, BARDOT (bacterial rapid detection using optical scattering technology) for rapid screening and differentiation of colonies of the major bacterial genera from Enterobacteriaceae on CHROMagar(TM) Orientation. A total of 36 strains representing 12 genera and 15 species were used to generate colony scatter image library that comprised 1683 scatter images. This library was used to differentiate mixed cultures of Enterobacteriaceae family - Klebsiella pneumoniae, Enterobacter spp., Citrobacter freundii and Serratia marcescens (KECS group); Proteus mirabilis, Morganella morganii and Providencia rettgeri (PMP group); and non-Enterobacteriaceae family: Pseudomonas aeruginosa, Acinetobacter spp. and Staphylococcus aureus (PAS group) - and data show high accuracy (83-100%) for intra-group classification of colonies in 10-22 h or even before visible production of chromogens. BARDOT successfully differentiated the major genera, including the ones that do not produce visually distinguishable chromogens on CHROMagar(TM) Orientation, providing a label-free, real-time on-plate colony screening tool for Enterobacteriaceae. PMID:26503189

  15. Description of Leeds Acinetobacter Medium, a new selective and differential medium for isolation of clinically important Acinetobacter spp., and comparison with Herellea agar and Holton's agar.

    PubMed Central

    Jawad, A; Hawkey, P M; Heritage, J; Snelling, A M

    1994-01-01

    Acinetobacter spp. are responsible for an increasing number of opportunistic, nosocomial infections. They have been isolated from diverse inanimate objects in the hospital environment and are resistant to most of the commonly used antibiotics. Existing media for the isolation of Acinetobacter spp. are either nonselective, allowing the growth of unwanted bacteria, or too inhibitory, inhibiting the growth of many Acinetobacter strains. For the rapid isolation and effective control of Acinetobacter infection, a new selective and differential medium, Leeds Acinetobacter Medium (LAM), has been developed to isolate Acinetobacter spp. from clinical and environmental sources. The concentration of antibiotics and other ingredients in this medium have been determined according to the results of MIC and viable counts performed for these ingredients. LAM was compared with other selective and differential media for the isolation of Acinetobacter spp. from a local hospital environment and proved to be better in terms of recovery and selectivity. PMID:7814465

  16. Antiadipogenic effects of subthermal electric stimulation at 448 kHz on differentiating human mesenchymal stem cells

    PubMed Central

    HERNÁNDEZ-BULE, MARÍA LUISA; MARTÍNEZ-BOTAS, JAVIER; TRILLO, MARÍA ÁNGELES; PAÍNO, CARLOS L; ÚBEDA, ALEJANDRO

    2016-01-01

    The 448 kHz capacitive-resistive electric transfer (CRET) is an electrothermal therapy currently applied in anticellulite and antiobesity treatments. The aim of the present study was to determine whether exposure to the CRET electric signal at subthermal doses affected early adipogenic processes in adipose-derived stem cells (ADSC) from human donors. ADSC were incubated for 2 or 9 days in the presence of adipogenic medium, and exposed or sham-exposed to 5 min pulses of 448 kHz electric signal at 50 µA/mm2 during the last 48 h of the incubation. Colorimetric, immunofluorescence, western blotting and reverse transcription-quantitative polymerase chain reaction assays were performed to assess adipogenic differentiation of the ADSC. Electric stimulation significantly decreased cytoplasmic lipid content, after both 2 and 9 days of differentiation. The antiadipogenic response in the 9 day samples was accompanied by activation of mitogen-activated protein kinase kinase 1/2, decreased expression and partial inactivation of peroxisome proliferator-activated receptor (PPAR) γ, which was translocated from the nucleus to the cytoplasm, together with a significant decrease in the expression levels of the PPARG1 gene, perilipin, angiopoietin-like protein 4 and fatty acid synthase. These results demonstrated that subthermal stimulation with CRET interferes with the early adipogenic differentiation in ADSC, indicating that the electric stimulus itself can modulate processes controlling the synthesis and mobilization of fat, even in the absence of the concomitant thermal and mechanical components of the thermoelectric therapy CRET. PMID:27035334

  17. CHROMagar Candida, a new differential isolation medium for presumptive identification of clinically important Candida species.

    PubMed Central

    Odds, F C; Bernaerts, R

    1994-01-01

    CHROMagar Candida is a novel, differential culture medium that is claimed to facilitate the isolation and presumptive identification of some clinically important yeast species. We evaluated the use of this medium with 726 yeast isolates, including 82 isolated directly on the medium from clinical material. After 2 days of incubation at 37 degrees C, 285 C. albicans isolates gave distinctive green colonies that were not seen with any of 441 other yeast isolates representing 21 different species. A total of 54 C. tropicalis isolates also developed distinctive dark blue-gray colonies with a halo of dark brownish purple in the surrounding agar. C. krusei isolates (n = 43) also formed highly characteristic rough, spreading colonies with pale pink centers and a white edge that was otherwise encountered only rarely with isolates of C. norvegensis. Trichosporon spp. (n = 34) formed small, pale colonies that became larger and characteristically rough with prolonged incubation. Most of the other 310 yeasts studied formed colonies with a color that ranged from white to pink to purple with a brownish tint. The only exceptions were found among isolates identified as Geotrichum sp. or Pichia sp., some of which formed colonies with a gray to blue color and which in two instances formed a green pigment or a dark halo in the agar. The specificity and sensitivity of the new medium for the presumptive identification of C. albicans, C. krusei, and C. tropicalis exceeded 99% for all three species. A blinded reading test involving four personnel and 57 yeast isolates representing nine clinically important species confirmed that colonial appearance after 48 h of incubation on CHROMagar Candida afforded the correct presumptive recognition of C. albicans, C. tropicalis, C, krusei, and Trichosporon spp. None of nine bacterial isolates grew on CHROMagar Candida within 72 h, and bacteria (Escherichia coli) grew from only 4 of 104 vaginal, 100 oral, and 99 anorectal swabs. The new medium

  18. Identification of Mouse Mesenteric and Subcutaneous in vitro Adipogenic Cells

    PubMed Central

    Miyata, Yugo; Otsuki, Michio; Kita, Shunbun; Shimomura, Iichiro

    2016-01-01

    Fat accumulation and the dysfunction of visceral white adipose tissue (WAT), but not subcutaneous WAT, cause abnormalities in whole body metabolic homeostasis. However, no current drugs specifically target visceral WAT. The primary reason for this is that a practical in vitro culture system for mesenteric adipocytes has not been established. To resolve this issue, we sought to identify in vitro adipogenic cells in mesenteric and subcutaneous WATs. First, we examined the expression pattern of surface antigens in stromal-vascular fraction (SVF) cells from mouse mesenteric and subcutaneous WATs, and found the expression of 30 stem cell-related surface antigens. Then, to evaluate the adipogenic ability of each fraction, we performed in vitro screening, and identified five candidate markers for mesenteric adipogenic cells and one candidate marker for subcutaneous adipogenic cells. To investigate whether in vitro adipogenic ability accurately reflects the conditions in vivo, we performed transplantation experiments, and identified CD9− CD201+ Sca-1− cells and CD90+ cells as mesenteric and subcutaneous in vitro adipogenic cells, respectively. Furthermore, mature adipocytes derived from mesenteric and subcutaneous adipogenic cells maintained each characteristic phenotype in vitro. Thus, our study should contribute to the development of a useful culture system for visceral adipocytes. PMID:26884347

  19. ARN: analysis and prediction by adipogenic professional database.

    PubMed

    Huang, Yan; Wang, Li; Zan, And Lin-Sen

    2016-01-01

    Adipogenesis is the process of cell differentiation by which mesenchymal stem cells become adipocytes. Extensive research is ongoing to identify genes, their protein products, and microRNAs that correlate with fat cell development. The existing databases have focused on certain types of regulatory factors and interactions. However, there is no relationship between the results of the experimental studies on adipogenesis and these databases because of the lack of an information center. This information fragmentation hampers the identification of key regulatory genes and pathways. Thus, it is necessary to provide an information center that is quickly and easily accessible to researchers in this field. We selected and integrated data from eight external databases based on the results of text-mining, and constructed a publicly available database and web interface (URL: http://210.27.80.93/arn/ ), which contained 30873 records related to adipogenic differentiation. Then, we designed an online analysis tool to analyze the experimental data or form a scientific hypothesis about adipogenesis through Swanson's literature-based discovery process. Furthermore, we calculated the "Impact Factor" ("IF") value that reflects the importance of each node by counting the numbers of relation records, expression records, and prediction records for each node. This platform can support ongoing adipogenesis research and contribute to the discovery of key regulatory genes and pathways. PMID:27503118

  20. ARN: analysis and prediction by adipogenic professional database.

    PubMed

    Huang, Yan; Wang, Li; Zan, And Lin-Sen

    2016-08-08

    Adipogenesis is the process of cell differentiation by which mesenchymal stem cells become adipocytes. Extensive research is ongoing to identify genes, their protein products, and microRNAs that correlate with fat cell development. The existing databases have focused on certain types of regulatory factors and interactions. However, there is no relationship between the results of the experimental studies on adipogenesis and these databases because of the lack of an information center. This information fragmentation hampers the identification of key regulatory genes and pathways. Thus, it is necessary to provide an information center that is quickly and easily accessible to researchers in this field. We selected and integrated data from eight external databases based on the results of text-mining, and constructed a publicly available database and web interface (URL: http://210.27.80.93/arn/ ), which contained 30873 records related to adipogenic differentiation. Then, we designed an online analysis tool to analyze the experimental data or form a scientific hypothesis about adipogenesis through Swanson's literature-based discovery process. Furthermore, we calculated the "Impact Factor" ("IF") value that reflects the importance of each node by counting the numbers of relation records, expression records, and prediction records for each node. This platform can support ongoing adipogenesis research and contribute to the discovery of key regulatory genes and pathways.

  1. Protein inhibitor of activated STAT3 inhibits adipogenic gene expression

    SciTech Connect

    Deng Jianbei; Hua Kunjie; Caveney, Erica J.; Takahashi, Nobuyuki; Harp, Joyce B. . E-mail: jharp@unc.edu

    2006-01-20

    Protein inhibitor of activated STAT3 (PIAS3), a cytokine-induced repressor of signal transducer and activator of transcription 3 (STAT3) and a modulator of a broad array of nuclear proteins, is expressed in white adipose tissue, but its role in adipogenesis is not known. Here, we determined that PIAS3 was constitutively expressed in 3T3-L1 cells at all stages of adipogenesis. However, it translocated from the nucleus to the cytoplasm 4 days after induction of differentiation by isobutylmethylxanthine, dexamethasone, and insulin (MDI). In ob/ob mice, PIAS3 expression was increased in white adipose tissue depots compared to lean mice and was found in the cytoplasm of adipocytes. Overexpression of PIAS3 in differentiating preadipocytes, which localized primarily to the nucleus, inhibited mRNA level gene expression of adipogenic transcription factors C/EBP{alpha} and PPAR{gamma}, as well as their downstream target genes aP2 and adiponectin. PIAS3 also inhibited C/EBP{alpha} promoter activation mediated specifically by insulin, but not dexamethasone or isobutylmethylxanthine. Taken together, these data suggest that PIAS3 may play an inhibitory role in adipogenesis by modulating insulin-activated transcriptional activation events. Increased PIAS3 expression in adipose tissue may play a role in the metabolic disturbances of obesity.

  2. Serum-free medium enhances growth and differentiation of cultured pig granulosa cells.

    PubMed

    Baraño, J L; Hammond, J M

    1985-01-01

    We have developed new serum-free culture techniques for swine granulosa cells from immature (1-3 mm) follicles. These methods have allowed more detailed examination of factors regulating both replication and cytodifferentiation of these cells. For optimal replication, collagen-coated culture dishes and a highly supplemented nutrient medium (a 1:1 mixture of Dulbecco's modified Eagle's medium and Ham's F-10), containing 5 micrograms/ml transferrin, 300 mU/ml insulin, 40 ng/ml hydrocortisone, 4 mg/ml BSA, and 2.5% (vol/vol) of a platelet extract (PE) was found to be essential. Cultures maintained in this serum-free complete medium (SFCM) grew to confluence and contained as many or more cells than replicate cultures maintained in 10% fetal calf serum (10% FCS) (e.g. SFCM: 1.89 +/- 0.17; 10% FCS: 1.12 +/- 0.02 cells per well X 10(-5) on day 6). In the absence of albumin, PE, or without collagen coating, the cell numbers were, respectively 4.5%, 9.8%, and 5.0% of that observed with complete SFCM. The mitogenic effect of the PE was due to heat-labile as well as heat-stable components and could not be replaced by platelet-derived growth factor. To evaluate cytodifferentiation, cells grown in SFCM were compared with those grown in 10% FCS with regard to progesterone secretion and FSH responsiveness. Basal progesterone levels were higher in SFCM at all stages in culture. FSH stimulated progesterone secretion in both 10% FCS and SFCM. However, FSH responsiveness was diminished after 4 days with 10% FCS, whereas cells in SFCM remained responsive for 10 days. Thus, this system seems to be highly suitable for the study of the regulation of growth and differentiation of granulosa cells.

  3. Differentiation of hamstring short latency versus medium latency responses after tibia translation.

    PubMed

    Friemert, B; Bumann-Melnyk, M; Faist, M; Schwarz, W; Gerngross, H; Claes, L

    2005-01-01

    After injuries to the anterior cruciate ligament (ACL) a functional instability is frequently observed which has been attributed to a disturbed sensorimotor function. In light of the clinical importance of ACL injuries and the resulting functional instability, it is of enormous clinical interest to elucidate the role of sensorimotor pathways that involve the ACL. In animals and humans a direct reflex pathway between the ACL and the hamstrings has been shown. The onset latencies of responses reported after ventral tibia translation were around 40-50 ms (range 17.9-65) and were regarded as medium latency responses (MLR). However, ventral tibia translation should also induce a stretch of the hamstring muscles and evoke a short latency response (SLR). Before any muscle response after ventral tibia translation can be ascribed to anatomical structures, it is crucial to analyze the obtained muscle responses carefully. The aim of the present study was the development of an algorithm to differentiate SLR and MLR responses after ventral tibia translation. In ten healthy subjects reflex responses of the hamstrings after anterior tibia translation and after tendon taps on the biceps femoris tendon were evaluated. To investigate the influence of skin afferents, control experiments were performed after lidocain injection of the dorsal calf. The mean onset latency of the tendon jerk reflex was 21.9 +/- 3.1 ms (range 17.3 - 28.7 ms). Both SLR responses (mean onset latency: 20.3 +/- 3.5 ms; range 15.4 - 25.8) and MLR responses (mean onset latency: 38.9 +/- 4.2 ms; range 32.9 - 46.7) were obtained in all subjects. Skin afferents from the calf do not play a major role. The development of an evaluation algorithm is presented that allows a safe differentiation between these partly superimposed SLR and MLR components. It is demonstrated that by measuring the first part of the SLR from the onset to the first peak the end of the SLR can be predicted and that the onset latency of the MLR

  4. The Polymyxin Ceftazidime Oxford Medium as an alternative selective and differential medium for isolation of Listeria monocytogenes from raw or unpasteurized food.

    PubMed

    Martínez-Gonzáles, N E; Martínez-Chávez, L; Martínez-Cárdenas, C; Cabrera-Díaz, E; Castillo, A

    2014-04-01

    The Polymyxin Ceftazidime Oxford Medium (PCOM) was developed to recover Listeria monocytogenes from raw or unpasteurized foods. It contains esculin-ferric ammonium citrate as indicator system for Listeria growth, and ceftazidime and polymyxin B as selective agents, which are available in several Latin American countries. Comparison of PCOM, Modified Oxford Medium (MOX) and Tryptic Soy agar with 0.6% yeast extract (TSAYE) indicated that both selective media were equally effective at recovering four individual strains of L. monocytogenes (Scott A, V7, California and broccoli), and a mixture of these strains (LMM) (P > 0.05). The ability of PCOM, MOX, TSAYE and TSAYE supplemented with 4% NaCl to recover heat, acid and freeze-damaged LMM was similar for all media (P > 0.05). The PCOM proved to be effective at isolating colonies of LMM from inoculated raw beef chunks, unpasteurized orange juice, cabbage, and Mexican-style cheese by direct plating and by the US Department of Agriculture's Food Safety and Inspection Service enrichment method. Differentiation of L. monocytogenes colonies was easier on PCOM than on MOX for foods with high levels of background microbiota. Based on the evaluations performed on foods naturally contaminated with L. monocytogenes, PCOM was a more economical alternative than MOX for selective and differential isolation of Listeria from raw or unpasteurized foods.

  5. Use of an axenic medium for differentiation between pathogenic and nonpathogenic Naegleria fowleri isolates.

    PubMed

    De Jonckheere, J

    1977-04-01

    Growth in an axenic medium composed by Chang (3rd Int. Congr. Parasitol. Munich Abstr. ICPIII 1:187-188, 1974) allowed separation of pathogenic from nonpathogenic Naegleria fowleri strains, since only the former show luxuriant growth in this medium. On the basis of these results, this medium was used in early screening for virulent Naegleria isolates. During an extensive ecological study, data were obtained on 102 Naegleria strains. Twenty of these strains grew luxuriantly in this liquid medium. Seventeen of them were tested by intranasal instillation in mice, and all proved to be highly pathogenic. Strains showing only moderate growth or no growth at all in this axenic medium were found to be nonpathogenic for mice. Moreover, it was found that using this medium in the early stage of Naegleria sampling favors isolation of pathogenic strains in mixtures of Naegleria. During these experiments, further evidence was obtained that thermal polluted waters are the main origin of N. fowleri in the environment.

  6. Platelet-rich concentrate in serum free medium enhances osteogenic differentiation of bone marrow-derived human mesenchymal stromal cells.

    PubMed

    Samuel, Shani; Ahmad, Raja Elina; Ramasamy, Thamil Selvee; Karunanithi, Puvanan; Naveen, Sangeetha Vasudevaraj; Murali, Malliga Raman; Abbas, Azlina A; Kamarul, Tunku

    2016-01-01

    Previous studies have shown that platelet concentrates used in conjunction with appropriate growth media enhance osteogenic differentiation of human mesenchymal stromal cells (hMSCs). However, their potential in inducing osteogenesis of hMSCs when cultured in serum free medium has not been explored. Furthermore, the resulting osteogenic molecular signatures of the hMSCs have not been compared to standard osteogenic medium. We studied the effect of infrequent supplementation (8-day interval) of 15% non-activated platelet-rich concentrate (PRC) in serum free medium on hMSCs proliferation and differentiation throughout a course of 24 days, and compared the effect with those cultured in a standard osteogenic medium (OM). Cell proliferation was analyzed by alamar blue assay. Gene expression of osteogenic markers (Runx2, Collagen1, Alkaline Phosphatase, Bone morphogenetic protein 2, Osteopontin, Osteocalcin, Osteonectin) were analyzed using Q-PCR. Immunocytochemical staining for osteocalcin, osteopontin and transcription factor Runx2 were done at 8, 16 and 24 days. Biochemical assays for the expression of ALP and osteocalcin were also performed at these time-points. Osteogenic differentiation was further confirmed qualitatively by Alizarin Red S staining that was quantified using cetylpyridinium chloride. Results showed that PRC supplemented in serum free medium enhanced hMSC proliferation, which peaked at day 16. The temporal pattern of gene expression of hMSCs under the influence of PRC was comparable to that of the osteogenic media, but at a greater extent at specific time points. Immunocytochemical staining revealed stronger staining for Runx2 in the PRC-treated group compared to OM, while the staining for Osteocalcin and Osteopontin were comparable in both groups. ALP activity and Osteocalcin/DNA level were higher in the PRC group. Cells in the PRC group had similar level of bone mineralization as those cultured in OM, as reflected by the intensity of Alizarin red

  7. Platelet-rich concentrate in serum free medium enhances osteogenic differentiation of bone marrow-derived human mesenchymal stromal cells

    PubMed Central

    Ramasamy, Thamil Selvee; Karunanithi, Puvanan; Naveen, Sangeetha Vasudevaraj; Murali, Malliga Raman; Abbas, Azlina A.; Kamarul, Tunku

    2016-01-01

    Previous studies have shown that platelet concentrates used in conjunction with appropriate growth media enhance osteogenic differentiation of human mesenchymal stromal cells (hMSCs). However, their potential in inducing osteogenesis of hMSCs when cultured in serum free medium has not been explored. Furthermore, the resulting osteogenic molecular signatures of the hMSCs have not been compared to standard osteogenic medium. We studied the effect of infrequent supplementation (8-day interval) of 15% non-activated platelet-rich concentrate (PRC) in serum free medium on hMSCs proliferation and differentiation throughout a course of 24 days, and compared the effect with those cultured in a standard osteogenic medium (OM). Cell proliferation was analyzed by alamar blue assay. Gene expression of osteogenic markers (Runx2, Collagen1, Alkaline Phosphatase, Bone morphogenetic protein 2, Osteopontin, Osteocalcin, Osteonectin) were analyzed using Q-PCR. Immunocytochemical staining for osteocalcin, osteopontin and transcription factor Runx2 were done at 8, 16 and 24 days. Biochemical assays for the expression of ALP and osteocalcin were also performed at these time-points. Osteogenic differentiation was further confirmed qualitatively by Alizarin Red S staining that was quantified using cetylpyridinium chloride. Results showed that PRC supplemented in serum free medium enhanced hMSC proliferation, which peaked at day 16. The temporal pattern of gene expression of hMSCs under the influence of PRC was comparable to that of the osteogenic media, but at a greater extent at specific time points. Immunocytochemical staining revealed stronger staining for Runx2 in the PRC-treated group compared to OM, while the staining for Osteocalcin and Osteopontin were comparable in both groups. ALP activity and Osteocalcin/DNA level were higher in the PRC group. Cells in the PRC group had similar level of bone mineralization as those cultured in OM, as reflected by the intensity of Alizarin red

  8. Platelet-rich concentrate in serum free medium enhances osteogenic differentiation of bone marrow-derived human mesenchymal stromal cells

    PubMed Central

    Ramasamy, Thamil Selvee; Karunanithi, Puvanan; Naveen, Sangeetha Vasudevaraj; Murali, Malliga Raman; Abbas, Azlina A.; Kamarul, Tunku

    2016-01-01

    Previous studies have shown that platelet concentrates used in conjunction with appropriate growth media enhance osteogenic differentiation of human mesenchymal stromal cells (hMSCs). However, their potential in inducing osteogenesis of hMSCs when cultured in serum free medium has not been explored. Furthermore, the resulting osteogenic molecular signatures of the hMSCs have not been compared to standard osteogenic medium. We studied the effect of infrequent supplementation (8-day interval) of 15% non-activated platelet-rich concentrate (PRC) in serum free medium on hMSCs proliferation and differentiation throughout a course of 24 days, and compared the effect with those cultured in a standard osteogenic medium (OM). Cell proliferation was analyzed by alamar blue assay. Gene expression of osteogenic markers (Runx2, Collagen1, Alkaline Phosphatase, Bone morphogenetic protein 2, Osteopontin, Osteocalcin, Osteonectin) were analyzed using Q-PCR. Immunocytochemical staining for osteocalcin, osteopontin and transcription factor Runx2 were done at 8, 16 and 24 days. Biochemical assays for the expression of ALP and osteocalcin were also performed at these time-points. Osteogenic differentiation was further confirmed qualitatively by Alizarin Red S staining that was quantified using cetylpyridinium chloride. Results showed that PRC supplemented in serum free medium enhanced hMSC proliferation, which peaked at day 16. The temporal pattern of gene expression of hMSCs under the influence of PRC was comparable to that of the osteogenic media, but at a greater extent at specific time points. Immunocytochemical staining revealed stronger staining for Runx2 in the PRC-treated group compared to OM, while the staining for Osteocalcin and Osteopontin were comparable in both groups. ALP activity and Osteocalcin/DNA level were higher in the PRC group. Cells in the PRC group had similar level of bone mineralization as those cultured in OM, as reflected by the intensity of Alizarin red

  9. Osteoporosis-associated alteration in the signalling status of BMP-2 in human MSCs under adipogenic conditions.

    PubMed

    Donoso, Oscar; Pino, Ana María; Seitz, Germán; Osses, Nelson; Rodríguez, J Pablo

    2015-07-01

    Postmenopausal osteoporosis is characterized by decreased bone quality and mineral density. Mesenchymal stem cells (MSCs) found in the bone marrow, are pluripotent cells able to differentiate into several phenotypes, including osteoblasts and adipocytes. In osteoporosis, MSCs' commitment and differentiation into osteoblast/adipocyte is unbalanced, favoring adipocyte formation. The osteo and adipogenic processes are modulated by the bone morphogenetic protein-2 (BMP-2). This cytokine regulates the expression of transcription factors PPARγ and Runx 2, but its action on cells under adipogenic conditions is poorly understood. In this work we studied BMP-2 signaling in MSCs obtained from bone marrow of control or osteoporotic volunteer postmenopausal women. MSCs were cultured under basal, adipogenic (AD) or AD plus BMP-2 conditions. The protein content of PPARγ, p-PPARγ, Runx2, bone morphogenetic receptor IA (BMPR IA), phosphorylated Smad-1/5/8 (p-Smad) and Smad 4 were determined by specific western blots. mRNA level for BMPRs was determined by PCR and cell localization of p-Smad-1/5/8 were detected by immunocytochemistry. Control MSCs showed a differential response to both AD and AD plus BMP-2 treatments: BMP-2 exerted an anti-adipogenic effect increasing both transcription factors analyzed. Moreover, p-Smads-1/5/8 were detected in nuclei after short term BMP-2 treatment. Osteoporotic MSCs showed no response to exogenous added BMP-2, as shown by p-PPARγ/PPARγ ratio and Runx2 levels, although BMPR-IA level was significantly higher in osteoporotic than in control MSCs. In addition, staining for p-Smad-1/5/8 in o-MSCs was observed around nuclei at all experimental conditions. Taken together results demonstrate failure of BMP-2 signaling in osteoporotic MSCs.

  10. Isolation and Manipulation of Adipogenic Cells to Assess TGF-β Superfamily Functions.

    PubMed

    Namwanje, Maria; Bournat, Juan C; Brown, Chester W

    2016-01-01

    A variety of TGF-β superfamily members affect adipocyte differentiation and function with consequential effects on energy metabolism. There has been a growing interest in this area because of the apparent influence of the BMP subgroup on brown adipose characteristics and potential application to the treatment of human obesity. In this chapter we describe methods that are useful in allowing one to assess the roles of specific members of the superfamily on adipocyte differentiation and mature adipocyte function, including the isolation and differentiation of mouse embryo fibroblasts (MEFs) to examine cell autonomous effects and the efficient transfection of two commonly used (but difficult to transfect) adipogenic cell lines, C3H/10T1/2 and 3T3-L1. PMID:26520126

  11. On the passage of radiation through inhomogeneous, moving media. VIII - Ray paths and fluxes in a plane differentially sheared medium

    NASA Technical Reports Server (NTRS)

    Lee, M. A.

    1974-01-01

    We give a detailed discussion of the group-velocity ray paths in a plane differentially sheared medium with constant index of refraction as measured by a local inertial observer. For a given velocity profile the numerical ray paths are presented graphically for several representative cases. Assuming that the medium has a volume emissivity and that a given flux of radiation is incident at the base of the medium, the flux of radiation leaving the slab as a function of exit angle is calculated and presented in the same representative cases. Peaks and discontinuities in the flux generally appear at given exit angles, but their locations and the half-widths of the peaks depend sensitively on the index of refraction.

  12. Evaluation of Urea-motility-indole medium for recognition and differentiation of Salmonella and Shigella species in stool cultures.

    PubMed Central

    Rosa Fraile, M; Vega Aleman, D; Fernandez Gutierrez, C

    1980-01-01

    A semisolid urea-motility-indole medium designed for detection in Enterobacteriaceae of urease activity, motility, and indole production in one tube was prepared and evaluated. The formulation of the medium was similar to that of Christensen urea agar, but the agar concentration was 0.2%, and 1% tryptone was added. Results with 687 strains of Enterobacteriaceae were the same as those obtained with standard test media (98% overall agreement). The urea-motility-indole medium was also used in combination with Kligler iron agar for the recognition and differentiation of Salmonella and Shigella species from colonies picked from plating media in fecal cultures. This combination was compared with the combination of Kligler iron agar and lysine iron agar with 507 strains of non-lactose-fermenting Enterobacteriaceae. Although both combinations enabled the presumptive recognition and differentiation of Salmonella and Shigella species, an analysis of data indicated that the combination of Kligler iron agar and urea-motility-indole medium performed better than the combination of Kligler iron agar and lysine iron agar in detecting Salmonella and Shigella species. PMID:7217332

  13. Development of a Novel Selective and Differential Medium for the Isolation of Listeria monocytogenes

    PubMed Central

    Park, Sang-Hyun; Chang, Pahn-Shick; Ryu, Sangryeol

    2014-01-01

    A new medium (lecithin and levofloxacin [LL] medium) is described for the isolation of Listeria monocytogenes from food samples. LL medium includes lecithin from soybeans for the detection of phosphatidylinositol-specific phospholipase C (PI-PLC) and phosphatidylcholine-specific phospholipase C (PC-PLC) produced by L. monocytogenes. Levofloxacin is incorporated to inhibit the growth of microorganisms other than L. monocytogenes, especially Bacillus cereus, shown to possess PI-PLC and PC-PLC activities. L. monocyogenes produced white colonies with a halo on LL medium, whereas Listeria innocua appeared as white colonies without a halo. Levofloxacin at 0.20 mg/liter completely inhibited the growth of B. cereus, while the growth of L. monocytogenes was unaffected. In the second phase of the study, the sensitivity and the specificity of LL medium were compared to those of modified Oxford agar (MOX) and two chromogenic media (Brilliance Listeria agar and CHROMagar Listeria), using a total of 250 food samples. From 200 unspiked food samples, the specificity of LL medium (96.0%) was superior to that of MOX (72.0%) and similar to the specificities of Brilliance Listeria agar (96.5%) and CHROMagar Listeria (94.5%). From 50 spiked food samples, LL medium and CHROMagar Listeria represented the highest sensitivities (96.0%), followed by Brilliance Listeria agar (92.0%) and MOX (54.0%). Also, LL medium showed the highest confirmation rate (98.8%), followed by Brilliance Listeria agar (98.7%), CHROMagar Listeria (98.3%), and MOX (52.0%). On the basis of its good specificity and cost effectiveness, LL medium is useful for the isolation of L. monocytogenes from food samples. PMID:24271177

  14. Development of selective and differential medium for Shigella sonnei using three carbohydrates (lactose, sorbitol, and xylose) and X-Gal.

    PubMed

    Na, G N; Kim, S A; Kwon, O C; Rhee, M S

    2015-08-01

    The aim of this study was to develop a new selective and differential medium for isolating Shigella sonnei (designated 3SD medium). The new medium was based on three carbohydrates (lactose, sorbitol, and xylose) and a chromogenic substrate (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside, X-Gal). S. sonnei cannot ferment lactose, sorbitol, or xylose, but can ferment X-Gal, which generates turquoise-blue colonies with rough edges. Other bacteria (54 strains of foodborne pathogens and spoilage bacteria) produced visually distinct colonies on 3SD medium (colorless or pink-violet colonies), or their growth was inhibited on 3SD medium. The optimum concentration of 50 mg/L X-Gal was selected because it yielded the highest level of morphological discrimination between S. sonnei and other bacteria, and this concentration was cost-effective. Bile salt concentration optimization was performed using healthy, heat-injured, and acid-injured S. sonnei. The recovery rate differed significantly depending on the bile salt concentration; media containing >1.0 g/L bile salt showed significantly lower recovery of stress-injured cells than medium containing 0.5 g/L bile salt (P<0.05). Growth of all Gram-positive bacteria was inhibited on medium containing 0.5 g/L bile salt; therefore, this concentration was used as the optimal concentration. Previous media used to isolate Shigella spp. (MacConkey, xylose lysine desoxycholate, and Salmonella-Shigella agar) showed poor performance when used to support the growth of injured S. sonnei cells, whereas 3SD medium supported a high growth rate of injured and healthy cells (equivalent to that obtained with nutrient-rich tryptic soy agar). To validate the performance of 3SD medium with real specimens, S. sonnei and other bacteria were spiked into samples such as untreated water, carrot, salad, and oyster. 3SD medium showed superior specificity (100%) and sensitivity (100%) for S. sonnei, and yielded no false-positive or false-negative results

  15. Development of selective and differential medium for Shigella sonnei using three carbohydrates (lactose, sorbitol, and xylose) and X-Gal.

    PubMed

    Na, G N; Kim, S A; Kwon, O C; Rhee, M S

    2015-08-01

    The aim of this study was to develop a new selective and differential medium for isolating Shigella sonnei (designated 3SD medium). The new medium was based on three carbohydrates (lactose, sorbitol, and xylose) and a chromogenic substrate (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside, X-Gal). S. sonnei cannot ferment lactose, sorbitol, or xylose, but can ferment X-Gal, which generates turquoise-blue colonies with rough edges. Other bacteria (54 strains of foodborne pathogens and spoilage bacteria) produced visually distinct colonies on 3SD medium (colorless or pink-violet colonies), or their growth was inhibited on 3SD medium. The optimum concentration of 50 mg/L X-Gal was selected because it yielded the highest level of morphological discrimination between S. sonnei and other bacteria, and this concentration was cost-effective. Bile salt concentration optimization was performed using healthy, heat-injured, and acid-injured S. sonnei. The recovery rate differed significantly depending on the bile salt concentration; media containing >1.0 g/L bile salt showed significantly lower recovery of stress-injured cells than medium containing 0.5 g/L bile salt (P<0.05). Growth of all Gram-positive bacteria was inhibited on medium containing 0.5 g/L bile salt; therefore, this concentration was used as the optimal concentration. Previous media used to isolate Shigella spp. (MacConkey, xylose lysine desoxycholate, and Salmonella-Shigella agar) showed poor performance when used to support the growth of injured S. sonnei cells, whereas 3SD medium supported a high growth rate of injured and healthy cells (equivalent to that obtained with nutrient-rich tryptic soy agar). To validate the performance of 3SD medium with real specimens, S. sonnei and other bacteria were spiked into samples such as untreated water, carrot, salad, and oyster. 3SD medium showed superior specificity (100%) and sensitivity (100%) for S. sonnei, and yielded no false-positive or false-negative results

  16. KR-62980: a novel peroxisome proliferator-activated receptor gamma agonist with weak adipogenic effects.

    PubMed

    Kim, Kwang Rok; Lee, Jeong Hyung; Kim, Seung Jun; Rhee, Sang Dal; Jung, Won Hoon; Yang, Sung-Don; Kim, Sung Soo; Ahn, Jin Hee; Cheon, Hyae Gyeong

    2006-08-14

    The nuclear receptor peroxisome proliferator-activated receptor gamma (PPARgamma) is the target for the anti-diabetic drugs including thiazolidinediones. We report here the identification and characterization of a novel PPARgamma agonist KR-62980. KR-62980 acted as a selective PPARgamma agonist in transactivation assay with an EC50 of 15 nM. In fully differentiated 3T3-L1 adipocytes, KR-62980 induced [3H]-deoxyglucose uptake in a concentration-dependent manner in the presence of insulin. KR-62980 was weakly adipogenic with little induction of aP2 mRNA, and was able to antagonize the adipogenic effects of rosiglitazone in C3H10T1/2 cells. In vivo pharmacokinetic profile of KR-62980 revealed that the compound exhibited good oral bioavailability of 65% with a terminal elimination half-life of 2.5 h in the rat. Treatment of high fat diet-induced C57BL/6J mice with KR-62980 for 14 days reduced plasma glucose levels with little side effects with regard to weight gain, cardiac hypertrophy and hepatotoxicity. These results suggest that KR-62980 acts as a selective PPARgamma modulator with anti-hyperglycemic activity, and that the mechanism of actions of KR-62980 appears to be different from that of rosiglitazone with improved side effect profiles.

  17. Restricted differentiation potential of progenitor cell populations obtained from the equine superficial digital flexor tendon (SDFT).

    PubMed

    Williamson, Kate Ann; Lee, Katie Joanna; Humphreys, William James Edward; Comerford, Eithne Josephine Veronica; Clegg, Peter David; Canty-Laird, Elizabeth Gail

    2015-06-01

    The aim of this study was to characterize stem and progenitor cell populations from the equine superficial digital flexor tendon, an energy-storing tendon with similarities to the human Achilles tendon, which is frequently injured. Using published methods for the isolation of tendon-derived stem/progenitor cells by low-density plating we found that isolated cells possessed clonogenicity but were unable to fully differentiate towards mesenchymal lineages using trilineage differentiation assays. In particular, adipogenic differentiation appeared to be restricted, as assessed by Oil Red O staining of stem/progenitor cells cultured in adipogenic medium. We then assessed whether differential adhesion to fibronectin substrates could be used to isolate a population of cells with broader differentiation potential. However we found little difference in the stem and tenogenic gene expression profile of these cells as compared to tenocytes, although the expression of thrombospondin-4 was significantly reduced in hypoxic conditions. Tendon-derived stem/progenitor cells isolated by differential adhesion to fibronectin had a similar differentiation potential to cells isolated by low density plating, and when grown in either normoxic or hypoxic conditions. In summary, we have found a restricted differentiation potential of cells isolated from the equine superficial digital flexor tendon despite evidence for stem/progenitor-like characteristics. PMID:25877997

  18. Restricted differentiation potential of progenitor cell populations obtained from the equine superficial digital flexor tendon (SDFT)

    PubMed Central

    Humphreys, William James Edward; Comerford, Eithne Josephine Veronica; Clegg, Peter David; Canty‐Laird, Elizabeth Gail

    2015-01-01

    ABSTRACT The aim of this study was to characterize stem and progenitor cell populations from the equine superficial digital flexor tendon, an energy‐storing tendon with similarities to the human Achilles tendon, which is frequently injured. Using published methods for the isolation of tendon‐derived stem/progenitor cells by low‐density plating we found that isolated cells possessed clonogenicity but were unable to fully differentiate towards mesenchymal lineages using trilineage differentiation assays. In particular, adipogenic differentiation appeared to be restricted, as assessed by Oil Red O staining of stem/progenitor cells cultured in adipogenic medium. We then assessed whether differential adhesion to fibronectin substrates could be used to isolate a population of cells with broader differentiation potential. However we found little difference in the stem and tenogenic gene expression profile of these cells as compared to tenocytes, although the expression of thrombospondin‐4 was significantly reduced in hypoxic conditions. Tendon‐derived stem/progenitor cells isolated by differential adhesion to fibronectin had a similar differentiation potential to cells isolated by low density plating, and when grown in either normoxic or hypoxic conditions. In summary, we have found a restricted differentiation potential of cells isolated from the equine superficial digital flexor tendon despite evidence for stem/progenitor‐like characteristics. © 2015 The Authors. Journal of Orthopaedic Research Published by Wiley Periodicals, Inc. on behalf of Orthopaedic Research Society. J Orthop Res 33:849–858, 2015. PMID:25877997

  19. On the geometry dependence of differential pathlength factor for near-infrared spectroscopy. I. Steady-state with homogeneous medium

    NASA Astrophysics Data System (ADS)

    Piao, Daqing; Barbour, Randall L.; Graber, Harry L.; Lee, Daniel C.

    2015-10-01

    This work analytically examines some dependences of the differential pathlength factor (DPF) for steady-state photon diffusion in a homogeneous medium on the shape, dimension, and absorption and reduced scattering coefficients of the medium. The medium geometries considered include a semi-infinite geometry, an infinite-length cylinder evaluated along the azimuthal direction, and a sphere. Steady-state photon fluence rate in the cylinder and sphere geometries is represented by a form involving the physical source, its image with respect to the associated extrapolated half-plane, and a radius-dependent term, leading to simplified formula for estimating the DPFs. With the source-detector distance and medium optical properties held fixed across all three geometries, and equal radii for the cylinder and sphere, the DPF is the greatest in the semi-infinite and the smallest in the sphere geometry. When compared to the results from finite-element method, the DPFs analytically estimated for 10 to 25 mm source-detector separations on a sphere of 50 mm radius with μa=0.01 mm-1 and μs‧=1.0 mm-1 are on average less than 5% different. The approximation for sphere, generally valid for a diameter ≥20 times of the effective attenuation pathlength, may be useful for rapid estimation of DPFs in near-infrared spectroscopy of an infant head and for short source-detector separation.

  20. On the geometry dependence of differential pathlength factor for near-infrared spectroscopy. I. Steady-state with homogeneous medium.

    PubMed

    Piao, Daqing; Barbour, Randall L; Graber, Harry L; Lee, Daniel C

    2015-10-01

    This work analytically examines some dependences of the differential pathlength factor (DPF) for steady-state photon diffusion in a homogeneous medium on the shape, dimension, and absorption and reduced scattering coefficients of the medium. The medium geometries considered include a semi-infinite geometry, an infinite-length cylinder evaluated along the azimuthal direction, and a sphere. Steady-state photon fluence rate in the cylinder and sphere geometries is represented by a form involving the physical source, its image with respect to the associated extrapolated half-plane, and a radius-dependent term, leading to simplified formula for estimating the DPFs. With the source-detector distance and medium optical properties held fixed across all three geometries, and equal radii for the cylinder and sphere, the DPF is the greatest in the semi-infinite and the smallest in the sphere geometry. When compared to the results from finite-element method, the DPFs analytically estimated for 10 to 25 mm source–detector separations on a sphere of 50 mm radius with μa=0.01  mm(−1) and μ′s=1.0  mm(−1) are on average less than 5% different. The approximation for sphere, generally valid for a diameter≥20 times of the effective attenuation pathlength, may be useful for rapid estimation of DPFs in near-infrared spectroscopy of an infant head and for short source–detector separation.

  1. Second malignancies in patients with differentiated thyroid carcinoma treated with low and medium activities of radioactive I-131

    PubMed Central

    PICIU, DOINA; PESTEAN, CLAUDIU; BARBUS, ELENA; LARG, MARIA IULIA; PICIU, ANDRA

    2016-01-01

    Background and aim This study aimed at determining whether there is a risk regarding the development of second primary malignancies after patient exposure to the low and medium radioiodine activity used during the treatment of differentiated thyroid cancers (DTC). Methods Second primary malignancies that occurred after DTC were detected in 1,990 patients treated between 1970 and 2003. The mean long-term follow-up period was 182 months. Results Radioiodine I-131was administrated at a mean dose of 63.2 mCi. There were 93 patients with at least one second primary malignancy. The relative risk of development of second malignancy in DTC patients was increased (p<0.0001) for breast, uterine and ovarian cancers compared with the general population. Conclusions The overall risk concerning the development of second primary malignancies was related to the presence of DTC, but not to exposure to the low and medium activities of radioiodine administered as adjuvant therapy. PMID:27547058

  2. Determination of osteogenic or adipogenic lineages in muscle-derived stem cells (MDSCs) by a collagen-binding peptide (CBP) derived from bone sialoprotein (BSP)

    SciTech Connect

    Choi, Yoon Jung; Lee, Jue Yeon; Lee, Seung Jin; Chung, Chong-Pyoung; Park, Yoon Jeong

    2012-03-09

    Highlights: Black-Right-Pointing-Pointer CBP sequence is identified from BSP and has collagen binding activity. Black-Right-Pointing-Pointer CBP directly activates the MAPK signaling, especially ERK1/2. Black-Right-Pointing-Pointer CBP increase osteoblastic differentiation by the activation of Runx2. Black-Right-Pointing-Pointer CBP decrease adipogenic differentiation by the inhibition of PPAR{gamma}. -- Abstract: Bone sialoprotein (BSP) is a mineralized, tissue-specific, non-collagenous protein that is normally expressed only in mineralized tissues such as bone, dentin, cementum, and calcified cartilage, and at sites of new mineral formation. The binding of BSP to collagen is thought to be important for initiating bone mineralization and bone cell adhesion to the mineralized matrix. Several recent studies have isolated stem cells from muscle tissue, but their functional properties are still unclear. In this study, we examined the effects of a synthetic collagen-binding peptide (CBP) on the differentiation efficiency of muscle-derived stem cells (MDSCs). The CBP sequence (NGVFKYRPRYYLYKHAYFYPHLKRFPVQ) corresponds to residues 35-62 of bone sialoprotein (BSP), which are located within the collagen-binding domain in BSP. Interestingly, this synthetic CBP inhibited adipogenic differentiation but increased osteogenic differentiation in MDSCs. The CBP also induced expression of osteoblastic marker proteins, including alkaline phosphatase (ALP), type I collagen, Runt-related transcription factor 2 (Runx2), and osteocalcin; prevented adipogenic differentiation in MDSCs; and down-regulated adipose-specific mRNAs, such as adipocyte protein 2 (aP2) and peroxisome proliferator-activated receptor {gamma}. The CBP increased Extracellular signal-regulated kinases (ERK) 1/2 protein phosphorylation, which is important in lineage determination. These observations suggest that this CBP determines the osteogenic or adipogenic lineage in MDSCs by activating ERK1/2. Taken together, a

  3. Differential plating medium for quantitative detection of histamine-producing bacteria.

    PubMed Central

    Niven, C F; Jeffrey, M B; Corlett, D A

    1981-01-01

    A histidine-containing agar medium has been devised for quantitative detection of histamine-producing bacteria that are alleged to be associated with scombroid fish poisoning outbreaks. The responsible bacteria produce a marked pH change in the agar, with attendant color change of pH indicator adjacent to the colonies, thus facilitating their recognition. Proteus morganii and Klebsiella pneumoniae were the two most common histidine-decarboxylating species isolated from scombroid fish and mahi mahi. PMID:7013698

  4. Differential requirements of two insect cell lines for growth in serum-free medium.

    PubMed

    Vaughn, J L; Fan, F

    1997-06-01

    The development of a serum-free medium that supports the growth of cells from a Spodoptera frugiperda and a Lymantria dispar cell line is reported. A yeast hydrolysate provided the B-vitamin complex, and a combination of a meat hydrolysate and tryptose provided most of the free amino acids required for cell growth. Supplemental cystine and methionine were required to achieve maximum cell growth. The serum or serum replacements used in earlier formulations were replaced with commercial lipid preparations and increased levels of iron salts. Although the cell growth cycle had a somewhat extended lag phase and the population doubling time of the S. frugiperda cells was longer than on serum-containing medium, the saturation densities were much higher. Spodoptera cells grown in this medium replicated the Autographa californica nuclear polyhedrosis virus well, producing 8.71 x 10(6) TCID50 extracellular virus and 4.4 x 10(6) polyhedra/ml culture. The specific activity of the polyhedra was somewhat less than that of polyhedra produced in insects. PMID:9201517

  5. Differential requirements of two insect cell lines for growth in serum-free medium.

    PubMed

    Vaughn, J L; Fan, F

    1997-06-01

    The development of a serum-free medium that supports the growth of cells from a Spodoptera frugiperda and a Lymantria dispar cell line is reported. A yeast hydrolysate provided the B-vitamin complex, and a combination of a meat hydrolysate and tryptose provided most of the free amino acids required for cell growth. Supplemental cystine and methionine were required to achieve maximum cell growth. The serum or serum replacements used in earlier formulations were replaced with commercial lipid preparations and increased levels of iron salts. Although the cell growth cycle had a somewhat extended lag phase and the population doubling time of the S. frugiperda cells was longer than on serum-containing medium, the saturation densities were much higher. Spodoptera cells grown in this medium replicated the Autographa californica nuclear polyhedrosis virus well, producing 8.71 x 10(6) TCID50 extracellular virus and 4.4 x 10(6) polyhedra/ml culture. The specific activity of the polyhedra was somewhat less than that of polyhedra produced in insects.

  6. Chemically-defined medium for growth and differentiation of mixed epithelial and connective tissues in organ culture.

    PubMed

    Hodges, G M; Melcher, A H

    1976-06-01

    The effect on tissue differentiation and growth in vitro of certain of the factors implicated in collagen synthesis (ascorbic acid, alpha-ketoglutarate and oxygen) and the influence of hydrocortisone was studied using organ cultures of fetal mouse mandible as a mixed epithelial and connective tissue system. Using serum-free Waymouth's MB 752/1 chemically-defined medium, addition of high levels of ascorbic acid (300mug per ml), hydrocortisone (1mug per ml) and oxygen (95%) enhanced differentiation in a number of tissues, in particular skin and appendages, tooth germs and bone, while osteoid and dentine production were noticeable promoted. It is suggested that an essential aspect of media design for organ culture involves the incorporaation of collagen-promoting factors to the in vitro enviornment particularly with regard to the controlling role implicated for collagen in a variety of biological processess.

  7. Stem cells from human exfoliated deciduous teeth differentiate toward neural cells in a medium dynamically cultured with Schwann cells in a series of polydimethylsiloxanes scaffolds

    NASA Astrophysics Data System (ADS)

    Su, Wen-Ta; Pan, Yu-Jing

    2016-08-01

    Objective. Schwann cells (SCs) are primary structural and functional cells in the peripheral nervous system. These cells play a crucial role in peripheral nerve regeneration by releasing neurotrophic factors. This study evaluated the neural differentiation potential effects of stem cells from human exfoliated deciduous teeth (SHEDs) in a rat Schwann cell (RSC) culture medium. Approach. SHEDs and RSCs were individually cultured on a polydimethylsiloxane (PDMS) scaffold, and the effects of the RSC medium on the SHEDs differentiation between static and dynamic cultures were compared. Main results. Results demonstrated that the SHED cells differentiated by the RSC cultured medium in the static culture formed neurospheres after 7 days at the earliest, and SHED cells formed neurospheres within 3 days in the dynamic culture. These results confirm that the RSC culture medium can induce neurospheres formation, the speed of formation and the number of neurospheres (19.16 folds high) in a dynamic culture was superior to the static culture for 3 days culture. The SHED-derived spheres were further incubated in the RSCs culture medium, these neurospheres continuously differentiated into neurons and neuroglial cells. Immunofluorescent staining and RT-PCR revealed nestin, β-III tubulin, GFAP, and γ-enolase of neural markers on the differentiated cells. Significance. These results indicated that the RSC culture medium can induce the neural differentiation of SHED cells, and can be used as a new therapeutic tool to repair nerve damage.

  8. Modified Pseudomonas agar: new differential medium for the detection/enumeration of Pseudomonas aeruginosa in mineral water.

    PubMed

    Ramalho, Rita; Cunha, Joaquim; Teixeira, Paula; Gibbs, Paul A

    2002-03-01

    Pseudomonas aeruginosa has been implicated as a foodborne and waterborne pathogen and is now considered a primary infectious agent. In the present study, the survival of P. aeruginosa inoculated in mineral water was evaluated by drop counts on Pseudomonas Agar Base (PAB), PAB with CN supplement X107, PAB with cetrimide, PAB with nalidixic acid, and these media with added FeSO(4). Initial counts, before starvation, were the same in all media tested. Following this period, P. aeruginosa became sensitive to PAB with added cetrimide. The addition of FeSO(4) did not improve the recovery of stressed P. aeruginosa but gave colonies a typical dark brown colour being easily differentiated from other species that can grow at 42 degrees C. The modified Pseudomonas agar medium was also tested with several P. aeruginosa strains, other species of Pseudomonas, and other genera. Only P. aeruginosa strains (pyocyanin positive) produced the typical colonies. Our results demonstrate that Pseudomonas agar with ferrous sulphate, used for the differentiation of P. aeruginosa colonies, and nalidixic acid, used as an inhibitor of Gram-positive bacteria, might be a useful medium for the detection of injured P. aeruginosa in mineral water. PMID:11777584

  9. Conditioned medium from human umbilical vein endothelial cells markedly improves the proliferation and differentiation of circulating endothelial progenitors.

    PubMed

    Castelli, Germana; Parolini, Isabella; Cerio, Anna Maria; D'Angiò, Agnese; Pasquini, Luca; Carollo, Maria; Sargiacomo, Massimo; Testa, Ugo; Pelosi, Elvira

    2016-10-01

    Circulating endothelial progenitor cells (EPCs) have been suggested as a precious source for generating functionally competent endothelial cells (ECs), candidate for various clinical applications. However, the paucity of these progenitor cells and the technical difficulties for their in vitro growth represent a main limitation to their use. In the present study we hypothesized that the paracrine effects of human umbilical vein endothelial cells (HUVECs) may improve endothelial cell generation from cord blood (CB) EPCs. In line with this hypothesis we showed that HUVEC conditioned medium (CM) or co-culture with HUVECs markedly improved the proliferation and differentiation and delayed the senescence of CB EPCs. The endothelial-promoting effect of CM seems to be related to smaller vesicles including exosomes (sEV/exo) contained in this medium and transferred to CB CD34(+) EPCs: in fact, purified preparations of sEV/exo isolated from CM mimicked the effect of CM to sustain endothelial formation. These observations provided the interesting indication that mature ECs exert a stimulatory effect on endothelial cell differentiation from CD34(+) cells. PMID:27667168

  10. Longevity of U cells of differentiated yeast colonies grown on respiratory medium depends on active glycolysis.

    PubMed

    Čáp, Michal; Váchová, Libuše; Palková, Zdena

    2015-01-01

    Colonies of Saccharomyces cerevisiae laboratory strains pass through specific developmental phases when growing on solid respiratory medium. During entry into the so-called alkali phase, in which ammonia signaling is initiated, 2 prominent cell types are formed within the colonies: U cells in upper colony regions, which have a longevity phenotype and activate the expression of a large number of metabolic genes, and L cells in lower regions, which die more quickly and exhibit a starvation phenotype. Here, we performed a detailed analysis of the activities of enzymes of central carbon metabolism in lysates of both cell types and determined several fermentation end products, showing that previously reported expression differences are reflected in the different enzymatic capabilities of each cell type. Hence, U cells, despite being grown on respiratory medium, behave as fermenting cells, whereas L cells rely on respiratory metabolism and possess active gluconeogenesis. Using a spectrum of different inhibitors, we showed that glycolysis is essential for the formation, and particularly, the survival of U cells. We also showed that β-1,3-glucans that are released from the cell walls of L cells are the most likely source of carbohydrates for U cells.

  11. Characterization and endocrine regulation of proliferation and differentiation of primary cultured preadipocytes from gilthead sea bream (Sparus aurata).

    PubMed

    Salmerón, C; Acerete, L; Gutiérrez, J; Navarro, I; Capilla, E

    2013-07-01

    A preadipocyte primary cell culture was established to gain knowledge about adipose tissue development in gilthead sea bream (Sparus aurata), one of the most extensively produced marine aquaculture species in the Mediterranean. The preadipocytes obtained from the stromal-vascular cell fraction of adipose tissue proliferated in culture, reaching confluence around day 8. At that time, the addition of an adipogenic medium promoted differentiation of the cells into mature adipocytes, which showed an enlarged cytoplasm filled with lipid droplets. First, cell proliferation and differentiation were analyzed under control and adipogenic conditions during culture development. Next, the effects of insulin, GH, and IGF-I on cell proliferation were evaluated at day 8. All peptides significantly stimulated proliferation of the cells after 48 h of incubation (P < 0.002 for GH and IGF-I and P < 0.05 for insulin), despite no differences were observed between the different doses tested. Subsequently, the effects of insulin and IGF-I maintaining differentiation when added to growth medium were studied at day 11, after 3 d of induction with adipogenic medium. The results showed that IGF-I is more potent than insulin enhancing differentiation (P < 0.01 for IGF-I compared with the control). In summary, a primary culture of gilthead sea bream preadipocytes has been characterized and the effects of several regulators of growth and development have been evaluated. This cellular system can be a good model to study the process of adipogenesis in fish, which may help improve the quality of the product in aquaculture.

  12. Rigidity of silicone substrates controls cell spreading and stem cell differentiation

    PubMed Central

    Vertelov, Grigory; Gutierrez, Edgar; Lee, Sin-Ae; Ronan, Edward; Groisman, Alex; Tkachenko, Eugene

    2016-01-01

    The dependences of spreading and differentiation of stem cells plated on hydrogel and silicone gel substrates on the rigidity and porosity of the substrates have recently been a subject of some controversy. In experiments on human mesenchymal stem cells plated on soft, medium rigidity, and hard silicone gels we show that harder gels are more osteogenic, softer gels are more adipogenic, and cell spreading areas increase with the silicone gel substrate rigidity. The results of our study indicate that substrate rigidity induces some universal cellular responses independently of the porosity or topography of the substrate. PMID:27651230

  13. Rigidity of silicone substrates controls cell spreading and stem cell differentiation.

    PubMed

    Vertelov, Grigory; Gutierrez, Edgar; Lee, Sin-Ae; Ronan, Edward; Groisman, Alex; Tkachenko, Eugene

    2016-01-01

    The dependences of spreading and differentiation of stem cells plated on hydrogel and silicone gel substrates on the rigidity and porosity of the substrates have recently been a subject of some controversy. In experiments on human mesenchymal stem cells plated on soft, medium rigidity, and hard silicone gels we show that harder gels are more osteogenic, softer gels are more adipogenic, and cell spreading areas increase with the silicone gel substrate rigidity. The results of our study indicate that substrate rigidity induces some universal cellular responses independently of the porosity or topography of the substrate. PMID:27651230

  14. Rigidity of silicone substrates controls cell spreading and stem cell differentiation

    NASA Astrophysics Data System (ADS)

    Vertelov, Grigory; Gutierrez, Edgar; Lee, Sin-Ae; Ronan, Edward; Groisman, Alex; Tkachenko, Eugene

    2016-09-01

    The dependences of spreading and differentiation of stem cells plated on hydrogel and silicone gel substrates on the rigidity and porosity of the substrates have recently been a subject of some controversy. In experiments on human mesenchymal stem cells plated on soft, medium rigidity, and hard silicone gels we show that harder gels are more osteogenic, softer gels are more adipogenic, and cell spreading areas increase with the silicone gel substrate rigidity. The results of our study indicate that substrate rigidity induces some universal cellular responses independently of the porosity or topography of the substrate.

  15. Recovery and differentiation of long ripened cheese microflora through a new cheese-based cultural medium.

    PubMed

    Neviani, Erasmo; De Dea Lindner, Juliano; Bernini, Valentina; Gatti, Monica

    2009-05-01

    A partial picture of the typical microflora of PDO Parmigiano Reggiano cheese was achieved by studying the cultivability of lactic acid bacteria associated with its manufacturing and ripening. A comprehensive sampling design allowed for the analysis of the cheese microflora during its production over 20 months of ripening. An innovative cheese agar medium (CAM) was prepared after testing 18 formulations all based on grated Parmigiano Reggiano ripened cheese. During cheese manufacturing and ripening, different samples were sampled and their microflora was recovered using CAM in comparison with other traditional media. Colonies which formed units from the different agar media tested were picked and isolated; the phylogenetic positions of 154 isolated strains were studied at level of species by 16S-rRNA gene sequencing. CAM seems to be able to recover the minority population coming from milk and whey starter, hardly estimable, during the first hours of production, on traditional media.

  16. Anti-adipogenic effect of epiberberine is mediated by regulation of the Raf/MEK1/2/ERK1/2 and AMPKα/Akt pathways.

    PubMed

    Choi, Jae Sue; Kim, Ji-Hye; Ali, Md Yousof; Jung, Hee Jin; Min, Byung-Sun; Choi, Ran Joo; Kim, Gun-Do; Jung, Hyun Ah

    2015-12-01

    It has been reported that alkaloids derived from Coptis chinensis exert anti-adipogenic activity on 3T3-L1 adipocytes by downregulating peroxisome proliferation-activity receptor-γ (PPAR-γ) and CCAAT/enhancer binding protein-α (C/EBP-α). However, the signaling-based mechanism of the inhibitory role of epiberberine in the early stages of 3T3-L1 adipocyte differentiation is uncharacterized. Here, we show that epiberberine had inhibitory effects on adipocyte differentiation and significantly decreased lipid accumulation by downregulating an adipocyte-specific transcription factor, sterol regulatory element-binding protein-1 (SREBP-1). Furthermore, we observed that epiberberine markedly suppressed the differentiation-mediated phosphorylation of components of both the Raf/mitogen-activated protein kinase 1 (MEK1)/extracellular signal-regulated protein kinase 1/2 (ERK1/2) and AMP-activated protein kinase-α1 (AMPKα)/Akt pathways. In addition, gene expression of fatty acid synthase (FAS) was significantly inhibited by treatment with epiberberine during adipogenesis. These results indicate that the anti-adipogenic mechanism of epiberberine is associated with inhibition of phosphorylation of Raf/MEK1/ERK1/2 and AMPKα/Akt, followed by downregulation of the major transcription factors of adipogenesis, such as PPAR-γ, C/EBP-α, and SREBP-1, and FAS. Taken together, this study suggests that the anti-adipogenic effect of epiberberine is mediated by downregulation of the Raf/MEK1/ERK1/2 and AMPKα/Akt pathways during 3T3-L1 adipocyte differentiation. Moreover, the anti-adipogenic effects of epiberberine were not accompanied by modulation of β-catenin.

  17. Brown-like adipose progenitors derived from human induced pluripotent stem cells: Identification of critical pathways governing their adipogenic capacity

    PubMed Central

    Hafner, Anne-Laure; Contet, Julian; Ravaud, Christophe; Yao, Xi; Villageois, Phi; Suknuntha, Kran; Annab, Karima; Peraldi, Pascal; Binetruy, Bernard; Slukvin, Igor I.; Ladoux, Annie; Dani, Christian

    2016-01-01

    Human induced pluripotent stem cells (hiPSCs) show great promise for obesity treatment as they represent an unlimited source of brown/brite adipose progenitors (BAPs). However, hiPSC-BAPs display a low adipogenic capacity compared to adult-BAPs when maintained in a traditional adipogenic cocktail. The reasons of this feature are unknown and hamper their use both in cell-based therapy and basic research. Here we show that treatment with TGFβ pathway inhibitor SB431542 together with ascorbic acid and EGF were required to promote hiPSCs-BAP differentiation at a level similar to adult-BAP differentiation. hiPSC-BAPs expressed the molecular identity of adult-UCP1 expressing cells (PAX3, CIDEA, DIO2) with both brown (ZIC1) and brite (CD137) adipocyte markers. Altogether, these data highlighted the critical role of TGFβ pathway in switching off hiPSC-brown adipogenesis and revealed novel factors to unlock their differentiation. As hiPSC-BAPs display similarities with adult-BAPs, it opens new opportunities to develop alternative strategies to counteract obesity. PMID:27577850

  18. Anti-adipogenic and antioxidant effects of the traditional Korean herbal formula Samchulgeonbi-tang: an in vitro study

    PubMed Central

    Yoo, Sae-Rom; Seo, Chang-Seob; Kim, Ohn-Soon; Shin, Hyeun-Kyoo; Jeong, Soo-Jin

    2015-01-01

    Aims: Here we report in vitro anti-adipogenic and antioxidant effects of Samchulgeonbi-tang (SCGBT), a traditional Korean herbal formula. Methods: 3T3-L1 preadipocytes were differentiated into adipocytes with or without SCGBT. After differentiation, we measured Oil Red O staining, glycerol-3-phosphate dehydrogenase (GPDH) activity and leptin production. In addition, its effect on scavenging activities of 2,2’-azinobis-(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) and 2,2’-diphenyl-1-picrylhydrazyl (DPPH) radicals in in vitro systems. Results: In differentiated 3T3-L1 adipocytes, SCGBT significantly inhibited lipid accumulation and triglyceride production, and mediated inactivation of GPDH, a major enzyme in the process of adipogenesis. Consistent with this, SCGBT stimulation significantly decreased the amount of leptin in 3T3-L1 adipose cells. Furthermore, SCGBT enhanced the scavenging activities on ABTS and DPPH radicals. The generation of malondialdehyde (MDA) during low-density lipoprotein (LDL) oxidation was significantly reduced by SCGBT treatment. Of interest, SCGBT extract inhibited reactive oxygen species (ROS) generation in 3T3-L1 adipocytes. Conclusion: Overall, our findings suggest that SCGBT has the potential for anti-adipogenic activity and antioxidant properties. PMID:26309521

  19. Brown-like adipose progenitors derived from human induced pluripotent stem cells: Identification of critical pathways governing their adipogenic capacity.

    PubMed

    Hafner, Anne-Laure; Contet, Julian; Ravaud, Christophe; Yao, Xi; Villageois, Phi; Suknuntha, Kran; Annab, Karima; Peraldi, Pascal; Binetruy, Bernard; Slukvin, Igor I; Ladoux, Annie; Dani, Christian

    2016-01-01

    Human induced pluripotent stem cells (hiPSCs) show great promise for obesity treatment as they represent an unlimited source of brown/brite adipose progenitors (BAPs). However, hiPSC-BAPs display a low adipogenic capacity compared to adult-BAPs when maintained in a traditional adipogenic cocktail. The reasons of this feature are unknown and hamper their use both in cell-based therapy and basic research. Here we show that treatment with TGFβ pathway inhibitor SB431542 together with ascorbic acid and EGF were required to promote hiPSCs-BAP differentiation at a level similar to adult-BAP differentiation. hiPSC-BAPs expressed the molecular identity of adult-UCP1 expressing cells (PAX3, CIDEA, DIO2) with both brown (ZIC1) and brite (CD137) adipocyte markers. Altogether, these data highlighted the critical role of TGFβ pathway in switching off hiPSC-brown adipogenesis and revealed novel factors to unlock their differentiation. As hiPSC-BAPs display similarities with adult-BAPs, it opens new opportunities to develop alternative strategies to counteract obesity. PMID:27577850

  20. Hospital morbidity in a medium-sized city: differentials between men and women

    PubMed Central

    de Arruda, Guilherme Oliveira; Molena-Fernandes, Carlos Alexandre; Mathias, Thais Aidar de Freitas; Marcon, Sonia Silva

    2014-01-01

    Objective characterize the hospital morbidity of adults living in the city of Maringá, PR, Brazil, between 2000 and 2011, focusing on the differential between men and women. Method this descriptive study was developed based on data from the Hospital Information System of the Unified Health System in order to investigate the association between groups of hospitalization causes and the average length of hospitalization per gender, in three-year periods. Results the main groups of hospitalization causes for men were: mental disorders, lesions and circulatory diseases; and, among women: tumors, circulatory and genitourinary diseases. Mental disorders and lesions, tumors, circulatory and genitourinary diseases were significantly associated with the female and male genders across the study period. Although not significant, the mean length of hospitalization dropped across the four three-year periods, and only showed a significant difference between men and women in the second triennium. Conclusion differences in the hospital morbidity profile between men and women underline the need for specific health and nursing actions, especially in primary health care, with a view to reducing hospitalizations due to the main groups of causes in the city. PMID:24553699

  1. Differentiation of human adipose stem cells into neural phenotype by neuroblastoma- or olfactory ensheathing cells-conditioned medium.

    PubMed

    Lo Furno, Debora; Pellitteri, Rosalia; Graziano, Adriana C E; Giuffrida, Rosario; Vancheri, Carlo; Gili, Elisa; Cardile, Venera

    2013-11-01

    Olfactory ensheathing cells (OECs) are known to be capable of continuous neurogenesis throughout lifetime and are a source of multiple trophic factors important in central nervous system regeneration. B104 neuroblastoma cells are recognized to induce differentiation of neural stem cells into oligodendrocyte precursor cells. Therefore, the aim of this study was to verify if conditioned medium (CM) obtained from OECs or B104 cells was capable of inducing differentiation of adipose tissue-derived mesenchymal stem cells (AT-MSCs) to a neuronal phenotype. In order to this goal, immunocytochemical procedures and flow cytometry analysis were used and some neural markers, as nestin, protein gene product 9.5 (PGP 9.5), microtubule-associated protein 2 (MAP2), glial fibrillary acidic protein (GFAP), and neuron cell surface antigen (A2B5) were examined 24 h and 7 days after the treatment. The results showed that both OECs- or B104-CM treated AT-MSCs express markers of progenitor and mature neurons (nestin, PGP 9.5 and MAP2) in time-dependent manner, display morphological features resembling neuronal cells, and result negative for GFAP and A2B5, astrocyte and oligodendrocyte markers, respectively. This study demonstrated that AT-MSCs can be influenced by the environment, indicating that these cells can respond to environmental cues also versus a neuronal phenotype.

  2. Murine keratinocyte cultures grown at the air/medium interface synthesize stratum corneum lipids and recycle linoleate during differentiation

    SciTech Connect

    Madison, K.C.; Swartzendruber, D.C.; Wertz, P.W.; Downing, D.T.

    1989-07-01

    In a recent investigation we showed that murine keratinocyte cultures grown at the air/medium interface in the presence of dermis exhibit morphologic differentiation comparable to that seen in vivo, including the formation of lamellar granules and stratum corneum intercellular lipid lamellae. In the present study, lifted cultures were found to more closely reproduce the lipid composition of the parent epidermal tissue than submerged cultures grown on plastic. In addition, the specific fatty acid profile of individual lipid classes in lifted cultures was, in general, remarkably well maintained in vitro. Acylceramides, which are highly enriched in linoleic acid in vivo, remained enriched in vitro; however, the linoleic acid content of the cultures was substantially lower than that in vivo, confirming previous reports of the relative essential fatty acid deficiency of standard culture media. As the lifted cultures differentiated over time, the lipid composition changed to reflect the formation of a stratum corneum with its different complement of lipids. Label from (U-/sup 14/C)linoleic acid was specifically incorporated into linoleate-containing lipids during short pulses in both submerged and lifted cultures. Changes in label distribution over a long chase period in lifted cultures indicated that linoleate was transferred from phospholipids to ceramides, providing evidence for the ''recycling'' of essential fatty acids in epidermis.

  3. An endothelial cultured condition medium embedded porous PLGA scaffold for the enhancement of mouse embryonic stem cell differentiation.

    PubMed

    Li, Ching-Wen; Pan, Wei-Ting; Ju, Jyh-Cherng; Wang, Gou-Jen

    2016-04-01

    In this study, we have developed a microporous poly(lactic-co-glycolic acid) (PLGA) scaffold that combines a continuous release property and a three-dimensional (3D) scaffolding technique for the precise and efficient formation of endothelial cell lineage from embryonic stem cells (ESCs). Eight PLGA scaffolds (14.29%, 16.67%, 20% and 25% concentrations of PLGA solutions) mixed with two crystal sizes of sodium chloride (NaCl) were fabricated by leaching. Then, vascular endothelial cell conditioned medium (ECCM) mixed with gelatin was embedded into the scaffold for culturing of mouse embryonic stem cells (mESCs). The 14.29% PLGA scaffolds fabricated using non-ground NaCl particles (NG-PLGA) and the 25% PLGA containing scaffolds fabricated using ground NaCl particles (G-PLGA) possessed minimum and maximum moisture content and bovine serum albumin (BSA) content properties, respectively. These two groups of scaffolds were used for future experiments in this study. Cell culture results demonstrated that the proposed porous scaffolds without growth factors were sufficient to induce mouse ESCs to differentiate into endothelial-like cells in the early culture stages, and combined with embedded ECCM could provide a long-term inducing system for ESC differentiation. PMID:27068738

  4. Effects of strontium on proliferation and differentiation of rat bone marrow mesenchymal stem cells

    SciTech Connect

    Li, Yunfeng; Li, Jihua; Zhu, Songsong; Luo, En; Feng, Ge; Chen, Qianming; Hu, Jing

    2012-02-24

    Highlights: Black-Right-Pointing-Pointer Strontium ranelate (SrR) inhibits proliferation of BMMSCs. Black-Right-Pointing-Pointer SrR increases osteoblastic but decreases adipocytic differentiation of BMMSCs. Black-Right-Pointing-Pointer SrR increases expression of Runx2, BSP and OCN by BMMSCs in osteogenic medium. Black-Right-Pointing-Pointer SrR decreases expression of PPAR{gamma}, aP2/ALBP and LPL by BMMSCs in adipogenic medium. -- Abstract: Strontium ranelate (SrR) was an effective anti-osteoporotic drug to increase bone formation and decrease bone resorption. However, reports about the effect of SR on osteoblastic and adipocytic differentiation from bone marrow mesenchymal stem cells (BMMSCs) are limited. The purpose of this study is to evaluate whether SrR affects the ability of BMMSCs to differentiate into osteoblasts or adipocytes. Rat BMMSCs were identified by flow cytometry and exposed to SR (0.1 and 1.0 mM Sr{sup 2+}) under osteogenic or adipogenic medium for 1 and 2 weeks. The proliferation and differentiation of BMMSCs were analyzed by MTT, alkaline phosphatase (ALP), Oil red O staining, quantitative real-time RT-PCR and Western blot assays. SrR significantly inhibited the proliferation, increased osteoblastic but decreased adipocytic differentiation of rat BMMSCs dose-dependently. In osteogenic medium, SrR increased the expression of ALP, the mRNA levels of Cbfa1/Runx2, bone sialoprotein, and osteocalcin by RT-PCR, and the protein levels of Cbfa1/Runx2 by Western blot. In adipogenic medium, SrR decreased the mRNA levels of PPAR{gamma}2, adipocyte lipid-binding protein 2 (aP2/ALBP), and lipoprotein lipase (LPL) by RT-PCR, and the protein expression of PPAR{gamma} in Western blot analysis. These results indicated that the effects of SrR to promote osteoblastic but inhibit adipocytic differentiation of BMMSCs might contribute to its effect on osteoporosis treatment.

  5. Different origin of adipogenic stem cells influences the response to antiretroviral drugs.

    PubMed

    Gibellini, Lara; De Biasi, Sara; Nasi, Milena; Carnevale, Gianluca; Pisciotta, Alessandra; Bianchini, Elena; Bartolomeo, Regina; Polo, Miriam; De Pol, Anto; Pinti, Marcello; Cossarizza, Andrea

    2015-10-01

    Lipodystrophy (LD) is a main side effect of antiretroviral therapy for HIV infection, and can be provoked by nucleoside reverse transcriptase inhibitors (NRTIs) and protease inhibitors (PIs). LD exists in different forms, characterized by fat loss, accumulation, or both, but its pathogenesis is still unclear. In particular, few data exist concerning the effects of antiretroviral drugs on adipocyte differentiation. Adipose tissue can arise either from mesenchymal stem cells (MSCs), that include bone marrow-derived MSCs (hBM-MSCs), or from ectodermal stem cells, that include dental pulp stem cells (hDPSCs). To analyze whether the embryonal origin of adipocytes might impact the occurrence of different phenotypes in LD, we quantified the effects of several antiretroviral drugs on the adipogenic differentiation of hBM-MSCs and hDPSCs. hBM-MSCs and hDPSCs were isolated from healthy donors. Cells were treated with 10 and 50 μM stavudine (d4T), efavirenz (EFV), atazanavir (ATV), ritonavir (RTV), and ATV-boosted RTV. Viability and adipogenesis were evaluated by staining with propidium iodide, oil red, and adipoRed; mRNA levels of genes involved in adipocyte differentiation, i.e. CCAAT/enhancer-binding protein alpha (CEBPα) and peroxisome proliferator-activated receptor gamma (PPARγ), and in adipocyte functions, i.e. fatty acid synthase (FASN), fatty acid binding protein-4 (FABP4), perilipin-1 (PLIN1) and 1-acylglycerol-3-phosphate O-acyltransferase-2 (AGPAT2), were quantified by real time PCR. We found that ATV, RTV, EFV, and ATV-boosted RTV, but not d4T, caused massive cell death in both cell types. EFV and d4T affected the accumulation of lipid droplets and induced changes in mRNA levels of genes involved in adipocyte functions in hBM-MSCs, while RTV and ATV had little effects. All drugs stimulated the accumulation of lipid droplets in hDPSCs. Thus, the adipogenic differentiation of human stem cells can be influenced by antiretroviral drugs, and depends, at least in

  6. Different origin of adipogenic stem cells influences the response to antiretroviral drugs

    SciTech Connect

    Gibellini, Lara; De Biasi, Sara; Nasi, Milena; Carnevale, Gianluca; Pisciotta, Alessandra; Bianchini, Elena; Bartolomeo, Regina; Polo, Miriam; De Pol, Anto; Pinti, Marcello; Cossarizza, Andrea

    2015-10-01

    Lipodystrophy (LD) is a main side effect of antiretroviral therapy for HIV infection, and can be provoked by nucleoside reverse transcriptase inhibitors (NRTIs) and protease inhibitors (PIs). LD exists in different forms, characterized by fat loss, accumulation, or both, but its pathogenesis is still unclear. In particular, few data exist concerning the effects of antiretroviral drugs on adipocyte differentiation. Adipose tissue can arise either from mesenchymal stem cells (MSCs), that include bone marrow-derived MSCs (hBM-MSCs), or from ectodermal stem cells, that include dental pulp stem cells (hDPSCs). To analyze whether the embryonal origin of adipocytes might impact the occurrence of different phenotypes in LD, we quantified the effects of several antiretroviral drugs on the adipogenic differentiation of hBM-MSCs and hDPSCs. hBM-MSCs and hDPSCs were isolated from healthy donors. Cells were treated with 10 and 50 μM stavudine (d4T), efavirenz (EFV), atazanavir (ATV), ritonavir (RTV), and ATV-boosted RTV. Viability and adipogenesis were evaluated by staining with propidium iodide, oil red, and adipoRed; mRNA levels of genes involved in adipocyte differentiation, i.e. CCAAT/enhancer-binding protein alpha (CEBPα) and peroxisome proliferator-activated receptor gamma (PPARγ), and in adipocyte functions, i.e. fatty acid synthase (FASN), fatty acid binding protein-4 (FABP4), perilipin-1 (PLIN1) and 1-acylglycerol-3-phosphate O-acyltransferase-2 (AGPAT2), were quantified by real time PCR. We found that ATV, RTV, EFV, and ATV-boosted RTV, but not d4T, caused massive cell death in both cell types. EFV and d4T affected the accumulation of lipid droplets and induced changes in mRNA levels of genes involved in adipocyte functions in hBM-MSCs, while RTV and ATV had little effects. All drugs stimulated the accumulation of lipid droplets in hDPSCs. Thus, the adipogenic differentiation of human stem cells can be influenced by antiretroviral drugs, and depends, at least in

  7. The Anti-Adipogenic Potential of COUP-TFII Is Mediated by Downregulation of the Notch Target Gene Hey1

    PubMed Central

    Scroyen, Ilse; Bauters, Dries; Vranckx, Christine; Lijnen, H. Roger

    2015-01-01

    Background Chicken ovalbumin upstream promoter transcription factor II (COUP-TFII) belongs to the steroid/thyroid hormone receptor superfamily and may contribute to the pathogenesis of obesity. It has not conclusively been established, however, whether its role is pro- or anti-adipogenic. Methods and Results Gene silencing of Coup-tfII in 3T3-F442A preadipocytes resulted in enhanced differentiation into mature adipocytes. This was associated with upregulation of the Notch signaling target gene Hey1. A functional role of Hey1 was confirmed by gene silencing in 3T3-F442A preadipocytes, resulting in impaired differentiation. In vivo, de novo fat pad formation in NUDE mice was significantly stimulated following injection of preadipocytes with Coup-tfII gene silencing, but impaired with Hey1 gene silencing. Moreover, expression of Coup-tfII was lower and that of Hey1 higher in isolated adipocytes of obese as compared to lean adipose tissue. Conclusions These in vitro and in vivo data support an anti-adipogenic role of COUP-TFII via downregulating the Notch signaling target gene Hey1. PMID:26719988

  8. Weight Loss Improves the Adipogenic Capacity of Human Preadipocytes and Modulates Their Secretory Profile

    PubMed Central

    Rossmeislová, Lenka; Mališová, Lucia; Kračmerová, Jana; Tencerová, Michaela; Kováčová, Zuzana; Koc, Michal; Šiklová-Vítková, Michaela; Viquerie, Nathalie; Langin, Dominique; Štich, Vladimír

    2013-01-01

    Calorie restriction–induced weight loss is accompanied by profound changes in adipose tissue characteristics. To determine the effect of weight loss on differentiation of preadipocytes and secretory capacity of in vitro differentiated adipocytes, we established cultures of these cells from paired subcutaneous adipose tissue biopsies obtained before and at the end of weight-reducing dietary intervention (DI) in 23 obese women. Based on lipid accumulation and the expression of differentiation markers, in vitro adipogenesis increased after weight loss and it was accompanied by enhanced expression of genes involved in de novo lipogenesis. This effect of weight loss was not driven by changes of peroxisome proliferator–activated receptor γ sensitivity to rosiglitazone. Weight loss also enhanced the expression of adiponectin and leptin while reducing that of monocyte chemoattractant protein 1 and interleukin-8 by cultured adipocytes. Thus, the weight-reducing (DI) increased adipogenic capacity of preadipocytes and shifted their secretion toward lower inflammatory profile. Reprogramming of preadipocytes could represent an adaptation to weight loss leading to partial restoration of preobese adipose tissue traits and thus contribute to the improvement of metabolic status. However, enhanced adipogenesis could also contribute to the unwanted weight regain after initial weight loss. PMID:23378611

  9. Different anti-adipogenic effects of bio-compounds on primary visceral pre-adipocytes and adipocytes.

    PubMed

    Colitti, Monica; Stefanon, Bruno

    2016-01-01

    Several natural compounds exhibit strong capacity for decreasing triglyceride accumulation, enhancing lipolysis and inducing apoptosis. The present study reports the anti-adipogenic effects of Silybum marianum (SL), Citrus aurantium (CA), Taraxacum officinale (TO), resveratrol (RE), Curcuma longa (CU), caffeine (CF), oleuropein (OL) and docosahexaenoic acid (DHA) in reducing differentiation and increasing lipolysis and apoptosis. Analyses were performed on human primary visceral pre-adipocytes after 10 (P10) and 20 (P20) days of treatment during differentiation and on mature adipocytes after 7 days of treatment (A7). The percentage of apoptosis induced by TO extract in P10 and P20 cells was significantly higher than that induced by all other compounds and in CTRL cells. Triglyceride accumulation was significantly lower in cells treated with DHA, CF, RE in comparison to cells treated with OL and in CTRL cells. Treatments with CF, DHA and OL significantly incremented lipolysis in P20 cells in comparison to other compounds and in CTRL cells. On the contrary, the treatment of A7 cells with OL, CA and TO compounds significantly increased cell lipolysis. The addition of CF in differentiating P20 pre-adipocytes significantly increased the expression of genes involved in inhibition of adipogenesis, such as GATA2, GATA3, WNT1, WNT3A, SFRP5, and DLK1. Genes involved in promoting adipogenesis such as CCND1, CEBPB and SREBF1 were significantly down-regulated by the treatment. The screening of bioactive compounds for anti-adipogenic effects showed that in differentiating cells TO extract was the most effective in inducing apoptosis and CF and DHA extracts were more efficient in inhibition of differentiation and in induction of cell lipolysis. PMID:27540349

  10. Different anti-adipogenic effects of bio-compounds on primary visceral pre-adipocytes and adipocytes

    PubMed Central

    Colitti, Monica; Stefanon, Bruno

    2016-01-01

    Several natural compounds exhibit strong capacity for decreasing triglyceride accumulation, enhancing lipolysis and inducing apoptosis. The present study reports the anti-adipogenic effects of Silybum marianum (SL), Citrus aurantium (CA), Taraxacum officinale (TO), resveratrol (RE), Curcuma longa (CU), caffeine (CF), oleuropein (OL) and docosahexaenoic acid (DHA) in reducing differentiation and increasing lipolysis and apoptosis. Analyses were performed on human primary visceral pre-adipocytes after 10 (P10) and 20 (P20) days of treatment during differentiation and on mature adipocytes after 7 days of treatment (A7). The percentage of apoptosis induced by TO extract in P10 and P20 cells was significantly higher than that induced by all other compounds and in CTRL cells. Triglyceride accumulation was significantly lower in cells treated with DHA, CF, RE in comparison to cells treated with OL and in CTRL cells. Treatments with CF, DHA and OL significantly incremented lipolysis in P20 cells in comparison to other compounds and in CTRL cells. On the contrary, the treatment of A7 cells with OL, CA and TO compounds significantly increased cell lipolysis. The addition of CF in differentiating P20 pre-adipocytes significantly increased the expression of genes involved in inhibition of adipogenesis, such as GATA2, GATA3, WNT1, WNT3A, SFRP5, and DLK1. Genes involved in promoting adipogenesis such as CCND1, CEBPB and SREBF1 were significantly down-regulated by the treatment. The screening of bioactive compounds for anti-adipogenic effects showed that in differentiating cells TO extract was the most effective in inducing apoptosis and CF and DHA extracts were more efficient in inhibition of differentiation and in induction of cell lipolysis. PMID:27540349

  11. Adipogenic role of alternatively activated macrophages in β-adrenergic remodeling of white adipose tissue.

    PubMed

    Lee, Yun-Hee; Kim, Sang-Nam; Kwon, Hyun-Jung; Maddipati, Krishna Rao; Granneman, James G

    2016-01-01

    De novo brown adipogenesis involves the proliferation and differentiation of progenitors, yet the mechanisms that guide these events in vivo are poorly understood. We previously demonstrated that treatment with a β3-adrenergic receptor (ADRB3) agonist triggers brown/beige adipogenesis in gonadal white adipose tissue following adipocyte death and clearance by tissue macrophages. The close physical relationship between adipocyte progenitors and tissue macrophages suggested that the macrophages that clear dying adipocytes might generate proadipogenic factors. Flow cytometric analysis of macrophages from mice treated with CL 316,243 identified a subpopulation that contained elevated lipid and expressed CD44. Lipidomic analysis of fluorescence-activated cell sorting-isolated macrophages demonstrated that CD44+ macrophages contained four- to five-fold higher levels of the endogenous peroxisome-proliferator activated receptor gamma (PPARγ) ligands 9-hydroxyoctadecadienoic acid (HODE), and 13-HODE compared with CD44- macrophages. Gene expression profiling and immunohistochemistry demonstrated that ADRB3 agonist treatment upregulated expression of ALOX15, the lipoxygenase responsible for generating 9-HODE and 13-HODE. Using an in vitro model of adipocyte efferocytosis, we found that IL-4-primed tissue macrophages accumulated lipid from dying fat cells and upregulated expression of Alox15. Furthermore, treatment of differentiating adipocytes with 9-HODE and 13-HODE potentiated brown/beige adipogenesis. Collectively, these data indicate that noninflammatory removal of adipocyte remnants and coordinated generation of PPARγ ligands by M2 macrophages provides localized adipogenic signals to support de novo brown/beige adipogenesis.

  12. Carbonate pore system evaluation using the velocity-porosity-pressure relationship, digital image analysis, and differential effective medium theory

    NASA Astrophysics Data System (ADS)

    Lima Neto, Irineu A.; Misságia, Roseane M.; Ceia, Marco A.; Archilha, Nathaly L.; Oliveira, Lucas C.

    2014-11-01

    Carbonate reservoirs exhibit heterogeneous pore systems and a wide variety of grain types, which affect the rock's elastic properties and the reservoir parameter relationships. To study the Albian carbonates in the Campos Basin, a methodology is proposed to predict the amount of microporosity and the representative aspect ratio of these inclusions. The method assumes three pore-space scales in two representative inclusion scenarios: 1) a macro-mesopore median aspect ratio from the thin-section digital image analysis (DIA) and 2) a microporosity aspect ratio predicted based on the measured P-wave velocities. Through a laboratory analysis of 10 grainstone core samples of the Albian age, the P- and S-wave velocities (Vp and Vs) are evaluated at effective pressures of 0-10 MPa. The analytical theories in the proposed methodology are functions of the aspect ratios from the differential effective medium (DEM) theory, the macro-mesopore system recognized from the DIA, the amount of microporosity determined by the difference between the porosities estimated from laboratorial helium-gas and the thin-section petrographic images, and the P-wave velocities under dry effective pressure conditions. The DIA procedure is applied to estimate the local and global parameters, and the textural implications concerning ultrasonic velocities and image resolution. The macro-mesopore inclusions contribute to stiffer rocks and higher velocities, whereas the microporosity inclusions contribute to softer rocks and lower velocities. We observe a high potential for this methodology, which uses the microporosity aspect ratio inverted from Vp to predict Vs with a good agreement. The results acceptably characterize the Albian grainstones. The representative macro-mesopore aspect ratio is 0.5, and the inverted microporosity aspect ratio ranges from 0.01 to 0.07. The effective pressure induced an effect of slight porosity reduction during the triaxial tests, mainly in the microporosity inclusions

  13. Atypical antipsychotics induce both proinflammatory and adipogenic gene expression in human adipocytes in vitro

    SciTech Connect

    Sárvári, Anitta K.; Veréb, Zoltán; Uray, Iván P.; Fésüs, László; Balajthy, Zoltán

    2014-08-08

    Highlights: • Antipsychotics modulate the expression of adipogenic genes in human adipocytes. • Secretion of proinflammatory cytokine IL8 and MCP-1 is induced by antipsychotics. • Adipocyte-dependent inflammatory abnormality could develop during chronic treatment. • Infiltrated macrophages would further enhance proinflammatory cytokine production. - Abstract: Schizophrenia requires lifelong treatment, potentially causing systemic changes in metabolic homeostasis. In the clinical setting, antipsychotic treatment may differentially lead to weight gain among individual patients, although the molecular determinants of such adverse effects are currently unknown. In this study, we investigated changes in the expression levels of critical regulatory genes of adipogenesis, lipid metabolism and proinflammatory genes during the differentiation of primary human adipose-derived stem cells (ADSCs). These cells were isolated from patients with body mass indices <25 and treated with the second-generation antipsychotics olanzapine, ziprasidone, clozapine, quetiapine, aripiprazole and risperidone and the first-generation antipsychotic haloperidol. We found that antipsychotics exhibited a marked effect on key genes involved in the regulation of cell cycle, signal transduction, transcription factors, nuclear receptors, differentiation markers and metabolic enzymes. In particular, we observed an induction of the transcription factor NF-KB1 and NF-KB1 target genes in adipocytes in response to these drugs, including the proinflammatory cytokines TNF-α, IL-1β, IL-8 and MCP-1. In addition, enhanced secretion of both IL8 and MCP-1 was observed in the supernatant of these cell cultures. In addition to their remarkable stimulatory effects on proinflammatory gene transcription, three of the most frequently prescribed antipsychotic drugs, clozapine, quetiapine and aripiprazole, also induced the expression of essential adipocyte differentiation genes and the adipocyte hormones leptin

  14. Role of PRDM16 and its PR domain in the epigenetic regulation of myogenic and adipogenic genes during transdifferentiation of C2C12 cells.

    PubMed

    Li, Xiao; Wang, Jinquan; Jiang, Zheng; Guo, Feng; Soloway, Paul D; Zhao, Ruqian

    2015-10-10

    The positive regulatory domain containing 16 (PRDM16) is commonly regarded as a "switch" controlling the transdifferentiation of myoblasts to brown adipocytes. The N-positive regulatory (PR) domain, which is highly homologous to SET domain, is a characteristic structure for the PRDM family. Many SET domain containing proteins and several PRDM members have been found to possess histone methyltransferase activity, yet the role of PRDM16 and its PR domain in the epigenetic regulation of myogenic and adipogenic genes during myoblasts/adipocytes transdifferentiation remains unexplored. In this study, we transfected C2C12 myoblasts to stably express PRDM16 and observed the repression of myogenic genes and activation of adipogenic genes at both proliferation and differentiation stages. Ectopic PRDM16-induced reprogramming of myogenic and adipogenic genes was associated with the hypermethylation on some CpG sites in the enhancer or promoter of MyoD and myogenin, but the methylation status of PPARγ promoter was not affected. C2C12 cells expressing truncated PRDM16 lacking PR domain (ΔPR-PRDM16) demonstrated attenuation of both adipogenic and myogenic potentials, indicated by PPARγ inactivation and decreased triglyceride deposition, as well as a downregulation of MyoD, MyHC and MCK genes, as compared with C2C12 cells expressing intact PRDM16. Furthermore, C2C12 cells expressing ΔPR-PRDM16 exhibited significant differences in histone modifications on the promoters of MyoD and PPARγ genes. Taken together, PRDM16-induced C2C12 transdifferentiation is associated with alterations in CpG methylation of myogenic factors, and PR domain affects both myogenesis and adipogenesis with modified histone methylation marks on MyoD and PPARγ promoters.

  15. Human adipocytes from the subcutaneous superficial layer have greater adipogenic potential and lower PPAR-γ DNA methylation levels than deep layer adipocytes.

    PubMed

    Kosaka, Kentaro; Kubota, Yoshitaka; Adachi, Naoki; Akita, Shinsuke; Sasahara, Yoshitaro; Kira, Tomoe; Kuroda, Masayuki; Mitsukawa, Nobuyuki; Bujo, Hideaki; Satoh, Kaneshige

    2016-08-01

    Human subcutaneous fat tissue consists of two layers, superficial adipose tissue (SAT) and deep adipose tissue (DAT). Some recent reports suggest that a disproportionate accumulation of DAT is related to obesity-associated metabolic complications. However, the differences in adipocyte function between SAT and DAT are unclear. To clarify the differences in human adipocyte characteristics between SAT and DAT, human ceiling culture-derived proliferative adipocytes (ccdPAs) were primary cultured from SAT and DAT of three lean female patients. Differences in adipogenic differentiation potential and sensitivity to exogenous adipogenic factors were examined. Epigenetic modification of the CpG island DNA methylation levels of genes related to adipogenesis was measured. In histological analyses, the mean adipocyte size in SAT was significantly larger than that in DAT (8,741 ± 416 vs. 7,732 ± 213 μm(2), P < 0.05). Primary cultured adipocytes from SAT showed significantly greater adipogenesis than did those of DAT. Sensitivity to partial adipogenic stimulation was significantly different between ccdPAs of SAT and DAT. Peroxisome proliferator-activated receptor-γ (PPAR-γ) protein expression and leptin protein secretion from ccdPAs were significantly higher in SAT than DAT. DNA methylation levels of PPAR-γ were significantly lower in ccdPAs of SAT than DAT. Adipocyte size was larger in SAT than DAT in vivo. This is consistent with the findings of an in vitro study that, compared with ccdPAs in DAT, ccdPAs in SAT have higher adipogenic potential and lower DNA methylation levels of PPAR-γ. PMID:27251439

  16. Reverse Differentiation as a Gene Filtering Tool in Genome Expression Profiling of Adipogenesis for Fat Marker Gene Selection and Their Analysis

    PubMed Central

    Ullah, Mujib; Stich, Stefan; Häupl, Thomas; Eucker, Jan; Sittinger, Michael; Ringe, Jochen

    2013-01-01

    Background During mesenchymal stem cell (MSC) conversion into adipocytes, the adipogenic cocktail consisting of insulin, dexamethasone, indomethacin and 3-isobutyl-1-methylxanthine not only induces adipogenic-specific but also genes for non-adipogenic processes. Therefore, not all significantly expressed genes represent adipogenic-specific marker genes. So, our aim was to filter only adipogenic-specific out of all expressed genes. We hypothesize that exclusively adipogenic-specific genes change their expression during adipogenesis, and reverse during dedifferentiation. Thus, MSC were adipogenic differentiated and dedifferentiated. Results Adipogenesis and reverse adipogenesis was verified by Oil Red O staining and expression of PPARG and FABP4. Based on GeneChips, 991 genes were differentially expressed during adipogenesis and grouped in 4 clusters. According to bioinformatic analysis the relevance of genes with adipogenic-linked biological annotations, expression sites, molecular functions, signaling pathways and transcription factor binding sites was high in cluster 1, including all prominent adipogenic genes like ADIPOQ, C/EBPA, LPL, PPARG and FABP4, moderate in clusters 2–3, and negligible in cluster 4. During reversed adipogenesis, only 782 expressed genes (clusters 1–3) were reverted, including 597 genes not reported for adipogenesis before. We identified APCDD1, CHI3L1, RARRES1 and SEMA3G as potential adipogenic-specific genes. Conclusion The model system of adipogenesis linked to reverse adipogenesis allowed the filtration of 782 adipogenic-specific genes out of total 991 significantly expressed genes. Database analysis of adipogenic-specific biological annotations, transcription factors and signaling pathways further validated and valued our concept, because most of the filtered 782 genes showed affiliation to adipogenesis. Based on this approach, the selected and filtered genes would be potentially important for characterization of adipogenesis and

  17. ADV36 adipogenic adenovirus in human liver disease

    PubMed Central

    Trovato, Francesca M; Catalano, Daniela; Garozzo, Adriana; Martines, G Fabio; Pirri, Clara; Trovato, Guglielmo M

    2014-01-01

    Obesity and liver steatosis are usually described as related diseases. Obesity is regarded as exclusive consequence of an imbalance between food intake and physical exercise, modulated by endocrine and genetic factors. Non-alcoholic fatty liver disease (NAFLD), is a condition whose natural history is related to, but not completely explained by over-nutrition, obesity and insulin resistance. There is evidence that environmental infections, and notably adipogenic adenoviruses (ADV) infections in humans, are associated not only with obesity, which is sufficiently established, but also with allied conditions, such as fatty liver. In order to elucidate the role, if any, of previous ADV36 infection in humans, we investigated association of ADV36-ADV37 seropositivity with obesity and fatty liver in humans. Moreover, the possibility that lifestyle-nutritional intervention in patients with NAFLD and different ADV36 seropositive status, achieves different clinical outcomes on ultrasound bright liver imaging, insulin resistance and obesity was challenged. ADV36 seropositive patients have a more consistent decrease in insulin resistance, fatty liver severity and body weight in comparison with ADV36 seronegative patients, indicating a greater responsiveness to nutritional intervention. These effects were not dependent on a greater pre-interventional body weight and older age. These results imply that no obvious disadvantage - and, seemingly, that some benefit - is linked to ADV36 seropositivity, at least in NAFLD. ADV36 previous infection can boost weight loss and recovery of insulin sensitivity under interventional treatment. PMID:25356033

  18. Melatonin affects voltage-dependent calcium and potassium currents in MCF-7 cell line cultured either in growth or differentiation medium.

    PubMed

    Squecco, Roberta; Tani, Alessia; Zecchi-Orlandini, Sandra; Formigli, Lucia; Francini, Fabio

    2015-07-01

    Big efforts have been dedicated up to now to identify novel targets for cancer treatment. The peculiar biophysical profile and the atypical ionic channels activity shown by diverse types of human cancers suggest that ion channels may be possible targets in cancer therapy. Earlier studies have shown that melatonin exerts an oncostatic action on different tumors. In particular, it was shown that melatonin was able to inhibit growth/viability and proliferation, to reduce the invasiveness and metastatic properties of human estrogen-sensitive breast adenocarcinoma MCF-7 cell line cultured in growth medium, with substantial impairments of epidermal growth factor (EGF) and Notch-1-mediated signaling. The purpose of this work was to evaluate on MCF-7 cells the possible effects of melatonin on the biophysical features known to have a role in proliferation and differentiation, by using the patch-clamp technique. Our results show that in cells cultured in growth as well as in differentiation medium melatonin caused a hyperpolarization of resting membrane potential paralleled by significant changes of the inward Ca(2+) currents (T- and L-type), outward delayed rectifier K(+) currents and cell capacitance. All these effects are involved in MCF-7 growth and differentiation. These findings strongly suggest that melatonin, acting as a modulator of different voltage-dependent ion channels, might be considered a new promising tool for specifically disrupting cell viability and differentiation pathways in tumour cells with possible beneficial effects on cancer therapy. PMID:25843408

  19. The environmental chemical tributyltin chloride (TBT) shows both estrogenic and adipogenic activities in mice which might depend on the exposure dose

    SciTech Connect

    Penza, M.; Jeremic, M.; Marrazzo, E.; Maggi, A.; Ciana, P.; Rando, G.; Grigolato, P.G.; Di Lorenzo, D.

    2011-08-15

    Exposure during early development to chemicals with hormonal action may be associated with weight gain during adulthood because of altered body homeostasis. It is known that organotins affect adipose mass when exposure occurs during fetal development, although no knowledge of effects are available for exposures after birth. Here we show that the environmental organotin tributyltin chloride (TBT) exerts adipogenic action when peripubertal and sexually mature mice are exposed to the chemical. The duration and extent of these effects depend on the sex and on the dose of the compound, and the effects are relevant at doses close to the estimated human intake (0.5 {mu}g/kg). At higher doses (50-500 {mu}g/kg), TBT also activated estrogen receptors (ERs) in adipose cells in vitro and in vivo, based on results from acute and longitudinal studies in ERE/luciferase reporter mice. In 3T3-L1 cells (which have no ERs), transiently transfected with the ERE-dependent reporter plus or minus ER{alpha} or ER{beta}, TBT (in a dose range of 1-100 nM) directly targets each ER subtype in a receptor-specific manner through a direct mechanism mediated by ER{alpha} in undifferentiated preadipocytic cells and by ER{beta} in differentiating adipocytes. The ER antagonist ICI-182,780 inhibits this effect. In summary, the results of this work suggest that TBT is adipogenic at all ages and in both sexes and that it might be an ER activator in fat cells. These findings might help to resolve the apparent paradox of an adipogenic chemical being also an estrogen receptor activator by showing that the two apparently opposite actions are separated by the different doses to which the organism is exposed. - Research Highlights: > The environmental organotin tributyltin chloride shows dose-dependent estrogenic and adipogenic activities in mice. > The duration and extent of these effects depend on the sex and the dose of the compound. > The estrogenic and adipogenic effects of TBT occur at doses closed to

  20. In vitro cementoblast-like differentiation of postmigratory neural crest-derived p75{sup +} stem cells with dental follicle cell conditioned medium

    SciTech Connect

    Wen, Xiujie; Liu, Luchuan; Deng, Manjing; Liu, Rui; Zhang, Li; Nie, Xin

    2015-09-10

    Cranial neural crest-derived cells (CNCCs) play important role in epithelial–mesenchymal interactions during tooth morphogenesis. However, the heterogeneity of CNCCs and their tendency to spontaneously differentiate along smooth muscle or osteoblast lineages in vitro limit further understanding of their biological properties. We studied the differentiation properties of isolated rat embryonic postmigratory CNCCs, expressing p75 neurotrophin receptor (p75NTR). These p75NTR positive (p75{sup +}) CNCCs, isolated using fluorescence activated cell sorter, exhibited fibroblast-like morphology and characteristics of mesenchymal stem cells. Incubation of p75{sup +} CNCCs in dental follicle cell conditioned medium (DFCCM) combined with dentin non-collagenous proteins (dNCPs), altered their morphological features to cementoblast-like appearance. These cells also showed low proliferative activity, high ALP activity and significantly increased calcified nodule formation. Markers related to mineralization or specific to cementoblast lineage were highly expressed in dNCPs/DFCCM-treated p75{sup +} cells, suggesting their differentiation along cementoblast-like lineage. p75{sup +} stem cells selected from postmigratory CNCCs represent a pure stem cell population and could be used as a stem cell model for in vitro studies due to their intrinsic ability to differentiate to neuronal cells and transform from neuroectoderm to ectomesenchyme. They can provide a potential stem cell resource for tooth engineering studies and help to further investigate mechanisms of epithelial–mesenchymal interactions in tooth morphogenesis. - Highlights: • Cranial neural crest-derived cells (CNCCs) take part in tooth morphogenesis. • positive (p75{sup +}) CNCCs are fibroblast-like and resemble mesenchymal stem cells. • p75{sup +} CNCCs in dental follicle cell medium (DFCCM/dNCP) appear like cementoblasts. • DFCCM/dNCP-treated p75{sup +} cells express cementoblast specific mineralization

  1. Adipogenic Gene Expression in Gilthead Sea Bream Mesenchymal Stem Cells from Different Origin

    PubMed Central

    Salmerón, Cristina; Riera-Heredia, Natàlia; Gutiérrez, Joaquim; Navarro, Isabel; Capilla, Encarnación

    2016-01-01

    During the last decades, adipogenesis has become an emerging field of study in aquaculture due to the relevance of the adipose tissue in many physiological processes and its connection with the endocrine system. In this sense, recent studies have translated into the establishment of preadipocyte culture models from several fish species, sometimes lacking information on the mRNA levels of adipogenic genes. Thus, the aim of this study was to determine the gene expression profile of gilthead sea bream (Sparus aurata) primary cultured mesenchymal stem cells (MSCs) from different origin (adipose tissue and vertebra bone) during adipogenesis. Both cell types differentiated into adipocyte-like cells, accumulating lipids inside their cytoplasm. Adipocyte differentiation of MSCs from adipose tissue resulted in downregulation of several adipocyte-related genes (such as lpl, hsl, pparα, pparγ and gapdh2) at day 4, gapdh1 at day 8, and fas and pparβ at day 12. In contrast, differences in lxrα mRNA expression were not observed, while g6pdh levels increased during adipocyte maturation. Gapdh and Pparγ protein levels were also detected in preadipocyte cultures; however, only the former increased its expression during adipogenesis. Moreover, differentiation of bone-derived cells into adipocytes also resulted in the downregulation of several adipocyte gene markers, such as fas and g6pdh at day 10 and hsl, pparβ, and lxrα at day 15. On the other hand, the osteogenic genes fib1a, mgp, and op remained stable, but an increase in runx2 expression at day 20 was observed. In summary, the present study demonstrates that gilthead sea bream MSCs, from both adipose tissue and bone, differentiate into adipocyte-like cells, although revealed some kind of species- and cell lineage-specific regulation with regards to gene expression. Present data also provide novel insights into some of the potential key genes controlling adipogenesis in gilthead sea bream that can help to better

  2. Adipogenic Gene Expression in Gilthead Sea Bream Mesenchymal Stem Cells from Different Origin

    PubMed Central

    Salmerón, Cristina; Riera-Heredia, Natàlia; Gutiérrez, Joaquim; Navarro, Isabel; Capilla, Encarnación

    2016-01-01

    During the last decades, adipogenesis has become an emerging field of study in aquaculture due to the relevance of the adipose tissue in many physiological processes and its connection with the endocrine system. In this sense, recent studies have translated into the establishment of preadipocyte culture models from several fish species, sometimes lacking information on the mRNA levels of adipogenic genes. Thus, the aim of this study was to determine the gene expression profile of gilthead sea bream (Sparus aurata) primary cultured mesenchymal stem cells (MSCs) from different origin (adipose tissue and vertebra bone) during adipogenesis. Both cell types differentiated into adipocyte-like cells, accumulating lipids inside their cytoplasm. Adipocyte differentiation of MSCs from adipose tissue resulted in downregulation of several adipocyte-related genes (such as lpl, hsl, pparα, pparγ and gapdh2) at day 4, gapdh1 at day 8, and fas and pparβ at day 12. In contrast, differences in lxrα mRNA expression were not observed, while g6pdh levels increased during adipocyte maturation. Gapdh and Pparγ protein levels were also detected in preadipocyte cultures; however, only the former increased its expression during adipogenesis. Moreover, differentiation of bone-derived cells into adipocytes also resulted in the downregulation of several adipocyte gene markers, such as fas and g6pdh at day 10 and hsl, pparβ, and lxrα at day 15. On the other hand, the osteogenic genes fib1a, mgp, and op remained stable, but an increase in runx2 expression at day 20 was observed. In summary, the present study demonstrates that gilthead sea bream MSCs, from both adipose tissue and bone, differentiate into adipocyte-like cells, although revealed some kind of species- and cell lineage-specific regulation with regards to gene expression. Present data also provide novel insights into some of the potential key genes controlling adipogenesis in gilthead sea bream that can help to better

  3. Adipogenic Gene Expression in Gilthead Sea Bream Mesenchymal Stem Cells from Different Origin.

    PubMed

    Salmerón, Cristina; Riera-Heredia, Natàlia; Gutiérrez, Joaquim; Navarro, Isabel; Capilla, Encarnación

    2016-01-01

    During the last decades, adipogenesis has become an emerging field of study in aquaculture due to the relevance of the adipose tissue in many physiological processes and its connection with the endocrine system. In this sense, recent studies have translated into the establishment of preadipocyte culture models from several fish species, sometimes lacking information on the mRNA levels of adipogenic genes. Thus, the aim of this study was to determine the gene expression profile of gilthead sea bream (Sparus aurata) primary cultured mesenchymal stem cells (MSCs) from different origin (adipose tissue and vertebra bone) during adipogenesis. Both cell types differentiated into adipocyte-like cells, accumulating lipids inside their cytoplasm. Adipocyte differentiation of MSCs from adipose tissue resulted in downregulation of several adipocyte-related genes (such as lpl, hsl, pparα, pparγ and gapdh2) at day 4, gapdh1 at day 8, and fas and pparβ at day 12. In contrast, differences in lxrα mRNA expression were not observed, while g6pdh levels increased during adipocyte maturation. Gapdh and Pparγ protein levels were also detected in preadipocyte cultures; however, only the former increased its expression during adipogenesis. Moreover, differentiation of bone-derived cells into adipocytes also resulted in the downregulation of several adipocyte gene markers, such as fas and g6pdh at day 10 and hsl, pparβ, and lxrα at day 15. On the other hand, the osteogenic genes fib1a, mgp, and op remained stable, but an increase in runx2 expression at day 20 was observed. In summary, the present study demonstrates that gilthead sea bream MSCs, from both adipose tissue and bone, differentiate into adipocyte-like cells, although revealed some kind of species- and cell lineage-specific regulation with regards to gene expression. Present data also provide novel insights into some of the potential key genes controlling adipogenesis in gilthead sea bream that can help to better

  4. Fatty Acid Profiles for Differentiating Growth Medium Formulations Used to Culture Bacillus cereus T-strain Spores.

    PubMed

    Ehrhardt, Christopher J; Murphy, Devonie L; Robertson, James M; Bannan, Jason D

    2015-07-01

    Microbial biomarkers that indicate aspects of an organism's growth conditions are important targets of forensic research. In this study, we examined fatty acid composition as a signature for the types of complex nutrients in the culturing medium. Bacillus cereus T-strain spores were grown in medium formulations supplemented with one of the following: peptone (meat protein), tryptone (casein protein), soy protein, and brain-heart infusion. Cellular biomass was profiled with fatty acid methyl ester (FAME) analysis. Results showed peptone cultures produced spores enriched in straight-chained lipids. Tryptone cultures produced spores enriched in branched-odd lipids when compared with peptone, soy, and brain-heart formulations. The observed FAME variation was used to construct a set of discriminant functions that could help identify the nutrients in a culturing recipe for an unknown spore sample. Blinded classification tests were most successful for spores grown on media containing peptone and tryptone, showing 88% and 100% correct identification, respectively.

  5. Fatty Acid Profiles for Differentiating Growth Medium Formulations Used to Culture Bacillus cereus T-strain Spores.

    PubMed

    Ehrhardt, Christopher J; Murphy, Devonie L; Robertson, James M; Bannan, Jason D

    2015-07-01

    Microbial biomarkers that indicate aspects of an organism's growth conditions are important targets of forensic research. In this study, we examined fatty acid composition as a signature for the types of complex nutrients in the culturing medium. Bacillus cereus T-strain spores were grown in medium formulations supplemented with one of the following: peptone (meat protein), tryptone (casein protein), soy protein, and brain-heart infusion. Cellular biomass was profiled with fatty acid methyl ester (FAME) analysis. Results showed peptone cultures produced spores enriched in straight-chained lipids. Tryptone cultures produced spores enriched in branched-odd lipids when compared with peptone, soy, and brain-heart formulations. The observed FAME variation was used to construct a set of discriminant functions that could help identify the nutrients in a culturing recipe for an unknown spore sample. Blinded classification tests were most successful for spores grown on media containing peptone and tryptone, showing 88% and 100% correct identification, respectively. PMID:25854710

  6. Distinct populations of adipogenic and myogenic Myf5-lineage progenitors in white adipose tissues.

    PubMed

    Shan, Tizhong; Liang, Xinrong; Bi, Pengpeng; Zhang, Pengpeng; Liu, Weiyi; Kuang, Shihuan

    2013-08-01

    Brown adipose tissues (BAT) are derived from a myogenic factor 5 (Myf5)-expressing cell lineage and white adipose tissues (WAT) predominantly arise from non-Myf5 lineages, although a subpopulation of adipocytes in some WAT depots can be derived from the Myf5 lineage. However, the functional implication of the Myf5- and non-Myf5-lineage cells in WAT is unclear. We found that the Myf5-lineage constitution in subcutaneous WAT depots is negatively correlated to the expression of classical BAT and newly defined beige/brite adipocyte-specific genes. Consistently, fluorescent-activated cell sorting (FACS)-purified Myf5-lineage adipo-progenitors give rise to adipocytes expressing lower levels of BAT-specific Ucp1, Prdm16, Cidea, and Ppargc1a genes and beige adipocyte-specific CD137, Tmem26, and Tbx1 genes compared with the non-Myf5-lineage adipocytes from the same depots. Ablation of the Myf5-lineage progenitors in WAT stromal vascular cell (SVC) cultures leads to increased expression of BAT and beige cell signature genes. Strikingly, the Myf5-lineage cells in WAT are heterogeneous and contain distinct adipogenic [stem cell antigen 1(Sca1)-positive] and myogenic (Sca1-negative) progenitors. The latter differentiate robustly into myofibers in vitro and in vivo, and they restore dystrophin expression after transplantation into mdx mouse, a model for Duchenne muscular dystrophy. These results demonstrate the heterogeneity and functional differences of the Myf5- and non-Myf5-lineage cells in the white adipose tissue.

  7. Inhibition of Adipocyte Differentiation by Phytoestrogen Genistein Through a Potential Downregulation of Extracellular Signal-Regulated Kinases 1/2 Activity

    PubMed Central

    Liao, Qing-Chuan; Li, Ya-Lin; Qin, Yan-Fang; Quarles, L. Darryl; Xu, Kang-Kang; Li, Rong; Zhou, Hong-Hao; Xiao, Zhou-Sheng

    2016-01-01

    In the current study, we investigated the effects of genistein on adipogenic differentiation of mouse bone marrow-derived mesenchymal stem cell (BMSC) cultures and its potential signaling pathway. The terminal adipogenic differentiation was assessed by western-blotting analysis of adipogenic-specific proteins such as PPARγ, C/EBPα, and aP2 and the formation of adipocytes. Treatment of mouse BMSC cultures with adipogenic cocktail resulted in sustained activation of extracellular signal-regulated kinases 1 and 2 (ERK1/2), which are members of the mitogen-activated protein kinase (MAPK) family, at the early phase of adipogenesis (from days 3 to 9). Inhibition of ERK1/2 activation by PD98059, a specific MEK inhibitor, reversed the induced adipogenic differentiation. Genistein dose-dependently decreased the phosphorylation of ERK1/2 in mouse BMSC cultures. Genistein incubation for the entire culture period, as well as that applied during the early phase of the culture period, significantly inhibited the adipogenic differentiation of mouse BMSC cultures. While genistein was incubated at the late stage (after day 9), no inhibitory effect on adipogenic differentiation was observed. BMSC cultures treated with genistein in the presence of fibroblast growth factor-2 (FGF-2), an activator of the ERK1/2 signaling pathway, expressed normal levels of ERK1/2 activity, and, in so doing, are capable of undergoing adipogenesis. Our results suggest that activation of the ERK1/2 signaling pathway during the early phase of adipogenesis (from days 3 to 9) is essential to adipogenic differentiation of BMSC cultures, and that genistein inhibits the adipogenic differentiation through a potential downregulation of ERK1/2 activity at this early phase of adipogenesis. PMID:18384126

  8. [Adipogenic function and other biologic effects of insulin].

    PubMed

    Pankov, Y A

    2016-01-01

    adipocytes during inhibition of glucose transformation into triglyceride in adipose tissue. Knockout of the Insr gene in muscles blocked glucose uptake by myocytes, but it did not induce hyperglycemia, probably due to the increase in glucose uptake by other organs, which retained the insulin receptor, and induced some increase in fat resources in adipose tissue. Similar results were obtained in mice with knockout the glucose transporter 4 GLUT4 in muscle and/or adipose tissue. Insulin microinjections in the brain, in the cerebral ventricle 4 (ICV) and mediobasal hypothalamus (MBH) did not affect the insulin levels in the general circulation, but effectively activated lipogenesis and inhibited lipolysis in adipose tissue. They induced obesity, similar to conventional obesity when the insulin levels increased. These results may serve as additional evidence for importance of the adipogenic insulin function in mechanisms of regulation of general metabolism.

  9. [Adipogenic function and other biologic effects of insulin].

    PubMed

    Pankov, Y A

    2016-01-01

    adipocytes during inhibition of glucose transformation into triglyceride in adipose tissue. Knockout of the Insr gene in muscles blocked glucose uptake by myocytes, but it did not induce hyperglycemia, probably due to the increase in glucose uptake by other organs, which retained the insulin receptor, and induced some increase in fat resources in adipose tissue. Similar results were obtained in mice with knockout the glucose transporter 4 GLUT4 in muscle and/or adipose tissue. Insulin microinjections in the brain, in the cerebral ventricle 4 (ICV) and mediobasal hypothalamus (MBH) did not affect the insulin levels in the general circulation, but effectively activated lipogenesis and inhibited lipolysis in adipose tissue. They induced obesity, similar to conventional obesity when the insulin levels increased. These results may serve as additional evidence for importance of the adipogenic insulin function in mechanisms of regulation of general metabolism. PMID:26973181

  10. Syngeneic Cardiac and Bone Marrow Stromal Cells Display Tissue-Specific microRNA Signatures and microRNA Subsets Restricted to Diverse Differentiation Processes

    PubMed Central

    Meraviglia, Viviana; Azzimato, Valerio; Piacentini, Luca; Chiesa, Mattia; Kesharwani, Rupesh K.; Frati, Caterina; Capogrossi, Maurizio C.; Gaetano, Carlo; Pompilio, Giulio

    2014-01-01

    MicroRNAs are key modulators at molecular level in different biological processes, including determination of cell fate and differentiation. Herein, microRNA expression profiling experiments were performed on syngeneic cardiac (CStC) and bone marrow (BMStC) mesenchymal stromal cells cultured in standard growth medium and then in vitro exposed to adipogenic, osteogenic, cardiomyogenic and endothelial differentiation media. Analysis identified a tissue-specific microRNA signature composed of 16 microRNAs that univocally discriminated cell type of origin and that were completely unaffected by in vitro differentiation media: 4 microRNAs were over-expressed in cardiac stromal cells, and 12 were overexpressed or present only in bone marrow stromal cells. Further, results revealed microRNA subsets specifically modulated by each differentiation medium, irrespective of the cell type of origin, and a subset of 7 microRNAs that were down-regulated by all media with respect to growth medium. Finally, we identified 16 microRNAs that were differentially modulated by the media when comparing the two tissues of origin. The existence of a tissue-specific microRNA signature surviving to any differentiation stimuli, strongly support the role if microRNAs determining cell identity related to tissue origin. Moreover, we identified microRNA subsets modulated by different culture conditions in a tissue-specific manner, pointing out their importance during differentiation processes. PMID:25232725

  11. HDAC-regulated myomiRs control BAF60 variant exchange and direct the functional phenotype of fibro-adipogenic progenitors in dystrophic muscles.

    PubMed

    Saccone, Valentina; Consalvi, Silvia; Giordani, Lorenzo; Mozzetta, Chiara; Barozzi, Iros; Sandoná, Martina; Ryan, Tammy; Rojas-Muñoz, Agustin; Madaro, Luca; Fasanaro, Pasquale; Borsellino, Giovanna; De Bardi, Marco; Frigè, Gianmaria; Termanini, Alberto; Sun, Xin; Rossant, Janet; Bruneau, Benoit G; Mercola, Mark; Minucci, Saverio; Puri, Pier Lorenzo

    2014-04-15

    Fibro-adipogenic progenitors (FAPs) are important components of the skeletal muscle regenerative environment. Whether FAPs support muscle regeneration or promote fibro-adipogenic degeneration is emerging as a key determinant in the pathogenesis of muscular diseases, including Duchenne muscular dystrophy (DMD). However, the molecular mechanism that controls FAP lineage commitment and activity is currently unknown. We show here that an HDAC-myomiR-BAF60 variant network regulates the fate of FAPs in dystrophic muscles of mdx mice. Combinatorial analysis of gene expression microarray, genome-wide chromatin remodeling by nuclease accessibility (NA) combined with next-generation sequencing (NA-seq), small RNA sequencing (RNA-seq), and microRNA (miR) high-throughput screening (HTS) against SWI/SNF BAF60 variants revealed that HDAC inhibitors (HDACis) derepress a "latent" myogenic program in FAPs from dystrophic muscles at early stages of disease. Specifically, HDAC inhibition induces two core components of the myogenic transcriptional machinery, MYOD and BAF60C, and up-regulates the myogenic miRs (myomiRs) (miR-1.2, miR-133, and miR-206), which target the alternative BAF60 variants BAF60A and BAF60B, ultimately directing promyogenic differentiation while suppressing the fibro-adipogenic phenotype. In contrast, FAPs from late stage dystrophic muscles are resistant to HDACi-induced chromatin remodeling at myogenic loci and fail to activate the promyogenic phenotype. These results reveal a previously unappreciated disease stage-specific bipotency of mesenchimal cells within the regenerative environment of dystrophic muscles. Resolution of such bipotency by epigenetic intervention with HDACis provides a molecular rationale for the in situ reprogramming of target cells to promote therapeutic regeneration of dystrophic muscles.

  12. Nitrogen Source and External Medium pH Interaction Differentially Affects Root and Shoot Metabolism in Arabidopsis

    PubMed Central

    Sarasketa, Asier; González-Moro, M. Begoña; González-Murua, Carmen; Marino, Daniel

    2016-01-01

    Ammonium nutrition often represents an important growth-limiting stress in plants. Some of the symptoms that plants present under ammonium nutrition have been associated with pH deregulation, in fact external medium pH control is known to improve plants ammonium tolerance. However, the way plant cell metabolism adjusts to these changes is not completely understood. Thus, in this work we focused on how Arabidopsis thaliana shoot and root respond to different nutritional regimes by varying the nitrogen source (NO3- and NH4+), concentration (2 and 10 mM) and pH of the external medium (5.7 and 6.7) to gain a deeper understanding of cell metabolic adaptation upon altering these environmental factors. The results obtained evidence changes in the response of ammonium assimilation machinery and of the anaplerotic enzymes associated to Tricarboxylic Acids (TCA) cycle in function of the plant organ, the nitrogen source and the degree of ammonium stress. A greater stress severity at pH 5.7 was related to NH4+ accumulation; this could not be circumvented in spite of the stimulation of glutamine synthetase, glutamate dehydrogenase, and TCA cycle anaplerotic enzymes. Moreover, this study suggests specific functions for different gln and gdh isoforms based on the nutritional regime. Overall, NH4+ accumulation triggering ammonium stress appears to bear no relation to nitrogen assimilation impairment. PMID:26870054

  13. Hyperglycemia Diverts Dividing Osteoblastic Precursor Cells to an Adipogenic Pathway and Induces Synthesis of a Hyaluronan Matrix That Is Adhesive for Monocytes*

    PubMed Central

    Wang, Aimin; Midura, Ronald J.; Vasanji, Amit; Wang, Andrew J.; Hascall, Vincent C.

    2014-01-01

    Isolated rat bone marrow stromal cells cultured in osteogenic medium in which the normal 5.6 mm glucose is changed to hyperglycemic 25.6 mm glucose greatly increase lipid formation between 21–31 days of culture that is associated with decreased biomineralization, up-regulate expression of cyclin D3 and two adipogenic markers (CCAAT/enhancer binding protein α and peroxisome proliferator-activated receptor γ) within 5 days of culture, increase neutral and polar lipid synthesis within 5 days of culture, and form a monocyte-adhesive hyaluronan matrix through an endoplasmic reticulum stress-induced autophagic mechanism. Evidence is also provided that, by 4 weeks after diabetes onset in the streptozotocin-induced diabetic rat model, there is a large loss of trabecular bone mineral density without apparent proportional changes in underlying collagen matrices, a large accumulation of a hyaluronan matrix within the trabecular bone marrow, and adipocytes and macrophages embedded in this hyaluronan matrix. These results support the hypothesis that hyperglycemia in bone marrow diverts dividing osteoblastic precursor cells (bone marrow stromal cells) to a metabolically stressed adipogenic pathway that induces synthesis of a hyaluronan matrix that recruits inflammatory cells and establishes a chronic inflammatory process that demineralizes trabecular cancellous bone. PMID:24569987

  14. Testicular cell-conditioned medium supports embryonic stem cell differentiation toward germ lineage and to spermatocyte- and oocyte-like cells.

    PubMed

    Shah, Syed M; Saini, Neha; Singh, Manoj K; Manik, Radheysham; Singla, Suresh K; Palta, Prabhat; Chauhan, Manmohan S

    2016-08-01

    Testicular cells are believed to secrete various growth factors that activate signaling pathways finally leading to gametogenesis. In vitro gametogenesis is an obscure but paramountly important task primarily because of paucity of the precursor cells and first trimester gonadal tissues. To overcome these limitations for development of in vitro gametes, the present study was designed to induce differentiation of buffalo embryonic stem (ES) cells into germ lineage cells on stimulation by testicular cell-conditioned medium (TCM), on the basis of the assumption that ES cells have the intrinsic property to differentiate into any cell type and TCM would provide the necessary growth factors for differentiation toward germ cell lineage. For this purpose, buffalo ES cells were differentiated as embryoid bodies (EB) in floating cultures and as monolayer adherent cultures in different doses (10%, 20%, and 40%) of TCM for different culture intervals (4, 8, and 14 days), to identify the optimum dose-and-time period. We observed that 40% TCM dose induces highest expression of primordial germ cell-specific (DAZL, VASA, and PLZF), meiotic (SYCP3, MLH1, TNP1/2, and PRM2), spermatocyte-specific (BOULE and TEKT1), and oocyte-specific genes (GDF9 and ZP2/3) for a culture period of 14 days under both floating and adherent differentiation. Immunocytochemical analysis of EBs and adherent cultures revealed presence of primordial germ cell markers (c-KIT, DAZL, and VASA), meiotic markers (SYCP3, MLH1 and PROTAMINE1), spermatocyte markers (ACROSIN and HAPRIN), and oocyte markers (GDF9 and ZP4), indicating progression into post-meiotic gametogenesis. The detection of germ cell-specific proteins in Day 14 EBs like VASA, GDF9, and ZP4 by Western blotting further confirmed germ lineage differentiation. The significantly lower (P < 0.05) concentration of 5-methyl-2-deoxycytidine in optimally differentiated EBs is suggestive of the process of methylation erasure. Oocyte-like structures

  15. Induction of E-cadherin+ human amniotic fluid cell differentiation into oocyte-like cells via culture in medium supplemented with follicular fluid.

    PubMed

    Liu, Te; Huang, Yongyi; Bu, Yanzhen; Zhao, Yanhui; Zou, Gang; Liu, Zhixue

    2014-07-01

    Pluripotent human amniotic fluid cells (HuAFCs) can differentiate into various types of somatic cell in vitro. However, their differentiation into oocyte-like cells has never been described to the best of our knowledge. In the present study, differentiation of E-cadherin+ and E-cadherin- HuAFC sub-populations into oocyte-like cells was induced via culture in medium containing bovine follicular fluid and β-mercaptoethanol. The E-cadherin+ HuAFCs expressed DAZL highly. Post-induction, cells with an oocyte-like phenotype were found among the E-cadherin+ HuAFCs, expressing markers specific to germ cells and oocytes (VASA, ZP3 and GDF9) and meiosis (DMC1 and SCP3). When specific small interfering RNA (siRNA) was used to suppress E-cadherin in the E-cadherin+ HuAFCs, the levels of DAZL expression were reduced. Post-induction, the morphology of the siRNA‑E‑cadherin HuAFCs was poorer and the expression levels of germ cell-specific markers were lower compared with those of the siRNA-mock HuAFCs. Therefore, E-cadherin+ HuAFCs could be more easily induced to differentiate into oocyte-like cells by bovine follicular fluid and β-mercaptoethanol. In addition, the E-cadherin+ HuAFCs exhibited potential characteristics of DAZL protein expression, and thus it was conjectured that bovine follicular fluid acts on DAZL protein and promotes E-cadherin+ HuAFC differentiation into oocyte-like cells.

  16. Induction of E-cadherin+ human amniotic fluid cell differentiation into oocyte-like cells via culture in medium supplemented with follicular fluid.

    PubMed

    Liu, Te; Huang, Yongyi; Bu, Yanzhen; Zhao, Yanhui; Zou, Gang; Liu, Zhixue

    2014-07-01

    Pluripotent human amniotic fluid cells (HuAFCs) can differentiate into various types of somatic cell in vitro. However, their differentiation into oocyte-like cells has never been described to the best of our knowledge. In the present study, differentiation of E-cadherin+ and E-cadherin- HuAFC sub-populations into oocyte-like cells was induced via culture in medium containing bovine follicular fluid and β-mercaptoethanol. The E-cadherin+ HuAFCs expressed DAZL highly. Post-induction, cells with an oocyte-like phenotype were found among the E-cadherin+ HuAFCs, expressing markers specific to germ cells and oocytes (VASA, ZP3 and GDF9) and meiosis (DMC1 and SCP3). When specific small interfering RNA (siRNA) was used to suppress E-cadherin in the E-cadherin+ HuAFCs, the levels of DAZL expression were reduced. Post-induction, the morphology of the siRNA‑E‑cadherin HuAFCs was poorer and the expression levels of germ cell-specific markers were lower compared with those of the siRNA-mock HuAFCs. Therefore, E-cadherin+ HuAFCs could be more easily induced to differentiate into oocyte-like cells by bovine follicular fluid and β-mercaptoethanol. In addition, the E-cadherin+ HuAFCs exhibited potential characteristics of DAZL protein expression, and thus it was conjectured that bovine follicular fluid acts on DAZL protein and promotes E-cadherin+ HuAFC differentiation into oocyte-like cells. PMID:24788191

  17. Ligninolytic peroxidase gene expression by Pleurotus ostreatus: differential regulation in lignocellulose medium and effect of temperature and pH.

    PubMed

    Fernández-Fueyo, Elena; Castanera, Raul; Ruiz-Dueñas, Francisco J; López-Lucendo, María F; Ramírez, Lucía; Pisabarro, Antonio G; Martínez, Angel T

    2014-11-01

    Pleurotus ostreatus is an important edible mushroom and a model lignin degrading organism, whose genome contains nine genes of ligninolytic peroxidases, characteristic of white-rot fungi. These genes encode six manganese peroxidase (MnP) and three versatile peroxidase (VP) isoenzymes. Using liquid chromatography coupled to tandem mass spectrometry, secretion of four of these peroxidase isoenzymes (VP1, VP2, MnP2 and MnP6) was confirmed when P. ostreatus grows in a lignocellulose medium at 25°C (three more isoenzymes were identified by only one unique peptide). Then, the effect of environmental parameters on the expression of the above nine genes was studied by reverse transcription-quantitative PCR by changing the incubation temperature and medium pH of P. ostreatus cultures pre-grown under the above conditions (using specific primers and two reference genes for result normalization). The cultures maintained at 25°C (without pH adjustment) provided the highest levels of peroxidase transcripts and the highest total activity on Mn(2+) (a substrate of both MnP and VP) and Reactive Black 5 (a VP specific substrate). The global analysis of the expression patterns divides peroxidase genes into three main groups according to the level of expression at optimal conditions (vp1/mnp3>vp2/vp3/mnp1/mnp2/mnp6>mnp4/mnp5). Decreasing or increasing the incubation temperature (to 10°C or 37°C) and adjusting the culture pH to acidic or alkaline conditions (pH 3 and 8) generally led to downregulation of most of the peroxidase genes (and decrease of the enzymatic activity), as shown when the transcription levels were referred to those found in the cultures maintained at the initial conditions. Temperature modification produced less dramatic effects than pH modification, with most genes being downregulated during the whole 10°C treatment, while many of them were alternatively upregulated (often 6h after the thermal shock) and downregulated (12h) at 37°C. Interestingly, mnp4 and

  18. Ligninolytic peroxidase gene expression by Pleurotus ostreatus: differential regulation in lignocellulose medium and effect of temperature and pH.

    PubMed

    Fernández-Fueyo, Elena; Castanera, Raul; Ruiz-Dueñas, Francisco J; López-Lucendo, María F; Ramírez, Lucía; Pisabarro, Antonio G; Martínez, Angel T

    2014-11-01

    Pleurotus ostreatus is an important edible mushroom and a model lignin degrading organism, whose genome contains nine genes of ligninolytic peroxidases, characteristic of white-rot fungi. These genes encode six manganese peroxidase (MnP) and three versatile peroxidase (VP) isoenzymes. Using liquid chromatography coupled to tandem mass spectrometry, secretion of four of these peroxidase isoenzymes (VP1, VP2, MnP2 and MnP6) was confirmed when P. ostreatus grows in a lignocellulose medium at 25°C (three more isoenzymes were identified by only one unique peptide). Then, the effect of environmental parameters on the expression of the above nine genes was studied by reverse transcription-quantitative PCR by changing the incubation temperature and medium pH of P. ostreatus cultures pre-grown under the above conditions (using specific primers and two reference genes for result normalization). The cultures maintained at 25°C (without pH adjustment) provided the highest levels of peroxidase transcripts and the highest total activity on Mn(2+) (a substrate of both MnP and VP) and Reactive Black 5 (a VP specific substrate). The global analysis of the expression patterns divides peroxidase genes into three main groups according to the level of expression at optimal conditions (vp1/mnp3>vp2/vp3/mnp1/mnp2/mnp6>mnp4/mnp5). Decreasing or increasing the incubation temperature (to 10°C or 37°C) and adjusting the culture pH to acidic or alkaline conditions (pH 3 and 8) generally led to downregulation of most of the peroxidase genes (and decrease of the enzymatic activity), as shown when the transcription levels were referred to those found in the cultures maintained at the initial conditions. Temperature modification produced less dramatic effects than pH modification, with most genes being downregulated during the whole 10°C treatment, while many of them were alternatively upregulated (often 6h after the thermal shock) and downregulated (12h) at 37°C. Interestingly, mnp4 and

  19. Yin yang 1 and adipogenic gene network expression in longissimus muscle of beef cattle in response to nutritional management.

    PubMed

    Moisá, Sonia J; Shike, Daniel W; Meteer, William T; Keisler, Duane; Faulkner, Dan B; Loor, Juan J

    2013-01-01

    Among 36 differentially-expressed genes during growth in longissimus muscle (LM) of Angus steers, Yin Yang 1 (YY1) had the most relationships with other genes including some associated with adipocyte differentiation. The objective of this study was to examine the effect of nutritional management on mRNA expression of YY1 along with its targets genes PPARG, GTF2B, KAT2B, IGFBP5 and STAT5B. Longissimus from Angus and Angus × Simmental steers (7 total/treatment) on early weaning plus high-starch (EWS), normal weaning plus starch creep feeding (NWS), or normal weaning without starch creep feeding (NWN) was biopsied at 0, 96, and 240 days on treatments. Results suggest that YY1 does not exert control of adipogenesis in LM, and its expression is not sensitive to weaning age. Among the YY1-related genes, EWS led to greater IGFBP5 during growing and finishing phases. Pro-adipogenic transcriptional regulation was detected in EWS due to greater PPARG and VDR at 96 and 240 d vs. 0 d. GTF2B and KAT2B expression was lower in response to NWS and EWS than NWN, and was most pronounced at 240 d. The increase in PPARG and GTF2B expression between 96 and 240 d underscored the existence of a molecular programming mechanism that was sensitive to age and dietary starch. Such response partly explains the greater carcass fat deposition observed in response to NWS. PMID:23700364

  20. Differential equations governing slip-induced pore-pressure fluctuations in a water-saturated granular medium

    USGS Publications Warehouse

    Iverson, R.M.

    1993-01-01

    Macroscopic frictional slip in water-saturated granular media occurs commonly during landsliding, surface faulting, and intense bedload transport. A mathematical model of dynamic pore-pressure fluctuations that accompany and influence such sliding is derived here by both inductive and deductive methods. The inductive derivation shows how the governing differential equations represent the physics of the steadily sliding array of cylindrical fiberglass rods investigated experimentally by Iverson and LaHusen (1989). The deductive derivation shows how the same equations result from a novel application of Biot's (1956) dynamic mixture theory to macroscopic deformation. The model consists of two linear differential equations and five initial and boundary conditions that govern solid displacements and pore-water pressures. Solid displacements and water pressures are strongly coupled, in part through a boundary condition that ensures mass conservation during irreversible pore deformation that occurs along the bumpy slip surface. Feedback between this deformation and the pore-pressure field may yield complex system responses. The dual derivations of the model help explicate key assumptions. For example, the model requires that the dimensionless parameter B, defined here through normalization of Biot's equations, is much larger than one. This indicates that solid-fluid coupling forces are dominated by viscous rather than inertial effects. A tabulation of physical and kinematic variables for the rod-array experiments of Iverson and LaHusen and for various geologic phenomena shows that the model assumptions commonly are satisfied. A subsequent paper will describe model tests against experimental data. ?? 1993 International Association for Mathematical Geology.

  1. The differentiation of amniotic fluid stem cells into sweat glandlike cells is enhanced by the presence of Sonic hedgehog in the conditioned medium.

    PubMed

    Liang, Hansi; Sun, Qing; Zhen, Yunfang; Li, Fang; Xu, YunYun; Liu, Yao; Zhang, Xueguang; Qin, Mingde

    2016-09-01

    After patients suffer severe full-thickness burn injuries, the current treatments cannot lead to the complete self-regeneration of the sweat gland structure and function. Therefore, it is important to identify new methods for acquiring sufficient functional sweat gland cells to restore skin function. In this study, we induced CD117+ human amniotic fluid stem (hAFS) cells to differentiate into sweat glandlike (hAFS-SG) cells based on the use of conditioned medium (CM) from the human sweat gland (hSG) cells. Real-time PCR and immunofluorescent staining were used to confirm the expression of the sweat gland-related genes Ectodysplasin-A (EDA), Ectodysplasin-A receptor (EDAR), keratin 8 (K8) and carcino-embryonic antigen (CEA). Transmission electron microscopy analysis shows that microvilli, the cellular structures that are typical for hSG cells, can also be observed on the membrane of the hAFS-SG cells. Our test for the calcium response to acetylcholine (Ach) proved that hAFS-SG cells have the potential to respond to Ach in a manner similar to normal sweat glands. A three-dimensional culture is an effective approach that stimulates the hAFS-SG cells to form tubular structures and drives hAFS-SG cells to mature into higher stage. We also found that epidermal growth factor enhances the efficiency of differentiation and that Sonic hedgehog is an important factor of the CM that influences sweat gland differentiation. Our study provides the basis for further investigations into novel methods of inducing stem cells to differentiate into sweat glandlike cells. PMID:27120089

  2. RKIP phosphorylation-dependent ERK1 activation stimulates adipogenic lipid accumulation in 3T3-L1 preadipocytes overexpressing LC3.

    PubMed

    Hahm, Jong Ryeal; Ahmed, Mahmoud; Kim, Deok Ryong

    2016-09-01

    3T3-L1 preadipocytes undergo adipogenesis in response to treatment with dexamethaxone, 1-methyl-3-isobutylxanthine, and insulin (DMI) through activation of several adipogenic transcription factors. Many autophagy-related proteins are also highly activated in the earlier stages of adipogenesis, and the LC3 conjugation system is required for formation of lipid droplets. Here, we investigated the effect of overexpression of green fluorescent protein (GFP)-LC3 fusion protein on adipogenesis. Overexpression of GFP-LC3 in 3T3-L1 preadipocytes using poly-l-lysine-assisted adenoviral GFP-LC3 transduction was sufficient to produce intracellular lipid droplets. Indeed, GFP-LC3 overexpression stimulated expression of some adipogenic transcription factors (e.g., C/EBPα or β, PPARγ, SREBP2). In particular, SREBP2 was highly activated in preadipocytes transfected with adenoviral GFP-LC3. Also, phosphorylation of Raf kinase inhibitory protein (RKIP) at serine 153, consequently stimulating extracellular-signal regulated kinase (ERK)1 activity, was significantly increased during adipogenesis induced by either poly-l-lysine-assisted adenoviral GFP-LC3 transduction or culture in the presence of dexamethasone, 1-methyl-3-isobutylxanthine, and insulin. Furthermore, RKIP knockdown promoted ERK1 and PPARγ activation, and significantly increased the intracellular accumulation of triacylglycerides in DMI-induced adipogenesis. In conclusion, GFP-LC3 overexpression in 3T3-L1 preadipocytes stimulates adipocyte differentiation via direct modulation of RKIP-dependent ERK1 activity. PMID:27470585

  3. RKIP phosphorylation-dependent ERK1 activation stimulates adipogenic lipid accumulation in 3T3-L1 preadipocytes overexpressing LC3.

    PubMed

    Hahm, Jong Ryeal; Ahmed, Mahmoud; Kim, Deok Ryong

    2016-09-01

    3T3-L1 preadipocytes undergo adipogenesis in response to treatment with dexamethaxone, 1-methyl-3-isobutylxanthine, and insulin (DMI) through activation of several adipogenic transcription factors. Many autophagy-related proteins are also highly activated in the earlier stages of adipogenesis, and the LC3 conjugation system is required for formation of lipid droplets. Here, we investigated the effect of overexpression of green fluorescent protein (GFP)-LC3 fusion protein on adipogenesis. Overexpression of GFP-LC3 in 3T3-L1 preadipocytes using poly-l-lysine-assisted adenoviral GFP-LC3 transduction was sufficient to produce intracellular lipid droplets. Indeed, GFP-LC3 overexpression stimulated expression of some adipogenic transcription factors (e.g., C/EBPα or β, PPARγ, SREBP2). In particular, SREBP2 was highly activated in preadipocytes transfected with adenoviral GFP-LC3. Also, phosphorylation of Raf kinase inhibitory protein (RKIP) at serine 153, consequently stimulating extracellular-signal regulated kinase (ERK)1 activity, was significantly increased during adipogenesis induced by either poly-l-lysine-assisted adenoviral GFP-LC3 transduction or culture in the presence of dexamethasone, 1-methyl-3-isobutylxanthine, and insulin. Furthermore, RKIP knockdown promoted ERK1 and PPARγ activation, and significantly increased the intracellular accumulation of triacylglycerides in DMI-induced adipogenesis. In conclusion, GFP-LC3 overexpression in 3T3-L1 preadipocytes stimulates adipocyte differentiation via direct modulation of RKIP-dependent ERK1 activity.

  4. Differential susceptibility of cholinergic and noncholinergic neurogenic responses to calcium channel blockers and low Ca2+ medium in rat urinary bladder.

    PubMed Central

    Bhat, M. B.; Mishra, S. K.; Raviprakash, V.

    1989-01-01

    1. The influence of calcium channel blockers and low Ca2+ medium on the neurogenic responses to single pulse electric field stimulation in rat urinary bladder has been examined. 2. Single pulse stimulation evoked a biphasic contractile response consisting of a fast component with a time to peak of 0.72 +/- 0.05 s and a slow component that reached a maximal tension at 2.8 +/- 0.21 s, possibly mediated by two different neurotransmitters. 3. Atropine (3 x 10(-6) M) selectively inhibited the slow component without altering the fast component, suggesting the involvement of cholinergic and non-cholinergic neurotransmitters, respectively. 4. Reducing Ca2+ in the medium to 1/4 of the normal, abolished the slow component of the neurogenic response while the fast contractile response was not altered which may indicate a relatively greater dependence of the cholinergic component on extracellular Ca2+ than the noncholinergic one. 5. The IC50 values for the fast component with respect to verapamil and diltiazem were 1.08 microM and 1.76 microM, respectively. The greater susceptibility of the slow component to calcium channel blockers (IC50 values of verapamil: 0.07 microM and of diltiazem: 0.25 microM) indicates the differential activation of slow calcium channels by the endogenously released substances. 6. Calcium channel blockers inhibited the ATP-induced contraction which was comparable to that of the non-cholinergic component of the neurogenic response suggesting the involvement of ATP as a possible neurotransmitter. 7. Ach-induced contractions were relatively less susceptible to calcium channel blockers and low Ca2+ medium than was the atropine-sensitive cholinergic component of the neurogenic response. PMID:2743079

  5. Heat pump without particle transport or external work on the medium achieved by differential thermostatting of the phase space.

    PubMed

    Patra, Puneet Kumar; Bhattacharya, Baidurya

    2016-03-01

    We propose a mechanism that enables heat flow from a colder region to a hotter region without necessitating either particle transport or external work on the conductor, thereby bypassing the compressor part of a classical heat pump cycle. Our mechanism relies on thermostatting the kinetic and configurational temperatures of the same particle differently. We keep the two ends of a conductor, which in the present study is a single dimensional ϕ(4) chain, at the same kinetic temperature T(0), but at different configurational temperatures--one end hotter and the other end colder than T(0). While external energy is needed within the thermostatted regions to achieve this differential thermostatting, no external work is performed on the system itself. We show that the mechanism satisfies the statistical form of the second law of thermodynamics (the fluctuation theorem). The proposed mechanism reveals two interesting findings: (i) contrary to traditional thermodynamics where only the kinetic temperature is thought to govern heat conduction, configurational temperature can also play an important role, and (ii) the relative temperature difference between the kinetic and configurational variables governs the direction of heat flow. The challenge, however, is in developing experimental techniques to thermostat the kinetic and configurational variables of the same particle at different values.

  6. Heat pump without particle transport or external work on the medium achieved by differential thermostatting of the phase space.

    PubMed

    Patra, Puneet Kumar; Bhattacharya, Baidurya

    2016-03-01

    We propose a mechanism that enables heat flow from a colder region to a hotter region without necessitating either particle transport or external work on the conductor, thereby bypassing the compressor part of a classical heat pump cycle. Our mechanism relies on thermostatting the kinetic and configurational temperatures of the same particle differently. We keep the two ends of a conductor, which in the present study is a single dimensional ϕ(4) chain, at the same kinetic temperature T(0), but at different configurational temperatures--one end hotter and the other end colder than T(0). While external energy is needed within the thermostatted regions to achieve this differential thermostatting, no external work is performed on the system itself. We show that the mechanism satisfies the statistical form of the second law of thermodynamics (the fluctuation theorem). The proposed mechanism reveals two interesting findings: (i) contrary to traditional thermodynamics where only the kinetic temperature is thought to govern heat conduction, configurational temperature can also play an important role, and (ii) the relative temperature difference between the kinetic and configurational variables governs the direction of heat flow. The challenge, however, is in developing experimental techniques to thermostat the kinetic and configurational variables of the same particle at different values. PMID:27078485

  7. Heat pump without particle transport or external work on the medium achieved by differential thermostatting of the phase space

    NASA Astrophysics Data System (ADS)

    Patra, Puneet Kumar; Bhattacharya, Baidurya

    2016-03-01

    We propose a mechanism that enables heat flow from a colder region to a hotter region without necessitating either particle transport or external work on the conductor, thereby bypassing the compressor part of a classical heat pump cycle. Our mechanism relies on thermostatting the kinetic and configurational temperatures of the same particle differently. We keep the two ends of a conductor, which in the present study is a single dimensional ϕ4 chain, at the same kinetic temperature T0, but at different configurational temperatures—one end hotter and the other end colder than T0. While external energy is needed within the thermostatted regions to achieve this differential thermostatting, no external work is performed on the system itself. We show that the mechanism satisfies the statistical form of the second law of thermodynamics (the fluctuation theorem). The proposed mechanism reveals two interesting findings: (i) contrary to traditional thermodynamics where only the kinetic temperature is thought to govern heat conduction, configurational temperature can also play an important role, and (ii) the relative temperature difference between the kinetic and configurational variables governs the direction of heat flow. The challenge, however, is in developing experimental techniques to thermostat the kinetic and configurational variables of the same particle at different values.

  8. Estrogen-related receptor {alpha} modulates the expression of adipogenesis-related genes during adipocyte differentiation

    SciTech Connect

    Ijichi, Nobuhiro; Ikeda, Kazuhiro; Horie-Inoue, Kuniko; Yagi, Ken; Okazaki, Yasushi; Inoue, Satoshi . E-mail: INOUE-GER@h.u-tokyo.ac.jp

    2007-07-06

    Estrogen-related receptor {alpha} (ERR{alpha}) is an orphan nuclear receptor that regulates cellular energy metabolism by modulating gene expression involved in fatty acid oxidation and mitochondrial biogenesis in brown adipose tissue. However, the physiological role of ERR{alpha} in adipogenesis and white adipose tissue development has not been well studied. Here, we show that ERR{alpha} and ERR{alpha}-related transcriptional coactivators, peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) coactivator-1{alpha} (PGC-1{alpha}) and PGC-1{beta}, can be up-regulated in 3T3-L1 preadipocytes at mRNA levels under the adipogenic differentiation condition including the inducer of cAMP, glucocorticoid, and insulin. Gene knockdown by ERR{alpha}-specific siRNA results in mRNA down-regulation of fatty acid binding protein 4, PPAR{gamma}, and PGC-1{alpha} in 3T3-L1 cells in the adipogenesis medium. ERR{alpha} and PGC-1{beta} mRNA expression can be also up-regulated in another preadipocyte lineage DFAT-D1 cells and a pluripotent mesenchymal cell line C3H10T1/2 under the differentiation condition. Furthermore, stable expression of ERR{alpha} in 3T3-L1 cells up-regulates adipogenic marker genes and promotes triglyceride accumulation during 3T3-L1 differentiation. These results suggest that ERR{alpha} may play a critical role in adipocyte differentiation by modulating the expression of various adipogenesis-related genes.

  9. Adipogenic placenta-derived mesenchymal stem cells are not lineage restricted by withdrawing extrinsic factors: developing a novel visual angle in stem cell biology

    PubMed Central

    Hu, C; Cao, H; Pan, X; Li, J; He, J; Pan, Q; Xin, J; Yu, X; Li, J; Wang, Y; Zhu, D; Li, L

    2016-01-01

    Current evidence implies that differentiated bone marrow mesenchymal stem cells (BMMSCs) can act as progenitor cells and transdifferentiate across lineage boundaries. However, whether this unrestricted lineage has specificities depending on the stem cell type is unknown. Placental-derived mesenchymal stem cells (PDMSCs), an easily accessible and less invasive source, are extremely useful materials in current stem cell therapies. No studies have comprehensively analyzed the transition in morphology, surface antigens, metabolism and multilineage potency of differentiated PDMSCs after their dedifferentiation. In this study, we showed that after withdrawing extrinsic factors, adipogenic PDMSCs reverted to a primitive cell population and retained stem cell characteristics. The mitochondrial network during differentiation and dedifferentiation may serve as a marker of absent or acquired pluripotency in various stem cell models. The new population proliferated faster than unmanipulated PDMSCs and could be differentiated into adipocytes, osteocytes and hepatocytes. The cell adhesion molecules (CAMs) signaling pathway and extracellular matrix (ECM) components modulate cell behavior and enable the cells to proliferate or differentiate during the differentiation, dedifferentiation and redifferentiation processes in our study. These observations indicate that the dedifferentiated PDMSCs are distinguishable from the original PDMSCs and may serve as a novel source in stem cell biology and cell-based therapeutic strategies. Furthermore, whether PDMSCs differentiated into other lineages can be dedifferentiated to a primitive cell population needs to be investigated. PMID:26986509

  10. Conditioned medium from human amniotic epithelial cells may induce the differentiation of human umbilical cord blood mesenchymal stem cells into dopaminergic neuron-like cells.

    PubMed

    Yang, Shu; Sun, Hai-Mei; Yan, Ji-Hong; Xue, Hong; Wu, Bo; Dong, Fang; Li, Wen-Shuai; Ji, Feng-Qing; Zhou, De-Shan

    2013-07-01

    Dopaminergic (DA) neuron therapy has been established as a new clinical tool for treating Parkinson's disease (PD). Prior to cell transplantation, there are two primary issues that must be resolved: one is the appropriate seed cell origin, and the other is the efficient inducing technique. In the present study, human umbilical cord blood-derived mesenchymal stem cells (hUCB-MSCs) were used as the available seed cells, and conditioned medium from human amniotic epithelial cells (ACM) was used as the inducing reagent. Results showed that the proportion of DA neuron-like cells from hUCB-MSCs was significantly increased after cultured in ACM, suggested by the upregulation of DAT, TH, Nurr1, and Pitx3. To identify the process by which ACM induces DA neuron differentiation, we pretreated hUCB-MSCs with k252a, the Trk receptor inhibitor of brain-derived neurotrophic factor (BDNF) and nerve growth factor (NGF), and found that the proportion of DA neuron-like cells was significantly decreased compared with ACM-treated hUCB-MSCs, suggesting that NGF and BDNF in ACM were involved in the differentiation process. However, we could not rule out the involvement of other unidentified factors in the ACM, because ACM + k252a treatment does not fully block DA neuron-like cell differentiation compared with control. The transplantation of ACM-induced hUCB-MSCs could ameliorate behavioral deficits in PD rats, which may be associated with the survival of engrafted DA neuron-like cells. In conclusion, we propose that hUCB-MSCs are a good source of DA neuron-like cells and that ACM is a potential inducer to obtain DA neuron-like cells from hUCB-MSCs in vitro for an ethical and legal cell therapy for PD.

  11. Wnt/β-Catenin Pathway Regulates Cementogenic Differentiation of Adipose Tissue-Deprived Stem Cells in Dental Follicle Cell-Conditioned Medium

    PubMed Central

    Nie, Xin; Zhang, Bo; Zhou, Xia; Deng, Manjing

    2014-01-01

    The formation and attachment of new cementum is crucial for periodontium regeneration. Tissue engineering is currently explored to achieve complete, reliable and reproducible regeneration of the periodontium. The capacity of multipotency and self-renewal makes adipose tissue-deprived stem cells (ADSCs) an excellent cell source for tissue regeneration and repair. After rat ADSCs were cultured in dental follicle cell-conditioned medium (DFC-CM) supplemented with DKK-1, an inhibitor of the Wnt pathway, followed by 7 days of induction, they exhibited several phenotypic characteristics of cementoblast lineages, as indicated by upregulated expression levels of CAP, ALP, BSP and OPN mRNA, and accelerated expression of BSP and CAP proteins. The Wnt/β-catenin signaling pathway controls differentiation of stem cells by regulating the expression of target genes. Cementoblasts share phenotypical features with osteoblasts. In this study, we demonstrated that culturing ADSCs in DFC-CM supplemented with DKK-1 results in inhibition of β-catenin nuclear translocation and down-regulates TCF-4 and LEF-1 mRNA expression levels. We also found that DKK-1 could promote cementogenic differentiation of ADSCs, which was evident by the up-regulation of CAP, ALP, BSP and OPN gene expressions. On the other hand, culturing ADSCs in DFC-CM supplemented with 100 ng/mL Wnt3a, which activates the Wnt/β-catenin pathway, abrogated this effect. Taken together, our study indicates that the Wnt/β-catenin signaling pathway plays an important role in regulating cementogenic differentiation of ADSCs cultured in DFC-CM. These results raise the possibility of using ADSCs for periodontal regeneration by modifying the Wnt/β-catenin pathway. PMID:24806734

  12. Exploring the activated adipogenic niche: interactions of macrophages and adipocyte progenitors.

    PubMed

    Lee, Yun-Hee; Thacker, Robert I; Hall, Brian Eric; Kong, Raymond; Granneman, James G

    2014-01-01

    Adult adipose tissue contains a large supply of progenitors that can renew fat cells for homeostatic tissue maintenance and adaptive growth or regeneration in response to external challenges. However, the in vivo mechanisms that control adipocyte progenitor behavior are poorly characterized. We recently demonstrated that recruitment of adipocyte progenitors by macrophages is a central feature of adipose tissue remodeling under various adipogenic conditions. Catabolic remodeling of white adipose tissue by β3-adrenergic receptor stimulation requires anti-inflammatory M2-polarized macrophages to clear dying adipocytes and to recruit new brown adipocytes from progenitors. In this Extra Views article, we discuss in greater detail the cellular elements of adipogenic niches and report a strategy to isolate and characterize the subpopulations of macrophages and adipocyte progenitors that actively participate in adrenergic tissue remodeling. Further characterization of these subpopulations may facilitate identification of new cellular targets to improve metabolic and immune function of adipose tissue.

  13. Articular cartilage-derived cells hold a strong osteogenic differentiation potential in comparison to mesenchymal stem cells in vitro

    SciTech Connect

    Salamon, Achim; Jonitz-Heincke, Anika; Adam, Stefanie; Rychly, Joachim; Müller-Hilke, Brigitte; Bader, Rainer; Lochner, Katrin; Peters, Kirsten

    2013-11-01

    Cartilaginous matrix-degenerative diseases like osteoarthritis (OA) are characterized by gradual cartilage erosion, and also by increased presence of cells with mesenchymal stem cell (MSC) character within the affected tissues. Moreover, primary chondrocytes long since are known to de-differentiate in vitro and to be chondrogenically re-differentiable. Since both findings appear to conflict with each other, we quantitatively assessed the mesenchymal differentiation potential of OA patient cartilage-derived cells (CDC) towards the osteogenic and adipogenic lineage in vitro and compared it to that of MSC isolated from adipose tissue (adMSC) of healthy donors. We analyzed expression of MSC markers CD29, CD44, CD105, and CD166, and, following osteogenic and adipogenic induction in vitro, quantified their expression of osteogenic and adipogenic differentiation markers. Furthermore, CDC phenotype and proliferation were monitored. We found that CDC exhibit an MSC CD marker expression pattern similar to adMSC and a similar increase in proliferation rate during osteogenic differentiation. In contrast, the marked reduction of proliferation observed during adipogenic differentiation of adMSC was absent in CDC. Quantification of differentiation markers revealed a strong osteogenic differentiation potential for CDC, however almost no capacity for adipogenic differentiation. Since in the pathogenesis of OA, cartilage degeneration coincides with high bone turnover rates, the high osteogenic differentiation potential of OA patient-derived CDC may affect clinical therapeutic regimens aiming at autologous cartilage regeneration in these patients. - Highlights: • We analyze the mesenchymal differentiation capacity of cartilage-derived cells (CDC). • CDC express mesenchymal stem cell (MSC) markers CD29, CD44, CD105, and CD166. • CDC and MSC proliferation is reduced in adipogenesis and increased in osteogenesis. • Adipogenic differentiation is virtually absent in CDC, but

  14. Proliferation and differentiation of bone marrow stromal cells under hypoxic conditions

    SciTech Connect

    Ren Hongying; Cai Huiguo; Han Zhongchao; Yang Renchi; Zhao, Qinjun; Cao Ying; Li Jing; Zhou Cixiang; Liao Lianming; Jia Mingyue; Zhao Qian; Chen Guoqiang . E-mail: chengq@shsmu.edu.cn; Zhao, R.C. |. E-mail: chunhuaz@public.tpt.tj.cn

    2006-08-18

    Low oxygen tension is a potent differentiation inducer of numerous cell types and an effective stimulus of many gene expressions. Here, we described that under 8% O{sub 2}, bone marrow stromal cells (MSCs) exhibited proliferative and morphologic changes. The level of differentiated antigen H-2Dd and the number of G{sub 2}/S/M phase cells increased evidently under 8% O{sub 2} condition. Also, the proportion of wide, flattened, and epithelial-like cells (which were alkaline phosphatase staining positive) in MSCs increased significantly. When cultured in adipogenic medium, there was a 5- to 6-fold increase in the number of lipid droplets under hypoxic conditions compared with that in normoxic culture. We also demonstrated the existence of MSC differentiation under hypoxic conditions by electron microscopy. Expression of Oct4 was inhibited under 8% O{sub 2} condition, but after adipocyte differentiation in normoxic culture and hypoxia-mimicking agents cobalt chloride (CoCl{sub 2}) and deferoxamine mesylate (DFX) treatments, Oct4 was still expressed in MSCs. These results indicate hypoxia accelerates MSC differentiation and hypoxia and hypoxia-mimicking agents exert different effects on MSC differentiation.

  15. Disruption of cell-matrix interactions by heparin enhances mesenchymal progenitor adipocyte differentiation

    SciTech Connect

    Luo Weijun; Shitaye, Hailu; Friedman, Michael; Bennett, Christina N.; Miller, Joshua; MacDougald, Ormond A.; Hankenson, Kurt D.

    2008-11-01

    Differentiation of marrow-derived mesenchymal progenitors to either the osteoblast or adipocyte lineage is reciprocally regulated. Factors that promote osteoblastogenesis inhibit adipogenesis, while adipogenic factors are inhibitory to osteoblast differentiation. Heparin, a soluble glycosaminoglycan, inhibits bone formation in vivo and osteoblast cell differentiation and function in vitro, and has been shown to promote adipocyte differentiation. To elucidate the role that heparin plays in the adipogenic induction of murine mesenchymal progenitors, we studied immortalized marrow stromal cells (IM-MSC), the MSC cell line, ST2, and 3T3L1 pre-adipocytes. Heparin alone was not sufficient to induce adipogenesis, but enhanced the induction under a variety of adipogenic cocktails. This effect was both dose- and time-dependent. Heparin showed a positive effect at concentrations > 0. 1 {mu}g/ml when applied before day 3 during the induction course. Heparin's effect on adipogenesis was independent of cell proliferation, cell density, and extracellular lipid. This effect is likely related to the unique structure of heparin because another polyanionic glycosaminoglycan, dextran sulfate, did not promote adipogenic differentiation. Heparin treatment altered morphology and adhesion characteristics of progenitor cells, resulting in cell rounding and aggregation. As well, heparin counteracted the known inhibitory effect of fibronectin on adipogenesis and decreased basal focal adhesion kinase and paxillin phosphorylation. We conclude that heparin-mediated disruption of cell-matrix adhesion enhances adipogenic potential.

  16. Anti-adipogenic effect of Artemisia annua in diet-induced-obesity mice model

    PubMed Central

    Baek, Hye Kyung; Shim, Hyeji; Lim, Hyunmook; Shim, Minju; Kim, Chul-Kyu; Park, Sang-Kyu; Lee, Yong Seok; Song, Ki-Duk; Kim, Sung-Jo

    2015-01-01

    Obesity has increased continuously in western countries during the last several decades and recently become a problem in developing countries. Currently, anti-obesity drugs originating from natural products are being investigated for their potential to overcome adverse effects associated with chemical drugs. Artemisinic acid, which was isolated from the well-known anti-malaria herb Artemisia annua (AA) L., was recently shown to possess anti-adipogenic effects in vitro. However, the anti-adipogenic effects of AA in animal models have not yet been investigated. Therefore, we conducted daily oral administration with AA water extract in a diet-induced obesity animal model and treated 3T3-L1 cells with AA to confirm the anti-adipogenic effects in the related protein expressions. We then evaluated the physiology, adipose tissue histology and mRNA expressions of many related genes. Inhibition of adipogenesis by the AA water extract was observed in vitro. In the animal model, weight gain was significantly lower in the AA treated group, but there were no changes in food intake volume or calories. Reductions in lipid droplet size and mRNA expression associated with adipogenesis were also observed in animal epididymal fat. This study is the first to report that AA has an anti-obese effects in vivo. PMID:26243598

  17. Anti-adipogenic effect of Artemisia annua in diet-induced-obesity mice model.

    PubMed

    Baek, Hye Kyung; Shim, Hyeji; Lim, Hyunmook; Shim, Minju; Kim, Chul-Kyu; Park, Sang-Kyu; Lee, Yong Seok; Song, Ki-Duk; Kim, Sung-Jo; Yi, Sun Shin

    2015-01-01

    Obesity has increased continuously in western countries during the last several decades and recently become a problem in developing countries. Currently, anti-obesity drugs originating from natural products are being investigated for their potential to overcome adverse effects associated with chemical drugs. Artemisinic acid, which was isolated from the well-known anti-malaria herb Artemisia annua (AA) L., was recently shown to possess anti-adipogenic effects in vitro. However, the anti-adipogenic effects of AA in animal models have not yet been investigated. Therefore, we conducted daily oral administration with AA water extract in a diet-induced obesity animal model and treated 3T3-L1 cells with AA to confirm the anti-adipogenic effects in the related protein expressions. We then evaluated the physiology, adipose tissue histology and mRNA expressions of many related genes. Inhibition of adipogenesis by the AA water extract was observed in vitro. In the animal model, weight gain was significantly lower in the AA treated group, but there were no changes in food intake volume or calories. Reductions in lipid droplet size and mRNA expression associated with adipogenesis were also observed in animal epididymal fat. This study is the first to report that AA has an anti-obese effects in vivo. PMID:26243598

  18. {beta}-Catenin mediates the anti-adipogenic effect of baicalin

    SciTech Connect

    Lee, Haeyong; Bae, Sungmin; Kim, Kijeong; Kim, Wonyong; Chung, Sang-In; Yoon, Yoosik

    2010-08-06

    Research highlights: {yields} Baicalin maintains the levels of {beta}-Catenin during adipogenesis. {yields} {beta}-Catenin mediates the anti-adipogenic effect of baicalin. {yields} Baicalin maintains the WNT/{beta}-Catenin pathway during adipogenesis. -- Abstract: {beta}-Catenin reportedly inhibits adipogenesis through the down-regulations of peroxisome proliferator-activated receptor (PPAR){gamma} and CCAAT/enhancer binding protein (C/EBP){alpha}. We report that baicalin, a natural flavonoid compound, inhibits adipogenesis by modulating {beta}-Catenin. During 3T3-L1 cell adipogenesis, {beta}-Catenin was down-regulated, but baicalin treatment maintained {beta}-Catenin expression. Anti-adipogenic effects of baicalin were significantly attenuated by {beta}-Catenin siRNA transfection. {beta}-Catenin siRNA rescued the reduced expressions of PPAR{gamma}, C/EBP{alpha}, fatty acid binding protein 4 and lipoprotein lipase by baicalin. Furthermore, baicalin modulated members of the WNT/{beta}-Catenin pathway by maintaining the expressions of low-density lipoprotein receptor-related protein 6, disheveled (DVL)2 and DVL3. These findings suggest that {beta}-Catenin mediates the anti-adipogenic effects of baicalin.

  19. In vitro differentiation of human umbilical cord Wharton’s jelly mesenchymal stromal cells to insulin producing clusters

    PubMed Central

    Nekoei, Seideh Masoomeh; Azarpira, Negar; Sadeghi, Ladan; Kamalifar, Sulmaz

    2015-01-01

    AIM: To investigate the differentiation of human Wharton’s jelly derived mesenchymal stromal cells (WJ-MSCs) to insulin producing clusters (IPC) this study was conducted. METHODS: The umbilical cords samples were collected from full term caesarian section mothers and the WJ-MSCS were cultured from tissue explants in High glucose-Dulbecco’s Modified Eagle Medium (H-DMEM); H-DMEM supplemented with 10% fetal bovine serum (FBS) and antibiotics. The expression of CD90, CD44, CD105, CD34 and CD133 as well as osteogenic and adipogenic differentiation of cells in appropriate medium were also evaluated. The cells were differentiated toward IPC with changing the culture medium and adding the small molecules such as nicotinic acid, epidermal growth factor, and exendin-4 during 3 wk period. The gene expression of PDX1, NGN3, Glut2, insulin was monitored by reveres transcription polymerase chain reaction method. The differentiated clusters were stained with Dithizone (DTZ) which confirms the presence of insulin granules. The insulin challenge test (low and high glucose concentration in Krebs-Ringer HEPES buffer) was also used to evaluate the functional properties of differentiated clusters. RESULTS: WJ-MSCS were positive for mesenchymal surface markers (CD90, CD44, CD105), and negative for CD34 and CD133. The accumulation of lipid vacuoles and deposition of calcium mineral in cells were considered as adipogenic and osteogenic potential of WJ-MSCS. The cells also expressed the transcriptional factors such as Nanog and OCT4. During this three step differentiation, the WJ-MSCS morphology was gradually changed from spindle shaped cells in to epithelioid cells and eventually to three dimensional clusters. The clusters expressed PDX1, NGN3, Glut2, and insulin. The cells became bright red color when stained with DTZ and the insulin secretion was also confirmed. In glucose challenge test a significant increase in insulin secretion from 0.91 ± 0.04 μIu/mL (2.8 mmol/L glucose) to

  20. Overexpression of hsa-miR-125b during osteoblastic differentiation does not influence levels of Runx2, osteopontin, and ALPL gene expression

    PubMed Central

    Pinto, M.T.; Nicolete, L.D.F.; Rodrigues, E.S.; Palma, P.V.B.; Orellana, M.D.; Kashima, S.; Covas, D.T.

    2013-01-01

    Multipotent mesenchymal stromal cells (MSCs) were first isolated from bone marrow and then from various adult tissues including placenta, cord blood, deciduous teeth, and amniotic fluid. MSCs are defined or characterized by their ability to adhere to plastic, to express specific surface antigens, and to differentiate into osteogenic, chondrogenic, adipogenic, and myogenic lineages. Although the molecular mechanisms that control MSC proliferation and differentiation are not well understood, the involvement of microRNAs has been reported. In the present study, we investigated the role of miR-125b during osteoblastic differentiation in humans. We found that miR-125b increased during osteoblastic differentiation, as well as Runx2 and ALPL genes. To study whether the gain or loss of miR-125b function influenced osteoblastic differentiation, we transfected MSCs with pre-miR-125b or anti-miR-125b and cultured the transfected cells in an osteoblastic differentiation medium. After transfection, no change was observed in osteoblastic differentiation, and Runx2, OPN, and ALPL gene expression were not changed. These results suggest that the gain or loss of miR-125b function does not influence levels of Runx2, OPN, and ALPL during osteoblastic differentiation. PMID:24036939

  1. Overexpression of hsa-miR-125b during osteoblastic differentiation does not influence levels of Runx2, osteopontin, and ALPL gene expression.

    PubMed

    Pinto, M T; Nicolete, L D F; Rodrigues, E S; Palma, P V B; Orellana, M D; Kashima, S; Covas, D T

    2013-08-01

    Multipotent mesenchymal stromal cells (MSCs) were first isolated from bone marrow and then from various adult tissues including placenta, cord blood, deciduous teeth, and amniotic fluid. MSCs are defined or characterized by their ability to adhere to plastic, to express specific surface antigens, and to differentiate into osteogenic, chondrogenic, adipogenic, and myogenic lineages. Although the molecular mechanisms that control MSC proliferation and differentiation are not well understood, the involvement of microRNAs has been reported. In the present study, we investigated the role of miR-125b during osteoblastic differentiation in humans. We found that miR-125b increased during osteoblastic differentiation, as well as Runx2 and ALPL genes. To study whether the gain or loss of miR-125b function influenced osteoblastic differentiation, we transfected MSCs with pre-miR-125b or anti-miR-125b and cultured the transfected cells in an osteoblastic differentiation medium. After transfection, no change was observed in osteoblastic differentiation, and Runx2, OPN, and ALPL gene expression were not changed. These results suggest that the gain or loss of miR-125b function does not influence levels of Runx2, OPN, and ALPL during osteoblastic differentiation.

  2. Long-Term Fructose Intake Increases Adipogenic Potential: Evidence of Direct Effects of Fructose on Adipocyte Precursor Cells

    PubMed Central

    Zubiría, María Guillermina; Alzamendi, Ana; Moreno, Griselda; Rey, María Amanda; Spinedi, Eduardo; Giovambattista, Andrés

    2016-01-01

    We have previously addressed that fructose rich diet (FRD) intake for three weeks increases the adipogenic potential of stromal vascular fraction cells from the retroperitoneal adipose tissue (RPAT). We have now evaluated the effect of prolonged FRD intake (eight weeks) on metabolic parameters, number of adipocyte precursor cells (APCs) and in vitro adipogenic potential from control (CTR) and FRD adult male rats. Additionally, we have examined the direct fructose effects on the adipogenic capacity of normal APCs. FRD fed rats had increased plasma levels of insulin, triglyceride and leptin, and RPAT mass and adipocyte size. FACS studies showed higher APCs number and adipogenic potential in FRD RPAT pads; data is supported by high mRNA levels of competency markers: PPARγ2 and Zfp423. Complementary in vitro experiments indicate that fructose-exposed normal APCs displayed an overall increased adipogenic capacity. We conclude that the RPAT mass expansion observed in eight week-FRD fed rats depends on combined accelerated adipogenesis and adipocyte hypertrophy, partially due to a direct effect of fructose on APCs. PMID:27049396

  3. Development of a rapid culture method to induce adipocyte differentiation of human bone marrow-derived mesenchymal stem cells

    SciTech Connect

    Ninomiya, Yuichi; Sugahara-Yamashita, Yzumi; Nakachi, Yutaka; Tokuzawa, Yoshimi; Okazaki, Yasushi; Nishiyama, Masahiko

    2010-04-02

    Human mesenchymal stem cells (hMSCs) derived from bone marrow are multipotent stem cells that can regenerate mesenchymal tissues such as adipose, bone or muscle. It is thought that hMSCs can be utilized as a cell resource for tissue engineering and as human models to study cell differentiation mechanisms, such as adipogenesis, osteoblastogenesis and so on. Since it takes 2-3 weeks for hMSCs to differentiate into adipocytes using conventional culture methods, the development of methods to induce faster differentiation into adipocytes is required. In this study we optimized the culture conditions for adipocyte induction to achieve a shorter cultivation time for the induction of adipocyte differentiation in bone marrow-derived hMSCs. Briefly, we used a cocktail of dexamethasone, insulin, methylisobutylxanthine (DIM) plus a peroxisome proliferator-activated receptor {gamma} agonist, rosiglitazone (DIMRo) as a new adipogenic differentiation medium. We successfully shortened the period of cultivation to 7-8 days from 2-3 weeks. We also found that rosiglitazone alone was unable to induce adipocyte differentiation from hMSCs in vitro. However, rosiglitazone appears to enhance hMSC adipogenesis in the presence of other hormones and/or compounds, such as DIM. Furthermore, the inhibitory activity of TGF-{beta}1 on adipogenesis could be investigated using DIMRo-treated hMSCs. We conclude that our rapid new culture method is very useful in measuring the effect of molecules that affect adipogenesis in hMSCs.

  4. Dehydrodiconiferyl Alcohol Isolated from Cucurbita moschata Shows Anti-adipogenic and Anti-lipogenic Effects in 3T3-L1 Cells and Primary Mouse Embryonic Fibroblasts*

    PubMed Central

    Lee, Junghun; Kim, Donghyun; Choi, Jonghyun; Choi, Hyounjeong; Ryu, Jae-Ha; Jeong, Jinhyun; Park, Eun-Jin; Kim, Seon-Hee; Kim, Sunyoung

    2012-01-01

    A water-soluble extract from the stems of Cucurbita moschata, code named PG105, was previously found to contain strong anti-obesity activities in a high fat diet-induced obesity mouse model. One of its biological characteristics is that it inhibits 3T3-L1 adipocyte differentiation. To isolate the biologically active compound(s), conventional solvent fractionation was performed, and the various fractions were tested for anti-adipogenic activity using Oil Red O staining method. A single spot on thin layer chromatography of the chloroform fraction showed a potent anti-adipogenic activity. When purified, the structure of its major component was resolved as dehydrodiconiferyl alcohol (DHCA), a lignan, by NMR and mass spectrometry analysis. In 3T3-L1 cells, synthesized DHCA significantly reduced the expression of several adipocyte marker genes, including peroxisome proliferator-activated receptor γ (Pparg), CCAAT/enhancer-binding protein α (Cebpa), fatty acid-binding protein 4 (Fabp4), sterol response element-binding protein-1c (Srebp1c), and stearoyl-coenzyme A desaturase-1 (Scd), and decreased lipid accumulation without affecting cell viability. DHCA also suppressed the mitotic clonal expansion of preadipocytes (an early event of adipogenesis), probably by suppressing the DNA binding activity of C/EBPβ, and lowered the production level of cyclinA and cyclin-dependent kinase 2 (Cdk2), coinciding with the decrease in DNA synthesis and cell division. In addition, DHCA directly inhibited the expression of SREBP-1c and SCD-1. Similar observations were made, using primary mouse embryonic fibroblasts. Taken together, our data indicate that DHCA may contain dual activities, affecting both adipogenesis and lipogenesis. PMID:22262865

  5. Dehydrodiconiferyl alcohol isolated from Cucurbita moschata shows anti-adipogenic and anti-lipogenic effects in 3T3-L1 cells and primary mouse embryonic fibroblasts.

    PubMed

    Lee, Junghun; Kim, Donghyun; Choi, Jonghyun; Choi, Hyounjeong; Ryu, Jae-Ha; Jeong, Jinhyun; Park, Eun-Jin; Kim, Seon-Hee; Kim, Sunyoung

    2012-03-16

    A water-soluble extract from the stems of Cucurbita moschata, code named PG105, was previously found to contain strong anti-obesity activities in a high fat diet-induced obesity mouse model. One of its biological characteristics is that it inhibits 3T3-L1 adipocyte differentiation. To isolate the biologically active compound(s), conventional solvent fractionation was performed, and the various fractions were tested for anti-adipogenic activity using Oil Red O staining method. A single spot on thin layer chromatography of the chloroform fraction showed a potent anti-adipogenic activity. When purified, the structure of its major component was resolved as dehydrodiconiferyl alcohol (DHCA), a lignan, by NMR and mass spectrometry analysis. In 3T3-L1 cells, synthesized DHCA significantly reduced the expression of several adipocyte marker genes, including peroxisome proliferator-activated receptor γ (Pparg), CCAAT/enhancer-binding protein α (Cebpa), fatty acid-binding protein 4 (Fabp4), sterol response element-binding protein-1c (Srebp1c), and stearoyl-coenzyme A desaturase-1 (Scd), and decreased lipid accumulation without affecting cell viability. DHCA also suppressed the mitotic clonal expansion of preadipocytes (an early event of adipogenesis), probably by suppressing the DNA binding activity of C/EBPβ, and lowered the production level of cyclinA and cyclin-dependent kinase 2 (Cdk2), coinciding with the decrease in DNA synthesis and cell division. In addition, DHCA directly inhibited the expression of SREBP-1c and SCD-1. Similar observations were made, using primary mouse embryonic fibroblasts. Taken together, our data indicate that DHCA may contain dual activities, affecting both adipogenesis and lipogenesis.

  6. A Testa Extract of Black Soybean (Glycine max (L.) Merr.) suppresses Adipogenic Activity of Adipose-derived Stem Cells

    PubMed Central

    Jeon, Younmi; Lee, Myoungsook; Cheon, Yong-Pil

    2015-01-01

    Black soybean teata is helpful to preventing obesity through enhancing energy expenditure and suppressing accumulation in mesenteric adipose tissue. The ethanol testa-extract of Cheongja #3 black soybean (ETCBS) is also have similar effects on obesity. So far, it is not clear whether the ethanol testa extract of black soybean can have effect on the characters of subcutaneous adipose stem cells such as proliferation, activity, and adipogenicity. The doubling time was different between subcutaneous adipose-derived stem (ADS) and visceral ADS cells. By the in vitro culture and passage, the doubling time was increased both of them. The shape was not different between groups and their passages were not cause the change of shapes. In the case of visceral ADS cells, the doubling time was 62.3 h or 40.3 h in control or high fat diet administrated mice, respectively, but not modified in subcutaneous ADS cells. ETCBS administration caused of increased the doubling time from 62.3 h to 84.2 h. ETCBS had suppressive effects on the cellular activity of subcutaneous ADS cells. The intensity of Oil Red O staining was very faint in 100 and 200 μg/mL ETCBS treated groups. The amounts of accumulated triglyceride were also significantly low in 100 and 200 μg/mL treated groups. From these results we know that the doubling times and the effects of ETCBS are different by the anatomical origin of ADS cells. It also suggested that ETCBS may suppress the differentiation of subcutaneous ADS cells into the precursors and maturing of adipocytes. PMID:26973975

  7. A Testa Extract of Black Soybean (Glycine max (L.) Merr.) suppresses Adipogenic Activity of Adipose-derived Stem Cells.

    PubMed

    Jeon, Younmi; Lee, Myoungsook; Cheon, Yong-Pil

    2015-12-01

    Black soybean teata is helpful to preventing obesity through enhancing energy expenditure and suppressing accumulation in mesenteric adipose tissue. The ethanol testa-extract of Cheongja #3 black soybean (ETCBS) is also have similar effects on obesity. So far, it is not clear whether the ethanol testa extract of black soybean can have effect on the characters of subcutaneous adipose stem cells such as proliferation, activity, and adipogenicity. The doubling time was different between subcutaneous adipose-derived stem (ADS) and visceral ADS cells. By the in vitro culture and passage, the doubling time was increased both of them. The shape was not different between groups and their passages were not cause the change of shapes. In the case of visceral ADS cells, the doubling time was 62.3 h or 40.3 h in control or high fat diet administrated mice, respectively, but not modified in subcutaneous ADS cells. ETCBS administration caused of increased the doubling time from 62.3 h to 84.2 h. ETCBS had suppressive effects on the cellular activity of subcutaneous ADS cells. The intensity of Oil Red O staining was very faint in 100 and 200 μg/mL ETCBS treated groups. The amounts of accumulated triglyceride were also significantly low in 100 and 200 μg/mL treated groups. From these results we know that the doubling times and the effects of ETCBS are different by the anatomical origin of ADS cells. It also suggested that ETCBS may suppress the differentiation of subcutaneous ADS cells into the precursors and maturing of adipocytes.

  8. Interplay of Matrix Stiffness and Cell-Cell Contact in Regulating Differentiation of Stem Cells.

    PubMed

    Ye, Kai; Cao, Luping; Li, Shiyu; Yu, Lin; Ding, Jiandong

    2016-08-31

    Stem cells are capable of sensing and responding to the mechanical properties of extracellular matrixes (ECMs). It is well-known that, while osteogenesis is promoted on the stiff matrixes, adipogenesis is enhanced on the soft ones. Herein, we report an "abnormal" tendency of matrix-stiffness-directed stem cell differentiation. Well-defined nanoarrays of cell-adhesive arginine-glycine-aspartate (RGD) peptides were modified onto the surfaces of persistently nonfouling poly(ethylene glycol) (PEG) hydrogels to achieve controlled specific cell adhesion and simultaneously eliminate nonspecific protein adsorption. Mesenchymal stem cells were cultivated on the RGD-nanopatterned PEG hydrogels with the same RGD nanospacing but different hydrogel stiffnesses and incubated in the induction medium to examine the effect of matrix stiffness on osteogenic and adipogenic differentiation extents. When stem cells were kept at a low density during the induction period, the differentiation tendency was consistent with the previous reports in the literature; however, both lineage commitments were favored on the stiff matrices at a high cell density. We interpreted such a complicated stiffness effect at a high cell density in two-dimensional culture as the interplay of matrix stiffness and cell-cell contact. As a result, this study strengthens the essence of the stiffness effect and highlights the combinatory effects of ECM cues and cell cues on stem cell differentiation.

  9. Interplay of Matrix Stiffness and Cell-Cell Contact in Regulating Differentiation of Stem Cells.

    PubMed

    Ye, Kai; Cao, Luping; Li, Shiyu; Yu, Lin; Ding, Jiandong

    2016-08-31

    Stem cells are capable of sensing and responding to the mechanical properties of extracellular matrixes (ECMs). It is well-known that, while osteogenesis is promoted on the stiff matrixes, adipogenesis is enhanced on the soft ones. Herein, we report an "abnormal" tendency of matrix-stiffness-directed stem cell differentiation. Well-defined nanoarrays of cell-adhesive arginine-glycine-aspartate (RGD) peptides were modified onto the surfaces of persistently nonfouling poly(ethylene glycol) (PEG) hydrogels to achieve controlled specific cell adhesion and simultaneously eliminate nonspecific protein adsorption. Mesenchymal stem cells were cultivated on the RGD-nanopatterned PEG hydrogels with the same RGD nanospacing but different hydrogel stiffnesses and incubated in the induction medium to examine the effect of matrix stiffness on osteogenic and adipogenic differentiation extents. When stem cells were kept at a low density during the induction period, the differentiation tendency was consistent with the previous reports in the literature; however, both lineage commitments were favored on the stiff matrices at a high cell density. We interpreted such a complicated stiffness effect at a high cell density in two-dimensional culture as the interplay of matrix stiffness and cell-cell contact. As a result, this study strengthens the essence of the stiffness effect and highlights the combinatory effects of ECM cues and cell cues on stem cell differentiation. PMID:26600563

  10. ERK2 protein regulates the proliferation of human mesenchymal stem cells without affecting their mobilization and differentiation potential

    SciTech Connect

    Carcamo-Orive, Ivan; Tejados, Naiara; Delgado, Jesus; Gaztelumendi, Ainhoa; Otaegui, David; Lang, Valerie; Trigueros, Cesar

    2008-05-01

    Human Mesenchymal Stem Cells (hMSC), derived mainly from adult bone marrow, are valuable models for the study of processes involved in stem cell self-renewal and differentiation. As the Extracellular signal-Regulated Kinase (ERK) signalling pathway is a major contributor to cellular growth, differentiation and survival, we have studied the functions of this kinase in hMSC activity. Ablation of ERK2 gene expression (but not ERK1) by RNA interference significantly reduced proliferation of hMSC. This reduction was due to a defect in Cyclin D1 expression and subsequent arrest in the G0/G1 phase of the cell cycle. hMSC growth is enhanced through culture medium supplementation with growth factors (GFs) such as Platelet-Derived Growth Factor (PDGF), basic Fibroblast Growth Factor (bFGF) or Epidermal Growth Factor (EGF). However, these supplements could not rescue the defect observed after ERK2 knockdown, suggesting a common signalling pathway used by these GFs for proliferation. In contrast, ERK1/2 may be dissociated from chemotactic signalling induced by the same GFs. Additionally, hMSCs were capable of differentiating into adipocytes even in the absence of either ERK1 or ERK2 proteins. Our data show that hMSCs do not require cell division to enter the adipogenic differentiation process, indicating that clonal amplification of these cells is not a critical step. However, cell-cell contact seems to be an essential requirement to be able to differentiate into mature adipocytes.

  11. WEHI-3 cells inhibit adipocyte differentiation in 3T3-L1 cells

    SciTech Connect

    Lai, Jing; Liu, Gexiu; Yan, Guoyao; He, Dongmei; Zhou, Ying; Chen, Shengting

    2015-06-26

    By investigating the anti-adipogenic effects of WEHI-3 cells – a murine acute myelomonocytic leukemia cell line – we sought to improve the efficiency of hematopoietic stem cell transplantation (HSCT). Analysis of Oil Red O staining and the expression of adipogenic genes, including PPARγ, C/EBPα, FAS and LPL, indicated that WEHI-3 cells significantly inhibited 3T3-L1 mouse preadipocyte cells from differentiating into adipocytes. In vivo, fat vacuoles in mice injected with WEHI-3 cells were also remarkably reduced in the murine bone marrow pimelosis model. Moreover, the key gene in the Rho signaling pathway, ROCKII, and the key gene in the Wnt signaling pathway, β-catenin, were both upregulated compared with the control group. siRNA-mediated knockdown of ROCKII and β-catenin reversed these WEHI-3-mediated anti-adipogenic effects. Taken together, these data suggest that WEHI-3 cells exert anti-adipogenic effects and that both ROCKII and β-catenin are involved in this process. - Highlights: • WEHI-3, an acute myelomonocytic leukemia cell line, inhibited 3T3-L1 preadipocyte from differentiating into adipocyte. • WEHI-3 cells can arrest 3T3-L1 cells in G0/G1 phase by secreting soluble factors and thus inhibit their proliferation. • WEHI-3 cells reduced bone marrow pimelosis in the murine model. • Both ROCKII and β-catenin were involved in the WEHI-3-mediated anti-adipogenic effects.

  12. Basic fibroblast growth factor is pro-adipogenic in rat skeletal muscle progenitor clone, 2G11 cells.

    PubMed

    Nakano, Shin-ichi; Nakamura, Katsuyuki; Teramoto, Naomi; Yamanouchi, Keitaro; Nishihara, Masugi

    2016-01-01

    Intramuscular adipose tissue (IMAT) formation is a hallmark of marbling in cattle. IMAT is considered to originate from skeletal muscle progenitor cells with adipogenic potential. However, the mechanism involved in IMAT formation from these progenitor cells in vivo remains unclear. In the present study, among the growth factors tested, which were known to be expressed in skeletal muscle, we found only basic fibroblast growth factor (bFGF) has a pro-adipogenic effect on skeletal muscle derived adipogenic progenitor clone, 2G11 cells. Pre-exposure of 2G11 cells to bFGF did not affect initial gene expressions of CCAAT/enhancer-binding protein (C/EBP)β and C/EBPδ, while resulting in an enhancement of subsequent expressions of C/EBPα and proliferator-activated receptor gamma (PPARγ) during adipogenesis, indicating that bFGF is acting on the transcriptional regulation of C/EBPα and PPARγ. In addition, the effect of bFGF is mediated via two types of FGF receptor (FGFR) isoforms: FGFR1 and FGFR2 IIIc, and both receptors are prerequisite for bFGF to express its pro-adipogenic effect. These results suggest that bFGF plays an important role as a key trigger of IMAT formation in vivo.

  13. Anti-Adipogenic Effects of Ethanol Extracts Prepared from Selected Medicinal Herbs in 3T3-L1 Cells

    PubMed Central

    Park, Min-Jun; Song, Ji-Hye; Shon, Myung-Soo; Kim, Hae Ok; Kwon, O Jun; Roh, Seong-Soo; Kim, Choon Young; Kim, Gyo-Nam

    2016-01-01

    Obesity is a major risk factor for various metabolic diseases such as cardiovascular disease, hypertension, and type 2 diabetes mellitus. In this study, we prepared ethanol extracts from Agastache rugosa (ARE), Chrysanthemum zawadskii (CZE), Mentha arvensis (MAE), Perilla frutescens (PFE), Leonurus sibiricus (LSE), Gardenia jasminoides (GJE), and Lycopus coreanus (LCE). The anti-oxidant and anti-adipogenic effects were evaluated. The IC50 values for ascorbic acid and LCE against 2,2-diphenyl-1-picrylhydrazyl radicals were 246.2 μg/mL and 166.2 μg/mL, respectively, followed by ARE (186.6 μg/mL), CZE (198.6 μg/mL), MAE (337.1 μg/mL), PFE (415.3 μg/mL), LSE (548.2 μg/mL), and GJE (626.3 μg/mL). In non-toxic concentration ranges, CZE had a strong inhibitory effect against 3T3-L1 adipogenes (84.5%) than those of the other extracts. Furthermore, the anti-adipogenic effect of CZE is largely limited in the early stage of adipogenesis, and we revealed that the inhibitory role of CZE in adipogenesis is required for the activation of Wnt signaling. Our results provide scientific evidence that the anti-adipogenic effect of CZE can be applied as an ingredient for the development of functional foods and nutri-cosmetics for obesity prevention. PMID:27752499

  14. Different Culture Media Affect Proliferation, Surface Epitope Expression, and Differentiation of Ovine MSC.

    PubMed

    Adamzyk, Carina; Emonds, Tanja; Falkenstein, Julia; Tolba, René; Jahnen-Dechent, Wilhelm; Lethaus, Bernd; Neuss, Sabine

    2013-01-01

    Orthopedic implants including engineered bone tissue are commonly tested in sheep. To avoid rejection of heterologous or xenogeneic cells, autologous cells are preferably used, that is, ovine mesenchymal stem cells (oMSC). Unlike human MSC, ovine MSC are not well studied regarding isolation, expansion, and characterization. Here we investigated the impact of culture media composition on growth characteristics, differentiation, and surface antigen expression of oMSC. The culture media varied in fetal calf serum (FCS) content and in the addition of supplements and/or additional epidermal growth factor (EGF). We found that FCS strongly influenced oMSC proliferation and that specific combinations of supplemental factors (MCDB-201, ITS-plus, dexamethasone, and L-ascorbic acid) determined the expression of surface epitopes. We compared two published protocols for oMSC differentiation towards the osteogenic, adipogenic, and chondrogenic fate and found (i) considerable donor to donor variations, (ii) protocol-dependent variations, and (iii) variations resulting from the preculture medium composition. Our results indicate that the isolation and culture of oMSC in different growth media are highly variable regarding oMSC phenotype and behaviour. Furthermore, variations from donor to donor critically influence growth rate, surface marker expression, and differentiation. PMID:24228035

  15. Different Culture Media Affect Proliferation, Surface Epitope Expression, and Differentiation of Ovine MSC.

    PubMed

    Adamzyk, Carina; Emonds, Tanja; Falkenstein, Julia; Tolba, René; Jahnen-Dechent, Wilhelm; Lethaus, Bernd; Neuss, Sabine

    2013-01-01

    Orthopedic implants including engineered bone tissue are commonly tested in sheep. To avoid rejection of heterologous or xenogeneic cells, autologous cells are preferably used, that is, ovine mesenchymal stem cells (oMSC). Unlike human MSC, ovine MSC are not well studied regarding isolation, expansion, and characterization. Here we investigated the impact of culture media composition on growth characteristics, differentiation, and surface antigen expression of oMSC. The culture media varied in fetal calf serum (FCS) content and in the addition of supplements and/or additional epidermal growth factor (EGF). We found that FCS strongly influenced oMSC proliferation and that specific combinations of supplemental factors (MCDB-201, ITS-plus, dexamethasone, and L-ascorbic acid) determined the expression of surface epitopes. We compared two published protocols for oMSC differentiation towards the osteogenic, adipogenic, and chondrogenic fate and found (i) considerable donor to donor variations, (ii) protocol-dependent variations, and (iii) variations resulting from the preculture medium composition. Our results indicate that the isolation and culture of oMSC in different growth media are highly variable regarding oMSC phenotype and behaviour. Furthermore, variations from donor to donor critically influence growth rate, surface marker expression, and differentiation.

  16. Prospective evaluation of the chromogenic medium CandiSelect 4 for differentiation and presumptive identification of non-Candida albicans Candida species.

    PubMed

    Zhao, Liang; de Hoog, G Sybren; Cornelissen, Akke; Lyu, Qian; Mou, Lili; Liu, Taohua; Cao, Yu; Vatanshenassan, Mansoureh; Kang, Yingqian

    2016-02-01

    Rapid identification of pathogenic yeasts is a crucial step in timely and appropriate antifungal therapy. For diagnostics in the clinical laboratory, simplified alternatives to barcoding are needed. CandiSelect 4 (CS4) medium, a chromogenic medium for isolation of clinical yeasts, allows routine recognition of Candida albicans and presumptive identification of Candida tropicalis, Candida glabrata, and Candida krusei. We evaluated an extension of this method with 46 non-Candida albicans Candida (NCAC) and 7 Malassezia species. The medium supported growth of all species tested and a wide diversity of cultural types were observed. Colony colours were in violet, turquoise (including green and blue), or white tinges. Eight NCAC species produced violet pigmentation similar to that of C. albicans. Most NCAC species, including C. glabrata and C. tropicalis were distributed in the turquoise group. Malassezia species were invariably blue.

  17. Prospective evaluation of the chromogenic medium CandiSelect 4 for differentiation and presumptive identification of non-Candida albicans Candida species.

    PubMed

    Zhao, Liang; de Hoog, G Sybren; Cornelissen, Akke; Lyu, Qian; Mou, Lili; Liu, Taohua; Cao, Yu; Vatanshenassan, Mansoureh; Kang, Yingqian

    2016-02-01

    Rapid identification of pathogenic yeasts is a crucial step in timely and appropriate antifungal therapy. For diagnostics in the clinical laboratory, simplified alternatives to barcoding are needed. CandiSelect 4 (CS4) medium, a chromogenic medium for isolation of clinical yeasts, allows routine recognition of Candida albicans and presumptive identification of Candida tropicalis, Candida glabrata, and Candida krusei. We evaluated an extension of this method with 46 non-Candida albicans Candida (NCAC) and 7 Malassezia species. The medium supported growth of all species tested and a wide diversity of cultural types were observed. Colony colours were in violet, turquoise (including green and blue), or white tinges. Eight NCAC species produced violet pigmentation similar to that of C. albicans. Most NCAC species, including C. glabrata and C. tropicalis were distributed in the turquoise group. Malassezia species were invariably blue. PMID:26781374

  18. The effect of cell passage number on osteogenic and adipogenic characteristics of D1 cells.

    PubMed

    Kwist, K; Bridges, W C; Burg, K J L

    2016-08-01

    Cell line passage number is an important consideration when designing an experiment. At higher passages, it is generally understood that cell health begins to decline and, when this occurs, the result can be variable data. However, there are no specific guidelines regarding optimal passage range, and this information is dependent on cell type. To explore these variabilities, low passage D1 cells were thawed (passage 3) and passaged serially until a much higher number (passage 34). Samples were taken every five passages and analyzed for alkaline phosphatase and triglyceride; also, the gene expression of both adipogenic and osteogenic markers was tested. The results indicate that the growth rate of these cells did slow down after passage 30. However, expression of the osteogenic characteristics seemed to cycle, with the highest levels seen at passage 4 and 24. The adipocyte expression levels remained the same throughout the study.

  19. Chronic administration of iron and copper potentiates adipogenic effect of high fat diet in Wistar rats.

    PubMed

    Tinkov, Alexey A; Polyakova, Valentina S; Nikonorov, Alexandr A

    2013-06-01

    The primary objective of this research project is explore a possible adipogenic effect of iron and/or copper in albino Wistar rats kept on standard (STD) and high-fat (HFD) diets. The female Wistar rats in the study were divided into eight experimental groups (n = 6). Rats maintained on STD and HFD received 3 mg/l FeSO₄∙7H₂O, 4.88 mg/l CuSO₄ and a combination of 1.5 mg/l FeSO₄∙7H₂O and 2.44 mg/l CuSO₄ with drinking water. Control groups were kept on STD and HFD and received pure water without metal salts. Consumption of iron and copper in the groups of rats maintained on an STD did not produce a significant increase in weight, adipose tissue content or body mass index. However, the adipocyte size and infiltration were increased in the adipose tissue of STD-fed rats receiving a mixture of iron and copper with drinking water. The rats fed iron and copper and, especially, their combination on a HFD background had a significantly higher weight gain, adipose tissue content, morphometric parameters values and adipocyte size compared to STD- and HFD-fed controls. Iron and copper consumption produced their accumulation in the rats' adipose tissue. Moreover, the studied metals reduced adipose tissue concentration of chromium and vanadium. The lipoprotein profile and serum oxidative stress biomarkers were affected in the rats receiving the metals and STD. Hyperglycemia was observed in the rats receiving the studied metals on HFD-background. Based on the analysis of the test subjects, the study suggests that iron and copper administration, especially combined, may potentiate adipogenic effect of HFD.

  20. Platelet Rich Concentrate Promotes Early Cellular Proliferation and Multiple Lineage Differentiation of Human Mesenchymal Stromal Cells In Vitro

    PubMed Central

    Shani, Samuel; Vasudevaraj Naveen, Sangeetha; Murali, Malliga Raman; Puvanan, Karunanithi; Abbas, Azlina Amir; Kamarul, Tunku

    2014-01-01

    Platelet rich concentrate (PRC) is a natural adjuvant that aids in human mesenchymal stromal cell (hMSC) proliferation in vitro; however, its role requires further exploration. This study was conducted to determine the optimal concentration of PRC required for achieving the maximal proliferation, and the need for activating the platelets to achieve this effect, and if PRC could independently induce early differentiation of hMSC. The gene expression of markers for osteocytes (ALP, RUNX2), chondrocytes (SOX9, COL2A1), and adipocytes (PPAR-γ) was determined at each time point in hMSC treated with 15% activated and nonactivated PRC since maximal proliferative effect was achieved at this concentration. The isolated PRC had approximately fourfold higher platelet count than whole blood. There was no significant difference in hMSC proliferation between the activated and nonactivated PRC. Only RUNX2 and SOX9 genes were upregulated throughout the 8 days. However, protein expression study showed formation of oil globules from day 4, significant increase in ALP at days 6 and 8 (P ≤ 0.05), and increased glycosaminoglycan levels at all time points (P < 0.05), suggesting the early differentiation of hMSC into osteogenic and adipogenic lineages. This study demonstrates that the use of PRC increased hMSC proliferation and induced early differentiation of hMSC into multiple mesenchymal lineages, without preactivation or addition of differentiation medium. PMID:25436230

  1. Highly Efficient Neural Differentiation of CD34-Positive Hair-Follicle-Associated Pluripotent Stem Cells Induced by Retinoic Acid and Serum-Free Medium.

    PubMed

    Sagha, Mohsen; Najafzadeh, Nowruz

    2016-01-01

    Neural differentiation of hair-follicle-associated pluripotent (HAP) stem cells residing in the bulge area is a promising autologous source for stem cell therapy. In the present chapter, we describe the identification and enrichment of CD34(+) HAP stem cells by magnetic-activated cell sorting (MACS), and induce them to differentiate into neuronal and glial cells using defined neural-induction media. The different neural cell populations arising during in vitro differentiation from HAP stem cells are characterized by reverse transcription polymerase chain reaction (RT-PCR) and immunocytochemistry assay. PMID:27431256

  2. HGH isoforms: cDNA expression, adipogenic activity and production in cell culture.

    PubMed

    Rincón-Limas, D E; Reséndez-Pérez, D; Ortíz-López, R; Alvídrez-Quihui, L E; Castro-MuñozLedo, F; Kuri-Harcuch, W; Martínez-Rodríguez, H G; Barrera-Saldaña, H A

    1993-02-20

    We have isolated, cloned and achieved functional expression of the cDNAs for both 22 kDa and 20 kDa human growth hormone (hGH) isoforms. A selective cDNA cloning strategy was used to preferentially and simultaneously obtain both hGH 22 kDa and hGH 20 kDa cDNAs. These were used to construct minigenes which were subcloned into two eukaryotic expression vectors and then introduced transiently in COS-7 cells and stably into CHO cells in culture. Transfection assays in COS-7 cells of both minigenes allowed the detection of the secreted hGH 22 kDa and hGH 20 kDa. These hGHs isoforms secreted into COS-7 medium were able to specifically promote differentiation of 3T3-F442A preadipocytes to adipose cells. Adipocyte differentiation was quantitated by Oil Red O triacylglycerol staining or glycerophosphate dehydrogenase activity. Furthermore, stable CHO cell lines have been derived that produce these hGH isoforms.

  3. New medium licensed for campylobacter

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A medium, “Campy-Cefex”, has been licensed by the ARS Office of Technology Transfer with Becton Dickinson (No. 1412-002) and Neogen (No. 1412-001) based on patent No. 5,891,709, “Campy-Cefex Selective and Differential Medium for Campylobacter” by Dr. Norman Stern of the Poultry Microbiological Safet...

  4. The conditioned medium from osteo-differentiating human mesenchymal stem cells affects the viability of triple negative MDA-MB231 breast cancer cells.

    PubMed

    Librizzi, Mariangela; Tobiasch, Edda; Luparello, Claudio

    2016-01-01

    This study aimed to investigate the effect of conditioned media (CM) from osteo-differentiating and adipo-differentiating human mesenchymal stem cells (MSCs) isolated from lipoaspirates of healthy female donors on the viability of triple-negative breast cancer cells MDA-MB231. The CM of undifferentiated and differentiating MSCs were collected after 7, 14, 21 and 28 days of culture. The effects of MSC CM on cell proliferation were assessed using an 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay after 24 h. The effects of osteo-differentiating cell CM on apoptotic promotion, cell cycle impairment, mitochondrial transmembrane potential dissipation, production of reactive oxygen species and autophagosome accumulation were analysed by flow cytometry and Western blot. MTT assay showed that only CM collected from osteo-induced cells at day 28 (d28O-CM) reduced tumour cell viability. Treatment with d28O-CM restrained cell cycle progression through G2 phase, elicited a caspase-8-driven apoptotic effect already after 5 h of culture, and down-regulated autophagosome accumulation and beclin-1 expression. The finding that factor(s) secreted by osteo-differentiating MSCs shows properties of an apoptotic inducer and autophagy inhibitor on triple-negative breast cancer cells may have an important applicative potential that deserves further investigation.

  5. Is cyberbullying worse than traditional bullying? Examining the differential roles of medium, publicity, and anonymity for the perceived severity of bullying.

    PubMed

    Sticca, Fabio; Perren, Sonja

    2013-05-01

    Cyberbullying, a modern form of bullying performed using electronic forms of contact (e.g., SMS, MMS, Facebook, YouTube), has been considered as being worse than traditional bullying in its consequences for the victim. This difference was mainly attributed to some specific aspect that are believed to distinguish cyberbullying from traditional bullying: an increased potential for a large audience, an increased potential for anonymous bullying, lower levels of direct feedback, decreased time and space limits, and lower levels of supervision. The present studies investigated the relative importance of medium (traditional vs. cyber), publicity (public vs. private), and bully's anonymity (anonymous vs. not anonymous) for the perceived severity of hypothetical bullying scenarios among a sample of Swiss seventh- and eight-graders (study 1: 49% female, mean age = 13.7; study 2: 49% female, mean age = 14.2). Participants ranked a set of hypothetical bullying scenarios from the most severe one to the least severe one. The scenarios were experimentally manipulated based on the aspect of medium and publicity (study 1), and medium and anonymity (study 2). Results showed that public scenarios were perceived as worse than private ones, and that anonymous scenarios were perceived as worse than not anonymous ones. Cyber scenarios generally were perceived as worse than traditional ones, although effect sizes were found to be small. These results suggest that the role of medium is secondary to the role of publicity and anonymity when it comes to evaluating bullying severity. Therefore, cyberbullying is not a priori perceived as worse than traditional bullying. Implications of the results for cyberbullying prevention and intervention are discussed.

  6. Human umbilical cord Wharton's jelly stem cells undergo enhanced chondrogenic differentiation when grown on nanofibrous scaffolds and in a sequential two-stage culture medium environment.

    PubMed

    Fong, Chui-Yee; Subramanian, Arjunan; Gauthaman, Kalamegam; Venugopal, Jayarama; Biswas, Arijit; Ramakrishna, Seeram; Bongso, Ariff

    2012-03-01

    The current treatments used for osteoarthritis from cartilage damage have their disadvantages of donor site morbidity, complicated surgical interventions and risks of infection and graft rejection. Recent advances in tissue engineering have offered much promise in cartilage repair but the best cell source and in vitro system have not as yet been optimised. Human bone marrow mesenchymal stem cells (hBMSCs) have thus far been the cell of choice. However, we derived a unique stem cell from the human umbilical cord Wharton's jelly (hWJSC) that has properties superior to hBMSCs in terms of ready availability, prolonged stemness characteristics in vitro, high proliferation rates, wide multipotency, non-tumorigenicity and tolerance in allogeneic transplantation. We observed enhanced cell attachment, cell proliferation and chondrogenesis of hWJSCs over hBMSCs when grown on PCL/Collagen nanoscaffolds in the presence of a two-stage sequential complex/chondrogenic medium for 21 days. Improvement of these three parameters were confirmed via inverted optics, field emission scanning electron microscopy (FESEM), MTT assay, pellet diameters, Alcian blue histology and staining, glycosaminglycans (GAG) and hyaluronic acid production and expression of key chondrogenic genes (SOX9, Collagen type II, COMP, FMOD) using immunohistochemistry and real-time polymerase chain reaction (qRT-PCR). In separate experiments we demonstrated that the 16 ng/ml of basic fibroblast growth factor (bFGF) present in the complex medium may have contributed to driving chondrogenesis. We conclude that hWJSCs are an attractive stem cell source for inducing chondrogenesis in vitro when grown on nanoscaffolds and exposed sequentially first to complex medium and then followed by chondrogenic medium.

  7. Nobiletin suppresses adipogenesis by regulating the expression of adipogenic transcription factors and the activation of AMP-activated protein kinase (AMPK).

    PubMed

    Choi, Youngmin; Kim, Younghwa; Ham, Hyeonmi; Park, Yooheon; Jeong, Heon-Sang; Lee, Junsoo

    2011-12-28

    The objective of this study was to elucidate the effect of nobiletin (5,6,7,8,3',4'-hexamethoxyflavone) on adipogenesis in 3T3-L1 cells. To determine the effect of nobiletin on adipogenesis, preadipocyte differentiation was induced in the presence or absence of nobiletin (10-100 μM) for 4 days. The results revealed that nobiletin markedly inhibited lipid accumulation and glycerol-3-phosphate dehydrogenase (GPDH) activity and blocked the expression of adipogenic transcription factors, including peroxisome proliferator-activated receptors (PPARγ) and CCAAT/enhancer binding proteins (C/EBPα). Moreover, nobiletin significantly increased AMP-activated protein kinase (AMPK), a major regulator of cellular energy balance, phosphorylation, and intracellular reactive oxygen species (ROS) generation. This study also investigated the involvement of AMPK in the expression of a major transcription factor, PPARγ. It was found that pretreatment with compound C, a cell permeable inhibitor of AMPK, abolished the inhibitory effects of nobiletin on PPARγ expression. The results suggest that nobiletin exerts antiadipogenic effects through modulation of the PPARγ and AMPK signaling pathway and, therefore, may be a promising antiobesity agent.

  8. Cell kinetics, DNA integrity, differentiation, and lipid fingerprinting analysis of rabbit adipose-derived stem cells.

    PubMed

    Barretto, Letícia Siqueira de Sá; Lessio, Camila; Sawaki e Nakamura, Ahy Natally; Lo Turco, Edson Guimarães; da Silva, Camila Gonzaga; Zambon, João Paulo; Gozzo, Fábio César; Pilau, Eduardo Jorge; de Almeida, Fernando Gonçalves

    2014-10-01

    Human adipose tissue has been described as a potential alternative reservoir for stem cells. Although studies have been performed in rabbits using autologous adipose-derived stem cells (ADSC), these cells have not been well characterized. The primary objectives of this study were to demonstrate the presence of adipose-derived stem cells isolated from rabbit inguinal fat pads and to characterize them through osteogenic and adipogenic in vitro differentiation and lipid fingerprinting analysis. The secondary objective was to evaluate cell behavior through growth kinetics, cell viability, and DNA integrity. Rabbit ADSCs were isolated to determine the in vitro growth kinetics and cell viability. DNA integrity was assessed by an alkaline Comet assay in passages 0 and 5. The osteogenic differentiation was evaluated by Von Kossa, and Alizarin Red S staining and adipogenic differentiation were assessed by Oil Red O staining. Lipid fingerprinting analyses of control, adipogenic, and osteogenic differentiated cells were performed by MALDI-TOF/MS. We demonstrate that rabbit ADSC have a constant growth rate at the early passages, with increased DNA fragmentation at or after passage 5. Rabbit ADSC viability was similar in passages 2 and 5 (90.7% and 86.6%, respectively), but there was a tendency to decreased cellular growth rate after passage 3. The ADSC were characterized by the expression of surface markers such as CD29 (67.4%) and CD44 (89.4%), using CD 45 (0.77%) as a negative control. ADSC from rabbits were successfully isolated form the inguinal region. These cells were capable to differentiate into osteogenic and adipogenic tissue when they were placed in inductive media. After each passage, there was a trend towards decreased cell growth. On the other hand, DNA fragmentation increased at each passage. ADSC had a different lipid profile when placed in control, adipogenic, or osteogenic media.

  9. Effects of the extract of Ginkgo biloba on the differentiation of bone marrow mesenchymal stem cells in vitro.

    PubMed

    Wu, Zhe; Zhang, Jiadi; Gu, Xu; Zhang, Xiaoxiao; Shi, Shuman; Liu, Chang

    2016-01-01

    The balance of osteogenesis and adipogenesis in bone marrow mesenchymal stem cells (BMSCs) is disrupted in osteoporosis. This study was designed to investigate the effects of extract of Ginkgo biloba (EGB) on proliferation, osteogenic and adipogenic differentiation of bone marrow mesenchymal stem cells in vitro. The effect of EGB on proliferation was evaluated by CCK-8 assay and flow cytometry. Osteogenic differentiation was evaluated by Alizarin Red S staining and Alkaline phosphatase assay. Adipogenic differentiation was evaluated by Oil Red O staining. Quantitative real-time polymerase chain reaction (Real-time PCR) was used to detect the expression of osteogenic specific genes (BMP-2, Runx2 and Colla1) and adipogenic specific genes (ap2, PPARγ). EGB did not significantly affect proliferation of BMSCs. However, it increased the calcium accumulation and significantly promoted the activity of alkaline phosphatase, especially when the concentration of EGB reached 150 µg/mL. EGB dose-dependently inhibited the adipogenic ability of BMSCs. The osteogenic-related genes (BMP-2, Runx2, Colla1) were overexpressed while the expression of genes involved in adipogenesis, such as PPAR-γ and ap2, was decreasing with the increase of EGB concentration. Our data proves that EGB inhibited adipocyte differentiation and enhanced osteogenic differentiation in BMSCs, but had no effect on the proliferation of BMSCs. PMID:27508023

  10. Effects of the extract of Ginkgo biloba on the differentiation of bone marrow mesenchymal stem cells in vitro

    PubMed Central

    Wu, Zhe; Zhang, Jiadi; Gu, Xu; Zhang, Xiaoxiao; Shi, Shuman; Liu, Chang

    2016-01-01

    The balance of osteogenesis and adipogenesis in bone marrow mesenchymal stem cells (BMSCs) is disrupted in osteoporosis. This study was designed to investigate the effects of extract of Ginkgo biloba (EGB) on proliferation, osteogenic and adipogenic differentiation of bone marrow mesenchymal stem cells in vitro. The effect of EGB on proliferation was evaluated by CCK-8 assay and flow cytometry. Osteogenic differentiation was evaluated by Alizarin Red S staining and Alkaline phosphatase assay. Adipogenic differentiation was evaluated by Oil Red O staining. Quantitative real-time polymerase chain reaction (Real-time PCR) was used to detect the expression of osteogenic specific genes (BMP-2, Runx2 and Colla1) and adipogenic specific genes (ap2, PPARγ). EGB did not significantly affect proliferation of BMSCs. However, it increased the calcium accumulation and significantly promoted the activity of alkaline phosphatase, especially when the concentration of EGB reached 150 µg/mL. EGB dose-dependently inhibited the adipogenic ability of BMSCs. The osteogenic-related genes (BMP-2, Runx2, Colla1) were overexpressed while the expression of genes involved in adipogenesis, such as PPAR-γ and ap2, was decreasing with the increase of EGB concentration. Our data proves that EGB inhibited adipocyte differentiation and enhanced osteogenic differentiation in BMSCs, but had no effect on the proliferation of BMSCs. PMID:27508023

  11. Differential effects of sporulation temperature on the high pressure resistance of Clostridium botulinum type E spores and the interconnection with sporulation medium cation contents.

    PubMed

    Lenz, Christian A; Vogel, Rudi F

    2015-04-01

    High pressure thermal (HPT) processing can be used to improve traditional preservation methods and increase food safety and durability, whereas quality related characteristics can be largely maintained. Clostridium (C.) botulinum type E is a non-proteolytic, psychrotrophic, toxin-producing spore former, commonly associated with aquatic environments in temperate regions of the northern hemisphere. Sporulation in nature is likely to occur under varying conditions including temperature and nutrient availability, which might affect resistance properties of resulting spores. In our study, we determined the effect of sporulation temperature (13-38 °C) on the resistance of three Clostridium botulinum type E strains to differently intense HPT treatments (200 MPa at 40 and 80 °C, and 800 MPa at 40 and 80 °C). Furthermore, the effect of cations on sporulation temperature-mediated alterations in HHP resistance was investigated. Results indicate that low and high sporulation temperatures can increase and decrease sporal HPT resistance, respectively, in a treatment-dependent (pressure level, treatment temperature) manner, whereas the trends observed are largely unaffected by pressure dwells (1 s-10 min). Furthermore, results show that the cation content of the sporulation medium (Ca(2+), Mg(2+), Mn(2+)) marginally influences and partially counteracts effects on the HPT resistance of spores grown at low and elevated temperatures, respectively. This suggests that sporulation temperature and medium cations provoke changes in some common spore resistance structures. Sporulation conditions can markedly affect spore resistance properties and, thus, should be considered for the experimental setup of worst case studies aiming to evaluate the effectiveness of food processes in terms of the inactivation of C. botulinum type E spores.

  12. A novel crosstalk between Alk7 and cGMP signaling differentially regulates brown adipocyte function

    PubMed Central

    Balkow, Aileen; Jagow, Johanna; Haas, Bodo; Siegel, Franziska; Kilić, Ana; Pfeifer, Alexander

    2015-01-01

    Objective Obesity is an enormous burden for patients and health systems world-wide. Brown adipose tissue dissipates energy in response to cold and has been shown to be metabolically active in human adults. The type I transforming growth factor β (TGFβ) receptor Activin receptor-like kinase 7 (Alk7) is highly expressed in adipose tissues and is down-regulated in obese patients. Here, we studied the function of Alk7 in brown adipocytes. Methods Using pharmacological and genetic tools, Alk7 signaling pathway and its effects were studied in murine brown adipocytes. Brown adipocyte differentiation and activation was analyzed. Results Alk7 is highly upregulated during differentiation of brown adipocytes. Interestingly, Alk7 expression is increased by cGMP/protein kinase G (PKG) signaling, which enhances brown adipocyte differentiation. Activin AB effectively activates Alk7 and SMAD3 signaling. Activation of Alk7 in brown preadipocytes suppresses the master adipogenic transcription factor PPARγ and differentiation. Stimulation of Alk7 during late differentiation of brown adipocytes reduces lipid content and adipogenic marker expression but enhances UCP1 expression. Conclusions We found a so far unknown crosstalk between cGMP and Alk7 signaling pathways. Tight regulation of Alk7 is required for efficient differentiation of brown adipocytes. Alk7 has differential effects on adipogenic differentiation and the development of the thermogenic program in brown adipocytes. PMID:26266090

  13. PTHrP in differentiating human mesenchymal stem cells: transcript isoform expression, promoter methylation, and protein accumulation.

    PubMed

    Longo, Alessandra; Librizzi, Mariangela; Naselli, Flores; Caradonna, Fabio; Tobiasch, Edda; Luparello, Claudio

    2013-10-01

    Human PTHrP gene displays a complex organization with nine exons producing diverse mRNA variants due to alternative splicing at 5' and 3' ends and the existence of three different transcriptional promoters (P1, P2 and P3), two of which (P2 and P3) contain CpG islands. It is known that the expression of PTHrP isoforms may be differentially regulated in a developmental stage- and tissue-specific manner. To search for novel molecular markers of stemness/differentiation, here we have examined isoform expression in fat-derived mesenchymal stem cells both maintained in stem conditions and induced toward adipo- and osteogenesis. In addition, the expression of the splicing isoforms derived from P2 and P3 promoters was correlated to the state of methylation of the latter. Moreover, we also performed a quantitative evaluation of intracellular and secreted PTHrP protein product in undifferentiated stem cells and in parallel cultures at various differentiation stages. The data obtained indicate that from the stemness condition to that of osteo- and adipo-genic differentiated cells, the expression of isoforms becomes increasingly selective, thereby being a potential gene signature for the monitoring of cell stem or committed/differentiating state and that the switching-off of PTHrP isoform expression is mostly promoter methylation-dependent. Moreover, PTHrP intracellular retention is down-regulated in osteo-differentiating cells whereas the secretion of the protein in the extracellular medium is up-regulated with respect to stem cells, thereby suggesting that these variations of the intracellular and extracellular levels of PTHrP could potentially be enclosed in the list of the available protein signature of osteogenic differentiation.

  14. PTHrP in differentiating human mesenchymal stem cells: transcript isoform expression, promoter methylation, and protein accumulation.

    PubMed

    Longo, Alessandra; Librizzi, Mariangela; Naselli, Flores; Caradonna, Fabio; Tobiasch, Edda; Luparello, Claudio

    2013-10-01

    Human PTHrP gene displays a complex organization with nine exons producing diverse mRNA variants due to alternative splicing at 5' and 3' ends and the existence of three different transcriptional promoters (P1, P2 and P3), two of which (P2 and P3) contain CpG islands. It is known that the expression of PTHrP isoforms may be differentially regulated in a developmental stage- and tissue-specific manner. To search for novel molecular markers of stemness/differentiation, here we have examined isoform expression in fat-derived mesenchymal stem cells both maintained in stem conditions and induced toward adipo- and osteogenesis. In addition, the expression of the splicing isoforms derived from P2 and P3 promoters was correlated to the state of methylation of the latter. Moreover, we also performed a quantitative evaluation of intracellular and secreted PTHrP protein product in undifferentiated stem cells and in parallel cultures at various differentiation stages. The data obtained indicate that from the stemness condition to that of osteo- and adipo-genic differentiated cells, the expression of isoforms becomes increasingly selective, thereby being a potential gene signature for the monitoring of cell stem or committed/differentiating state and that the switching-off of PTHrP isoform expression is mostly promoter methylation-dependent. Moreover, PTHrP intracellular retention is down-regulated in osteo-differentiating cells whereas the secretion of the protein in the extracellular medium is up-regulated with respect to stem cells, thereby suggesting that these variations of the intracellular and extracellular levels of PTHrP could potentially be enclosed in the list of the available protein signature of osteogenic differentiation. PMID:23810909

  15. Genistein-mediated inhibition of mammary stromal adipocyte differentiation limits expansion of mammary stem/progenitor cells by paracrine signaling

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Mammary adiposity may contribute to breast cancer development and progression by releasing cytokines and other inflammatory mediators that promote mammary epithelial proliferation. We evaluated the effects of soy isoflavone genistein (GEN) on the adipogenic differentiation of a SV40-immortalized mou...

  16. Microbioreactor Array Screening of Wnt Modulators and Microenvironmental Factors in Osteogenic Differentiation of Mesenchymal Progenitor Cells

    PubMed Central

    Padmanabhan, Harish; Cooper-White, Justin J.

    2013-01-01

    Cellular microenvironmental conditions coordinate to regulate stem cell populations and their differentiation. Mesenchymal precursor cells (MPCs), which have significant potential for a wide range of therapeutic applications, can be expanded or differentiated into osteo- chondro- and adipogenic lineages. The ability to establish, screen, and control aspects of the microenvironment is paramount if we are to elucidate the complex interplay of signaling events that direct cell fate. Whilst modulation of Wnt signaling may be useful to direct osteogenesis in MPCs, there is still significant controversy over how the Wnt signaling pathway influences osteogenesis. In this study, we utilised a full-factorial microbioreactor array (MBA) to rapidly, combinatorially screen several Wnt modulatory compounds (CHIR99021, IWP-4 and IWR-1) and characterise their effects upon osteogenesis. The MBA screening system showed excellent consistency between donors and experimental runs. CHIR99021 (a Wnt agonist) had a profoundly inhibitory effect upon osteogenesis, contrary to expectations, whilst the effects of the IWP-4 and IWR-1 (Wnt antagonists) were confirmed to be inhibitory to osteogenesis, but to a lesser extent than observed for CHIR99021. Importantly, we demonstrated that these results were translatable to standard culture conditions. Using RT-qPCR of osteogenic and Wnt pathway markers, we showed that CHIR exerted its effects via inhibition of ALP and SPP1 expression, even though other osteogenic markers (RUNX2, MSX2, DLX, COL1A1) were upregulated. Lastly, this MBA platform, due to the continuous provision of medium from the first to the last of ten serially connected culture chambers, permitted new insight into the impacts of paracrine signaling on osteogenic differentiation in MPCs, with factors secreted by the MPCs in upstream chambers enhancing the differentiation of cells in downstream chambers. Insights provided by this cell-based assay system will be key to better

  17. Yolk sac mesenchymal progenitor cells from New World mice (Necromys lasiurus) with multipotent differential potential.

    PubMed

    Favaron, Phelipe Oliveira; Mess, Andrea; Will, Sônia Elisabete; Maiorka, Paulo César; de Oliveira, Moacir Franco; Miglino, Maria Angelica

    2014-01-01

    Fetal membranes are abundant, ethically acceptable and readily accessible sources of stem cells. In particular, the yolk sac is a source of cell lineages that do not express MHCs and are mainly free from immunological incompatibles when transferred to a recipient. Although data are available especially for hematopoietic stem cells in mice and human, whereas other cell types and species are dramatically underrepresented. Here we studied the nature and differentiation potential of yolk sac derived mesenchymal stem cells from a New World mouse, Necromys lasiurus. Explants from mid-gestation were cultured in DMEM-High glucose medium with 10% defined fetal bovine serum. The cells were characterized by standard methods including immunophenotyping by fluorescence and flow cytometry, growth and differentiation potential and tumorigenicity assays. The first adherent cells were observed after 7 days of cell culture and included small, elongated fibroblast-like cells (92.13%) and large, round epithelial-like cells with centrally located nuclei (6.5%). Only the fibroblast-like cells survived the first passages. They were positive to markers for mesenchymal stem cells (Stro-1, CD90, CD105, CD73) and pluripotency (Oct3/4, Nanog) as well as precursors of hematopoietic stem cells (CD117). In differentiation assays, they were classified as a multipotent lineage, because they differentiated into osteogenic, adipogenic, and chondrogenic lineages and, finally, they did not develop tumors. In conclusion, mesenchymal progenitor cells with multipotent differentiation potential and sufficient growth and proliferation abilities were able to be obtained from Necromys yolk sacs, therefore, we inferred that these cells may be promising for a wide range of applications in regenerative medicine.

  18. Differential induction of innate defense antimicrobial peptides in primary nasal epithelial cells upon stimulation with inflammatory cytokines, Th17 cytokines or bacterial conditioned medium from Staphylococcus aureus isolates.

    PubMed

    Burgey, Christine; Kern, Winfried V; Römer, Winfried; Rieg, Siegbert

    2016-01-01

    To date it is incompletely understood why half of the human population is intrinsically resistant to Staphylococcus aureus colonization whereas the other half is intermittently or permanently colonized. Nasal colonization represents the primary niche for S. aureus. We therefore investigated whether primary nasal epithelial cells (HNEC) express antimicrobial peptides (AMPs) upon stimulation by inflammatory cytokines or bacterial conditioned medium (BCM) of different colonizing and invasive staphylococci. Stimulation with classical cytokines (IL-1β, TNF-α, IFN-γ) potently induced hBD-3 and RNase7 in HNEC. Th17 cytokines (IL-17A, IL-17F, IL-22) yielded comparably weak hBD-3 and RNase7 induction and no synergistic effects with classical cytokines. BCM of S. aureus and Staphylococcus epidermidis isolates moderately induced hBD3 and RNase7 mRNA expression without significant differences when comparing colonizing vs. invasive isolates. Our results indicate that HNEC contribute to the innate defense by secretion of an AMP-containing chemical defense shield along the nasal mucosa i.e. within the primary colonization niche of S. aureus. Further studies are needed to investigate whether a deficient AMP expression in the nasal mucosa may be related to different S. aureus carrier states. AMPs or AMP-inducing agents may be promising candidates for future topical decolonization regimens that aim to prevent invasive S. aureus infections.

  19. Cultivation and Differentiation Change Nuclear Localization of Chromosome Centromeres in Human Mesenchymal Stem Cells

    PubMed Central

    Voldgorn, Yana I.; Adilgereeva, Elmira P.; Nekrasov, Evgeny D.; Lavrov, Alexander V.

    2015-01-01

    Chromosome arrangement in the interphase nucleus is not accidental. Strong evidences support that nuclear localization is an important mechanism of epigenetic regulation of gene expression. The purpose of this research was to identify differences in the localization of centromeres of chromosomes 6, 12, 18 and X in human mesenchymal stem cells depending on differentiation and cultivating time. We analyzed centromere positions in more than 4000 nuclei in 19 mesenchymal stem cell cultures before and after prolonged cultivation and after differentiation into osteogenic and adipogenic directions. We found a centromere reposition of HSAX at late passages and after differentiation in osteogenic direction as well as of HSA12 and HSA18 after adipogenic differentiation. The observed changes of the nuclear structure are new nuclear characteristics of the studied cells which may reflect regulatory changes of gene expression during the studied processes. PMID:25775427

  20. Reduced input from foot sole skin through cooling differentially modulates the short latency and medium latency vestibular reflex responses to galvanic vestibular stimulation.

    PubMed

    Muise, Stephanie B; Lam, Chris K; Bent, Leah R

    2012-04-01

    Sensory afferent information from the skin of the foot sole and information from the vestibular system converge within the central nervous system; however, their mode of interaction remains unknown. The purpose of this study was to investigate the effect of reduced cutaneous foot sole information on the ability of the vestibular system to evoke short latency (SL) and medium latency (ML) lower limb muscle reflex responses. Galvanic vestibular stimulation (GVS; bipolar; binaural; 25 ms; 2 mA square-wave pulse) was applied to standing human subjects (four women, eight men, average age 21.1 ± 3.0 years) both before and after cooling the foot soles in 1°C ice water (15 min initially, followed by 5 min between blocks of 200 GVS pulses). Changes in soleus reflex amplitude were examined. Following ice water immersion, there was a 35.16% increase in the size of the ML response in the soleus muscle when expressed as a percentage of pre-stimulus electromyographic (EMG) activity (control 26.48 ± 4.91%; ice 36.16 ± 6.52%) with no change in size of the SL response (control 7.42 ± 1.12%; ice 8.72 ± 1.10%). These results support the previously proposed dissociation of the SL and ML responses with respect to their circuitry and functions. The results also suggest a greater role for cutaneous-vestibular interaction in the modulation of the ML than the SL response and at a location prior to the motoneuron pool.

  1. Differentiation of PDX1 gene-modified human umbilical cord mesenchymal stem cells into insulin-producing cells in vitro.

    PubMed

    He, Dongmei; Wang, Juan; Gao, Yangjun; Zhang, Yuan

    2011-12-01

    Mesenchymal stem cells (MSCs) have significant advantages over other stem cell types, and greater potential for immediate clinical application. MSCs would be an interesting cellular source for treatment of type 1 diabetes. In this study, MSCs from human umbilical cord were differentiated into functional insulin-producing cells in vitro by introduction of the pancreatic and duodenal homeobox factor 1 (PDX1) and in the presence of induction factors. The expressions of cell surface antigens were detected by flow cytometry. After induction in an adipogenic medium or an osteogenic medium, the cells were observed by Oil Red O staining and alkaline phosphatase staining. Recombinant adenovirus carrying the PDX1 gene was constructed and MSCs were infected by the recombinant adenovirus, then treated with several inducing factors for differentiation into islet β-like cells. The expression of the genes and protein related to islet β-cells was detected by immunocytochemistry, RT-PCR and Western blot analysis. Insulin and C-peptide secretion were assayed. Our results show that the morphology and immunophenotype of MSCs from human umbilical cord were similar to those present in human bone marrow. The MSCs could be induced to differentiate into osteocytes and adipocytes. After induction by recombined adenovirus vector with induction factors, MSCs were aggregated and presented islet-like bodies. Dithizone staining of these cells was positive. The genes' expression related to islet β-cells was found. After induction, insulin and C-peptide secretion in the supernatant were significantly increased. In conclusion, our results demonstrated that PDX1 gene-modified human umbilical cord mesenchymal stem cells could be differentiated into insulin-producing cells in vitro. PMID:21837359

  2. Spatially coordinated changes in intracellular rheology and extracellular force exertion during mesenchymal stem cell differentiation.

    PubMed

    McAndrews, Kathleen M; McGrail, Daniel J; Quach, Nhat D; Dawson, Michelle R

    2014-01-01

    The mechanical properties within the cell are regulated by the organization of the actin cytoskeleton, which is linked to the extracellular environment through focal adhesion proteins that transmit force. Chemical and mechanical stimuli alter the organization of cytoskeletal actin, which results in changes in cell shape, adhesion, and differentiation. By combining particle-tracking microrheology and traction force cytometry, we can monitor the mechanical properties of the actin meshwork and determine how changes in the intracellular network contribute to force generation. In this study, we investigated the effects of chemical (differentiation factors) and mechanical (substrate rigidity) stimuli important in mesenchymal stem cell (MSC) differentiation on the intracellular mechanics and traction stress generation. We found the presence of adipogenic factors resulted in stiffening of the actin meshwork regardless of substrate rigidity. In contrast, these factors increased traction stresses on hard substrates, which was associated with increased expression of contractility genes. Furthermore, MSCs cultured on hard substrates expressed both adipogenic and osteogenic markers indicative of mixed differentiation. On hard substrates, heterogeneity in the local elastic modulus-traction stress correlation was also increased in response to adipogenic factors, indicating that these mechanical properties may be reflective of differences in the level of MSC differentiation. These results suggest intracellular rheology and traction stress generation are spatially regulated and contribute insight into how single cell mechanical forces contribute to MSC differentiation.

  3. Spatially Coordinated Changes in Intracellular Rheology and Extracellular Force Exertion during Mesenchymal Stem Cell Differentiation

    PubMed Central

    McAndrews, Kathleen M.; McGrail, Daniel J.; Quach, Nhat D.; Dawson, Michelle R.

    2014-01-01

    The mechanical properties within the cell are regulated by the organization of the actin cytoskeleton, which is linked to the extracellular environment through focal adhesion proteins that transmit force. Chemical and mechanical stimuli alter the organization of cytoskeletal actin, which results in changes in cell shape, adhesion, and differentiation. By combining particle-tracking microrheology and traction force cytometry, we can monitor the mechanical properties of the actin meshwork and determine how changes in the intracellular network contribute to force generation. In this study, we investigated the effects of chemical (differentiation factors) and mechanical (substrate rigidity) stimuli important in mesenchymal stem cell (MSC) differentiation on the intracellular mechanics and traction stress generation. We found the presence of adipogenic factors resulted in stiffening of the actin meshwork regardless of substrate rigidity. In contrast, these factors increased traction stresses on hard substrates, which was associated with increased expression of contractility genes. Furthermore, MSCs cultured on hard substrates expressed both adipogenic and osteogenic markers indicative of mixed differentiation. On hard substrates, heterogeneity in the local elastic modulus-traction stress correlation was also increased in response to adipogenic factors, indicating that these mechanical properties may be reflective of differences in level of MSC differentiation. These results suggest intracellular rheology and traction stress generation are spatially regulated and contribute insight into how single cell mechanical forces contribute to MSC differentiation. PMID:25156989

  4. Spatially coordinated changes in intracellular rheology and extracellular force exertion during mesenchymal stem cell differentiation

    NASA Astrophysics Data System (ADS)

    McAndrews, Kathleen M.; McGrail, Daniel J.; Quach, Nhat D.; Dawson, Michelle R.

    2014-10-01

    The mechanical properties within the cell are regulated by the organization of the actin cytoskeleton, which is linked to the extracellular environment through focal adhesion proteins that transmit force. Chemical and mechanical stimuli alter the organization of cytoskeletal actin, which results in changes in cell shape, adhesion, and differentiation. By combining particle-tracking microrheology and traction force cytometry, we can monitor the mechanical properties of the actin meshwork and determine how changes in the intracellular network contribute to force generation. In this study, we investigated the effects of chemical (differentiation factors) and mechanical (substrate rigidity) stimuli important in mesenchymal stem cell (MSC) differentiation on the intracellular mechanics and traction stress generation. We found the presence of adipogenic factors resulted in stiffening of the actin meshwork regardless of substrate rigidity. In contrast, these factors increased traction stresses on hard substrates, which was associated with increased expression of contractility genes. Furthermore, MSCs cultured on hard substrates expressed both adipogenic and osteogenic markers indicative of mixed differentiation. On hard substrates, heterogeneity in the local elastic modulus-traction stress correlation was also increased in response to adipogenic factors, indicating that these mechanical properties may be reflective of differences in the level of MSC differentiation. These results suggest intracellular rheology and traction stress generation are spatially regulated and contribute insight into how single cell mechanical forces contribute to MSC differentiation.

  5. Development and characterization of a clinically compliant xeno-free culture medium in good manufacturing practice for human multipotent mesenchymal stem cells.

    PubMed

    Chase, Lucas G; Yang, Sufang; Zachar, Vladimir; Yang, Zheng; Lakshmipathy, Uma; Bradford, Jolene; Boucher, Shayne E; Vemuri, Mohan C

    2012-10-01

    Human multipotent mesenchymal stem cell (MSC) therapies are currently being tested in clinical trials for Crohn's disease, multiple sclerosis, graft-versus-host disease, type 1 diabetes, bone fractures, cartilage damage, and cardiac diseases. Despite remarkable progress in clinical trials, most applications still use traditional culture media containing fetal bovine serum or serum-free media that contain serum albumin, insulin, and transferrin. The ill-defined and variable nature of traditional culture media remains a challenge and has created a need for better defined xeno-free culture media to meet the regulatory and long-term safety requirements for cell-based therapies. We developed and tested a serum-free and xeno-free culture medium (SFM-XF) using human bone marrow- and adipose-derived MSCs by investigating primary cell isolation, multiple passage expansion, mesoderm differentiation, cellular phenotype, and gene expression analysis, which are critical for complying with translation to cell therapy. Human MSCs expanded in SFM-XF showed continual propagation, with an expected phenotype and differentiation potential to adipogenic, chondrogenic, and osteogenic lineages similar to that of MSCs expanded in traditional serum-containing culture medium (SCM). To monitor global gene expression, the transcriptomes of bone marrow-derived MSCs expanded in SFM-XF and SCM were compared, revealing relatively similar expression profiles. In addition, the SFM-XF supported the isolation and propagation of human MSCs from primary human marrow aspirates, ensuring that these methods and reagents are compatible for translation to therapy. The SFM-XF culture system allows better expansion and multipotentiality of MSCs and serves as a preferred alternative to serum-containing media for the production of large scale, functionally competent MSCs for future clinical applications.

  6. Reduction by strontium of the bone marrow adiposity in mice and repression of the adipogenic commitment of multipotent C3H10T1/2 cells.

    PubMed

    Fournier, C; Perrier, A; Thomas, M; Laroche, N; Dumas, V; Rattner, A; Vico, L; Guignandon, A

    2012-02-01

    Multipotent mesenchymal cells (MMCs) differentiate into osteoblasts or adipocytes through RUNX2 and PPARγ2, respectively. Strontium ranelate has been shown to promote osteoblastogenesis and prevent adipogenesis in long-term experiments using MMCs. The present study involved in-vitro and in-vivo investigations of whether Sr might first be an inhibitor of adipogenesis, thus explaining late osteoblastogenesis. It was established in vivo that Sr reduces adipogenesis in mice treated only for 3 weeks with a 6 mmol/kg/day dose of Sr while the trabecular bone volume is increased. In order to decipher molecular mechanisms during inhibition of adipogenesis, we used murine MMCs C3H10T1/2 cultured under adipogenic conditions (AD) and treated Sr of a concentration up to 3 mM. It was shown that early on (day 1), Sr dose-dependently reduced PPARγ2 and CEBPα mRNA without affecting the RUNX2 gene expression whereas it repressed ALP mRNA. Later (day 5), PPARγ2 and CEBPα mRNA remained inhibited by Sr, preventing adipocyte lipid accumulation, while Runx2 and ALP mRNA were increased. Moreover, under the mentioned conditions, Sr was able to quickly induce the Cyclin D1 gene expression, proliferation and fibronectin fibrillogenesis, both involved in the inhibition of adipogenesis. The inhibition of the ERK pathway by U0126 blunted the Sr-induced PPARγ2 repression while restoring the lipid accumulation. These results demonstrated that Sr was capable of rapidly reducing adipogenesis by a selective PPARγ2 repression that can be explained by its ability to promote MMC proliferation.

  7. Tetrandrine has anti-adipogenic effect on 3T3-L1 preadipocytes through the reduced expression and/or phosphorylation levels of C/EBP-α, PPAR-γ, FAS, perilipin A, and STAT-3.

    PubMed

    Jang, Byeong-Churl

    2016-08-01

    Tetrandrine is a bisbenzylisoquinoline alkaloid isolated from the roots of Stephania tetrandra S. Moore and has been shown to possess anti-inflammatory and anti-cancerous activities. In this study, the effect of tetrandrine on adipogenesis in 3T3-L1 preadipocytes was investigated. Tetrandrine at 10 μM concentration strongly inhibited lipid accumulation and triglyceride (TG) synthesis during the differentiation of 3T3-L1 preadipocytes into adipocytes. On mechanistic levels, tetrandrine reduced not only the expressions of CCAAT/enhancer-binding protein-α (C/EBP-α), peroxisome proliferator-activated receptor-γ (PPAR-γ), fatty acid synthase (FAS), and perilipin A but also the phosphorylation levels of signal transducer and activator of transcription-3 (STAT-3) during 3T3-L1 adipocyte differentiation. Tetrandrine also reduced the mRNA expression of leptin, but not adiponectin, during 3T3-L1 adipocyte differentiation. Collectively, these findings show that tetrandrine has strong anti-adipogenic effect on 3T3-L1 preadipocytes and the effect is largely attributable to the reduced expression and/or phosphorylation levels of C/EBP-α, PPAR-γ, FAS, perilipin A, and STAT-3. PMID:27246736

  8. Cocoa tea (Camellia ptilophylla) water extract inhibits adipocyte differentiation in mouse 3T3-L1 preadipocytes

    PubMed Central

    Li, Kai Kai; Liu, Chuek Lun; Shiu, Hoi Ting; Wong, Hing Lok; Siu, Wing Sum; Zhang, Cheng; Han, Xiao Qiang; Ye, Chuang Xing; Leung, Ping Chung; Ko, Chun Hay

    2016-01-01

    Cocoa tea (Camellia ptilophylla) is a naturally decaffeinated tea plant. Previously we found that cocoa tea demonstrated a beneficial effect against high-fat diet induced obesity, hepatic steatosis, and hyperlipidemia in mice. The present study aimed to investigate the anti-adipogenic effect of cocoa tea in vitro using preadipocytes 3T3-L1. Adipogenic differentiation was confirmed by Oil Red O stain, qPCR and Western blot. Our results demonstrated that cocoa tea significantly inhibited triglyceride accumulation in mature adipocytes in a dose-dependent manner. Cocoa tea was shown to suppress the expressions of key adipogenic transcription factors, including peroxisome proliferator-activated receptor gamma (PPAR γ) and CCAAT/enhancer binding protein (C/EBP α). The tea extract was subsequently found to reduce the expressions of adipocyte-specific genes such as sterol regulatory element binding transcription factor 1c (SREBP-1c), fatty acid synthase (FAS), Acetyl-CoA carboxylase (ACC), fatty acid translocase (FAT) and stearoylcoenzyme A desaturase-1 (SCD-1). In addition, JNK, ERK and p38 phosphorylation were inhibited during cocoa tea inhibition of 3T3-L1 adipogenic differentiation. Taken together, this is the first study that demonstrates cocoa tea has the capacity to suppress adipogenesis in pre-adipocyte 3T3-L1 similar to traditional green tea PMID:26833256

  9. Cocoa tea (Camellia ptilophylla) water extract inhibits adipocyte differentiation in mouse 3T3-L1 preadipocytes.

    PubMed

    Li, Kai Kai; Liu, Chuek Lun; Shiu, Hoi Ting; Wong, Hing Lok; Siu, Wing Sum; Zhang, Cheng; Han, Xiao Qiang; Ye, Chuang Xing; Leung, Ping Chung; Ko, Chun Hay

    2016-02-01

    Cocoa tea (Camellia ptilophylla) is a naturally decaffeinated tea plant. Previously we found that cocoa tea demonstrated a beneficial effect against high-fat diet induced obesity, hepatic steatosis, and hyperlipidemia in mice. The present study aimed to investigate the anti-adipogenic effect of cocoa tea in vitro using preadipocytes 3T3-L1. Adipogenic differentiation was confirmed by Oil Red O stain, qPCR and Western blot. Our results demonstrated that cocoa tea significantly inhibited triglyceride accumulation in mature adipocytes in a dose-dependent manner. Cocoa tea was shown to suppress the expressions of key adipogenic transcription factors, including peroxisome proliferator-activated receptor gamma (PPAR γ) and CCAAT/enhancer binding protein (C/EBP α). The tea extract was subsequently found to reduce the expressions of adipocyte-specific genes such as sterol regulatory element binding transcription factor 1c (SREBP-1c), fatty acid synthase (FAS), Acetyl-CoA carboxylase (ACC), fatty acid translocase (FAT) and stearoylcoenzyme A desaturase-1 (SCD-1). In addition, JNK, ERK and p38 phosphorylation were inhibited during cocoa tea inhibition of 3T3-L1 adipogenic differentiation. Taken together, this is the first study that demonstrates cocoa tea has the capacity to suppress adipogenesis in pre-adipocyte 3T3-L1 similar to traditional green tea.

  10. Cocoa tea (Camellia ptilophylla) water extract inhibits adipocyte differentiation in mouse 3T3-L1 preadipocytes.

    PubMed

    Li, Kai Kai; Liu, Chuek Lun; Shiu, Hoi Ting; Wong, Hing Lok; Siu, Wing Sum; Zhang, Cheng; Han, Xiao Qiang; Ye, Chuang Xing; Leung, Ping Chung; Ko, Chun Hay

    2016-01-01

    Cocoa tea (Camellia ptilophylla) is a naturally decaffeinated tea plant. Previously we found that cocoa tea demonstrated a beneficial effect against high-fat diet induced obesity, hepatic steatosis, and hyperlipidemia in mice. The present study aimed to investigate the anti-adipogenic effect of cocoa tea in vitro using preadipocytes 3T3-L1. Adipogenic differentiation was confirmed by Oil Red O stain, qPCR and Western blot. Our results demonstrated that cocoa tea significantly inhibited triglyceride accumulation in mature adipocytes in a dose-dependent manner. Cocoa tea was shown to suppress the expressions of key adipogenic transcription factors, including peroxisome proliferator-activated receptor gamma (PPAR γ) and CCAAT/enhancer binding protein (C/EBP α). The tea extract was subsequently found to reduce the expressions of adipocyte-specific genes such as sterol regulatory element binding transcription factor 1c (SREBP-1c), fatty acid synthase (FAS), Acetyl-CoA carboxylase (ACC), fatty acid translocase (FAT) and stearoylcoenzyme A desaturase-1 (SCD-1). In addition, JNK, ERK and p38 phosphorylation were inhibited during cocoa tea inhibition of 3T3-L1 adipogenic differentiation. Taken together, this is the first study that demonstrates cocoa tea has the capacity to suppress adipogenesis in pre-adipocyte 3T3-L1 similar to traditional green tea. PMID:26833256

  11. A medium-chain fatty acid, capric acid, inhibits RANKL-induced osteoclast differentiation via the suppression of NF-κB signaling and blocks cytoskeletal organization and survival in mature osteoclasts.

    PubMed

    Kim, Hyun-Ju; Yoon, Hye-Jin; Kim, Shin-Yoon; Yoon, Young-Ran

    2014-08-01

    Fatty acids, important components of a normal diet, have been reported to play a role in bone metabolism. Osteoclasts are bone-resorbing cells that are responsible for many bone-destructive diseases such as osteoporosis. In this study, we investigated the impact of a medium-chain fatty acid, capric acid, on the osteoclast differentiation, function, and survival induced by receptor activator of NF-κB ligand (RANKL) and macrophage colony-stimulating factor (MCSF). Capric acid inhibited RANKL-mediated osteoclastogenesis in bone marrow-derived macrophages and suppressed RANKL-induced IκBα phosphorylation, p65 nuclear translocation, and NF-κB transcriptional activity. Capric acid further blocked the RANKL-stimulated activation of ERK without affecting JNK or p38. The induction of NFATc1 in response to RANKL was also attenuated by capric acid. In addition, capric acid abrogated M-CSF and RANKL-mediated cytoskeleton reorganization, which is crucial for the efficient bone resorption of osteoclasts. Capric acid also increased apoptosis in mature osteoclasts through the induction of Bim expression and the suppression of ERK activation by M-CSF. Together, our results reveal that capric acid has inhibitory effects on osteoclast development. We therefore suggest that capric acid may have potential therapeutic implications for the treatment of bone resorption-associated disorders.

  12. Pathway Signature and Cellular Differentiation in Clear Cell Renal Cell Carcinoma

    PubMed Central

    Tun, Han W.; Marlow, Laura A.; von Roemeling, Christina A.; Cooper, Simon J.; Kreinest, Pamela; Wu, Kevin; Luxon, Bruce A.; Sinha, Mala; Anastasiadis, Panos Z.; Copland, John A.

    2010-01-01

    Background Clear cell renal cell carcinoma (ccRCC) is the most common kidney cancer. The purpose of this study is to define a biological pathway signature and a cellular differentiation program in ccRCC. Methodology We performed gene expression profiling of early-stage ccRCC and patient-matched normal renal tissue using Affymetrix HG-U133a and HG-U133b GeneChips combined with a comprehensive bioinformatic analyses, including pathway analysis. The results were validated by real time PCR and IHC on two independent sample sets. Cellular differentiation experiments were performed on ccRCC cell lines and their matched normal renal epithelial cells, in differentiation media, to determine their mesenchymal differentiation potential. Principal Findings We identified a unique pathway signature with three major biological alterations—loss of normal renal function, down-regulated metabolism, and immune activation–which revealed an adipogenic gene expression signature linked to the hallmark lipid-laden clear cell morphology of ccRCC. Culturing normal renal and ccRCC cells in differentiation media showed that only ccRCC cells were induced to undergo adipogenic and, surprisingly, osteogenic differentiation. A gene expression signature consistent with epithelial mesenchymal transition (EMT) was identified for ccRCC. We revealed significant down-regulation of four developmental transcription factors (GATA3, TFCP2L1, TFAP2B, DMRT2) that are important for normal renal development. Conclusions ccRCC is characterized by a lack of epithelial differentiation, mesenchymal/adipogenic transdifferentiation, and pluripotent mesenchymal stem cell-like differentiation capacity in vitro. We suggest that down-regulation of developmental transcription factors may mediate the aberrant differentiation in ccRCC. We propose a model in which normal renal epithelial cells undergo dedifferentiation, EMT, and adipogenic transdifferentiation, resulting in ccRCC. Because ccRCC cells grown in adipogenic

  13. Directing Parthenogenetic Stem Cells Differentiate into Adipocytes for Engineering Injectable Adipose Tissue

    PubMed Central

    Liu, Wei; Yang, Xingyuan; Yan, Xingrong; Cui, Jihong; Liu, Wenguang; Sun, Mei; Rao, Yang; Chen, Fulin

    2014-01-01

    The selection of appropriate seed cells is crucial for adipose tissue engineering. Here, we reported the stepwise induction of parthenogenetic embryonic stem cells (pESCs) to differentiate into adipogenic cells and its application in engineering injectable adipose tissue with Pluronic F-127. pESCs had pluripotent differentiation capacity and could form teratomas that include the three primary germ layers. Cells that migrated from the embryoid bodies (EBs) were selectively separated and expanded to obtain embryonic mesenchymal stem cells (eMSCs). The eMSCs exhibited similar cell surface marker expression profiles with bone morrow mesenchymal stem cells (BMSCs) and had multipotent differentiation capacity. Under the induction of dexamethasone, indomethacin, and insulin, eMSCs could differentiate into adipogenic cells with increased expression of adipose-specific genes and oil droplet depositions within the cytoplasm. To evaluate their suitability as seed cells for adipose tissue engineering, the CM-Dil labelled adipogenic cells derived from eMSCs were seeded into Pluronic F-127 hydrogel and injected subcutaneously into nude mice. Four weeks after injection, glistering and semitransparent constructs formed in the subcutaneous site. Histological observations demonstrated that new adipose tissue was successfully fabricated in the specimen by the labelled cells. The results of the current study indicated that pESCs have great potential in the fabrication of injectable adipose tissue. PMID:25587287

  14. Epac, not PKA catalytic subunit, is required for 3T3-L1 preadipocyte differentiation

    PubMed Central

    Ji, Zhenyu; Mei, Fang C.; Cheng, Xiaodong

    2009-01-01

    Cyclic AMP plays a critical role in adipocyte differentiation and maturation. However, it is not clear which of the two intracellular cAMP receptors, exchange protein directly activated by cAMP/cAMP-regulated guanine nucleotide exchange factor or protein kinase A/cAMP-dependent protein kinase, is essential for cAMP-mediated adipocyte differentiation. In this study, we utilized a well-defined adipose differentiation model system, the murine preadipocyte line 3T3-L1, to address this issue. We showed that knocking down Epac expression in 3T3-L1 cells using lentiviral based small hairpin RNAs down-regulated peroxisome proliferator-activated receptor gamma expression and dramatically inhibited adipogenic conversion of 3T3-L1 cells while inhibiting PKA catalytic subunit activity by two mechanistically distinct inhibitors, heat stable protein kinase inhibitor and H89, had no effect on 3T3-L1 adipocyte differentiation. Moreover, cAMP analog selectively activating Epac was not able to stimulate adipogenic conversion. Our study demonstrated that while PKA catalytic activity is dispensable, activation of Epac is necessary but not sufficient for adipogenic conversion of 3T3-L1 cells. PMID:20036887

  15. Small Molecule-Induced Complement Factor D (Adipsin) Promotes Lipid Accumulation and Adipocyte Differentiation.

    PubMed

    Song, No-Joon; Kim, Suji; Jang, Byung-Hyun; Chang, Seo-Hyuk; Yun, Ui Jeong; Park, Ki-Moon; Waki, Hironori; Li, Dean Y; Tontonoz, Peter; Park, Kye Won

    2016-01-01

    Adipocytes are differentiated by various transcriptional cascades integrated on the master regulator, Pparγ. To discover new genes involved in adipocyte differentiation, preadipocytes were treated with three newly identified pro-adipogenic small molecules and GW7845 (a Pparγ agonist) for 24 hours and transcriptional profiling was analyzed. Four genes, Peroxisome proliferator-activated receptor γ (Pparγ), human complement factor D homolog (Cfd), Chemokine (C-C motif) ligand 9 (Ccl9), and GIPC PDZ Domain Containing Family Member 2 (Gipc2) were induced by at least two different small molecules but not by GW7845. Cfd and Ccl9 expressions were specific to adipocytes and they were altered in obese mice. Small hairpin RNA (shRNA) mediated knockdown of Cfd in preadipocytes inhibited lipid accumulation and expression of adipocyte markers during adipocyte differentiation. Overexpression of Cfd promoted adipocyte differentiation, increased C3a production, and led to induction of C3a receptor (C3aR) target gene expression. Similarly, treatments with C3a or C3aR agonist (C4494) also promoted adipogenesis. C3aR knockdown suppressed adipogenesis and impaired the pro-adipogenic effects of Cfd, further suggesting the necessity for C3aR signaling in Cfd-mediated pro-adipogenic axis. Together, these data show the action of Cfd in adipogenesis and underscore the application of small molecules to identify genes in adipocytes. PMID:27611793

  16. Small Molecule-Induced Complement Factor D (Adipsin) Promotes Lipid Accumulation and Adipocyte Differentiation

    PubMed Central

    Jang, Byung-Hyun; Chang, Seo-Hyuk; Yun, Ui Jeong; Park, Ki-Moon; Waki, Hironori; Li, Dean Y.; Tontonoz, Peter; Park, Kye Won

    2016-01-01

    Adipocytes are differentiated by various transcriptional cascades integrated on the master regulator, Pparγ. To discover new genes involved in adipocyte differentiation, preadipocytes were treated with three newly identified pro-adipogenic small molecules and GW7845 (a Pparγ agonist) for 24 hours and transcriptional profiling was analyzed. Four genes, Peroxisome proliferator-activated receptor γ (Pparγ), human complement factor D homolog (Cfd), Chemokine (C-C motif) ligand 9 (Ccl9), and GIPC PDZ Domain Containing Family Member 2 (Gipc2) were induced by at least two different small molecules but not by GW7845. Cfd and Ccl9 expressions were specific to adipocytes and they were altered in obese mice. Small hairpin RNA (shRNA) mediated knockdown of Cfd in preadipocytes inhibited lipid accumulation and expression of adipocyte markers during adipocyte differentiation. Overexpression of Cfd promoted adipocyte differentiation, increased C3a production, and led to induction of C3a receptor (C3aR) target gene expression. Similarly, treatments with C3a or C3aR agonist (C4494) also promoted adipogenesis. C3aR knockdown suppressed adipogenesis and impaired the pro-adipogenic effects of Cfd, further suggesting the necessity for C3aR signaling in Cfd-mediated pro-adipogenic axis. Together, these data show the action of Cfd in adipogenesis and underscore the application of small molecules to identify genes in adipocytes. PMID:27611793

  17. REDUCED GLUTEAL EXPRESSION OF ADIPOGENIC AND LIPOGENIC GENES IN BLACK SOUTH AFRICAN WOMEN IS ASSOCIATED WITH OBESITY-RELATED INSULIN RESISTANCE

    PubMed Central

    Goedecke, Julia H.; Evans, Juliet; Keswell, Dheshnie; Stimson, Roland H.; Livingstone, Dawn E.W.; Hayes, Philip; Adams, Kevin; Dave, Joel A.; Victor, Hendriena; Levitt, Naomi S.; Lambert, Estelle V.; Walker, Brian R.; Seckl, Jonathan R.; Olsson, Tommy; Kahn, Steven E.

    2014-01-01

    Context Black South African women are less insulin sensitive than their white counterparts, despite less central and greater peripheral fat deposition. We hypothesized that this paradox may be explained, in part, by differences in the adipogenic capacity of subcutaneous adipose tissue (SAT). Objective To measure adipogenic and lipogenic gene expression in abdominal and gluteal SAT depots, and determine their relationships with insulin sensitivity (SI) in South African women. Design Cross-sectional. Participants 14 normal-weight (BMI <25 kg/m2) black, 13 normal-weight white, 14 obese (BMI >30 kg/m2) black and 13 obese white premenopausal South African women. Main outcomes SI (frequently sampled intravenous glucose tolerance test) in relation to expression of adipogenic and lipogenic genes in abdominal and gluteal SAT depots. Results With increasing BMI, black women had less visceral fat (P=0.03) and more abdominal (P=0.017) and gynoid (P=0.041) SAT but had lower SI (P<0.01) than white women. The expression of adipogenic and lipogenic genes was proportionately lower with obesity in black, but not white women in the gluteal and deep SAT depots (P<0.05 for ethnicity x BMI effect). In black women only, the expression of these genes correlated positively with SI (all P<0.05), independently of age and fat mass. Conclusions Obese black women have reduced SAT expression of adipogenic and lipogenic genes compared to white women, which associates with reduced SI. These findings suggest that obesity in black women impairs SAT adipogenesis and storage, potentially leading to insulin resistance and increased risk of type 2 diabetes. PMID:21956425

  18. Hesperetin inhibit adipocyte differentiation and enhance Bax- and p21-mediated adipolysis in human mesenchymal stem cell adipogenesis.

    PubMed

    Subash-Babu, Pandurangan; Alshatwi, Ali A

    2015-03-01

    We aimed to explore the antiadipogenic and adipolysis effect of hesperetin in human mesenchymal stem cells (hMSCs)-induced adipogenesis. IC50 value of hesperetin was higher for hMSCs such as 149.2 ± 13.2 μmol for 24 h and 89.4 ± 11.4 μmol in 48 h, whereas in preadipocytes was 87.6 ± 9.5 μmol and 72.4 ± 5.6 μmol in 24 h and 48 h, respectively. Hesperetin treatment (5, 10, and 20 μmol) to adipogenesis-induced hMSCs (Group 1) and preadipocytes (Group 2) resulted in a significantly (p < 0.05) increased lipolysis. The treatment with hesperetin decreased the expression of resistin, adiponectin, aP2, LPL, PPAR-γ, and TNF-α in Groups 1 and 2, whereas a significant increase was observed in Bcl, Bax, and p21 expression in Group 2 compared to untreated preadipocytes. hMSCs cultured in adipogenic medium along with hesperetin significantly inhibited adipocyte differentiation and increased the proapoptotic gene expression levels in preadipocyte. Our result indicates the antiadipogenic and adipolysis effects of hesperetin.

  19. Naringin Stimulates Osteogenic Differentiation of Rat Bone Marrow Stromal Cells via Activation of the Notch Signaling Pathway

    PubMed Central

    Yu, Guo-yong; Zheng, Gui-zhou; Chang, Bo; Hu, Qin-xiao; Lin, Fei-xiang; Liu, De-zhong; Wu, Chu-cheng; Du, Shi-xin

    2016-01-01

    Naringin is a major flavonoid found in grapefruit and is an active compound extracted from the Chinese herbal medicine Rhizoma Drynariae. Naringin is a potent stimulator of osteogenic differentiation and has potential application in preventing bone loss. However, the signaling pathway underlying its osteogenic effect remains unclear. We hypothesized that the osteogenic activity of naringin involves the Notch signaling pathway. Rat bone marrow stromal cells (BMSCs) were cultured in osteogenic medium containing-naringin, with or without DAPT (an inhibitor of Notch signaling), the effects on ALP activity, calcium deposits, osteogenic genes (ALP, BSP, and cbfa1), adipogenic maker gene PPARγ2 levels, and Notch expression were examined. We found that naringin dose-dependently increased ALP activity and Alizarin red S staining, and treatment at the optimal concentration (50 μg/mL) increased mRNA levels of osteogenic genes and Notch1 expression, while decreasing PPARγ2 mRNA levels. Furthermore, treatment with DAPT partly reversed effects of naringin on BMSCs, as judged by decreases in naringin-induced ALP activity, calcium deposits, and osteogenic genes expression, as well as upregulation of PPARγ2 mRNA levels. These results suggest that the osteogenic effect of naringin partly involves the Notch signaling pathway. PMID:27069482

  20. Comparison of Stromal/Stem Cells Isolated from Human Omental and Subcutaneous Adipose Depots: Differentiation and Immunophenotypic Characterization.

    PubMed

    Shah, Forum S; Li, Jie; Dietrich, Marilyn; Wu, Xiying; Hausmann, Mark G; LeBlanc, Karl A; Wade, James W; Gimble, Jeffrey M

    2014-01-01

    The emerging field of regenerative medicine has identified adipose tissue as an abundant source of stromal/stem cells for tissue engineering applications. Therefore, we have compared the differentiation and immunophenotypic features of adipose-derived stromal/stem cells (ASC) isolated from either omental or subcutaneous adipose depots. Human tissue samples were obtained from bariatric and plastic surgical practices at a university-affiliated teaching hospital and a private practice, respectively, with informed patient consent. Primary cultures of human ASC were isolated from adipose specimens within 24 h of surgery and culture expanded in vitro. The passaged ASC were induced to undergo adipogenic or osteogenic differentiation as assessed by histochemical methods or evaluated for surface antigen expression profiles by flow cytometry. ASC yields per unit weight of tissue were comparable between omental and subcutaneous depots. At passage 0, the immunophenotype of omental and subcutaneous ASC were not significantly different with the exception of CD105 and endoglin, a component of the transforming growth factor β receptor. The adipogenic differentiation of omental ASC was less robust than that of subcutaneous ASC based on in vitro histochemical and PCR assays. Although the yield and immunophenotype of ASC from omental adipose depots resembled that of subcutaneous ASC, omental ASC displayed significantly reduced adipogenic differentiation capacity following chemical induction. Further studies are necessary to evaluate and optimize the differentiation function of omental ASC in vitro and in vivo. Pending such analyses, omental ASC should not be used interchangeably with subcutaneous ASC for regenerative medical applications. PMID:26089088

  1. Effects of proposed adipogenic factors in fetal swine sera upon preadipocyte development

    SciTech Connect

    Ramsay, T.G.; Hausman, G.J.; Martin, R.J.

    1986-03-01

    Genetic obesity has been detected in fetal pigs which suggests primary factors that cause the obesity develop prenatally. Growth hormone and thyroid hormones have been implicated as regulatory factors in fetal serum for preadipocyte differentiation. This experiment examined effects of growth hormone (GH) and thyroxine (T4) addition upon preadipocyte proliferation and differentiation when supplemented to deficient fetal pig sea. Hormones were added to decapitated fetal pig (Decap) sera to concentrations present in intact littermate (Reference) sera. Primary stromal-vascular cell cultures were prepared from rat inguinal adipose tissue. Cells were incubated with 5% decap or reference sera and hormones in media 199 during: days 1 to 5 for a /sup 3/H-thymidine incorporation assay; days 1 to 15 for assay of ..cap alpha..-glycerol phosphate dehydrogenase; days 5 to 14 for a complete differentiation assay. Decap sera promoted less proliferation and enzyme differentiation than reference sera with no effect of GH addition. GH reduced detection of lipid accumulating cells on percol density gradients by 81%. T4 addition stimulated preadipocyte multiplication and produced a 30% increase in completely differentiated preadipocytes. These results indicate thyroid hormones are important components of fetal sera for regulation of preadipocyte development, whereas GH may only affect cellular metabolism.

  2. The adipogenic transcriptional cofactor ZNF638 interacts with splicing regulators and influences alternative splicing

    PubMed Central

    Du, Chen; Ma, Xinran; Meruvu, Sunitha; Hugendubler, Lynne; Mueller, Elisabetta

    2014-01-01

    Increasing evidence indicates that transcription and alternative splicing are coordinated processes; however, our knowledge of specific factors implicated in both functions during the process of adipocyte differentiation is limited. We have previously demonstrated that the zinc finger protein ZNF638 plays a role as a transcriptional coregulator of adipocyte differentiation via induction of PPARγ in cooperation with CCAAT/enhancer binding proteins (C/EBPs). Here we provide new evidence that ZNF638 is localized in nuclear bodies enriched with splicing factors, and through biochemical purification of ZNF638’s interacting proteins in adipocytes and mass spectrometry analysis, we show that ZNF638 interacts with splicing regulators. Functional analysis of the effects of ectopic ZNF638 expression on a minigene reporter demonstrated that ZNF638 is sufficient to promote alternative splicing, a function enhanced through its recruitment to the minigene promoter at C/EBP responsive elements via C/EBP proteins. Structure-function analysis revealed that the arginine/serine-rich motif and the C-terminal zinc finger domain required for speckle localization are necessary for the adipocyte differentiation function of ZNF638 and for the regulation of the levels of alternatively spliced isoforms of lipin1 and nuclear receptor co-repressor 1. Overall, our data demonstrate that ZNF638 participates in splicing decisions and that it may control adipogenesis through regulation of the relative amounts of differentiation-specific isoforms. PMID:25024404

  3. A novel role for neural cell adhesion molecule in modulating insulin signaling and adipocyte differentiation of mouse mesenchymal stem cells.

    PubMed

    Yang, Hai Jie; Xia, Yin Yan; Wang, Lei; Liu, Rui; Goh, Kim Jee; Ju, Pei Jun; Feng, Zhi Wei

    2011-08-01

    Neural cell adhesion molecule (NCAM) has recently been found on adult stem cells, but its biological significance remains largely unknown. In this study, we used bone-marrow-derived mesenchymal stem cells (MSCs) from wild-type and NCAM knockout mice to investigate the role of NCAM in adipocyte differentiation. It was demonstrated that NCAM isoforms 180 and 140 but not NCAM-120 are expressed on almost all wild-type MSCs. Upon adipogenic induction, Ncam(-/-) MSCs exhibited a marked decrease in adipocyte differentiation compared with wild-type cells. The role of NCAM in adipocyte differentiation was also confirmed in NCAM-silenced preadipocyte 3T3-L1 cells, which also had a phenotype with reduced adipogenic potential. In addition, we found that Ncam(-/-) MSCs appeared to be insulin resistant, as shown by their impaired insulin signaling cascade, such as the activation of the insulin-IGF-1 receptor, PI3K-Akt and CREB pathways. The PI3K-Akt inhibitor, LY294002, completely blocked adipocyte differentiation of MSCs, unveiling that the reduced adipogenic potential of Ncam(-/-) MSCs is due to insulin resistance as a result of loss of NCAM function. Furthermore, insulin resistance of Ncam(-/-) MSCs was shown to be associated with induction of tumor necrosis factor α (TNF-α), a key mediator of insulin resistance. Finally, we demonstrated that re-expression of NCAM-180, but not NCAM-140, inhibits induction of TNF-α and thereby improves insulin resistance and adipogenic potential of Ncam(-/-) MSCs. Our results suggest a novel role of NCAM in promoting insulin signaling and adipocyte differentiation of adult stem cells. These findings raise the possibility of using NCAM intervention to improve insulin resistance.

  4. Follistatin promotes adipocyte differentiation, browning, and energy metabolism.

    PubMed

    Braga, Melissa; Reddy, Srinivasa T; Vergnes, Laurent; Pervin, Shehla; Grijalva, Victor; Stout, David; David, John; Li, Xinmin; Tomasian, Venina; Reid, Christopher B; Norris, Keith C; Devaskar, Sherin U; Reue, Karen; Singh, Rajan

    2014-03-01

    Follistatin (Fst) functions to bind and neutralize the activity of members of the transforming growth factor-β superfamily. Fst has a well-established role in skeletal muscle, but we detected significant Fst expression levels in interscapular brown and subcutaneous white adipose tissue, and further investigated its role in adipocyte biology. Fst expression was induced during adipogenic differentiation of mouse brown preadipocytes and mouse embryonic fibroblasts (MEFs) as well as in cold-induced brown adipose tissue from mice. In differentiated MEFs from Fst KO mice, the induction of brown adipocyte proteins including uncoupling protein 1, PR domain containing 16, and PPAR gamma coactivator-1α was attenuated, but could be rescued by treatment with recombinant FST. Furthermore, Fst enhanced thermogenic gene expression in differentiated mouse brown adipocytes and MEF cultures from both WT and Fst KO groups, suggesting that Fst produced by adipocytes may act in a paracrine manner. Our microarray gene expression profiling of WT and Fst KO MEFs during adipogenic differentiation identified several genes implicated in lipid and energy metabolism that were significantly downregulated in Fst KO MEFs. Furthermore, Fst treatment significantly increases cellular respiration in Fst-deficient cells. Our results implicate a novel role of Fst in the induction of brown adipocyte character and regulation of energy metabolism. PMID:24443561

  5. A comparative evaluation of the effect of polymer chemistry and fiber orientation on mesenchymal stem cell differentiation.

    PubMed

    Rowland, David C L; Aquilina, Thomas; Klein, Andrei; Hakimi, Osnat; Alexis-Mouthuy, Pierre; Carr, Andrew J; Snelling, Sarah J B

    2016-11-01

    Bioengineered tissue scaffolds in combination with cells hold great promise for tissue regeneration. The aim of this study was to determine how the chemistry and fiber orientation of engineered scaffolds affect the differentiation of mesenchymal stem cells (MSCs). Adipogenic, chondrogenic, and osteogenic differentiation on aligned and randomly orientated electrospun scaffolds of Poly (lactic-co-glycolic) acid (PLGA) and Polydioxanone (PDO) were compared. MSCs were seeded onto scaffolds and cultured for 14 days under adipogenic-, chondrogenic-, or osteogenic-inducing conditions. Cell viability was assessed by alamarBlue metabolic activity assays and gene expression was determined by qRT-PCR. Cell-scaffold interactions were visualized using fluorescence and scanning electron microscopy. Cells grew in response to scaffold fiber orientation and cell viability, cell coverage, and gene expression analysis showed that PDO supports greater multilineage differentiation of MSCs. An aligned PDO scaffold supports highest adipogenic and osteogenic differentiation whereas fiber orientation did not have a consistent effect on chondrogenesis. Electrospun scaffolds, selected on the basis of fiber chemistry and alignment parameters could provide great therapeutic potential for restoration of fat, cartilage, and bone tissue. This study supports the continued investigation of an electrospun PDO scaffold for tissue repair and regeneration and highlights the potential of optimizing fiber orientation for improved utility. © 2016 The Authors Journal of Biomedical Materials Research Part A Published by Wiley Periodicals, Inc. J Biomed Mater Res Part A: 104A: 2843-2853, 2016.

  6. Buckwheat (Fagopyrum esculentum M.) sprout treated with methyl jasmonate (MeJA) improved anti-adipogenic activity associated with the oxidative stress system in 3T3-L1 adipocytes.

    PubMed

    Lee, Young-Jun; Kim, Kui-Jin; Park, Kee-Jai; Yoon, Bo-Ra; Lim, Jeong-Ho; Lee, Ok-Hwan

    2013-01-11

    Buckwheat sprouts contain various bioactive compounds including rutin which have a number of biological activities. We have previously shown that buckwheat sprouts (TBWE) treated with methyl jasmonate (MeJA) significantly increased the amount of phenolics and the antioxidant activity. The aim of this study was to demonstrate the effect of TBWE on anti-adipogenesis and pro-oxidant enzyme in 3T3-L1 adipocytes. We also evaluated the anti-oxidative activity of TBWE in adipocytes by using the nitroblue tetrazolium assay. Our data showed that TBWE markedly inhibited adipocyte differentiation and ROS production in 3T3-L1 cells compared with control groups. Moreover, TBWE has strongly shown the inhibition of adipogenic transcription factor as well as pro-oxidant enzymes. Together, we demonstrate that the MeJA treatment significantly increased the amount of phenolic compound, resulting in the suppression of adipogenesis and ROS production in the 3T3-L1 cells. These findings indicate that TBWE has the potential for anti-adipogenesis activity with anti-oxidative properties.

  7. Supplementation of CHROMagar Candida Medium with Pal's Medium for Rapid Identification of Candida dubliniensis

    PubMed Central

    Sahand, Ismail H.; Moragues, María D.; Eraso, Elena; Villar-Vidal, María; Quindós, Guillermo; Pontón, José

    2005-01-01

    CHROMagar Candida medium is used for the isolation and identification of Candida species, but it does not differentiate Candida albicans from Candida dubliniensis. This differentiation can be achieved by using Pal's agar, which cannot be used in primary isolation. We have combined both media to obtain a new medium that can be used for the isolation and identification of C. dubliniensis in primary cultures. PMID:16272515

  8. Oncogenic steroid receptor coactivator-3 is a key regulator of the white adipogenic program

    PubMed Central

    Louet, Jean-Francois; Coste, Agnès; Amazit, Larbi; Tannour-Louet, Mounia; Wu, Ray-Chang; Tsai, Sophia Y.; Tsai, Ming-Jer; Auwerx, Johan; O'Malley, Bert W.

    2006-01-01

    The white adipocyte is at the center of dysfunctional regulatory pathways in various pathophysiological processes, including obesity, diabetes, inflammation, and cancer. Here, we show that the oncogenic steroid receptor coactivator-3 (SRC-3) is a critical regulator of white adipocyte development. Indeed, in SRC-3−/− mouse embryonic fibroblasts, adipocyte differentiation was severely impaired, and reexpression of SRC-3 was able to restore it. The early stages of adipocyte differentiation are accompanied by an increase in nuclear levels of SRC-3, which accumulates to high levels specifically in the nucleus of differentiated fat cells. Moreover, SRC-3−/− animals showed reduced body weight and adipose tissue mass with a significant decrease of the expression of peroxisome proliferator-activated receptor γ2 (PPARγ2), a master gene required for adipogenesis. At the molecular level, SRC-3 acts synergistically with the transcription factor CAAT/enhancer-binding protein to control the gene expression of PPARγ2. Collectively, these data suggest a crucial role for SRC-3 as an integrator of the complex transcriptional network controlling adipogenesis. PMID:17098861

  9. The Expression of Adipogenic Genes in Adipose Tissues of Feedlot Steers Fed Supplementary Palm Oil or Soybean Oil

    PubMed Central

    Choi, Seong Ho; Park, Sung Kwon; Choi, Chang Weon; Li, Xiang Zi; Kim, Kyoung Hoon; Kim, Won Young; Jeong, Joon; Johnson, Bradley J.; Zan, Linsen; Smith, Stephen B.

    2016-01-01

    We hypothesized that supplementing finishing diets with palm oil would promote adipogenic gene expression and stearoyl-CoA desaturase (SCD) gene expression in subcutaneous (s.c.) and intramuscular (i.m.) adipose tissues of feedlot steers. Eighteen Angus and Angus crossbred steers were assigned to three groups of 6 steers and fed a basal diet (control), with 3% palm oil, or with 3% soybean oil, for 70 d, top-dressed daily. Tailhead s.c. adipose tissue was obtained by biopsy at 14 d before the initiation of dietary treatments and at 35 d of dietary treatments. At slaughter, after 70 d of dietary treatment, tailhead s.c. adipose tissue and i.m. adipose tissue were obtained from the longissimus thoracis muscle. Palm oil increased plasma palmitic acid and soybean oil increased plasma linoleic acid and α-linolenic acid relative to the initial sampling time. Expression of AMP-activated protein kinase alpha (AMPKα) and peroxisome proliferator-activated receptor gamma (PPARγ) increased between the initial and intermediate biopsies and declined thereafter (p<0.03). SCD gene expression did not change between the initial and intermediate biopsies but declined by over 75% by the final period (p = 0.04), and G-coupled protein receptor 43 (GPR43) gene expression was unaffected by diet or time on trial. Soybean oil decreased (p = 0.01) PPARγ gene expression at the intermediate sample time. At the terminal sample time, PPARγ and SCD gene expression was less in i.m. adipose tissue than in s.c. adipose tissue (p<0.05). AMPKα gene expression was less in s.c. adipose tissue of palm oil-fed steers than in control steers (p = 0.04) and CCAAT enhancer binding protein-beta (CEBPβ) gene expression was less in s.c. and i.m. adipose tissues of palm oil-fed steers than in soybean oil-fed steers (p<0.03). Soybean oil decreased SCD gene expression in s.c. adipose tissue (p = 0.05); SCD gene expression in palm oil-fed steers was intermediate between control and soybean oil-fed steers

  10. The Expression of Adipogenic Genes in Adipose Tissues of Feedlot Steers Fed Supplementary Palm Oil or Soybean Oil.

    PubMed

    Choi, Seong Ho; Park, Sung Kwon; Choi, Chang Weon; Li, Xiang Zi; Kim, Kyoung Hoon; Kim, Won Young; Jeong, Joon; Johnson, Bradley J; Zan, Linsen; Smith, Stephen B

    2016-03-01

    We hypothesized that supplementing finishing diets with palm oil would promote adipogenic gene expression and stearoyl-CoA desaturase (SCD) gene expression in subcutaneous (s.c.) and intramuscular (i.m.) adipose tissues of feedlot steers. Eighteen Angus and Angus crossbred steers were assigned to three groups of 6 steers and fed a basal diet (control), with 3% palm oil, or with 3% soybean oil, for 70 d, top-dressed daily. Tailhead s.c. adipose tissue was obtained by biopsy at 14 d before the initiation of dietary treatments and at 35 d of dietary treatments. At slaughter, after 70 d of dietary treatment, tailhead s.c. adipose tissue and i.m. adipose tissue were obtained from the longissimus thoracis muscle. Palm oil increased plasma palmitic acid and soybean oil increased plasma linoleic acid and α-linolenic acid relative to the initial sampling time. Expression of AMP-activated protein kinase alpha (AMPKα) and peroxisome proliferator-activated receptor gamma (PPARγ) increased between the initial and intermediate biopsies and declined thereafter (p<0.03). SCD gene expression did not change between the initial and intermediate biopsies but declined by over 75% by the final period (p = 0.04), and G-coupled protein receptor 43 (GPR43) gene expression was unaffected by diet or time on trial. Soybean oil decreased (p = 0.01) PPARγ gene expression at the intermediate sample time. At the terminal sample time, PPARγ and SCD gene expression was less in i.m. adipose tissue than in s.c. adipose tissue (p<0.05). AMPKα gene expression was less in s.c. adipose tissue of palm oil-fed steers than in control steers (p = 0.04) and CCAAT enhancer binding protein-beta (CEBPβ) gene expression was less in s.c. and i.m. adipose tissues of palm oil-fed steers than in soybean oil-fed steers (p<0.03). Soybean oil decreased SCD gene expression in s.c. adipose tissue (p = 0.05); SCD gene expression in palm oil-fed steers was intermediate between control and soybean oil-fed steers

  11. The Expression of Adipogenic Genes in Adipose Tissues of Feedlot Steers Fed Supplementary Palm Oil or Soybean Oil.

    PubMed

    Choi, Seong Ho; Park, Sung Kwon; Choi, Chang Weon; Li, Xiang Zi; Kim, Kyoung Hoon; Kim, Won Young; Jeong, Joon; Johnson, Bradley J; Zan, Linsen; Smith, Stephen B

    2016-03-01

    We hypothesized that supplementing finishing diets with palm oil would promote adipogenic gene expression and stearoyl-CoA desaturase (SCD) gene expression in subcutaneous (s.c.) and intramuscular (i.m.) adipose tissues of feedlot steers. Eighteen Angus and Angus crossbred steers were assigned to three groups of 6 steers and fed a basal diet (control), with 3% palm oil, or with 3% soybean oil, for 70 d, top-dressed daily. Tailhead s.c. adipose tissue was obtained by biopsy at 14 d before the initiation of dietary treatments and at 35 d of dietary treatments. At slaughter, after 70 d of dietary treatment, tailhead s.c. adipose tissue and i.m. adipose tissue were obtained from the longissimus thoracis muscle. Palm oil increased plasma palmitic acid and soybean oil increased plasma linoleic acid and α-linolenic acid relative to the initial sampling time. Expression of AMP-activated protein kinase alpha (AMPKα) and peroxisome proliferator-activated receptor gamma (PPARγ) increased between the initial and intermediate biopsies and declined thereafter (p<0.03). SCD gene expression did not change between the initial and intermediate biopsies but declined by over 75% by the final period (p = 0.04), and G-coupled protein receptor 43 (GPR43) gene expression was unaffected by diet or time on trial. Soybean oil decreased (p = 0.01) PPARγ gene expression at the intermediate sample time. At the terminal sample time, PPARγ and SCD gene expression was less in i.m. adipose tissue than in s.c. adipose tissue (p<0.05). AMPKα gene expression was less in s.c. adipose tissue of palm oil-fed steers than in control steers (p = 0.04) and CCAAT enhancer binding protein-beta (CEBPβ) gene expression was less in s.c. and i.m. adipose tissues of palm oil-fed steers than in soybean oil-fed steers (p<0.03). Soybean oil decreased SCD gene expression in s.c. adipose tissue (p = 0.05); SCD gene expression in palm oil-fed steers was intermediate between control and soybean oil-fed steers

  12. Isolation, characterization and neural differentiation potential of amnion derived mesenchymal stem cells.

    PubMed

    Manochantr, Sirikul; Tantrawatpan, Chairat; Kheolamai, Pakpoom; U-pratya, Yaowaluk; Supokawej, Aungkura; Issaragrisil, Surapol

    2010-12-01

    Mesenchymal stem cells (MSCs) derived from amnion are considered to be adult stem cells that can be easily obtained in large quantities by a less invasive method in comparison to bone marrow-derived MSCs (BM-MSCs). However; the biological properties and the differentiation capacity of amnion-derived MSCs (AM-MSCs) are still poorly characterized. The objectives of this study were to isolate, characterize and explore the potential of AM-MSCs in differentiating toward neural lineage in comparison to those of BM-MSCs. To isolate AM-MSCs, amnion was digested with trypsin-EDTA and cultured in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% fetal bovine serum. The expression profiles of several MSC markers were examined by flow cytometry. AM-MSCs from passage 3-5 were used for adipogenic, osteogenic and neural differentiation assays by culturing in appropriate induction media. The expression of several neural marker genes, including MAP-2, GFAP and beta-tubulin III in AM-MSCs was determined by quantitative real time-PCR. The expression of neural-specific markers, MAP-2 and beta-tubulin III, was subsequently confirmed by immunocytochemistry using confocal laser microscope. The results demonstrated that AM-MSCs could be easily expanded to 18-20 passages while maintaining the undifferentiated state and exhibiting MSC markers (CD73, CD90, and CD105) but do not express the hematopoietic markers (CD34 and CD45). Similar to BM-MSCs, AM-MSCs were able to differentiate to several mesodermal-lineages including adipocytes and osteoblasts. Moreover; these cells could be induced to differentiate to neuron-like cells as characterized by cell morphology and the expression of several neural markers including MAP-2, GFAP and beta-tubulin III. The present study demonstrated that AM-MSCs can be easily obtained and expanded in culture. These cells also have transdifferentiation capacity as evidenced by their neural differentiation potential. According to the results, amnion

  13. Impacts of Alternative Splicing Events on the Differentiation of Adipocytes

    PubMed Central

    Lin, Jung-Chun

    2015-01-01

    Alternative splicing was found to be a common phenomenon after the advent of whole transcriptome analyses or next generation sequencing. Over 90% of human genes were demonstrated to undergo at least one alternative splicing event. Alternative splicing is an effective mechanism to spatiotemporally expand protein diversity, which influences the cell fate and tissue development. The first focus of this review is to highlight recent studies, which demonstrated effects of alternative splicing on the differentiation of adipocytes. Moreover, use of evolving high-throughput approaches, such as transcriptome analyses (RNA sequencing), to profile adipogenic transcriptomes, is also addressed. PMID:26389882

  14. Sodium butyrate activates ERK to regulate differentiation of mesenchymal stem cells.

    PubMed

    Chen, Tain-Hsiung; Chen, Wei-Ming; Hsu, Ke-Hsun; Kuo, Cheng-Deng; Hung, Shih-Chieh

    2007-04-20

    Histone deacetylase inhibitors such as sodium butyrate are known to regulate the differentiation of a variety of cells. Mesenchymal stem cells (MSCs) differentiate into osteoblasts and adipocytes under transcriptional control of Runx2 and PPARgamma2, respectively. How these two transcription factors are regulated by sodium butyrate in order to specify the alternate cell fates remains a pivotal question. Sodium butyrate stimulated osteogenic differentiation and increased expression of Runx2 and genes regulated by Runx2 when cells were induced to undergo osteogenic differentiation. Sodium butyrate suppressed the adipogenic differentiation and decreased the expression of PPARgamma2 and LPL when MSCs were treated under conditions that promote adipogenic differentiation. Sodium butyrate also decreased the ratio of RANKL/OPG gene expression by MSCs. Analysis of MSCs induced in the presence of sodium butyrate revealed an immediate increase in ERK phosphorylation by sodium butyrate. The MEK-specific inhibitor, PD98059 but not p38- or JNK-specific inhibitor and the transfection with dominant negative ERK expressing plasmids blocked the sodium butyrate-induced regulation of MSC differentiation and increase in the RANKL/OPG ratio. Our results suggest that sodium butyrate modulates MSC differentiation and the RANKL/OPG ratio via activating ERK, and could be applied for in vivo bone growth using MSCs.

  15. Discovery of Isoquinolinoquinazolinones as a Novel Class of Potent PPARγ Antagonists with Anti-adipogenic Effects

    PubMed Central

    Jin, Yifeng; Han, Younho; Khadka, Daulat Bikram; Zhao, Chao; Lee, Kwang Youl; Cho, Won-Jea

    2016-01-01

    Conformational change in helix 12 can alter ligand-induced PPARγ activity; based on this reason, isoquinolinoquinazolinones, structural homologs of berberine, were designed and synthesized as PPARγ antagonists. Computational docking and mutational study indicated that isoquinolinoquinazolinones form hydrogen bonds with the Cys285 and Arg288 residues of PPARγ. Furthermore, SPR results demonstrated strong binding affinity of isoquinolinoquinazolinones towards PPARγ. Additionally, biological assays showed that this new series of PPARγ antagonists more strongly inhibit adipocyte differentiation and PPARγ2-induced transcriptional activity than GW9662. PMID:27695006

  16. New phenolic compounds with anti-adipogenic activity from the aerial parts of Pulsatilla koreana.

    PubMed

    Liu, Qing; Ahn, Jong Hoon; Kim, Seon Beom; Hwang, Bang Yeon; Lee, Mi Kyeong

    2012-11-01

    Three new phenolic compounds, pulsatillosides A (1), B (2), and C (3), were isolated from the aerial parts of Pulsatilla koreana, together with two known flavonoid glycosides, trans-tiliroside (4) and kaempferol-3-O-β-glycoside (5). The structures of the isolated compounds were determined on the basis of spectroscopic analysis including 1D, 2D NMR and HR-MS. Among the isolated compounds, compounds 1-3 significantly inhibited adipocyte differentiation as measured by fat accumulation in 3 T3-L1 cells using Oil Red O staining.

  17. Dissimilar differentiation of mesenchymal stem cells from bone marrow, umbilical cord blood, and adipose tissue.

    PubMed

    Rebelatto, C K; Aguiar, A M; Moretão, M P; Senegaglia, A C; Hansen, P; Barchiki, F; Oliveira, J; Martins, J; Kuligovski, C; Mansur, F; Christofis, A; Amaral, V F; Brofman, P S; Goldenberg, S; Nakao, L S; Correa, A

    2008-07-01

    Mesenchymal stem cells (MSCs) have been investigated as promising candidates for use in new cell-based therapeutic strategies such as mesenchyme-derived tissue repair. MSCs are easily isolated from adult tissues and are not ethically restricted. MSC-related literature, however, is conflicting in relation to MSC differentiation potential and molecular markers. Here we compared MSCs isolated from bone marrow (BM), umbilical cord blood (UCB), and adipose tissue (AT). The isolation efficiency for both BM and AT was 100%, but that from UCB was only 30%. MSCs from these tissues are morphologically and immunophenotypically similar although their differentiation diverges. Differentiation to osteoblasts and chondroblasts was similar among MSCs from all sources, as analyzed by cytochemistry. Adipogenic differentiation showed that UCB-derived MSCs produced few and small lipid vacuoles in contrast to those of BM-derived MSCs and AT-derived stem cells (ADSCs) (arbitrary differentiation values of 245.57 +/- 943 and 243.89 +/- 145.52 mum(2) per nucleus, respectively). The mean area occupied by individual lipid droplets was 7.37 mum(2) for BM-derived MSCs and 2.36 mum(2) for ADSCs, a finding indicating more mature adipocytes in BM-derived MSCs than in treated cultures of ADSCs. We analyzed FAPB4, ALP, and type II collagen gene expression by quantitative polymerase chain reaction to confirm adipogenic, osteogenic, and chondrogenic differentiation, respectively. Results showed that all three sources presented a similar capacity for chondrogenic and osteogenic differentiation and they differed in their adipogenic potential. Therefore, it may be crucial to predetermine the most appropriate MSC source for future clinical applications.

  18. Dissimilar differentiation of mesenchymal stem cells from bone marrow, umbilical cord blood, and adipose tissue.

    PubMed

    Rebelatto, C K; Aguiar, A M; Moretão, M P; Senegaglia, A C; Hansen, P; Barchiki, F; Oliveira, J; Martins, J; Kuligovski, C; Mansur, F; Christofis, A; Amaral, V F; Brofman, P S; Goldenberg, S; Nakao, L S; Correa, A

    2008-07-01

    Mesenchymal stem cells (MSCs) have been investigated as promising candidates for use in new cell-based therapeutic strategies such as mesenchyme-derived tissue repair. MSCs are easily isolated from adult tissues and are not ethically restricted. MSC-related literature, however, is conflicting in relation to MSC differentiation potential and molecular markers. Here we compared MSCs isolated from bone marrow (BM), umbilical cord blood (UCB), and adipose tissue (AT). The isolation efficiency for both BM and AT was 100%, but that from UCB was only 30%. MSCs from these tissues are morphologically and immunophenotypically similar although their differentiation diverges. Differentiation to osteoblasts and chondroblasts was similar among MSCs from all sources, as analyzed by cytochemistry. Adipogenic differentiation showed that UCB-derived MSCs produced few and small lipid vacuoles in contrast to those of BM-derived MSCs and AT-derived stem cells (ADSCs) (arbitrary differentiation values of 245.57 +/- 943 and 243.89 +/- 145.52 mum(2) per nucleus, respectively). The mean area occupied by individual lipid droplets was 7.37 mum(2) for BM-derived MSCs and 2.36 mum(2) for ADSCs, a finding indicating more mature adipocytes in BM-derived MSCs than in treated cultures of ADSCs. We analyzed FAPB4, ALP, and type II collagen gene expression by quantitative polymerase chain reaction to confirm adipogenic, osteogenic, and chondrogenic differentiation, respectively. Results showed that all three sources presented a similar capacity for chondrogenic and osteogenic differentiation and they differed in their adipogenic potential. Therefore, it may be crucial to predetermine the most appropriate MSC source for future clinical applications. PMID:18445775

  19. Phenolic composition, antioxidant activity and anti-adipogenic effect of hot water extract from safflower (Carthamus tinctorius L.) seed.

    PubMed

    Yu, Seok-Yeong; Lee, Young-Jun; Kim, Jong-Dai; Kang, Suk-Nam; Lee, Seong-Kap; Jang, Jung-Young; Lee, Hyo-Ku; Lim, Jeong-Ho; Lee, Ok-Hwan

    2013-11-28

    This study was to evaluate the phenolic content and composition of Carthamus tinctorius L. seed extract (CSE) and to further assess its antioxidant and anti-adipogenic activities using various radical scavenging systems and 3T3-L1 cells. Our results show that the total phenolic and flavonoid contents of CSE were 126.0 ± 2.4 mg GAE/g and 62.2 ± 1.9 mg QE/g, respectively. The major phenolic compounds in CSE was (-)-epigallocatechin (109.62 mg/g), with a 4-hydroxy benzhydrazide derivative and gallocatechin present at 18.28 mg/g and 17.02 mg/g, respectively. CSE exhibited remarkable radical scavenging activities, FRAP (ferric reducing antioxidant power) and reducing power in a dose-dependent manner. Moreover, the oxygen radical absorbance capacity (ORAC) value of CSE (0.1 mg/mL) was 62.9 ± 4.7 μM TE (trolox equivalent)/g. During adipogenesis, CSE significantly inhibited fat accumulation in 3T3-L1 cells compared with control cells. Overall, these results indicate that CSE might be a valuable source of bioactive compounds that impart functional food and natural antioxidant properties.

  20. Adipogenic Activity of Wild Populations of Rhododendron groenlandicum, a Medicinal Shrub from the James Bay Cree Traditional Pharmacopeia.

    PubMed

    Rapinski, Michel; Musallam, Lina; Arnason, John Thor; Haddad, Pierre; Cuerrier, Alain

    2015-01-01

    The traditional medicinal plant, Labrador tea (Rhododendron groenlandicum (Oeder) Kron & Judd; Ericaceae), present in the pharmacopoeia of the Cree of Eeyou Istchee, has shown glitazone-like activity in the 3T3-L1 adipogenesis bioassay. This activity has been attributed to phenolic compounds, which have been shown to vary in this plant as a function of insolation parameters. The goal of this study was to determine if these changes in phenolic content were pharmacologically significant. Leaves were harvested in 2006 throughout the James Bay region of Northern Quebec and ethanol extracts were tested in vitro using the 3T3-L1 murine cell line adipogenesis bioassay. This traditional medicinal plant was found active in the assay. However, there was no detectable spatial pattern in the accumulation of intracellular triglycerides, suggesting that such patterns previously observed in the phenolic profile of Labrador tea were not pharmacologically significant. Nonetheless, a reduction in the adipogenic activity was observed and associated with higher concentrations of quercetin for which selected environmental variables did not appropriately explain its variation. PMID:26508979

  1. Adipogenic Activity of Wild Populations of Rhododendron groenlandicum, a Medicinal Shrub from the James Bay Cree Traditional Pharmacopeia.

    PubMed

    Rapinski, Michel; Musallam, Lina; Arnason, John Thor; Haddad, Pierre; Cuerrier, Alain

    2015-01-01

    The traditional medicinal plant, Labrador tea (Rhododendron groenlandicum (Oeder) Kron & Judd; Ericaceae), present in the pharmacopoeia of the Cree of Eeyou Istchee, has shown glitazone-like activity in the 3T3-L1 adipogenesis bioassay. This activity has been attributed to phenolic compounds, which have been shown to vary in this plant as a function of insolation parameters. The goal of this study was to determine if these changes in phenolic content were pharmacologically significant. Leaves were harvested in 2006 throughout the James Bay region of Northern Quebec and ethanol extracts were tested in vitro using the 3T3-L1 murine cell line adipogenesis bioassay. This traditional medicinal plant was found active in the assay. However, there was no detectable spatial pattern in the accumulation of intracellular triglycerides, suggesting that such patterns previously observed in the phenolic profile of Labrador tea were not pharmacologically significant. Nonetheless, a reduction in the adipogenic activity was observed and associated with higher concentrations of quercetin for which selected environmental variables did not appropriately explain its variation.

  2. Adipogenic Activity of Wild Populations of Rhododendron groenlandicum, a Medicinal Shrub from the James Bay Cree Traditional Pharmacopeia

    PubMed Central

    Rapinski, Michel; Musallam, Lina; Arnason, John Thor; Haddad, Pierre; Cuerrier, Alain

    2015-01-01

    The traditional medicinal plant, Labrador tea (Rhododendron groenlandicum (Oeder) Kron & Judd; Ericaceae), present in the pharmacopoeia of the Cree of Eeyou Istchee, has shown glitazone-like activity in the 3T3-L1 adipogenesis bioassay. This activity has been attributed to phenolic compounds, which have been shown to vary in this plant as a function of insolation parameters. The goal of this study was to determine if these changes in phenolic content were pharmacologically significant. Leaves were harvested in 2006 throughout the James Bay region of Northern Quebec and ethanol extracts were tested in vitro using the 3T3-L1 murine cell line adipogenesis bioassay. This traditional medicinal plant was found active in the assay. However, there was no detectable spatial pattern in the accumulation of intracellular triglycerides, suggesting that such patterns previously observed in the phenolic profile of Labrador tea were not pharmacologically significant. Nonetheless, a reduction in the adipogenic activity was observed and associated with higher concentrations of quercetin for which selected environmental variables did not appropriately explain its variation. PMID:26508979

  3. ECM microenvironment unlocks brown adipogenic potential of adult human bone marrow-derived MSCs

    PubMed Central

    Lee, Michelle H.; Goralczyk, Anna G.; Kriszt, Rókus; Ang, Xiu Min; Badowski, Cedric; Li, Ying; Summers, Scott A.; Toh, Sue-Anne; Yassin, M. Shabeer; Shabbir, Asim; Sheppard, Allan; Raghunath, Michael

    2016-01-01

    Key to realizing the diagnostic and therapeutic potential of human brown/brite adipocytes is the identification of a renewable, easily accessible and safe tissue source of progenitor cells, and an efficacious in vitro differentiation protocol. We show that macromolecular crowding (MMC) facilitates brown adipocyte differentiation in adult human bone marrow mesenchymal stem cells (bmMSCs), as evidenced by substantially upregulating uncoupling protein 1 (UCP1) and uncoupled respiration. Moreover, MMC also induced ‘browning’ in bmMSC-derived white adipocytes. Mechanistically, MMC creates a 3D extracellular matrix architecture enshrouding maturing adipocytes in a collagen IV cocoon that is engaged by paxillin-positive focal adhesions also at the apical side of cells, without contact to the stiff support structure. This leads to an enhanced matrix-cell signaling, reflected by increased phosphorylation of ATF2, a key transcription factor in UCP1 regulation. Thus, tuning the dimensionality of the microenvironment in vitro can unlock a strong brown potential dormant in bone marrow. PMID:26883894

  4. Silibinin Regulates Lipid Metabolism and Differentiation in Functional Human Adipocytes

    PubMed Central

    Barbagallo, Ignazio; Vanella, Luca; Cambria, Maria T.; Tibullo, Daniele; Godos, Justyna; Guarnaccia, Laura; Zappalà, Agata; Galvano, Fabio; Li Volti, Giovanni

    2016-01-01

    Silibinin, a natural plant flavonolignan is the main active constituent found in milk thistle (Silybum marianum). It is known to have hepatoprotective, anti-neoplastic effect, and suppresses lipid accumulation in adipocytes. Objective of this study was to investigate the effect of silibinin on adipogenic differentiation and thermogenic capacity of human adipose tissue derived mesenchymal stem cells. Silibinin (10 μM) treatment, either at the beginning or at the end of adipogenic differentiation, resulted in an increase of SIRT-1, PPARα, Pgc-1α, and UCPs gene expression. Moreover, silibinin administration resulted in a decrease of PPARγ, FABP4, FAS, and MEST/PEG1 gene expression during the differentiation, confirming that this compound is able to reduce fatty acid accumulation and adipocyte size. Our data showed that silibinin regulated adipocyte lipid metabolism, inducing thermogenesis and promoting a brown remodeling in adipocyte. Taken together, our findings suggest that silibinin increases UCPs expression by stimulation of SIRT1, PPARα, and Pgc-1α, improved metabolic parameters, decreased lipid mass leading to the formation of functional adipocytes. PMID:26834634

  5. Active form Notch4 promotes the proliferation and differentiation of 3T3-L1 preadipocytes

    SciTech Connect

    Lai, Peng-Yeh; Tsai, Chong-Bin; Tseng, Min-Jen

    2013-01-18

    Highlights: ► Notch4IC modulates the ERK pathway and cell cycle to promote 3T3-L1 proliferation. ► Notch4IC facilitates 3T3-L1 differentiation by up-regulating proadipogenic genes. ► Notch4IC promotes proliferation during the early stage of 3T3-L1 adipogenesis. ► Notch4IC enhances differentiation during subsequent stages of 3T3-L1 adipogenesis. -- Abstract: Adipose tissue is composed of adipocytes, which differentiate from precursor cells in a process called adipogenesis. Many signal molecules are involved in the transcriptional control of adipogenesis, including the Notch pathway. Previous adipogenic studies of Notch have focused on Notch1 and HES1; however, the role of other Notch receptors in adipogenesis remains unclear. Q-RT-PCR analyses showed that the augmentation of Notch4 expression during the differentiation of 3T3-L1 preadipocytes was comparable to that of Notch1. To elucidate the role of Notch4 in adipogenesis, the human active form Notch4 (N4IC) was transiently transfected into 3T3-L1 cells. The expression of HES1, Hey1, C/EBPδ and PPARγ was up-regulated, and the expression of Pref-1, an adipogenic inhibitor, was down-regulated. To further characterize the effect of N4IC in adipogenesis, stable cells expressing human N4IC were established. The expression of N4IC promoted proliferation and enhanced differentiation of 3T3-L1 cells compared with those of control cells. These data suggest that N4IC promoted proliferation through modulating the ERK pathway and the cell cycle during the early stage of 3T3-L1 adipogenesis and facilitated differentiation through up-regulating adipogenic genes such as C/EBPα, PPARγ, aP2, LPL and HSL during the middle and late stages of 3T3-L1 adipogenesis.

  6. Fibrin glue is a candidate scaffold for long-term therapeutic protein expression in spontaneously differentiated adipocytes in vitro

    SciTech Connect

    Aoyagi, Yasuyuki; Kuroda, Masayuki; Asada, Sakiyo; Tanaka, Shigeaki; Konno, Shunichi; Tanio, Masami; Aso, Masayuki; Okamoto, Yoshitaka; Nakayama, Toshinori; Saito, Yasushi; Bujo, Hideaki

    2012-01-01

    Adipose tissue is expected to provide a source of cells for protein replacement therapies via auto-transplantation. However, the conditioning of the environment surrounding the transplanted adipocytes for their long-term survival and protein secretion properties has not been established. We have recently developed a preparation procedure for preadipocytes, ceiling culture-derived proliferative adipocytes (ccdPAs), as a therapeutic gene vehicle suitable for stable gene product secretion. We herein report the results of our evaluation of using fibrin glue as a scaffold for the transplanted ccdPAs for the expression of a transduced gene in a three-dimensional culture system. The ccdPAs secreted the functional protein translated from an exogenously transduced gene, as well as physiological adipocyte proteins, and the long viability of ccdPAs (up to 84 days) was dependent on the fibrinogen concentrations. The ccdPAs spontaneously accumulated lipid droplets, and their expression levels of the transduced exogenous gene with its product were maintained for at least 56 days. The fibrinogen concentration modified the adipogenic differentiation of ccdPAs and their exogenous gene expression levels, and the levels of exogenously transduced gene expression at the different fibrinogen concentrations were dependent on the extent of adipogenic differentiation in the gel. These results indicate that fibrin glue helps to maintain the high adipogenic potential of cultured adipocytes after passaging in a 3D culture system, and suggests that once they are successfully implanted at the transplantation site, the cells exhibit increased expression of the transduced gene with adipogenic differentiation.

  7. Terbium promotes adhesion and osteogenic differentiation of mesenchymal stem cells via activation of the Smad-dependent TGF-β/BMP signaling pathway.

    PubMed

    Liu, Dan-Dan; Ge, Kun; Jin, Yi; Sun, Jing; Wang, Shu-Xiang; Yang, Meng-Su; Zhang, Jin-Chao

    2014-08-01

    With its special physical and chemical properties, terbium has been widely used, which has inevitably increased the chance of human exposure to terbium-based compounds. It was reported that terbium mainly deposited in bone after introduction into the human body. Although some studies revealed the effects of terbium on bone cell lines, there have been few reports about the potential effect of terbium on adhesion and differentiation of mesenchymal stem cells (MSCs). In this study, we investigated the effects of terbium on the adhesion and osteogenic and adipogenic differentiation of MSCs and the associated molecular mechanisms. Our data reveal that terbium promoted the osteogenic differentiation in a time-dependent manner and conversely inhibited the adipogenic differentiation of MSCs. Meanwhile, the cell-cell or cell-matrix interaction was enhanced by activating adherent-related key factors, which were evaluated by real-time reverse transcriptase polymerase chain reaction (RT-PCR). Real-time RT-PCR and Western blot analysis were also performed to further detect osteogenic and adipogenic biomarkers of MSCs. The regulation of terbium on differentiation of MSCs led to the interaction between the transforming growth factor β/bone morphogenetic protein and peroxisome-proliferator-activated receptor γ (PPARγ) signaling pathways, resulting in upregulation of the osteogenic master transcription factors, such as Runt-related transcription factor 2, bone morphogenetic protein 2, collagen I, alkaline phosphatase, and osteocalcin, and downregulation of the adipogenic master transcription factors, such as PPARγ2. The results provide novel evidence to elucidate the mechanisms of bone metabolism by terbium and may be helpful for more rational application of terbium-based compounds in the future.

  8. Myotube formation is affected by adipogenic lineage cells in a cell-to-cell contact-independent manner

    SciTech Connect

    Takegahara, Yuki; Yamanouchi, Keitaro Nakamura, Katsuyuki; Nakano, Shin-ichi; Nishihara, Masugi

    2014-05-15

    Intramuscular adipose tissue (IMAT) formation is observed in some pathological conditions such as Duchenne muscular dystrophy (DMD) and sarcopenia. Several studies have suggested that IMAT formation is not only negatively correlated with skeletal muscle mass but also causes decreased muscle contraction in sarcopenia. In the present study, we examined w hether adipocytes affect myogenesis. For this purpose, skeletal muscle progenitor cells were transfected with siRNA of PPARγ (siPPARγ) in an attempt to inhibit adipogenesis. Myosin heavy chain (MHC)-positive myotube formation was promoted in cells transfected with siPPARγ compared to that of cells transfected with control siRNA. To determine whether direct cell-to-cell contact between adipocytes and myoblasts is a prerequisite for adipocytes to affect myogenesis, skeletal muscle progenitor cells were cocultured with pre- or mature adipocytes in a Transwell coculture system. MHC-positive myotube formation was inhibited when skeletal muscle progenitor cells were cocultured with mature adipocytes, but was promoted when they were cocultured with preadipocytes. Similar effects were observed when pre- or mature adipocyte-conditioned medium was used. These results indicate that preadipocytes play an important role in maintaining skeletal muscle mass by promoting myogenesis; once differentiated, the resulting mature adipocytes negatively affect myogenesis, leading to the muscle deterioration observed in skeletal muscle pathologies. - Highlights: • We examined the effects of pre- and mature adipocytes on myogenesis in vitro. • Preadipocytes and mature adipocytes affect myoblast fusion. • Preadipocytes play an important role in maintaining skeletal muscle mass. • Mature adipocytes lead to muscle deterioration observed in skeletal muscle pathologies.

  9. Radicicol, a heat shock protein 90 inhibitor, inhibits differentiation and adipogenesis in 3T3-L1 preadipocytes

    SciTech Connect

    He, Yonghan; Li, Ying; Zhang, Shuocheng; Perry, Ben; Zhao, Tiantian; Wang, Yanwen; Sun, Changhao

    2013-06-28

    Highlights: •Radicicol suppressed intracellular fat accumulation in 3T3-L1 adipocytes. •Radicicol inhibited the expression of FAS and FABP4. •Radicicol blocked cell cycle at the G1-S phase during cell differentiation. •Radicicol inhibited the PDK1/Akt pathway in adipocyte differentiation. -- Abstract: Heat shock protein 90 (Hsp90) is involved in various cellular processes, such as cell proliferation, differentiation and apoptosis. As adipocyte differentiation plays a critical role in obesity development, the present study investigated the effect of an Hsp90 inhibitor radicicol on the differentiation of 3T3-L1 preadipocytes and potential mechanisms. The cells were treated with different concentrations of radicicol during the first 8 days of cell differentiation. Adipogenesis, the expression of adipogenic transcriptional factors, differentiation makers and cell cycle were determined. It was found that radicicol dose-dependently decreased intracellular fat accumulation through down-regulating the expression of peroxisome proliferator-activated receptor γ (PPAR{sub γ}) and CCAAT element binding protein α (C/EBP{sub α}), fatty acid synthase (FAS) and fatty acid-binding protein 4 (FABP4). Flow cytometry analysis revealed that radicicol blocked cell cycle at G1-S phase. Radicicol redcued the phosphorylation of Akt while showing no effect on β-catenin expression. Radicicol decreased the phosphorylation of phosphoinositide-dependent kinase 1 (PDK1). The results suggest that radicicol inhibited 3T3-L1 preadipocyte differentiation through affecting the PDK1/Akt pathway and subsequent inhibition of mitotic clonal expansion and the expression/activity of adipogenic transcriptional factors and their downstream adipogenic proteins.

  10. Characterization of lipid metabolism in insulin-sensitive adipocytes differentiated from immortalized human mesenchymal stem cells

    SciTech Connect

    Prawitt, Janne; Niemeier, Andreas; Kassem, Moustapha; Beisiegel, Ulrike; Heeren, Joerg

    2008-02-15

    There is a great demand for cell models to study human adipocyte function. Here we describe the adipogenic differentiation of a telomerase-immortalized human mesenchymal stem cell line (hMSC-Tert) that maintains numerous features of terminally differentiated adipocytes even after prolonged withdrawal of the peroxisome proliferator activated receptor {gamma} (PPAR{gamma}) agonist rosiglitazone. Differentiated hMSC-Tert developed the characteristic monolocular phenotype of mature adipocytes. The expression of adipocyte specific markers was highly increased during differentiation. Most importantly, the presence of the PPAR{gamma} agonist rosiglitazone was not required for the stable expression of lipoprotein lipase, adipocyte fatty acid binding protein and perilipin on mRNA and protein levels. Adiponectin expression was post-transcriptionally down-regulated in the absence of rosiglitazone. Insulin sensitivity as measured by insulin-induced phosphorylation of Akt and S6 ribosomal protein was also independent of rosiglitazone. In addition to commonly used adipogenic markers, we investigated further PPAR{gamma}-stimulated proteins with a role in lipid metabolism. We observed an increase of lipoprotein receptor (VLDLR, LRP1) and apolipoprotein E expression during differentiation. Despite this increased expression, the receptor-mediated endocytosis of lipoproteins was decreased in differentiated adipocytes, suggesting that these proteins may have an additional function in adipose tissue beyond lipoprotein uptake.

  11. Stress of endoplasmic reticulum modulates differentiation and lipogenesis of human adipocytes

    SciTech Connect

    Koc, Michal; Mayerová, Veronika; Kračmerová, Jana; Mairal, Aline; Mališová, Lucia; Štich, Vladimír; Langin, Dominique; Rossmeislová, Lenka

    2015-05-08

    Background: Adipocytes are cells specialized for storage of neutral lipids. This storage capacity is dependent on lipogenesis and is diminished in obesity. The reason for the decline in lipogenic activity of adipocytes in obesity remains unknown. Recent data show that lipogenesis in liver is regulated by pathways initiated by endoplasmic reticulum stress (ERS). Thus, we aimed at investigating the effect of ERS on lipogenesis in adipose cells. Methods: Preadipocytes were isolated from subcutaneous abdominal adipose tissue from obese volunteers and in vitro differentiated into adipocytes. ERS was induced pharmacologically by thapsigargin (TG) or tunicamycin (TM). Activation of Unfolded Protein Response pathway (UPR) was monitored on the level of eIF2α phosphorylation and mRNA expression of downstream targets of UPR sensors. Adipogenic and lipogenic capacity was evaluated by Oil Red O staining, measurement of incorporation of radio-labelled glucose or acetic acid into lipids and mRNA analysis of adipogenic/lipogenic markers. Results: Exposition of adipocytes to high doses of TG (100 nM) and TM (1 μg/ml) for 1–24 h enhanced expression of several UPR markers (HSPA5, EDEM1, ATF4, XBP1s) and phosphorylation of eIF2α. This acute ERS substantially inhibited expression of lipogenic genes (DGAT2, FASN, SCD1) and glucose incorporation into lipids. Moreover, chronic exposure of preadipocytes to low dose of TG (2.5 nM) during the early phases of adipogenic conversion of preadipocytes impaired both, lipogenesis and adipogenesis. On the other hand, chronic low ERS had no apparent effect on lipogenesis in mature adipocytes. Conclusions: Acute ERS weakened a capacity of mature adipocytes to store lipids and chronic ERS diminished adipogenic potential of preadipocytes. - Highlights: • High intensity ERS inhibits lipogenic capacity of adipocytes. • ERS impairs adipogenesis when present in early stages of adipogenesis. • Lipogenesis in mature adipocytes is not

  12. Diminished satellite cells and elevated adipogenic gene expression in muscle as caused by ovariectomy are averted by low-magnitude mechanical signals

    PubMed Central

    Frechette, Danielle M.; Krishnamoorthy, Divya; Adler, Benjamin J.; Chan, M. Ete

    2015-01-01

    Age-related degeneration of the musculoskeletal system, accelerated by menopause, is further complicated by increased systemic and muscular adiposity. The purpose of this study was to identify at the molecular, cellular, and tissue levels the impact of ovariectomy on adiposity and satellite cell populations in mice and whether mechanical signals could influence any outcomes. Eight-week-old C57BL/6 mice were ovariectomized, with one half subjected to low-intensity vibration (LIV; 0.3 g/90 Hz, 15 min/day, 5 day/wk; n = 10) for 6 wk and the others sham vibrated (OVX; n = 10). Data are compared with age-matched, intact controls (AC; n = 10). In vivo μCT analysis showed that OVX mice gained 43% total (P < 0.001) and 125% visceral adiposity (P < 0.001) compared with their baseline after 6 wk, whereas LIV gained only 21% total (P = 0.01) and 70% visceral adiposity (P < 0.01). Relative to AC, expression of adipogenic genes (PPARγ, FABP4, PPARδ, and FoxO1) was upregulated in OVX muscle (P < 0.05), whereas LIV reduced these levels (P < 0.05). Adipogenic gene expression was inversely related to the percentage of total and reserve satellite cell populations in the muscle, with both declining in OVX compared with AC (−21 and −28%, respectively, P < 0.01). LIV mitigated these declines (−11 and −17%, respectively). These results provide further evidence of the negative consequences of estrogen depletion and demonstrate that mechanical signals have the potential to interrupt subsequent adipogenic gene expression and satellite cell suppression, emphasizing the importance of physical signals in protecting musculoskeletal integrity and slowing the fat phenotype. PMID:25930028

  13. Berberine Suppresses Adipocyte Differentiation via Decreasing CREB Transcriptional Activity

    PubMed Central

    Deng, Ruyuan; Wang, Ning; Zhang, Yuqing; Wang, Yao; Liu, Yun; Li, Fengying; Wang, Xiao; Zhou, Libin

    2015-01-01

    Berberine, one of the major constituents of Chinese herb Rhizoma coptidis, has been demonstrated to lower blood glucose, blood lipid, and body weight in patients with type 2 diabetes mellitus. The anti-obesity effect of berberine has been attributed to its anti-adipogenic activity. However, the underlying molecular mechanism remains largely unknown. In the present study, we found that berberine significantly suppressed the expressions of CCAAT/enhancer-binding protein (C/EBP)α, peroxisome proliferators-activated receptor γ2 (PPARγ2), and other adipogenic genes in the process of adipogenesis. Berberine decreased cAMP-response element-binding protein (CREB) phosphorylation and C/EBPβ expression at the early stage of 3T3-L1 preadipocyte differentiation. In addition, CREB phosphorylation and C/EBPβ expression induced by 3-isobutyl-1-methylxanthine (IBMX) and forskolin were also attenuated by berberine. The binding activities of cAMP responsive element (CRE) stimulated by IBMX and forskolin were inhibited by berberine. The binding of phosphorylated CREB to the promoter of C/EBPβ was abrogated by berberine after the induction of preadipocyte differentiation. These results suggest that berberine blocks adipogenesis mainly via suppressing CREB activity, which leads to a decrease in C/EBPβ-triggered transcriptional cascades. PMID:25928058

  14. Depolarizing differential Mueller matrices.

    PubMed

    Ortega-Quijano, Noé; Arce-Diego, José Luis

    2011-07-01

    The evolution of a polarized beam can be described by the differential formulation of Mueller calculus. The nondepolarizing differential Mueller matrices are well known. However, they only account for 7 out of the 16 independent parameters that are necessary to model a general anisotropic depolarizing medium. In this work we present the nine differential Mueller matrices for general depolarizing media, highlighting the physical implications of each of them. Group theory is applied to establish the relationship between the differential matrix and the set of transformation generators in the Minkowski space, of which Lorentz generators constitute a particular subgroup. PMID:21725434

  15. Effects of Parabens on Adipocyte Differentiation

    PubMed Central

    Zhao, Ling

    2013-01-01

    Parabens are a group of alkyl esters of p-hydroxybenzoic acid that include methylparaben, ethylparaben, propylparaben, butylparaben, and benzylparaben. Paraben esters and their salts are widely used as preservatives in cosmetics, toiletries, food, and pharmaceuticals. Humans are exposed to parabens through the use of such products from dermal contact, ingestion, and inhalation. However, research on the effects of parabens on health is limited, and the effects of parabens on adipogenesis have not been systematically studied. Here, we report that (1) parabens promote adipogenesis (or adipocyte differentiation) in murine 3T3-L1 cells, as revealed by adipocyte morphology, lipid accumulation, and mRNA expression of adipocyte-specific markers; (2) the adipogenic potency of parabens is increased with increasing length of the linear alkyl chain in the following potency ranking order: methyl- < ethyl- < propyl- < butylparaben. The extension of the linear alkyl chain with an aromatic ring in benzylparaben further augments the adipogenic ability, whereas 4-hydroxybenzoic acid, the common metabolite of all parabens, and the structurally related benzoic acid (without the OH group) are inactive in promoting 3T3-L1 adipocyte differentiation; (3) parabens activate glucocorticoid receptor and/or peroxisome proliferator-activated receptor γ in 3T3-L1 preadipocytes; however, no direct binding to, or modulation of, the ligand binding domain of the glucocorticoid receptor by parabens was detected by glucocorticoid receptor competitor assays; and lastly, (4) parabens, butyl- and benzylparaben in particular, also promote adipose conversion of human adipose–derived multipotent stromal cells. Our results suggest that parabens may contribute to obesity epidemic, and the role of parabens in adipogenesis in vivo needs to be examined further. PMID:22956630

  16. Effects of parabens on adipocyte differentiation.

    PubMed

    Hu, Pan; Chen, Xin; Whitener, Rick J; Boder, Eric T; Jones, Jeremy O; Porollo, Aleksey; Chen, Jiangang; Zhao, Ling

    2013-01-01

    Parabens are a group of alkyl esters of p-hydroxybenzoic acid that include methylparaben, ethylparaben, propylparaben, butylparaben, and benzylparaben. Paraben esters and their salts are widely used as preservatives in cosmetics, toiletries, food, and pharmaceuticals. Humans are exposed to parabens through the use of such products from dermal contact, ingestion, and inhalation. However, research on the effects of parabens on health is limited, and the effects of parabens on adipogenesis have not been systematically studied. Here, we report that (1) parabens promote adipogenesis (or adipocyte differentiation) in murine 3T3-L1 cells, as revealed by adipocyte morphology, lipid accumulation, and mRNA expression of adipocyte-specific markers; (2) the adipogenic potency of parabens is increased with increasing length of the linear alkyl chain in the following potency ranking order: methyl- < ethyl- < propyl- < butylparaben. The extension of the linear alkyl chain with an aromatic ring in benzylparaben further augments the adipogenic ability, whereas 4-hydroxybenzoic acid, the common metabolite of all parabens, and the structurally related benzoic acid (without the OH group) are inactive in promoting 3T3-L1 adipocyte differentiation; (3) parabens activate glucocorticoid receptor and/or peroxisome proliferator-activated receptor γ in 3T3-L1 preadipocytes; however, no direct binding to, or modulation of, the ligand binding domain of the glucocorticoid receptor by parabens was detected by glucocorticoid receptor competitor assays; and lastly, (4) parabens, butyl- and benzylparaben in particular, also promote adipose conversion of human adipose-derived multipotent stromal cells. Our results suggest that parabens may contribute to obesity epidemic, and the role of parabens in adipogenesis in vivo needs to be examined further.

  17. Differential roles of hypoxia inducible factor subunits in multipotential stromal cells under hypoxic condition

    PubMed Central

    Tamama, Kenichi; Kawasaki, Haruhisa; Kerpedjieva, Svetoslava S.; Guan, Jianjun; Ganju, Ramesh K.; Sen, Chandan K.

    2014-01-01

    Cell therapy with bone marrow multipotential stromal cells (MSCs) represents a promising approach to promote wound healing and tissue regeneration. MSCs expanded in vitro lose early progenitors with differentiation and therapeutic potentials under normoxic condition, whereas hypoxic condition promotes MSC self-renewal through preserving colony forming early progenitors and maintaining undifferentiated phenotypes. Hypoxia inducible factor (HIF) pathway is a crucial signaling pathway activated in hypoxic condition. We evaluated the roles of HIFs in MSC differentiation, colony formation, and paracrine activity under hypoxic condition. Hypoxic condition reversibly decreased osteogenic and adipogenic differentiation. Decrease of osteogenic differentiation depended on HIF pathway; whereas decrease of adipogenic differentiation depended on the activation of unfolded protein response (UPR), but not HIFs. Hypoxia-mediated increase of MSC colony formation was not HIF-dependent also. Hypoxic exposure increased secretion of VEGF, HGF and basic FGF in a HIF-dependent manner. These findings suggest that HIF has a limited, but pivotal role in enhancing MSC self-renewal and growth factor secretions under hypoxic condition. PMID:21328454

  18. Long-Term Tracking Mesenchymal Stem Cell Differentiation with Photostable Fluorescent Nanoparticles.

    PubMed

    Liu, Shiying; Tay, Li Min; Anggara, Raditya; Chuah, Yon Jin; Kang, Yuejun

    2016-05-18

    Mesenchymal stem cells (MSCs) have proved to be a promising and abundant cell source for tissue and organ repair in regenerative medicine. However, the cell fate, distribution and migration of these transplanted cells are still unclear due to the limited tracking methods. It is desirable to develop a biocompatible and photostable probe to label the MSCs for long-term tracking without affecting the cell proliferation and potency. Herein we apply a recently developed nanoprobe system, in which di(thiophene-2-yl)-diketopyrrolopyrrole (DPP) is covalently linked in the middle of polycaprolactone (PCL) forming the PCL-DPP-PCL polymer complex. Although the PCL-DPP-PCL nanoparticles uptaken by the MSCs did not affect the cell viability, it was interesting that they exhibited different effects on the multilineage potency of the MSCs in the subsequent differentiation in vitro. Specifically, we found that the PCL-DPP-PCL labeling was unfavorable to the MSC osteogenic differentiation, whereas the labeled MSCs exhibited the same adipogenic and chondrogenic differentiations compared to the unlabeled controls as verified by gene expressions and histological staining. Furthermore, the PCL-DPP-PCL nanoparticles remained strong fluorescence intensity even after 4 weeks of differentiation. This study indicated that PCL-DPP-PCL nanoparticles could be used for long-term cell tracing in MSC differentiation into adipogenic and chondrogenic lineages. PMID:27124820

  19. Enhancement of Matrix Metalloproteinase-2 (MMP-2) as a Potential Chondrogenic Marker during Chondrogenic Differentiation of Human Adipose-Derived Stem Cells.

    PubMed

    Arai, Yoshie; Park, Sunghyun; Choi, Bogyu; Ko, Kyoung-Won; Choi, Won Chul; Lee, Joong-Myung; Han, Dong-Wook; Park, Hun-Kuk; Han, Inbo; Lee, Jong Hun; Lee, Soo-Hong

    2016-01-01

    Human adipose-derived stem cells (hASCs) have a capacity to undergo adipogenic, chondrogenic, and osteogenic differentiation. Recently, hASCs were applied to various fields including cell therapy for tissue regeneration. However, it is hard to predict the direction of differentiation of hASCs in real-time. Matrix metalloproteinases (MMPs) are one family of proteolytic enzymes that plays a pivotal role in regulating the biology of stem cells. MMPs secreted by hASCs are expected to show different expression patterns depending on the differentiation state of hASCs because biological functions exhibit different patterns during the differentiation of stem cells. Here, we investigated proteolytic enzyme activity, especially MMP-2 activity, in hASCs during their differentiation. The activities of proteolytic enzymes and MMP-2 were higher during chondrogenic differentiation than during adipogenic and osteogenic differentiation. During chondrogenic differentiation, mRNA expression of MMP-2 and the level of the active form of MMP-2 were increased, which also correlated with Col II. It is concluded that proteolytic enzyme activity and the level of the active form of MMP-2 were increased during chondrogenic differentiation, which was accelerated in the presence of Col II protein. According to our findings, MMP-2 could be a candidate maker for real-time detection of chondrogenic differentiation of hASCs. PMID:27322256

  20. Enhancement of Matrix Metalloproteinase-2 (MMP-2) as a Potential Chondrogenic Marker during Chondrogenic Differentiation of Human Adipose-Derived Stem Cells

    PubMed Central

    Arai, Yoshie; Park, Sunghyun; Choi, Bogyu; Ko, Kyoung-Won; Choi, Won Chul; Lee, Joong-Myung; Han, Dong-Wook; Park, Hun-Kuk; Han, Inbo; Lee, Jong Hun; Lee, Soo-Hong

    2016-01-01

    Human adipose-derived stem cells (hASCs) have a capacity to undergo adipogenic, chondrogenic, and osteogenic differentiation. Recently, hASCs were applied to various fields including cell therapy for tissue regeneration. However, it is hard to predict the direction of differentiation of hASCs in real-time. Matrix metalloproteinases (MMPs) are one family of proteolytic enzymes that plays a pivotal role in regulating the biology of stem cells. MMPs secreted by hASCs are expected to show different expression patterns depending on the differentiation state of hASCs because biological functions exhibit different patterns during the differentiation of stem cells. Here, we investigated proteolytic enzyme activity, especially MMP-2 activity, in hASCs during their differentiation. The activities of proteolytic enzymes and MMP-2 were higher during chondrogenic differentiation than during adipogenic and osteogenic differentiation. During chondrogenic differentiation, mRNA expression of MMP-2 and the level of the active form of MMP-2 were increased, which also correlated with Col II. It is concluded that proteolytic enzyme activity and the level of the active form of MMP-2 were increased during chondrogenic differentiation, which was accelerated in the presence of Col II protein. According to our findings, MMP-2 could be a candidate maker for real-time detection of chondrogenic differentiation of hASCs. PMID:27322256

  1. Synthetic laser medium

    DOEpatents

    Stokowski, Stanley E.

    1989-01-01

    A laser medium is particularly useful in high average power solid state lasers. The laser medium includes a chormium dopant and preferably neodymium ions as codopant, and is primarily a gadolinium scandium gallium garnet, or an analog thereof. Divalent cations inhibit spiral morphology as large boules from which the laser medium is derived are grown, and a source of ions convertible between a trivalent state and a tetravalent state at a low ionization energy are in the laser medium to reduce an absorption coefficient at about one micron wavelength otherwise caused by the divalent cations. These divalent cations and convertible ions are dispersed in the laser medium. Preferred convertible ions are provided from titanium or cerium sources.

  2. Synthetic laser medium

    DOEpatents

    Stokowski, S.E.

    1987-10-20

    A laser medium is particularly useful in high average power solid state lasers. The laser medium includes a chromium dopant and preferably neodymium ions as codopant, and is primarily a gadolinium scandium gallium garnet, or an analog thereof. Divalent cations inhibit spiral morphology as large boules from which the laser medium is derived are grown, and a source of ions convertible between a trivalent state and a tetravalent state at a low ionization energy are in the laser medium to reduce an absorption coefficient at about one micron wavelength otherwise caused by the divalent cations. These divalent cations and convertible ions are dispersed in the laser medium. Preferred convertible ions are provided from titanium or cerium sources.

  3. TGF-β Small Molecule Inhibitor SB431542 Reduces Rotator Cuff Muscle Fibrosis and Fatty Infiltration By Promoting Fibro/Adipogenic Progenitor Apoptosis

    PubMed Central

    Lee, Lawrence; Laron, Dominique; Ning, Anne Y.; Kim, Hubert T.; Feeley, Brian T.

    2016-01-01

    Rotator cuff tears represent a large burden of muscle-tendon injuries in our aging population. While small tears can be repaired surgically with good outcomes, critical size tears are marked by muscle atrophy, fibrosis, and fatty infiltration, which can lead to failed repair, frequent re-injury, and chronic disability. Previous animal studies have indicated that Transforming Growth Factor-β (TGF-β) signaling may play an important role in the development of these muscle pathologies after injury. Here, we demonstrated that inhibition of TGF-β1 signaling with the small molecule inhibitor SB431542 in a mouse model of massive rotator cuff tear results in decreased fibrosis, fatty infiltration, and muscle weight loss. These observed phenotypic changes were accompanied by decreased fibrotic, adipogenic, and atrophy-related gene expression in the injured muscle of mice treated with SB431542. We further demonstrated that treatment with SB431542 reduces the number of fibro/adipogenic progenitor (FAP) cells—an important cellular origin of rotator cuff muscle fibrosis and fatty infiltration, in injured muscle by promoting apoptosis of FAPs. Together, these data indicate that the TGF-β pathway is a critical regulator of the degenerative muscle changes seen after massive rotator cuff tears. TGF-β promotes rotator cuff muscle fibrosis and fatty infiltration by preventing FAP apoptosis. TGF-β regulated FAP apoptosis may serve as an important target pathway in the future development of novel therapeutics to improve muscle outcomes following rotator cuff tear. PMID:27186977

  4. Niacin promotes adipogenesis by reducing production of anti-adipogenic PGF2α through suppression of C/EBPβ-activated COX-2 expression.

    PubMed

    Fujimori, Ko; Amano, Fumio

    2011-04-01

    Niacin is converted to NAD and NADP in tissues, whose products are involved in a number of cellular processes; and it is associated with the regulation of adipogenesis. In this study, we identified the molecular mechanism by which niacin promotes the adipogenesis in mouse 3T3-L1 cells. When the cells were cultured with niacin, the expression of adipogenic peroxisome proliferator-activated receptor γ, CCAAT enhancer binding protein (C/EBP)α, and their target genes was enhanced concomitant with an increase in triglyceride storage. Moreover, niacin suppressed the expression of cyclooxygenase-2 and decreased the production of prostaglandin (PG) F(2α) in the early phase of adipogenesis, which PG suppresses the progression of adipogenesis via the PGF(2α) receptor. Furthermore, niacin decreased the C/EBPβ level in the early phase of adipogenesis. These results indicate that niacin promoted adipogenesis by suppressing the production of the anti-adipogenic PGF(2α) through down-regulation of C/EBPβ-activated cyclooxygenase-2 expression in adipocytes.

  5. Adhesive and mechanical regulation of mesenchymal stem cell differentiation in human bone marrow and periosteum-derived progenitor cells

    PubMed Central

    Eyckmans, Jeroen; Lin, Grace L.; Chen, Christopher S.

    2012-01-01

    Summary It has previously been demonstrated that cell shape can influence commitment of human bone marrow-derived mesenchymal stem cells (hBMCs) to adipogenic, osteogenic, chondrogenic, and other lineages. Human periosteum-derived cells (hPDCs) exhibit multipotency similar to hBMCs, but hPDCs may offer enhanced potential for osteogenesis and chondrogenesis given their apparent endogenous role in bone and cartilage repair in vivo. Here, we examined whether hPDC differentiation is regulated by adhesive and mechanical cues comparable to that reported for hBMC differentiation. When cultured in the appropriate induction media, hPDCs at high cell seeding density demonstrated enhanced levels of adipogenic or chondrogenic markers as compared with hPDCs at low cell seeding density. Cell seeding density correlated inversely with projected area of cell spreading, and directly limiting cell spreading with micropatterned substrates promoted adipogenesis or chondrogenesis while substrates promoting cell spreading supported osteogenesis. Interestingly, cell seeding density influenced differentiation through both changes in cell shape and non-shape-mediated effects: density-dependent adipogenesis and chondrogenesis were regulated primarily by cell shape whereas non-shape effects strongly influenced osteogenic potential. Inhibition of cytoskeletal contractility by adding the Rho kinase inhibitor Y27632 further enhanced adipogenic differentiation and discouraged osteogenic differentiation of hPDCs. Together, our results suggest that multipotent lineage decisions of hPDCs are impacted by cell adhesive and mechanical cues, though to different extents than hBMCs. Thus, future studies of hPDCs and other primary stem cell populations with clinical potential should consider varying biophysical metrics for more thorough optimization of stem cell differentiation. PMID:23213385

  6. Prepatterning of differentiation-driven nuclear lamin A/C-associated chromatin domains by GlcNAcylated histone H2B

    PubMed Central

    Rønningen, Torunn; Shah, Akshay; Oldenburg, Anja R.; Vekterud, Kristin; Delbarre, Erwan; Moskaug, Jan Øivind; Collas, Philippe

    2015-01-01

    Dynamic interactions of nuclear lamins with chromatin through lamin-associated domains (LADs) contribute to spatial arrangement of the genome. Here, we provide evidence for prepatterning of differentiation-driven formation of lamin A/C LADs by domains of histone H2B modified on serine 112 by the nutrient sensor O-linked N-acetylglucosamine (H2BS112GlcNAc), which we term GADs. We demonstrate a two-step process of lamin A/C LAD formation during in vitro adipogenesis, involving spreading of lamin A/C–chromatin interactions in the transition from progenitor cell proliferation to cell-cycle arrest, and genome-scale redistribution of these interactions through a process of LAD exchange within hours of adipogenic induction. Lamin A/C LADs are found both in active and repressive chromatin contexts that can be influenced by cell differentiation status. De novo formation of adipogenic lamin A/C LADs occurs nonrandomly on GADs, which consist of megabase-size intergenic and repressive chromatin domains. Accordingly, whereas predifferentiation lamin A/C LADs are gene-rich, post-differentiation LADs harbor repressive features reminiscent of lamin B1 LADs. Release of lamin A/C from genes directly involved in glycolysis concurs with their transcriptional up-regulation after adipogenic induction, and with downstream elevations in H2BS112GlcNAc levels and O-GlcNAc cycling. Our results unveil an epigenetic prepatterning of adipogenic LADs by GADs, suggesting a coupling of developmentally regulated lamin A/C-genome interactions to a metabolically sensitive chromatin modification. PMID:26359231

  7. Shikonin suppresses ERK 1/2 phosphorylation during the early stages of adipocyte differentiation in 3T3-L1 cells

    PubMed Central

    2013-01-01

    Background The naphthoquinone pigment, shikonin, is a major component of Lithospermum erythrorhizon and has been shown to have various biological functions, including antimicrobial, anti-inflammatory, and antitumor effects. In this study, we investigated the effect of shikonin on adipocyte differentiation and its mechanism of action in 3T3-L1 cells. Methods To investigate the effects of shikonin on adipocyte differentiation, 3T3-L1 cells were induced to differentiate using 3-isobutyl-1-methylzanthine, dexamethasone, and insulin (MDI) for 8 days in the presence of 0–2 μM shikonin. Oil Red O staining was performed to determine the lipid accumulation in 3T3-L1 cells. To elucidate the anti-adipogenic mechanism of shikonin, adipogenic transcription factors, the phosphorylation levels of ERK, and adipogenic gene expression were analyzed by Western blotting and quantitative real-time PCR. To further confirm that shikonin inhibits adipogenic differentiation through downregulation of ERK 1/2 activity, 3T3-L1 cells were treated with shikonin in the presence of FGF-2, an activator, or PD98059, an inhibitor, of the ERK1/2 signaling pathway. Results Shikonin effectively suppressed adipogenesis and downregulated the protein levels of 2 major transcription factors, PPARγ and C/EBPα, as well as the adipocyte specific gene aP2 in a dose-dependent manner. qRT-PCR analysis revealed that shikonin inhibited mRNA expression of adipogenesis-related genes, such as PPARγ, C/EBPα, and aP2. Adipocyte differentiation was mediated by ERK 1/2 phosphorylation, which was confirmed by pretreatment with PD98059 (an ERK 1/2 inhibitor) or FGF-2 (an ERK 1/2 activator). The phosphorylation of ERK1/2 during the early stages of adipogenesis in 3T3-L1 cells was inhibited by shikonin. We also confirmed that FGF-2-stimulated ERK 1/2 activity was attenuated by shikonin. Conclusions These results demonstrate that shikonin inhibits adipogenic differentiation via suppression of the ERK signaling pathway

  8. The effect of dehydroleucodine in adipocyte differentiation.

    PubMed Central

    Galvis, Adriana; Marcano, Adriana; Stefancin, Chad; Villaverde, Nicole; Priestap, Horacio A.; Tonn, Carlos E.; Lopez, Luis A.; Barbieri, Manuel A.

    2012-01-01

    Dehydroleucodine (DhL) is a sesquiterpene lactone of the guaianolide group with gastric citoprotective activity. Recent studies have also demonstrated that DhL inhibits the proliferation of vascular smooth muscle cells. In this study we examined the effect of DhL in the differentiation 3T3-L1 preadipocytes. The addition of DhL significantly inhibited the differentiation 3T3-L1 preadipocytes along with significant decrease in the accumulation of lipid content by a dramatic down regulation of the expression of adipogenic-specific transcriptional factors PPARγ and C-EBPα. However, phosphorylation of AMPKα, Erk1/2 and Akt1 was not inhibited by DhL treatment. Interestingly, we also found that 11,13-dihydro-dehydroleucodine, a derivative of DhL with inactivated α-methylene-γ-lactone function, also inhibited the differentiation 3T3-L1 preadipocytes. Taken together, these data suggest DhL has an important inhibitory effect in cellular pathways regulating adipocyte differentiation by modulating the PPARγ expression, which is known to play a pivotal role during adipogenesis. PMID:21963454

  9. Probing metabolic states of differentiating stem cells using two-photon FLIM

    PubMed Central

    Meleshina, Aleksandra V.; Dudenkova, Varvara V.; Shirmanova, Marina V.; Shcheslavskiy, Vladislav I.; Becker, Wolfgang; Bystrova, Alena S.; Cherkasova, Elena I.; Zagaynova, Elena V.

    2016-01-01

    The ability of stem cells to differentiate into specialized cell types presents a number of opportunities for regenerative medicine, stem cell therapy and developmental biology. Because traditional assessments of stem cells are destructive, time consuming, and logistically intensive, the use of a non-invasive, label-free approach to study of cell differentiation provides a powerful tool for rapid, high-content characterization of cell and tissue cultures. Here, we elucidate the metabolic changes in MSCs during adipogenic differentiation, based on the fluorescence of the metabolic co-factors NADH, NADPH, and FAD using the methods of two-photon fluorescence microscopy combined with FLIM. To estimate the contribution of energy metabolism and lipogenesis in the observed changes of the metabolic profile, a separate analysis of NADH and NADPH is required. In our study we demonstrated, for the first time, an increased contribution of protein-bound NADPH in adipocytes that is associated with lipogenesis. The optical redox ratio FAD/NAD(P)H decreased during adipogenic differentiation, and that this was likely to be explained by the intensive biosynthesis of lipids and the enhanced NADPH production associated with this. Based on the data on the fluorescence lifetime contribution of protein-bound NAD(P)H, we registered a metabolic switch from glycolysis to oxidative phosphorylation in adipocytes. PMID:26911347

  10. Extracellular Matrix Stiffness Regulates Osteogenic Differentiation through MAPK Activation

    PubMed Central

    Hwang, Jun-Ha; Byun, Mi Ran; Kim, A. Rum; Kim, Kyung Min; Cho, Hang Jun; Lee, Yo Han; Kim, Juwon; Jeong, Mi Gyeong; Hwang, Eun Sook; Hong, Jeong-Ho

    2015-01-01

    Mesenchymal stem cell (MSC) differentiation is regulated by the extracellular matrix (ECM) through activation of intracellular signaling mediators. The stiffness of the ECM was shown to be an important regulatory factor for MSC differentiation, and transcriptional coactivator with PDZ-binding motif (TAZ) was identified as an effector protein for MSC differentiation. However, the detailed underlying mechanism regarding the role of ECM stiffness and TAZ in MSC differentiation is not yet fully understood. In this report, we showed that ECM stiffness regulates MSC fate through ERK or JNK activation. Specifically, a stiff hydrogel matrix stimulates osteogenic differentiation concomitant with increased nuclear localization of TAZ, but inhibits adipogenic differentiation. ERK and JNK activity was significantly increased in cells cultured on a stiff hydrogel. TAZ activation was induced by ERK or JNK activation on a stiff hydrogel because exposure to an ERK or JNK inhibitor significantly decreased the nuclear localization of TAZ, indicating that ECM stiffness-induced ERK or JNK activation is important for TAZ-driven osteogenic differentiation. Taken together, these results suggest that ECM stiffness regulates MSC differentiation through ERK or JNK activation. PMID:26262877

  11. Extracellular Matrix Stiffness Regulates Osteogenic Differentiation through MAPK Activation.

    PubMed

    Hwang, Jun-Ha; Byun, Mi Ran; Kim, A Rum; Kim, Kyung Min; Cho, Hang Jun; Lee, Yo Han; Kim, Juwon; Jeong, Mi Gyeong; Hwang, Eun Sook; Hong, Jeong-Ho

    2015-01-01

    Mesenchymal stem cell (MSC) differentiation is regulated by the extracellular matrix (ECM) through activation of intracellular signaling mediators. The stiffness of the ECM was shown to be an important regulatory factor for MSC differentiation, and transcriptional coactivator with PDZ-binding motif (TAZ) was identified as an effector protein for MSC differentiation. However, the detailed underlying mechanism regarding the role of ECM stiffness and TAZ in MSC differentiation is not yet fully understood. In this report, we showed that ECM stiffness regulates MSC fate through ERK or JNK activation. Specifically, a stiff hydrogel matrix stimulates osteogenic differentiation concomitant with increased nuclear localization of TAZ, but inhibits adipogenic differentiation. ERK and JNK activity was significantly increased in cells cultured on a stiff hydrogel. TAZ activation was induced by ERK or JNK activation on a stiff hydrogel because exposure to an ERK or JNK inhibitor significantly decreased the nuclear localization of TAZ, indicating that ECM stiffness-induced ERK or JNK activation is important for TAZ-driven osteogenic differentiation. Taken together, these results suggest that ECM stiffness regulates MSC differentiation through ERK or JNK activation.

  12. Multipotential differentiation of human urine-derived stem cells: potential for therapeutic applications in urology.

    PubMed

    Bharadwaj, Shantaram; Liu, Guihua; Shi, Yingai; Wu, Rongpei; Yang, Bin; He, Tongchuan; Fan, Yuxin; Lu, Xinyan; Zhou, Xiaobo; Liu, Hong; Atala, Anthony; Rohozinski, Jan; Zhang, Yuanyuan

    2013-09-01

    We sought to biologically characterize and identify a subpopulation of urine-derived stem cells (USCs) with the capacity for multipotent differentiation. We demonstrated that single USCs can expand to a large population with 60-70 population doublings. Nine of 15 individual USC clones expressed detectable levels of telomerase and have long telomeres. These cells expressed pericyte and mesenchymal stem cell markers. Upon induction with appropriate media in vitro, USCs differentiated into bladder-associated cell types, including functional urothelial and smooth muscle cell lineages. When the differentiated USCs were seeded onto a scaffold and subcutaneously implanted into nude mice, multilayered tissue-like structures formed consisting of urothelium and smooth muscle. Additionally, USCs were able to differentiate into endothelial, osteogenic, chondrogenic, adipogenic, skeletal myogenic, and neurogenic lineages but did not form teratomas during the 1-month study despite telomerase activity. USCs may be useful in cell-based therapies and tissue engineering applications, including urogenital reconstruction.

  13. Interplay of matrix stiffness and protein tethering in stem cell differentiation

    NASA Astrophysics Data System (ADS)

    Wen, Jessica H.; Vincent, Ludovic G.; Fuhrmann, Alexander; Choi, Yu Suk; Hribar, Kolin C.; Taylor-Weiner, Hermes; Chen, Shaochen; Engler, Adam J.

    2014-10-01

    Stem cells regulate their fate by binding to, and contracting against, the extracellular matrix. Recently, it has been proposed that in addition to matrix stiffness and ligand type, the degree of coupling of fibrous protein to the surface of the underlying substrate, that is, tethering and matrix porosity, also regulates stem cell differentiation. By modulating substrate porosity without altering stiffness in polyacrylamide gels, we show that varying substrate porosity did not significantly change protein tethering, substrate deformations, or the osteogenic and adipogenic differentiation of human adipose-derived stromal cells and marrow-derived mesenchymal stromal cells. Varying protein-substrate linker density up to 50-fold changed tethering, but did not affect osteogenesis, adipogenesis, surface-protein unfolding or underlying substrate deformations. Differentiation was also unaffected by the absence of protein tethering. Our findings imply that the stiffness of planar matrices regulates stem cell differentiation independently of protein tethering and porosity.

  14. Interplay of matrix stiffness and protein tethering in stem cell differentiation.

    PubMed

    Wen, Jessica H; Vincent, Ludovic G; Fuhrmann, Alexander; Choi, Yu Suk; Hribar, Kolin C; Taylor-Weiner, Hermes; Chen, Shaochen; Engler, Adam J

    2014-10-01

    Stem cells regulate their fate by binding to, and contracting against, the extracellular matrix. Recently, it has been proposed that in addition to matrix stiffness and ligand type, the degree of coupling of fibrous protein to the surface of the underlying substrate, that is, tethering and matrix porosity, also regulates stem cell differentiation. By modulating substrate porosity without altering stiffness in polyacrylamide gels, we show that varying substrate porosity did not significantly change protein tethering, substrate deformations, or the osteogenic and adipogenic differentiation of human adipose-derived stromal cells and marrow-derived mesenchymal stromal cells. Varying protein-substrate linker density up to 50-fold changed tethering, but did not affect osteogenesis, adipogenesis, surface-protein unfolding or underlying substrate deformations. Differentiation was also unaffected by the absence of protein tethering. Our findings imply that the stiffness of planar matrices regulates stem cell differentiation independently of protein tethering and porosity.

  15. Silica nanoparticles inhibit brown adipocyte differentiation via regulation of p38 phosphorylation

    NASA Astrophysics Data System (ADS)

    Son, Min Jeong; Kim, Won Kon; Kwak, Minjeong; Oh, Kyoung-Jin; Chang, Won Seok; Min, Jeong-Ki; Lee, Sang Chul; Song, Nam Woong; Bae, Kwang-Hee

    2015-10-01

    Nanoparticles are of great interest due to their wide variety of biomedical and bioengineering applications. However, they affect cellular differentiation and/or intracellular signaling when applied and exposed to target organisms or cells. The brown adipocyte is a cell type important in energy homeostasis and thus closely related to obesity. In this study, we assessed the effects of silica nanoparticles (SNPs) on brown adipocyte differentiation. The results clearly showed that brown adipocyte differentiation was significantly repressed by exposure to SNPs. The brown adipocyte-specific genes as well as mitochondrial content were also markedly reduced. Additionally, SNPs led to suppressed p38 phosphorylation during brown adipocyte differentiation. These effects depend on the size of SNPs. Taken together, these results lead us to suggest that SNP has anti-brown adipogenic effect in a size-dependent manner via regulation of p38 phosphorylation.

  16. Glucagon Like Peptide-1 Promotes Adipocyte Differentiation via the Wnt4 Mediated Sequestering of Beta-Catenin.

    PubMed

    Liu, Rui; Li, Na; Lin, Yi; Wang, Mei; Peng, Yongde; Lewi, Keidren; Wang, Qinghua

    2016-01-01

    Glucagon-like peptide-1 (GLP-1) plays a role in the regulation of adipogenesis; however, the precise underlying molecular mechanism has not been fully defined. Wnt was recently identified as an important regulator of adipogenesis. This study aimed to investigate the involvement of the Wnt signaling pathway in the effects of GLP-1 on adipocyte differentiation. 3T3-L1 cells were induced to differentiate. The changes in the expression levels of adipogenic transcription factors and Wnts and the phosphorylation level and subcellular localization of β-catenin were quantified after GLP-1 treatment. GLP-1 stimulated adipocyte differentiation and lipid accumulation, which were accompanied by the expression of adipocyte marker genes. The expression of Wnt4 was upregulated in the process of adipocyte differentiation, which was further enhanced by treatment with GLP-1. β-catenin, an important mediator of the Wnt pathway, was immediately dephosphorylated and translocated from cytoplasm to nucleus when differentiation was induced. In the presence of GLP-1, however, β-catenin was redirected to the cell plasma membrane leading to its decreased accumulation in the nucleus. Knockdown of Wnt4 blocked the effect of GLP-1 on the cellular localization of β-catenin and expression level of adipogenic transcription factors. Our findings showed that GLP-1 promoted adipogenesis through the modulation of the Wnt4/β-catenin signaling pathway, suggesting that the GLP-1-Wntβ-catenin system might be a new target for the treatment of metabolic disease. PMID:27504979

  17. Glucagon Like Peptide-1 Promotes Adipocyte Differentiation via the Wnt4 Mediated Sequestering of Beta-Catenin

    PubMed Central

    Liu, Rui; Li, Na; Lin, Yi; Wang, Mei; Peng, Yongde; Lewi, Keidren; Wang, Qinghua

    2016-01-01

    Glucagon-like peptide-1 (GLP-1) plays a role in the regulation of adipogenesis; however, the precise underlying molecular mechanism has not been fully defined. Wnt was recently identified as an important regulator of adipogenesis. This study aimed to investigate the involvement of the Wnt signaling pathway in the effects of GLP-1 on adipocyte differentiation. 3T3-L1 cells were induced to differentiate. The changes in the expression levels of adipogenic transcription factors and Wnts and the phosphorylation level and subcellular localization of β-catenin were quantified after GLP-1 treatment. GLP-1 stimulated adipocyte differentiation and lipid accumulation, which were accompanied by the expression of adipocyte marker genes. The expression of Wnt4 was upregulated in the process of adipocyte differentiation, which was further enhanced by treatment with GLP-1. β-catenin, an important mediator of the Wnt pathway, was immediately dephosphorylated and translocated from cytoplasm to nucleus when differentiation was induced. In the presence of GLP-1, however, β-catenin was redirected to the cell plasma membrane leading to its decreased accumulation in the nucleus. Knockdown of Wnt4 blocked the effect of GLP-1 on the cellular localization of β-catenin and expression level of adipogenic transcription factors. Our findings showed that GLP-1 promoted adipogenesis through the modulation of the Wnt4/β-catenin signaling pathway, suggesting that the GLP-1-Wntβ-catenin system might be a new target for the treatment of metabolic disease. PMID:27504979

  18. Extraction of Flavonoids from the Flowers of Abelmoschus manihot (L.) Medic by Modified Supercritical CO₂ Extraction and Determination of Antioxidant and Anti-Adipogenic Activity.

    PubMed

    Li, Jingjing; Zhang, Juan; Wang, Min

    2016-01-01

    Abelmoschus manihot (L.) Medic has been used for many years in Chinese traditional medicine. In this study, supercritical CO₂ plus a modifier was utilized to extract flavonoids from the flowers of Abelmoschus manihot (L.) Medic. The effects of temperature (40 °C-60 °C), pressure (10-30 MPa) and different concentrations of ethanol as modifier (60%-90%, ethanol:water, v/v) on major flavonol content and the antioxidant activity of the extracts were studied by response surface methodology (RSM) using a Box-Behnken design. The flavonol content was calculated as the sum of the concentrations of seven major flavonoids, namely rutin, hyperin, isoquercetin, hibifolin, myricetin, quercetin-3'-O-glucoside and quercetin, which were simultaneously determined by a HPLC method. The antioxidant activity was evaluated by a 2,2-diphenyl-1-picrylhydarzyl (DPPH) free radical-scavenging assay. The results showed that three factors and their interactions could be well fitted to second-order polynomial models (p < 0.05). At the optimal extraction conditions for flavonol content (20 MPa, 52 °C, and 85% ethanol content), the yield of flavonoids was 41.96 mg/g and the IC50 value was 0.288 mg/mL, respectively, suggesting the extract has high antioxidant activity. Furthermore, the anti-adipogenic activity of the extract on the 3T3-L1 cell line was investigated. The results indicated that it can downregulate PPARγ and C/EBPα expression at mRNA. In summary, in this study, we have established a cost-effective method for the extraction of flavonoids from the flowers of Abelmoschus manihot (L.) Medic using supercritical fluid extraction and the extracts exhibited potent antioxidant and anti-adipogenic effects, suggesting a possible therapeutic approach for the prevention and treatment of obesity. PMID:27347916

  19. Anti-adipogenic effects of extracts of Ficus deltoidea var. deltoidea and var. angustifolia on 3T3-L1 adipocytes*

    PubMed Central

    Woon, Shiau Mei; Seng, Yew Wei; Ling, Anna Pick Kiong; Chye, Soi Moi; Koh, Rhun Yian

    2014-01-01

    Objective: This study examined the anti-adipogenic effects of extracts of Ficus deltoidea var. deltoidia and var. angustifolia, a natural slimming aid, on 3T3-L1 adipocytes. Methods: Methanol and water extracts of leaves of the F. deltoidea varieties were analyzed to determine their total flavonoid content (TFC) and total phenolic content (TPC), respectively. The study was initiated by determining the maximum non-toxic dose (MNTD) of the methanol and water extracts for 3T3-L1 preadipocytes. Possible anti-adipogenic effects were then examined by treating 2-d post confluent 3T3-L1 preadipocytes with either methanol extract or water extract at MNTD and half MNTD (½MNTD), after which the preadipocytces were induced to form mature adipocytes. Visualisation and quantification of lipid content in mature adipocytes were carried out through oil red O staining and measurement of optical density (OD) at 520 nm, respectively. Results: The TFCs of the methanol extracts were 1.36 and 1.97 g quercetin equivalents (QE)/100 g dry weight (DW), while the TPCs of the water extracts were 5.61 and 2.73 g gallic acid equivalents (GAE)/100 g DW for var. deltoidea and var. angustilofia, respectively. The MNTDs determined for methanol and water extracts were (300.0±28.3) and (225.0±21.2) μg/ml, respectively, for var. deltoidea, while much lower MNTDs [(60.0±2.0) μg/ml for methanol extracts and (8.0±1.0) μg/ml for water extracts] were recorded for var. angustifolia. Studies revealed that the methanol extracts of both varieties and the water extracts of var. angustifolia at either MNTD or ½MNTD significantly inhibited the maturation of preadipocytes. Conclusions: The inhibition of the formation of mature adipocytes indicated that leaf extracts of F. deltoidea could have potential anti-obesity effects. PMID:24599694

  20. Extraction of Flavonoids from the Flowers of Abelmoschus manihot (L.) Medic by Modified Supercritical CO₂ Extraction and Determination of Antioxidant and Anti-Adipogenic Activity.

    PubMed

    Li, Jingjing; Zhang, Juan; Wang, Min

    2016-06-25

    Abelmoschus manihot (L.) Medic has been used for many years in Chinese traditional medicine. In this study, supercritical CO₂ plus a modifier was utilized to extract flavonoids from the flowers of Abelmoschus manihot (L.) Medic. The effects of temperature (40 °C-60 °C), pressure (10-30 MPa) and different concentrations of ethanol as modifier (60%-90%, ethanol:water, v/v) on major flavonol content and the antioxidant activity of the extracts were studied by response surface methodology (RSM) using a Box-Behnken design. The flavonol content was calculated as the sum of the concentrations of seven major flavonoids, namely rutin, hyperin, isoquercetin, hibifolin, myricetin, quercetin-3'-O-glucoside and quercetin, which were simultaneously determined by a HPLC method. The antioxidant activity was evaluated by a 2,2-diphenyl-1-picrylhydarzyl (DPPH) free radical-scavenging assay. The results showed that three factors and their interactions could be well fitted to second-order polynomial models (p < 0.05). At the optimal extraction conditions for flavonol content (20 MPa, 52 °C, and 85% ethanol content), the yield of flavonoids was 41.96 mg/g and the IC50 value was 0.288 mg/mL, respectively, suggesting the extract has high antioxidant activity. Furthermore, the anti-adipogenic activity of the extract on the 3T3-L1 cell line was investigated. The results indicated that it can downregulate PPARγ and C/EBPα expression at mRNA. In summary, in this study, we have established a cost-effective method for the extraction of flavonoids from the flowers of Abelmoschus manihot (L.) Medic using supercritical fluid extraction and the extracts exhibited potent antioxidant and anti-adipogenic effects, suggesting a possible therapeutic approach for the prevention and treatment of obesity.

  1. Selective medium for isolation and enumeration of Bifidobacterium spp.

    PubMed Central

    Muñoa, F J; Pares, R

    1988-01-01

    A new method was developed for the isolation and enumeration of Bifidobacterium spp. from natural aquatic environments. The method was based on the utilization of a new medium, Bifidobacterium iodoacetate medium 25, and resuscitation techniques were used to isolate injured bifidobacteria. The new medium was tested with a nonselective reference medium on sewage and sewage-polluted surface waters. Relatively little colonial growth of any other bacterial genera occurred; when such colonies did grow, Bifidobacterium could be easily differentiated by its colonial morphology or, after Gram staining, by its typical bifidobacterial morphology. PMID:3415235

  2. Induction of chondro-, osteo- and adipogenesis in embryonic stem cells by bone morphogenetic protein-2: Effect of cofactors on differentiating lineages

    PubMed Central

    zur Nieden, Nicole I; Kempka, Grazyna; Rancourt, Derrick E; Ahr, Hans-Jürgen

    2005-01-01

    Background Recently, tissue engineering has merged with stem cell technology with interest to develop new sources of transplantable material for injury or disease treatment. Eminently interesting, are bone and joint injuries/disorders because of the low self-regenerating capacity of the matrix secreting cells, particularly chondrocytes. ES cells have the unlimited capacity to self-renew and maintain their pluripotency in culture. Upon induction of various signals they will then differentiate into distinctive cell types such as neurons, cardiomyocytes and osteoblasts. Results We present here that BMP-2 can drive ES cells to the cartilage, osteoblast or adipogenic fate depending on supplementary co-factors. TGFβ1, insulin and ascorbic acid were identified as signals that together with BMP-2 induce a chondrocytic phenotype that is characterized by increased expression of cartilage marker genes in a timely co-ordinated fashion. Expression of collagen type IIB and aggrecan, indicative of a fully mature state, continuously ascend until reaching a peak at day 32 of culture to approximately 80-fold over control values. Sox9 and scleraxis, cartilage specific transcription factors, are highly expressed at very early stages and show decreased expression over the time course of EB differentiation. Some smaller proteoglycans, such as decorin and biglycan, are expressed at earlier stages. Overall, proteoglycan biosynthesis is up-regulated 7-fold in response to the supplements added. BMP-2 induced chondrocytes undergo hypertrophy and begin to alter their expression profile towards osteoblasts. Supplying mineralization factors such as β-glycerophosphate and vitamin D3 with the culture medium can facilitate this process. Moreover, gene expression studies show that adipocytes can also differentiate from BMP-2 treated ES cells. Conclusions Ultimately, we have found that ES cells can be successfully triggered to differentiate into chondrocyte-like cells, which can further alter

  3. Hypermedia as medium

    NASA Technical Reports Server (NTRS)

    Dede, Christopher J.

    1990-01-01

    Claims and rebuttals that hypermedia (the associative, nonlinear interconnection of multimedia materials) is a fundamentally innovative means of thinking and communicating are described. This representational architecture has many advantages that make it a major advance over other media; however, it also has several intrinsic problems that severly limits its effectiveness as a medium. These advantages and limits in applications are discussed.

  4. Holographic recording medium

    NASA Technical Reports Server (NTRS)

    Gange, Robert Allen (Inventor)

    1977-01-01

    A holographic recording medium comprising a conductive substrate, a photoconductive layer and an electrically alterable layer of a linear, low molecular weight hydrocarbon polymer has improved fatigue resistance. An acrylic barrier layer can be interposed between the photoconductive and electrically alterable layers.

  5. Differentiation within autologous fibrin scaffolds of porcine dermal cells with the mesenchymal stem cell phenotype

    SciTech Connect

    Puente, Pilar de la

    2013-02-01

    Porcine mesenchymal stem cells (pMSCs) are an attractive source of cells for tissue engineering because their properties are similar to those of human stem cells. pMSCs can be found in different tissues but their dermal origin has not been studied in depth. Additionally, MSCs differentiation in monolayer cultures requires subcultured cells, and these cells are at risk of dedifferentiation when implanting them into living tissue. Following this, we attempted to characterize the MSCs phenotype of porcine dermal cells and to evaluate their cellular proliferation and differentiation in autologous fibrin scaffolds (AFSs). Dermal biopsies and blood samples were obtained from 12 pigs. Dermal cells were characterized by flow cytometry. Frozen autologous plasma was used to prepare AFSs. pMSC differentiation was studied in standard structures (monolayers and pellets) and in AFSs. The pMSCs expressed the CD90 and CD29 markers of the mesenchymal lineage. AFSs afforded adipogenic, osteogenic and chondrogenic differentiation. The porcine dermis can be proposed to be a good source of MSCs with adequate proliferative capacity and a suitable expression of markers. The pMSCs also showed optimal proliferation and differentiation in AFSs, such that these might serve as a promising autologous and implantable material for use in tissue engineering. -- Highlights: ► Low fibrinogen concentration provides a suitable matrix for cell migration and differentiation. ► Autologous fibrin scaffolds is a promising technique in tissue engineering. ► Dermal cells are an easily accessible mesenchymal stem cell source. ► Fibrin scaffolds afforded adipogenic, osteogenic and chondrogenic differentiation.

  6. A comparative evaluation of the effect of polymer chemistry and fiber orientation on mesenchymal stem cell differentiation

    PubMed Central

    Rowland, David C.L.; Aquilina, Thomas; Klein, Andrei; Hakimi, Osnat; Alexis‐Mouthuy, Pierre; Carr, Andrew J

    2016-01-01

    Abstract Bioengineered tissue scaffolds in combination with cells hold great promise for tissue regeneration. The aim of this study was to determine how the chemistry and fiber orientation of engineered scaffolds affect the differentiation of mesenchymal stem cells (MSCs). Adipogenic, chondrogenic, and osteogenic differentiation on aligned and randomly orientated electrospun scaffolds of Poly (lactic‐co‐glycolic) acid (PLGA) and Polydioxanone (PDO) were compared. MSCs were seeded onto scaffolds and cultured for 14 days under adipogenic‐, chondrogenic‐, or osteogenic‐inducing conditions. Cell viability was assessed by alamarBlue metabolic activity assays and gene expression was determined by qRT‐PCR. Cell‐scaffold interactions were visualized using fluorescence and scanning electron microscopy. Cells grew in response to scaffold fiber orientation and cell viability, cell coverage, and gene expression analysis showed that PDO supports greater multilineage differentiation of MSCs. An aligned PDO scaffold supports highest adipogenic and osteogenic differentiation whereas fiber orientation did not have a consistent effect on chondrogenesis. Electrospun scaffolds, selected on the basis of fiber chemistry and alignment parameters could provide great therapeutic potential for restoration of fat, cartilage, and bone tissue. This study supports the continued investigation of an electrospun PDO scaffold for tissue repair and regeneration and highlights the potential of optimizing fiber orientation for improved utility. © 2016 The Authors Journal of Biomedical Materials Research Part A Published by Wiley Periodicals, Inc. J Biomed Mater Res Part A: 104A: 2843–2853, 2016. PMID:27399850

  7. Liquid chromatographic extraction medium

    DOEpatents

    Horwitz, E. Philip; Dietz, Mark L.

    1994-01-01

    A method and apparatus for extracting strontium and technetium values from biological, industrial and environmental sample solutions using a chromatographic column is described. An extractant medium for the column is prepared by generating a solution of a diluent containing a Crown ether and dispersing the solution on a resin substrate material. The sample solution is highly acidic and is introduced directed to the chromatographic column and strontium or technetium is eluted using deionized water.

  8. Liquid chromatographic extraction medium

    DOEpatents

    Horwitz, E.P.; Dietz, M.L.

    1994-09-13

    A method and apparatus are disclosed for extracting strontium and technetium values from biological, industrial and environmental sample solutions using a chromatographic column. An extractant medium for the column is prepared by generating a solution of a diluent containing a Crown ether and dispersing the solution on a resin substrate material. The sample solution is highly acidic and is introduced directed to the chromatographic column and strontium or technetium is eluted using deionized water. 1 fig.

  9. Lecithin:Cholesterol Acyltransferase (LCAT) Deficiency Promotes Differentiation of Satellite Cells to Brown Adipocytes in a Cholesterol-dependent Manner.

    PubMed

    Nesan, Dinushan; Tavallaee, Ghazaleh; Koh, Deborah; Bashiri, Amir; Abdin, Rawand; Ng, Dominic S

    2015-12-18

    Our laboratory previously reported that lecithin:cholesterol acyltransferase (LCAT) and LDL receptor double knock-out mice (Ldlr(-/-)xLcat(-/-) or DKO) spontaneously develop functioning ectopic brown adipose tissue (BAT) in skeletal muscle, putatively contributing to protection from the diet-induced obesity phenotype. Here we further investigated their developmental origin and the mechanistic role of LCAT deficiency. Gene profiling of skeletal muscle in DKO newborns and adults revealed a classical lineage. Primary quiescent satellite cells (SC) from chow-fed DKO mice, not in Ldlr(-/-)xLcat(+/+) single-knock-out (SKO) or C57BL/6 wild type, were found to (i) express exclusively classical BAT-selective genes, (ii) be primed to express key functional BAT genes, and (iii) exhibit markedly increased ex vivo adipogenic differentiation into brown adipocytes. This gene priming effect was abrogated upon feeding the mice a 2% high cholesterol diet in association with accumulation of excess intracellular cholesterol. Ex vivo cholesterol loading of chow-fed DKO SC recapitulated the effect, indicating that cellular cholesterol is a key regulator of SC-to-BAT differentiation. Comparing adipogenicity of Ldlr(+/+)xLcat(-/-) (LCAT-KO) SC with DKO SC identified a role for LCAT deficiency in priming SC to express BAT genes. Additionally, we found that reduced cellular cholesterol is important for adipogenic differentiation, evidenced by increased induction of adipogenesis in cholesterol-depleted SC from both LCAT-KO and SKO mice. Taken together, we conclude that ectopic BAT in DKO mice is classical in origin, and its development begins in utero. We further showed complementary roles of LCAT deficiency and cellular cholesterol reduction in the SC-to-BAT adipogenesis.

  10. Lecithin:Cholesterol Acyltransferase (LCAT) Deficiency Promotes Differentiation of Satellite Cells to Brown Adipocytes in a Cholesterol-dependent Manner.

    PubMed

    Nesan, Dinushan; Tavallaee, Ghazaleh; Koh, Deborah; Bashiri, Amir; Abdin, Rawand; Ng, Dominic S

    2015-12-18

    Our laboratory previously reported that lecithin:cholesterol acyltransferase (LCAT) and LDL receptor double knock-out mice (Ldlr(-/-)xLcat(-/-) or DKO) spontaneously develop functioning ectopic brown adipose tissue (BAT) in skeletal muscle, putatively contributing to protection from the diet-induced obesity phenotype. Here we further investigated their developmental origin and the mechanistic role of LCAT deficiency. Gene profiling of skeletal muscle in DKO newborns and adults revealed a classical lineage. Primary quiescent satellite cells (SC) from chow-fed DKO mice, not in Ldlr(-/-)xLcat(+/+) single-knock-out (SKO) or C57BL/6 wild type, were found to (i) express exclusively classical BAT-selective genes, (ii) be primed to express key functional BAT genes, and (iii) exhibit markedly increased ex vivo adipogenic differentiation into brown adipocytes. This gene priming effect was abrogated upon feeding the mice a 2% high cholesterol diet in association with accumulation of excess intracellular cholesterol. Ex vivo cholesterol loading of chow-fed DKO SC recapitulated the effect, indicating that cellular cholesterol is a key regulator of SC-to-BAT differentiation. Comparing adipogenicity of Ldlr(+/+)xLcat(-/-) (LCAT-KO) SC with DKO SC identified a role for LCAT deficiency in priming SC to express BAT genes. Additionally, we found that reduced cellular cholesterol is important for adipogenic differentiation, evidenced by increased induction of adipogenesis in cholesterol-depleted SC from both LCAT-KO and SKO mice. Taken together, we conclude that ectopic BAT in DKO mice is classical in origin, and its development begins in utero. We further showed complementary roles of LCAT deficiency and cellular cholesterol reduction in the SC-to-BAT adipogenesis. PMID:26494623

  11. Reciprocal regulation of adipocyte and osteoblast differentiation of mesenchymal stem cells by Eupatorium japonicum prevents bone loss and adiposity increase in osteoporotic rats.

    PubMed

    Kim, Min-Ji; Jang, Woo-Seok; Lee, In-Kyoung; Kim, Jong-Keun; Seong, Ki-Seung; Seo, Cho-Rong; Song, No-Joon; Bang, Min-Hyuk; Lee, Young Min; Kim, Haeng Ran; Park, Ki-Moon; Park, Kye Won

    2014-07-01

    Pathological increases in adipogenic potential with decreases in osteogenic differentiation occur in osteoporotic bone marrow cells. Previous studies have shown that bioactive materials isolated from natural products can reciprocally regulate adipogenic and osteogenic fates of bone marrow cells. In this study, we showed that Eupatorium japonicum stem extracts (EJE) suppressed lipid accumulation and inhibited the expression of adipocyte markers in multipotent C3H10T1/2 and primary bone marrow cells. Conversely, EJE stimulated alkaline phosphatase activity and induced the expression of osteoblast markers in C3H10T1/2 and primary bone marrow cells. Daily oral administration of 50 mg/kg of EJE for 6 weeks to ovariectomized rats prevented body weight increase and bone mineral density decrease. Finally, activity-guided fractionation led to the identification of coumaric acid and coumaric acid methyl ester as bioactive anti-adipogenic and pro-osteogenic components in EJE. Taken together, our data indicate a promising possibility of E. japonicum as a functional food and as a therapeutic intervention for preventing osteoporosis and bone fractures.

  12. p53 Plays a Role in Mesenchymal Differentiation Programs, in a Cell Fate Dependent Manner

    PubMed Central

    Goldfinger, Naomi; Pevsner-Fischer, Meirav; Olson, Melissa; Rinon, Ariel; Tzahor, Eldad; Lozano, Guillermina; Zipori, Dov; Sarig, Rachel; Rotter, Varda

    2008-01-01

    Background The tumor suppressor p53 is an important regulator that controls various cellular networks, including cell differentiation. Interestingly, some studies suggest that p53 facilitates cell differentiation, whereas others claim that it suppresses differentiation. Therefore, it is critical to evaluate whether this inconsistency represents an authentic differential p53 activity manifested in the various differentiation programs. Methodology/Principal Findings To clarify this important issue, we conducted a comparative study of several mesenchymal differentiation programs. The effects of p53 knockdown or enhanced activity were analyzed in mouse and human mesenchymal cells, representing various stages of several differentiation programs. We found that p53 down-regulated the expression of master differentiation-inducing transcription factors, thereby inhibiting osteogenic, adipogenic and smooth muscle differentiation of multiple mesenchymal cell types. In contrast, p53 is essential for skeletal muscle differentiation and osteogenic re-programming of skeletal muscle committed cells. Conclusions These comparative studies suggest that, depending on the specific cell type and the specific differentiation program, p53 may exert a positive or a negative effect, and thus can be referred as a “guardian of differentiation” at large. PMID:19002260

  13. Hedgehog associated to microparticles inhibits adipocyte differentiation via a non-canonical pathway

    PubMed Central

    Fleury, Audrey; Hoch, Lucile; Martinez, M. Carmen; Faure, Hélène; Taddei, Maurizio; Petricci, Elena; Manetti, Fabrizio; Girard, Nicolas; Mann, André; Jacques, Caroline; Larghero, Jérôme; Ruat, Martial; Andriantsitohaina, Ramaroson; Le Lay, Soazig

    2016-01-01

    Hedgehog (Hh) is a critical regulator of adipogenesis. Extracellular vesicles are natural Hh carriers, as illustrated by activated/apoptotic lymphocytes specifically shedding microparticles (MP) bearing the morphogen (MPHh+). We show that MPHh+ inhibit adipocyte differentiation and orientate mesenchymal stem cells towards a pro-osteogenic program. Despite a Smoothened (Smo)-dependency, MPHh+ anti-adipogenic effects do not activate a canonical Hh signalling pathway in contrast to those elicited either by the Smo agonist SAG or recombinant Sonic Hedgehog. The Smo agonist GSA-10 recapitulates many of the hallmarks of MPHh+ anti-adipogenic effects. The adipogenesis blockade induced by MPHh+ and GSA-10 was abolished by the Smo antagonist LDE225. We further elucidate a Smo/Lkb1/Ampk axis as the non-canonical Hh pathway used by MPHh+ and GSA-10 to inhibit adipocyte differentiation. Our results highlight for the first time the ability of Hh-enriched MP to signal via a non-canonical pathway opening new perspectives to modulate fat development. PMID:27010359

  14. High aminopeptidase N/CD13 levels characterize human amniotic mesenchymal stem cells and drive their increased adipogenic potential in obese women.

    PubMed

    Iaffaldano, Laura; Nardelli, Carmela; Raia, Maddalena; Mariotti, Elisabetta; Ferrigno, Maddalena; Quaglia, Filomena; Labruna, Giuseppe; Capobianco, Valentina; Capone, Angela; Maruotti, Giuseppe Maria; Pastore, Lucio; Di Noto, Rosa; Martinelli, Pasquale; Sacchetti, Lucia; Del Vecchio, Luigi

    2013-08-15

    Maternal obesity is associated to increased fetal risk of obesity and other metabolic diseases. Human amniotic mesenchymal stem cells (hA-MSCs) have not been characterized in obese women. The aim of this study was to isolate and compare hA-MSC immunophenotypes from obese (Ob-) and normal weight control (Co-) women, to identify alterations possibly predisposing the fetus to obesity. We enrolled 16 Ob- and 7 Co-women at delivery (mean/SEM prepregnancy body mass index: 40.3/1.8 and 22.4/1.0 kg/m2, respectively), and 32 not pregnant women. hA-MSCs were phenotyped by flow cytometry; several maternal and newborn clinical and biochemical parameters were also measured. The expression of membrane antigen CD13 was higher on Ob-hA-MSCs than on Co-hA-MSCs (P = 0.005). Also, serum levels of CD13 at delivery were higher in Ob- versus Co-pregnant women and correlated with CD13 antigen expression on Ob-hA-MSCs (r2 = 0.84, P < 0.0001). Adipogenesis induction experiments revealed that Ob-hA-MSCs had a higher adipogenic potential than Co-hA-MSCs as witnessed by higher peroxisome proliferator-activated receptor gamma and aP2 mRNA levels (P = 0.05 and P = 0.05, respectively), at postinduction day 14 associated with increased CD13 mRNA levels from baseline to day 4 postinduction (P < 0.05). Adipogenesis was similar in the two sets of hA-MSCs after CD13 silencing, whereas it was increased in Co-hA-MSCs after CD13 overexpression. CD13 expression was high also in Ob-h-MSCs from umbilical cords or visceral adipose tissue of not pregnant women. In conclusion, antigen CD13, by influencing the adipogenic potential of hA-MSCs, could be an in utero risk factor for obesity. Our data strengthen the hypothesis that high levels of serum and MSC CD13 are obesity markers.

  15. High Aminopeptidase N/CD13 Levels Characterize Human Amniotic Mesenchymal Stem Cells and Drive Their Increased Adipogenic Potential in Obese Women

    PubMed Central

    Iaffaldano, Laura; Nardelli, Carmela; Raia, Maddalena; Mariotti, Elisabetta; Ferrigno, Maddalena; Quaglia, Filomena; Labruna, Giuseppe; Capobianco, Valentina; Capone, Angela; Maruotti, Giuseppe Maria; Pastore, Lucio; Di Noto, Rosa; Martinelli, Pasquale; Del Vecchio, Luigi

    2013-01-01

    Maternal obesity is associated to increased fetal risk of obesity and other metabolic diseases. Human amniotic mesenchymal stem cells (hA-MSCs) have not been characterized in obese women. The aim of this study was to isolate and compare hA-MSC immunophenotypes from obese (Ob-) and normal weight control (Co-) women, to identify alterations possibly predisposing the fetus to obesity. We enrolled 16 Ob- and 7 Co-women at delivery (mean/SEM prepregnancy body mass index: 40.3/1.8 and 22.4/1.0 kg/m2, respectively), and 32 not pregnant women. hA-MSCs were phenotyped by flow cytometry; several maternal and newborn clinical and biochemical parameters were also measured. The expression of membrane antigen CD13 was higher on Ob-hA-MSCs than on Co-hA-MSCs (P=0.005). Also, serum levels of CD13 at delivery were higher in Ob- versus Co-pregnant women and correlated with CD13 antigen expression on Ob-hA-MSCs (r2=0.84, P<0.0001). Adipogenesis induction experiments revealed that Ob-hA-MSCs had a higher adipogenic potential than Co-hA-MSCs as witnessed by higher peroxisome proliferator-activated receptor gamma and aP2 mRNA levels (P=0.05 and P=0.05, respectively), at postinduction day 14 associated with increased CD13 mRNA levels from baseline to day 4 postinduction (P<0.05). Adipogenesis was similar in the two sets of hA-MSCs after CD13 silencing, whereas it was increased in Co-hA-MSCs after CD13 overexpression. CD13 expression was high also in Ob-h-MSCs from umbilical cords or visceral adipose tissue of not pregnant women. In conclusion, antigen CD13, by influencing the adipogenic potential of hA-MSCs, could be an in utero risk factor for obesity. Our data strengthen the hypothesis that high levels of serum and MSC CD13 are obesity markers. PMID:23488598

  16. The Local Interstellar Medium

    NASA Astrophysics Data System (ADS)

    Ferlet, Roger

    Substantial progress in the field of the Local Interstellar Medium has been largely due to recent launches of space missions, mostly in the UV and X-ray domains, but also to ground-based observations, mainly in high resolution spectroscopy. However, a clear gap seems to remain between the wealth of new data and the theoretical understanding. This paper gives an overview of some observational aspects, with no attempt of completeness or doing justice to all the people involved in the field. As progress rarely evolves in straight paths, we can expect that our present picture of the solar system surroundings is not definitive.

  17. Heterogeneous Differentiation of Human Mesenchymal Stem Cells in 3D Extracellular Matrix Composites

    PubMed Central

    Jung, Jangwook P.; Bache-Wiig, Meredith K.; Provenzano, Paolo P.; Ogle, Brenda M.

    2016-01-01

    Abstract Extracellular matrix (ECM) proteins are structural elements of tissue and also potent signaling molecules. Previously, our laboratory showed that ECM of 2D coatings can trigger differentiation of bone marrow-derived mesenchymal stem cells (MSCs) into mesodermal lineages in an ECM-specific manner over 14 days, in some cases comparable to chemical induction. To test whether a similar effect was possible in a 3D, tissue-like environment, we designed a synthetic-natural biomaterial composite. The composite can present whole-molecule ECM proteins to cells, even those that do not spontaneously form hydrogels ex vivo, in 3D. To this end, we entrapped collagen type I, laminin-111, or fibronectin in ECM composites with MSCs and directly compared markers of mesodermal differentiation including cardiomyogenic (ACTC1), osteogenic (SPP1), adipogenic (PPARG), and chondrogenic (SOX9) in 2D versus 3D. We found the 3D condition largely mimicked the 2D condition such that the addition of type I collagen was the most potent inducer of differentiation to all lineages tested. One notable difference between 2D and 3D was pronounced adipogenic differentiation in 3D especially in the presence of exogenous collagen type I. In particular, PPARG gene expression was significantly increased ∼16-fold relative to chemical induction, in 3D and not in 2D. Unexpectedly, 3D engagement of ECM proteins also altered immunomodulatory function of MSCs in that expression of IL-6 gene was elevated relative to basal levels in 2D. In fact, levels of IL-6 gene expression in 3D composites containing exogenously supplied collagen type I or fibronectin were statistically similar to levels attained in 2D with tumor necrosis factor-α (TNF-α) stimulation and these levels were sustained over a 2-week period. Thus, this novel biomaterial platform allowed us to compare the biochemical impact of whole-molecule ECM proteins in 2D versus 3D indicating enhanced adipogenic differentiation and IL-6 expression

  18. Heterogeneous Differentiation of Human Mesenchymal Stem Cells in 3D Extracellular Matrix Composites.

    PubMed

    Jung, Jangwook P; Bache-Wiig, Meredith K; Provenzano, Paolo P; Ogle, Brenda M

    2016-01-01

    Extracellular matrix (ECM) proteins are structural elements of tissue and also potent signaling molecules. Previously, our laboratory showed that ECM of 2D coatings can trigger differentiation of bone marrow-derived mesenchymal stem cells (MSCs) into mesodermal lineages in an ECM-specific manner over 14 days, in some cases comparable to chemical induction. To test whether a similar effect was possible in a 3D, tissue-like environment, we designed a synthetic-natural biomaterial composite. The composite can present whole-molecule ECM proteins to cells, even those that do not spontaneously form hydrogels ex vivo, in 3D. To this end, we entrapped collagen type I, laminin-111, or fibronectin in ECM composites with MSCs and directly compared markers of mesodermal differentiation including cardiomyogenic (ACTC1), osteogenic (SPP1), adipogenic (PPARG), and chondrogenic (SOX9) in 2D versus 3D. We found the 3D condition largely mimicked the 2D condition such that the addition of type I collagen was the most potent inducer of differentiation to all lineages tested. One notable difference between 2D and 3D was pronounced adipogenic differentiation in 3D especially in the presence of exogenous collagen type I. In particular, PPARG gene expression was significantly increased ∼16-fold relative to chemical induction, in 3D and not in 2D. Unexpectedly, 3D engagement of ECM proteins also altered immunomodulatory function of MSCs in that expression of IL-6 gene was elevated relative to basal levels in 2D. In fact, levels of IL-6 gene expression in 3D composites containing exogenously supplied collagen type I or fibronectin were statistically similar to levels attained in 2D with tumor necrosis factor-α (TNF-α) stimulation and these levels were sustained over a 2-week period. Thus, this novel biomaterial platform allowed us to compare the biochemical impact of whole-molecule ECM proteins in 2D versus 3D indicating enhanced adipogenic differentiation and IL-6 expression of MSC in

  19. Apolipoprotein E promotes lipid accumulation and differentiation in human adipocytes

    SciTech Connect

    Lasrich, Dorothee; Bartelt, Alexander; Grewal, Thomas; Heeren, Joerg

    2015-09-10

    Several studies in mice indicate a role for apolipoprotein E (APOE) in lipid accumulation and adipogenic differentiation in adipose tissue. However, little is yet known if APOE functions in a similar manner in human adipocytes. This prompted us to compare lipid loading and expression of adipocyte differentiation markers in APOE-deficient and control adipocytes using the differentiated human mesenchymal stem cell line hMSC-Tert as well as primary human and mouse adipocytes as model systems. Differentiated hMSC-Tert were stably transduced with or without siRNA targeting APOE while murine adipocytes were isolated from wild type and Apoe knockout mice. Human APOE knockdown hMSC-Tert adipocytes accumulated markedly less triglycerides compared to control cells. This correlated with strongly decreased gene expression levels of adipocyte markers such as adiponectin (ADIPOQ) and fatty acid binding protein 4 (FABP4) as well as the key transcription factor driving adipocyte differentiation, peroxisome proliferator activator receptor gamma (PPARG), in particular the PPARG2 isoform. Similarly, differentiation of murine Apoe-deficient adipocytes was characterized by reduced gene expression of Adipoq, Fabp4 and Pparg. Interestingly, incubation of APOE-deficient hMSC-Tert adipocytes with conditioned media from APOE3-overexpressing adipocytes or APOE-containing Very Low Density Lipoprotein (VLDL) partially restored triglyceride accumulation, but were unable to induce adipocyte differentiation, as judged by expression of adipocyte markers. Taken together, depletion of endogenous APOE in human adipocytes severely impairs lipid accumulation, which is associated with an inability to initiate differentiation. - Highlights: • Immortalized human mesenchymal stem cells were used to study adipocyte development. • Knockdown of endogenous APOE lead to impaired lipid accumulation and adipogenesis. • APOE supplementation partially restored lipid accumulation but not differentiation.

  20. Alpha-adrenergic blocker mediated osteoblastic stem cell differentiation

    SciTech Connect

    Choi, Yoon Jung; Lee, Jue Yeon; Lee, Seung Jin; Chung, Chong-Pyoung; Park, Yoon Jeong

    2011-12-16

    Highlights: Black-Right-Pointing-Pointer Doxazocin directly up-regulated bone metabolism at a low dose. Black-Right-Pointing-Pointer Doxazocin induced osteoblastic stem cell differentiation without affecting cell proliferation. Black-Right-Pointing-Pointer This osteogenic stem cell differentiation is mediated by ERK-signal dependent pathway. -- Abstract: Recent researches have indicated a role for antihypertensive drugs including alpha- or beta-blockers in the prevention of bone loss. Some epidemiological studies reported the protective effects of those agents on fracture risk. However, there is limited information on the association with those agents especially at the mechanism of action. In the present study, we investigated the effects of doxazosin, an alpha-blocker that is clinically used for the treatment of benign prostatic hyperplasia (BPH) along with antihypertensive medication, on the osteogenic stem cell differentiation. We found that doxazosin increased osteogenic differentiation of human mesenchymal stem cells, detected by Alizarin red S staining and calcein. Doxazosin not only induced expression of alkaline phosphatase, type I collagen, osteopontin, and osteocalcin, it also resulted in increased phosphorylation of extracellular signal-regulated kinase (ERK1/2), a MAP kinase involved in osteoblastic differentiation. Treatment with U0126, a MAP kinase inhibitor, significantly blocked doxazosin-induced osteoblastic differentiation. Unrelated to activation of osteogenic differentiation by doxazosin, we found that there were no significant changes in adipogenic differentiation or in the expression of adipose-specific genes, including peroxisome proliferator-activated receptor {gamma}, aP2, or LPL. In this report, we suggest that doxazosin has the ability to increase osteogenic cell differentiation via ERK1/2 activation in osteogenic differentiation of adult stem cells, which supports the protective effects of antihypertensive drug on fracture risk and

  1. DENSE MEDIUM CYCLONE OPTIMIZATON

    SciTech Connect

    Gerald H. Luttrell; Chris J. Barbee; Peter J. Bethell; Chris J. Wood

    2005-06-30

    Dense medium cyclones (DMCs) are known to be efficient, high-tonnage devices suitable for upgrading particles in the 50 to 0.5 mm size range. This versatile separator, which uses centrifugal forces to enhance the separation of fine particles that cannot be upgraded in static dense medium separators, can be found in most modern coal plants and in a variety of mineral plants treating iron ore, dolomite, diamonds, potash and lead-zinc ores. Due to the high tonnage, a small increase in DMC efficiency can have a large impact on plant profitability. Unfortunately, the knowledge base required to properly design and operate DMCs has been seriously eroded during the past several decades. In an attempt to correct this problem, a set of engineering tools have been developed to allow producers to improve the efficiency of their DMC circuits. These tools include (1) low-cost density tracers that can be used by plant operators to rapidly assess DMC performance, (2) mathematical process models that can be used to predict the influence of changes in operating and design variables on DMC performance, and (3) an expert advisor system that provides plant operators with a user-friendly interface for evaluating, optimizing and trouble-shooting DMC circuits. The field data required to develop these tools was collected by conducting detailed sampling and evaluation programs at several industrial plant sites. These data were used to demonstrate the technical, economic and environmental benefits that can be realized through the application of these engineering tools.

  2. Valproic acid, a histone deacetylase inhibitor, decreases proliferation of and induces specific neurogenic differentiation of canine adipose tissue-derived stem cells.

    PubMed

    Kurihara, Yasuhiro; Suzuki, Takehito; Sakaue, Motoharu; Murayama, Ohoshi; Miyazaki, Yoko; Onuki, Atsushi; Aoki, Takuma; Saito, Miyoko; Fujii, Yoko; Hisasue, Masaharu; Tanaka, Kazuaki; Takizawa, Tatsuya

    2014-01-01

    Adipose tissue-derived stem cells (ADSCs) isolated from adult tissue have pluripotent differentiation and self-renewal capability. The tissue source of ADSCs can be obtained in large quantities and with low risks, thus highlighting the advantages of ADSCs in clinical applications. Valproic acid (VPA) is a widely used antiepileptic drug, which has recently been reported to affect ADSC differentiation in mice and rats; however, few studies have been performed on dogs. We aimed to examine the in vitro effect of VPA on canine ADSCs. Three days of pretreatment with VPA decreased the proliferation of ADSCs in a dose-dependent manner; VPA concentrations of 4 mM and above inhibited the proliferation of ADSCs. In parallel, VPA increased p16 and p21 mRNA expression, suggesting that VPA attenuated the proliferative activity of ADSCs by activating p16 and p21. Furthermore, the effects of VPA on adipogenic, osteogenic or neurogenic differentiation were investigated morphologically. VPA pretreatment markedly promoted neurogenic differentiation, but suppressed the accumulation of lipid droplets and calcium depositions. These modifications of ADSCs by VPA were associated with a particular gene expression profile, viz., an increase in neuronal markers, that is, NSE, TUBB3 and MAP2, a decrease in the adipogenic marker, LPL, but no changes in osteogenic markers, as estimated by reverse transcription-PCR analysis. These results suggested that VPA is a specific inducer of neurogenic differentiation of canine ADSCs and is a useful tool for studying the interaction between chromatin structure and cell fate determination.

  3. Isolation of dental pulp stem cells from a single donor and characterization of their ability to differentiate after 2 years of cryopreservation

    PubMed Central

    Alsulaimani, Reem S.; Ajlan, Sumaiah A.; Aldahmash, Abdullah M.; Alnabaheen, May S.; Ashri, Nahid Y.

    2016-01-01

    Objectives: To investigate the viability and differentiation capacity of dental pulp stem cells (DPSCs) isolated from single donors after two years of cryopreservation. Methods: This prospective study was conducted between October 2010 and February 2014 in the Stem Unit, College of Medicine, King Saud University, Riyadh, Saudi Arabia. Seventeen teeth extracted from 11 participants were processed separately to assess the minimum tissue weight needed to yield cells for culturing in vitro. Cell stemness was evaluated before passage 4 using the colony forming unit assay, immunofluorescence staining, and bi-lineage differentiation. Dental pulp stem cells were cryopreserved for 2 years. Post-thaw DPSCs were cultured until senescence and differentiated toward osteogenic, odontogenic, adipogenic, and chondrogenic lineages. Results: Viable cells were isolated successfully from 6 of the 11 participants. Three of these 6 cultured cell lines were identified as DPSCs. A minimum of 0.2 g of dental pulp tissue was required for successful isolation of viable cells from a single donor. Post-thaw DPSCs successfully differentiated towards osteogenic, odontogenic, chondrogenic, and adipogenic lineages. The post-thaw DPSCs were viable in vitro up to 70 days before senescence. There was no significant difference between the cells. Conclusion: Within the limitations of this investigation, viable cells from dental pulp tissue were isolated successfully from the same donor using a minimum of 2 extracted teeth. Not all isolated cells from harvested dental pulp tissue had the characteristics of DPSCs. Post-thaw DPSCs maintained their multi-lineage differentiation capacity. PMID:27146619

  4. IL-1β Irreversibly Inhibits Tenogenic Differentiation and Alters Metabolism In Injured Tendon-Derived Progenitor Cells In Vitro

    PubMed Central

    Zhang, Kairui; Asai, Shuji; Yu, Bin; Enomoto-Iwamoto, Motomi

    2015-01-01

    Tendon injuries are common, and the damaged tendon often turns into scar tissue and never completely regains the original biomechanical properties. Previous studies have reported that the mRNA levels of inflammatory cytokines such as IL-1β are remarkably up-regulated in injured tendons. To examine how IL-1β impacts tendon repair process, we isolated the injured tendon-derived progenitor cells (inTPCs) from mouse injured Achilles tendons and studied the effects of IL-1β on the inTPCs in vitro. IL-1β treatment strongly reduced expression of tendon cell markers such as scleraxis and tenomodulin, and also down-regulated gene expression of collagen 1, collagen 3, biglycan and fibromodulin in inTPCs. Interestingly, IL-1β stimulated lactate production with increases in hexokinase II and lactate dehydrogenase expression and a decrease in pyruvate dehydrogenase. Inhibition of lactate production restored IL-1β-induced down-regulation of collagen1 and scleraxis expression. Furthermore, IL-1β significantly inhibited adipogenic, chondrogenic and osteogenic differentiation of inTPCs. Interestingly, inhibition of tenogenic and adipogenic differentiation was not recovered after removal of IL-1β while chondrogenic and osteogenic differentiation abilities were not affected. These findings indicate that IL-1β strongly and irreversibly impairs tenogenic potential and alters glucose metabolism in tendon progenitors appearing in injured tendons. Inhibition of IL-1β may be beneficial for maintaining function of tendon progenitor cells during the tendon repair process. PMID:26051275

  5. Transcriptome profiling of Xanthomonas campestris pv. campestris grown in minimal medium MMX and rich medium NYG.

    PubMed

    Liu, Wei; Yu, Yan-Hua; Cao, Shi-Yuan; Niu, Xiang-Na; Jiang, Wei; Liu, Guo-Fang; Jiang, Bo-Le; Tang, Dong-Jie; Lu, Guang-Tao; He, Yong-Qiang; Tang, Ji-Liang

    2013-06-01

    Xanthomonas campestris pathovar campestris (Xcc) is the causal agent of black rot disease in cruciferous plants worldwide. Although the complete genomes of several Xcc strains have been determined, the gene expression and regulation mechanisms in this pathogen are far from clear. In this work, transcriptome profiling of Xcc 8004 grown in MMX medium (minimal medium for Xanthomonas campestris) and NYG medium (peptone yeast glycerol medium) were investigated by RNA-Seq. Using the Illumina HiSeq 2000 platform, a total of 26,514,630 reads (90 nt in average) were generated, of which 15,708,478 reads mapped uniquely to coding regions of Xcc 8004 genome. Of the 4273 annotated protein-coding genes of Xcc 8004, 629 were found differentially expressed in Xcc grown in MMX and NYG. Of the differentially expressed genes, 495 were up-regulated and 134 were down-regulated in MMX. The MMX-induced genes are mainly involved in amino acid metabolism, transport systems, atypical condition adaptation and pathogenicity, especially the type III secretion system, while the MMX-repressed genes are mainly involved in chemotaxis and degradation of small molecules. The global transcriptome analyzes of Xcc 8004 grown in MMX and NYG might facilitate the gene functional characterization of this phytopathogenic bacterium.

  6. Immobilization of cross linked Col-I-OPN bone matrix protein on aminolysed PCL surfaces enhances initial biocompatibility of human adipogenic mesenchymal stem cells (hADMSC)

    NASA Astrophysics Data System (ADS)

    Kim, Young-Hee; Jyoti, Md. Anirban; Song, Ho-Yeon

    2014-06-01

    In bone tissue engineering surface modification is considered as one of the important ways of fabricating successful biocompatible material. Addition of biologically active functionality on the surfaces has been tried for improving the overall biocompatibility of the system. In this study poly-ɛ-caprolactone film surfaces have been modified through aminolysis and immobilization process. Collagen type I (COL-I) and osteopontin (OPN), which play an important role in osteogenesis, was immobilized onto PCL films followed by aminolysis treatment using 1,6-hexanediamine. Characterization of animolysed and immobilized surfaces were done by a number techniques using scanning electron microscopy (SEM), FT-IR, XPS, ninhydrin staining, SDS-PAGE and confocal microscopy and compared between the modified and un-modified surfaces. Results of the successive experiments showed that aminolysis treatment was homogeneously achieved which helped to entrap or immobilize Col-I-OPN proteins on surfaces of PCL film. In vitro studies with human adipogenic mesenchymal stem cells (hADMSC) also confirmed the attachment and proliferation of cells was better in modified PCL surfaces than the unmodified surfaces. SEM, confocal microscopy and MTT assay showed a significant increase in cell spreading, attachment and proliferations on the biofunctionalized surfaces compared to the unmodified PCL surfaces at all-time points indicating the success of surface biofunctionalization.

  7. The effects of 2-bromopalmitate on the fatty acid composition in differentiating adipocytes of red sea bream (Pagrus major).

    PubMed

    Oku, Hiromi; Tokuda, Masaharu; Umino, Tetsuya

    2009-04-01

    To determine whether external factors affect the adipogenic function of fish adipocytes, the effects of 2-bromopalmitate (a PPAR agonist) on the fatty acid composition in differentiating adipocytes of red sea bream were investigated in vitro. In the presence of 2-bromopalmitate, the red sea bream adipocytes were differentiated and the effects on the fatty acid composition and the adipogenic gene expression were analyzed. With the level of 2-bromopalmitate, the content of 16:1n-7, a delta-9 desaturation product, increased in association with the increase in a stearoyl CoA desaturase (SCD) gene expression level while the triglyceride accumulation was not affected. Subsequently, the effects on the bioconversion of the n-3 and n-6 fatty acids, which are main series of dietary essential fatty acids, were examined. In the presence of 300 microM of 18:3n-3 or 18:2n-6, red sea bream stromal-vascular cells accumulated the lipid in the cytoplasm within 3 days by the fatty acid uptake with the increase of corresponding fatty acid contents. Furthermore, in both the 18:3n-3 and 18:2n-6 stored cells, the products of delta-6 desaturation (18:4n-3 and 18:3n-6, respectively) and C(18-20) elongation (20:3n-3 and 20:2n-6, respectively) were detected. However, neither the delta-6 desatutration nor C(18-20) elongation of 18:3n-3 and 18:2n-6 were enhanced by 2-bromopalmitate treatment. In conclusion, the results indicate that the adipocyte function in fish, e.g. adipogenic gene expression and fatty acid composition, can be modified by external factors and a main effect of 2-bromopalmitate is the increase in the content of delta-9 desaturation product by stimulating the SCD gene expression.

  8. Fatty acid profiles and adipogenic gene expression of various fat depots in Japanese Black and Holstein steers.

    PubMed

    Shirouchi, Bungo; Albrecht, Elke; Nuernberg, Gerd; Maak, Steffen; Olavanh, Samadmanivong; Nakamura, Yoshinori; Sato, Masao; Gotoh, Takafumi; Nuernberg, Karin

    2014-01-01

    Objective of the study was to assess the breed effect on fatty acid (FA) composition of different adipose tissues and on mRNA expression of genes involved in adipogenesis and fat metabolism. Japanese Black (JB) and Holstein (HS) steers were kept under equivalent conditions with high energy intake resulting in large differences in intramuscular fat (IMF) accumulation in longissimus muscle (LM). The relative FA composition of muscle, intermuscular fat, visceral fat, and perirenal fat was comparable between JB and HS steers. Circulating fatty acids were also similar in both breeds. Most relevant breed effects were identified in IMF, underlining the uniqueness of this adipose tissue site. JB steers had more monounsaturated FA and less saturated FA. Perilipin 1 and adipose differentiation-related protein (ADFP) mRNA levels were higher in IMF of JB. The results suggest advanced maturity of IMF cells in JB and altered local conditions in muscle influencing IMF accumulation and composition.

  9. Ivy gourd (Coccinia grandis L. Voigt) root suppresses adipocyte differentiation in 3T3-L1 cells

    PubMed Central

    2014-01-01

    Background Ivy gourd (Coccinia grandis L. Voigt) is a tropical plant widely distributed throughout Asia, Africa, and the Pacific Islands. The anti-obesity property of this plant has been claimed but still remains to be scientifically proven. We therefore investigated the effects of ivy gourd leaf, stem, and root on adipocyte differentiation by employing cell culture model. Methods Dried roots, stems, and leaves of ivy gourd were separately extracted with ethanol. Each extract was then applied to 3T3-L1 pre-adipocytes upon induction with a mixture of insulin, 3-isobutyl-1-methylxanthine, and dexamethasone, for anti-adipogenesis assay. The active extract was further fractionated by a sequential solvent partitioning method, and the resulting fractions were examined for their abilities to inhibit adipogenesis in 3T3-L1 cells. Differences in the expression of adipogenesis-related genes between the treated and untreated cells were determined from their mRNA and protein levels. Results Of the three ivy gourd extracts, the root extract exhibited an anti-adipogenic effect. It significantly reduced intracellular fat accumulation during the early stages of adipocyte differentiation. Together with the suppression of differentiation, expression of the genes encoding PPARγ, C/EBPα, adiponectin, and GLUT4 were down-regulated. Hexane-soluble fraction of the root extract also inhibited adipocyte differentiation and decreased the mRNA levels of various adipogenic genes in the differentiating cells. Conclusions This is the first study to demonstrate that ivy gourd root may prevent obesity based mainly on the ability of its active constituent(s) to suppress adipocyte differentiation in vitro. Such an inhibitory effect is mediated by at least down-regulating the expression of PPARγ-the key transcription factor of adipogenesis in pre-adipocytes during their early differentiation processes. PMID:24884680

  10. Effects of quercetin, a natural phenolic compound, in the differentiation of human mesenchymal stem cells (MSC) into adipocytes and osteoblasts.

    PubMed

    Casado-Díaz, Antonio; Anter, Jaouad; Dorado, Gabriel; Quesada-Gómez, José Manuel

    2016-06-01

    Natural phenols may have beneficial properties against oxidative stress, which is associated with aging and major chronic aging-related diseases, such as loss of bone mineral mass (osteoporosis) and diabetes. The main aim of this study was to analyze the effect of quercetin, a major nutraceutical compound present in the "Mediterranean diet", on mesenchymal stem-cell (MSC) differentiation. Such cells were induced to differentiate into osteoblasts or adipocytes in the presence of two quercetin concentrations (0.1 and 10μM). Several physiological parameters and the expression of osteoblastogenesis and adipogenesis marker genes were monitored. Quercetin (10μM) inhibited cell proliferation, alkaline phosphatase (ALPL) activity and mineralization, down-regulating the expression of ALPL, collagen type I alpha 1 (COL1A1) and osteocalcin [bone gamma-carboxyglutamate protein (BGLAP)] osteoblastogenesis-related genes in MSC differentiating into osteoblasts. Moreover, in these cultures, CCAAT/enhancer-binding protein alpha (CEBPA) and peroxisome proliferator-activated receptor gamma 2 (PPARG2) adipogenic genes were induced, and cells differentiated into adipocytes were observed. Quercetin did not affect proliferation, but increased adipogenesis, mainly at 10-μM concentration in MSC induced to differentiate to adipocytes. β- and γ-catenin (plakoglobin) nuclear levels were reduced and increased, respectively, in quercetin-treated cultures. This suggests that the effect of high concentration of quercetin on MSC osteoblastic and adipogenic differentiation is mediated via Wnt/β-catenin inhibition. In conclusion, quercetin supplementation inhibited osteoblastic differentiation and promoted adipogenesis at the highest tested concentration. Such possible adverse effects of high quercetin concentrations should be taken into account in nutraceutical or pharmaceutical strategies using such flavonol. PMID:27142748

  11. BKCa and hEag1 channels regulate cell proliferation and differentiation in human bone marrow-derived mesenchymal stem cells.

    PubMed

    Zhang, Ying-Ying; Yue, Jianbo; Che, Hui; Sun, Hai-Ying; Tse, Hung-Fat; Li, Gui-Rong

    2014-02-01

    Human bone marrow-derived mesenchymal stem cells (MSCs) serve as a reservoir for the continuous renewal of various mesenchymal tissues; however, cellular physiology of ion channels is not fully understood. The present study investigated potential roles of large-conductance Ca(2+) -activated potassium (BKCa ) channels and ether-à-go-go potassium (hEag1 or Kv10.1) channels in regulating cell proliferation and differentiation in human MSCs. We found that inhibition of BKCa with paxilline or hEag1 with astemizole, or knockdown of BKCa with shRNAs targeting KCa1.1 or hEag1 channels with shRNAs targeting KCNH1 arrested the cells at G0/G1 phase. In addition, silencing BKCa or hEag1 channels significantly reduced adipogenic differentiation with decrease of lipid accumulation and expression of the adipocyte marker PPARγ, and decreased osteogenic differentiation with reduction of mineral precipitation and osteocalcin. These effects were accompanied with a reduced cyclin D1, cyclin E, p-ERK1/2, and p-Akt. Our results demonstrate that BKCa and hEag1 channels not only regulate cell proliferation, but also participate in the adipogenic and osteogenic differentiations in human MSCs, which indicates that BKCa and hEag1 channels may be essential in maintaining bone marrow physiological function and bone regeneration. PMID:23881642

  12. Averrhoa carambola L. peel extract suppresses adipocyte differentiation in 3T3-L1 cells.

    PubMed

    Rashid, Asyifah Mohamed; Lu, Kaihui; Yip, Yew Mun; Zhang, Dawei

    2016-02-01

    Obesity is associated with an increased risk of many chronic diseases. Recently, a growing body of evidence has shown that phytochemicals may inhibit adipogenesis and obesity. In this study, we report for the first time, the ability of Averrhoa carambola L. peel extract commonly known as star fruit (SFP) to effectively suppress adipocyte differentiation in 3T3-L1 preadipocytes and therefore, address it as a potential candidate to treat obesity and its related diseases. (-)-Epicatechin was identified as a bioactive compound likely responsible for this suppression. As the genetic expression studies revealed that the adipogenic activity of SFP extract was due to the simultaneous downregulation of the C/EBPα and PPARγ as well as the upregulation of PPARα receptor genes, a detailed computational docking study was also elucidated to reveal the likely binding mode of (-)-epicatechin to the receptor of interest, accounting for the likely mechanism that results in the overall suppression of adipocyte differentiation.

  13. Adipose-derived stem cell differentiation as a basic tool for vascularized adipose tissue engineering.

    PubMed

    Volz, Ann-Cathrin; Huber, Birgit; Kluger, Petra J

    2016-01-01

    The development of in vitro adipose tissue constructs is highly desired to cope with the increased demand for substitutes to replace damaged soft tissue after high graded burns, deformities or tumor removal. To achieve clinically relevant dimensions, vascularization of soft tissue constructs becomes inevitable but still poses a challenge. Adipose-derived stem cells (ASCs) represent a promising cell source for the setup of vascularized fatty tissue constructs as they can be differentiated into adipocytes and endothelial cells in vitro and are thereby available in sufficiently high cell numbers. This review summarizes the currently known characteristics of ASCs and achievements in adipogenic and endothelial differentiation in vitro. Further, the interdependency of adipogenesis and angiogenesis based on the crosstalk of endothelial cells, stem cells and adipocytes is addressed at the molecular level. Finally, achievements and limitations of current co-culture conditions for the construction of vascularized adipose tissue are evaluated. PMID:26976717

  14. Anti-adipogenic activities of Alnus incana and Populus balsamifera bark extracts, part I: sites and mechanisms of action.

    PubMed

    Martineau, Louis C; Hervé, Jessica; Muhamad, Asim; Saleem, Ammar; Harris, Cory S; Arnason, John T; Haddad, Pierre S

    2010-09-01

    Obesity is an epidemic in most developed countries and novel therapeutic approaches are needed. In the course of a screening project of medicinal plants used by the Eastern James Bay Cree of Canada and having potential for the treatment of diabetes, we have identified several products that inhibit adipogenesis, suggesting potential antiobesity activities. The inhibitory activity of two of these, the extract of the inner bark of the deciduous trees Alnus incana ssp. rugosa (Speckled Alder) and Populus balsamifera L. (Balsam Poplar), was analyzed using the 3T3-L1 cell model of adipogenesis. Intracellular triglyceride accumulation, pre-adipocyte proliferation, and PPAR- γ activity were measured. Alnus incana extracts acted early in the differentiation process but did not affect clonal expansion of pre-adipocytes nor the morphological transformation from fibroblast-like to rounded fat-laden cells. Alnus incana extracts were found to act as partial agonists toward PPAR- γ activity. In contrast, Populus balsamifera extracts completely abrogated adipogenesis, severely limited clonal expansion of pre-adipocytes and generally maintained cells in an undifferentiated fibroblast-like morphology. Populus balsamifera extracts exerted antagonistic action against PPAR- γ activity. It is concluded that, through their actions on the adipocyte, these plant products may be useful for the treatment of obesity and related metabolic diseases.

  15. Cardiac mesenchymal progenitors differentiate into adipocytes via Klf4 and c-Myc

    PubMed Central

    Kami, D; Kitani, T; Kawasaki, T; Gojo, S

    2016-01-01

    Direct reprogramming of differentiated cells to pluripotent stem cells has great potential to improve our understanding of developmental biology and disorders such as cancers, and has implications for regenerative medicine. In general, the effects of transcription factors (TFs) that are transduced into cells can be influenced by pre-existing transcriptional networks and epigenetic modifications. However, previous work has identified four key TFs, Oct4, Sox2, Klf4 and c-Myc, which can reprogram various differentiated cells to generate induced pluripotent stem cells. Here, we show that in the heart, the transduction of cardiac mesenchymal progenitors (CMPs) with Klf4 and c-Myc (KM) was sufficient to drive the differentiation of these cells into adipocytes without the use of adipogenic stimulation cocktail, that is, insulin, 3-isobutyl-1-methylxanthine (IBMX) and dexamethasone. KM-transduced CMPs exhibited a gradually increased expression of adipogenic-related genes, such as C/Ebpα, Pparγ and Fabp4, activation of the peroxisome proliferator-activated receptor (PPAR) signaling pathway, inactivation of the cell cycle-related pathway and formation of cytoplasmic lipid droplets within 10 days. In contrast, NIH3T3 fibroblasts, 3T3-L1 preadipocytes, and bone marrow-derived mesenchymal stem cells transduced with KM did not differentiate into adipocytes. Both in vitro and in vivo cardiac ischemia reperfusion injury models demonstrated that the expression of KM genes sharply increased following a reperfusion insult. These results suggest that ectopic adipose tissue formation in the heart following myocardial infarction results from CMPs that express KM following a stress response. PMID:27077806

  16. Probing the nuclear medium with the K{sup +} meson

    SciTech Connect

    Chrien, R.E.

    1995-12-31

    Elastic differential cross sections for K{sup +} mesons scattered from targets of carbon and {sup 6}Li have been measured at an incident momentum of 715 MeV/c. The ratios of scattering cross sections from these targets are not predicted by theory, and are consistent with earlier suggestions that the K{sup +}-nucleon interaction is modified in the nuclear medium.

  17. Interstellar medium simulations

    NASA Astrophysics Data System (ADS)

    Breitschwerdt, D.; de Avillez, M. A.; Feige, J.; Dettbarn, C.

    2012-06-01

    In this review we critically assess numerical simulations of the interstellar medium (ISM), and argue that 3D high resolution calculations are the most promising method to determine the structure of the interstellar gas and follow its evolution well into the nonlinear regime. Based on a Riemann solver adaptive mesh refinement code, we present a model, which fulfills the basic requirements of running it sufficiently long in order to erase memory effects of the initial conditions, set up a disk-halo fountain flow cycle, for converging solutions with increasing mesh refinement. We obtain the following results: (i) in a supernova driven ISM, high Reynolds number turbulence generates structures on all scales, (ii) the volume filling factor of the hot gas is substantially reduced due to the fountain flow, (iii) gas clouds are transient shock compressed layers, (iv) more than half of the gas mass resides in thermally unstable regimes, (v) O VI is distributed in patchy mixing layers, with the derived column densities being in agreement with FUSE and Copernicus observations, (vi) the electron density distribution up to distances of 8 kpc in the disk is consistent with pulsar dispersion measure observations, provided that the electron and ionization structure are not in equilibrium, (vii) the interstellar cooling function depends both on space and time (and not only on temperature and metallicity), (viii) the Local Bubble has been produced by 14-20 supernovae about 14 Myr ago, exploding in a moving group on its path through the local ISM, (ix) the nearest supernova explosion to Earth occurred 2.2 {×} 106 yr ago at a distance of {˜} 85 pc, in agreement with measurements of the radionuclide 60Fe found in the ferromanganese crust on the ocean floor.

  18. Conditions controlling commitment of differentiation in Bacillus megaterium.

    PubMed Central

    Freese, E B; Cooney, P; Freese, E

    1975-01-01

    The developmental stage at which cells of Bacillus megaterium are committed to continue differentiation, i.e., sporulation, depends on both the previous growth medium and the new medium to which the cells are transferred for the commitment test. The latest "stage of no return," after which cells continue differentiation, no matter how rich in nutrients the medium, is reached as soon as the forespore is completely surrounded by a double membrane. Images PMID:812086

  19. Development of an OP9 Derived Cell Line as a Robust Model to Rapidly Study Adipocyte Differentiation

    PubMed Central

    Lane, Jacqueline M.; Doyle, Jamie R.; Fortin, Jean-Philippe; Kopin, Alan S.; Ordovás, José M.

    2014-01-01

    One hallmark of obesity is adipocyte hypertrophy and hyperplasia. To gain novel insights into adipose biology and therapeutics, there is a pressing need for a robust, rapid, and informative cell model of adipocyte differentiation for potential RNAi and drug screens. Current models are prohibitive for drug and RNAi screens due to a slow differentiation time course and resistance to transfection. We asked if we could create a rapid, robust model of adipogenesis to potentially enable rapid functional and obesity therapeutic screens. We generated the clonal population OP9-K, which differentiates rapidly and reproducibly, and displays classic adipocyte morphology: rounded cell shape, lipid accumulation, and coalescence of lipids into a large droplet. We further validate the OP9-K cells as an adipocyte model system by microarray analysis of the differentiating transcriptome. OP9-K differentiates via known adipogenic pathways, involving the transcriptional activation and repression of common adipose markers Plin1, Gata2, C/Ebpα and C/Ebpβ and biological pathways, such as lipid metabolism, PPARγ signaling, and osteogenesis. We implemented a method to quantify lipid accumulation using automated microscopy and tested the ability of our model to detect alterations in lipid accumulation by reducing levels of the known master adipogenic regulator Pparγ. We further utilized our model to query the effects of a novel obesity therapeutic target, the transcription factor SPI1. We determine that reduction in levels of Spi1 leads to an increase in lipid accumulation. We demonstrate rapid, robust differentiation and efficient transfectability of the OP9-K cell model of adipogenesis. Together with our microscopy based lipid accumulation assay, adipogenesis assays can be achieved in just four days' time. The results of this study can contribute to the development of rapid screens with the potential to deepen our understanding of adipose biology and efficiently test obesity

  20. Maternal overnutrition enhances mRNA expression of adipogenic markers and collagen deposition in skeletal muscle of beef cattle fetuses.

    PubMed

    Duarte, M S; Gionbelli, M P; Paulino, P V R; Serão, N V L; Nascimento, C S; Botelho, M E; Martins, T S; Filho, S C V; Dodson, M V; Guimarães, S E F; Du, M

    2014-09-01

    Twenty-four pregnant Nellore cows were randomly assigned into 2 feeding level groups (control [CTL]; fed 1.0 times the maintenance requirement; n = 12; and overnourished [ON]; fed at 1.5 times the maintenance requirement; n = 12) to evaluate effects of maternal overnutrition on fetal skeletal muscle development. Cows were slaughtered at 135, 190, and 240 d of gestation and samples of fetal LM were collected for analysis of mRNA expression analysis and for histological evaluation of collagen content and number of muscle cells. There was no interaction between gestational period and maternal nutrition for the variables evaluated (P > 0.05). The mRNA expression of Cadherin-associated protein, β 1 (β-catenin) tended to be greater in fetuses from ON cows (P = 0.08), while myogenic differentiation 1 (MyoD; P = 0.56), myogenin (MyoG; P = 0.70), and the number of muscle cells (P = 0.90) were not affected by maternal overnutrition. Gestational period did not affect the mRNA expression of β-catenin (P = 0.60) and MyoG (P = 0.21). The mRNA expression of MyoD tended to increase with days of gestation (P = 0.06). The mRNA expression of zinc finger protein 423 (Zfp423; P < 0.0001), C/EBPα (P = 0.01), and PPARγ (P < 0.0001) were enhanced in ON fetuses. No effects of days of gestation were observed for mRNA expression of Zfp423 (P = 0.75) and C/EBPα (P = 0.48). The mRNA expression of PPARγ in fetuses at 190 d of gestation tended to be greater than those at 135 and 240 d of gestation (P = 0.06). The mRNA expression of transforming growth factor β (TGF-β; P < 0.0001), collagen type III, α I (COL3A1; P < 0.0001), and collagen content (P = 0.01) were increased in ON fetuses. Gestational period did not affect the mRNA expression of collagen type I, α I (COL1A1; P = 0.65). The mRNA expression of COL3A1 (P = 0.09) in fetuses at 190 d of gestation tended to be greater than fetuses at 135 and 240 d of gestation. The mRNA expression of TGF-β in fetuses at 190 d of gestation was

  1. Differentiated Staffing.

    ERIC Educational Resources Information Center

    Geisinger, Robert W.; And Others

    This report describes school operation changes in scheduling, curriculum, decisionmaking powers, and individualization of instruction that are concurrent with the adoption of differentiated staffing. The author defines differentiated staffing, explains where and at what levels it has been utilized, provides descriptions of results achieved, gives…

  2. Differential games.

    NASA Technical Reports Server (NTRS)

    Varaiya, P. P.

    1972-01-01

    General discussion of the theory of differential games with two players and zero sum. Games starting at a fixed initial state and ending at a fixed final time are analyzed. Strategies for the games are defined. The existence of saddle values and saddle points is considered. A stochastic version of a differential game is used to examine the synthesis problem.

  3. Cancer exosomes trigger mesenchymal stem cell differentiation into pro-angiogenic and pro-invasive myofibroblasts

    PubMed Central

    Gurney, Mark; Mason, Malcolm D.; Tabi, Zsuzsanna; Clayton, Aled

    2015-01-01

    Stromal fibroblasts become altered in response to solid cancers, to exhibit myofibroblastic characteristics, with disease promoting influence. Infiltrating mesenchymal stem cells (MSC) may contribute towards these changes, but the factors secreted by cancer cells that impact MSC differentiation are poorly understood. We investigated the role of nano-metre sized vesicles (exosomes), secreted by prostate cancer cells, on the differentiation of bone-marrow MSC (BM-MSC), and the subsequent functional consequences of such changes. Purified exosomes impaired classical adipogenic differentiation, skewing differentiation towards alpha-smooth muscle actin (αSMA) positive myofibroblastic cells. A single exosomes treatment generated myofibroblasts secreting high levels of VEGF-A, HGF and matrix regulating factors (MMP-1, −3 and −13). Differentiated MSC had pro-angiogenic functions and enhanced tumour proliferation and invasivity assessed in a 3D co-culture model. Differentiation was dependent on exosomal-TGFβ, but soluble TGFβ at matched dose could not generate the same phenotype. Exosomes present in the cancer cell secretome were the principal factors driving this phenotype. Prostate cancer exosomes dominantly dictate a programme of MSC differentiation generating myofibroblasts with functional properties consistent with disease promotion. PMID:25596732

  4. The effect of donor variation and senescence on endothelial differentiation of human mesenchymal stromal cells.

    PubMed

    Portalska, Karolina Janeczek; Groen, Nathalie; Krenning, Guido; Georgi, Nicole; Mentink, Anouk; Harmsen, Martin C; van Blitterswijk, Clemens; de Boer, Jan

    2013-11-01

    Application of autologous cells is considered for a broad range of regenerative therapies because it is not surrounded by the immunological and ethical issues of allo- or xenogenic cells. However, isolation, expansion, and application of autologous cells do suffer from variability in therapeutic efficacy due to donor to donor differences and due to prolonged culture. One important source of autologous cells is mesenchymal stromal cells (MSCs), which can differentiate toward endothelial-like cells, thus making them an ideal candidate as cell source for tissue vascularization. Here we screened MSCs from 20 donors for their endothelial differentiation capacity and correlated it with the gene expression profile of the whole genome in the undifferentiated state. Cells of all donors were able to form tubes on Matrigel and induced the expression of endothelial genes, although with quantitative differences. In addition, we analyzed the effect of prolonged in vitro expansion on the multipotency of human MSCs and found that endothelial differentiation is only mildly sensitive to expansion-induced loss of differentiation as compared to osteogenic and adipogenic differentiation. Our results show the robustness of the endothelial differentiation protocol and the gene expression data give insight in the differences in endothelial differentiation between donors.

  5. Rho/Rock signal transduction pathway is required for MSC tenogenic differentiation

    PubMed Central

    Maharam, Edward; Yaport, Miguel; Villanueva, Nathaniel L; Akinyibi, Takintope; Laudier, Damien; He, Zhiyong; Leong, Daniel J; Sun, Hui B

    2015-01-01

    Mesenchymal stem cell (MSC)-based treatments have shown promise for improving tendon healing and repair. MSCs have the potential to differentiate into multiple lineages in response to select chemical and physical stimuli, including into tenocytes. Cell elongation and cytoskeletal tension have been shown to be instrumental to the process of MSC differentiation. Previous studies have shown that inhibition of stress fiber formation leads MSCs to default toward an adipogenic lineage, which suggests that stress fibers are required for MSCs to sense the environmental factors that can induce differentiation into tenocytes. As the Rho/ROCK signal transduction pathway plays a critical role in both stress fiber formation and in cell sensation, we examined whether the activation of this pathway was required when inducing MSC tendon differentiation using rope-like silk scaffolds. To accomplish this, we employed a loss-of-function approach by knocking out ROCK, actin and myosin (two other components of the pathway) using the specific inhibitors Y-27632, Latrunculin A and blebbistatin, respectively. We demonstrated that independently disrupting the cytoskeleton and the Rho/ROCK pathway abolished the expression of tendon differentiation markers and led to a loss of spindle morphology. Together, these studies suggest that the tension that is generated by MSC elongation is essential for MSC teno-differentiation and that the Rho/ROCK pathway is a critical mediator of tendon differentiation on rope-like silk scaffolds. PMID:26509098

  6. Capsaicin Induces “Brite” Phenotype in Differentiating 3T3-L1 Preadipocytes

    PubMed Central

    Baboota, Ritesh K.; Singh, Dhirendra P.; Sarma, Siddhartha M.; Kaur, Jaspreet; Sandhir, Rajat; Boparai, Ravneet K.; Kondepudi, Kanthi K.; Bishnoi, Mahendra

    2014-01-01

    Objective Targeting the energy storing white adipose tissue (WAT) by pharmacological and dietary means in order to promote its conversion to energy expending “brite” cell type holds promise as an anti-obesity approach. Present study was designed to investigate/revisit the effect of capsaicin on adipogenic differentiation with special reference to induction of “brite” phenotype during differentiation of 3T3-L1 preadipocytes. Methods Multiple techniques such as Ca2+ influx assay, Oil Red-O staining, nutrigenomic analysis in preadipocytes and matured adipocytes have been employed to understand the effect of capsaicin at different doses. In addition to in-vitro experiments, in-vivo studies were carried out in high-fat diet (HFD) fed rats treated with resiniferatoxin (RTX) (a TRPV1 agonist) and in mice administered capsaicin. Results TRPV1 channels are expressed in preadipocytes but not in adipocytes. In preadipocytes, both capsaicin and RTX stimulate Ca2+ influx in dose-dependent manner. This stimulation may be prevented by capsazepine, a TRPV1 antagonist. At lower doses, capsaicin inhibits lipid accumulation and stimulates TRPV1 gene expression, while at higher doses it enhances accumulation of lipids and suppresses expression of its receptor. In doses of 0.1–100 µM, capsaicin promotes expression of major pro-adipogenic factor PPARγ and some of its downstream targets. In concentrations of 1 µM, capsaicin up-regulates anti-adipogenic genes. Low-dose capsaicin treatment of 3T3-L1 preadipocytes differentiating into adipocytes results in increased expression of brown fat cell marker genes. In white adipose of mice, capsaicin administration leads to increase in browning-specific genes. Global TRPV1 ablation (i.p. by RTX administration) leads to increase in locomotor activity with no change in body weight. Conclusion Our findings suggest the dual modulatory role of capsaicin in adipogenesis. Capsaicin inhibits adipogenesis in 3T3-L1 via TRPV1 activation and

  7. Isolating "Unknown" Bacteria in the Introductory Microbiology Laboratory: A New Selective Medium for Gram-Positives.

    ERIC Educational Resources Information Center

    McKillip, John L.; Drake, MaryAnne

    1999-01-01

    Describes the development, preparation, and use of a medium that can select against a wide variety of Gram-negative bacteria while still allowing growth and differentiation of a wide range of Gram-positives. (WRM)

  8. Differentiation of Human Adipose-Derived Stem Cells into Fat Involves Reactive Oxygen Species and Forkhead Box O1 Mediated Upregulation of Antioxidant Enzymes

    PubMed Central

    Higuchi, Masayoshi; Dusting, Gregory J.; Peshavariya, Hitesh; Jiang, Fan; Hsiao, Sarah Tzu-Feng; Chan, Elsa C.

    2013-01-01

    Both reactive oxygen species (ROS) and Forkhead box O (FOXO) family transcription factors are involved in the regulation of adipogenic differentiation of preadipocytes and stem cells. While FOXO has a pivotal role in maintaining cellular redox homeostasis, the interactions between ROS and FOXO during adipogenesis are not clear. Here we examined how ROS and FOXO regulate adipogenesis in human adipose-derived stem cells (hASC). The identity of isolated cells was confirmed by their surface marker expression pattern typical for human mesenchymal stem cells (positive for CD29, CD44, CD73, CD90, and CD105, negative for CD45 and CD31). Using a standard adipogenic cocktail consisting of insulin, dexamethasone, indomethacin, and 3-Isobutyl-1-methylanxthine (IDII), adipogenesis was induced in hASC, which was accompanied by ROS generation. Scavenging ROS production with N-acetyl-L-cysteine or EUK-8, a catalytic mimetic of superoxide dismutase (SOD) and catalase, inhibited IDII-induced adipogenesis. We then mimicked IDII-induced oxidative stress through a lentiviral overexpression of Nox4 and an exogenous application of hydrogen peroxide in hASC and both manipulations significantly enhanced adipogenesis without changing the adipogenic differentiation rate. These data suggest that ROS promoted lipid accumulation in hASC undergoing adipogenesis. Antioxidant enzymes, including SOD2, catalase, and glutathione peroxidase were upregulated by IDII during adipogenesis, and these effects were blunted by FOXO1 silencing, which also suppressed significantly IDII-induced adipogenesis. Our findings demonstrated a balance of ROS generation and endogenous antioxidants in cells undergoing adipogenesis. Approaches targeting ROS and/or FOXO1 in adipocytes may bring new strategies to prevent and treat obesity and metabolic syndrome. PMID:23025577

  9. Anti-diabetic and anti-adipogenic effects of a novel selective 11β-hydroxysteroid dehydrogenase type 1 inhibitor, 2-(3-benzoyl)-4-hydroxy-1,1-dioxo-2H-1,2-benzothiazine-2-yl-1-phenylethanone (KR-66344).

    PubMed

    Park, Ji Seon; Rhee, Sang Dal; Kang, Nam Sook; Jung, Won Hoon; Kim, Hee Youn; Kim, Jun Hyoung; Kang, Seung Kyu; Cheon, Hyae Gyeong; Ahn, Jin Hee; Kim, Ki Young

    2011-04-15

    The selective inhibitors of 11β-hydroxysteroid dehydrogenase type 1 (11β-HSD1) have considerable potential for treating type 2 diabetes mellitus and metabolic syndrome. In the present study, we investigated the anti-diabetic and anti-adipogenic effects of 2-(3-benzoyl)-4-hydroxy-1,1-dioxo-2H-1,2-benzothiazine-2-yl-1-phenylethanone (KR-66344), as a 11β-HSD1 inhibitor; we also investigated the underlying molecular mechanisms in the cortisone-induced 3T3-L1 adipogenesis model system and C57BL/6-Lep(ob/ob) mice. KR-66344 concentration-dependently inhibited 11β-HSD1 activity in human liver microsome, mouse C2C12 myotube and human SW982 cells. In the C57BL/6-Lep(ob/ob) mice study, the administration of KR-66344 (200mg/kg/d, orally for 5 days) improved the glucose intolerance as determined by the oral glucose tolerance test, in which the area under the curve (AUC) of the plasma glucose concentration was significantly reduced by 27% compared with the vehicle treated group. Further, KR-66344 suppressed adipocyte differentiation on cortisone-induced adipogenesis in 3T3-L1 cells is associated with the suppression of the cortisone-induced mRNA levels of FABP4, G3PD, PPARγ2 and Glut4, and 11β-HSD1 expression and activity. Our results additionally demonstrate evidence showing that KR-66344 improved glycemic control and inhibited adipogenesis via 11β-HSD1 enzyme activity. Taken together, these results may provide evidence of the therapeutic potential of KR-66344, as a 11β-HSD1 inhibitor, in obesity and type 2 diabetes patients with metabolic syndrome.

  10. Paclitaxel Impairs Adipose Stem Cell Proliferation and Differentiation

    PubMed Central

    Choron, Rachel L.; Chang, Shaohua; Khan, Sophia; Villalobos, Miguel A.; Zhang, Ping; Carpenter, Jeffrey P.; Tulenko, Thomas N.; Liu, Yuan

    2015-01-01

    BACKGROUND Cancer patients with chemotherapy-induced immunosuppression have poor surgical site wound healing. Prior literature supports the use of human adipose-derived stem cell (hASC) lipoinjection to improve wound healing. It has been established multipotent hASCs facilitate neovascularization, accelerated epithelialization, and wound closure in animal models. While hASC wound therapy may benefit surgical cancer patients, the chemotherapeutic effects on hASCs are unknown. We hypothesized Paclitaxel, a chemotherapeutic agent, impairs hASC growth, multipotency, and induces apoptosis. METHODS hASCs were isolated and harvested from consented, chemotherapy and radiation naïve patients. Growth curves, MTT, and EdU assays measured cytotoxicity and proliferation. Oil-Red-O stain, Alazarin-Red stain, Matrigel tube-formation assay, and qPCR analyzed hASC differentiation. Annexin V assay measured apoptosis. Immunostaining and Western blot determined TNF-α expression. RESULTS hASCs were selectively more sensitive to Paclitaxel (0.01μM–30μM) than fibroblasts (p<0.05). After 12 days, Paclitaxel caused hASC growth arrest whereas control hASCs proliferated (p=0.006). Paclitaxel caused an 80.6% reduction in new DNA synthesis (p<0.001). Paclitaxel severely inhibited endothelial differentiation and capillary-like tube formation. Differentiation markers LPL (adipogenic), alkaline phosphatase (osteogenic), CD31 and vWF (endothelial) were significantly decreased (all: p<0.05) confirming Paclitaxel impaired differentiation. Paclitaxel was also found to induce apoptosis and TNF-α was up-regulated in Paclitaxel-treated hASCs (p<0.001). CONCLUSION Paclitaxel is more cytotoxic to hASCs than fibroblasts. Paclitaxel inhibits hASC proliferation, differentiation, and induces apoptosis, possibly through the TNF-α pathway. Paclitaxel’s severe inhibition of endothelial differentiation indicates neovascularization disruption, possibly causing poor wound healing in cancer patients

  11. Medium-depth chemical peels.

    PubMed

    Monheit, G D

    2001-07-01

    The combination medium-depth chemical peel (Jessner's solution +35% TCA) has been accepted as a safe, reliable, and effective method for the treatment of moderate photoaging skin. This article discusses the procedure in detail, including postoperative considerations. PMID:11599398

  12. An improved holographic recording medium

    NASA Technical Reports Server (NTRS)

    Gange, R. A.

    1973-01-01

    Solid, linear chain hydrocarbons with molecular weight ranging from about 300 to 2000 can serve as long-lived recording medium in optical memory system. Suitable recording hydrocarbons include microcrystalline waxes and low molecular weight polymers or ethylene.

  13. Ethanol extract of lotus (Nelumbo nucifera) root exhibits an anti-adipogenic effect in human pre-adipocytes and anti-obesity and anti-oxidant effects in rats fed a high-fat diet.

    PubMed

    You, Jeong Soon; Lee, Yun Ju; Kim, Kyoung Soo; Kim, Sung Hoon; Chang, Kyung Ja

    2014-03-01

    Lotus (Nelumbo Nucifera) root, a well-known medicinal plant in Asia, is reported to have various therapeutic benefits, including anti-diabetes, anti-hypertension, and anti-hyperlipidaemia. We hypothesized that the ethanol extract of lotus root (ELR) would exhibit an anti-adipogenic effect in human pre-adipocytes as well as anti-obesity and anti-oxidant effects in rats fed a high-fat diet. Treatment with ELR in human pre-adipocytes resulted in inhibition of lipid accumulation and attenuated expression of adipogenic transcription factors such as peroxisome proliferator-activated receptor gamma and adipocyte marker genes, such as glucose transporter 4 and leptin. Administration of ELR resulted in a significant decrease in relative weights of adipose tissues in rats fed a high-fat diet. Consumption of a high-fat diet resulted in an increase in serum total cholesterol (TC) and triglyceride (TG) levels; however, administration of ELR resulted in a decrease in the levels of TC and TG. Administration of ELR resulted in a decrease in the level of serum leptin and insulin. Administration of ELR in rats fed a high-fat diet resulted in a decrease in hepatic thiobarbituric acid reactive substance content, elevated by a high-fat diet and an increase in superoxide dismutase activity and hepatic glutathione content. These results suggest that lotus root exerts anti-oxidant and anti-obesity effects and could be used as a functional and nutraceutical ingredient in combatting obesity-related diseases.

  14. DIFFERENTIAL ANALYZER

    DOEpatents

    Sorensen, E.G.; Gordon, C.M.

    1959-02-10

    Improvements in analog eomputing machines of the class capable of evaluating differential equations, commonly termed differential analyzers, are described. In general form, the analyzer embodies a plurality of basic computer mechanisms for performing integration, multiplication, and addition, and means for directing the result of any one operation to another computer mechanism performing a further operation. In the device, numerical quantities are represented by the rotation of shafts, or the electrical equivalent of shafts.

  15. Sexual differentiation.

    PubMed

    Sinisi, A A; Pasquali, D; Notaro, A; Bellastella, A

    2003-01-01

    In humans, like as in other mammals, the gonads, the internal genital ducts, and the external genital structures all develop from bipotential embryologic tissues. Male or female phenotype develops through a cascade of processes which initiate with sex determination and follow with sex differentiation. The karyotype (46, XY or 46, XX) of the embryo (genetic sex) determines whether primordial gonad differentiates into a testis or an ovary, respectively (gonadal differentiation). A Y-related gene, SRY, acts as a switch signal for testis differentiation. Testis development process involves several steps controlled by other non-OY-linked genes, such as Wilms tumor gene 1 (WT1), EMX2, LIM1, steroidogenic factor 1(SF-1), SRY box-related gene 9 (SOX9). Since other genes, such as Wnt-4 and DAX-1, are necessary for the initiation of female pathway in sex determination, female development cannot be considered a default process. Hormonal production of differentiated gonads is relevant for differentiation of the internal and external genitalia during fetal life, and for the development of secondary sex characteristics at puberty. Antimullerian hormone (AMH) secreted by Sertoli cells inhibits the development of female internal genitalia (tube, uterus, upper part of vagina); testosterone secreted by Leydig cells induces stabilization of wolffian ducts and development of internal male genitalia. Differentiation of external male genitalia requires the transformation of testosterone to dihydrotestosterone by 5alpha reductase type 2 expressed in genital skin and urogenital sinus. The effects of androgens occur in presence of functional androgen receptor (AR) protein. Mutations of genes coding for steroidogenic enzymes, AMH, AMH receptor, AR and 5alpha reductase are all associated with impairment of sex differentiation and result in genital ambiguity. PMID:12834017

  16. The Role of Scleraxis in Fate Determination of Mesenchymal Stem Cells for Tenocyte Differentiation

    PubMed Central

    Li, Yonghui; Ramcharan, Melissa; Zhou, Zuping; Leong, Daniel J.; Akinbiyi, Takintope; Majeska, Robert J.; Sun, Hui B.

    2015-01-01

    Mesenchymal stem cells (MSCs) are pluripotent cells that primarily differentiate into osteocytes, chondrocytes, and adipocytes. Recent studies indicate that MSCs can also be induced to generate tenocyte-like cells; moreover, MSCs have been suggested to have great therapeutic potential for tendon pathologies. Yet the precise molecular cascades governing tenogenic differentiation of MSCs remain unclear. We demonstrate scleraxis, a transcription factor critically involved in embryonic tendon development and formation, plays a pivotal role in the fate determination of MSC towards tenocyte differentiation. Using murine C3H10T1/2 pluripotent stem cells as a model system, we show scleraxis is extensively expressed in the early phase of bone morphogenetic protein (BMP)-12-triggered tenocytic differentiation. Once induced, scleraxis directly transactivates tendon lineage-related genes such as tenomodulin and suppresses osteogenic, chondrogenic, and adipogenic capabilities, thus committing C3H10T1/2 cells to differentiate into the specific tenocyte-like lineage, while eliminating plasticity for other lineages. We also reveal that mechanical loading-mediated tenocytic differentiation follows a similar pathway and that BMP-12 and cyclic uniaxial strain act in an additive fashion to augment the maximal response by activating signal transducer Smad8. These results provide critical insights into the determination of multipotent stem cells to the tenocyte lineage induced by both chemical and physical signals. PMID:26289033

  17. Suppression of ornithine decarboxylase promotes osteogenic differentiation of human bone marrow-derived mesenchymal stem cells.

    PubMed

    Tsai, Yo-Hsian; Lin, Kuan-Lian; Huang, Yuan-Pin; Hsu, Yi-Chiang; Chen, Chung-Hwan; Chen, Yuhsin; Sie, Min-Hua; Wang, Gwo-Jaw; Lee, Mon-Juan

    2015-07-22

    Ornithine decarboxylase (ODC) is the rate-limiting enzyme for polyamine biosynthesis. Suppression of ODC by its irreversible inhibitor, α-difluoromethylornithine (DFMO), or by RNA interference through siRNA, enhanced osteogenic gene expression and alkaline phosphatase activity, and accelerated matrix mineralization of human bone marrow-derived mesenchymal stem cells (hBMSCs). Besides, adipogenic gene expression and lipid accumulation was attenuated, indicating that the enhanced osteogenesis was accompanied by down-regulation of adipogenesis when ODC was suppressed. A decrease in the intracellular polyamine content of hBMSCs during osteogenic induction was observed, suggesting that the level of endogenous polyamines is regulated during differentiation of hBMSCs. This study elucidates the role of polyamine metabolism in the lineage commitment of stem cells and provides a potential new indication for DFMO as bone-stimulating drug. PMID:26140984

  18. N-Acetylcysteine Reduces Markers of Differentiation in 3T3-L1 Adipocytes

    PubMed Central

    Calzadilla, Pablo; Sapochnik, Daiana; Cosentino, Soledad; Diz, Virginia; Dicelio, Lelia; Calvo, Juan Carlos; Guerra, Liliana N.

    2011-01-01

    Oxidative stress plays a critical role in the pathogenesis of diabetes, hypertension and atherosclerosis. Some authors reported that fat accumulation correlates to systemic oxidative stress in humans and mice, but the relationship of lipid production and oxidative metabolism is still unclear. In our laboratory we used 3T3-L1 preadipocytes, which are able to differentiate into mature adipocytes and accumulate lipids, as obesity model. We showed that intracellular reactive oxygen species (ROS) and antioxidant enzymes superoxide dismutase (SOD) and glutathione peroxidase (GPx) activities increased in parallel with fat accumulation. Meanwhile N-acetylcysteine (NAC), a well known antioxidant and Glutathione (GSH) precursor, inhibited ROS levels as well as fat accumulation in a concentration-dependent manner. NAC also inhibited both adipogenic transcription factors CCAAT/enhancer binding protein beta (C/EBP β) and peroxisomal proliferator activated receptor gamma (PPAR γ) expression; we suggested that intracellular GSH content could be responsible for these effects. PMID:22072928

  19. Differentiation of Pre-Adipocytes in Modelled Microgravity

    NASA Astrophysics Data System (ADS)

    Coinu, R.; Postiglione, I.; Meloni, M. A.; Galleri, G.; Pippia, P.; Palumbo, G.

    2008-06-01

    It has been demonstrated that microgravity affects biological and biochemical functions of cells including: morphology, cytoskeleton and embryogenesis [1]; proliferation, reduction of DNA, protein synthesis and glucose transport [2]; signalling, reduction of EGF-dependant c-fos and c-jun expression [3]; gene expression, reduction of IL2 expression and release by activated T-cells [4]. Moreover it has be found that peroxisome proliferators activated receptor γ (PPARγ2), which is known to be important for adipocyte differentiation, adipsin, leptin, and glucose transporter-4, are highly expressed in response to modelled microgravity [5]. These findings prompted us to investigate the effects of microgravity on cellular differentiation rate using a well characterized model. Such model consists in murine pre-adipocyte cells (3T3-L1) properly stimulated with insulin, dexamethazone and isobuthylmethyl-xantine (DMI protocol). The adipogenic program is completed within a short time. The entire process requires coordinated and temporarily beated molecular events. Early events. Growth arrest at confluence; Clonal expansion (this process involves synchronous entry of cells into S phase of the cell cycle, leading to one or two rounds of mitosis); Early expression of C/EBPβ and C/EBPδ. Late events. Expression of PPARγ and C/EBPα Assumption of rounded morphology and accumulation of lipid droplets.

  20. Mir193b-365 is essential for brown fat differentiation.

    PubMed

    Sun, Lei; Xie, Huangming; Mori, Marcelo A; Alexander, Ryan; Yuan, Bingbing; Hattangadi, Shilpa M; Liu, Qingqing; Kahn, C Ronald; Lodish, Harvey F

    2011-07-10

    Mammals have two principal types of fat. White adipose tissue primarily serves to store extra energy as triglycerides, whereas brown adipose tissue is specialized to burn lipids for heat generation and energy expenditure as a defence against cold and obesity. Recent studies have demonstrated that brown adipocytes arise in vivo from a Myf5-positive, myoblastic progenitor by the action of Prdm16 (PR domain containing 16). Here, we identified a brown-fat-enriched miRNA cluster, MiR-193b-365, as a key regulator of brown fat development. Blocking miR-193b and/or miR-365 in primary brown preadipocytes markedly impaired brown adipocyte adipogenesis by enhancing Runx1t1 (runt-related transcription factor 1; translocated to, 1) expression, whereas myogenic markers were significantly induced. Forced expression of Mir193b and/or Mir365 in C2C12 myoblasts blocked the entire programme of myogenesis, and, in adipogenic conditions, miR-193b induced myoblasts to differentiate into brown adipocytes. Mir193b-365 was upregulated by Prdm16 partially through Pparα. Our results demonstrate that Mir193b-365 serves as an essential regulator for brown fat differentiation, in part by repressing myogenesis.

  1. Differentiation and characterization of human facial subcutaneous adipocytes.

    PubMed

    Chon, Su-Hyoun; Pappas, Apostolos

    2015-01-01

    Aging is associated with the loss of facial subcutaneous fat and with increased abdominal subcutaneous fat. Site specific differences in adipocyte phenotype and/or gene expression may play a role in these age-related changes. In this study, we isolated and characterized human facial preadipocytes and investigated distinct metabolic properties such as a differentiation pattern in relation to abdominal preadipocytes. Subcutaneous preadipocytes were isolated from human facial and abdominal skin and cultured in the presence of differentiation factors including rosiglitazone, a known peroxisome proliferator-activated receptor gamma (PPAR-γ) agonist, isobutyl-methyl xanthine (IBMX) and insulin. Differentiation was characterized microscopically and by quantitative real-time PCR. Unexpected superior adipogenic capacity of facial preadipocytes was observed; more facial preadipocytes differentiated in response to rosiglitazone than abdominal preadipocytes and facial preadipocytes retained their ability to differentiate through passage 11 compared with passage 5 for abdominal preadipocytes. Experiments confirmed a reduced lipolysis response in facial versus abdominal adipocytes after exposure to isoproterenol, which was consistent with the reduced β2-adrenergic receptor expression by 60% in the facial cells. The expression of other lipid metabolic gene markers was similar in both facial and abdominal adipocytes with the exception of β3-adrenergic receptor which was only found in abdominal adipose tissue. Gene profiling, by microarray analysis, identified that several HOX genes are robustly reduced in facial adipocytes compared to abdominal adipocytes, suggesting different characteristics between the 2 fat depots. These differences may have implications for development of treatments for facial fat loss during aging.

  2. Differentiation and characterization of human facial subcutaneous adipocytes

    PubMed Central

    Chon, Su-Hyoun; Pappas, Apostolos

    2014-01-01

    Aging is associated with the loss of facial subcutaneous fat and with increased abdominal subcutaneous fat. Site specific differences in adipocyte phenotype and/or gene expression may play a role in these age-related changes. In this study, we isolated and characterized human facial preadipocytes and investigated distinct metabolic properties such as a differentiation pattern in relation to abdominal preadipocytes. Subcutaneous preadipocytes were isolated from human facial and abdominal skin and cultured in the presence of differentiation factors including rosiglitazone, a known peroxisome proliferator-activated receptor gamma (PPAR-γ) agonist, isobutyl-methyl xanthine (IBMX) and insulin. Differentiation was characterized microscopically and by quantitative real-time PCR. Unexpected superior adipogenic capacity of facial preadipocytes was observed; more facial preadipocytes differentiated in response to rosiglitazone than abdominal preadipocytes and facial preadipocytes retained their ability to differentiate through passage 11 compared with passage 5 for abdominal preadipocytes. Experiments confirmed a reduced lipolysis response in facial versus abdominal adipocytes after exposure to isoproterenol, which was consistent with the reduced β2-adrenergic receptor expression by 60% in the facial cells. The expression of other lipid metabolic gene markers was similar in both facial and abdominal adipocytes with the exception of β3-adrenergic receptor which was only found in abdominal adipose tissue. Gene profiling, by microarray analysis, identified that several HOX genes are robustly reduced in facial adipocytes compared to abdominal adipocytes, suggesting different characteristics between the 2 fat depots. These differences may have implications for development of treatments for facial fat loss during aging. PMID:26167398

  3. Bone-marrow-derived mesenchymal stem cells as a target for cytomegalovirus infection: Implications for hematopoiesis, self-renewal and differentiation potential

    SciTech Connect

    Smirnov, Sergey V.; Harbacheuski, Ryhor; Lewis-Antes, Anita; Zhu Hua; Rameshwar, Pranela; Kotenko, Sergei V. . E-mail: kotenkse@umdnj.edu

    2007-03-30

    Mesenchymal stem cells (MSCs) in bone marrow (BM) regulate the differentiation and proliferation of adjacent hematopoietic precursor cells and contribute to the regeneration of mesenchymal tissues, including bone, cartilage, fat and connective tissue. BM is an important site for the pathogenesis of human cytomegalovirus (HCMV) where the virus establishes latency in hematopoietic progenitors and can transmit after reactivation to neighboring cells. Here we demonstrate that BM-MSCs are permissive to productive HCMV infection, and that HCMV alters the function of MSCs: (i) by changing the repertoire of cell surface molecules in BM-MSCs, HCMV modifies the pattern of interaction between BM-MSCs and hematopoietic cells; (ii) HCMV infection of BM-MSCs undergoing adipogenic or osteogenic differentiation impaired the process of differentiation. Our results suggest that by altering BM-MSC biology, HCMV may contribute to the development of various diseases.

  4. Bacterial differentiation.

    PubMed

    Shapiro, L; Agabian-Keshishian, N; Bendis, I

    1971-09-01

    The foregoing studies are intended to define a differentiation process and to permit genetic access to the mechanisms that control this process. In order to elucidate the basic mechanisms whereby a cell dictates its own defined morphogenic changes, we have found it helpful to study an organism that can be manipulated both biochemically and genetically. We have attempted to develop the studies initiated by Poindexter,Stove and Stanier, and Schmidt and Stanier (16, 17, 20) with the Caulobacter genus so that these bacteria can serve as a model system for prokaryotic differentiation. The Caulobacter life cycle, defined in synchronously growing cultures, includes a sequential series of morphological changes that occur at specific times in the cycle and at specific locations in the cell. Six distinct cellular characteristics, which are peculiar to these bacteria, have been defined and include (i) the synthesis of a polar organelle which may be membranous (21-23), (ii) a satellite DNA in the stalked cell (26), (iii) pili to which RNA bacteriophage specifically adsorb (16, 33), (iv) a single polar flagellum(17), (v) a lipopolysaccharide phage receptor site (27), and (vi) new cell wall material at the flagellated pole of the cell giving rise to a stalk (19, 20). Cell division, essential for the viability of the organism, is dependent on the irreversible differentiation of a flagellated swarmer cell to a mature stalked cell. The specific features of the Caulobacter system which make it a system of choice for studies of the control of sequential events resulting in cellular differentiation can be summarized as follows. 1) Cell populations can be synchronized, and homogeneous populations at each stage in the differentiation cycle can thus be obtained. 2) A specific technique has been developed whereby the progress of the differentiation cycle can be accurately measured by adsorption of labeled RNA phage or penetration of labeled phage DNA into specific cell forms. This

  5. Properties of the nuclear medium.

    PubMed

    Baldo, M; Burgio, G F

    2012-02-01

    We review our knowledge on the properties of the nuclear medium that have been studied, over many years, on the basis of many-body theory, laboratory experiments and astrophysical observations. Throughout the presentation particular emphasis is placed on the possible relationship and links between the nuclear medium and the structure of nuclei, including the limitations of such an approach. First we consider the realm of phenomenological laboratory data and astrophysical observations and the hints they can give on the characteristics that the nuclear medium should possess. The analysis is based on phenomenological models, that however have a strong basis on physical intuition and an impressive success. More microscopic models are also considered, and it is shown that they are able to give invaluable information on the nuclear medium, in particular on its equation of state. The interplay between laboratory experiments and astrophysical observations is particularly stressed, and it is shown how their complementarity enormously enriches our insights into the structure of the nuclear medium. We then introduce the nucleon-nucleon interaction and the microscopic many-body theory of nuclear matter, with a critical discussion about the different approaches and their results. The Landau-Fermi liquid theory is introduced and briefly discussed, and it is shown how fruitful it can be in discussing the macroscopic and low-energy properties of the nuclear medium. As an illustrative example, we discuss neutron matter at very low density, and it is shown how it can be treated within the many-body theory. The general bulk properties of the nuclear medium are reviewed to indicate at which stage of our knowledge we stand, taking into account the most recent developments both in theory and experiments. A section is dedicated to the pairing problem. The connection with nuclear structure is then discussed, on the basis of the energy density functional method. The possibility of linking

  6. Properties of the nuclear medium

    NASA Astrophysics Data System (ADS)

    Baldo, M.; Burgio, G. F.

    2012-02-01

    We review our knowledge on the properties of the nuclear medium that have been studied, over many years, on the basis of many-body theory, laboratory experiments and astrophysical observations. Throughout the presentation particular emphasis is placed on the possible relationship and links between the nuclear medium and the structure of nuclei, including the limitations of such an approach. First we consider the realm of phenomenological laboratory data and astrophysical observations and the hints they can give on the characteristics that the nuclear medium should possess. The analysis is based on phenomenological models, that however have a strong basis on physical intuition and an impressive success. More microscopic models are also considered, and it is shown that they are able to give invaluable information on the nuclear medium, in particular on its equation of state. The interplay between laboratory experiments and astrophysical observations is particularly stressed, and it is shown how their complementarity enormously enriches our insights into the structure of the nuclear medium. We then introduce the nucleon-nucleon interaction and the microscopic many-body theory of nuclear matter, with a critical discussion about the different approaches and their results. The Landau-Fermi liquid theory is introduced and briefly discussed, and it is shown how fruitful it can be in discussing the macroscopic and low-energy properties of the nuclear medium. As an illustrative example, we discuss neutron matter at very low density, and it is shown how it can be treated within the many-body theory. The general bulk properties of the nuclear medium are reviewed to indicate at which stage of our knowledge we stand, taking into account the most recent developments both in theory and experiments. A section is dedicated to the pairing problem. The connection with nuclear structure is then discussed, on the basis of the energy density functional method. The possibility of linking

  7. An alternative bacteriological medium for the isolation of Aeromonas spp.

    USGS Publications Warehouse

    Jenkins, J.A.; Taylor, P.W.

    1995-01-01

    Two solid bacteriologic media were compared for cultivating Aeromonas spp. from piscine sources: the Rimler-Shotts (RS) medium and a starch-glutamate-ampicillin-penicillin-based medium (SGAP-10C) used for the recovery of Aeromonas spp. from water samples. The selective and differential capacities of the media were assessed March through October 1992 by recovery rate and phenotype of 99 isolates representing 15 genera of bacteria. Recovery frequency of Aeromonas spp. (n = 62) was similar at 97% on RS and 95% on SGAP-10C. The SGAP-10C medium proved to be more specific than RS toward Aeromonas species (P ≤ 0.005). Use of SGAP-10C at 24 C for 48 hr offers a better choice for the laboratory recovery of Aeromonas spp. from clinical fish specimens.

  8. Effects of arachidonic acid on the concentration of hydroxyeicosatetraenoic acids in culture media of mesenchymal stromal cells differentiating into adipocytes or osteoblasts.

    PubMed

    Casado-Díaz, Antonio; Ferreiro-Vera, Carlos; Priego-Capote, Feliciano; Dorado, Gabriel; Luque-de-Castro, María Dolores; Quesada-Gómez, José Manuel

    2014-01-01

    Metabolites derived from the polyunsaturated fatty acids (PUFA) may modulate the mesenchymal stromal cell (MSC) differentiation. Such cells can differentiate into different cellular types, including adipocytes and osteoblasts. Aging favors the bone marrow MSC differentiation toward the former, causing a loss of bone density associated with pathologies like osteoporosis. The omega-6 arachidonic acid (AA) favors MSC adipogenesis to a greater extent than omega-3 eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA). In this work, we study the joint action of both PUFA. Thus, not induced and induced to adipocyte or osteoblast MSC were treated with 20 μM of each PUFA (either AA, AA + DHA or AA + EPA). The expression of osteogenic and adipogenic molecular markers, the alox15b lipoxygenase gene expression and the 5-, 8-, 11-, 12- and 15-hydroxyeicosatetraenoic acids (HETE) derived from the AA metabolism in the culture media were determined. The results show that the adipogenesis induction of AA is not suppressed by the joint presence of EPA and DHA. In fact, both increased the adipogenic effect of AA on MSC differentiated into osteoblasts. The different HETE concentrations increased in cultures supplemented with AA, albeit such concentrations were lower in the cultures induced to differentiate, mainly at day 21 after the induction. Furthermore, the reduction in the HETE concentration was correlated with a higher expression of the alox15b gene. These results highlight the PUFA metabolism differences between uninduced and induced MSC to differentiate into adipocytes and osteoblasts, besides the relevant role of the lipoxygenase gene expression in adipogenesis induction.

  9. Low intensity pulsed ultrasound (LIPUS) influences the multilineage differentiation of mesenchymal stem and progenitor cell lines through ROCK-Cot/Tpl2-MEK-ERK signaling pathway.

    PubMed

    Kusuyama, Joji; Bandow, Kenjiro; Shamoto, Mitsuo; Kakimoto, Kyoko; Ohnishi, Tomokazu; Matsuguchi, Tetsuya

    2014-04-11

    Mesenchymal stem cells (MSCs) are pluripotent cells that can differentiate into multilineage cell types, including adipocytes and osteoblasts. Mechanical stimulus is one of the crucial factors in regulating MSC differentiation. However, it remains unknown how mechanical stimulus affects the balance between adipogenesis and osteogenesis. Low intensity pulsed ultrasound (LIPUS) therapy is a clinical application of mechanical stimulus and facilitates bone fracture healing. Here, we applied LIPUS to adipogenic progenitor cell and MSC lines to analyze how multilineage cell differentiation was affected. We found that LIPUS suppressed adipogenic differentiation of both cell types, represented by impaired lipid droplet appearance and decreased gene expression of peroxisome proliferator-activated receptor γ2 (Pparg2) and fatty acid-binding protein 4 (Fabp4). LIPUS also down-regulated the phosphorylation level of peroxisome proliferator-activated receptor γ2 protein, inhibiting its transcriptional activity. In contrast, LIPUS promoted osteogenic differentiation of the MSC line, characterized by increased cell calcification as well as inductions of runt-related transcription factor 2 (Runx2) and Osteocalcin mRNAs. LIPUS induced phosphorylation of cancer Osaka thyroid oncogene/tumor progression locus 2 (Cot/Tpl2) kinase, which was essential for the phosphorylation of mitogen-activated kinase kinase 1 (MEK1) and p44/p42 extracellular signal-regulated kinases (ERKs). Notably, effects of LIPUS on both adipogenesis and osteogenesis were prevented by a Cot/Tpl2-specific inhibitor. Furthermore, effects of LIPUS on MSC differentiation as well as Cot/Tpl2 phosphorylation were attenuated by the inhibition of Rho-associated kinase. Taken together, these results indicate that mechanical stimulus with LIPUS suppresses adipogenesis and promotes osteogenesis of MSCs through Rho-associated kinase-Cot/Tpl2-MEK-ERK signaling pathway. PMID:24550383

  10. Potential Effect of CD271 on Human Mesenchymal Stromal Cell Proliferation and Differentiation

    PubMed Central

    Calabrese, Giovanna; Giuffrida, Raffaella; Lo Furno, Debora; Parrinello, Nunziatina Laura; Forte, Stefano; Gulino, Rosario; Colarossi, Cristina; Schinocca, Luciana Rita; Giuffrida, Rosario; Cardile, Venera; Memeo, Lorenzo

    2015-01-01

    The Low-Affinity Nerve Growth Factor Receptor (LNGFR), also known as CD271, is a member of the tumor necrosis factor receptor superfamily. The CD271 cell surface marker defines a subset of multipotential mesenchymal stromal cells and may be used to isolate and enrich cells derived from bone marrow aspirate. In this study, we compare the proliferative and differentiation potentials of CD271+ and CD271− mesenchymal stromal cells. Mesenchymal stromal cells were isolated from bone marrow aspirate and adipose tissue by plastic adherence and positive selection. The proliferation and differentiation potentials of CD271+ and CD271− mesenchymal stromal cells were assessed by inducing osteogenic, adipogenic and chondrogenic in vitro differentiation. Compared to CD271+, CD271− mesenchymal stromal cells showed a lower proliferation rate and a decreased ability to give rise to osteocytes, adipocytes and chondrocytes. Furthermore, we observed that CD271+ mesenchymal stromal cells isolated from adipose tissue displayed a higher efficiency of proliferation and trilineage differentiation compared to CD271+ mesenchymal stromal cells isolated from bone marrow samples, although the CD271 expression levels were comparable. In conclusion, these data show that both the presence of CD271 antigen and the source of mesenchymal stromal cells represent important factors in determining the ability of the cells to proliferate and differentiate. PMID:26184166

  11. Fucoxanthin and its metabolite, fucoxanthinol, suppress adipocyte differentiation in 3T3-L1 cells.

    PubMed

    Maeda, Hayato; Hosokawa, Masashi; Sashima, Tokutake; Takahashi, Nobuyuki; Kawada, Teruo; Miyashita, Kazuo

    2006-07-01

    Fucoxanthin is a major carotenoid found in edible seaweed such as Undaria pinnatifida and Hijikia fusiformis. We investigated the suppressive effects of fucoxanthin and its metabolite, fucoxanthinol, on the differentiation of 3T3-L1 preadipocytes to adipocytes. Fucoxanthin inhibited intercellular lipid accumulation during adipocyte differentiation of 3T3-L1 cells. Furthermore, fucoxanthin was converted to fucoxanthinol in 3T3-L1 cells. Fucoxanthinol also exhibited suppressive effects on lipid accumulation and decreased glycerol-3-phosphate dehydrogenase activity, an indicator of adipocyte differentiation. The suppressive effect of fucoxanthinol was stronger than that of fucoxanthin. In addition, in 3T3-L1 cells treated with fucoxanthin and fucoxanthinol, peroxisome proliferator-activated receptor gamma (PPARgamma), which regulates adipogenic gene expression, was down-regulated in a dose-dependent manner. These results suggest that fucoxanthin and fucoxanthinol inhibit the adipocyte differentiation of 3T3-L1 cells through down-regulation of PPARgamma. Fucoxanthinol had stronger suppressive effects than fucoxanthin on adipocyte differentiation in 3T3-L1 cells. PMID:16786166

  12. Induction of Adipocyte Differentiation by Polybrominated Diphenyl Ethers (PBDEs) in 3T3-L1 Cells

    PubMed Central

    Tung, Emily W. Y.; Boudreau, Adèle; Wade, Michael G.; Atlas, Ella

    2014-01-01

    Polybrominated diphenyl ethers (PBDEs) are a class of brominated flame retardants that were extensively used in commercial products. PBDEs are ubiquitous environmental contaminants that are both lipophilic and bioaccumulative. Effects of PBDEs on adipogenesis were studied in the 3T3-L1 preadipocyte cell model in the presence and absence of a known adipogenic agent, dexamethasone (DEX). A PBDE mixture designed to mimic body burden of North Americans was tested, in addition to the technical mixture DE-71 and the individual congener BDE-47. The mixture, DE-71, and BDE-47 all induced adipocyte differentiation as assessed by markers for terminal differentiation [fatty acid binding protein 4 (aP2) and perilipin] and lipid accumulation. Characterization of the differentiation process in response to PBDEs indicated that adipogenesis induced by a minimally effective dose of DEX was enhanced by these PBDEs. Moreover, C/EBPα, PPARγ, and LXRα were induced late in the differentiation process. Taken together, these data indicate that adipocyte differentiation is induced by PBDEs; they act in the absence of glucocorticoid and enhance glucocorticoid-mediated adipogenesis. PMID:24722056

  13. Potential Effect of CD271 on Human Mesenchymal Stromal Cell Proliferation and Differentiation.

    PubMed

    Calabrese, Giovanna; Giuffrida, Raffaella; Lo Furno, Debora; Parrinello, Nunziatina Laura; Forte, Stefano; Gulino, Rosario; Colarossi, Cristina; Schinocca, Luciana Rita; Giuffrida, Rosario; Cardile, Venera; Memeo, Lorenzo

    2015-01-01

    The Low-Affinity Nerve Growth Factor Receptor (LNGFR), also known as CD271, is a member of the tumor necrosis factor receptor superfamily. The CD271 cell surface marker defines a subset of multipotential mesenchymal stromal cells and may be used to isolate and enrich cells derived from bone marrow aspirate. In this study, we compare the proliferative and differentiation potentials of CD271+ and CD271- mesenchymal stromal cells. Mesenchymal stromal cells were isolated from bone marrow aspirate and adipose tissue by plastic adherence and positive selection. The proliferation and differentiation potentials of CD271+ and CD271- mesenchymal stromal cells were assessed by inducing osteogenic, adipogenic and chondrogenic in vitro differentiation. Compared to CD271+, CD271- mesenchymal stromal cells showed a lower proliferation rate and a decreased ability to give rise to osteocytes, adipocytes and chondrocytes. Furthermore, we observed that CD271+ mesenchymal stromal cells isolated from adipose tissue displayed a higher efficiency of proliferation and trilineage differentiation compared to CD271+ mesenchymal stromal cells isolated from bone marrow samples, although the CD271 expression levels were comparable. In conclusion, these data show that both the presence of CD271 antigen and the source of mesenchymal stromal cells represent important factors in determining the ability of the cells to proliferate and differentiate. PMID:26184166

  14. Differentiation within autologous fibrin scaffolds of porcine dermal cells with the mesenchymal stem cell phenotype.

    PubMed

    de la Puente, Pilar; Ludeña, Dolores; López, Marta; Ramos, Jennifer; Iglesias, Javier

    2013-02-01

    Porcine mesenchymal stem cells (pMSCs) are an attractive source of cells for tissue engineering because their properties are similar to those of human stem cells. pMSCs can be found in different tissues but their dermal origin has not been studied in depth. Additionally, MSCs differentiation in monolayer cultures requires subcultured cells, and these cells are at risk of dedifferentiation when implanting them into living tissue. Following this, we attempted to characterize the MSCs phenotype of porcine dermal cells and to evaluate their cellular proliferation and differentiation in autologous fibrin scaffolds (AFSs). Dermal biopsies and blood samples were obtained from 12 pigs. Dermal cells were characterized by flow cytometry. Frozen autologous plasma was used to prepare AFSs. pMSC differentiation was studied in standard structures (monolayers and pellets) and in AFSs. The pMSCs expressed the CD90 and CD29 markers of the mesenchymal lineage. AFSs afforded adipogenic, osteogenic and chondrogenic differentiation. The porcine dermis can be proposed to be a good source of MSCs with adequate proliferative capacity and a suitable expression of markers. The pMSCs also showed optimal proliferation and differentiation in AFSs, such that these might serve as a promising autologous and implantable material for use in tissue engineering.

  15. Long-term in vitro culture of bovine preantral follicles: Effect of base medium and medium replacement methods.

    PubMed

    Araújo, V R; Gastal, M O; Wischral, A; Figueiredo, J R; Gastal, E L

    2015-10-01

    Two culture media and replacement methods were compared during long-term in vitro culture of secondary follicles of cattle using α-MEM(+) or TCM-199(+) as base media. The medium replacement methods were: Conventional - removal and subsequent addition of the same amount (60μl) in a 100μl aliquot (MEM-C and TCM-C), and Small Supplementation - addition of 5μl of fresh medium to an initial small aliquot (50μl), resulting in a final volume of 125μl on the last day of culture (MEM-S and TCM-S). A total of 207 secondary follicles were cultured individually for 32 days at 38.5°C in 5% CO2 and medium replacement was performed every other day. The MEM-S treatment resulted in a larger (P<0.01) follicular diameter, greater (P<0.02) growth rate, greater (P<0.02) antrum formation, as well as greater (P<0.0001) estradiol concentrations when compared with the MEM-C treatment. The medium change methods did not affect (P>0.05) the follicular and estradiol end points for TCM-199(+). The expression of the FSHR gene was greater (P<0.03) with the TCM-C than TCM-S treatment, while the relative amounts of mRNA for IGF1 was greater (P<0.02) with MEM-S than TCM-S treatments and for VEGF was greater (P<0.02) with MEM-C than TCM-C treatment. In conclusion, the type of base medium and the effect of periodic addition of medium differentially affected follicle development, estradiol production, and gene expression. Furthermore, α-MEM(+) can be used to replace TCM-199(+) for culture of preantral follicles of cattle if progressive addition of medium is used for medium change.

  16. Atmospheric-pressure plasma-irradiation inhibits mouse embryonic stem cell differentiation to mesoderm and endoderm but promotes ectoderm differentiation

    NASA Astrophysics Data System (ADS)

    Miura, Taichi; Hamaguchi, Satoshi; Nishihara, Shoko

    2016-04-01

    Recently, various effects of low-temperature atmospheric-pressure plasma irradiation on living cells have been demonstrated, such as tissue sterilization, blood coagulation, angiogenesis, wound healing, and tumor elimination. However, the effect of plasma-irradiation on the differentiation of mouse embryonic stem cells (mESCs) has not yet been clarified. A large number of reactive species are generated by plasma-irradiation in medium, of which hydrogen peroxide (H2O2) is one of the main species generated. Here, we investigated the effect of plasma-irradiation on the differentiation of mESCs using an embryoid body (EB) formation assay with plasma-irradiated medium or H2O2-supplemented non-irradiated medium. Our findings demonstrated that plasma-irradiated medium potently inhibits the differentiation from mESCs to mesoderm and endoderm by inhibiting Wnt signaling as determined by quantitative polymerase chain reaction and immunoblotting analyses. In contrast, both the plasma-irradiated medium and H2O2-supplemented non-irradiated medium enhanced the differentiation to epiblastoid, ectodermal, and neuronal lineages by activation of fibroblast growth factor 4 (FGF4) signaling, suggesting that these effects are caused by the H2O2 generated by plasma-irradiation in medium. However, in each case, the differentiation to glial cells remained unaffected. This study is the first demonstration that plasma-irradiation affects the differentiation of mESCs by the regulation of Wnt and FGF4 signaling pathways.

  17. Purple Sweet Potato Leaf Extract Induces Apoptosis and Reduces Inflammatory Adipokine Expression in 3T3-L1 Differentiated Adipocytes.

    PubMed

    Lee, Shou-Lun; Chin, Ting-Yu; Tu, Ssu-Chieh; Wang, Yu-Jie; Hsu, Ya-Ting; Kao, Ming-Ching; Wu, Yang-Chang

    2015-01-01

    Background. Purple sweet potato leaves (PSPL) are widely grown and are considered a healthy vegetable in Taiwan. PSPL contain a high content of flavonoids, and the boiling water-extracted PSPL (PSPLE) is believed to prevent metabolic syndrome. However, its efficacy has not yet been verified. Therefore, we investigated the effect of PSPLE on adipocytes. Methods. The differentiated 3T3-L1 cells used in this study were derived from preadipocytes that were differentiated into adipocytes using an adipogenic agent (insulin, dexamethasone, and 3-isobutyl-1-methylxanthine); approximately 90% of the cells were differentiated using this method. Results. Treating the differentiated 3T3-L1 cells with PSPLE caused a dose-dependent decrease in the number of adipocytes rather than preadipocytes. In addition, treatment with PSPLE resulted in apoptosis of the differentiated 3T3-L1 cells as determined by DAPI analysis and flow cytometry. PSPLE also increased the expression of cleaved caspase-3 and poly ADP-ribose polymerase (PARP). Furthermore, PSPLE induced downregulation of interleukin-6 (IL-6) and tumor necrosis factor-α (TNF-α) gene expression in the differentiated 3T3-L1 cells. Conclusions. These results suggest that PSPLE not only induced apoptosis but also downregulated inflammation-associated genes in the differentiated 3T3-L1 cells. PMID:26170870

  18. Id4, a New Candidate Gene for Senile Osteoporosis, Acts as a Molecular Switch Promoting Osteoblast Differentiation

    PubMed Central

    Yamashita, Yzumi; Nakachi, Yutaka; Nikaido, Itoshi; Bono, Hidemasa; Ninomiya, Yuichi; Kanesaki-Yatsuka, Yukiko; Akita, Masumi; Motegi, Hiromi; Wakana, Shigeharu; Noda, Tetsuo; Sablitzky, Fred; Arai, Shigeki; Kurokawa, Riki; Fukuda, Toru; Katagiri, Takenobu; Schönbach, Christian; Suda, Tatsuo; Mizuno, Yosuke; Okazaki, Yasushi

    2010-01-01

    Excessive accumulation of bone marrow adipocytes observed in senile osteoporosis or age-related osteopenia is caused by the unbalanced differentiation of MSCs into bone marrow adipocytes or osteoblasts. Several transcription factors are known to regulate the balance between adipocyte and osteoblast differentiation. However, the molecular mechanisms that regulate the balance between adipocyte and osteoblast differentiation in the bone marrow have yet to be elucidated. To identify candidate genes associated with senile osteoporosis, we performed genome-wide expression analyses of differentiating osteoblasts and adipocytes. Among transcription factors that were enriched in the early phase of differentiation, Id4 was identified as a key molecule affecting the differentiation of both cell types. Experiments using bone marrow-derived stromal cell line ST2 and Id4-deficient mice showed that lack of Id4 drastically reduces osteoblast differentiation and drives differentiation toward adipocytes. On the other hand knockdown of Id4 in adipogenic-induced ST2 cells increased the expression of Pparγ2, a master regulator of adipocyte differentiation. Similar results were observed in bone marrow cells of femur and tibia of Id4-deficient mice. However the effect of Id4 on Pparγ2 and adipocyte differentiation is unlikely to be of direct nature. The mechanism of Id4 promoting osteoblast differentiation is associated with the Id4-mediated release of Hes1 from Hes1-Hey2 complexes. Hes1 increases the stability and transcriptional activity of Runx2, a key molecule of osteoblast differentiation, which results in an enhanced osteoblast-specific gene expression. The new role of Id4 in promoting osteoblast differentiation renders it a target for preventing the onset of senile osteoporosis. PMID:20628571

  19. Bone Marrow Mesenchymal Stromal Cells from Clinical Scale Culture: In Vitro Evaluation of Their Differentiation, Hematopoietic Support, and Immunosuppressive Capacities.

    PubMed

    Fajardo-Orduña, Guadalupe R; Mayani, Héctor; Castro-Manrreza, Marta E; Flores-Figueroa, Eugenia; Flores-Guzmán, Patricia; Arriaga-Pizano, Lourdes; Piña-Sánchez, Patricia; Hernández-Estévez, Erika; Castell-Rodríguez, Andrés E; Chávez-Rueda, Adriana K; Legorreta-Haquet, María V; Santiago-Osorio, Edelmiro; Montesinos, Juan J

    2016-09-01

    The differentiation capacity, hematopoietic support, and immunomodulatory properties of human bone marrow mesenchymal stromal cells (BM-MSCs) make them attractive therapeutic agents for a wide range of diseases. Clinical scale cultures (CSCs) have been used to expand BM-MSCs for their use in cell therapy protocols; however, little is known about the functionality of the expanded cells. The main goal of the present study was to evaluate the functional characteristics of BM-MSCs expanded from CSCs to determine the quality of the cells for cellular therapy protocols. To address this issue, we analyzed the morphology, immunophenotype, differentiation potential (adipogenic, osteogenic and chondrogenic), hematopoietic support, and immunosuppressive capacity of BM-MSCs from short scale cultures (SSCs) and CSCs in a comparative manner. After 12 days of culture in CSCs (HYPERFlask System), BM-MSCs reached cell numbers of 125.52 × 10(6) ± 25.6 × 10(6) MSCs, which corresponded to the number of cells required for transplantation (∼1.7 × 10(6) MSCs/kg for a 70-kg patient). After expansion, BM-MSCs expressed the characteristic markers CD73, CD90, and CD105; however, expansion decreased their differentiation capacity toward the adipogenic, osteogenic, and chondrogenic lineages and their ability to inhibit T-cell proliferation compared with SSCs-MSCs. Importantly, CSCs-MSCs maintained the ability to support the proliferation and expansion of hematopoietic progenitor cells and the capacity to express the molecules, cytokines, and extracellular matrix proteins involved in the regulation of hematopoiesis. Our study highlights the need to evaluate the functional properties of the expanded BM-MSCs for verification of their quality for cell therapy protocols. PMID:27462977

  20. Medium Modification of Vector Mesons

    SciTech Connect

    Chaden Djalali, Michael Paolone, Dennis Weygand, Michael H. Wood, Rakhsha Nasseripour

    2011-03-01

    The theory of the strong interaction, Quantum Chromodynamics (QCD), has been remarkably successful in describing high-energy and short-distance-scale experiments involving quarks and gluons. However, applying QCD to low energy and large-distance scale experiments has been a major challenge. Various QCD-inspired models predict a partial restoration of chiral symmetry in nuclear matter with modifications of the properties of hadrons from their free-space values. Measurable changes such as a shift in mass and/or a change of width are predicted at normal nuclear density. Photoproduction of vector mesons off nuclei have been performed at different laboratories. The properties of the ρ, ω and φ mesons are investigated either directly by measuring their mass spectra or indirectly through transparency ratios. The latest results regarding medium modifications of the vector mesons in the nuclear medium will be discussed.

  1. Medium modifications with recoil polarization

    SciTech Connect

    Brand, J.F.J. van den; Ent, R.

    1994-04-01

    The authors show that the virtual Compton scattering process allows for a precise study of the off-shell electron-nucleon vertex. In a separable model, they show the sensitivity to new unconstrained structure functions of the nucleon, beyond the usual Dirac and Pauli form factors. In addition, they show the sensitivity to bound nucleon form factors using the reaction 4He({rvec e},e{prime},{rvec p}){sup 3}H. A nucleon embedded in a nucleus represents a complex system. Firstly, the bound nucleon is necessarily off-shell and in principle a complete understanding of the dynamical structure of the nucleon is required in order to calculate its off-shell electromagnetic interaction. Secondly, one faces the possibility of genuine medium effects, such as for example quark-exchange contributions. Furthermore, the electromagnetic coupling to the bound nucleon is dependent on the nuclear dynamics through the self-energy of the nucleon in the nuclear medium.

  2. Sclerostin Enhances Adipocyte Differentiation in 3T3-L1 Cells.

    PubMed

    Ukita, Mayumi; Yamaguchi, Taihiko; Ohata, Noboru; Tamura, Masato

    2016-06-01

    Sclerostin, a secreted protein encoded by the Sost gene, is produced by osteocytes and is inhibited by osteoblast differentiation and bone formation. Recently, a functional association between bone and fat tissue has been suggested, and a correlation between circulating sclerostin levels and lipid metabolism has been reported in humans. However, the effects of sclerostin on adipogenesis remain unexplored. In the present study, we examined the role of sclerostin in regulating adipocyte differentiation using 3T3-L1 preadipocytes. In these cells, sclerostin enhanced adipocyte-specific gene expression and the accumulation of lipid deposits. Sclerostin also upregulated CCAAT/enhancer binding protein β expression but not cell proliferation and caspase-3/7 activities. Sclerostin also attenuated canonical Wnt3a-inhibited adipocyte differentiation. Recently, the transcriptional modulator TAZ has been involved in the canonical Wnt signaling pathway. Sclerostin reduced TAZ-responsive transcriptional activity and TAZ-responsive gene expression. Transfection of 3T3-L1 cells with TAZ siRNA increased the lipid deposits and adipogenic gene expression. These results show that sclerostin upregulates adipocyte differentiation in 3T3-L1 cells, suggesting a possible role for the osteocyte-derived sclerostin as a regulator of fat metabolism and as a reciprocal regulator of bone and adipose tissues metabolism.

  3. Vitisin A inhibits adipocyte differentiation through cell cycle arrest in 3T3-L1 cells

    SciTech Connect

    Kim, Soon-hee; Park, Hee-Sook; Lee, Myoung-su; Cho, Yong-Jin; Kim, Young-Sup; Hwang, Jin-Taek; Sung, Mi Jeong; Kim, Myung Sunny; Kwon, Dae Young

    2008-07-18

    Inhibition of adipocyte differentiation is one approach among the anti-obesity strategies. This study demonstrates that vitisin A, a resveratrol tetramer, inhibits adipocyte differentiation most effectively of 18 stilbenes tested. Fat accumulation and PPAR{gamma} expression were decreased by vitisin A in a dose-dependent manner. Vitisin A significantly inhibited preadipocyte proliferation and consequent differentiation within the first 2 days of treatment, indicating that the anti-adipogenic effect of vitisin A was derived from anti-proliferation. Based on cell cycle analysis, vitisin A blocked the cell cycle at the G1-S phase transition, causing cells to remain in the preadipocyte state. Vitisin A increased p21 expression, while the Rb phosphorylation level was reduced. Therefore, vitisin A seems to induce G1 arrest through p21- and consequent Rb-dependent suppression of transcription. On the other hand, ERK and Akt signaling pathways were not involved in the anti-mitotic regulation by vitisin A. Taken together, these results suggest that vitisin A inhibits adipocyte differentiation through preadipocyte cell cycle arrest.

  4. Quantitative metabolic imaging using endogenous fluorescence to detect stem cell differentiation

    NASA Astrophysics Data System (ADS)

    Quinn, Kyle P.; Sridharan, Gautham V.; Hayden, Rebecca S.; Kaplan, David L.; Lee, Kyongbum; Georgakoudi, Irene

    2013-12-01

    The non-invasive high-resolution spatial mapping of cell metabolism within tissues could provide substantial advancements in assessing the efficacy of stem cell therapy and understanding tissue development. Here, using two-photon excited fluorescence microscopy, we elucidate the relationships among endogenous cell fluorescence, cell redox state, and the differentiation of human mesenchymal stem cells into adipogenic and osteoblastic lineages. Using liquid chromatography/mass spectrometry and quantitative PCR, we evaluate the sensitivity of an optical redox ratio of FAD/(NADH + FAD) to metabolic changes associated with stem cell differentiation. Furthermore, we probe the underlying physiological mechanisms, which relate a decrease in the redox ratio to the onset of differentiation. Because traditional assessments of stem cells and engineered tissues are destructive, time consuming, and logistically intensive, the development and validation of a non-invasive, label-free approach to defining the spatiotemporal patterns of cell differentiation can offer a powerful tool for rapid, high-content characterization of cell and tissue cultures.

  5. Transcriptional and epigenetic mechanisms underlying enhanced in vitro adipocyte differentiation by the brominated flame retardant BDE-47.

    PubMed

    Kamstra, Jorke H; Hruba, Eva; Blumberg, Bruce; Janesick, Amanda; Mandrup, Susanne; Hamers, Timo; Legler, Juliette

    2014-04-01

    Recent studies suggest that exposure to endocrine-disrupting compounds (EDCs) may play a role in the development of obesity. EDCs such as the flame retardant 2,2',4,4'-tetrabrominated diphenyl ether (BDE-47) have been shown to enhance adipocyte differentiation in the murine 3T3-L1 model. The mechanisms by which EDCs direct preadipocytes to form adipocytes are poorly understood. Here, we examined transcriptional and epigenetic mechanisms underlying the induction of in vitro adipocyte differentiation by BDE-47. Quantitative high content microscopy revealed concentration-dependent enhanced adipocyte differentiation following exposure to BDE-47 or the antidiabetic drug troglitazone (TROG). BDE-47 modestly activated the key adipogenic transcription factor peroxisome proliferator-activated receptor gamma (PPARγ) in COS7 cells, transiently transfected with a GAL4 reporter construct. Increased gene expression was observed for Pparγ2, leptin (Lep), and glucose-6-phophatase catalytic subunit (G6pc) in differentiated 3T3-L1 cells after BDE-47 exposure compared to TROG. Methylation-sensitive high resolution melting (MS-HRM) revealed significant demethylation of three CpG sites in the Pparγ2 promoter after exposure to both BDE-47 and TROG in differentiated 3T3-L1 cells. This study shows the potential of BDE-47 to induce adipocyte differentiation through various mechanisms that include Pparγ2 gene induction and promoter demethylation accompanied by activation of PPARγ, and possible disruption of glucose homeostasis and IGF1 signaling. PMID:24559133

  6. Induction of differentiation by down-regulation of Nanog and Rex-1 in cord blood derived unrestricted somatic stem cells.

    PubMed

    Langroudi, Lida; Forouzandeh, Mehdi; Soleimani, Masoud; Atashi, Amir; Golestaneh, Azadeh Fahim

    2013-07-01

    Stem cells with high self-renewal and tissue regeneration potentials are the core components of regenerative medicine. Adult stem cells with many available sources, high repairing ability, and also possessing no ethical issues are popular candidates in the clinical field. In this study we looked upon the effects of two transcription factors Nanog and Rex-1 in self-renewal and differentiation abilities of a subpopulation of cord blood stem cells known as unrestricted somatic stem cells (USSCs). USSCs were expanded and transfected in vitro with siRNAs targeting either Nanog, Rex-1, and in combination. Gene suppressions were achieved at both transcript and proteome level. Differentiations were evaluated by specific Real time PCR and differentiating staining. Nanog knock down revealed a significant increase in osteogenic markers, Osteocalcin and Osteopontin expression as well as a positive Alizarin Red staining, which proposes Osteogenesis. This treatment also became positive for Oil Red staining, implying adipogenic differentiation as well. In contrast, Rex-1 knock down showed an increase in MAP II and Nestin expression, which is a hall mark of neural differentiation. Surprisingly, treatment with both siRNAs did not express any changes in any of the assessed markers. Therefore, our results indicated a bilateral mesenchymal differentiation for Nanog and a neural lineage fate for Rex-1 suppression. Considering that both transcription factors are core activators of self-renewal and also are orchestrating with other factors, our results imply a positive feedback in response to changes in the regulatory network of self-renewal.

  7. Inhibitory effect of leptin on rosiglitazone-induced differentiation of primary adipocytes prepared from TallyHO/Jng mice

    SciTech Connect

    Kim, Ki Young; Kim, Joo Young; Sung, Yoon-Young; Jung, Won Hoon; Kim, Hee-Youn; Park, Ji Seon; Cheon, Hyae Gyeong; Rhee, Sang Dal

    2011-03-25

    Research highlights: {yields} In this study, we investigated the effects of leptin on adipocyte differentiation prepared from subcutaneous fat of TallyHo mice. {yields} Leptin inhibited the adipocytes differentiation at physiological concentration via inhibition of PPAR{gamma} expression. {yields} Inhibitors of ERK and STAT1 restored the leptin's inhibitory activity both in vitro and in vivo. -- Abstract: The effects of leptin on rosiglitazone-induced adipocyte differentiation were investigated in the primary adipocytes prepared from subcutaneous fat of TallyHO/Jng (TallyHO) mouse, a recently developed model animal for type 2 diabetes mellitus (T2DM). The treatment of leptin inhibited the rosiglitazone-induced adipocyte differentiation with a decreased expression of peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) a key adipogenic transcription factor, both in mRNA and protein levels. Leptin (10 nM) was sufficient to inhibit the adipocyte differentiation, which seemed to come from increased expression of leptin receptor genes in the fat of TallyHO mice. The inhibition of adipogenesis by leptin was restored by the treatment of inhibitors for extracellular-signal-regulated kinase (ERK) (PD98059) and signal transducer and activator of transcription-1 (STAT1) (fludarabine). Furthermore, in vivo intraperitoneal administration of PD98059 and fludarabine increased the PPAR{gamma} expression in the subcutaneous fat of TallyHO mice. These data suggest that leptin could inhibit the PPAR{gamma} expression and adipocyte differentiation in its physiological concentration in TallyHO mice.

  8. RAC1 regulate tumor necrosis factor-α-mediated impaired osteogenic differentiation of dental pulp stem cells.

    PubMed

    Feng, Guijuan; Shen, Qijie; Lian, Min; Gu, Zhifeng; Xing, Jing; Lu, Xiaohui; Huang, Dan; Li, Liren; Huang, Shen; Wang, Yi; Zhang, Jinlong; Shi, Jiahai; Zhang, Dongmei; Feng, Xingmei

    2015-09-01

    Human dental pulp contains a rapidly proliferative subpopulation of precursor cells termed dental pulp stem cells (DPSCs) that show self-renewal and multilineage differentiation, including neurogenic, chondrogenic, osteogenic and adipogenic. We previously reported that tomuor necrosis factor-α (TNF-α) (10 ng/mL) triggered osteogenic differentiation of human DPSCs via the nuclear factor-κB (NF-κB) signaling pathway. While previous studies showed that cells treated with TNF-α at higher concentrations showed decreased osteogenic differentiation capability. In this study we analyze the function of TNF-α (100 ng/mL) on osteogenic differentiation of human DPSCs for the first time and identify the underlying molecule mechanisms. Our data revealed that TNF-α with higher concentration significantly reduced mineralization and the expression of bone morphogenetic protein 2 (BMP2), alkaline phosphatase (ALP) and runt-related transcription factor 2 (RUNX2). Further, we revealed that TNF-α could suppress the osteogenic differentiation of DPSCs via increasing the expression of RAC1, which could activate the Wnt/β-catenin signaling pathway and liberate β-catenin to translocate into the nucleus. Genetic silencing of RAC1 expression using siRNA restored osteogenic differentiation of DPSCs. Our findings may provide a potential approach to bone regeneration in inflammatory microenvironments.

  9. Human Amniotic Fluid Mesenchymal Stem Cells from Second- and Third-Trimester Amniocentesis: Differentiation Potential, Molecular Signature, and Proteome Analysis

    PubMed Central

    Savickiene, Jurate; Treigyte, Grazina; Baronaite, Sandra; Valiuliene, Giedre; Kaupinis, Algirdas; Valius, Mindaugas; Arlauskiene, Audrone; Navakauskiene, Ruta

    2015-01-01

    Human amniotic fluid stem cells have become an attractive stem cell source for potential applications in regenerative medicine and tissue engineering. The aim of this study was to characterize amniotic fluid-derived mesenchymal stem cells (AF-MSCs) from second- and third-trimester of gestation. Using two-stage protocol, MSCs were successfully cultured and exhibited typical stem cell morphological, specific cell surface, and pluripotency markers characteristics. AF-MSCs differentiated into adipocytes, osteocytes, chondrocytes, myocytes, and neuronal cells, as determined by morphological changes, cell staining, and RT-qPCR showing the tissue-specific gene presence for differentiated cell lineages. Using SYNAPT G2 High Definition Mass Spectrometry technique approach, we performed for the first time the comparative proteomic analysis between undifferentiated AF-MSCs from late trimester of gestation and differentiated into myogenic, adipogenic, osteogenic, and neurogenic lineages. The analysis of the functional and expression patterns of 250 high abundance proteins selected from more than 1400 demonstrated the similar proteome of cultured and differentiated AF-MSCs but the unique changes in their expression profile during cell differentiation that may help the identification of key markers in differentiated cells. Our results provide evidence that human amniotic fluid of second- and third-trimester contains stem cells with multilineage potential and may be attractive source for clinical applications. PMID:26351462

  10. Differential gearing

    SciTech Connect

    Tamiya, S.

    1986-07-29

    A differential for motor vehicles is described and the like comprising, an input drive shaft, a pair of coaxially spaced drive gears simultaneously driven by the input shaft in a same direction at a same speed of rotation about a common axis of rotation, a driven gear driven peripherally by the pair of drive gears for transmission of power from the input drive shaft, two coaxial opposed bevel sun gears having an axis of rotation concentric with an axis of rotation of the driven gear, two planetary gears disposed between the sun gears for differential driving thereof during turns of the vehicle to the right and to the left of each meshing with the sun gears for driving the suns gears. Each planetary gear has a separate axis of rotation carried by the driven gear disposed therein radially and symmetrically relative to the axis of rotation of the sun gears, and each sun gear having a respective power output shaft connected thereto for rotation therewith.

  11. Epimedium koreanum Nakai and its main constituent icariin suppress lipid accumulation during adipocyte differentiation of 3T3-L1 preadipocytes.

    PubMed

    Han, Yunk-Yung; Song, Mi-Young; Hwang, Min-Sub; Hwang, Ji-Hye; Park, Yong-Ki; Jung, Hyo-Won

    2016-09-01

    Obesity is associated with a number of metabolic abnormalities such as type 2 diabetes and has become a major health problem worldwide. In the present study, we investigated the effects of Epimedium koreanum Nakai (Herba Epimedii, HE) and its main constituent icariin on the adipocyte differentiation in 3T3-L1 preadipocytes. HE extract and icariin significantly reduced lipid accumulation and suppressed the expressions of PPARγ, C/EBPα, and SREBP-1c in 3T3-L1 adipocytes. They also inhibited fatty acid synthase (FAS), acyl-Co A synthase (ACS1), and perilipin. Moreover, HE extract and icariin markedly increased the phosphorylation of AMPK. These results indicated that HE extract and icariin can inhibit the adipocyte differentiation through downregulation of the adipogenic transcription factors, suggesting that HE containing icariin may be used as a potential therapeutic agent in the treatment and prevention of obesity. PMID:27667512

  12. Transgene expression and differentiation of baculovirus-transduced adipose-derived stem cells from dystrophin-utrophin double knock-out mouse.

    PubMed

    Li, Qiuling; Zhai, Qiongxiang; Geng, Jia; Zheng, Hui; Chen, Fei; Kong, Jie; Zhang, Cheng

    2012-08-01

    In this study, recombinant baculovirus carrying the microdystrophin and β-catenin genes was used to infect adipose-derived stem cells from a dystrophin-utrophin double knock-out mouse. Results showed that, after baculovirus transgene infection, microdystrophin and β-catenin genes were effectively expressed in adipose-derived stem cells from the dystrophin-utrophin double knock-out mouse. Furthermore, this transgenic expression promoted adipose-derived stem cell differentiation into muscle cells, but inhibited adipogenic differentiation. In addition, protein expression related to the microdystrophin and Wnt/β-catenin signaling pathway was upregulated. Our experimental findings indicate that baculovirus can successfully deliver the microdystrophin and β-catenin genes into adipose-derived stem cells, and the microdystrophin and Wnt/β-catenin signaling pathway plays an important role in myogenesis of adipose-derived stem cells in the dystrophin-utrophin double knock-out mouse.

  13. Polysome profiling shows extensive posttranscriptional regulation during human adipocyte stem cell differentiation into adipocytes.

    PubMed

    Spangenberg, Lucia; Shigunov, Patricia; Abud, Ana Paula R; Cofré, Axel R; Stimamiglio, Marco A; Kuligovski, Crisciele; Zych, Jaiesa; Schittini, Andressa V; Costa, Alexandre Dias Tavares; Rebelatto, Carmen K; Brofman, Paulo R S; Goldenberg, Samuel; Correa, Alejandro; Naya, Hugo; Dallagiovanna, Bruno

    2013-09-01

    Adipocyte stem cells (hASCs) can proliferate and self-renew and, due to their multipotent nature, they can differentiate into several tissue-specific lineages, making them ideal candidates for use in cell therapy. Most attempts to determine the mRNA profile of self-renewing or differentiating stem cells have made use of total RNA for gene expression analysis. Several lines of evidence suggest that self-renewal and differentiation are also dependent on the control of protein synthesis by posttranscriptional mechanisms. We used adipogenic differentiation as a model, to investigate the extent to which posttranscriptional regulation controlled gene expression in hASCs. We focused on the initial steps of differentiation and isolated both the total mRNA fraction and the subpopulation of mRNAs associated with translating ribosomes. We observed that adipogenesis is committed in the first days of induction and three days appears as the minimum time of induction necessary for efficient differentiation. RNA-seq analysis showed that a significant percentage of regulated mRNAs were posttranscriptionally controlled. Part of this regulation involves massive changes in transcript untranslated regions (UTR) length, with differential extension/reduction of the 3'UTR after induction. A slight correlation can be observed between the expression levels of differentially expressed genes and the 3'UTR length. When we considered association to polysomes, this correlation values increased. Changes in the half lives were related to the extension of the 3'UTR, with longer UTRs mainly stabilizing the transcripts. Thus, changes in the length of these extensions may be associated with changes in the ability to associate with polysomes or in half-life.

  14. Mitochondria in mesenchymal stem cell biology and cell therapy: From cellular differentiation to mitochondrial transfer.

    PubMed

    Hsu, Yi-Chao; Wu, Yu-Ting; Yu, Ting-Hsien; Wei, Yau-Huei

    2016-04-01

    Mesenchymal stem cells (MSCs) are characterized to have the capacity of self-renewal and the potential to differentiate into mesoderm, ectoderm-like and endoderm-like cells. MSCs hold great promise for cell therapies due to their multipotency in vitro and therapeutic advantage of hypo-immunogenicity and lower tumorigenicity. Moreover, it has been shown that MSCs can serve as a vehicle to transfer mitochondria into cells after cell transplantation. Mitochondria produce most of the energy through oxidative phosphorylation in differentiated cells. It has been increasingly clear that the switch of energy supply from glycolysis to aerobic metabolism is essential for successful differentiation of MSCs. Post-translational modifications of proteins have been established to regulate mitochondrial function and metabolic shift during MSCs differentiation. In this article, we review and provide an integrated view on the roles of different protein kinases and sirtuins in the maintenance and differentiation of MSCs. Importantly, we provide evidence to suggest that alteration in the expression of Sirt3 and Sirt5 and relative changes in the acylation levels of mitochondrial proteins might be involved in the activation of mitochondrial function and adipogenic differentiation of adipose-derived MSCs. We summarize their roles in the regulation of mitochondrial biogenesis and metabolism, oxidative responses and differentiation of MSCs. On the other hand, we discuss recent advances in the study of mitochondrial dynamics and mitochondrial transfer as well as their roles in the differentiation and therapeutic application of MSCs to improve cell function in vitro and in animal models. Accumulating evidence has substantiated that the therapeutic potential of MSCs is conferred not only by cell replacement and paracrine effects but also by transferring mitochondria into injured tissues or cells to modulate the cellular metabolism in situ. Therefore, elucidation of the underlying mechanisms

  15. A Heterogeneous Medium Analytical Benchmark

    SciTech Connect

    Ganapol, B.D.

    1999-09-27

    A benchmark, called benchmark BLUE, has been developed for one-group neutral particle (neutron or photon) transport in a one-dimensional sub-critical heterogeneous plane parallel medium with surface illumination. General anisotropic scattering is accommodated through the Green's Function Method (GFM). Numerical Fourier transform inversion is used to generate the required Green's functions which are kernels to coupled integral equations that give the exiting angular fluxes. The interior scalar flux is then obtained through quadrature. A compound iterative procedure for quadrature order and slab surface source convergence provides highly accurate benchmark qualities (4- to 5- places of accuracy) results.

  16. Medium Effects in Parton Distributions

    SciTech Connect

    William Detmold, Huey-Wen Lin

    2011-12-01

    A defining experiment of high-energy physics in the 1980s was that of the EMC collaboration where it was first observed that parton distributions in nuclei are non-trivially related to those in the proton. This result implies that the presence of the nuclear medium plays an important role and an understanding of this from QCD has been an important goal ever since Here we investigate analogous, but technically simpler, effects in QCD and examine how the lowest moment of the pion parton distribution is modified by the presence of a Bose-condensed gas of pions or kaons.

  17. A medium for the rapid enumeration of Escherichia coli in the presence of other faecal coliforms in tropical waters.

    PubMed

    Wright, R C

    1982-04-01

    A selective membrane filtration medium is described for use in the rapid assessment of water quality in tropical countries where the incidence of faecal coliforms other than E. coli presents problems in the interpretation of results. The medium gives comparable results to MPN values obtained in the multiple tube dilution test using modified Gray's glutamate medium, and to membrane filtration counts obtained using M-FC broth and membrane-enriched Teepol broth, whilst differentiation of E. coli is enhanced.

  18. COL18A1 is highly expressed during human adipocyte differentiation and the SNP c.1136C > T in its "frizzled" motif is associated with obesity in diabetes type 2 patients.

    PubMed

    Errera, Flavia I V; Canani, Luís H; Yeh, Erika; Kague, Erika; Armelin-Corrêa, Lucia M; Suzuki, Oscar T; Tschiedel, Balduíno; Silva, Maria Elizabeth R; Sertié, Andréa L; Passos-Bueno, Maria Rita

    2008-03-01

    Collagen XVIII can generate two fragments, NC11-728 containing a frizzled motif which possibly acts in Wnt signaling and Endostatin, which is cleaved from the NC1 and is a potent inhibitor of angiogenesis. Collagen XVIII and Wnt signaling have recently been associated with adipogenic differentiation and obesity in some animal models, but not in humans. In the present report, we have shown that COL18A1 expression increases during human adipogenic differentiation. We also tested if polymorphisms in the Frizzled (c.1136C>T; Thr379Met) and Endostatin (c.4349G>A; Asp1437Asn) regions contribute towards susceptibility to obesity in patients with type 2 diabetes (113 obese, BMI > or =30; 232 non-obese, BMI < 30) of European ancestry. No evidence of association was observed between the allele c.4349G>A and obesity, but we observed a significantly higher frequency of homozygotes c.1136TT in obese (19.5%) than in non-obese individuals (10.9%) [P = 0.02; OR = 2.0 (95%CI: 1.07-3.73)], suggesting that the allele c.1136T is associated to obesity in a recessive model. This genotype, after controlling for cholesterol, LDL cholesterol, and triglycerides, was independently associated with obesity (P = 0.048), and increases the chance of obesity in 2.8 times. Therefore, our data suggest the involvement of collagen XVIII in human adipogenesis and susceptibility to obesity.

  19. Aniline blue-containing buffered charcoal-yeast extract medium for presumptive identification of Legionella species

    SciTech Connect

    Holmes, R.L.

    1982-04-01

    By utilizing buffered charcoal-yeast extract medium containing 0.01% aniline blue in conjunction with a long-wave UV light, the differentiation of five species of Legionella was facilitated. L. pneumophila, when grown on this medium, did not absorb the aniline blue dye; however, L. micdadei, L. dumoffii, L. bozemanii, and L. gormanii absorbed the dye in varying amounts and produced colonies of various shades of blue.

  20. How Does the Medium Affect the Message?

    ERIC Educational Resources Information Center

    Dommermuth, William P.

    1974-01-01

    This experimental comparison of the advertising effectiveness of television, movies, radio, and print finds no support for McLuhan's idea that television is a "cool" medium and movies are a "hot" medium. (RB)

  1. Gravitational lensing in plasmic medium

    SciTech Connect

    Bisnovatyi-Kogan, G. S. Tsupko, O. Yu.

    2015-07-15

    The influence of plasma on different effects of gravitational lensing is reviewed. Using the Hamiltonian approach for geometrical optics in a medium in the presence of gravity, an exact formula for the photon deflection angle by a black hole (or another body with a Schwarzschild metric) embedded in plasma with a spherically symmetric density distribution is derived. The deflection angle in this case is determined by the mutual combination of different factors: gravity, dispersion, and refraction. While the effects of deflection by the gravity in vacuum and the refractive deflection in a nonhomogeneous medium are well known, the new effect is that, in the case of a homogeneous plasma, in the absence of refractive deflection, the gravitational deflection differs from the vacuum deflection and depends on the photon frequency. In the presence of a plasma nonhomogeneity, the chromatic refractive deflection also occurs, so the presence of plasma always makes gravitational lensing chromatic. In particular, the presence of plasma leads to different angular positions of the same image if it is observed at different wavelengths. It is discussed in detail how to apply the presented formulas for the calculation of the deflection angle in different situations. Gravitational lensing in plasma beyond the weak deflection approximation is also considered.

  2. Gravitational lensing in plasmic medium

    NASA Astrophysics Data System (ADS)

    Bisnovatyi-Kogan, G. S.; Tsupko, O. Yu.

    2015-07-01

    The influence of plasma on different effects of gravitational lensing is reviewed. Using the Hamiltonian approach for geometrical optics in a medium in the presence of gravity, an exact formula for the photon deflection angle by a black hole (or another body with a Schwarzschild metric) embedded in plasma with a spherically symmetric density distribution is derived. The deflection angle in this case is determined by the mutual combination of different factors: gravity, dispersion, and refraction. While the effects of deflection by the gravity in vacuum and the refractive deflection in a nonhomogeneous medium are well known, the new effect is that, in the case of a homogeneous plasma, in the absence of refractive deflection, the gravitational deflection differs from the vacuum deflection and depends on the photon frequency. In the presence of a plasma nonhomogeneity, the chromatic refractive deflection also occurs, so the presence of plasma always makes gravitational lensing chromatic. In particular, the presence of plasma leads to different angular positions of the same image if it is observed at different wavelengths. It is discussed in detail how to apply the presented formulas for the calculation of the deflection angle in different situations. Gravitational lensing in plasma beyond the weak deflection approximation is also considered.

  3. A comparison of the original Rappaport medium (R medium) and the Rappaport-Vassiliadis medium (RV medium) in the isolation of salmonellae from meat products.

    PubMed Central

    Vassiliadis, P.; Kalapothaki, V.; Mavrommati, C.; Trichopoulos, D.

    1984-01-01

    The Rappaport-Vassiliadis enrichment medium (RV medium) in 10 ml quantities (RV/43 degrees C, 10 ml) inoculated with 0.1 ml of pre-enrichment medium (P medium) was found more efficient in the isolation of salmonellae from 409 pre-enriched samples (mainly meat products), than the original Rappaport medium incubated at 43 degrees C (R/43 degrees C) and the RV medium in 5 ml quantities (RV/43 degrees C, 5 ml) inoculated with 0.01 ml of P medium (P less than 0.001, in both instances). Therefore, the inoculum from pre-enriched foods should not be less than 0.1 ml in 10 ml of RV medium. The RV/43 degrees, 10 ml was also better (P less than 0.01) in detecting samples containing salmonellas than the original Rappaport medium incubated at 37 degrees C (R/37 degrees C, 10 ml) and the modification R25 of R medium incubated at 37 degrees C. The R25 modification was used in 10 ml quantities (R25/37 degrees C, 10 ml) inoculated with 0.1 ml of P medium and in 5 ml quantities (R25/37 degrees, 5 ml) inoculated with 0.01 ml of P medium. The last two R25 procedures were of the same efficiency in isolating salmonellas from meat products. PMID:6747286

  4. 49 CFR 195.306 - Test medium.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 49 Transportation 3 2014-10-01 2014-10-01 false Test medium. 195.306 Section 195.306... PIPELINE Pressure Testing § 195.306 Test medium. (a) Except as provided in paragraphs (b), (c), and (d) of this section, water must be used as the test medium. (b) Except for offshore pipelines,...

  5. 49 CFR 195.306 - Test medium.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 49 Transportation 3 2012-10-01 2012-10-01 false Test medium. 195.306 Section 195.306... PIPELINE Pressure Testing § 195.306 Test medium. (a) Except as provided in paragraphs (b), (c), and (d) of this section, water must be used as the test medium. (b) Except for offshore pipelines,...

  6. 49 CFR 195.306 - Test medium.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 49 Transportation 3 2011-10-01 2011-10-01 false Test medium. 195.306 Section 195.306... PIPELINE Pressure Testing § 195.306 Test medium. (a) Except as provided in paragraphs (b), (c), and (d) of this section, water must be used as the test medium. (b) Except for offshore pipelines,...

  7. 49 CFR 195.306 - Test medium.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 49 Transportation 3 2013-10-01 2013-10-01 false Test medium. 195.306 Section 195.306... PIPELINE Pressure Testing § 195.306 Test medium. (a) Except as provided in paragraphs (b), (c), and (d) of this section, water must be used as the test medium. (b) Except for offshore pipelines,...

  8. 27 CFR 19.914 - Medium plants.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Medium plants. 19.914 Section 19.914 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT... Medium plants. Any person wishing to establish a medium plant shall make application for and obtain...

  9. 49 CFR 195.306 - Test medium.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 49 Transportation 3 2010-10-01 2010-10-01 false Test medium. 195.306 Section 195.306... PIPELINE Pressure Testing § 195.306 Test medium. (a) Except as provided in paragraphs (b), (c), and (d) of this section, water must be used as the test medium. (b) Except for offshore pipelines,...

  10. Deleterious effects of freezing on osteogenic differentiation of human adipose-derived stromal cells in vitro and in vivo.

    PubMed

    James, Aaron W; Levi, Benjamin; Nelson, Emily R; Peng, Michelle; Commons, George W; Lee, Min; Wu, Benjamin; Longaker, Michael T

    2011-03-01

    Human adipose-derived stromal cells (hASCs) represent a multipotent stromal cell type with a proven capacity to undergo osteogenic differentiation. Many hurdles exist, however, between current knowledge of hASC osteogenesis and their potential future use in skeletal tissue regeneration. The impact of frozen storage on hASC osteogenic differentiation, for example, has not been studied in detail. To examine the effects of frozen storage, hASCs were harvested from lipoaspirate and either maintained in standard culture conditions or frozen for 2 weeks under standard conditions (90% fetal bovine serum, 10% dimethyl sulfoxide). Next, in vitro parameters of cell morphology (surface electron microscopy [EM]), cell viability and growth (trypan blue; bromodeoxyuridine incorporation), osteogenic differentiation (alkaline phosphatase, alizarin red, and quantitative real-time (RT)-polymerase chain reaction), and adipogenic differentiation (Oil red O staining and quantitative RT-polymerase chain reaction) were performed. Finally, in vivo bone formation was assessed using a critical-sized cranial defect in athymic mice, utilizing a hydroxyapatite (HA)-poly(lactic-co-glycolic acid) scaffold for ASC delivery. Healing was assessed by serial microcomputed tomography scans and histology. Freshly derived ASCs differed significantly from freeze-thaw ASCs in all markers examined. Surface EM showed distinct differences in cellular morphology. Proliferation, and osteogenic and adipogenic differentiation were all significantly hampered by the freeze-thaw process in vitro (*P < 0.01). In vivo, near complete healing was observed among calvarial defects engrafted with fresh hASCs. This was in comparison to groups engrafted with freeze-thaw hASCs that showed little healing (*P < 0.01). Finally, recombinant insulin-like growth factor 1 or recombinant bone morphogenetic protein 4 was observed to increase or rescue in vitro osteogenic differentiation among frozen hASCs (*P < 0.01). The

  11. Isolation, characterization and the multi-lineage differentiation potential of rabbit bone marrow-derived mesenchymal stem cells

    PubMed Central

    Tan, Sik-Loo; Ahmad, Tunku Sara; Selvaratnam, Lakshmi; Kamarul, Tunku

    2013-01-01

    Mesenchymal stem cells (MSCs) are recognized by their plastic adherent ability, fibroblastic-like appearance, expression of specific surface protein markers, and are defined by their ability to undergo multi-lineage differentiation. Although rabbit bone marrow-derived MSCs (rbMSCs) have been used extensively in previous studies especially in translational research, these cells have neither been defined morphologically and ultrastructurally, nor been compared with their counterparts in humans in their multi-lineage differentiation ability. A study was therefore conducted to define the morphology, surface marker proteins, ultrastructure and multi-lineage differentiation ability of rbMSCs. Herein, the primary rbMSC cultures of three adult New Zealand white rabbits (at least 4 months old) were used for three independent experiments. rbMSCs were isolated using the gradient-centrifugation method, an established technique for human MSCs (hMSCs) isolation. Cells were characterized by phase contrast microscopy observation, transmission electron microscopy analysis, reverse transcriptase-polymerase chain reaction (PCR) analysis, immunocytochemistry staining, flow cytometry, alamarBlue® assay, histological staining and quantitative (q)PCR analysis. The isolated plastic adherent cells were in fibroblastic spindle-shape and possessed eccentric, irregular-shaped nuclei as well as rich inner cytoplasmic zones similar to that of hMSCs. The rbMSCs expressed CD29, CD44, CD73, CD81, CD90 and CD166, but were negative (or dim positive) for CD34, CD45, CD117 and HLD-DR. Despite having similar morphology and phenotypic expression, rbMSCs possessed significantly larger cell size but had a lower proliferation rate as compared with hMSCs. Using established protocols to differentiate hMSCs, rbMSCs underwent osteogenic, adipogenic and chondrogenic differentiation. Interestingly, differentiated rbMSCs demonstrated higher levels of osteogenic (Runx2) and chondrogenic (Sox9) gene expressions

  12. Uncarboxylated osteocalcin inhibits high glucose-induced ROS production and stimulates osteoblastic differentiation by preventing the activation of PI3K/Akt in MC3T3-E1 cells.

    PubMed

    Liu, Jingli; Yang, Jianhong

    2016-01-01

    Uncarboxylated osteocalcin, an osteoblast-derived protein, plays an important role in the regulation of glucose metabolism. It has previously been demonstrated that high glucose levels inhibit osteoblast proliferation and differentiation. However, the mechanisms through which uncarboxylated osteocalcin regulates osteoblast proliferation and differentiation under high glucose conditions remain unclear. Thus, in the present study, we aimed to examine the effects of uncarboxylated osteocalcin on the proliferation and differentiation of MC3T3-E1 cells under high glucose conditions. We demonstrated that high glucose levels induced the production of reactive oxygen species (ROS) in MC3T3-E1 cells, and this production was inhibited by treatment with uncarboxylated osteocalcin and N-acetyl-L-cysteine (NAC), a ROS scavenger. In addition, we found that uncarboxylated osteocalcin reduced high glucose‑induced oxidative stress and increased the mRNA expression of the osteogenic markers, runt-related transcription factor 2 (Runx2), osterix and osteocalcin, as well as the formation of mineralized nodules; it also inhibited adipogenic differentiation, as shown by a decrease in the mRNA expression of the adipogenic markers, peroxisome proliferator‑activated receptor γ (PPARγ), adipocyte fatty acid-binding protein (adipocyte protein 2; aP2) and fatty acid synthase (FAS), and reduced lipid drop accumulation. Furthermore, we found that uncarboxylated osteocalcin inhibited PI3K/Akt signaling which was induced by ROS and facilitated the osteogenic differentiation of MC3T3-E1 cells under high glucose conditions. Taken together and to the best of ou knowledge, our results demonstrate for the first time that uncarboxylated osteocalcin inhibits high glucose-induced ROS production and stimulates osteoblastic differentiation by inhibiting the activation of PI3K/Akt in MC3T3-E1 cells. Therefore, we suggest that uncarboxylated osteocalcin may be a potential therapeutic agent for diabetes

  13. Isomer-specific regulation of differentiating pig preadipocytes by conjugated linoleic acids.

    PubMed

    Brandebourg, T D; Hu, C Y

    2005-09-01

    Conjugated linoleic acids are a group of geometric and positional isomers of linoleic acid that decrease body fat in growing animals by a poorly understood mechanism. The objective of this study was to investigate the isomer-specific effect of CLA on the proliferation and differentiation of pig preadipocytes in primary culture. The effect of CLA on preadipocyte proliferation was determined using cleavage of the tetrazolium salt, WST-1, as a marker for proliferation. Preadipocyte number was decreased in a dose-dependent fashion by trans-12,cis-10 CLA (P < 0.05). No other fatty acid affected preadipocyte number. Differentiation was monitored on d 10 after induction morphologically, enzymatically, and by measuring the mRNA abundance of key adipogenic transcription factors. Both a crude CLA preparation containing a mixture of CLA isomers (CLA-mix) and the pure trans-10,cis-12 CLA isomer inhibited glycerol-3-phosphate dehydrogenase (GPDH) activity in a dose-dependent fashion, with trans-10,cis-12 CLA being more potent (P < 0.01) than the CLA-mix. Cis-9,trans-11 CLA failed to decrease GPDH activity; however, increasing concentrations of cis-9,trans-11 CLA tended to blunt the inhibitory effect of trans-10,cis-12 CLA on GPDH activity (P < 0.09), suggesting that cis-9,trans-11 CLA may antagonize the action of trans-10,cis-12 CLA in porcine adipocytes. Finally, the isomer-specific effect of CLA on adipogenic transcription factor gene expression was investigated. Trans-10,cis-12 CLA decreased expression of peroxisome proliferator-activated rec